text stringlengths 8 5.77M |
|---|
Antofine-induced connexin43 gap junction disassembly in rat astrocytes involves protein kinase Cβ.
Antofine, a phenanthroindolizidine alkaloid derived from Cryptocaryachinensis and Ficusseptica in the Asclepiadaceae milkweed family, is cytotoxic for various cancer cell lines. In this study, we demonstrated that treatment of rat primary astrocytes with antofine induced dose-dependent inhibition of gap junction intercellular communication (GJIC), as assessed by scrape-loading 6-carboxyfluorescein dye transfer. Levels of Cx43 protein were also decreased in a dose- and time-dependent manner following antofine treatment. Double-labeling immunofluorescence microscopy showed that antofine (10ng/ml) induced endocytosis of surface gap junctions into the cytoplasm, where Cx43 was co-localized with the early endosome marker EEA1. Inhibition of lysosomes or proteasomes by co-treatment with antofine and their respective specific inhibitors, NH4Cl or MG132, partially inhibited the antofine-induced decrease in Cx43 protein levels, but did not inhibit the antofine-induced inhibition of GJIC. After 30min of treatment, antofine induced a rapid increase in the intracellular Ca(2+) concentration and activation of protein kinase C (PKC)α/βII, which was maintained for at least 6h. Co-treatment of astrocytes with antofine and the intracellular Ca(2+) chelator BAPTA-AM prevented downregulation of Cx43 and inhibition of GJIC. Moreover, co-treatment with antofine and a specific PKCβ inhibitor prevented endocytosis of gap junctions, downregulation of Cx43, and inhibition of GJIC. Taken together, these findings indicate that antofine induces Cx43 gap junction disassembly by the PKCβ signaling pathway. Inhibition of GJIC by antofine may undermine the neuroprotective effect of astrocytes in CNS. |
Q:
voltage and current rms calculations python
Im doing som calculations for voltage and current rms values, and just got a new way to do it with more precision.
It Works well for what it was designed for, full period values, but it doesn´t work for half period values.
spp = 200, and the input is an array with Nx200 values, (period by period).
So i get full 230 V when i do the full period version, but only get around 100 V from the half period version
full period calculations:
k = np.arange(spp) #
v_samples = np.vstack((np.zeros(spp), data_u_periods))
#print ("v_samples", v_samples)
v_samples = np.diff(v_samples, axis=0)
#print ("v_samples :", v_samples)
v_cossum = np.cumsum(v_samples * np.cos(2*np.pi/spp*k)) * np.sqrt(2)/spp
v_sinsum = np.cumsum(v_samples * np.sin(2*np.pi/spp*k)) * np.sqrt(2)/spp
print ("fp", 2*np.pi/spp*k)
v_complex = v_cossum + 1j*v_sinsum
v_complex = np.mean(v_complex.reshape((-1,spp)), axis=1)
i_samples = np.vstack((np.zeros(spp), data_i_periods))
i_samples = np.diff(i_samples, axis=0)
i_cossum = np.cumsum(i_samples * np.cos(2*np.pi/spp*k)) * np.sqrt(2)/spp
i_sinsum = np.cumsum(i_samples * np.sin(2*np.pi/spp*k)) * np.sqrt(2)/spp
i_complex = i_cossum + 1j*i_sinsum
i_complex = np.mean(i_complex.reshape((-1,spp)), axis=1)
s_complex = v_complex * i_complex.conjugate() # save for power calculations
ueffs = np.abs(v_complex)
ieffs = np.abs(i_complex)
half period calculations:
data_u_periods = data_u_periods.flatten()
data_i_periods = data_i_periods.flatten()
data_u_periods = data_u_periods.reshape((int(data_u_periods.shape[0]/(int(spp/2))),int(spp/2)))
data_i_periods = data_i_periods.reshape((int(data_i_periods.shape[0]/(int(spp/2))),int(spp/2)))
spp = spp/2
k = np.arange(spp) #
#print(spp)
#print (k)
#print (data_u_periods.shape)
v_samples = np.vstack((np.zeros(spp), data_u_periods))
#print ("v_samples", v_samples)
v_samples = np.diff(v_samples, axis=0)
#print ("v_samples :", v_samples)
#input("press enter")
v_cossum = np.cumsum(v_samples * np.cos(2*np.pi/spp*k)) * np.sqrt(2)/spp
v_sinsum = np.cumsum(v_samples * np.sin(2*np.pi/spp*k)) * np.sqrt(2)/spp
v_complex = v_cossum + 1j*v_sinsum
v_complex = np.mean(v_complex.reshape((-1,spp)), axis=1)
i_samples = np.vstack((np.zeros(spp), data_i_periods))
i_samples = np.diff(i_samples, axis=0)
i_cossum = np.cumsum(i_samples * np.cos(2*np.pi/spp*k)) * np.sqrt(2)/spp
i_sinsum = np.cumsum(i_samples * np.sin(2*np.pi/spp*k)) * np.sqrt(2)/spp
i_complex = i_cossum + 1j*i_sinsum
i_complex = np.mean(i_complex.reshape((-1,spp)), axis=1)
#s_complex = v_complex * i_complex.conjugate() # save for power calculations
print ("hp", 2*np.pi/spp*k)
ueffs = np.abs(v_complex)
ieffs = np.abs(i_complex)
A:
It was a simple oversight, instead of taking the difference between two periods at the same point, i took the difference between the first and second half of the same period. And the second half vs the first half of the next period....
So now it works as it should!
fixed code:
"""
function for getting period RMS values
Args
-----
data_u_periods : all voltage periods
data_i_periods : all current periods
spp : samples per period
Returns
---------
arrays with half period rms values
"""
k = np.arange(spp)
v_samples = np.vstack((np.zeros(spp), data_u_periods))
v_samples = np.diff(v_samples, axis = 0)
v_prepp_cos = v_samples * np.cos(2*np.pi/spp*k)
v_prepp_sin = v_samples * np.sin(2*np.pi/spp*k)
v_prepp_cos = v_prepp_cos.flatten()
v_prepp_cos = v_prepp_cos.reshape((int(v_prepp_cos.shape[0]/(int(spp/2))), int(spp/2)))
v_prepp_sin = v_prepp_sin.flatten()
v_prepp_sin = v_prepp_sin.reshape((int(v_prepp_sin.shape[0]/(int(spp/2))), int(spp/2)))
#print ("v_samples hp", v_samples)
i_samples = np.vstack((np.zeros(spp), data_i_periods))
i_samples = np.diff(i_samples, axis = 0)
i_prepp_cos = i_samples * np.cos(2*np.pi/spp*k)
i_prepp_sin = i_samples * np.sin(2*np.pi/spp*k)
i_prepp_cos = i_prepp_cos.flatten()
i_prepp_cos = i_prepp_cos.reshape((int(i_prepp_cos.shape[0]/(int(spp/2))), int(spp/2)))
i_prepp_sin = i_prepp_sin.flatten()
i_prepp_sin = i_prepp_sin.reshape((int(i_prepp_sin.shape[0]/(int(spp/2))), int(spp/2)))
spp = spp/2
v_cossum = np.cumsum(v_prepp_cos) * np.sqrt(2)/(2*spp)
v_sinsum = np.cumsum(v_prepp_sin) * np.sqrt(2)/(2*spp)
v_complex = v_cossum + 1j*v_sinsum
v_complex = np.mean(v_complex.reshape((-1, spp)), axis = 1)
i_cossum = np.cumsum(i_prepp_cos) * np.sqrt(2)/(2*spp)
i_sinsum = np.cumsum(i_prepp_sin) * np.sqrt(2)/(2*spp)
i_complex = i_cossum + 1j*i_sinsum
i_complex = np.mean(i_complex.reshape((-1, spp)), axis = 1)
ueffs = np.abs(v_complex)
ieffs = np.abs(i_complex)
#print ("ueff hp", ueffs)
return ueffs, ieffs
|
Q:
Code with i+= in the loop is not working
I have the following piece of code called Code1.
http://pastebin.com/tc0Vd8xh
When I run this, the sketch does not work.
However when I replace "i=+50" for "i = i + 50" the code works.
My question is why the "i=+50" bit does not work?
As far as I know "i=+50" is proper Java and Processing is based on Java.
I tried to Google about "i=+50" but Google does not process non-alphanumeric characters.
So I came here and I searched in previous questions before asking here. Anyone, any idea why "i=+50" does not work?
A:
You're using =+, which is not a java operator (or an operator in any other language I know of)
The proper syntax is:
i+=50
|
A tribute plaque has been unveiled to honour and recognise the survivors of the Hillsborough disaster.
Dozens of people gathered at Liverpool’s Central Station on Sunday to see the tribute revealed after it was donated by the family of late campaigner, Anne Williams, whose 15-year-old son, Kevin, died in the 1989 tragedy.
Mrs Williams became a symbol of defiance after campaigning constantly to uncover the truth about the deaths of the 96 victims until she herself passed away in 2013. Her brother, Danny Gordon, and daughter, Sara Williams, then carried on her work by commissioning the work.
Steve Hart, a Hillsborough survivor, told JMU Journalism: “I think you can tell by the amount of people that turned up today just how important this plaque is to the people who came back that day.
“This is a focal point for them all now, and I hope so because so many of them to this day have never had the help that they should’ve had. If this can give them some sort of peace and closure then I think it’s fantastic.
“A lot of them still have their demons to face, and if this in any way at all helps them then I think it’s fantastic.”
Merseyrail agreed to place the memorial in the station so everyone passing through will be able to stop and see the plaque.
YouTube: Amy Harding
Steve Rotheram, Liverpool City Region’s Metro Mayor, told JMU Journalism: “I think it’s an appropriate place as there’s as much as 16 million people here every year, and I think some of those people will take an opportunity to come here and have a look and just pause for a second and think about what happened all those years ago.”
Mayor Rotheram, who was at Hillsborough, said: “It’ll mean different things for different people because some who have attended today’s unveiling, like myself, were there on the day and we will have our own memories of the tragic events in April 1989.
“For others, it’ll be about the true-spirited people of Liverpool and how that solidarity carried us through for nearly three decades until we got truth and justice.” |
Contact River Center Clinic
River Center Clinic Reviews
Moonlitelover4uonly reviewed on River Center Clinic
This eating disorder clinic will say anything to keep you in the program include lying to you, your family and your dr. and telling each a different story. The treatment only runs Monday-Friday from 11:30am to 6:30p.m. then they just trust you to do what you are suppose to do of course there is a huge grocery store next door and a gas station beside it. There is no staff for the adults at all after hours. They will call you a lair to your face. Even if telling the truth. I noticed that a few of the patients were staying longer because they had no place to go after treatment and this was a bed. THEY CAN NOT TAKE CARE OF GASTRIC BYPASS PATIENTS WITH EATING DISORDERS they will tell you they have had several They are lying to you. You do not have the knowledge or the means to deal with the way we have to eat food unless you want to try and eat a 1400cals meal plan eating every single hour from 11am to 6pm because we can not hold much food then get in trouble for not drinking enough.
posted on Saturday, January 22, 2011
Publish your business online
Get an online business listing and attract new customers. Much of a consumer's purchasing power now comes from online browsing.
It's important you establish an online prescense to promote your business, or the target market you want to reach may just wind up
browsing to your competition.
Easy online submission
Whether or not your business will be succesful, stems largely from a proper online prescense.
Business Listings Website goes beyond simply having a web prescense - we are your web presence.
Let us manage your online business submission,
so you can focus on what's important to you - servicing your customers, and growing your client base. |
I profiled a kernel while doing a series of lat_connect runs
(from lmbench), and the first line was:
Each sample counts as 0.00390625 seconds.
% cumulative self self total
time seconds seconds calls us/call us/call name
13.33 0.28 0.28 724 388.47 388.47 in_pcblookup_port
Connect speed may not seem the most important benchmark, but I can
imagine that something like a webserver would like to have these
numbers a lot lower. The connect latency, as I measured it on
the same hardware with hbench, doubled between NetBSD 1.3
and NetBSD 1.4, and I think we should get back to the old
numbers.
Anyway.. it would appear that in_pcblookup_port is a plain linear
search on a linked list, which soaks up a lot of time even
on the machine where I ran the test (which isn't listening to
a whole lot of ports). FreeBSD, for example, made this a hash
lookup. It may be worthwhile to do the same.
Comments?
- Frank
--
Frank van der Linden fvdl@wasabisystems.com
======================================================================
Quality NetBSD CDs, Support & Service. http://www.wasabisystems.com/ |
Q:
SQL Sum not working correctly with group by
I’m writing Oracle SQL for detailed and summary reports. My detailed report is finish with example output rows would be:
domain name, student name, completed
Domain Name, Student Name, Y
Domain Name, Student Name, N
Note the completed column is “Y” or “N”.
The problem is with my summary report. I’m grouping by domain name and splitting the detailed report column “Completed” of “Y” and “N” to the Summary columns of “Complete” and “Incomplete”. I changing the “Y” to 1 or 0, and the “N” to 1 or 0 and then SUM each column.
My detailed report returns 17k rows, my Summary report returns 174 rows but total of sums are not correct. Example output for summary report is one of three types: “Domain Name, 1, 0” or “Domain Name, 1,1” or “Domain Name, 0, 0 “. These rows should have numbers like “Domain Name, 254, 110”, etc.
Any help or guidance with code would be appreciated.
SELECT inner_clause.dmn_id,
SUM(decode(status_remday,'Y',1,0)) COMPLETED,
SUM(decode(status_remday,'N',1,0)) INCOMPLETED
FROM
(SELECT DISTINCT q.qual_id,
q.qual_title,
s.dmn_id,
SUBSTR(pkg_student.get_delm_stud_qual_stat_rmday(sq.stud_id, sq.qual_id, sq.qual_id),1,1) AS status_remday
FROM pa_stud_qual sq,
pa_student s,
pa_user_preference userPref,
pa_qual q
WHERE sq.stud_id = s.stud_id
AND s.stud_id = userPref.user_id(+)
AND userPref.user_type(+)='S'
AND sq.qual_id = q.qual_id
/** and q.qual_id in [CurriculumSearch] */
/** and s.stud_id in [UserSearch] */
/** and s.notactive = [UserStatus] */
/** and [security:pa_student s] */
) inner_clause
GROUP BY inner_clause.dmn_id
ORDER BY inner_clause.dmn_id
A:
The inner clause needed to DISTINCT more fields for the result. The final solution was:
SELECT inner_clause.dmn_id,
inner_clause.qual_title,
SUM(decode(status_remday,'Y',1,0)) AS COMPLET,
SUM(decode(status_remday,'N',1,0)) AS INCOMPLET,
COUNT(decode(status_remday,'Y',1,'N',1)) AS TOTAL,
SYSDATE AS CURRENTDATETIME
FROM
(SELECT DISTINCT q.qual_id,
q.qual_title,
sq.stud_id,
s.lname,
s.fname,
s.mi,
s.dmn_id,
sq.assgn_dte,
sq.qual_id,
NVL(userPref.preferred_timezone,pkg_state.get_default_timezone()) AS preferred_timezone,
DECODE(S.NOTACTIVE,'Y','label.NotActive', 'N','label.Active') AS NOTACTIVE,
s.email_addr,
SUBSTR(pkg_student.get_delm_stud_qual_stat_rmday(sq.stud_id, sq.qual_id, sq.qual_id),1,1) AS status_remday
FROM pa_stud_qual sq,
pa_student s,
pa_user_preference userPref,
pa_qual q
WHERE sq.stud_id = s.stud_id
AND s.stud_id = userPref.user_id(+)
AND userPref.user_type(+) = 'S'
AND sq.qual_id = q.qual_id
/** and q.qual_id in [CurriculumSearch] */
/** and s.stud_id in [UserSearch] */
/** and s.notactive = [UserStatus] */
/** and [security:pa_student s] */
ORDER BY 1
) inner_clause
GROUP BY inner_clause.dmn_id, inner_clause.qual_title
ORDER BY inner_clause.dmn_id
|
Comparison of different concurrency models: Actors, CSP, Disruptor and Threads - r4um
http://java-is-the-new-c.blogspot.com/2014/01/comparision-of-different-concurrency.html
======
noelwelsh
Disagree with the characterization of CSP. CSP as I understand it has channels
as the main building block for interprocess communication. Channels can be
synchronous or asynchronous, and bounded or unbounded. The important point is
that a channel is a value (you can pass it to a method, return it from a
method) and usually has a type.
Actors are like a simplified CSP where each (lightweight) thread has a single
input channel. In the case of Akka this mean you lose type information because
control messages are mingled with data messages and you can't assign any
useful type of them.
Disruptor is mainly a pattern and implementation for high efficiency -- big
queues, minimum number of threads, and some tricks using CAS operations and
the like. I wouldn't call it a model of concurrency -- it's basically a
particular implementation of CSP.
~~~
calibraxis
Yes, authors cited their sources, so we can understand their perspective
better.
~~~
calibraxis
_facepalm_ That should be "authors _should_..." Which is BTW an absurdly
trivial observation to post in retrospect, on top of it.
------
kenrose
Can anyone elaborate on what happens with Akka after 5 cores? In all of the
timings, Akka has an equivalent exponential drop to all of the other systems -
until it hits 5 cores. At that point, it levels off or goes up. Is there
anything inherent in the Akka implementation that would cause this?
------
stcredzero
There should be a rethink of how our multicore computers are architected. Here
is what I have to do in order to write a multicore parallel soft real-time
application.
1) I have to scrutinize the way I use memory, such that no two threads are
going to stomp on the same cache line too often. (False sharing)
2) The above includes the way I use locking primitives and higher level
constructs that are built on them! (Lock convoying)
3) If I am using a sophisticated container like a PersistentMap, which is
supposed to make it easy to think about concurrency, I still have to think
about 1 & 2 above at the level of the container's API/contract, as well as
think about how they might interleave contended data within their
implementations. (Yes, Concurrency is not Parallelism. Here we see why.)
4) Garbage Collection -- Now I have to think about if the GC is in a separate
worker thread and think about how that can result in cache line contention.
5) Even if you do all of the above correctly, the OS can still come along and
do something counterproductive, like trying to schedule all your threads on as
few cores/sockets as possible. (This is even nicknamed "Stupid Scheduling" in
Linux by people who have to contend with it.) This entails yet more work.
6) Profiling all of the above is, as far as I can tell, still a hazy art.
Nothing is a smoking gun for one of the pitfalls of multicore parallelism. One
is only left with educated guesses, which means that you have to increase data
gathering. Is there something like a debugger like QEMU which can simulate
multicore machines and provide statistics on cache misses? Apparently, there
are ways to get this information from hardware as well.
It would seem that Erlang has an advantage with regards to multicore
parallelism, because its model is "distributed by default," so contention is
severely limited, which is great for parallelism. However, coordination is
severely limited as well! (I need to look at Supervisors and see what they can
and cannot do.)
It would also seem like there's room for languages that combine these recently
popular advanced concurrency tools with enough low-level power to navigate the
above pitfalls, combined with a memory management abstraction that increases
productivity without requiring the complications for parallelism entailed by
GC. Rust, C++, and Objective-C are the only languages that somewhat fit this
bill. (If only Rust were not quite so new!) Go, with its emphasis on pass by
value semantics might also work for certain applications, despite its reliance
on GC.
~~~
vertex-four
What do you mean by coordination being limited in Erlang, exactly?
Supervisors are essentially in charge of one thing, and that's process
lifecycle management; starting up processes, restarting them when they die,
and bailing out if something goes wrong.
~~~
stcredzero
_What do you mean by coordination being limited in Erlang, exactly?_
I have an algorithm for an absolute occupancy grid that can handle multicore
parallelism. Basically, the grid is subdivided into smaller parts that just do
their thing independently, but if they detect that a move takes a player out
of their boundaries, they queue it up locally for the global grid. Once all of
the subgrid threads are done, they wait while the global grid does its thing.
(Aggregating all the local subgrid queues, then processing those moves
requiring global coordination.)
I don't see how I can do that in Erlang. The closest thing I'm aware of (and I
know almost nothing about Erlang) is that moves are are done optimistically,
then collisions can be detected after the fact and rolled back. Maybe that's
what I'll need to do: port to Erlang and use rollbacks.
_Supervisors are essentially in charge of one thing, and that 's process
lifecycle management_
I thought they could do more than just that, maybe.
~~~
vertex-four
That should be reasonably possible, surely? Your global grid is one process,
that sends messages containing the smaller parts to the processing processes,
then waits for them to reply with another message, and then aggregates the
replies. It's all just message buses, you can push whatever stuff you want
around however you want.
Imagine how you'd implement your system if each part of the system had to
communicate with the others over a network socket, and you're most of the way
to implementing it in Erlang.
It's probably not optimal to do things involving lots of calculations in
Erlang, though, as the VM is fairly slow. Akka implements a similar system,
but for the JVM (Scala).
~~~
stcredzero
_waits for them to reply with another message, and then aggregates the
replies_
Basically, you are proposing that the world actor aggregate the entire world's
data? That wouldn't scale. Or, maybe the world actor just becomes responsible
for adjudicating moves between subgrids. Maybe.
~~~
MetaCosm
Isn't the fundamental point of concurrency the players?
Couldn't you have X players moving on a global grid? I have built systems with
literally tens of millions of players (Erlang processes) moving on a grid (and
doing way more, localized threat detection, decision making, moving away or
towards, and coordination with other units in X range).
~~~
stcredzero
Can you give a high level description of how you implement the global grid?
It's really only absolute coordination of a checkerboard-like grid that I'm
wrestling with. I've verified that my algorithm works, and is nicely stable.
I've also scrutinized it with VisualVM, and on Linux and OS X, the threads are
either in wait or running, in the pattern I'd expect. (The subgrid worker-
group threads have to wait for the global grid to do its coordinating.) I'm
also seeing expected use of the thread pools. However, for some reason I can't
seem to scale beyond 250 users.
One complication is that my grid is for a procedurally generated world with
2^120 locations in it. This is why I generate subgrids. A degenerate case is
one subgrid per user. However, these subgrids are organized in load-balanced
groups, each of which has their own thread pool, caches, and locks.
Also, rollbacks are problematic, though the real problems are arguably corner
cases.
Erlang might be a win because each garbage collector only has to deal with its
own local memory.
EDIT: It turns out my algorithm is somewhat similar to Pikko:
[http://www.erlang-
factory.com/upload/presentations/297/Pikko...](http://www.erlang-
factory.com/upload/presentations/297/PikkoServerErlangconference.pdf)
One big difference, is that my algorithm doesn't move or reconfigure masts,
instead it dynamically creates subgrids, which are then grouped into
"workgroups" each of which is supposed to be processed by a different CPU
socket. Instead of there being an API, it's more that the subgrids stop what
they are doing and their information is briefly managed by the global grid
code. (The procedurally generated map is rigged, so that there are many
opportunities for crossing from one subgrid to another.)
~~~
MetaCosm
Going to do my best to put a quick summary (from memory) on something that
took us a long time to get right and was a bit convoluted.
Our units actually would report to intermediaries their maximum interaction
boundries, which would then be passed to processes to create something
somewhat like a mast, someone like a subgrid -- a dynamic interaction zone.
All our units had hard constraints (max speed, etc) and worked in global ticks
that represented real time. Then, we would talk to global to stretch all the
interaction zones to fill empty space and report back boundaries. Then, our
units would work in little worlds until they crossed a threshold, we caused a
rezoning among them and their neighbors. So initially, the everything would
have to be parsed out into interaction zones, but then they could ignore each
other for periods of times until a unit strayed across an edge, and then
rezoning took place.
Not sure how well it would work with amped up movement (making it have to go
all the way up to global more) and not certain how it would work at the scale
of 1 undecillion 329 decillion 227 nonillion 995 octillion 784 septillion 915
sextillion 872 quintillion 903 quadrillion 807 trillion 60 billion 280 million
344 thousand 576 points!
~~~
stcredzero
I woke up with the realization that my problem is probably GC pressure. The
system is currently written in idiomatic Clojure so doing everything generates
garbage. What's more, the garbage is created in one tick, then released in a
subsequent tick, so I'm losing the benefit of generational GC.
I think I can make my subgrids algorithm work, but it will have to be using
_mutable_ data structures.
------
eternalban
Disruptor is an _application_ of the pre-emptive threading model. It certainly
it interesting but to put it in the same pedestal as CSP and Actor model is
wrong. (Also the stability of Disruptor approach in face of competing
applications on the same machine was an issue last I checked.)
------
rdtsc
It is interesting since in Erlang data structures are functional (immutable)
actor mailboxes could as well be implemented to share data instead of copying
it. Large binaries are handled that way. They live in a binary memory area and
are referenced via pointers. The rest of the messages are not. At some point
it was deemed it was better to actually make the copy.
~~~
ANTSANTS
Even if everything is immutable, sharing data between threads adds memory
management overhead that isn't worth it for most objects. For GC, you have to
walk the environment of every thread to free anything in the shared memory. I
dunno how big of a difference that makes for fancy concurrent GCs, but for
regular ones, you'd have to stop every thread during collection. For reference
counting, it's a bit simpler; so long as each thread keeps its own reference
count, you can decouple the reference counting from freeing and have a hybrid
scheme where you "GC" the shared object heap by scanning for objects with
reference counts of 0 in all threads. Still not free, though.
------
vanderZwan
> _For maximum performance one would create one large job for each Core of the
> CPU used._
Dmitry Vyukov has suggested otherwise in a similar scenario using Go:
> _If you split the image into say 8 equal parts, and then one of the
> goroutines /threads/cores accidentally took 2 times more time to complete,
> then whole processing is slowed down 2x. The slowdown can be due to OS
> scheduling, other processes/interrupts, unfortunate NUMA memory layout,
> different amount of processing per part (e.g. ray tracing) and other
> reasons. [...] size of a work item must never be dependent on input data
> size (in an ideal world), it must be dependent on overheads of
> parallelization technology. Currently a reference number is ~100us-1ms per
> work item. So you can split the image into blocks of fixed size (say 64x64)
> and then distribute them among threads/goroutines. This has advantages of
> both locality and good load balancing._
[https://groups.google.com/d/msg/golang-
nuts/CZVymHx3LNM/esYk...](https://groups.google.com/d/msg/golang-
nuts/CZVymHx3LNM/esYkA_YoB-MJ)
Or to put it this way: imagine that there was zero concurrency overhead. Then
splitting out jobs to their minimal size would be the ideal option, as that
would allow for the most smoothed out division of labour where every processor
does work all the time and they are all doing work until the entire task is
completed.
|
EU solidarity damaged by splits on migrants and Greece Katya Adler
Europe editor
@BBCkatyaadleron Twitter Published duration 16 June 2015 Related Topics Europe migrant crisis
image copyright AFP image caption Italy and France are involved in a dispute over hundreds of migrants trying to cross the Italian border
"A community of values". Always standing by those seeking "peace and human dignity." "A vision of freedom and justice."
That was how Jose Manuel Barroso, then EU Commission President, described the European Union three years ago when it was awarded the Nobel Peace Prize.
But take a long, hard look at the bickering, posturing and dirty media war currently being fought over the Greek euro crisis and the migrant tragedy now bleeding in to the Mediterranean and the EU's image looks decidedly less shiny.
In EU circles, the word "solidarity" is being bandied about more than ever - but those using it are invariably arguing for something in their own national interest.
Greece calls on its creditors to show solidarity with its austerity-stricken population and to restructure (meaning reduce) its debts.
image copyright Reuters image caption European leaders are divided on proposals for a quota system to take in migrants
In turn, big creditor nations like Germany are refusing debt haircuts - insisting that they must show solidarity with their own taxpayers whose money flows to Greece.
The migration crisis in the Mediterranean makes the biggest mockery of the EU claim to always stand by those in pursuit of peace and human dignity.
There is very little dignity evident in the cramped, unhygienic, panicked conditions on board the boats crammed full of desperate people, washing over to Europe from Libya. And even less dignity on display amongst the EU nations falling over themselves to explain why those people should not be their problem.
A community of values indeed.
'Flood of immigrants'
The migrant issue is, of course, a very emotional one.
image copyright Getty Images image caption More than 100,000 migrants have arrived in Europe in 2015, many in Italy and Greece
How can one not feel outrage about the people smugglers and compassion for the innocent when confronted with images of small babies, unaccompanied youngsters, pregnant women and war-scarred men stumbling on to Europe's shores?
More than 100,000 people have arrived in Europe like this so far this year.
Many EU governments and citizens undoubtedly are horrified at the human suffering, fewer are keen on welcoming migrants, caring for them socially and medically and paying for them to start new lives, particularly in the wake of a biting economic crisis, whose toothmarks are still evident all over the continent.
The prospect of the arrival of a "flood of immigrants" often provokes another emotional reaction in Europe which has precious little to do with solidarity.
Ministers from all 28 EU countries were meeting in Luxembourg on Tuesday to discuss proposals to tackle the crisis.
These include the recently bolstered search and rescue mission in the Mediterranean, the (limited) plan to work with African nations to better prevent economic migrants leaving for Europe, the speedier forced return of economic migrants who make it to Europe, and the sharing of asylum applications more equally across the EU.
The burden-sharing pilot project is daring in its premise but extremely modest in its scale.
European Commission migrant plan
media caption How can EU address its migrant issue?
EU countries volunteer to take in a certain number of a total of 20,000 asylum seekers who have not yet left north Africa for Europe
EU countries accept a mandatory quota system (based on GDP, population, unemployment, and how many asylum seekers they have taken in the past) to redistribute 40,000 Syrian and Eritrean asylum seekers, who arrive in the EU by boat
The chances of this plan being accepted by EU ministers are about zero.
EU countries can roughly be divided into three categories in terms of their attitude towards the proposed quota system.
The most sanguine are the Danes, the British, and the Irish who have exemptions on issues like this and so are free to make decisions after listening to their voters, their economists and their consciences.
Then comes a group of important nations, including France, Germany, and Italy, which accept the idea of redistribution but remain uncertain over elements of the plan.
And finally, there are the countries mainly in Central and Eastern Europe who reject the idea outright and have threatened to scupper it.
'Make Europe suffer'
Before passing judgement, it is worth bearing in mind here that the minimum wage in the Baltics is lower than that in struggling Greece; that Hungary is already an overland EU transit hot-spot for would-be asylum seekers from Syria and Afghanistan as well as nearby Albania and Kosovo; and that Poland has taken in tens of thousands of Ukrainians fleeing the fighting with Russian-backed separatists.
Poland is thought to be a deciding nation when it comes to the quota proposal.
Its buy-in might be secured by an assurance from key EU nations, like Germany, that they will stand firm over an issue that Poland feels far more strongly about - maintaining strong sanctions against Russia.
image copyright Reuters image caption The Italian prime minister has threatened to hurt Europe if he does not get help
So this is what solidarity really looks like, EU style: horse-trading to ensure a national advantage.
And while the ministers bicker and exchange recriminations behind closed doors in Luxembourg, there is an ugly display of EU community values in a far more public arena.
France has closed its borders to migrants coming from Italy; and neighbouring Switzerland, Austria and Slovenia are threatening to do the same.
Now the beleaguered Italian Prime Minister, Matteo Renzi, has made his own threat: to "make Europe suffer" if he does not get help. |
This invention relates to an induction system for an internal combustion engine and more particularly to an improved cylinder head and induction passage arrangement for a multiple valve internal combustion engine.
It has been recognized that the performance of engines can be improved by increasing the number of valves serving each cylinder of the engine. Four valve per cylinder engines employing two intake valves per cylinder are now common practice, particularly in the automotive industry. However, it is also acknowledged that greater performance can be obtained through the use of three intake valves per cylinder. However, the use of three intake valves per cylinder does give rise to certain problems in that the flow through the three intake valves can cause interfering relationship within the cylinder under some conditions and can adversely affect performance.
For example, in a normal three input valve engine there are provided a pair of side intake valves that are disposed on opposite sides of a first plane that lies on the cylinder bore axis and which are intersected or lie close to a second plane perpendicular to the first plane and also passing through the cylinder bore axis. A third or center intake valve is disposed on the first plane and is spaced further from the second plane than the pair of side intake valves.
With this type of valve placement, the side intake valves can be disposed so as to generate a tumble action within the cylinder which has been found to promote performance, particularly under low and mid-range performance. This tumble action directs the charge into the cylinder in such a way as to cause a swirl about an axis that extends transversely to the cylinder bore axis and is thus distinguished from more conventional, axial swirl which occurs around the cylinder bore axis.
It has been found, however, that the positioning of the center intake valve creates a reverse tumble action which obscures or reduces the tumble action which is generated by the side intake valves and can under some running conditions deteriorate engine performance.
It is, therefore, a principal object of this invention to provide an improved induction system arrangement for an engine employing three intake valves per cylinder.
It is a further object of this invention to provide a cylinder head and intake passage arrangement for a three intake valve per cylinder engine wherein the effects of tumble in low and mid-ranges can be maintained.
In addition to the desirability of maintaining a tumble action in the cylinder under some running conditions, it is also desirable to employ a control valve for controlling the flow through the various intake valves. By doing this, it is possible to tune some of the intake passages to suit running conditions substantially different than those of the remaining valves. However, in order to do this, it is necessary to provide intake passages of different lengths and with previously proposed multi-valve constructions, this has not been easy to accomplish.
It is, therefore, a still further object of this invention to provide a cylinder head and induction passage arrangement for a multi-valve engine wherein the passages can be configured so as to have substantially different lengths without interfering with each other and while still maintaining a compact construction.
With the use of multi-valves and multiple intake passages to achieve the aforenoted result, it is the practice to provide at least one intake passage that is separate from the remaining intake passages that serve the cylinder. However, total isolation between the intake passages, particularly where one of them is throttled, can give rise to some performance defects in mid-range conditions where at the transition between the flow between only certain of the intake passages and flow between all of the intake passages.
It is, therefore, a still further object of this invention to provide an improved cylinder head and intake passage arrangement for a multiple valve engine that will provide good performance throughout the entire engine speed in low ranges. |
If this is your first visit, be sure to
check out the FAQ by clicking the
link above. You may have to register
before you can post: click the register link above to proceed. To start viewing messages,
select the forum that you want to visit from the selection below.
From an outstanding group of talented applicants, Adam Frantz of Belltown Brewing (Seattle, WA) has been named recipient of the 2018 American Brewers Guild scholarship. Adam will be attending ABG’s Intensive Brewing Science & Engineering course that runs from January to June 2018. The Intensive Brewing Science & Engineering course is a 22-week distance education program with a final week of residential instruction in Middlebury, VT. The course covers all the fundamentals of beer production and quality assurance with a special emphasis on practical issues.
Adam Frantz is currently Head Brewer at Belltown Brewing. Adam began as a home brewer ten years ago, picking up many accolades along the way. He translated that talent and passion into a career about five years ago working his way up through a myriad of positions to a full-time production brewer at Mac & Jack’s, then Head Brewer for American Brewing Company, before being tapped at the beginning of this year to help start up Belltown Brewing in downtown Seattle. About Adam, a Selection Committee highlighted his “innate ability to marry the art and science of brewing,” citing his “steadfast dedication and continual drive towards innovation built upon a biology science background.” In the brewhouse, Adam does much to mentor other brewers, “empowering them to explore their own creative instincts in a disciplined yet positive, encouraging way.” What also impressed the Selection Committee was Adam’s “desire to engage and educate with customers and his broader community and collaborate with fellow brewers.” “In all respects, Adam stands to benefit greatly from the ABG course as this is really the missing piece in the puzzle for a bigger brewing career, and everyone will benefit from all that he learns and shares.”
The American Brewers Guild is a premier school for the craft brewing industry dedicated to providing a comprehensive learning experience that focuses on the technical, scientific, and operational matters and issues that brewers face in a craft brewing environment. Adam Franz is the tenth Falconer Foundation recipient to the ABG. This year marks the ninth year of collaboration between the Falconer Foundation and the American Brewers Guild. We offer our deepest gratitude to ABG for its long-standing and continuing support for the Foundation’s brewing education scholarship program.
Join us in thanking the Selection Committee of Paul Bergman, Head Brewer and Owner of Wild Ride Brewing, Rodger Davis, Owner and Brewer of Faction Brewing, Alan Moen, Senior Writer and Columnist for American Brewer Magazine, Steve Parkes, Owner and Lead Instructor of American Brewers Guild, and Alan Sprints, Top Dog at Hair of the Dog Brewery and Tasting Room, who were given the difficult decision of selecting a single recipient from a deep and talented group of deserving candidates.
The Falconer Foundation has granted 37 scholarships since 2004 and is dedicated to promoting knowledge and expertise in the craft brewing industry in memory and honor of Glen Hay Falconer. For more information on the Glen Hay Falconer Foundation, visit www.glenfalconerfoundation.org and follow us on Facebook. |
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec001}
============
The insulin receptor (IR) belongs to the receptor tyrosine-kinase (RTK) family of cell-surface receptors \[[@pone.0205180.ref001], [@pone.0205180.ref002]\]. Early work on insulin and epidermal growth factor (EGF) revealed the presence of signaling molecules in hepatic endosomes fractions \[[@pone.0205180.ref003]\]. The concept of endosomal signaling is now well established \[[@pone.0205180.ref004]\], but the rules underlying IR trafficking and signaling compared with those underlying the EGF receptor (EGFR) remain relatively unknown; this may be because proper insulin signaling and trafficking correlate with the maintenance of cell polarity \[[@pone.0205180.ref005]\].
Type 2 diabetes (T2D) is the result of a chronic energy surplus \[[@pone.0205180.ref006]\] coupled with a strong hereditary component. Estimates for the heritability of T2D range from 20 to 80% with a sibling relative risk of approximately 2, with obesity being an important driver in every population. The detailed genetic architecture of T2D was recently elucidated, and unlike type 1 diabetes (T1D) where the genetic risk is mostly concentrated in the HLA region, the genetic component explaining part of the heritability of T2D is primarily due to a combination of numerous common variants of small effect scattered across the genome \[[@pone.0205180.ref007]--[@pone.0205180.ref009]\]. T2D is characterized by both resistance to the action of insulin and defects in insulin secretion; the former has been an important motivating factor in the exploration of insulin signaling \[[@pone.0205180.ref001], [@pone.0205180.ref002]\]. Previous efforts to demonstrate that the genes mapping close to T2D risk loci are enriched for established insulin signaling pathways, however met with limited success; the most robust finding to date implicates seemingly unrelated cellular mechanisms, the majority of which affect insulin secretion and beta cell function \[[@pone.0205180.ref008]--[@pone.0205180.ref012]\].
An accumulation of proteins associated with T2D was previously observed in the interactome of the IRs endocytosed in an hepatic Golgi/endosomes fraction \[[@pone.0205180.ref013]\], suggesting the existence of a disease module at this intracellular locus that could help to further understand IR routing mechanisms, the primary mechanisms of the disease and drive the development of rational approaches for new therapies \[[@pone.0205180.ref014]--[@pone.0205180.ref016]\]. Here, starting from a proteome of IR-containing endosomes to narrow the space search, and the construction of a T2D-protomodule using validated genes, we reveal the presence of a T2D disease module with functional relevance both to insulin targets and insulin producing cells.
Materials and methods {#sec002}
=====================
Cell Fractions- Harlan Sprague-Dawley rats (female 120--140 g, b.w.) were purchased from Charles River Ltd. (St. Constant, Québec, Canada) and were maintained under standard laboratory conditions with food and water available *ad libitum*, except that the food was removed 18 hours before the experiments. All animal procedures were approved by the Comité de Protection des animaux du Centre de Recherche du Centre Hospitalier de L\'Université Laval (CPA-CRCHUQ, certificate 055--3). The G/E and the PM fractions were prepared and characterized in terms of enzyme markers, electron microscopy (EM) and ligand-mediated endocytosis, as originally described and used directly \[[@pone.0205180.ref003]\]. The G/E fraction was also characterized in terms of proteomic survey and construction of the protein interaction network (GEN) \[[@pone.0205180.ref013]\]. The compiled yield for the G/E fraction was 0.47 ± 0.04 mg protein/g liver weight (n = 57). A compiled yield of 2.4 ± 0.6 mg of protein/g of liver (n = 25) was obtained. IR-immuno-enriched endosomes were prepared as originally depicted \[[@pone.0205180.ref017]\] from the parent mixed hepatic Golgi/endosomal (G/E) fraction with only minor modifications \[[@pone.0205180.ref018]\]. Dynabeads (Dynal-A, Invitrogen, San Francisco, CA, USA) that were pretreated with 0.1% BSA and coated with the anti-IR β-subunit antibody (Sc-711, Santa Cruz Biotechnology, Santa Cruz, CA, USA), were incubated with freshly prepared G/E fractions (10 mg of protein) for 1 hour at 4°C under gentle agitation. Beads were then rapidly rinsed before being subjected to EM, immunoblotting and mass spectrometry (MS) analysis. There was no major differences in the size and morphology of the vesicles immuno-isolated after 2 minutes or after 15 minutes of stimulation. They were relatively homogeneous with a diameter of 70--200 nm and some tubular elements. The IR was detected by Liquid chromatography-multiple reaction monitoring analysis (LC-MRM) using the peptide TIDSVTAQELR (P15127_IR, Q1 charge 660.3 (+2), Q3 charge 804.4 (2y^7^, +1) \[[@pone.0205180.ref013]\]. The amount of total protein bound to the beads was calculated by substracting the nonbound from the starting material \[[@pone.0205180.ref017]\] \[[@pone.0205180.ref018]\]. A 16--23 range fold- purification over the parent fraction was measured.
Protein in-gel digestion- Beads were washed 3 times with 50 mM ammonium bicarbonate buffer. They were suspended in 25 0μl of 50 mM ammonium bicarbonate, following which trypsin (1 μg) was added. Proteolysis was done at 37°C and stopped by acidification with 3% acetonitrile-1% TFA-0.5% acetic acid. Beads were removed by centrifugation, and peptides were purified from the supernatant by stage tip (C18) and vacuum dried before MS injection. Samples were solubilized into 10 μl of 0.1% formic acid and 5 μl was analyzed by mass spectrometry \[[@pone.0205180.ref019]\].
Mass spectrometry- Peptide samples were separated by online reverse-phase (RP) nanoscale capillary liquid chromatography (nanoLC) and analyzed by electrospray mass spectrometry (ES MS/MS). The experiments were performed with an Agilent 1200 nano pump connected to a 5600 mass spectrometer (AB Sciex, Framingham, MA, USA) equipped with a Nanoelectrospray ion source. Peptide separation occurred on a self-packed PicoFrit column (New Objective, Woburn, MA) packed with Jupiter (Phenomenex, Torrance, CA) 5 μl, 300A C18, 15 cm x 0.075 mm internal diameter. Peptides were eluted with a linear gradient from 2--30% solvent B (acetonitrile, 0.1% formic acid) in 30 minutes at 300 nl/min. Mass spectra were acquired using a data-dependent acquisition mode using Analyst software version 1.6. Each full scan mass spectrum (400 m/z to 1250 m/z) was followed by collision-induced dissociation of the twenty most intense ions. Dynamic exclusion was set for a period of 3 sec and a tolerance of 100 ppm. All MS/MS peak lists (MGF files) were generated using Protein Pilot (AB Sciex, Framingham, MA, USA, Version 4.5) with the paragon algorithm. MGF sample files were then analyzed using Mascot (Matrix Science, London, UK; version 2.4.0). MGF peak list files were created using Protein Pilot version 4.5 software (ABSciex) utilizing the Paragon and Progroup algorithms. (Shilov). MGF sample files were then analyzed using Mascot (Matrix Science, version 2.4.0) \[[@pone.0205180.ref020]\], and rodent databases ([S1 Table](#pone.0205180.s006){ref-type="supplementary-material"}). The number of newly identified proteins plateaued at approximately 10--20% of total for the second and third experiments, indicating that we were close to the completion point with this method \[[@pone.0205180.ref021]\] ([S1A Fig](#pone.0205180.s001){ref-type="supplementary-material"}).
Databases and network analyses- Conversion to human orthologs was performed using the InParanoid8 database ([S2 Table](#pone.0205180.s007){ref-type="supplementary-material"}). The PPIN was generated from a listing of protein-coding genes generated and named according to HUGO database nomenclature. Proteins found to be associated with IR in hepatic endosomes were included in the analysis: ATIC, PTPLAD1, SHP1, Cdk2, PLVAP1, CdkN1B and CCNE1. The interactions were curated using Y2H binary interactions of the CCSB human interactome, physical complexes and direct interactions from Intact, Database of Interacting Protein (DIP, UCLA), REACTOME, HITPREDICT and HINT databases, affinity complexes from BIOGRID and HPRD databases. Proteins having nonspecific interactions such as chaperones, ribosomal (RPL family) proteins, ubiquitylation and sumoylation processes (UBC, CUL), elongation factors were removed \[[@pone.0205180.ref022]--[@pone.0205180.ref024]\]. The Cytoscape platform (Version 3.2.0) was used for network visualization \[[@pone.0205180.ref025]\]. Self-loops and duplicated edges were removed prior the analyses. The cytoHubba algorithm was used to compute and rank nodes according to their centrality « Betweenness and Connectivity » scores in the network \[[@pone.0205180.ref022], [@pone.0205180.ref026], [@pone.0205180.ref027]\] ([S3 Table](#pone.0205180.s008){ref-type="supplementary-material"}). Cellular component grouping and functional analysis were performed after a gene ontology analysis with the Biological Networks Gene Ontology tool *(BINGO version 2*.*44)*. Hypergeometric test was used for statistical analysis and the Benjamin & Hochberg False Discovery Rate correction was set as multiple testing correction when performing gene ontology analysis with BINGO. Kinase predictions were performed with GPS 3.0 \[[@pone.0205180.ref028]\], phosphosites \[[@pone.0205180.ref029]\] and NetworKIN \[[@pone.0205180.ref030]\] version 3.0 (KinomeXplorer) using the high-throughput workflow option. Data from GPS 3.0 were additionally filtered by a differential score (difference between Score and Cut of) higher or equal to 1.0. Networking associations were considered if the Networkin score was observed to be higher than 2.0. Analyses were performed on November 10 2017. [http://dx.doi.org/10.17504/protocols.io.\[PROTOCOL](https://webmail.chuq.qc.ca/owa/redir.aspx?C=797c4a416d7845bb8b338bef0531bb0f&URL=http%3a%2f%2fdx.doi.org%2f10.17504%2fprotocols.io.%5bPROTOCOL) DOI.
Candidate gene analysis and identification- *GO analysis-* We verified the probability of intracellular colocalization for candidates and seeds using the plugin BINGO adapted for the Cytoscape platform. We clustered the hybrid network ([S2 Fig](#pone.0205180.s002){ref-type="supplementary-material"}) based on enrichment in the same cellular compartment by GO. In IREP proteins coming from Golgi-endosomal fractions, 21 seeds were found to be enriched in the Golgi apparatus (p \< 5.6822 x 10^−14^, after correction) and endosomes (p \< 1.1315 x 10^−16^, after correction). Of the 126 IREP candidates identified by PPIN, 32 have at least three interactors among the 21 Golgi-endosomal seeds. The analysis was expanded to other compartments with 7 candidates interacting each with three seeds in the cytosol cluster (p \< 6.8728 x 10^−17^, after correction), 10 candidates in the endoplasmic reticulum (p \< 1.6173 x 10^−12^, after correction), 25 in the plasmamembrane (p \< 5.6570 x 10^−8^, after correction), and 13 in the extracellular region (p \< 4.6024 10 x 10^−5^, after correction). Taken together, 54 nonredundant IREP coding genes among the 126 identified by PPIN were found to be colocalized with validated seeds based on GO analysis ([S3 Fig](#pone.0205180.s003){ref-type="supplementary-material"} and [S4 Table](#pone.0205180.s009){ref-type="supplementary-material"}).
Fine-mapping approach- We performed a linkage disequilibrium (LD) analysis and identified proximal SNPs correlated to diabetes GWAS signals (p ≤10^−3^) using replicated data as displayed in tables from the Wellcome Trust Case Control Consortium (WTCCC), GWAS Central portal, GWAS catalog or DIAGRAM GWAS-Metabochip or trans-ethnic data. This analysis provided a list of 130 IREP coding genes falling in genomic loci reliably associated with diabetes ([S5 Table](#pone.0205180.s010){ref-type="supplementary-material"}).
Genes expression analysis- Most of the SNPs identified by GWAS are intergenic or fall in intronic regions of genes suggesting a regulatory role \[[@pone.0205180.ref007], [@pone.0205180.ref009]\]. Among the 130 candidates identified by fine-mapping, we verified which ones had SNPs experimentally shown to affect gene expression and to likely regulate some transcription factor binding as described in category-1 of high-confidence associations in the RegulomeDB database \[[@pone.0205180.ref031]\]. We identified 15 IREP coding genes fulfilling these criteria, consequently forming a first pool of IREP candidates based on gene expression regulation ([S6 Table](#pone.0205180.s011){ref-type="supplementary-material"}). A second pool was made-up of IREP genes showing or predicted to have similar patterns of expression with at least three of the 184 seeds by RNA-Seq analysis and simultaneously sharing regulatory binding motifs either for transcription factors or for miRNA. The candidates and seeds pairs were considered coexpressed if they were mutually ranked among the top 1% of coexpressed genes pairs by the Genefriends database \[[@pone.0205180.ref032]\]. The transcription factor targets (TFTs) or microRNA targets were analyzed using the top 10 grouping of the Gene Set Enrichment Analysis \[[@pone.0205180.ref033], [@pone.0205180.ref034]\] with (p \< 4.35 x 10--16 after correction for TFTs and p \< 2.88 x 10--6 for miRNA targets). In all, 296 IREP coding genes were found to share TFTs with at least three diabetes genes compared with 112 for miRNA targets and 109 for RNA-Seq. Only 80 genes from the RNA-Seq analysis were considered for the second pool of candidates because they simultaneously showed some shared binding targets with at least three DAGs for TFs (72 genes) and/or for miRNA (28 genes). Taken together, 94 nonredundant IREP coding genes from the first and second pools are considered candidates based on shared regulatory elements with validated DAGs ([S6 Table](#pone.0205180.s011){ref-type="supplementary-material"}).
IR endosomal autophosphorylation- IR endosomal autophosphorylation was measured as previously reported \[[@pone.0205180.ref035]\] with minor modifications \[[@pone.0205180.ref013]\]. *SiRNA* in vivo: Rats were injected via the jugular vein with a scrambled or predesigned stabilized rat PTPLAD1 sequence (100 mg/100 g bw; IVORY in vivo siRNA `GGGGCAGUCUAAUUCGGUGUGCU`, D-00203-0200-V; purified/desalted by RP/IEX-HPLC; Riboxx Life Sciences, Germany; Liver *In vivo* transfection reagent 5061, Altogen Biosystems, Las Vegas, CA) 48 and 24 hours before isolating the G/E fraction. The PTPLAD1 mRNA expression level was measured against GAPDH in liver sections using quantitative polymerase chain reaction (qPCR) and was decreased by 52 +/- 6.2%, n = 3.
Cell culture and analysis- HEK293 cells were maintained in DMEM high-glucose medium with 10% foetal bovine serum. PTPLAD1 siRNA knockdown was performed as previously described \[[@pone.0205180.ref013]\] using the predesigned human sequence as follows: `GACCCAGAGGCAGGUAAACAUUACA` NM_016395_STEALTH_367. Cells were transfected using Lipofectamine 2000^TM^ (Life Technologies) for 48 hours and subjected to the described experiments. For overexpression experiments PTPLAD1 WT and Cdk2 WT were cloned into the pcDNA3 expression vector. Transfection was performed with Lipofectamine 2000^TM^ and plasmid DNA (300 ng/ml). Cells were preincubated at 37 ^0^C without serum for 5 hours before insulin (35 nM) stimulation for the indicated times. Immunoprecipitation (IP) were done under solubilization conditions that preserve the integrity of insulin-dependent complexes (Empigen BB 0.3%, 2 hours, 4°C) \[[@pone.0205180.ref018]\].
Reagents and antibodies- Porcine insulin (I5523) was obtained from Sigma-Aldrich (St. Louis, MO, USA). The following antibodies were used: anti-phosphotyrosine (PY20, Sigma-Aldrich, St. Louis, MO, USA). The IR β-subunit (Sc-711), Rab5c (sc-365667) and Cdk2 (sc-163, sc-163AC) antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The anti-PTPLAD1 was from Abcam (ab57143, Cambridge MA, USA). The anti-tubulin antibodies were obtained from Sigma-Aldrich (T5168, TUB 2.1, St. Louis, MO, USA). The anti-MAD2 was from Bethyl Laboratories (Montgomery, TX, USA). The RILP antibody was from Invitrogen (PA5-34357, Waltham, MA, USA). The generic anti-phosphothreonine was from Zymed (San Francisco, CA, USA). The antibody against Rab11a was from ThermoFisher Scientific (Rockford, IL, USA). Peroxidase-conjugated secondary antibodies were used (1:10,000, Jackson Immuno Research Laboratories, West Grove, PA, USA). Membranes (PVDF) were analyzed using a chemiluminescence kit (ECL, Perkin Elmer Life science, Boston, MA) or using an ImageQuant LAS 40 000 imager (GE Healthcare Biosciences, Baie d'Urfé, QC, CA). \[γ-^32^P\]-ATP (1000--3000 Ci/mmol) was from New England Nuclear Radiochemicals (Lachine, Québec). Other chemicals and reagents were of analytical grade and were purchased from Fisher Scientific (Sainte-Foy, Québec, CAN) or from Roche Laboratories (Laval, Québec, CAN).
Results and discussion {#sec003}
======================
Rabs, V-ATPase subunits, tyrosine phosphatases, and cell cycle proteins shape IR-containing endosomes {#sec004}
-----------------------------------------------------------------------------------------------------
To determine the proteomic environment of the internalized IRs, we performed a survey of IR-containing endosomes fractions. We started with a mixed Golgi/endosomes fraction (G/E) using a single dose of insulin (1.5 μg/100 g body weight \[b.w.\]) that resulted in 50% saturation of rat liver receptors. Fractions were prepared at the 2-minute time peak of IR accumulation and the 15-minute 50% decline time \[[@pone.0205180.ref013], [@pone.0205180.ref036]\] to collect a larger proteome. Freshly prepared fractions were then incubated with anti-IR (β-subunit)-coated magnetic beads, and endosomes were collected with a magnet \[[@pone.0205180.ref017], [@pone.0205180.ref018]\]. We identified a total of 620 proteins with high confidence (named IREP: IR Endosome Proteome, [Fig 1A](#pone.0205180.g001){ref-type="fig"} and [S1 Table](#pone.0205180.s006){ref-type="supplementary-material"}).
{ref-type="supplementary-material"}). (B) (left panel), Comparative enrichment profiles of trafficking proteins according to the insulin post-injection time. (right panel), the bound fraction (equal amount of starting material, see [methods](#sec002){ref-type="sec"}, [S1 Fig](#pone.0205180.s001){ref-type="supplementary-material"}) was blotted and pieces were incubated with antibodies against IR (95 kDA β-subunit), phosphotyrosine (PY-20, PY-95 kDA) and PTPLAD1.](pone.0205180.g001){#pone.0205180.g001}
Gene ontology (GO) analysis revealed enrichment of proteins involved in trafficking and signaling (MGI database; Biological Network Gene Ontology (BINGO) tool). These were primarily represented by coat-forming elements, small GTPases, components of the actin cytoskeleton, microtubules and motor proteins of the microtubule cytoskeleton and regulators of the cell cycle ([Fig 1A and 1B](#pone.0205180.g001){ref-type="fig"} left panel). Immunoblotting analysis confirmed the peak of IR accumulation occurring at 2 minutes post-insulin injection ([Fig 1B](#pone.0205180.g001){ref-type="fig"} right panel). The protein PTPLAD1 (*HACD3*), previously observed to be associated with the IR in G/E fractions after insulin stimulation \[[@pone.0205180.ref013]\], was also detected here at 15 minutes post-insulin injection ([Fig 1B](#pone.0205180.g001){ref-type="fig"}, right panel). Consistent with the presence of sets of Rabs \[[@pone.0205180.ref017], [@pone.0205180.ref037]\], thirteen Rabs were identified. They were shown to be involved in transport from early to recycling endosomes (Rab22a, 2 minutes post-insulin injection) or late recycling endosomes (Rab11a, Rab17) \[[@pone.0205180.ref038]\]. Rab8a, reported to act exclusively in the trans-Golgi network to plasma membrane transport, was identified at 15 minutes post-insulin injection ([Fig 1A](#pone.0205180.g001){ref-type="fig"}). Other Rabs identified at both times (Rab6a, Rab5c, Rab1a, Rab2b, Rab11b, Rab14, Rab1b, Rab7a and Rap1b) are all implicated in recycling, transcytotic or Golgi transport events \[[@pone.0205180.ref017], [@pone.0205180.ref038]\]. Among signaling proteins, the transmembrane protein tyrosine phosphatase (PTP) of the R subfamily \[[@pone.0205180.ref039]\], PTPRF (also named leukocytes antigen-related, LAR) was identified ([Fig 1A](#pone.0205180.g001){ref-type="fig"}). PTPRs are generally associated with IR tyrosine dephosphorylation \[[@pone.0205180.ref040]--[@pone.0205180.ref043]\], acting preferentially on the juxtamembrane sites Y960 and Y1146 located in the IR activation loop \[[@pone.0205180.ref041], [@pone.0205180.ref043]\]. The putative PTP Dnajc6 (also called auxillin) is a chaperone involved in clathrin-mediated endocytosis of EGFR \[[@pone.0205180.ref044], [@pone.0205180.ref045]\]. PTPN6 (SHP-1) is a known IR regulator in the liver \[[@pone.0205180.ref046]\]. The large representation of regulators of the cell cycle was less expected but is consistent with the attenuation of endocytosis during cell division \[[@pone.0205180.ref047]\]. The proton translocation machinery necessary to achieve optimal lumenal acidic pH is also particularly well represented (ATPv1a, ATPv1b2, ATPv1f, Atpv1e1, ATPv0a1; 2 minutes post-insulin injection) ([Fig 1A and 1B](#pone.0205180.g001){ref-type="fig"} left panel, [S1 Table](#pone.0205180.s006){ref-type="supplementary-material"}). Efficient acidification by V-ATPase is particularly important for the ligand dissociation-degradation sequence according to the law of mass action and is specific to insulin in contrast with EGF or prolactin complexes. This sequence is followed by a rapid recycling of the freed IR under the concerted action of endosomal protein tyrosine phosphatases (PTPs), thus supporting efficient circulating clearance \[[@pone.0205180.ref003], [@pone.0205180.ref048]\].
Genes at risk for type-2 diabetes form a proto-module enriched for transport and oxygen species regulation {#sec005}
----------------------------------------------------------------------------------------------------------
Most of the established T2D genes are supported by low and high probability GWAS signals of their identified variants \[[@pone.0205180.ref008], [@pone.0205180.ref009]\]. To verify if the IREP is associated with T2D, we used complementary data sources (DIAGRAM consortium, SNPs provided in replicated GWAS from the NHGRI-EBI GWAS catalog and GWAS Central portal, source [S7 Table](#pone.0205180.s012){ref-type="supplementary-material"}) to compile a list of 452 T2D and associated trait genes on the basis of single-nucleotide polymorphisms (SNPs) identified in their genomic loci (diabetes-associated gene: DAG; p-value \< 5 x 10^−8^; [S8 Table](#pone.0205180.s013){ref-type="supplementary-material"}). This list also contains relevant genes associated with T2D Mendelian traits described in the OMIM database and tagged with the symbol (3) indicative of known molecular associations ([S8 Table](#pone.0205180.s013){ref-type="supplementary-material"}-sheet OMIM). To reduce false-positive associations, the 452 DAG products were validated in a physical protein interaction network (PPIN) \[[@pone.0205180.ref014], [@pone.0205180.ref024]\]. We gathered physical protein-protein interaction data from the Biological General Repository Interaction Datasets (BIOGRID), the human interactomes I and II generated with Y2H systems from the Center for System Biology (CCSB) interactome, Intact, Reactome, Database of Interacting Proteins (DIP, UCLA), HitPredict databases or from the Human Proteins Repository Database (HPRD). The network was visualized with Cytoscape \[[@pone.0205180.ref025]\]. The 452 DAG products formed a PPIN of 184 proteins and 309 interactions we called the *proto-T2D module* ([Fig 2A](#pone.0205180.g002){ref-type="fig"} and [S3 Table](#pone.0205180.s008){ref-type="supplementary-material"}- sheet T2DN-protomodule).
{ref-type="supplementary-material"}).](pone.0205180.g002){#pone.0205180.g002}
The proto-T2D module is made up essentially of protein coding-genes from OMIM (26%), GWAS variants with a p-value \< 1x10^-8^; 69%, and GWAS variants with 5 x 10^−8^ \< p-value \<1 x 10^−8^; 5%, ([Fig 2B](#pone.0205180.g002){ref-type="fig"}). It displays a scale-free topology relying on a few hubs of large size such as HNF4A surrounded by a majority of the peripheral nodes (more than 38% of the nodes have only one interactor) \[[@pone.0205180.ref014], [@pone.0205180.ref015]\] ([Fig 2A and 2C](#pone.0205180.g002){ref-type="fig"} and [S3 Table](#pone.0205180.s008){ref-type="supplementary-material"}-sheet ProtoT2Dmodule). Protein transport (p \< 1.82 x 10^−34^) and response to oxygen-containing compounds (p \< 1.32 x 10^−32^) are the most enriched cellular processes identified by a gene ontology (GO) analysis with the presence of trafficking proteins (Rab5b, RABEPP1, RABEPP2) and transcription factors from the HNF (HNF4A, HNF1A or HNF1B), FOX (FOXO3, FOXA2) and TCF families (TCF7L2, TCF4, and TCF19). Signaling modules associated with insulin sensitivity are also present (INSR, IRSs, GRB14, PTPN1) ([Fig 2A](#pone.0205180.g002){ref-type="fig"} and [S3 Table](#pone.0205180.s008){ref-type="supplementary-material"}-sheet GO analysis-T2D-protomodule). The affinity for these biological processes is supported by the enriched subcellular component analysis which revealed an accumulation of the coding genes associated with risk for T2D in endosomes and endoplasmic reticulum among the major genes. Proteins from the histocompatibility complex are also among the most significant clusters in the T2D-protomodule ([Fig 2A](#pone.0205180.g002){ref-type="fig"} and [S3 Table](#pone.0205180.s008){ref-type="supplementary-material"} sheet GO analysis-T2D-protomodule).
Overall, 62% of the 452 selected DAGs are disconnected (267/452). Five factors likely contribute to this fragmentation as follows:
1. i\) True lack of binary or indirect physical interaction.
2. ii\) Interactome incompleteness \[[@pone.0205180.ref024]\].
3. iii\) False positives (not all genes have a known mechanistic association with the disease), and genes associated with late complications of the disease.
4. iv\) The T1D-T2D paradox and disease classification \[[@pone.0205180.ref007]\].
5. v\) Missing heritability \[[@pone.0205180.ref008], [@pone.0205180.ref009]\].
A total of 101 high confidence candidate genes for type 2 diabetes risk are identified in IREP {#sec006}
----------------------------------------------------------------------------------------------
Genes that fall within one of the known disease loci and whose protein products interact with a known risk factor are predicted to be 10-fold enriched in a true disease gene. By considering the cellular localization as well, the network information leads to a 1000-fold enrichment over random genes \[[@pone.0205180.ref014], [@pone.0205180.ref049]\]. We used a combination of approaches to identify candidate genes confidently associated with diabetes traits. The candidates were grouped and ranked according to i) their topological proximity with the 184 previously validated DAG "seeds" in the PPIN approach, ii) the probability of co-localization in the same subcellular locus ([S4 Table](#pone.0205180.s009){ref-type="supplementary-material"}), iii) the identification of proximal variants correlating with the diabetes GWAS signal by fine-mapping analysis ([S5 Table](#pone.0205180.s010){ref-type="supplementary-material"}) and iv) the similarity of gene expression regulation with the 184 seeds of the proto-T2D-module ([S6 Table](#pone.0205180.s011){ref-type="supplementary-material"}) (see [Methods](#sec002){ref-type="sec"}).
A total of 246 nonredundant IREP coding genes are associated with diabetes traits when considering each of the approaches individually. Of these, 38 were validated by at least three of the approaches mentioned previously. This list includes the *Cdk2* gene which is located in the risk area composed of 4 blocks in strong LD around the T2D SNP rs2069408 ([S4A Fig](#pone.0205180.s009){ref-type="supplementary-material"} and [S5 Table](#pone.0205180.s010){ref-type="supplementary-material"}). ATIC, which was previously observed to be associated with the IR in endosomes together with PTPLAD1 and AMPK \[[@pone.0205180.ref013]\]; PTPN6 (SHP-1); the small GTPases of Rab the family (Rab14, and Rab5c); and a series of coat components (i.e., AP complexes, CAV1, COPA, SEC23A and SEC24C) are also present ([Table 1](#pone.0205180.t001){ref-type="table"}).
10.1371/journal.pone.0205180.t001
###### List of candidates.
Thirty-eight IREP coding genes are validated for association with diabetes traits by at least three out of four distinct approaches. (PPIN) protein-protein interactions network. (GO) Gene Ontology, Subcellular co-localization. (GWAS) fine-mapping. (COEXPRESSION) same expression pattern.
{#pone.0205180.t001g}
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------
CANDIDATES/\ CANDIDATES NAMES UPSTREAM KINASES IN IREP VALIDATION
SUBSTRATES
------------------ ---------------------------------------------------------------------------- ------------------------------------------------ ---------------------------
**CDK2** Cyclin-Dependent Kinase 2 CDK2 PPIN/GO/GWAS/COEXPRESSION
**B2M** Beta-2-Microglobulin \- PPIN/GO/COEXPRESSION
**ATP2A2** Sarcoplasmic/Endoplasmic Reticulum Calcium Atpase 2 AMPKA1/CAMKK2/CDK2/ROCK1 PPIN/GO/COEXPRESSION
**CTNNB1** Catenin Beta-1 AMPKA2/CAMKK2/CDK2/CIT/INSR/ROCK1 PPIN/GO/GWAS
**GNB4** Guanine Nucleotide-Binding Protein Subunit Beta-4 CAMKK2/ROCK1 PPIN/GO/GWAS
**HSPA8** Heat Shock Protein Family A (Hsp70) Member 8 AMPKA1/CAMKK2/CDK2/CIT/INSR PPIN/GO/GWAS
**RAB14** Ras-Related Protein Rab-14 AMPKA1 PPIN/GO/GWAS
**SEC24A** Protein Transport Protein Sec24a AMPKA1/AMPKA2/CAMKK2/CDK2 PPIN/GO/GWAS
**SEC31A** Protein Transport Protein Sec31a AMPKA1/AMPKA2/CDK2/CIT/INSR PPIN/GO/GWAS
**TFRC** Transferrin Receptor Protein 1 CAMKK2/CDK2/CIT/INSR PPIN/GO/GWAS
**ALB** Albumin \- PPIN/GO/COEXPRESSION
**AP1B1** Ap-1 Complex Subunit Beta-1 CAMKK2/CDK2/CIT PPIN/GO/COEXPRESSION
**AP1G1** Ap-1 Complex Subunit Gamma-1 AMPKA2/CAMKK2/CIT PPIN/GO/COEXPRESSION
**AP1M1** Ap-1 Complex Subunit Mu-1 AMPKA1/CDK2/CIT/INSR/ROCK1 PPIN/GO/COEXPRESSION
**AP1S1** Ap-1 Complex Subunit Sigma-1a CDK2 PPIN/GO/COEXPRESSION
**APOC2** Apolipoprotein C-Ii \- PPIN/GO/COEXPRESSION
**ATIC** Bifunctional Purine Biosynthesis Protein Purh CAMKK2/INSR/ROCK1 PPIN/GO/COEXPRESSION
**AP2M1** Ap-2 Complex Subunit Mu AMPKA1/CAMKK2/CDK2/CIT PPIN/GO/COEXPRESSION
**CALR** Calreticulin AMPKA2/CDK2/ERBB4 PPIN/GO/COEXPRESSION
**CAV1** Caveolin-1 INSR PPIN/GO/COEXPRESSION
**CD74** Hla Class Ii Histocompatibility Antigen Gamma Chain AMPKA1/CAMKK2/INSR/ROCK1 PPIN/GO/COEXPRESSION
**CLTC** Clathrin Heavy Chain 1 AMPKA2/CAMKK2/CDK2/CIT/INSR/ROCK1 PPIN/GO/COEXPRESSION
**EEF1A1** Elongation Factor 1-Alpha 1 CDK2 PPIN/GO/COEXPRESSION
**FGA** Fibrinogen Alpha Chain AMPKA2/CAMKK2/CDK2/CIT/INSR PPIN/GO/COEXPRESSION
**GNAI2** Guanine Nucleotide-Binding Protein G CAMKK2/CIT/INSR PPIN/GO/COEXPRESSION
**HPX** Hemopexin CDK2/CIT/ERBB4/INSR PPIN/GO/COEXPRESSION
**JUP** Junction Plakoglobin AMPKA2/CaMKK2/CDK2/ERBB4 PPIN/GO/COEXPRESSION
**LRP1** Low-Density Lipoprotein Receptor-Related Protein 1 AMPKA1/AMPKA2/CaMKK2/CDK2/CIT/ERBB4/INSR/ROCK1 PPIN/GO/COEXPRESSION
**PTPRF** Receptor-Type Tyrosine-Protein Phosphatase F AMPKA1/AMPKA2/CAMKK2/CDK2/ERBB4/INSR PPIN/GO/COEXPRESSION
**RAB5C** Ras-Related Protein Rab-5c CAMKK2/CDK2/CIT/INSR PPIN/GO/COEXPRESSION
**RAP1A** Ras-Related Protein Rap-1a CDK2/ERBB4 PPIN/GO/COEXPRESSION
**SDC1** Syndecan-1 AMPKA1/CDK2/INSR PPIN/GO/COEXPRESSION
**SEC23A** Protein Transport Protein Sec23a AMPKA1/CDK2/INSR PPIN/GO/COEXPRESSION
**SEC24C** Protein Transport Protein Sec24c AMPKA2/CAMKK2/CDK2/CIT/INSR PPIN/GO/COEXPRESSION
**ATP5B** Atp Synthase Subunit Beta, Mitochondrial AMPKA1/AMPKA2/CDK2/CIT PPIN/GWAS/COEXPRESSION\
**COPA** Coatomer Subunit Alpha AMPKA1/AMPKA2/CDK2/ERBB4 PPIN/GWAS/COEXPRESSION
**GBF1** Golgi-Specific Brefeldin A-Resistance Guanine Nucleotide Exchange Factor 1 AMPKA1/AMPKA2/CAMKK2/CDK2/ERBB4/ROCK1 PPIN/GWAS/COEXPRESSION
**PTPN6 (SHP1)** Tyrosine-Protein Phosphatase Non-Receptor Type 6 AMPKA2/CAMKK2/CDK2/INSR PPIN/GWAS/COEXPRESSION
**MTHFD1** C-1-Tetrahydrofolate Synthase, Cytoplasmic AMPKA2/CAMKK2/CDK2/CIT/INSR/ROCK1 PPIN/GWAS/COEXPRESSION
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Sixty-three other IREP coding genes are shown to have reliable association with diabetes after validation with any two approaches. This list includes the *HACD3* (PTPLAD1) gene, located in a risk area ([S4B Fig](#pone.0205180.s009){ref-type="supplementary-material"} and [S5 Table](#pone.0205180.s010){ref-type="supplementary-material"}), that was also previously associated with T2D in human islets \[[@pone.0205180.ref050]\]. PRKAA1 (AMPK); the Cdk2 regulators (CDKN1B, CCNE1); a V-ATPase subunit (ATP6VA1); the small GTPase Rab1a, Rab1b and Rab8a; several coat components; the putative tyrosine phosphatase DNAJC6; ACTB and TUBA also fall into this category (Table A in [S4 Table](#pone.0205180.s009){ref-type="supplementary-material"}). IREP is also enriched in genes associated with the T2D risk with 15 of the 184 validated DAGs from the human genome being identified indicating a nonrandom concentration of diabetes genes variants during IR endocytosis (p-value of 3.44 x 10^−4^; hypergeometric test) ([S2 Table](#pone.0205180.s007){ref-type="supplementary-material"}- sheet IREP-HUGO).
Collectively, IREP consists of more than 20% (15 validated DAGs from the T2D-protomodule and 101 candidates) of gene products confidently associated with the T2D risk.
The insulin receptor-containing endosome network (IREN) displays a type-2 diabetes disease module architecture {#sec007}
--------------------------------------------------------------------------------------------------------------
A disease module can be defined as a connected subnetwork showing mechanistic evidence for a phenotype \[[@pone.0205180.ref014], [@pone.0205180.ref015]\]. To identify the molecular mechanisms associated with IREP, we constructed a PPIN of IR-containing endosomes. The cytoHubba algorithm was used to compute and to rank nodes in the network \[[@pone.0205180.ref026]\]. The resulting collated PPIN is formed by 313 nodes and 1147 edges (55% of IREP proteins; named IREN, Insulin Receptor Endosome Network). The general topology of IREN is based on few major hubs, with the kinase Cdk2 displaying the highest centrality. Large nodes represented by the IR itself, proteins of the actin cytoskeleton (ACTB), and those involved in vesicular trafficking (CAV1) were observed. More peripheral nodes were also present as follows: coats (GOLGA2, CLTC), V-ATPase subunits (ATP6V1A), and cargos (APOA1) ([Fig 3](#pone.0205180.g003){ref-type="fig"} and [S3 Table](#pone.0205180.s008){ref-type="supplementary-material"}-sheet IREN).
{ref-type="supplementary-material"}). Candidates (yellow and blue colors and black characters; Tables [1](#pone.0205180.t001){ref-type="table"} and Table A in [S4 Table](#pone.0205180.s009){ref-type="supplementary-material"}) and DAGs (pink color and black characters) form a single-connected disease module of 94 nodes (33% of IREN nodes) with 330 interactions (28,7% of IREN interactions). An expansion to the first level of adjacent nodes results in a connected subnetwork of 272 nodes (88% of nodes) covering 92% of interactions (1070 out of 1147 IREN interactions). The functional groups are represented according to the colors of the borders indicated in the legends.](pone.0205180.g003){#pone.0205180.g003}
From the 101 high-confidence candidates (Tables [1](#pone.0205180.t001){ref-type="table"} and Table A in [S4 Table](#pone.0205180.s009){ref-type="supplementary-material"}) and 15 of the 184 validated DAGs identified in IREP, 94 of the candidates and 10 of the DAGs are present in IREN. They form a single-connected subnetwork of 94 nodes with 330 interactions ([Fig 3](#pone.0205180.g003){ref-type="fig"} and [S3 Table](#pone.0205180.s008){ref-type="supplementary-material"}). To test whether this module could arise by chance in the context of IR endocytosis, we made random reiterations of any 94 nodes of IREN. The results showed that the subnetwork is robust (p-value \< 0.0049, [S5 Fig](#pone.0205180.s005){ref-type="supplementary-material"}; [http://dx.doi.org/10.17504/protocols.io.\[PROTOCOL](https://webmail.chuq.qc.ca/owa/redir.aspx?C=797c4a416d7845bb8b338bef0531bb0f&URL=http%3a%2f%2fdx.doi.org%2f10.17504%2fprotocols.io.%5bPROTOCOL) DOI\]). Its collective influence was analyzed by expanding it to the first adjacent nodes. This resulted in a connected network of 271 nodes (88% of nodes) and 1070 out of 1147 IREN interactions (Figs [3](#pone.0205180.g003){ref-type="fig"} and [S5](#pone.0205180.s005){ref-type="supplementary-material"}), coverage that is largely more than expected by chance ([S5 Fig](#pone.0205180.s005){ref-type="supplementary-material"}). GO analysis also revealed an enrichment for vesicle transport (p\< 1.85 \< 10−^51^) and response to oxygen species (p \< 8.52 x 10^−20^), with the most enriched cell components being endosomes (p \< 7.00 x 10^−25^), Golgi apparatus (p \< 1.77 x 10−^27^) and endoplasmic reticulum (p \< 2.13 x 10^−23^), showing that the T2D-protomodule expansion coincides with a functional expansion ([Fig 3](#pone.0205180.g003){ref-type="fig"} and [S3 Table](#pone.0205180.s008){ref-type="supplementary-material"}-sheet IREN, GO analysis). Of the 94 of the 101 high-confidence candidates in IREP, 94 have credible tyrosine phosphorylation motifs with the IREN kinases ([Table 1](#pone.0205180.t001){ref-type="table"} and [S9 Table](#pone.0205180.s014){ref-type="supplementary-material"}). Of the 87 present in IREN, 71 have at least one of their kinase-substrate interactions confirmed in IREN ([Fig 3](#pone.0205180.g003){ref-type="fig"} and [S9 Table](#pone.0205180.s014){ref-type="supplementary-material"}), further emphasizing the mechanistic association. Taken together, these results indicate that IREN is a T2D-disease module.
Cdk2 affects the association of IR with microtubules {#sec008}
----------------------------------------------------
A prerequisite in the description of interaction maps is the validation of hubs in terms of perturbation responses. We then tested examples here of hub complexes in term of insulin response. We verified first whether Cdk2, which displays the highest centrality and is a high-confidence candidate ([Table 1](#pone.0205180.t001){ref-type="table"} and [S4A Fig](#pone.0205180.s004){ref-type="supplementary-material"}), is indeed associated with key elements. Microtubules, for instance, rely on dimerization of tubulin subunits alpha and beta for their assembly and Rab5-containing endosomes have a capacity to move along microtubules \[[@pone.0205180.ref051]\]. We noticed that the tubulin alpha subunit (TUBA), a reported substrate for the IR in vitro \[[@pone.0205180.ref052], [@pone.0205180.ref053]\], is preponderant within the IREN ([Fig 3](#pone.0205180.g003){ref-type="fig"}). We show that TUBA indeed readily associates with the IR after insulin stimulation in HEK293 cells, while TUBB has a different profile ([Fig 4A](#pone.0205180.g004){ref-type="fig"}). In addition, the association was nearly abolished upon Cdk2 overexpression, confirming the presence of complexes and indicating that Cdk2 levels can effect complexes organization within IREN ([Fig 4A](#pone.0205180.g004){ref-type="fig"}).
{#pone.0205180.g004}
PTPLAD1 expression affects the IR autophosphorylation activity and association with Cdk2, Rab5c, Rab11a and actin {#sec009}
-----------------------------------------------------------------------------------------------------------------
Compared with Cdk2, PTPLAD1 is an example of good centrality, but it is poorly studied and identified as a moderate candidate (Table A in [S4 Table](#pone.0205180.s009){ref-type="supplementary-material"} and [Fig 3](#pone.0205180.g003){ref-type="fig"}). Because the fatty acid elongation enzymatic activity was not confirmed, it was recently hypothesized that PTPLAD1 (HACD3) is involved in the elongation of specialized forms of 3-OH acyl-CoAs, such as those containing a short or branched alkylic chain \[[@pone.0205180.ref054]\]. An interaction with Rac1 was also reported \[[@pone.0205180.ref055]\]. PTPLAD1 has a well-positioned conserved cysteine C(X)5K motif in the soluble cytosolic loop, residues 257--279, and its partial deletion in cultured HEK293 cells coincided with IR tyrosine hyper-phosphorylation \[[@pone.0205180.ref013]\]. We verified whether PTPLAD1 acts on IR tyrosine phosphorylation outside a whole-cell context. We used an in vitro assay, whereby IR-loaded endosomes were incubated in the presence of ATP. We observed that a prior siRNA-mediated depletion in rat PTPLAD1 nearly abolished the PTPLAD1 presence from isolated endosomes, which coincided with a marked increase in IR autophosphorylation, demonstrating that the IR tyrosine-phosphorylated state is modified by PTPLAD1 ([Fig 4B](#pone.0205180.g004){ref-type="fig"} right panels). Low, but consistent, enzymatic activity towards the artificial substrate pNPP was measured ([Fig 4B](#pone.0205180.g004){ref-type="fig"} left panel) resembling the loss of PTP activity towards the IR observed previously observed after membrane solubilization \[[@pone.0205180.ref035]\]. In accordance with these results, and with prior PTPLAD1 depletion experiments \[[@pone.0205180.ref013]\], we observed that overexpression of PTPLAD1 in HEK293 cells markedly decreases the IR tyrosine-phosphorylated state ([Fig 4C](#pone.0205180.g004){ref-type="fig"}). Of further interest, the candidate Rab5c ([Table 1](#pone.0205180.t001){ref-type="table"}) also associates with the IR and this association increases in an insulin-regulated ([Fig 4C](#pone.0205180.g004){ref-type="fig"}). Rab5a and b are well documented as playing a role in the early events of EGFR endocytosis but the role of Rab5c remains unclear \[[@pone.0205180.ref056]\]. Rab5c may therefore be particularly important for IR action as we noted the presence of an IR phosphorylation motifs located in the GTP binding site (Y83) ([S9 Table](#pone.0205180.s014){ref-type="supplementary-material"}) that resembles an inhibitory feedback loop described previously for Rab24 \[[@pone.0205180.ref057]\]. In support of this finding, we detected Rab5c and Cdk2, but not Rab11a, in anti-phosphotyrosine affinity complexes, and this association was markedly decreased after PTPLAD1 overexpression ([Fig 4C](#pone.0205180.g004){ref-type="fig"}). In addition, both IR and Rab5c were present in Cdk2 affinity complexes, and this association decreased following PTPLAD1 overexpression ([Fig 4C](#pone.0205180.g004){ref-type="fig"}). To further test the importance of PTPLAD1 on IR complexes, we verified and noticed an insulin-dependent association of IR with Rab11a, a known marker at the intersection between the endocytic and exocytic pathways \[[@pone.0205180.ref038], [@pone.0205180.ref058]\]. This supports a role for PTPLAD1 in cycling from endosomes to the plasmamembrane (PM). On another hand, we confirmed that under the same circumstances PTPLAD1 deletion, using siRNA, increases IR tyrosine phosphorylation and the presence of actin in IR immunoprecipitates ([Fig 4D](#pone.0205180.g004){ref-type="fig"}) \[[@pone.0205180.ref013]\].
We also observed an insulin-dependent recruitment of the Rab- interacting lysosomal protein (RILP) in IR immunoprecipitates that was nearly abolished by PTPLAD1 deletion ([Fig 4D](#pone.0205180.g004){ref-type="fig"}). RILP was demonstrated to be required for EGFR confinement and degradation in late endosome compartments \[[@pone.0205180.ref059]\] and is an inhibitor of V-ATPase activity \[[@pone.0205180.ref060]\]. This supports the importance of the PTPLAD1 node within IREN. Collectively, the data support the presence of dynamic insulin-dependent interactions for Cdk2 between the IR, PTPLAD1, Rab5c, Rab11a, tubulin and actin cytoskeletons whereby PTPLAD1 controls IR tyrosine phosphorylation and key interactions.
To verify the idea that cell cycle components have expanded their action on endocytic traffic, we verified whether the protein MAD2, which binds to the MAD2-interacting motif (MIM) located in the carboxyterminal domain of the IR β-subunit during clathrin-mediated endocytosis \[[@pone.0205180.ref061]\], is responsive to insulin at the cell surface. The results demonstrate that MAD2 readily disappears from the PM fractions following IR tyrosine kinase activation ([Fig 4E](#pone.0205180.g004){ref-type="fig"}), thus supporting the idea that cells use cell cycle regulators for both early \[[@pone.0205180.ref061]\] and later events of IR endocytosis. No MAD2 signals were detected in the G/E fraction, suggesting a rapid dissociation of the complexes toguether with the clathrin coat.
Inhibition of V-ATPase shifts the IR accumulation rate in endosomes in vivo {#sec010}
---------------------------------------------------------------------------
V-ATPase subunits are well represented in IREP ([Fig 1](#pone.0205180.g001){ref-type="fig"} and [S1 Table](#pone.0205180.s006){ref-type="supplementary-material"}), forming large, more peripheral nodes in IREN ([Fig 3](#pone.0205180.g003){ref-type="fig"}) with ATP6V1A being identified here as moderate candidate (Table A in [S4 Table](#pone.0205180.s009){ref-type="supplementary-material"}) for type 2 diabetes risk. We thus verified whether the kinetics of IR endocytosis are affected in vivo after treatments with two different potent V-ATPases inhibitors. We observed that the peak of IR accumulation in endosomes is markedly shifted towards later times of endocytosis following either concanamycin A or bafilomycin A1 pretreatments as demonstrated by immunoblotting and hexokinase activity measurements, indicating that V-ATPase reduces IR degradation and transport or decreases IR recycling to the plasma membrane \[[@pone.0205180.ref062]\] or both ([Fig 5A](#pone.0205180.g005){ref-type="fig"}). Concanamycin A does not affect IR on going IR autophosphorylation in vitro, showing that V-ATPase inhibitors do not inadvertently function through PTPs inhibition ([Fig 5B](#pone.0205180.g005){ref-type="fig"} left panel). We noted however a strong and consistent reconstituted threonine phosphorylation signal that was readily abolished by concanamycin A ([Fig 5B](#pone.0205180.g005){ref-type="fig"} right panel), suggesting the presence of additional feedback loop layers, which have yet to be characterized, informing the cell that the lumenal acidification process is optimized. We verified whether V-ATPases elements contains IR phosphorylation motifs. The kinase network analysis indicated that ATP6V1A (Table A in [S4 Table](#pone.0205180.s009){ref-type="supplementary-material"}) and ATP6V1E1 are indeed strong candidate substrates for the IR as well as for Cdk2 and AMPK (PRKAA1) ([Fig 5C](#pone.0205180.g005){ref-type="fig"} and [S9 Table](#pone.0205180.s014){ref-type="supplementary-material"}).
{ref-type="fig"}) depicting the connectivity of V-ATPase subunits. The V-ATPase subunits ATP6V1A, ATP6V1E1, ATP6VDA1 and ATP6V1B2 containing high confidence IR-tyrosine kinase phosphorylation and Ser/Thr kinases Cdk2, PRKAA1 (AMPK) and Citron phosphorylation motifs ([S9 Table](#pone.0205180.s014){ref-type="supplementary-material"}) are marked according to the legend.](pone.0205180.g005){#pone.0205180.g005}
Conclusion {#sec011}
==========
Using a combination of cell fractionation and computational approaches, we found a T2D disease module in IR-containing endosomes. The starting point of our analysis was a list of seed genes with established genetic T2D association and high GWAS p-values (1 x 10^−8^) against the background of random variation. They carry enough information to build a robust T2D-protomodule ([Fig 2](#pone.0205180.g002){ref-type="fig"}). The functional specialization of the T2D-protomodule also found in IREN ([Fig 3](#pone.0205180.g003){ref-type="fig"}) is in accord with the connection of these processes (protein transport, transcriptional factors and response to oxygen) in insulin action \[[@pone.0205180.ref001], [@pone.0205180.ref002]\]. The topological features of a scale-free network, with the view that hubs with the highest influence represent important points in biological networks \[[@pone.0205180.ref014], [@pone.0205180.ref026]\], coupled with the large enrichment in T2D genetic risk is particularly well represented by Cdk2 ([Fig 3](#pone.0205180.g003){ref-type="fig"} and [Table 1](#pone.0205180.t001){ref-type="table"}). Cdk2 regulators were independently and repeatedly reported by GWAS and their role, with many other common variants, was interpreted more in terms of insulin production and secretion indicating that the beta-cell is a more appropriate place to find a T2D-disease module \[[@pone.0205180.ref009], [@pone.0205180.ref011], [@pone.0205180.ref063], [@pone.0205180.ref064]\]. Indeed, mice lacking Cdk2 are viable \[[@pone.0205180.ref065], [@pone.0205180.ref066]\] and targeted Cdk2 deletion in the pancreas induces glucose intolerance primarily by affecting glucose-stimulated insulin secretion \[[@pone.0205180.ref067]\]. Similar to endosomes, the secretory pathway consists of multiple dynamic compartments linked via anterograde and retrograde transport \[[@pone.0205180.ref068], [@pone.0205180.ref069]\]. The T2D-disease module thus can be co-functional in endosomes and insulin-secreting cells. In this regard, in the liver the presence of insulin-regulated Cdk2/cyclinE/p27^kip1^complexes having a capacity to inhibit hybrid endosome formation in vitro has been previously reported \[[@pone.0205180.ref070]\].
In contrast with Cdk2, PTPLAD1 has less topological influence in IREN and is a less-studied protein. PTPLAD1 is, however, functionally well connected as the control of IR activity may be achieved at several endosomal targets by PTPLAD1 that, together with Cdk2, seems to have a considerable local influence on actin and microtubule networks, Rabs and V-ATPase. The finding that IR complexes are under the control of PTPLAD1 would also be particularly important because PTPLAD1 mobilization in response to insulin inputs has also interesting consequences by favoring tyrosine phosphorylated-IR quanta formation, which is considered as an emergent property of endosomes as signaling devices \[[@pone.0205180.ref004]\]. This PTP activity is yet to be fully characterized and can be supported elsewhere in the cell by the small fraction of the endoplasmic reticulum-associated PTP-1B with high specific activity that can reach the plasmamembrane at specific points of cell-cell contact \[[@pone.0205180.ref071]\], by cytosolic PTPs (SHP1/2) ([Fig 2](#pone.0205180.g002){ref-type="fig"} and [Table 1](#pone.0205180.t001){ref-type="table"}) that couple to RTK phosphorylation in a negative feedback manner at the PM with longer delays \[[@pone.0205180.ref072]\], and by PTPRs that are thought to display low specific activity towards basal RTK autophosphorylation activities occurring at the cell surface \[[@pone.0205180.ref073]\]. Through a concerted action on microtubules and actin elements, IREN supports a model in which Cdk2 controls the microtubules-based traffic, and PTPLAD1 is an insulin-dependent switch deciding the choice of IR interaction with microtubules versus actin routing events ([Fig 4](#pone.0205180.g004){ref-type="fig"}). Interesting times are ahead for investigating insulin responses in the context of IREN. The question arises as to the extent of crosstalk between the IR-Tyr kinase and the predominantly Ser/Thr kinases (Cdk2, AMPK) that drive IR trafficking and signaling, and when and where this crosstalk occurs. Apart from the presence of multiple high-confidence substrates for Cdk2 and AMPK in IREN, the current results strongly point to the internalized IR as a relatively pleiotropic *writer* in the disease module (Tables [1](#pone.0205180.t001){ref-type="table"}, [S4](#pone.0205180.s009){ref-type="supplementary-material"} and [S9](#pone.0205180.s014){ref-type="supplementary-material"}. For example, ATP6V1E1: Y-464; AMPK: Y-247; ATIC: Y-151; Rab5c: Y-83) and PTPLAD1 as the insulin-dependent *eraser* with short delay. A related challenge will be systematically matching these phospho-sites to their cognate physiological *readers* \[[@pone.0205180.ref074]\].
Another connected example of the IR regulatory mechanism associated with the T2D genetic risk concerns the marked effect of the proton pumping activity on IR in vivo ([Fig 5](#pone.0205180.g005){ref-type="fig"}). A concrete problem for the cell concerns the energy sources, and it seems that an efficient solution was found to connect IR activity with intermediary metabolism and trafficking by linking V-ATPase subunits (continuous energy demand) with AMPK (energy sensor and action on IR trafficking) and the metabolic enzyme ATIC (ATP production) ([Fig 5](#pone.0205180.g005){ref-type="fig"}) further supporting the idea of the presence of an IR/ATIC/AMPK/PTPLAD1 circuit \[[@pone.0205180.ref013], [@pone.0205180.ref075]\]. The decreased presence of ATIC homodimers, using a small interface interactor, indeed activates AMPK and improve glucose intolerance in a mouse model \[[@pone.0205180.ref076]\]. We also noted the presence of related candidate enzyme, MTHFD1 ([Fig 3](#pone.0205180.g003){ref-type="fig"} and [Table 1](#pone.0205180.t001){ref-type="table"}: PPIN, GWAS, co-expression). The fact that V-ATPase controls the activity of AMPK \[[@pone.0205180.ref077]\] emphasizes the idea that all the conditions are present in IREN to auto-regulate this node and thus IR routing, signaling and hepatic clearance in relation to global cell energy status. The presence of the V-ATPase inhibitor RILP \[[@pone.0205180.ref060]\] in IR immunoprecipitates, which was nearly abolished by PTPLAD1 deletion ([Fig 4D](#pone.0205180.g004){ref-type="fig"}), further supports the idea that PTPLAD1 has a large capacity for action to decide IR routing towards early versus late compartments \[[@pone.0205180.ref059]\].
A facet of IR trafficking in endosomes that can affect indirectly insulin production and secretion is the insulin dissociation/degradation sequence occurring in endosomes, which supports efficient hepatic insulin clearance \[[@pone.0205180.ref003], [@pone.0205180.ref048]\]. A reduction in hepatic insulin clearance is viewed as an adaptive mechanism that relieves the burden on pancreatic beta-cells \[[@pone.0205180.ref006], [@pone.0205180.ref078]\]. On the other hand, as shown by a mouse model, moderate chronic hyperinsulinemia can be the primary mechanism resulting in insulin resistance \[[@pone.0205180.ref079]\]. The idea that the complex genetic heterogeneity converges towards a single module co-functional in insulin-producing and target cells, implies a mechanistic promiscuity between insulin signaling, transport and production, that can explain the prevalence of insulin clearance in insulin sensitivity found in some animal models \[[@pone.0205180.ref080]\].
We acknowledge that some endosomal structures might not be accessible to the IR β-subunit antibody and the limitations inherent to the fractionation approaches such as true tubular connection between different organelles versus contaminants \[[@pone.0205180.ref017], [@pone.0205180.ref081]\]. Nonetheless, the present IREN helps us narrow the search space of the full organism interactome and focus a search in a well-localized network neighborhood. Quantitative proteomic approaches are needed to establish how changes in endosomes occur in space and time according to low (around 10% saturating) versus large saturating insulin doses. This will provide a more complete picture of IREN dynamics that takes the in vivo polarized situation into account \[[@pone.0205180.ref005]\].
In conclusion, our results establish that the endosomal apparatus contains a T2D disease module located in close proximity to the IR. It senses the state of IR activation and seems co-functional with insulin secretion and islets biology. It helps to explain disease heterogeneity and represents a valuable new resource to understand insulin action and to classify related metabolic traits \[[@pone.0205180.ref082]\]. Rewiring a network, distorted under the combined genetic and environmental pressures \[[@pone.0205180.ref083]\], with designed surface interactors \[[@pone.0205180.ref024]\], provides a mechanistic rationale for the exploration of personalized medicine and elaborate new necessary drugs \[[@pone.0205180.ref001], [@pone.0205180.ref002], [@pone.0205180.ref084]\].
Supporting information {#sec012}
======================
###### Controls IR containing endosomes and IPs.
A\) IREP, the number of newly identified proteins from one independent experiment to another (tryptic peptides, see [Methods](#sec002){ref-type="sec"}). B) upper panel: The G/E fraction was prepared 2 minutes after insulin injections and incubated with uncoated beads (C), with beads coated with an unrelated IgG (IgG) or beads coated with the anti-IR (2 min). The bound fraction was blotted and incubated with the antibody against IR β-subunit. Lower panel: HEK293 cells were preincubated in serum-free medium for 5 hours and then stimulated for the indicated times with insulin (35 nM). Left, IP with an unrelated IgG (IgG) or the anti-IR antibody (anti-IR). Right, IP with an unrelated IgG (IgG) or the anti-Cdk2 antibody.
(TIF)
######
Click here for additional data file.
###### The hybrid T2D-protomodule/IREP module.
In total, 126 IREP proteins were selected on the basis of having each at least three interactors among 112 of the 184 seeds of the T2D protomodule ([S4 Table](#pone.0205180.s009){ref-type="supplementary-material"}-sheet hybrid module). The 126 IREP coding genes make up the list of candidates based on the PPIN approach. The diabetes-associated genes (DAGs) are represented according to the colors indicated in the legend. Orange: Diabetes-associated traits. Blue: Insulin-associated traits. Dark green: Obesity-associated traits. Green: Glycemic traits ([S3 Table](#pone.0205180.s008){ref-type="supplementary-material"}-sheet validated DAGs seeds). White: IREP candidates.
(TIF)
######
Click here for additional data file.
###### The extracted IREN subnetwork of DAGs physically associated with candidates.
The general topology of IREN is conserved and based on few major hubs, with the kinase Cdk2 displaying the highest centrality ([S8 Table](#pone.0205180.s013){ref-type="supplementary-material"}). Candidates (yellow and blue colors and black characters; Tables [1](#pone.0205180.t001){ref-type="table"} and 2) and DAGs (pink color and black characters) form a single-connected disease module of 94 nodes (33% of IREN nodes) with 330 interactions (28,7% of IREN interactions). An expansion to the first level of adjacent nodes results in a connected subnetwork of 272 nodes (88% of nodes) covering 92% of interactions (1070 out of 1147 IREN interactions). The functional groups are represented according to the colors of borders indicated in the legends.
(TIF)
######
Click here for additional data file.
###### LD display (Haploview) of the CDK2 and HACD3 genes.
For all graphs, a reference track with chromosomal location, SNP position, and gene position runs along the top. (Red) indicates strong LD between markers; (white) no LD; (light blue) lack of information to evaluate LD. The block-like patterns of LD are evident in the triangles representing regions of high LD, divided by narrow areas where even adjacent markers are completely independent. The SNP in the red box are associated with T2D. A) Cdk2 genotyped in European population (CEU TSI FIN GBR) as part of the 1000 Genomes project (release 2013/05/03). The pop-up represents the haplotype block of the SNP rs2069408 implicated in T2D ([S2 Table](#pone.0205180.s007){ref-type="supplementary-material"}). B) The HACD3 genotype in an African population (YRI) as part of the 1000 Genomes project (release 2013/05/03). Three SNPs associate with T2D (rs3759852, rs3784448 and rs3743171, [S2 Table](#pone.0205180.s007){ref-type="supplementary-material"}) and SNPs in strong LD with these three SNPs in the gene HACD3 (PTPLAD1).
(TIF)
######
Click here for additional data file.
###### Random simulation of T2D subnetworks.
Subnetworks were constructed by 10 000 reiterations of 94 randomly selected IREN nodes. For each simulation, the number of interactions was computed protocols.io[dx.doi.org/10.17504/protocols.io.sdqea5w](https://webmail.chuq.qc.ca/owa/redir.aspx?C=797c4a416d7845bb8b338bef0531bb0f&URL=https%3a%2f%2fdx.doi.org%2f10.17504%2fprotocols.io.sdqea5w)). A) The distribution of the number of nodes for each subnetwork with the neighborhood of 94 selected nodes; the number of nodes observed with the T2D subnetwork is in red. B) The distribution of the number of interactions in the same subnetwork used in A; in red, the number of interaction observed with the T2D subnetwork. C) Distribution of the number of interactions; the number of interactions observed from the 94 T2D nodes is in red.
(TIF)
######
Click here for additional data file.
###### Proteome: Proteins and spectra reports.
(XLS)
######
Click here for additional data file.
###### Listing of IREP proteins orthology and networks listing.
(XLSX)
######
Click here for additional data file.
###### IREN and T2D-protomodule construction with Hubaa; GO analysis.
(XLS)
######
Click here for additional data file.
###### Gene ontology (GO) subcellular analysis.
(XLSX)
######
Click here for additional data file.
###### Fine mapping analysis: LD analysis of IREP coding genes and DAGs variants.
(XLSX)
######
Click here for additional data file.
###### TF motifs and coexpression analysis.
(XLS)
######
Click here for additional data file.
###### Source list of T2D and associated traits (glucose intolerance, obesity) genes.
(XLSX)
######
Click here for additional data file.
###### Selected DAGs and validated seeds.
(XLSX)
######
Click here for additional data file.
###### Kinase-substrate analysis based on Phosphositeplus, Networkin and GPS 3.0 databases.
(XLSX)
######
Click here for additional data file.
[^1]: **Competing Interests:**The authors declare that they have no competing interests.
[^2]: Current address: H. Lee Moffit Cancer Center and Research Institute, Tampa, FL, United States of America
[^3]: Current address: Cold Spring Harbor Laboratory, New York, NY, United States of America
|
Improvement of banana cv. Rasthali (Silk, AAB) against Fusarium oxysporum f.sp. cubense (VCG 0124/5) through induced mutagenesis: Determination of LD50 specific to mutagen, explants, toxins and in vitro and in vivo screening for Fusarium wilt resistance.
Shoot tips and in vitro grown proliferating buds of banana cv. Rasthali (Silk, AAB) were treated with various concentrations and durations of chemical mutagens viz., EMS, NaN3 and DES. LD50 for shoot tips based on 50% reduction in fresh weight was determined as 2% for 3 h, 0.02% for 5 h and 0.15% for 5 h, while for proliferating buds, they were 0.6% for 30 min, 0.01% for 2 h and 0.06% for 2 h for the mutagens EMS, NaN3 and DES, respectively. Subsequently, the mutated explants were screened in vitro against fusarium wilt using selection agents like fusaric acid and culture filtrate. LD50 for in vitro selection agents calculated based on 50% survival of explants was 0.050 mM and 7% for fusaric acid and culture filtrate, respectively and beyond which a rapid decline in growth was observed. This was followed by pot screening which led to the identification of three putative resistant mutants with an internal disease score of 1 (corm completely clean, no vascular discolouration). The putative mutants identified in the present study have also been mass multiplied in vitro. |
Like I've said, I rarely play competitive games online but I don't know if a day has gone by in the last few weeks where I haven't played at least one match of Rocketeague.
Congrats guys and the new field looks awesome! Heard someone describe the old maps, one with pirate sails and such, and would love to see ones like that too if just for the novelty. |
Pages
16 May 2013
On The Tummy Spot: Tasty Dumplings Hong Ma!
I’m
sure by now you guys know that I am an avid fan and Binondo food addict. There
is just something comforting about delicious and well-prepared dim sums and
other Chinese dishes that I just can’t resist them. It’s a lifelong love affair
from eating at my Angkong’s table with the dishes he has prepared when I was
still a little kid to the weekend Binondo forays with the mum. It’s in my
blood!
And
as a yearly tradition, we make sure that every Chinese New Year we are in
Binondo to take part in the revelry of it all. From the dragon dances, to the
red ang pao’s, busy streets, and of course the delicious food, we really try
and make it in Binondo yearly. This year as with last year, we had one of our
stop-overs in Tasty Dumplings along Ongpin road. Presently though they have
transferred to Condesa Street which is just near the old location in Ongpin.
Since we tried some of their best sellers before, we decided to try some dishes
that my friend C recommended. We ordered their Meatball soup, Hong Ma, and the
Silver roll bread that was best together with the Hong Ma. We just ordered
these 3 because we were going to another restaurant later.
The
meatball soup was a revelation. The delicious and beautifully seasoned
meatballs floating in a clear but very flavorful broth was something else. We
all loved it. It was a great starter and personally I think it’s good to share
since the meatballs are quite filling.
The
star of our orders was the tender, soy and anise flavored (pork belly, I think)
Hong Ma drenched in its own sauce with the right proportions of meat and fat.
It was literally a melt-in-your-mouth tasty piece of morsel and the Silver Roll
bread was the perfect foil for it.
Hong Ma
Hong Ma
The
Silver Roll bread was a fried and crunchy bread on the outside with a soft and
light inside. You could put pieces of Hong Ma inside the bread and eat it like
a sandwich. They were absolutely perfect together. A match made in heaven if I do
say so myself.
Silver Roll
I do suggest that if you guys check out Tasty Dumplings, be sure
to order the Hong Ma and the Silver Roll bread and you will be glad you did. The Silver Roll bread will also go well with the Pata Tim! |
Synthesis and cytotoxicity of oligomycin A derivatives modified in the side chain.
A novel way of chemical modification of the macrolide antibiotic oligomycin A (1) at the side chain was developed. Mesylation of 1 with methane sulfonyl chloride in the presence of 4-dimethylaminopyridine produced 33-O-mesyl oligomycin in 56% yield. Reactions of this intermediate with sodium azide produced the key derivative 33-azido-33-deoxy-oligomycin A in 60% yield. 1,3-Dipolar cycloaddition reaction with propiolic acid, methyl ester of propiolic acid, and phenyl acetylene resulted in 33-deoxy-33-(1,2,3-triazol-1-yl)oligomycin A derivatives substituted at N4 of the triazole cycle. The mesylated oligomycin A and 33-deoxy-33-azidooligomycin A did not inhibit F0F1 ATFase ATPase; however, 33-azido-33-deoxy-oligomycin A and the derivatives containing 4-phenyltriazole, 4-methoxycarbonyl-triazole and 3-dimethylaminoethyl amide of carboxyltriazole substituents demonstrated a high cytotoxicity against K562 leukemia and HCT116 human colon carcinoma cell lines whereas non-malignant skin fibroblasts were less sensitive to these compounds. Novel series of oligomycin A derivatives allow for the search of intracellular molecules beyond F0F1 ATP synthase relevant to the cytotoxic properties of this perspective chemical class. |
/*
===========================================================================
Copyright (C) 1999-2005 Id Software, Inc.
This file is part of Quake III Arena source code.
Quake III Arena source code is free software; you can redistribute it
and/or modify it under the terms of the GNU General Public License as
published by the Free Software Foundation; either version 2 of the License,
or (at your option) any later version.
Quake III Arena source code is distributed in the hope that it will be
useful, but WITHOUT ANY WARRANTY; without even the implied warranty of
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
GNU General Public License for more details.
You should have received a copy of the GNU General Public License
along with Foobar; if not, write to the Free Software
Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA
===========================================================================
*/
#if !defined(AFX_RADEDITWND_H__DC829124_812D_11D1_B548_00AA00A410FC__INCLUDED_)
#define AFX_RADEDITWND_H__DC829124_812D_11D1_B548_00AA00A410FC__INCLUDED_
#if _MSC_VER >= 1000
#pragma once
#endif // _MSC_VER >= 1000
// RADEditWnd.h : header file
//
#include "EditWnd.h"
/////////////////////////////////////////////////////////////////////////////
// CRADEditWnd window
class CRADEditWnd : public CWnd
{
// Construction
public:
CRADEditWnd();
// Attributes
public:
CEdit* GetEditWnd() {return dynamic_cast<CEdit*>(&m_wndEdit); };
protected:
CEditWnd m_wndEdit;
// Operations
public:
// Overrides
// ClassWizard generated virtual function overrides
//{{AFX_VIRTUAL(CRADEditWnd)
//}}AFX_VIRTUAL
// Implementation
public:
virtual ~CRADEditWnd();
// Generated message map functions
protected:
//{{AFX_MSG(CRADEditWnd)
afx_msg int OnCreate(LPCREATESTRUCT lpCreateStruct);
afx_msg void OnSize(UINT nType, int cx, int cy);
//}}AFX_MSG
DECLARE_MESSAGE_MAP()
};
/////////////////////////////////////////////////////////////////////////////
//{{AFX_INSERT_LOCATION}}
// Microsoft Developer Studio will insert additional declarations immediately before the previous line.
#endif // !defined(AFX_RADEDITWND_H__DC829124_812D_11D1_B548_00AA00A410FC__INCLUDED_)
|
Q:
How do you get Angular bootstrap tooltip to work?
I'm following the tooltip example in the Angular bootstrap docs but I can't seem to get the tooltip to work. I'm using Angular version 1.5.5 and angular-bootstrap version 0.11.2.
Here is my code:
app.js
angular.module('app', ['ui.bootstrap'])
.controller('TooltipDemoCtrl', function ($scope) {
//doesn't matter from what I can tell
})
index.html
<head>
<link href="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.6/css/bootstrap.min.css" rel="stylesheet">
</head>
<body>
<script src="bower_components/jquery/dist/jquery.js"></script>
<script src="bower_components/angular/angular.js"></script>
<script src="bower_components/angular-bootstrap/ui-bootstrap-tpls.js"></script>
</body>
tooltip.html
<div ng-controller="TooltipDemoCtrl">
<div class="w-col w-col-4 w-col-small-4 w-col-tiny-4 w-clearfix icon-col">
<img width="17" src="../assets/images/pc-icon-two.png"
uib-tooltip="NOT WORKING" class="info-icon-five1">
</div>
</div>
I have an image that I want to use as a tooltip. I tried moving the uib-tooltip in both the img tag and the div tag. Neither works. What is going on here?
A:
This worked for me:
html code:
<!DOCTYPE html>
<html ng-app="myApp">
<head>
<link href="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.6/css/bootstrap.min.css" rel="stylesheet">
<script src="//code.angularjs.org/1.5.0-rc.2/angular.js"></script>
<script src="//cdnjs.cloudflare.com/ajax/libs/angular-ui-bootstrap/1.2.4/ui-bootstrap-tpls.js"></script>
<script src="SO.js"></script>
</head>
<body >
<div ng-controller="TooltipDemoCtrl">
<div class="w-col w-col-4 w-col-small-4 w-col-tiny-4 w-clearfix icon-col">
<img width="17" src="SO/nick_pic2.jpg" uib-tooltip="WORKING" class="info-icon-five1">
</div>
</div>
</body>
</html>
Angular code:
var app = angular.module('myApp', ['ui.bootstrap']);
app.controller('TooltipDemoCtrl', function ($scope) {
});
This shows a picture in the upper left corner of the page.
|
Q:
Chess engine with no evaluation
One of the most difficult parts of a chess engine is the evaluation function. Handcrafted evaluation functions are very long and complicated, while NN evaluations are hard to make and train. That's why I was wondering whether an implementation of a chess engine with no evaluation function would be possible. Search algorithms like MCTS don't need an explicit one, as they can rely on random playouts.
Could a similar approach be used to create a chess engine with a random search algorithm, which averages the results from those random games and optimally reach to the best move?
Theoretically, it should converge to the optimal solution (minimax), right?
Of course it would be for testing and experimentation purposes, but I think with a good implementation of the algorithm, it should play at least at almost master level. I would implement it on Golang, as it would be easier to implement concurrency/parallelism.
What are your thoughts on this?
A:
I have tried using MCTS before for a chess engine and the results were not very good. The problem was that the results when playing out a game with only random moves were basically just that: random. Most of the results would only be reached after over 100 plies so the initial position had little to do with the result.
I had better results when I cutoff the tree after x plies where x would be somewhere between 20 and 50 and using a simple evaluation function for that position. But then you would be relying on a evaluation function again.
A:
The number of board states is on the order of 10^45. That's within a few orders of magnitude of the number of water molecules in the Earth's oceans. So solving chess by exhaustively searching the possible board states is not currently considered computationally feasible.
Instead you're proposing Monte Carlo Tree Search. In this approach, you would use random roll-outs (i.e. playing a game to the end by making random moves, then seeing if you won). This is equivalent to randomly choosing a branch of the possible future board states and seeing if it results in a win, and from that, making moves that you estimate to be likely to lead to victory.
For this to work, given the scale of the possible board states, you need a sampling algorithm that is very thorough and very fast, and most importantly, very representative. Unfortunately, the surface you're trying to optimize over is not very smooth: even the best board position can be turned into a loss with a couple bonehead moves, and if you're sampling random future board states (the hallmark of Monte Carlo, vs. exhaustive, search methods), you have no way to know whether what you have sampled is representative of the entire branch, or if you just picked a rollout that included some really bad plays (or conversely, one where your opponent did something dumb that gave you a needlessly rosy view of your odds).
That's the entire point of the evaluation function: you estimate the value of a set of intermediate board states, which you can more thoroughly explore within a reasonable future-turn horizon. (Until you reach the endgame, where you can realistically do exhaustive search.)
Note that MCTS is in a sense learning an evaluation function: instead of an explicitly stated value for a board state, you're keeping statistics on the number of times a sequence of random moves from that board state have resulted in wins/losses. The problem is, because of how distant the eventual win/loss is from most board states, and because of your inevitable computational limits, you're learning a pretty bad evaluation function.
If your sampling rate was high enough, this could work; but with no evaluation function (or way to approximate an evaluation function, like a neural network), you're going to spend far too much of your time evaluating obviously bad plays and not learning anything actionable. It just isn't computationally feasible given the numbers involved.
|
Q:
Spring with spring.config.location
I am trying to point at path to external configuration file like this:
--spring.config.location=file: C:/Users/some_user/workspace/repository1/payment-api/payment.yml
and it doesn't work. Any idea why?
A:
The proper prefix is file://. On Windows you need an extra "/" in the file URL if it is absolute with a drive prefix
Try file:///C:/Users/some_user/workspace/repository1/payment-api/payment.yml instead.
|
Thursday, August 31, 2006
Grata Non Persona
On Meeting People You Have Previously Only Known From The Internet In Real Life
It's easy. Just go up to a person in the street you don't recognise and introduce yourself.
They will very likely be looking for somebody they don't recognise, too; so you'll have something to talk about.
The only circumstance in which this will not work is if you have previously agreed on the time, date, and place to meet up but find out later that you have both agreed on different times, dates, and places.
Although one way to avoid this is to deliberately make a mistake, and turn up at the wrong time and the wrong place.
This method might even be successful if they turn up at the wrong time and the wrong place, too.
Are they black? Make sure you do not notice this, as that may make you racist.
Are they male, or female? Again, make sure you do not notice this as this would make you racist. Everything does, nowadays.
Most people who frequent the internet are either socially maladaptive, geeks, stalkers, or murderous psychopaths (hey, Mum, look at my blog!) If the Person You Have Previously Only Known From The Internet is one of these people, a word of warning: they may be a little unusual.
Pay no attention to any photographs of stalkees, severed limbs, etc, etc, they might have.
You wouldn't want to make them uncomfortable.
Once you have failed to recognise them, meet them at the right location, or at the right time, notice their personal characteristics, ethnicity, sex, or sociopathic tendencies, you might like to fail to agree to share a cup of coffee or a beer with them, in one of the many fine cafes in your vicinity.
There again, I am equally cagey in person as I am on my blog. Consistently inconsistent, you might say. It's easier for me to get into the whole 'blogs as voyeurism' thing than the 'blogs as self-expression' thing. |
The overall hypothesis is that the decline in physical activity habits and resultant increase in body fat reduces exercise capacity & muscle mass in military women. These lifestyle changes worsen metabolic & cardiovascular risk factors. Therefore continued involvement in resistance & endurance exercise programs which increases or preserves fat free mass,as well as enhances physical activity will prevent functional declines in military-eligible women. |
Filed 10/21/14 Opinion following remand
CERTIFIED FOR PUBLICATION
IN THE COURT OF APPEAL OF THE STATE OF CALIFORNIA
SECOND APPELLATE DISTRICT
DIVISION FOUR
THE PEOPLE, B231038
(Los Angeles County
Plaintiff and Respondent, Super. Ct. No. GA079423)
v.
JEFFREY ALLEN WHITMER,
Defendant and Appellant.
APPEAL from a judgment of the Superior Court of Los Angeles County,
Candace Beason, Judge. Reversed in part, affirmed in part, and remanded with
directions.
Jolene Larimore, under appointment by the Court of Appeal, for Defendant
and Appellant.
Kamala D. Harris, Attorney General, Dane R. Gillette, Chief Assistant
Attorney General, Lance E. Winters, Assistant Attorney General, Victoria B.
Wilson and Noah P. Hill, Deputy Attorneys General, for Plaintiff and Respondent.
_______________________
Appellant Jeffrey Allen Whitmer challenges his convictions on 20 counts of
grand theft and 20 counts of making false financial statements. He contends he
was unlawfully convicted of grand theft and making false financial statements; in
addition, he maintains that his judgment of conviction must be reversed due to
insufficiency of the evidence, instructional error, sentencing error, and ineffective
assistance of counsel.
In our original opinion (People v. Whitmer (2013) 213 Cal.App.4th 122,
review granted May 1, 2013, S208843), we determined that appellant had shown
reversible error only with respect to certain counts of making false financial
statements. In rejecting appellant’s other contentions, we concluded that under
People v. Bailey (1961) 55 Cal.2d 514 (Bailey), a defendant may be convicted of
multiple counts of grand theft based on separate and distinct acts of grand theft
committed pursuant to a single scheme. Because other appellate courts had
adopted a contrary interpretation of Bailey, we urged the Supreme Court to clarify
the holding in Bailey.
After granting appellant’s petition for review, the Supreme Court limited its
review to our determination regarding Bailey. In People v. Whitmer (2014)
59 Cal.4th 733, 735 (Whitmer), the Supreme Court agreed with our conclusion that
under Bailey, “a defendant may be convicted of multiple counts of grand theft
based on separate and distinct acts of theft, even if committed pursuant to a single
overarching scheme.” The court nonetheless determined that its holding could not
be applied to appellant, due to prior appellate decisions that had “reached a
conclusion contrary to ours . . . .” (Id. at p. 742.) Finding appellant entitled to the
benefit of the law as previously construed, the court held that he could be
convicted of only one count of grand theft. (Ibid.)
Following remand of the matter, we have examined appellant’s remaining
contentions in light of Whitmer. We conclude that grand theft of an automobile
2
does not encompass the theft of motorcycles and motorized dirt bikes, but
determine that appellant suffered no prejudice from the charging of grand theft of
an automobile based on the taking of motorcycles, motorized dirt bikes, and related
vehicles. We further conclude that appellant has shown reversible error only with
respect to 14 counts of making false financial statements. We therefore reverse his
convictions under those counts, as well as all but one of his convictions for grand
theft, and remand the matter for resentencing.
RELEVANT PROCEDURAL BACKGROUND
On July 20, 2010, an information was filed, charging appellant with 21
counts of grand theft of an automobile (Pen. Code, § 487, subd. (d)(1)), 7 counts of
making false financial statements (Pen. Code, § 532a), and 14 counts of theft of
1
access cards or account information (Pen. Code, § 484e, subd. (d)).
Accompanying the charges was an allegation that appellant took, damaged, or
destroyed property valued at more than $200,000 (§ 12022.6). Appellant pleaded
not guilty and denied the special allegation.
At the prosecutor’s request, the trial court dismissed one count of grand theft
of an automobile and one count of making false financial statements. After the
presentation of evidence at the jury trial, the trial court amended the information to
replace the charges of theft of access cards or account information (§ 484e, subd.
(d)) with charges of making false financial statements (§ 532a). The jury found
appellant guilty on all counts, as amended, and found the special allegation to be
true. The trial court sentenced appellant to a total term of imprisonment of 12
years. In imposing the sentence, the court stayed punishment under all the counts
of making false financial statements (§ 654).
3
FACTS
A. Prosecution Evidence
1. Overview
The prosecution submitted evidence that appellant, while acting as manager
for a motorcycle dealership, arranged for the fraudulent sale of 20 motorcycles,
motorized dirt bikes, all terrain vehicles (ATVs), and similar recreational vehicles.
In collaboration with Mordichi Mor, appellant arranged fraudulent sales to
fictitious buyers, using falsified financing agreements and credit purchases,
2
resulting in monetary losses to the dealership.
2. Background
Jerome Gilding owned Temple City Power Sports, a business located in San
Gabriel that sold and serviced motorcycles, motorized dirt bikes, ATVs, and jet
skis. Because Gilding devoted most of his time to dealerships he owned in
Temecula and other locations, he employed a sales manager to operate the
dealership, maintain its inventory, and supervise the sales staff, including
employees in its finance department.
Customers of the dealership negotiated purchases with salespersons. The
dealership made sales to customers who entered into financing agreements or paid
with credit cards. In such cases, after the salesperson reached an agreement with
the customer regarding an item and the manner of payment, the transaction was
referred to the sales manager for approval. If approved, the transaction was sent to
the dealership finance department, which collected the information necessary to
1
All further statutory citations are to the Penal Code, unless otherwise indicated.
2
Mor’s name is stated in different ways in the record. For simplicity, we refer to
him as Mor or Mordichi.
4
process the financing agreement or credit card sale. When the dealership sold an
item to a customer who failed to make the loan payments or used a bad credit card,
the dealership incurred a “charge back,” that is, took responsibility for the loss on
the transaction. According to Gilding, to prevent charge backs, the dealership’s
policy was to require customers to make purchases in person and to present two
forms of identification.
Ordinarily, when credit card purchases were made, the card was swiped
through a credit card machine, which instantaneously sent information regarding
the purchase to the pertinent bank. An approval or denial was received from the
bank within a few seconds. In contrast, if the machine was set for an “offline” or
“forced” sale, the machine recorded the transaction but sent no information to the
bank. As a result, no immediate credit approval or denial was generated; instead,
information regarding the transaction was transmitted to the bank at the end of the
business day. Gilding did not permit offline sales.
Associated with each vehicle sold by the dealership is a document known as
the “manufacturer certificate of origin” (MSO). The vehicle’s original MSO can
be used to establish title to the vehicle in other states and countries. The dealership
retained the original MSO after a sale unless the vehicle was sold to an out-of-state
purchaser or transferred to another dealer. The dealership had contractual
obligations to several manufacturers not to sell vehicles for exportation outside the
United States.
In 2009, appellant was the dealership’s sales manager, and Alex Barrera was
employed as a salesperson. Eric Van Hek worked in the financial department until
August or September 2009, when he was replaced by Richard Carlos. In late
August or early September 2009, Gilding told appellant not to deal with Mordichi
Mor, who had engaged in a fraudulent transaction at the dealership in 2008.
5
3. Offenses
Carlos testified that he was a finance manager at the dealership for six to
eight months. He had little prior experience with financial operations. According
to Carlos, appellant ran the dealership and directed his activities. In the fall of
2009, Carlos often saw a person he knew as “Mordichi” talking to appellant in the
dealership. After meeting with Mordichi, appellant directed Carlos to process sales
transactions involving customers Carlos had never met, contrary to the dealership’s
policy. Whenever the transaction involved a credit card, appellant told Carlos to
process it as an offline sale. Carlos prepared the paperwork for each transaction
and gave it to appellant, who returned the documents with the customer’s signature
to Carlos. Carlos heard appellant direct other employees to deliver the purchased
vehicles to Mordichi’s home and obtain the customers’ signatures there.
In December 2009, when Carlos received phone calls from banks attempting
to locate the customers, he brought the calls to the attention of appellant, who said
he would take care of them. After a fraud inquiry began, Carlos overheard
appellant suggest to investigating police officers that appellant did not know Mor’s
full name. Later, Carlos saw appellant shredding some documents. Appellant
directed Carlos not to place the shredded documents in the dealership’s dumpster,
but to dispose of them elsewhere.
Angela Wilcox, a dealership employee, testified that during the fall of 2009,
she saw appellant with Mor many times in the dealership. At appellant’s request,
she gave appellant original MSOs from the dealership’s files related to deals
appellant arranged with Mor. Later, she overheard appellant tell police officers
that he was unsure of Mor’s name, even though Mor was a well known customer
whose name and address were in the dealership’s computer system. Afterward,
Carlos told her that appellant had asked him to dispose of shredded documents off
the dealership’s premises.
6
Gilding testified that in mid-December 2009, a credit card company told him
that credit card usage had increased at the dealership, and that he should expect
charge backs. He initiated an inquiry that uncovered 20 potentially fraudulent
sales of motorcycles, motorized dirt bikes, ATVs, and recreational vehicles at the
dealership from August 4 to December 8, 2009. Barrera was the salesperson in all
the sales, each of which involved one of seven purported buyers. None of the
purported buyers was Mor. The first two sales were processed by Van Hek, and
the remaining sales were processed by Carlos. Fourteen of the transactions
involved offline credit sales, and six involved financing agreements. The
dealership incurred a charge back on each sale ranging from $9,100 to $21,479.80,
resulting in losses exceeding $250,000. In addition, the original MSOs for the
vehicles in the dealership’s files had been replaced by copies, even though the
transactions were not of the type that required the dealership to transfer the original
MSO to the purchaser.
Shortly after Gilding discovered the potential fraud, Barrera stopped
appearing for work. On December 15, 2009, Los Angeles County Sheriff’s
Department Detective David Swanson interviewed appellant regarding the
potential fraud. Appellant described Mor as a person who “hung around” the
dealership, but denied that Mor was his friend. Appellant further stated that Mor
had introduced the actual buyers to him and recommended them as customers.
Later, El Monte Police Department Detective Armando Valenzuela
determined that the identification information provided for the buyers on the sales
documents was false, and that the existence of the buyers could not be established.
He also discovered that several of the vehicles had been shipped to Israel.
On February 16, 2010, Detective Valenzuela, accompanied by El Monte
Police Department Detective Brian Villa, interviewed appellant. Appellant
initially stated that “somebody named Mordichai” had referred the purchasers, who
7
appeared in person at the dealership. When the detectives replied that they had
information establishing that appellant personally knew Mor, he became agitated
and asked, “Am I under arrest?” The detectives then arrested him. After receiving
3
Miranda warnings, appellant stated that Mor had “got[ten] the ball rolling” on the
transactions, that Van Hek had taught him how to do offline transactions, and that
he had participated for “personal gain” because he faced “some bad times at home
economically.” Appellant also acknowledged that none of the purchasers came to
the dealership.
B. Defense Evidence
Appellant testified that he had only a professional relationship with Mor,
who often brokered transactions at the dealership. Appellant denied that Gilding
warned him not to do business with Mor, that he arranged the fraudulent sales with
Mor, or that he directed employees to deliver the vehicles to Mor. He also denied
any knowledge that the sales were fraudulent when they were transacted.
According to appellant, Carlos had primary responsibility for the financial
aspects of the transactions. Appellant’s role in a transaction was limited to
approving the salesperson’s initial agreement with the customer before it moved to
a financial manager. If the customer chose to pay by credit card, the financial
manager was responsible for collecting the payment through the credit card
machine; if the customer chose to finance the purchase, the financial manager was
responsible for obtaining the relevant documentation. In each case, the purchase
documents were then transmitted to Gilding’s Temecula dealership for final
processing before they were returned to Temple City Power Sports.
3
Miranda v. Arizona (1996) 384 U.S. 436.
8
Appellant further testified that after the fraud was discovered, he told police
officers that he was unsure of Mor’s name because people referred to Mor in
different ways. Later, in February 2010, when appellant met with Detectives
Valenzuela and Villa, Villa acted in an insulting and threatening manner.
4
Appellant denied having admitted any misconduct during the interview.
Ryan Morgan testified that in the fall of 2009, appellant directed him to
deliver vehicles to the home of someone he knew as “Mordichi.” In signing for the
deliveries, Mordichi used the name of the person identified in the contract.
Stephen Valdez, a dealership salesperson, testified that he accompanied Morgan
during one such delivery.
DISCUSSION
As explained above, our Supreme Court has determined that appellant may
suffer only one conviction for grand theft. (Whitmer, supra, 59 Cal.4th at pp. 734,
742.) Appellant’s remaining contentions are (1) that he was unlawfully convicted
of grand theft of an automobile, (2) that he was unlawfully convicted of making
false financial statements, (3) that there is insufficient evidence to support his
convictions, (4) that the trial court erred in failing to instruct on aiding and abetting
liability, and (5) that he received ineffective assistance of counsel. As explained
below, we conclude that appellant has established reversible error with respect to
14 of his 20 convictions for making false financial statements. We reject his
remaining contentions.
4
Appellant acknowledged telling the detectives that the purchasers had personally
appeared in the dealership, but testified that in saying this he was relying on information
from other people.
9
A. Grand Theft of an Automobile
Appellant contends he was unlawfully convicted of grand theft of an
automobile because that crime does not encompass motorcycles, off road dirt
bikes, ATVs, and other recreational vehicles. He thus argues that the information
improperly charged him with the crime, that the jury received erroneous
instructions regarding it, and that the jury’s verdicts fail for want of sufficient
evidence. As explained below, we agree that the crime is limited to the theft of
automobiles, but conclude that the errors in the information, instructions, and
verdict forms were not prejudicial.
1. Grand Theft
Our inquiry requires us to examine the statutory scheme regarding grand
theft. Generally, “the crime of theft is divided into two degrees, grand theft and
petty theft. (§ 486.) Grand theft, therefore, is not a separate offense, but simply
the higher degree of the crime of theft. [¶] Section 487 defines grand theft to
include theft of property worth more than $400 (subd. (a)) and the theft of an
automobile (subd. (d)[(1)]).” (People v. Ortega (1998) 19 Cal.4th 686, 696, italics
omitted, disapproved on another ground in People v. Reed (2006) 38 Cal.4th 1224,
1228.) Under the statute, theft of an automobile constitutes grand theft regardless
of its value. (People v. Thomas (1974) 43 Cal.App.3d 862, 870.)
2. Underlying Proceedings
The information initially charged appellant with 21 counts of grand theft of
an automobile (§ 487, subd. (d)(1)), one of which was later dismissed at the
beginning of the trial. During the trial, the prosecution presented evidence that
appellant orchestrated the theft of 20 motorcycles, motorized dirt bikes, ATVs, and
other recreational vehicles, each of which was valued at no less than $9,100.
10
In instructing the jury, the trial court stated that appellant was charged with
5
grand theft in violation of section 487. The court further told the jury: “If you
conclude that the defendant committed a theft, you must decide whether the crime
was grand theft or petty theft. [¶] The defendant committed grand theft if he stole
property worth more than $400. Theft of an automobile or a motor vehicle is
grand theft.” (Italics added.) Later, during closing arguments, the prosecutor
stated that each stolen vehicle was the subject of a “[section] 487 charge” or
“grand theft auto” charge, and maintained that the term “auto” encompassed motor
vehicles, including motorcycles and ATVs. The verdict form for each grand theft
count asked the jury to determine whether appellant was guilty of “grand theft
auto, in violation of . . . [s]ection 487[, subdivision] (d)(1)” regarding a specified
vehicle. (Upper case omitted.)
The record discloses no objection by appellant to the instructions,
prosecutor’s argument, or verdict forms. The jury found appellant guilty on all the
counts, and also found that he had taken property worth more than $200,000.
3. “Automobile”
The initial question we confront is whether the term “automobile,” as used in
subdivision (d)(1) of section 487, is equivalent to the term “motor vehicle,” as the
instructions and the prosecutor informed the jury. We conclude that the term
“automobile” does not encompass all motor vehicles.
Because our research has disclosed no decision addressing the question
before us, we confront an issue of statutory interpretation. “‘In construing a
statute, our task is to determine the Legislature’s intent and purpose for the
5
The trial court initially stated that appellant was charged with grand theft under
section 484, but later corrected this error.
11
enactment. [Citation.] We look first to the plain meaning of the statutory
language, giving the words their usual and ordinary meaning. [Citation.] If there
is no ambiguity in the statutory language, its plain meaning controls; we presume
the Legislature meant what it said. [Citation.] . . .’ [Citations.] We examine the
statutory language in the context in which it appears, and adopt the construction
that best harmonizes the statute internally and with related statutes. [Citations.]”
(People v. Palmer (2005) 133 Cal.App.4th 1141, 1149, quoting People v. Garcia
(2002) 28 Cal.4th 1166, 1172.) In addition, we may examine the statute’s
legislative history. (People v. Palmer, supra, 133 Cal.App.4th at p. 1149.)
The term “automobile,” as commonly understood, does not encompass all
motor vehicles. The term is ordinarily defined to mean a particular type of motor
vehicle, namely, a four-wheeled self-propelled vehicle intended to transport
people. (Webster’s 3d New Internat. Dict. (2002) p. 148 [“a us[ually] 4-wheeled
automotive vehicle designed for passenger transportation on streets and roadways
and commonly propelled by an internal-combustion engine using a volatile fuel (as
gasoline)”]; Merriam-Webster’s Collegiate Dict. (1995) p. 78 [“a . . . four-wheeled
automotive vehicle designed for passenger transportation”].)
Nor does subdivision (d)(1) of section 487 disclose any legislative intent to
attach a broader meaning to the term. Generally, under the principle of expressio
unius est exclusio alterius, “‘the expression of certain things in a statute necessarily
involves exclusion of other things not expressed. . . .’ [Citation.]” (Dyna-Med,
Inc. v. Fair Employment & Housing Com. (1987) 43 Cal.3d 1379, 1391, fn. 13).
Here, subdivision (d)(1) of section 487 states that grand theft is committed when
“the property taken is any of the following: [¶] . . . An automobile, horse, mare,
gelding, any bovine animal, any caprine animal, mule, jack, jenny, sheep, lamb,
hog, sow, boar, gilt, barrow, or pig.” It is well established that the Legislature’s
intent regarding this provision was to designate theft of the enumerated items as
12
grand theft regardless of their value. (People v. Thomas, supra, 43 Cal.App.3d at
p. 870.) Because the items following the term “automobile” are carefully and
precisely specified, the provision exhibits no intent to use the term “automobile”
broadly to mean “motor vehicle,” for purposes of proving grand theft without a
demonstration of the stolen item’s value.
Our conclusion finds additional support in the legislative history of section
487, subdivision (d)(1), and related statutes. As enacted in the 19th Century, the
predecessor of section 487, subdivision (d)(1), exempted only animals from the
proof of value requirement. (See People v. Townsley (1870) 39 Cal. 405, 406.) In
1905, the Legislature enacted former Penal Code section 499b, the so-called
““joyrid[ing] statute,’” which established as a crime the act of driving or
temporarily using “any automobile, bicycle, motorcycle or other vehicle” without
the owner’s consent. (Stats. 1905, ch. 90, § 1, pp. 184-185, italics added; People v.
Thomas (1962) 58 Cal.2d 121, 125, overruled on another ground in People v.
Barrick (1982) 33 Cal.3d 115, 135, fn. 9.) In 1913, the Legislature created a
similar offense in enacting the statutory predecessor of Vehicle Code section
10851, which established as a crime the act of driving any “motor vehicle” without
the owner’s consent, and expressly defined “‘automobile’” to mean “all motor
vehicles excepting motorcycles.” (Stats. 1913, ch. 326, § 1, p. 639, italics added.)
Not until 1927 did the Legislature amend the predecessor of section 487,
subdivision (d)(1), to include “automobiles” among the enumerated items. (Stats.
1927, ch. 619, § 4, p. 1047.) Later, in 1996, the Legislature amended section 499b
to eliminate from it all provisions duplicative of Vehicle Code section 10851,
which addresses the driving or taking of a “vehicle.” (Stats. 1996, ch. 660, §§ 1-3,
pp. 3669-3670.) Under the Vehicle Code, the term “‘vehicle“” is defined broadly
to mean “a device by which any person or property may be propelled, moved, or
13
drawn upon a highway, excepting a device moved exclusively by human power or
used exclusively upon stationary rails or tracks.” (Veh. Code, § 670.)
In view of this history, the term “automobile” in section 487, subdivision
(d)(1), cannot be regarded as equivalent to “motor vehicle.” The Legislature, in
establishing the related crimes, used the term “automobile” in a manner that
excluded -- at a minimum -- motorcycles. Furthermore, after amending the
predecessor of section 487, subdivision (d)(1) to include the term “automobile,”
the Legislature has undertaken no action suggesting that the term encompasses
motorcycles or is equivalent to the broad term “vehicle,” as defined in the Vehicle
Code.
Appellant was thus improperly charged with grand theft of an automobile
under subdivision (d)(1) of section 487, as the charges were clearly erroneous to
6
the extent they involved motorcycles or dirt bikes. However, for the reasons
explained below, it is unnecessary for us to determine the full extent of the
charging error, as appellant suffered no prejudice from it.
4. Grand Theft of Property Exceeding $400 in Value
In view of the trial proceedings, we further conclude that appellant was
properly convicted of a different type of grand theft under subdivision (a) of
section 487, that is, the theft of property worth more than $400.
6
We do not address or decide whether the charges were erroneous with respect to
the ATVs and other recreational vehicles because the record contains little or no evidence
regarding their design and function.
14
a. Informal Amendment of the Information
To the extent appellant argues that he lacked notice that he was charged with
grand theft under subdivision (a) of section 487, his contention fails in light of the
so-called “informal amendment doctrine,” which constitutes a judicial recognition
that an information may be amended without written alterations to it. (People v.
Sandoval (2006) 140 Cal.App.4th 111, 113 (Sandoval)). Generally, the purpose of
an accusatory pleading is “‘to provide the accused with reasonable notice of the
charges.’” (Sandoval, supra, 140 Cal.App.4th at p. 132, quoting People v. Ruiloba
(2005) 131 Cal.App.4th 674, 689-690.) Nonetheless, the Penal Code permits
accusatory pleadings to be amended at any stage of the proceedings “for any defect
or insufficiency” (§ 1009), and bars reversal of a criminal judgment “by reason of
any defect or imperfection in matter of form which does not prejudice a substantial
right of the defendant upon the merits” (§ 960). In view of these provisions, “[t]he
proceedings in the trial court may constitute an informal amendment of the
accusatory proceeding, when the defendant’s conduct or circumstances created by
him amount to an implied consent to the amendment.” (4 Witkin & Epstein, Cal.
7
Criminal Law (3d ed. 2000) Pretrial Proceedings, § 213, p. 418.)
An instructive application of the doctrine is found in People v. Toro (1989)
47 Cal.3d 966, 973, disapproved on another ground in People v. Guiuan (1998)
18 Cal.4th 558, 568, fn. 3. There, the information charged the defendant with
attempted murder and assault with a deadly weapon. (Toro, supra, 47 Cal.3d at
p. 972.) In addition to these offenses, the jury was instructed regarding the offense
7
As explained in Sandoval, “[t]he informal amendment doctrine makes it clear that
California law does not attach any talismanic significance to the existence of a written
information. Under this doctrine, a defendant’s conduct may effect an informal
amendment of an information without the People having formally filed a written
amendment to the information.” (Sandoval, supra, 140 Cal.App.4th at p. 133.)
15
of battery with serious bodily injury, which the instructions and verdict forms
erroneously described as a lesser included offense of attempted murder. (Id. at
p. 973.) The defendant’s counsel raised no objection to the instructions and verdict
form regarding battery with serious bodily injury, or to the jury’s consideration of
the offense. (Id. at pp. 977-978.) Noting that such failure to object may be
“‘“regarded as an implied consent to treat the information as having been amended
to include the offense on which the sentence was imposed,”’” our Supreme Court
concluded that the defendant had impliedly consented to the submission of the
charge to the jury, and had forfeited any contention of error. (Id. at pp. 976-977,
quoting People v. Francis (1969) 71 Cal.2d 66, 75.)
Here, the jury was instructed that appellant could be convicted of grand theft
under section 487 if it found that “he stole property worth more than $400” or took
“an automobile or a motor vehicle.” Although the prosecutor referred to the
“section 487” offense as “grand theft auto,” and the verdict forms cited subdivision
(d)(1) of section 487, nothing in the prosecutor’s argument or the verdict forms
suggested that the propriety of a conviction for grand theft hinged on the
classification of the stolen property as an automobile or motor vehicle. Rather, the
instructions informed the jury that it could convict appellant under each count of
grand theft if he stole property exceeding $400. The instructions thus effectively
presented the jury with two distinct theories of grand theft. Because appellant
never raised any objection to the instructions before the trial court, he impliedly
8
consented to the submission of both theories to the jury.
8
We recognize that an amendment to the information is improper when no evidence
supporting the amended charges was presented at the preliminary hearing. (People v.
Tallman (1945) 27 Cal.2d 209, 213.) Here, however, evidence that the value of each
pertinent vehicle exceeded $400 was presented at appellant’s preliminary hearing.
16
b. No Reversal Based on Erroneous Theory
The remaining question concerning the charges against appellant is whether
the presentation of a legally erroneous theory of grand theft to the jury requires a
reversal of the grand theft convictions. The error here is subject to the rule
propounded in People v. Green (1980) 27 Cal.3d 1, reversed on other grounds in
People v. Martinez (1999) 20 Cal.4th 225, 234, and in People v. Hall (1986)
41 Cal.3d 826, 834, and People v. Guiton (1993) 4 Cal.4th 1116. Under the
Guiton-Green rule, “if a jury is presented with multiple theories supporting
conviction on a single charge and on review one theory is found legally defective,
that is, the theory does not present a legally sufficient basis for conviction, reversal
is required unless substantial reasons exist to find that the verdict was based on a
legally valid theory.” (People v. Llamas (1997) 51 Cal.App.4th 1729, 1740.)
However, “[a]n instructional error presenting the jury with a legally invalid theory
of guilt does not require reversal, . . . if other parts of the verdict demonstrate that
the jury necessarily found the defendant guilty on a proper theory.” (People v.
Pulido (1997) 15 Cal.4th 713, 727.) Under the rule, we will reverse unless it is
clear beyond a reasonable doubt that the error did not contribute to the jury’s
verdict. (People v. Chun (2009) 45 Cal.4th 1172, 1201.)
Here, the record demonstrates that the jury necessarily found appellant guilty
under a legally correct theory. In connection with the 20 grand theft counts, the
prosecutor presented evidence as to the value of each vehicle, including that no
vehicle was valued at less than $9,100. As this evidence was never challenged or
disputed at trial, no rational jury could have rejected it. (People v. Nicholson
(2004) 123 Cal.App.4th 823, 833.) Accordingly, in convicting appellant under the
grand theft counts, the jury could not have determined that appellant took the
vehicles without concluding that each vehicle was worth more than $400.
Furthermore, in finding appellant guilty on all counts, the jury made a special
17
finding that he had taken property worth more than $200,000. As no single vehicle
was shown to be worth more than $21,479.80 -- the maximum value attributed to
the most expensive vehicle -- the jury’s finding necessarily reflected its
determination that each of the vehicles was worth more than $400. (See People v.
Guiton, supra, 4 Cal.4th at p. 1131 [stating that other portions of verdict may show
that jury necessarily found defendant guilty on a proper theory].) In sum, none of
appellant’s grand theft convictions must be reversed due to defects in the
information, prosecutor’s closing argument, or verdict forms.
B. Lesser Included Offense
Appellant contends he was unlawfully convicted of making false financial
statements under section 532a, subdivision (1), because that offense was
necessarily included within the offense of grand theft charged against him. The
jury convicted him of 20 counts of making false financial statements, each of
which was related to a specific count of grand theft. Appellant maintains he cannot
be convicted under any count of making false financial statements because the jury
received instructions on grand theft by trick and by larceny. He argues that making
false financial statements was a lesser included offense of the associated types of
grand theft, as set forth in the instructions. For the reasons discussed below, we
disagree.
Generally, “multiple convictions may not be based on necessarily included
offenses.” (People v. Pearson (1986) 42 Cal.3d 351, 355, italics omitted.) For
purposes of this rule, courts apply the so-called “‘elements’” test to decide whether
an offense is necessarily included within a charged offense. (People v. Reed,
supra, 38 Cal.4th at pp. 1227-1228.) “Under the elements test, if the statutory
elements of the greater offense include all of the statutory elements of the lesser
offense, the latter is necessarily included in the former.” (Ibid.)
18
The application of the elements test to grand theft thus requires an
examination of the statutory scheme governing theft. In 1927, the Legislature
consolidated several formerly distinct offenses into the single crime of theft
defined in section 484. (People v. Davis (1998) 19 Cal.4th 301, 304-305 (Davis).)
Those offenses include larceny and theft by trick. (Ibid.; People v. Ashley (1954)
42 Cal.2d 246, 258.) The consolidation simplified pleading the crime of the theft,
but neither changed the elements of the consolidated crimes nor eliminated the
substantive distinctions among them. (Davis, supra, 19 Cal.4th at pp. 304-305;
People v. Nazary (2010) 191 Cal.App.4th 727, 740-741.)
Our research has disclosed no published decision addressing whether the
elements test attaches simply to the statutory definition of grand theft of property
exceeding $400, or also requires a consideration of the elements of theft by trick
and by larceny. However, it is unnecessary for us to resolve this issue, as
appellant’s contention fails in light of the elements of each offense.
The statutory elements of grand theft of property exceeding $400 do not
include the statutory elements of making a false financial statement. The elements
of the former offense are “the taking of personal property [valued at more than
$400] from the owner[] into the possession of the criminal without the consent of
the owner or under a claim of right, [and] the asportation of the subject matter
[with] the specific intent to deprive the owner of his property wholly and
permanently.” (People v. Walther (1968) 263 Cal.App.2d 310, 316; § 487, subd.
(a).) Under section 532a, subdivision (1), a defendant commits the offense of
making a false financial statement by “knowingly mak[ing] or caus[ing] to be
made . . . , any false statement in writing, with intent that it shall be relied upon,
respecting the financial condition, or means or ability to pay, of himself or herself,
or any other person, firm or corporation, in whom he or she is interested, or for
whom he or she is acting, for the purpose of procuring in any form whatsoever,
19
either the delivery of personal property, the payment of cash, [or] the making of a
loan or credit . . . .” (Italics added.) Because grand theft of property exceeding
$400 can be accomplished without a written statement, appellant’s contention fails.
The same is true of grand theft of property exceeding $400 accomplished by
larceny or trick. Theft by larceny “is committed by every person who (1) takes
possession (2) of personal property (3) owned or possessed by another, (4) by
means of trespass and (5) with intent to steal the property, and (6) carries the
property away. [Citations.]” (Davis, supra,19 Cal.4th at p. 305.) It requires no
written statement. Similarly, to constitute theft by trick, “the following elements
must be present: (1) there must be a taking; (2) there must be an asportation of the
thing taken; (3) the thing taken must be the property of another; and (4) the taking
and carrying away must be with an intent, without claim or pretense of right or
justification, to deprive the owner of his property wholly and permanently
[citation].” (People v. Woolson (1960) 181 Cal.App.2d 657, 668.) No false
writing is required. In short, neither type of theft requires a written false financial
statement. Appellant’s contention thus fails because making false financial
statements is not an offense necessarily included within the offense of grand theft
9
charged against him.
C. Substantial Evidence
Appellant contends that his convictions for grand theft and some of his
9
People v. Gonda (1982) 138 Cal.App.3d 774, upon which appellant relies, is
inapposite. There, the appellate court held that grand theft by false pretenses necessarily
includes the crimes defined in Corporations Code section 31110 and 31201, which make
it an offense to sell franchises without proper registration or to make specified reports
containing false statements or omitting material information. (People v. Gonda, supra, at
pp. 778-779.) As the appellate court did not apply the elements tests in reaching these
conclusions (see ibid.), it does not constitute persuasive authority on the issue before us.
20
convictions for making false financial statements fail for want of substantial
evidence. For the reasons explained below, we reject his contention regarding the
convictions for grand theft, but conclude there is insufficient evidence to support
10
the pertinent convictions for making false financial statements.
1. Grand Theft Convictions
For the reasons set forth in Whitmer, appellant may convicted only of a
single count of grand theft. We nonetheless observe that there is sufficient
evidence to support his conviction on each count of grand theft, viewed as a
separate crime. With respect to the grand theft convictions, appellant argues there
was no direct evidence that he intentionally participated in the fraud activities
related to the taking of each vehicle. He directs our attention to the evidence that
Mor was a direct participant in the scheme, and maintains that the trial evidence
also supports the reasonable inference that Carlos was Mor’s “insider.”
Appellant’s argument misapprehends our role in reviewing the record for
substantial evidence. We do not engage in independent factfinding, but instead
affirm the jury’s determinations if they are supported by any logical inferences
grounded in the evidence. (People v. Rodriguez (1999) 20 Cal.4th 1, 11-14.)
10
“In determining whether the evidence is sufficient to support a conviction . . . ,
‘the relevant question is whether, after viewing the evidence in the light most favorable to
the prosecution, any rational trier of fact could have found the essential elements of the
crime beyond a reasonable doubt.’ [Citations.] Under this standard, ‘an appellate court
in a criminal case . . . does not ask itself whether it believes that the evidence at the trial
established guilt beyond a reasonable doubt.’ [Citation.] Rather, the reviewing court
‘must review the whole record in the light most favorable to the judgment below to
determine whether it discloses substantial evidence -- that is, evidence which is
reasonable, credible, and of solid value -- such that a reasonable trier of fact could find
the defendant guilty beyond a reasonable doubt.’ [Citation.]” (People v. Vy (2004) 122
Cal.App.4th 1209, 1224.)
21
Furthermore, we are guided by the principle that “[t]he testimony of a single
witness is sufficient to uphold a judgment even if it is contradicted by other
evidence . . . . [Citations.]” (In re Frederick G. (1979) 96 Cal.App.3d 353, 366,
fn. omitted.)
There was ample evidence that appellant directly perpetrated the thefts.
Carlos testified that appellant authorized the offline credit card sales and other
violations of dealership policies, obtained the false signatures from the fictitious
buyers on the sales documents, and arranged for the delivery of the vehicles.
Furthermore, according to Detective Valenzuela, appellant admitted that Mor had
“got[ten] the ball rolling” on the thefts, that Van Hek had instructed appellant how
to do offline transactions, and that appellant had participated for “personal gain.”
This evidence was sufficient to establish that appellant supervised and directed the
thefts within the dealership.
2. False Financial Statement Convictions Based On Credit Card
Transactions
Appellant also challenges his convictions for making false financial
statements under the counts based on credit card transactions (Counts 14, 16, 18,
20, 24, 26, 28, 30, 32, 34, 36, 38, 40, and 42). Regarding the credit card
transactions, appellant maintains there is no evidence he arranged for falsified
buyer signatures to be placed on any written sale documents affirming the buyer’s
11
financial condition or ability to pay. We agree.
11
Appellant does not dispute the existence of substantial evidence to support the
remaining counts of making false statements (Counts 4, 6, 8, 10, 12, and 22), which
involved transactions based on financing agreements.
22
To commit the offense of false financial statement (see pt. C., ante), a
defendant must “knowingly make or cause to be made . . . , [a] false statement in
writing, with intent that it shall be relied upon, respecting the financial condition,
or means or ability to pay, of himself or herself, or any other person, firm or
corporation, in whom he or she is interested, or for whom he or she is acting . . . .”
(§ 532s, subd. (1), italics added.) The offense is rendered a felony when a
fictitious name is used in connection with the false financial statement (§ 532a,
subd. (4)).
However, as explained in People v. Vincent (1993) 19 Cal.App.4th 696, the
use of a fictitious name by itself does not establish the offense, absent a false
written statement regarding an individual’s financial condition or means or ability
to pay. There, the defendant opened two bank accounts using a false name, and
then attempted to obtain funds from the bank by depositing a forged check in one
of the accounts. (Vincent, supra, 19 Cal.App.4th at pp. 698-699.) After the
defendant was convicted of forgery and making false financial statements, we
reversed her conviction for the latter offense, as the documents she signed to open
the accounts contained no representations “regarding [her] business or financial
condition . . . or her means or ability to pay.” (Id. at pp. 702-703.)
Here, the documents executed by the purported buyers in connection with
the credit card transactions also disclose no such representations. Although each
purported buyer executed a sales agreement, the agreements themselves state only
that the buyer is obliged to pay for the vehicle. Respondent has identified no
language in the sales documents -- and we have found none -- containing any
statement affirming the buyer’s ability to pay. For this reason, appellant’s
convictions under the pertinent counts fail for want of substantial evidence.
23
Accordingly, the convictions must be reversed, notwithstanding the fact that the
12
trial court stayed the imposition of punishment on them (§ 654).
D. Aiding and Abetting Instruction
Appellant contends the trial court erred in failing to instruct the jury sua
sponte on aiding and abetting liability. He is mistaken. Generally, “[a]ll persons
concerned in the commission of a crime, . . . whether they directly commit the act
constituting the offense, or aid and abet in its commission, . . . are principals in any
crime so committed.” (§ 31.) As our Supreme Court has explained, “[i]nstructions
on aiding and abetting are not required where ‘[t]he defendant was not tried as an
aider and abettor, [and] there was no evidence to support such a theory.’” (People
v. Young (2005) 34 Cal.4th 1149, 1201, quoting People v. Sassounian (1986)
182 Cal.App.3d 361, 404.) Thus, the jury need not receive instructions on aiding
and abetting when the prosecutor tries the case on the theory that the defendant
was one of the direct perpetrators of the crimes, neither side relies on an aiding and
abetting theory, and no evidence is presented suggesting that the defendant acted
merely as an aider and abettor of the crimes. (People v. Sassounian, supra,
182 Cal.App.3d at p. 404.)
That is the case here. Although the prosecutor argued that Mor
“perpetrated” the fraud, he maintained that appellant was Mor’s partner within the
dealership. As noted above (see pt. C.1. ante), the prosecution evidence
established that appellant was directly responsible for the fraudulent transactions
12
In view of this conclusion, it is unnecessary to address appellant’s contentions that
the counts in question were never properly amended to assert charges under section 532a,
and that his counsel rendered ineffective assistance by failing to object to the defective
amendments and absence of evidence regarding the amended charges. Our determination
renders these contentions moot.
24
inside the dealership. There is otherwise no evidence suggesting that appellant was
merely an aider and abettor. At trial, appellant denied any role in the crimes, and
never advanced the theory that he merely aided and abetted them. Accordingly,
there was no instructional error.
E. Remedy In Light of Decision in Whitmer
Although we reject appellant’s challenges to his convictions for grand theft,
our Supreme Court has concluded on other grounds that appellant may suffer only
one conviction for grand theft. (Whitmer, supra, 59 Cal.4th at pp. 734, 742.)
Under the circumstances, the appropriate remedy is to affirm the judgment as to
the grand theft charged in Count 3, which the trial court identified as the base term,
reverse the remaining grand theft counts, and remand the matter for resentencing,
including imposition of the enhancement on Count 3 (§ 12022.6). (See People v.
Brooks (1985) 166 Cal.App.3d 24, 32, disapproved on another ground in Whitmer,
supra, 59 Cal.4th at pp. 739-741; People v. Packard (1982) 131 Cal.App.3d 622,
627, disapproved on another ground in Whitmer, supra, 59 Cal.4th at pp. 739-741;
People v. Bowie (1977) 72 Cal.App.3d 143, 157.)
25
DISPOSITION
The judgment is reversed with respect to appellant’s convictions for grand
theft, with the exception of the grand theft charged in Count 3, which the trial court
identified as the base term. Also reversed are appellant’s convictions for making
false financial statements (§ 532a, subds. (1), (4)) under Counts 14, 16, 18, 20, 24,
26, 28, 30, 32, 34, 36, 38, 40, and 42. The matter is remanded to the superior court
with directions to resentence appellant on Count 3, to impose the enhancement
under section 12022.6, and to impose sentence on the remaining counts of making
false financial statements (Counts 4, 6, 8, 10, 12, and 22). The judgment is
affirmed in all other respects. Following resentencing, the superior court is
directed to prepare an amended abstract of judgment reflecting the resentencing,
and to forward a copy of the amended abstract of judgment to the California
Department of Corrections and Rehabilitation.
CERTIFIED FOR PUBLICATION.
MANELLA, J.
We concur:
EPSTEIN, P. J.
WILLHITE, J.
26
|
Spanish adaptation of the scale of psychological empowerment in the workplace.
The objective of this study is to adapt and translate into Spanish Spreitzer's Psychological Empowerment Scale (1995a). A process of translation and reverse-translation was applied to the scale's items, whose psychometric properties were then examined using a sample of 272 professional nurses at public hospitals in the province of Seville. The data were subjected to confirmatory factor analysis. The significance of the factor loadings demonstrated the need to create a new model eliminating one item. The 11-item model was shown to possess adequate construct validity and internal consistency. The results confirm the original, four-factor structure obtained by Spreitzer, with the exception of item 10, and support the utilization of the Spanish version of this scale in the workplace. Future research should more extensively investigate its construct validity, and test the nomological network of the operationalized construct within the field of psychological well-being and in the context of the workplace. |
Transition span at (0:0,0 [1] ) (Accepts:None) - Parent: Statement block at (0:0,0 [11] )
MetaCode span at (1:0,1 [1] ) (Accepts:None) - Parent: Statement block at (0:0,0 [11] )
Code span at (2:0,2 [2] ) (Accepts:Any) - Parent: Statement block at (0:0,0 [11] )
Markup span at (4:1,0 [3] ) (Accepts:None) - Parent: Tag block at (4:1,0 [3] )
Markup span at (7:1,3 [4] ) (Accepts:None) - Parent: Tag block at (7:1,3 [4] )
Code span at (11:1,7 [0] ) (Accepts:Any) - Parent: Statement block at (0:0,0 [11] )
|
On the current situation
Before you ask, there's a list of things I'm not going to do. I'm not going to tell anyone who I actually am; that's point one. I'm a blogger and I am paid for my writings, and I have cause to believe that I would legitimately be either fired or in a very very unfavourable position as a result of this. Make of that what you will. I'm not going to make a video. I'm not going to swear unconditional allegiance to some sort of movement that calls itself 'anti-SJW' because I believe that tarring anyone who vociferously campaigns for social justice with the same brush is unfair. And I should know: I've been unfair. To 4chan.
Allow me to explain. Before all of this started I was alerted by a friend (who will also remain unnamed because she is also in an awkward position) of this whole situation. The background to me AT THE TIME was thus: here is a woman, Ms Zoe Quinn, being slut shamed, having her game bombarded with troll reviews and 1/10 scores, getting doxxed, getting her private life more or less splashed all over the gaming and tech journalism district of the internet. And here's a company, TFYC, that I 'knew' to be an exploitative, nasty piece of work from the failed project in the past attempting to ride this wave to fund itself after the first attempt failed.
I was incensed. Here was 4chan, an entity that as far as I was concerned existed only to call me a slut and a cunt in the comments sections of my articles, claiming to be all pro-feminism. I took to twitter to make my opinions known. I made reactionary posts because I thought that TFYC had stone age trans policies (they don't) and that they were mansplaining feminism from a position of privilege (they aren't). I went so far as to call collusion with 4chan a form of deep corruption, compromising so-called 'feminist' values for the sake of making profit. That was until I saw that they stand to make NO money from this and will in fact be giving women with good ideas, not programmers, a portion of the profits commensurable with a producer in the entertainment industry.
And the rest goes to charity.
And then I thought: why am I against this again? Details emerged. The project was more or less killed by Zoe Quinn claiming that they were anti-trans and exploitative. This was a stance I absolutely believed, and I believed it because Ms Quinn said it. I didn't do research. Why would I? Obviously someone as awesome as her would know what she's talking about. And therein lies the problem. It's so easy to misdirect and deflect blame or scrutiny from yourself by choosing your words carefully. I came to learn that 4chan is the way it is because of anonymity, NOT because of some deep rooted ideology. A friend came to me (not disclosing - seeing a pattern here?) and told me that they browsed their lgbt board. Another explained to me that it's sort of like reddit in that the overall entity cannot be spoken for by its subdivisions, which have their own culture and often fight amongt themselves to boot.
And then I started to get headaches, and sweat, and get cravings for the cigarettes that I gave up years ago, because I just made the kind of errors I constantly lampooned people for making: I did not do my research. For that I am sorry. I am sorry I insulted 4chan and I am sorry I insulted The Fine Young Capitalists. I even gave money, for what it's worth.
Don't think this means I've 'defected' in some way. Anyone making twitter accounts solely to harass people with foul language and insults is a leech. But equally, any 'SJW' (shudders at using the term) who blindly defends Ms Quinn and thinks this is just about misogyny is WRONG. WRONG WRONG WRONG. This wouldn't be going on for over a week if it was and there wouldn't be THOUSANDS raised for charity and there wouldn't be people demanding that Nathan Grayson resign (he should) or that Zoe Quinn should apologise for issuing false DMCA requests (she absolutely should).
And to anyone trying to take away 4chan's donations by calling them 'spiteful'...hello? Do you remember how you all threw money at Anita Sarkeesian to spite the mean trolls harassing her? That money was given out of spite, but you STILL BELIEVED IN HER CAUSE. People don't just open their wallets out of pure spite to the tune of 30 thousand dollars. If the cause of feminism in gaming was REALLLY so abhorrent to ALL of 4chan, then they wouldn't give money, period. Imagine asking me to give money to some pro-life group just because it would spite one of the cretins who posts NSFW photos on my blog posts. I'd NEVER do it and don't pretend a lot of you would either. There has to be some underlying sympathy.
And as a final point: I've begun to notice an awful lot of harassment coming from people I'd consider to be on 'my' side. SJW's throwing around words like neckbeard, virgin, misogynist pigs, even going so far as to compare them to ISIS. Sorry guys but just because 4chan is a big meanie, doesn't mean you get to be bigoted and uninformed as well. Five minutes' reading will tell you that Zoe Quinn is not an emblem of feminism in gaming, she's a rebuttal to it. She symbolises a 'straw-feminist' that I never would've thought existed had this whole situation not blown up. I'll think carefully on this last point from now on, and you all should too.
Love and kisses,
'Ariel'
Reply · Report Post |
Q:
get xpath following sibling to make use of a template with its value
I have following XSLT :
<xsl:if test="$CurPos mod 2 =1">
<li style="width:604px;">
<div class="content-left" style="width:300px; height:290px;float:left;">
<xsl:if test="string-length($SafeImageUrl) != 0">
<div class="images-area-left">
<a href="{$SafeLinkUrl}" target="{$LinkTarget}">
<img class="image" src="{$SafeImageUrl}" alt="{@ImageUrlAltText}" />
</a>
<div class="Heading-desc">
<span class="NewsHeading"><h4><xsl:value-of select="@Title"/></h4></span>
<span class="Desc">
<xsl:value-of select="substring(@Comments,0,200)"/>
<xsl:if test="string-length(@Comments) > 200">…</xsl:if>
<a href="{$SafeLinkUrl}" class="ReadMore"> Read More</a>
</span>
</div>
</div>
</xsl:if>
</div>
<div class="content-right" style="float:right; width:300px; height:290px;">
<xsl:value-of select="following-sibling::*[1]/@PublishingRollupImage" disable-output-escaping="yes" />
<span class="NewsHeading"><h4><xsl:value-of select="following-sibling::*[1]/@Title"/></h4></span>
<span class="Desc" style="display:block; width:280px;"><xsl:value-of select="substring(following-sibling::*[1]/@Comments,0,200)"/>
<xsl:if test="string-length(following-sibling::*[1]/@Comments) > 200">…</xsl:if><a href="{$SafeLinkUrl}" class="ReadMore"> Read More</a>
</span>
</div>
</li>
</xsl:if>
There is a variable $SafeLinkUrl coming from another template that gets the page URL for the current Row. Since I am getting following sibling while I am still on the current node, I am unable to get the URL for the following sibling.
<xsl:variable name="SafeLinkUrl">
<xsl:call-template name="OuterTemplate.GetSafeLink">
<xsl:with-param name="UrlColumnName" select="'LinkUrl'"/>
</xsl:call-template>
</xsl:variable>
============> points to this template
<xsl:template name="OuterTemplate.GetSafeLink">
<xsl:param name="UrlColumnName"/>
<xsl:if test="$UseCopyUtil = 'True'">
<xsl:value-of select="concat($RootSiteRef,'/_layouts/CopyUtil.aspx?Use=id&Action=dispform&ItemId=',@ID,'&ListId=',@ListId,'&WebId=',@WebId,'&SiteId=',$SiteId,'&Source=',$Source)"/>
</xsl:if>
<xsl:if test="$UseCopyUtil != 'True'">
<xsl:call-template name="OuterTemplate.GetSafeStaticUrl">
<xsl:with-param name="UrlColumnName" select="$UrlColumnName"/>
</xsl:call-template>
</xsl:if>
</xsl:template>
and this has a call to ====>
<xsl:template name="OuterTemplate.GetSafeStaticUrl">
<xsl:param name="UrlColumnName"/>
<xsl:variable name="Url">
<xsl:call-template name="OuterTemplate.FormatColumnIntoUrl">
<xsl:with-param name="UrlColumnName" select="$UrlColumnName"/>
</xsl:call-template>
</xsl:variable>
<xsl:value-of select="cmswrt:EnsureIsAllowedProtocol($Url)"/>
</xsl:template>
Which again calls another template, on and on =====>
<xsl:template name="OuterTemplate.FormatColumnIntoUrl">
<xsl:param name="UrlColumnName"/>
<xsl:variable name="Value" select="@*[name()=$UrlColumnName]"/>
<xsl:if test="contains($DataColumnTypes,concat(';',$UrlColumnName,',URL;'))">
<xsl:call-template name="OuterTemplate.FormatValueIntoUrl">
<xsl:with-param name="Value" select="$Value"/>
</xsl:call-template>
</xsl:if>
<xsl:if test="not(contains($DataColumnTypes,concat(';',$UrlColumnName,',URL;')))">
<xsl:value-of select="$Value"/>
</xsl:if>
</xsl:template>
Here is the Actual XML: https://gist.github.com/4380967
XSL for the container: https://gist.github.com/4389989
XSL for the individual Row: https://gist.github.com/4389997
I am unable to use $SafeLinkUrl for the following-sibling::*[1] as it is applicable for current item and not the immediate sibling. How do I make the variable applicable for the sibling too??
A:
Use:
<xsl:variable name="SafeLinkUrl">
<xsl:for-each select="following-sibling::*[1]">
<xsl:call-template name="OuterTemplate.GetSafeLink">
<xsl:with-param name="UrlColumnName" select="'LinkUrl'"/>
</xsl:call-template>
</xsl:for-each>
</xsl:variable>
Or even better, add a second parameter to your template:
<xsl:template name="OuterTemplate.GetSafeLink">
<xsl:param name="UrlColumnName"/>
<xsl:param name="pContext" select="."/>
<xsl:if test="$UseCopyUtil = 'True'">
<xsl:value-of select="concat($RootSiteRef,'/_layouts/CopyUtil.aspx?Use=id&Action=dispform&ItemId=', $pContext/@ID,'&ListId=',$pContext/@ListId,'&WebId=',$pContext/@WebId,'&SiteId=',$pContext/$SiteId,'&Source=',$Source)"/>
</xsl:if>
<xsl:if test="$UseCopyUtil != 'True'">
<xsl:call-template name="OuterTemplate.GetSafeStaticUrl">
<xsl:with-param name="UrlColumnName" select="$UrlColumnName"/>
</xsl:call-template>
</xsl:if>
</xsl:template>
Do so for the other two templates. Specify the $pContext parameter when calling any of the two inner templates.
Then call the outermost template specifying the $pContext parameter as following-sibling::*[1].
|
{
"images" : [
{
"idiom" : "universal",
"scale" : "1x"
},
{
"idiom" : "universal",
"filename" : "barbuttonicon_Camera_Golden@2x.png",
"scale" : "2x"
},
{
"idiom" : "universal",
"filename" : "barbuttonicon_Camera_Golden@3x.png",
"scale" : "3x"
}
],
"info" : {
"version" : 1,
"author" : "xcode"
}
} |
Note: Don't miss CBSSports' one-week Fantasy Football championship on FanDuel -- double your cash each week, compete against CBSSports experts and play in a FREE $100K final! Enter now
Three of the best running backs from Week 4 have tough matchups this week, but you should still plan on starting them in the majority of leagues. We're looking at Devonta Freeman, Todd Gurley and Jeremy Hill.
Clearly if you have better options you can bench any of these guys, but I would stick with Freeman and Gurley as No. 1 running backs, with Hill as a No. 2 option. Workload and touchdown potential should allow them to post quality stat lines.
Start with Freeman, who has been the best Fantasy running back this season through four games. But the Redskins have allowed just one touchdown to an opposing running back and none to gain more than 53 rushing yards or 75 total yards. Freeman faced a similar situation with Dallas and Houston the past two weeks and came through with huge stat lines, so have no fear.
Gurley was amazing in his second NFL game against the Cardinals with 19 carries for 146 yards and two catches for 15 yards. He's facing a Packers defense that swallows up running backs at home, but I still expect Gurley to reach double digits in Fantasy points and score his first NFL touchdown. Jamaal Charles scored three times in Lambeau Field in Week 3, and Gurley can manage at least 50 rushing yards and a score this week.
Hill's situation is a little tougher because the Seahawks haven't allowed a running back to score this season or in their past six games going back to last season. And Hill has been touchdown dependent this year with his only games with double digits in Fantasy points coming when he scored multiple touchdowns in Week 1 and Week 4.
It's easier to bench Hill than Freeman or Gurley, but just be careful in case Hill does punch in a short-yardage run. I've downgraded him from a No. 1 running back to a No. 2 option, but I would still start him in the majority of leagues. That said, I do like Giovani Bernard better than Hill this week since he should have more total yards.
Start of the Week: Justin Forsett, RB, Ravens
Justin Forsett DEN • RB • 20 vs. CLE Projections WEEK 5 PROJECTION 15.6 View Profile
It was nice to see the real Justin Forsett step up in Week 4 against Pittsburgh, and we hope that's a sign of things to come. He definitely has the chance to stay hot this week against the Browns.
Forsett had 27 carries for 150 yards against the Steelers, and the Ravens should continue to ride him with Steve Smith (back) banged up, leaving an already thin receiving corps even worse. Forsett didn't have any catches for the first time this season against the Steelers, but he should continue to be viable in standard and PPR leagues this week. He did have four catches in each of the first three games.
The Browns have been terrible against opposing running backs all season. And going back to last year, they have allowed a running back to reach double digits in Fantasy points in seven games in a row, including Danny Woodhead, Latavius Murray, Dexter McCluster and Chris Ivory this season.
Forsett is part of that streak since he had 17 carries for 119 yards and two catches for 17 yards against the Browns in Week 17 last year. We could see Lorenzo Taliaferro or Javorius Allen vulture a touchdown from Forsett, and I like Taliaferro as a sleeper in deeper leagues.
But Forsett should return as a fixture in your lineup if you were hesitant to start him prior to last week. He delivered in a big way, and we hope the Ravens lean on him against a Browns defense playing their second consecutive game on the road.
I'm starting Forsett over: Todd Gurley (at GB), Frank Gore (at HOU), Jeremy Hill (vs. SEA), Latavius Murray (vs. DEN) and Carlos Hyde (at NYG)
Quarterbacks
Start 'Em
Carson Palmer ARI • QB • 3 at DET Projections WEEK 5 PROJECTION 24.7 Palmer had gone nine games in a row with at least 20 Fantasy points in outings he was able to play the whole game before scoring just 18 points against the Rams in Week 4. He should have scored at least 20 points, but running back David Johnson dropped a touchdown, leaving Palmer with 352 passing yards, one touchdown and one interception. He should rebound in Week 5 at Detroit, and the Lions have allowed all four opposing quarterbacks this season to score at least 18 Fantasy points, with Philip Rivers, Teddy Bridgewater and Peyton Manning all scoring at least 20 points. Palmer will again be a Top 10 Fantasy quarterback this week, and he scored 29 Fantasy points in his lone road game at Chicago in Week 2. View Profile
Eli Manning NYG • QB • 10 vs. SF Projections WEEK 5 PROJECTION 23.2 Manning has been great the past three weeks, and it's time to buy in if you haven't done so already. He has scored at least 23 Fantasy points in three games in a row with seven touchdowns and one interception over that span. He's also been great at home with at least 21 Fantasy points in five games in a row, including two outings this year against Atlanta and Philadelphia. The last time he failed to reach 20 Fantasy points in New York was Week 11 last year against the 49ers when he passed for 280 yards, one touchdown and five interceptions. But San Francisco has struggled with opposing quarterbacks this year as Ben Roethlisberger and Palmer each had at least 22 Fantasy points against this defense. I'm sticking with Manning at home this year with the 49ers on a long road trip to the East Coast. View Profile
Sam Bradford ARI • QB • 9 vs. NO Projections WEEK 5 PROJECTION 20.1 I have a feeling the Eagles come out with their best offensive game of the season and blow out the Saints at home. New Orleans has struggled with quarterbacks this season not named Brandon Weeden, as Palmer, Jameis Winston and Cam Newton scored at least 20 Fantasy points in the first three games of the year. Bradford had his best outing in Week 4 at Washington with 270 passing yards and three touchdowns, and he finally challenged the defense down the field with four completions of over 30 yards. We hope that carries over to this week at home, and this could be when Bradford and the Eagles are ready to take off as a quality offensive team. View Profile
Drew Brees NO • QB • 9 at PHI Projections WEEKS 5 PROJECTION 27.1 It's not often we get to talk about Brees as a starter in this column, but some Fantasy owners still have questions about him with his shoulder issue. He looked fine in his Week 4 outing against Dallas with 41 pass attempts, albeit most of them were of the short variety. Still, he completed 33 passes for 359 yards and two touchdowns, including an 80-yard score to C.J. Spiller in overtime. The Eagles have only allowed Kirk Cousins to score at least 20 Fantasy points this season, but this game should feature plenty of points, with Brees again attempting at least 40 passes. As long as he doesn't suffer a setback, we expect Brees to start posting big stat lines for the rest of the year. View Profile
Philip Rivers IND • QB • 17 vs. PIT Projections WEEK 5 PROJECTION 27.1 Rivers has played two games at home so far this season against the Lions and Browns, and he's scored at least 24 Fantasy points in both outings. He might not have Steve Johnson (hamstring) or Malcom Floyd (concussion) this week, but he does get Antonio Gates back with his four-game suspension now over. Keenan Allen is playing like a third-year breakout, and Rivers has used all his weapons with Danny Woodhead and Ladarius Green also chipping in. The Steelers have allowed at least 30 Fantasy points to Tom Brady and Colin Kaepernick in the first two games of the season but have held Nick Foles and Joe Flacco to a combined 15 Fantasy points the past two weeks. We expect Rivers to have success in this matchup, and he's worth starting in all leagues. View Profile
Sleepers
Marcus Mariota (vs. BUF): QBs have averaged 24.5 Fantasy points vs. BUF.
Nick Foles (at GB): Six road QBs in a row have 20 Fantasy points vs. GB.
Alex Smith (vs. CHI): Three QBs have multiple touchdowns vs. CHI.
Sit 'Em
Matthew Stafford DET • QB • 9 vs. ARI Projections WEEK 5 PROJECTION 22.5 Stafford was again terrible in Week 4 at Seattle with eight Fantasy points, and he has now been held to 17 points or less in three of four games. That number will likely be four of five after this home meeting with the Cardinals. He had just five Fantasy points at Arizona in Week 11 last year, and the Cardinals have held three of four opposing quarterbacks to 18 Fantasy points or less, with Foles the lone quarterback to top 20 Fantasy points last week. Things should get easier for Stafford starting in Week 6 against Chicago, but this is another week to keep him on your bench. View Profile
Colin Kaepernick SF • QB • 7 at NYG Projections WEEK 5 PROJECTION 17.1 Kaepernick had 15 Fantasy points at the Giants in Week 11 last year, and if he reached that total this week everyone would be thrilled. He was again awful in Week 4 against Green Bay with nine Fantasy points and has now combined for just 13 points the past two games. The Giants allowed Tony Romo and Ryan to score at least 20 Fantasy points in the first two games, but New York has limited Cousins and Tyrod Taylor to a combined 31 Fantasy points the past two weeks. There's no way to trust Kaepernick in two-quarterback leagues, and I'd feel more confident starting Josh McCown or Weeden over Kaepernick this week. View Profile
Joe Flacco NYJ • QB • 5 vs. CLE Projections WEEK 5 PROJECTION 20.3 The matchup with the Browns doesn't worry me since Cleveland has allowed every opposing quarterback to throw multiple touchdowns this season, with Carr and Rivers each scoring at least 24 Fantasy points the past two weeks. And Flacco was great against Cleveland in his last home meeting in Week 17 last year with 24 Fantasy points. But Flacco's receiving corps is depleted even more with Smith out. And while I like Kamar Aiken and Crocket Gillmore (if he's active), it's not like those players are going to elevate Flacco's level of play. As we stated above, this is the perfect game to lean on Forsett against the Browns on back-to-back road games, and Flacco should only be used as an option in two-quarterback leagues. View Profile
Derek Carr LV • QB • 4 vs. DEN Projections WEEK 5 PROJECTION 22 The Broncos pass rush is going to be all over Carr this week, and we expect him to struggle to make plays. So far this season, the Broncos have allowed the fewest Fantasy points to opposing quarterbacks with Flacco, Alex Smith, Stafford and Teddy Bridgewater combining for 31 points over four games. The high total during that span came from Bridgewater with 16 Fantasy points last week, and Denver has at least two turnovers from every opposing quarterback this season. Carr had two touchdowns at Chicago in Week 4, but he failed to score at least 20 Fantasy points for the third game in a row. He also combined for 23 Fantasy points in two meetings with the Broncos as a rookie last year. View Profile
Russell Wilson SEA • QB • 3 at CIN Projections WEEK 5 PROJECTION 22 Wilson has not been a standout Fantasy quarterback so far this season with only one game above 17 Fantasy points, which was Week 2 at Green Bay. Two things are part of the problem for his low point total, which are a struggling offensive line and his lack of rushing touchdowns. He has yet to score on the ground, and once he finds the end zone running then his big games will follow. But this isn't one of those weeks. His offensive line could be in trouble against the Bengals front seven, which is led by Geno Atkins, who is an early contender for defensive player of the year. Flacco in Week 3 is the lone quarterback to score more than 17 Fantasy points against Cincinnati, and Wilson could struggle on a short week following the Monday night victory against Detroit. It's difficult to bench Wilson based on his upside, but this is a good game to sit him if you have a second quality quarterback on your roster like Palmer, Mariota or Cutler. View Profile
Andy Dalton DAL • QB • 14 vs. SEA Projections WEEK 5 PROJECTION 19.3 Dalton has been as good as any Fantasy quarterback this year aside from Aaron Rodgers or Brady. he was serviceable as our Start of the Week in Week 4 with 19 Fantasy points, which made him a Top 12 quarterback in standard leagues, and he scored at least 22 Fantasy points in his first three games. But the Seahawks will easily be his toughest test to date, and they come rolling into Cincinnati after holding Jimmy Clausen and Stafford a to a combined 11 Fantasy points the past two weeks. This game should be a low-scoring affair given their two defenses, but Dalton won't be completely shut down since he has so many weapons. I just wouldn't consider him a No. 1 Fantasy quarterback even at home since I expect the Seahawks defense to come into Cincinnati ready and give Dalton some of those "bad Andy" moments we've been used to seeing in recent years. View Profile
Running back
Start 'Em
Dion Lewis NYG • RB • 33 at DAL Projections WEEK 5 PROJECTION 11.9 Sean Lee (concussion) is expected to play for the Cowboys, but if he's out for this game the Cowboys defense will be in bad shape. Even if he's active, start Lewis for sure and consider LeGarrette Blount a No. 2 running back in standard formats. Start with Lewis, who has scored at least 11 Fantasy points in a standard league every week this season. He's great in PPR leagues with at least four catches in each game, and the Cowboys have already allowed four running backs to catch at least five passes for 50 yards. And if the Patriots build a lead in this game, Blount should have the chance to kill the clock. Dallas has allowed a running back to score in three of four games, and Blount just scored three touchdowns in his last outing against Jacksonville in Week 3. View Profile
Doug Martin LV • RB • 22 vs. JAC Projections WEEK 5 PROJECTION 14 Martin is coming off his best game of the season with 20 carries for 106 yards and a touchdown and five catches for 37 yards against Carolina. He should have the chance for another big game against the Jaguars, who are playing their third game in a row on the road. The Jaguars could be without standout linebacker Paul Posluszny, who has a high ankle sprain, and Martin has double digits in Fantasy points in three of his past five home games going back to last season. Charles Sims will impact Martin in the passing game, but Jacksonville has allowed a running back to gain 80 total yards or score a touchdown in every game this season. If Posluszny is out as expected then Martin has the chance to be a Top 10 running back this week. View Profile
T.J. Yeldon BUF • RB • 22 at TB Projections WEEK 5 PROJECTION 16.5 Yeldon is coming off his best game of the season in Week 4 at the Colts with 22 carries for 105 yards and two catches for 4 yards. He has yet to score a touchdown this season, but this is a good matchup to trust him, even with the three consecutive road games for Jacksonville. Tampa Bay has allowed a running back to score in three of four games this season, with Bishop Sankey (20 Fantasy points) and Alfred Blue (19 Fantasy points) having their best games of the year against the Buccaneers. Yeldon has gotten 20-plus carries in two of his past three games, and if that happens again this week he should deliver in a big way against Tampa Bay. View Profile
Ronnie Hillman DAL • RB • 34 at OAK Projections WEEK 5 PROJECTION 9.8 I'm buying in that Hillman will start to take over for C.J. Anderson this week because Denver needs to inject some life into the offense, and it makes sense to give Hillman more touches. Anderson will also play a role this week, and don't be surprised if he scores against the Raiders, who have allowed three running backs to reach double digits in Fantasy points in four games with three touchdowns allowed. Last year at Oakland in Week 10 is when Hillman hurt his foot, and Anderson took over with 13 carries for 90 yards and four catches for 73 yards and a touchdown. Maybe a similar changing of the guard will happen this week. Hillman should be considered a No. 2 running back. View Profile
DeMarco Murray TEN • RB • 29 vs. NO Projections WEEK 5 PROJECTION 14.5 It feels like the Eagles are going to let out all of their offensive frustrations on the Saints this week, and Murray should benefit. New Orleans is coming off an emotional home victory against the Cowboys, and the Eagles have been stuck in neutral all season with only flashes of their potential. If the Eagles build any sort of lead this week then Murray should get plenty of touches in the fourth quarter after he complained about his workload. He's been an obvious bust so far with 29 carries for 47 yards and a touchdown and 11 catches for 76 yards and a touchdown, along with missing Week 3 because of a hamstring injury, but we'll find out if Chip Kelly plans to feed his big offseason acquisition in what should be a favorable matchup. I'm starting Murray as a No. 2 running back in all formats. View Profile
Sleepers
Andre Williams (vs. SF): SF has allowed six rushing touchdowns this year.
Anthony Dixon (at TEN): He should produce if Karlos Williams is out.
Chris Thompson (at ATL): He'll be the best WAS running back this week.
Danny Woodhead (vs. PIT): Just continue to start him until further notice.
Giovani Bernard (vs. SEA): I like him better than Jeremy Hill in this matchup.
Sit 'Em
Joseph Randle DAL • RB • 21 vs. NE Projections WEEK 5 PROJECTION 14.1 Randle could again come out with a three-touchdown game like we saw two weeks ago against the Falcons or he could barely be on the field like we saw in the second half last week against the Saints. The good news for Randle is Lance Dunbar (knee) is out for the season, which could allow for Randle to see more work in the passing game. The bad news is Christine Michael could also see a bigger role, and the Cowboys are clearly frustrated with Randle. It's a risk to start him, but he does have four touchdowns in the past two games. I'd only consider him as a flex option this week against the Patriots, who have allowed just two touchdowns to running backs this season. View Profile
Isaiah Crowell LV • RB • 20 at BAL Projections WEEK 5 PROJECTION 13.5 Crowell had a solid game in Week 4 at San Diego with 12 carries for 63 yards and three catches for 62 yards, which was highlighted by a 53-yard reception. Good luck counting on those receiving yards to carry his Fantasy value again, especially against the Ravens on the road. Baltimore has allowed two rushing touchdowns this season, but Crowell has just one touchdown on the season and continues to lose playing time to Duke Johnson. Against the Chargers, Crowell played just 37 percent of the offensive snaps, and Johnson had eight carries for 31 yards and nine catches for 85 yards and a touchdown. I'd rather start Johnson this week over Crowell, and Crowell is just a No. 3 running back in the majority of leagues. View Profile
Ameer Abdullah MIN • RB • 31 vs. ARI Projections WEEK 5 PROJECTION 13.6 Abdullah had his highest work total of the season in Week 4 at Seattle, but he struggled as expected with 13 carries for 33 yards and two catches for 11 yards. We hope he follows in the footsteps of fellow rookie Gurley, who had 19 carries for 146 yards and two catches for 15 yards against the Cardinals last week. But we're not that optimistic, even though he should again get plenty of touches with Joique Bell (ankle) likely out. The Cardinals have still allowed just one touchdown to an opposing running back this season, and this defense should be fired up after losing at home to the Rams. Abdullah is just a flex option in the majority of leagues. View Profile
Thomas Rawls JAC • RB • 34 at CIN Projections WEEK 5 PROJECTION 6.2 It's a small sample size, but we've seen the Seahawks struggle to run the ball now for most of the season. Take away what Rawls did against the Bears in Week 3, and Seattle has 50 carries for 162 yards from its leading rusher in three games against St. Louis, Green Bay and Detroit. The Seahawks have no rushing touchdowns from their running backs, and now they're facing a Bengals defense that hasn't allowed a rushing touchdown to a running back this year. Marshawn Lynch (hamstring) could return this week, which would obviously send Rawls to the bench, but if he does start then he has minimal Fantasy value in the majority of leagues. It would be hard to trust him going against this defense on the road. View Profile
Alfred Morris ARI • RB • 36 at ATL Projections WEEK 5 PROJECTION 13.9 The Falcons gave up the huge rushing game to Randle in Week 3 with the three touchdowns, but for the most part they've been tough to run on. Atlanta has allowed seven rushing touchdowns, but Randle is the only running back to reach double digits in Fantasy points against the Falcons because of his rushing totals alone. Pass-catching running backs have done damage against the Falcons, which is why we like Thompson as the best Washington running back, and that's been with teams chasing points against Atlanta, which should happen here. Morris is still looking for his first rushing touchdown this season, and he's combined for 13 Fantasy points the past three weeks while sharing playing time with Thompson and Matt Jones. Morris is a risky starting option on the road this week. View Profile
Latavius Murray NO • RB • 28 vs. DEN Projections WEEK 5 PROJECTION 16.2 Murray had his worst game of the season in Week 4 at Chicago with 16 carries for 49 yards and three catches for 12 yards and a fumble. He appeared to be benched after the fumble, but we have no doubt the Raiders will stick with him this week. That said, I'd expect minimal production from Murray, who has two games this season with at least 14 Fantasy points and two games with seven points or less. Denver has struggled with running backs in two of the past three weeks, but that was Charles and Adrian Peterson. As much as I like Murray, he's nowhere near that level. Murray has one game this season with more than 65 rushing yards, and we could see Roy Helu get more work catching the ball out of the backfield. Denver should be able to contain Murray, and he should be considered just a flex option at best this week. View Profile
Wide receiver
Start 'Em
Jordan Matthews SF • WR • 81 vs. NO Projections WEEK 5 PROJECTION 4.6 Fantasy owners are frustrated with Matthews the past two weeks, and rightfully so given his lack of production. He has nine catches for 99 yards despite 16 targets over that span, and the Eagles had three receiving touchdowns to Miles Austin, Riley Cooper and Brent Celek, while Matthews was held out of the end zone for the second game in a row. But Matthews remains the top target for Bradford, and he should rebound against the Saints. The opposing No. 1 receiver against New Orleans has scored at least eight Fantasy points in all four games with two touchdowns, and Matthews best game so far this season has been at home in Week 2 against Dallas when he had 14 Fantasy points. I'd stick with Matthews in the majority of leagues, and he should deliver in a big way this week. View Profile
Terrance Williams DAL • WR • 83 vs. NE Projections WEEK 5 PROJECTION 3 There's a good chance the Cowboys are going to be chasing points this week, which should allow Williams to see a hefty amount of targets. He's played three games since Dez Bryant (foot) got hurt, and he's responded with two touchdowns in those outings. He's also had at least seven targets in three games this year, and the Patriots have allowed four receivers to catch a touchdown with at least 60 receiving yards. Williams doesn't have the best quarterback situation with Brandon Weeden, and Bryant could return as early as Week 7. But he remains the No. 1 receiver for now, and he should deliver as a No. 2 Fantasy option in the majority of leagues. View Profile
Allen Robinson CHI • WR • 12 at TB Projections WEEK 5 PROJECTION 4.79 View Profile
Allen Hurns MIA • WR • 17 at TB Projections WEEK 5 PROJECTION 4.81 Robinson has been outplayed by Hurns the past two games, who has 13 catches for 186 yards and two touchdowns compared to eight catches for 148 yards and no touchdowns for Robinson. But Robinson still has more targets (21) than Hurns (19) over that span, and it's only a matter of time before Robinson starts finding the end zone. I would start Robinson over Hurns this week, but both have the potential to be viable Fantasy options. The Buccaneers have allowed six touchdowns to opposing receivers, and four guys have scored double digits in Fantasy points. This game could be high scoring, and Robinson and Hurns should benefit if the targets continue to come in their direction. View Profile
Kendall Wright ARI • WR • 12 vs. BUF Projections WEEK 5 PROJECTION 3.23 The Bills have struggled with slot receivers this season, and Wright could give them more problems this week coming off his bye. Julian Edelman, Jarvis Landry and Dwayne Harris have combined for 24 catches, 205 yards and three touchdowns the past three games against Buffalo, and Wright has scored in two of three games this season. His last game against the Colts in Week 3 was encouraging with seven catches for 95 yards and a touchdown on 12 targets, and we expect Mariota to lean on him in this matchup. He's a high-end No. 2 Fantasy option in all leagues with upside this week. View Profile
Mike Evans TB • WR • 13 vs. JAC Projections WEEK 5 PROJECTION 4.47 Evans was a disappointment last week as expected because of his matchup with Carolina cornerback Josh Norman. Evans was held to three catches for 32 yards on eight targets, and he's still searching for his first touchdown this year. Let's hope what happened to Robinson and DeAndre Hopkins after facing Norman happens to Evans this week. Norman shut down Robinson in Week 1, but he rebounded with six catches for 155 yards and two touchdowns against Miami in Week 2. Norman then held Hopkins in check in Week 3, but he bounced back with eight catches for 101 yards and a touchdown in Week 4. Evans had seven catches for 101 yards on 17 targets in Week 3 at Houston, and he should score in double digits again this week. I have no hesitation starting him in all leagues despite the slow start. View Profile
Sleepers
John Brown (at DET): Big games are coming. Continue to start him.
Rueben Randle (vs. SF): He's scored in back-to-back games.
Leonard Hankerson (vs. WAS): He's stepped up as the No. 2 WR in ATL.
Brandin Cooks (at PHI):No. 1 receivers have been great vs. PHI this year.
Kamar Aiken (vs. CLE):He'll be the No. 1 WR in BAL with Steve Smith out.
Sit 'Em
Marvin Jones DET • WR • 11 vs. SEA Projections WEEK 5 PROJECTION 2.55 You're not going to bench A.J. Green this week even with the matchup against the Seahawks, but you should stay away from Jones. Dalton did last week against Kansas City when he had just two targets for one catch and 4 yards, and that's the problem with Jones throughout his career. Just when it looked like he was going to be a vital part of the offense with seven catches for 136 yards and two touchdowns the previous two games, he puts up a stinker of a stat line the next week. We'll see if he has a good game against the Seahawks, but I'd stay away. Only Randall Cobb in Week 2 has scored double digit in Fantasy points against Seattle this season. View Profile
Tavon Austin SF • WR • 10 at GB Projections WEEK 5 PROJECTION 2.68 I hope Austin plays well this week against the Packers, and there's a good chance for that to happen. St. Louis should be chasing points, meaning plenty of chances for Foles to target Austin, and he could deliver. But I'm not buying Austin as a legitimate Fantasy option. Yes, he was great in Week 4 at Arizona with six catches for 96 yards and two touchdowns on seven targets, but all those stats were season highs. He had 38 receiving yards as his best total prior to last week, and I'd rather start Kenny Britt if I'm looking for a Rams receiver this week. Like I said, I hope Austin plays well in this matchup and this is the start of a big year for him, but I'm not optimistic even after what happened in Week 4 against the Cardinals. View Profile
Anquan Boldin BUF • WR • 80 at NYG Projections WEEK 5 PROJECTION 4.24 The Giants have done a good job against opposing receivers for the most part this season, and they should be able to contain this passing attack given how poorly Kaepernick has looked of late. Boldin has one touchdown on the season, which was Week 2 at the Steelers, but in his three other games he's combined for five Fantasy points against the Vikings, Cardinals and Packers. The Giants have allowed two receivers to reach double digits in Fantasy points, but Hankerson is the only receiver to score against this secondary. It's been tight ends who have done damage against the Giants, and we expect Boldin and Torrey Smith to post minimal production in this matchup on the road. View Profile
Golden Tate NYG • WR • 15 vs. ARI Projections WEEK 5 PROJECTION 4.58 Tate has faced this Cardinals secondary quite a bit during his career going back to his days with the Seahawks, and he hasn't had much success. He has 15 catches for 204 yards and no touchdowns in his past five meetings with the Cardinals, including two catches for 41 yards at Arizona last year with the Lions. The Cardinals have allowed five touchdowns to receivers this season, with all of them coming from non-No. 1 options like Brandon Coleman, Josh Bellamy, Austin and Stedman Bailey, which bodes well for Tate. But he's been terrible for most of the year with eight Fantasy points his season high in Week 2, and he's averaging just four Fantasy points a game through Week 4. We'd love to see him turn things around and play at a high level, but it's hard to trust Tate right now based on his lack of production to start the season. View Profile
Percy Harvin BUF • WR • 11 at TEN Projections WEEK 5 PROJECTION 4.6 Harvin could be successful for Fantasy owners this week, especially if Sammy Watkins (calf) remains out again. He has eight targets in back-to-back weeks, so it's clear Taylor is looking in his direction. But Harvin has just 10 catches for 92 yards over that span, and he hasn't scored a touchdown since Week 1. The Titans have allowed four touchdowns to opposing receivers, but only Travis Benjamin and Philip Dorsett have reached double digits in Fantasy points. I'd be OK with Harvin as a No. 3 Fantasy receiver if Watkins is out again, but he burned many Fantasy owners last week against the Giants with three catches for 26 yards on eight targets and could again have minimal production on the road. View Profile
Amari Cooper DAL • WR • 19 vs. DEN Projections WEEK 5 PROJECTION 4.53 It's difficult to bench Cooper in the majority of leagues because he's been awesome the past three weeks. He has double digits in Fantasy points in every game over that span with 19 catches for 292 yards and two touchdowns on 31 targets. But the Broncos secondary is great, and they should focus on taking out Cooper. Mike Wallace is the lone receiver to score against the Broncos or reach double digits in Fantasy points, including matchups with Steve Smith, Jeremy Maclin and Calvin Johnson. I would still start Cooper as a No. 3 Fantasy receiver in the majority of leagues, but this should be his worst game of the season since Week 1 when he was held to five catches for 47 yards on nine targets. View Profile
Tight end
Start 'Em
Owen Daniels DEN • TE • 81 at OAK Projections WEEK 5 PROJECTION 2.32 No team has been worse at defending tight end than the Raiders, who have made Fantasy household names out of Crockett Gillmore and Gary Barnidge. Oakland has allowed six touchdowns to opposing tight ends, with Tyler Eifert and Gillmore each scoring two touchdowns, and Barnidge and Martellus Bennett each scored one. All four tight ends have scored at least 14 Fantasy points. Daniels has scored a touchdown in consecutive games, but he's scored just 14 Fantasy points combined in those outings against Detroit and Minnesota. Still, given the opponent and the track record so far, Daniels should be in line for his best game to date. Last year, Peyton Manning had three touchdowns to Julius Thomas (two) and Virgil Green in two games against the Raiders. View Profile
Charles Clay ARI • FB • 85 at TEN Projections WEEK 5 PROJECTION 4.2 Clay has been great the past three games with two touchdowns and two games with at least 82 receiving yards over that span. The highlight was Week 4 against the Giants with nine catches for 111 yards on 13 targets, and he had a 32-yard touchdown called back due to a penalty. With Watkins banged up, Taylor should continue to lean on Clay, and the Titans have allowed one big game to a tight end this season with Austin Seferian-Jenkins (23 Fantasy points) in Week 1. I picked Clay up in several leagues last week with Rob Gronkowski on a bye, but I still plan to use Clay as a flex option since he's playing well and has the chance for another solid game this week. View Profile
Antonio Gates (vs. PIT): Gates is back from his four-game suspension, and hopefully he's ready to go in what should be a favorable matchup. The Steelers have allowed two tight ends to catch at least five passes for 62 yards this season with Gronkowski in Week 1 and Vernon Davis in Week 2, and Gronkowski and Scott Chandler scored four touchdowns in that matchup. Gates has three games with double digits in Fantasy points in five career meetings with the Steelers, and he scored double digits in Fantasy points in two of his past five home games going back to last year. Rivers could lean on Gates this week with Steve Johnson and Floyd banged up.
Sleepers
Garrett Celek (at NYG): NYG have struggled with tight ends all season.
Delanie Walker (vs. BUF): Two tight ends have scored vs. BUF this year.
Richard Rodgers (vs. STL): Davante Adams being hurt makes Rodgers relevant.
Sit 'Em
Heath Miller PIT • TE • 83 at SD Projections WEEK 5 PROJECTION 2.92 Miller gets to face a Chargers defense that has allowed three touchdowns to opposing tight ends in the past four games, including Barnidge getting six catches for 75 yards and a touchdown in Week 4 on six targets. But Miller just hasn't been involved the past three games with a combined seven targets over that span for five catches, 33 yards and one touchdown against San Francisco, St. Louis and Baltimore. We'll see what his rapport will be with Michael Vick after extra time to prepare for this game, but I'm not sure Vick will lean on Miller in this game with Bryant back on the active roster. View Profile
Jared Cook NO • TE • 87 at GB Projections WEEK 5 PROJECTION 3.11 The Packers have been hit or miss in their tight end defense this season. Bennett scored a touchdown, and Travis Kelce had six catches for 80 yards, but Jimmy Graham was held to one catch for 11 yards. The Rams should be throwing a lot in this game while chasing points, but Cook has been a disappointment most of the season. He had eight Fantasy points in Week 1 against Seattle, but he's combined for six points over the past three games, with no touchdowns on the season. Cook might have a big game this week, but he'll do so on my bench. View Profile
Gary Barnidge CLE • TE • 82 at BAL Projections WEEK 5 PROJECTION 2.8 Barnidge has been great the past two games with 12 catches for 180 yards and two touchdowns on 16 targets against Oakland and San Diego, and he's become a go-to target for Josh McCown. We'll find out if he's legit or not in this matchup with the Ravens. Baltimore has limited Daniels, Eifert and Miller to three catches for 6 yards, although Eifert had a touchdown called back that should have counted. Going back to last year, only two tight ends reached double digits in Fantasy points against the Ravens, and Barnidge could be limited with his production in this matchup. View Profile
Coby Fleener NO • TE • 82 at HOU Projections WEEK 5 PROJECTION 3.17 I was excited about Fleener this week, but that was with Dwayne Allen expected to sit out again with an ankle injury. It appears like Allen will play Thursday night against the Texans, and that means Fleener will take a backseat in the offense. Fleener was great the past two games with 13 catches for 134 yards and a touchdown on 18 targets with Allen out, but Fleener had just one catch for 5 yards in the first two games when Allen was active. Factor in Andrew Luck (shoulder) playing at less than 100 percent and it's a dicey situation to trust Fleener in the majority of leagues. Now, if Allen is out, Fleener would be considered a Top 10 tight end against the Texans. View Profile
Defense/Special teams
Start 'Em
Bengals (vs. SEA): The Bengals DST was good but not great in Week 4 against the Chiefs. It failed to get an interception for the first time this season, but they did have a season-high five sacks against Alex Smith. This might seem like a surprise to see an opposing DST against the Seahawks, but Seattle has actually been a favorable matchup this year. Three teams have scored at least 10 Fantasy points against the Seahawks, who have scored 17 points or less as a team twice in their past three games. Wilson has been sacked six times twice this year and 18 times for the season, and the Bengals defense has nine sacks and three fumble recoveries in two home games.
Sleepers
Giants (vs. SF): SF allows the most Fantasy points to opposing DSTs.
Falcons (vs. WAS): A good flier based on their showing last week.
Jaguars (at TB): TB is No. 2 in Fantasy points allowed to opposing DSTs.
Sit 'Em
Rams (at GB): The Rams DST has been as advertised with three games of at least 12 Fantasy points in a standard league behind 17 sacks, three interceptions and three fumble recoveries. They just lost linebacker Alec Ogletree (leg) for the next eight weeks, which hurts, and playing the Packers in Green Bay won't help matters. The Packers allow the fewest Fantasy points to opposing DST units in large part due to Aaron Rodgers. He has no interceptions on the season and has been sacked just six times. Green Bay also averages 28 points per game this year, including 33 points at home in two games against the Seahawks and Chiefs. You might not want to drop the Rams DST in the majority of leagues, but you should consider other alternatives like the Giants, Falcons or Jaguars.
Kicker
Start 'Em
Cairo Santos (vs. CHI): This could be a scenario of chasing points since Santos just had a career game with seven field goals at Cincinnati in Week 4, including two made kicks of 50-plus yards, and prior to that game he made just four field goals in three games. But the Bears come into this matchup having allowed six made field goals in the past two games against Steven Hauschka and Sebastian Janikowski, and every opposing kicker has scored at least six Fantasy points against Chicago. Santos will likely have a similar game to his Week 1 outing at Houston with nine Fantasy points, but this is a good week to trust him after his outstanding performance in Week 4.
Sleepers
Josh Lambo (vs. PIT): PIT has allowed five field goals the past two games.
Caleb Sturgis (vs. NO): Three kickers have multiple field goals vs. NO.
Travis Coons (at BAL): Three kickers have multiple field goals vs. BAL.
Sit 'Em
Dan Carpenter (at TEN): If Carpenter makes a field goal against the Titans this week he'll be the first kicker to have a field goal against Tennessee this season. The Titans have allowed 11 extra points in three games but no field goal attempts, and they are the only team yet to allow a field goal this season. Carpenter also has two games with multiple field goals and two games with six Fantasy points or less. He did have 13 Fantasy points in his last road game, which was Week 3 at Miami, but last year he had just three games with multiple field goals on the road. His production could be minimal this week based on how Tennessee has done with opposing kickers so far.
Full Disclosure from Week 4
Week 4 ended up being a good week in this column, and I hit on many of the top guys at their respective positions. Andy Dalton also played well as the Start of the Week since he was the No. 11 Fantasy quarterback in standard leagues.
Including sleepers, I had the No. 1 quarterback in Philip Rivers, the Top 3 running backs in Devonta Freeman, Jeremy Hill and Chris Ivory, three Top 20 receivers in Amari Cooper, Keenan Allen and Pierre Garcon and three of the Top 4 tight ends in Martellus Bennett, Coby Fleener and Charles Clay. Bennett was the No. 1 tight end in Week 4.
Our bad calls were saying to start guys like Tyrod Taylor and Derek Carr at quarterback, and Melvin Gordon was a failure at running back. I also missed on benching Eli Manning, Doug Martin and Jeremy Maclin, and Todd Gurley was far from a bust alert at running back.
I did suggest benching Mike Evans, who struggled, but he should rebound this week in a more favorable matchup. |
news, local-news,
Ballarat has been named as a top travel destination by a prestigious tourism website, beating locations such as Melbourne, Sydney and the Gold Coast. Tourism website Experience Oz ranked Ballarat as number five in its top 10 major destinations list this week, talking up the city’s rich history and architecture. “Full of heritage both in its landmarks and architecture as a result of its early development during the Australian Gold Rush period, the city is large and brimming with examples of Victorian-era buildings that remain in top condition to this day,” its website read. “As a result of its strong gold mining heritage, a visit to Ballarat is akin in many ways to stepping back in time, and many history-oriented attractions that document the interesting and sometimes-tumultuous past of Ballarat to visitors can be experienced firsthand.” Mayor Samantha McIntosh was thrilled Ballarat was punching above its weight on a national stage. “What a spectacular position for a regional city to hold, ahead of many places you could imagine being positioned higher,” she said. “It’s not just about spruiking how great our city is, but it’s also good for business, hospitality, accommodation and venues.” Warmer destinations outranked Ballarat on Experience Oz’s list. The most popular major destination was the Whitsundays, followed by Mackay, the Kimberley, and Cairns. It comes after new figures show more than 789,000 people attended Sovereign Hill in 2015-16. Sovereign Hill chief executive Jeremy Johnson previously said the report’s figures showed the site was one of the largest tourist attractions in regional Victoria. Mr Johnson said it further confirmed its award-winning reputation as a magnet for new tourists to Ballarat.
https://nnimgt-a.akamaihd.net/transform/v1/crop/frm/34dXacDR8RguBkyLHxYXLhN/39e04411-bf89-4e35-8df0-a0363fc82fa9.JPG/r0_312_4256_2717_w1200_h678_fmax.jpg |
There is a Grassroots movement happening in schools. “Many teachers, schools, kura and Kāhui Ako are already making digital technologies learning part of their teaching programmes. This change to the national curriculum ensures that all learners get these experiences, to prepare them for a world where digital skills are increasingly valuable to the economy and wider society.”
The consultation session that I attended with my principal was run for principals, and school leaders including Kāhui Ako because the new addition to the national curriculum needs senior management understanding.
The goals for the session were to
Understand the nature of the DT|HM areas
Understand the various reasons it’s being offered.
See ways that we and our students might engage with it.
………. So we could provide information feedback.
Wendy and I were particularly interested in the session offered to all schools in Auckland because the official announcement in regards to the addition to the New Zealand Curriculum from Education Minister Nikki Kaye took place at Newmarket School on the 28th of June. That and because we both have strengths in Digital Technologies with a history of designing and developing digital outcomes for all our learners. We both believe that our pedagogy with digital technologies pedagogy is strong.
However what I found particularly fascinating was the way that both Tim and Hinerangi emphasised the importance of people and how they communicate. They both said the new curriculum was not about computers but was really about computational thinking. How the digital world interacts with the human world.
They both explained that DT|HM curriculum is about human need.
Some of the session focussed on unpacking computational thinking and looking at the technology dealing with digital technology using binary digits. But again there were no digital devices or digital technology used to push the concept of computational thinking. Instead both facilitators took us through basic activities to highlight the Progress Outcomes on Page 17 of the draft. There was a mention of Kāhui Ako and how as educators we need to develop understanding of transitioning so that we can help our learners as they move between the sectors. They stressed the importance of ensuring that our learners understood the why so that we can shift them from not just being consumers of digital technologies but to being creators.
Background and what we need to be know as educators
Digital technology Hangarau Matihiko is to be formally integrated into the NZ Curriculum. DTlHM is the first change to the NZ Curriculum since 2007. By 2018 the addition will be in schools. The subject will be fully integrated into the NZ Curriculum and Te Marautanga o Aotearoa by 2020.
What is DT|HM
DT|HM is about teaching students how technology works, and how they can use that knowledge to solve problems. This new curriculum will equip our learners for the increasingly digitalised workplace and society. This will keep New Zealand competitive. Schools will be teaching our young people the computer science principles that all digital technologies are built on. They will be teaching Computational Thinking for Digital Technologies. Computational thinking is when students will develop an understanding of computer science principles that underlie all digital technologies. They’ll learn core programming concepts so that they can become creators of digital technology, not just users.
They will be Designing and Developing Digital Outcomes (learning how to design quality, fit-for-purpose digital solutions) because more and more people need digital technology skills and knowledge to succeed, whether making robots, be a politician, or a farmer. DT|HM is so that our learners become conscious users of the systems.
Again and I repeat the message
DT|HM is not about computers but is about how the digital world interacts with the human world.
What exactly is Digital Technology
Digital Technology is any technology that operates algorithms and uses digits to send messages” a key is to include storage (e.g. a mobile phone can store music, photos and maps as digits, as well as send them). It is any technology that uses digits to store and send information and operates algorithms on them. (e.g. My Fitbit tracking my personal health.)
What impact might DT|HM have on teacher practice?
Many teachers, schools, kura and Kāhui Ako are already making digital technologies learning part of their teaching programmes. This change ensures that all learners get these experiences, to prepare them for a world where digital skills are increasingly valuable to the economy and wider society. Use and understanding of DT|HM can lead to exponential learning.
Positives and negatives of DT|HM
I believe the positives of the draft is the focus on humans and social interaction rather than the technology. I also really like that there is a separate one for Maori that incorporates Maori World View. However the challenge is developing teacher capabilities as fast as possible as there is a huge shortage in this area in schools. Therefore professional development needs to be put in place across the sector to teach teachers how to engage their students with the subject. There is a fabulous site to help teachers begin the process of developing understanding around Computational thinking. This is Computer Science Unplugged (CS Unplugged). Yet still schools must find ways of upskilling teachers.
Whose voice is not currently not being heard?
Currently Maori and Pasifika are under represented in studying Digital Technology and in having success in this field. However they are consumers and creators of digital technology and so it is important that they also have access in schools.
Computational thinking will be at the same level of importance as reading, writing and mathematics and will be part of NCEA.
Computational thinking is about getting our learners to think big but without using computers. In order to do this they must understand the concept of algorithms. That is how many steps does it take to solve a problem so attention to detail and being persistent are important strategies to learn. Algorithms have been around for a long time and the general principles will not change. What is important is that our children understand what is done to them. DT|HM is also that our children learn to create, think about other people, work with each other and develop spatial knowledge. We can do this by helping them to count, sequence, mix colours and develop spatial awareness. Diversity on the team must reflect the user.
We already know the jobs most likely to be exponentially affected by automation and as the saying goes, if teachers can be replaced by digital technologies then we should be.
So just to sum up.
Teachers need understanding to teach DT|HM especially in Computational Thinking and in designing and developing digital outcomes. DT|HM is not about computers but is about how the digital world interacts with the human world. DT|HM is not coming it is here and what is your school doing to ensure it is embedded in your learning by 2020?
As Kāhui Ako how do we ensure that our schools are ready for DT|HM and this is an area to consider when we update our achievement challenges because of its impact on learning.
Tidbits that were highlights for me.
Binary Code is still beyond me.
Computers search 1000,000,000,000 sites in 40 operations.
Cone cells in the fovea that detect colours only sees RBG.
Steganography is a a way of sending encoded messages. Here is a fabulous story explaining how.
Currently the Ministry of Education are consulting with leaders, teachers and whānau about the the Draft of this Curriculum. The consultation process will run until 3 September. They are particularly keen to hear from the education and technology sectors as well as parents, students and their whānau.
Feedback is welcomed and all submissions will be considered with a report back later this year, prior to the curriculum’s implementation in 2018.
4 thoughts on “Digital Technologies Hangarau Matihiko”
Really enjoyed your summary Sonya. I went to the North Akl one yesterday and found the presenters to be very clear about what the curriculum is and is not. Interesting to see the spectrum of reactions in the room, from “We need to recruit a DF teacher right now and get this on the timetable” (Secondary- and yes, we talked about it) all the way to “We’re doing this all already!”
It was the latter I challenged, very carefully. All of it? I know some incredible schools, doing amazing things who are not doing ALL of it… I’m hoping she’ll show me I’m wrong to question her! I wrote this yesterday…
“Catering for our digitally native students is not new. It has been a priority for many New Zealand teachers for several years and more recently has become a national priority via the Ministry. Much like the NZC, the current draft copy must not be interpreted as a set of learning intentions to be adhered to. It’s a broader more holistic approach to establishing digital fluency within today’s learners. It’s new, but it’s not really new. Many forward thinking schools have continued to push the boundaries of education and digital possibilities for years. The development of the DT & HM curriculum is simply a step towards helping others be and do more. Like the NZC it incorporates a strong ‘why’ and detailed explanations around the value we need to place in developing wider skillsets to meet the needs of both future employers and our current learners. It is not prescriptive nor is it a sequence of lessons or breakdown of modules to teach. Like every other learning area (both within and outside of the NZC), the intention is to use existing strengths within inquiry teaching and extend them using algorithmic and computational thinking. ”
I’m thinking I like your phrasing “DT|HM is not about computers but is about how the digital world interacts with the human world.” Can I quote you? Will reference back to here and happily link to an online profile 🙂 Tweet me or just send me a one liner if it’s okay.
Hi James, “DT|HM is not about computers but is about how the digital world interacts with the human world.” This phrase is what Tim said, so technically it is his quote. I will readjust my writing to say that. Tim also suggested I add to my definition of Digital Technologies so I have added his suggestion to make it clearer.
Eduignite Digital Tattoo
Eduignte: O Lau Malu
www.sonyavanschaijik.com
Follow me
About Me
Talofa lava, Kia Ora. My name is Sonya Van Schaijik . I am a teacher at Newmarket School in Auckland New Zealand. I am a mother of two grown sons and the caregiver of my parents in their winter years of life.
Recently I helped set up a curated blog site for New Zealand educators to share their learning. You can check that out here. www.edblognz.blogspot.com. Together with Nathaniel and Alex we monitor and maintain the site. |
Central Bureau of Investigation searched Jayanthi Natarajan's premises in Chennai on Saturday.
Highlights Former environment minister charged in corruption case filed by CBI
Accused of abusing powers to divert forest land for mining in 2012
Was minister between 2011-2013, quit Congress in 2015
CBI officials raided the Chennai home of ex-Congress leader Jayanthi Natarajan on Saturday.
Former environment minister Jayanthi Natarajan has been charged with corruption in a case filed by the Central Bureau of Investigation which raided her home in Chennai on Saturday. She has been accused of abusing her powers to divert forest land for a mining project in 2012 when she was the environment minister in the previous Congress-led coalition government.Ms Natarajan, 63, was environment minister between 2011 and 2013 in the Manmohan Singh-led UPA regime. She quit the Congress in 2015.Sources said Saturday's searches were carried out as a follow-up to a complaint registered by the agency that accused Ms Natarajan of clearing diversion of 55.79 hectares of forest land in Jharkhand's Singhbhum district for a mining project.Her predecessor Jairam Ramesh had rejected the proposal but after Ms Natarajan took charge in 2011, she approved it.The CBI complaint said Ms Natarajan had reversed Jairam Ramesh's decision "without any change in the circumstances after rejection". She had also ignored advice to seek approval from a committee of experts which had earlier rejected the proposal, violated environmental laws and went against the directions of the Supreme Court.Sources said the CBI has been probing multiple decisions taken by the ministry during her tenure. This is the first case where a formal complaint has been registered. The CBI has been inquiring into this case since 2014.Ms Natarajan, who was with the Congress for more than 30 years, quit the Congress in January 2015 with a scathing attack on party vice president Rahul Gandhi who she alleged, first instructed her to protect the environment and later publicly criticised her decisions ahead of the 2014 Lok Sabha elections to woo the industry.The Congress had then given it back to her, calling her statements a n "image bacchao andolan" (image-saving mission) , a reference to allegations of corruption at the environment ministry when she was in-charge. The Congress had added that Mr Natarajan appeared to be acting at the behest of "new political masters who may have got evidence against her".
She was also reported to have met BJP president Amit Shah before quitting the Congress to explore her options but the BJP leadership was not keen to induct Ms Natarajan. As the CBI's complaint reveals, the BJP was reportedly aware that her decisions were under the CBI's scrutiny.Ms Natarajan could not be contacted for her comments. |
(Newser) – A $12.9 billion aircraft carrier probably doesn't lack much, but the brand new Gerald R. Ford comes without one thing: urinals. The Navy Times reports on the surprising first, which came about following the decision to make every "head" gender-neutral. That will reportedly make it easier for the Navy to pivot and change the corresponding berthing area to housing female sailors versus male and vice versa as the makeup of deployments change. The decision to eliminate them from carriers was made in 2012, per a CNN piece published at the time, which noted urinal drain pipes are more likely to clog, increasing both maintenance costs and unpleasant odors.
Those are the pros. The cons, according to design experts, are that toilets eat up more space than urinals do and are much less sanitary. As one such expert explains, men are more likely to miss their mark in a toilet, meaning urine more likely to accumulate on the floor. But it's a done deal, regardless: President Trump commissioned the warship on Saturday in Norfolk, Virginia, but the AP reports deployment isn't nigh: Sea trials finished up in April, but a battery of at-sea tests and workups are next required and could take more than four years to finish. (In other bathroom news...)
|
With a footprint of only 735 x 855 mm and 7 trays, SNAKKY MAX allows a complete refreshment service offering a choice of snacks, confectionery, cans and bottles. As you would expect from Necta, the Snakky Max is the operator’s dream, as replenishing stocks couldn’t be simpler, with pull out trays which tilt to allow […]
Astro is the medium volume hot & cold drinks machine by Necta, which is based on the very popular Zenith and innovative Kikko models. Thanks to the new technical solutions, simple to use 18 direct selection buttons, standard Necta components and eye catching design, Astro offers remarkable performance for a machine in this market segment. […]
World Arabica and Robusta Coffee Production Converging Global production for 2014/15 is now forecast at 149.8 million bags, down 2.7 million from the previous year as lower output in Brazil, Peru, Indonesia, and Vietnam more than offsets gains in Central America and Colombia. World Arabica production is expected to decline a second consecutive year while […]
by United States Department of Agriculture, Foreign Agricultural Service 2014/15 Forecast Overview World coffee production for 2014/15 is forecast to decline 1.5 million bags from the previous year to 148.7 million due primarily to a weather related shortfall in Brazil. However, the reduction is expected to be partially offset by rebounding production in Colombia and […]
Release Date: April 19, 2006 NEW YORK AND LONDON, HARPER & BROTHERS PUBLISHERS, 1899 A story of what is happening when men who think themselves smarter than they are face off against a man who’s smarter than he seems. Set entirely in the dining room of a cheap boarding house, Coffee and Repartee chronicles the […] |
Q:
Ajax GET request failing
I have an ajax request as follows:
permissionRequestModel.showApprovers = function () {
$.ajax({
url: "http://ec6484646848compute-1.amazonaws.com/api/Request/permission?appid=1&opertype=requestor,
type: "GET",
contentType: "application/json",
dataType: "json",
error: function(){
alert("failed");
},
success: function (data) {
alert("Success");
}
});
};
which is failing, but the requested URL is returning the JSON response in the Rest Client on chrome properly. What am I doing wrong here?
A:
Are you having cross domain issues?
|
Foreigners figure high in rape statistics Threshold lower for women to report rapes by non-Finns
By Anu Partanen
Last Wednesday two black men raped a young woman in the Helsinki suburb of Malmi. The woman had been pushing her two-year-old
daughter in a buggy when the two men attacked her. The daughter sat in the buggy the whole time.
In the midst of all the summer news items about rapes, date-rapes, and attempted rapes, this particular story stopped people
in their tracks. A woman pushing a child in a stroller? Black-skinned men? Is NOTHING sacred to these people?
"Unless the perpetrators' intention
was to harm the child as well as the mother, they may simply not have been aware that interfering with a child in this way
or subjecting a child to witnessing sexual violence carries with it a powerful taboo in our culture", notes researcher Sari Näre.
Sociologist Näre has investigated both sexual violence and the sexual mores of different cultures. She, too, is at a loss
to explain the Malmi incident, but when asked she observes that the different cultural background of the two men may have influenced their actions.
"In some cultures, for instance, there are practices in initiation rites that would in our society be regarded as egregious
examples of the sexual abuse of a minor. Such practices include for instance the circumcision of young girls", says Näre.
Psychologist Niina Nurminen is responsible for a rehabilitation programme for convicted rapists that has been launched in Kuopio District Prison. Nurminen
knows a good deal about the way that a rapist's mind works. Can cultural background be a determining factor?
"Sex-related crimes
are always a question of the need to control and intimidate the victim. These acts can be explained in a number of ways,
and cultural background is just one factor in the equation. It does not of itself make anyone a rapist, but if the rapist
has grown up in a culture that accentuates or condones violent behaviour or male supremacy, then the background can come into
play."
In Uganda, for example, it has been estimated that as many as one in four schoolgirls has been the victim of rape. According
to Ugandan law rape can be a capital offence, but nevertheless it is the way of the world down there. John Karara - who achieved notoriety in Finland in the early 1990s after raping several women when he knew himself to be HIV-positive
- was from Uganda. On his release from prison he was deported back to Africa, despite his claims that the action was an infringement
of his human rights.
A rape committed by a foreigner
in this or any country can label all immigrants at a stroke. When some immigrant youths gang-raped a Swedish girl, anti-immigrant
feeling jumped upwards in opinion surveys, and we have also seen the damage done to the American forces' presence in Japan
by a number of similar cases involving soldiers and Japanese girls.
But the big question is: do foreigners really commit rape exceptionally often, or is it simply that more attention is paid
to their doings? Of the rape cases reported to the Finnish police, in some 8-10% of cases the assailant is shown to be a foreigner.
When the victims file their accusations, as many as 17% of the women involved believed the rapist to be of foreign extraction.
This is a pretty huge figure, given that there are only some 85,000 foreigners living in Finland, or just 1.65% of the population.
The figures do not tell the whole story, however. The police receive slightly fewer than 500 reports of rape annually, but
experts have estimated that the yearly total of rapes is in the thousands, perhaps even the tens of thousands of women. The
great majority of rapists are the Finnish relatives, friends, and acquaintances of Finnish victims, and crimes committed by
such persons are not generally reported to the police.
The helpline of a rape victim crisis centre
known as Tukinainen has recorded that around 6% of callers say that they were sexually assaulted by a foreigner. Considerably more of those women
attacked by foreigners have come forward and filed charges than those who were victims of the unwelcome attentions of Finnish
men.
"It may be that a Finnish woman regards it as more of a crime when the perpetrator is foreign. If the rapist is a Finn, the
woman might perhaps think more about her own role in what has happened", ponders Chief Inspector Kalle Kekomäki. Kekomäki has put together a Ministry of the Interior memorandum on violent crimes committed by foreigners in Finland during
1998. The statistics do not specify the individual nationalities of foreign rapists, since there is no wish to tar a particular
group with the rapist brush.
, one nationality has 5 or six rapes against its name, and in the other cases the numbers are restricted to one or two. Some
nationalities are conspicuous by their absence from the statistics: not even the police can recall having heard of rapists
hailing from Vietnam or China.
The victims and the crime-scenes of Finnish and foreign rapists differ from one another quite demonstrably: a Finnish man
is much more likely to rape someone known to him in the victim's own home, while foreigners attack either complete strangers
or a woman they have only just met, either outdoors or after an evening in a bar or restaurant.
Studies examining the emotional traumas caused to victims indicate that rape by a fellow Finn can be an even worse experience,
since the victim is left with deeper wounds when the perpetrator is either closer or more familiar, and not a complete stranger.
The victims of rape by foreigners
are more often young girls than mature women. Young women are more likely to go off with a man either straight off the
street or after a liquid evening in a restaurant, and according to Sari Näre's studies, some 12% of women between 10 and 20
years of age have met their assailant only shortly before the attack. Of these cases, a substantial number - 40% - feature
a foreigner in the rapist role.
So why is it that a foreign man assaults his female company like this at the end of a short acquaintance that has begun in
congenial circumstances? "In many cultures a woman would never go off with a man in this way on their first meeting", notes
Näre. "In this country, the relationship between the sexes is based to a large degree on trust, on the trust that the woman
has that the man can control his desires. In societies where the difference between the sexes is accentuated, the time and
the place are stronger determining factors for the way in which a man interprets a woman's sexual willingness or motives."
A foreigner in such circumstances might think that if a woman is prepared to accompany a man to his apartment in the middle
of the night, the woman herself is responsible for what happens next. The man considers the time and the place and does not
listen to the woman's actual message.
A man coming from a strikingly different culture
may view a woman through the filter of his own culture - and in so doing may misinterpret the signals totally. Sari Näre
has for instance heard that in Turkey some men take the view that a circumcised male can satisfy a woman better than a man
who is uncircumcised. "A man who thinks in this fashion might draw the conclusion that a woman who is scantily and alluringly
dressed is looking for casual sex, because the uncircumcised man or men in her life have not been able to satisfy her."
It can even be that the rapist imagines he is satisfying the woman's needs and doing her a favour, however much she might
appear not to appreciate his attentions.
In war-zones
, women belonging to "the enemy" are constantly being raped somewhere around the world. Even if there is no state of war as
such, the rapist may believe himself to be at war. Näre cites the example of Black Panther leader Eldridge Cleaver: "Cleaver raped white women and only after he was incarcerated in prison for it did he come to interpret his actions as a
means of opposing the supremacy of the white male. He regarded woman as objects and rape as a political weapon", she says.
A man who finds himself the underdog in society can work out his aggression through subjecting a woman.
More often, however, a foreign man mistreats women in cultures that he believes to be intrinsically inferior to his own. It
is a well-known though not very palatable fact that Finnish men are among those who engage in sex tourism to places like Thailand,
or buy sex from children just over the Russian border in Sortavala, even if they would not dream of doing such things here
in Finland.
The callers to the rape victims' helpline
include immigrant women who have been raped by a Finnish man. "Some female immigrants have said that Finnish men treat them
with no respect whatsoever and simply assume their sexual needs will automatically be met. Some of these women have reported
that they find they unwittingly fit the bill of Finnish males' sexual fantasies", says Riitta Rajas, one of the helpers at Tukinainen.
Sari Näre points out that some men who have moved here from abroad are used to seeing blonde and fair-skinned women only
in the pages of porno magazines. "If you live in a culture in which all the respectable women - those who have a standing
in society - are dark, and where blonde women only show up in porno mags or as gorgeous pouting pin-ups in the tabloids, as
is the case in a country like Turkey, well, this can quite easily affect attitudes."
Here in Finland
people are horrified about the behaviour of foreigners and the things that happen in countries such as Uganda, but Sari Näre
is not slow to point the finger at the Finns themselves: "We should not forget that rapes within marriage have been "acceptable"
right up to just a decade ago. Rape as a crime is still in a class by itself, in which the victim is discriminated against,
demeaned, and has precious few rights. Nobody could say that women are well-protected even here." |
Q:
How do I change the ACLs on a registry key? (C++)
I need to delete a regsitry key. It has a deny ACL on Set Value (I need this permission to delete it).
How do I change the ACLs in C++?
A:
You could use RegSetKeySecurity to adjust the security settings and then delete the key as usual.
|
namespace ClassLib094
{
public class Class014
{
public static string Property => "ClassLib094";
}
}
|
Below the bowels of the Daley Center courthouse, in an office where the website lists one address next to a photo of the building across the street, a man in a uniform sits behind a desk shuttling incomers by their business.
Marriage, go this way. Birth and death, go this way. He shunts people to lines marked with barricades connected by ribbons made of seatbelt fabric and, when people complain about the $15 fee, reminds them how much worse it could be.
“In Wisconsin, it’s $25,” the man said over his shoulder to the line. “New York? $40.”
Whistles, groans, “hmmm” and “dang” rustled through the crowd as we waited for our turn at the front.
We live in public records. Every move, every mailing address or traffic ticket, every time we stand in front of a state official or rabbi and say we’re never going to split up and every birth, death and divorce is charted, quantified and kept on file for decades to come.
My task was a happy one, but personal. When I was called up as next, I stood next to a phone-flicking woman and a giggling, happy baby who turned unprovoked a moment later into wails and shrieks, as babies do. The new person’s records obtained, the woman made way for a stout, fussy white man in a suit seeking access to the death certificate of his client.
A woman behind the desk typed at breakneck or at least breaknail speeds. She never looked at me, just took my request, information, confirmation, signature, payment, signature and copies with machine efficiency. I could have asked for birth, death, life, marriage and it all would have been the same as the clock clicked on and the line advanced.
What is more life than this? What is more a symbol of our existence than this life under fluorescence in the office of the only local government official running a tight ship? Our loves and births are kept here. Our deaths and new humans.
We’re kept under fluorescent light in the bowels of government buildings. Behind barricades and ribbons we wait in line for a chance to pay $15 for a certified official copy of ourselves. |
Do physicians correctly estimate radiation risks from medical imaging?
Proper use of medical imaging tools requires knowledge of their associated radiation risks, as well as their possible benefits. The authors assessed physicians' knowledge of the radiation risks associated with bone scintigraphy (bone scan) during an annual meeting of the Israeli Orthopedic Society. The mortality risk of radiation-induced carcinoma from bone scan was identified correctly by less than 5% of respondents. The most frequent answer (38.4%) was the option that was least correct. Senior orthopedists estimated lower risks than did residents. Overall, respondents grossly underestimated the potential radiation risk from bone scan. |
I'm workin' on it, OKAY??
It’s only Monday, but WHAT A WEEK IT’S ALREADY BEEN! The Legend of Korra pilot episode was leaked online (amazing, by the way), the Hunger Games film comes out in two days at midnight (going to see it in IMAX, of course ), and now the reviews are pouring in for the film! And they are extremely positive thusfar! I must be honest, I was pretty worried about the film. I just [still] don’t completely understand how the novels can be adapted successfully. However, I have finally let out a sigh of relief *sigh*. In fact, as of now on Rotten Tomatoes, the film has 100%! Granted, not all the reviews are in yet, but below you will find some snippets from reviews across the interwebz!
“The Hunger Games, a vision of human life in all its nasty, brutish brevity demands to be devoured… The Hunger Games is an essential science fiction film for our times; perhaps the essential science fiction film of our times. Whatever your age, it demands to be devoured.”– Robbie Collin – Daily Telegraph
“the camera does mostly cling to Katniss, requiring a Herculean amount of heavy lifting from Lawrence. She bears the load. Stoical or heart-on-sleeve, afraid or defiant, the starlet hits the mark. Factor in archery skills to make Robin Hood soil his Lincoln greens and you have Katniss as Collins intended.”
– Total Film
“The Hunger Games is enthralling from beginning to end, science fiction that has depth and intelligence to match its pulse-racing entertainment value.”
– Digital Spy
Interestingly:
“Ross has done more than churn out a faithful adaptation of the book. His vision of the world of The Hunger Games is bigger, scarier, darker, and more political than the books ever dared to be.”
–Den of Geek
I think we all know what scene this is:
“The most moving scene in the book becomes the moving scene in the film.”
–Total Film
For those who compare it to Twilight:
“What’s remarkable is the lack of cheese. Tacky effects, corny dialogue and creaky performances are all shown the door. We repeat: not the new Twilight.”
–Total Film
I will be with you all Thursday night — 11:59 PM SHARP — at theaters across the country, ready and giddy to experience The Hunger Games as we’ve been waiting to see it for what can only be textually described (in non-hyperbolic terms) as “an eternity!!”
Here’s Gale looking at Katniss during one of their wilderness excursions. While the trailer does indicate the film will follow the book very closely, they have to trim or change some things to fit the time. We just have to accept it. The book lists and mentions several of their excursions outside the fence which introduce important story elements. I’d bet Lionsgate combines some of the excursions into one, or else introduces plot points in other areas of the story. My worry about Gale is the fact Liam Hemsworth is playing him. He did a Miley Cyrus movie before this, for crying out loud. I hope he can actually act worth Read the rest of this entry »
I’m back from my posting break!! I’ve got a new computer, other new hardware, and a new passion to… POST THINGS! Yes, it’s true. And there’s been a lot of new Hunger Games info that I need to keep everyone updated on. Yep. Because I’m the only source of Hunger Games news, after all! Now down to business…
There’s only one thing that’s important today. TONIGHT AT THE MTV VMAs A PROMO FOR THE HUNGER GAMES MOVIE WILL BE SHOWN! Yes, you read that right. Tonight (Sunday, August 28) at 9/8c Jennifer Lawrence will make an appearance at the VMA’s, where she will introduce the promo for the film. This is awesome news!
I know this isn’t exactly a “new” shot of Jennifer Lawrence as Katniss, but man is it cool. Still my favorite of all the shots thus released. Katniss is such a great character, I really hope the team is able to translate her depth well. So I thought I’d share it with everyone!
Sam Jack Seal of Approval.
In other news I missed this photo from yesterday’s EW Hunger Games bonanza. It’s probably my favorite of the Peeta pictures so far. I especially dig it because it reminds me a bit of LOST. The way the quote in the picture is worded is a little bit silly. I’m trying to imagine someone saying it over and over in my head and it makes me smirk. |
A Kentucky sheriff who refused to enforce any new gun laws that he deemed unconstitutional says that the Second Amendment is "like the Bible" because "you either believe it or you don't."
In a recent interview with The Lexington Herald-Leader, Jackson County Sheriff Denny Peyman said that he had a "moral obligation" to defy any new executive orders from President Barack Obama or laws passed by Congress if they restricted the Constitutional right to bear arms.
"I swore an oath to the Constitution," Peyman explained to Fox News host Greta Van Susteren on Monday. "And in the Constitution is the Second Amendment and that's what this country is based upon. How can I rightfully in my own mind and in my heart come in and take guns away from people when that is their protection?"
Susteren asked the sheriff, who is a member of the National Rifle Association (NRA), how gun laws should be changed to prevent another mass shooting like the one that killed 20 children in Newtown, Connecticut.
"If you take out part -- it's kind of like the Bible -- either you believe it or you don't believe it," he insisted. "The Constitution, either you believe it or you don't. Either you live by it or you don't."
"If the people in the theater [in Aurora, Colorado], if there had been somebody in there or several people in there with a firearm, how many people would have got shot? In the school, how many people would have got shot?"
Susteren pressed Peyman on what he would do "put the lid on some of these incidents" if he were president.
"The Secondment Amendment, the way it was designed was to protect the people," he replied. "In protection, it's just like if I'm a bad guy and I'm going to go kick a door but I know that the guy behind that door has a gun, and I go to this other door where I know a guy doesn't have a gun, that's the door I'm going to kick."
"You're still going to have incidences, you're still going to have violence. You're not going to be able to curb that, but the innocent people are going to be able to protect themselves." |
Launch of Student Digital Learning Hub
by joeshortt
The transition year Digital Champions team has developed a website called the Student Digital Learning Hub. The purpose of the website and the accompanying Android app is to provide information for all students in our school about digital technologies and resources which will help them with learning.
This project is also designed to support the introduction of an ePortfolio solution in the school. The ePortfolio solution will be introduced in Transition Year and the team for this project is made up of transition year students. The Digital Learning Hub site uses the same platform (Google Sites) as the ePortfolio solution. The site will give information and advice from a student perspective on how to build an ePortfolio. The team is currently doing a pilot of eportfolio using Google Sites and their advice will be helpful to other students in the future.
The team has built the site and Android app and are now promoting them. They will also, enable others to collaborate in adding content. The rationale is to give students a voice in promoting digital technologies in learning at our school and to collaborate in building a community of practice among students in effective use of technology in learning. |
In the Garden:Lower South
March, 2006
Regional Report
Container citrus are decorative additions to an outdoor area, and their fragrant blooms and edible fruits are a bonus.
A Time and Place for Messin' Around
We've all heard the rules about landscaping and gardening. Landscapes should be created using proper design techniques, color combinations, balance, texture, etc. Vegetable gardens have their prescribed order, with productivity in mind. The list goes on.
Well, while I certainly appreciate the purpose and logic behind all such directions, I must say that I have a need for some space where I just do what I want without concern for all the aforementioned stuff.
The "Out Back"
I have an area "out back" where I just play and experiment. Plants set there are subject to being moved at a whim in the not-to-distant future. There is no real concern for aesthetics, although I find the eclectic amalgam of evolving horticulture to be quite interesting.
My space is an Etch-A-Sketch, where I can create and then wipe the slate clean and start over if I like. It's just for messin' around.
I may try a new way to grow or trellis a tomato, or plant something out of season to see if I can make it work. You know how we gardeners are forever drawn to some new plant we don't have? There is seldom a place in the ordered landscape for such spontaneous acquisitions. But there's always room in my space out back.
Star performers in this play area may get promoted to the landscape. New ideas that work get a shot at the real garden. But the space is not just a laboratory, it's an escape.
Contemplative Mowing and Watering
Can you relate to the therapeutic benefits of spending an hour walking behind a lawn mower turning a shaggy lawn into a perfectly trimmed patch? The drone of the mower drowns out all but your daydreams. A lot can be accomplished in an hour behind a mower!
At the end of a long day, the end of a water hose is another favorite destination for me. I know all the reasons why squirting water from a hose is not the best way to water, But whether I'm sprinkling a container of something I just propagated (you know, a plant I saw and just had to have) or a patch of turf that needs a little drink, it's winding-down time.
Give me a trickling garden hose and I'll squat down beside a rose bush and get some real thinking done while watching the water soak in, sending creatures scurrying out of the mulch to escape the flood.
In my outdoor playspace there are plenty of clumps of blooming herbs and flowers. Give me a glass of iced tea and I'll find a spot to just plop down and watch. You'd be amazed at how much garden life you miss on a normal stroll through the garden. Sit still and some small hover flies and tiny parasitoid wasps will show up for their sip of energy from a small flower's nectar. Move a little mulch and you may find a colorful metallic ground beetle in search of prey.
There is plenty of room for proper design and real landscape work; plenty of space for creating beauty and producing bounty. But we all need some space just for messin' around -- kind of like an adult outdoor romper room for playing and relaxing. This is my horticultural therapy. |
Introduction
============
The human leukocyte antigen (*HLA*) region accounts for approximately one half of the genetic risk of rheumatoid arthritis (RA). This risk is attributable to alleles encoding a conserved amino acid sequence in the third hypervariable region of the *DRB1*chain (commonly referred to as the *shared epitope*\[*SE*\]) \[[@B1]\]. Recent efforts have examined the importance of interactions of *SE*with other genetic and environmental factors in RA risk and progression. Most notably, studies have yielded evidence of significant interactions between *SE*and cigarette smoking in the development of anticitrullinated protein antibody (ACPA)-positive RA \[[@B2],[@B3]\], although the precise mechanisms underpinning this interaction are not understood.
Genetic and environmental factors that mediate oxidative stress, including cigarette smoking, are postulated to play a central role in the pathogenesis of autoimmune disorders including RA. While oxidative stress represents a form of host defense, it can also result in tissue damage. Oxidative modification of proteins and other biologic molecules leads to the expression of neoantigens, a possible first step in the development of autoimmunity, which may herald the future onset of clinically relevant autoimmune disease \[[@B4]\]. Antioxidants, which mitigate tissue damage caused by reactive oxygen species, may serve important protective functions in RA. While not all studies have identified a similar protective effect \[[@B4],[@B5]\], the dietary intake of small-molecule antioxidants has been reported to be inversely associated with RA risk \[[@B6]-[@B9]\]. Additionally, low circulating levels of antioxidants have been reported to portend the onset of RA \[[@B10]\].
In addition to the effects of exogenous antioxidants, oxidation is also regulated by several enzymes, including glutathione *S*-transferase (GST). A ubiquitous cytosolic protein, GST catalyzes the conjugation of glutathione to a variety of substrates, including reactive oxygen species and other toxins, facilitating their elimination. Four classes of GST have been identified: α, μ, π and θ. Approximately one half of all individuals of European ancestry are homozygous for a deletion at the *GST Mu-1*(*GSTM1*) locus (*GSTM1-null*) \[[@B11]\] located on chromosome 1 (1p13.1).
The *GSTM1-null*genotype has been associated with an increased risk of RA and in most \[[@B12]-[@B14]\] but not all \[[@B15]\] case control studies. In addition to being implicated as a potential risk factor in RA, the *GSTM1-null*genotype is associated with higher levels of oxidative stress \[[@B16]\] and has been reported to be a risk factor for other smoking-related inflammatory diseases, including asthma, emphysema and atherosclerosis \[[@B17]-[@B21]\]. However, there have been no studies examining associations of *GSTM1*genotypes with ACPA expression in patients with RA. This represents an important knowledge gap, since these antibodies are disease-specific, have significant prognostic and pathogenic significance and are increasingly recognized to characterize a unique subset of patients with RA \[[@B22],[@B23]\]. In the present study, we have evaluated potential gene-gene interactions by exploring the *GSTM1*-null genotype as a risk factor for ACPA positivity in RA, providing evidence of an interaction with *HLA-DRB1 shared epitope (SE)*-containing alleles.
Materials and methods
=====================
Study subjects
--------------
All study subjects satisfied the American College of Rheumatology (ACR) criteria for RA \[[@B24]\] and were from two U.S. cohorts: the Veterans Affairs Rheumatoid Arthritis (VARA) registry \[[@B25]\] and the Study of New-Onset Rheumatoid Arthritis (SONORA) \[[@B26]\]. To limit population heterogeneity, analyses were limited to individuals self-reporting Caucasian race for whom banked samples and *HLA-DRB1*data were available.
VARA is a multicenter registry with sites at nine VA medical centers in Brooklyn, NY; Dallas, TX; Denver, CO; Iowa City, IA; Jackson, MS; Omaha, NE; Portland, OR; Salt Lake City, UT; and Washington, DC. The registry has Institutional Review Board approval at each site, and patients provided informed written consent. Patients are eligible if they are U.S. Department of Veterans Affairs (VA) beneficiaries. SONORA includes patients with recent-onset RA enrolled within 12 months of diagnosis as part of a 5-year prospective follow-up study \[[@B26]\]. SONORA patients were recruited from 98 rheumatology practices in the U.S. and Canada, and all participants provided informed written consent. Variables abstracted from the corresponding data sets included age, gender and smoking status (never, former, or current). Smoking status in both cohorts was obtained using questionnaires reflecting exposure at the time of enrollment. Quantitative measures of smoking (pack-years and duration) were not routinely collected.
Anticitrullinated protein antibody (ACPA)
-----------------------------------------
Serum ACPA (immunoglobulin G (IgG)) was measured using second-generation enzyme-linked immunosorbent assays (ELISAs) in VARA (Diastat, Axis-Shield Diagnostics Ltd., Dundee, Scotland, UK; positive ≥5 U/ml) and SONORA (Inova Diagnostics, San Diego, CA, USA; positive ≥20 U/ml) using serum samples collected at enrollment.
Determination of *GSTM1*genotype
--------------------------------
Primers \"G2\" and \"G3\" from a study by Brockmöller *et al*. \[[@B27]\] were used to amplify exons 3 through 5 of the *GSTM1*gene using genomic DNA that was prepared from whole blood. These primers produce a 650-bp amplified fragment in individuals carrying at least one functional *GSTM1*allele. This band is absent in *GSTM1-null*individuals because this mutation deletes exons 4 and 5. A 195-bp fragment of exon 7 of the *CYP1a1*gene was used as an internal positive control for sample quality and polymerase chain reaction (PCR) using the primers described by Shields *et al*. \[[@B28]\]. Amplified products were resolved by electrophoresis through 1% agarose gels. Genotypes were scored independently by two investigators (KAG and KKB). On the basis of the empiric evidence for associations of this genotype across multiple conditions \[[@B17],[@B29]-[@B31]\], individuals were categorized as *GSTM1-null*(homozygous for deletion) or *GSTM1-present*(one or two copies of functional allele). Individuals with an absent or faint *CYP1a1*band (*n*= 8 from VARA and *n*= 25 from SONORA) were excluded from further analyses, leaving available data from 703 VARA individuals and 610 SONORA participants for analysis.
Determination of *HLA-DRB1*genotypes
------------------------------------
In VARA, *HLA*genotyping was performed using one of two approaches: DNA sequencing of exon 2 using the AlleleSEQR HLA-DRB1 reagent kit and protocol (Abbott Molecular, Abbott Park, IL, USA) or with a PCR-based, sequence-specific oligonucleotide probe system. In the second of these methods, a series of oligonucleotide probes corresponding to known sequence motifs in *HLA*-*DRB1*were immobilized onto a backed nylon membrane to create a \"linear array.\" Exon 2 of *DRB1*was amplified with a set of upstream biotinylated PCR primers corresponding to known sequence motifs in the first variable region of *DRB1*and a single downstream biotinylated PCR primer that amplifies all alleles. This method specifically amplified only *DRB1*genes and avoided amplification of other *DRB*genes. The PCR product was denatured and hybridized to the 81-probe *DRB1*linear array. Arrays were incubated with streptavidin-horseradish peroxidase followed by tetramethylbenzidine. Images were created by placing the arrays on a flatbed scanner, and probe intensities were measured with proprietary software. Preliminary genotypes were determined, and data were then imported into Sequence Compilation and Rearrangement Evaluation software (SCORE(tm), QIAGEN, Valencia, CA, USA) for final genotyping and data export. The following were considered to be *DRB1 shared epitope*(*SE)*-containing alleles: *\*0101, \*0102, \*0104, \*0105, \*0401, \*0404, \*0405, \*0408, \*0409, \*1001, \*1402*and *\*1406*.
In SONORA, all participants were *HLA-DRB1*-typed as previously described \[[@B32]\] initially using the sequence-specific oligonucleotide probes (SSOP) low-resolution method \[[@B33]\]. Individuals with DRB1 \*04 and \*01 were subsequently tested using a medium-resolution panel to allow for four-digit DRB1 subtyping.
Statistical analyses
--------------------
Associations of the *GSTM1-null*genotype with ACPA positivity were examined for each RA cohort using multivariate unconditional logistic regression. All analyses were adjusted for age (continuous variable) and gender to facilitate comparisons across the two divergent patient cohorts that differed based on these factors. Associations of *HLA-DRB1 SE*(positive vs. negative in addition to the number of *SE*alleles, 0 vs. 1 or 2) and smoking status modeled as ever versus never (and as current or former vs. never in a separate model) with ACPA positivity were also examined in separate analyses. Patients were then categorized on the basis of the presence of risk factor pairings (*GSTM1*-SE, *GSTM1*-smoking and smoking-*SE*), and associations of these risk factor assignments with outcomes were examined using similar regression techniques.
Gene-gene (*GSTM1-SE*) and gene-environment (*GSTM1-*smoking and *SE*-smoking) interactions were assessed with regard to ACPA positivity by examining for evidence of departure from additivity using the methods described by Rothman *et al*. \[[@B34]\]. Three-way interactions were not examined. Using this approach, an attributable proportion (AP) due to interaction (AP = 0 corresponds to no interaction, and AP = 1.0 corresponds to \"complete\" additive interaction) and 95% confidence intervals (CIs) were calculated, using the method of Hosmer and Lemeshow \[[@B35]\] to calculate the latter. The confidence interval serves as a statistical test of the interaction; if the null value (zero in this case) falls outside the interval, then the interaction is considered statistically significant. This method accounts for both the random variability and overlapping intervals in strata defined by the risk factors of interest \[[@B35]\]. Evidence of multiplicative interaction was examined by modeling the product term of interest. To optimize study power, assessments of interaction were limited to dichotomous variables (*SE-positive*vs. *SE-negative*, ever vs. never smoking) and to two-way interactions. All analyses were conducted using Stata version 10.0 software (Stata Corp., College Station, TX, USA).
Results
=======
Patient characteristics
-----------------------
Patient characteristics are summarized in Table [1](#T1){ref-type="table"}. Consistent with the demographic characteristics of VA beneficiaries nationally \[[@B36]\], VARA registry patients were predominantly men (93%) with a mean (± SD) age of 64 (± 11) years. In contrast, SONORA patients were younger, with a mean (SD) age of 53 (± 15) years, and were predominantly women (72%). A majority of patients were seropositive for ACPA (76% in VARA Registry and 69% in SONORA).
######
Characteristics of rheumatoid arthritis study patients^a^
Mean (SD) or number (%)
------------------------- ------------------------- ------------
Sociodemographics
Age, yr^b^ 64 (11) 53 (15)
Male gender^b^ 655 (93%) 173 (28%)
ACPA-positive^b^ 536 (76%) 420 (69%)
RA risk factors
*HLA-DRB1 SE*-positive 531 (76%) 434 (71%)
One copy 356 (51%) 303 (50%)
Two copies 175 (25%) 131 (21%)
*GSTM1-null* 372 (53%) 315 (52%)
Smoking history^b^ (*n*= 693) (*n*= 610)
Never 140 (20%) 213 (35%)
Former 371 (54%) 257 (42%)
Current 182 (26%) 141 (23%)
^a^ACPA, anticitrullinated protein antibody; *GSTM1, glutathione S-transferase Mu-1*; *SE, shared epitope*; SONORA, Study of New-Onset RA; VARA, Veterans Affairs Rheumatoid Arthritis Registry. ^b^*P*\< 0.05 for differences between VARA and SONORA.
Risk factor prevalence
----------------------
The frequency of RA-related risk factors is shown in Table [1](#T1){ref-type="table"}. The prevalence of at least one *HLA*-*DRB1 SE*-containing allele was similar in the VARA Registry (76%) and SONORA (71%) (*P*= NS). Approximately one half of patients (53% in the VARA Registry and 52% in SONORA) were *GSTM1-null*(*P*= NS), and a majority had a history of smoking, either current or former (80% in the VARA Registry and 65% in SONORA; *P*\< 0.05).
Age- and gender-adjusted associations
-------------------------------------
Associations of *GSTM1*, smoking, and *HLA-DRB1*status with ACPA positivity in the VARA registry and SONORA are summarized in Table [2](#T2){ref-type="table"}. In reference to patients with at least one functional *GSTM1*allele, *GSTM1-null*was associated with a significantly higher odds ratio (OR) of ACPA positivity in the VARA Registry (OR, 1.45; 95% CI, 1.02 to 2.05), but not in SONORA (OR, 1.00; 95% CI, 0.71 to 1.42). There was a significant dose-related association of *HLA-DRB1 SE*with ACPA positivity in both cohorts, with more than 10-fold greater odds of ACPA positivity for those with 2 *SE*alleles compared with those with no *SE*allele (Table [2](#T2){ref-type="table"}). In both cohorts, there were nonsignificant trends suggesting associations of current (vs. never) smoking with ACPA positivity, an effect that appeared to be more striking in the VARA registry (OR, 1.68; 95% CI, 0.98 to 2.88) than in SONORA (OR, 1.23; 95% CI, 0.76 to 1.99) (Table [2](#T2){ref-type="table"}). Age- and gender-adjusted associations of composite risk factors with ACPA positivity are summarized in Table [3](#T3){ref-type="table"}.
######
Association of GSTM1-null, HLA-DRB1 shared epitope (SE) and smoking with ACPA positivity in rheumatoid arthritis^a^
VARA (*n*= 703) SONORA (*n*= 610)
----------------------------------- ----------------- ----------------------- ---------- ---- ----------------------- ----------
*GSTM1-present* 73 *Ref*. \- 69 *Ref*. \-
*GSTM1-null* 79 1.45 (1.02 to 2.05) 0.039 69 1.00 (0.71 to 1.42) 0.981
Never smoking 69 *Ref*. \- 69 *Ref*. \-
Ever smoking 78 1.48 (0.97 to 2.26) 0.067 68 0.90 (0.62 to 1.30) 0.574
Former smoking 77 1.41 (0.91 to 2.19) 0.129 65 0.77 (0.52 to 1.14) 0.193
Current smoking 81 1.68 (0.98 to 2.88) 0.059 74 1.23 (0.76 to 1.99) 0.407
*SE-negative* 53 *Ref*. \- 54 *Ref*. \-
*SE-positive*(one or two alleles) 84 4.36 (2.98 to 6.37) \< 0.001 75 2.56 (1.77 to 3.70) \< 0.001
*SE-positive*(one allele) 79 3.23 (2.17 to 4.81) \< 0.001 68 1.77 (1.21 to 2.60) 0.003
*SE-positive*(two alleles) 93 10.65 (5.61 to 20.20) \< 0.001 92 10.27 (5.05 to 20.89) \< 0.001
^a^ACPA, anticitrullinated protein antibody; CI, confidence interval; *GSTM1*, *glutathione S-transferase Mu-1*; OR, odds ratio; *SE*, *shared epitope*; SONORA, Study of New-Onset Rheumatoid Arthritis; VARA, Veterans Affairs Rheumatoid Arthritis Registry. All analyses are age- and gender-adjusted. \"*Ref.*\" = referent group in each analysis.
######
Associations of composite risk factors with ACPA positivity in patients with rheumatoid arthritis^a^
VARA (*n*= 703) SONORA (*n*= 610)
-------------------- --------------------------- --------------------------- ---------- ---- --------------------- -------
*GSTM1*/*SE*^a,b^
Present/Negative 50 *Ref*. \- 59 *Ref*. \-
Null/Negative 56 1.26 (0.68 to 2.33) 0.456 48 0.63 (0.35 to 1.15) 0.135
Present/Positive 79 3.65 (2.09 to 6.40) \< 0.001 72 1.79 (1.05 to 3.03) 0.032
Null/Positive 88 7.30 (4.01 to 13.29) \< 0.001 77 2.29 (1.34 to 3.90) 0.002
AP = 0.46 (0.20 to 0.73) AP = 0.38 (0.00 to 0.76)
*P*~add~\< 0.001 *P*~add~= 0.050
*P*~mult~= 0.246 *P*~mult~= 0.063
*GSTM1*/Smoking^a^
Present/Never 67 *Ref*. \- 72 *Ref*. \-
Present/Ever 75 1.42 (0.80 to 2.52) 0.227 67 0.72 (0.42 to 1.22) 0.223
Null/Never 72 1.35 (0.65 to 2.79) 0.421 67 0.75 (0.42 to 1.36) 0.349
Null/Ever 81 2.01 (1.13 to 3.55) 0.017 70 0.83 (0.49 to 1.42) 0.502
AP = 0.12 (-1.41 to 1.65) AP = 0.44 (-0.28 to 1.15)
*P*~add~= 0.881 *P*~add~= 0.231
*P*~mult~= 0.917 *P*~mult~= 0.245
*SE*/Smoking^a^
Negative/Never 55 *Ref*. \- 58 *Ref*. \-
Negative/Ever 53 0.90 (0.40 to 1.99) 0.788 51 0.73 (0.39 to 1.37) 0.329
Positive/Never 73 2.24 (0.97 to 5.16) 0.058 74 2.03 (1.08 to 3.82) 0.027
Positive/Ever 87 5.05 (2.31 to 11.05) \< 0.001 75 2.10 (1.17 to 3.78) 0.013
AP = 0.58 (0.31 to 0.85) AP = 0.16 (-0.34 to 0.66)
*P*~add~\< 0.001 *P*~add~= 0.530
*P*~mult~= 0.054 *P*~mult~= 0.380
^a^ACPA, anticitrullinated protein antibody; AP, attributable proportion; *GSTM1, glutathione S-transferase Mu-1*; *SE*, shared epitope; SONORA, Study of New-Onset Rheumatoid Arthritis; VARA, Veterans Affairs Rheumatoid Arthritis. All analyses are age- and gender-adjusted. ^b^Corresponding ORs and 95% for *GSTM1/SE*composite risk after further adjustment for ever smoking in VARA: Null/Negative OR = 1.22 (0.66 to 2.27); Present/Positive OR = 3.75 (2.13 to 6.59); Null/Positive OR = 7.34 (4.02 to 13.34); in SONORA, Null/Negative OR = 0.65 (0.36 to 1.18); Present/Positive OR = 1.80 (1.06 to 3.06); Null/Positive OR = 2.31 (1.36 to 3.95). \"*Ref.*\" = referent group in each analysis.
*SE-GSTM1*interactions
----------------------
In the VARA registry, there was significant additive interaction between *SE*and *GSTM1*status (AP, 0.46; 95% CI, 0.20 to 0.73; *P*\< 0.001), an interaction that was evident, albeit of borderline significance, in SONORA (AP, 0.38; 95% CI, 0.00 to 0.76; *P*= 0.050). There was no evidence of a multiplicative *SE-GSTM1*interaction in the VARA registry (*P*= 0.25), although the *P*value of the product term approached significance in SONORA (*P*= 0.06) (Table [3](#T3){ref-type="table"}). These results were not changed for either cohort after further adjustments for cigarette smoking (Table [3](#T3){ref-type="table"}).
In exploratory analyses stratified by *SE*dose (0, 1 or 2 copies) rather than *SE*positivity, there were marked differences in the associations of composite risk factors of *GSTM1*status and *SE*dose with ACPA positivity. Compared to individuals lacking both risk factors, *SE*homozygotes carrying the *GSTM1-null*genotype were \~28-fold more likely to be ACPA-positive in the VARA registry (OR, 28.50; 95% CI, 8.21 to 98.87) (Figure [1](#F1){ref-type="fig"}) and \~21-fold more likely to be ACPA-positive in SONORA (OR, 21.04; 95% CI, 4.82 to 91.75) (Figure [2](#F2){ref-type="fig"}).
{#F1}
{#F2}
*GSTM1*-smoking and *SE*-smoking interactions
---------------------------------------------
There were no significant additive or multiplicative interactions between *GSTM1*status and smoking for ACPA positivity in either cohort (Table [3](#T3){ref-type="table"}). In contrast, there was a significant additive interaction between *SE*positivity and ever smoking in the VARA registry, accounting for more than 50% of the overall risk of ACPA positivity in *SE*-positive smokers (AP, 0.58; 95% CI, 0.31 to 0.85; *P*\< 0.001); there was also a nonsignificant trend to suggest multiplicative interaction (*P*= 0.054). Consistent with prior reports in SONORA \[[@B37]\], we observed no evidence of additive or multiplicative interactions between *SE*and ever smoking referent to ACPA positivity in this cohort. To explore the effect of smoking categorization on this finding, these analyses were repeated to examine for evidence of interaction between *SE*and current smoking (vs. never and former smoking combined). In these analyses, there was significant additive interaction between *SE*and current smoking (AP, 0.47; 95% CI, 0.13 to 0.82; *P*= 0.008), but no evidence of multiplicative interaction (*P*= 0.153) (data not shown).
Discussion
==========
Associations of *glutathione S-transferase*polymorphisms with RA have been the subject of several other investigations \[[@B12]-[@B15],[@B38],[@B39]\], although none of these have examined the association of *GSTM1*status with ACPA-positive disease. This study is the first to show that the *GSTM1-null*genotype, present in approximately one half of all individuals of European ancestry, shows a significant biologic interaction with *HLA-DRB1 SE*-containing alleles with reference to the risk of ACPA positivity in RA. This is noteworthy, given the disease specificity (\> 95%) of ACPA and the association of worse long-term outcomes in RA with ACPA seropositivity \[[@B22],[@B23]\]. These results show that patients with both genetic risk factors (*HLA-DRB1 SE*and *GSTM1-null*) are two to seven times more likely to be ACPA-positive than patients lacking both risk factors. Furthermore, \~40% to 50% of the \"excess\" risk in this group is directly attributable to gene-gene interaction, an interaction that appears to be independent of smoking status. It is important to note that the magnitude of this interaction is similar to that previously reported to exist between *HLA-DRB1 SE*positivity and smoking \[[@B2],[@B3]\]. The potential generalizability of these findings is further bolstered by its replication in two widely divergent RA cohorts: one composed primarily of men with long-standing disease and the other including primarily women with early-onset disease. These data are an important addition to studies showing significant additive interactions between *SE*and ever smoking in the risk of ACPA-positive RA \[[@B2],[@B3]\]. Our results support the hypothesis that an oxidative environment promoted through the absence of functional *GSTM1*enzyme potently enhances the risk of ACPA positivity in RA conferred by the presence of *HLA-DRB1 SE*.
Oxidative stress plays a pathogenic role in other autoimmune and inflammatory conditions, including systemic lupus erythematosus (SLE), scleroderma, diabetes and atherosclerosis \[[@B40]\]. Compared to those with functional *GSTM1*, individuals with the *GSTM1-null*genotype appear to be more prone to have increased levels of oxidative stress following exposure to select toxins \[[@B41]\]. Oxidation of nucleotides by reactive oxygen species increases the immunogenicity of DNA in SLE, generating autoantigens with significantly higher affinity for circulating autoantibodies \[[@B42]\]. In addition to modifying DNA and lipids, oxidative stress promotes the formation of neoantigens through posttranslational peptide modification. Bang *et al*. \[[@B43]\] have shown that oxidation of citrullinated vimentin, implicated as an autoantigen in RA, leads to substantially increased antibody reactivity to this antigen in RA.
Our results complement the prior findings of Klareskog *et al*. \[[@B2]\], who reported that patients who had ever smoked and were homozygous for *SE*were 21 times more likely to develop ACPA-positive RA compared to *SE-negative*patients who had never smoked. Results from the Swedish case control study \[[@B2]\] differed from an analysis of three North American cohorts including SONORA \[[@B37]\], which found no evidence of interaction between *SE*and ever smoking in SONORA and only weak evidence of interaction in one of the two other cohorts examined. In these two other cohorts, but not in SONORA, ever smoking showed a borderline association with ACPA positivity with ORs approaching 1.4 \[[@B37]\]. Although it was not statistically significant, we found a similar association of ever smoking with ACPA positivity in the VARA registry with an OR of 1.48, suggesting that our study was underpowered to detect this association because of the relatively small proportion of never smokers in the VARA Registry.
Differences in these reports (and differences between the VARA registry and SONORA) could relate to population heterogeneity, including differences in gender distribution and cumulative smoking exposure. Compared to women, men have been shown to have a higher penetrance of *HLA-DRB1*\[[@B44]\], are more likely to smoke and (among smokers) are more likely to be categorized as heavy smokers \[[@B45]\]. Differences in smoking exposure may be salient here, given findings from a separate North American study showing that *SE*-smoking interactions in the risk of seropositive RA (a combined rheumatoid factor (RF)/ACPA-positive phenotype) were limited to individuals with heavy smoking (\> 10 pack-years) \[[@B46]\]. The importance of quantifying cumulative smoking exposure has also recently been shown among African Americans with RA risk limited to those with more than 10 pack-years of exposure \[[@B47]\]. Cumulative smoking exposure was not available in the present study involving the VARA registry and SONORA, precluding such analyses. Underscoring the potential importance of accounting for cumulative exposure, we observed significant *SE*-smoking interactions in SONORA when smoking exposure was dichotomized as current vs. noncurrent rather than ever vs. never, with the \"current\" category likely to account for individuals with greater lifelong smoking exposure.
These results differ from a prior study showing significant multiplicative interactions between *GSTM1-null*status and smoking in RA disease risk \[[@B12]\], an effort that did not include examinations of *GSTM1-SE*interactions. In the present study, we found no evidence of significant interaction (multiplicative or additive) between *GSTM1-null*and smoking in ACPA positivity, a phenotype that was not examined in the prior nested case control analysis from the Iowa Women\'s Health Study \[[@B12]\]. It is possible that in the present study we simply lacked sufficient power to detect this interaction. Differences in study design (case only vs. case control) and study populations (smoking prevalence and predominantly male vs. female patients) may also help explain these discrepant study results.
Controversy and uncertainty remain regarding the most appropriate manner in which to model gene-gene and gene-environment interactions \[[@B48]\]. In contrast to prior studies that have examined smoking-*SE*interactions in RA risk by calculating only measures of additive interaction \[[@B2],[@B49]\], we have examined measures of both additive and multiplicative interaction. Multiplicative interaction refers to the inclusion of a product term in regression analyses to generate an optimal fit of the data in the statistical model. It is important to note that the absence of multiplicative interaction does not exclude the existence of important biologic interactions. For example, the present study shows that at least one pathway to ACPA positivity in RA requires the presence of two risk factors (that is, *GSTM1-null*and *HLA-DRB1 SE*).
Although they involved two large independent cohorts, our analyses were limited to two-way interactions. We lacked the sample sizes even after combining cohorts that would be necessary to examine more complex interactions, including analyses of *GSTM1-SE*stratified by smoking status. Future analyses of this sort with larger patient populations will be essential not only in replicating our findings but also in providing critical insight into mechanisms underpinning these observed interactions. Although this study included a case-only approach, ACPA positivity is increasingly recognized as a distinct disease phenotype in RA. Indeed, the well-defined associations of cigarette smoking and *HLA-DRB1 SE*with RA in European populations apply only to ACPA-positive disease and do not apply to seronegative disease \[[@B2]\]. Because of the limited sample sizes in subgroups of interest, our study did not include analyses of interactions of distinct *HLA-DRB1*subtypes with *GSTM1*. Recent findings have shown that different \**01*and \**04*subtypes appear to contribute equally to *SE*-smoking interactions in ACPA-positive RA \[[@B50]\], suggesting that analyses of specific *SE*subtypes may yield limited incremental information.
Conclusions
===========
The *GSTM1-null genotype*, observed in approximately 50% of individuals of European ancestry, shows significant interactions with *HLA-DRB1 SE*alleles in ACPA positivity among patients with RA. Future studies will be needed to explore precisely how *GSTM1*and other antioxidant enzymes influence disease expression in RA. Along with other recent reports, this work emphasizes the need for the simultaneous investigation of multiple genetic and environmental factors to better understand the pathogenic contributions of these elements to the development and progression of RA with potential application to other autoimmune diseases.
Abbreviations
=============
ACPA: anticitrullinated protein antibody; ACR: American College of Rheumatology; AP: attributable proportion; CI: confidence interval; CYP1a1: cytochrome p450 1a1; GSTM1: *glutathione S-transferase Mu-1*; HLA: human leukocyte antigen; OR: odds ratio; PCR: polymerase chain reaction; RA: rheumatoid arthritis; SE: *shared epitope*; SLE: systemic lupus erythematosus; SONORA: Study of New-Onset Rheumatoid Arthritis; SSOP: specific oligonucleotide probes; VA: Veterans Affairs; VARA: Veterans Affairs Rheumatoid Arthritis.
Competing interests
===================
The authors declare that they have no competing interests.
Authors\' contributions
=======================
TRM was involved in all aspects of study conception, design, analysis, interpretation and report generation and provided final approval of the version of the submitted manuscript. TRM had full access to all of the study data and had final responsibility for the decision to submit the manuscript. SLB, LH, PKG, JAN, FY, KAG, TDLV, GMT, KDM, JRO\'D, AMR, RH, LC, DSJ, GK, JSR, GWC and KKB were involved in data acquisition, analysis and report drafting and provided final approval of the submitted manuscript. LAC was involved in data interpretation and report generation and also provided final approval of the submitted manuscript draft.
Acknowledgements
================
This work was funded by a grant from the National Institutes of Health/National Institute of Arthritis and Musculoskeletal and Skin Diseases (grant R03 AR054539). The VARA Registry has received research support from the Health Services Research & Development (HSR&D) Program of the Veterans Health Administration (VHA) in addition to unrestricted research funds from Abbott Laboratories and Bristol-Myers Squibb. Dr Mikuls receives research support from the VHA (VA Merit) and the American College of Rheumatology Research and Education Foundation. The authors thank Debra Bergman and Bart Hamilton for their assistance in this work and the many U.S. veterans who have generously participated in this research.
|
Play2 support 0.4.0
By Scala IDE team on Aug 03 2013
The Scala IDE team is happy to announce the 0.4.0 release of the Play2 support plugin in Scala IDE for Eclipse!
This release features a brand new editor for Play2 Template files that integrates with the Eclipse Web Tools Platform to provide a first-class HTML editing experience. The highlights of the new editor are:
In addition to Web Tools integration, the Play2 template parser has been rewritten. As a result:
Editor performance has been greatly improved
Code completion now properly works in all cases
Several types of Template parse errors will be displayed with as-you-type source validation
This new Template editor sports a new icon and is now the default editor for all Template files. The old Template editor still exists (using the original icon), and can be accessed by right-clicking on a template file in the Project Explore, and selecting Open With -> Template Editor. |
EXCLUSIVE: Now that the launch of Super 8 is behind him, JJ Abrams is moving toward a commitment to direct Star Trek 2. But just as Deadline has been telling you, there’s no way that he’ll be able to make the June 29, 2012 release date that Paramount carved out for the film. I’m told that the studio will give that slot to G.I. Joe: Retaliation, the sequel that will be directed by Jon M. Chu and stars Channing Tatum, Dwayne Johnson and Adrianne Palicki, with Lorenzo di Bonaventura producing.
Abrams has just returned from vacation and is hunkering down with writers Roberto Orci, Alex Kurtzman and Damon Lindelof to work on the Trek script and beginning prep for a Trek sequel that will likely begin production in January and either be dated for release for the fourth quarter of 2012 or summer 2013. Abrams hasn’t formally committed and hasn’t approved a script yet, but the studio has exercised its option on the cast and they will be ready when Abrams is. All this means that Chris Pine will definitely play Captain Kirk before he reboots Jack Ryan for the same studio. That project, with script by Adam Cozad, was in the process of getting a rewrite from David Koepp. All of this falls into the scenario that was described for Deadline in late May when the writers admitted they had a 70-page outline, some 13 months before the film’s release. |
Everyone knows a turtle when he sees one. Turtles are easy to recognize by their shells. A baby turtle is born with a shell just the right size for its body. As the turtle grows, its shell grows too.
The hard shells of most turtles are made up of a “bony box” covered by horny plates. A turtle can’t crawl out of its shell. The shell makes up much of a turtle’s skeleton, and is firmly attached to its body. Turtles are well-protected by their shells. Some turtles, such as the box turtle, can pull their heads, tails, and legs into their shell when frightened. Then, very few enemies can get at them.
All turtles hatch from eggs. The mother turtle lays the eggs in a hole she has dug. She then leaves them. The sun’s warmth hatches the eggs in about two months. As soon as the baby turtles are hatched, they are on their own. They must be able to tend for themselves. – Dick Rogers
A starfish is a star-shaped animal that lives on the bottom of the sea in bays and shallow water. Starfish eat clams and other shellfish by pulling the shells apart and pushing their stomach into the shells to digest the food.
Starfish have a peculiar way of eating. The common starfish feeds mostly on shellfish, it especially likes to eat clams, oysters, and mussels.
To open a clam shell, the starfish wraps its arms around it. Under each arm are rows of tube like feet that stick to the shell like suction cups. The starfish then pulls the two section of the clam’s shell assist with its powerful arms.
A starfish’s mouth is under its body. As soon as a starfish has pulled open the clam, it opens its mouth, turns it stomach inside out and pushes it inside the clam’s shell and digests the clam’s soft body.
Once the meat is finished, the starfish pulls back its stomach, leaving only an empty clam shell behind. Most starfish have five arms, but some have seven arms or more. If a starfish loose an arm, it can grow another. – Dick Rogers |
[Study of acetylsalicylic acid role in the potentiation of antiamnesic and neuroprotective properties of piracetam in rats with alloxan diabetes].
It has been established that prolonged alloxan-induced hyperglycemia in rats potentiates amnesic properties of scopolamine hydrobromide. It was characterized by shortening of the latent period by 44% (p<0,01) and by 47,7% (p<0,05) after 24 hours and on the 20th day of conditioned passive avoidance test. This effect was accompanied by increase in oxidative modification of proteins and nitric oxide synthesis in the cerebral cortex. Along with this, a significant enhancement of ADP- and collagen-induced platelet aggregation was observed. These processes may play the leading role in the development of cognitive deficit in diabetes. Meanwhile, co-administration of piracetam with acetylsalicylic acid was accompanied by an expressed antiamnetic potential - the reduction of early markers of proteins degradation (aldehydephenylhydrazones, APH) by 21,7% (p<0,05) and late markers of proteins degradation (ketonephenylhydrazones, KPH) by 23,8% (p<0,001) was noted. This combination was 15,7% (p<0,05) more active than piracetam according to the effect upon KPH. NO2-/NO3- level was also decreased by 30,3% (p<0,05) in comparison with alloxan-diabetic rats. The significant anti-platelet effect was observed: degree of collagen-induced platelet aggregation was reduced by 56,8% (p<0,01), ADP (5 μmol/l)-induced - by 31,7% (p<0,01), ADP (20 μmol/l)-induced - by 47,3% (p<0,01) as compared to the hyperglycemic rats. Such an increase in nootropic activity of piracetam may be assumed to be directly related to the ability of acetylsalicylic acid to improve microcirculation in the ischemic areas of the brain in diabetes and probably to its neuroprotective potential. |
/**
* The safe-mode layout
*
* Copyright (C) 2010-2011 Nikolay Nemshilov
*/
var RightJS = (function(window, src) {
// premassaging the source code, swapping the document reference where needed
src = src
// the default document to the current one
.replace(',document,', ',parent.document,')
// building the inside types conversion methods
+ 'RightJS.$N=function(v){return new Number(v)};'
+ 'RightJS.$S=function(v){return new String(v)}';
// building the frame sandbox
var frame_id = '__rightjs_condom', document = window.document;
if ('attachEvent' in window) {
document.write('<iframe name="'+ frame_id +'" style="display:none"></iframe>');
} else {
var frame = document.createElement('iframe');
frame.name = frame_id;
frame.style.display = 'none';
document.documentElement.appendChild(frame);
}
// puttin the code into the frame
var win = window.frames[frame_id];
if ('execScript' in win) {
win.execScript(src);
} else {
var doc = win.document;
doc.open();doc.write('<html></html>'); doc.close();
var script = document.createElement('script');
script.text = src;
doc.body.appendChild(script);
}
// transferring the object references from the sandbox into local variable
var RightJS = win.RightJS;
RightJS.context = win;
RightJS.safe = true;
// building the access and types conversion proxy
var proxy = function(value) {
switch (typeof value) {
case 'number': return RightJS.$N(value);
case 'string': return RightJS.$S(value);
case 'function': return RightJS.$ext(value, RightJS.Function.Methods);
case 'object':
if (RightJS.isArray(value))
return RightJS.$A(value);
}
return value;
};
return RightJS.$ext(proxy, RightJS);
})(window, %{source_code});
|
A computer model to analyze the cost-effectiveness of hormone replacement therapy.
This paper gives a detailed presentation of a computer model for evaluating the cost-effectiveness (CE) of hormone replacement therapy (HRT), describing the model's design, structure, and data requirements. The model needs data specified for costs, quality of life, risks, and mortality rates. As an illustration, the CE of HRT in Sweden is calculated. Two treatment strategies are evaluated for asymptomatic women: estrogen-only therapy and estrogen combined with a progestin. The model produces similar results compared with earlier studies. The CE ratios improve with the size of the risk reduction and generally with age. Further, estrogen-only therapy is associated with a lower cost per gained effectiveness unit compared with combined therapy. Uncertainty surrounding the long-term effects of HRT means that the CE estimates should be interpreted carefully. The model permits the inclusion of indirect costs and costs in added life-years, allowing the analysis to be made from a societal perspective, which is an improvement relative to previous studies. |
Lucy May’s Cafe is a friendly relaxed Cafe in Korumburra. We also have an outdoor Garden which seats 30. Two kinds of Coffee (a Strong and a Smooth) Ever changing Menu…. All Food is Handmade and freshly baked daily… Open 8am – 4pm – 7 days a week Finger Food Catering Available Check out our […]
Company owners, Jackie and Mick Parsons, divide their time between Italy and Australia and are passionate about the walking, the food and the wine of both countries. The philosophy behind all Hedonistic Hiking tours is to provide a truly authentic encounter with the country and its people. This encompasses where you stay, what you eat, […] |
NM Supreme Court Set to Hear Marriage Equality Case
After eight of the 33 counties in New Mexico started issuing marriage licenses to same-sex couples this year, the state's Supreme Court agreed on Friday to hear a gay marriage case, deciding whether or not marriage equality should be legal throughout the entire state, NBCNews reports.
The high court will hear debates on gay marriage on Oct. 23, after New Mexico's debate on marriage equality has gained national attention. Currently, the state does not recognize any form of same-sex relationships, such as civil unions or domestic partnerships. New Mexico does, however, provide benefits to same-sex partners of state employees.
The five justices of the state's Supreme Court previously refused to rule on the gay marriage issue, saying they wanted the lower courts to decide on marriage equality. In August, a district judge in Santa Fe ruled that New Mexico's ban on same-sex marriage was unconstitutional and ordered a local government clerk to issue marriage licenses to same-sex couples. Just a few days later, a district judge in Bernalillo Country, N.M., which includes Albuquerque, also ruled that same-sex couples should have the right to marry. In total, eight counties allow same-sex couples to marry. On Sept. 4, the northern county of Los Alamos was the latest county to do so.
"Anytime two people get to exercise their freedom for their first time, that's important. That's what is important to our clients," Brian Egolf, a Democratic state legislator and Santa Fe lawyer for the couple, told the Associated Press.
The 33 county clerks in New Mexico, joined by the New Mexico Association of Counties, have petitioned the state's Supreme Court to rule on the issue and decide if marriage equality should be applied to the entire state.
Unsurprisingly, New Mexico's Republican lawmakers are fighting back and have filed a lawsuit against a Dona Ana Country clerk who led the way by acting independently and handed out marriage licenses to same-sex couples in August.
"I think it's excellent," state Rep. Anna Crook, a Republican from the town of Clovis, one of 29 lawmakers who have so far joined the lawsuit in Dona Ana County, told NBCNews. "It's been absolute chaos. We need to have a ruling one way or the other instead of 'my county can, yours can't.'"
Officials from the American Civil Liberties Union, who are representing couples from Bernalillo County in the case, said gay rights supporters hope that the Supreme Court's announcement to rule on marriage equality "will lead to a speedy decision establishing the freedom to marry for all same-sex couples in New Mexico." |
Modern French Architecture Smorgasbord Of Styles In Architecture Modern Architecture French Churches
modern french architecture smorgasbord of styles in architecture modern architecture french churches.
modern french chateau style custom home design bunch interior residential architecture famous colonial,famous modern french architecture country homes classic,modern french country architecture luxury homes plans style post,suburbs modern architecture detail stock french country famous post,modern architecture french churches country this is it circle courtyard style homes,modern french style homes sustainable architecture in now provincial chateau,post modern french architecture provincial style connecting three historic dwellings with a extension,modern french architecture homes tower in suburb stock photo image of churches style home plans,modern french style homes architecture 4 designed stock photo residential,famous modern french architecture homes country one story houses style chateau. |
Hillary Clinton Refuses to Comment on Spitzer’s Sex Scandal
Hillary Clinton is refusing comment on New York Democrat governor, and Hillary Clinton super delegate, Eliot Spitzer’s admitted frequenting of a prostitute. This seems to be a situation that Hillary has somehow found her way into many, many times over her years in public life. Her “experience” must tell her not to comment on this situation.
But Spitzer’s prostitution bust goes much deeper than just hiring a prostitute. He may be charged with federal crimes for wiring money across state lines for use in an illegal activity. This is far more serious than prostitution.
I find it amusing that Hillary is going to sit idly by and not denounce what Spitzer has done. Clinton has been bashing Barack Obama for his ties to Tony Rezko, who this week went on trial for money laundering, conveniently forgetting that she has ties to Rezko also.
Now one of her committed, soon to be incarcerated, super delegates is in serious trouble with the Feds, and she doesn’t feel the need to distance herself from him. Doesn’t she feel as though Spitzer should step down? Does she think this is a fire-able offence? Does she condone it by not calling for his resignation?
Her silence leads to these questions. Voters need to know that she thinks this is not acceptable behavior. Or does she?
The double standard continues. |
{
"essn": "1613-978X",
"issn": "0043-6275",
"last_updated": "2019-06-17T13:54:43.850633+02:00",
"publisher": "springer_verlag",
"title": "Wirtschaftsdienst"
}
|
The Pentagon has affirmed it intends to make a determination on the transgender military ban this spring after the conclusion this month of an internal six-month review.
Matthew Allen, a Pentagon spokesperson, said Defense Secretary Ashton Carter will make a decision at that time in response to a Washington Blade inquiry this week for an update on the review.
“The transgender working group appointed by the secretary of defense will conclude its deliberations by the end of January and present its findings and recommendations directly to the secretary soon thereafter,” Allen said. “The secretary will take whatever time he needs to analyze, evaluate, and discuss the Working Group’s findings with his immediate staff and the senior leadership of the department. We do, however, anticipate a final decision from the secretary sometime in the spring.”
In July, Carter announced the Pentagon would undertake a review of transgender military service, which is currently banned as a result of medical regulation. At the time, Carter said the review would be conducted under the presumption the policy would be changed. In an attempt to limit transgender discharges, the secretary also directed that all separations of troops for gender identity would be handled by a senior civilian official.
According to the Pentagon, the working group’s recommendations will address accessions, retention, transition and medical care for transgender service members and potential applicants to the armed forces.
Although the Pentagon is set to complete its report by the end of the January, Allen indicated no part of the report will be officially made public until the final policy determination is made.
“Materials from the working group will be released only after the secretary makes a final decision and has determined what is appropriate for public release,” Allen said.
Media reports last year indicated the Pentagon was set to lift the trans ban on May 27, but Allen disavowed that was the target date, even with the expectation of a spring decision.
“Any end to the current prohibition on accessing transgender persons, or their open service in the military services, will be informed by the working group’s recommendations and final decisions made by the secretary of defense,” Allen said.
Aaron Belkin, director of the Palm Center, said the only determination Carter could make based on available data is lifting the ban on transgender service.
“If the new DOD policy is based on the successful experiences of our allies who allow transgender personnel to serve, and on the scientific consensus of the the American Medical Association and retired Surgeons General that there is no medically valid reason to exclude transgender individuals from military service, then I believe that full repeal will take place and implementation will be successful,” he said. |
INSERT IGNORE INTO category (ID, title, parentID) VALUES (3060, 'Foreign', 3000);
INSERT IGNORE INTO category (ID, title, parentID) VALUES (8060, 'Foreign', 8000);
UPDATE `site` set `value` = '40' where `setting` = 'sqlpatch';
|
The first ambulatory screening on thromboembolism: a multicentre, cross-sectional, observational study on risk factors for venous thromboembolism.
To assess the prevalence of risk factors for venous thromboembolism (VTE) and the prevalence of recent (<1 year) VTE [including superficial vein thrombosis (SVT), deep vein thrombosis (DVT) and pulmonary embolism (PE)] amongst patients attending general practitioner (GP) surgeries. Multicentre, cross-sectional, observational study. A total of 1536 GP surgeries. A total of 15 180 adult, co-operative subjects, who had consulted their GP for a health disorder and signed the informed consent form. None. Prevalence of known VTE risk factors graded according to importance and prevalence of recent (<1 year) VTE events (including SVT), based on interviews. About 1:5 patients had at least one strong risk factor and about 1:20 had at least two risk factors, with no difference between sexes. The prevalence of strong risk factors increased with age. Most were related to medical conditions: history of SVT and/or DVT/PE, heart failure and malignancy. About 3:4 women and 2:3 men had at least one moderate to weak risk factor; nearly 1:2 women and 1:3 men had at least two moderate to weak risk factors. The most common were: history of VTE, smoking, history of miscarriage, estrogen therapy, obesity, and varicose veins. Overall, 80% women and 67% men had at least one risk factor, and 50% women and 35% men had at least two risk factors. The prevalence of recent (<1 year) VTE was 3.4% in women and 2.4% in men, and increased with age. The majority of cases were SVT in both sexes (2.5% in women and 1.5% in men). The prevalence of risk factors for VTE amongst patients attending GP surgeries is high. GPs should bear this in mind during their daily practice. |
Q:
Problem when linking out to separate file within foreach loop
I'm customizing my theme's category template to display the current category's child categories instead of the posts from that category.
The category template links to another template file (content-grid.php) which generates the dynamic post/category content.
The only way I can get it to work is by combining all the code together on the category template.
This is the original category template:
<?php
/**
* The template for displaying category archive pages.
*
* @link https://codex.wordpress.org/Template_Hierarchy
*
* @package Codilight_Lite
*/
get_header(); ?>
<div id="content" class="site-content container <?php echo codilight_lite_sidebar_position(); ?>">
<div class="content-inside">
<div id="primary" class="content-area">
<main id="main" class="site-main" role="main">
<?php
if ( have_posts() ) : $count = 0; ?>
<header class="page-header">
<?php
the_archive_title( '<h1 class="page-title">', '</h1>' );
the_archive_description( '<div class="taxonomy-description">', '</div>' );
?>
</header><!-- .page-header -->
<?php
$layout_archive_posts = get_theme_mod( 'layout_archive_posts', 'grid' );
if ( $layout_archive_posts == 'grid' ) {
echo '<div class="block1 block1_grid">';
echo '<div class="row">';
while ( have_posts() ) : the_post();
$count++;
get_template_part( 'template-parts/content-grid' );
if ( $count % 2 == 0 ) {
echo '</div>';
echo '<div class="row">';
}
endwhile;
echo '</div>';
echo '</div>';
codilight_lite_custom_paginate();
} else {
echo '<div class="block1 block1_list">';
while ( have_posts() ) : the_post();
get_template_part( 'template-parts/content-list' );
endwhile;
codilight_lite_custom_paginate();
echo '</div>';
}
?>
<?php else : ?>
<?php get_template_part( 'template-parts/content', 'none' ); ?>
<?php endif; ?>
</main><!-- #main -->
</div><!-- #primary -->
<?php get_sidebar(); ?>
<?php get_footer(); ?>
...and this is the content-grid.php template file:
<?php
/**
* Template part for displaying posts with grid style.
*
* @link https://codex.wordpress.org/Template_Hierarchy
*
* @package Codilight_Lite
*/
?>
<article id="post-<?php the_ID(); ?>" <?php post_class( 'col-md-6 col-sm-12' ); ?>>
<div class="entry-thumb">
<a href="<?php echo esc_url( get_permalink() ); ?>" title="<?php the_title(); ?>">
<?php
if ( has_post_thumbnail( ) ) {
the_post_thumbnail( 'codilight_lite_block_2_medium' );
} else {
echo '<img alt="'. esc_html( get_the_title() ) .'" src="'. esc_url( get_template_directory_uri() . '/assets/images/blank325_170.png' ) .'">';
}
?>
</a>
<?php
$category = get_the_category();
if($category[0]){
echo '<a class="entry-category" href="'.get_category_link($category[0]->term_id ).'">'.$category[0]->cat_name.'</a>';
}
?>
</div>
<div class="entry-detail">
<header class="entry-header">
<?php the_title( sprintf( '<h2 class="entry-title"><a href="%s" rel="bookmark">', esc_url( get_permalink() ) ), '</a></h2>' ); ?>
<?php if ( 'post' === get_post_type() ) codilight_lite_meta_1();?>
</header><!-- .entry-header -->
<div class="entry-excerpt">
<?php echo codilight_lite_excerpt(120); ?>
</div><!-- .entry-content -->
</div>
</article><!-- #post-## -->
...and now for the customized category template file:
<?php
/**
* Category Template: Custom
*/
get_header(); ?>
<div id="content" class="site-content container <?php echo codilight_lite_sidebar_position(); ?>">
<div class="content-inside">
<div id="primary" class="content-area">
<main id="main" class="site-main" role="main">
<?php
$cat = get_category( get_query_var( 'cat' ) );
$cat_id = $cat->cat_ID;
$child_categories=get_categories(
array(
'parent' => $cat_id,
// Uncomment the below line if you want empty category to appear on the list.
// 'hide_empty' => 0
)
);
if (!empty($child_categories)) : $count = 0; ?>
<header class="page-header">
<?php
the_archive_title( '<h1 class="page-title">', '</h1>' );
the_archive_description( '<div class="taxonomy-description">', '</div>' );
?>
</header><!-- .page-header -->
<?php
echo '<div class="block1 block1_grid">';
echo '<div class="row">';
foreach ( $child_categories as $child ){ $count++;
get_template_part( 'template-parts/content-grid' );
if ( $count % 2 == 0 ) {
echo '</div>';
echo '<div class="row">';
}
}
echo '</div>';
echo '</div>';
?>
<?php else : ?>
<?php get_template_part( 'template-parts/content', 'none' ); ?>
<?php endif; ?>
</main><!-- #main -->
</div><!-- #primary -->
<?php get_sidebar(); ?>
<?php get_footer(); ?>
...and the customized content-grid.php template file:
<?php
/**
* Template part for displaying posts with grid style.
*
* @link https://codex.wordpress.org/Template_Hierarchy
*
* @package Codilight_Lite
*/
?>
<article id="" class="col-md-6 col-sm-12">
<div class="entry-thumb">
<a href="<?php echo get_category_link( $child->cat_ID ); ?>" title="<?php echo $child ->cat_name;?>">
<?php $image_url = z_taxonomy_image_url($child->term_id); ?>
<?php if (!empty($image_url)) : ?>
<img alt="" src="<?php if (function_exists('z_taxonomy_image_url')) echo z_taxonomy_image_url($child->term_id);?>" />
<?php else: ?>
<img alt="" src="<?php echo esc_url( get_template_directory_uri() . '/assets/images/blank325_170.png' ) ?>" />
<?php endif; ?>
</a>
</div>
<div class="entry-detail">
<header class="entry-header">
<h2 class="entry-title"><a href="<?php echo get_category_link( $child->cat_ID ); ?> " rel="bookmark"><?php echo $child ->cat_name;?></a>
</h2>
</header><!-- .entry-header -->
<div class="entry-excerpt">
<?php echo $child ->description;?>
</div><!-- .entry-content -->
</div>
</article><!-- #post-## -->
...and lastly this is how I put all the code together in the category template file which works:
<?php
/**
* Category Template: Custom
*/
get_header(); ?>
<div id="content" class="site-content container <?php echo codilight_lite_sidebar_position(); ?>">
<div class="content-inside">
<div id="primary" class="content-area">
<main id="main" class="site-main" role="main">
<?php
$cat = get_category( get_query_var( 'cat' ) );
$cat_id = $cat->cat_ID;
$child_categories=get_categories(
array(
'parent' => $cat_id,
// Uncomment the below line if you want empty category to appear on the list.
// 'hide_empty' => 0
)
);
if (!empty($child_categories)) : $count = 0; ?>
<header class="page-header">
<?php
the_archive_title( '<h1 class="page-title">', '</h1>' );
the_archive_description( '<div class="taxonomy-description">', '</div>' );
?>
</header><!-- .page-header -->
<?php
echo '<div class="block1 block1_grid">';
echo '<div class="row">';
foreach ( $child_categories as $child ) : $count++; ?>
<article id="" class="col-md-6 col-sm-12">
<div class="entry-thumb">
<a href="<?php echo get_category_link( $child->cat_ID ); ?>" title="<?php echo $child ->cat_name;?>">
<?php $image_url = z_taxonomy_image_url($child->term_id); ?>
<?php if (!empty($image_url)) : ?>
<img alt="" src="<?php if (function_exists('z_taxonomy_image_url')) echo z_taxonomy_image_url($child->term_id);?>" />
<?php else: ?>
<img alt="" src="<?php echo esc_url( get_template_directory_uri() . '/assets/images/blank325_170.png' ) ?>" />
<?php endif; ?>
</a>
</div>
<div class="entry-detail">
<header class="entry-header">
<h2 class="entry-title"><a href="<?php echo get_category_link( $child->cat_ID ); ?> " rel="bookmark"><?php echo $child ->cat_name;?></a></h2>
</header><!-- .entry-header -->
<div class="entry-excerpt">
<?php echo $child ->description;?>
</div><!-- .entry-content -->
</div>
</article><!-- #post-## -->
<?php ?>
<?php if ( $count % 2 == 0 ) {
echo '</div>';
echo '<div class="row">';
}
endforeach;
echo '</div>';
echo '</div>';
?>
<?php else : ?>
<?php get_template_part( 'template-parts/content', 'none' ); ?>
<?php endif; ?>
</main><!-- #main -->
</div><!-- #primary -->
<?php get_sidebar(); ?>
<?php get_footer(); ?>
A:
As far I've known get_template_part() function does not work with foreach loop. So we need to use locate_template() function to this case. This is your customized category template code. Put it there -
<?php
/**
* Category Template: Custom
*/
get_header(); ?>
<div id="content" class="site-content container <?php echo codilight_lite_sidebar_position(); ?>">
<div class="content-inside">
<div id="primary" class="content-area">
<main id="main" class="site-main" role="main">
<?php
$cat = get_category( get_query_var( 'cat' ) );
$cat_id = $cat->cat_ID;
$child_categories=get_categories(
array(
'parent' => $cat_id,
// Uncomment the below line if you want empty category to appear on the list.
// 'hide_empty' => 0
)
);
if (!empty($child_categories)) : $count = 0; ?>
<header class="page-header">
<?php
the_archive_title( '<h1 class="page-title">', '</h1>' );
the_archive_description( '<div class="taxonomy-description">', '</div>' );
?>
</header><!-- .page-header -->
<div class="block1 block1_grid">
<?php
foreach(array_chunk($child_categories, 2) as $item) {
echo '<div class="row">';
foreach ($item as $child) {
// get_template_part( 'template-parts/content-grid' );
include( locate_template( 'template-parts/content-grid.php' ) );
}
echo '</div>';
}
?>
</div>
<?php else : ?>
<?php get_template_part( 'template-parts/content', 'none' ); ?>
<?php endif; ?>
</main><!-- #main -->
</div><!-- #primary -->
<?php get_sidebar(); ?>
<?php get_footer(); ?>
|
Dino Patti, co-founder of indie studio Playdead, has left the company. He announced the news himself on Twitter earlier today, writing that he's "leaving to seek new challenges."
Following almost 10 incredible years building Playdead from an idea to two dents in the games industry, I’m leaving to seek new challenges. — Dino Patti (@DinoPatti) July 19, 2016
He didn't elaborate on what that may entail, but his Linkedin page suggests that he'll be going the independent, entrepreneurial route.
Patti's shares in the Danish studio, whose latest game is the well-received platformer Inside, have been transferred to business partner Arnt Jensen, according to GameIndustry.biz. Jensen and Patti started Playdead together in 2006, nearly 10 years ago.
The studio has developed and self-published two titles since then; Limbo preceded Inside in 2010. Both games are heavily stylized adventures that went on to develop cult audiences. You can get a feeling for Inside in our video review below.
We've reached out to Jensen and Playdead regarding Patti's announcement, which comes just after Inside's launch on Windows PC. The game came to PC on July 7. |
A GAME OF THRONES PODCAST THAT IS TALKING ABOUT OTHER GREAT POP CULTURE DURING THE OFF SEASON
With Joanna Robinson from Vanity Fair, Dave Gonzales from Geek.com and Neil Miller from Film School Rejects!
Welcome to another off season tour episode of A STORM OF SPOILERS!
This week, our hosts take trip to Yorktown via Lin Manuel Miranda's Broadway sensation Hamilton! It was by far our most requested off season tour stop and on top of providing a few production insights to the show and Joanna sharing her knowledge of the play's production, the crew spends a good deal of time sharing personal memories and trying to dig into what it is about musicals that make them a special form of storytelling and adaptation.
THIS WEEK'S TIMECODES:
0:00:00 – Intro, Game of Thrones News 0:14:58 – Hamilton and Musicals 1:24:54 – Bubbling/Fall Preview Preview
Follow Neil (@rejects), Joanna (@jowrotethis), Da7e (@da7e) and the show (@StormofSpoilers) on Twitter! Like this podcast? Subscribe to FIGHTING IN THE WAR ROOM through iTunes or your podcast app.
Off Season Art by @WikiRascals
This week's closing track: |
Q:
how to open specific Jframe as a main jframe?
when I run the project compiler says BUILD SUCCESSFUL but not any window is appear. when I runt the project I want to start main_window as a default window. but I have no Idea how to setting up this.
A:
If you are creating a jar file (as I assume you will be doing from your previously deleted question), the main class would be specified by the jar file's manifest.
e.g., the manifest file, named MANIFEST.MF could contain a line looking like:
Main-Class: gui.main_window
|
Question of the Day
Should President Trump pardon Michael Flynn?
The United States is conducting the war on terrorism without taking into account its allies' interests, and expanding the war beyond Afghanistan lacks international support, according to a survey among 275 opinion leaders from 24 countries released yesterday.The survey, conducted by the Pew Research Center, also shows the world's "love-hate relationship" with the United States hasn't changed after the September 11 attacks in New York and on the Pentagon. America's power and its contribution to widening the gap between rich and poor are most frequently cited as reasons for resentment abroad."While the survey reports popular support for the war on terror, the United States is seen as overreacting to the terrorist attacks," Andrew Kohut, Pew's director, said at the project's release in the offices of the Albright Group, a global strategy firm founded by former Secretary of State Madeleine K. Albright and other members of the Clinton administration.More than half of all overseas respondents said the September 11 attacks were "caused by U.S. policy," while this opinion was shared by 81 percent of the participants from the Middle East. About 70 percent of all surveyed agreed that it was "good for the United States to feel vulnerable."Such an attitude is a result of the fact that for a long time "we just talked about turbulence in the world" without knowing what it's really like, said Mrs. Albright, who chairs the survey as part of the Pew Global Attitudes Project.The United States is a "major magnet for those who have problems with major powers," she said, but "you don't want to live in a neighborhood where everyone hates you."Mrs. Albright said the "major red flag" in the survey is the gap between rich and poor, noting that she should have used it as a reason to ask Congress for an increase of the foreign aid budget, which is currently less than 1 percent."We are rich, and we don't share" is how she characterized the perception of the United States overseas. "We are powerful and selfish."Asked about the main reasons for "liking" America, most international survey respondents pointed to its democratic values, the opportunities it offered, and its scientific and technological advances.The survey also found that 54 percent of foreign opinion leaders and 40 percent of those in the Middle East said the battle against terrorism was worth the risk of destabilizing the governments of Muslim and Arab states supporting the anti-terror coalition.Unlike the majority of U.S. respondents 70 percent who think Washington's support of Israel is a major source of resentment, fewer than 30 percent of the foreign participants share that opinion.The survey reflects the views of political, media, cultural, business and government leaders. The interviews were conducted between Nov. 12 and Dec. 13. |
Q:
How has Linux geek culture reacted to Esperanto over the years?
In this question there is an answer that comments "There was for a long time resistance in some parts of the Linux world to Esperanto, so it seems it was only this year that the Esperanto localization was made official in the libc, the basic library in Linux, although some distributions such as Debian and Ubuntu had Esperanto for a long time." What level of resistance was there, and how has it been resolved?
A:
Well the resistance is/was similar as resistance to Esperanto in any other segment of society. In this case, see for example https://sourceware.org/bugzilla/show_bug.cgi?id=711#c2 or https://sourceware.org/bugzilla/show_bug.cgi?id=14943 for some of the history. This particular issue has been fixed: https://sourceware.org/bugzilla/show_bug.cgi?id=16190.
With libc now (since only this august) including eo locale in the distribution, the main sticking point in terms of basic out of the box language support is resolved.
The problem with libc was the fact that the maintainers were actively opposed to including Esperanto locale, refusing to even consider changes done by other people for inclusion.
Though note that Debian, and hence Ubuntu, included EO support for quite a while now.
I remember long time ago (15 years) when I first considered learning Esperanto and I was working on GNOME at the time, I did hear some disparaging comments about EO. Linux was, and especially the companies around Linux were, trying to be professional, and EO was not perceived that way.
Although I have been mostly out of the active free software community for a while, so I am not sure what is the prevailing view nowadays. But note that the free software community is a very wide ranging far flung community with people of all sorts of different views. It is not a homogeneous bunch at all. But a lot of the core people around Linux and related projects work for Linux companies rather than being volunteers, and this does change the way a purely grassroots movement such as Esperanto is going to be received.
|
Palin is Back at Work.
5122008
I looked at the Anchorage Daily News today, and my first thought was, “Hey, isn’t that the lady from TV?” Yes, indeed, Governor Sarah Palin is back in Alaska and it looks like she’s working!
After the national media descended on Alaska last summer, like ravens on a Wendy’s dumpster, many things were dragged out into the spotlight that otherwise might have lingered in Alaskan obscurity. I think of that bizarre phenomenon like a team of ten or twelve strangers coming into your house and emptying out your closets, taking inventory, and then writing about it. You’d realize that maybe you had some strange stuff in there, that you had just gotten used to, and other stuff you didn’t even know was in there…but now that you look at it all in the light of day, through someone else’s eyes, you realize that maybe you should have been cleaning out your closets more often. One of those things was the Palin administration’s record on health care for children and pregnant women. The national media was not kind in its analysis of how Palin was caring for women and children, and many Alaskans had been furious about it for some time, and felt vindicated by the media analysis from outside the state.
Lawmakers have scrapped for years over Denali KidCare, which provides health insurance for lower income children and pregnant women. Palin last year opposed the push to increase coverage — even though the state was enjoying a huge surplus at the time from high oil prices. It’s one of dozens of policy calls that came under scrutiny as the governor became a national figure in the wake of her nomination this summer for vice president.
Palin, pressed on why she’s now changed her position, kept repeating that it is an opportunity for more children to be covered.
And, as usual, nobody is happy. Democrats think she hasn’t gone far enough, and Republicans think she’s gone too far. But Republicans will likely not stop it, and Democrats will take what they can get.
One of the good things that has come from Palin’s run for VP, is that Alaskans have been forced to look outside the bubble. Those who have felt that Palin’s policies and attitudes were not in alignment with their own, are now realizing that a lot of other Americans out there share their sentiments. It’s hard sometimes to remember that out there is a big wide world that isn’t Alaskan.
We were all expecting, with the price of oil dipping below $40/barrel yesterday, that the state budget was once again going to fall victim to Palin’s dreaded red pen. So this increase in an “entitlement program” in the face of plummeting oil prices, and the coming economic crunch, came as a bit of a surprise. I wonder how much her decisions in the next few years will be made in consideration of that world outside. She has plans for 2012, after all…
Palin will release the rest of her proposed state budget next week and said not to expect any significant cuts. She downplayed the danger falling oil prices pose to the state budget, saying Alaska is in a far better position than other states.
Palin claimed the state could still end up with a surplus even if oil averages $45 a barrel over the next several months.
David Teal, the state Legislature’s chief budget analyst, said that is possible for the current fiscal year that ends in June. But he has doubts. “Oil is falling pretty fast; we don’t know if we’re going to have a surplus or a deficit,” Teal said in an interview. Palin’s new spending plan, though, would start in the next fiscal year — when Alaska oil prices would have to average at least $20 a barrel more than now to balance the budget.
Welcome to the season of tight-rope walking, fiscal wrangling and hand-wringing as we try to pack all that stuff back in the closet.
52 responses
Yep, she’s playing to her bigger audience – her gov’t might not be transparent but she sure is.
5122008
Erin(10:13:12) :
My first thought when I saw her on the local news this morning was, “Well, at least she’s back in town.”
5122008
InJuneau(10:14:01) :
Yeah, when I heard the announcement on last night’s news, I thought, “huh, she’s trying to get back in the good graces of Alaskans. You don’t suppose she finally heard (and comprehended) about our season of discontent, do you?” Not that I’m not happy about increases in Denali KidCare, for the sake of those who need it, but give me a break…
5122008
Denise sansMSgaAZca(10:20:13) :
May be a lucky break for those Alaskans who had been less favored when Palin was playing her home game. Looking only to appeal to conservatives and evangelicals.
Now that she is looking for attention to follow her “good” administration, then Alaskans can lobby with that in mind. Use Palin’s national desire to help obtain what Alaskans have been needing. Perhaps the special needs kids will actually see funding increased rather than cut. Else those pesky national reporters will notice.
5122008
halcrow(10:24:13) :
Thanks, AKM.
While Alaska is only a small part of the world, the effect of falling energy prices will similarly impact greatly upon other American states; upon Canada’s oil-producing provinces; and upon many of those benighted, immoral oil-producing countries which cream off the revenue for the elite.
5122008
Grammy in PA(10:25:03) :
Also on the ADN today:
Palin won’t release Troopergate deposition
As far as Gov. Sarah Palin is concerned, her office says, Troopergate is behind her and she won’t provide a transcript of her testimony in an investigation into whether she violated ethics laws in firing Public Safety Commissioner Walt Monegan
5122008
LibertyLover(10:25:35) :
Do you constitutionally have to balance your budget?
5122008
Hope(10:28:17) :
austintx (09:45:40) :
I won’t even stop to pee at Exxon while on a road trip…….
Actually, that might be the only appropriate symbolic act to perform at an Exxon station… AKM
*****AKM, you are, as always, priceless! I laughed out loud at Austintx’s comment, and then again at your response!! Oh, YEAH!!!
And your description of the closets! HILARIOUS!! Now just so we don’t let her “fix” everything as if those closets had never been opened!!! Gotta keep on it!
Does seem like she’s back to trying to buy favor, but at best, she’s only buying time…. I imagine she’s banking on oil prices rising again, in time to ‘save’ her and the state budget. Faith, and all that.
Tick… tock… tick… tock….
5122008
Gus(10:40:40) :
“Or maybe we have witnessed one of the biggest frauds in American political history and the biggest failures among the American media in a very, very long time.”
Some political consultant told Palin what she needs to do to avoid criticism on certain issues that are important to independents. I still don’t see how she can get past the stupid factor and religious issues. Then there is snubbing Oprah. Remember how well McCain did snubbing Letterman? Finally, the money she spent on the campaign is not going to go away.
When Alaskans stop getting the things they are used to getting from the State, how long do you think her popularity figures will stay above the mean?
5122008
Grammy in PA(12:11:29) :
What is FOIA?
5122008
nswfm CA(12:16:33) :
AKM, “like ravens on a Wendy’s dumpster” was so true–down in CA, it’s the seagulls on a Carl’s/Wendy’s/McD’s dumpster. Hope AK throws SP into the dumpster since she’s such a dumbster.
And peeing / Exxon station was what I thought when I read Austin’s comment, but then got busy at work!
5122008
nswfm CA(12:16:58) :
Freedom of Information Act FOIA
5122008
shrinkdr(12:22:53) :
Amazingly, ran into the Lt. Gov. this morning on the flight to Fairbanks. He says, “what they are not saying (in the newspaper) is that this is not new money.” I believe he indicated it was unused teacher incentive $$. Expressed my appreciation and left it at that.
5122008
austintx(12:24:02) :
When you look at the picture – it is obvious that it is some sort of padded belt……..just stare for a few moments…….she is a pathetic lying sack of shit !!!
5122008
nswfm CA(12:24:10) :
She’s a fraud in my book. Sullivan photo from above: I’ll bet her fake baby bump had shifted to the side and is hiding under that big coat. She’s not pregnant in that photo, and the strap label is kinda showing if you look at the palindeception blog from the Night Kitchen a couple of nights ago. I thought the flying while leaking story was complete moose poo the first time I heard it. No legitamate medical doctor would advocate a giant malpractice suit like that.
Comments will “live longer” there, and continue the conversation beyond the life of this thread, and will allow the blog to remain OT! A win-win!😀
5122008
austintx(12:47:26) :
BTW – where is the Dr. ??????
5122008
texasbrian(12:50:36) :
Hmmm…Palin is back to work. When does her Christmas break? Probably next week.
5122008
texasbrian(12:51:27) :
whoops…meant to say when does her Christmas break start.
5122008
Winski(12:58:05) :
Did SP remember where her office was?? Or did she have to mush around on TP’s snow machine for a while??
I do NOT envy anyone in Alaska right now cause it seems she’ll try everything out on you first before her hardcore right-wing neonuts try to get it to fly in the lower 48..
What’s the deal on her refusing now to release the testimony in her Troopergate deposition she ‘promised’ she was going to release?? Hummm….
5122008
pvazwindy(12:58:34) :
Now is this part of Sarah’s budget or Todd’s? Nice to hear that the Palin family is giving a little thought to Alaska. Last I read she had Georgia on her mind.
5122008
pdx mb(13:01:54) :
I am eating pie for lunch (pumpkin chiffon and then apple…) so, of course, had to stop by for some company.
Personally, I don’t see how Sarah can possibly stand up to the everyday scrutiny she will surely be subject to now. It’s that old test of time. She just won’t last.
5122008
CRFlats(13:07:56) :
Sorry, sort of OT, but this just came across my desk, and muddies are always asking “how can I help?”. I hope someone who knows how to navigate the forum will post where it belongs:
The Mitzvah Mall:
Instead of buying material gifts this holiday season, Alaskans have
the chance to do something a little different. They can shop at
Anchorage’s first-ever Mitzvah Mall and purchase some goodwill that
will continue the giving for months to come. The Mitzvah Mall, an
alternative gift fair, will be held on Sunday, Dec. 7 from 1 to 4 p.m.
at Congregation Beth Sholom. Mitzvah is Hebrew for “good deed,” and
the Mitzvah Mall allows shoppers to donate to local non-profits on
behalf of friends, family or others on their holiday gift list.
Thirty local non-profits will offer everything from the chance to buy
groceries for a hungry family to paying for a juvenile diabetes kit,
funding a therapeutic outing for a child or purchasing a safe night of
lodging for a rape victim. Shoppers receive decorative gift cards to
present to the person in whose honor the gift was purchased. Gifts are
in various price ranges, from $5 to $100 and up.
Sarah Palin has proved she can lie and get away with it.
She will say that she TRIED to get increased health care for women and children but that the mean legislators threw out her plan.
Of course the fact that she vetoed it twice before(when it could easily be paid for) will never see the light of day UNLESS people are willing to keep tract of things like this and call her on it
This is a wonderful idea; I just sent the Congregation an email asking how out-of-staters can donate. If anyone is interested, I will let you know what I find out-
5122008
CO Almost Native(13:42:00) :
Grammy in PA (10:25:03) :
Also on the ADN today:
Palin won’t release Troopergate deposition
As far as Gov. Sarah Palin is concerned, her office says, Troopergate is behind her and she won’t provide a transcript of her testimony in an investigation into whether she violated ethics laws in firing Public Safety Commissioner Walt Monegan
I wonder if the Alaskan Legislature will roll over and play dead on this, or if they’ll bite the hand that feeds them, and decide which investigation is correct.
all I can say is I’m glad you have her and we don’t …we have enough problems with ‘Good Hair Perry’…and ole Kay is going after his job…why can’t we get a democrat to run for Govenor besides a guitar playing mystery writer…????
5122008
katiebegood(13:58:05) :
The thing that amazes me the most about this baby story is that if she was not pregnant, there are an awful lot of people in Alaska who are covering for her including the staff at the hospital where Trig was supposedly born.
5122008
Trini(14:09:41) :
Back to work? Is she OK? Does she need to lie down? Or, maybe, just lie……..
5122008
pvazwindy(14:16:39) :
shrinkdr (12:22:53) :
Amazingly, ran into the Lt. Gov. this morning on the flight to Fairbanks. He says, “what they are not saying (in the newspaper) is that this is not new money.” I believe he indicated it was unused teacher incentive $$. Expressed my appreciation and left it at that.
************ “Unused teacher incentive money”, figures. And Alaskans have the highest dropout rate in the country. Now I know that Alaska has plenty of wonderful teachers just as all states do, but what on earth is she doing spending dollars taken from a teacher incentive program. Wouldn’t this money be better spent on those teachers who are marginlized? Just wondering.
5122008
austintx(14:30:56) :
Yellowdoggranny – Kinky is actually smart and has good ideas…he just putzs around too much.
your Ms. Palin will be under a magnifying glass from now on until she’s busted, along with those fools protecting her, it’s bound to happen. Course she doesn’t believe that, lol. Neither did Ted.
House cleaning is always a good healthy thing. Trouble is those dang closet skeletons that won’t stop rattling. Can you hear them? I can, way down here!
Where’s that Pastor?…..I don’t think he successfully cast out all that all witchcraft business…..something evil within her has some under her spell. Maybe shake some closet bones or something. Chant? Dance in the spirit?
5122008
KarenJ(15:42:11) :
Alaskans got FOURTEEN days of work out of Sarah Palin, of the 30 days since the Presidential election! Wow!!
From the latest headlines, she also spent a little time padding the Alaska state budget for her new pet projects — health care for children (and probably later, especially children with special needs — aren’t you lucky, all you Alaska taxpayers?)
More compalints need to be registered with the Legislature/somebody. The more you let her get away with, the more she will take, and laugh in your face. You have someone there that thinks they are above the law–just like Cheney.
Love this blog–follow you everyday.
5122008
Catherine(22:52:47) :
This woman is a hazard. Thank you for trying to keep her honest and bringing her conduct to the attention of us in the lower 48. It is incomprehensible how she consistently says that something is reprehensible and then she does just what she said was so awful.
I hope she gets banished back to Wasilla where she can lead a quiet life and slowly disappear.
There is the possibility that she views these positions of Governor and VP/President as figure heads with nothing more to do but preen about and go out shopping and do whatever. Well let her live in her dreamworld because the reality is there will be a day of reckoning . If the GOP are considering the Barbie and brother Jeb as their salvation — God help the USA. |
Obama says North Korea hacked Sony, vows response
A movie billboard is displayed behind a Sony Pictures Entertainment Studio entrance in Culver City, Calif., Thursday, Dec. 18, 2014. Companies across the globe are on high alert to tighten up network security to avoid being the next company brought to its knees by hackers like those that executed the dramatic cyberattack against Sony Pictures Entertainment.
WASHINGTON — President Barack Obama declared Friday that Sony "made a mistake" in shelving a satirical film about a plot to assassinate North Korea's leader, and he pledged the U.S. would respond "in a place and manner and time that we choose" to the hacking attack on Sony that led to the withdrawal. The FBI blamed the hack on the communist government.
Speaking of executives at Sony Pictures Entertainment, Obama said at a year-end news conference, "I wish they had spoken to me first. ... We cannot have a society in which some dictator someplace can start imposing censorship."
Obama said he imagined situations in which dictators "start seeing a documentary that they don't like or news reports that they don't like."
Sony said it had had no choice but to cancel distribution of the movie since theaters were refusing to show it. North Korea denied anew that it had hacked the studio.
"There is not any connection," U.N. diplomat Kim Song told The Associated Press. Song criticized the film but disputed his government hacked Sony and orchestrated the movie's shutdown: "It defamed the image of our country. It made a mockery of our sovereignty. We reject it. But there is no relation" to the hacking.
The U.S. decision to openly blame North Korea — which involved agreement by the State Department and intelligence agencies — escalated a global game of brinkmanship. It happened after the disclosure of confidential Sony emails and business files and threats of terror attacks against U.S. movie theaters until Sony agreed to cancel the Christmas Day release of its comedy, "The Interview."
Obama spoke not long after the FBI provided the most detailed accounting to date of the digital break-in. The president's pointed criticism of Sony shifted focus to whether the studio would modify its decision, as some leading celebrities — including actors George Clooney and Sean Penn — have recommended.
"Sony is a corporation. It suffered significant damage. There were threats against its employees. I am sympathetic to the concerns that they faced," Obama said. "Having said all that, yes, I think they made a mistake."
Sony Pictures chief executive Michael Lynton said it was the president who was mistaken, noting that Sony canceled the release only after all major theater chains decided not to show the movie. But the Homeland Security Department concluded those threats were not credible, and the top multiplex chains in North America dropped "The Interview" only after Sony informed them it would not protest if the theaters pulled the film. Representatives for Regal, AMC, and Carmike did not immediately respond to request for comment Friday.
"The president, the press and the public are mistaken as to what actually happened," Lynton told CNN. "We do not own movie theaters. We cannot determine whether or not a movie will be played in movie theaters."
Lynton did not indicate whether Sony planned to release the movie on DVD or through video-on-demand services, which are not controlled by theaters, but the company suggested that was an option in a statement late Friday.
"The only decision that we have made with respect to release of the film was not to release it on Christmas Day in theaters, after the theater owners declined to show it," the company said. "After that decision, we immediately began actively surveying alternatives to enable us to release the movie on a different platform."
Lynton said to CNN that though YouTube distribution is "one thing that we will consider," no major video-on-demand or e-commerce site has stepped forward to offer to distribute the film. A DVD release falls into the same category.
"If we can't find one of those large retailers, or many of those large retailers to sell our DVDs, we wouldn't be able to provide them with 'The Interview'," said Lynton.
As for the case against North Korea, the U.S. detected communications between computer Internet addresses known to be operated by North Korea and hacking tools left behind at the crime scene, which the FBI said contained subtle clues linking them to that country's government.
The U.S. said in a statement: "North Korea's actions were intended to inflict significant harm on a U.S. business and suppress the right of American citizens to express themselves." The statement included a general promise to impose "costs and consequences" on any person, group or government using cyberattacks to threaten the U.S. or its interests.
Obama wasn't any more specific.
"They caused a lot of damage, and we will respond," he said. "We will respond proportionally, and we'll respond in a place and time and manner that we choose. It's not something that I will announce here today at a press conference."
In a taunting new email, the hackers told Sony that executives were "very wise" to cancel the movie's release and warned the studio never to release the film "in any form."
In Hollywood, Clooney said the entertainment industry should push for immediate release of "The Interview" online. In an interview with the trade site Deadline, he urged Sony to "do whatever you can to get this movie out. Not because everybody has to see the movie, but because I'm not going to be told we can't see the movie. That's the most important part."
Penn said: "By caving to the outside threat, we make our nightmares real. The decision to pull 'The Interview' is historic. It's a case of putting short-term interests ahead of the long term."
The evidence implicating North Korea was previously described as largely circumstantial, including unspecified clues in the hacking tools left behind and the involvement of at least one computer in Bolivia traced to earlier attacks blamed on North Korea. Now, the FBI said, those clues included similarities to other tools developed by North Korea in specific lines of computer code, encryption algorithms and data deletion methods. More significantly, the FBI discovered that computer Internet addresses known to be operated by North Korea were communicating directly with other computers used to deploy and control the hacking tools and collect the stolen Sony files.
The FBI noted in its statement that it worked closely on the investigation with "other U.S. government departments and agencies." Those included the National Security Agency, a person familiar with the case said, speaking only on condition of anonymity because some information NSA was providing in the case was highly classified.
An internal FBI investigative document obtained by The Associated Press identified the computers in the Sony hacking as operating in New York, Thailand, Poland, Italy, Bolivia, Singapore and Cyprus. At least three were still functioning Friday, responding online to Internet test signals transmitted by the AP. The hackers previously published some of the stolen materials with a message that included five addresses using an anonymous email service in France.
U.S. options for acting against North Korea are limited. The U.S. already has severe trade sanctions in place, and there is no appetite for military action. Even if investigators could identify and prosecute the individual hackers believed responsible, there's no guarantee that any located are overseas would ever see a U.S. courtroom. Hacking back at North Korean targets by U.S. government experts could encourage further attacks against American targets.
"I think the administration is going to look for other ways that we can press financial pain on the leadership of the regime and its cronies," said Rep. Adam Schiff, D-Calif., a member of the House intelligence committee whose congressional district includes major movie studios.
Associated Press Writers Jake Coyle in New York and Cara Anna at the United Nations contributed to this report. |
Semiconductor devices use interconnect, which includes metal lines and contacts/vias, to provide connection between active and/or device devices with external contacts. Typically, the metal patterns of different metallization layers are electrically interconnected by vias. Semiconductor devices with interconnect circuits, according to current technology, may comprise eight or more levels of metallization to satisfy device connection and geometry requirements. There are challenges in forming interconnect for advanced device technologies. |
noeixjtcoxexhwfei
cejjgtjxkhtntjxkegnxiwnxfq
gddxiwnxqi thqxgnxbwtxpwhvqnxbwthjqdp
nwxoq vqxfqxgixgxefxexjwd gqhxg
wd qhxgixyhecngcqxekdqhxnoeixbwthjqdp
nwxfeaqxcwi gngwij
khtntjxvwxnwxbwtxehqxiwnxcejjgtj
cejjgtjxgxef
khtntjxgxjebxbwtxehqxiwn
cejjgtjxthvqxfqxiwxfwhqxgxjoeddxpwhvqnxfbjqdp
oezqxfgi xtywixbwthxoqednoxnqfynxfqxiwxpehnoqh
khtntjxemebxjdgvonxfei
cejjgtjxgjnxywjjgkdq
khtntjxoqehxfqxpwhxgxmgddxjyqea
ftjnxgxvgzqxmebxei xhwwfxnwxbwthxhejoxcowdqh
joeddxgxkqxphgvonq xmoqixexfe feixjnehqj
cejjgtjxwxvw jxbqxvw jxftjnxgxqi thqxeddxnogj
khtntjxeddxnogjxebxfwhqxphqnxngddxbwthxyhwt xoqehnxkhqea
vwxjowmxbwthxjdezqjxowmxcowdqhgcxbwtxehq
ei xfeaqxbwthxkwi fqixnhqfkdqxftjnxgxkwtvq
ftjnxgxwkjqhzqxbwtxftjnxgxjnei xei xchwtco
ti qhxbwthxnqjnbxotfwhxkbxnoqxvw j
bwtxjoeddx gvqjnxnoqxzqiwfxwpxbwthxjydqqi
nowtvoxgnx wxjydgnxbwtxpwhxphwfxnogjx ebxpwhno
gddxtjqxbwtxpwhxfbxfghnoxbqexpwhxfbxdetvonqh
moqixbwtxehqxmejygjo
cejjgtjxgjxgnxcwfqxnwxnogj
khtntjxbwtxjebxbwtxehqxexkqnnqhxjwd gqh
dqnxgnxeyyqehxjwxfeaqxbwthxzetingivxnhtq
ei xgnxjoeddxydqejqxfqxmqddxpwhxfgiqxwmixyehn
gxjoeddxkqxvde xnwxdqehixwpxiwkdqxfqi
cejjgtjxbwtxmhwivxfqxqzqhbxmebxbwtxmhwivxfqxkhtntj
gxjeg xeixqd qhxjwd gqhxiwnxexkqnnqh
g xgxjebxkqnnqh
khtntjxgpxbwtx g xgxcehqxiwn
cejjgtjxmoqixceqjehxdgzq xoqx thjnxiwnxnotjxoezqxfwzq xfq
khtntjxyqecqxyqecqxbwtx thjnxiwnxjwxoezqxnqfynq xogf
cejjgtjxgx thjnxiwn
khtntjxiw
cejjgtjxmoenx thjnxiwnxnqfynxogf
khtntjxpwhxbwthxdgpqxbwtx thjnxiwn
cejjgtjx wxiwnxyhqjtfqxnwwxftcoxtywixfbxdwzq
gxfebx wxnoenxgxjoeddxkqxjwhhbxpwh
khtntjxbwtxoezqx wiqxnoenxbwtxjowtd xkqxjwhhbxpwh
noqhqxgjxiwxnqhhwhxcejjgtjxgixbwthxnohqenj
pwhxgxefxehf xjwxjnhwivxgixowiqjnb
noenxnoqbxyejjxkbxfqxejxnoqxg dqxmgi
mogcoxgxhqjyqcnxiwnxgx g xjqi xnwxbwt
pwhxcqhnegixjtfjxwpxvwd xmogcoxbwtx qigq xfq
pwhxgxceixhegjqxiwxfwiqbxkbxzgdqxfqeij
kbxoqezqixgxoe xhenoqhxcwgixfbxoqehn
ei x hwyxfbxkdww xpwhx hecofejxnoeixnwxmhgiv
phwfxnoqxoeh xoei jxwpxyqejeinjxnoqghxzgdqxnhejo
kbxeibxgi ghqcngwixgx g xjqi
nwxbwtxpwhxvwd xnwxyebxfbxdqvgwij
mogcoxbwtx qigq xfqxmejxnoenx wiqxdgaqxcejjgtj
jowtd xgxoezqxeijmqh xcegtjxcejjgtjxjw
moqixfehctjxkhtntjxvhwmjxjwxcwzqnwtj
nwxdwcaxjtcoxhejcedxcwtinqhjxphwfxogjxphgqi j
kqxhqe bxvw jxmgnoxeddxbwthxnoti qhkwdnj
ejoxogfxnwxygqcqj
cejjgtjxgx qigq xbwtxiwn
khtntjxbwtx g
cejjgtjxgx g xiwnxoqxmejxktnxexpwwd
noenxkhwtvonxfbxeijmqhxkecaxkhtntjxoenoxhgzq xfbxoqehn
exphgqi xjowtd xkqehxogjxphgqi jxgipghfgngqj
ktnxkhtntjxfeaqjxfgiqxvhqenqhxnoeixnoqbxehq
khtntjxgx wxiwnxngddxbwtxyhecngjqxnoqfxwixfq
cejjgtjxbwtxdwzqxfqxiwn
khtntjxgx wxiwnxdgaqxbwthxpetdnj
cejjgtjxexphgqi dbxqbqxcwtd xiqzqhxjqqxjtcoxpetdnj
khtntjxexpdennqhqhjxmwtd xiwnxnowtvoxnoqbx wxeyyqeh
ejxotvqxejxogvoxwdbfytj
cejjgtjxcwfqxeinwibxei xbwtivxwcnezgtjxcwfq
hqzqivqxbwthjqdzqjxedwiqxwixcejjgtj
pwhxcejjgtjxgjxemqehbxwpxnoqxmwhd
oenq xkbxwiqxoqxdwzqjxkhezq xkbxogjxkhwnoqh
coqca xdgaqxexkwi feixeddxogjxpetdnjxwkjqhzq
jqnxgixexiwnqkwwaxdqehi xei xcwii xkbxhwnq
nwxcejnxginwxfbxnqqnoxwxgxcwtd xmqqy
fbxjyghgnxphwfxfgiqxqbqjxnoqhqxgjxfbx evvqh
ei xoqhqxfbxieaq xkhqejnxmgnogixexoqehn
qehqhxnoeixydtnwjxfgiqxhgcoqhxnoeixvwd
gpxnoenxnowtxkqjnxexhwfeixneaqxgnxpwhno
gxnoenx qigq xnoqqxvwd xmgddxvgzqxfbxoqehn
jnhgaqxejxnowtx g jnxenxceqjehxpwhxgxaiwm
moqixnowtx g jnxoenqxogfxmwhjnxnowtxdwzq jnxogfxkqnnqh
noeixqzqhxnowtxdwzq jnxcejjgtj
khtntjxjoqenoqxbwthx evvqh
kqxeivhbxmoqixbwtxmgddxgnxjoeddxoezqxjcwyq
wxmoenxbwtxmgddx gjowiwhxjoeddxkqxotfwh
wxcejjgtjxbwtxehqxbwaq xmgnoxexdefk
noenxcehhgqjxeivqhxejxnoqxpdginxkqehjxpghq
mowxftcoxqipwhcq xjowmjxexoejnbxjyeha
ei xjnhegvonxgjxcwd xevegi
cejjgtjxoenoxcejjgtjxdgzq
nwxkqxktnxfghnoxei xdetvonqhxnwxogjxkhtntj
moqixvhgqpxei xkdww xgddnqfyqh xzquqnoxogf
khtntjxmoqixgxjywaqxnoenxgxmejxgddnqfyqh xnww
cejjgtjx wxbwtxcwipqjjxjwxftcoxvgzqxfqxbwthxoei
khtntjxei xfbxoqehnxnww
cejjgtjxwxkhtntj
khtntjxmoenjxnoqxfennqh
cejjgtjxoezqxiwnxbwtxdwzqxqiwtvoxnwxkqehxmgnoxfq
moqixnoenxhejoxotfwhxmogcoxfbxfwnoqhxvezqxfq
feaqjxfqxpwhvqnptd
khtntjxbqjxcejjgtjxei xphwfxoqicqpwhno
moqixbwtxehqxwzqhqehiqjnxmgnoxbwthxkhtntj
oqddxnogiaxbwthxfwnoqhxcog qjxei xdqezqxbwtxjw
ywqnxmgnogixdqnxfqxvwxgixnwxjqqxnoqxvqiqhedj
noqhqxgjxjwfqxvht vqxkqnmqqixqfxngjxiwnxfqqn
noqbxkqxedwiq
dtcgdgtjxmgnogixbwtxjoeddxiwnxcwfqxnwxnoqf
ywqnxmgnogixiwnogivxktnx qenoxjoeddxjnebxfq
qinqhxywqnxpwddwmq xkbxdtcgdgtjxngngigtjxei xdtcgtj
cejjgtjxowmxiwmxmoenjxnoqxfennqh
ywqnxpwhxjoefqxbwtxvqiqhedjxmoenx wxbwtxfqei
dwzqxei xkqxphgqi jxejxnmwxjtcoxfqixjowtd xkq
pwhxgxoezqxjqqixfwhqxbqehjxgfxjthqxnoeixbq
cejjgtjxoexoexowmxzgdqdbx wnoxnogjxcbigcxhobfq
khtntjxvqnxbwtxoqicqxjghheoxjetcbxpqddwmxoqicq
cejjgtjxkqehxmgnoxogfxkhtntjxngjxogjxpejogwi
khtntjxgddxaiwmxogjxotfwhxmoqixoqxaiwmjxogjxngfq
moenxjowtd xnoqxmehjx wxmgnoxnoqjqxlgvvgivxpwwdj
cwfyeigwixoqicq
cejjgtjxemebxemebxkqxvwiqxxxxxxxxxxxxxxxxxxxxxxxqugnxywqn
khtntjxdtcgdgtjxei xngngigtjxkg xnoqxcwffei qhj
yhqyehqxnwxdw vqxnoqghxcwfyeigqjxnwigvon
cejjgtjxei xcwfqxbwthjqdzqjxei xkhgivxfqjjedexmgnoxbwt
gffq genqdbxnwxtjxxxxxxxxxxxxxquqtinxdtcgdgtjxei xngngigtj
khtntjxdtcgtjxexkwmdxwpxmgiqxxxxxxxxxxxxxxxxxxxqugnxdtcgtj
cejjgtjxgx g xiwnxnogiaxbwtxcwtd xoezqxkqqixjwxeivhb
khtntjxwxcejjgtjxgxefxjgcaxwpxfeibxvhgqpj
cejjgtjxwpxbwthxyogdwjwyobxbwtxfeaqxiwxtjq
gpxbwtxvgzqxydecqxnwxeccg qinedxqzgdj
khtntjxiwxfeixkqehjxjwhhwmxkqnnqhxywhngexgjx qe
cejjgtjxoexywhnge
khtntjxjoqxgjx qe
cejjgtjxowmxjceyq xagddgivxmoqixgxchwjj xbwtxjw
wxgijtyywhnekdqxei xnwtcogivxdwjj
tywixmoenxjgcaiqjj
khtntjxgfyengqinxwpxfbxekjqicq
ei xvhgqpxnoenxbwtivxwcnezgtjxmgnoxfehaxeinwib
oezqxfe qxnoqfjqdzqjxjwxjnhwivxpwhxmgnoxoqhx qeno
noenxng givjxcefqxmgnoxnogjxjoqxpqddx gjnhecn
ei xoqhxennqi einjxekjqinxjmeddwm xpghq
cejjgtjxei x gq xjw
khtntjxqzqixjw
cejjgtjxwxbqxgffwhnedxvw j
hqqinqhxdtcgtjxmgnoxmgiqxei xneyqh
khtntjxjyqeaxiwxfwhqxwpxoqhxvgzqxfqxexkwmdxwpxmgiq
gixnogjxgxkthbxeddxtiagi iqjjxcejjgtjxxxxxxxxxxxxxx hgiaj
cejjgtjxfbxoqehnxgjxnoghjnbxpwhxnoenxiwkdqxydq vq
pgddxdtcgtjxngddxnoqxmgiqxwqhjmqddxnoqxcty
gxceiiwnx hgiaxnwwxftcoxwpxkhtntjxdwzqxxxxxxxxxxxxxxx hgiaj
khtntjxcwfqxgixngngigtjxxxxxxxxxxxxxxxxxxxxxxxxqugnxdtcgtj
hqqinqhxngngigtjxmgnoxfqjjede
mqdcwfqxvww xfqjjede
iwmxjgnxmqxcdwjqxekwtnxnogjxneyqhxoqhq
ei xceddxgixrtqjngwixwthxiqcqjjgngqj
cejjgtjxywhngexehnxnowtxvwiq
khtntjxiwxfwhqxgxyhebxbwt
fqjjedexgxoezqxoqhqxhqcqgzq xdqnnqhj
noenxbwtivxwcnezgtjxei xfehaxeinwib
cwfqx wmixtywixtjxmgnoxexfgvonbxywmqh
kqi givxnoqghxquyq gngwixnwmeh xyogdgyyg
fqjjedexfbjqdpxoezqxdqnnqhjxwpxnoqxjqdpjefqxnqithq
khtntjxmgnoxmoenxe gngwi
fqjjedexnoenxkbxyhwjchgyngwixei xkgddjxwpxwtndemhb
wcnezgtjxeinwibxei xdqyg tj
oezqxytnxnwx qenoxeixoti hq xjqienwhj
khtntjxnoqhqxgixwthxdqnnqhjx wxiwnxmqddxevhqq
fgiqxjyqeaxwpxjqzqinbxjqienwhjxnoenx gq
kbxnoqghxyhwjchgyngwijxcgcqhwxkqgivxwiq
cejjgtjxcgcqhwxwiq
fqjjedexcgcqhwxgjx qe
ei xkbxnoenxwh qhxwpxyhwjchgyngwi
oe xbwtxbwthxdqnnqhjxphwfxbwthxmgpqxfbxdwh
khtntjxiwxfqjjede
fqjjedexiwhxiwnogivxgixbwthxdqnnqhjxmhgnxwpxoqh
khtntjxiwnogivxfqjjede
fqjjedexnoenxfqnogiajxgjxjnheivq
khtntjxmobxejaxbwtxoqehxbwtxetvonxwpxoqhxgixbwthj
fqjjedexiwxfbxdwh
khtntjxiwmxejxbwtxehqxexhwfeixnqddxfqxnhtq
fqjjedexnoqixdgaqxexhwfeixkqehxnoqxnhtnoxgxnqdd
pwhxcqhnegixjoqxgjx qe xei xkbxjnheivqxfeiiqh
khtntjxmobxpehqmqddxywhngexmqxftjnx gqxfqjjede
mgnoxfq gnengivxnoenxjoqxftjnx gqxwicq
gxoezqxnoqxyengqicqxnwxqi thqxgnxiwm
fqjjedexqzqixjwxvhqenxfqixvhqenxdwjjqjxjowtd xqi thq
cejjgtjxgxoezqxejxftcoxwpxnogjxgixehnxejxbwt
ktnxbqnxfbxienthqxcwtd xiwnxkqehxgnxjw
khtntjxmqddxnwxwthxmwhaxedgzqxmoenx wxbwtxnogia
wpxfehcogivxnwxyogdgyygxyhqjqindb
cejjgtjxgx wxiwnxnogiaxgnxvww
khtntjxbwthxhqejwi
cejjgtjxnogjxgnxgj
ngjxkqnnqhxnoenxnoqxqiqfbxjqqaxtj
jwxjoeddxoqxmejnqxogjxfqeijxmqehbxogjxjwd gqhj
wgivxogfjqdpxwppqijqxmogdjnxmqxdbgivxjngdd
ehqxptddxwpxhqjnx qpqijqxei xigfkdqiqjj
khtntjxvww xhqejwijxftjnxwpxpwhcqxvgzqxydecqxnwxkqnnqh
noqxyqwydqxnmgunxyogdgyygxei xnogjxvhwti
wxjnei xktnxgixexpwhcq xeppqcngwi
pwhxnoqbxoezqxvht vq xtjxcwinhgktngwi
noqxqiqfbxfehcogivxedwivxkbxnoqf
kbxnoqfxjoeddxfeaqxexptddqhxitfkqhxty
cwfqxwixhqphqjo xiqme q xei xqicwthevq
phwfxmogcoxe zeinevqxjoeddxmqxctnxogfxwpp
gpxenxyogdgyygxmqx wxpecqxogfxnoqhq
noqjqxyqwydqxenxwthxkeca
cejjgtjxoqehxfqxvww xkhwnoqh
khtntjxti qhxbwthxyeh wixbwtxftjnxiwnqxkqjg q
noenxmqxoezqxnhgq xnoqxtnfwjnxwpxwthxphgqi j
wthxdqvgwijxehqxkhgfptddxwthxcetjqxgjxhgyq
noqxqiqfbxgichqejqnoxqzqhbx eb
mqxenxnoqxoqgvonxehqxhqe bxnwx qcdgiq
noqhqxgjxexng qxgixnoqxeppeghjxwpxfqi
mogcoxneaqixenxnoqxpdww xdqe jxwixnwxpwhntiq
wfgnnq xeddxnoqxzwbevqxwpxnoqghxdgpq
gjxkwti xgixjoeddwmjxei xgixfgjqhgqj
wixjtcoxexptddxjqexehqxmqxiwmxepdwen
ei xmqxftjnxneaqxnoqxcthhqinxmoqixgnxjqhzqj
whxdwjqxwthxzqinthqj
cejjgtjxnoqixmgnoxbwthxmgddxvwxwi
mqddxedwivxwthjqdzqjxei xfqqnxnoqfxenxyogdgyyg
khtntjxnoqx qqyxwpxigvonxgjxchqynxtywixwthxneda
ei xienthqxftjnxwkqbxiqcqjjgnb
mogcoxmqxmgddxigvveh xmgnoxexdgnndqxhqjn
noqhqxgjxiwxfwhqxnwxjeb
cejjgtjxiwxfwhqxvww xigvon
qehdbxnwfwhhwmxmgddxmqxhgjqxei xoqicq
khtntjxdtcgtj
hqqinqhxdtcgtj
fbxvwmixxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxqugnxdtcgtj
pehqmqddxvww xfqjjede
vww xigvonxngngigtjxiwkdqxiwkdqxcejjgtj
vww xigvonxei xvww xhqywjq
cejjgtjxwxfbx qehxkhwnoqh
nogjxmejxeixgddxkqvgiigivxwpxnoqxigvon
iqzqhxcwfqxjtcox gzgjgwixnmqqixwthxjwtdj
dqnxgnxiwnxkhtntj
khtntjxqzqhbnogivxgjxmqdd
cejjgtjxvww xigvonxfbxdwh
khtntjxvww xigvonxvww xkhwnoqh
ngngigtjxfqjjedexvww xigvonxdwh xkhtntj
khtntjxpehqmqddxqzqhbwiq
quqtinxeddxktnxkhtntj
hqqinqhxdtcgtjxmgnoxnoqxvwmi
vgzqxfqxnoqxvwmixmoqhqxgjxnobxgijnhtfqin
dtcgtjxoqhqxgixnoqxnqin
khtntjxmoenxnowtxjyqeajnx hwmjgdb
ywwhxaiezqxgxkdefqxnoqqxiwnxnowtxehnxwqhmenco
ceddxcdet gwxei xjwfqxwnoqhxwpxfbxfqi
gddxoezqxnoqfxjdqqyxwixctjogwijxgixfbxnqin
dtcgtjxzehhwxei xcdet gw
qinqhxzehhwxei xcdet gw
zehhwxceddjxfbxdwh
khtntjxgxyhebxbwtxjghjxdgqxgixfbxnqinxei xjdqqy
gnxfebxkqxgxjoeddxhegjqxbwtxkbxei xkb
wixktjgiqjjxnwxfbxkhwnoqhxcejjgtj
zehhwxjwxydqejqxbwtxmqxmgddxjnei xei xmencoxbwthxydqejthq
khtntjxgxmwtd xiwnxoezqxgnxjwxdgqx wmixvww xjghj
gnxfebxkqxgxjoeddxwnoqhmgjqxkqnogiaxfq
dwwaxdtcgtjxoqhqjxnoqxkwwaxgxjwtvonxpwhxjw
gxytnxgnxgixnoqxywcaqnxwpxfbxvwmi
zehhwxei xcdet gwxdgqx wmi
dtcgtjxgxmejxjthqxbwthxdwh jogyx g xiwnxvgzqxgnxfq
khtntjxkqehxmgnoxfqxvww xkwbxgxefxftcoxpwhvqnptd
ceijnxnowtxowd xtyxnobxoqezbxqbqjxemogdq
ei xnwtcoxnobxgijnhtfqinxexjnhegixwhxnmw
dtcgtjxebxfbxdwh xeinxydqejqxbwt
khtntjxgnx wqjxfbxkwb
gxnhwtkdqxnoqqxnwwxftcoxktnxnowtxehnxmgddgiv
dtcgtjxgnxgjxfbx tnbxjgh
khtntjxgxjowtd xiwnxthvqxnobx tnbxyejnxnobxfgvon
gxaiwmxbwtivxkdww jxdwwaxpwhxexngfqxwpxhqjn
dtcgtjxgxoezqxjdqynxfbxdwh xedhqe b
khtntjxgnxmejxmqddx wiqxei xnowtxjoednxjdqqyxevegi
gxmgddxiwnxowd xnoqqxdwivxgpxgx wxdgzq
gxmgddxkqxvww xnwxnoqqxxxxxxxxxxxxxxxxxxxftjgcxei xexjwiv
nogjxgjxexjdqqybxntiqxwxfthnoqhwtjxjdtfkqh
debqjnxnowtxnobxdqe qixfecqxtywixfbxkwb
noenxydebjxnoqqxftjgcxvqindqxaiezqxvww xigvon
gxmgddxiwnx wxnoqqxjwxftcoxmhwivxnwxmeaqxnoqq
gpxnowtx wjnxiw xnowtxkhqeajnxnobxgijnhtfqin
gddxneaqxgnxphwfxnoqqxei xvww xkwbxvww xigvon
dqnxfqxjqqxdqnxfqxjqqxgjxiwnxnoqxdqepxnthi x wmi
moqhqxgxdqpnxhqe givxoqhqxgnxgjxgxnogiaxxxxxxxxjgnjx wmi
qinqhxnoqxvowjnxwpxceqjeh
owmxgddxnogjxneyqhxkthijxoexmowxcwfqjxoqhq
gxnogiaxgnxgjxnoqxmqeaiqjjxwpxfgiqxqbqj
noenxjoeyqjxnogjxfwijnhwtjxeyyehgngwi
gnxcwfqjxtywixfqxehnxnowtxeibnogiv
ehnxnowtxjwfqxvw xjwfqxeivqdxwhxjwfqx qzgd
noenxfeaqjnxfbxkdww xcwd xei xfbxoeghxnwxjnehq
jyqeaxnwxfqxmoenxnowtxehn
vowjnxnobxqzgdxjyghgnxkhtntj
khtntjxmobxcwfqjnxnowt
vowjnxnwxnqddxnoqqxnowtxjoednxjqqxfqxenxyogdgyyg
khtntjxmqddxnoqixgxjoeddxjqqxnoqqxevegi
vowjnxebxenxyogdgyyg
khtntjxmobxgxmgddxjqqxnoqqxenxyogdgyygxnoqixxxxxqugnxvowjn
iwmxgxoezqxneaqixoqehnxnowtxzeigjoqjn
gddxjyghgnxgxmwtd xowd xfwhqxnedaxmgnoxnoqq
kwbxdtcgtjxzehhwxcdet gwxjghjxemeaq
cdet gw
dtcgtjxnoqxjnhgivjxfbxdwh xehqxpedjq
khtntjxoqxnogiajxoqxjngddxgjxenxogjxgijnhtfqin
dtcgtjxemeaq
dtcgtjxfbxdwh
khtntjx g jnxnowtx hqefxdtcgtjxnoenxnowtxjwxchgq jnxwtn
dtcgtjxfbxdwh xgx wxiwnxaiwmxnoenxgx g xchb
khtntjxbqjxnoenxnowtx g jnx g jnxnowtxjqqxeibnogiv
dtcgtjxiwnogivxfbxdwh
khtntjxjdqqyxevegixdtcgtjxjghheoxcdet gw
nwxzehhwxpqddwmxnowtxemeaq
zehhwxfbxdwh
cdet gwxfbxdwh
khtntjxmobx g xbwtxjwxchbxwtnxjghjxgixbwthxjdqqy
zehhwxcdet gwx g xmqxfbxdwh
khtntjxebxjemxbwtxeibnogiv
zehhwxiwxfbxdwh xgxjemxiwnogiv
cdet gwxiwhxgxfbxdwh
khtntjxvwxei xcwffqi xfqxnwxfbxkhwnoqhxcejjgtj
kg xogfxjqnxwixogjxywmqhjxkqngfqjxkqpwhq
ei xmqxmgddxpwddwm
zehhwxcdet gwxgnxjoeddxkqx wiqxfbxdwh xxxxxxxxxxxxxquqtin
ecnxzxjcqiqxg
noqxydegijxwpxyogdgyyg
qinqhxwcnezgtjxeinwibxei xnoqghxehfb
wcnezgtjxiwmxeinwibxwthxowyqjxehqxeijmqhq
bwtxjeg xnoqxqiqfbxmwtd xiwnxcwfqx wmi
ktnxaqqyxnoqxogddjxei xtyyqhxhqvgwij
gnxyhwzqjxiwnxjwxnoqghxkenndqjxehqxenxoei
noqbxfqeixnwxmehixtjxenxyogdgyygxoqhq
eijmqhgivxkqpwhqxmqx wx qfei xwpxnoqf
einwibxntnxgxefxgixnoqghxkwjwfjxei xgxaiwm
moqhqpwhqxnoqbx wxgnxnoqbxcwtd xkqxcwinqin
nwxzgjgnxwnoqhxydecqjxei xcwfqx wmi
mgnoxpqehptdxkhezqhbxnogiagivxkbxnogjxpecq
nwxpejnqixgixwthxnowtvonjxnoenxnoqbxoezqxcwthevq
ktnxngjxiwnxjw
qinqhxexfqjjqivqh
fqjjqivqhxyhqyehqxbwtxvqiqhedj
noqxqiqfbxcwfqjxwixgixveddeinxjowm
noqghxkdww bxjgvixwpxkenndqxgjxotivxwtn
ei xjwfqnogivxnwxkqx wiqxgffq genqdb
einwibxwcnezgtjxdqe xbwthxkenndqxjwpndbxwi
tywixnoqxdqpnxoei xwpxnoqxqzqixpgqd
wcnezgtjxtywixnoqxhgvonxoei xgxaqqyxnowtxnoqxdqpn
einwibxmobx wxbwtxchwjjxfqxgixnogjxqugvqin
wcnezgtjxgx wxiwnxchwjjxbwtxktnxgxmgddx wxjw
fehcox htfxqinqhxkhtntjxcejjgtjxei xnoqghxehfb
dtcgdgtjxngngigtjxfqjjedexei xwnoqhj
khtntjxnoqbxjnei xei xmwtd xoezqxyehdqb
cejjgtjxjnei xpejnxngngigtjxmqxftjnxwtnxei xneda
wcnezgtjxfehaxeinwibxjoeddxmqxvgzqxjgvixwpxkenndq
einwibxiwxceqjehxmqxmgddxeijmqhxwixnoqghxcoehvq
feaqxpwhnoxnoqxvqiqhedjxmwtd xoezqxjwfqxmwh j
wcnezgtjxjnghxiwnxtingdxnoqxjgviedxiwnxtingdxnoqxjgvied
khtntjxmwh jxkqpwhqxkdwmjxgjxgnxjwxcwtinhbfqi
wcnezgtjxiwnxnoenxmqxdwzqxmwh jxkqnnqhxejxbwtx w
khtntjxvww xmwh jxehqxkqnnqhxnoeixke xjnhwaqjxwcnezgtj
einwibxgixbwthxke xjnhwaqjxkhtntjxbwtxvgzqxvww xmwh j
mgniqjjxnoqxowdqxbwtxfe qxgixceqjehjxoqehn
chbgivxdwivxdgzqxoegdxceqjeh
cejjgtjxeinwib
noqxywjnthqxwpxbwthxkdwmjxehqxbqnxtiaiwmi
ktnxpwhxbwthxmwh jxnoqbxhwkxnoqxobkdexkqqj
ei xdqezqxnoqfxowiqbdqjj
einwibxiwnxjngivdqjjxnww
khtntjxwxbqjxei xjwti dqjjxnww
pwhxbwtxoezqxjnwdixnoqghxktssgivxeinwib
ei xzqhbxmgjqdbxnohqenxkqpwhqxbwtxjngiv
einwibxzgddegijxbwtx g xiwnxjwxmoqixbwthxzgdqx evvqhj
oeca xwiqxeiwnoqhxgixnoqxjg qjxwpxceqjeh
bwtxjowm xbwthxnqqnoxdgaqxeyqjxei xpemi xdgaqxowti j
ei xkwm xdgaqxkwi fqixagjjgivxceqjehjxpqqn
mogdjnx efiq xcejcexdgaqxexcthxkqogi
jnhwwaqxceqjehxwixnoqxiqcaxwxbwtxpdennqhqhj
cejjgtjxpdennqhqhjxiwmxkhtntjxnoeiaxbwthjqdp
nogjxnwivtqxoe xiwnxwppqi q xjwxnw eb
gpxcejjgtjxfgvonxoezqxhtdq
wcnezgtjxcwfqxcwfqxnoqxcetjqxgpxehvtgivxfeaqxtjxjmqen
noqxyhwwpxwpxgnxmgddxnthixnwxhq qhx hwyj
dwwa
gx hemxexjmwh xevegijnxcwijyghenwhj
moqixnogiaxbwtxnoenxnoqxjmwh xvwqjxtyxevegi
iqzqhxngddxceqjehjxnohqqxei xnoghnbxmwti j
kqxmqddxezqivq xwhxngddxeiwnoqhxceqjeh
oezqxe q xjdetvonqhxnwxnoqxjmwh xwpxnhegnwhj
khtntjxceqjehxnowtxceijnxiwnx gqxkbxnhegnwhjxoei j
tidqjjxnowtxkhgivjnxnoqfxmgnoxnoqq
wcnezgtjxjwxgxowyq
gxmejxiwnxkwhixnwx gqxwixkhtntjxjmwh
khtntjxwxgpxnowtxmqhnxnoqxiwkdqjnxwpxnobxjnhegi
bwtivxfeixnowtxcwtd jnxiwnx gqxfwhqxowiwhekdq
cejjgtjxexyqqzgjoxjcowwdxkwbxmwhnodqjjxwpxjtcoxowiwh
lwgi xmgnoxexfejaqhxei xexhqzqdqh
einwibxwd xcejjgtjxjngdd
wcnezgtjxcwfqxeinwibxemeb
qpgeicqxnhegnwhjxothdxmqxgixbwthxnqqno
gpxbwtx ehqxpgvonxnw ebxcwfqxnwxnoqxpgqd
gpxiwnxmoqixbwtxoezqxjnwfecoj
quqtinxwcnezgtjxeinwibxei xnoqghxehfb
cejjgtjxmobxiwmxkdwmxei xjmqddxkgddwmxei xjmgfxkeha
noqxjnwhfxgjxtyxei xeddxgjxwixnoqxoeseh
khtntjxowxdtcgdgtjxoehaxexmwh xmgnoxbwt
dtcgdgtjxjnei jxpwhnoxfbxdwh
khtntjxei xdtcgdgtjxcwizqhjqxeyehn
cejjgtjxfqjjede
fqjjedexjnei jxpwhnoxmoenxjebjxfbxvqiqhed
cejjgtjxfqjjede
nogjxgjxfbxkghno ebxejxnogjxzqhbx eb
mejxcejjgtjxkwhixvgzqxfqxnobxoei xfqjjede
kqxnowtxfbxmgniqjjxnoenxevegijnxfbxmgdd
ejxywfyqbxmejxefxgxcwfyqdd xnwxjqn
tywixwiqxkenndqxeddxwthxdgkqhngqj
bwtxaiwmxnoenxgxoqd xqygcthtjxjnhwiv
ei xogjxwygigwixiwmxgxcoeivqxfbxfgi
ei xyehndbxchq gnxnogivjxnoenx wxyhqjevq
cwfgivxphwfxjeh gjxwixwthxpwhfqhxqijgvi
nmwxfgvonbxqevdqjxpqddxei xnoqhqxnoqbxyqhco
vwhvgivxei xpqq givxphwfxwthxjwd gqhjxoei j
mowxnwxyogdgyygxoqhqxcwijwhnq xtj
nogjxfwhigivxehqxnoqbxpdq xemebxei xvwiq
ei xgixnoqghxjnqe jx wxhezqijxchwmjxei xagnqj
pdbxwqhxwthxoqe jxei x wmimeh xdwwaxwixtj
ejxmqxmqhqxjgcadbxyhqbxnoqghxjoe wmjxjqqf
exceiwybxfwjnxpenedxti qhxmogco
wthxehfbxdgqjxhqe bxnwxvgzqxtyxnoqxvowjn
fqjjedexkqdgqzqxiwnxjw
cejjgtjxgxktnxkqdgqzqxgnxyehndb
pwhxgxefxphqjoxwpxjyghgnxei xhqjwdzq
nwxfqqnxeddxyqhgdjxzqhbxcwijneindb
khtntjxqzqixjwxdtcgdgtj
cejjgtjxiwmxfwjnxiwkdqxkhtntj
noqxvw jxnw ebxjnei xphgqi dbxnoenxmqxfeb
dwzqhjxgixyqecqxdqe xwixwthx ebjxnwxevq
ktnxjgicqxnoqxeppeghjxwpxfqixhqjnxjngddxgicqhnegi
dqnjxhqejwixmgnoxnoqxmwhjnxnoenxfebxkqpedd
gpxmqx wxdwjqxnogjxkenndqxnoqixgjxnogj
noqxzqhbxdejnxngfqxmqxjoeddxjyqeaxnwvqnoqh
moenxehqxbwtxnoqix qnqhfgiq xnwx w
khtntjxqzqixkbxnoqxhtdqxwpxnoenxyogdwjwyob
kbxmogcoxgx g xkdefqxcenwxpwhxnoqx qeno
mogcoxoqx g xvgzqxogfjqdpxgxaiwmxiwnxowm
ktnxgx wxpgi xgnxcwmeh dbxei xzgdq
pwhxpqehxwpxmoenxfgvonxpeddxjwxnwxyhqzqin
noqxngfqxwpxdgpqxehfgivxfbjqdpxmgnoxyengqicq
nwxjnebxnoqxyhwzg qicqxwpxjwfqxogvoxywmqhj
noenxvwzqhixtjxkqdwm
cejjgtjxnoqixgpxmqxdwjqxnogjxkenndq
bwtxehqxcwinqinq xnwxkqxdq xgixnhgtfyo
nowhwtvoxnoqxjnhqqnjxwpxhwfq
khtntjxiwxcejjgtjxiwxnogiaxiwnxnowtxiwkdqxhwfei
noenxqzqhxkhtntjxmgddxvwxkwti xnwxhwfq
oqxkqehjxnwwxvhqenxexfgi xktnxnogjxjefqx eb
ftjnxqi xnoenxmwhaxnoqxg qjxwpxfehcoxkqvti
ei xmoqnoqhxmqxjoeddxfqqnxevegixgxaiwmxiwn
noqhqpwhqxwthxqzqhdejngivxpehqmqddxneaq
pwhqzqhxei xpwhqzqhxpehqmqddxcejjgtj
gpxmqx wxfqqnxevegixmobxmqxjoeddxjfgdq
gpxiwnxmobxnoqixnogjxyehngivxmejxmqddxfe q
cejjgtjxpwhqzqhxei xpwhqzqhxpehqmqddxkhtntj
gpxmqx wxfqqnxevegixmqddxjfgdqxgi qq
gpxiwnxngjxnhtqxnogjxyehngivxmejxmqddxfe q
khtntjxmobxnoqixdqe xwixwxnoenxexfeixfgvonxaiwm
noqxqi xwpxnogjx ebjxktjgiqjjxqhqxgnxcwfq
ktnxgnxjtppgcqnoxnoenxnoqx ebxmgddxqi
ei xnoqixnoqxqi xgjxaiwmixcwfqxowxemebxxxxxxxxxxxquqtin
jcqiqxgg
noqxpgqd xwpxkenndq
edehtfxqinqhxkhtntjxei xfqjjede
khtntjxhg qxhg qxfqjjedexhg qxei xvgzqxnoqjqxkgddj
tinwxnoqxdqvgwijxwixnoqxwnoqhxjg qxxxxxxxxxxxxxdwt xedehtf
dqnxnoqfxjqnxwixenxwicqxpwhxgxyqhcqgzq
ktnxcwd x qfqeiwhxgixwcnezgejxmgiv
ei xjt qixytjoxvgzqjxnoqfxnoqxwzqhnohwm
hg qxhg qxfqjjedexdqnxnoqfxeddxcwfqx wmixxxxxxxxxquqtin
jcqiqxggg
eiwnoqhxyehnxwpxnoqxpgqd
edehtfjxqinqhxcejjgtjxei xngngigtj
cejjgtjxwxdwwaxngngigtjxdwwaxnoqxzgddegijxpdb
fbjqdpxoezqxnwxfgiqxwmixnthi xqiqfb
nogjxqijgvixoqhqxwpxfgiqxmejxnthigivxkeca
gxjdqmxnoqxcwmeh xei x g xneaqxgnxphwfxogf
ngngigtjxwxcejjgtjxkhtntjxvezqxnoqxmwh xnwwxqehdb
mowxoezgivxjwfqxe zeinevqxwixwcnezgtj
nwwaxgnxnwwxqevqhdbxogjxjwd gqhjxpqddxnwxjywgd
mogdjnxmqxkbxeinwibxehqxeddxqicdwjq
qinqhxygi ehtj
ygi ehtjxpdbxpthnoqhxwppxfbxdwh xpdbxpthnoqhxwpp
fehaxeinwibxgjxgixbwthxnqinjxfbxdwh
pdbxnoqhqpwhqxiwkdqxcejjgtjxpdbxpehxwpp
cejjgtjxnogjxogddxgjxpehxqiwtvoxdwwaxdwwaxngngigtj
ehqxnowjqxfbxnqinjxmoqhqxgxyqhcqgzqxnoqxpghq
ngngigtjxnoqbxehqxfbxdwh
cejjgtjxngngigtjxgpxnowtxdwzqjnxfq
fwtinxnowtxfbxowhjqxei xog qxnobxjythjxgixogf
ngddxoqxoezqxkhwtvonxnoqqxtyxnwxbwi qhxnhwwyj
ei xoqhqxevegixnoenxgxfebxhqjnxejjthq
moqnoqhxbwi xnhwwyjxehqxphgqi xwhxqiqfb
ngngigtjxgxmgddxkqxoqhqxevegixqzqixmgnoxexnowtvonxxxxxqugn
cejjgtjxvwxygi ehtjxvqnxogvoqhxwixnoenxogdd
fbxjgvonxmejxqzqhxnogcaxhqveh xngngigtj
ei xnqddxfqxmoenxnowtxiwnqjnxekwtnxnoqxpgqd
ygi ehtjxejcqi jxnoqxogdd
nogjx ebxgxkhqenoq xpghjnxngfqxgjxcwfqxhwti
ei xmoqhqxgx g xkqvgixnoqhqxjoeddxgxqi
fbxdgpqxgjxhtixogjxcwfyejjxjghheoxmoenxiqmj
ygi ehtjxekwzqxwxfbxdwh
cejjgtjxmoenxiqmj
ygi ehtjxekwzqxngngigtjxgjxqicdwjq xhwti xekwtn
mgnoxowhjqfqixnoenxfeaqxnwxogfxwixnoqxjyth
bqnxoqxjythjxwixiwmxnoqbxehqxedfwjnxwixogf
iwmxngngigtjxiwmxjwfqxdgvonxwxoqxdgvonjxnww
oqjxneqixjowtnxei xoehaxnoqbxjowtnxpwhxlwb
cejjgtjxcwfqx wmixkqowd xiwxfwhq
wxcwmeh xnoenxgxefxnwxdgzqxjwxdwiv
nwxjqqxfbxkqjnxphgqi xneqixkqpwhqxfbxpecq
ygi ehtjx qjcqi j
cwfqxognoqhxjghheo
gixyehnogex g xgxneaqxnoqqxyhgjwiqh
ei xnoqixgxjmwhqxnoqqxjezgivxwpxnobxdgpq
noenxmoenjwqzqhxgx g xkg xnoqqx w
nowtxjowtd jnxennqfynxgnxcwfqxiwmxaqqyxnogiqxweno
iwmxkqxexphqqfeixei xmgnoxnogjxvww xjmwh
noenxheixnohwtvoxceqjehjxkwmqdjxjqehcoxnogjxkwjwf
jnei xiwnxnwxeijmqhxoqhqxneaqxnowtxnoqxogdnj
ei xmoqixfbxpecqxgjxcwzqh xejxngjxiwm
vtg qxnowtxnoqxjmwh xygi ehtjxjnekjxogfxceqjehxnowtxehn
hqzqivq
qzqixmgnoxnoqxjmwh xnoenxagdd xnoqqxxxxxxxxxxxxxxxxxx gqj
ygi ehtjxjwxgxefxphqqxbqnxmwtd xiwnxjwxoezqxkqqi
thjnxgxoezqx wiqxfbxmgddxwxcejjgtj
pehxphwfxnogjxcwtinhbxygi ehtjxjoeddxhti
moqhqxiqzqhxhwfeixjoeddxneaqxiwnqxwpxogfxxxxxxxxxxxxxxqugn
hqqinqhxngngigtjxmgnoxfqjjede
fqjjedexgnxgjxktnxcoeivqxngngigtjxpwhxwcnezgtj
gjxwzqhnohwmixkbxiwkdqxkhtntjxywmqh
ejxcejjgtjxdqvgwijxehqxkbxeinwib
ngngigtjxnoqjqxng givjxmwtd xmqddxcwfpwhnxcejjgtj
fqjjedexmoqhqx g xbwtxdqezqxogf
ngngigtjxeddx gjcwijwdenq
mgnoxygi ehtjxogjxkwi feixwixnogjxogdd
fqjjedexgjxiwnxnoenxoqxnoenxdgqjxtywixnoqxvhwti
ngngigtjxoqxdgqjxiwnxdgaqxnoqxdgzgivxwxfbxoqehn
fqjjedexgjxiwnxnoenxoq
ngngigtjxiwxnogjxmejxoqxfqjjede
ktnxcejjgtjxgjxiwxfwhqxwxjqnngivxjti
ejxgixnobxhq xhebjxnowtx wjnxjgiaxnwxigvon
jwxgixogjxhq xkdww xcejjgtjx ebxgjxjqn
noqxjtixwpxhwfqxgjxjqnxwthx ebxgjxvwiq
cdwt jx qmjxei x eivqhjxcwfqxwthx qq jxehqx wiq
fgjnhtjnxwpxfbxjtccqjjxoenox wiqxnogjx qq
fqjjedexfgjnhtjnxwpxvww xjtccqjjxoenox wiqxnogjx qq
wxoenqptdxqhhwhxfqdeicowdbjxcogd
mobx wjnxnowtxjowmxnwxnoqxeynxnowtvonjxwpxfqi
noqxnogivjxnoenxehqxiwnxwxqhhwhxjwwixcwicqgzq
nowtxiqzqhxcwfqjnxtinwxexoeyybxkghno
ktnxagddjnxnoqxfwnoqhxnoenxqivqi qh xnoqq
ngngigtjxmoenxygi ehtjxmoqhqxehnxnowtxygi ehtj
fqjjedexjqqaxogfxngngigtjxmogdjnxgxvwxnwxfqqn
noqxiwkdqxkhtntjxnohtjngivxnogjxhqywhn
ginwxogjxqehjxgxfebxjebxnohtjngivxgn
pwhxygqhcgivxjnqqdxei x ehnjxqizqiwfq
joeddxkqxejxmqdcwfqxnwxnoqxqehjxwpxkhtntj
ejxng givjxwpxnogjxjgvon
ngngigtjxogqxbwtxfqjjede
ei xgxmgddxjqqaxpwhxygi ehtjxnoqxmogdqxxxxxxxxqugnxfqjjede
mobx g jnxnowtxjqi xfqxpwhnoxkhezqxcejjgtj
g xgxiwnxfqqnxnobxphgqi jxei x g xiwnxnoqb
ytnxwixfbxkhwmjxnogjxmhqenoxwpxzgcnwhb
ei xkg xfqxvgzqxgnxnoqqx g jnxnowtxiwnxoqehxnoqghxjowtnj
edejxnowtxoejnxfgjcwijnhtq xqzqhbnogiv
ktnxowd xnoqqxneaqxnogjxvehdei xwixnobxkhwm
nobxkhtntjxkg xfqxvgzqxgnxnoqqxei xg
mgddx wxogjxkg givxkhtntjxcwfqxeyecq
ei xjqqxowmxgxhqveh q xcegtjxcejjgtj
kbxbwthxdqezqxvw jxnogjxgjxexhwfeijxyehn
cwfqxcejjgtjxjmwh xei xpgi xngngigtjxoqehn
agddjxogfjqdp
edehtfxhqqinqhxfqjjedexmgnoxkhtntjxbwtivxcenw
ei xwnoqhj
khtntjxmoqhqxmoqhqxfqjjedex wnoxogjxkw bxdgq
fqjjedexdwxbwi qhxei xngngigtjxfwthigivxgn
khtntjxngngigtjxpecqxgjxtymeh
cenwxoqxgjxjdegi
khtntjxwxltdgtjxceqjehxnowtxehnxfgvonbxbqn
nobxjyghgnxmedajxekhwe xei xnthijxwthxjmwh j
gixwthxwmixyhwyqhxqinhegdjxxxxxxxxxxxxxxxxxxxxxdwmxedehtfj
cenwxkhezqxngngigtj
dwwaxmoqqhxoqxoezqxiwnxchwmi x qe xcejjgtj
khtntjxehqxbqnxnmwxhwfeijxdgzgivxjtcoxejxnoqjq
noqxdejnxwpxeddxnoqxhwfeijxpehqxnoqqxmqdd
gnxgjxgfywjjgkdqxnoenxqzqhxhwfq
jowtd xkhqq xnobxpqddwmxphgqi jxgxwmqxfwqxnqehj
nwxnogjx qe xfeixnoeixbwtxjoeddxjqqxfqxyeb
gxjoeddxpgi xngfqxcejjgtjxgxjoeddxpgi xngfq
cwfqxnoqhqpwhqxei xnwxnoejwjxjqi xogjxkw b
ogjxptiqhedjxjoeddxiwnxkqxgixwthxcefy
dqjnxgnx gjcwfpwhnxtjxdtcgdgtjxcwfq
ei xcwfqxbwtivxcenwxdqnxtjxnwxnoqxpgqd
dekgwxei xpdezgwxjqnxwthxkenndqjxwi
ngjxnohqqxwcdwcaxei xhwfeijxbqnxqhqxigvon
mqxjoeddxnhbxpwhntiqxgixexjqcwi xpgvonxxxxxxxxxxxxxxquqtin
jcqiqxgz
eiwnoqhxyehnxwpxnoqxpgqd
edehtfxqinqhxpgvongivxjwd gqhjxwpxkwnoxehfgqjxnoqixkhtntjxbwtivxcenw
dtcgdgtjxei xwnoqhj
khtntjxbqnxcwtinhbfqixwxbqnxowd xtyxbwthxoqe j
cenwxmoenxkejneh x wnoxiwnxmowxmgddxvwxmgnoxfq
gxmgddxyhwcdegfxfbxiefqxekwtnxnoqxpgqd
gxefxnoqxjwixwpxfehctjxcenwxow
expwqxnwxnbheinjxei xfbxcwtinhbjxphgqi
gxefxnoqxjwixwpxfehctjxcenwxow
khtntjxei xgxefxkhtntjxfehctjxkhtntjxg
khtntjxfbxcwtinhbjxphgqi xaiwmxfqxpwhxkhtntjxxxxxxxqugn
dtcgdgtjxwxbwtivxei xiwkdqxcenwxehnxnowtx wmi
mobxiwmxnowtx gqjnxejxkhezqdbxejxngngigtj
ei xfebjnxkqxowiwh xkqgivxcenwjxjwi
pghjnxjwd gqhxbgqd xwhxnowtx gqjn
dtcgdgtjxwidbxgxbgqd xnwx gq
wppqhjxfwiqbxnoqhqxgjxjwxftcoxnoenxnowtxmgdnxagddxfqxjnhegvon
agddxkhtntjxei xkqxowiwh xgixogjx qeno
pghjnxjwd gqhxmqxftjnxiwnxexiwkdqxyhgjwiqh
jqcwi xjwd gqhxhwwfxowxnqddxeinwibxkhtntjxgjxneqi
pghjnxjwd gqhxgddxnqddxnoqxiqmjxoqhqxcwfqjxnoqxvqiqhed
qinqhxeinwib
khtntjxgjxneqixkhtntjxgjxneqixfbxdwh
einwibxmoqhqxgjxoq
dtcgdgtjxjepqxeinwibxkhtntjxgjxjepqxqiwtvo
gx ehqxejjthqxnoqqxnoenxiwxqiqfb
joeddxqzqhxneaqxedgzqxnoqxiwkdqxkhtntj
noqxvw jx qpqi xogfxphwfxjwxvhqenxexjoefq
moqixbwtx wxpgi xogfxwhxedgzqxwhx qe
oqxmgddxkqxpwti xdgaqxkhtntjxdgaqxogfjqdp
einwibxnogjxgjxiwnxkhtntjxphgqi xktnxgxejjthqxbwt
exyhgsqxiwxdqjjxgixmwhnoxaqqyxnogjxfeixjepq
vgzqxogfxeddxagi iqjjxgxoe xhenoqhxoezq
jtcoxfqixfbxphgqi jxnoeixqiqfgqjxvwxwi
ei xjqqxmoqqhxkhtntjxkqxedgzqxwhx qe
ei xkhgivxtjxmwh xtinwxwcnezgtjxnqin
owmxqzqhbnogivxgjxcoeicq xxxxxxxxxxxxxxxxxxxxxxxxxxxquqtin
jcqiqxz
eiwnoqhxyehnxwpxnoqxpgqd
qinqhxkhtntjx eh eigtjxcdgntjxjnhenwxei xzwdtfigtj
khtntjxcwfqxywwhxhqfegijxwpxphgqi jxhqjnxwixnogjxhwca
cdgntjxjnengdgtjxjowm xnoqxnwhcodgvonxktnxfbxdwh
oqxcefqxiwnxkecaxoqxgjxwhxneqixwhxjdegi
khtntjxjgnxnoqqx wmixcdgntjxjdebgivxgjxnoqxmwh
gnxgjxex qq xgixpejogwixoehaxnoqqxcdgntjxxxxxxxxmogjyqhj
cdgntjxmoenxgxfbxdwh xiwxiwnxpwhxeddxnoqxmwhd
khtntjxyqecqxnoqixiwxmwh j
cdgntjxgddxhenoqhxagddxfbjqdp
khtntjxoehaxnoqqx eh eigtjxxxxxxxxxxxxxxxxxxxxxxxxmogjyqhj
eh eigtjxjoeddxgx wxjtcoxex qq
cdgntjxwx eh eigtj
eh eigtjxwxcdgntj
cdgntjxmoenxgddxhqrtqjnx g xkhtntjxfeaqxnwxnoqq
eh eigtjxnwxagddxogfxcdgntjxdwwaxoqxfq gnenqj
cdgntjxiwmxgjxnoenxiwkdqxzqjjqdxptddxwpxvhgqp
noenxgnxhtijxwzqhxqzqixenxogjxqbqj
khtntjxcwfqxognoqhxvww xzwdtfigtjxdgjnxexmwh
zwdtfigtjxmoenxjebjxfbxdwh
khtntjxmobxnogjxzwdtfigtj
noqxvowjnxwpxceqjehxoenoxeyyqeh xnwxfq
nmwxjqzqhedxngfqjxkbxigvonxenxjeh gjxwicq
ei xnogjxdejnxigvonxoqhqxgixyogdgyygxpgqd j
gxaiwmxfbxowthxgjxcwfq
zwdtfigtjxiwnxjwxfbxdwh
khtntjxiebxgxefxjthqxgnxgjxzwdtfigtj
nowtxjqqjnxnoqxmwhd xzwdtfigtjxowmxgnxvwqj
wthxqiqfgqjxoezqxkqenxtjxnwxnoqxygnxxxxxxxxxxxxdwmxedehtfj
gnxgjxfwhqxmwhnobxnwxdqeyxgixwthjqdzqj
noeixnehhbxngddxnoqbxytjoxtjxvww xzwdtfigtj
nowtxaiwmjnxnoenxmqxnmwxmqinxnwxjcowwdxnwvqnoqh
qzqixpwhxnoenxwthxdwzqxwpxwd xgxyhgnoqq
owd xnowtxfbxjmwh ogdnjxmogdjnxgxhtixwixgn
zwdtfigtjxnoenjxiwnxeixwppgcqxpwhxexphgqi xfbxdwh
edehtfxjngdd
cdgntjxpdbxpdbxfbxdwh xnoqhqxgjxiwxnehhbgivxoqhq
khtntjxpehqmqddxnwxbwtxei xbwtxei xbwtxzwdtfigtj
jnhenwxnowtxoejnxkqqixeddxnogjxmogdqxejdqqy
pehqmqddxnwxnoqqxnwwxjnhenwxcwtinhbfqi
fbxoqehnx wnoxlwbxnoenxbqnxgixeddxfbxdgpq
gxpwti xiwxfeixktnxoqxmejxnhtqxnwxfq
gxjoeddxoezqxvdwhbxkbxnogjxdwjgivx eb
fwhqxnoeixwcnezgtjxei xfehaxeinwib
kbxnogjxzgdqxcwirtqjnxjoeddxennegixtinw
jwxpehqxbwtxmqddxenxwicqxpwhxkhtntjxnwivtq
oenoxedfwjnxqi q xogjxdgpqjxogjnwhb
igvonxoeivjxtywixfgiqxqbqjxfbxkwiqjxmwtd xhqjn
noenxoezqxktnxdekwh xnwxennegixnogjxowth
edehtfxchbxmgnogixpdbxpdbxpdb
cdgntjxpdbxfbxdwh xpdb
khtntjxoqicqxgxmgddxpwddwm
quqtinxcdgntjx eh eigtjxei xzwdtfigtj
gxyhgnoqqxjnhenwxjnebxnowtxkbxnobxdwh
nowtxehnxexpqddwmxwpxexvww xhqjyqcn
nobxdgpqxoenoxoe xjwfqxjfencoxwpxowiwhxgixgn
owd xnoqixfbxjmwh xei xnthixemebxnobxpecq
mogdqxgx wxhtixtywixgnxmgdnxnowtxjnhenw
jnhenwxvgzqxfqxbwthxoei xpghjnxpehqxbwtxmqddxfbxdwh
khtntjxpehqmqddxvww xjnhenwxxxxxxxxxxxxxxhtijxwixogjxjmwh
ceqjehxiwmxkqxjngdd
gxagdd xiwnxnoqqxmgnoxoedpxjwxvww xexmgddxxxxxxxxxxxx gqj
edehtfxhqnhqenxqinqhxwcnezgtjxeinwibxfqjjede
dtcgdgtjxei xnoqxehfb
wcnezgtjxmoenxfeixgjxnoen
fqjjedexfbxfejnqhjxfeixjnhenwxmoqhqxgjxnobxfejnqh
jnhenwxphqqxphwfxnoqxkwi evqxbwtxehqxgixfqjjede
noqxcwirtqhwhjxceixktnxfeaqxexpghqxwpxogf
pwhxkhtntjxwidbxwzqhcefqxogfjqdp
ei xiwxfeixqdjqxoenoxowiwhxkbxogjx qeno
dtcgdgtjxjwxkhtntjxjowtd xkqxpwti xgxnoeiaxnoqqxkhtntj
noenxnowtxoejnxyhwzq xdtcgdgtjxjebgivxnhtq
wcnezgtjxeddxnoenxjqhzq xkhtntjxgxmgddxqinqhnegixnoqf
pqddwmxmgdnxnowtxkqjnwmxnobxngfqxmgnoxfq
jnhenwxebxgpxfqjjedexmgddxyhqpqhxfqxnwxbwt
wcnezgtjx wxjwxvww xfqjjede
fqjjedexowmx gq xfbxfejnqhxjnhenw
jnhenwxgxoqd xnoqxjmwh xei xoqx g xhtixwixgn
fqjjedexwcnezgtjxnoqixneaqxogfxnwxpwddwmxnoqq
noenx g xnoqxdenqjnxjqhzgcqxnwxfbxfejnqh
einwibxnogjxmejxnoqxiwkdqjnxhwfeixwpxnoqfxedd
eddxnoqxcwijyghenwhjxjezqxwidbxoq
g xnoenxnoqbx g xgixqizbxwpxvhqenxceqjeh
oqxwidbxgixexvqiqhedxowiqjnxnowtvon
ei xcwffwixvww xnwxeddxfe qxwiqxwpxnoqf
ogjxdgpqxmejxvqindqxei xnoqxqdqfqinj
jwxfgu xgixogfxnoenxienthqxfgvonxjnei xty
ei xjebxnwxeddxnoqxmwhd xnogjxmejxexfei
wcnezgtjxeccwh givxnwxogjxzghntqxdqnxtjxtjqxogf
mgnoxeddxhqjyqcnxei xhgnqjxwpxkthged
mgnogixfbxnqinxogjxkwiqjxnwigvonxjoeddxdgq
fwjnxdgaqxexjwd gqhxwh qhq xowiwhekdb
jwxceddxnoqxpgqd xnwxhqjnxei xdqnjxemeb
nwxyehnxnoqxvdwhgqjxwpxnogjxoeyybx ebxxxxxxxxxxxxxxquqtin
noqxqi
noqxnhevq bxwpxagivxdqeh
kbxmgddgefxjoeaqjyqehq
hefengjxyqhjwieq
dqehxagivxwpxkhgnegi
agivxwpxpheicq
taqxwpxkthvti b
taqxwpxcwhimedd
taqxwpxedkeib
qehdxwpxaqin
qehdxwpxvdwtcqjnqh
q vehxjwixwpxvdwtcqjnqh
q fti xkejneh xjwixnwxvdwtcqjnqh
ctheixexcwthngqh
wd xfeixnqieinxnwxvdwtcqjnqh
wcnwh
dqehjxpwwd
wjmed xjnqmeh xnwxvwiqhgd
exceynegixti qhxq fti jxcwffei
vqindqfqi
exoqhed
jqhzeinjxnwxcwhimedd
vwiqhgdx etvonqhxnwxdqeh
hqveix etvonqhxnwxdqeh
cwh qdgex etvonqhxnwxdqeh
aigvonjxennqi givxwixdqehxwppgcqhjxfqjjqivqhjxjwd gqhj
ennqi einj
jcqiqxxkhgnegi
ecnxgxjcqiqxg
agivxdqehjxyedecq
qinqhxaqinxvdwtcqjnqhxei xq fti xaqinxei xvdwtcqjnqxcwizqhjq
q fti xjnei jxkeca
aqinxgxnowtvonxnoqxagivxoe xfwhqxeppqcnq xnoqx taqxwpxedkeibxnoei
cwhimedd
vdwtxgnx g xedmebjxjqqfxjwxnwxtjxktnxiwmxgixnoqx gzgjgwixwpxnoq
agiv wfxgnxeyyqehjxiwnxmogcoxwpxnoqx taqjxoqxzedtqjxfwjnxpwh
qrtedgngqjxehqxjwxmqgvo xnoenxcthgwjgnbxgixiqgnoqhxceixfeaq
cowgcqxwpxqgnoqhjxfwgqnb
aqinxgjxiwnxnogjxbwthxjwixfbxdwh
vdwtxogjxkhqq givxjghxoenoxkqqixenxfbxcoehvqxgxoezqxjwxwpnqi
kdtjo xnwxecaiwmdq vqxogfxnoenxiwmxgxefxkhes xnwn
aqinxgxceiiwnxcwicqgzqxbwt
vdwtxjghxnogjxbwtivxpqddwmjxfwnoqhxcwtd xmoqhqtywixjoqxvhqm
hwti mwfk xei xoe xgi qq xjghxexjwixpwhxoqhxche dqxqhqxjoq
oe xexotjkei xpwhxoqhxkq x wxbwtxjfqddxexpetdn
aqinxgxceiiwnxmgjoxnoqxpetdnxti wiqxnoqxgjjtqxwpxgnxkqgivxjw
yhwyqh
vdwtxktnxgxoezqxjghxexjwixkbxwh qhxwpxdemxjwfqxbqehxqd qhxnoei
nogjxmowxbqnxgjxiwx qehqhxgixfbxeccwtinxnowtvoxnogjxaiezqxcefq
jwfqnogivxjetcgdbxginwxnoqxmwhd xkqpwhqxoqxmejxjqinxpwhxbqnxmej
ogjxfwnoqhxpeghxnoqhqxmejxvww xjywhnxenxogjxfeagivxei xnoq
mowhqjwixftjnxkqxecaiwmdq vq x wxbwtxaiwmxnogjxiwkdqxvqindqfei
q fti
q fxcwfqjxpwhmeh xiwxfbxdwh
vdwtxfbxdwh xwpxaqinxhqfqfkqhxogfxoqhqepnqhxejxfbxowiwthekdq
phgqi
q fxfbxjqhzgcqjxnwxbwthxdwh jogy
aqinxgxftjnxdwzqxbwtxei xjtqxnwxaiwmxbwtxkqnnqh
q fxjghxgxjoeddxjnt bx qjqhzgiv
vdwtxoqxoenoxkqqixwtnxigiqxbqehjxei xemebxoqxjoeddxevegi
jwti xexjqiiqn
noqxagivxgjxcwfgiv
qinqhxwiqxkqehgivxexcwhwiqnxnoqixdqehxnoqixnoqx taqjxwp
edkeibxei xcwhimeddxiqunxvwiqhgdxhqveixcwh qdgexmgno
pwddwmqhj
dqehxennqi xnoqxdwh jxwpxpheicqxei xkthvti bxvdwtcqjnqh
vdwtxgxjoeddxfbxdgqvq
quqtinxvdwtcqjnqhxei xq fti
dqehxfqeingfqxmqxjoeddxquyhqjjxwthx ehaqhxythywjq
vgzqxfqxnoqxfeyxnoqhqxaiwmxmqxoezqx gzg q
gixnohqqxwthxagiv wfxei xngjxwthxpejnxginqin
nwxjoeaqxeddxcehqjxei xktjgiqjjxphwfxwthxevq
cwipqhhgivxnoqfxwixbwtivqhxjnhqivnojxmogdqxmq
tikthnoqi xchemdxnwmeh x qenoxwthxjwixwpxcwhimedd
ei xbwtxwthxiwxdqjjxdwzgivxjwixwpxedkeib
mqxoezqxnogjxowthxexcwijneinxmgddxnwxytkdgjo
wthx etvonqhjxjqzqhedx wmqhjxnoenxptnthqxjnhgpq
febxkqxyhqzqinq xiwmxnoqxyhgicqjxpheicqxei xkthvti b
vhqenxhgzedjxgixwthxbwtivqjnx etvonqhjxdwzq
dwivxgixwthxcwthnxoezqxfe qxnoqghxefwhwtjxjwlwthi
ei xoqhqxehqxnwxkqxeijmqh xnqddxfqxfbx etvonqhj
jgicqxiwmxmqxmgddx gzqjnxtjxkwnoxwpxhtdq
ginqhqjnxwpxnqhhgnwhbxcehqjxwpxjnenq
mogcoxwpxbwtxjoeddxmqxjebx wnoxdwzqxtjxfwjn
noenxmqxwthxdehvqjnxkwtinbxfebxqunqi
moqhqxienthqx wnoxmgnoxfqhgnxcoeddqivqxvwiqhgd
wthxqd qjnkwhixjyqeaxpghjn
vwixjghxgxdwzqxbwtxfwhqxnoeixmwh jxceixmgqd xnoqxfennqh
qehqhxnoeixqbqjgvonxjyecqxei xdgkqhnb
kqbwi xmoenxceixkqxzedtq xhgcoxwhxhehq
iwxdqjjxnoeixdgpqxmgnoxvhecqxoqednoxkqetnbxowiwth
ejxftcoxejxcogd xqqhxdwz xwhxpenoqhxpwti
exdwzqxnoenxfeaqjxkhqenoxywwhxei xjyqqcoxtiekdq
kqbwi xeddxfeiiqhxwpxjwxftcoxgxdwzqxbwt
cwhxejg qxmoenxjoeddxcwh qdgexjyqeaxdwzqxei xkqxjgdqin
dqehxwpxeddxnoqjqxkwti jxqzqixphwfxnogjxdgiqxnwxnogj
mgnoxjoe wmbxpwhqjnjxei xmgnoxcoefyegijxhgco
mgnoxydqinqwtjxhgzqhjxei xmg qjaghnq xfqe j
mqxfeaqxnoqqxde bxnwxnogiqxei xedkeibjxgjjtq
kqxnogjxyqhyqntedxmoenxjebjxwthxjqcwi x etvonqh
wthx qehqjnxhqveixmgpqxnwxcwhimeddxjyqea
hqvxjghxgxefxfe q
wpxnoqxjqdpjefqxfqnedxnoenxfbxjgjnqhxgj
ei xyhgsqxfqxenxoqhxmwhnoxgixfbxnhtqxoqehn
gxpgi xjoqxiefqjxfbxzqhbx qq xwpxdwzq
widbxjoqxcwfqjxnwwxjowhnxnoenxgxyhwpqjj
fbjqdpxeixqiqfbxnwxeddxwnoqhxlwbj
mogcoxnoqxfwjnxyhqcgwtjxjrtehqxwpxjqijqxywjjqjjqj
ei xpgi xgxefxedwiqxpqdgcgnenq
gixbwthx qehxogvoiqjjxdwzq
cwhxejg qxnoqixywwhxcwh qdge
ei xbqnxiwnxjwxjgicqxgxefxjthqxfbxdwzqj
fwhqxhgcoqhxnoeixfbxnwivtq
dqehxnwxnoqqxei xnogiqxoqhq gnehbxqzqh
hqfegixnogjxefydqxnogh xwpxwthxpeghxagiv wf
iwxdqjjxgixjyecqxzedg gnbxei xydqejthq
noeixnoenxcwipqhh xwixvwiqhgdxiwmxwthxlwb
ednowtvoxnoqxdejnxiwnxdqejnxnwxmowjqxbwtivxdwzq
noqxzgiqjxwpxpheicqxei xfgdaxwpxkthvti b
jnhgzqxnwxkqxginqhqjnxmoenxceixbwtxjebxnwx hem
exnogh xfwhqxwytdqinxnoeixbwthxjgjnqhjxjyqea
cwhxiwnogivxfbxdwh
dqehxiwnogiv
cwhxiwnogiv
dqehxiwnogivxceixcwfqxwpxiwnogivxjyqeaxevegi
cwhxtioeyybxnoenxgxefxgxceiiwnxoqezq
fbxoqehnxginwxfbxfwtnoxgxdwzqxbwthxfelqjnb
eccwh givxnwxfbxkwi xiwxfwhqxiwhxdqjj
dqehxowmxowmxcwh qdgexfqi xbwthxjyqqcoxexdgnndq
dqjnxgnxfebxfehxbwthxpwhntiqj
cwhxvww xfbxdwh
bwtxoezqxkqvwnxfqxkhq xfqxdwz xfqxg
hqnthixnowjqx tngqjxkecaxejxehqxhgvonxpgn
wkqbxbwtxdwzqxbwtxei xfwjnxowiwthxbwt
mobxoezqxfbxjgjnqhjxotjkei jxgpxnoqbxjeb
noqbxdwzqxbwtxeddxoeydbxmoqixgxjoeddxmq
noenxdwh xmowjqxoei xftjnxneaqxfbxydgvonxjoeddxcehhb
oedpxfbxdwzqxmgnoxogfxoedpxfbxcehqxei x tnb
jthqxgxjoeddxiqzqhxfehhbxdgaqxfbxjgjnqhj
nwxdwzqxfbxpenoqhxedd
dqehxktnxvwqjxnobxoqehnxmgnoxnogj
cwhxebxvww xfbxdwh
dqehxjwxbwtivxei xjwxtinqi qh
cwhxjwxbwtivxfbxdwh xei xnhtq
dqehxdqnxgnxkqxjwxnobxnhtnoxnoqixkqxnobx wmqh
pwhxkbxnoqxjechq xhe geicqxwpxnoqxjti
noqxfbjnqhgqjxwpxoqcenqxei xnoqxigvon
kbxeddxnoqxwyqhengwixwpxnoqxwhkj
phwfxmowfxmqx wxqugjnxei xcqejqxnwxkq
oqhqxgx gjcdegfxeddxfbxyenqhiedxcehq
yhwygirtgnbxei xyhwyqhnbxwpxkdww
ei xejxexjnheivqhxnwxfbxoqehnxei xfq
owd xnoqqxphwfxnogjxpwhxqzqhxnoqxkehkehwtjxjcbnogei
whxoqxnoenxfeaqjxogjxvqiqhengwixfqjjqj
nwxvwhvqxogjxeyyqngnqxjoeddxnwxfbxkwjwf
kqxejxmqddxiqgvokwth xygngq xei xhqdgqz
ejxnowtxfbxjwfqngfqx etvonqh
aqinxvww xfbxdgqvq
dqehxyqecqxaqin
cwfqxiwnxkqnmqqixnoqx hevwixei xogjxmheno
gxdwz xoqhxfwjnxei xnowtvonxnwxjqnxfbxhqjn
wixoqhxagi xithjqhbxoqicqxei xezwg xfbxjgvon
jwxkqxfbxvhezqxfbxyqecqxejxoqhqxgxvgzq
oqhxpenoqhjxoqehnxphwfxoqhxceddxpheicqxmowxjnghj
ceddxkthvti bxcwhimeddxei xedkeib
mgnoxfbxnmwx etvonqhjx wmqhjx gvqjnxnogjxnogh
dqnxyhg qxmogcoxjoqxceddjxydegiiqjjxfehhbxoqh
gx wxgizqjnxbwtxlwgindbxgixfbxywmqh
yhqqfgiqicqxei xeddxnoqxdehvqxqppqcnj
noenxnhwwyxmgnoxfelqjnbxwthjqdpxkbxfwinodbxcwthjq
mgnoxhqjqhzengwixwpxeixoti hq xaigvonj
kbxbwtxnwxkqxjtjnegi xjoeddxwthxekw q
feaqxmgnoxbwtxkbx tqxnthijxwidbxmqxjngddxhqnegi
noqxiefqxei xeddxnoxe gngwijxnwxexagivxnoqxjmeb
hqzqitqxquqctngwixwpxnoqxhqjn
kqdwzq xjwijxkqxbwthjxmogcoxnwxcwipghf
nogjxcwhwiqnxyehnxkqnmgunxbwt
aqinxhwbedxdqeh
mowfxgxoezqxqzqhxowiwth xejxfbxagiv
dwz xejxfbxpenoqhxejxfbxfejnqhxpwddwm
ejxfbxvhqenxyenhwixnowtvonxwixgixfbxyhebqhj
dqehxnoqxkwmxgjxkqinxei x hemixfeaqxphwfxnoqxjoepn
aqinxdqnxgnxpeddxhenoqhxnowtvoxnoqxpwhaxgize q
noqxhqvgwixwpxfbxoqehnxkqxaqinxtifeiiqhdb
moqixdqehxgjxfe xmoenxmwtd jnxnowtx wxwd xfei
nogiajnxnowtxnoenx tnbxjoeddxoezqx hqe xnwxjyqea
moqixywmqhxnwxpdennqhbxkwmjxnwxydegiiqjjxowiwthjxkwti
moqixfelqjnbxpeddjxnwxpwddbxhqzqhjqxnobx wwf
ei xgixnobxkqjnxcwijg qhengwixcoqca
nogjxog qwtjxhejoiqjjxeijmqhxfbxdgpqxfbxlt vfqin
nobxbwtivqjnx etvonqhx wqjxiwnxdwzqxnoqqxdqejn
iwhxehqxnowjqxqfynboqehnq xmowjqxdwmxjwti
hqzqhkjxiwxowddwmiqjj
dqehxaqinxwixnobxdgpqxiwxfwhq
aqinxfbxdgpqxgxiqzqhxoqd xktnxejxexyemi
nwxmevqxevegijnxnogiqxqiqfgqjxiwhxpqehxnwxdwjqxgn
nobxjepqnbxkqgivxnoqxfwngzq
dqehxwtnxwpxfbxjgvon
aqinxjqqxkqnnqhxdqehxei xdqnxfqxjngddxhqfegi
noqxnhtqxkdeiaxwpxnogiqxqbq
dqehxiwmxkbxeywddw
aqinxiwmxkbxeywddwxagiv
nowtxjmqehjnxnobxvw jxgixzegi
dqehxwxzejjedxfgjchqein
debjxogjxoei xwixogjxjmwh
edkxcwhix qehxjghxpwhkqeh
aqinx w
agddxnobxyobjgcgeixei xnoqxpqqxkqjnwm
tywixnoqxpwtdx gjqejqxhqzwaqxnobxvgpn
whxmogdjnxgxceixzqinxcdefwthxphwfxfbxnohwen
gddxnqddxnoqqxnowtx wjnxqzgd
dqehxoqehxfqxhqchqein
wixnogiqxeddqvgeicqxoqehxfq
jgicqxnowtxoejnxjwtvonxnwxfeaqxtjxkhqeaxwthxzwm
mogcoxmqx thjnxiqzqhxbqnxei xmgnoxjnhegi xyhg q
nwxcwfqxkqnmqqixwthxjqinqicqxei xwthxywmqh
mogcoxiwhxwthxienthqxiwhxwthxydecqxceixkqeh
wthxywnqicbxfe qxvww xneaqxnobxhqmeh
pgzqx ebjxmqx wxeddwnxnoqqxpwhxyhwzgjgwi
nwxjogqd xnoqqxphwfx gjqejqjxwpxnoqxmwhd
ei xwixnoqxjgunoxnwxnthixnobxoenq xkeca
tywixwthxagiv wfxgpxwixnoqxnqinox ebxpwddwmgiv
nobxkeigjo xnhtiaxkqxpwti xgixwthx wfgigwij
noqxfwfqinxgjxnobx qenoxemebxkbxltygnqh
nogjxjoeddxiwnxkqxhqzwa
aqinxpehqxnoqqxmqddxagivxjgicqxnotjxnowtxmgdnxeyyqeh
phqq wfxdgzqjxoqicqxei xkeigjofqinxgjxoqhq
nwxcwh qdgexnoqxvw jxnwxnoqghx qehxjoqdnqhxneaqxnoqqxfeg
noenxltjndbxnogiajnxei xoejnxfwjnxhgvondbxjeg
nwxhqveixei xvwiqhgdxei xbwthxdehvqxjyqqcoqjxfebxbwthx qq j
eyyhwzq
noenxvww xqppqcnjxfebxjyhgivxphwfxmwh jxwpxdwzq
notjxaqinxwxyhgicqjxkg jxbwtxeddxe gqt
oqddxjoeyqxogjxwd xcwthjqxgixexcwtinhbxiqm
qugn
pdwthgjoxqinqhxvdwtcqjnqhxmgnoxpheicqxei xkthvti bxennqi einj
vdwtxoqhqjxpheicqxei xkthvti bxfbxiwkdqxdwh
dqehxfbxdwh xwpxkthvti b
mqxpghjnxe hqjjxnwmeh xbwtxmowxmgnoxnogjxagiv
oenoxhgzedd xpwhxwthx etvonqhxmoenxgixnoqxdqejn
mgddxbwtxhqrtghqxgixyhqjqinx wmqhxmgnoxoqh
whxcqejqxbwthxrtqjnxwpxdwzq
kthxfwjnxhwbedxfelqjnb
gxchezqxiwxfwhqxnoeixoenoxbwthxogvoiqjjxwppqh
iwhxmgddxbwtxnqi qhxdqjj
dqehxhgvonxiwkdqxkthvti b
moqixjoqxmejx qehxnwxtjxmqx g xowd xoqhxjw
ktnxiwmxoqhxyhgcqxgjxpeddixjghxnoqhqxjoqxjnei j
gpxetvonxmgnogixnoenxdgnndqxjqqfgivxjtkjneicq
whxeddxwpxgnxmgnoxwthx gjydqejthqxygqc
ei xiwnogivxfwhqxfebxpgndbxdgaqxbwthxvhecq
joqjxnoqhqxei xjoqxgjxbwthj
kthxgxaiwmxiwxeijmqh
dqehxmgddxbwtxmgnoxnowjqxgipghfgngqjxjoqxwmqj
tiphgqi q xiqmxe wynq xnwxwthxoenq
wmh xmgnoxwthxcthjqxei xjnheivqh xmgnoxwthxweno
neaqxoqhxwhxdqezqxoqh
kthxyeh wixfqxhwbedxjgh
|
//
// traits/set_error_free.hpp
// ~~~~~~~~~~~~~~~~~~~~~~~~~
//
// Copyright (c) 2003-2020 Christopher M. Kohlhoff (chris at kohlhoff dot com)
//
// Distributed under the Boost Software License, Version 1.0. (See accompanying
// file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
//
#ifndef BOOST_ASIO_TRAITS_SET_ERROR_FREE_HPP
#define BOOST_ASIO_TRAITS_SET_ERROR_FREE_HPP
#if defined(_MSC_VER) && (_MSC_VER >= 1200)
# pragma once
#endif // defined(_MSC_VER) && (_MSC_VER >= 1200)
#include <boost/asio/detail/config.hpp>
#include <boost/asio/detail/type_traits.hpp>
#if defined(BOOST_ASIO_HAS_DECLTYPE) \
&& defined(BOOST_ASIO_HAS_NOEXCEPT) \
&& defined(BOOST_ASIO_HAS_WORKING_EXPRESSION_SFINAE)
# define BOOST_ASIO_HAS_DEDUCED_SET_ERROR_FREE_TRAIT 1
#endif // defined(BOOST_ASIO_HAS_DECLTYPE)
// && defined(BOOST_ASIO_HAS_NOEXCEPT)
// && defined(BOOST_ASIO_HAS_WORKING_EXPRESSION_SFINAE)
#include <boost/asio/detail/push_options.hpp>
namespace boost {
namespace asio {
namespace traits {
template <typename T, typename E, typename = void>
struct set_error_free_default;
template <typename T, typename E, typename = void>
struct set_error_free;
} // namespace traits
namespace detail {
struct no_set_error_free
{
BOOST_ASIO_STATIC_CONSTEXPR(bool, is_valid = false);
BOOST_ASIO_STATIC_CONSTEXPR(bool, is_noexcept = false);
};
#if defined(BOOST_ASIO_HAS_DEDUCED_SET_ERROR_FREE_TRAIT)
template <typename T, typename E, typename = void>
struct set_error_free_trait : no_set_error_free
{
};
template <typename T, typename E>
struct set_error_free_trait<T, E,
typename void_type<
decltype(set_error(declval<T>(), declval<E>()))
>::type>
{
BOOST_ASIO_STATIC_CONSTEXPR(bool, is_valid = true);
using result_type = decltype(
set_error(declval<T>(), declval<E>()));
BOOST_ASIO_STATIC_CONSTEXPR(bool, is_noexcept = noexcept(
set_error(declval<T>(), declval<E>())));
};
#else // defined(BOOST_ASIO_HAS_DEDUCED_SET_ERROR_FREE_TRAIT)
template <typename T, typename E, typename = void>
struct set_error_free_trait :
conditional<
is_same<T, typename remove_reference<T>::type>::value
&& is_same<E, typename decay<E>::type>::value,
typename conditional<
is_same<T, typename add_const<T>::type>::value,
no_set_error_free,
traits::set_error_free<typename add_const<T>::type, E>
>::type,
traits::set_error_free<
typename remove_reference<T>::type,
typename decay<E>::type>
>::type
{
};
#endif // defined(BOOST_ASIO_HAS_DEDUCED_SET_ERROR_FREE_TRAIT)
} // namespace detail
namespace traits {
template <typename T, typename E, typename>
struct set_error_free_default :
detail::set_error_free_trait<T, E>
{
};
template <typename T, typename E, typename>
struct set_error_free :
set_error_free_default<T, E>
{
};
} // namespace traits
} // namespace asio
} // namespace boost
#include <boost/asio/detail/pop_options.hpp>
#endif // BOOST_ASIO_TRAITS_SET_ERROR_FREE_HPP
|
A study of chromosomal organization of repetitive DNA sequences by in situ hybridization.
Chromosomal DNA restriction fragments from Triturus cristatus carnifex, were cloned in pBR322. Five clones containing repetitive DNA sequences were analysed in terms of size, repetition frequencies, GC contents and interspersion patterns. All the data suggest that the cloned sequences are typical for the major repetitive classes found in carnifex and represent members of individual repetitive families. All five cloned sequences hybridize in situ to nascent RNA transcripts on lampbrush loops present in the heteromorphic region of chromosome 1. One of the cloned sequences is interesting in that it shows individual variation. The least repeated sequences are transcribed at many more loci than the more highly repeated sequences and are better represented in the total ovarian RNA. |
Author
Topic: Compass Watch Discussions (Read 21544 times)
Just want to show you on how to use my compass clock to locate treasure. The first picture is my compass clock. The second photo is an example of treasure area wherein two old santol trees are the markers or point of reference. Now, how will you locate the exact treasure site?
You now have been given your own thread, in which i hope you are able to explain and enlighten the members just what is your theory and method.If you are unable to, then the members will get bored and your thread will go just like the previous one who, could not explain anything that the members could understand.......so..
In order to locate the treasure, you need to identify the Midpoint marker between the two trees marker. This is how to do it. Your compass should always point to the north and check the angle/ time orientation between the two trees marker.
This is a sample of the Japanese treasure map clock puzzle. 12, 11, 10 and 8 oclock. Now, how will locate the treasure site using the clock puzzle. Since we already identified the midpoint tree marker, the first site to locate here is the 8 0'clock treasure site.
what made you determine that the Santol trees are markers? Pics pls so we can their size and age..
i ask, as i have no idea what your talking about..
The land was owned by my uncle. He bought that land way back 1975. It was a former Japanese camp. During the 80's, Japanese went to his land and asked him to dig the treasure. My uncle did not allowed them to dig. The 2 santol trees are the target of those Japanese guy. If you look at the 2 santol trees since 1975 until now, It has the same size and height. Nothing has changed as my uncle claimed. The old folks around the farm claimed that the Japs used that 2 santol trees for hanging Filipinos guerrillas. |
1. Field of the Invention
The present invention relates to a wafer bonding device for bonding two substrates together and, in particular, to a wafer bonding device suitable for use in bonding two silicon substrates together in a semiconductor manufacturing process.
2. Description of the Related Art
FIGS. 6A through 6F are process diagrams illustrating a process for preparing an SOI (silicon on insulator) substrate using a wafer bonding technique of this type.
In the preparation of this SOI substrate, first, as shown in FIG. 6A, patterning is performed on a first silicon substrate 30 by photolithography, etching or the like, and, on the uneven surface thereby formed, an insulating layer 31 consisting of SiO.sub.2 is formed. Further, a polysilicon layer 32 is formed on this insulating layer 31.
Next, as shown in FIG. 6B, the surface of the polysilicon layer 32 is flattened by grinding, and then, as shown in FIG. 6C, using the polysilicon layer 32 as the joint layer, a second silicon substrate 33 is bonded.
Subsequently, as shown in FIG. 6D, the peripheral edge portion of the substrate is chamfered, and then, as shown in FIG. 6E, the surface of the first silicon layer 30 is ground. In this process, a portion 34 of the first silicon substrate 30 is left on the protruding surfaces of the insulating layer 31.
Finally, as shown in FIG. 6F, selective grinding is performed until the insulating layer 31 is exposed, whereby there is obtained a so-called element-separated device structure, in which silicon portions 34 exist in the recesses of the insulating layer 31.
Conventionally, when bonding the first and second silicon substrates 30 and 33 to each other, a wafer bonding device as shown in FIG. 7 has been used.
In this conventional device shown in FIG. 7, a suction member 51 is engaged with and secured to a support member 50 serving as the base, and grooves 52 are formed concentrically in the upper surface of the suction member 51, thereby forming a chuck surface 53. When bonding the substrates together, the first silicon substrate 30 is placed on the chuck surface 53, and evacuation is effected as indicated by the arrow in the drawing, whereby the first silicon substrate 30 is attracted to the chuck surface 53 by vacuum suction, and, in this condition, the second silicon substrate 33 is bonded.
However, the above-described conventional wafer bonding device involves the following problem when, for example, an airborne particle 54 falls and, as shown in FIG. 8, adheres to a chuck surface (protruding surface) 53.
That is, when vacuum suction is effected with the silicon substrate 30 having been placed on the chuck surface 53, the silicon substrate 30 is partially pushed up due to the presence of the particle 54, whereby the silicon substrate 30 undergoes deformation, such as swell. As a result, the flatness of the substrate 30 markedly deteriorates, and, when bonded to the other silicon substrate 33, the substrate 30 entails the generation of voids 55 in the vicinity of the deformed portion or pattern expansion on the substrate, resulting in a deterioration in yield in the bonding process. |
The legislation would also prohibit corrections staff from asking pregnant women to squat and cough during searches. All vaginal exams would have to be done by a licensed medical professional.
While officials from the Georgia Department of Corrections and a representative for the state’s sheriffs departments said neither group has a policy of shackling, pregnant women told lawmakers it was done to them while they were incarcerated.
Pamela Winn said she was pregnant in 2008 and being held in a county jail in Lovejoy during her trial. She said she was routinely shackled as she was transferred to doctor appointments and court dates.
When she was about 20 weeks pregnant, she fell while she was shackled and miscarried.
“Then during my miscarriage was shackled to hospital bed,” Winn said. “Afterward, I was placed in solitary, which they say is for medical observation.”
The legislation now heads back to the House, which will have to approve changes that were made to the bill in the Senate.
State Sen. Renee Unterman, R-Buford, who ushered the legislation through the Senate, said she believes the two chambers will have to work out differences in a compromise committee. An agreement must be reached by the time the General Assembly adjourns next Tuesday for the bill to become law. |
Which One Will Dogs Love Best? The iFetch, iFetch Too and iFetch Frenzy
iFetch started out as an idea while a kid was trying to do his homework and the family pet would not stop badgering him for some play time. The pet was picked up by the kid’s grandfather and this gave birth to a fun family project that debuted on Kickstarter in June 2013.
With $88,000 in pledges and more than 1,000 people backing the project, iFetch was born. The idea is simple: create a device that would throw a ball for your pet to fetch, allowing you to continue working while keeping your furry family member preoccupied.
The first iFetch became a success with pet owners and earned several awards to boot. These included “Best New Product” and “Best in Show” at the 2013 Superzoo. Since then, there have been two other iFetch products: iFetch Too and iFetch Frenzy.
iFetch
The original iFetch automatically launches miniature tennis balls measuring 1.6 inches into the hole you find on top of the device.
You can either put the ball in yourself, or have your dog put the ball back into the hole after fetching it. This will allow your dog to play by itself and not bother you. What’s more, the company has included a video that teaches you how to train your dog to put the ball into the hole.
This will help your dog learn about fetch and recall.
You can take iFetch indoors or outdoors. Depending on how big your play area is, you can set iFetch to throw the balls anywhere from 10 feet, 20 feet or 30 feet. That means you can play indoors without the tennis balls hitting walls and bouncing all over the place.
If you are playing indoors, you can plug it into any wall outlet. Meanwhile, you can use six C batteries if you plan to take the fun outside.
You would appreciate how this device was conceptualized and designed by a family of dog lovers.
Once you try it with your dogs, you’ll see how everything just works, from the way it throws the ball, to pandering to your dog’s inherent love of unlimited fetching, to that gurgling sound when the machine is about to release the ball which gives your dog some sort of signal.
What you would love about the original iFetch
iFetch is clearly designed by dog lovers for dogs. It has smooth edges and follows a rounded theme all throughout. It looks modern yet playful. The device is made with quality materials guaranteed to last a long time. Also, the design is one-of-a-kind and unmistakable.
And if you do not like tennis balls for fear they might damage your dog’s teeth when picking it up or chewing on it, you will surely love the fact that you can replace the tennis balls with any lightweight rubber ball measuring 1.6 inches in diameter. You can also use squash balls.
This might result in some jamming, where the iFetch might not throw the squash balls out for some reason. If this happens, you just need to unplug the device and fish the ball out.
Jamming does not happen when you use the official iFetch ball, so it is probably good news that the company is planning to come out with a smooth rubber ball for iFetch in the future.
Some concerns
iFetch would throw the ball even if you or your dog is standing right in front of it. Some dog owners might think that this could hurt their dogs and could keep their pets from interacting with the device in the future.
However, most dog owners notice that their dogs do not mind this. This does not seem to hurt the dogs and some even try to get the ball as soon as it shoots out of the machine.
Still, for some dogs, it would have been better if the iFetch has sensors that would detect if something is in front of it and if it has the ability to wait until the coast is clear before throwing out the ball.
However, this has been discussed by the people behind iFetch on their Kickstarter page, and they explained that they since they want to keep the price low for the device, they decided to forego on the sensor.
If you live in an area where you get a lot of rain or if you find yourself cooped up indoors a lot, you and your dog can still have fun with iFetch. You do not even have to go to the park for this.
For busy dog lovers, having iFetch means they no longer have to feel guilty about neglecting their furry friends, or having to choose work over playtime.
This is also a great help for dog owners who have limited movement, or those who have problems throwing things such as those suffering from arthritis. They can still give their dogs quality playtime.
iFetch in a nutshell:
Uses balls that measure 1.6” in diameter. Three balls are included in the box.
iFetch Too
iFetch Too works similarly to the original iFetch, but it is ideal for big dogs. The original iFetch can throw balls that are only 1.6 inches in diameter and this can be too small for big dogs.
iFetch Too can throw standard sized tennis balls with a diameter of 2.5 inches. It can launch a ball 10 feet, 25 feet or 40 feet out. You can flip a switch to vary the distance so that your dog will have more fun guessing how far the ball would be thrown.
iFetch Too is also ideal for outdoor play as it can throw balls up to 40 feet out. Other than that, iFetch Too works pretty much like the original iFetch. You can also train your dog to leave the ball on the device so that they could play on their own.
In this case, you can set your iFetch Too to throw the ball out for random distances.
Another difference is that iFetch Too uses a rechargeable battery, so you do not have to waste money buying the 6 C batteries that you need to make the original device portable. The package comes with an AC charger that you can use using any power source.
iFetch in a nutshell:
Uses balls that measure 2.5” in diameter. Three balls are included in the box.
iFetch Frenzy
iFetch Frenzy, the third device from the same company, is for small to medium-sized dogs. Unlike the first two iFetches, Frenzy does not need to be plugged in and has no need for batteries. It does not really launch the ball; you only need to place it on a flat surface, put in the ball and start playing.
There are three chutes on the base of the iFetch Frenzy. The ball can come out of any one of these chutes at random, so that your dog would have to guess which chute the ball is going to come out of.
As such, iFetch Frenzy is not only a great physical exercise but is also a test of your dog’s mental faculties. Your dog would surely enjoy the guessing game and you can see it actively engaged when playing with iFetch Frenzy.
You can observe your dog trying to guess where the ball would roll out of next.
The iFetch Frenzy may work differently from the other iFetch devices, but your dog can still have lots of fun with it. You can also train your dog to put the ball back into the hole so that it could play on its own.
Instead of attending to your dog, you are free to help your kids with their homework, clean the house, or do other stuff.
The iFetch Frenzy is ideal for those who live in smaller apartments because it uses less force and launches the balls to roll on the floor.
It uses the same-sized balls as the original iFetch and, after playing, you can hide away these balls in a built-in storage compartment so that you do not lose any of them.
iFetch Frenzy in a nutshell:
Non-electronic, does not need batteries, does not need to be plugged in.
Uses balls that measure 1.6” in diameter.
Three balls are included in the box, and have a hidden storage for these balls.
How to choose
What’s the perfect iFetch for you and your dog? If you have a small or medium-sized dog, you can choose between the iFetch Frenzy or the original iFetch. The original iFetch is great for both indoor and outdoor playtime and can provide great physical exercise for your furry friends.
However, if you and your dog like to stay mostly indoors and you would like to challenge your dog with a simple puzzle figuring out where the ball would come out next, then go for the iFetch Frenzy. Meanwhile, the iFetch Too is great for big dogs who like playing outdoors.
The Final Word
iFetch has designed a range of automatic ball launchers for dogs of different sizes. All of these devices are fun and engaging for your dogs and can help you make sure that your dog gets all the play time it wants while also giving you the freedom to do other things.
All iFetch products have everything you need, but the company also provides extra balls for sale and even other accessories such as the AC charger for the iFetch Too and the adaptor for the original iFetch. These devices are also very easy to clean and the balls are not going to harm your dog’s teeth.
It is easy to see that the people behind iFetch are dog lovers themselves and they saw a need and came up with a solution to help fellow dog-lovers keep their pets happy.
Related
Reader Interactions
Your email address will not be published. Required fields are marked *
Comment
Name *
Email *
Website
Notify me of follow-up comments by email.
Notify me of new posts by email.
Primary Sidebar
About the Founder
Patrick Sinclair is a geek; make no mistake about that. He runs All Home Robotics in his spare time so he doesn’t have to think about his depressing cubicle and it gives him an excuse to buy expensive gadgets to review! |
/// Copyright (c) 2009 Microsoft Corporation
///
/// Redistribution and use in source and binary forms, with or without modification, are permitted provided
/// that the following conditions are met:
/// * Redistributions of source code must retain the above copyright notice, this list of conditions and
/// the following disclaimer.
/// * Redistributions in binary form must reproduce the above copyright notice, this list of conditions and
/// the following disclaimer in the documentation and/or other materials provided with the distribution.
/// * Neither the name of Microsoft nor the names of its contributors may be used to
/// endorse or promote products derived from this software without specific prior written permission.
///
/// THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR
/// IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS
/// FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE
/// FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT
/// LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
/// INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY,
/// OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
/// ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
ES5Harness.registerTest({
id: "15.4.4.22-9-7",
path: "TestCases/chapter15/15.4/15.4.4/15.4.4.22/15.4.4.22-9-7.js",
description: "Array.prototype.reduceRight not affect call when the array is deleted during the call",
test: function testcase() {
function callbackfn(prevVal, curVal, idx, obj) {
delete o.arr;
return prevVal + curVal;
}
var o = new Object();
o.arr = ['1', 2, 3, 4, 5];
return o.arr.reduceRight(callbackfn) === "141" && !o.hasOwnProperty("arr");
},
precondition: function prereq() {
return fnExists(Array.prototype.reduceRight);
}
});
|
COMMISSION INFO (temporarily closed)
COMMISSION INFO (temporarily closed)
Apr 3, 2020
Updated 8 April 2020:
Thank you again for your substantial support! My waiting list is so full now... Guess I'll need quite some time to digest them, so I might need to temporarily close the commission for now!
I'll reopen the commission once the list is clear out, please be sure to check again then!
Thank you so much. love you guys! ^^
----------------------------------------------------------------------------------------------------------
Hi guys! Thanks for all your support so far!
We all know that the world economy comes to a tough point recently due to COVID-19 outbreak. I hope that people that want to commission me can save up more for their daily expenses, so I decided to make a discount on my current price tags :)
And also I’d including some new categories of commission types while remove some that takes longer to finish with (mostly multi-characters’ commission)
----------------------------------------------------------------------------------------------------------
I
Animation comissions journal
Animation comissions journal
Mar 2, 2020
Decided to put all my comission types into one journal. Also a new option!
1. Transformation animation1 frame - 12$. Minimum frame amount - 10 frames (120$). Maximum amount - whatever you want, no limit^^
Simple background included.
I can make price quote after finishing rough sketch of future animation. If you have a certain budget please mention it beforhand, so I'll try to make frame amount accordingly. As I do rough sketch before paymant please be sure you want it and woudn't disapper in the process before claiming a slot.
1 slot - OPEN
Examples:
2. Custom animated comissions with simple movements, 10 frames.Simple background, 1 ch
I am a simple Kansan that enjoys drawing for fun and for my friends. I specialize in cute things because I enjoy cute things. I'm pretty sure there isn't anything out there that I can't cutie-fy somehow. ;3
So...yeah! Welcome to my gallery of crap! :D
Oh, I made a Ko-fi account too. Check it out!
Oh, don't forget to check out my amaze-za-zing friends' dAs as well! They have awesome things that you may enjoy! <3
Favourite Movies
The Labyrinth
Favourite TV Shows
Monsters Inside Me, Too Cute!, River Monsters, The Amazing World of Gumball |
Q:
Strapi Beta with custom Sendgrid Controller code for email
The structure for Strapi beta has changed how plugins are architected, removing the /plugins directory and the plugins are now kept in the /node_modules directory. I am trying to write some custom code to fire a confirmation email after an order is placed. In the previous version of Strapi, the email plugin directory was here:
/server/plugins/email/controllers
In this directory, the following code was wrote that is working in alpha in the SEND controller:
We comment this out:
// await.strapi.plugins.email.services.send(options, config);
And then this code is used in the SEND controller inside module.exports of the once extistent email controller...
let options = ctx.request.body;
try {
// send email to user
await strapi.plugins['email'].services.email.send({
to: options.to,
from: 'test@example.com',
subject: options.subject,
text: options.text,
html: options.html
})
} catch (err) {
return ctx.badRequest(null, err);
}
// Send 200 'ok;
ctx.send({});
Ok, that was the Strapi Send controller on the server side... now on the client after the promise for the order returns, we fire another promise for confirmation email that hits Strapi API:
await.strapi.request('POST', '/email', {
data: {
to: confirmationEmailAdress,
subject: "Order Confirmation',
text: 'Your order has been processed',
html: '<b>Expect your stuff to arrive broken. Thanks.</b>'
}
});
In a nutshell, the question is now that the architecture of Strapi has changed, not sure where to put my server code above, and also the API url to call to fire the email. I have SendGrid setup in Strapi with API key, permissions, and everything is good to go, just a question of where is the proper place to put this code now that the Beta architecture has changed from alpha?
* UPDATED CODE *
From Jim's suggestion, I have now created an Email controller in the /extensions folder like this:
/server/extensions/email/controllers/Email.js
Email.js
'use strict';
module.exports = {
send: async (ctx) => {
let options = ctx.request.body;
try {
//Send email to the user
await strapi.plugins['email'].services.email.send({
to: options.to,
from: 'test@example.com',
subject: options.subject,
text: options.text,
html: options.html
});
} catch (err) {
return ctx.badRequest(null, err);
}
}
}
Now, in the client I use a promise with React to call our email extension like this:
await strapi.request('POST', '/email', {
data: {
to: confirmationEmailAddress,
subject: `Order Confirmation - South of Sleep ${new Date(Date.now())}`,
text: 'Your order has been processed',
html: '<bold>Except your stuff to be broken upon arriving</bold>'
}
});
It works! The email is sent from Strapi, and I see that the information in the controller is part of the email. The problem?
The promise in the client is part of a try/catch and after the email is fired it returns a 404, because it can't find /email as a route. So, I don't understand why it is working and finding the extension controller for email, firing the email but returning a 404 for the route.
I am calling the extension controller from the client incorrectly.
A:
Now you will have to follow the customization documentation.
Here is the doc https://strapi.io/documentation/3.0.0-beta.x/concepts/customization.html#plugin-extensions
You will have to create the file that follow the file path you want to update.
Then you copy only the function that you need.
And finally you add your email service call.
|
It is known that Hillary Clinton, a potential candidate in the 2016 US Presidential elections, has supported the gay community before, but yesterday she did it together with the gay rights advocacy group 'Human Rights Campaign'. Clinton made the announcement just a few days after the statement of her husband Bill, who has appealed to the U.S. Supreme Court to call off the law of 1996, which defines marriage as a union between a man and a woman, making it discriminatory. She said that, like many other people, her views on gay marriage have changed over time, by talking to people about the experiences that they had.
"To deny the opportunity for marriage to any of our daughters and sons solely on the basis of who they are and who they love, is to deny them the chance to live up to their own God-given potential“, Clinton concluded. And we totally agree. Always keep an open mind! |
1. Introduction {#sec1-sensors-16-01256}
===============
Computer-aided design (CAD) tools are often used to facilitate electronic circuit design before implementation. They are developed to achieve numerous goals such as the reuse of design components, ease of design modification, automatic generation of designs, and verification of designs against specifications and design rules. The ultimate purpose is to derive predictions of circuit behavior that are highly similar or even identical to the real physical behavior of the circuit after implementation. For analog or mixed-signal integrated circuit (IC) designs, electronic design automation (EDA) tools such as HSPICE are widely used to accurately simulate the ICs for performance evaluations. This transistor-level simulator can derive circuit information precisely, enabling designers to predict the functionality, power dissipation, timing, and reliability of their designs. Although this class of transistor-level simulators is powerful for evaluating circuits for various performance metrics, the simulation process is time-consuming. Generally, this would require at least several hours or possibly several days, depending on the simulation settings. To overcome this problem, at the early design stage of numerous ICs, such as phase locked loops (PLLs), frequency synthesizers, and delta-sigma modulators, behavioral models have been built and evaluated using SIMULINK; some simulation precision was sacrificed for the rapid calculation of rough results \[[@B1-sensors-16-01256],[@B2-sensors-16-01256],[@B3-sensors-16-01256],[@B4-sensors-16-01256],[@B5-sensors-16-01256],[@B6-sensors-16-01256],[@B7-sensors-16-01256],[@B8-sensors-16-01256]\]. Researchers developed so-called "behavioral simulation techniques", which trade accuracy for speed; the design procedure can thus be accelerated by applying these high-speed simulation techniques. Typically, circuit trimming techniques are further applied during the design of physical device models to mitigate the gap between behavioral and transistor-level simulations. However, the required time for the trimming process is unpredictable.
In numerous industrial, home, and office electronic devices, smart temperature sensors (STSs) are increasingly required to monitor and manage temperatures. Due to the demand for small, low-dissipation devices, CMOS STSs are highly competitive and have strong appeal. Several CMOS time-domain STSs (TDSTSs) have been developed over the past 10 years \[[@B9-sensors-16-01256],[@B10-sensors-16-01256],[@B11-sensors-16-01256],[@B12-sensors-16-01256],[@B13-sensors-16-01256],[@B14-sensors-16-01256],[@B15-sensors-16-01256],[@B16-sensors-16-01256],[@B17-sensors-16-01256],[@B18-sensors-16-01256],[@B19-sensors-16-01256],[@B20-sensors-16-01256]\]. Compared with CMOS voltage-domain STSs, which have highly favorable accuracy for voltage and process variations \[[@B21-sensors-16-01256],[@B22-sensors-16-01256],[@B23-sensors-16-01256],[@B24-sensors-16-01256]\], CMOS TDSTSs possess the advantages of lower cost and lower circuit complexity. Thus, several TDSTSs have been reported \[[@B10-sensors-16-01256],[@B11-sensors-16-01256],[@B12-sensors-16-01256],[@B13-sensors-16-01256],[@B14-sensors-16-01256],[@B15-sensors-16-01256],[@B16-sensors-16-01256],[@B17-sensors-16-01256],[@B18-sensors-16-01256],[@B19-sensors-16-01256],[@B20-sensors-16-01256]\]. HSPICE simulations are precise but extremely time-consuming, particularly because STS simulations must simulate multiple temperature points to evaluate performance. Thus, researchers must develop a time-efficient and accurate simulation tool that can effectively derive valid temperature information regarding TDSTSs. However, to the best of our knowledge, no behavioral simulator for TDSTSs meets the standards of simulators for PLLs, frequency synthesizers, or delta-sigma modulators. Beyond behavioral simulation, accurate predictions are also desirable in transistor-level simulations of TDSTS designs. With such predictions, designers can modify a TDSTS at the early design stage without several rounds of time-consuming HSPICE simulations.
The widely used SIMULINK platform provides time-efficient behavioral simulations. Thus, this study proposes a high-speed SIMULINK-based behavioral simulator for TDSTSs. In this paper, we organize simple and accurate equations describing TDSTS into a temperature-dependent model (TDM) and derive temperature-sensing models of a CMOS NOT gate by using HSPICE, which has a very short simulation time. With the TDM and the derived models, the proposed simulator achieved rapid and accurate simulation. The remainder of this paper is arranged as follows: [Section 2](#sec2-sensors-16-01256){ref-type="sec"} introduces the TDM of the TDSTSs, and the building blocks of the proposed SIMULINK simulator are introduced in detail in [Section 3](#sec3-sensors-16-01256){ref-type="sec"}. Subsequently, [Section 4](#sec4-sensors-16-01256){ref-type="sec"} presents the experimental results, which validate the proposed technique, and finally, [Section 5](#sec5-sensors-16-01256){ref-type="sec"} concludes this study.
2. TDM for the TDSTSs {#sec2-sensors-16-01256}
=====================
In a TDSTS, an inverter-based delay line or oscillator is typically adopted to sense temperature because a simple CMOS NOT gate can act as an effective proportional to absolute temperature (PTAT) sensor that generates a temperature-dependent delay time *t~NOT~*(*T*) \[[@B9-sensors-16-01256],[@B12-sensors-16-01256],[@B13-sensors-16-01256],[@B14-sensors-16-01256],[@B15-sensors-16-01256],[@B16-sensors-16-01256],[@B17-sensors-16-01256]\], which can be expressed as follows \[[@B13-sensors-16-01256],[@B17-sensors-16-01256]\]: $$t_{NOT}(T) = \frac{2LC_{L}T_{0}^{km}}{\mu_{0}WC_{ox}V_{DD}} \times \frac{\text{ln}(3 - 4V_{th}/V_{DD})}{1 - V_{th}/V_{DD}} \times \frac{1}{T^{km}} = \gamma \times T^{- km}$$ where *μ*~0~, *T*, *T*~0~, *V~th~*, *W*/*L*, and *C~L~* are the reference carrier mobility, operation temperature, reference temperature, threshold voltage, effective aspect ratio of transistors, and loading capacitance of the NOT gates, respectively. Without considering the effect of voltage variation, the summed parameter *γ* can be regarded as a process-dependent factor that is nearly independent of temperature. The parameter −*km* is considered to be temperature independent; this parameter determines the thermal characteristics of the CMOS NOT gate. For example, its value ranges from −1.2 to −2.0 for a 0.35-µm CMOS process and, thus, the *t~NOT~*(*T*) changes linearly with the temperature \[[@B17-sensors-16-01256]\].
[Figure 1](#sensors-16-01256-f001){ref-type="fig"} shows a block diagram of an all-digital CMOS oscillator-based TDSTS \[[@B12-sensors-16-01256]\]. An oscillator consists of an odd number (*k*) stages of NOT gates that generate a PTAT period width *t~OSC~*(*T*). To achieve a satisfactory temperature resolution (*R*), a time amplifier (TA) is used to amplify the *t~OSC~*(*T*) with a time gain *n*. With a simple XOR gate, a sufficiently wide PTAT pulse *t~P~*(*T*) is generated. A reference clock with a stable period width (*t~REF~*) is used to convert the *t~P~*(*T*) into a corresponding digital code *N*(*T*) by using an AND gate and output counter. The *N*(*T*) of the simple sensor can be formulated as follows \[[@B13-sensors-16-01256],[@B17-sensors-16-01256]\]: $$N(T) = \frac{t_{p}(T)}{t_{REF}} = \frac{n \times t_{OSC}(T)}{t_{REF}} = \frac{n}{t_{REF}} \times 2 \times k \times \gamma \times T^{- km}$$
Since (in theory) *n*, *k*, and *t~REF~* are ideally temperature- and process-insensitive, the thermal characteristics of *N*(*T*) are ideally identical to those of *t~NOT~*(*T*). Equation (2) is a simple, but accurate, equation that describes the temperature behavior of the TDSTS, which has been verified in previous studies \[[@B12-sensors-16-01256],[@B13-sensors-16-01256],[@B17-sensors-16-01256]\]. If the models (i.e., *γ* × *T*^−*km*^ for process and temperature variation) of a single CMOS NOT gate can be derived precisely, the sensor code *N*(*T*) can be attained by computing Equation (2) such that the performance can be roughly evaluated and the design procedure can be simplified. Various crucial specifications, such as the limits of accuracy and the resolution, can be estimated quickly.
[Figure 2](#sensors-16-01256-f002){ref-type="fig"} shows a block diagram of an all-digital TDSTS with one-point calibration support that incorporates process-variation calibration \[[@B13-sensors-16-01256]\]. In contrast to the simple TDSTS shown in [Figure 1](#sensors-16-01256-f001){ref-type="fig"}, the adjustable-gain time amplifier (AGTA) shown in [Figure 2](#sensors-16-01256-f002){ref-type="fig"} is modified from a standard time amplifier to realize the variable time gain *n~C~* for calibration. The calibration circuit is composed of a magnitude comparator and SAR (successive approximation register) control logic; this eliminates the influence of process variation (denoted as *i*) to support one-point calibration. The calibration technique and detailed procedure were presented in \[[@B13-sensors-16-01256]\]. For one-point calibration, the calibrated code *N~C,i~*(*T~C~*) at the calibration temperature *T~C~* can be adjusted to match the calibration value *N~S~*. This calibration condition can be expressed as follows: $$N_{C,i}(T_{C}) = \frac{n_{C,i} \times t_{OSC,i}(T_{C})}{t_{REF}} = N_{S}$$
The oscillation period width of the *i*th sensor on *T~C~* (*t~OSC,i~*(*T~C~*)) is compensated dynamically by adjusting the corresponding *n~C,i~*. The calibration result is presented as follows: $$n_{C,i} = \frac{t_{REF} \times N_{S}}{t_{OSC,i}(T_{C})} = \frac{t_{REF} \times N_{S}}{2 \times k \times \gamma \times T_{C}^{- km}}$$
Finally, Equation (4) is substituted into Equation (2), and the *N~C,i~*(*T*) after the calibration can be expressed as: $$N_{C,i}(T) = \frac{n_{C,i} \times 2 \times k \times T^{- km}}{t_{REF}} = {(\frac{T}{T_{C}})}^{- km} \times N_{S}$$
In other words, with the calibration, the calibrated time gain *n~C,i~* replaces the fixed *n* in the uncalibrated sensor to generate the *N~C,i~*(*T*) of the calibrated sensor. The result of Equation (5) reveals that the process term *γ* can be eliminated effectively, enabling the calibrated sensor to support one-point calibration. According to the two chosen values (*N*(*T*~1~) and *N*(*T*~2~)) and their temperature interval (*T*~1~ − *T*~2~), the sensor resolution *R* can be determined as follows: $$R = \frac{T_{1} - T_{2}}{N(T_{1}) - N(T_{2})}$$
Furthermore, the conversion time can be estimated as the product of the digital value at the highest temperature and *t~REF~* (i.e., *N*(*T*~2~) × *t~REF~*) without considering the delay time of the devices in the sensor and, thus, the ideally lowest conversion rate (*CR*) is determined as: $$CR = \frac{1}{N(T_{2}) \times t_{REF}}$$
The transistor-level of the CMOS TDSTSs can be simulated using HSPICE to derive the uncalibrated codes *N~i~*(*T*) accurately with process and temperature variations (i.e., Equation (2)). With the calibration, the calibrated *n~C,i~* (i.e., Equation (4)) can be simulated to further derive the calibrated codes *N~C,i~*(*T*) (i.e., Equation (5)). The HSPICE simulation is precise but extremely time-consuming. To reduce the simulation time substantially, Equations (1)--(5) were used in the proposed simulator as a TDM for behavioral simulation.
3. Proposed Behavioral Simulator Using SIMULINK {#sec3-sensors-16-01256}
===============================================
According to Equations (1)--(5) of the TDM, the *t~NOT~*(*T*) is the most crucial item because it is the only quantity related to the temperature and process. This feature can be used to develop a time-efficient behavioral simulator for TDSTSs in order to estimate behavior without using HSPICE, significantly reducing the simulation time. Another vital issue is that the simulator is concise because its equations are simple and linear. The equations have been verified to function effectively \[[@B12-sensors-16-01256],[@B13-sensors-16-01256],[@B14-sensors-16-01256],[@B15-sensors-16-01256],[@B16-sensors-16-01256],[@B17-sensors-16-01256]\], which is conducive to precise simulation.
A conceptual block diagram of a concise simulation tool for a TDSTS is shown in [Figure 3](#sensors-16-01256-f003){ref-type="fig"}. The designer selects the basic parameters (*n*, *k*, *t~REF~*, *N~C~*, *T~C~*) and loads the models (*γ* × *T*^−*km*^) from the library for mathematical computation; the system calculates the equations using the models and the input parameters. After the simulation results have been generated, the performance can be evaluated. Moreover, the figures for the results (*N~i~*(*T*) and *N~C,i~*(*T*)) and the processed data (for example, the inaccuracy) can be directly displayed using a suitable program, which simplifies the operations and increases the functionality of the tool.
The objective of this study was to develop a concise and low-cost simulator for performing rapid and accurate TDSTS simulations. SIMULINK is a widely used behavioral simulation platform that is highly suitable for implementing the simulator. Implementation in the SIMULINK environment brings numerous advantages such as high construction flexibility, large computation capability, a user-friendly graphical interface, and extremely short computation time. The design presented in [Figure 3](#sensors-16-01256-f003){ref-type="fig"} can be elaborated with TDSTSs and process-variation calibration in the SIMULINK environment to yield the constructed block of the proposed simulator shown in [Figure 4](#sensors-16-01256-f004){ref-type="fig"}. The block of the TDSTSs comprises a library that stores the temperature-sensing models of a single NOT gate derived from HSPICE simulations, and two sensors (without and with calibration) for estimating system performance. The block of the calibration is used to generate the calibrated time gain *n~C,i~* for the sensor with calibration. Finally, the simulation results (*N~i~*(*T*) and *N~C,i~*(*T*)) are stored in .mat files for figure generation with MATLAB. The software structure is concise and the defining equations are simple. Thus, a low-cost simulator for rapid performance evaluations can be constructed.
First, considering the uncalibrated sensor (i.e., the simple sensor without calibration), the input values of the parameters are *k* for determining the oscillation period width *t~OSC,i~*(*T*) (*i* denotes the three process corners: typical-typical (TT), fast-fast (FF), and slow-slow (SS)), *n* for amplifying the width to generate *t~P,i~*(*T*), and *t~REF~* for time-to-digital conversion. The results of *N~i~*(*T*) are obtained using Equation (2) and the models of *t~NOT,i~*(*T*). Second, the process-variation calibration is activated by giving the value of *N~S~* on *T~C~*. Through Equation (3), the corresponding *n*~C,*i*~ of the three process corners can be generated for the AGTA in the calibrated sensor. Then, the estimation of the calibrated sensor is performed. With the same *t~NOT,i~*(*T*), *k*, and *t~REF~*, the computation of Equation (5) generates the results of *N~C,i~*(*T*).
After the results have been generated, the data of *N~i~*(*T*) and *N~C,i~*(*T*) are stored in a .mat file, which is loaded into a prewritten MATLAB file to estimate the sensor resolution *R* by using Equation (6), and to generate the figures that display the performance. In other words, the linearity and inaccuracy after data processing can be directly presented in the figures in a simple manner. This simplifies the figure generation procedure considerably.
3.1. Temperature-Sensing Model of a Single CMOS NOT Gate {#sec3dot1-sensors-16-01256}
--------------------------------------------------------
In the SIMULINK platform, the blocks are described by the equations of the TDM, which express their outputs in terms of the input parameters and NOT gate models. Therefore, the precision of the behavioral simulation depends on how accurately those equations describe the actual condition of each building block and the precision of the captured model. The accurate equations are presented in previous subsections. This subsection introduces the temperature-sensing model of a NOT gate.
To build a library that stores the models for behavioral simulation, an oscillator composed of 21 stages of CMOS NOT gates (PMOS: W/L = 2/2 µm, NMOS: W/L = 1/2 µm) was simulated using HSPICE in a TSMC 0.35-µm CMOS process for process and temperature variations (TT, SS, and FF of the three process corners, ranging from 0 to 80 °C in 10 °C increments). The long MOS channel length was selected to facilitate the realization of a wider oscillation period width. An oscillator with relatively high stages was used to optimize the precision. Furthermore, the models of the single NOT gate were derived by averaging the period width and were stored in the library, as presented in [Table 1](#sensors-16-01256-t001){ref-type="table"}. This averaging data would be expected to dominate the precision of the proposed simulator. Thus, the numerical precision of the data for the captured models is expected to suffice. It is related to the least significant bit (LSB) time (i.e., *t~REF~*) and the value of 2 × *k* × *n*. For example, Equation (2) shows that when *t~REF~* = 25 ns (i.e., 40 MHz) and 2 × *n* × *k* = 100,000, the precision needs to be in the order of tens of femtoseconds (fs) (i.e., 1/1000 in picoseconds (ps)). This is because when the data are amplified by 100,000, the amplified data of the LSB is near 10 ns at most, which is less than 25 ns (the LSB time). Equivalently, the non-ideal effect for the sensor code is less than 1 LSB and is practically irrelevant to the result. When it is necessary to estimate more results, the data for greater numbers of temperature points in a range wider than the commercial temperature range can be obtained in the same manner.
3.2. TDSTSs {#sec3dot2-sensors-16-01256}
-----------
[Figure 5](#sensors-16-01256-f005){ref-type="fig"} presents the detailed construction of TDSTSs in the SIMULINK environment for (a) the block of the oscillator including the library; (b) the block of the TAs; and (c) the block of the TDCs. The sensor codes (*N~i~*(*T*) and *N~C,i~*(*T*)) for the two sensors are generated by the two TAs and the corresponding TDCs. Their operation is totally identical except for *n* and *n~C,i~*. Although two sensors were designed in this simulator, the total simulation time was not increased considerably because the proposed simulator is concise and performed by using SIMULINK, which was a notable advantage of the SIMULINK platform.
As shown in [Figure 5](#sensors-16-01256-f005){ref-type="fig"}a, by the product of 2 and *k* and the captured models in the library, the *t~OSC,i~*(*T*) are generated and used in the two sensors. Simultaneously, the value of 2 × *k* is sent to the calibration block (next subsection). Next, when the *t~OSC,i~*(*T*) is amplified with *n* or *n~C,i~* generated from the calibration block, the *t~P,i~*(*T*) in the uncalibrated sensor and the *t~P~*~C,*i*~(*T*) in the calibrated sensor are produced, as presented in [Figure 5](#sensors-16-01256-f005){ref-type="fig"}b. [Figure 5](#sensors-16-01256-f005){ref-type="fig"}c presents the process generating *N~i~*(*T*) or *N~C,i~*(*T*) by counting *t~P,i~*(*T*) or *t~PC,i~*(*T*), respectively, by using the *t~REF~*. The three steps refer to Equations (2) and (5).
3.3. Process-Variation Calibration for the Three Process Corners {#sec3dot3-sensors-16-01256}
----------------------------------------------------------------
To evaluate the calibrated sensor, the calibrated time gain *n~C,i~* (*n~C,TT~*, *n~C,FF~*, and *n~C,SS~*) must be derived for time amplification. The calibration compensates for the process variation of the oscillator on *T~C~*. Thus, only the model on *T~C~* (i.e., *t~NOT,i~*(*T~C~*)) is used in this scheme. The constructed scheme is illustrated in [Figure 6](#sensors-16-01256-f006){ref-type="fig"}. The value *N~S~* on *T~C~* is selected to perform one-point calibration. The *t~OSC,i~*(*T~C~*) are generated using the value of 2 × *k* (from the block of the oscillator) and the model of *t~NOT,i~*(*T~C~*). With the product of *N~S~* and *t~REF~*, the corresponding *n~C,i~* can be determined using Equation (4) and is used in the calibrated sensor. The higher the value of *N~S~* is, the higher the value of *n~C~* and the sensor resolution are.
3.4. Figure Generation for Performance Evaluation {#sec3dot4-sensors-16-01256}
-------------------------------------------------
Generally, after a simulation has generated results, a suitable program processes the output into a user-friendly format with figures that present the required functions (e.g., the linearity and the inaccuracy). To simplify the procedure, the simulated data of the proposed simulator are stored in .mat format during simulation and are automatically loaded into a prewritten .m file. MATLAB processes the data in the .m file and generates the required figures. For example, the linearity of the simulation results and the corresponding inaccuracy, including two-point calibration for the uncalibrated sensor and one-point calibration for the calibrated sensor, are often presented in figures to illustrate system performance. Since this simulator features an .m file, the figures of the required functions for the two sensors can be simultaneously exhibited in a remarkably simple manner. Designers can easily see whether the presented performance levels satisfy the specifications.
4. Experimental Results {#sec4-sensors-16-01256}
=======================
To validate the behavioral simulator, behavioral and transistor-level simulations were performed with the proposed simulator and HSPICE, respectively. A sufficiently wide *t~REF~* can effectively reduce the influence of the delay mismatch and delay variation along various signal paths, thereby improving the precision of the simulation. In addition, a low operational frequency can mitigate high power consumption. Thus, the design should specify relatively wide values of *t~REF~* and *t~OSC~*(*T*). For simplicity, *t~REF~* = 25 ns is given for all situations, and the *T~C~* is set to 40 °C (i.e., the median of 0--80 °C).
In the uncalibrated sensor, the value *k* = 21 was set to achieve a relatively wide oscillation period width *t~OSC~*(*T*) (for example, 2 × 21 × *t~NOT,TT~* (40 °C) = 32.832 ns) for low power consumption. In additional, the fixed time gain *n* = 5000 was set for a satisfactory *R*. With the transistor-level simulations using HSPICE, the simulation time for the three process corners in 10 °C steps from 0 °C to 80 °C was around 27 hours to derive the results. By the contrast, under the same simulation setting, the total simulation time of the proposed system was only a few seconds, which saved a notable amount of time. After the proposed simulation generated the outcome of *N~i~*(*T*), it was stored in *N~i~*(*T*) .mat; the graphical output is presented in [Figure 7](#sensors-16-01256-f007){ref-type="fig"}. MATLAB loaded the .m file, which contained the data of *N~i~*(*T*), and produced figures depicting the linearity and the inaccuracies after two-point calibration, as shown in [Figure 8](#sensors-16-01256-f008){ref-type="fig"}. Furthermore, the figure generation procedure was simplified considerably. Simultaneously, the proposed simulator calculated the *R* values for the three process corners. For example, in TT mode, *N*(0 °C) = 5735 and *N*(80 °C) = 7352 were chosen with a temperature interval of 80 °C; the *R* was calculated as approximately 0.05 °C. Moreover, the estimated conversion time at 80 °C can be calculated as 183.8 µs (7352 × 25 ns) and the lowest *CR* is determined as 5.44 k samples/s in this TT mode. These operations demonstrated the functionality of the proposed simulator.
To further demonstrate the precision of the proposed simulator, the two simulation results *N~i~*(*T*), and their differences in degrees Celsius, are presented in [Figure 9](#sensors-16-01256-f009){ref-type="fig"} for comparison. The highly similar conditions between the behavioral and transistor-level simulators are shown. The maximal difference is within −0.8 °C\~0.35 °C only, which verifies the functionality of the proposed simulator.
To perform the process-variation calibration, the value of *N~S~* = 6500 was set to *T~C~* = 40 °C to realize a calibrated *R* of approximately 0.05 °C. The same values of *k* = 21 and *t~REF~* = 25 ns were selected and the model *t~NOT,i~*(40 °C) was used to determine the *n~C,i~* for the three process corners. With the same operation as that of the uncalibrated sensor, the calibrated sensor attained the calibrated *N~C,i~*(*T*) in an extremely short time. The generated figures for the simulated *N~C,i~*(*T*) after the calibration and for the corresponding inaccuracy after one-point calibration are shown in [Figure 10](#sensors-16-01256-f010){ref-type="fig"}. The *N~C,i~*(*T*) values for the three corners nearly coincided and a stable *R* was achieved, thereby validating the proposed one-point calibration.
To verify the precision, a calibration was executed using HSPICE for comparison; this required a substantial amount of simulation time. The HSPICE-simulated *n*~C,*i*~ were used as the corresponding time gain values to simulate a transistor-level calibrated sensor, and (predictably) the simulation time was very long. The simulation results *N~C,i~*(*T*) of the two simulators are shown in [Figure 11](#sensors-16-01256-f011){ref-type="fig"}a and the maximal difference is in the range of −0.7 °C to 0.6 °C, as shown in [Figure 11](#sensors-16-01256-f011){ref-type="fig"}b. The highly similar results of these tests validate the calibration of the proposed simulator. To further verify the effect of the voltage variation, we capture the models of the CMOS inverter from 3.1 V to 3.5 V and store them in the library. With the same operation, [Figure 12](#sensors-16-01256-f012){ref-type="fig"} shows the corresponding differences and presents the similar results, which validate the proposed simulator for the different-voltage operation.
For precision considerations, the selected value of *k* also determines the precision of the simulator because of the precision of the captured models. Using the models listed in [Table 1](#sensors-16-01256-t001){ref-type="table"}, simulations of the calibrated sensor were performed using the proposed system and HSPICE with values of *k* that varied from 17 to 25 with increments of 2. The corresponding differences in degrees Celsius are presented in [Figure 13](#sensors-16-01256-f013){ref-type="fig"}. The smallest difference was at *k* = 21; both *k* = 17 and 25 had larger differences than *k* = 21 did. The greater the distance between *k* and 21 was, the greater the difference was. This shows that the captured models for identical stages should be used to achieve the highest possible precision.
To improve the precision, the library was extended with models of the appropriate stages (*k* = 17--25). For simplicity, [Figure 14](#sensors-16-01256-f014){ref-type="fig"} shows the extended library with three TT corner models. In addition to the extended models, the control logics for selecting the *k* values and the corresponding switches were added to output the appropriate model for the oscillator. Additionally, the designer could input *k* \> 25 or *k* \< 17 and the system would automatically substitute the model for *k* = 25 or *k* = 17, respectively. The improvements from this modification are presented in [Figure 15](#sensors-16-01256-f015){ref-type="fig"}. The precision values were obviously enhanced by this modified library. When necessary, the detailed models for every value of *k* can be constructed to achieve high precision by increasing the library cost. The experiments show that the proposed simulator for all-digital CMOS TDSTSs can perform rapid simulations with accurate results.
5. Conclusions {#sec5-sensors-16-01256}
==============
An accurate behavioral simulator of an all-digital CMOS TDSTS based on SIMULINK is presented in this paper. A behavioral simulation tool was developed as a rapid performance evaluator that provides the benefits of a user-friendly graphical interface, high flexibility for circuit extension, and substantial data processing capabilities. With the TDM and the captured models of the unit device, the proposed simulator derives accurate results rapidly. The high precision of the simulator was verified through a transistor-level simulation by using HSPICE. To our knowledge, this is the first behavioral simulator for TDSTSs.
This study was financially supported by Ministry of Science and Technology (MOST) of Taiwan for Grant MOST 104-2221-E-327-031. The authors would like to express their deep appreciation to National Chip Implementation Center (CIC) of Taiwan for supporting EDA tools.
C.-C.C. proposed the idea, designed the simulator, and wrote the manuscript. C.-L.C. helped with the simulator design and the manuscript writing. Y.-T.L. implemented the simulator and performed the simulations.
The authors declare no conflict of interest.
{#sensors-16-01256-f001}
{#sensors-16-01256-f002}
{#sensors-16-01256-f003}
{#sensors-16-01256-f004}
{#sensors-16-01256-f005}
{#sensors-16-01256-f006}
{#sensors-16-01256-f007}
{#sensors-16-01256-f008}
{#sensors-16-01256-f009}
{#sensors-16-01256-f010}
{#sensors-16-01256-f011}
{#sensors-16-01256-f012}
{#sensors-16-01256-f013}
{#sensors-16-01256-f014}
{#sensors-16-01256-f015}
sensors-16-01256-t001_Table 1
######
Simulation model (data) with numerical fineness of tens in digit in fs.
Process Corner TT (ps) FF (ps)
------- ---------------- --------- ---------
0 °C 682.71 615.89 761.48
10 °C 707.32 638.92 790.24
20 °C 732.76 661.34 818.87
30 °C 756.34 682.60 845.57
40 °C 781.72 704.23 872.86
50 °C 805.21 726.93 898.20
60 °C 828.53 747.62 926.09
70 °C 851.50 769.51 951.71
80 °C 875.17 790.70 978.69
|
/*
* open-color v1.4.2
* https://github.com/yeun/open-color/blob/master/open-color.css
*/
//General
$oc-white: #ffffff;
$oc-white-rgb: 255, 255, 255;
$oc-black: #000000;
$oc-black-rgb: 0, 0, 0;
//Gray
$oc-gray-0: #f8f9fa;
$oc-gray-0-rgb: 248, 249, 250;
$oc-gray-1: #f1f3f5;
$oc-gray-1-rgb: 241, 243, 245;
$oc-gray-2: #e9ecef;
$oc-gray-2-rgb: 233, 236, 239;
$oc-gray-3: #dee2e6;
$oc-gray-3-rgb: 222, 226, 230;
$oc-gray-4: #ced4da;
$oc-gray-4-rgb: 206, 212, 218;
$oc-gray-5: #adb5bd;
$oc-gray-5-rgb: 173, 181, 189;
$oc-gray-6: #868e96;
$oc-gray-6-rgb: 134, 142, 150;
$oc-gray-7: #495057;
$oc-gray-7-rgb: 73, 80, 87;
$oc-gray-8: #343a40;
$oc-gray-8-rgb: 52, 58, 64;
$oc-gray-9: #212529;
$oc-gray-9-rgb: 33, 37, 41;
//Red
$oc-red-0: #fff5f5;
$oc-red-0-rgb: 255, 245, 245;
$oc-red-1: #ffe3e3;
$oc-red-1-rgb: 255, 227, 227;
$oc-red-2: #ffc9c9;
$oc-red-2-rgb: 255, 201, 201;
$oc-red-3: #ffa8a8;
$oc-red-3-rgb: 255, 168, 168;
$oc-red-4: #ff8787;
$oc-red-4-rgb: 255, 135, 135;
$oc-red-5: #ff6b6b;
$oc-red-5-rgb: 255, 107, 107;
$oc-red-6: #fa5252;
$oc-red-6-rgb: 250, 82, 82;
$oc-red-7: #f03e3e;
$oc-red-7-rgb: 240, 62, 62;
$oc-red-8: #e03131;
$oc-red-8-rgb: 224, 49, 49;
$oc-red-9: #c92a2a;
$oc-red-9-rgb: 201, 42, 42;
//Pink
$oc-pink-0: #fff0f6;
$oc-pink-0-rgb: 255, 240, 246;
$oc-pink-1: #ffdeeb;
$oc-pink-1-rgb: 255, 222, 235;
$oc-pink-2: #fcc2d7;
$oc-pink-2-rgb: 252, 194, 215;
$oc-pink-3: #faa2c1;
$oc-pink-3-rgb: 250, 162, 193;
$oc-pink-4: #f783ac;
$oc-pink-4-rgb: 247, 131, 172;
$oc-pink-5: #f06595;
$oc-pink-5-rgb: 240, 101, 149;
$oc-pink-6: #e64980;
$oc-pink-6-rgb: 230, 73, 128;
$oc-pink-7: #d6336c;
$oc-pink-7-rgb: 214, 51, 108;
$oc-pink-8: #c2255c;
$oc-pink-8-rgb: 194, 37, 92;
$oc-pink-9: #a61e4d;
$oc-pink-9-rgb: 166, 30, 77;
//Grape
$oc-grape-0: #f8f0fc;
$oc-grape-0-rgb: 248, 240, 252;
$oc-grape-1: #f3d9fa;
$oc-grape-1-rgb: 243, 217, 250;
$oc-grape-2: #eebefa;
$oc-grape-2-rgb: 238, 190, 250;
$oc-grape-3: #e599f7;
$oc-grape-3-rgb: 229, 153, 247;
$oc-grape-4: #da77f2;
$oc-grape-4-rgb: 218, 119, 242;
$oc-grape-5: #cc5de8;
$oc-grape-5-rgb: 204, 93, 232;
$oc-grape-6: #be4bdb;
$oc-grape-6-rgb: 190, 75, 219;
$oc-grape-7: #ae3ec9;
$oc-grape-7-rgb: 174, 62, 201;
$oc-grape-8: #9c36b5;
$oc-grape-8-rgb: 156, 54, 181;
$oc-grape-9: #862e9c;
$oc-grape-9-rgb: 134, 46, 156;
//Violet
$oc-violet-0: #f3f0ff;
$oc-violet-0-rgb: 243, 240, 255;
$oc-violet-1: #e5dbff;
$oc-violet-1-rgb: 229, 219, 255;
$oc-violet-2: #d0bfff;
$oc-violet-2-rgb: 208, 191, 255;
$oc-violet-3: #b197fc;
$oc-violet-3-rgb: 177, 151, 252;
$oc-violet-4: #9775fa;
$oc-violet-4-rgb: 151, 117, 250;
$oc-violet-5: #845ef7;
$oc-violet-5-rgb: 132, 94, 247;
$oc-violet-6: #7950f2;
$oc-violet-6-rgb: 121, 80, 242;
$oc-violet-7: #7048e8;
$oc-violet-7-rgb: 112, 72, 232;
$oc-violet-8: #6741d9;
$oc-violet-8-rgb: 103, 65, 217;
$oc-violet-9: #5f3dc4;
$oc-violet-9-rgb: 95, 61, 196;
//Indigo
$oc-indigo-0: #edf2ff;
$oc-indigo-0-rgb: 237, 242, 255;
$oc-indigo-1: #dbe4ff;
$oc-indigo-1-rgb: 219, 228, 255;
$oc-indigo-2: #bac8ff;
$oc-indigo-2-rgb: 186, 200, 255;
$oc-indigo-3: #91a7ff;
$oc-indigo-3-rgb: 145, 167, 255;
$oc-indigo-4: #748ffc;
$oc-indigo-4-rgb: 116, 143, 252;
$oc-indigo-5: #5c7cfa;
$oc-indigo-5-rgb: 92, 124, 250;
$oc-indigo-6: #4c6ef5;
$oc-indigo-6-rgb: 76, 110, 245;
$oc-indigo-7: #4263eb;
$oc-indigo-7-rgb: 66, 99, 235;
$oc-indigo-8: #3b5bdb;
$oc-indigo-8-rgb: 59, 91, 219;
$oc-indigo-9: #364fc7;
$oc-indigo-9-rgb: 54, 79, 199;
//Blue
$oc-blue-0: #e8f7ff;
$oc-blue-0-rgb: 232, 247, 255;
$oc-blue-1: #ccedff;
$oc-blue-1-rgb: 204, 237, 255;
$oc-blue-2: #a3daff;
$oc-blue-2-rgb: 163, 218, 255;
$oc-blue-3: #72c3fc;
$oc-blue-3-rgb: 114, 195, 252;
$oc-blue-4: #4dadf7;
$oc-blue-4-rgb: 77, 173, 247;
$oc-blue-5: #329af0;
$oc-blue-5-rgb: 50, 154, 240;
$oc-blue-6: #228ae6;
$oc-blue-6-rgb: 34, 138, 230;
$oc-blue-7: #1c7cd6;
$oc-blue-7-rgb: 28, 124, 214;
$oc-blue-8: #1b6ec2;
$oc-blue-8-rgb: 27, 110, 194;
$oc-blue-9: #1862ab;
$oc-blue-9-rgb: 24, 98, 171;
//Cyan
$oc-cyan-0: #e3fafc;
$oc-cyan-0-rgb: 227, 250, 252;
$oc-cyan-1: #c5f6fa;
$oc-cyan-1-rgb: 197, 246, 250;
$oc-cyan-2: #99e9f2;
$oc-cyan-2-rgb: 153, 233, 242;
$oc-cyan-3: #66d9e8;
$oc-cyan-3-rgb: 102, 217, 232;
$oc-cyan-4: #3bc9db;
$oc-cyan-4-rgb: 59, 201, 219;
$oc-cyan-5: #22b8cf;
$oc-cyan-5-rgb: 34, 184, 207;
$oc-cyan-6: #15aabf;
$oc-cyan-6-rgb: 21, 170, 191;
$oc-cyan-7: #1098ad;
$oc-cyan-7-rgb: 16, 152, 173;
$oc-cyan-8: #0c8599;
$oc-cyan-8-rgb: 12, 133, 153;
$oc-cyan-9: #0b7285;
$oc-cyan-9-rgb: 11, 114, 133;
//Teal
$oc-teal-0: #e6fcf5;
$oc-teal-0-rgb: 230, 252, 245;
$oc-teal-1: #c3fae8;
$oc-teal-1-rgb: 195, 250, 232;
$oc-teal-2: #96f2d7;
$oc-teal-2-rgb: 150, 242, 215;
$oc-teal-3: #63e6be;
$oc-teal-3-rgb: 99, 230, 190;
$oc-teal-4: #38d9a9;
$oc-teal-4-rgb: 56, 217, 169;
$oc-teal-5: #20c997;
$oc-teal-5-rgb: 32, 201, 151;
$oc-teal-6: #12b886;
$oc-teal-6-rgb: 18, 184, 134;
$oc-teal-7: #0ca678;
$oc-teal-7-rgb: 12, 166, 120;
$oc-teal-8: #099268;
$oc-teal-8-rgb: 9, 146, 104;
$oc-teal-9: #087f5b;
$oc-teal-9-rgb: 8, 127, 91;
//Green
$oc-green-0: #ebfbee;
$oc-green-0-rgb: 235, 251, 238;
$oc-green-1: #d3f9d8;
$oc-green-1-rgb: 211, 249, 216;
$oc-green-2: #b2f2bb;
$oc-green-2-rgb: 178, 242, 187;
$oc-green-3: #8ce99a;
$oc-green-3-rgb: 140, 233, 154;
$oc-green-4: #69db7c;
$oc-green-4-rgb: 105, 219, 124;
$oc-green-5: #51cf66;
$oc-green-5-rgb: 81, 207, 102;
$oc-green-6: #40c057;
$oc-green-6-rgb: 64, 192, 87;
$oc-green-7: #37b24d;
$oc-green-7-rgb: 55, 178, 77;
$oc-green-8: #2f9e44;
$oc-green-8-rgb: 47, 158, 68;
$oc-green-9: #2b8a3e;
$oc-green-9-rgb: 43, 138, 62;
//Lime
$oc-lime-0: #f4fce3;
$oc-lime-0-rgb: 244, 252, 227;
$oc-lime-1: #e9fac8;
$oc-lime-1-rgb: 233, 250, 200;
$oc-lime-2: #d8f5a2;
$oc-lime-2-rgb: 216, 245, 162;
$oc-lime-3: #c0eb75;
$oc-lime-3-rgb: 192, 235, 117;
$oc-lime-4: #a9e34b;
$oc-lime-4-rgb: 169, 227, 75;
$oc-lime-5: #94d82d;
$oc-lime-5-rgb: 148, 216, 45;
$oc-lime-6: #82c91e;
$oc-lime-6-rgb: 130, 201, 30;
$oc-lime-7: #74b816;
$oc-lime-7-rgb: 116, 184, 22;
$oc-lime-8: #66a80f;
$oc-lime-8-rgb: 102, 168, 15;
$oc-lime-9: #5c940d;
$oc-lime-9-rgb: 92, 148, 13;
//Yellow
$oc-yellow-0: #fff9db;
$oc-yellow-0-rgb: 255, 249, 219;
$oc-yellow-1: #fff3bf;
$oc-yellow-1-rgb: 255, 243, 191;
$oc-yellow-2: #ffec99;
$oc-yellow-2-rgb: 255, 236, 153;
$oc-yellow-3: #ffe066;
$oc-yellow-3-rgb: 255, 224, 102;
$oc-yellow-4: #ffd43b;
$oc-yellow-4-rgb: 255, 212, 59;
$oc-yellow-5: #fcc419;
$oc-yellow-5-rgb: 252, 196, 25;
$oc-yellow-6: #fab005;
$oc-yellow-6-rgb: 250, 176, 5;
$oc-yellow-7: #f59f00;
$oc-yellow-7-rgb: 245, 159, 0;
$oc-yellow-8: #f08c00;
$oc-yellow-8-rgb: 240, 140, 0;
$oc-yellow-9: #e67700;
$oc-yellow-9-rgb: 230, 119, 0;
//Orange
$oc-orange-0: #fff4e6;
$oc-orange-0-rgb: 255, 244, 230;
$oc-orange-1: #ffe8cc;
$oc-orange-1-rgb: 255, 232, 204;
$oc-orange-2: #ffd8a8;
$oc-orange-2-rgb: 255, 216, 168;
$oc-orange-3: #ffc078;
$oc-orange-3-rgb: 255, 192, 120;
$oc-orange-4: #ffa94d;
$oc-orange-4-rgb: 255, 169, 77;
$oc-orange-5: #ff922b;
$oc-orange-5-rgb: 255, 146, 43;
$oc-orange-6: #fd7e14;
$oc-orange-6-rgb: 253, 126, 20;
$oc-orange-7: #f76707;
$oc-orange-7-rgb: 247, 103, 7;
$oc-orange-8: #e8590c;
$oc-orange-8-rgb: 232, 89, 12;
$oc-orange-9: #d9480f;
$oc-orange-9-rgb: 217, 72, 15;
|
/*
* Copyright 2010-2017 Amazon.com, Inc. or its affiliates. All Rights Reserved.
*
* Licensed under the Apache License, Version 2.0 (the "License").
* You may not use this file except in compliance with the License.
* A copy of the License is located at
*
* http://aws.amazon.com/apache2.0
*
* or in the "license" file accompanying this file. This file is distributed
* on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either
* express or implied. See the License for the specific language governing
* permissions and limitations under the License.
*/
#pragma once
#include <aws/gamelift/GameLift_EXPORTS.h>
#include <aws/gamelift/GameLiftRequest.h>
#include <aws/core/utils/memory/stl/AWSString.h>
#include <utility>
namespace Aws
{
namespace GameLift
{
namespace Model
{
/**
* <p>Represents the input for a request action.</p><p><h3>See Also:</h3> <a
* href="http://docs.aws.amazon.com/goto/WebAPI/gamelift-2015-10-01/GetInstanceAccessInput">AWS
* API Reference</a></p>
*/
class AWS_GAMELIFT_API GetInstanceAccessRequest : public GameLiftRequest
{
public:
GetInstanceAccessRequest();
// Service request name is the Operation name which will send this request out,
// each operation should has unique request name, so that we can get operation's name from this request.
// Note: this is not true for response, multiple operations may have the same response name,
// so we can not get operation's name from response.
inline virtual const char* GetServiceRequestName() const override { return "GetInstanceAccess"; }
Aws::String SerializePayload() const override;
Aws::Http::HeaderValueCollection GetRequestSpecificHeaders() const override;
/**
* <p>Unique identifier for a fleet that contains the instance you want access to.
* The fleet can be in any of the following statuses: <code>ACTIVATING</code>,
* <code>ACTIVE</code>, or <code>ERROR</code>. Fleets with an <code>ERROR</code>
* status may be accessible for a short time before they are deleted.</p>
*/
inline const Aws::String& GetFleetId() const{ return m_fleetId; }
/**
* <p>Unique identifier for a fleet that contains the instance you want access to.
* The fleet can be in any of the following statuses: <code>ACTIVATING</code>,
* <code>ACTIVE</code>, or <code>ERROR</code>. Fleets with an <code>ERROR</code>
* status may be accessible for a short time before they are deleted.</p>
*/
inline void SetFleetId(const Aws::String& value) { m_fleetIdHasBeenSet = true; m_fleetId = value; }
/**
* <p>Unique identifier for a fleet that contains the instance you want access to.
* The fleet can be in any of the following statuses: <code>ACTIVATING</code>,
* <code>ACTIVE</code>, or <code>ERROR</code>. Fleets with an <code>ERROR</code>
* status may be accessible for a short time before they are deleted.</p>
*/
inline void SetFleetId(Aws::String&& value) { m_fleetIdHasBeenSet = true; m_fleetId = std::move(value); }
/**
* <p>Unique identifier for a fleet that contains the instance you want access to.
* The fleet can be in any of the following statuses: <code>ACTIVATING</code>,
* <code>ACTIVE</code>, or <code>ERROR</code>. Fleets with an <code>ERROR</code>
* status may be accessible for a short time before they are deleted.</p>
*/
inline void SetFleetId(const char* value) { m_fleetIdHasBeenSet = true; m_fleetId.assign(value); }
/**
* <p>Unique identifier for a fleet that contains the instance you want access to.
* The fleet can be in any of the following statuses: <code>ACTIVATING</code>,
* <code>ACTIVE</code>, or <code>ERROR</code>. Fleets with an <code>ERROR</code>
* status may be accessible for a short time before they are deleted.</p>
*/
inline GetInstanceAccessRequest& WithFleetId(const Aws::String& value) { SetFleetId(value); return *this;}
/**
* <p>Unique identifier for a fleet that contains the instance you want access to.
* The fleet can be in any of the following statuses: <code>ACTIVATING</code>,
* <code>ACTIVE</code>, or <code>ERROR</code>. Fleets with an <code>ERROR</code>
* status may be accessible for a short time before they are deleted.</p>
*/
inline GetInstanceAccessRequest& WithFleetId(Aws::String&& value) { SetFleetId(std::move(value)); return *this;}
/**
* <p>Unique identifier for a fleet that contains the instance you want access to.
* The fleet can be in any of the following statuses: <code>ACTIVATING</code>,
* <code>ACTIVE</code>, or <code>ERROR</code>. Fleets with an <code>ERROR</code>
* status may be accessible for a short time before they are deleted.</p>
*/
inline GetInstanceAccessRequest& WithFleetId(const char* value) { SetFleetId(value); return *this;}
/**
* <p>Unique identifier for an instance you want to get access to. You can access
* an instance in any status.</p>
*/
inline const Aws::String& GetInstanceId() const{ return m_instanceId; }
/**
* <p>Unique identifier for an instance you want to get access to. You can access
* an instance in any status.</p>
*/
inline void SetInstanceId(const Aws::String& value) { m_instanceIdHasBeenSet = true; m_instanceId = value; }
/**
* <p>Unique identifier for an instance you want to get access to. You can access
* an instance in any status.</p>
*/
inline void SetInstanceId(Aws::String&& value) { m_instanceIdHasBeenSet = true; m_instanceId = std::move(value); }
/**
* <p>Unique identifier for an instance you want to get access to. You can access
* an instance in any status.</p>
*/
inline void SetInstanceId(const char* value) { m_instanceIdHasBeenSet = true; m_instanceId.assign(value); }
/**
* <p>Unique identifier for an instance you want to get access to. You can access
* an instance in any status.</p>
*/
inline GetInstanceAccessRequest& WithInstanceId(const Aws::String& value) { SetInstanceId(value); return *this;}
/**
* <p>Unique identifier for an instance you want to get access to. You can access
* an instance in any status.</p>
*/
inline GetInstanceAccessRequest& WithInstanceId(Aws::String&& value) { SetInstanceId(std::move(value)); return *this;}
/**
* <p>Unique identifier for an instance you want to get access to. You can access
* an instance in any status.</p>
*/
inline GetInstanceAccessRequest& WithInstanceId(const char* value) { SetInstanceId(value); return *this;}
private:
Aws::String m_fleetId;
bool m_fleetIdHasBeenSet;
Aws::String m_instanceId;
bool m_instanceIdHasBeenSet;
};
} // namespace Model
} // namespace GameLift
} // namespace Aws
|
[Antioxidant effect of laser irradiation in chronic bronchitis].
The levels of medium-weight molecules and the parameters of lipid peroxidation (antioxidative defence) were studied in 64 patients with chronic bronchitis (33 with chronic pyoobstructive bronchitis and 31 with nonobstructive bronchitis). There was a substantial increase in the concentrations of lipid peroxides, malonic dialdehyde, and medium-weight molecules in the blood and a considerable decrease in its levels of vitamin E and the enzyme catalase. To correct the above disorders, the author used the conventional therapy alone or in combination with endobronchial laser radiation. The results of treatment, which were assessed by the end of 3rd and 6th weeks of its initiation, only does a combination of traditional therapy and laser radiation provides a balance of the lipid peroxidation balance--antioxidative defence followed by its stabilization by the end of week 6 of treatment. |
We all know that eating fruits and vegetables is very important, but they can also take time to prep, and you have to eat them within a certain amount of time because they go bad quickly. One way to increase your servings is to have a homemade smoothie (ones from restaurants and smoothie shops are usually loaded with sugar and excess ingredients you don’t want). Our tip for making smoothies quickly? Make a bunch of baggies with your smoothie ingredients and then freeze them. If you have fruits or vegetables that are about to go bad, this is an excellent way to extend their life, and cut down on waste. So, grab 7 little plastic baggies (and yes you can keep reusing them) and below is a suggested recipe: ½ banana chopped up ½ cup fresh or already frozen berries 1 C baby spinach or baby kale 1 Tbsp flaxseed Place each set of ingredients into a bag. Throw in the freezer. To make, put bag contents in blender with 4oz orange juice and 4 oz water. Blend and go. Add a hardboiled egg on the side for an added protein boost. |
Drink Pineapple Water In The Morning For A Year (And These 10 Things Happen)
Ayurvedic practitioners are the ones who claim that your daily routine is the one to affect the way your body fights and prevents diseases. We’re here to discuss about the benefits of fresh pineapple water. It can boost your body’s ability to cope with diseases. If you drink it before your breakfast, you’ll be able to notice the amazing effect it has on your health.
Pineapples contain various micronutrients, vitamin and bromelain. We need all of them so that we can function normally.
Here are 10 reasons why we should drink pineapple water:
Reduce inflammation
Bromelain is the one that offers a strong anti-inflammatory effect. It fights inflammatory processes, and eliminates toxins at the same time. Eat fresh pineapple chunks as often as you can! It will help you relieve any sports injury as well as any arthritis symptom.
Weight loss
The fiber found in pineapples is slowly digested. After you’ve eaten a pineapple snack, you won’t crave for food for a long time. It will also help you prevent the fat and sugar cravings. Thiamine is also a part of pineapples and it turns the carbs into energy, but also stimulates your metabolism.
Eliminate parasites from liver and gut
Bromelain is full of anti-parasitic properties. They can keep your intestines healthy and safe from parasites. Scientists have managed to prove that a simple 3-day pineapple fasting is able to destroy tape worms.
Thyroid function
Iodine and bromelain contained in pineapples are both excellent for your thyroid. They are also excellent to help you treat various autoimmune disorders, but also relieve any symptoms associated with thyroid dysfunction.
Electrolyte balance
The potassium found in pineapples balances electrolytes and strengthens your system. This mineral will help you prevent cramps and injuries.
Flush out toxins and heavy metals
Pineapples contain a lot of enzymes, fiber, and antioxidants that work in a synergy to remove toxins and heavy metals from the body.
Enhance digestion
Bromelain is the one that eases the digestion of protein.
Strengthen gums, whiten and protect teeth
According to Dr. Frawley, bromelain is very powerful and helps in removing stains. You can also use it to get rid of plaque!
Better vision
Pineapples are also abundant in beta-carotene and vitamin A. They’re both excellent in boosting your vision. According to experts at the Archives of Ophthalmology, consuming 3 or more servings of pineapple will help you reduce the risk of age-related macular degeneration (ARMD). According to statistics, this is the top cause of vision loss in elderly.
Prevent cancer
A research published in the journal Planta Medica managed to prove that bromelain works better than 5-fluorouracil which is a chemo drug commonly given to cancer patients!
In researchers’ own words: “This antitumoral effect (of bromelain) was superior to that of 5-FU (5-fluorouracil), whose survival index was approximately 363%, relative to the untreated control.” |
CinniBird is the ONLY ORIGINAL kitchen implement to make creative messages and drawings with all natural materials found in food, such as cinnamon, coffee grounds, instant cocoa powder, Hungarian paprika, ground parsley, ground sugar, and more. CinniBird offers a great way to surprise loved ones with a thoughtful message written in their favorite spice, and it’s perfect for adding a little extra ‘spice’ to parties and gatherings. |
Factors influencing the psychological impact of prolonged unemployment and of re-employment.
Six hundred and twenty-nine unemployed men were re-interviewed 9 months after initial measurement of their psychological health and commitment to the labour market. For those men remaining continuously unemployed between interviews, no further decrement was observed in mean General Health Questionnaire scores after 3 months without a job, but a significant deterioration was recorded for the sub-sample initially unemployed for less than 3 months. Small but significant declines were observed after 3 months on a single-item measure of reported health and on an 8-item index of commitment to the labour market. For those regaining paid work, all measures of health showed large improvements, and employment commitment was unchanged. Multiple regression analyses were used to examine factors associated with magnitude of changes during continuous unemployment, yielding a systematic pattern of significant relationships. For example, higher employment commitment at initial interview was significantly associated with a greater subsequent decline in psychological health, but not in physical health; reporting a chronic health impairment at initial interview was significantly associated with a greater subsequent decrement in physical health, but not in psychological health. |
Dispatchers said the fire broke out Wednesday around 4 p.m. at R.H. Towing, near the intersection of St. James Avenue and Plainfield Road.
A man who lived in a basement apartment was trapped inside the burning building for between five to eight minutes, firefighters said.
The man was unresponsive when firefighters rescued him from the home.
He was flown from Bethesda North Hospital to the University of Cincinnati Medical Center with burns to 80 percent of his body, the fire chief said. He is listed in critical condition.
“He had came up once to say the electric went out and he went back down,” said Holly Hess, an employee of the towing company connected to the apartment. “When they realized there was smoke coming through the walls, they tried to go down and get him, but they couldn’t get the door open.”
Hess and Bob Jennings watched helplessly as firefighters carried their friend from the burning building.
“I see him almost every day,” Jennings said. “Matter of fact, I talked to him a few minutes before the fire broke out. I was downstairs starting to do my laundry, and he was saying he had electrical problems. Apparently, the problem was worse than we realized. It must have been in the wall already.”
The victim’s friends feared a handicap prevented him from escaping the blaze.
“I’m kind of afraid for him,” said Judy Sturgill, an employee of the towing company. “He has had one leg amputated and wasn’t in the best of health.” |
Q:
Missing product data on Magento reports (bestseller, products ordered) although in database
Yesterday I ran a modified XML export at the Sales -> Orders overview. During this process there was an error and now I have a reporting issue:
My reports seem to be reset and all information prior to the export appears to be missing.
However, everything works fine with the reports in the interval after the incident, so no unusual behaviour - topsellers etc. are shown like you would expect them to.
The following reports are affected (not a complete list):
Reports -> Products -> Bestsellers
Reports -> Products -> Products Ordered
Reports -> Customers -> Customers by Orders Total
Reports -> Sales -> Tax
However, for example this report works fine:
Reports -> Shopping Cart -> [any]
When going to Sales -> Orders I have a complete list of all sales ever done in the shop. Whichever order I open, there is all the required information available (e.g. products bought, subtotal, date etc.).
I read that the
Reports -> Products -> Bestsellers
table is based on the sales_flat_order_item & sales_flat_order table. I checked these, all entries up to the first day of the shop are there.
As far as I can tell, all shop history is available and no data has been deleted. I also tried Reports -> Refresh statistics (lifetime) but it had no effect.
Does anybody know where else to look or what to check?
A:
After some database examination I discovered that in the table sales_flat_order_item the column "state" had Null everywhere whereas the column "status" was fine and had the right information.
I updated the table via SQL
SELECT * FROM sales_flat_order UPDATE sales_flat_order SET state
= "processing" WHERE state is Null
and refresehd the lifetime statistics in the backend (reports -> update statistics) and the reports now show everything correctly once more.
|
News Main Menu
The GridSTAR Center under construction is a Smart Energy Campus initiative at The Navy Yard in Philadelphia.
Image: Mike Gorga
GridSTAR Net Zero Energy Demonstration Project under way at The Navy Yard
May 13, 2013
GridSTAR Net Zero Energy Demonstration Project under way at The Navy Yard
PHILADELPHIA — A powerful collaboration of researchers, manufacturers and economic development officials are embarking on a groundbreaking demonstration project for smart-grid, net zero energy buildings called the GridSTAR Center — a Smart Energy Campus initiative at The Navy Yard in Philadelphia.
Spearheaded by Penn State with support from the U.S. Department of Energy, Commonwealth of Pennsylvania and Philadelphia Industrial Development Corporation (PIDC), the GridSTAR Net Zero Energy Demonstration Structure is the first phase of the GridSTAR Center and will serve as a valuable hub for workforce training, building performance testing, energy management research and “smart” microgrid modernization deployments. Strategically located at The Navy Yard — which serves as a shining example of energy-related innovation and research — the structure is slated for completion this summer.
“The GridSTAR Net Zero Energy Demonstration Structure will create a live, interactive demonstration of electrical systems technologies, serve as a hub for hands-on education and training, and provide a rich infrastructure for data and research,” said David Riley, project leader and Penn State associate professor of architectural engineering. “In leveraging the talented pool of Pennsylvania-based public and private sector leaders, the GridSTAR Net Zero Energy Demonstration Structure offers tremendous potential to further drive the adoption of energy efficiency, solar energy and energy storage systems in our residential communities.”
The GridSTAR Net Zero Energy Demonstration Structure utilizes industry-leading construction techniques and an innovative strategy for energy generation, management and coordination within the host microgrid. Using modular construction techniques, the wall systems for the structure were assembled by Simplex Industries at their climate-controlled Scranton, Pa., facility. A team of building product manufacturers is supporting the project through product donations and technical expertise, including:
• Ultra-sophisticated, wireless SmartSite™ outdoor lighting systems from Amerlux that will broadcast information about the project to passersby.
PIDC, the master developer of The Navy Yard, provided the microgrid infrastructure and managerial collaboration in partnership with the GridSTAR Center. The Navy Yard’s Smart Energy Campus is a collaboration of businesses, universities and government, focused on making The Navy Yard a national center for energy research, education and commercialization. By actively engaging all of The Navy Yard’s assets — its people, infrastructure and buildings — the Smart Energy Campus is developing and deploying net generation solutions in energy efficiency, smart grids and related engineering and IT fields.
The highly instrumented building will be connected to a microgrid test loop within the larger unregulated microgrid of The Navy Yard. Components will be able to be easily installed and removed using “plug and play” adaptations that will also be connected to the PJM electricity market and operate in response to real-time price signals.
The modular components of the structure will be delivered to The Navy Yard in May, with on-site construction and interior finishing continuing through the end of June. Once complete, the structure will be used as a research facility, a classroom laboratory and a showcase for ultra energy efficient living.
The additional phases of the GridSTAR Center will include a solar training facility and electric vehicle (EV) charging station, which will provide a comprehensive infrastructure to further optimize solar power generation and energy storage. |
1. Field of the Invention
The present invention relates to a starter that starts an engine by pushing a pinion with a shift lever so that the pinion meshes with a ring gear of the engine.
2. Background Art
A structure often adopted by a starter of this type is as follows. That is, a lever device (shift lever) provided with a lever ring is swayed by exploiting a plunger attracting force of a magnet switch. A pinion provided integrally with a clutch shaft (output shaft) is then pushed in an axial direction by the lever ring and meshes with a ring gear to get the engine started. After the engine is started, the pinion is demeshed from the ring gear.
In order to start the engine, it is necessary to form the clutch shaft to be able to rotate at a high speed. Also, in order to allow the ring gear and the pinion to mesh with each other, it is necessary to form the clutch shaft to be movable in the axial direction and thereby become able to operate in association with an operation of the lever device including the lever ring. Further, in order to prevent displacement between the clutch shaft and the lever device, there is a case where the clutch shaft and the lever device are coupled to each other.
In this case, the starter adopts a fall-off preventing structure. More specifically, after components, such as the lever ring, a stop ring, and a washer, are attached to the clutch shaft, these components are fixed to the clutch shaft with a snap ring so as not to fall off (for example, Patent Document 1).
A C-type snap ring, which is a circular ring with a uniform peripheral rim width and having a notch, is used as the snap ring and serves as a retainer for the respective components when the engine is started normally. However, in a case where the pinion is not pushed back after the engine is started and the ring gear and the pinion remain in a meshed state, there occurs a phenomenon called an overrun that a motor rotates excessively due to rotations of the engine. In order to avoid this inconvenience, the starter of this type is provided with a one-way clutch. Nevertheless, it is still impossible to prevent an overrun at a predetermined region between the clutch and the pinion, that is, the clutch shaft to which the snap ring is attached, and the clutch shaft and the snap ring rotate at a high speed. Accordingly, an excessively large centrifugal force of the clutch shaft in a radially outward direction acts on the snap ring attached to the clutch shaft. As the clutch shaft rotates faster, the snap ring may possibly undergo deformation because of an increasing centrifugal force. When the centrifugal force exceeds fixing force of the snap ring, the snap ring may undergo expansion deformation to the extent that the snap ring falls off from the clutch shaft. As a result, the stop ring and the washer fall off from the clutch shaft. In a case where the lever device is unable to push the pinion provided integrally with the clutch shaft in the axial direction, the engine fail to start. In a case where the lever device is unable to demesh the pinion from the ring gear after the engine is started, the starter is damaged by the overrun. The starter in the related art therefore has a problem that the reliability is deteriorated considerably.
As a countermeasure to prevent a fall-off of the snap ring, the rim width of the snap ring may be increased to make the snap ring more rigid, so that the snap ring has not only the fixing force necessary to regulate the respective components attached to the clutch shaft in the axial direction but also the fixing force high enough to withstand the centrifugal force of the clutch shaft generated while the clutch shaft is rotating at a high speed. Another countermeasure may be to provide a holder that is fit onto the snap ring shown in FIG. 7 of Patent Document 1 from a radially outward direction to prevent the snap ring from undergoing deformation due to the centrifugal force, thereby making it possible to prevent a fall-off of the snap ring.
Patent Document 1: Japanese Patent No. 4375314
According to the former countermeasure to prevent a fall-off of the snap ring, however, because the snap ring is made more rigid by increasing the rim width thereof, a large force is necessary to attach or remove the snap ring when the starter is assembled or disassembled. The former countermeasure therefore has a problem that attaching and removing workability becomes poor. Meanwhile, the latter countermeasure requires an extra work to attach or remove the fall-off preventing holder when the starter is assembled or disassembled. The latter countermeasure therefore has a problem that attaching and removing workability of the snap ring becomes poor in comparison with a structure having no fall-off preventing holder. |
Q:
Compound expression in if statement
I stumbled upon the ability to do this.
#include <iostream>
using namespace std;
int main() {
if ( ({int i = 1024; i == 10;}) ) {
cout << "In" << endl;
}
}
The important disassembly area seems to be:
-> 0x10000118f <+15>: movl $0x400, -0x18(%rbp) ; imm = 0x400
0x100001196 <+22>: cmpl $0xa, -0x18(%rbp)
0x10000119a <+26>: sete %al
0x10000119d <+29>: andb $0x1, %al
0x10000119f <+31>: movb %al, -0x19(%rbp)
0x1000011a2 <+34>: testb $0x1, -0x19(%rbp)
0x1000011a6 <+38>: je 0x1000011d9 ; <+89> at main.cpp:37
From examining this, it does seem like it takes the last statement (the comparison i == 10) as the boolean for the if statement.
I understand that this case doesn't allow me to use variable i within the if statement because of the scope operator, but wanted to know why the if statement decides to use i == 10 as the boolean statement.
For alternatives to this, I understand that a function call might be cleaner which returns a boolean that I can use to set to a variable for the if statement. However, I see MACROs that expand to this very similar style within glibc source code.
Is it an old style of programming with MACROs?
Is there a benefit to this I am missing?
A:
A GCC extension to the C++ language allows a parenthesized compound statement (that is, semicolon-delimited statements, inside braces, inside parentheses) to be used as an expression. To evaluate the expression, the statements are executed in order, and the value of the expression in the last statement is used as the value of the expression as a whole.
It's primarily useful for function-like macros which need to declare local variables of their own. Because it's GCC-specific, it's best to avoid it unless absolutely necessary — and in the case of C++, function-like macros themselves are best avoided, in favor of template functions.
So it's a nice thing to know about, but it's not a good thing to use in C++, even on a compiler which supports it.
EDIT: As Jodocus noted, there's a similar feature available in C++17, whereby a for-loop-style initializer can precede the condition in an if-statement (as it does in a for-statement). Personally I think it's an unnecessary complication, as it has roughly the same effect as just putting the initializer and the if-statement in braces, but in the code you posted it would technically be a valid option.
|
George Memmoli
George Memmoli (August 3, 1938 – May 20, 1985) was an American actor. Memmoli was a friend and frequent collaborator of director Martin Scorsese, appearing in Mean Streets as a pool hall owner (1973) and New York, New York (1977), and contributing to a documentary focused on a mutual friend of Scorsese's and Memmoli's - American Boy: A Profile of Steven Prince (1978), the gun dealer in the film Taxi Driver in which George was originally intended for the role Scorsese played as the jealous husband staring obsessively at his wife's window. He is also known for his portrayal of the engineer Earl during the first season (21 episodes) of the sitcom Hello, Larry, and he was a founding member of the improv comedy troupe Ace Trucking Company.
Career
Memmoli also played Philbin in Brian De Palma's Phantom of the Paradise (1974) and Jenkins in Scorsese collaborator Paul Schrader's Blue Collar (1978), and he had a small but memorable role in Rocky (1976) playing the ice rink worker who, while sporadically counting down, allows Rocky and Adrian their rushed first date, alone on the ice after closing. It was on the set of Blue Collar where co-star Richard Pryor hit George Memmoli over the head with a chair and fractured his skull. As a result, Memmoli filed a $1 million lawsuit against Pryor.
Memmoli's last TV appearance was in the Hill Street Blues episode "The Rise and Fall of Paul the Wall," as Paul "the Wall" Srignoli, which aired on December 6, 1984. Memmoli's final screen appearance was in the 1985 film, The Sure Thing as Uncle Nunzi.
Memmoli died in 1985 from injuries sustained in an accident involving a stunt car during the filming of "The Farmer" in 1976 or 1977.
Filmography
External links
Category:1938 births
Category:1985 deaths
Category:Male actors from New York City
Category:American male film actors
Category:American male television actors
Category:20th-century American male actors |
1. Field of the Invention
The present invention is directed to pharmaceutical compositions, and primarily to topically applied ophthalmic compositions comprising as the active ingredient one or more compounds having the ability to inhibit guanylate cyclase. The pharmaceutical compositions are useful for reducing intraocular pressure in animals of the mammalian species. In another aspect, the present invention is directed to administering such formulations and compositions to animals of the mammalian species (including humans) for reducing intraocular pressure in the eye.
2. Brief Description of the Art
Glaucoma is an optical neuropathy associated with elevated intraocular pressures which are too high for normal function of the eye, and results in irreversible loss of visual function. It is estimated in medical science that glaucoma afflicts approximately 2 per cent of the population over the age of forty years, and is therefore a serious health problem. Ocular hypertension, i.e. the condition of elevated intraocular pressure, which has not yet caused irreversible damage, is believed to represent the earliest phase of glaucoma. Many therapeutic agents have been devised and discovered in the prior art for the treatment or amelioration of glaucoma and of the condition of increased intraocular pressure which precedes glaucoma.
The drugs currently utilized in the treatment of glaucoma include miotics (e.g., pilocarpine, carbachol, and acetylcholinesterase inhibitors), sympathomimetrics (e.g., epinephrine and dipivalylepinephrine), beta-blockers (e.g., betaxolol, levobunolol and timmolol), alpha-2 agonists (e.g., para-amino clonidine) and carbonic anhydrase inhibitors (e.g., acetazolamide, methazolamide and ethoxzolamide). Miotics and sympathomimetics are believed to lower intraocular pressure by increasing the outflow of aqueous humor, while beta-blockers, alpha-2 agonists and carbonic anhydrase inhibitors are believed to lower intraocular pressure by decreasing the formation of aqueous humor. All five types of drugs have potential side effects. Miotics, such as pilocarpine, can cause blurring of vision and other visual side effects which may either decrease patient compliance or require termination of miotic drug therapy. Carbonic anhydrase inhibitors can also cause serious side effects which affect patient compliance and/or necessitate withdrawal of the drug therapy. At least one beta-blocker, timolol, has increasingly become associated with serious pulmonary side effects attributable to its effect on beta-2 receptors in pulmonary tissue.
As a result additional antiglaucoma drugs are being developed, e.g., prostaglandin derivatives, muscarinic antagonists, etc.
In light of the foregoing circumstances, it is clear that a need exists for new, more potent antiglaucoma compositions which avoid or reduce the above-cited side effects and enhance patient compliance. The present invention is directed to the provision of such compositions.
6-anilinoquinoline-5,8-quinone (LY 83583) was originally developed as an inhibitor of antigen-induced leukotriene release. Subsequently, it was found to be an effective agent for the lowering of cyclic GMP levels in a wide range of tissues, while having little or no effect on cyclic AMP levels. The mechanisms of its lowering action on cyclic GMP may include inhibition of endothelium-derived relaxing factor and blocking of activation of soluble guanylate cyclase.
The cyclic GMP-lowering effect of LY 83583 has been used to help elucidate the mechanisms by which atrial natriuretic factor acts on cation channel transport, and the mechanisms of muscle relaxation induced by nitrate esters. |
Q:
Is a motor-generator set a reasonable way to get the purest waveform electricity?
It looks like audiophiles go as far as installing separate powerlines to power their high quality audio systems. The motivation is that the amplifier and other hardware would run cleaner when the powersource provides cleaner waveform and with a separate powerline the amplifier will not be affected by various electrical devices run by other households.
Let's not assess whether any audible difference can exist because that's highly subjective. I'm interested in the purest waveform of the powersource part.
That separate powerline
can be hit by lightning
is also parallel to many other wires around it and so can be affected by processes in those wires
is connected to a large grid which has tons of transient processes happening all the times
so it doesn't really sound like a reliable best purest waveform source.
Would a motor-generator set run on the original powerline be better? It looks like it doesn't care much about all those lightnings, parallel wires and the grid.
How good is a motor-generator set for generating the purest waveform electricity?
A:
The "purest waveform" you want for noise-sensitive equipment is flat DC.
The both simplest and best way to get it is a battery. Why?
Any kind of AC needs rectification of some kind. Even a motor-generator with a standard DC generator produces a rectified sinusoidal current. You could use an unipolar DC generator, as it was done for ultra-low-voltage ultra-high-current DC applications as galvanic plating in the past.
But even then, you have a second concern, and that's AC currents on ground. In your motor-generator the two machines are connected with a steel rod. It's not possible not to have at least some AC noise on the DC ground without replacing that one by glass fibre or something like that.
Use a battery. Charge it if the device is not used. Medical equipment is sometimes designed that way. (It makes also the compliance testing simpler.)
|
Q:
Column is not iterable in pySpark
So, we are a bit puzzled. In Jupyter Notebook we have the following data frame:
+--------------------+--------------+-------------+--------------------+--------+-------------------+
| created_at|created_at_int| screen_name| hashtags|ht_count| single_hashtag|
+--------------------+--------------+-------------+--------------------+--------+-------------------+
|2017-03-05 00:00:...| 1488672001| texanraj| [containers, cool]| 1| containers|
|2017-03-05 00:00:...| 1488672001| texanraj| [containers, cool]| 1| cool|
|2017-03-05 00:00:...| 1488672002| hubskihose|[automation, future]| 1| automation|
|2017-03-05 00:00:...| 1488672002| hubskihose|[automation, future]| 1| future|
|2017-03-05 00:00:...| 1488672002| IBMDevOps| [DevOps]| 1| devops|
|2017-03-05 00:00:...| 1488672003|SoumitraKJana|[VoiceOfWipro, Cl...| 1| voiceofwipro|
|2017-03-05 00:00:...| 1488672003|SoumitraKJana|[VoiceOfWipro, Cl...| 1| cloud|
|2017-03-05 00:00:...| 1488672003|SoumitraKJana|[VoiceOfWipro, Cl...| 1| leader|
|2017-03-05 00:00:...| 1488672003|SoumitraKJana| [Cloud, Cloud]| 1| cloud|
|2017-03-05 00:00:...| 1488672003|SoumitraKJana| [Cloud, Cloud]| 1| cloud|
|2017-03-05 00:00:...| 1488672004|SoumitraKJana|[VoiceOfWipro, Cl...| 1| voiceofwipro|
|2017-03-05 00:00:...| 1488672004|SoumitraKJana|[VoiceOfWipro, Cl...| 1| cloud|
|2017-03-05 00:00:...| 1488672004|SoumitraKJana|[VoiceOfWipro, Cl...| 1|managedfiletransfer|
|2017-03-05 00:00:...| 1488672004|SoumitraKJana|[VoiceOfWipro, Cl...| 1| asaservice|
|2017-03-05 00:00:...| 1488672004|SoumitraKJana|[VoiceOfWipro, Cl...| 1| interconnect2017|
|2017-03-05 00:00:...| 1488672004|SoumitraKJana|[VoiceOfWipro, Cl...| 1| hmi|
|2017-03-05 00:00:...| 1488672005|SoumitraKJana|[Cloud, ManagedFi...| 1| cloud|
|2017-03-05 00:00:...| 1488672005|SoumitraKJana|[Cloud, ManagedFi...| 1|managedfiletransfer|
|2017-03-05 00:00:...| 1488672005|SoumitraKJana|[Cloud, ManagedFi...| 1| asaservice|
|2017-03-05 00:00:...| 1488672005|SoumitraKJana|[Cloud, ManagedFi...| 1| interconnect2017|
+--------------------+--------------+-------------+--------------------+--------+-------------------+
only showing top 20 rows
root
|-- created_at: timestamp (nullable = true)
|-- created_at_int: integer (nullable = true)
|-- screen_name: string (nullable = true)
|-- hashtags: array (nullable = true)
| |-- element: string (containsNull = true)
|-- ht_count: integer (nullable = true)
|-- single_hashtag: string (nullable = true)
We are trying to get the count of hashtags per hour. The approach we are taking is to use Window to partition by single_hashtag. Something like this:
# create WindowSpec
hashtags_24_winspec = Window.partitionBy(hashtags_24.single_hashtag). \
orderBy(hashtags_24.created_at_int).rangeBetween(-3600, 3600)
However, when we try to do the sum of the ht_count column using:
#sum_count_over_time = sum(hashtags_24.ht_count).over(hashtags_24_winspec)
we get the following error:
Column is not iterable
Traceback (most recent call last):
File "/usr/hdp/current/spark2-client/python/pyspark/sql/column.py", line 240, in __iter__
raise TypeError("Column is not iterable")
TypeError: Column is not iterable
The error message is not very informative and we are puzzled, which column exactly to investigate. Any ideas?
A:
You're using wrong sum:
from pyspark.sql.functions import sum
sum_count_over_time = sum(hashtags_24.ht_count).over(hashtags_24_winspec)
In practice you'll probably want alias or package import:
from pyspark.sql.functions import sum as sql_sum
# or
from pyspark.sql.functions as F
F.sum(...)
|
Background
==========
Knowledge of constraints governing systems provides a means to predict events and mechanisms that cause their breakdown. It may also allow one to speculate how such systems might have evolved. One class of biological systems that have captured much interest involves protein-protein interactions and protein complexes. Protein complexes are groups of two or more proteins that physically interact. Such interaction serves to spatially join, modify or create novel functional capability from component proteins. Once in a complex, proteins can achieve greater structural stabilization and protection from proteases, which result in significantly longer half-lives \[[@B1],[@B2]\]. A breakdown in complex assembly has been associated with a number of diseases \[[@B3]-[@B5]\].
What forces have shaped the formation of complexes and what is their effect? The formation of quaternary structure is associated with greater constraint in the evolution of proteins \[[@B6]-[@B8]\]. Recently, a large collection of manually annotated mammalian complexes has become available in the CORUM database \[[@B9]\]. The combination of data from this resource and complexes derived from HPRD \[[@B10]\] and BIND \[[@B11]\] allows for one of the largest investigations of complex-specific protein constraints in mammalian species to date.
Recently, complexes have been investigated in the context of intrinsic disorder \[[@B12]\] and aggregation propensity of the subunits \[[@B13]\]. In this study, we focus on two characteristics of complexes: the complexity of a complex as represented by the number of unique proteins in a complex and the number of complexes a particular protein participates in. The number of protein subunits that bind together fluctuates in the context of different conditions. Complexes extracted from cells can be viewed as snapshot samples of proteins that have come together with adequate stability to be isolated. We subsequently derive \'complex participation\' for individual proteins by counting the number of complexes that they belong to, in our large combined collection of protein complex samples.
Although these characteristics of complexes are dynamic, their relation to properties of component proteins derived in their isolated state can be studied. By deriving these relations, we hope to gain insight into certain constraints governing the organization of complexes. Here, we find evidence that protein length, predicted secondary structure and isoelectric point, as well as the nonsynonymous/synonymous substitution ratio of genes are associated with our measures of complex complexity and participation.
Available data on protein-protein interactions have been used extensively to predict complexes \[[@B14]-[@B25]\]. A strong discriminator between interacting and non-interacting protein pairs appears to be the presence of domains known to interact \[[@B26]\]. We assess the utility of known binary protein-protein and domain-domain interactions in predicting the composition and interactions in the mammalian complexes that we have collected.
Methods
=======
Complex and Interaction data
----------------------------
1732 experimentally verified protein complexes annotated at MIPS \[[@B27]\] and stored in the CORUM database \[[@B9]\] were combined with 631 complexes retrieved from HPRD \[[@B10]\] and 538 complexes from BIND \[[@B11]\]. After removal of redundancy, there were 2706 different complexes containing 4543 different proteins from human, mouse, rat, dog, rabbit, cow, pig and other mammals. Of these 2706 unique complexes, 665 are subcomplexes of other complexes in the data. A more detailed description of the complexes appears in the additional files \[see Additional file [1](#S1){ref-type="supplementary-material"}\].
The focus of this study was on mammalian complexes but we also analyzed the MIPS yeast complexes stored in CYGD \[[@B28]\]. We use a set of 1142 unique yeast complexes consisting of 2755 proteins. A much larger set of yeast complexes consisting of 5370 proteins in 2025 complexes was produced by merging the MIPS yeast complexes with the 893 complexes predicted by Friedel et al. \[[@B25]\]. We will refer to this set of complexes as the \'extended yeast complex set\'. Possible estimates of the completeness of the human and yeast complex data appear in the additional files \[see Additional file [1](#S1){ref-type="supplementary-material"}\].
We assembled 94906 pairwise eukaryotic protein-protein interactions from BIND, DIP \[[@B29]\], HPRD, MINT \[[@B30]\], Mpact \[[@B31]\] and MPPI \[[@B32]\]. 29074 of those interactions were between different proteins from human, mouse or rat and were used in this study. We also retrieved 127514 binary protein interactions by over 36500 proteins from IntAct \[[@B33]\]. We will refer to interaction data from IntAct in the text specifically with the word \'IntAct\' to distinguish from the interaction set we collected.
We refer as domain-domain interactions in the text as those derived from known 3D structures of proteins, obtained from the iPfam \[[@B34]\] and 3did \[[@B35]\] database. There are 3654 such interactions between protein domains in total. Pfam domains of protein sequences were taken from Uniprot \[[@B36]\]. We assume that peptide chains in PDB structures with C-beta atoms within 8 Angstroms of each other interact.
We generated random complexes using two different random models to evaluate significance of trends associated with non-stochastic protein complex organization. For the random model in the main text (Model 1), we generated the same number of random complexes as found in annotated complexes by picking the same number of proteins as found in each of the annotated complexes from a pool of all proteins collected from these complexes. We picked proteins randomly with replacement throughout the process of random complex generation to simulate neutrality of protein reuse in the complexes. A second random model (Model 2) of the complexes which uses the complex complexity and participation preserving rewiring method, first introduced by Maslov and Sneppen \[[@B37]\] was also tested \[see Additional file [1](#S1){ref-type="supplementary-material"}\]. In certain parts of this paper, we used sets of randomly generated complexes (each set containing the same number of complexes as found in the annotated complexes) in Monte-Carlo simulations (denoted MC-test) to derive p-values for significance statements. P-values of events were estimated by the fraction of random simulations supporting the null hypothesis.
Computed features of genes and proteins
---------------------------------------
Secondary structure was predicted with PSIPRED \[[@B38]\]. Our conclusions did not change when we repeated our experiments using SSPRO \[[@B39]\]. The performance of PSIPRED in terms of secondary structure content prediction is benchmarked \[see Additional file [2](#S2){ref-type="supplementary-material"}\]. We measured human protein evolutionary rates by non-synonymous to synonymous substitution (*dN/dS*) ratios computed from coding sequences of ortholog pairs from Ensembl \[[@B40]\]. Yeast (*S. cerevisiae*) gene *dN/dS*ratios were computed using orthologs \[[@B41]\] from *S. mikatae*by PAL2NAL \[[@B42]\] with default parameters and Codeml from the PAML package \[[@B43]\]. The smallest *dN/dS*ratio was recorded for each gene when more than one potential ortholog was identified (our conclusions did not change if we chose the larger one). The values of *dN/dS*depend on the calculation methodology but they should be comparable within the same species pairs chosen. Note that only *dN/dS*ratios less than 1 (computed from human-mouse orthologs) were associated with the annotated human complexes. The mean *dN/dS*ratio of individual genes encoding a given protein complex was taken as a measure of selection associated with the protein complex. We focused on a measure of evolutionary rate reflecting more on changes in protein sequence. We considered evolution at synonymous sites \[[@B44],[@B45]\] to be neutral.
We refer to \"pI\" in the text as values obtained from BioPerl-based \[[@B46]\] isoelectric point prediction on protein sequences. Essential genes for *S. cerevisiae*were taken from CYGD \[[@B28]\]. Essential genes for human were gathered by merging those from \[[@B47]\] and Table S6 of \[[@B48]\].
Statistics of trends in 2-D plots
---------------------------------
We assessed trends concerning 2-dimensional protein complex data by first applying standard linear regression to see if there is a noticeable slope different from a horizontal line (observed when the y values do not depend on the x values). We considered a given trend to be significantly associated with non-stochastic protein complex organization if the p-value reported by the t-test on the slope of the regression line (the null hypothesis being a slope = 0) was less than the maximum value observed when 1000 sets of random human or yeast complexes were generated. For example, when random complexes were generated from entire sets of annotated complexes, p-values associated with plots between mean *dN/dS*values and complex complexity for these random complexes were always above 0.003; so we set this value as a threshold of significance for such trends. However, the use of the t-test by itself is potentially inadequate because it could be significantly affected by biases in our snap-shot protein complex samples. So in addition, we repeated the same plots using sets of complexes likely to have different biases. These include the MIPS yeast complexes, the extended yeast complex set, sets of complexes where subcomplexes were removed and sets of complexes in different subcellular compartments. Unless otherwise stated, only those trends in which all assessments (from the regression line analysis to the analysis with other complex datasets) are considered significant are reported. Analysis was aided by the PROMPT tool \[[@B49]\].
Results and discussion
======================
Complex Complexity and Participation
------------------------------------
We first examined the distribution of complex complexity, the number of unique proteins in a complex. Amongst all mammalian complexes collected, the number of unique proteins ranges from one for homo-oligomers to 142 (U2-type spliceosome \[CORUM:351\]). When the number of unique proteins increases past 4, complexes become increasingly rare following a power law-like distribution (Figure [1A](#F1){ref-type="fig"}). When we considered yeast complexes, we saw similar trends \[see Additional file [3](#S3){ref-type="supplementary-material"}\].
{#F1}
Not all proteins are exclusive to a single complex. Having defined complex participation as the number of complexes that a particular protein is found in, we find that it also follows a power law-like distribution (Figure [1B](#F1){ref-type="fig"}, \[Additional file [3](#S3){ref-type="supplementary-material"}\]). Some of the proteins currently with the highest complex participation include human integrin beta-1 \[Uniprot:P05556\], histone deacetylase 1 \[Uniprot:Q13547\] and RING-box protein 1 \[Uniprot:P62877\] which were annotated to be in 54, 39 and 24 complexes, respectively so far.
The decrease in the number of complexes as the number of subunits increase might be a reflection of the increased difficulty in assembling and thus evolving larger beneficial complexes. Although this trend seems to follow a power law, as commonly reported for biological networks \[[@B50]\], we could not ascertain if this truly is the case. Similarly, we could not ascertain whether complex participation follows a power law. Our observed complex complexity and participation distributions may be the result of our complexes being samples of mammalian proteins \[[@B51],[@B52]\] derived under a variety of conditions \[Additional file [1](#S1){ref-type="supplementary-material"}\]. The number of unique proteins in yeast complexes was also observed to follow a similar-shaped distribution and an exponential model of the data has been proposed \[[@B53],[@B54]\]. In both mammalian and yeast complexes, most proteins belong to few complexes, thus supporting the idea of modularity \[[@B55]\] between complexes in the context of the protein-protein interaction network that have been examined.
The length of proteins in complexes
-----------------------------------
One of the simplest protein properties to study is the length of the protein in terms of the number of amino acids. The distribution of human protein lengths is skewed towards smaller values and subsequently when we sample uniformly from this distribution to generate random complexes, the distribution of the protein lengths remains skewed (Figure [2A](#F2){ref-type="fig"}). The mean length of proteins in this distribution is \~500 amino acids (Figure [2A](#F2){ref-type="fig"}).
{#F2}
By picking proteins with replacement from the distribution of proteins in Figure [2A](#F2){ref-type="fig"}, we generated random complexes and plotted the complexity of the complexes in terms of the number of unique subunits against the mean length of these subunits (Figure [2B](#F2){ref-type="fig"}). As complex complexity increases the upper bound for mean lengths of proteins drops (before 20 unique proteins) and levels out at \~510 amino acids for more complex complexes. Because the mean length of proteins in the human proteome which we sample from is \~500 amino acids, as one adds more random proteins to complexes, the mean length of proteins in the complexes tends to stabilize near 500 amino acids. This observation was similarly made in annotated human complexes (Figure [2C](#F2){ref-type="fig"}) and random complexes generated from this annotated data (Figure [2D](#F2){ref-type="fig"}). A similar asymptotic bound is thus formed in all our plots. For example, mean lengths of 2000 amino acids were absent in complexes of more than 20 subunits in both the random and the complexes that we have collected. Like for the random human complexes, the mean protein length distribution for the real human complexes (Figure [2C](#F2){ref-type="fig"}) was also skewed towards smaller protein lengths. Similar plots were observed for all mammalian complexes that we collected and Model 2 random complexes \[Additional file [4](#S4){ref-type="supplementary-material"}\]. These results suggest that the mean protein length in complexes reflects to an observable degree the length distribution of proteins encoded in the proteome (Figure [2A](#F2){ref-type="fig"}). Similar observations were made when the median length of proteins was studied in the context of complex complexity \[Additional file [5](#S5){ref-type="supplementary-material"}\].
In contrast to randomly generated complexes, the complexes that we have collected had much more variable mean lengths, especially for complexes with large numbers of subunits. We observe this as an increased scattering of points on the right side of the plot (Figure [2C](#F2){ref-type="fig"}). This phenomenon was similarly observed in yeast complexes \[Additional file [6](#S6){ref-type="supplementary-material"}\]. In particular, when complex complexity increases past 20 different subunits, complexes with mean protein lengths below 250 amino acids are rarely generated randomly (Random Model 1: P \< 10^-6^) but are present in annotated mammalian and yeast complexes. For example, the 81 subunits of the human ribosomal complex \[CORUM:306\] have a mean length of 169 amino acids and the 37 subunits of the mouse mitochondrial NADH dehydrogenase complex \[CORUM:381\] have a mean length of 234 amino acids.
Although the complexes analyzed are samples of what is in cells, it is a large set that has been manually annotated. Assuming that the plots in Figure [2](#F2){ref-type="fig"} capture length constraint bounds, they can provide rules of thumb for spot-checking errors in newly isolated complexes. For example, if an isolated human complex of 10 subunits had a mean subunit length of 2000 amino acids, our plots suggest that large numbers of additional missing subunits of length 2000 or more are unlikely. If such a complex did exist, then it would be striking given both the annotated complex data (Figure [2C](#F2){ref-type="fig"}) and data generated from random complexes (Figure [2B](#F2){ref-type="fig"}, Figure [2D](#F2){ref-type="fig"}; \[Additional file [4](#S4){ref-type="supplementary-material"}\]). Unusual property distributions associated with complexes provide initial suggestions of errors in the composition of the complexes or unusual constraints associated with these complexes. For example, the average length of a large sample of human mitochondrial proteins appears to be much smaller than the average length of all human proteins (means ± standard deviation/medians are: \~320 ± 304/235aa vs. \~500 ± 551/364aa, respectively; MW, KS-test (Mann-Whitney, Kolmogorov-Smirnov tests): P \< 10^-57^) in the Eukaryotic Subcellular Localization Database \[[@B56]\] \[Additional file [7](#S7){ref-type="supplementary-material"}\]. Similar results were obtained when we used the reference set from MitoP2 \[[@B57]\] as a source of mitochondrial proteins. Despite large amounts of protein turnover since the mitochondria prokaryotic origin \[[@B58]\], most (\> 97%) human mitochondrial proteins have lengths less than 1000 amino acids. These results suggest unusual size constraints associated with mitochondrial proteins. Mitochondria-related functions, the need for proteins to import into the mitochondria \[[@B59]\], the presence of reactive oxygen species which can impose difficulties for protein folding \[[@B60]\] are possible reasons which may have helped limit the incorporation of very large proteins into mitochondria. The scarcity of large proteins in the mitochondria, in turn, will likely limit mean protein lengths of its complexes. Although many (300/1962 = 15%) human complexes in our data have mean protein lengths over 1000 amino acids (Figure [2C](#F2){ref-type="fig"}), none of the 28 mitochondrial human complexes we annotated so far exceed this limit. If mean protein lengths in complexes reflect protein length distributions, we expect hetero-oligomeric mitochondria human complexes with mean protein lengths over 1000 amino acids to be extremely rare.
The relative lack of complexes with many (\>20) different large proteins (\> 1500aa) in both mammals and yeast suggests that evolving such complexes is also extremely difficult. Smaller subunits may be easier to fold, transport \[[@B61]\], require less conformation sampling \[[@B2]\] and undergo smaller entropic loss \[\[[@B62]\] -- Supplement\] during complex assembly. These factors may have contributed to the absence of highly complex complexes with many large proteins in our data.
Natural selection and complexes
-------------------------------
To understand observations from a more evolutionary point of view, we analyzed non-synonymous to synonymous substitution ratios (*dN/dS*) derived from human coding sequences and their alignments with orthologs from mouse (Figure [3](#F3){ref-type="fig"}). One way of comparing selection on coding sequences associated with different complexes is by their mean *dN/dS*ratios derived from the same species pairs.
{#F3}
For example, proteins from the human MBD1-MCAF complex \[CORUM:2759\] are encoded by two genes with a mean *dN/dS*ratio of 0.37, computed from mouse orthologs. The sequences coding for this complex seem to be under much less selective constraint than ones coding the eIF3 complex \[CORUM:742\] which is associated with a mean *dN/dS*ratio of 0.04 (Stdv. = 0.03, median = 0.02).
It has been noted previously that easily alignable eukaryotic mRNAs are over-represented for multi-subunit complexes \[[@B63]\] due to increased sequence conservation. In terms of trends, we find that as the complexity of the complex increases, the mean *dN/dS*ratio of human genes of associated constituent proteins tends to decrease suggesting that complex complexity negatively correlates with purifying selective pressure on genes (Figure [3D](#F3){ref-type="fig"}). The trend is not extremely strong but such a trend was not observed with random complexes (Figure [3C](#F3){ref-type="fig"}; \[Additional file [8](#S8){ref-type="supplementary-material"}\]). In particular, complexes with more than 15 proteins and mean *dN/dS*ratios below 0.07 are absent in our random complex set. For example, the 20 genes from the PA700 proteosome regulator complex \[CORUM:32\] have a mean *dN/dS*ratio of 0.03 but such complexes are not likely generated randomly (Random model 1: P \< 0.05). A contributing reason can be derived by examining the distribution of *dN/dS*ratios. The distribution of human-mouse *dN/dS*ratios is skewed towards small values considering all known human genes with over 40% of the values \< 0.1 (Figure [3A](#F3){ref-type="fig"}). The distribution of *dN/dS*ratios associated with our sample of annotated complexes (Figure [3B](#F3){ref-type="fig"}) is likewise skewed with 60% of the values \< 0.1. In both cases, the mean *dN/dS*ratio is close to \~0.1. As more randomly-selected proteins are added to form random complexes, the mean *dN/dS*ratio for genes associated with the complexes tends to stabilize also at 0.1. Thus, highly complex complexes with mean *dN/dS*ratios substantially below 0.1 are rarely generated randomly.
Knowing that many proteins belong to more than one complex, we also asked how this fact was related to selective pressure. We find that as the number of complexes a protein participates in increases, the *dN/dS*ratio of corresponding genes also tends to decrease (Figure [3F](#F3){ref-type="fig"}), suggesting that complex participation also correlates negatively with the *dN/dS*ratio. This trend is not observed when complexes were generated randomly by picking proteins with replacement (Figure [3E](#F3){ref-type="fig"}). From such randomly generated complexes, proteins participating in more than 10 complexes rarely occur, but they are clearly present in our annotated data. Binned average plots of Figures [3D](#F3){ref-type="fig"} and [3F](#F3){ref-type="fig"} appear in the additional files \[see Additional file [9](#S9){ref-type="supplementary-material"}\].
Because such results could potentially be sensitive to the ortholog pairs compared, the quality of the gene models, and peculiarities of human/mouse evolution, we also repeated such analyses using a variety of other mammals \[see Additional file [10](#S10){ref-type="supplementary-material"}\]. For human-dog, human-chimp and human-rat orthologs, we observed similar trends although in the closely related human-chimp case in which complex complexity was plotted against mean *dN/dS*, the trend was not statistically significant. We also had similar observations with yeast complexes using *S. cerevisiae*-- *S. mikatae*, *S. cerevisiae*-- *S. paradoxus*orthologs. We did not observe such trends from *dN/dS*ratios derived from the more distant pairing of *S. cerevisiae*-- *S. castellii*orthologs (data not shown). For both mammalian and yeast complexes, the trends appear to be conserved using *dN/dS*ratios generated from a variety of ortholog-pairs with some exceptions.
Related to *dN/dS*ratios is the gene conservation of orthologs of the proteins in complexes. Compared to *dN/dS*ratios, statistically significant differences in gene conservation are even more difficult to detect in closely related genomes. However, over large evolutionary distances we noticed that highly complex complexes tend to have conserved their subunits. For example, between yeast and human, yeast complexes with more than 60 subunits had more than 80% of their subunits also encoded in human. This was not observed in random complexes \[Additional file [11](#S11){ref-type="supplementary-material"}\]. Yeast complex proteins conserved in human also participated in a significantly higher number of complexes than those without a human ortholog (mean ± standard deviation/median complex participation of 8.0 ± 6.8/6.0 vs. 4.2 ± 4.3/3.0; MW, KS-test: P \< 10^-70^). A significant difference in complex participation was not observed for model 1 randomly generated complexes. These results concerning *dN/dS*ratios and gene conservation portrays similar relationships between gene evolution, complex complexity and participation at different time and constraint scales.
Because our conclusions are based on a limited sample of complexes, we sought for extra datasets of protein complexes. The combination of the annotated MIPS yeast complexes with those that were predicted \[[@B25]\] allowed us to test our hypotheses on a large set of complexes covering 5370 (88%) of the proteins encoded in the yeast proteome. We continued to observe a significant negative correlation between mean *dN/dS*with complex complexity and *dN/dS*with complex participation using such an extended complex dataset \[Additional file [12](#S12){ref-type="supplementary-material"}\].
Often in a cell, complexes exist along side their subcomplexes. In our data, subcomplexes of complexes are present. If we repeated our analysis with subcomplexes removed, we still observed a significant negative correlation between mean *dN/dS*with complex complexity and *dN/dS*with complex participation \[Additional file [12](#S12){ref-type="supplementary-material"}\]. Similar trends were also observed when we considered nuclear localized and non-localized complexes separately \[Additional file [12](#S12){ref-type="supplementary-material"}\].
As complexes are assembled or disassembled, the mean *dN/dS*ratio should fluctuate as proteins are added or subtracted from the complex. Nevertheless, there also seems to be an asymptotic bound for mean *dN/dS*ratios as complex complexity increases and *dN/dS*ratios as complex participation increases. The conserved trends we observe may be a reflection of these bounds. We find that genes associated with our human complexes which are considered essential (see Methods) tend to have lower *dN/dS*ratios (computed by human-mouse orthologs) and encode proteins that participate in more complexes (MW, KS-test: P \< 0.01) compared with all genes in the human complexes. We see the same significant trend for yeast (*dN/dS*ratios computed with *S. cerevisiae*-- *S. paradoxus*orthologs). These results suggest that for proteins participating in increasing number of complexes, lower *dN/dS*ratios tend to be associated with purifying selection to maintain organism fitness. Essential *S. cerevisiae*complex proteins tend to be found in complexes with more unique subunits (MW, KS-test: P \< 0.05) compared to other proteins in the yeast complex data. However, such a trend was not observed for human possibly because a significant number of proteins which contribute to complex complexity are not known to be essential. We conclude that there is strong evidence of non-random association between *dN/dS*ratios of genes and complexes of their protein products.
The finding that the number of protein-protein interactions positively correlates with the level of conservation of orthologs between species \[[@B64],[@B65]\] is similar to our finding that highly complex complexes tend to conserve their orthologs. Previously, increased gene conservation has been correlated with lower evolutionary rate \[[@B66]\]. We have found that highly complex complexes tend to conserve their orthologs and have lower *dN/dS*ratios, in agreement with these results.
In summary, we observed that the mean *dN/dS*ratios of proteins in the collected complexes tend to decrease with increasing complex complexity. There seem to be at least two major phenomena associated with this observation:
1\) The skewed distribution of *dN/dS*ratios amongst genes as depicted in Figure [3B](#F3){ref-type="fig"}. In particular, as complex complexity increases, the mean *dN/dS*ratios of proteins in complexes tend to stabilize towards the mean of this skewed distribution.
2\) increased selective pressure on proteins involved in the organization and function of more complex complexes
The median of the mouse *dN/dS*values (Figure [3B](#F3){ref-type="fig"}) is 0.08 which is less than the mean of 0.1. When we plotted Figure [3D](#F3){ref-type="fig"} and related supplements using median *dN/dS*values instead of the mean, we also found the median *dN/dS*decreased significantly with increasing number of unique subunits. Such a trend was consistently found when human-mouse, human-dog, human-rat, *S. cerevisiae*-- *S. paradoxus*and *S. cerevisiae*-- *S. mikatae dN/dS*median values were used (for all plots, t-test: P \< 7.1 × 10^-7^; selected plots are shown in the additional files \[Additional file [13](#S13){ref-type="supplementary-material"}\]).
Thus, for the complex data available, we observed that both the mean and median *dN/dS*ratios of genes negatively correlates with the complex complexity.
Homogeneity of Protein and Gene Properties
------------------------------------------
Next, we examined similarities between proteins within mammalian protein complexes (Table [1](#T1){ref-type="table"}). Although not necessarily similar to physiological pI, our predicted pI values reflect sequence properties which may be of some utility. We ask whether subunits in complexes tend to have greater homogeneity than expected in terms of predicted pI values. Considering complexes of 3 or more unique proteins, we found that the standard deviations in protein pI are significantly lower in the annotated complexes compared to those in model 1 random complexes. Thus, the pI of a protein can be a feature which may be useful in predicting whether the protein belongs to a particular complex or not. The need for subunits to co-localize \[[@B67]\] and the presence of highly sequence similar paralogs in complexes \[[@B68]\] should be contributing factors to our observation of lower than expected pI deviation between complex proteins.
######
Homogeneity of protein properties in mammalian complexes of 3 or more proteins.
Protein Complex Data Property Mean Stdev. Annotated Mean Stdev. Random
----------------------- ---------- ----------------------- --------------------
All mammalian pI 1.5 ± 0.7 (1.5) 1.8 ± 0.7 (1.8)
All mammalian \% Helix 14.4 ± 7.8 (13.5) 18.6 ± 7.5 (18.6)
All mammalian \% Sheet 9.5 ± 5.9 (8.7) 10.9 ± 5.4 (10.3)
All mammalian \% Coil 10.3 ± 5.0 (9.8) 13.3 ± 5.6 (13)
Human (against mouse) *dN/dS* 0.07 ± 0.05 (0.06) 0.09 ± 0.06 (0.08)
The standard deviations of protein property values for each annotated complex are significantly smaller than ones for model 1 random complexes (MC-test using 1000 complexes generated randomly with replacement: P \< 0.001). The means ± standard deviation of these standard deviations for each property are shown in the last two columns along with median values (in parentheses).
The common presence of paralogs in complexes and the correlation between secondary structure and localization \[[@B69]\] also contributes to explaining why we observed significantly lower than expected deviations of secondary structure content (percent helix, sheet and coil) in proteins belonging to the annotated complexes versus those in random complexes.
Similar to protein properties, we also found that the *dN/dS*ratio of genes associated with annotated human complexes are significantly more homogeneous compared with those from randomly generated complexes. Some examples of complexes with very low deviation of *dN/dS*values include Ubiquitin E3 ligase \[CORUM:386\] and the MKK4-ARRB2-ASK1 complex \[CORUM:1297\] with a standard deviation of 0.0007 and 0.001, respectively. The complex with the highest observed *dN/dS*deviation of 0.34 is the DNA ligase IV-XRCC4-XLF complex \[CORUM:359\]. Significant differences between random and annotated complexes were also observed when the *dN/dS*ratio was computed with dog, rat, or chimp orthologs (data not shown). These observations agree with previous results providing evidence that yeast proteins belonging to the same functional module tend to have more similar evolutionary rates than those belonging to different modules \[[@B70]\]. We observed similar results when we examined yeast complexes \[Additional file [14](#S14){ref-type="supplementary-material"}\] and when we generated model 2 random mammalian and yeast complexes (data not shown).
To conclude, we suggest that pI, secondary structure and *dN/dS*ratios can be used to help predict the probability that a protein belongs to a particular complex. We did not observe a significant difference in standard deviations of protein length between proteins belonging to annotated versus Model 1 random mammalian complexes. It may still prove useful for the separation between real and erroneous complexes when combined with other properties.
Comparison with pairwise protein interactions
---------------------------------------------
The overlap between binary protein-protein and predicted domain-domain interactions with proteins in our complexes was assessed (Figure [4](#F4){ref-type="fig"}). On average, 57%, 46% and 71% of the proteins found in the complexes (of 3 or more proteins) can be explained by known binary protein-protein, predicted domain-domain or either type of interactions (see Methods), respectively. The entire annotated protein complement of 24%, 10%, and 29% of these complexes can be explained by binary, domain-domain or either type of interactions, respectively. In addition we find that 14% of binary protein-protein interactions can be explained by domain-domain interactions which is in the range of 4--19% identified by Schuster-Bockler & Bateman \[[@B71]\].
{#F4}
192 PDB structures are available for our complexes (103 of which consist of at least 3 different proteins). A large proportion of these structures are solved with protein fragments rather than the full-length proteins. Many of the interactions between peptides in these structures (see Methods) are supported by binary protein-protein interactions. The IntAct interaction set (excluding interactions derived only from NMR or X-ray diffraction) covered on average \~40% of detected interactions in a given complex containing PDB structure. Interactions in 34 (18%) PDB structures were fully explained by these IntAct binary interactions. A similar coverage (Figure [4B](#F4){ref-type="fig"}: 45% mean interaction coverage; 13% of complexes with all interactions fully explained) is provided by these IntAct binary interactions even if we consider only complexes with 3 or more distinct interacting peptides. In contrast, on average 53% of interactions in complexes with 3 or more distinct interacting proteins are explained by predicted domain-domain interactions. Predicted domain-domain interactions explain all interactions in about 25% of such complexes. Our results suggest that known protein-protein and domain-domain interactions can aid substantially in predicting interactions in our complex data. Many of these binary and domain-domain interaction defined protein pairs may be subcomplex precursors of the mammalian complexes which form during the course of assembly. Some of these subcomplex precursors might be functional complexes in current mammalian and ancestral organisms \[[@B62]\].
Considering binary protein-protein interaction pairs in IntAct, those found in our complexes, and those derived from contacts in PDB structures associated with our mammalian complexes, we found that larger proteins tend to have larger length differences with their interacting partners (Figure [5](#F5){ref-type="fig"}, \[Additional file [15](#S15){ref-type="supplementary-material"}\]). For example, a large protein of length 5000 amino acids was more likely to be found interacting with a protein of \~1000 amino acids (a 4000 amino acid difference) rather than another protein of 5000 amino acids. However, a protein of length 300 amino acids often was found interacting with another protein of similar size. A number of reasons can explain this observation. First, the length distribution of the proteins is skewed such that relatively long proteins tend to be rare (Figure [2A](#F2){ref-type="fig"}). Second, on average shorter genes appear to be more abundantly expressed \[[@B72],[@B73]\] than longer genes. Thus, relatively large proteins may have a greater chance to encounter shorter proteins rather than longer proteins. The observation that many complex complexes tend to be composed of proteins with a shorter mean length may also be related to this phenomenon since the evolution of large complexes may depend on how often and easy it is to bring together undamaged components. The relatively low *dN/dS*ratios of genes from highly complex complexes may also be associated with this phenomenon (Figure [3D](#F3){ref-type="fig"}). Interestingly, similar observations (fitting even better to the straight line) were made with random protein-protein interactions (generated by picking proteins in each interaction pair randomly with replacement) from the IntAct data (Figure [5B](#F5){ref-type="fig"}). The relative low abundance of relatively large proteins in both the real and random interaction data can explain the trends in Figure [5A--C](#F5){ref-type="fig"}. The differences between real (Figure [5A, C](#F5){ref-type="fig"}) and random (Figure [5B](#F5){ref-type="fig"}) plots might be attributed to historical, selective constraints or experimental error on certain protein-protein interactions. Binned plots of Figure [5A](#F5){ref-type="fig"} are found in \[Additional file [15](#S15){ref-type="supplementary-material"}\].
{#F5}
Explaining evolutionary rate
----------------------------
In this work, we have hinted at various explanations such as the ease of complex assembly to reason why more complex complexity and participation negatively correlates with our measures of evolutionary rate. We believe that these explanations are contributing factors but clearly a systems approach \[[@B74]\] is warranted. The ability of a protein to change sequence is related to the mutability of its encoding gene, its subsequent expression, the consequences of errors in the gene\'s products which is related to the magnitude of expression and finally the degradation of those products. Fitness effects for the individual and the population under historical environmental constraints needs to be taken into account to completely understand why certain sequences have been transmitted for millions of years of evolution. A challenge is to uncover which factors are more important than others in explaining evolutionary rate \[[@B75]-[@B77]\]. Factors associated with proteins early in their expression such as transcription and translation \[[@B78]\] error rate or more general factors such as protein abundance would affect the evolutionary rate of all proteins. However, factors which are related to later events in a protein\'s life cycle such as functional molecular interactions will likely explain evolutionary rate differently for different types of proteins. For example, transcription factors which bind DNA will have sequences constrained by the need to bind DNA. Such constraints would be absent for those proteins that do not bind DNA. If shorter proteins are more abundantly expressed, and more complex complexes tend to contain smaller proteins, higher expression of smaller proteins in more complex complexes could help explain our observations of lower dN/dS ratios. While expression appears to be important, the functional and non-functional \[[@B79]\] interactions of the protein and its precursors with other proteins \[[@B7],[@B80]\] or molecules most likely play a major role in defining the protein\'s relation to organism fitness. It can be very challenging relating evolutionary rate to these different factors, especially when some of these factors are measured with substantial noise or are unknown \[[@B81],[@B82]\]. While the processes leading up to complex assembly can help explain protein evolutionary rate, there may be factors not directly related to complex formation yet to be fully accounted for. Some progress has been made in teasing apart contributions to evolutionary rate \[[@B83]\].
Part of the reason why deriving mechanisms explaining evolutionary rate has captured so much interest is because such data is readily available from comparative genomics. However, without knowing mechanisms explaining evolutionary rate values, its significance and the utility of associated information becomes limited. In particular, its relation to protein function and disease needs to be worked out. By combining other information such as those derived from complexes, one might gain a deeper insight. For example, just knowing whether a protein complex contains a certain number of proteins or whether a protein belongs to a certain number of complexes may significantly help us predict its relation to certain fitness effects and future diseases, given information on its evolutionary rate. It has also been observed by many that proteins related to genetic diseases in OMIM \[[@B84]\] tend to be relatively long \[[@B85],[@B86]\] and it might be interesting to work out how this relates to specific sequences and structural features in the complexes.
Conclusion
==========
In conclusion, we have found relations and trends between the *dN/dS*ratio, primary sequence properties, secondary structure, complex complexity, participation and localization using large samples of protein complexes derived under certain distributions of conditions. There is a large evolutionary distance between yeast and mammals. Protein complexes and their subunits are not necessarily conserved between distant species \[[@B87]\]. The different environments which mammals and yeast occupy may have produced different evolutionary pressure on the protein complexes. Despite these differences, many of our observations appear to be conserved for the mammalian and yeast complex data that we have. We suggest that our observations have been significantly influenced by constraints during the evolution of the complexes. Because of these constraints, numerical boundaries were discovered when we related properties such as protein length to complex complexity. Proteins at these property value boundaries are interesting because they are exceptional and possibly point to unusual pressures or homeostatic adaptations that allow for their presence in cells. For example, by studying highly complex protein complexes composed of very large proteins, one might uncover new mechanisms that allow for their assembly and the assembly of later evolved proteins. We also observed that random phenomena (as in neutral drift) from skewed origins can appear highly stable when averaged over large numbers (Ex. Figure [2B, D](#F2){ref-type="fig"}; Figure [5B](#F5){ref-type="fig"}). Compared to randomly generated phenomena, biologically-derived characteristics can appear less structured despite these circumstances (Ex. Figure [2C](#F2){ref-type="fig"}, Figure [5A](#F5){ref-type="fig"}). Our focus in this study is mainly on information about the presence of certain protein complexes. Once data on the abundance, stoichiometry and dynamics of mammalian protein and protein complexes become available on a large scale, one can obtain other views.
Competing interests
===================
The authors declare that they have no competing interests.
Authors\' contributions
=======================
AH, SA, PW, MO organized the complex data. AK provided secondary structure predictions. NS and PP provided the protein interaction data. PS provided PDB contact data. PW, SA, AH, BG, PP, FB performed analysis. PS, AR, AK, TS, PP, FT, DF supervised the research process and manuscript preparation. All authors read and approved the final manuscript.
Supplementary Material
======================
###### Additional File 1
**Description of the protein complex data.** A detailed description of annotated and random complex data used.
######
Click here for file
###### Additional File 2
**Benchmark of PSIPRED.** A benchmark of PSIPRED\'s ability to predict secondary structure content from protein sequences is provided.
######
Click here for file
###### Additional File 3
**Yeast complex complexity and participation distributions.** The distribution of yeast complex complexity and participation approximately follows a power- law.
######
Click here for file
###### Additional File 4
**Mammalian complex complexity and protein length.**The mean length of proteins in available mammalian complexes is examined with respect to complex complexity.
######
Click here for file
###### Additional File 5
**Median length of proteins in annotated human complexes.** The median length of proteins in human complexes is examined with respect to complex complexity.
######
Click here for file
###### Additional File 6
**Yeast complex complexity and protein length.** The mean length of proteins in available yeast complexes is examined with respect to complex complexity.
######
Click here for file
###### Additional File 7
**Length distribution of human mitochondrial proteins.** The length distribution of human mitochondrial proteins is plotted.
######
Click here for file
###### Additional File 8
**Random complexes and dN/dS (Human-Mouse Orthologs).** dN/dS ratios of genes associated with model 2 random complexes are examined with respect to complex complexity and participation.
######
Click here for file
###### Additional File 9
**Binned Plots for Figures 3D and 3F**.[3](#F3){ref-type="fig"}
######
Click here for file
###### Additional File 10
**Protein complexes and dN/dS based on orthologs from a variety of species.** dN/dS ratios of genes based on human-dog, human-chimp, human-rat, S. cerevisiae-S. mikatae and S. cerevisiae-S. paradoxus orthologs are examined with respect to complex complexity and participation.
######
Click here for file
###### Additional File 11
**Complexes and gene conservation.** The fraction of orthologs conserved in yeast and human complexes is examined against complex complexity.
######
Click here for file
###### Additional File 12
**Extension and subsets of the protein complex data.** Extended yeast complexes, complexes with subcomplexes removed, nuclear and non-nuclear complexes are examined with respect to complex complexity and participation.
######
Click here for file
###### Additional File 13
**Analysis of protein complex data using the median.** Analysis of protein complex data with respect to mean dN/dS ratios and sequence length is compared with analysis using the median.
######
Click here for file
###### Additional File 14
**Homogeneity of Protein Properties in Yeast Complexes.** Deviation in pI, secondary structure and evolutionary rate between proteins in annotated yeast complexes are compared to those in random complexes.
######
Click here for file
###### Additional File 15
**Length difference of interacting proteins.** Large proteins tend to interact with much smaller partners.
######
Click here for file
Acknowledgements
================
The work was funded by the BioSapiens Network of Excellence (grant number LHSG-CT-2003-503265). We thank John Parsch for comments, Gabi Kastenmueller for help with BioRS, Brigitte Waegele for the complex data, Michael Telgkamp for figure preparation, Alexei Antonov and Werner Mewes for insightful discussion and emails. We also thank the anonymous reviewers.
|
Q. Gentlemen, first of all give us your impressions of the circuit and Singapore as a whole.
Gerhard BERGER: I think it was a great experience today. Different things came together and I think the lighting is very spectacular and going between the houses makes a really fantastic show for the people. The other positive thing is we have seen a lot of people today at the circuit. The grandstands were already quite full and it seems that Formula One can become very popular here. So overall I think it is a great place to be and it is going to be a great place.
Q. And from a technical point of view, Christian?
Christian HORNER: First of all I would like to echo what Gerhard has said. The guys here have done an absolutely unbelievable job. The effort that has gone into this circuit in the last 12 months is nothing short of phenomenal. I think the spectacle of a night race, but not only have we got a night race, we have also got a great circuit, a really challenging circuit.
We have already test driven the barriers today and we can see that it is pretty unforgiving out there. I think it is going to be a real challenge of a race and I think it is going to be a fantastic weekend. Hats off to everybody involved. I think they have just raised the bar considerably for a new circuit and the spectacle of racing at night in a big city such as Singapore is really exciting.
Q. Adam, your feelings? Perhaps from a commercial point of view?
Adam PARR: Well, like Christian and Gerhard I think what has been achieved here is absolutely amazing. I was here between Australia and Malaysia and there was the beginnings of a circuit and the building of the pit lane but what has been done in six months is incredible. From a commercial perspective and from a sporting perspective I think it is just an extraordinary experience and spectacle and that is fantastic for Formula One, so it is very exciting.
Norbert HAUG: Basically the same. First of all thank you to everybody who was involved to make this happen. I think it is a big, big step forward for Formula One. The pictures, the atmosphere is really one of a kind and this gives a completely new experience to all the viewers worldwide but also to the spectators. As Gerhard pointed out, an impressive amount of spectators here today for free practice. That is very positive and the whole scenery I think is unreal. It is like in a movie and I think it is a big, big step.
I think Bernie (Ecclestone, FOM President) pushed very hard, so thanks to him and FOM. It is really a good step forward and I am sure that Singapore will be watched throughout the world over the weekend. The track is very challenging in addition, so it is not going to be an easy one but so far I think we have really gathered the best impressions so far.
Q. Gerhard, how has the win affected the team since Monza?
GB: They are still all drunk. No, I mean it was an unbelievable experience to have the first win with Toro Rosso. I think it was a big push for the team and gave us even a bit more confidence. It was a great day for Red Bull. I think to win in Monza with Toro Rosso was just unbelievable. I think it shows we are going step by step in the right direction. It shows our car is a good car.
It is quick and reliable and now we have a very good experience. We have seen an unbelievably big step from last year to this year. I still believe that in the last four races we can do something good. I know if you go and win people expect it to go on like this. It is very clear our goal is to put one car, and if everything runs fantastic, both cars into the first 10 in qualifying and then collect the big points. But I think we are going to remember for a long time our win from last week.
Q. Christian, perhaps you looked on that win with mixed feelings. But what has it meant for Red Bull Racing?
CH: I think for Red Bull, as Gerhard says, it was a fantastic result. Toro Rosso, the whole weekend, did an excellent job. They did a better job than anybody else. Everybody in Red Bull is very proud of the result that they achieved. We have got 600 people back in Milton Keynes that form part of Red Bull Technology that are supplying both teams. Under Adrian's (Newey - Chief Technical Officer) leadership they have done a good job this year and as I say, Toro Rosso did a superb job. Sebastian drove the race of his life and demonstrated that he is a real star of the future. It was a bit of a fairytale. For Gerhard, I remember watching as a kid his win 20 years ago at Monza and I don't think on the podium he looked so much different to what he did 20 years ago.
GB: Thank you, Christian. But I also want to say (something) about Red Bull. Our car comes from Red Bull Technology and thanks to them and, as Christian said, thanks to Adrian we have got the base to do something, so it is a great thing to have this car.
Q. Adam, how did the independents feel? What was the atmosphere within Williams and the fact that Williams can win a Grand Prix?
AP: Well, as an independent constructor we looked on with great feelings. You cannot take away from them what they achieved over the weekend and congratulations to them. I think what it means for us is simply that we have to do the things that we do better. Not a great take away from that weekend but we have got to do better.
Q. Norbert, do you feel the World Championship is a two horse race now?
NH: No, I don't think so. As long as the mathematical chances are existing, they are existing. I think everybody learned their lesson last year, not least us. There are more involved than two guys which is good for the sport, We should have some more points but it is what it is. I think it is a thrilling season. We have had great races so far, very, very exceptional with rain and now a new track in Valencia and this particular track, a night race. I think it is going to be remembered as a remarkable season, whatever happens. It is close and the championship starts right here because it is very close together between the top guys.
QUESTIONS FROM THE FLOOR
Q. (John O'Brian – Reuters) Do you think that the global credit crunch will have an effect on teams in the future?
GB: For us it doesn't make any difference, as we don't get anything. I think it is going to affect all of us. I think it is going to be difficult times, no question, and if you look at new sponsors coming into Formula One, it is very seldom, especially the big ones. As I see it, it is not going to be easy the next two years.
CH: I agree with Gerhard. The global economy at the moment isn't in great shape and it affects all areas of the pit lane. It is down to the teams to work collectively with the governing body to make sure that we are responsible in what we do to control our costs. But, on the other hand, venues and races such as this one are so powerful and strong for Formula One and demonstrate Formula One in such a strong and fantastic light, excuse the pun, I think there are other very positive aspects as well and I think this race, certainly this weekend, will be a big boost for the series in general.
AP: I think that it would be foolish to think that the external environment doesn't affect our business but I think what is important, as with any business, is to prepare and we are trying to do that, some perhaps harder than others. I think that we need within FOTA (Formula One Teams' Association) to get on and identify ways to reduce our costs. I think we need to work with the Commercial Rights Holder, with Bernie, to continue to grow the sport and I think this weekend is a testament to what FOM has achieved in terms of creating something absolutely phenomenal.
Our partners and our sponsors are absolutely riveted by this event and they are here in force. I think that in spite of the global environment we are in rude good health but we will only stay in rude good health if we prepare for the future because the world is changing right now, very, very fast, faster than anybody could have imagined even a month ago. I think it is time to get down and change a few things.
NH: Pretty much the same. If we concentrate on this venue, I think this is a great chance. Of course, in whole financial world, all the surroundings are really challenging, probably more so than ever, but if you look at what was invested here, and what will be the outcome, what will be the exposure worldwide... Singapore is known for being a metropole for financial business for example, and I think that sends out really positive signals.
I think this is an enormous chance, and the more you are under pressure, the more you are under pressure to sell your products, the more you need advertising, but very specified and very special examples, and I think Formula One can deliver that. I think that, remarkably, in the middle of a period where it is really difficult everywhere, to have a race like this is remarkable.
Again, I think we should be mindful that (the reason why) this is happening here currently is that so many people put so much effort behind it. It is not just another normal race, it's a huge step and a really good chance for Formula One, for the sponsor partners, for everybody involved, for the media, for worldwide television viewers. I think it's special and that needs to be addressed on this occasion.
Q. (James Allen – ITV) Could you tell us something specific that you learned about the track today, the way the grip levels changed or something unusual that you hadn't perhaps foreseen, perhaps Christian or Gerhard?
CH: We learned that crashing on your third lap isn't the best preparation for the weekend, and there is very little margin for error here. I think you saw quite a few incidents today. You can see that the drivers are right on edge and there is a very, very small margin for error which is the trait of a street circuit. It's bumpy, it's quick in areas, it's a challenge set-up-wise. Obviously we're running the soft tires here as well which presents a challenge in itself. We've worked through our program, which was compromised in some respects on one side of the garage, but we've learned a great deal from today.
GB: Well, we have found the set-up direction very quickly at the last few circuits on Friday but to be honest today we've been struggling a bit. We were especially struggling with riding over the curbs and not enough grip, so overall we did not find our way today. Hopefully the engineers and the drivers will find it overnight but it's a bit more difficult than in the last three races.
Q. (Will Buxton – Australasian Motorsport News) Adam, the FIA has announced that the Formula Two tender has gone to Palmer and that Williams will be helping out with that. Could you just let us know exactly what William’s involvement will be and how you see the category developing into the future?
AP: We are designing the car for Jonathan Palmer. We have no involvement in the F2 series beyond that, but it may well be that what we will do with Jonathan later on is to introduce a sub-series using the same chassis and the same format around the world as feeder series.
That's broadly our involvement. In terms of the way the series is going to develop, it's a very exciting new challenge because it is a difficult format to operate successfully but Jonathan's been doing it for eleven years with his Formula Palmer Audi and our collective goal and ambition is to create a series which is really accessible. You've seen the pricing of it, really fair, but also a fast exciting car and that's our responsibility, so we're hoping it will create an opportunity for people who couldn't afford some of the more expensive series to have a go.
Q. (Joe Saward – Grand Prix Special) The result in Monza was a fairy-tale for Formula One and it did a lot of good among viewers around the world, but in the Formula One world, a customer car winning is costing constructors money. What are the attitudes of the four teams that we have here about customer cars, and do you think it will cause more opposition now that a customer car has actually won a race?
NH: Well, I'm very open. I can understand a traditional constructor like Williams. They have contributed a lot in the past and I think we just need to find a way together. But concentrating on what is allowed currently, whether this is a customer team or not, I think the guys deserve all credit. I already pointed this out in Monza, and it is really what concerns me. It comes from my heart, it's not just a sing-song, it is really great what they achieved and it just shows how closely-fought Formula One is these days and it doesn't come from nothing.
Of course they have a good technical package, but there are good guys involved, there are good racers involved in Gerhard, like Franz Tost, Ascanelli. They know what they're talking about and I think it is pleasing. They shouldn't do it each and every race if possible but they deserve their victory and their victory was a positive message and it was a positive message for Formula One. We could have done a better job, that happens sometimes but all credit to them.
I have to say I was pleased but at the same time, I fully understand a traditional team like Williams for they have contributed a lot to Formula One and where Formula One is right now is partly due to Williams as well. So I think you just need to get the right balance and I think that's internal stuff which we need to discuss and that is currently happening and I'm sure a solution will be in place in the future.
AP: I think actually Norbert has put it very nicely... We take our hats off to Gerhard and his team for what they did over that weekend and we had an opportunity to beat them, let's face it, and we didn't and so that's our problem. In the longer term, we believe that customer cars have no place in Formula One. It's ultimately a design and engineering challenge as well as a racing challenge, and we believe that is the reason for example why this event is going to be so incredible. There is no other motor sport series in the world that could do what we're going to do here this weekend, and that's been built on the back of not just teams like Williams but many teams.
There are 53 teams since 1970 that have tried to design a chassis and compete in Formula One and have failed, which is nine out of every ten teams that have tried. I think that what we are doing here this weekend is built on a lot of history and we passionately believe that that is the way forward for Formula One. Because of our respect for Gerhard and Red Bull and what they put into the sport we've agreed an arrangement for this period which is temporary but in the longer term we must go back to being a sport of constructors, that's our view.
CH: I think you have to look at a bigger picture. I think that today we have ten teams, there are twelve potential entrants and there are only ten teams here and I don't see other teams knocking on the door to come into Formula One because to come in as a constructor is hugely prohibitive to have any chance to compete. With the global financial situation, and with the way that Formula One is, with the amount of manufacturers we also have in Formula One, whilst respecting Adam's and William’s position, I'm afraid I disagree and feel that it's in the interests of Formula One to have a mix.
It is good for a team such as Toro Rosso or Red Bull to win races. I'm sure Gerhard will answer the question for you but for Toro Rosso to become a constructor is a massive, massive undertaking and is it represented in the television audiences. Are the people in the grandstands and watching television really interested in how many wind tunnels we run, how many people we have working in R&D or CfD or stress finite element analysis or all these areas? I think that Formula One, at the end of the day, is a sport and secondly it's a show, and I think we need to address those issues and then concern ourselves about constructors and non-constructors. That would be my take on it.
GB: Well, Christian, I think, spelt it out quite well. I have to say that first, what is a customer car? The definition is still very wide, but anyway, I fully respect the position of Williams, but I have to say that times are changing; time is also changing in the normal automobile industry where today there is co-operation between companies trying to use synergies, because otherwise they have no chance to survive in the market. Here in Formula One, we have ten teams, nobody is waiting to come in. I think we have a bigger chance to lose two teams than to get in another two teams.
If we are sitting here and say, well, we cannot think about synergies, getting costs down because Williams have invested into some areas some years ago, I think it's the wrong way. I think Formula One has to go on, to do what is right for Formula One and where Formula One has the best chance to end up with 24 competitive cars again, not cars that are running two laps behind just to fill the field, and making a good show, because just as Christian says, nobody out in the grandstands is proud that we have 600 people. They want to see a race, that's what they want to see.
Q. (Ralf Bach – R & B) Christian, could you explain to ordinary people outside Formula One, who are interested in Formula One but are not real insiders, how it is possible that one team can win in Monza, and the other team is in the middle of nowhere with the same car?
CH: It's quite simple. Red Bull Technology provide the same car for two teams and Toro Rosso did an excellent job during the weekend in running the car and the driver also did an outstanding job. Obviously we have a difference in our package of engine and driver and it's always easy to point fingers but it would be wrong for me to sit here and talk about those differences. The key is that for Red Bull it was a fantastic result. It's probably harder for you to understand because I think many of you see Toro Rosso as the old Minardi, and it's something very different from that.
It's a well-run team now, it's well supported technically by Red Bull through Red Bull Technology and I think that the achievements in Monza two weekends ago were not only positive for the sport but I think that for the investment that Red Bull have put into Formula One were significant. Obviously we want to see both teams up there and Toro Rosso and Red Bull Racing are now only a point apart in the Constructors and will race hard on a Sunday afternoon, but on a Monday the two teams belong to the same family.
GB: I would also like to say something. You have to see it over the year. There have been a lot of races where we have not been able to get the set-up in the way that Webber got it or Red Bull Racing got it. This time we got it right and we also got the weather conditions right on the right day at the right moment. We got everything right, and so we had great success, fantastic, but if you look at it over the year and if you look at the points we are at a similar level, so I think it's up to the daily performance.
Copyright 1999-2014 | AutoRacing1 is an
independent internet online publication and is not affiliated with, sponsored by, or endorsed
by IndyCar, NASCAR, FIA, Sprint, or any other series sponsor.
This material may not be published, broadcast, or redistributed without
permission. |
Category Archives: BOOKS
Putinism is apparently a thing. Why? And what thing is it? Putin is enormously popular among Russians because (1) they think he is responsible for the increase in their living standards when in fact they have benefited from the spike in oil prices; (2) he controls the media, which presents him as a savior; (3) he has reintroduced public order after the chaos of the transition; (4) he has appealed to national pride by making Russia a superpower again (or so they think: really a Potemkin-power); and (5) Russians don’t like democracy or liberalism but prefer the iron fist of an authoritarian ruler.
Back in the 1990s, there was a lot of interest among law professors about the interaction between law and social norms. There were several conferences. I wrote a book about it. Even the New Yorker published an article about it. There had been a general sense that traditional economic models then being used in law and economics took too much for granted–suggested that the government could in an uncomplicated way lay down the rules for people to follow and then sanction them if they violate those rules. In fact, people often act in orderly ways and generate public goods for themselves without resorting to law. They may not even know about the law. Robert Ellickson wrote a famous book about this phenomenon. If all this is so, the question is how.
Game-theoretic models–then newish among lawyers (although decades old), now familiar–seemed to offer explanations. And they had interesting implications. Scholars quickly realized, and showed with these models, that poorly designed law, if it did not respect or work off of social norms, could damage them, possibly, or in other ways generate perverse consequences. Maybe people would be less likely to trust the government and follow its laws if the government tries to change the social norms they care about. On the other hand, the models provided no guarantee that social norms would be efficient, contrary to Ellickson.
The literature seemed to have run out of steam a number of years ago. The game-theoretic models turned out to be not very tractable. They seemed to be able to explain too much. (Game theory is good at showing that cooperative behavior is consistent with rationality, less good at showing that it is entailed by it.) Or maybe we don’t need (as well as can’t have) a general theory of social norms. It’s enough to know a lot about whatever particular area of human behavior you’re writing about.
Richard McAdams has published a new book called The Expressive Powers of Law. It is in some ways a throwback to the earlier literature. It puts a great deal of emphasis on the way that “focal points” can structure people’s behavior when people are otherwise trying to coordinate with each other. The government can manipulate focal points, and in that way influence people’s behavior for the better. But in the complex informational environment in which people operate, there are limits to how much the government can do. The strength of the book lies in the careful way that it explores those limits, and throws cold water on some excessively ambitious claims about how the government can “send a message” in order to influence behavior. This excellent book is well worth a read.
I wrote this review for a magazine which accepted it and then for unexplained reasons never published it. On the principle that “blog” is just another word for vanity press, I self-publish it here. Hull’s book is very good; you can buy it here.
Glen Weyl and I wrote a piece for The New Republic on Piketty’s book. Piketty’s book has received a lot of attention for two reasons–the first is that it is rigorous and fascinating; the second is that its focus on inequality resonates with public anxieties about the direction of the market economy.
There is a sensible argument about inequality and there is a dubious one. The sensible argument is that today certain lucky folks–financiers, start-up entrepreneurs who hit the jackpot, top CEOs, and so on–who earn vast incomes, almost certainly far in excess of what is needed to motivate people to generate value for the economy, and in many cases (above all, in finance) even in excess of whatever value they do generate, should pay higher income taxes. Many people think that Piketty’s book makes this argument. But while Piketty endorses this view, or at least seems to, this view is not the distinctive contribution of his book.
The book is called “Capital in the Twenty-First Century,” not “Income in the Twenty-First Century.” Piketty argues that extreme inequality is the result of the accumulation of capital in the hands of the few across generations. And because the rate of return on capital is higher than the “natural” rate of economic growth, inequality can only increase. This argument really is distinctive–it is the distinctive contribution of the book–and it is what leads him to endorse a wealth tax (as opposed to a higher income tax, though he does support a higher income tax as well). This argument is dubious. It rests on implausible assumptions about how super-rich people spend their money, and, most of all, how they transfer it to heirs.
This book explores compliance with the laws of war, focusing on laws regulating the treatment of POWs, using theoretical models and empirical data. Governments take an instrumental approach to the law: they follow it when it serves their interest. The major way this can happen is if retaliation by the enemy is worse than any temporary gains from violating the law while the enemy follows it. Thus, a state may violate the law if (1) the law puts it at disadvantage and so it gains from disregarding it even if the enemy does as well; or (2) the law puts the enemy at a disadvantage so it cannot be expected to comply with it. Mutually beneficial cooperation can break down because the rules are unclear, but trying to get them precise in advance is difficult because of uncertainties about future changes in technology and the like.
A good companion book is Isabel Hull’s A Scrap of Paper, which examines the laws of war during World War I. Hull also addresses the laws of neutrality, which create more complex strategic interactions than POW rules do. A belligerent wants to inflict as much harm on the enemy as possible, including interference with trade with neutrals, but up to the point where the neutrals themselves protest and may join forces with the enemy. The legal rules play an even more limited role than POW rules do. Neutrals have complex attitudes toward the belligerents, and some will tolerate violations of the law of neutrality by one belligerent because of their hostility to the other.
Hull is a historian while Morrow is a political scientist but the books tell a similar tale about governments’ instrumental attitudes toward international law. International law professors, who regard international law from a static, doctrinal perspective, and against all evidence take compliance for granted rather than as a problem that influences how the law is interpreted, could learn a lot from these books.
There is much of interest in this excellent new book by Cass Sunstein. The preface contains a defense of the different roles of the academic–to challenge conventional wisdom–and the public official, who must often keep his opinions to himself for the sake of operating in a team. People like Sunstein who move between academic and public roles face numerous challenges–both from the public, who see in the academic writings evidence of ideological extremity and from (naive) colleagues, who expect the advocate of (impractical) X to champion it public life even if it would bring down the ship of state. These divergent reactions are difficult to handle; few people handle it as gracefully as Sunstein has. A whole book could be written about those less graceful individuals, many of them also law professors, who traveled between law schools and various recent presidential administrations.
A few comments on Chapter 1, on conspiracy theories, which has received outsized attention:
1. Are conspiracy theories important or are they just little clumps of seaweed in the vast and bottomless ocean of public ignorance?
2. I can’t help thinking that there would be even more conspiracy theories ruining public life if people heeded calls from academics and politicians to become more involved in political debate.
3. Can “cognitive infiltration” (an unfortunate choice of words, I think, with its unnecessary sinister overtones) really work? The idea is that anonymous government agents could penetrate chat rooms and answer craziness with reason. But conspiracy theories seem to answer a deeper need than the desire for truth. N.B.: I suspect that government officials, on their own time, and not as part of formal programs, already do this, leading one to wonder how often Man-Who-Was-Thursday scenarios erupt in these chat rooms.
Have you read your iTunes contract–the one that Apple asked you to read and accept before using the service? No? Neither have I. It’s 55 pages long. How about the mortgage disclosures that accompanied your last refinancing? In Illinois, you would need to read 49 disclosure forms spread out over 101 pages. When I refinanced my mortgage, the huge stack of disclosures induced a faint bout of nausea but no wisdom. A professor who teaches contract law and banking law, I quickly gave up trying to understand what I was reading.
The law overflows with disclosure mandates even though it is pretty obvious to everyone that they hardly do any good. Instead, they confuse and frustrate buyers. In this terrific book, Omri Ben-Shahar and Carl Schneider exhaustively describe this phenomenon. Mandatory disclosure is law’s biggest and phoniest panacea, as they amply demonstrate.
The appeal of mandatory disclosure laws is easy to understand. They seem like a good way to protect buyers without interfering with the seller’s power to choose terms that protect its interests–an early form of “nudge.” And while in certain circumstances they can do good, they more often cause the seller to game the system by reducing quality along dimensions that the disclosure mandate does not cover, leading the government to force the seller to disclose more and more. The upshot is that consumers are overwhelmed with information they can’t understand.
In a kind of infinite cycle to hell, courts strike down contracts because buyers can’t pick out a key term among the Borges’ library of information, and sellers protect themselves by pointing out the most important terms and demanding that buyers initial them. I can’t remember how many terms I was required to initial in my mortgage but it was surely dozens. (I didn’t read any of them as an act of defiance and self-preservation.) Eventually, people will be required to initial every sentence of 100-page contracts and be required to take exams that test their understanding before being allowed to go home with their toaster or space heater. We will understand every last detail of everything we buy but have no time to use it.
William Easterly argues that efforts to help poor countries achieve economic growth have gone astray because western experts impose top-down recipes for growth (a kind of Stalinist approach that mixes hubris and incompetence):
The conventional approach to economic development … is based on a technocratic illusion: that the belief that poverty is a purely technical problem amenable to such technical solutions as fertilizers, antibiotics, or nutritional supplements.
The problem, as Easterly shows in this book and in his previous books (including the terrific White Man’s Burden), is that these technical solutions fail because western experts rarely understand the intricacies of the local environment, and, more important, the politics and institutions in the countries they seek to help. Often, technically flawless development projects fail because of corruption and abuse in the country that is being helped. The gleaming power plant operates for a few years and then falls into disrepair because the absence of an effective legal system that enforces property and contract rights makes it impossible to collect bills or protect against squatters.
The solution? It turns out to be human rights:
What you can do [about global poverty] is advocate that the poor should have the same rights as the rich…. This assertion of the rights of the poor is needed now more than ever…. This books argues [that] an incremental positive change in freedom will yield a positive change in well-being for the world’s poor.
Easterly does not explain what any of this means. Which rights should we advocate? How should we insist that they be implemented? What should we do to governments that refuse to take our advice? I suspect that if he gave these questions some thought, he would realize that any serious effort to compel or bribe poor countries to recognize rights would look like the development activities that he criticizes. Indeed, his bête noir, the World Bank, famously tried to implement “rule of law” projects that were supposed to enhance rights. These projects failed for all the reasons that all the other development projects failed.
Easterly provides no evidence that if we advanced human rights in poor countries, well-being in those countries, or even respect for rights, would improve. In fact, there isn’t any.
Fragile by Design, by Charles Calomiris and Stephen Haber, is a great book. The authors argue that the stability and efficiency of financial systems in different countries depend on political bargains that set the rules of the game. Authoritarian countries produce inefficient state-owned banking systems because governments cannot commit not to expropriate. But democracies produce a wide range of outcomes, depending on the configuration of constituencies and interest groups. The United States is cursed with a highly unstable banking system because local interests have been able to ensure a huge number of local unit banks that were insufficiently diversified. This system finally broke down thanks to the inflation of the 1970s, but our further misfortune was a political bargain between activist groups and large banks in the 1990s that resulted in a system where banks were encouraged to reduce underwriting standards so as to extend credit to low-income people. Meanwhile, countries like Canada were lucky enough that the initial political bargain at a national level led to a small number of stable and efficient banks that weathered the financial crisis of 2008.
There are a huge number of moving parts and epicycles (why was our unstable system so stable from 1936-1980?, and what explains the success of activists like ACORN?), but the book is nonetheless enormously illuminating, and contains the most powerful and concise account of the causes of the 2008 crisis that I have seen.
Via a helpful review by Daniel Farber, I found out about this book, which is a much-needed one. I have searched in vain for some time for an overall assessment of deregulation in the United States. Unfortunately, if the remit of McGarity’s beloved Consumer Protection Safety Commission extended to books, this one would have to be recalled.
McGarity argues that the deregulation movement arose from a conspiracy between business interests and right-wing intellectuals, who hoodwinked Congress and the public. In fact, deregulation was largely a bipartisan movement that started in the Carter administration, and reflected an emerging consensus that many (but not all) regulations did more harm than good–in particular, rate regulation. McGarity barely discusses or discusses not at all airline, trucking, and railroad deregulation of the 1970s, which generally has received high marks, or the resistance of business interests to some forms of deregulation–all of this contrary to this thesis. He is certainly right that a lot of deregulation went too far–notably financial deregulation–but because he refuses to provide a realistic baseline for determining whether deregulation benefits or harms the public, he provides no reasonable method for distinguishing between good deregulation and bad deregulation or, for that matter, good regulation and bad regulation.
Instead, he resorts to anecdotes. One of the weakest chapters discusses transportation safety, and he includes some distressing anecdotes of terrible accidents that he blames on deregulation. But transportation safety has greatly improved over the period of deregulation. Numerous studies show that railroads, airlines, passenger vehicles, and other modes of transportation are vastly safer today than they were in the 1970s. McGarity acknowledges some of these statistics at the beginning of the chapter, but by the end he has forgotten them, and instead pronounces deregulation a disaster for safety. Nor does he acknowledge the economic benefits from transportation deregulation, which have been extensively documented by economists.
Similar points can be made about other chapters, for example, the chapter on workplace safety, which provides a tendentious picture of mine safety being utterly neglected, when in fact safety has steadily improved (as shown by the graph above). The fatality rate dropped from 0.200 (1970) to 0.059 (in 1980) to 0.016 (in 2010) fatalities per 100,000 workers in coal mines. Certainly, stricter regulation would have caused the fatality rate to drop even further, but would it have been worth the cost? No answer is provided.
Another lurking question is the extent to which deregulation actually took place. As Farber notes, the evidence is often equivocal. The sheer number of rules has greatly increased; budgets are a more complex story, but private rights of action have also become more important. When rate regulation in the railroad and telecommunications sectors were eliminated, it was also thought necessary to introduce regulations to ensure free entry, leading to quite complex regulatory regimes. Airline safety was never deregulated; the fear was that price competition would lead to less safe airlines. What exactly deregulation is, and whether it has had good or bad effects, are important questions. We’ll need to wait for another book for the answers.
This book provides a nice history of the evolution of voting rules, with emphasis on supermajority rules, but is less successful in its attempt to argue that supermajority rule should presumptively be replaced with majority rule. Schwartzberg simultaneously argues that majority rule is superior to supermajority rule because the latter creates a bias in favor of the status quo, and acknowledges that a status quo bias is justified so that people can plan their lives. Her solution–what she calls “complex majoritarianism”–is the manipulation of majority rules so that they are applied to favor–the status quo. For example, she favors constitutional amendment requiring a temporally separated majority vote in the legislature (plus subsequent ratification), but the effect is just bias in favor of the status quo except in the unlikely event that preferences don’t change. She argues that this approach advances deliberation but deliberation can be encouraged in other ways and in any event the status quo bias is not resolved.
The book is right to emphasize historical, empirical, and institutional factors as opposed to the sometimes tiresome analytics of social choice theory–as emphasized by this enthusiastic review here–but Schwartzberg’s argument against supermajority is ultimately analytic itself, based on abstract considerations of human dignity, rather than grounded in history or empiricism. The empirical fact that the book doesn’t come to terms with is that supermajority rule is well-nigh universal, not only in constitutions but virtually every organization–clubs, corporations, civic associations, nonprofits–where people voluntarily come together and use supermajority rules to enhance stability and to prevent situational majorities from expropriating from minorities.
David Bosco‘s new book tells the history of the International Criminal Court. It is nicely done and will be a reference for everyone who does work in this area. The conclusion will not surprise any observers: the ICC survived efforts at marginalization by great powers but only by confining its investigations to weak countries. Thus, the ICC operates de facto according to the initial U.S. proposal, rejected by other countries, to make ICC jurisdiction conditional on Security Council (and hence U.S.) approval.
Bosco seems to think this equilibrium can persist, but the book only touches on (perhaps because it is too recently written) the growing resentment of weak countries, above all African countries, which have woken up to the fact that the Court is used only against them, and have begun to murmur about withdrawing. The Court now faces political pressure to avoid trying not only westerners, but also Africans. Meanwhile, the Kenya trials are heading toward debacle, while the ICC is unable to address international criminals like Assad. The Court’s room to maneuver is shrinking rapidly, and one wonders whether it can sustain its snail’s pace (one conviction over a decade) much longer. The book might have been called “Just Roughness.”
Adrian Vermeule’s new book, The Constitution of Risk, argues that much constitutional thinking follows a model of “precautionary constitutionalism,” where doctrines are designed to avoid worst-case outcomes. A better approach is what he calls “optimizing constitutionalism,” where such “political risks” are traded off rather than minimized. The Court of Appeals in Noel Canning, for example, appeared to be driven by a fear that if it upheld President Obama’s recess appointments, then presidents could tyrannize by avoiding the Senate altogether. It ignored the countervailing risk that if the recess appointment is limited, important offices would go unfilled. As Cass Sunstein has written in the area of regulation, the precautionary principle makes little sense on its own terms since there are always risks on all sides, and leads to pretty unattractive outcomes even when it can be applied. It’s as if we should all stay in our basements rather than take the risk that flower pot will fall on our heads if we go outside.
Among the many excellent insights, the one I found most striking was the claim that much traditional constitutional thinking and doctrine has a precautionary-principle cast to it, and is thus vulnerable to the same criticisms as that principle is.
Kirkland and Ellis Distinguished Service Professor, University of Chicago Law School |
An overview of venous thromboembolism prophylaxis.
This symposium reviewed the risk factors and problems associated with venous thromboembolism in surgical patients, especially those patients having total hip replacement. The importance of venous thromboembolism prophylaxis was emphasized by a theoretical analysis indicating that venous thromboembolism in patients having hip replacement not only saves lives but is also effective. A discussion of the pharmacology of low-molecular-weight heparin (LMWH) included a review of its role, clinically and experimentally, in venous thromboembolism prophylaxis. Three of the discussants presented their favorable experiences with LMWH in reducing the incidence of venous thromboembolism in patients having hip replacement. It can be concluded that LMWH does reduce the incidence of venous thromboembolism in patients having hip replacement without causing an increase in blood loss. If its effectiveness and safety remain substantiated, LMWH may soon become the preferred agent for venous thromboembolism prophylaxis. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.