text stringlengths 8 5.77M |
|---|
Baltimore police have arrested Anita Jones (pictured) after they say she fatally stabbed her husband inside John Hopkins Hospital
Baltimore police have arrested a woman they say fatally stabbed her husband inside John Hopkins Hospital in Baltimore.
Police arrested 30-year-old Anita Jones on Saturday and charged her with first-degree murder stemming from the stabbing death of 33-year-old Christopher Yancey.
On Friday, police in Baltimore said a man was found dead of multiple stab wounds in his young son's room at the hospital.
Police spokesman T.J. Smith said in a statement that officers were called to the room at around 2.30pm after hearing reports of a disturbance.
Smith commented that the man was in his son's room with the boy's mother.
Their 14-year-old son was there to undergo a minor medical procedure. The stabbing occurred when the boy's parents were left in a private room alone together.
When they arrived hospital staff told them that Jones and Yancey had been arguing in a room.
Christopher Yancey, 33, was found stabbed to death inside the hospital Friday afternoon
Jones then came out and told staff that Yancey had cut himself. Staff members found Yancey suffering from multiple lacerations. He was pronounced dead. Jones left the hospital before officers arrived.
Police say no weapon was found in the hospital room, and Yancey's injuries were determined to be inconsistent with suicide.
Police spokesman T.J. Smith (picturerd) said that officers were called to the room at around 2.30pm
Smith says the man was stabbed in the upper body.
The hospital said in a statement that the stabbing was an isolated incident.
'We would like to extend our deepest sympathies to the family of the deceased,' Johns Hopkins Hospital spokeswoman Kim Hoppe said.
Since this is a police investigation, we must defer all inquiries to them,' she added.
Friday's killing marked Baltimore's 281st homicide in Baltimore in 2017, a record for the city.
The world-renown hospital has been at the epicenter of violent events within its parameters before.
The most-notable incident occurred in 2010, when a Virginia man entered the hospital and shot his mother’s doctor, killed his mother and then killed himself, according to The Baltimore Sun.
The man, Paul Warren Pardus, blamed Dr. David B. Cohen for paralyzing his mother during surgery. Dr. Cohen survived the homicide attempt. |
# Create React App [](https://dev.azure.com/facebook/create-react-app/_build/latest?definitionId=1&branchName=master) [](https://github.com/facebook/create-react-app/blob/master/CONTRIBUTING.md)
<img alt="Logo" align="right" src="https://create-react-app.dev/img/logo.svg" width="20%" />
Create React apps with no build configuration.
- [Creating an App](#creating-an-app) – How to create a new app.
- [User Guide](https://facebook.github.io/create-react-app/) – How to develop apps bootstrapped with Create React App.
Create React App works on macOS, Windows, and Linux.<br>
If something doesn’t work, please [file an issue](https://github.com/facebook/create-react-app/issues/new).<br>
If you have questions or need help, please ask in [GitHub Discussions](https://github.com/facebook/create-react-app/discussions).
## Quick Overview
```sh
npx create-react-app my-app
cd my-app
npm start
```
If you've previously installed `create-react-app` globally via `npm install -g create-react-app`, we recommend you uninstall the package using `npm uninstall -g create-react-app` or `yarn global remove create-react-app` to ensure that npx always uses the latest version.
_([npx](https://medium.com/@maybekatz/introducing-npx-an-npm-package-runner-55f7d4bd282b) comes with npm 5.2+ and higher, see [instructions for older npm versions](https://gist.github.com/gaearon/4064d3c23a77c74a3614c498a8bb1c5f))_
Then open [http://localhost:3000/](http://localhost:3000/) to see your app.<br>
When you’re ready to deploy to production, create a minified bundle with `npm run build`.
<p align='center'>
<img src='https://cdn.jsdelivr.net/gh/facebook/create-react-app@27b42ac7efa018f2541153ab30d63180f5fa39e0/screencast.svg' width='600' alt='npm start'>
</p>
### Get Started Immediately
You **don’t** need to install or configure tools like webpack or Babel.<br>
They are preconfigured and hidden so that you can focus on the code.
Create a project, and you’re good to go.
## Creating an App
**You’ll need to have Node 8.16.0 or Node 10.16.0 or later version on your local development machine** (but it’s not required on the server). You can use [nvm](https://github.com/creationix/nvm#installation) (macOS/Linux) or [nvm-windows](https://github.com/coreybutler/nvm-windows#node-version-manager-nvm-for-windows) to switch Node versions between different projects.
To create a new app, you may choose one of the following methods:
### npx
```sh
npx create-react-app my-app
```
_([npx](https://medium.com/@maybekatz/introducing-npx-an-npm-package-runner-55f7d4bd282b) is a package runner tool that comes with npm 5.2+ and higher, see [instructions for older npm versions](https://gist.github.com/gaearon/4064d3c23a77c74a3614c498a8bb1c5f))_
### npm
```sh
npm init react-app my-app
```
_`npm init <initializer>` is available in npm 6+_
### Yarn
```sh
yarn create react-app my-app
```
_[`yarn create <starter-kit-package>`](https://yarnpkg.com/lang/en/docs/cli/create/) is available in Yarn 0.25+_
It will create a directory called `my-app` inside the current folder.<br>
Inside that directory, it will generate the initial project structure and install the transitive dependencies:
```
my-app
├── README.md
├── node_modules
├── package.json
├── .gitignore
├── public
│ ├── favicon.ico
│ ├── index.html
│ └── manifest.json
└── src
├── App.css
├── App.js
├── App.test.js
├── index.css
├── index.js
├── logo.svg
└── serviceWorker.js
└── setupTests.js
```
No configuration or complicated folder structures, only the files you need to build your app.<br>
Once the installation is done, you can open your project folder:
```sh
cd my-app
```
Inside the newly created project, you can run some built-in commands:
### `npm start` or `yarn start`
Runs the app in development mode.<br>
Open [http://localhost:3000](http://localhost:3000) to view it in the browser.
The page will automatically reload if you make changes to the code.<br>
You will see the build errors and lint warnings in the console.
<p align='center'>
<img src='https://cdn.jsdelivr.net/gh/marionebl/create-react-app@9f6282671c54f0874afd37a72f6689727b562498/screencast-error.svg' width='600' alt='Build errors'>
</p>
### `npm test` or `yarn test`
Runs the test watcher in an interactive mode.<br>
By default, runs tests related to files changed since the last commit.
[Read more about testing.](https://facebook.github.io/create-react-app/docs/running-tests)
### `npm run build` or `yarn build`
Builds the app for production to the `build` folder.<br>
It correctly bundles React in production mode and optimizes the build for the best performance.
The build is minified and the filenames include the hashes.<br>
Your app is ready to be deployed.
## User Guide
You can find detailed instructions on using Create React App and many tips in [its documentation](https://facebook.github.io/create-react-app/).
## How to Update to New Versions?
Please refer to the [User Guide](https://facebook.github.io/create-react-app/docs/updating-to-new-releases) for this and other information.
## Philosophy
- **One Dependency:** There is only one build dependency. It uses webpack, Babel, ESLint, and other amazing projects, but provides a cohesive curated experience on top of them.
- **No Configuration Required:** You don't need to configure anything. A reasonably good configuration of both development and production builds is handled for you so you can focus on writing code.
- **No Lock-In:** You can “eject” to a custom setup at any time. Run a single command, and all the configuration and build dependencies will be moved directly into your project, so you can pick up right where you left off.
## What’s Included?
Your environment will have everything you need to build a modern single-page React app:
- React, JSX, ES6, TypeScript and Flow syntax support.
- Language extras beyond ES6 like the object spread operator.
- Autoprefixed CSS, so you don’t need `-webkit-` or other prefixes.
- A fast interactive unit test runner with built-in support for coverage reporting.
- A live development server that warns about common mistakes.
- A build script to bundle JS, CSS, and images for production, with hashes and sourcemaps.
- An offline-first [service worker](https://developers.google.com/web/fundamentals/getting-started/primers/service-workers) and a [web app manifest](https://developers.google.com/web/fundamentals/engage-and-retain/web-app-manifest/), meeting all the [Progressive Web App](https://facebook.github.io/create-react-app/docs/making-a-progressive-web-app) criteria. (_Note: Using the service worker is opt-in as of `react-scripts@2.0.0` and higher_)
- Hassle-free updates for the above tools with a single dependency.
Check out [this guide](https://github.com/nitishdayal/cra_closer_look) for an overview of how these tools fit together.
The tradeoff is that **these tools are preconfigured to work in a specific way**. If your project needs more customization, you can ["eject"](https://facebook.github.io/create-react-app/docs/available-scripts#npm-run-eject) and customize it, but then you will need to maintain this configuration.
## Popular Alternatives
Create React App is a great fit for:
- **Learning React** in a comfortable and feature-rich development environment.
- **Starting new single-page React applications.**
- **Creating examples** with React for your libraries and components.
Here are a few common cases where you might want to try something else:
- If you want to **try React** without hundreds of transitive build tool dependencies, consider [using a single HTML file or an online sandbox instead](https://reactjs.org/docs/try-react.html).
- If you need to **integrate React code with a server-side template framework** like Rails, Django or Symfony, or if you’re **not building a single-page app**, consider using [nwb](https://github.com/insin/nwb), or [Neutrino](https://neutrino.js.org/) which are more flexible. For Rails specifically, you can use [Rails Webpacker](https://github.com/rails/webpacker). For Symfony, try [Symfony's webpack Encore](https://symfony.com/doc/current/frontend/encore/reactjs.html).
- If you need to **publish a React component**, [nwb](https://github.com/insin/nwb) can [also do this](https://github.com/insin/nwb#react-components-and-libraries), as well as [Neutrino's react-components preset](https://neutrino.js.org/packages/react-components/).
- If you want to do **server rendering** with React and Node.js, check out [Next.js](https://nextjs.org/) or [Razzle](https://github.com/jaredpalmer/razzle). Create React App is agnostic of the backend, and only produces static HTML/JS/CSS bundles.
- If your website is **mostly static** (for example, a portfolio or a blog), consider using [Gatsby](https://www.gatsbyjs.org/) or [Next.js](https://nextjs.org/). Unlike Create React App, Gatsby pre-renders the website into HTML at build time. Next.js supports both server rendering and pre-rendering.
- Finally, if you need **more customization**, check out [Neutrino](https://neutrino.js.org/) and its [React preset](https://neutrino.js.org/packages/react/).
All of the above tools can work with little to no configuration.
If you prefer configuring the build yourself, [follow this guide](https://reactjs.org/docs/add-react-to-an-existing-app.html).
## React Native
Looking for something similar, but for React Native?<br>
Check out [Expo CLI](https://github.com/expo/expo-cli).
## Contributing
We'd love to have your helping hand on `create-react-app`! See [CONTRIBUTING.md](CONTRIBUTING.md) for more information on what we're looking for and how to get started.
## Credits
This project exists thanks to all the people who [contribute](CONTRIBUTING.md).<br>
<a href="https://github.com/facebook/create-react-app/graphs/contributors"><img src="https://opencollective.com/create-react-app/contributors.svg?width=890&button=false" /></a>
Thanks to [Netlify](https://www.netlify.com/) for hosting our documentation.
## Acknowledgements
We are grateful to the authors of existing related projects for their ideas and collaboration:
- [@eanplatter](https://github.com/eanplatter)
- [@insin](https://github.com/insin)
- [@mxstbr](https://github.com/mxstbr)
## License
Create React App is open source software [licensed as MIT](https://github.com/facebook/create-react-app/blob/master/LICENSE).
|
869 P.2d 1181 (1994)
STATE of Alaska, DIVISION OF AGRICULTURE, AGRICULTURAL REVOLVING LOAN FUND, Appellant,
v.
Wayne M. CARPENTER, Appellee.
No. S-5228.
Supreme Court of Alaska.
March 4, 1994.
Rehearing Denied March 31, 1994.
Richard L. Musick, Asst. Atty. Gen., Fairbanks, and Charles E. Cole, Atty. Gen., Juneau, for appellant.
Joe P. Josephson, Anchorage, for appellee.
Before MOORE, C.J., and RABINOWITZ, MATTHEWS and COMPTON, JJ.
*1182 OPINION
COMPTON, Justice.
This case arises out of the purchase of, and failure to pay for, agricultural lands and agricultural loans. The State appeals the superior court's denial of its motion for a directed verdict on Carpenter's claim that his duty to pay on the loans was discharged based upon the theories of mutual mistake, commercial impracticability and misrepresentation. The State also appeals the superior court's denial of its motion for a directed verdict on Carpenter's counterclaim based on misrepresentation as to the underlying land sales contract. We reverse.
I. FACTUAL AND PROCEDURAL BACKGROUND
In April 1978 Wayne Carpenter purchased land from the Division of Lands of the Department of Natural Resources (DNR). In April 1981 he purchased more land from DNR. Both land sale contracts contained the same disclaimer:
The Seller makes no warranty, express or implied, nor assumes any liability whatsoever, regarding the social, economic, or environmental aspects of the Parcel, to include, without limitation, the soil conditions, water drainage, or natural or artificial hazards.
The contracts also disclaimed any guaranty of profitability. In addition, the contracts included farm conservation or development plans, requiring the buyer to improve and develop the land as a working farm. In 1980 and 1983 Carpenter borrowed money from the Agricultural Revolving Loan Fund (ARLF), a state agency created within DNR for the purpose of lending money to farmers to help them develop their land.
Carpenter made repeated efforts over the years to plant, but these efforts were unsuccessful. Spring flooding of the land became a perennial problem. As soon as the ground thawed in June, the water table rose and the land became too wet to support the equipment required for planting. In 1987 Carpenter abandoned efforts to farm the land. The land was reclassified as unsuitable for agriculture. Carpenter ceased making payments toward his ARLF loans.
ARLF filed an action for damages, repossession and foreclosure. Carpenter filed an answer claiming he was excused from performing under the contracts, along with counterclaims based upon allegations of negligence, misrepresentation, mutual mistake of fact and breach of contract. The superior court granted the State's directed verdict motion on the claims of negligence and breach of contract, but denied the motion as to misrepresentation, mutual mistake of fact and commercial impracticability. The jury found that Carpenter was excused from his duty to repay the loans because of mutual mistake, commercial impracticability and misrepresentation. The jury also found that Carpenter proved his counterclaim of misrepresentation. The court, sitting without a jury for the purpose of considering equitable restitution, made decisions concerning the property to be returned to the State and the State's monetary obligation to Carpenter. Final judgment was entered in June 1992. The State appeals.
II. DISCUSSION
A. STANDARD OF REVIEW.
In reviewing a ruling on a motion for a directed verdict, this court determines "whether the evidence, when viewed in the light most favorable to the non-moving party, is such that reasonable [people] could not differ in their judgment." Holiday Inns of Am., Inc. v. Peck, 520 P.2d 87, 92 (Alaska 1974).
B. THERE WAS INSUFFICIENT EVIDENCE UPON WHICH A REASONABLE JURY COULD HAVE FOUND MUTUAL MISTAKE OF FACT.
Carpenter contends that both he and the State held an honest but mistaken belief that the land could be farmed. He argues that he was not consciously uncertain of the suitability of the land for agriculture. He further contends that the "disclaimer" clauses were "boilerplate" clauses in form contracts. In addition, Carpenter argues that the jury could have reasonably inferred that because the loans were given to develop the land, *1183 there was a mutual mistake on the part of both parties as to the suitability of the land for agriculture.
The State contends that the disclaimer clauses are unrebutted evidence of Carpenter's awareness of the possibility that the land might not be suitable for agriculture. Further, the disclaimers placed the risk of potential problems with the land on Carpenter. The State also argues that there was no showing that the character of the land was part of the "basic" assumption of the loan contracts. The State emphasizes that the record is devoid of any evidence that the loans were to be paid from Carpenter's agricultural earnings, "or that they were in any way linked to the success of Carpenter's farming efforts."
Under Alaska law,
[j]udicial relief from the provisions of a contract on the basis of mutual mistake is proper where there was a mistake of both parties at the time of contracting as to a basic assumption on which the contract was made; the mistake had a material effect on the agreed exchange of performances, and the party seeking relief did not bear the risk of the mistake.
Mat-Su/Blackard/Stephan & Sons v. State, 647 P.2d 1101, 1104 (Alaska 1982); Fowler v. City of Anchorage, 583 P.2d 817 (Alaska 1978). We agree with the State that the law distinguishes between mistakes concerning the nature of the subject matter of a contract and conscious uncertainty concerning that nature. John D. Calamari & Joseph M. Perillo, Contracts § 9-26, at 382 (3d ed. 1987). "Where there is conscious uncertainty there is an assumption of the risk that the resolution of the uncertainty may be unfavorable." Id.
The State correctly asserts that the detailed disclaimers of warranty as to the condition of the land demonstrate that Carpenter was consciously uncertain as to the character of the land. Furthermore, the State correctly contends that even if Carpenter was not consciously uncertain as to the character of the land, he failed to demonstrate that he did not contractually bear the risk of the mistake. See Mat-Su, 647 P.2d at 1101, 1104-05.
The disclaimers in the land sale contracts place the risk of the condition of the land on Carpenter. The contracts provide: "The Seller does not warrant by such classification that the land is suited for [agricultural] use, nor does the Seller make any warranty, express or implied, that the use by the Purchaser under such classification shall be profitable." In addition, a contractual provision provided that Carpenter had examined the description of the parcel, "had inspected the parcel, or had voluntarily declined to do so, and was satisfied with [its] description and condition." These provisions demonstrate that the risk of the condition of the land was allocated to Carpenter.
Although both parties may have intended that the land be developed for agricultural purposes, the disclaimers in the land sale contracts stand as unrebutted evidence that both parties were consciously uncertain of the suitability of the land for such a purpose. In addition, Carpenter contractually bore the risk of the condition of the land. The discharge of Carpenter's duty to pay the ARLF loans, based on mutual mistake, cannot stand. Therefore, we hold as a matter of law that the superior court should have granted the State's motion for a directed verdict as to the mutual mistake of fact claim.
C. THERE WAS INSUFFICIENT EVIDENCE UPON WHICH A REASONABLE JURY COULD HAVE FOUND COMMERCIAL IMPRACTICABILITY.
Carpenter argues that he never assumed the risk that his land would be unsuitable for agriculture. Carpenter argues that a basic assumption, both in buying the land and in borrowing money from the ARLF, was that the land could be developed as agricultural land. Therefore, when it became clear that the land was not suitable for agriculture, the purpose of the contracts was frustrated. Carpenter also claims that the impracticability of payment falls within the scope of commercial impracticability. Because farming his land was no longer a viable option, he contends that it was impracticable to pay off the ARLF loans.
*1184 The State argues that the only performance required of Carpenter was to repay the loans. The State claims that commercial impracticability looks to the nature of the performance required, not the financial resources of the debtor. Here, when the only duty to be performed was repayment of a loan, commercial impracticability is inapposite. Also, the State again argues that the disclaimers evidence that there was no mutual mistake that the land would be suitable for agriculture or that it would be profitable.
In order for Carpenter to be excused from performing under the loan contracts on the theory of commercial impracticability he must show that his "performance under [the contracts was] impracticable without his fault because of a fact of which he [had] no reason to know and the non-existence of which [was] a basic assumption on which the contract[s] [were] made." Restatement (Second) of Contracts § 266(1) (1981). We find that Carpenter fails to meet these requirements.
As discussed supra, the facts do not support Carpenter's contentions. The disclaimers in the land sale contracts disclaim any warranty as to the soil condition or profitability of the land purchased by Carpenter. The disclaimers make it clear that any problems in these areas were not unanticipated. Carpenter assumed the risk of the condition of the land that he purchased. Therefore, the feasibility of farming the land as well as the profitability resulting from the farming cannot be fairly categorized as a "basic assumptions" on which the contracts were made. Furthermore, the continuation of a party's financial solvency ordinarily is not a basic assumption on which contracts are made. See Restatement (Second) of Contracts § 261 cmt. a (1981). In addition, the condition of the land does not make repayment of the loans impracticable, only more difficult because farming the land has not been profitable. There was nothing in the loan contracts conditioning repayment on the profitability of the farming venture. Therefore, Carpenter's duty to pay on the ARLF loans was not discharged on the basis of commercial impracticability. We hold as a matter of law that the superior court should have granted the State's motion for a directed verdict as to the commercial impracticability claim.[1]
D. THERE WAS NO EVIDENCE UPON WHICH A REASONABLE JURY COULD HAVE FOUND MISREPRESENTATION.
Under Alaska law,
In order to avoid a contract on the ground of misrepresentation, a party must show four things: 1) that there was a misrepresentation, 2) which was fraudulent or material, 3) which induced the party to enter the contract, and 4) upon which the party was justified in relying.
Bering Straits Native Corp. v. Birklid, 739 P.2d 767, 768 (Alaska 1987).
Carpenter attempted to avoid his duty to repay the ARLF loans and also attempted to rescind the land sale contracts based upon the State's alleged misrepresentation of the nature of the land. Carpenter contends that despite the disclaimers in the land sale contracts, the jury could have reasonably found that the State Division of Agriculture, which oversees the "farm program and which, through its agent, [a loan examiner], advised [him] that there was money available to borrow through the ARLF, was holding out by *1185 implication that the land to be improved and developed was farmable land." He contends that the purpose of the State's loans to him was the development of his farm, consistent with the development plans incorporated in the land sale contracts.
Carpenter admits that the State's alleged representations that continuous working of the land would dry it out over a period of years were made only after he had signed the land sale contracts and borrowed through the notes sued upon.[2] Thus, these representations could not have induced him to enter the contracts. Further, his contention that he was justified in believing that the State would not sell land and make agricultural loans if the land was not suitable for agricultural development is without merit, considering the specific disclaimers in the land sale contracts.
Viewing the evidence and the reasonable inference therefrom in the light most favorable to Carpenter, we conclude that fair minded jurors could not differ as to whether the State misrepresented to Carpenter the suitability of the land for agriculture, thus inducing him to enter into the land sale contracts or to enter into the loan agreements. The superior court erred in not directing a verdict in the State's favor on this misrepresentation claim, since the evidence is insufficient to support it.
III. CONCLUSION
We conclude that a directed verdict in favor of the State should have been granted on all claims. The decision of the trial court is REVERSED, and the case REMANDED for entry of judgment consistent with this opinion.
NOTES
[1] Carpenter also appears to assert a defense based on commercial frustration. The Restatement (Second) of Contracts § 266(2) (1981), provides:
Where, at the time a contract is made, a party's principal purpose is substantially frustrated without his fault by a fact of which he has no reason to know and the non-existence of which is a basic assumption on which the contract is made, no duty of that party to render performance arises, unless the language or circumstances indicate the contrary.
For the same reasons discussed in our analysis regarding commercial impracticability, a defense of frustration cannot prevail. The disclaimers in the loan contracts are evidence that Carpenter was aware that his land potentially could be unsuitable for agriculture. See, e.g., Smelting, Refining & Mining Co. v. Wigger, 684 P.2d 850, 857 (Alaska 1984) ("[C]ommercial frustration is no defense if the event was foreseeable."); Restatement (Second) of Contracts § 265 cmt. a (1981) ("The frustration must be so severe that it is not fairly to be regarded as within the risks that [were] assumed under the contract.").
[2] Carpenter later in his brief contends that assurances of the agricultural potential of the land began immediately after the land sales contracts were signed. However, Carpenter does not give specific dates or names of the persons who allegedly gave these assurances.
|
---
abstract: 'We show how second-order Floquet engineering can be employed to realize systems in which many-body localization coexists with topological properties in a driven system. This allows one to implement and dynamically control a symmetry protected topologically ordered qubit even at high energies, overcoming the road block that the respective states cannot be prepared as ground states of nearest-neighbor Hamiltonians. Floquet engineering — the idea that a periodically driven non-equilibrium system can effectively emulate the physics of a different Hamiltonian — is exploited to approximate an effective three-body interaction among spins in one dimension, using time-dependent two-body interactions only. In the effective system emulated topology and disorder coexist which provides an intriguing inroad into the interplay of many-body localization, defying our standard understanding of thermodynamics, and topological phases of matter, which are of fundamental and technological importance. We demonstrate explicitly how combining Floquet engineering, topology and many-body localization allows one to harvest the advantages (time-dependent control, topological protection and reduction of heating, respectively) of each of these sub-fields while protecting them from their disadvantages (heating, static control parameters and strong disorder).'
author:
- 'K. S. C. Decker'
- 'C. Karrasch'
- 'J. Eisert'
- 'D. M. Kennes'
bibliography:
- 'references.bib'
title: 'Floquet engineering topological many-body localized systems'
---
In the long-standing quest for the practical realization of key quantum technologies such as quantum computing [@Roadmap], a key goal is to fight off decoherence and to manipulate quantum systems in a controlled way [@Ladd2010]. Several promising concepts have been proposed within the past decade and became central research fields in the study of quantum many-body phenomena: Topology provides an inherent geometric protection of quantum states at low energies. Many-body localization in disordered systems defies our standard understanding of thermodynamics [@mbl_basko; @mbl_huse; @mbl_exp1; @mbl_rmp] and can extend this protection to high energies [@topmbl_huse; @topmbl_hondhi]. Floquet engineering — the idea that a periodically-driven non-equilibrium system can effectively emulate the physics of a different Hamiltonian — allows one to realize ‘toy models’ in real-life systems and to establish stable real-time protocols to manipulate quantum states [@floquet1].
Most of the proposals on how topology, disorder, and Floquet-engineering can be exploited in the design of quantum devices [@PhysRevLett.116.250401; @PhysRevB.98.064203; @PhysRevB.98.174203; @PhysRevA.96.022306; @kuno2019manybodylocalization; @li2019classification; @PhysRevX.6.021013; @PhysRevLett.118.115301; @PhysRevX.6.041070; @PhysRevA.100.023622; @PhysRevLett.123.126401; @PhysRevB.99.205419], yet, either concentrate on one or two of these phenomena separately or use special models. Floquet-engineering has been suggested as a route to realizing effective topological systems [@Lindner2011; @Sentef2015a; @Hubener2017a; @Topp2018a; @Grushin2014; @Claassen2017a; @Kennes19], but those studies neglect two-body interactions and thus ignore that a generic driven system will heat up [@floquet_alessio]. Heating can be efficiently suppressed by many-body localization [@noheating1; @noheating2], but topological properties of a clean system are normally lost in the presence of strong disorder [@PhysRevLett.121.126803; @PhysRevB.98.134507; @orito2019].
![We combine insights from the subfields of Floquet engineering, many-body localization, and topology. By doing so we demonstrate how to harvest the full advantages promised by these fields — flexible control, suppression of heating, and topological protection — while removing their respective disadvantages. We explicitly illustrate this in Fig. \[fig:dis\] (topological protection), Fig. \[fig:heating\] (suppression of heating), and Fig. \[fig:control\] (control), which are schematically given as insets here.[]{data-label="fig:triangle"}](figure1.pdf){width="\linewidth"}
Recently, an artificial toy model exhibiting three-body interactions was identified in which topology and many-body localization co-exist instead of hampering with each other [@topmbldyn_bahri; @topmbldyn_yao; @firstpaper; @goihl2019]. Both phenomena conspire to provide topological protection of an edge spin degree of freedom even at high energies. Three body-interactions are, however, difficult to realize in a real-life Hamiltonian, but they can naturally arise in Floquet-engineered setups, as suggested in Ref. [@PhysRevLett.119.123601]. Here, we build on these ideas and extend them in four different directions: i) We show how the toy Hamiltonian of Refs. [@topmbldyn_bahri; @topmbldyn_yao] can be obtained by means of Floquet-engineering starting from a physical quantum spin model $t\mapsto H(t)$ with time-periodic two-body interactions. ii) We explicitly benchmark how well the effective, time-independent Floquet Hamiltonian $H^{\rm eff}$ describes the stroboscopic physics of $t\mapsto H(t)$. iii) We demonstrate to which extent heating is suppressed by many-body localization. (iv) We design a dynamical protocol which allows one to flip the edge spin on a short time scale.
In sum, Floquet-engineering, many-body localization (i.e., disorder), and topological protection are three pillars on which useful quantum applications can be built. The combination of these three ingredients elegantly counteracts all their individual shortcomings – if one removes only one of them, one can no longer fully harvest their strengths. We now illustrate this explicitly and demonstrate the co-existence of topology and many-body localization in a driven system, the avoidance of heating, and the topologically-protected dynamical control of quantum states. A brief summary is given in Fig. \[fig:triangle\].
*Model.* We consider a one-dimensional spin-$\frac{1}{2}$ Hamiltonian consisting of a time-periodic and a time-independent contribution, $
H(t)=H_1(t)+H_2.
$ The time-periodic part is given by $$\begin{aligned}
H_1(t) &= \sqrt{\omega}\sin(\omega t) \sum_{i=1}^{L/2} \alpha_i \sigma^z_{2i-1} \sigma^z_{2i}\label{eq:H1_t}\\
+
\sqrt{\omega}&\cos(\omega t+\phi_0) \sum_{i=1}^{(L-1)/2} \left( \beta_i \sigma^y_{2i} \sigma^z_{2i+1} + \gamma_i \sigma^z_{2i} \sigma^y_{2i+1} \right),\nonumber\end{aligned}$$ where $\omega$ denotes the driving frequency. The time-independent contribution reads $$\label{eq:H2}
H_2 = \sum_{i=1}^{L-1} V_{i} \sigma^{x}_{i} \sigma^{x}_{i+1} + \sum_{i=1}^{L} h_{i} \sigma^{x}_{i},$$ with $\sigma_i^{x,y,z}$ being the Pauli matrices. The prefactors $h_i,V_i,\alpha_i,\beta_i,\gamma_i$ can be chosen differently for each lattice site $i$, and we draw them from a random Gaussian distribution with a standard deviation of $\sigma_{h,V,\alpha,\beta,\gamma}$ in order to drive the system into a many-body localized phase. The above Hamiltonian is time periodic, $H(t+T)=H(t)$, with $T=2\pi/\omega$. In order to gain some understanding of what physics one should expect to be modeled by $t\mapsto H(t)$, one can exploit the fact that the stroboscopic dynamics (which neglects the micro-motion) can be described by an effective *time-independent* Hamiltonian $H^{\rm eff}$. In the high frequency limit $\omega\gg h_i,V_i,\alpha_i,\beta_i,\gamma_i$, this effective Hamiltonian can be obtained by virtue of a Magnus expansion [@magnus], see supplemental information for details. An expansion up to order $\mathcal{O}\left({1}/{\sqrt{\omega}}\right)$ yields $$\begin{aligned}
H^{\rm eff} &= \sum_{i=1}^{L-2} \lambda_{i} \sigma^z_i \sigma^x_{i+1} \sigma^z_{i+2} +\sum_{i=1}^{L-1} V_{i} \sigma^{x}_{i} \sigma^{x}_{i+1} + \sum_{i=1}^{L} h_{i} \sigma^{x}_{i} ,\label{eq:Heff}\end{aligned}$$ with coupling terms $$\label{eq:efflambda}
\lambda_{i,\textnormal{odd}} = \cos(\phi_0)\alpha_i \beta_{i} ,~~\lambda_{i,\textnormal{even}} =\cos(\phi_0) \gamma_i \alpha_{i+1}.$$ The second and third term in Eq. arise from a first order Magnus expansion (which amounts to a time average) of $H_2$ (the first order expansion of $H_1$ vanishes as the time-average is zero). The first term in Eq. , which is an effective three-spin interaction, arises from the second order Magnus expansion which involves a time-averaged commutator of $[H_1(t),H_1(t')]$, see Fig. \[fig:comm\] for a pictorial representation. All of the other commutators in the second order Magnus expansion as well as all higher-order terms scale away with ${1}/{\sqrt{\omega}}$ or faster. One should note that this procedure is general and can be used to engineer effective three body terms of a different desired form in the same way as illustrated here.
A benchmark of how well the Floquet-engineered physics of the time-dependent Hamiltonian given in Eqs. (\[eq:H1\_t\]) and (\[eq:H2\]) agrees with that of the effective time-independent Hamiltonian $H^{\rm eff}$ of Eq. (\[eq:Heff\]) is shown in Fig. \[fig:dis\] as well as in the supplemental information. We find perfect agreement in the large-frequency limit where the Magnus expansion is justified. We emphasize that the results in this work are obtained using the full time-dependent Hamiltonian and the effective Hamiltonian $H^{\rm eff}$ only facilitates the physical interpretation.
*Results.* The beauty of the effective Hamiltonian in Eq. (\[eq:Heff\]) is that it can host a symmetry protected topological phase with protected gapless spin-$\frac{1}{2}$ edge excitations that can be used to define a qubit [@topmbldyn_bahri; @topmbldyn_yao]. In the presence of disorder, many-body localization inhibits ergodicity and prevents the system from thermalizing, thereby extending the topological protection to high energies. The downside of this highly-desirable behavior is that Eq. (\[eq:Heff\]) contains three-body interactions that are generally not available. It is key to the understanding of the significance of the present scheme to acknowledge that no nearest neighbor Hamiltonian $H = \sum_i (A_i B_{i+1}+ \text{h.c.}) $ can give rise to the ground state of $H^{\rm eff}$ [@Nielsen]. The Floquet approach presented here hence overcomes a road block against preparing such states of matter, as native three-body interactions of this type are generally not available. Cluster states as ground states of $H^{\rm eff}$ can be approximated by nearest-neighbor Hamiltonians [@PhysRevA.74.040302] using Hamiltonian gadgets, but they require strong interactions and high levels of control.
Floquet engineering overcomes this hurdle [@PhysRevLett.119.123601] and moreover provides a natural way to dynamically control the edge qubit. Normally, a periodically-driven system would heat up and eventually approach an infinite-temperature state. In our case, however, many-body localization suppresses heating. In a nutshell, the combination of Floquet engineering, topology, and many-body localization can be utilized to level disadvantages, while harvesting the full advantages of the respective subfields. This allows one to implement and dynamically control a spin-$\frac{1}{2}$ qubit at high energies. We illustrate the three different aspects — disorder, heating, and control — separately in the following sections (see Fig. \[fig:triangle\] for a schematic summary).
![*Topological protection at high energies.* Time evolution of the edge spin $\langle L_z\rangle$ governed by Eqs. (\[eq:H1\_t\]) and (\[eq:H2\]) for different system sizes and a driving frequency of $\omega = 1000$. As the system size increases, the life time of the spin becomes exponentially large (inset) due to the protection by topology and many-body localization even at high energies. The deviation from $\langle L_z\rangle=1$ is due to the fact that this operator has a finite overlap (but is not identical) to the topologically-protected gapless edge mode. We choose $\phi_0=0$, disorder strengths $\sigma_{\alpha,\beta,\gamma}= 1.0$, $\sigma_V = 0.1$, $\sigma_h=0.05$, and average over $1000$ random configurations. For $L=8$, we show data obtained using the effective time-independent Hamiltonian of Eq. (\[eq:Heff\]) for comparison. []{data-label="fig:dis"}](figure3.pdf){width="\linewidth"}
*Topological protection.* The time-dependent Hamiltonian in Eqs. (\[eq:H1\_t\]) and (\[eq:H2\]) hosts a topological phase at high energies since the system is barred from thermalization by many-body localization. One can illustrate this explicitly by demonstrating that the gapless spin-$\frac{1}{2}$ edge mode has an infinitely long life. To this end, we prepare the system in a product state in which all the spins are initially pointing along the positive $z$-direction. The driving frequency is chosen as $\omega=1000$. We calculate the time evolution of the expectation value of the boundary spin $\langle L_z\rangle =\left\langle\sigma_1^z\right\rangle$ using the full $t\mapsto H(t)$ in Eqs. (\[eq:H1\_t\]) and (\[eq:H2\]). The operator $L_z$ has a finite overlap with the exact topologically-protected gapless spin-$\frac{1}{2}$ edge mode at the left boundary. The results are summarized in Fig. \[fig:dis\]. As the system becomes larger, topological protection becomes increasingly robust, and the life time of $\langle L_z\rangle$ becomes exponentially large. We emphasize that the spins $\langle \sigma^z_i\rangle$ away from the edge decay fast for arbitrary $L$ since they do not have a finite overlap with a topologically-protected mode (data not shown). In a nutshell, Fig. \[fig:dis\] illustrates that topology and many-body localization team up so that information can be stored robustly at the edge of a driven system at high energies.
![*Suppression of heating.* Time evolution of the excess energy pumped into the system by the periodic drive. The energy saturates quickly, and the system does not approach an infinite-temperature state. This suppression of heating is due to many body localization and detuning from single-particle resonances. We choose $L=10$, $\phi_0=0$, $\sigma_{\alpha,\beta,\gamma}=1.0$, $\sigma_V=0.1$, $\sigma_h=0.05$ and average over $1000$ random configurations. Note that the scaling of the linear time axis changes at $t=100$.[]{data-label="fig:heating"}](figure4.pdf){width="\linewidth"}
*Heating.* An interacting, periodically-driven quantum system is generically expected to heat up over time [@floquet_alessio]. This would be detrimental to our aim of storing information in the topologically-protected edge states, as the system would heat up to infinite temperature, an equal superposition of all many-body states with no memory of the initial state. However, many-body localization bars the system from thermalizing [@mbl_huse; @mbl_rmp] and is thus expected to push the effects of heating to exponentially large times [@noheating1; @noheating2]. This is less obvious than it may seem, as many-body localized systems still allow for quantum information propagation [@Local], a feature that is reflected by a logarithmic entanglement growth in time following global quenches [@Prosen_localisation; @Pollmann_unbounded]. At the same time, an emergent picture of $L$ quasi-local constants $C_j$, $j=1,\dots, L$, of motion emerges for $H^{\rm eff}$ that approximately commute with each other and with $H^{\rm eff}$.
Detuning away from single particle resonances by going to high frequencies has a similar effect. Therefore, a system like ours is doubly protected from heating by employing both mechanisms: many-body localization and detuning. This is illustrated in Fig. \[fig:heating\], where we monitor the time evolution of the energy pumped into the system by the periodic drive in $t\mapsto H(t)$. We initially prepare the system in the ground state of the effective Hamiltonian in Eq. of the corresponding Magnus expansion. The energy initially increases as the drive produces excess energy, which, if redistributed thermally, would translate to heating. As we approach the high-frequency limit and Floquet-engineer the many-body localized Hamiltonian in Eq. , excess heat production ceases and the system remains close to its ground state for arbitrary large times. This demonstrates that many-body localization and Floquet engineering conspire to efficiently suppress heating, which would be detrimental to storing information.
![*Dynamical control.* The edge spin can be flipped on a short time scale $T_1 \le t \le T_2$, $T_2-T_1\sim 1$ by applying a constant magnetic field $B_x$ as well as a brief $\pi/2$ phase shift to the drive (lower panel). Before ($t<T_1$) and after ($t>T_2$), the spin is stable on exponentially-long time scales (upper panel). We choose $L=10$, a driving frequency of $\omega=1000$, and disorder strengths $\sigma_{\alpha,\beta,\gamma}=1.0$, $\sigma_V=0.1$, $\sigma_h=0.05$. Disorder averages are performed over $1265$ random configurations.[]{data-label="fig:control"}](figure5.pdf){width="\linewidth"}
*Control.* Finally, we demonstrate how to dynamically control the Floquet-engineered system. Our aim is to manipulate the edge spin on a short time scale by changing the parameters of the drive. To this end, we introduce a time-dependent phase $t\mapsto \phi(t)$ replacing $\phi_0$ in Eq. , which in general breaks the time-periodicity. However, in either the case of (i) a slowly varying $\phi$, or (ii) a piece-wise constant phase $\phi$, the above arguments still hold within each time-interval in which $\phi$ is (approximately) constant. Changing the phase of the drive allows us to effectively control the system as the phase governs the magnitude of the couplings $\lambda_i$ in the effective Hamiltonian Eq. via Eq. (\[eq:efflambda\]).
We will now concentrate on the following, particularly instructive, example $$\phi(t)=\begin{cases}0 & t <T_1 \;\;\;\; {\rm{or}} \;\;\;\; t>T_2,\\
\pi/2 &T_1\leq t \leq T_2.
\end{cases}$$ We aim at rotating the spin and thus for times $T_1\leq t\leq T_2$ add a constant field along the $x$-direction, $H_2\mapsto H_2+B_x \sum \sigma_x$. The effective (now piece-wise time-dependent) Hamiltonian from a second order Magnus expansion reads $$\begin{aligned}
H^{\rm eff}(t) =& \sum_{i=1}^{L-2} \lambda_{i}(t) \sigma^z_i \sigma^x_{i+1} \sigma^z_{i+2}+\sum_{i=1}^{L-1} V_{i} \sigma^{x}_{i} \sigma^{x}_{i+1}\notag\\&+ \sum_{i=1}^{L}\left(B_x(t)+ h_{i}\right) \sigma^{x}_{i} ,\label{eq:Heff_t}\end{aligned}$$ where $$\lambda_\text{i,odd\;(even)}(t)=\begin{cases} \alpha_i \beta_{i}\; (\gamma_i \alpha_{i+1}) & t <T_1 ~{\rm{or}}~ t>T_2\\
0& T_1\leq t \leq T_2.
\end{cases}$$ and $B_x(t)=B_x$ for $T_1 \leq t \leq T_2$.
In Fig. \[fig:control\], we present results for the time evolution of the edge spin $\langle L_z\rangle$ for different switching times $T_2-T_1\sim 1$, $B_x=1.0$, and a driving frequency of $\omega=1000$ (disorder parameters are given in the caption). We again stress that the time-evolution is calculated using the full time-dependent Hamiltonian $t\mapsto H(t)$ and that its high-frequency counterpart, the effective Hamiltonian $H^{\rm eff}$, only facilitates the interpretation of the results. For times $t<T_1$, the edge state is protected by topology, and its information (i.e., being in the up-state) can be stored for exponentially long times. At $t=T_1$, the phase of the driven Hamiltonian is switched from $\phi_0=0$ to $\pi/2$, and a magnetic field is applied. The magnetic field flips the direction of the spin. At time $t=T_2$, both the phase and the magnetic field are switched back off, $\phi_0=B_x=0$. The new state (where the edge spin now points down) can again be stored for exponentially long times as the topological properties are restored. This exemplifies how the versatility inherent to Floquet engineering can be utilized to dynamically control and manipulate the information in the topologically-protected edge states.
*Conclusion.* We have demonstrated how quantum states can be dynamically manipulated in a stable way in a periodically-driven, realistic spin system. Starting from a simple spin model with two-body interactions, Floquet-engineering allows one to design a toy Hamiltonian in which topology and disorder conspire to protect (qubit) spin states even away from low energies. We explicitly demonstrated how heating is suppressed efficiently and investigated how well the toy Hamiltonian approximates the dynamics governed by the original one. This provides a fascinating new route to implementing and controlling stable qubits even at high temperatures.
*Acknowledgments.* This work has been supported by the Deutsche Forschungsgemeinschaft through the CRC 183 (Project A01) and through the Emmy Noether program (KA 3360/2-2). Gefördert durch die Deutsche Forschungsgemeinschaft (DFG) im Rahmen der Exzellenzstrategie des Bundes und der Länder - Exzellenzcluster Materie und Licht für Quanteninformation (ML4Q) EXC 2004/1 - 390534769. Funded by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) under Germany’s Excellence Strategy - Cluster of Excellence Matter and Light for Quantum Computing (ML4Q) EXC 2004/1 - 390534769.
Supplemental material {#supplemental-material .unnumbered}
=====================
*Magnus expansion.* Solving the time-dependent Schrödinger equation for a time-independent system described by the Hamiltonian $H$ yields the well-known time-evolution operator $U(0,t) = e^{-iH t}$. If the system is time-dependent, the time-evolution operator can be expressed as $$U(0,t) = e^{\Omega(t)} = \exp{\sum_{k}^{\infty} \Omega_{k}(t)},$$ where $t\mapsto \Omega(t)$ is a series known as the Magnus expansion. The first three terms in the Magnus expansion are given by $$\begin{aligned}
\Omega_{1}(t) &= \int_{0}^{t} \dd{t_1} A(t_1),\nonumber\\
\Omega_{2}(t) &= \frac{1}{2} \int_{0}^{t} \dd{t_1} \int_{0}^{t_1} \dd{t_2} [A(t_1),A(t_2)],\nonumber\\
\Omega_{3}(t) &= \frac{1}{6} \int_{0}^{t} \dd{t_1} \int_{0}^{t_1} \dd{t_2} \int_{0}^{t_2} \dd{t_3}\nonumber\\ [A(&t_1),[A(t_2),A(t_3)]] + [A(t_3),[A(t_2),A(t_1)]],\end{aligned}$$ with $A(t)=-iH(t)$. If the Hamiltonian is time-independent, all Magnus terms but the first vanish.
The time-periodic Hamiltonian of Eqs. (\[eq:H1\_t\]) and (\[eq:H2\]) is now plugged into this expansion, and one focuses on times $t$ which are an integer multiple of the driving period $T=2\pi/\omega$. The first-order term involving $H_1$ vanishes (since the time-average is zero), and the one involving $H_2$ yields the second and third term of Eq. (\[eq:Heff\]). The second-order contribution associated with $[H_1(t_1),H_1(t_2)]$ yields the first term of Eq. (\[eq:Heff\]). The second-order contribution involving $[H_1(t_1),H_2(t_2)]$ as well as all higher-order terms scale away with $1/\sqrt{\omega}$ or faster.
![Top: Put the three different $\omega$ you have instead and only show one (converged) $\Delta t$.... Bottom:... Of course the style needs reformatting.[]{data-label="fig:bench"}](FQS_different_Delta_t_L4_omega100.pdf "fig:"){width="\linewidth"} ![Top: Put the three different $\omega$ you have instead and only show one (converged) $\Delta t$.... Bottom:... Of course the style needs reformatting.[]{data-label="fig:bench"}](FQS_disorder_sim_per_omega_sV0_1_sh0_05.pdf "fig:"){width="\linewidth"}
A benchmark of how well the time-evolution computed using the effective Hamiltonian $H^{\rm eff}$ agrees with the one governed by the full $t\mapsto H(t)$ is shown in Fig. \[fig:dis\], Fig. \[fig:bench\], and Fig. \[fig:bench2\].
![Same as Fig. \[fig:dis\] of the main text but for more values of the system size $L$. The driving frequency is $\omega=1000$.[]{data-label="fig:bench"}](figure6.pdf){width="\linewidth"}
*Numerical details.* In order to tackle the time-evolution governed by $t\mapsto H(t)$, we first compute the time-evolution operator $U(0,t)$ for $t=T=2\pi/\omega$ numerically using a discrete time step of $\Delta t = T/100$. The periodicity of the Hamiltonian implies that $U(t_1,t_2)=U(t_1+T,t_2+T)$ and thus $U(0,2T)=U(0,T)^2$, $U(0,4T)=U(0,2T)^2$, which allows one to efficiently propagate the system to large times $t/T\sim 10^7$.
![Same as Fig. \[fig:dis\] of the main text but for various driving frequencies $\omega$ at a fixed system size $L=8$.[]{data-label="fig:bench2"}](figure7.pdf){width="\linewidth"}
![Heating: energy with respect to the effective Hamiltonian $H^{\rm eff}$ for one $\lambda$ disorder configuration, $L=10$, $\sigma_V=0.1$, $\sigma_h=0.05$, $\sigma_a=\sigma_b=\sigma_c=1.0$, $1000$ repeats.[]{data-label="fig:heating_supp1"}](FQS_paper_figure2_Energy_org.pdf){width="\linewidth"}
![Heating: Energy with respect to the effective Hamiltonian $H^{\rm eff}$ for one $\lambda$ disorder configuration, $L=10$, $\sigma_V=0.1$, $\sigma_h=0.05$, $\sigma_a=\sigma_b=\sigma_c=1.0$, $1000$ repeats.[]{data-label="fig:heating_supp2"}](FQS_paper_figure2_Energy_org_2.pdf){width="\linewidth"}
|
Open House from Sunday, April 14, 2013 to Sunday, April 14, 2013 02:00 PM - 04:00 PM
Over 2000 sq ft!
***JUST RENOVATED *** Massive half-duplex (nearly 2000 sq ft + garage) - almost the size of a house but for a much lower price! Perfect for a growing family!
4 bedrooms/ 3 baths on two floors! Features include a panorama view of the pond and hiking trails behind from the rear deck and patio; a large kitchen with eating nook and dining room; a large rec room with kitchenette, a sizeable laundry room with extra space for storage; two hot water tanks; built in vacuum; and 2nd deck at front of home. Potential in-law accommodation down. Fully fenced yard.
Shows like new!
Located on a quiet kid-friendly cul-de-sac and within easy walking distance to Uplands Elementary School and Nanaimo North Town Centre (Sears, Target, London Drugs, Fairway Market). Lots of parks, playgrounds, and walking trails nearby. |
Q:
Which type sizes can I use for specific semantics
Microsoft provides a list explaining the input and output semantics of vertex and pixel shaders. By now I've seen some code examples that don't use the documented data types. They are using float3 as input COLOR to the pixel shader or float2 as input POSITION to the vertex shader. Even though a 2-component position or a 3-component color do make sense to me, I can't find this documented, which makes me wonder
Can I use float3 as vertex shader input POSITION (if I know I won't be using the W component) without expecting errors?
If I can use data types other than the documented ones, is there a list available that shows every allowed data type for a semantic or a rule like "As long as the used data type is smaller or equally sized as the documented one, you can use it"?
Code examples not following the documentation:
StackOverflow - Passing colors through a pixel shader in HLSL
C++ / DirectX11 Tutorials - S02E05 - Creating and loading Shaders at 9:33
A:
In shader model 4.0 and later (DX10+), the only semantic names that matter are system-value semantics (those prefixed by SV_). Other semantics have no special treatment aside from being used to match shader parameters to their inputs. The documentation regarding semantics such as COLOR being float4 is purely convention, or legacy from DX9. In DX10/SM4+, there's nothing stopping you from declaring COLOR as a float2, or deciding to use UNICORN as the semantic name for your colors, though don't be surprised if this confuses other developers (or yourself) reviewing the code in the future.
To answer your specific question, yes you can use any data type you want for non-SV_ semantics, or even invent your own names. Just make sure you use consistent naming and channel counts between stages and input layout declaration.
|
Q:
What is O(1) space complexity?
I am having a hard time understanding what is O(1) space complexity. I understand that it means that the space required by the algorithm does not grow with the input or the size of the data on which we are using the algorithm. But what does it exactly mean?
If we use an algorithm on a linked list say 1->2->3->4, to traverse the list to reach "3" we declare a temporary pointer. And traverse the list until we reach 3. Does this mean we still have O(1) extra space? Or does it mean something completely different. I am sorry if this does not make sense at all. I am a bit confused.
A:
To answer your question, if you have a traversal algorithm for traversing the list which allocate a single pointer to do so, the traversal algorithms is considered to be of O(1) space complexity. Additionally, let's say that traversal algorithm needs not 1 but 1000 pointers, the space complexity is still considered to be O(1).
However, if let's say for some reason the algorithm needs to allocate 'N' pointers when traversing a list of size N, i.e., it needs to allocate 3 pointers for traversing a list of 3 elements, 10 pointers for a list of 10 elements, 1000 pointers for a list of 1000 elements and so on, then the algorithm is considered to have a space complexity of O(N). This is true even when 'N' is very small, eg., N=1.
To summarise the two examples above, O(1) denotes constant space use: the algorithm allocates the same number of pointers irrespective to the list size. In contrast, O(N) denotes linear space use: the algorithm space use grows together with respect to the input size.
|
Justice Stevens and the Korematsu era
Posted Mon, May 24th, 2010 12:43 pm by Anna Christensen
The following essay was written by Craig Green, an Associate Professor of Law at Temple University Beasley School of Law. His areas of expertise include wartime detention, equal protection, the federal sentencing guidelines, customary international law, and Erie, and he has also worked in the Solicitor General’s Office as a Bristow Fellow. His current research is entitled “Ending the Korematsu Era: A Modern Approach.”
There is no substitute for experience, and John Paul Stevens’ career presents an awful lot of it. During his thirty-five years as a justice, many cases have drawn the Court to consider recurrent constitutional questions such as federalism, privacy, race, sex, criminal procedure, and free speech. Such long precedential arcs are fascinating in their own right, and Justice Stevens has made contributions in almost every field imaginable. Yet other long-lived justices have accrued comparably large banks of experience, and so may current or future members of the Court "” if they remain fortunate and healthy.
By contrast, cases about wartime detention and military commissions appear only sporadically and in tight clusters. National conflicts with broad claims of presidential war power typically arise just once in a legal lifetime. But not for Stevens, and in this regard he is truly unique. Stevens entered law school and clerked in the 1940s during what could be called the “Korematsu era,” and his long judicial career was capped by twenty-first-century cases about the War on Terror. Many aspects of Stevens’ career deserve careful remembrance, but none more so than this.
In the years in and around World War II, presidents won many famous cases about war powers, as the Court upheld slipshod military commissions, enforced racist “curfew” and “evacuation” orders, and denied habeas jurisdiction altogether for extraterritorial aliens. For some observers, such judicial acquiescence came as no surprise. By 1943, Roosevelt had picked eight of the nine sitting justices, the country was shocked and angered by Pearl Harbor, and the Court had to rely (as always) on the President himself for information about the military’s needs in keeping our country safe.
Fast forward to September 2001. Seven of nine justices were chosen by Republican Presidents, and five voted to approve President Bush’s own election in 2000. The World Trade Center attacks had stunned and horrified the country. And many details about our War on Terror seemed unknowable to outside observers such as the public and the courts.
In November 2001, President Bush authorized the creation of military commissions to try unlawful enemy combatants in this new conflict, and the military crafted special procedures for those trials. In January 2002, the United States began detaining lawful enemy combatants without trials or charges at Guantanamo Bay, where the government argued that federal courts lacked jurisdiction to even consider claims of illegality and abuse.
Consistent with Korematsu-era cases, judicial review of these presidential actions could have been quick and easy. Congress had authorized the use of military force, triggering the President’s war powers; and the President claimed that his policies of military commissions and unreviewable detention were vital to national security. Because the Court lacks expertise in any kind of warmaking, much less antiterrorism, executive lawyers might have anticipated a series of solid victories. Instead, Justice Stevens helped lead the Court to issue an unmatched string of presidential defeats.
Two obvious questions about these recent cases are how exactly they came to be, and whether they have limited presidential power too little or too much. At this moment of Stevens’ retirement, we cannot know for sure. What is clear is that today’s Court has chosen a different path from the Court of Stevens’ youth. Not only has the modern Court expressed greater commitments to the rule of law and procedural fairness, but "“ equally important "“ the modern Court has also shown extraordinary patience for slow constitutional decisionmaking.
Contrast the World War II precedents. In Hirabayashi, the Court unanimously upheld a racist military curfew one year after it took effect. This was the first term of Justice Wiley Rutledge, for whom Stevens later clerked. In Hirabayashi,the government’s policy rested on remarkably scant information, which the Court accepted as reasonable even though it was embarrassingly false. One year later, the government in Korematsu made exactly the same legal and factual arguments to support a racist “evacuation plan,” which the Court also upheld. Notably, however, the government lost three dissenting votes in the twelve months from Hirabayashi to Korematsu, and the conference vote was just five to four "” with Rutledge as the government’s fifth and decisive vote.
If Hirbayashi and Korematsu had been decided a year or two later, would the government’s implausible racial arguments have been exposed by that passage of time, with corresponding damage to presidential credibility? Our modern cases give reason to wonder. In 2004, Justice Stevens’ majority opinion in Rasul extended statutory habeas jurisdiction to Guantanamo detainees, but explicitly avoided deciding what constitutional rights might apply to such prisoners. In 2006, Stevens likewise wrote a narrow opinion in Hamdan, invalidating certain procedures for military commissions without exploring constitutional limits on such tribunals. Even Boumediene in 2008 (in which Stevens assigned the majority to Justice Kennedy) held that Guantanamo prisoners were protected by the Constitution’s Suspension Clause. But the Court did not decide whether such detainees had other constitutional rights, much less whether constitutional protections extend to extraterritorial detainees held in Iraq, Afghanistan, or elsewhere.
Nearly a decade has passed since the attacks of 2001, and it’s been a long several years for detainees who even today can only speculate about their legal rights. On the other hand, the modern Court’s series of narrow rulings has prevented the hasty overreactions that characterized the Korematsu era. Indeed, recent events might recall Justice Jackson’s dissent in Korematsu "” especially for those who witnessed such history first hand. Jackson could not quite bring himself to recant his year-old pro-government vote in Hirabayashi, but he did refer to such judicial decisions as “[lying] about like a loaded weapon ready for the hand of any authority that can bring forward a plausible claim of an urgent need.” And instead of trying to distinguish Hirabayashi from Korematsu on some legal or factual ground, Jackson remarked with vivid simplicity: “I think we should learn something from that experience.”
With opinions of Stevens and his colleagues as landmarks, perhaps the Korematsu era’s main lesson was not to trust Presidents quite so much, or so quickly. Certainly the modern Court’s mild and tentative approach to war powers has made life harder for Presidents Bush and Obama, and more especially for the government lawyers who give advice in such dynamic terrain. Yet by eschewing a stance of blind acquiescence "” which might indeed have risked “another Korematsu” with different facts "” Stevens and his colleagues have created time for the slow process of public debate and entrepreneurial politics to run its course. Perhaps this is what Stevens learned from the experiences of Rutledge, Jackson, and the Korematsu era more generally. And we may hope that Stevens’ successor, the legal community, and future generations may likewise learn that lesson well and quickly before the next crisis comes, whenever that might be.
Merits Case Pages and Archives
The court issued additional orders from the December 2 conference on Monday. The court did not grant any new cases or call for the views of the solicitor general in any cases. On Tuesday, the court released its opinions in three cases. The court also heard oral arguments on Monday, Tuesday and Wednesday. The calendar for the December sitting is available on the court's website. On Friday the justices will meet for their December 9 conference; our list of "petitions to watch" for that conference is available here.
Major Cases
Gloucester County School Board v. G.G.(1) Whether courts should extend deference to an unpublished agency letter that, among other things, does not carry the force of law and was adopted in the context of the very dispute in which deference is sought; and (2) whether, with or without deference to the agency, the Department of Education's specific interpretation of Title IX and 34 C.F.R. § 106.33, which provides that a funding recipient providing sex-separated facilities must “generally treat transgender students consistent with their gender identity,” should be given effect.
Bank of America Corp. v. City of Miami(1) Whether, by limiting suit to “aggrieved person[s],” Congress required that a Fair Housing Act plaintiff plead more than just Article III injury-in-fact; and (2) whether proximate cause requires more than just the possibility that a defendant could have foreseen that the remote plaintiff might ultimately lose money through some theoretical chain of contingencies.
Moore v. Texas(1) Whether it violates the Eighth Amendment and this Court’s decisions in Hall v. Florida and Atkins v. Virginia to prohibit the use of current medical standards on intellectual disability, and require the use of outdated medical standards, in determining whether an individual may be executed.
Pena-Rodriguez v. ColoradoWhether a no-impeachment rule constitutionally may bar evidence of racial bias offered to prove a violation of the Sixth Amendment right to an impartial jury.
Conference of December 9, 2016
FTS USA, LLC v. Monroe (1) Whether the Fair Labor Standards Act and the Due Process Clause permit a collective action to be certified and tried to verdict based on testimony from a small subset of the putative plaintiffs, without either any statistical or other similarly reliable showing that the experiences of those who testified are typical and can reliably be extrapolated to the entire class, or a jury finding that the testifying witnesses are representative of the absent plaintiffs; and (2) whether the procedure for determining damages upheld by the Sixth Circuit, in which the district court unilaterally determined damages without any jury finding, violates the Seventh Amendment.
Overton v. United States Whether, consistent with this Court's Brady v. Maryland jurisprudence, a court may require a defendant to demonstrate that suppressed evidence “would have led the jury to doubt virtually everything” about the government's case in order to establish that the evidence is material.
Turner v. United States (1) Whether, under Brady v. Maryland, courts may consider information that arises after trial in determining the materiality of suppressed evidence; and (2) whether, in a case where no physical evidence inculpated petitioners, the prosecution's suppression of information that included the identification of a plausible alternative perpetrator violated petitioners' due process rights under Brady. |
Q:
Android geopoint from location/locality
I have seen numerous examples of getting location name from Geocoder and then get addresses by getFromLocation() but how can I get geoPoint for a location by name. User enters a city name and I turn them into a geopoint and show on map. Is there a way in Android or google API's.
I dont mean current location but any location by giving its name. Basically I want it to allow user to get weather update for remote cities.I am able to do so for current location by getting current locality.
A:
Try this, you'd better run it in a separately thread rather than UI-thread. You can both get Address and GeoPoint by this method.
public static Address searchLocationByName(Context context, String locationName){
Geocoder geoCoder = new Geocoder(context, Locale.getDefault());
GeoPoint gp = null;
Address ad = null;
try {
List<Address> addresses = geoCoder.getFromLocationName(locationName, 1);
for(Address address : addresses){
gp = new GeoPoint((int)(address.getLatitude() * 1E6), (int)(address.getLongitude() * 1E6));
address.getAddressLine(1);
ad = address;
}
} catch (IOException e) {
e.printStackTrace();
}
return ad;
}
A:
use the below url to get lat and long from the address through reverse geo coding::
http://maps.googleapis.com/maps/api/geocode/json?address=hyderabad&sensor=false
or
http://maps.googleapis.com/maps/api/geocode/xml?address=hyderabad&sensor=true
|
python calculate_trecvid_ap.py --overlap 0.5 --gt trecvid_7.val --answer "trecvid_7_test_res101.frcnn;trecvid_7_test_vgg16.frcnn;trecvid_7_test_googlenet_v1.frcnn" | tee -a ap.log
|
PHILADELPHIA -- Animal welfare officers removed 260 cats Wednesday from two connected row houses where an elderly lady had been trying to care for them in increasingly overwhelming circumstances, CBS Philadelphia reported.
The Pennsylvania Society for the Prevention of Cruelty to animals said its officers executed a warrant to remove scores of felines from unsanitary confinement at the home in Philadelphia's Frankford neighborhood.
The agency said he elderly woman who lived there was trying to provide a shelter but things spiraled out of control. At one point, she had as many as 300 cats, but did recently surrender about 30 animals, according to the PSPCA, which had been working with the woman over the past few weeks.
Get Breaking News Delivered to Your Inbox
A sign is posted on fence at the location of where members of the Pennsylvania Society for the Prevention of Cruelty to Animals removed cats from two connected row homes Wednesday, March 26, 2014, in Philadelphia. Matt Rourke, AP
Destiny
Perez, a local resident with a 14-month-old daughter, said she worried about the cats.
"My daughter has been scratched twice. They like to bite and rub all over you. Some of them would sneak in the (adjacent) houses," she said.
Sarah Eramus of the PSPCA called it a "sad" situation.
"You can see our officers have masks on and respirators so they can spend time in there. So you can imagine what it is like for the cats," she said.
The animals were being transported to the PSPCA's Erie Avenue headquarters for veterinary exams, treatment and shelter.
The PSPCA said it had created a temporary cat shelter onsite to help cope with the influx of felines.
"This is a sad situation involving a woman who wanted to help animals, but got in over her head and couldn't provide the care this number of cats requires," said CEO Jerry Buckley in a release. "We're doing everything we can to ensure the wellbeing of these cats."
CBS Philadelphia said Internal Revenue Service and city records showed that a nonprofit rescue shelter called Animals In Crisis operated inside the home, two row houses that were connected when part of the center interior wall was removed.
The PSPCA said the resident was licensed to operate a rescue shelter.
The woman has not been charged, but an investigation is ongoing. |
Man arrested after robbery
Portage police arrested a 35-year-old Three Rivers man last week after he was suspected of committing an armed robbery in Kalamazoo.
The robbery occurred around 10:25 a.m. Friday at the Rite Aid drug store on East Cork Street. A witness was able to get a good look at the suspect and his vehicle, which proved to be helpful, as the man’s car was spotted driving south on U.S. 131 in Portage.
The man was stopped and arrested without incident. Police said a weapon and evidence from the robbery were found inside the vehicle. The suspect’s name was not released until his arraignment takes place in Kalamazoo County. |
Peso tumbles on news of Britain’s planned exit from EU
Mexico’s currency has the unenviable role of serving as the bellwether for volatility in the world’s emerging markets. And Great Britain’s vote to exit the European Union is sending it for a tumble.
On Friday June 24, the Mexican peso sank to its weakest level ever against the US dollar, 19.52, on news of the UK vote Thursday night, reports the Wall Street Journal. It was its biggest daily loss in nearly five years, following a five-day rally based on expectations that UK voters would opt to remain in the EU. By Friday afternoon, the currency had recovered to 18.91against the US dollar.
The Mexican government responded to the turmoil on Friday (June 24) by announcing it would shave $1.7 billion off federal government spending. The central bank also said it was ready to intervene in the exchange markets if it saw speculators had singled out the country’s currency.
(IMAGE: zocalo.com.mx)
International traders have adopted the heavily-traded currency as aproxy for hedging risk among developing and middle-income countries (a strategy some are also employing for a possible Trump presidency). In the run-up to the Brexit referendum, the currency’s market volatility grew more in step with the British pound, suggesting speculators were using it hedge down-side risk of the UK’s departure from the European Union, reports Bloomberg. The 120-day correlation between the pound and peso has doubled since the beginning of the year.
Mexico’s currency is now the second-worst performer against the dollar this year among the 24 emerging market currencies Bloomberg tracks(Argentina being the worst). Bank of Mexico’s deputy governor, Roberto del Cueto, said the body would assess the impact of Brexit on the markets before its next monetary policy meeting on June 30. “Markets often have an overreaction, and as time passes the different variables begin to settle, and exchange rates adjust,” he said on Friday. |
18. Uniform cost accounting in long-term care.
Uniform cost data are essential for managing health services, establishing billing and reimbursement rates, and measuring effectiveness and impact. Although it is especially difficult in the case of long-term health care to develop standard cost accounting procedures because of the varied configurations of inpatient, intermediate, and ambulatory services, the overall approaches to cost accounting and its content can be made more uniform. With this purpose in mind, a general model of cost accounting is presented for a multilevel program of long-term services, together with a special method for ambulatory services using "hours accounted for" as the basic measure. |
833 F.2d 267
56 USLW 2335
Joseph WHEELER, Clarice Wheeler, Cliff DevelopmentCorporation, and S & S Builders, Inc., etc.,Plaintiffs-Appellees, Cross-Appellants,v.CITY OF PLEASANT GROVE, etc., Defendant-Appellant, Cross-Appellee,Bobby Patrick, etc., et al., Defendants.
No. 86-7661.
United States Court of Appeals, Eleventh Circuit.
Dec. 1, 1987.
Thomas N. Crawford, Jr., Cooper, Mitch & Crawford, Birmingham, Ala., for City of Pleasant Grove, etc.
Donald H. Brockway, Jr., Corretti & Newsom, Birmingham, Ala., for Joseph Wheeler, Clarice Wheeler and Cliff Development Corp.
Appeals from the United States District Court for the Northern District of Alabama.
Before TJOFLAT and ANDERSON, Circuit Judges, and HENDERSON, Senior Circuit Judge.
TJOFLAT, Circuit Judge:
1
This appeal marks the third time this case has been before us. The present appeal is limited to the issue of whether the district court applied the correct measure of damages.
I.
2
In 1978, Cliff Development Corp. (Cliff Development) contracted with Joseph and Clarice Wheeler (the Wheelers) to buy a parcel of land in Pleasant Grove, Alabama for the sum of $160,000. Cliff Development planned to build a 120-unit apartment complex on the site. Pursuant to the contract, Cliff Development made a downpayment of $1,000 to the Wheelers. After finding that the proposed land use complied with applicable zoning ordinances, the Pleasant Grove Planning Commission issued a building permit. Cliff Development paid the city $6,165 for the permit and commenced work in preparation for construction.
3
Strong community opposition to the proposed development soon arose. Two mass public meetings were held, followed by a referendum in which a majority of the citizens of Pleasant Grove expressed opposition to construction of the apartments. In the wake of the referendum, the City Council in July 1978 passed Ordinance No. 216, which outlawed construction of apartment complexes in Pleasant Grove.
4
Cliff Development and the Wheelers brought suit in the district court against the City of Pleasant Grove and seven city officials, alleging violations of the fifth and fourteenth amendments.1 They sought damages as well as declaratory and injunctive relief.
5
In November 1979, sixteen months after the City Council passed Ordinance No. 216, the district court ruled that the ordinance was unconstitutional as applied to the plaintiffs. The court held that the ordinance had been enacted and implemented arbitrarily and capriciously, was confiscatory in nature, and bore no substantial relationship to any legitimate police power interest. The court permanently enjoined the defendants from enforcing the ordinance against the plaintiffs, but it refused to grant the plaintiffs' request for monetary relief. The court based its refusal to award damages on its determination that all the defendants were shielded by a qualified immunity defense.
6
On appeal, a panel of the former Fifth Circuit held that Ordinance No. 216 had no rational purpose and affirmed the district court's ruling that the application of the ordinance to the plaintiffs was unconstitutional. The court of appeals reversed the district court's ruling on damages, however, holding that the good faith defense was not available to municipalities in section 1983 actions. Wheeler v. City of Pleasant Grove, 664 F.2d 99 (5th Cir. Unit B Dec. 1981), cert. denied, 456 U.S. 973, 102 S.Ct. 2236, 72 L.Ed.2d 847 (1982) (hereinafter Wheeler I ). The court of appeals remanded the case for a determination of damages.
7
On remand, the district court again refused to award any damages. This time, it concluded that the implementation of Ordinance No. 216 had not proximately caused any compensable injury to the plaintiffs. On appeal, this court reversed. We observed that the prior panel, in affirming the district court's finding of liability, had "at least by necessary implication[ ] decided that the unconstitutional conduct upon which that finding was predicated had damaged plaintiffs." Wheeler v. City of Pleasant Grove, 746 F.2d 1437, 1441 (11th Cir.1984) (hereinafter Wheeler II ). We concluded that the district court, in refusing to award any damages, had violated the law of the case. Accordingly, we once again remanded the case for a determination of the amount of damages sustained by the plaintiffs.
8
At the hearing that followed, the district court considered the Wheelers' damages claims and Cliff Development's damages claims separately. The Wheelers claimed that they would have sold their property for $160,000 to Cliff Development but for the enactment of Ordinance No. 216. They sought damages in the amount of the interest they would have received on the proceeds of the sale over the sixteen months that the ordinance was in effect, less rental income derived from the property over the same period. The Wheelers also sought damages for mental anguish they allegedly suffered as a result of the lost sale.
9
Cliff Development claimed that it had suffered damages separate and apart from those claimed by the Wheelers. First, it claimed that it was entitled to compensation for the expenditures--in excess of $19,000--it had made in preparation for construction before the enactment of Ordinance No. 216. Second, it claimed that it had suffered damages to the extent that building costs and temporary and permanent financing costs had increased over the sixteen months that the ordinance was in effect. Third, it claimed it was entitled to the profits it would have made had construction proceeded on schedule. Fourth, it sought damages for injury to its business reputation. Finally, it sought punitive damages.
10
After hearing the testimony of several real estate agents and considering the parties' post-hearing briefs, the district judge awarded the Wheelers $1. In concluding that the Wheelers were entitled only to nominal damages, the judge emphasized that they had made no attempt to sell the property after the court enjoined enforcement of the ordinance in November 1979. The judge found that the post-November 1979 value of the property as a site for apartments was $50,000 greater than the sum Cliff Development had originally contracted to pay. He further found that the contract between the Wheelers and Cliff Development was unenforceable for want of an adequate description of the subject property. He concluded that since the Wheelers could now sell the property on the market at a sizeable profit, they had suffered no actual injury.
11
With respect to Cliff Development, in contrast, the district judge was able to discern a compensable injury. In the judge's view, however, Cliff Development could collect only for the increases in construction costs and temporary financing costs. Based on the representation by Cliff Development that it planned to proceed with construction of the apartments, the judge refused to award damages for out-of-pocket expenditures. The judge also refused to award damages for lost profits, finding that such profits were purely speculative. Further, he found that the methodologies urged at trial for estimating increases in permanent financing costs were too speculative to support a damages award; he emphasized the unpredictability of interest rates and the possibility that Cliff Development could obtain refinancing at lower rates in the future. In addition, he refused to award any damages for injury to Cliff Development's business reputation, finding the proof adduced at trial inadequate to establish such injury. Finally, he denied the plaintiffs' request for punitive damages, concluding that the City was immune from such liability.2
12
The City of Pleasant Grove appealed, and the Wheelers and Cliff Development cross-appealed. Because we conclude that the district court applied an incorrect measure of damages, we vacate its decision and remand for further proceedings consistent with this opinion.
II.
13
The issue of liability is settled in this case. In Wheeler I a panel of the former Fifth Circuit held that the City of Pleasant Grove had engaged in a taking when it applied Ordinance No. 216 against the plaintiffs. In Wheeler II we held that a necessary implication of the Wheeler I holding was that the plaintiffs were entitled to compensation for the injury they sustained as a result of the temporary taking.3
14
At the time Wheeler I and Wheeler II were decided, the Supreme Court had not yet ruled on the issue of whether a landowner could recover damages for a temporary regulatory taking--that is, a taking that is ultimately invalidated by a court. Several courts had taken the position that an injunction prohibiting the enforcement of the unconstitutional ordinance was a complete remedy, and had refused to award damages for injuries sustained during the period when the ordinance was in effect. The Supreme Court, however, has since affirmed our position in Wheeler I and Wheeler II by holding that the Constitution requires compensation for a temporary regulatory taking. See First English Evangelical Lutheran Church of Glendale v. County of Los Angeles, --- U.S. ----, 107 S.Ct. 2378, 2387-88, 96 L.Ed.2d 250 (1987). In this appeal, we confront the difficult issue of how to calculate the compensation due when such a taking has occurred.
15
It is well settled that in determining the compensation due for a taking, "the question is, What has the owner lost?" Boston Chamber of Commerce v. City of Boston, 217 U.S. 189, 195, 30 S.Ct. 459, 460, 54 L.Ed. 725 (1910). The owner's loss is measured by the extent to which governmental action has deprived him of an interest in property. See United States v. General Motors Corp., 323 U.S. 373, 378, 65 S.Ct. 357, 359, 89 L.Ed. 311 (1945). The value of that interest, in turn, is determined by isolating it as a component of the overall fair market value of the affected property. See Kimball Laundry Co. v. United States, 338 U.S. 1, 7, 69 S.Ct. 1434, 1438, 93 L.Ed. 1765 (1949).
16
In the case of a temporary regulatory taking, the landowner's loss takes the form of an injury to the property's potential for producing income or an expected profit. See generally 7 P. Rohan, Zoning and Land Use Controls Sec. 52A.03 (1986 & Supp. 1987). The landowner's compensable interest, therefore, is the return on the portion of fair market value that is lost as a result of the regulatory restriction. Accordingly, the landowner should be awarded the market rate return computed over the period of the temporary taking on the difference between the property's fair market value without the regulatory restriction and its fair market value with the restriction.4 See Nemmers v. City of Dubuque, 764 F.2d 502, 505 (8th Cir.1985). Under this approach, the landowner recovers what he lost. To award any affected party additional compensation for lost profits or increased costs of development would be to award double recovery: the relevant fair market values by definition reflect a market estimation of future profits and development costs with respect to the particular property at issue.
17
The district court misperceived the nature of the task before it. It incorrectly viewed the dispute as involving two separate compensable injuries--one sustained by the Wheelers and one sustained by Cliff Development. When the government has engaged in a taking, the Constitution requires that compensation be paid to the owner of the property taken. On remand, therefore, the district court must determine the relative interests of the parties in the subject property and allocate the total damages accordingly.
18
Assuming that the Wheelers had a total interest in the property, the district court plainly applied an incorrect measure of damages. The court concluded that the Wheelers had suffered no compensable loss because the property's value after the lifting of the regulatory restriction was greater than its value before the restriction came into effect. The district court's analysis fails to account for their loss as measured by the formula we set forth above, that is, the loss in income-producing potential suffered over the sixteen months that Ordinance No. 216 was in effect.5 On remand, the district court must determine the amount of that loss.
III.
19
We find no reason to disturb the district court's refusal to award damages for emotional distress and injury to business reputation. Assuming that such damages would otherwise be proper in a case of this kind, we conclude that the district court's finding that the plaintiffs failed to establish such damages was not clearly erroneous. Likewise, we do not disturb the district court's disposition of the punitive damages claim. The district court correctly ruled that the City of Pleasant Grove, the sole defendant remaining in this case,6 is immune from liability for punitive damages under City of Newport v. Fact Concerts, Inc., 453 U.S. 247, 101 S.Ct. 2748, 69 L.Ed.2d 616 (1981).
IV.
20
To summarize, we vacate the district court's ruling insofar as it pertains to the calculation and allocation of compensation due as a result of the temporary taking, and remand the case for further proceedings consistent with this opinion. We affirm the district court's ruling with respect to punitive damages and damages based on emotional distress and injury to business reputation.
21
AFFIRMED in part, VACATED in part, and REMANDED.
1
The action was brought under 42 U.S.C. Secs. 1983, 1985, and 28 U.S.C. Secs. 2201-2202 (1982). In their complaint as amended, the plaintiffs alleged that the defendants had deprived them of their property without due process, had taken their property without just compensation, and had acted arbitrarily and capriciously in adopting the challenged ordinance
2
The City of Pleasant Grove is the only defendant remaining in the action. Pursuant to the agreement of the parties, the district court in October 1985 dismissed the complaint against the individual city officials insofar as it pertained to the plaintiffs' claims for damages
3
A "taking" as a ground for a suit against a governmental entity can be based on different constitutional provisions. The fifth amendment provides "nor shall private property be taken for public use, without just compensation." This provision is applied to the States through the fourteenth amendment. See Chicago, B. & Q.R.R. Co. v. Chicago, 166 U.S. 226, 17 S.Ct. 581, 41 L.Ed. 979 (1897). Technically, the fifth amendment's just compensation clause is not applicable where there has been no "public use." Such may be the case where, as here, the land use regulation that effected the taking was not enacted in furtherance of the public health, safety, morals, or general welfare. The affected landowner may nevertheless have a damage cause of action under section 1983 since the taking may violate his fourteenth amendment rights to due process. See Hernandez v. City of Lafayette, 643 F.2d 1188, 1200 n. 26 (5th Cir. Unit A May 1981), cert. denied, 455 U.S. 907, 102 S.Ct. 1251, 71 L.Ed.2d 444 (1982). Regardless of which constitutional provision a taking falls under, the measure of damages to which the aggrieved landowner is entitled is the same
4
That is, the price that a willing buyer with all relevant information--including knowledge of the land use restriction--would pay a willing seller
5
In the analogous context of temporary physical takings, the Supreme Court has rejected the measure of compensation used by the district court--that is, the difference between the market value of the owner's interest in the property before its taking and the market value on the date of its return. See Kimball Laundry Co. v. United States, 338 U.S. 1, 7, 69 S.Ct. 1434, 1438, 93 L.Ed. 1765 (1949). Because the market value of the property often would not have decreased, the Court observed, this approach would frequently result in no compensation for the owner, despite the identifiable loss he suffered over the period of the temporary taking. The same concern moves us to reject that approach in the context of a temporary regulatory taking
6
See supra note 2
|
Search found 12 matches
When I get audio dropouts, it's also almost always only the cymbals. hm...I wonder why. Anyways, not a big deal at all, because I just reexport. This little problem pales in comparison to issues with recording drums myself, so I'm still a totally happy camper.
If I'm not mistaken, I don't believe there is a popular thread to share songs you've made with BFD2. That's a shame. I'm interested to hear what kind of sounds others are able to get with BFD2. Here's a simple little tune I made last month. http://shadowsoflight1.bandcamp.com/album/homage-to-america...
Interesting. I'm pretty sure this isn't an issue with BFD2 itself. This is to say that if you were to install BFD2 onto a different computer, you probably wouldn't have this problem, which makes me suspect it's "something" with your computer. When you are exporting, you are indeed using yo...
Not a real sexy request here. It would be great if upcoming BFD2 / BFD3 release would be made to be compatible with the M-Audio file deltaiipnl.dll. Currently, they are not compatible, which throws an error in BFD2. Here are some threads about this. http://www.fxpansion.com/forum/viewtopic.php?t=757...
Well, we have figured it out. The deltaiipnl.dll file is not compatible with BFD2. At the Thread on the M-Audio forum, it is written "Many DAW applications are not compatible with opening the M-Audio Delta Control Panel." Here is a link: http://forums.m-audio.com/showthread.php?37704-Error...
Thank you for the recommendations DrNewcenstein. I am having this problem when only BFD2 is open. I just want to share my experience for others whom might have this problem. I opened a ticket with BFD2 technical support. It was identified that this is most likely a problem with the sound card / ASIO...
Greetings! In BFD2, I do this: click on Options select Open Audio Preferences click on Open ASIO panel I am getting error "DeltaIICpl.exe - Entry Point Not Found. The prodecure entry point ?depSetSpdifSource@@YA?AW4DEP_ERR@@HH@Z could not be located in the dynamic link library deltaiipnl.dll&qu...
Hi Jord, Thank you for the advise. I was also thinking that I should be using the Export Groove Audio menu item. However, my BFD2 does not have this option. The BFD2 Manual, Section 4:3 (page 74) has an image of the "Export Groove Audio..." option. However, in my BFD2, I do not have the &q...
Hi Steve, Thank you very much for your tips, suggestions and questions. I am clicking on Play when attempting to Export. Regarding your tip of ensuring my Windows Media Player is set 16, 24 or 32 bit, I was unable to determine my WMP setting. However, I exported a WAV as 16-bit, 24-bit and 32-bit, a...
Greetings, I must be missing something simple here. I'm unable to successfully export audio. Been trying for a few hours with no success. I just installed BFD2 a few days ago, so I'm a newbie. I load the "Dark Funk" preset. I can play and hear the dark funk beat in BFD2. From the Mixer pag... |
Pressure: the politechnics of water supply in Mumbai.
In Mumbai, most all residents are delivered their daily supply of water for a few hours every day, on a water supply schedule. Subject to a more precarious supply than the city's upper-class residents, the city's settlers have to consistently demand that their water come on “time” and with “pressure.” Taking pressure seriously as both a social and natural force, in this article I focus on the ways in which settlers mobilize the pressures of politics, pumps, and pipes to get water. I show how these practices not only allow settlers to live in the city, but also produce what I call hydraulic citizenship—a form of belonging to the city made by effective political and technical connections to the city's infrastructure. Yet, not all settlers are able to get water from the city water department. The outcomes of settlers' efforts to access water depend on a complex matrix of socionatural relations that settlers make with city engineers and their hydraulic infrastructure. I show how these arrangements describe and produce the cultural politics of water in Mumbai. By focusing on the ways in which residents in a predominantly Muslim settlement draw water despite the state's neglect, I conclude by pointing to the indeterminacy of water, and the ways in which its seepage and leakage make different kinds of politics and publics possible in the city. |
Carbonates such as ethylene carbonate, propylene carbonate and dimethyl carbonate are generally used as a solvent for dissolving an electrolyte salt for a non-aqueous electrolytic solution for lithium secondary batteries. However these hydrocarbon carbonates are low in a flash point and have high combustibility, and therefore, improvement in noncombustibility of a non-aqueous electrolytic solution is an important problem to be solved for securing safety especially in the cases of large size lithium secondary batteries for hybrid cars and distributed power source.
In order to improve noncombustibility of a non-aqueous electrolytic solution without lowering its performance, addition of a fluorine-containing solvent has been proposed (JP8-37024A, JP9-97627A, JP11-26015A, JP2000-294281A, JP2001-52737A, JP11-307123A and JP10-112334A). |
Clinical efficacy of celecoxib for osteoarthritis and bone anchor assisted knee extensor reconstruction.
Celecoxib is the most recent non steroidal anti-inflammatory analgesic, and has been gradually used in the treatment of acute pain, rheumatism and osteoarthritis. This paper analyzes the analgesic effect of celecoxib in the treatment of knee osteoarthritis and put forward a new mechanism of knee joint extensor reconstruction assisted by bone anchor. The experimental group was given celecoxib 200 mg/ time and 1 time /d. The results showed that VAS (Visual Analogue Scale) decreased gradually in both groups on the 1st, 3rd and 7th day of treatment and VAS in experimental group was lower than that in control group at the same time point (P<0.05). At the 1 year follow-up, experience group had a significant improvement on the Lysholm (69.33 ± 8.38 preoperatively and 88.65 ± 12.93 postoperatively) and Kujula (69.33 ± 8.38 preoperatively and 88.65 ±12.93 postoperatively) knee scores (P<0.05). The results showed that celecoxib had a good analgesic effect in patients with knee osteoarthritis and reducing the release of inflammatory factors may be its mechanism.. |
505 P.2d 1169 (1973)
Florence GREENE, as Administratrix of the Estate of Michael T. Greene, Plaintiff-Appellant,
v.
John TEXEIRA and Maxine Texeira, Defendants-Appellees.
No. 5082.
Supreme Court of Hawaii.
January 23, 1973.
*1170 Burnham H. Greeley, Honolulu (Padgett, Greeley, Marumoto & Steiner, Honolulu, of counsel), for plaintiff-appellant.
Dennis E.W. O'Connor and Peter G. Wheelon, Honolulu (Anthony, Hoddick, Reinwald & O'Connor, Honolulu, of counsel), for defendants-appellees.
Before RICHARDSON, C.J., ABE, LEVINSON and KOBAYASHI, JJ., and CHANG, Circuit Judge, in place of MARUMOTO, J., disqualified.
RICHARDSON, Chief Justice.
This appeal arises out of consolidated actions brought by Florence Greene, the appellant herein, in her individual capacity and as administratrix of the estate of her son, Michael T. Greene, against John and Maxine Texeira, parents of Ronald Texeira, *1171 a minor,[1] pursuant to HRS §§ 663-3[2] and 663-7.[3] The claims were the result of an automobile accident involving a single vehicle driven by Ronald Texeira. Michael T. Greene, a passenger in the car, sustained injuries from which he died, following 45 days of hospitalization. Michael was 19 years of age, unmarried, and a college freshman at the time of his death.
On April 27, 1970, verdicts were returned. The jury awarded the mother $30,000 under the Wrongful Death Act, HRS § 663-3, and $5,000 under the Survival Statute, HRS § 663-7. Judgment was entered in accordance with the verdicts on April 30, 1970. The Wrongful Death Act judgment was satisfied, but the administratrix appealed from the judgment under the Survival Statute.
The appellant alleges four specifications of error on appeal: (1) that the circuit court (a) erroneously permitted the introduction of evidence relating to the effect of federal and state income taxes upon the probable net excess earnings of the decedent, and (b) erroneously instructed the jury that these taxes were to be deducted from the present value of such earnings; (2) that the circuit court erroneously permitted the introduction of evidence concerning the cost of supporting a hypothetical wife and two hypothetical children and allowed the jury to deduct this amount from its award of probable net excess earnings; (3) that the circuit court improperly permitted the appellees to pose hypothetical questions to a witness based on the assumption that the present value of decedent's probable excess earnings should be determined on the basis of a 6% discount factor; and, (4) that the circuit court erred in refusing certain jury instructions concerning injuries which the decedent allegedly suffered as a result of the automobile accident.
The first three specifications of error alleged by the appellant concern the probable future earnings of the decedent, in excess of the probable cost of his own maintenance and the provision he would have made for his family and dependents during the time he would likely have lived but for the accident. That such earnings are a proper item of damages in an action under *1172 HRS § 663-7 was determined by this court in Rohlfing v. Akiona, 45 Haw. 373, 369 P.2d 96 (1961).
Following the submission of briefs and oral argument, the court began to reconsider the merits of the Rohlfing interpretation of § 663-7. On September 6, 1972, additional briefs were requested of counsel on both sides, directed to the question whether HRS § 663-7 or any other section of the Hawaii Revised Statutes, or the common law of Hawaii as defined in HRS § 1-1, provides a right to recovery in favor of an estate for damages based on the probable net excess earnings of a decedent projected beyond the date of his death, special consideration being given to whether Rohlfing v. Akiona should be overruled. Simultaneous reply briefs were thereafter requested and submitted, directed to the same issues.
Much deliberation and thorough consideration of this issue have led us to conclude that the probable future excess earnings of a decedent are not a proper item for damages under the Hawaii Survival Statute, HRS § 663-7. Insofar as Rohlfing v. Akiona, supra, conflicts with this determination it is hereby overruled.
A preliminary question on this appeal is whether it is proper for this court to consider an issue raised for the first time on the court's own motion, subsequent to submission of briefs and oral argument. We feel that in the circumstances of this case such a procedure is proper.
Rule 3(b) (3) of the Rules of the Supreme Court provides that the opening brief shall contain a "short and concise statement of... questions presented for decision," and further that "[q]uestions not presented ... will be disregarded." This cautionary admonition is modified by the final sentence in that paragraph, however, which provides: "The court, at its option, may notice a plain error not presented." This court is of the opinion that Rohlfing, supra, upon which three of appellant's four specifications of error are based, does not correctly state the law of Hawaii and reliance upon it is a plain error contemplated by the rule.
A similar issue was recently presented to this court in In re Taxes, Hawaiian Land Co., 53 Haw. 45, 487 P.2d 1070 (1971). In that case an issue of statutory application was raised for the first time in the reply brief. Id., at 52, 487 P.2d 1070. This court allowed both parties to submit further supplemental briefs on the matter. Id. We then listed three factors which should be considered before allowing a decision on an issue not raised in the opening brief: (1) whether the issue goes to the integrity of the fact finding process; (2) to what extent an error may have been correctable if properly raised; and (3) whether the issue involves questions of fact that were not but could have been fully developed in the trial court. Id. at 53, 487 P.2d 1070. We concluded that "If none of these factors are present, it is well within our discretion to hear new legal arguments, especially if it involves a question of great public import." Id.
In the present case, appellant at trial had full opportunity to present his facts on all issues concerning damages. Overruling Rohlfing by this court merely rendered trial of one issue, that concerning decedent's excess earnings, superfluous. The great importance to the public of a proper interpretation of Hawaii's Survival Statute is obvious. Thus, we will consider the issue whether the decedent's excess earnings are a proper item of damages under HRS § 663-7.
Under HRS § 663-7 there survives in favor of the decedent's legal representative only such cause of action as the decedent himself had at the moment of his death. Rohlfing v. Akiona, supra, 45 Haw. at 377, 400, 369 P.2d 96. The crux of the majority opinion in Rohlfing was that an injured person has a right to recovery of all future earnings lost as a result of his injury and that the intervention of death should not divest the decedent's estate of that right.
*1173 We have come to the conclusion that the minority opinion in Rohlfing presents the most sound position on this issue; that an injured plaintiff is not entitled to recover damages "for any earnings he might be supposed to make, if living, in that part of his life lost by reason of his injuries." Krakowski v. Aurora, Elgin & Chicago R.R., 167 Ill. App. 469, 472-473 (1912). As the decedent would not have been entitled to recover such earnings in his lifetime, it follows that his representative is not entitled to recover such earnings in a later survival action under HRS § 663-7.
Our interpretation of HRS § 663-7 is in accordance with the view of most states with statutes such as ours. In the majority of jurisdictions with both Survival and Wrongful Death statutes, recovery for lost earnings under the Survival Statute is not permitted beyond the time of death. McCormick, Damages, § 94 (1935); Prosser, Torts, § 127 (4th Ed. 1971); Speiser, Recovery for Wrongful Death, § 14:4 (1966). See, e.g., Farrington v. Stoddard, 115 F.2d 96 (1st Cir.1940); O'Leary v. United States Lines Co., 111 F. Supp. 745 (D. Mass. 1953); Ellis v. Brown, 77 So.2d 845 (Fla. 1955); Hindmarsh v. Sulpho Saline Bath Co., 108 Neb. 168, 187 N.W. 806 (1922); Gochenour v. St. Louis San Francisco Ry., 205 Okl. 594, 239 P.2d 769 (1952).
Our interpretation of HRS § 663-7 recognizes that the aim of the statutes in this area of the law is compensation for loss rather than punishment. Our wrongful death statute, HRS § 663-3, compensates a deceased's survivors for economic loss and deprivation of love, affection and companionship. Decedent's mother has already been awarded $30,000 under HRS § 663-3. To press HRS § 663-7 into service to further compensate the decedent's survivors for the loss of their loved one would result in excess damages, justifiable only on a theory of punishment, rather than compensation.
Our holding that future excess earnings are not an element of damages in an action under HRS § 663-7 renders irrelevant the first three specifications of error alleged by appellant, all of which concern the measure of decedent's future excess earnings. We turn now to appellant's fourth allegation.
The appellant alleges as error the circuit court's refusal of two requested jury instructions. The first instruction sets out the injuries which the decedent allegedly suffered as a result of the automobile accident, as well as the criteria to be considered by the jury in fixing damages, in the event the injuries were found to be the proximate result of the accident.[4] The second instruction concerned the degree of certainty as to the amount of damages necessary *1174 for the appellant to meet her burden of proof.[5] The appellees urge that the requested instructions were substantially covered by other instructions given by the court.[6]
The recurrent and nagging problem of selecting those instructions by which to inform the jury of the law applicable to the current case subjects the trial court to the danger of being "whipsawed by the obligation to give sufficient instructions and the opposing requirement not to give cumulative instructions." Barretto v. Akau, 51 Haw. 383, 399, 463 P.2d 917, 926 (1969). See Tittle v. Hurlbutt, 53 Haw. 526, 497 P.2d 1354 (1972). While "[i]t is generally considered error to refuse to give a requested instruction on a given point which is accurate and applicable though the point may have been unequivocally covered by a general instruction," Young v. Price, 50 Haw. 430, 439, 442 P.2d 67, 73 (1968), "the fact that more specific instructions are offered does not require the trial court to accept them and reject slightly more general instructions or give cumulative instructions on the same point." Id., 50 Haw. at 450, 442 P.2d at 79 (Levinson and Marumoto, JJ., dissenting).
Nevertheless, there are some clear signposts. In Barretto v. Akau, supra, 51 Haw. at 398, 463 P.2d at 926, we held that a plaintiff in a personal injury suit is "entitled to separate consideration as to each [alleged injury], any one of which might have supported an action for damages, although it [is] preferable to combine the instructions and eliminate repetition wherever possible." Plaintiff's Instruction No. 31 complied with these guidelines and cannot realistically be said to have been covered adequately in Court's Instruction No. 23. Therefore, we hold that the circuit court erred in refusing to give it. On the other hand, Plaintiff's Instruction No. 35, while a correct statement of the proposition contained in Coney v. Lihue Plantation Company, Ltd., 39 Haw. 129, 139 (1951), added nothing to Defendant's Instruction No. 5; refusal to give that instruction was a proper exercise of the circuit court's discretion.
Reversed and remanded for a new trial on the issue of the amount of damages accrued between the time of decedent's injury and the time of his death.
LEVINSON, Justice, dissenting, with whom KOBAYASHI, Justice, joins.
I dissent because I think that Rohlfing v. Moses Akiona, Ltd., 45 Haw. 373, 369 P.2d 96 (1961), was decided correctly.
I.
Rohlfing held, in effect, that those jurisdictions which have both survival and wrongful death statutes and which allow damages to be cut off at the date of death are misinterpreting the statutes, and I agree. The Rohlfing majority accurately characterized the source of an action under *1175 the survival statute as the injury rather than the loss of life:
Hence, under the survival statute the cause of action arises out of the injury. The injury may manifest itself in the loss of life instantly or subsequently, but the loss of life is not what gives rise to the cause of action. In contrast, an action under [the wrongful death statute] arises out of the death. [45 Haw. at 383, 369 P.2d at 101.]
The court further elaborated on this principle:
The touchstone is the right that was vested in the injured person at the moment of his death. It seems to us that a person mortally wounded cannot have less than the right to the present value of the sum, if any, that with due regard to his own cost of living and the care of his loved ones, would have been at his disposal during his lifetime had he been permitted to live it normally. If that is not a sound proposition then one can with equal justice urge that an injured person, alone in the world, who lies in a coma in a hospital and will never recover from it, has only a right to such sum as will maintain him in the hospital and nothing for lost earnings because, forsooth, he will not in future be able to spend anything; or that in any instance in which a person's earnings are more than he is ever likely to spend in his lifetime there should be no recovery for the excess since it will only go to his heirs anyway. [45 Haw. at 390, 369 P.2d at 105.]
While the issue of duplication of damages was not directly before the Rohlfing court on the facts of that case because that action was brought under the survival statute only, the court recognized this as a genuine problem and discussed it at length. It concluded that the legislature provided against this possibility by merging the common law wrongful death action into its statutory successor and by providing for consolidation of wrongful death and survival actions arising from the same incident. 45 Haw. at 394, 369 P.2d at 106-107.
The Rohlfing approach was noted with approval by Professor John G. Fleming in The Lost Years: A Problem in the Computation and Distribution of Damages, 50 Calif.L.Rev. 598, 606-07 (1962):
The standard solution [to the conflict between wrongful death claims of the survivors and those of the heirs under survival statutes] is to allow the dependents the value of their expectancy and to allot the estate, as representing the decedent, his probable earnings limited to the span between injury and death. This disposition offers the tortfeasor adequate protection against double liability (even when the actions are not consolidated), but incidentally confers on him a disguised windfall by not mulcting him for the difference between the present worth of the decedent's likely earnings during his lost years, reduced by the probable cost of his maintenance, and the amount awarded to the dependents. In recognizing the estate's legitimate claim to such "excess earnings," Pennsylvania and Hawaii are thus far alone in offering a commendable departure from the customary formula. (Footnotes omitted.)
In contrast to Rohlfing, the majority in the present case is attempting to reconcile the wrongful death and survival statutes on the theory that duplication of damages can be avoided by the simple device of limiting recovery in the survival action to the date of death, with the wrongful death action then picking up any loss of earning capacity from death to the date of life expectancy prior to the injury. Unfortunately, in its headlong rush to avoid what it labels "punishment," the majority has lost sight of such considerations as the true goals of compensation, the fact that our statutory scheme already avoids duplication, and the impact of its decision upon the distribution of damages.
The goals of compensation have been set forth with clarity in prior decisions of this court: The general rule in measuring damages *1176 is to award such sum of money to the injured person as will restore him to the position he would have been in had the injury not occurred. Rodrigues v. State, 52 Haw. 156, 167, 472 P.2d 509, 517 (1970). Lost future earnings are one element of damages commonly arising from personal injuries which are properly chargeable against the tortfeasor. Jendrusch v. Abbott, 39 Haw. 506, 508-510 (1952). If the injury results in a permanent destruction of the ability to earn income, the wage loss may form a large portion of the total injury suffered, and evidence of this future loss is properly admissible for consideration by the jury. Nakagawa v. Apana, 52 Haw. 379, 391, 477 P.2d 611, 618 (1970). The sum of these goals, that injured parties must be compensated by the wrongdoer for the totality of their losses, has been overlooked by the majority in its narrow concentration on the problem of "punishment."
Under the Hawaii statutory scheme duplication of damages is easily avoided. The problem, of course, is certainly one which cannot be ignored. See, Martin, Measuring Damages in Survival Actions for Tortious Death, 47 Wash.L.Rev. 609, 621-28 (1972); Duffey, The Maldistribution of Damages in Wrongful Death, 19 Ohio St.L.J. 264, 268-76 (1958). But the functional result under Rohlfing is that a dependent's recovery is limited to his net pecuniary loss, because any support which he would have received must be deducted from that part of the estate to which he is entitled as an heir. 45 Haw. at 385-389, 369 P.2d at 102-104. This constitutes a built-in prevention of any double recovery. Again, this feature is commended by Professor Fleming:
[A] more sophisticated disposition has recently been suggested which would actually offer him some measure of participation in the fund notionally represented by his lost years. According to this recommendation by the Hawaii court, it would be wholly proper to allow him the difference between his probable earnings during that period and the amount to which his dependents could lay a subsequent claim for loss of their expected support. Recognition of the decedent's title to such "excess earnings" has the undoubted advantage of forestalling the tortfeasor from any disguised windfall, insignificant though it may be in most cases, besides emphasizing that recovery based on normal life expectancy should be qualified only to the extent irreducibly necessary for sparing the tortfeasor from double liability. [50 Cal.L.Rev. at 613]
Perhaps the most important shortcoming of the majority's position is its refusal to acknowledge the impact of its broad-ranging language upon the distribution of damages. To rule that the probable future excess earnings of the decedent are not a proper item of damages in this case allows future defendants to obtain a windfall from their own actions. A benefit will be reaped when a victim is killed rather than injured.
There are a number of readily conceivable situations in which a tortfeasor will benefit under the majority's holding when an injury results in death rather than disability, thereby allowing the wrongdoer to escape all or part of his liability. Any situation in which a decedent has beneficiaries under his will or heirs who do not fall within those categories empowered to bring actions under the wrongful death statute, that is, any heir or beneficiary not supported by, or beneficiary not related to, the decedent, would result in the complete loss of an otherwise compensable damage. The fact that a dependent spouse, parent, or child has a valid action under the wrongful death statute offers no consolation to those who, in spite of an otherwise compensable interest, are now foreclosed from protecting it, especially in view of the fact that duplication of damages is already prevented in this jurisdiction.
Other interested parties, although they may appear with less frequency, are creditors and the state. The majority's opinion has a detrimental effect upon the interest *1177 of the creditors of an estate by virtue of the fact that lost future earnings would likely be the largest single damage item; nor does our wrongful death statute list creditors among those groups empowered to use it. Also, any advantage accruing to the state under the escheat statute would be lost, resulting in a loss of revenue.
The inevitable conclusion is that, as a result of the majority's balancing of the two statutes, distribution is by item of damage rather than upon any considered policy decision as to the extent of the damage interest. This, in my opinion, is patently unfair to those who have been damaged by the wrongdoing of others.
II.
Because I believe the Rohlfing decision was correct, it is necessary to address the other issues raised on appeal, for the reason that the legislature may now choose to amend the survival statute or the court may one day return to the proper interpretation.
A. The Deduction of Federal and State Income Tax from Award of Damages for Loss of Probable Net Excess Earnings.
At trial, the circuit court instructed the jury that future federal and state income tax payments should be deducted from the present value of the decedent's likely earnings in determining the loss to his estate of probable net excess earnings. This instruction reflected the obvious fact that, had the decedent lived, his future gross earnings would have been taxable.[1]
In my opinion, the circuit court erred in so instructing the jury. I agree with the well-reasoned opinion of Chief Judge Friendly in McWeeney v. New York, New Haven & Hartford Railroad Company, 282 F.2d 34, 36-39 (2d Cir.1960), cert. denied, 364 U.S. 870, 81 S.Ct. 115, 5 L.Ed.2d 93 (1960), that the pitfalls of presenting the jury with a task of such "delusive simplicity" outweigh whatever utility there might be. Accord, Boston & Maine Railroad v. Talbert, 360 F.2d 286, 291 (1st Cir.1966); Girard Trust Corn Exchange Bank v. Philadelphia Transportation Company, 410 Pa. 530, 538, 190 A.2d 293, 297-298 (1963). Even assuming that the jury could estimate with any degree of accuracy the number of the decedent's probable exemptions, the dates when they would come into being, the rates to which the decedent would be subject, the deductions to which he would variously be entitled, and the particular state tax structures under which he would incur liability during his lifetime, the instruction fails to credit the decedent's estate with a number of offsetting factors. First,
the theoretical measure of the loss of the plaintiff's earning capacity is that sum of money which if invested at a fair rate of return will yield annually the amount by which the plaintiff's earning capacity has been lessened and which will at the end of the plaintiff's life expectancy be reduced to zero. This takes account of the fact that money earns interest each year; and it should be remembered that this interest is taxable. Therefore, if a court is going to use income after taxes as a measure of plaintiff's loss, it must add back the taxes which would be due on the interest earned else the award would not fully compensate for the loss.
Morris and Nordstrom, Personal Injury Recoveries and the Federal Income Tax Law, 46 A.B.A.J. 274, 328 (1960). Second, such an instruction exacerbates the role of *1178 inflation and attorneys' contingency fees in diminishing the real recovery to a decedent's estate. A trial court should not permit the introduction of testimony relating to the likely incidence of tax liability which a decedent would have encountered but for his death or instruct the jury that such tax should be deducted from the measure of probable net excess earnings.[2]
B. The Hypothetical Wife and Children
In Rohlfing v. Moses Akiona, Ltd., 45 Haw. 373, 393, 369 P.2d 96, 106 (1961), this court declared the necessity of reducing an award to a decedent's estate for loss of excess earnings in such a way as "to eliminate the expenditures for decedent's own cost of living and the care of his family and dependents." With this caveat in mind, the appellees introduced evidence at trial, over the appellant's objection, that the decedent, had he lived, would probably have married and had two children, and that the cost of maintaining this hypothetical family over his life expectancy would have eliminated his excess earnings. The appellant contends that the circuit court's failure to exclude this evidence and to instruct the jury that it could not properly consider the effect of maintaining a hypothetical family upon a decedent's probable net excess earnings resulted in a disproportionately low jury award.
The appellees counter by urging that speculation is inevitable when excess earnings are at issue. They point to numerous instances in the record where the appellant resorted to such speculation in establishing the decedent's probable level of future income. They argue additionally that the circuit court's instruction to the jury did not require the jury to deduct the cost of maintaining a hypothetical wife and two children from the excess earnings credited to the decedent's estate.
The appellee's arguments, however, misconceive the injunction of the Rohlfing case. Under Rohlfing, support money actually awarded to a widow or children under HRS § 663-3 must be deducted from the excess earnings to be credited under HRS § 663-7 to the decedent's estate, in order to prevent a double recovery by the decedent's dependents and heirs. But there can be no double recovery by a widow or by children who do not in fact exist. To deduct the cost of maintaining a hypothetical family from the award to which a decedent's estate is entitled would give a windfall to the defendant and literally make it cheaper to kill a single man than a married man with a family. Such a course of action is inconsistent with the policies articulated in Rohlfing.
I would hold that in connection with the award under HRS § 663-7 it was error for the circuit court to permit the jury to consider the cost of maintaining a hypothetical family. On the other hand, under HRS § 663-3 the jury awarded $30,000 to the appellant for pecuniary injury and loss of love and affection. This sum has been paid. Of course, there is no way of knowing how much of it, if any, was to compensate for pecuniary injury, i.e., loss of support, and how much was to compensate for loss of love and affection. In any event, retrial of the appellant's claim under HRS § 663-7, which would be the only claim to *1179 be retried, poses no threat of double recovery; whatever sum the trier of fact finds would have been spent by the decedent in support of the appellant will by definition be excluded from the measure of probable net excess earnings.
C. The Hypothetical Questions
The appellant's expert economist testified on direct examination that, in his opinion, the present value of the decedent's probable excess earnings should be determined on the basis of a 4% discount factor, the average yield of U.S. government bonds over a 50 year period. Over the appellant's objection and subsequent motion to strike, the appellees were permitted to elicit an estimate from the witness based on a discount rate of 6%. The appellant argues that the assumption that 6% was a proper discount rate was unsupported by any evidence adduced at trial; she therefore maintains that to question the witness on that basis contravened the mandate of Barretto v. Akau, 51 Haw. 383, 388, 463 P.2d 917, 921 (1969), wherein we stated that:
While the authorities are divided on this issue, we think that in cross-examining an expert witness a question aimed at demonstrating an alternative theory or contesting a substantive element of the case may be based on (1) those facts already in evidence, (2) those facts which are the proper subject of judicial notice, and (3) those facts which the cross-examiner in good faith anticipates he will establish later in the trial. If the cross-examiner fails to prove the facts assumed in his hypothetical question, then a motion to strike by opposing counsel is appropriate to cure the defect. (Citations omitted.)
I think that a proper foundation was laid for calculation of present value based on a 6% discount rate, and that therefore the circuit court did not err in permitting the questions. The expert witness testified on cross-examination that several varieties of investments would currently yield greater than a 6% return. Although he maintained that to reduce future excess earnings to present value at that rate would not be economically "rational," in light of the risk which an investor would be required to take in order to obtain that rate of return, the question was ultimately one for the trier of fact to resolve on the basis of the evidence presented.
D. The Requested Jury Instructions
I am in agreement with the majority's opinion on this issue.
NOTES
[1] See HRS §§ 286-112 and 577-3.
[2] HRS § 663-3 provides:
Death by wrongful act. When the death of a person is caused by the wrongful act, neglect, or default of any person or corporation, the deceased's legal representative, or any of the persons hereinafter enumerated, may maintain an action against the person or corporation causing the death or against the person or corporation responsible for the death, on behalf of the persons hereinafter enumerated.
In any action under this section, such damages may be given as under the circumstances shall be deemed fair and just compensation, with reference to the pecuniary injury and loss of love and affection, including (1) loss of society, companionship, comfort, consortium, or protection, (2) loss of marital care, attention, advice, or counsel, (3) loss of filial care or attention or (4) loss of parental care, training, guidance, or education suffered as a result of the death of the person by the surviving spouse, children, father, mother, and by any person wholly or partly dependent upon the deceased person. The jury or court sitting without jury shall allocate the damages to the persons entitled thereto in its verdict or judgment, and any damage recovered under this section, except for reasonable expenses of last illness and burial, shall not constitute a part of the estate of the deceased. If an action is brought pursuant to this section and a separate action brought pursuant to section 663-7, such actions may be consolidated for trial on the motion of any interested party, and a separate verdict, report, or decision may be rendered as to each right of action. Any action brought under this section shall be commenced within two years from the date of death of the injured person.
[3] HRS § 663-7 provides:
Survival of actions. A cause of action arising out of a wrongful act, neglect, or default, except actions for defamation and malicious prosecution, shall not abate by reason of the death of the injured person. The action shall survive in favor of the legal representative of the person and any damage recovered shall form part of the estate of the deceased.
[4] Plaintiff's Instruction No. 31, refused, provided:
Plaintiffs claim that as a result of the accident of August 26, 1965, Michael T. Greene suffered the following injuries and conditions which ultimately resulted in his death:
Severe head injury
Cerebral edema and congestion
Brain stem injury
Loss of consciousness
Cranial surgery
Tracheostomy wound
Jejunostomy
Pulmonary congestion and edema
Fractured nose
Cerebral concussion
Emaciation
Focal necrosis of the brain
Congestion of the liver
Acute renal congestion
If you find from the evidence that as a proximate result of the accident Michael T. Greene suffered the above injuries and conditions, or any of them, then in determining the damages to be awarded you may consider the following:
The severity of the symptoms or conditions;
The duration of the symptoms or conditions;
The pain and suffering created thereby;
The mental distress arising therefrom;
The length of said pain and suffering and mental distress;
The effect of medication to relieve the pain and suffering; and
Any other evidence which may be of assistance to you in arriving at a fair and impartial verdict.
[5] Plaintiff's Instruction No. 35, refused, provided:
The law never insists upon a higher degree of certainty as to the amount of damages than the nature of the case admits.
Thus, while plaintiff has the burden of proof on the issue of damages, she needs to produce only such evidence on that issue as the circumstances of the case allow.
[6] Court's Instruction No. 23, supra, n. 5, informed the jury that the measure of damages should include that sum of money which would fairly compensate the decedent's estate for "(a) the pain, suffering, and mental anguish which Michael T. Greene may have consciously suffered as a result of the accident... ."
Defendant's Instruction No. 5, given as modified, provided:
While the burden rests upon the party who asserts the affirmative of an issue to prove his claim by a preponderance of the evidence, this rule does not require demonstration, or such degree of proof as produces absolute certainty, since in human affairs absolute certainty is seldom possible.
[1] The appellant relies upon Kawamoto v. Yasutake, 49 Haw. 42, 51, 410 P.2d 976, 981 (1966), for the proposition that "the incidence of taxation is not a proper fact for a jury's consideration since `[i]t introduces a wholly collateral matter into the damage issue.'" The principle underlying that case is not applicable to the issue presented in the instant appeal, since it dealt with an attempt to have the jury told, in fixing damages for personal injury, that the award is not taxable. Here, the question is whether the jury should properly be instructed to take into account the fact that future earnings would be taxable.
[2] I am aware of the warning in McWeeney that an added benefit might be bestowed upon the estates of decedents whose income levels were extraordinarily high. However, this possibility is counterbalanced by the salutary effect of the rule upon "the great mass of litigation at the lower or middle reach of the income scale, where future income is fairly predictable, added exemptions or deductions drastically affect the tax and, for the reasons indicated, the plaintiff is almost certain to be undercompensated for loss of earning power in any event." McWeeney v. New York, New Haven & Hartford Railroad Company, 282 F.2d 34, 39 (2d Cir.1960), cert. denied, 364 U.S. 870, 81 S.Ct. 115, 5 L.Ed.2d 93 (1960). But cf. Hartz v. United States, 415 F.2d 259, 264 (5th Cir.1969); Cox v. Northwest Airlines, Inc., 379 F.2d 893, 896 (7th Cir.1967), cert. denied, 389 U.S. 1044, 88 S.Ct. 788, 19 L.Ed.2d 836 (1968).
|
A press-in terminal for a connector is an important means for connecting with a printed circuit formed on a circuit board at a desired through-hole, and plays important roles in a connector which combines plural printed circuits. The press-in terminal should have excellent compliance, and be adapted for use with any through-hole, even if inner diameters of the through-holes are unequal. When pressed into the through-hole, the press-in terminal should electrically contact with a metallic plating formed on a inner surface of the through-hole and be mechanically held therein. Moreover, miniaturization of the press-in terminal is extremely desirable, for constructing the printed circuit with high density. On the other hand, the press-in terminal is required to have sufficient mechanical strength, for safety in manufacture and use.
Every effort has been made to improve the structure and the manufacturing process of the press-in terminal, and improvements have been achieved to some extent. However, even at present, a press-in terminal with excellent characteristics is hard to manufacture, and further investigations into the aforementioned problems are necessary. |
Electro Acoustic Guitars
Electro-Acoustic Guitars are fitted with a pickup and are typically played though an acoustic guitar amp. We stock a huge range of electro-acoustic guitars, from leading brands, such as Gibson, Taylor, Fender, Martin and Epiphone. |
Severe Weather
Bar raises drinking age to combat rowdy drunks
It's called Phil's Crummy Corner and neighbors say that's exactly what it is late at night on the weekends.
"It can be can be really loud," Alon Beneli, who lives in the neighborhood with his two daughters, told WPIX. "They are outside smoking, there are bottles and motorcycles, people outside smoking and talking."
He says sometimes it goes on until 4 a.m.
But owner Felix Marcano says he named the place based on it's appearance before he took over five years ago and cleaned it up. He says he's trying to fix the problem by putting the kibosh on rowdy young drinkers.
"I'm just trying to avoid the noise, the fights and it's working," Marcano said. "That's why I made it 25."
Neighbor Melisa Motola likes the idea.
"I think it's a good thing," she said. "I can get my daughter to sleep."
Others say Felix has promised an older more respectful crowd before but didn't follow through.
You might be wondering if upping the age to 25 is legal.
The state liquor authority says it is, as long as they don't discriminate against other groups and if they want a more experienced drinker that's OK.
Comments
The views expressed are not those of this site, this station or its affiliated companies. By posting your comments you agree to accept our terms of use. |
Virtual Gastric Band Hypnosis is a weight loss method developed in England that has been highly successful in the UK and United States. The client feels as if they have had the weight loss surgery combined with cognitive-behavioral tools leads to weight loss that is sustained. Randolph Bleiwas at Harbor Crest Counseling provides the Virtual Gastric Band Hypnosis process. He has Master's degrees in Psychology and Social Work as well as multiple certifications in addiction and hypnosis.
Follow by Email
Saturday, April 23, 2011
Virtual Gastric Band Hypnosis for Weight Loss - Rockland County
Welcome to the Virtual Gastric Band Hypnosis blog. For those of you that are unfamiliar with the process, Virtual Gastric Band uses hypnosis in order to help a client feel as if they have had the surgery reducing the size of their stomach. The person gets full on less food, becomes aware of subconscious barriers and develops tools to overcome them and uses other cognitive-behavioral tools to lose weight. Weight loss is done without feeling deprived as a choice leading to weight loss being sustained. More information can be obtained by visiting our website at http://harbor-crest.com. |
Fillmore County collects household hazmat waste
Anne Koliha of Harmony, at left, and Brenda Pohlman of Caledonia sorted through hazardous waste products and receptacles at the recent Fillmore County Household Hazardous Materials Collection. Both are employees of the Fillmore County Soil and Water Conservation District (SWCD).
The steady stream of cars going in and out of the Fillmore County Resource Recovery Center was testimony that another huge assortment of household hazardous waste materials made its way to the site this past week. It was the semi-annual opportunity for people to clean out and safely dispose of unwanted "stuff" from the basement, garage and sheds.
Residents dropped off everything from paint and lawn care products to automobile-related items. It's an easy drop-off for the "donors" - just drive up and the items are cheerfully removed from the vehicles by county employees who "volunteer" to staff the event, taking a break from their usual jobs.
These individuals act as either unloaders, meeting and greeting the residents who are dropping off, or as sorters who separate the materials into categories such as paint and flammables, pesticides, glues and fuels. New cans of paint are set aside and donated for use by others in need of those products.
Sometimes the sorting is not finished on the first day; in that case, some of the workers will return and complete the sorting and boxing on the second day. Finally, the materials are shipped to various locations around the country where they will be properly disposed of, depending on where the particular processing plants are located.
There are always some unidentifiable contents, which occurs because sometimes residents put a product into a container that was obviously not the original one - and then do not label it. In those cases, the volunteers will separate the items and send them to another "station" where they will be PH-tested for acid or base drain cleaner.
Oversight of the operation is one of the jobs of Kim Nelson, who works at Winona County Environmental Services. Fillmore County has a contract with Winona to provide for this supervision and expertise. Nelson said that workers at the site are protected from harmful effects of the materials by wearing steel-toed boots, gloves and aprons. In addition, all of the large doors at both ends of the building are left open during the event to provide as much cross-ventilation as possible.
The products are accepted at the site from noon to five on the first Tuesday of May and again in October. Residents are encouraged to save and safely store the chemicals and other hazardous materials they would like to discard, in anticipation of next spring's collection. |
Q:
A must-see in New Delhi for just a 5-6 hours break
I'll have just a five or six hours break between flights at Indira Gandhi International Airport. Is there any place or places in New Delhi that is:
considered a must-see for someone, who is visiting this city for the first time,
is reachable from the airport in given 5-6 hour period using taxi or other means of transportation.
If there is anything matching above, then can someone provide transportation guidances for that place or places?
Edit: Seems, that I didn't provided the most important idea, that these flights will be domestic, so I can both postpone return flight by an hour or two and that security etc. should be less time-consuming.
A:
It depends on what your interest really is. New Delhi has quite a lot to offer to foreigners who are looking for something different when they travel. When i travelled to India I wanted something completely different from how it is in Europe - mainly cuisine. I would recommend a couple of places:
1) Qutub Minar - a really tall brick minaret which is lovely to visit. It is also a UNESCO world heritage site. For directions of how to get there, Rome2Rio has an answer:
https://www.rome2rio.com/s/Delhi-Airport-DEL/Qutub-Minar
2) Chandni Chowk - A really really crowded place in the heart of the city. There are just too many people around you and more number of shops. And you get all varieties of Indian cuisine. I should warn you that some of them are really spicy and might not go well with people of European origin but i had a wonderful experience tasting some of the dishes made with traditional Indian ingredients. You can use the metro to get there.
Other places include the India Gate, Lotus tempel, a Red Fort (which is also quite popular), and there is a Rail musuem which was also something that I liked.
|
Q:
improve mock data generation
I'm trying to generate csv with mock data
for i in {1..1000000..1}
do
echo "$i,$(date -d "2017-08-01 + $(shuf -i 1-31 -n 1) days" +'%Y-%m-%d')" >> $F
done;
looping from 1 to million and generating unique id & random date
but it works very slowly, is there any one-liner to make it parallel?
A:
See very end for end result.
for i in {1..1000000..1}
do
echo "$i,$(date -d "2017-08-01 + $(shuf -i 1-31 -n 1) days" +'%Y-%m-%d')" >> $F
done;
Shell loops are slow, and there are two main things that makes this particular loop extra slow:
Opening and appending to a file in each iteration.
Two executions of external utilities (shuf and date) in each iteration. The echo is likely built into the shell, so that incurs less overhead.
The output redirection is most easily remedied:
for i in {1..1000000..1}
do
echo "$i,$(date -d "2017-08-01 + $(shuf -i 1-31 -n 1) days" +'%Y-%m-%d')"
done >"$F"
This only open the output file once and keeps it open for the duration of the loop.
The rest of the code can be done more efficiently with awk and GNU date (since you're using shuf I presume that you are on a Linux system, which means it's pretty likely that date is in fact GNU date).
awk 'END { for (i=0;i<100;++i) { printf("2017-08-01 + %d days\n", 1+int(31*rand())) }}' /dev/null
This thing generates 100 lines like
2017-08-01 + 22 days
2017-08-01 + 31 days
2017-08-01 + 11 days
2017-08-01 + 27 days
2017-08-01 + 27 days
2017-08-01 + 20 days
(etc.)
Let's feed these into GNU date. GNU date has this flag, -f, that lets us batch feed it with multiple date specifications, for example those outputted by our awk program:
awk 'END { for (i=0;i<100;++i) { printf("2017-08-01 + %d days\n", 1+int(31*rand())) }}' /dev/null |
date -f - +'%Y-%m-%d'
Now we get
2017-08-23
2017-08-27
2017-08-21
2017-08-29
2017-08-25
2017-08-17
2017-08-07
(etc.)
Then it's just a matter of adding the unique ID (a sequential integer) to each line:
awk 'END { for (i=0;i<100;++i) { printf("2017-08-01 + %d days\n", 1+int(31*rand())) }}' /dev/null |
date -f - +'%Y-%m-%d' |
awk -vOFS=',' '{ print NR, $0 }'
This gives you
1,2017-08-06
2,2017-08-17
3,2017-08-25
4,2017-08-28
5,2017-08-14
6,2017-08-15
7,2017-08-17
8,2017-08-10
9,2017-08-16
10,2017-08-08
(etc.)
And now we're done. And in the process, I totally forgot we had a shell loop. Turns out it's not needed.
Just crank up the 100 to whatever value you want, and adjust the random number generator to fit your needs. rand() returns a floating point value such that 0 <= number < 1.
Obviously, if you just want random dates in August (a month with 31 days), you may bypass date altogether:
awk 'END { for (i=1;i<=100;++i) { printf("%d,2017-08-%02d\n", i, 1+int(31*rand())) }}' /dev/null
With GNU awk and Mike's awk (mawk), but not with BSD awk, you may even do proper date handling directly in awk:
awk 'END { for (i=1;i<=100;++i) { printf("%d,%s\n", i, strftime("%Y-%m-%d", 1501545600 + int(2678400*rand()),1 )) }}' /dev/null
Now we're dealing with Unix timestamps rather than with days though. 1501545600 corresponds to "Tue Aug 1 00:00:00 UTC 2017" and there are 2678400 seconds in 31 days.
|
const debug = require('debug')('jest-mongodb:teardown');
module.exports = async function () {
debug('Teardown mongod');
await global.__MONGOD__.stop();
};
|
Use of green fluorescent proteins linked to cytoskeletal proteins to analyze myofibrillogenesis in living cells.
Once the appropriate site has been selected for the attachment of GFP to the sarcomeric protein, it is quite remarkable that the large size of the GFP molecule does not appear to interfere with the localization of the fluorescent sarcomeric proteins into the sarcomeric regions of the myofibrils. A similar approach using truncated parts of sarcomeric proteins linked to GFP should allow studies of the targeting properties of other sarcomeric domains for localization and assembly studies. |
Q:
Safety of keeping savings in a mortgage account
I have a mortgage account and a separate (yet linked) savings account with a certain Australian bank.
This bank draws a minimum mortgage repayment from the savings account into the mortgage account every month. However, it also permits me to freely transfer extra money in and out of the mortgage account, the balance of which offsets the interest charged.
Given the low cash rate, my savings seem to be working a lot harder by sitting in the mortgage account to offset the interest, as opposed to sitting in the savings account earning interest which is otherwise taxable.
My question: Is it safe to keep all my savings in such a mortgage account?
My concern is that, for whatever reason, could the bank suddenly deny access to my savings from the mortgage account (i.e., the funds on top of the minimum repayment balance), if they changed their policies or suffered some problem, like going into administration?
Perhaps this is a naïve/paranoid question, but I haven't found anything in the bank's terms, our contracts or in the product descriptions that say this couldn't happen...
EDIT
After a few discussions and the comments I've received so far, I gather that:
Keeping all my savings in one place is risky regardless of where they are kept, so it's perhaps best to keep at least a few thousand in a separate account for emergencies (thanks @MrChrister)
The worst that could happen does appear that, in the case I am denied access to my savings kept directly in the mortgage account, is a 'short-term liquidity crisis', which I can mitigate with the above strategy (thanks @fennec).
Using an offset account linked to the mortgage account for the emergency funds (and not the bulk of savings which is otherwise kept directly against the mortgage) which reduces the mortgage interest may be worth it if the savings in interest reductions are greater than the account cost (thanks @Victor).
A:
If your savings account linked to the mortgage account is an 100% offset account then you don't need to put extra funds into the mortgage account apart from the minimum payments which is done automatically. Any funds you have in an 100% offset acount reduces the amount of interest you have to pay on the mortgage.
So if your mortgage is $100,000 and you have $10,000 in the offset account then you only pay interest on $90,000 within the mortgage.
Also the funds in the offset account are at call any time as it is simply a savings account. You can have all your pay go into it and have direct debits set up for all your bills. This way you will benefit from maximising the amounts in your offset account and reducing the amount of interest you pay on your mortgage.
If your current linked savings account is not an 100% offset account ask your bank if you can change it over to one that is. If they don't have offset accounts for that particular mortgage account ask them if they have a different mortgage account with offset accounts. If they can't help you then shop arround for a bank or lender that does. I am currently with ANZ and they have a product with 100% offset account and about 0.7% below the standard variable rate, and there are plenty more similar products out there.
|
Road hauliers have called for troops to be sent in to break the ferry workers’ strike at Calais as more industrial action is threatened.
The government’s emergency committee met to the discuss the crisis as concerns began to mount about the safety of lorry drivers stuck in sweltering temperatures in huge queues prompted by the strike.
The port of Calais is expected to remain closed until Thursday, forcing all freight heading to Dover to be held at the side of the M20 motorway under Operation Stack – the emergency measure aimed at avoiding gridlock on Kent’s roads.
Cabinet minister Oliver Letwin chaired a meeting of the government’s Cobra emergency committee, while the prime minister, David Cameron, is due to speak by phone with the French president, François Hollande.
Cameron’s official spokeswoman said: “There’s an ongoing situation at the port, with it remaining closed, although Eurotunnel is open. This is part of us making sure that across government, working with the agencies and in discussions with the French, we are making sure we are doing all we can to get Calais back open.”
UK ambassador Sir Peter Ricketts is visiting Calais today to speak to port authorities.
The chief executive of the Road Haulage Association, Richard Burnett, said lorry drivers’ lives were at risk, as the UK Coastguard joined police in delivering bottled water to stranded drivers along the M20.
The delays have been caused by a fresh wave of industrial action by workers at MyFerryLink, who are trying to prevent job cuts after the firm was sold to a Danish group.
Eurostar said it expected to run a normal service on Wednesday for rail passengers after tyre fires on the tracks started by striking workers caused severe delays on Tuesday.
But further disruption was expected elsewhere on Wednesday and police were warning of heavy congestion on roads with long delays and a diversion in place on the A20 and the closure of a section of the M20 around Ashford.
Flames on the tracks after striking workers set alight to tyres on Tuesday Guardian
Burnett described the conditions facing drivers as “appalling” and called for military action to end the dispute. He said: “The UK and French governments must acknowledge their responsibilities to all port of Calais users, move in and act. If this means deployment of the armed forces then so be it.”
Speaking after witnessing the queues on the other side of the Channel at Calais, Burnett added: “The only word to describe what is happening there is absolute mayhem. There appears to be very little, if any, security and demonstrators have closed both the Eurostar and Le Shuttle tunnels by setting fire to tyres. This is not only causing disruption on a massive scale, it is inevitably putting many lives at risk.”
The disruption on both sides of the Channel began on Monday when MyFerryLink workers staged a wildcat strike – the second in a week – in protest at expected job cuts.
Traffic delays caused by last week’s strike prompted an increase in attempts by migrants to stow away on lorries heading across the Channel. High-security fences erected around Calais by British contractors have so far succeeded in preventing a repeat of last week’s scenes.
More industrial action is planned for Wednesday, according to trade unionist Eric Vercoutre of the MyFerryLink works council.
MyFerryLink was previously owned by Eurotunnel, the company that operates the undersea cross-Channel rail link. Eurotunnel’s chief executive, Jacques Gounon, was due to meet the French economy minister, Emmanuel Macron, on Friday, Vercoutre told Reuters.
“We want to make the French, British and Belgian governments understand that if a solution isn’t found to save our 600 jobs, there will be a lot of disruption this summer,” Vercoutre said. “When the mobilisation ramps up, we’ll block everything, which could disrupt Eurotunnel.”
Port of Dover officials said they had no idea when the industrial action would end.
A port of Dover spokesman said: “We sincerely regret the impact to the travelling public, freight and the Dover community of a situation that is beyond our control. We will continue to monitor the situation closely in liaison with our ferry partners and the port of Calais in order to resume normal operations as soon as possible.”
Dover coastguard watch officer Tracy Hawke-Treneer said: “We are currently helping Kent police to distribute food and water. As an emergency service we have the capability to respond to major incidents when needed. However this does not impact on our maritime search and rescue response capabilities.” |
I sometimes wonder how many nonprofit leaders realize they are serving two distinct but related missions?
First, of course, is the mission of service particular to your institution or organization. You may have an education mission, a healthcare mission, a nutrition mission, a faith-filled mission, a mission to assist the homeless, etc. Most nonprofit leaders understand this mission and can, on demand, speak to why this mission should matter to donors and how they can be supportive of this mission. Easy enough.
But, there is a distinctively separate mission – related to the service mission, but different – that nonprofit leaders assume as well. This second mission is related to the nonprofit status of your institution. As a 501 (c) 3 organization (or similar-chartered organization), the US Internal Revenue Service provides you with a federal tax exemption. Additionally, because your institution is considered as offering a “public good,” you are considered a “charity” or “charitable organization.” Therefore, you have a mission to encourage and promote volunteerism and charitable giving and to provide opportunities for people to respond to your service mission with generosity.
Your work as a nonprofit leader necessarily includes extolling the virtues of charitable gift giving. It is one way nonprofits are distinct corporations from for-profit ones. Charitable support is a key component of the very structure and operational realities of your institution. The federal government has provided your tax-exempt status and, further encourages you to engage other citizens in financially supporting your cause through various charitable giving deductions for donors within the tax code. So, anchored deep within the very DNA of your institution is the mission to encourage charitable giving from your various publics.
But, as I think about how nonprofit leaders communicate their mission, I rarely hear this message of giving emerge. I hear and see communications about how the services provided by the nonprofit are needed – even essential – for a just, caring, fair, healthy, and educated world. However, I don’t hear much about the “giving is good” mission and how it evinces empathy, compassion, and understanding – traits that are far too uncommon in our world today. Sometimes, I don’t even sense a leadership disposition to encourage generosity among as many as possible.
Make no mistake, though, your mission of promoting generosity is every bit as important as your service mission. In fact, it may just be that it is this mission – this mission of encouraging a more generous and giving world – that will do the most good and will end up also funding your service mission.
How do you respond when someone asks about your profession – what you do for a living? While it can be tempting to offer a knee-jerk and readily-understood response such as, “I’m a fundraiser,” please don’t.
Ever again.
For the sake of our authentically-transforming work, just don’t.
Fundraising is the transactional, point-in-time act of donating. Think of the Salvation Army’s red kettles outside of shopping centers before Christmas. Think of crowd-funding competitions at college football games. Think of point-of-sale donation drives at department stores.
Such fundraising strategies are not bad or unhelpful. And, being employed to plan and implement such strategies is not ignoble work. To be certain, transactional fundraising can raise significant sums of money!
But, that is exactly the point of why you should never refer to yourself as a “fundraiser.”
When you do this work well, it’s never about the money. Significant giving almost always follows time — and it always follows values and beliefs. Therefore, far from focusing on money, we should be focused on creating consequential donor engagement opportunities. Our work’s focus should be on inviting donors to better understand the need, to meet those our institution serves (if at all possible), and to vividly animate the overlap between our donor’s values and beliefs and the needs met by our institutions.
At its core, our work is about transformations, not transactions. Through engagement we invite others to join a meaningful cause. Through their acceptance of our invitation, the institutions we serve, the people our institutions serve, and the donors themselves, all are transformed.
Some years ago, I suggested that all development and advancement professionals should refer to themselves as “stewards.” Stewardship brings with an understanding of serving, protecting, and extending something good and bigger than yourself. I think that insight has worn well over time and today, I would certainly prefer that title over “fundraiser.” Having said that, there certainly are other more-apt descriptors to replace the ubiquitous “fundraiser” title.
You are engaged in an honorable, compassionate, encouraging, and virtuous profession. You do big things, even when working on modest scales. You build. You lift up. You bring good news and aspirations. You help nurture and grow programs that help others. In the end, you help transform individuals, communities, and the world by inviting others to express the most generous side of the human spirit.
Over the last few years, I’ve taken to explaining the purpose of donor and prospect management as the “management of exceptions.” By that phrase, I simply mean that all major donors and major donor prospects are “exceptions” to any conceivable universal rule one might use to engage them as a group. Each of these identified best prospects is unique. The relationship each has with your institution is unique. Their history, personality, life events, perspectives, values, beliefs – all different and unique to each of them.
Prospect management, then, simply helps us bring some semblance of structure to the scale and messiness of all of these exceptions. There is no “rule,” no “formula,” which will adequately assist the development officer with the personalized engagement of each of these prospects and donors. It is driven, at least in part, by the uniqueness of the donor herself.
The reason I have taken to referring to prospect management as the “management of exceptions,” is to remind us all that there simply is not a magic, singular rule, strategy, or tactic, which, when implemented, will open wallets wide. Although perhaps appealing in its simplicity, we should resist any temptation to seek or adopt any approach that purports to effectively engage donors and prospects using a template, a formula, or a pitch.
Here is the reality: There is no such formula, rule, strategy, tactic, or pitch. There is no single word choice, no special activity, which, when applied consistently, will helpfully engage all – or even a substantial number – of major donors and major donor prospects.
However, it can become confusing when one reads or listens to so many so-called development “experts” who, with great conviction, describe how certain strategies or pitches will work with women donors, or men donors, or business owners, or artists, or. . . well, you name it. As if development and advancement work were so easy.
Our work, when done authentically, honorably, and effectively, isn’t to come up with the perfect pitch to sell donors based on their demographics or characteristics. Instead, it’s to captivate each prospect as a full and complex human being and discover with each the bridges that connect their unique values, interests, and beliefs to your institution’s mission and vision. When you consistently engage individuals as “exceptions” through planful prospect and donor management techniques, you will realize far more success than any single, canned cultivation strategy can provide.
In a world seemingly plagued by insecurity, brittleness, volatility, anger, negativity, and senselessness, being involved as a professional in the arena of gift-giving and philanthropy is something for which you should be grateful. Each day you work in advancement, you are affirming the remarkable goodness of humanity through generosity. Consider what we know from research:
Giving is contagious. Even by-standers who watch givers in action, reap many of the physical and psychological benefits listed above.
So, as we begin 2018, I hope you keep close the foundational virtues of our work. Yes, you have specific goals that need to be exceeded this year. Facilities will need building, programs will need funding, endowments will need to grow, and budgets will need to be met.
But never lose sight of the bigger, more compelling reality: You are involved in a honorable, particularly human work. A work that brings us all a full step closer to the very best versions of ourselves. A work that encourages us to deepen our faith and care for each other, despite all of the nay-saying and negativity. A work that blesses both the giver and recipient. And I, for one, am honored to be toiling alongside of each of you in that vineyard.
Regardless of your circumstances, position, and station today, 2018 is a blank canvas waiting for you to create your picture. I hope each of us will use colors from the palettes of kindness, patience, inspiration, encouragement, and belief as we paint. Because when we encourage others to reach for their far edge of promise, we, in fact, become the best version of ourselves.
We all recognize the “law of supply and demand,” as a basic economic construct in free markets which states that ultimately, the price of a good or service will be determined by the supply of and customer demand for that good or service. But I believe there is a development program version of “the law of supply and demand” as well.
It’s quite simple.
Either you are “supplying” your donors and prospective donors with proactive, consistent, well-planned, inspirational messages about how you are meeting important needs today, will meet more needs tomorrow, and how, specifically, they can (and should!) give through you to help meet those needs, or. . .
Or, you are you regularly are responding to the “demands” of your donors. What does a donor-demand environment look like? Well you probably are receiving gifts more than inviting donors to give them, which means they may not be gifts that your institution actually wants/needs. You probably are communicating gratitude for a single gift 3 times more often than you are inviting specific gifts. And you probably are accepting gifts with so many strings that it causes problems within your institution.
If you aren’t strategically “supplying” your donors with the plans, the whys, and the hows of their giving – in other words if you aren’t educating them, guiding them, and encouraging their best giving in ways that most benefit your mission, you are most likely operating in a donor “demand” culture.
Receiving more gifts for the purposes that your institution truly needs to best meet the needs of those you serve doesn’t just happen. It happens because we consistently “supply” our donors with the education and inspiration to respond most helpfully. Over time, the more we proactively focus on our “supply,” the less we will have to react to “demands.”
It is well known that, given the choice, younger people will opt to meet new people and participate in new experiences as opposed to spending time with a sibling or other family members. Conversely, older folks tend to prefer spending time with those closest to them – family, long-held friends, etc. – as opposed to expanding their circle of friends or seeking new adventures. A macro-level task of youth, it would appear, is to expand boundaries, friend networks, and experiences. Meanwhile, the task of old age, it seems, is to embrace those family, friends, and patterns of behavior most comforting to us.
But why does this shift in mindset from expansion to contraction happen as we age? Stanford Center on Longevity Director, Laura Carstensen, has a theory. Over the last 20 years she has researched this psychological phenomenon extensively. And, here is what she has found: It is not necessarily age that causes us to become more focused on and desire to spend more time with the ones closest to us – the ones we love. Instead, it is our perspective – our individual sense of how much time we have left in this world. Regardless of age, it appears, when we are confronted with the limits of our own lifespan, we tend to home in on what is most important – our deep and abiding relationships with family and friends and the activities that bring us most meaning, joy, and comfort.
Tucked away in Professor Carstensen’s research on longevity is a gem of insight for development professionals. Simply put, the more we can remind people about the value of a life well-lived, about what brings meaning to their lives, and about what matters most to them, the more open they will be to considering supporting causes bigger than themselves. This is not to say, of course, that we should engage our donors in depressing and morbid discussions about the brevity of human life!
However, Professor Carstensen’s work should serve to remind us that our individual and unique perspectives on life and longevity impact our decision-making and behavior in profound ways. Perhaps our role as development professionals should be far less about asking people to support our cause and far more about inviting people to consider what lasting impact they want for their lives. Instead of asking questions to glean more about their financial capacity, it may be that encouraging conversations about what is deeply meaningful and gives purpose to their lives will more effectively trigger their generosity.
We often ask our donors questions about why they chose to support our institutions and organizations in the first place. Or, what they think about our proposed new program or facility expansion. And these are fine questions. But, first and foremost, they are questions about us, our institutions, and, our plans. If we would consistently turn the questions around and ask about them, as whole and complex individuals, we would pour the relational concrete for a strong gift-giving foundation. Questions like: “As you think back on your accomplishments, to what or to whom do you attribute your greatest successes?” Or, “Tell me about the most meaningful gift you’ve ever made.”
Not only will such an approach provide us with rich, deeply-personal information about our donors, it also gets them thinking about what and who is truly important to them and how giving is good. This approach also does something else that is powerful: It clearly communicates the message that, “your perspective matters to me. What is meaningful to you, is important to me.” And that message is what enhances trust between human beings.
It’s not a bad thing to be reminded that each of us has precious little time on this earth and that we should focus more on meaning and what matters most – people, experiences, and how our lives can leave a lasting, positive impact. In fact, encouraging others to reflect on this fact just may be critical to inspiring their generosity.
This week the U.S. House of Representatives and the Senate passed the much-discussed tax cut and reform bill, which focuses, primarily, on reducing corporate tax rates and re-organizing the individual tax code. In the charitable giving sector, non-profit leaders have expressed concerns that the greatly-increased standard tax deduction levels included in the bill – from $12,700 for married couples in 2017 to $24,000 in 2018 – will reduce the percentage of individual tax-payers who itemize deductions. In 2017, approximately 33% of tax-payers will forego the standard deduction and itemize, while estimates suggest that only 13% will behave similarly in 2018.
The reason this substantive decline in itemizing tax deductions concerns non-profit leaders is due to a belief that fewer itemizers will equate to fewer donors and dollars given away to 501 (c) 3 organizations. Put into question form, the clear concern is simple: If more individuals are not going to receive a tax “credit” for their gift, will they still be motivated to give?
It’s a fair and important question, to be sure. And while most analyses suggest that charitable giving will be negatively impacted by the changes incorporated within the new tax bill, I don’t believe this is the most concerning outcome of the tax bill even if it comes to pass. In fact, even if charitable giving should decrease by $10 billion or $20 billion as some analyses suggest, I still don’t believe this short-term result is the most concerning development related to this tax bill.
My deeper concern stems from a broader observation about policy and civil discourse today in our society. The tax cut and reform bill only evinces my unease, it is not the cause of it.
We live in a political and social context today in which there is no serious discussion about the role of philanthropy, the importance of giving personally, in support of the common good. Instead, we have treated all questions related to what makes a healthy, cohesive society as a binary choice: either the answer is government intervention or the answer is free-market capitalism. And while both of these institutions are critical to a high-functioning, free, and healthy society, they, alone, are not the full answer.
The U.S. has long been the world’s leader in generosity. On average over the last 50 years, Americans have given away approximately 2% of disposable income annually. No other country comes even close to that record of generous support. Historically, Americans have acted so generously in support of the least among us and in support of other communal concerns because of a broadly accepted ethos – that giving is good. That it is better to give than to receive. That being generous is a healthy, valuable, and esteemed trait in humans.
But this “generosity ethos,” is being questioned now more than ever during my lifetime. Politicians are questioning the appropriateness of gifts in support of educational institutions (and, now, through this tax bill, beginning to tax some college and university endowments). Additionally, in my consulting experiences, I’ve witnessed a rise in governing board members and other influential supporters pushing and jawboning non-profit leaders to seek “efficiency,” and “profit-making,” as if they were leading for-profit enterprises. In some settings, the non-profit mission itself is being called into question.
Quietly, I do not believe giving totals will be injured in 2018 because of this tax bill. I believe the analyses of this tax bill suggesting a negative impact over the short-term in charitable giving are wrong. Charitable giving, broadly-speaking, tracks very closely to market returns. So, if the financial markets continue to do well, charitable giving will probably fair well in 2018, and perhaps, for the next few years. Longer-term, though, I do have concerns. When the important role of personal giving is de-emphasized in our tax policy, we are heading down a pathway that leads not only to fewer Americans making charitable gifts, but more importantly, fewer Americans believing that they should.
This broader and longer-term loss of focus of what, truly, has made America great will be the impact of this tax bill that is most concerning to me. It’s not just our democratic government, and its not just our version of capitalism that has made the U.S. special. It is also our historically-agreed-upon “generosity ethos.” What has made and will continue to make America unique is an emphasis on helping each other, supporting those who have less than us, and, through our private giving, showing deep care for the common good.
This “generosity ethos,” though, isn’t a birthright. It must be nurtured and consistently reinforced. It must be taught throughout childhood. It must be modeled in communities. It must be celebrated by honoring generous individuals. And, yes, it must be affirmed in our fiscal and tax policies. When we consistently reinforce the “generosity ethos” in our families, our churches, our schools, our communities, and our political policies, we all benefit. Not only do those who need the care, support, and encouragement get assistance, but the givers are transformed too. It truly is better (and healthier) to be a giver than a taker.
Additionally, we end up being the envy of the world because we do not simply rely on either government or business to solve all our problems, to care for those who might fall through the cracks, or to enhance the communal experience for all. We have this third sector, this non-profit sector. This other beautiful, vibrant, robust, personal, and caring component of society which is supported in patchwork fashion by millions of generous people who are compelled to respond to needs larger than their own. The non-profit structure which encourages the expression of the impulse to help each other is as much a part of the American success story as is any political or business-related accomplishments.
So while many are focused on the short-term impacts of the tax bill on charitable giving totals, I’m not. What concerns me is not hearing any political, business, or other social leaders consistently and fervently raising the issue that we are in a longer-term trend of minimizing the role and importance of private giving to the health and well-being of our society. Over time, when fewer and fewer of us are encouraged to give in support of each other, we all lose. And not just financially. We lose what has made our society the envy of the world. We lose our capacity to relate to our common humanity.
This tax bill is not our primary problem, it’s just another expression of it.
As an advancement professional, you see the hackneyed phrase, “best practices” a ton. Professional development opportunities tout the teaching of “best practices” for this advancement function or that one. Members of your team may spend time benchmarking other shops to identify, “best practices.” Perhaps even you have sought or are seeking the silver-bulleted “best practices” as a way to immediately enhance your advancement results. Truly, it is a ubiquitous phrase in our profession.
But what if authentic, sustained advancement improvements and results come not from copying “best practices,” but instead emerge from how we think about our advancement work?
The problem with “best practices,” of course, is that what works for the university on the other side of town may not work as well for you. Or, activities which improved results at another organization could actually be detrimental to your advancement results. Every institution – each organization – is unique. Each has its own history, giving culture, greater and lesser strengths, leadership capabilities (and shortcomings), and donor interests. Each institution has its own opportunities as well as its own threats. So, as a profession, we probably should be critically questioning how beneficial the seeking of “best practices” really is for the progress of our individual advancement programs.
I’m not totally against “best practices,” mind you. Understanding the general idea of advancement “best practices,” can be helpful. As an example, learning what works for envelope teaser language in order to get the envelope opened is helpful. It’s just not what is most helpful.
I’m concerned that our profession touts “best practices” as some sort of “progress panacea.” “Do these 8 things,” the “best practice” elixir suggests, “and your online giving portal will produce more gifts.” “Best practices” provide guidance to our work around the edges of effectiveness. They do not represent the building blocks of longer-term success and enhanced advancement results.
Regularly, my encouragement to advancement professionals is to spend less time seeking “best practices” and far more time reflecting on “best thinking.” If you want to create environments in which donors give generously and consistently, here are 3 “best thoughts” to commit to memory and work by:
Being Generous is Good . . . for the Giver – When you really buy-in to the notion that giving is good for the giver, you will give strenuous scrutiny to gimmicks, give-aways, and other transactional maneuvers designed to raise money. You will put far more energy into creating compelling reasons and ways to invite donors into the wonderfully meaningful experience that comes with acting altruistically and generously. You will focus on your mission and why it should matter to more people in the world. And, you will bring a passion to your work that performance metrics and goals, alone, will never animate. Simply by looking at the strategies and tactics of some advancement programs, one would wonder what the leaders of those programs really believe about giving and generosity. I can assure you that the best, most effective advancement programs are led by people who fully embrace the truth that giving is good.
All Giving is Personal – Recently I co-presented at the Association of Healthcare Philanthropy International Conference with a dear friend, Tim Self, Executive Director of AnMed Health Foundation. As we were preparing for our presentation, Tim reminded me that years ago, I invited him to make his first “major” gift – an annual gift of $1,000. “Jason,” he said, “I’ll never forget the satisfaction I had in making that commitment and then bringing that gift to your office.” Here’s the rest of that story: I consider Tim a good and dear friend. And I have absolutely no recollection of inviting him to make that gift nor of his fulfilling it! To Tim that gift was beyond a “major” gift – it was meaningful – and that is all that really matters. The best, most effective advancement programs are led by people who fully embrace the notion of viewing all that you do through the eyes, ears, and perspectives of the prospective donor.
Educating Donors is Your Primary Role – Yes, you are supposed to use the art of inquiry to learn about prospective donors. Yes, you are supposed to listen actively to discern their interests and values. And, yes, are supposed to invite donors to give. But, eclipsing all of those activities should be a realization that you are an educator first. Educating donors on the need, on why they should care, on how they should make their gift, even on what amount they should consider giving. Too many in our profession fail to recognize their appropriate role in shaping gifts through donor education and, instead, are content to receive whatever gifts emerge from donor interactions. The best, most effective advancement programs are led by people who fully embrace the role of being a donor educator. And like all good educators, they lead. They encourage. They correct bad thinking. They challenge. And they do it with a deftness that inspires.
Cultivating habits of good thought in order to drive better practices should be our goal. When we embrace “best thinking” like the 3 examples above, we put ourselves and our advancement programs in the best possible position for long-term success and positive results. In the end, it will not be the employment of random “best practices” which will secure our success. It will be the employment of practices that are driven relentlessly by a habit of “best thinking.”
“It depends,” is a well-established, go-to answer for consultants, but that doesn’t mean it is an altogether unhelpful response. From leadership, to donor engagement, to giving history at the institution, successful campaigns do, in fact, “depend,” on numerous important variables.
One variable, though not often discussed, is exceptionally predictive of campaign success. It is what our firm calls the “believability factor.” This factor is important because it impacts the donor at the very beginning of the campaign process and discussion. It sets the stage for all future conversations and it colors all information, education, and engagement activities that occur through the cultivation and solicitation process. To understand the power of the “believability factor,” it is helpful to understand what, exactly, it is and how it works.
Campaign “believability” can be defined in two ways.
First, a campaign is seen as being “believable” if major donors, in general, perceive the proposed campaign dollar goal as achievable. The dollar goal may be viewed as a stretch for the institution, but, major donors must be willing to state that the stretch can be reached. If you were to ask major donors whether or not they believe a proposed campaign dollar goal is achievable, and you asked them to rate their confidence on a scale of 1-10 (with 10 being “high confidence in achieving the dollar goal”), you would want to see the scores around the 4-7 range. You certainly don’t want ratings of 1-3 as that would suggest they believe the campaign dollar goal to be a fantasy number. Conversely, you wouldn’t want to see scores in the 8-10 range as that would suggest that these major donors believe the campaign dollar goal is too low. When a campaign’s dollar goal is not “believable” – especially when it is viewed as being far too high – the institution runs the risk of turning off major donors from the start. Who would make a decision to give their best gift in support of a campaign they believed to be headed for failure?
The second way a campaign’s “believability” is understood by major donors is based on the campaign initiatives that are being presented. Are these initiatives viewed as being achievable by the institution should the money be raised? Is the leadership in place to deliver? Is the infrastructure present to support the initiative? Is the initiative viewed as a pipe-dream or as a logical next step for the institution based on its strengths and its strategic plan? If major donors perceive the institution to be “dreaming” recklessly, they will, again, be discouraged from making their best gifts.
Recently, I was with a higher education client in the process of preparing for a campaign. The president is a visionary with bold aspirations. He is an advancement leader’s dream but he can also be viewed as being a bit too ambitious with major donors expressing some measure of skepticism at his plans and aspirations. His initial instinct was to propose a campaign dollar goal that was far and away larger than anything ever considered by the institution. As I shared with him the importance and power of the “believablity factor,” he responded, “So, we need our campaign dollar goal to be a number that encourages each of our major donors to see how their stretch gift can help us achieve that goal.”
“Exactly!” I said, “your major donors know they are at the top of your giving pyramid. So, if they can’t imagine how their gift helps you significantly reach your proposed dollar goal, they won’t be inspired to give significantly.”
The aspirations we have for our institutions should always be filtered through the lens of “believability.” When we get it right, we encourage the best gifts from our best donors. But, if we get it wrong, we discourage them. And that may not be easy to reverse. |
Update : 20 July, 2016
20 July, 2016
Whew. It's done !
The two major lists of players have been consolidated (a separate list of players in British Columbia has been combined with our basic list which has been the main focus since we began the exercise more than 15 years ago). The Basin League (South Dakota-Nebraska) list remains a separate entity.
The first task, however, was a huge update of hundreds of new entries, mainly from BC and Manitoba. In total, we now have 45,389 different players listed. Duplication of player entries remains a concern, but with so many identified during their playing days only by last name or having various spellings of their names, it likely will remain a challenge for years to come.
Among the benefits of the updates is the discovery of another pair of major leaguers, Ike Rockenfield and Jerry Freeman who suited up with Vancouver teams back in 1902 !
The lists, divided into decades, are available on the Players Page. There is a separate page with the codes for all the teams.
26 June, 2016
Cann or Cant? That's Hec Cann or Hec Cant. That's second baseman Hec Cann or second baseman Hec Cant playing in the early 1920s in Vancouver area baseball.
At first glance it seemed like an obvious duplication. It must have been either Cann OR Cant. But - they are listed with different teams. Cann consistently with Vancouver city teams. Cant with the BC Box club out of New Westminster.
Sorting out that one (turns out there were two players, a Cann, left, and a Cant, right) has been among the challenges in a major task of trying to update all the roster sheets, THEN combine the now separate BC roster listings with the main data run. This could take most of the summer.
Anderson, born in Detroit, was just a few months old when his family moved to London, Ontario. With his dad and uncle deeply involved in baseball, Anderson learned the game on London's playgrounds. He was good enough to win a pro contract in the United States.
After five seasons in professional ball (including time in the New York Giants and St. Louis Cardinals systems) and two years in military service, Anderson became a fixture in the Intercounty League 1957 to 1966 with the London Majors, a six-time, first-team, all-star. He was a batting champion, MVP and league-leader in home runs and runs batted in.
Gordie Howe passed away June 10th, at age 88. Howe, celebrated as Canada's greatest hockey star, was also quite the ball player with Saskatoon clubs in the late 1940s and early 1950s (until barred from baseball play by the Detroit Red Wings). Howe, a close friend of Detroit Tiger star Al Kaline, used to take batting practice at Briggs Stadium with the Tigers.
We received a note from CJNB Radio in North Battleford, Saskatchewan requesting information and an interview on Howe's baseball career. We put the station in contact with Charlie Beene, a Howe teammate back in the 1950s. Charlie, a wonderful story teller, had some great memories of their times in Saskatoon ball.
(Geoff Smith, the News Director of CJNB, in noting our connection with the station back in the day, sent along a photo of Eldon Elliott, the long-time sports announcer and play-by-play man at the station during the days of the Western Canada League.)
Great to hear from fellow baseball researcher Gary Fink, who provided us with his very impressive work into players in the ManDak League, especially his effort to trace those Negro Leaguers in the Manitoba-Dakota circuit. Gary had a great question. Who was the first Canadian black player to be signed by a major league team? Well, Manny McIntyre (better known for his hockey prowess) was playing in pro ball just months after Jackie Robinson broke the colour barrier in professional ball. But, seems McIntyre was signed by Sherbrooke, Quebec, a minor league team. Stan Anderson, was born in the USA, so doesn't qualify, so perhaps the answer is Fred Thomas, the all-around athlete from Windsor, who was in the Cleveland system in 1948.
So far we've been unable to confirm whether Frankie Crosetti, the famous Yankee shortstop, suited up during his teenage years for Cumberland on Vancouver Island. The Cumberland Museum and Archives has come up empty trying to find anything in its catalogue to make the connection. We'll continue to search out the local papers for more clues. My neighbour is clear that his dad had mentioned playing against Crosetti in the late 1920s. The lone possible confirmation so far is a story in the Nanaimo paper saying Crosetti, in his early teens, played with Cumberland teams.
It was an unexpected joy to unearth a good photo of the 1926 BC champion Rossland Miners. We had been trying, without much success, to make presentable two newspaper copies of the photo. A chance contact with the Rossland Museum & Discovery Centre resulted in an actual photo of the team. There's still a little work to do in clarifying some of the names (the newspaper caption and the names provided in the Museum photo show some differences.
Among dozens of other things, ace reporter Rich Necker has dug out one more year of Charlie Miron's batting statistics, filling in season 1927. So, we are now missing just 1920 and 1935 of Miron's brilliant career in Vancouver baseball (see below). Between 1921 and 1932, his lowest batting average was .302, winning the batting crown five times and finishing as the runner-up twice.
Also, Mr. Necker has discovered this story on Don Stewart, the former Vancouver star of the 1930s. It is part of Gary Bedingfield's outstanding series on players who served in the military, including those like Stewart who died in action.
Once again our thanks to David Eskenazi, the Seattle sports historian-author-collector, for information on Washington ball. Our question this time was on Edward "Babe" Barberis and Floyd "Babe" Barberis. Both were showing up on our lists in the 1920s, 30s and 40s as playing for the University of Washington, semi-pro clubs in the state, a touch of pro ball and on teams in Vancouver. Turns out they are one and the same.
Big thanks to Lou DeRosa for sorting out the Trail "Mystery".First it was confirming it was DiPasquale and not DePasquale on the Trail, BC team. Next, validation that the nickname "Mystery" was indeed used for DiPasquale. And, finally, that Bill was his real name. Yes, Bill "Mystery" DiPasquale. We have yet to discover the nature of the "Mystery".
Old friend Jack Altman brings news of a book by former Vulcan, Alberta hurler Steve Cottrell. It's called Bartoli's Burden, available at Amazon. Jack says it was a really good read, as Steve blends fiction and fact.
Gino Bartoli enjoyed a brief stint as a weak-hitting Major League reserve infielder, followed by a long career as a scout. Retired and living in Nevada City, California, he meets each Thursday with his good pal Paddy Hannigan to drink and talk. Lots of drink, lots of talk. Indeed, Bartoli is a charming braggadocio who never lets truth (or a box score) get in the way of a good yarn –– but one day he slips and mentions a teenage pitcher he discovered in Alaska in 1963. When Paddy hounds him for more information, a lifetime of lies––some harmless, some not––begin to squeeze in on Gino, and he decides to record the truth of his life. For Paddy's eyes only. But secrets as dark as Bartoli’s force Paddy into the unavoidable dilemma of protecting or exposing his good friend.
Brian Morrison, Diamonds in the Dusk, is at it again ! He's unearthed this little gem from the Manitoba Free Press of June 18, 1880. Yes, 1880. Front page too.
MUD-TURTLES VS POLLYWOGS
Hooray ! Hooray !! Hooray !!! Once more has victory perched herself on the banners of Winnipeg's sporting men and she means to stay there. The long-looked-for and much-talked-of baseball match between Van's Mud-turtles and McDowell's Pollywogs took place yesterday afternoon at Dufferin Park in the presence of a vast concourse of spectators. When the teams showed up on the ground the Turtles struck terror to the souls of the Pollywogs from their massive build, and well-developed muscles, the distinguished foreigners put on as bold a face as possible and went to the bat determined to do or die, and now, if they keep their words, they've got to die, and that pretty suddenly. Notwithstanding that McDowell's crowd were picked from all over the United States and Canada, our little phalanx of base ball bangers has scooped them. The match was pretty close, and the score is estimated at all the way from 9 to 7 down to 2 to 1, but notwithstanding this little discrepancy all parties concede that the victory was ours. The Winnipeg team was comprised of Van in the pitcher's square, with Billy Dick behind the bat; Mell Wood was short stop, while Doc Lockhart, Frank Myer and Dave Martin bossed the first, second and third bases respectively, and Andy Colquhoun, Ham McMicken and Johnny Rossiter went leather-hunting in the long grass. The intruders were distributed something after this fashion : Will McDowell threw the ball at Harry Reeves, and Harry threw it back, with Billy Tough as short stop, J. H. Stuart, Charley Arnold and Fred Bryton made three rattling basemen, while they had Clarence Handyside, Mark Abjon, and Alex. Stuart leather hunting, while Mell and Van punched the ball in their direction, and Selwyn sat on the fence and shouted "Bravo!" The playing on both sides was remarkably good, but were are unable to give the exact score, as Frank Masonville and Cooper, the scorers, are in doubt as to where the score sheet is, but they think it was blown away with the cheers at the wind-up. A return march will be played next Wednesday.
Momoko Ito, of great assistance to us, especially on New Denver and Asahi baseball, when she ran the Nikkei Internment Memorial Centre in New Denver, has put us on a search for information on a Japanese team from Steveston. The Steveston Fuji were a force in the Vancouver area in the 1930s. If you have any information on the team please drop us a line.
01 June, 2016
Ooops. A paragraph missing from the earlier post & also note of an additional page, a photo of the 1926 Vancouver Asahis.
In the story of the Tesreaus, there is quite the coincidence. As Jeff Tesreau was going through his minor league experience his catcher in the old Three I League was a top flight receiver called Tubby Graves. And, years later, in 1926, as Elmer Tesreau, Jeff's nephew, began his college pitching career, his coach was ... Tubby Graves.
31 May, 2016
Wow. Our dynamic duo of Rich Necker and Henry "Red Eye" Ropertz have put 1926 British Columbia baseball in the books. With their latest discoveries, we've posted game reports for Vancouver and the Lower Mainland (Vancouver Senior City League, Terminal League, Twilight League, New Westminster & District League, Howe Sound League and the Senior "A" playoffs), Vancouver Island (Victoria Senior Amateur League & a few Nanaimo games) and the BC Interior (West Kootenay ball).
Along with the game reports, come the rosters and those illusive statistics. The material highlights some of the premier players of the day, noting the outstanding achievements of such guys as Jack Noble (right) who dominated the Victoria circuit winning the batting title, home run crown and was the leading hurler.
In the Vancouver Twilight League, Dave Gray not only finished in the top ten in hitting but topped the hurlers with a 15-3 record, including 12 or 13 straight wins to end the season. Young (probably still a teenager) Roy Yamamura (left) already was a star for the Asahis of the Terminal League. The diminutive shortstop was fourth in hitting with a .367 batting mark, led the league in runs, 35, hits, 33, and stolen bases, 37.
Charlie Miron (right), of the Vancouver Young Liberals was back as the top hitter in the league for the third time in six seasons, finishing a .375 average. (We've also located the Vancouver Senior League stats for 1922 when Miron hit .365 to leave just three seasons of Miron's career undocumented - with the below update, further updated.)
The 1926 search also provided a photo of the Trail, BC club of that season (although we have one of those "five players, six names" situation in trying to make the player IDs) and a photo of the 1926 Nanaimo Tar Flats (no names yet). And, as usual, we've made some additions to the Photo Gallery, including a couple of players from the University of Washington who also suited up for Canadian teams - catcher Gene Walby (below right) and shortstop Louis Tesreau (left).
Louis Tesreau's brother Elmer (below left) was a pitcher/outfielder for the college team. And, both brothers were also stars for the the college's football team. The Tesreau's uncle, Jeff, was a major league hurler with an interesting story.
After some eye-opening seasons as an amateur, Jeff Tesreau got into pro ball in the St. Louis Browns minor league system and then was picked up by the New York Giants. Having learned to throw a spitball, Tesreau became one of the league best hurlers going 17-7 with a league-leading 1.96 ERA (beating among others, Christy Mathewson) and a no-hitter in 1912. He remained a rotation star with the Giants through 1917. In 1918 he had a argument with manager John McGraw (Tesreau apparently refusing to inform on the off-field acitivites of his teammates) and quit the team in the middle of the season, never to play pro ball again. Tesreau took up the coaching reins for Dartmouth College and held that position until his death in 1946.
And, a few bits and pieces added - photos of Ralph Stong and the Telosky brothers to the 1935 Snapshot page and, courtesy of Kent Morgan, the cover of the schedule for the Greater Winnipeg Senior League to the 1949 home page.
27 May, 2016
As we dig more and more into baseball in British Columbia, we find more and more evidence of the star quality of such talents as Charlie Miron, a feared hitter who suited up with eight or ten different teams during a career which ran from about 1919 to 1937. Now with game reports and statistics from the 1926 Vancouver summer from our ace researchers/reporters Rich Necker and Henry "Red Eye" Ropertz (more on Henry below) we show Miron as the batting champion of 1926, just one more lofty achievement for the superb swatter.
Even though we're still missing information on three years of Miron's career, the talented flychaser (and sometimes 1B-2B-3B) won five batting titles, finished second twice and was third on two occasions. His best mark was .462 in 1921 with the Vancouver Province nine.
Game reports are now posted for the 1926 Vancouver Senior League and the Vancouver Terminal League along with rosters and statistics. (We've also added Vancouver Senior League batting stats for 1923.) There are also rosters for the Toronto Ossington League of 1926 and a couple of Manitoba game reports for 1924 (which featured starts by the celebrated small town hurler, Harold Nelson).
Henry and Rich also chased down more individual photographs which we've entered in the Vancouver Photo Gallery of 1926 and the Snapshot page of 1935. In addition, the gang has discovered a newspaper version of a team photo of the Rossland Miners, the BC Senior A champions of 1926.
That's Red Eye Ropertz (left) in a classic pose at the ball yard, eyes intently studying the action, scorecard at the ready. (It took more than a bit of prodding to get a photo and a little background out of Mr. Ropertz) :
My career begins and ends with baseball. I grew up in Moose Jaw, Saskatchewan in the 1950's. We were lucky to have had the opportunity to watch, cheer and appreciate ball players from all races and culture. as a youngster I was the bat boy for the visiting Delisle Gems. This team featured the brothers Bentley, Doug and Max of NHL fame. Incredibly I got paid for doing something I loved. Incidentally, I aced that job away from one of your correspondents, Rich Necker, who lived closer to the ball park than I did. During the dog days of my career I was able to earn a Ph.D. in Transportation from U.B.C. And lectured at several universities. I also worked as Policy Advisor To The Government of Canada and spent several years in Ottawa. In the later stage of my career I am the unofficial and at times the official scorer of The Regina Blue Jays. That team features my favourite Nephew Jake Vorrieter.
We are happy to discover that about ten years ago, Red Eye was among those to protest a decision by Ottawa to name a government office building in Vancouver after Howard Green, a former Conservative cabinet minister and MP for Vancouver. Turns out Mr. Green had strongly advocated excluding all Orientals from Canada and was a strong supporter of the internment of Japanese-Canadians and the seizure of their fishing boats and other assets during the Second World War. Green was not shy about publicly stating his anti-Japanese sentiments, time and again. Eventually, the government reversed its decision and named the building after Douglas Jung, a prominent Chinese-Canadian politician.
OK. Mystery time. Craig Smith has come across a belt buckle inscribed "Meril Huth Home Run King. BC Interleague 1923". I've managed to find some Huths playing in Chilliwack in the late 1940s and 1950s, but nothing on Meril so far. If you can help ID this player please drop us a line.
If you are in the Winnipeg area, look for a piece in the local community papers on the all-time Manitoba dream team. Kent Morgan has an item in the papers in advance of the Manitoba Baseball Hall of Fame dinner on June 4th. Bob Elliot, superstar baseball writer of the Toronto Sun and Canada's strongest supporter and chronicler of Canadian minor baseball talent, is to be the guest speaker at the gathering.
Jeff Wylie is searching for information on his father - Earl Alexander Wylie - who played in Edmonton (Lions?) in the 1950s (1953 a likely specific season). This could have been junior or juvenile ball.
Reed Clarke is looking to start an apparel company based on the teams of the old Western Canada League in Alberta, Saskatchewan and Manitoba during the early 1900s. He's looking for images of the uniforms of the era, especially anything in colour.
From Barry Forster comes this neat photo (distractify.com) of Jackie Mitchell, the woman who struck out both Babe Ruth and Lou Gehrig.
Mitchell - Virne Beatrice "Jackie" Mitchell Gilbert - was one of the first females in pro baseball. In 1931 she was on the mound for the Chattanooga Lookouts in an exhibition game against the Yankees. And, indeed, both Ruth and Gehrig fanned.
There is, however, some continuing doubt about the event, a hint that it was a staged performance.
Check out the piece in the July 2013 edition of the Smithsonian MagazineThe Woman Who (Maybe) Struck out Babe Ruth and Lou Gehrig.
Surfing the Victoria and District Baseball Association site I became aware of the passing of long time BC pitching star Bill Prior who died April, 2015, at the age of 92. The right-hander played amateur and professional ball over a two decade period from the mid 1930s to the mid 1950s. Inducted into both the Victoria and BC Sports Halls of Fame, Prior was a member of the Victoria Tyees, the 1952 Western International League pennant winners. He went on to coach minor baseball for another twenty years.
OK, you see the pitching line of 17 strikeouts, 11 walks. A name that might come to mind is Steve Dalkowski (who once had a game with 24 Ks and 18 walks). Nope, it's Bill Bell. And, you might be surprised to learn that game was a no-hitter, the first of two, back-to-back no-nos for Bell. Check it out at Brian Morrison's, Diamonds in the Dusk.
10 May, 2016
He's in the Canadian Baseball Hall of Fame having grown up in Toronto and learned his baseball fundamentals on the playing fields there, but the former Chicago Cubs catcher is not recognized as one of the Canadians who've played in major league baseball.
The story of Jimmy Archer has emerged from Rich Necker's research into early 1900s baseball in Manitoba. Rich found some material on an outstanding Canadian pitcher of the day, Bert Orr, and in trying to find more material on him, I uncovered the wonderful story of the kid who almost lost his throwing arm in an accident but turned misery into major league success.
"Catchers of the past have been called famous for their wonderful throwing to second base, their excellent receiving and their ability to steady pitchers. Kling was noted for his cleverness in helping a twirler when he threatened to blow up, but Archer surpasses any that I have ever seen ... There are many backstops who have arms like steel and can peg to second like a shot, but they cannot do the same to the other bases. Archer can, and that is what makes him a star ... he does it gracefully, without much effort and in a manner that is likely to catch the fastest runner off his guard."
An extensive feature carried in newspapers across the US in 1912 (and later) carried versions of the headline, "Here's the Greatest Backstop in Baseball".
"Jimmy Archer behind the bat is the personification of athletic grace. It is worth the price of admission alone to see him work. Fully three quarters of the time he squats on his heels, firm as a deep seated rock ... Backstopping literally means the receiving of the pitcher's delivery. In this special line ... Archer has no equal. But his resources do not stop there. His peculiar catching attitude seems to be admirably adapted to perfect throwing. Archer is a deadly marksman. Either standing or squatting, he can peg the bullseye at any cushion 99 times in 100. His throws snap out with rifle like velocity, but his greatest adjunct is the faculty of getting that throw away at once ... He never draws back his arm; he shoots the ball with a snap ... Let a man stray two feet beyond safe ground at any base and he's dead as a door nail." [The Oregon Daily Journal, August 18, 1912]
Archer, who honed his craft with the Wellingstons in the Toronto City League, says an accident at work, in February of 1902, turned out to be the reason for his success.
"While working at my trade as a cooper, I fell into a vat of boiling oak sap. All the doctors who looked me over decided that I’d lose the use of my right arm and wanted to amputate but that wing still looked good to me even in the condition it was ,,, when the arm began to mend I found that outside of a shortness of about two inches and an unnatural curve I was almost as good as new ... the two inches I had lost by the tightening of the cords in my arm made it almost impossible for me to throw overhand. I had to get the ball in the best way I could and soon discovered that what is now called the ”snap” or “flat-footed” throw was the easiest for me ... All that Winter I worked with my arm and by Spring I had got so I could snap the ball in any direction without moving from the position I was in. I practiced throwing from every angle I could possibly get into." [San Francisco Chronicle, May 25, 1913]
During his three month stay in hospital, the 19-year-old Archer received an offer from a former Torontonian who had gone to North Dakota to manage the Fargo nine. For $80 a month, Tommy Reynolds wanted Archer to join the Northern League team. He was unaware of the accident and Archer delayed replying. It appears that was viewed as holding out for more money and soon the offer was increased by $20 and Archer accepted. Placed in the outfield, Archer had a tough time and, with some money problems as well, he decided to leave the team for Virden, Manitoba where he played for the rest of 1902 and a portion of the following season.
He made his major league debut at age 21 with Pittsburgh. In 1909 he began a nine-year run with the Chicago Cubs. Over 12 seasons in the majors he compiled a batting average of .249. He was inducted into the Canadian Baseball Hall of Fame in 1990.
Snippets on Bert Orr (left) and Archer are featured on the new 1902 home page. Orr was a local boy (Virden) who traveled up and down the rail line (and occasionally over to the North-West Territories and even south of the border) as a hired gun for those teams with the assets to reward the import hurler.
Often, Orr and his battery mate, Archer, came up against a duo pitching for Winnipeg, Cox (far right) and Baerwald (near right). The pair had been brought in from a league in Minnesota. Turns out, Cox is the same Eugene "Chesty" Cox who went on to play with just about every team in the Western Canada League (Winnipeg, Regina, Calgary, Edmonton, Lethbridge, Moose Jaw and Bassano) in later years. And, that was Charles Baerwald (often spelled Bearwald) who advanced to pro ball for a half dozen seasons.
Weird advertisement in the The Globe, Toronto, March 18, 1903. This would be around the same time that Jimmy Archer is playing in Virden, Manitoba.
WANTED -- A TINSMITH AND TAILOR -- good wages: steady situations; must play fast amateur baseball; other situations open for good baseball players; no expense to play ball; team holds championship of Manitoba and Northwest Territories. Address correspondence to E. H. Garrison, Virden, Manitoba.
Thanks to Rich and Henry Ropertz there is much new material, including the 1901 home page with game reports from Manitoba, British Columbia and the North-West Territories' districts of Alberta and Assiniboia. Of course, the rosters page has been added to reflect those games and there is even the beginning of a 1901 Photo Gallery.
To provide some context for the early days of baseball in the West, we've dug out some of the population figures from the 1901 census. Montreal was the country's biggest city with a population of 266,826. Toronto was second with 207, 971. Winnipeg was the 6th largest (42,336) and Vancouver 12th (26,196). Calgary had just 4,398 and Edmonton 2,625. Surprisingly (and we are getting these double-checked) Nelson, BC, was shown with 4,610 people and Rossland 6,138. Kelowna was down at 375 residents. The Nelson-Rossland figures might represent the heavy interest in mining (gold, silver) during the heady "rush" days of the late 1800s and early 1900s.
We jumped the gun a bit with the posting of the material on the barnstorming Toronto Oslers. Henry had more information in a package which just arrived and we've added much more to the Oslers' sections. Turns out the Oslers tour was even more impressive as star shortstop and power hitter Joe Breen was unable to make the trip.
Frankie Crosetti, the famous New York Yankee shortstop may well have launched his baseball career in Canada, playing for Cumberland on Vancouver Island. My neighbour had mentioned long ago that his dad (a member of the Cumberland-area team, Royston Lumber) had played against Crosetti in the 1920s. Now, Rich has discovered a clipping from the Nanaimo paper which says Crosetti did indeed play in Cumberland. Apparently, he was too young (probably in the area of 14 to 16 years of age) to take a regular turn with the senior club. He later moved to San Francisco where he began his pro career at age 17. He joined the Yankees in 1932 at age 21 and played for 17 seasons.
Where does he find these things? Brian Morrison, Diamonds in the Dusk., has this UPI story from 1924.
OSSINING, N.Y., Saturday, May 24 -- Baseball players and fans among the convicts at Sing Sing penitentiary were made happy by the return to their midst of Joe Ryan, former star pitcher on the Mutual Welfare League team here. Sing Sing hasn't won a game since its crack moundsmen was released a few weeks ago. Ryan, however, has just started a new sentence of seven years for carrying a loaded revolver and will be out for practice shortly.
28 April, 2016
If the newspaper reports were even close to accurate, Joe Spring (left) was one heck of a pitcher.
Has been pitching ball since he was 15, and for the last 11 years has been the best right-hander in Eastern Canada, and still king of all cross-fire and curve ball flingers. In his long career he has been knocked out of the box once - a remarkable record. (Vancouver Sun)
Spring was the ace of the Toronto Oslers who, in 1926, again set out on a tour of Western Canada to show the country the Oslers were the best of the amateur teams in the nation. Although the club didn't field its full "A" team - star shortstop Joe Breen was unable to get away, shortstop and utility man Percy "Pucker" Reid didn't make the trip as he had just been married and headed out on the honeymoon, Spring injured his pitching hand in the third game of the tour, centre fielder Harvey Dodds suffered a hand injury and pitcher Charlie McCay had a sore arm. Nonetheless, the Oslers won ten, tied one and lost just three on their fourteen game adventure, which included a triple-header in Winnipeg.
Thanks to our ace researchers/reporters Henry Ropertz and Rich Necker we've pieced together the Oslers 1926 tour, game by game, and managed to uncovered a few photos along the way (including a newspaper team photo).
Other additions to the site include - rosters from the teams on the Oslers 1926 tour, rosters updates for 1930, statistics for the 1925 Victoria Senior League, rosters for 1900 and (thanks to Mr. Necker, the former batboy for the Florida Cubans) a correction to names in a 1952 photo of players on the Cubans.
Through the work of Bernie "Daniel" Wyatt (check out his incredible work at High on History) the Broadview Buffaloes of 1936-1938 have been selected for induction into the Saskatchewan Baseball Hall of Fame in the 2017 ceremony. We're now on the outlook for any descendants of the Broadview players of those seasons. Here is a list we have of the Broadview players :
I continue to be amazed at the wild and weird stories Brian Morrison manages to dig up for his Diamonds in the Dusk. How about striking out but still scoring a run, on the same play. Check out the piece on Jack Onslow.
26 April, 2016
The Saskatchewan Baseball Hall of Fame has announced the lineup of those to be honoured at the 2016 induction ceremony Saturday, August 20th at Battleford, Saskatchewan.
It's a big day for my old hometown as Lloydminster is the honoured community and Leo Wurtz (left) of Lloydminster is among the individual inductees !
It promises to be quite the party in August as 14 individuals will be inducted including Bev Hickie (below left, Melville Millionaires 1960s and 1970s), the late Doug Dodd (centre, lefty hurler for North Battleford, Lloydminster, Saskatoon, Biggar 1950s & 1960s) and Terry Buck (right, Mellville and Swift Current, 1960s & 1970s).
Three teams are to be inducted, the Leader Barons Senior team of 1961 to 1983, Viceroy 1946 to 1975 and the Marysburg Royals Senior team featuring the Strueby family. The family to be saluted this year is the Lloyd clan of Swift Current.
18 April, 2016
Back, back, back ... way back ... sounds like an announcer's call of a home run. Nope. That's just our Rich Necker digging through the archives for baseball news in the year 1900. There was skimpy coverage of the "American game" but the papers of the day did manage to squeeze in the odd game report. Although the items often made you wonder about the reporter's familiarity with the game. This was part of a report in the Edmonton Bulletin of September 3, 1900.
Notwithstanding their defeat, the Leduc players put up an exceptionally strong game for so new a team. F. Garrow, their pitcher, won the commendation of opponents and spectators alike for his very effective work. G.Hardy, who captained the team and played short stop, also did good work. (Edmonton Bulletin clipping of September 3, 1900)
F. Garrow, "very effective work"? He gave up 27 runs ! Yep, as you'll see in the game reports we've posted, Leduc lost to Edmonton 27-13 !
A note from the granddaughter of former Calgary player Woody Huckabay spurred me to action in posting more of the individual pictures of the Calgary players of the Big Four League in the 1949 Alberta Photo Gallery. There are also a few additions to the Alberta Snapshot page of 1949. In the research process, I believe we have made a connection between the Calgary Huckabays and two or three who played in Aberdeen, Saskatchewan, in the 1930s. And, we've confirmed it is Huckabay,not Huckaby.
11 April, 2016
Eddie Olson was Mr. Big as New Westminster's Fraser Cafe roared through five playoff series to capture the 1925 Interprovincial (BC-Alberta) Senior Amateur championship. Olson (described as a veteran even back in '25) hurled in 31 games, 27 starts, in running up an 18-7 won-lost mark. He went 12-3 in playoff action, despite a broken rib suffered in the first playoff series against White Rock.
Olson's marvelous season is among that detailed in the 1925 BC game reports from ace researchers and reporters Rich Necker and Henry “Redeye” Ropertz. The reports cover the Vancouver Senior League, Vancouver Terminal League, Vancouver Twilight League, New Westminster & District League and the various playoff challenges. The updated 1925 rosters reflect the new game reports.
We don't know a lot about Olson. He first shows up in our records pitching the Hammond Cedars to the provincial title in 1924, moving on to Fraser Cafe, the New Westminster Royals, Fraser Cafe, a Vancouver team, back to Fraser Cafe then to the Imperial Oil Imperials (IOCO) in 1935. That's our last trace of him. The photo above is actually from 1935 when he suited up with IOCO (the Terminal League champions).
The 1925 BC Photo Gallery also has a couple of new photos with Harry Copas and Mattie Malcolm now included.
Speaking of IOCO, we've now posted the rest of the individual photos of the 1935 champions (having earlier made mention of the photos of the Telosky brothers (Andy, George, Pete and Sam) four key members of the Imperial Oil club.
IOCO had a storied final series against the famous Asahis and fell behind three games to none before roaring back to win four straight to take the championship. The Imperials had three, THREE, no-hitters in that final, losing one of them. That's pitcher Reg Jowett (left) and third basemen Scotty Knox (right).
There's an addition to the Manitoba rosters (Neepawa, Virden and Sperling) for 1926. One of the names in the Sperling lineup ("Smokey" Harris) looked so familiar I took a second look. I'd guess this is the same Harris who played with Virden later on and moved on to Saskatoon and Calgary in the 1930s, but probably not the Smokey Harris who lineup up with Courtenay in the mid-30s.
The identities of the players in the team photos of the 1930 (and perhaps 1929) Brandon Greys of Manitoba baseball are proving illusive. While only one player has been identified thus far (Cliff Corey) we have begun to try and match up the faces, even without the names, in the two photos.
We are sadden to hear of the declining health of another former Western Canada player. Modie Risher was quite the attraction on the 1957 edition of the Lloydminster Meridians. The chatterbox catcher-utility man ensured a lively, entertaining ball game.
Risher joined boyhood buddy Curly Williams on the Meridians for just one summer before returning to Charleston, South Carolina to launch a teaching career which lasted more than three decades. His honours and awards are numerous and substantial. In 2009, a resolution in the South Carolina House of Representatives noted his outstanding career and political activism. Modie is 87 years old.
06 April, 2016
Former Negro Leaguer and Eston, Saskatchewan, Rambler Ted Toles Jr. passed away Monday at the age of 90.
Toles was among the few survivors of the Negro Leagues, which began to fade away with Jackie Robinson's integration of the Major Leagues in 1947.
Toles was the subject of a lovely little book, Living on Borrowed Time : The Life and Times of Negro League Player Ted Toles Jr., by Michael Swank (right) who sent along the sad news of Ted's passing. Toles and life-long friend, Joe Caffie*(who progressed to MLB with the Cleveland Indians) suited up for Eston in 1950.
I had one heck of a summer, played against many hockey greats, the Bentley brothers, Emile Francis, Bert Olmstead and of course, Mr. Hockey, Gordie Howe!
The country side was beautiful and the people were so genuine. There was no racism, no negative comments, just good old fashioned gags and baseball pranks to be had with all!
Signed by Cleveland, Toles played three seasons in the minors, including one in Quebec's Provincial League with Trois-Rivieres and St. Hyacinthe.
Nearly a dozen individual photographs have been added to the 1937 Manitoba Photo Gallery, all of members of the St. Boniface Native Sons. That's first baseman John Lawton (far left) and catcher Armand Leveque (near left).
St. Boniface, now part of Winnipeg, was a powerhouse in Manitoba baseball.
Also with Manitoba ball, we salute the umps too. We've begun a 1926 Manitoba Snapshot page with a newspaper photo of umpire Walter Jansen. And, thanks to Rich Necker, we have Manitoba game reports for 1926.
We've added another team photo of the Brandon Greys of 1929-30. Being able to provide the names is a whole other story.
From British Columbia, we have posted another of those marvelous photos from Powell River baseball in 1914.
Rich Necker, with assistance from Henry “Redeye” Ropertz of Vancouver, has filled in more BC material with game reports from the 1925 season of the Victoria Senior League and some other Island baseball. In conjunction with the game reports, the 1925 roster page has also been updated and we'll soon add the 1925 stats.
29 March, 2016
36 wins, 1 loss in pitching all of his team's games ? The story of Harold A. Nelson of Carberry, Manitoba reached far and wide. In 1929, he was even featured in Ripley's Believe It Or Not, a highly popular item syndicated in newspapers across the United States and Canada (and maybe even overseas).
Nelson's incredible 1924 season (25 straight wins, a loss, then 11 more wins) was among the information in a recent dispatch from our Rich Necker. The right-hander's exploits earned him a coveted spot in the Manitoba Baseball Hall of Fame. Curious about the details, I contacted Joe Wiwchar, manager at the Morden, Manitoba HOF. Joe was kind enough to copy and send some of the Nelson material. While we remain interested in tracking down the specifics of that 1924 season, in particular, we are pleased to have some details on what prompted his inclusion in the HOF.
In a 1943 item in the Winnipeg Tribune, Nelson revealed the actual story noted in Ripley's tribute was even more mind-blowing.
Pitching for Carberry "somewhere around 1924" he completed three games in a single day at a tournament in Plumas, Man. moved on to Oak Lake the following day to pitch another four. His record for those seven was five shutouts and 84 -- not 80 -- strikeouts.
Nelson pitched another three games the next day in Cardale. Of the ten tricks on the mound, he lost only the last one.
He grinned, recollecting the ordeal. "I was getting a little tired toward the finish."
Wow. Ten games in three days !
One day, we hope to take up a kind offer from Kathy Carr of The Carberry News-Express to go through the old editions of the paper to try and find reports on his career.
As news spread of Nelson's achievements, he received an approach from the New York Giants to attend a training camp but had to decline given his responsibilities on the farm. One season, 1926, he was banned from pitching in a local league because he was just too good.
Nelson was inducted into the Manitoba Baseball Hall of Fame in 2001. Of course, the Nelson photo has been added to the 1924 Manitoba Photo Gallery.
And, it's always a treat to find statistics. Mr. Necker has been busy digging out the numbers for 1925 for the Vancouver Senior League, Vancouver Twilight League, Calgary Senior Amateur League and Winnipeg Wesley League. And, with the help of colleague Henry Ropertz we'll soon add some 1925 stats for the Victoria loop as well.
Of course, along with those 1925 game reports, the 1925 roster page is updated as well.
There are lots of new/revised individual photos posted in the various photo galleries, including some corrections (name reversal, players misnamed). Included here are :
The 1955 Manitoba Snapshot page also displays a couple of additions, including catcher Bruce Hudson and pitcher Art Tooth.
A Hammond, BC team photo (1925-1927 squad) has been re-posted after going AWOL due to some mysterious circumstances.
A note from Warren Hall (asking about some missing names from the Major Leaguers pages) prompted me to search out information on Joe Kutina, the former St. Louis Brown first baseman, who ended up in the Rimbey area of Alberta in 1917 just five years after playing in the majors. Joe and two brothers moved from the states in the hopes of establishing a farm in Canada, but poor conditions forced their return to the USA just three years later. Although we've been unable so far to confirm the Kutinas playing in Alberta, a local history book is clear the Kutinas played ball for Rimbey (and, on at least one occasion, Edmonton).
In the book, History of Rimbey, Alberta : golden anniversary, 1902-1952, the authors note that suddenly near the end of the 1910s Rimbey and the surrounding area began to boom and settlers poured into the new province.
Among these were J. Lethbridge, the first manager of the first bank in Rimbey. This boy was a real ball player, and with his coming, it seemed to open the doors to a tide of talent. Then came the Connellys fresh from Illinois high school and semi pro ball, followed by the Kutinas, semi pro and professional ball players from Minnesota, Joe Kutina, having suffered a stomach injury, had been released by the St. Louis Browns, and having his career cut that short, decided to homestead in Western Canada and his choice became Rimbey. Along with him came Bill and George, two of his brothers, both high class semi pros. These boys had been preceded a few months by Floyd Little and Clyde Ely from the Nebraska state league, and already here, were some boys showing great promise namely Alfred and Gilbert Lloyd and Carl Cox. Little did all these immigrants know that they were to form one of the best, if not the best, ball club in Alberta ... The class of ball played can be judged by the fact that Henry Roache, the man of baseball at that time, drafted Joe Kutina, Bill Kutina and Warren Connelly to play in western Canadian finals, his Edmonton team having won the Alberta championship. These boys played through seven torrid games finally to go down to defeat in the last game.
Thanks to John Wakelin for his inquiry about Cleo Lewright a pitcher in Quebec pro ball in the 1950s. He was one of those we missed in our book Black Baseball Players in Canada.
In an eight year minor league career the right-hander reached as high as AAA in the Cleveland, Pittsburgh and Yankee farm systems. Lewright played for the St. Jean Canadians in 1952 and 1953. His best season came with Hutchinson of the Western Association in 1954 when he finished with a 20-10, 3.45 record in 44 games, 240 innings. At the time of publishing the book we could not confirm Lewright's ancestry. Subsequently we found material noting his role as the first coloured player in the history of the California Baseball League
29 February, 2016
Welcome to Leap Day !
Perhaps it was the relative isolation from the big cities and their attractions that allowed local ball to survive and prosper into the 1970s in the Slocan and Arrow Lakes area of British Columbia. Thanks to Daniel Hellyer we have added a couple of pieces from the era - a team photo of the 1971 New Denver-Silverton Combines (the league champs that season) and a snapshot of a couple of the players from that hippie era!
Among other things, Rich Necker discovered an ad for an exhibition game in Winnipeg in the 1920s featuring the touring Toronto Oslers. The Oslers have been mentioned more than a few times in our coverage and the question arose - why the Oslers on a barnstorming tour all the way to Vancouver in the tough travel days of the 20s? Well, Kevin Plummer, at the web site Torontoist, provides a fascinating look back at one of the premier local teams in the history of Toronto.
Out on Vancouver Island, Doreen Telosky (Sam, her husband, was a key member of the team) has dug up a photo of the 1953 Campbell River Athletics and from the team picture we've managed to extract individual shots of each of the players and posted them in the 1953 BC Photo Gallery. Among them (left to right) - Johnny Haramboure, Douglas "Baz" Nagle (a year later he'd be in the lineup of the Calgary Stampeders in Canadian football), Sam Telosky (one of the six baseball playing Telosky brothers), and Larry Walker Sr. (father of Larry Jr. the former Montreal Expo, MLB All-Star, MVP and batting champion.
Larry Sr. had a brief pro career, as a lefty hurler with Yakima of the Northwest League in 1956. One of his teammates was Jack Altman, out of Fresno State University, who honed his craft in Vulcan, Alberta.
(For those concerned about the work load for young pitchers today, please check out the Altman page for a rundown of his college and semi-pro mound duties in 1954. 365 1/3 innings ! A 32-11 record with an ERA of 1.60 and 431 strikeouts ! )
Speaking of the Teloskys, thanks to Doreen, we've added a photo of Pete Telosky from the 1950s standing in front of the ballpark he built for the Haney community.
The eagle-eyed Rich Necker spotted an on-line photo and cleared up a long standing mystery - the real first name of the big hurler -- Geoghegan -- from the prairies and Vancouver in the 1920s and 1930s.
And, it wasn't even a baseball photo. It was a picture of a fire station crew in Vancouver in 1933. Tiny or Big Six Geoghegan was formally called, Norman. Norman "Tiny or Big Six" Geoghegan. We've tried to make the change throughout the site.
And, while the quality is far from top notch, we've posted a newspaper version of the 1925 Powell River club, champions of the C.P.C. (Courtenay, Cumberland, Powell River). As we've noted before, at very least these low quality versions provide a place holder and are a reminder to chase the real thing.
Bill Guenthner (author of the wonderful Minot Mallards site, now attached to ours) sends along news of former Mallards' star Sugar Cain. Earlier this month, Cain was among a group of former Negro League players to be honoured in Macon, Georgia. The late Marion "Sugar" Cain, the late Lemuel Hawkins, Ernest Fann and Robert Scott were distinguished with plaques at Luther Williams Field in Central City Park. According to the local television station, the tribute was a result of an effort by a local Boy Scout :
The plaques were a part of a project led by 15-year-old Gordon Smith, an Eagle Scout of Troop 170. For his Eagle Scout project, Gordon raised money to create plaques for the men he says paved the way for him to play ball. Gordon said he's glad people will get to appreciate the history of the Negro League, and he carries their legacy with them to Cavalier Field.
"Well, it's a good feeling in my heart to know that they started it for me, so I can think about them as I'm playing," he said. (WMAZ, Macon)
Also, Bill discovered an eBay item, the 1958 contract Cain signed with the Kansas City Monarchs. I'll soon post a copy of the whole contract, but here's a snippet. The dollar figure is surprising, but there may have been other financial arrangements (such as a share of the gate or expense money).
01 February, 2016
February? Use to hate the month when still in the broadcast business. It was the pronunciation. Hardly anyone gets it right these days. FEB - roo - air - ee Not, FEB - you - air - ee. There's an "R" in there. But, the incorrect pronunciation has been used to so long, 'cuz the correct one is so difficult to say, it's now become an accepted version, at least in Canada and the US.
Today's update features photos, including a group of team pictures ranging from 1913 to 1966. And, with a lack of names for some of them, help would be appreciated in putting names to the faces.
Our keen-eyed Rich Necker has discovered a superb group of photos from 1934 Vancouver senior baseball, including some action shots and individual photos (Boyd Staggs and Tony Telosky among them). There's nearly a dozen photos on the 1934 Snapshot page. On the 1930 BC Snapshots, there's the addition of a photo of pitcher Dave Gray. New pictures from Powell River feature a pair of neat photos from a game of July 1st, 1914.
And, of course, with all of these there are additions to the respective BC photo galleries - 1923 , 1930, 1934, and 1940, and the start of the 1961 gallery. That's Bill Inglis (far left) a fixture on the local baseball scene in Vernon, BC along with Nick Janicki (left).
The exercise has helped to pin down the correct spelling of Otto Munk (and brothers Fred and Al), all BC players of the 1940s and 50s. Over the years both Monk and Munk were used in the newspaper reports. That's Otto on the right, above.
And, with Rich's incredible work with the old newspapers, we are pleased to post game reports for the 1934 season for the Vancouver Senior League and the Vancouver Terminal League (starring the famous Asahi nine and the Imperials of IOCO, the company town of Imperial Oil). Of course, rosters, have been updated to reflect the additions. Batting and pitching statistics have been added for the Terminal League and from the game reports we've identified the top pitchers for the Vancouver Senior League to add to the existing batting stats.
25 January, 2016
I am trying to recall the number of different spellings we had for a Duncan and Prince George hurler of the '40s and 50s.
Lyle Roger, Lyle Rogers, Lyle Rodger, Lyle Rodgers, Lyal Roger, Lyal Rodgers, Lyell Roger, Lyell Rogers, Lyell Rodger, Lyell Rodgers, and maybe a few more. It was further complicated because his brother Eric also played and all the same combinations also applied to him. (And, I believe another brother Leigh - sometimes spelled Lee - also played a bit.)
Turns out it was Lyell Rodger. I think we've made the change throughout the site.
Unfortunately, the confirmation comes from an obituary notice. Lyell passed last June after an outstanding career in education, mainly in Prince George, BC. He was a star hurler and hitter in the period after the war until the mid 1950s.
We've also sorted out much about the Teloskys of Haney, BC, thanks to Doreen Telosky (widow of Sam who passed away in 2010 at age 95) and former Haney player Bob Stinson (who sorted out the Stinson brothers as well).
Turns out there were six Telosky brothers who suited up for various teams in British Columbia from the 1920s into the 1950s (there were also three sisters in the family). The most prominent of the brothers was Pete Telosky, whose "Field of Dreams' story still resonates today. Well before the Kevin Costner movie and the corn field in Iowa, Pete took a piece of his farmland and created a beautiful ballpark for the people in the Haney area. Check out the story at the Maple Ridge Archives.
We are really pleased to get the 1953 Vancouver Island baseball game reports posted (Victoria Senior League, Comox District League & Mid-Island League). Rosters and Comox stats included. Baz Nagle (left) was one of the stars for Campbell River pitching the Athletics to a league title. You might remember the name from his days playing football for the Calgary Stampeders of the Canadian Football League.
Forbes, from Vancouver, was an all-star pitcher and hitter with the University of Oregon (he won the conference batting title one season). After playing in the Victoria Senior League, he played, as an outfielder, for a season with the Edmonton Eskimos of the fast Western Canada League.
There have been quite a number of team (and other) photos on the shelf awaiting identification of the players. However, with little progress in some of these, we figure out best bet for getting the IDs is to put them online. Here are the latest additions and revisions.
Our 'ol friend Brian Morrison at Diamonds in the Dusk is working on a lovely little piece on Archie Persons, a star in the old Western Canada League back in 1912. You'll be amazed at the information and photos he manages to dig out for his stories.
16 January, 2016
Bill "Snake" Siddle one of Manitoba's greatest baseball products had quite the compliment back in 1927. As a player in the amateur Manitoba Senior League, Siddle was part of a baseball card series by Honey Boy Ice Cream (just 21 cards) which also featured such major league stars as Babe Ruth, Tris Speaker and Grover Cleveland Alexander. Seems if you collected all 21 you could win a brick of Honey Boy Ice Cream. The accompanying photo is extracted from his 1927 card (#5 of the set, Ruth was #14),
Siddle's career as a player, manager and umpire covered nearly 40 years from 1909 to the late 1940s. Late in his playing days, the pitcher, shortstop, third baseman, signed up with the famous House of David and in a stroke of luck, was in the lineup as the club played in Winnipeg, his home town (right, that's Siddle in his HOD disguise).
About ten years ago, for Bob Elliott's The Northern Game, Baseball The Canadian Way a panel of experts selected all-time amateur all-star teams province by province. Siddle was chosen as the best shortstop in Manitoba history. In 1935 he was the umpire in the famous pitching duel between Negro League legends Satchel Paige and Chet Brewer at Osborne Stadium. The 1-0 thriller produced 30 strikeouts, 17 by Paige.
In yet a little more clearing of the backlog, we've added bits and pieces of Manitoba game reports from 1924, 1930 (disgraced former major leaguer Hap Felsch (left) is in the lineup for Virden, Manitoba) and 1932. Among the 1930 players is a pitcher, who - just from the name - I'd exercise considerable caution - Beano Meliti. Of course, rosters for those years noted have also been updated.
And, along the way, we discovered a photo of the 1930 Brandon Greys. Unfortunately, we have yet to find names to go along with the photo.
13 January, 2016
The 1937 St. Boniface Native Sons of Manitoba senior baseball had an interesting organizational chart.
There's John Lewis (left), President ... and Second Base. Athol Foster Manager ... and Pitcher (right). Another player, Chuck Ridgedale was listed as a Coach and Pitcher. The Lewis and Foster photos launch the 1937 Manitoba photo gallery page.
In another step in clearing up a backlog, we've posted game reports, rosters, and some statistics for 1951 Vancouver Island baseball. Pitchers Tony Folk and Doug English were among the stars.
The Vancouver Island data prompted me to chase a better photo of long-time island star Roy Schappert (who also suited up for teams on the mainland and in Saskatchewan). Schappert (left) played for at least 19 seasons. We found the photo (left) and in the process figured out what year (1939) Schappert played in Trail, BC.
A lost page is back on the site. About a year or so ago, Will Scheibler of Thunder Bay, Ontario, sent along information on baseball in northern Ontario (reflected in our posting of info on baseball in the area including a photo of the 1915 Fort William club of the professional Northern League). At the same time, Will sent along some photos of teams of the 1886, yes 1886, Winnipeg senior baseball. Somewhere along the way, the page went missing. It's now been re instituted.
Rich Necker has come up with some bits and pieces on BC baseball in 1925 (Vancouver, Island and Interior), including statistics for the New Westminster and District League.
06 January, 2016
Baseball is a business with no heart. 1914 edition. Calgary. Thanks to Brian MorrisonDiamonds in the Dusk for spotting this and passing it along. The player noted is catcher-outfielder Roy Kuhn.
The Calgary Club of the Western Canada League applies to the Commission for a reversal of the National Board’s award of Player Kuhn’s salary claim of $150 against it.
The player caught in the game of July 4 for his team and two days later he and his wife were stricken with scarlet fever and removed to a hospital. His wife died on July 8 and the player, who was discharged from the hospital early in August, was given his unconditional release on the fourth day of that month by the Calgary Club.
The Board ruled that the player was entitled to salary up to the date of his release for the reason that the Calgary Club did not exercise its privilege under a clause in his contract of suspending him during his unfitness for service from illness, and other specified causes, excepting injury incurred in a game.
The Calgary Club unquestionably neglected to avail itself of the only legal methods of terminating its salary obligations to the player under its contract by suspending him or releasing him until after he reported to it in August.
The decision of the Board is, therefore, affirmed, the Calgary Club’s appeal is dismissed and that club is directed to forthwith forward its check for $150 to Secretary Farrell for transmission to the player in adjustment of this award. [The Sporting News, November 19, 1914]
With chief sleuth Rich Necker plodding through the archives we are pleased to wrap up another segment of game reports, the 1952 games in three leagues on Vancouver Island -- the Victoria Senior Amateur League, the Mid-Island League and the Comox District League. This, of course, becomes a little more complex when we find the latter two loops played inter-league contests and Victoria teams played exhibition games against teams in both other loops ! The 1952 rosters have also been updated to reflect the Vancouver Island material.
Along with the game-by-game summaries, we've managed to dig up stats for the Comox circuit and post a few photos on the Snapshot Page, one of them of star pitcher-outfielder Ken Cessford (left) of the Duncan Athletics of the Mid-Island League. In the records we've found, Cessford not only was a top slugger, but went 12-0, including 7-0 in the playoffs. We've tracked down a nephew of Duncan pitcher Tony Folk and hope we'll be able to located a photo of the left-hander.
Meanwhile, Rich has dug up more photos from the 1925 season to add to the Photo Gallery and Snapshot Page. One of those photos - Bill Clark -- provided us with another name for the 1924 Hammond team photo (as the 1925 item mentioned Clark had played the previous season with Hammond).
We stumbled upon another photo of former Indian Head (Saskatchewan) Rocket Bobby Prescott, this one from 1961 when he was playing in the Pacific Coast League with Hawaii. Prescott made his major league debut that season with Kansas City.
In a career, which spanned twenty years, Prescott played with at least twenty-two teams in the USA, Canada, Mexico and his native Panama. He began with Sceptre and Indian Head, Saskatchewan in 1951 ending in Mexico in 1970. In the twilight of his career he was an outstanding power hitter in the Mexican League. In one four-year span he bashed 37, 39, 41 and 32 home runs, driving in more than 100 each season.
Former Lloydminster (Sask) Meridian (1957) Modie Risher is battling health issues. A recent fall added to the woes. Good wishes going out to Modie and DeLaris down in South Carolina.
20 December, 2015
Among the highlights of the 2016 induction ceremony at the Manitoba Baseball Hall of Fame will be special recognition for the province's 20th Century Dream Team. The team was selected by a special HOF committee for Bob Elliott's book The Northern Game, Baseball the Canadian Way.
Ten individuals have been selected for induction at the 2016 event, June 4th at Morden -- Myles Bond, Jamie Hodgson, Mike Krykewich, Rod Ledochowski, Larry Nicholls, Gerald Palidwor, Mel Soughton, Jeff Trager, Glen Johnson and Ross Tycoles. The major team to be inducted will be the Elmwood Giants, and the Small Community Teams are the Wawanesa Brewers and Waskada Orioles. More on each of the individuals here.
Krykewich (left) , now the baseball coach at the University of Winnipeg, has just advanced the program by leaps and bounds winning a spot in a US college N.A.I.A. league for 2016. Winnipeg, which has been playing exhibition games, will now be a member of the North Star Athletic Association with Bellevue (Neb.), Waldorf (Iowa) and Viterbo (Wis.), Dakota State (S.D.), Dickinson State (N.D.), Jamestown (N.D.), Mayville State (N.D.), Presentation (S.D.) and Valley City State (N.D.).
Thanks to Gladwyn Scott of the MBHOF for keeping us updated.
The newsletter from the Saskatchewan Baseball Hall of Fame brings the sad news of the passing of Don Sumner, former Brandon player, coach and statistician. He was killed in a car accident in October.
We have some better photos of the 1924 Mirror CNR team and of Cliff "Tiny" Turner the young Alberta phenom who died at just 23 years of age to cut short a promising pitching career. The photos come from the City of Edmonton Archives.
We stumbled across a bit of information on BC Fraser Valley baseball in 1958, so there are some rosters and an addition to the 1958 snapshot page.
In baseball, one of the rarest feats is having an ambidextrous hurler -- both a righty and a southpaw! In going through 1925 material from BC, Rich Necker came across one in a Japanese league on a feeder club for the famous Asahis of Vancouver.
G. Sarayama attracted the notice of the local paper, the Vancouver World, as he pitched the Mikados to a 10-4 victory over Hanburys in Senior B action at McBride Park on May 13, 1925.
Sarayama was the centre of interest as he pitched with his left hand for the first three innings and before the fourth, warmed up with his right. When Stan Clark knocked a two-bagger on a lefty delivery, Sarayama changed hands and allowed only one hit the rest of the game. In the seven-inning contest, he allowed seven hits, fanned six and walked a pair.
Good wishes to all for the holiday season and for contentment in the coming years. Merry Christmas !
16 December, 2015
Super sleuth Rich Necker and his new sidekick and Vancouver correspondent “Redeye” Ropertz have gone back to the archives to dig up the goods on 1935 Vancouver and area baseball (including the Imperial Oil town team of IOCO and the barnstorming tour of the soon-to-be Tokyo Giants and future Hall of Famers Victor Starrfin and Eiji Sawamura (right). (At the time Starrfin was 19 and Sawamura just 18).
In the fall of 1934, Sawamura faced a team of touring major league all-stars in Japan and in a relief role, he fanned nine including consecutive strikeouts of Charlie Gehringer, Babe Ruth, Lou Gehrig and Jimmie Foxx.
The 1935 Vancouver stories cover both the Vancouver Senior League and the Terminal League featuring the now-famous Asahis.
In addition, we have posted the first part of information on the 1951 and 1952 Vancouver Island baseball leagues -- the rosters. Again, thanks to Rich. So far we've extracted the rosters for those years and a few snapshots too. . Game reports still to come.
Going 'way back, we've added a snapshot page for 1917 in British Columbia with a copy of one of the few local baseball photos featured in the local papers (this one of star hurler Ira Brethour).
There's a new BC snapshot page for 1939 as well featuring a photo of two of the stars of the Vancouver Asahis - Roy Yamamura (far left) and Nag Nishihara (near left). The photo comes from a very nice on-line video (produced by Orbit Films) about the famous Asahis on the site Nikkei Stories. Of course, a major source of information on the Asahi is at the site by the National Nikkei Museum and Heritage Centre of Burnaby.
Along with another photo of Yamamura and pics from Rich's research, we've added a 1925 BC Photo Gallery, and updated the 1921, 1922, 1939 and 1940 galleries. A couple of photos for the 1957 BC gallery means we now have photo galleries for BC baseball right through from 1917 to 1960.
In another of those wonderful coincidences, Roy Yamamura was the great-uncle of a former working colleague of mine, Mel Tsuji, at CBC Television in Toronto. Of course, at the time, I had no idea that twenty years or so later I would be chasing material on the old Asahis players.
Well, after spending a couple of hours searching for a photo of 1968 Manitoba batting champion Claude Lambert, I discovered it - right here. Yep, he's in the photo of the St. Lazare team of that season.
Lambert was a 19-year-old right-handed hurler signed by the Astros in 1965 and he pitched for three seasons in pro ball before heading home to Manitoba. Obviously, he had more talent than mound work and copped the batting title with a .375 average and led in home runs too. Lambert is among the additions to the 1968 Manitoba Photo Gallery.
In the Basin League material from Tom Cason, the former Sturgis Titans star, we've added a photo (this one a newspaper quality picture) of the 1969 Sturgis team. Hope Tom can sort out who's who. Still to come from the package from Tom, photos of many of the major league stars who suited up in the Basin League.
10 December, 2015
Even more photos adorn the pages. Another 50-75 have been added, mainly for the Basin League photo pages of 1968, 1969 and, especially, 1970. Thanks to Tom Cason, former Basin Leaguer, for these and the statistics for 1968 and 1969, now posted.
We also happened upon some photos of members of Roy Taylor's 1954 team at the College of Sequoias. It was an interesting one as four members of the pitching staff were from the Canadian prairies - Dave Kosteniuk, Jim Hagemeister, Bob Holowaty and John Zeeben (left). Zeeben is still coaching in the Western Major Baseball League with Yorkton, Saskatchewan.
Among the bits and pieces, updates to all the Lloydminster individual photos in the 1955 photo gallery, and an addition to the Manitoba snapshot page of 1962.
06 December, 2015
Mom saved the day !
In this case Tom Cason's mom back in the late 1960s when she attended some of her son's games and made sure she picked up some game programs. Tom, the former Basin League star has provided a wealth of material from those programs (much yet to be processed) on the summer college loop in South Dakota (and Valentine, Nebraska) during his three year stint, 1968 to 1970.
Thus far, there are additions to the Basin League photo galleries of 1968, 1969 and 1970, along with roster updates for the same seasons, 1968, 1969, 1970.
We noted earlier the 1968 photo of Tom's team, the Sturgis Titans. There's also the beginning of a snapshot pages for 1970. Lots of photos still to come, and stats too. Thank you Tom !
Our pre-Christmas update is overwhelmingly about photos, probably about 150 of so of them, individual pictures, team pictures and snapshots. Rosters too.
In a catchup splurge, much of the output covers Manitoba senior baseball from the late 1950s through to the mid 1970s.
Three new team photos have also been posted. The quality isn't much to crow about, but as we've said before, at very least these reproductions, newspaper quality photos, serve as place holders for when we manage to dig out better versions. There's the Brandon Cloverleafs of 1966 and 1967 and the Binscarth Buffaloes of 1972.
We're very pleased to have discovered more statistics for Manitoba senior ball. Adding to our collection are the final stats for 1967, 1968, 1969 and 1970. The 1967 and 1968 additions are particularly helpful in having all players listed, not just the top hitters and pitchers.
Along the way we embarked on a little tangent to further study the record of import right-hander Richard Edward "Dick" Limke who spent six seasons with the Souris Cardinals of the Manitoba Senior League after two summers in the Basin League in South Dakota and a taste of pro ball in the St. Louis Cardinal farm system. Limke wrapped up a sterling career in Manitoba ball by being selected as the loop's top pitcher for the fourth straight season and the MVP for the fourth time in five seasons. He tied for the lead in wins, with seven, and finished with just 17 walks and 97 strikeouts in 85 innings of work. His best summer was 1967 when the former Minot State star went 10-1 with 110 strikeouts in 97 innings. In the 1968 playoffs, Limke hurled the first no-hitter in the league's history. Two walks kept him from a perfect game. He went on to play semi-pro ball in the US with Fargo, North Dakota, for another six campaigns and continued to pile up MVP awards.
BC ball has not been neglected (well, a bit as I've still haven't attacked a batch of material sent in by super sleuth Rich Necker and his new sidekick and Vancouver correspondent “Redeye” Ropertz).
The 1924 BC photo gallery now has players from the Collingwood team of that season and we've added a photo of three of the famous Cousins baseball family to their team photo page. On the 1921 BC snapshot page is a photo of some Haney players advertising an event to raise money for the team (not sure if, at the time, the players or the car happened to be the focus of the photo).
Good wishes going out to former Lloydminster Meridian David Moriarty who is on the way to recovery from a broken hip. He reports his rehab is going slowly but okay.
Years ago, in researching Manitoba baseball, I had wondered why their baseball trails had ended so suddenly. Within the last week, accidental research discoveries told the tales of Barry Moffatt and Ross Pollock.
Outfielder Barry Moffatt of the Riverside Canucks had just finished one of the most successful seasons in Manitoba senior baseball history. In the summer of 1969 the all-star in the outfield got at least one hit in every game he played, 30 in all, running away with the batting championship with a .481 average, nearly 70 points higher than the runner-up. Moffatt, who had had been playing senior ball in Manitoba since 1955 when he joined Souris as a 16-year-old, led the Canucks to the 1969 pennant.
Of course, Moffatt was also a hockey star. Four months after the end of the 1969 baseball season, playing for the Souris Elks in a Southwest Hockey League game he was checked into the boards and fell to the ice, unconscious. There was less than two minutes to play. Moffatt never regained consciousness. He had suffered a fractured skull. Moffatt had worn a helmet, a football helmet, a couple of years previous to protect a broken jaw, an injury suffered in another hockey game. But, he had discarded the protection once his jaw had healed. He was just 30.
Ross Charles Pollock, of McConnell, Manitoba, was just 21 coming off quite an accomplishment - making the roster of the celebrated Brandon Greys in 1949. Pollock had won two of his three starts, tossing a pair of complete games. The Greys, with a lineup loaded with imports, had a magical season easily winning the Manitoba Senior League (28 victories in 32 games) and ringing up an overall record of 87 wins in 108 games. Just a month after the close of the season, Pollock was killed in a single truck accident a few miles east of Oak River. Two others in the truck suffered just minor injuries. The trio were headed home from Brandon when the truck slid on a corner of the road and crashed into the ditch.
24 November, 2015
He was crowned "King of the Bushers" and once compared to Walter Johnson. But, young Cliff C. "Tiny" Turner of Mountain Park, Alberta (coal country west of Edmonton near the BC border) had barely started when he was struck down and out.
In 1921, as a teenager he had an introduction to pro ball with a tryout with the Edmonton Eskimos of the Western Canada League (as far as we can determine he got just an inning of work as a reliever). At age 21 he was the ace hurler for the Cadomin-Mountain Park nine and at 22 was the toast of Alberta in 1924 as he led the Mirror (a railway village of several hundred east of Red Deer) Canadian Nationals to impressive showings in the Central Alberta League and then in upper level competition in Edmonton. Mirror was invited as one of the teams for a "Bushers Tournament" at Edmonton and led Mirror to top money.
It is just seventeen years ago this summer that the immortal Walter Johnson of the Washington American League team was burning up the bushes down in Idaho for the little tank town of Weiser. He was striking out from ten to twenty-four men every time he pitched, and shutting teams out right and left at libitum. Every league ball team in the northwest was trying to sign him up, including the Edmonton team of the Western Canada League, but Cliff Blankenship, scouting for Washington, came along, secured his signature to a contract, and carried him back to the capitol of the United States, where he immediately made good.
As far as records in the bushes go there is a pitcher down at Mirror, Alberta, who is attracting wide notice this year by the same brand of phenomenal twirling. His name is C. C. Turner, and his wonderful feats on the hill among the semi-pro teams of Alberta have paralleled the achievements of Walter Johnson seventeen years ago. (Edmonton Bulletin, July 29, 1924)
[Photo an edited version of the original from the City of Edmonton Archives EA-523-15]
On August 4th, Turner hurled a four-hit shutout in the afternoon (with 16 strikeouts) and then came back in the second game to twirl four shutout innings (six strikeouts) as Mirror came from behind to win 7-4 and take top money in the tournament. A panel of thirty experts selected Turner as the top player in the event, "King of the Bushers".
The right-hander had a sensational season. Records are far from complete, but he won at least 13 games, nine by shutout. We've been able to track down 17 starts and two relief stints for a 13-3 (with one tie) record. In one amazing stretch Turner had 60 consecutive scoreless innings, with six straight complete game shutouts. He rang up 88 strikeouts in that 60 inning stretch.
In early September of 1924, Turner was signed by Ty Cobb's Detroit Tigers with an invitation to spring training, Farmed out to the East Texas League for his rookie season in pro ball, Turner excelled with 17 wins in over 190 innings of mound duty, But, not feeling well near the end of the campaign, Turner left the team early to return home to Alberta. Near the end of September, his conditioned worsened and he was taken to hospital in Edmonton. He died the next day, diagnosed with typhoid fever. He was just 23.
Turner story is woven in and around the 1924 Alberta & Tournament game reports just posted (with usual thanks to Rich Necker).. Of course, the 1924 roster page reflects the latest material. Along the way we found this newspaper plug for a Central Alberta game (note the admission prices). I'm not sure how much bats cost these days (although I seem to recall folks here talking about $300 CDN for a slow-pitch bat) but check out the 1924 prices for baseball bats and gloves in Red Deer, Alberta.
Tom Cason (left), the former Basin League star, has come through in a big way with material from his three seasons (1968-1969-1970) in the college circuit with the Sturgis, SD, Titans.
Just a couple of items posted so far, the 1968 Sturgis Titans team photo and the beginning of postings on the 1968 photo gallery and 1970 photo gallery. That's Allen "Rusty" Gerhardt right, Cason's teammate in 1970 who made the majors in 1974 with the Padres. More still to come, including statistics for at least two of those three seasons noted.
Walt McCoy, the former Negro League and ManDak League hurler, who passed away earlier this month, surely had a lot of good friends.Last week, the site The Negro Leagues Up Close published this report on a final farewell to McCoy. (Unfortunately, there was no mention of the article's author.)
Congrats to Jeremy Klaszus of Calgary for his efforts in preserving and presenting prairie baseball history. His site Wild Rose Baseball is image oriented, presenting program covers and artifacts of more recent heritage than Western Canada Baseball (mainly in the 1980s and 1990s).
He was known as one of the toughest and best players of the 1950s and 1960s in the National Hockey League, inducted into the Hockey Hall of Fame in 1985. Bert Olmstead died a week ago at his home in High River, Alberta. He was 89. The Saskatchewan native also excelled on the diamond in the late 1940s and early 1950s. Ol' pal Doug Abraham earlier wrote about the former pitcher/shortstop.
Perhaps it wasn't surprising that Olmstead played a lot of ball during those summers because he hailed from Sceptre, Sask., the Sceptre Nixons being the unofficial kings of 1950 baseball tournament play with $17,000 in winnings (his brother Dean had tossed a no-hitter in 1945 pitching for the Calgary Purity 99s). .
A 1946 Southern League report shows Olmstead tossing a one hitter in a seven-inning contest but coming out the losing hurler in a 2-0 Regina win over Moose Jaw. Big Bert also played third base/shortstop.
In 1948, Olmstead was a hired gun, one of five imports landed by Delisle Commodores in their halcyon days. He hurled complete-game wins and, in another contest, contributed two triples and two singles in six plate appearances.
Olmstead pitched Sceptre to the Camrose Tournament 1950 title by tossing a four-hit shutout in a 2-0 triumph over Kamloops in the final. Earlier in the day, he had fired four shutout innings in relief to pick up the win as Sceptre advanced to the final. The next weekend, Olmstead had a three-hit shutout at the Lacombe tournament.
If big Bert Olmstead was of such a mind, he could very well place among that rare athletic species that merits stardom in two phases of top-drawer professional sport.
Already the 23-year-old native son of Sceptre has won his spurs as a left winter with Chihawks under the big top in hockey, and there are many competent diamond observers who maintain that the strapping right-hander has what it takes to go far along the organized baseball trail as well. (Edmonton Journal, June 15, 1950)
15 November, 2015
Ty Cobb in Port Haney, British Columbia in 1920 ?
Naw, seems to be an imposter. The Maple Ridge Museum & Archives has a photo from 1920 (see the October 28th entry below) supposedly showing the famous major leaguer in a Port Haney team photo.
We sent along that photo (and another which appeared to show Cobb on a fishing trip up here) to an expert on photo identification, Mark Fimoff of SABR (Society for American Baseball Research). Mark has been a key member of SABR's Pictorial History Committee and has been engaged to identify photos for various publications, auction houses and institutions including the Boston Public Library and Chicago History Museum. His conclusion - it's NOT Ty Cobb. See the full report here.
We've added a couple more photos from the Maple Ridge Museum collection, one is on the 1953 BC Snapshot page, the other on the 1960 page.
With thanks to Rich Necker and his superb work we've been able to offer more game reports from British Columbia. The latest additions are the 1924 and 1950 reports for Vancouver Island baseball.
Of course, along with the game stories there are the rosters for 1924 and 1950 along with statistics for the 1950 Comox District League. The 1924 stats page now includes final numbers for the Vancouver Senior League, Terminal League and Victoria Senior League.
The 1924 BC photo gallery has been updated with a bunch of first names, mainly for players of the Victoria CPR team.
There's also a very brief entry for the 1919 BC Interior basically showing there was a league in the Okanagan area.
With all of the roster additions over the past few months we've also made a major update of the BC roster pages adding another 1,190 players to the lists (with another 300+ yet to be included, mainly from 1924).
Always a treat to hear from Jim Lester, the former Fresno State, Granum and Lethbridge star, but so sorry to hear of a broken hip. Jim had surgery a couple of months back and is still hobbled. Send some good thoughts Jim's way.
In chatting with Jim, in confusing a fractured hip with hip replacement, I gave him a whole wrong impression about the Canadian health system. I noted it often takes a long, long time (up to a couple of years) for hip surgery. But, of course, that's for replacement surgery, not after a fracture.
David Moriarty, son of the famous Detroit Tigers player, manager, MLB umpire and scout also took a tumble recently and is recovering from a hip fracture. David, who played Western Canada ball in my hometown of Lloydminster has had a tough run, as his wife Cathy passed last year. BTW, David's nephew is actor Michael Moriarty (Law and Order, Bang the Drum Slowly).
Sad news from Dan Doyle in San Diego who sends along the news of the passing of former Negro League and ManDak hurler Walter McCoy. He was 92. Dan and Walter became friends after first striking up a business relationship as Walter continued to work in San Diego as a contractor into his late 70s and early 80s.
I interviewed Walter a few years back for our book "Black Baseball Players in Canada" and Walter expressed his appreciation for his time up here. He recalled his first trip over the border traveling with Jesse Douglas, another former Negro Leaguer, going up to Winnipeg to play in the ManDak League. [Photo from the San Diego Union-Tribune, 2015]
As soon as we crossed the border and headed toward Winnipeg, Jesse says, “Homie, you’re in God’s country now.” And, oddly enough, you could feel something different. It seemed like the air was different. There was just a slight breeze in the air, you know. And I know we passed through wheat fields and there was a little bit of rustle of the wheat you know with the wind blowing over the tops and I was saying this is beautiful, really beautiful. There was nothing else in sight, except a highway and wheat fields on both sides ... It was the best time of my life, because in addition to everything else that happened to me, I got married there. I married a girl there in Winnipeg ... The fans were nicer than I ever encountered anywhere. They were so nice, they really treated the ballplayers like human beings you know as compared to here in the United States at that time.
Late last month, Elsie Emma Schmidt (nee: Gunther) passed away at the age of 102. Elsie was a member of the famous Gunther family baseball team in Saskatchewan ( inducted into the Saskatchewan Baseball Hall of Fame in 1999). She was the 5th youngest of 20 children born to Pauline and Fredrich Gunther in Lanigan, Saskatchewan. She was 11 when her mother died. Her father remarried a woman who had 4 children and together they had 6 more for a grand total of 30 in the Gunther Family!
You never know when an old photo might turn out to be "gold" for reasons other than its original purpose. A few years back Texas based Barry Forster began chasing down material on his father's baseball career in Canada. His dad, Bryan Forster had been a star infielder in Regina and in Victoria from the late 1920s through to the mid 1940s. In his search Barry collected a ton of material, a lot of it to appear here. One of the items posted here is a team photo of the 1912 team from Dysart, Saskatchewan. There in the background is Bryan, the three-year-old son of the team's playing manager. Well, also in that photo is a J. Cutler, who turns out to be the object of a genealogical search by Graham Cutler of the U.K. who had no idea his great uncle had anything to do with baseball ! We're now in the process of tracking down a high-resolution version of the photo for Graham.
By the way, that's the young Barry Forster (left) in Little League in Victoria in 1951 taking the torch from his dad (although, that does look a bit like a catcher's mitt not an infielder's glove).
The kid went on to a career as an engineer in the aerospace industry, working for the likes of Lockheed Martin Space Operations (including the Hubble Space Telescope) and Fairchild Space & Electronics. Not bad for a kid from the prairies.
Thanks to Kent Morgan of Winnipeg for keeping us in mind. A friend of Kent's dropped off some material from the mid 1990's on the Prairie League of the day (which included teams from Brandon, Moose Jaw, Regina and Saskatoon) and he's sent it along.
Happy to help out Holly Stevens of the Tessier Community Hall who was chasing material on Murray Coben a star pitcher/outfielder in Saskatchewan from the 1940s through to the mid 1960s.
Love the coincidences. In trying to track down a specific photo from the Winnipeg papers of 1916 I made a request to the University of Manitoba, repository of many of the papers of the era. The response came from U of M archivist Lewis St. George Stubbs. His book "Shoestring Glory, Semi-Pro Ball on the Prairies" was among the first I discovered and devoured when I started this project ! Thank you Lewis !
28 October, 2015
The stuff you learn if you only look.
The aim was to try and determine the correct spelling of Richie/Ritchie Nicol/Nichol/Nicholl, a pitcher-outfielder with Nanaimo and Vancouver teams in the 1940s. The search took us to a column by the prolific Tom Hawthorn on the first white player for the legendary Harlem Globetrotters basketball team. Yep, Ritchie Nichol (left) quite the basketball star in his day. Hawthorn also has columns on other BC stars Coley Hall and Bill Prior.
Our thanks to Val Patenaude, Director of the Maple Ridge, B.C.,Museum & Archives for his speedy and helpful response to our plea for material on baseball in Haney and Hammond. As a result we've now posted/updated team photos of the 1928 Haney club, 1950 Haney, 1953 Haney, 1953 Hammond, and 1955 Haney. On the 1955 BC Snapshot page there's a picture of the 1955 pitching staff of the Haney club. Previously on that snapshot page we posted the picture of Larry Walker Sr. as a pitcher with that Haney club.
The WMBL (The Western Major Baseball League), the successor to the Western Canada League, has completed its 2015 season with the Lethbridge Bulls taking the league title for the first time. The Bulls won all nine post-season games, beating Regina Red Sox in the final.
Outfielder Brandon Bufton (left) of the Bulls was named the league's MVP after hitting .359 during the regular season.
David Eskenazi, the amazing Seattle baseball historian and collector continues to dig up interesting items related to Canadian ball.
These pennants appear to be from the early Western Canada League, likely from the 1910s period.
The Calgary pennant clearly has the same colour as the Calgary Bronchos uniform David discovered a few years back. The uniform was from the 1914 season. The batting figure and uniform style on the Edmonton pennant appear to be from around that time frame.
As usual, a major thanks to Rich Necker for his incredible work in putting together the game report sections. And - in continuing to keep an eye out for photos, such as the one of Harry Sanzoku Miyasaki (right) the long time pilot of the Vancouver Asahis.
Now, a new mystery. One of the items in the Maple Ridge Museum & Archives is a team photo identified as from 1920. It is listed as the Port Haney team of 1920 with a special guest, Ty Cobb ! The entry in the museum contains a list of names as well.
I was surprised to find Cobb identified as the guy in uniform to the right of the chap in the white shirt and hat in the middle. Also, it seems interesting that if this is a Port Haney team, what the heck is the logo on their uniforms? Looks like a C, H and A? Help appreciated !
03 October, 2015
Transfixed by the Blue Jays terrific run for the AL pennant, our efforts here have been a bit limited lately, but that's about to change as we organize the latest posts, with thanks to Rich Necker, Brian Morrison, David Eskenazi and Val Patenaude.
Val, who is director of the Maple Ridge Museum & Archives has provided photos of teams and individuals his area. One which caught our eye is that of Larry Walker Senior of the 1955 Haney club. Yep - father of the former Expos star. Larry Sr. was good enough to have earned a pro contract back in the 1950s as a lefty hurler. He played on the same team - Yakima - in 1956 as Jack Altman, one of the stars of Alberta baseball in the mid-50s and one of the earliest contributors to our little operation.
Also, there's a photo of Larry Sr. on the 1955 BC Snapshot page and a half-dozen individual photos of Haney players in the 1955 BC Photo Gallery. There's the beginning of a 1960 BC Photo Gallery with a picture of long-time Hammond area hurler Roy Lehman.
We are still awaiting the names, but the photo of the 1955 Haney club has been processed and posted. More to come .
We have made some progress in identifying members of the 1916 Winnipeg team of the Northern League in those photos from David Eskenazi. Please check out the link and see if you can match names to photos. I'd guess this one will provide more than a few hours of study over the winter.
One of those 1916 Winnipeg players was first baseman Babe Adams, wanted by the major league Brooklyn Robins. You'd think they would have had some kind of formal process for attempting to acquire players from minor league teams. Not really, just a telegram from Brooklyn's owner C.N. Ebbets to Winnipeg's Charlie Moll (remember the idea of farm systems hadn't yet been formed).
"We are in bad shape. Can you possibly accommodate me by sending Adams to us at once? Answer to Cincinnati. C.N. Ebbetts, president, Brooklyn Baseball club."
Moll turned down the Brooklyn request. In retrospect, could it have been a prank? Note the spelling of "Ebbetts". Of course, the spelling error could have been just in the newspaper story and not the actual wire. Hard to believe there could have been those kind of pranks back in that era.
The 1921 game reports page for Vancouver and the Lower Mainland is one of the most complete compilations we've posted with reports for the Vancouver City League, the Commercial League, Terminal League, Dewdney League, and Twilight League plus the provincial Senior playoffs. Of course, along with the game details, are the rosters for more than thirty teams in the Vancouver area.
While we are on the topic of rosters, we've made considerable progress finishing off the 1940 names for Vancouver Island teams including those in the Victoria Senior League, Cowichan Mid-Island League, Mid-Island Japanese League and the Comox Valley Twilight League.
Similarly, we've organized rosters for the 1941 season on Vancouver Island, including the Victoria Senior Amateur League (along with the rosters of all the Washington teams up for exhibition games), Comox Valley Twilight League, Chemainus Baseball League and the Mid-Island Japanese League.
The rosters for Island baseball for 1943 are another addition. We have names for the Victoria Senior League (again with rosters for the USA teams up from Washington), the Nanaimo Army League (remember this is during the years of the Second World War), Comox Valley, Cowichan Valley and Cariboo region.
There's also an update on the 1944 rosters for Vancouver Island ball. The military influence is obvious in the areas posted, Victoria, Duncan, Nanaimo, Campbell River, and Courtenay.
Rich Necker, whose game reports on Vancouver ball in 1924 have just been received and should be posted within the next few days, has discovered a few photos from 1924 BC baseball. Len Arthur (far left) and Harry Richardson (near left) are among the additions to the 1924 BC Photo Gallery.
Brian MorrisonDiamonds in the Dusk has sent along a couple of photos from 1921 which he dug up in doing his marvelous review of the 1921 Western Canada Baseball League season. On the 1921 Snapshot page you'll find the additions of former major leaguer Frank Jude, one of three players to claim the batting title that season, and Andrew "Rip" King (right) the Regina catcher who went on to a career in football in the NFL & its predecessor.
With access to a more papers from Manitoba, we've added a few more game reports to the ManDak season of 1957.
We're really pleased to have heard from Tommy Cason (right), an outfielder out of George Southern, Auburn & Jacksonville State, who suited up in the Basin League in 1968-1969-1970 with the Sturgis Titans. Cason also had a four-year pro career in the Boston Red Sox system, mainly in Double-A. Our fingers crossed in hopes Tom can dig out some photos/clippings from his years in the loop.
The Nakusp, BC, Museum has a display on athletics with artifacts mainly from baseball and hockey in the area. A Nakusp baseball uniform, with cap, is prominent in the display case.
The museum, under the direction of Sharon Montgomery, has undergone a wide-ranging re-organization over the past few months and is holding an open house today.
A big thanks to Cheryl Nybo for her work on organizing the reunion of Swift Current players for the August induction into the Saskatchewan Baseball Hall of Fame, What a grand occasion.
They came in as old men and left feeling 18 again with renewed spirits and a weekend full of laughs and stories as they gathered in North Battleford for the Induction into the Sask Baseball Hall of Fame and for the Friday night reunion. They came from the west coast and from the east coast, they came from California and Minnesota and from all parts in between. They were the boys of summer from 1950 to 1975 who had played for the Swift Current Indians Baseball Team. If they did not know some of the fellows, they probably had heard of them. They arranged in age from the mid 60’s to 85 . Their memories were sharp and could retell many game moments. One younger fellow said, ”I had heard about many of these fellows from the earlier years and had often wondered where they where or how they were, as well as all of the guys I had played with. This weekend I was able to put closure to all my thoughts as I now know they are fine.” But at the end of the great weekend one of the older fellows said, with tears in his eyes and a lump in his throat, “ This has been a super time but I am sad as I know I will never see many of these friends again.”
Cheryl sent along a "team" photo of the whole reunion group which looked just too small when sized for this page, so I've left it over-sized and posted it on the site in a pdf version. Enjoy.
In the picture below, players re-enacted the photo of the 1963 championship team.
13 September, 2015
Brian Morrison, at Diamonds in the Dusk has an in depth review of the 1921 season of the Western Canada League, focused on the debate over who won the batting title. Check it out, it's a great effort, wonderful research, interesting stories.
Individual photos, 16 in all, of the 1924 Victoria C.P.R. squad are now posted (extracted from a composite photo of the 1924 "V.I." champions). For a time we couldn't figure out what the initials "V.I." represented, but it turned out to be easy - Vancouver Island. That's outfielder Ray Corpas (left) and pitcher Matty Malcolm (right).
David Eskenazi, the extraordinary Seattle collector, has some new mysteries for us. He's come upon some photos of Winnipeg baseball in 1916, including the photo below of the flooding of the ballpark and a photo of four members of the "Pegs". Winnipeg played in the Northern League in 1916 with Superior, Fort William, Duluth, Fargo and Virginia. It will be yet another challenge to try and identify players from just about 100 years ago !
Congratulations to Charlie & LeAnne Beene (right) who recently celebrated their 60th - yes, 60th wedding anniversary. Also, Charlie had a birthday, might be in triple digits by now ! Between the celebrants in the photo I believe that is daughter Marianne.
Thanks to history buff Fred Braches and Val Patenaude of the Maple Ridge Museum & Archives for helping out in trying to identify members of that 1924 Hammond, BC baseball team.
We started out with just two names and already we're pretty confident we can identify six or seven of the 1924 BC Senior champions.
11 September, 2015
Indoor baseball was quite the thing in the early part of the last century, especially in the Chicago area :
Indoor baseball was invented by George Hancock in 1887 at the Farragut Boat Club on Chicago's South Side. The basic equipment was a mushy soft 17-inch ball and a stick-like bat. No gloves were worn and bases were only 27 feet apart. The game spread like wildfire across the Chicago area, and by the winter of 1891–92 there were more than a hundred teams organized in flourishing amateur leagues. Colleges and high schools, girls and boys, embraced the sport. Around 1907, players began taking the game outdoors, calling it “playground ball” and later “softball.” The indoor version went into steep decline in the 1910s, most assuredly because of the rapid growth of basketball, a game far better designed for indoor play. By the early 1920s, indoor baseball was a dead sport, but it left as its progeny the playground game most peculiar to Chicago, 16-inch slow-pitch softball. (Robert Pruter, Encyclopedia of Chicago)
So far, we've tracked down indoor leagues in Vancouver into the 1920s. Previously, we posted a team photo of the 1923-1924 Grandview Retailers of the Vancouver Indoor City League. Now we've found a photo of Hanbury's indoor team of either 1923-1924 or 1924-1925 (note the thin bats and big ball). It's one more challenge for us to try and identify the players from 90 years ago ! We have one - Ab Mortimer (left).
From Vancouver Island baseball after the war, we've located a photo of the Alberni Athletics of 1948. It's still not been determined what league, if any, they participated in, but it appears they were part of a lively Island ball competition. Bob Prior and Vern Kendrick might be the two most recognizable names.
This one's not of the greatest quality, but it's another step forward to have a photo of the 1929 Vancouver Firemen of the Vancouver Senior City League. Many familiar names on the squad, including Norm Trasolini,Lefty Kaye, and Peggy Duff.
And, one poor quality team photo now has a much better version. It's the replacement for the 1923 BC Box Manufacturers team from New Westminster. The new photo is from the New Westminster Archives.
09 September, 2015
Among the challenging tasks we face in putting together baseball history are those team photos with the players not identified. They are fairly commonplace back in the first half of the last century. After about the 1950s, it appears the chances are much better that names are provided in the team pictures.
We have, however, devoted some considerable time and effort to try and put together names for several team photos we've had posted.
One is the 1929 Vancouver Generals. We are reasonably certain we have identified all but one of the players (and for that player we have reduced the choices to one of two names).
Another is a team photo of what appears to be an all-star squad from Vancouver. It was thought the photo was from the 1920s, but we now think it fits in 1919 as a Vancouver All-Star team.
We have a couple of names to go with the faces, but there are many left to be ID'd. Lefty Delcourt (left) was an easy one to identify, wish the rest were as accommodating.
The third team is the 1924 Hammond Cedar club, the provincial senior champions. We're still missing a few names here, but we have made a pretty good start.
And, rediscovered, material from Chad Evans, whose father Verne (right) was a force in both baseball and softball in the Victoria area in the 1940s and 1950s. The picture here is believed to be from a stint with the Victoria Eagles in 1951.
More game reports are now available, including the Vancouver Island teams (including clubs from Victoria, Duncan, Chemainus, Campbell River) for 1942, 1944 and 1947. Reports for Vancouver and Lower Mainland teams for 1935 have also been posted. Of course, roster updates (1935, 1942, 1944, 1947) go along with the game reports.
One aspect of baseball on the Island during the war years was the placement of Quebec and Prince Edward Island military units on Vancouver Island. The PEI squad was quite the powerhouse in 1944.
We're particularly pleased to post more statistics as well. Newly added are the statistics for the 1924 Vancouver Senior League and Terminal League, the 1935 Terminal League and the 1937 Senior circuit.
Mystery solved. Toss Naylor or Tosh Naylor or Tommy Naylor of Vancouver Island baseball in the 1930s and 1940s ? A few phone calls resulted in contacting Yvonne Naylor, the widow of Jack (Red) Naylor, whose brother Tommy (Toss) Naylor was quite the star of the era. Yes, Toss was the nickname for Tommy. Yvonne could not recall how the nickname came about. I think we've made the correction site-wide.
Matt Meredith, a fixture with the North Battleford Beavers of the late 1940s and early 1950s Saskatchewan baseball passed way August 28th, just a day before what would have been his 92nd birthday.
Daughter Lynn forwarded information noting a Celebration of Life to be held Thursday, September 10th at 1:00 pm at the Woodlawn Mission Funeral Home in Mission , BC.
Nice to hear from Jack Mullen, one time US college hurler digging for information on the 1957 California Junior College championship. Jack, who pitched for Pasadena CC in the '57 playoffs, says he was the losing pitcher in their final game against San Diego JC. He says "I never got to show off my move to first because none of the San Diego hitters stopped there !" Jack went on to serve on the police force in San Diego.
24 August, 2015
The 1921 BC season is taking shape, with much thanks to Rich Necker who has tracked down all this material and put together most of it. Some, we are still working on. Posted so far are game reports from a couple of the Vancouver leagues along with rosters and stats of the Vancouver City League.
Three new 1921 team photos have been added - Collingwood, Hudson's Bay Company and the C.P.R. (the Cee Pees). The latter pair are good quality photos replacing the iffy versions we culled from newspaper files. And, we've found a photo of Centrals' manager Charlie Crook to the 1921 BC Photo Gallery.
From Mack Reid's material we've added a few photos for the 1924 BC Photo gallery, including Hec Cann (left) and Bill Giguere.
And, on the 1924 Snapshot page, we've added a newspaper composition showing five of the stars of the Vancouver City League along with a newspaper photo of Lefty Kaye of the Vancouver Young Liberals and a copy of a real photo of Alex "Lefty" Simons, also of the Libs. On the 1920 BC Photo Gallery we've re-done the photo of Ab Mortimer, the only player identified so far from the 1920 Longshoremen's squad and added a couple more pictures to the 1923 BC Gallery (Babe Esplen & Tat Larsen).
In trying to determine whether if was Frank or Floyd Isakite or Isekite of the 1935 Vancouver Athletics, we stumbled upon some pretty interesting material on Floyd "Lefty" Isekite.
Seems he was a Tacoma baseball legend having played amateur ball in the city and then four great seasons as a professional with Tacoma in the Western International League ringing up seasons of 9-4, 16-5, 18-12 and 18-9 leading the league in strikeouts for three consecutive seasons. Near the beginning of his career he suited up for a short time with Trail, BC, while spending most of his time in Tacoma amateur circles before joining Vancouver and then Bellingham. After a one game stint in pro ball with San Francisco of the Pacific Coast League in 1933, Isekite launched his storied tenure with the Tacoma Tigers. He was inducted into the Tacoma-Pierce County Sports Hall of Fame in 1972. Isekite died in 1992 at the age of 83.
Was it Lowery or Lowry, the 1921 player with Kelly-Douglas of the Vancouver Senior League? Thank goodness we have some sources, such as the Henderson City Directories, to try and determine the correct spellings. A quick check of the 1921 directory appeared to provide a quick answer. Listed under Lowery is an A.L. Lowery, a shipper at ... Kelly-Douglas ! Wow, that was easy. That must be the guy, right?
Well, just to double-check, I went down to Lowry. Well there under Lorne Lowry is a warehouseman at ... Kelly Douglas. So, that's why in the 1921 game reports the name appears as Lowery/Lowry.
16 August, 2015
We've been busy as bees with much thanks to Mack Reid of Courtenay, BC who has been kind enough to send along some scrapbooks covering BC baseball in the 1920s. The clippings and a few photos focus on Mack's great grandfather, Alex "Lefty" Simons (left) a feared hurler of the day.
I've begun to work through the material which appears, in the main, to concentrate on the seasons of 1921 and 1924. Included are the final batting statistics for both seasons. It'll take a couple of weeks to get the stats posted.
Among the gems is a good quality photo of the 1923 Vancouver Young Liberals and another, showing individual pictures of the 1923-24 Grandview club of the indoor winter season (Charlie Miron, above right, was among the Grandview stars). Yes, they had a thriving, eight-team, INDOOR league, a popular pastime of the era. We've extracted those individual shots to be posted in the 1923 BC Photo Gallery.
From the box scores of 1921 games, we've made numerous additions and changes to the Vancouver rosters.
The clippings included newspaper copies of some team pictures, the 1921 IOCO Imperials, the BC Senior champions, 1921 Hanbury Lumbermen, champs of the Terminal League, 1921 Vancouver Province, 1921 Hudson's Bay Company, and 1923-24 Grandview Retailers of the winter indoor loop. The newspaper images are not of great quality, but, at the very least, they provide placeholders for when we track down better versions (as in the Young Liberals photo above)....
Unhappy with our first attempt at the 1938 Cousins Family team photo, we've edited out part of the background to better display the individuals, especially those in the back row. We're still hoping the Peachland Archives can dig out the original photo. And, we've added a second photo of the family team, a picture used in 1981 at the official opening of Cousins Park in Peachland.
In the interim we've managed to extract one picture from the team photo, that's pitcher Harold Cousins, far left, a long-time star in the Okanagan.
With the help of Eric Weitzel grandson of Alymer Cousins we've discovered this photo of Alymer (near left), a pitcher-outfielder, during his tour with the Canadian military during World War II. And, we now know there were five girls in the family for a total of fourteen !
Our major job of the week has been the update of the BC Roster pages. There are hundreds of new entries. Already I note some changes that need to be made - I neglected to include the Cousins family for 1938 and see there's a spelling change needed - Montcrieff in 1921, but Moncrief in 1936.
Thanks to Rich Necker's dogged work, we've added photos to the 1937 BC Photo Gallery, including that of George "Lefty" Boston (left) a major force in Vancouver ball for more than a dozen years in the 1930s and 1940s, and right-handed hurler Bill Sayles, who went on to suit up in the major leagues.
We've made updates to Gary Fink's marvelous work on rosters and stats for players in the Man-Dak League of the 1950s. I think it's time to work on a summary of the Man-Dak, similar to the one we've posted on the Basin League. That'll be one of our winter projects. That, and a similar presentation for the Western Canada League, 1954-1964.
The earlier story on the commemorative garden and mural in Regina to honour Bonnie Baker, a star of the All American Girls Professional Baseball League in the 1940s and early 1950s, brought back some memories for Barry Forster, whose dad was a manager in the Regina Pony League at the same time as Baker. Barry was a third baseman-pitcher for Baker's Moose Monarchs while his dad ran the Legion team.
Happy to help out Bradley Berman of Berkeley, California, who is working on a video about Richmond, California, and was looking for some information on Nat Bates, a long-time civic leader in the community. Bates spent a couple of summers on the Canadian prairies pitching for the Medicine Hat Mohawks and Indian Head Rockets. Bates was on the 1952 Rockets squad that included future major league Pumpsie Green, who integrated the Boston Red Sox, the last MLB team to allow a black player.
10 August, 2015
Walter "Dirk" Gibbons, who had one of the most impressive pitching seasons in Western Canada history, has died at the age of 86. He passed away July 24th at Tampa, Florida.
Gibbons, also known as "Bubblegum" went 19-5 with 229 strikeouts in 198 innings pitched with the Brandon Greys in 1949. He started 23 games and completed 20 of them. He stayed with the Greys when they were part of the formation of the Man-Dak League in 1950 and, after two years in military service, returned for five more seasons of Man-Dak ball. Gibbons had come to Canada after a couple of seasons in Negro League ball with Indianapolis. In 2006, he was inducted into the Manitoba Baseball Hall of Fame.
Buddy Timme sends word of the death of his father Paul Timme of Tyler, Texas. Paul, who played with Saskatoon Commodores in 1960 after a season with Huron in the Basin League in 1959, died July 7th at the age of 75.
A few years back, Buddy and I had some fun putting together photos and clippings of his dad's baseball career as a birthday surprise. The photo on the right above was taken in 1960 when he joined Saskatoon and I'd guess the "R" on his cap meant it was a cap from Rice University where Timme starred for two seasons. The left-hander was among the top finishers in ERA in the Basin loop in 1959 and in the Western Canada League in 1960 was a workhorse tying for the lead in both appearances and games started.
Thanks to Eric Weitzel, grandson of Alymer Cousins for helping to track down a photo of the Cousins baseball team ! We are now searching for a better quality version (of the 1938 squad) and the Peachland Historical Society has joined the hunt. A baseball park in Peachland has been named after the family.
The Cousins, from the Okanagan area of British Columbia, were famous enough to earn a mention in Ripley's Believe It Or Not, quite the newspaper feature of the day. The catch phrase in the item was something like "nine brothers who were also Cousins" and formed a baseball team. Our contact with Eric also allowed us to double-check the spelling of his grandfather's name - Alymer - and we've made changes through the site.
Barry Forster, whose dad, Bryan, was a force in Western Canada baseball in the 1920s, 30s and 40s, is pretty happy to have received our clippings from his dad's 1943 season in Victoria. We're still working on the 1940 game reports, but the 1940 Victoria rosters are now posted along with a few 1940 individual photos.
With thanks to the Elgin County Archives in St. Thomas, Ontario, we've added some individual photos for the years 1954, 1955, 1958, 1959, 1960 and 1961. These are photos of players of the Intercounty League of Southern Ontario, mainly the St. Thomas Elgins. Included are those of Tedd Bogal (who also suited up in Western Canada), Stanley "Doc" Glenn, right, the former Negro Leaguer, and stars such as Frank Colman , far left, (ex New York Yankee), Ed Drapcho, near left, (former Penn State All-American) and league standouts as former pro Johnny Ambrose.
Thanks to ol' Lloydminster pal Rodney Mclean for alerting us to the Regina event honouring legendary Canadian baseball player Mary "Bonnie" Baker. She was among a core of prairie women who starred in the All American Girls Professional Baseball League in the 1940s and early 1950s. On Saturday, a multi-panel mural and commemorative garden was unveiled in Regina's Central Park honouring Baker. It's pretty clear that Geena Davis' character in the 1992 movie A League of Their Own is based on Baker's role in the league. The mural is the work of Moose Jaw artist Carly Jaye Smith. Baker was inducted into the Saskatchewan Baseball Hall of Fame in 1985.
We stumbled upon some Vancouver Island photos and are in the process of trying to obtain some high resolution copies. They contain individuals such as Philip Houbregs of the 1947 Port Alberni Legion.
27 July, 2015
Thanks to super sleuth Rich Necker, who dug out and transcribed the the information, we have the 1936 game reports and rosters for the Vancouver and Lower Mainland area including the Vancouver Senior League, Terminal League and the Commercial League along with some material from the Senior A and B playoffs. The data for British Columbia is filling in nicely.
It's slow going at this end, but we've managed to put together the 1939 game reports for the Chemainus Baseball League. And, along with the games we've posted team rosters, including those of some barnstorming teams.
One of the major stars of the loop was shortstop Pete Hawryluk who we have playing a couple of years in Saskatchewan in 1933-1934 (then again in 1941) before settling on Vancouver Island. The papers surely had trouble with his name. In the 1939 clippings it came out as Haweylock, Hawleylock, Haureylock and Haweyrluk among the choices. We managed to confirm the spelling by locating a reunion site (Hillcrest Lumber Company) which included a brief bio of Hawryluk noting he had been recruited by a farm team of the New York Yankees in 1939 but instead served overseas during the war. It's believed he served with the Royal Canadian Air Force. Still, though, we've been unable to locate a quality photograph of Hawryluk.
Game reports have been completed for the 1943 Victoria Senior League. The rosters had been posted earlier along with several photos in the 1943 BC Photo Gallery (among them Gerry Whitney, Percy Switch, Bert Appleby). Final stats are also posted as noted previously. Ian Lowe, one of the stars of Manitoba baseball in the 1940s and 1950s with the Brandon Greys, was the loop's leading swatter.
There are a couple of additions to the 1942 BC Photo Gallery, members of the Victoria Army squad, Elmer Keller (far left) and Bus Algar.
There's a bit of new material from Ontario as well. Well, new and sorta-new. The 1954 team photo of the St. Thomas Elgins has been on the site for quite awhile, although the link to it has been missing. So it's now fixed and from the team picture and additions to the Snapshot page we've extracted a few individual photos (including Doc Glenn, Intercounty baseball legend Tommy White (right), Butch Lawing and Willie Casanova) for the 1954 Ontario Photo Gallery. The picture of the 1933 St. Thomas Elgins (also called the Tomcats) is new and we are grateful to the St. Thomas Ontario Group on Facebook for permission to use the photos.
One new Alberta team picture has been posted. It's the 1942 Edmonton Arrows, the Edmonton Senior champions. Among others, the squad featured southpaw hurler Eddie "Lefty" Belter, pitcher Morris Hawkey and catcher Doug Stevenson.
Before he graduated from the University of Alberta and proceeded to carve out an outstanding career as a lawyer and a judge (rising to the top as Chief Justice of the Court of Queen's Bench of Alberta), Allan was the bat boy of the 1950 Edmonton club and remained a strong supporter of baseball in Edmonton.
I've been bugging my next-door neighbour, Tad Kiyono, to look through his family's photos of any pictures of his dad, Shig, who played a lot of ball in the 30s-40s and 50s, first on Vancouver Island and then in New Denver. Just this week, he found another. I believe it's the 1949 New Denver entry. We've been able to ID all but one of the players.
It's not often we've covered softball and I don't believe we've even mentioned slo-pitch, but since it's now my hometown, it's the only game in town and my niece and neighbours are on the team, here are the 2015 Nakusp, BC Slo-Pitch Champions, the In the Parkers. ITP topped the Brew Jays in the final to take the title (the ball yard is just a half-block from my front door).
Murray Eddy (left) is among those to be inducted into the Saskatoon Sports Hall of Fame at their induction ceremony this fall. Eddy is being honoured for his achievements in baseball, curling and golf. The 30th annual event is scheduled for Saturday, November 7th.
A nice blast from the past - Bob Koroluk was back in touch this week. Bob was of great help in putting together the history of the North East Saskatchewan League and finding material on his dad, Gust, a Saskatchewan baseball Hall of Famer.
Jane Shury, the President & CEO of the Saskatchewan Baseball Hall of Fame writes to remind of this year's induction ceremony coming up in a hurry, Saturday, August 15th. Among those to be honoured are the members of the Swift Current baseball squads from the 1950s through to the mid 1970s who will first be the guests at a team reunion event Friday evening. A few weeks back, organizer Cheryl Nybo indicated that more than 30 old-timers had indicated they would be attending.
The Saskatoon Outlaws are also to be recognized in the team category, while former major leaguer Joe Erautt and power-hitter outfielder Wayne Commodore are among the individuals to be inducted. Others to be honoured are Bob Armstrong of Saskatoon, Sharon Bergerman from Regina, David Burke, Kindersley, the late Albert Cottenie, Kamsack, the late Merv Freeman, Goodwater, John Hemstad, Prince Albert, the late Sharon Hogg, Swift Current, the late Kenneth MacLeod, Regina and Wade Sauter of Fairlight.
Received an enigmatic email noting that the sender had spotted the "indefatigable Rich Necker ... leaving The Legislative Library (in Regina) loaded with baseball clips. Seen by a former part-time batboy of The Delisle Gems circa 1952". Well, turns out that note was from an old pal of Rich's, Hank Ropertz of Vancouver, who has been enlisted to help chase down some Vancouver resources to chase baseball information from the 1930s. We'd also really like to see some photos of his work back in '52 !
Brian Hayes, who runs a very nice little site on the Victoria HarbourCats (of the West Coast League, a summer collegiate, wood bat, circuit) is on the lookout for material on the Victoria Tyees of the early 1950s of the professional Western International League. Our recent posting of the Victoria Athletics 1948 and 1949 team photos spurred his interest. And, subsequently, Jack Altman has been able to ID two of the players in the 1948 photo - Sal Recca is on the far left, standing. Len Kasparovitch is third from the left, kneeling. Jack, by the way, is just a hop, step and jump from two of the league teams (in Medford and Corvallis, Oregon). One of the clubs is in my general neighbourhood - the Kelowna Falcons.
I hope Mark Wyatt was able to track down a few of his dad's old baseball buds while traveling up in Prince George, BC. Rudy Wyatt was posted there with the US Air Force in 1955 and the USAF Yankees were one of six teams in the BC Central Interior League.
I love checking out the work of T.Kent Morgan out of Manitoba. Last month he was at the Manitoba Baseball Hall of Fame induction to introduce the Rosedale Juniors, a powerhouse in the province in the late 1940s and early 1950s. Kent writes a regular column for the Canstar weekly papers in Winnipeg. Here's his piece on the Rosedales.
Gary Bedingfield, who's done such marvelous work on Baseball in Wartime has just published a very helpful piece on Negro Leaguers in military service. The list will help fill in a lot of blanks in our roster sheets. There is a link for the item on the Wartime site.
David Eskenazi and Steve Rudman have penned a fascinating look at the history of black baseball in the Seattle area. Check it out at the Wayback Machine. The article is based on the work of Lyle Kenai Wilson and his book, “Sunday Afternoons at Garfield Park.”
I'm going to post only the first paragraph of the latest story at Diamonds in the Dusk, Brian Morrison's dandy little site.
On July 15, 1921, in the northern Utah town of Ogden, former major league pitcher Dave Davenport achieves the unique distinction of being the only player ever released from a professional baseball team because he is too good.
Now, how can you resist checking out the rest of that story?
The baseball research community lost a giant in the industry in passing three months ago of ace researcher Ray Nemec of Naperville, Illinois.
Ray was such a huge help to our little operation as he had the most complete set of minor league and semi-pro statistics to be found and we had a lot of questions. We exchanged many dozens of emails over the years passing information back and forth and I continued to be in awe at the extent of his collection of statistics and his helpful, pleasant demeanour in spite of his standing in baseball research and as one of the founders of SABR (Society for American Baseball Research). No N.I.T.A. (Nose In The Air) here. A lovely man who went out of his way to help fledgling operations like ours. If they're playing up there, Ray is keeping track of the statistics. SABR's In Memoriam provides an expanded view of the man and his work.
Bill Prior, the Victoria pitching star of the 1940s and 1950s passed away in April this year in Victoria. Tom Hawthorne'sBenched notes that the right-hander was described as “one of the greatest baseball players to come out of Victoria” when inducted into the Greater Victoria Sports Hall of Fame in 2002.
Prior was also pretty good with the lumber. In 1948, for example, he not only topped the hurlers in the Victoria Senior League with a 9-1 record and 2.44 ERA (113 strikeouts in 70 innings. an eye-popping 14.5 Ks per nine innings) he led the league in hitting, batting .364 and topping the circuit with four homers. Prior died April 14th at the age of 92.
As you've probably noticed, the NEWS page has been abridged (with the previous material posted as News Page #19). So if you are looking for some of the older material, swing over there.
9 July, 2015
We've been pecking away at the keyboard to compile some rosters, one from the 1951 season of the Brooks-Medicine Hat and District League, and secondly, from the 1943 Victoria Senior League.
Interestingly, in the reports from 1943, provided by Rich Necker, there are notes of exhibition games with teams from Washington, including Fort Lewis (about ten miles from Tacoma), a U.S. Army team which featured major leaguer Morrie Arnovich as the playing manager and Saskatchewan's Aldon Wilkie (another major leaguer) as one of the team's hurlers. Another pitcher was Eddie Erautt, brother of Canadian catcher and future major leaguer Joe Erautt.who is to be inducted into the Saskatchewan Baseball Hall of Fame next month.
Victoria teams featured a number of players from elsewhere in the country -- Emil Hangs (left) who pitched for Wiseton, Saskatchewan, Gerry Whitney who went on to play in Saskatoon and Calgary, Billy Burke and Jack Couglin from Saskatoon and a few from Eastern Canada as well.
In the process of chasing down these rosters, we discovered Canadian catcher Bob Laurie playing as early as 1951 (you might recall the Laurie tangent of many months back as we tried to fill in the blanks in his career). We made a site wide correction to be consistent with the spelling of Walt Pashuk, a pitcher in Alberta in the 1940s and 1950s. And, we found Wilf "Lefty" Pennington (right) still throwing 'em in 1951-1952 for Medicine Hat. Our records have Pennington first noted as playing in 1928. That's a career of at least 25 years !
And, not sure if I mentioned the additions to the roster pages of 1910, 1915, 1921 and 1922.
In a search of Vancouver Asahi games in the 1930s, we came across the remarkable playoff between the Asahis and IOCO (Imperial Oil) for the Terminal League championship in 1935. Asahis took the first three games of the best-of-seven final (winning one of the games in spite of being no-hit). Then the Imperials roared back with four straight wins, including back-to-back no-hitters (yes, three in all) to take the title. The game reports are available on the 1935 Vancouver page.
Former Western Canada star Jack Altman has been such a good friend of our little operation. In fact, if not for Jack and his great assistance way back in the early days, the site may never have evolved past the eight years of Lloydminster's participation in the old Western Canada circuit (Lloydminster? Well, that was my home town and my role as bat boy, stats guy, clubhouse boy, assistant to the GM for the Meridians is the foundation for the site.)
(You might recall our research project to pin down Altman's 1954 season in college and semi-pro ball In Canada and the USA. It worked out to 59 games and 365 1/3 innings. He finished with a 32-11 won/lost record and fanned 431 while compiling an ERA of 1.60 !)
Jack has helped us again with some photos from back in 1958 in Honolulu, his home at the time. The impetus was the photo of the 1948 Victoria Athletics, noted a few days ago, and his recognition of a couple of names on the roster. He's hoping to ID some of the players from his playing days and connections in Hawaii. One of the players turned up in a batch of photos taken in Hawaii in '58. More on that when Jack has a chance to go over the Victoria photo (which was missing for a time from the site).
Below right - Jack Ladra (Kamsack Cyclones 1953) on the left with Greg Seastrom.
You wonder how so many players from Hawaii ended up on the Canadian prairies? It was a result of a recruiting effort by Coalinga Junior College in California, which brought the players to the United States where they were noticed and signed to play in Western Canada. |
Nick Young probably hates the 2016 version of himself for joining Warriors
Nick Young probably hates the 2016 version of himself for joining Warriors by David Austin Bumpus
The Denver Broncos signed Jamaal Charles this offseason in hopes of bolstering their run game, which has struggled to take off with C.J. Anderson.
For the first time since 2010, the Broncos missed the postseason last year with a 9-7 record. Much of the blame centered around the offense, which ranked 27th in total yardage. Part of the issue was running back C.J. Anderson missing nine games with a knee injury.
Anderson, 26, was signed to a four-year deal worth $18 million before the 2016 season, with general manager John Elway matching an offer sheet from the Miami Dolphins. Since then, Anderson has rushed for just 1,157 yards while splitting time with Ronnie Hillman and Devontae Booker over that span.
On the Stacking The Box podcast, NFL insider Benjamin Allbright revealed that the Broncos are unhappy with Anderson, potentially readying to move on.
“C.J. has kind of fallen out of favor here with these coaches,” Allbright said. “This will be his last year here either way. Showing up overweight, his work ethic maybe not where it should be.”
Anderson can be released without a cap penalty following this year. While Charles will become a free agent as well, Booker is still in house. Denver could add some more youth to the depth chart come 2018 or bring in another veteran back, perhaps retaining Charles if the former All-Pro regains his old form.
As a rookie out of the University of California, Anderson was a reserve before earning a share of the starting role in 2014. He was the main ball-carrier in 2015, helping the Broncos to their third Super Bowl title.
However, Anderson has consistently struggled with staying in shape. He’s listed at 5-foot-8 and 224 pounds, likely a bit heavier than Vance Joseph and the coaching staff would like to see. |
663 F.2d 1073
U. S.v.Couch
80-5444
UNITED STATES COURT OF APPEALS Sixth Circuit
7/14/81
1
E.D.Ky.
APPEAL DISMISSED
|
The aim of this project is to characterize the expression of the putative testis-determining gene, Sry, in preimplantation mouse embryos and to ask whether this expression is necessary for male sex determination. The level of expression of Sry mRNA will be quantified at several preimplantation stages using a polymerase chain reaction (PCR)-based procedure that was developed previously in my lab (Gaudette and Crain, 1991). To test whether Sry expression in early embryos causes male sex determination 'antisense' nucleic acids will be introduced to inactivate the Sry mRNA, and the sex of live offspring that derive from the treated embryos will be determined after transfer to host females. The appearance of XY females would indicate that functional in mRNA is required for male sex determination. Several "antisense" strategies will be tested: (1) incubation of embryos in media containing chemically modified and unmodified oligodeoxynucleotides (ODNs); (2) microinjection of modified and unmodified ODNs; (3) injection of antisense RNA synthesized from riboprobe vectors., Full length cDNA clones of Sry mRNA will be isolated from blastocyst and testis RNA, and their sequences compared to determine whether differential splicing or promotor use occurs to produce different proteins in the two tissues. The complete sequence of the cDNA clones will also be compared to the genomic DNA to determine the structure of the gene and to define the location of upstream sequences. With the long term goal of learning how the Sry gene is activated in early embryogenesis, in vivo competition assays will be used to locate the cis-regulatory elements associated with this gene. |
Introduction {#Sec1}
============
Epidemiological data consistently show a clear trend of decreasing semen sperm count and quality in men in the last few decades^[@CR1]--[@CR3]^. The cause of the declining sperm quality is not fully understood, but exposure to synthetic chemicals in the environment is regarded as a contributing factor^[@CR4]--[@CR6]^. Among them, plasticizers in consumer products are concerning because they are ubiquitous, in direct contact with humans, and known to disrupt the endocrine system^[@CR7],[@CR8]^. As of 2015, the yearly global production of plastics reached 381 million tons, which is equivalent to the mass of two-thirds of the world's population^[@CR8]--[@CR11]^.
Phthalates are synthetic plasticizers that are used primarily to improve flexibility and softness of polyvinyl chloride (PVC) plastic products^[@CR12]^. One of the most widely used phthalates is di-2-ethylhexyl phthalate (DEHP), which is considered to be one of the most widespread environmental contaminants worldwide, with a production volume of 4 million tons per year^[@CR13]--[@CR15]^. DEHP is used in a broad range of consumer products such as food and beverage containers, insecticides, personal care products, medical equipment such as intravenous blood bags, packaging, children's toys, and building materials^[@CR16],[@CR17]^. DEHP is not covalently bound to the PVC polymer, and it easily leaches out into the environment and comes into contact with humans and animals through ingestion, inhalation, or dermal absorption^[@CR18],[@CR19]^. Urinary DEHP metabolite concentrations indicate that human exposure to DEHP ranges between 3--30 µg/kg/day^[@CR20],[@CR21]^.
As an endocrine-disrupting chemical (EDC), DEHP disrupts the reproductive system and acts as an anti-androgen in both females and males^[@CR22]--[@CR24]^. DEHP metabolites have been detected in amniotic fluid^[@CR19]^, umbilical cord blood^[@CR25]^, and other bodily fluids^[@CR26]^, indicating that humans are exposed to DEHP as early as fetal stage of their development^[@CR27]^. Indeed, exposure to DEHP during the fetal period increases the chances of epigenetic changes that have long-lasting developmental and functional impacts^[@CR28]^. For instance, prenatal exposure to DEHP has been implicated in decreased anogenital distance, reduced testosterone levels, and poor semen quality^[@CR29]--[@CR32]^, and it accelerates reproductive aging, resulting in premature reproductive senescence in male as well as female mice^[@CR33],[@CR34]^.
When a pregnant female (F0) is exposed to an EDC, the F1 generation is exposed as a developing pup, whereas the second (F2) generation is exposed as the developing germ cells in the gonad of the F1 male or female^[@CR35],[@CR36]^. This means that the third (F3) generation is the generation not directly exposed to the EDC^[@CR36]^. Interestingly, prenatal exposure to DEHP is reported to impact fertility and reproduction of F3 generation^[@CR37]^. Previous studies showed that prenatal exposure to DEHP disrupts testicular germ cell organization and spermatogonial stem cell function in F3 generation^[@CR32],[@CR38]^. An important mechanism for transgenerational transmission of early-life EDC exposure is thought to involve epigenomic reprogramming during development^[@CR36],[@CR39],[@CR40]^. Therefore, EDC exposure that introduces epigenetic changes during early development permanently alters the epigenome in the germ line, and these changes can be transmitted to subsequent generations^[@CR41]--[@CR43]^. In contrast, when an EDC introduces epigenetic changes during adult life, the changes occur in somatic cells and are not transmitted to subsequent generations^[@CR44],[@CR45]^. The transgenerational impacts are probably carried from one generation to the next via epigenetic modification^[@CR35],[@CR36],[@CR38],[@CR46]^. Epigenetic inheritance can be modulated by environmental factors and transmitted to subsequent generations via germline cells^[@CR47]^.
In a previous study, we reported that prenatal exposure to DEHP caused adverse effects in F1 males^[@CR33]^. Specifically, we showed that prenatal exposure to DEHP accelerates reproductive aging and induces premature reproductive senescence, with an impairment of testosterone production and decline in sperm quality in the F1 male mice, but only after they were at least one year old. We followed the F1 generation males up to 22 months of age, as no obvious phenotype was seen at younger ages. Therefore, in this study, we kept the F3 males for more than one year so that we could follow their reproductive function at similar time-points as assessed in the F1 generation. Further, a number of studies have assessed the transgenerational impact of prenatal DEHP exposure on reproductive function and reported that DEHP induces reproductive dysfunction in the F2 and F3 generations^[@CR34],[@CR36],[@CR48],[@CR49]^. Interestingly, the impacted future generations display a wide range of heterogeneity in their reproductive traits. In the current study, the role that the Y chromosome plays in creating such heterogeneity is explored by testing the hypothesis that the Y chromosome serves as a carrier of the exposure impact to future generations. This hypothesis implies that a male with a Y chromosome that is from a male that was exposed to an endocrine disruptor will display a more severe reproductive phenotype than a male whose Y chromosome is from an unexposed male. We tested our hypothesis using a mouse model in which F1 generation animals were exposed prenatally to DEHP and the severity of impacted reproductive traits was compared between the F3 generation males that were descendants of F1 males (paternal lineage) and those from F1 females (maternal lineage). In the paternal lineage transmission, the males inherit the Y chromosome from their father only and gene modifications on the Y chromosome will pass from fathers to sons for multiple generations. In contrast, in maternal lineage transmission, the male inherits the X chromosome from the mother and will have an unexposed Y chromosome. Our results show that paternal lineage F3 DEHP males exhibited fertility, testicular steroidogenic capacity, and spermatogenesis outcomes that were more severely impaired than those of maternal lineage males. This transgenerational difference in the DEHP impact can be attributed specifically to the Y chromosome.
Results {#Sec2}
=======
Prenatal exposure to DEHP affects the body and gonadal weights and testosterone levels of the F3 generation in a lineage- and dose-dependent manner {#Sec3}
---------------------------------------------------------------------------------------------------------------------------------------------------
Pregnant female mice (F0) were orally dosed from gestational day (GD) 11 to the day of birth with either the vehicle control (tocopherol-stripped corn oil), 20 µg/kg/day, or 200 µg/kg/day of DEHP. We chose to dose between GD 11 until birth because this is a critical time for both gonadal development and establishing the germline epigenome^[@CR50],[@CR51]^. Therefore, any alterations caused by the exposure to DEHP may impact the gonadal function of the F1 and future generations. To produce the paternal male line, young adult F1 males were mated with non-treated females to generate F2, and the resulting young adult F2 males were bred with non-treated females to generate F3 generation males. Similarly, maternal lineage F3 males were produced by breeding F1 females with non-treated males and the resulting F2 females were then bred with non-treated males to generate F3 males **(**Fig. [1](#Fig1){ref-type="fig"}**)**. The paternal and maternal F3 generation males were used to assess the transgenerational impact of DEHP exposure.Figure 1Schematic diagram of the experimental design. The pregnant female mice (F0) were orally dosed with (tocopherol-stripped corn oil (control), or 20 µg/kg/day or 200 µg/kg/day of DEHP from gestational day (GD) 11 to the day of birth. Adult F1 males/females were mated to produce F3 males from paternal and maternal lineages. To examine DEHP transgenerational transmission through the paternal lineage, seven adult F1 males from different litters were randomly selected and naturally mated with non-treated females to generate F2 males for the paternal lines. When the F2 generation males were three months old, seven males from different litters were mated with non-treated females to create the F3 generation from the paternal lineage. By the same pattern, to examine the DEHP transgenerational transmission through the maternal lineage, seven adult F1 females were mated with non-treated males to generate F2 males from the maternal lineage. When the F2 generation females were three months old, seven females from different litters were randomly selected and mated with non-treated males to create the F3 generation males from the maternal lineage.
Paternal lineage F3 male mice from the 20 µg/kg/day DEHP treatment group had heavier body and gonadal weights than the controls (*P* = 0.04, *P* = 0.03; respectively) **(**Fig. [2A,B](#Fig2){ref-type="fig"}, n = 5 to 7 males/treatment**)**. In contrast, no significant differences in body and gonadal weights were seen between control and maternal lineage F3 DEHP males. The 200 µg/kg/day DEHP treatment group did not show an alteration in their gonadal and body weights in males from either lineage. These results show that prenatal exposure to DEHP impacts gonadal and body weights in a lineage- and dose-dependent manner. Serum testosterone levels of paternal lineage F3 DEHP males of the 20 μg/kg/day and 200 μg/kg/day DEHP were significantly lower (*P* = 0.01, *P* = 0.05; respectively) compared to the controls **(**Fig. [2C](#Fig2){ref-type="fig"}**)**. A similar trend was seen in the maternal lineage F3 males, even though the difference did not reach statistical significance in the 200 μg/kg/day DEHP lineage males **(**Fig. [2C](#Fig2){ref-type="fig"}**)**.Figure 2The effects of prenatal DEHP exposure on the body and gonadal weights, serum testosterone level, and fertility of Maternal and Paternal F3 males. (**A**) Body weight (g), **(B)** gonadal weights (mg), **(C)** serum testosterone concentration (ng/ml) were measured. **(D)** Fertility % (percent of males that produced a litter at each trial), **(E)** litter size (numbers of pups per litter), and **\[F\]** sex ratio (number of females to male pups produced in each litter) were measured. Graphs show mean ± SEM. Asterisks indicate *P* ≤ 0.05 when compared with control group, n = 5 to 7 males/treatment (Control= 7 males; 20 µg/kg/day DEHP group = 5 males; 200 µg/kg/day DEHP group = 5 males).
Prenatal exposure to DEHP decreases the fertility of F3 generation males in a lineage- and dose-dependent manner {#Sec4}
----------------------------------------------------------------------------------------------------------------
The transgenerational effects of DEHP exposure on overall gonadal function were assessed by fertility tests. To assess fertility, three-month-old proven breeder female CD-1 mice were purchased from Jackson Laboratory (Bar Harbor, MA) and given a week-long acclimation period. At the age of six months, F3 DEHP males of maternal and paternal lineages were housed with proven breeder females for two weeks and their fertility-related indices were measured **(**Fig. [2D](#Fig2){ref-type="fig"}, n = 5 to 7 males/treatment**)**. Paternal lineage F3 DEHP males that were from F1 males prenatally exposed to 20 µg/kg/day DEHP showed lower fertility compared to the controls (*P* = 0.03). However, the fertility of the maternal lineage F3 DEHP males was not different from those of the controls **(**Fig. [2D](#Fig2){ref-type="fig"}**)**. The litter size of both the paternal and maternal lineage F3 DEHP male groups was not different from that of the control **(**Fig. [2E](#Fig2){ref-type="fig"}**)**. The paternal lineage F3 males from the 20 µg/kg/day DEHP group had a significantly lower female-to-male ratio compared to the control group (P = 0.04) **(**Fig. [2F](#Fig2){ref-type="fig"}**)**.
Prenatal exposure to DEHP decreases the steroidogenic capacity of F3 generation males in a lineage- and dose-dependent manner {#Sec5}
-----------------------------------------------------------------------------------------------------------------------------
The lower testosterone level in the serum prompted us to determine if the testosterone synthesis pathway was transgenerationally affected by the DEHP exposure in a lineage-dependent manner. As the serum testosterone level is predominantly regulated by testicular testosterone synthesis^[@CR52]^, the expression patterns of the genes that are involved in testosterone synthesis were measured by quantitative PCR. The paternal lineage F3 males of the 20 µg/kg/day and 200 μg/kg/day DEHP treatment groups had significantly lower *Star* and *Hsd17β*1 expression levels than the controls \[20 µg/kg/day DEHP group (*P* = 0.01, *P* = 0.008), and 200 µg/kg/day DEHP group *(P* = 0.02, *P* = 0.05), respectively\] **(**Fig. [3A](#Fig3){ref-type="fig"}**)**. In the maternal lineage F3 males, only those from the 20 µg/kg/day DEHP dose group showed a significantly lower *Hsd17β*1 expression (*P* = 0.04) compared to the control group **(**Fig. [3A](#Fig3){ref-type="fig"}**)**. The expression of *Cyp17a*1 and *Hsd3b*1 was not altered in either group of F3 lineage males.Figure 3Impact of prenatal exposure to DEHP on steroidogenic and testicular blood testes barriers (BTB) genes expression of Maternal and Paternal F3 males. (**A**) Real time-PCR analysis of testicular steroidogenesis gene (mRNA) expressions in F3 males--paternal and maternal lineages. **(B)** Real time-PCR analysis of testicular blood testes barriers gene (mRNA) expressions (*Occludin, F11R, Claudin 11, and Zo-1*) in paternal and maternal lineage F3 males. Data from each gene were normalized to the corresponding value of the internal control (*L19*), gene expression data are presented as fold changes of each group compared to control. Graphs show mean ± SEM, asterisks indicate *P* ≤ 0.05 when compared with control group; n = 5 to 7 males per treatment group.
Prenatal exposure to DEHP alters blood testes barriers gene expression in the F3 generation males {#Sec6}
-------------------------------------------------------------------------------------------------
In the testes, the blood testes barrier (BTB) is created by adjacent Sertoli cells that prevent diffusion of any harmful substances to the inside of the testes^[@CR53],[@CR54]^. The BTB also plays a crucial role in spermatogenesis and differentiation of spermatogonia into spermatocytes^[@CR53]^. The expression of BTB tight junction components (*claudin* 1*1, occludin, Zo-1*, and *F11R*) were assessed by quantitative PCR **(**Fig. [3B](#Fig3){ref-type="fig"}, n = 5 to 7 males/treatment**)**. Paternal lineage F3 males from the 200 μg/kg/day DEHP dose group had a significantly lower expression of *claudin 11, occludin, Zo-1*, and *F11R* compared to the control group (*P* = 0.05, *P* = 0.03, *P* = 0.05, *P* = 0.02, respectively). Moreover, the 20 μg/kg/day DEHP treatment group had significantly lower *occludin* and *claudin 11* mRNA expression compared to controls (*P* = 0.01, *P* = 0.008, respectively) **(**Fig. [3B](#Fig3){ref-type="fig"}**)**. In contrast, in the maternal lineage F3 males, only the 20 μg/kg/day DEHP group had a lower *occludin* expression (*P* = 0.0 (5compared to control group **(**Fig. [3B](#Fig3){ref-type="fig"}**)**. The mRNA expression of *claudin 11, Zo-1*, and *F11R* was not altered in the maternal lineage F3 DEHP males. Utilizing immunohistochemistry, we examined SOX9 expression (Sertoli cell marker) in the testes because Sertoli cells constitute BTB in the seminiferous tubules (Fig. [S1](#MOESM1){ref-type="media"}). The testes of the paternal F3 male showed decreased number of SOX9-positive cells (Sertoli cells) and the distribution was disorganized compared to control. Expression of SOX9 was reduced in the testes of paternal F3 males compared to control testes.
Prenatal exposure to DEHP decreased the spermatogenesis of the F3 generation in a lineage-dependent manner {#Sec7}
----------------------------------------------------------------------------------------------------------
The impact of prenatal exposure to DEHP on the testes and epididymides of F3 males was microscopically examined. The seminiferous tubules of the controls showed active spermatogenesis **(**Fig. [4A1](#Fig4){ref-type="fig"}, n = 4 to 5 males/treatment**)**, and the epididymis contained dense sperm populations **(**Fig. [4B1](#Fig4){ref-type="fig"}**)**. However, the testes of the F3 paternal lineage of the 20 µg/kg/day and 200 μg/kg/day DEHP treatment groups exhibited impaired spermatogenesis and degenerative seminiferous tubules **(**Fig. [4A2,A3](#Fig4){ref-type="fig"}**)**. Maternal lineage F3 DEHP males also showed degenerative changes on the testes, but to a lesser degree than the paternal F3 males **(**Fig. [4A5,A6](#Fig4){ref-type="fig"}**)**. In the epididymides of both paternal and maternal lineage DEHP males, sloughed germ cells were seen in the lumen **(**Figs. [4B](#Fig4){ref-type="fig"}, [S2](#MOESM1){ref-type="media"}). Of note, one mouse from the 20 µg/kg/day DEHP F3 males of paternal lineage had testicular atrophy, spermatocele, and sperm stasis with complete absence of sperm in the epididymis **(**Fig. [4C](#Fig4){ref-type="fig"}). Quantitative histological analysis revealed that the paternal lineage F3 DEHP males had a higher number of pathological abnormalities than maternal lineage males **(**Table [1](#Tab1){ref-type="table"}**)**.Figure 4Effect of DEHP exposure on the testes and epididymis of Maternal and Paternal F3 males. (**A**) Testes and **(B)** epididymis was collected at 15 months of age and the epididymis were stained with hematoxylin and eosin, n = 4 to 5 males/treatment. **(**A1,A4**)** Testis of a control mouse. **(**A2,3,5,6) Testes of DEHP treated mice. (B1,B4) Epididymis of a control mouse. **(**B2,3,5,6) Epididymis of DEHP treated mice. **(C)** One mouse from the 20 µg/kg/day DEHP F3 males of paternal lineage had testicular atrophy and sperm stasis with complete absence of any sperm production in the epididymis. Note hypospermatogenesis with degenerative changes in the seminiferous tubules and germ cell degeneration (black arrows), desquamated germ cell the in lumen of epididymis (white arrows).Table 1Histopathological impact of transgenerational prenatal DEHP exposure.ControlF3- Paternal lineF3- Maternal line20 µg/kg/day DEHP200 µg/kg/day DEHP20 µg/kg/day DEHP200 µg/kg/day DEHP**Testis**-Hypospermatogenesis0% (0/4)75% (3/4)50% (2/4)20% (1/5)20% (1/5)-Germ cell degeneration0% (0/4)75% (3/4)50% (2/4)20% (1/5)40% (2/5)-Abnormal residual bodies0% (0/4)75% (3/4)25% (1/4)20% (1/5)20% (1/5)-Spermatocele0% (0/4)25% (1/4)0% (0/4)0% (0/5)0% (0/5)**Epididymis**-Epididymal vacuoles.0% (0/4)75% (3/4)50% (2/4)20% (1/5)20% (1/5)-Germ cell in lumen of epididymis25% (1/4)75% (3/4)75% (3/4)20% (1/5)40% (2/5)-Sperm stasis0% (0/4)25% (1/4)0% (0/4)0% (0/5)0% (0/5)a, the number of mice showing each abnormality per treatment group was divided by the total mice per treatment group to calculate a percentage of affected mice for each abnormality (affected mice/total number of mice).
Prenatal exposure to DEHP decreased the sperm quantity and quality of the F3 generation in a lineage- and dose-dependent manner {#Sec8}
-------------------------------------------------------------------------------------------------------------------------------
Epididymal sperm concentration and sperm motility were assessed by CASA at 15 months of age. Sperm concentration was significantly decreased in the paternal lineage F3 males of the 20 μg/kg/day and 200 μg/kg/day DEHP groups (*P* = 0.001, *P* = 0.005; respectively) compared to the control **(**Fig. [5A](#Fig5){ref-type="fig"}, n = 5 to 7 males/treatment**)**. The maternal lineage F3 males of 20 μg/kg/day DEHP group had also a lower sperm concentration, but to a lesser degree than paternal lineage males (*P* = 0.03). Interestingly, in the paternal lineage F3 males, exposure to 20 μg/kg/day of DEHP led to significantly lower percentages of motile sperm (*P* = 0.03), but no such decreased motility was seen in maternal lineage males **(**Fig. [5B](#Fig5){ref-type="fig"}**)**. The percentage of progressively motile sperm was decreased in the 20 μg/kg/day and 200 μg/kg/day DEHP groups (*P* = 0.01, *P* = 0.05; respectively), and increased numbers of immotile sperm were seen in the 20 µg/kg/day, 200 µg/kg/day groups (*P* = 0.03, *P* = 0.04, respectively) in the paternal lineage F3 males **(**Fig. [5C](#Fig5){ref-type="fig"}**)**. However, no differences were observed in the sperm motility parameters in the maternal lineage F3 DEHP males **(**Fig. [5B,C](#Fig5){ref-type="fig"}**)**.Figure 5The effects of prenatal DEHP exposure on sperm parameters of Maternal and Paternal F3 males. (**A**) Sperm concentrations (millions/mL), **(B)** sperm motility % (percent of motile sperm), **(C)** different pattern of motility % (progressive motility, local motility and immotile %) were measured. Graphs show mean ± SEM. Asterisks indicate *P* ≤ 0.05 when compared with control group, n = 5 to 7 males/treatment group.
Prenatal exposure to DEHP altered testicular gene expression of the F3 generation in a lineage-dependent manner {#Sec9}
---------------------------------------------------------------------------------------------------------------
Testes collected at 15 months of age from control and 20 µg/kg/day DEHP groups (n = 3 males/treatment) from the maternal and paternal F3 males were subjected to RNA sequencing. We chose the 20 µg/kg/day DEHP group as it is the dose that is relevant to daily human exposure to DEHP^[@CR15]^. The RNA sequencing result showed that a total of 21,353 genes were expressed in the testes. Among them, 320 genes were down-regulated and 122 genes were up-regulated in the paternal F3 DEHP males. Interestingly, of the paternal lineage F3 males, the top 100 most altered genes were all down-regulated as shown in Table [2](#Tab2){ref-type="table"}. The dynein light chain Tctex-type 1A gene (*Dynlt1a*) gene expression was most impacted as determined by fold changes in the paternal lineage F3 males. *Dynt1a* gene is also known as *Tctex-1* (t-complex-associated-testis-expressed 1-like 1) and known to play a role in male germ cell development^[@CR55]^. In the testes of maternal lineage F3 DEHP males, 77 genes were up-regulated and 23 genes down-regulated **(**Table [3](#Tab3){ref-type="table"}**)**.Table 2Top 100 differentially expressed genes (DEG) in the testes of DEHP F3 paternal males compared to control group.SymbolDescriptionFold Change (FC)P ValueDynlt1adynein light chain Tctex-type 1A−32.1713.6E-08Tmprss11atransmembrane protease, serine 11a−14.4481.5E-02Klk1b27kallikrein 1-related peptidase b27−14.1461.1E-01Gm19248thymosin, beta 10 pseudogene−10.9532.6E-01Klk1b22kallikrein 1-related peptidase b22−10.3931.0E-01Klk1b24kallikrein 1-related peptidase b24−9.9191.2E-01Gm6166fatty acid-binding protein, epidermal-like−9.9012.4E-02Klk1b21kallikrein 1-related peptidase b21−9.6621.2E-01Gm8220predicted gene 8220−7.6031.2E-04BC061237cDNA sequence BC061237−6.4421.5E-01Gm5693predicted gene 5693−6.3608.8E-02LOC102639037disks large homolog 5-like−6.0981.1E-05Gm8256predicted gene 8256−5.9782.8E-04Cd177CD177 antigen−5.8162.1E-05Zfp33bzinc finger protein 33B−5.1847.5E-07Gt(pU21)140Imeggene trap 140−4.9181.4E-01Gm33677predicted gene, 33677−4.6507.8E-02Cpa3carboxypeptidase A3, mast cell−4.6414.5E-05Rtkn2rhotekin 2−4.3599.1E-02Fam131cfamily with sequence similarity 131, member C−3.6693.2E-02SpegSPEG complex locus−3.6283.4E-024930579D09RikRIKEN cDNA 4930579D09 gene−3.4981.7E-01Klk1kallikrein 1−3.4871.4E-011700001G01RikRIKEN cDNA 1700001G01 gene−3.3471.6E-01Rps3a3ribosomal protein S3A3−3.3314.3E-01Aqp2aquaporin 2−3.1165.5E-03Pcdh9protocadherin 9−3.0941.4E-01Crisp1cysteine-rich secretory protein 1−2.9904.3E-01Pop4processing of precursor 4−2.8573.3E-07Zfp811zinc finger protein 811−2.8171.7E-02Atp1a3ATPase, Na+/K+ transporting, alpha 3 polypeptide−2.7751.4E-03Spock1sparc/osteonectin, cwcv−2.7576.0E-02Cntnap5ccontactin associated protein-like 5C−2.7172.7E-011700097N02RikRIKEN cDNA 1700097N02 gene−2.6922.0E-01Dapp1adaptor for phosphotyrosine and phosphoinositides−2.6634.0E-01Nipal1NIPA-like domain containing 1−2.6502.8E-02Gm33433predicted gene, 33433−2.6403.4E-02Zfp354bzinc finger protein 354B−2.6363.9E-03Cpne7copine VII−2.6261.4E-01Gm29779predicted gene, 29779−2.5953.3E-01Klk1b16kallikrein 1-related peptidase b16−2.5848.6E-02Myh7myosin, heavy polypeptide 7, cardiac muscle, beta−2.5755.0E-02Fcgr3Fc receptor, IgG, low affinity III−2.5701.8E-01Dnah8dynein, axonemal, heavy chain 8−2.5631.2E-04Gm35110predicted gene, 35110−2.5612.2E-01Gm32070predicted gene, 32070−2.5531.1E-031700049E15RikRIKEN cDNA 1700049E15 gene−2.5484.9E-01Lhfpl3lipoma HMGIC fusion partner-like 3−2.5473.9E-01Table 3Top 100 differentially expressed genes (DEG) in the testes of DEHP F3 maternal males compared to control group.SymbolDiscriptionFold change (FC)P Value1700061I17RikRIKEN cDNA 1700061I17 gene−5.3932.60E-064930503E14RikRIKEN cDNA 4930503E14 gene−11.3133.40E-064933422 A05RikRIKEN cDNA 4933422A05 gene−3.9146.90E-06Klk1b21kallikrein 1-related peptidase b212.5481.20E-05Mrs2MRS2 magnesium transporter1.8551.70E-054930401O12RikRIKEN cDNA 4930401O12 gene−1.8921.90E-051700120G07RikRIKEN cDNA 1700120G07 gene−3.2282.40E-05Itih5inter-alpha (globulin) inhibitor H52.0285.40E-05Klk1b27kallikrein 1-related peptidase b272.2435.20E-05Unc45bunc-45 myosin chaperone B3.6265.50E-05Klk1b24kallikrein 1-related peptidase b242.1666.20E-054930579D09RikRIKEN cDNA 4930579D09 gene3.6060.00008Klk1b22kallikrein 1-related peptidase b223.2200.00010Lrfn3leucine rich repeat and fibronectin type III domain 34.5930.00024Deradeoxyribose-phosphate aldolase (putative)−1.8090.00042Bdh13-hydroxybutyrate dehydrogenase, type 1−1.5200.00047Tfb1mtranscription factor B1, mitochondrial1.6720.00047Tdgf1teratocarcinoma-derived growth factor 1−5.6990.00068Slfn5osschlafen 5, opposite strand−2.1940.00070Kpna2-psKpna2 retrotransposed pseudogene−4.7850.00069Palmdpalmdelphin−2.0740.00076Serpina5serine (or cysteine) peptidase inhibitor, clade A, member 5−1.4550.00090Gtf2ird2GTF2I repeat domain containing 2−1.7560.00110Ccl24chemokine (C-C motif) ligand 24−2.1000.00110Adamts19a disintegrin-like and metallopeptidase3.6600.0011Rpl35aribosomal protein L35A3.8780.0012Lhcgrluteinizing hormone/choriogonadotropin receptor−1.3330.00134930548J01RikRIKEN cDNA 4930548J01 gene1.8850.0013Pvt1plasmacytoma variant translocation 1−1.5020.0014Tomm6translocase of outer mitochondrial membrane 6−1.3950.0014Fmo1flavin containing monooxygenase 12.5900.0015A930005H10RikRIKEN cDNA A930005H10 gene−1.6080.0017Kcnab2potassium voltage-gated channel, beta member 21.6890.0019Esx1extraembryonic, spermatogenesis, homeobox 11.6390.0019SgshN-sulfoglucosamine sulfohydrolase (sulfamidase)1.6050.0020Lrg1leucine-rich alpha-2-glycoprotein 1−1.4850.0021Obp2aodorant binding protein 2A−2.5540.0023Spink4serine peptidase inhibitor, Kazal type 4−1.6270.0023Specc1sperm antigen with calponin homology coil domains 1−1.3660.0024Lifrleukemia inhibitory factor receptor1.4640.0024Dhcr2424-dehydrocholesterol reductase−1.2870.0025Zfp951zinc finger protein 951−2.1120.0025Ifnkinterferon kappa−3.7120.0026Loxl2lysyl oxidase-like 2−1.7360.0027Tnni1troponin I, skeletal, slow 1−1.8570.0031
Prenatal exposure to DEHP altered testicular cAMP signaling pathway of the paternal lineage F3 generation {#Sec10}
---------------------------------------------------------------------------------------------------------
Steroid hormone biosynthesis in Leydig cells is regulated through hormone activation of Cyclic AMP (cAMP) signaling pathways^[@CR56]^. The decreased testosterone level and steroidogenic gene expression prompted us to examine if the cAMP signaling pathway was transgenerationally affected by the prenatal exposure to the DEHP in a lineage-dependent manner. Pathway analysis using the RNA sequencing data revealed a significant down-regulation of mRNAs for protein kinase type I (*Prkg1*), translocator protein (*Tspo*), cytochrome P450, 11a1 (*Cyp11a1*), cytochrome P450, 17a1 (*Cyp17a1*), and hydroxy-delta-5-steroid dehydrogenase 3 beta1 (*Hsd3b1*) of the paternal lineage DEHP F3 males compared to the control, but no such difference was seen in the maternal lineage males **(**Fig. [6A](#Fig6){ref-type="fig"}**)**. The expression levels of *Prkg1* and *Tspo* were down-regulated in the paternal lineage F3 DEHP males compared to the controls. Importantly, *Tspo* is involved in regulating cholesterol transport across the mitochondrial membranes^[@CR57]^. Furthermore, *Prkg1* in the Leydig cells plays an important role in phosphoprotein and activation of *Star* initiated testicular steroidogenesis^[@CR58],[@CR59]^. Principal coordinate analysis (PCoA) showed a variation of 86.2% between controls and DEHP F3 paternal lineage, but only 6.32% variation between control and DEHP F3 maternal lineage **(**Fig. [6B](#Fig6){ref-type="fig"}**)**, indicating that cAMP signaling pathway was heavily impacted in paternal lineage, but not in maternal lineage testis. Our results indicate that prenatal DEHP exposure transgenerationally impacts *Tspo* and *Prkg1* expression in Leydig cells, which may inhibit testosterone synthesis in paternal lineage F3 DEHP males.Figure 6DEHP disrupts cAMP signaling pathway in the F3 paternal lineage males but not in the F3 maternal lineage males. (**A**) Clustering analysis heat map showing log fold change of the cAMP signaling pathway-expressed genes of DEHP F3 maternal and paternal males relative to average control expression. Each row represents a sample, and each column represents a gene. **(B)** Principal coordinate analysis (PCoA) of the differentially expressed genes in the cAMP pathway, the percent of variation explained by each principal coordinate is indicated on the axes. The points represent individual mouse data from each group (n = 3 males/treatment) as: control (blue), F3 DEHP maternal group (red), and F3 DEHP paternal group (green).
Effect of prenatal DEHP exposure on the expression of Y- and X-chromosome genes in the F3 generation {#Sec11}
----------------------------------------------------------------------------------------------------
Our results show that ancestral DEHP exposure leads to a transgenerational impact on fertility, testicular steroidogenesis, and BTB integrity in paternal lineage F3 males more than in maternal lineage F3 males. This lineage-dependent transgenerational transmission led us to see if sex chromosome genes were responsible for such differences. The expression patterns of the sex chromosome genes were examined using the testicular RNA-seq data. In the paternal lineage F3 males of the DEHP exposed group, the expression of the sex-determining region of Chr Y gene (*Sry*) was down-regulated, whereas other Y-chromosome genes such as eukaryotic translation initiation factor 2 (*Eif2s3y*), chromodomain protein, Y chromosome-like (*Cdyl*), and Zinc finger protein 2 (*Zfy2*) genes were up-regulated compared to the controls. In contrast, the expression of these genes was not affected in maternal lineage F3 males compared to controls **(**Fig. [7A](#Fig7){ref-type="fig"}**)**. PCoA analysis showed a variation of 98.08% on the expression pattern of Y- chromosome genes between the controls and paternal lineage F3 males of DEHP group **(**Fig. [7B](#Fig7){ref-type="fig"}**)**, indicating that prenatal exposure to DEHP disrupts Y chromosome genes expression in the paternal lineage F3 males, but not in the maternal lineage. On the contrary, the expression patterns of X- chromosome genes in the paternal lineage F3 males and maternal lineage F3 males of DEHP groups were not different from those of the controls **(**Fig. [7C](#Fig7){ref-type="fig"}**)**. PCoA analysis showed that all the three groups clustered together **(**Fig. [7D](#Fig7){ref-type="fig"}**)**, confirming that no differences were found in the expression pattern of X-chromosome genes.
Discussion {#Sec12}
==========
It is known that prenatal exposure to DEHP impacts fertility and reproduction of the third (F3) generation^[@CR37],[@CR38],[@CR48],[@CR60],[@CR61]^. Previous studies showed that prenatal exposure to DEHP transgenerationally disrupts testicular germ cell organization and spermatogonial stem cell function in F3 generation males^[@CR32],[@CR38]^. Interestingly, the impacted future generations display a wide range of heterogeneity in their reproductive traits. In this study, the role that Y chromosome plays in creating such heterogeneity was explored by testing the hypothesis that the Y chromosome serves as a carrier of the exposure impact to future generations. Our results show that paternal lineage F3 DEHP males exhibited fertility, testicular steroidogenic capacity, and spermatogenesis outcomes that were more severely impaired than those of maternal lineage F3 males.
In this study, pregnant female mice were orally exposed daily from embryonic day 11 until birth to vehicle control or either 20 μg/kg/day or 200 μg/kg/day of DEHP. The paternal and maternal F3 generation males were used to assess the transgenerational impact of DEHP exposure. Our study showed that paternal lineage F3 male mice from the 20 µg/kg/day DEHP dosing group had body and gonadal weights that were significantly heavier than those of the control mice **(**Fig. [2A,B](#Fig2){ref-type="fig"}). In contrast, there were no changes to body or gonadal weight of maternal lineage F3 DEHP males compared to controls, indicating a paternal transmission of the phenotypes to the paternal F3 males. These impacts in the paternal lineage males suggest that the transgenerational effect is carried to next generations via sperm^[@CR62],[@CR63]^. The increased body weight was expected because previous studies reported that both current and future generations that prenatally exposed to DEHP tend to have heavier body weights and develop obesity^[@CR38],[@CR64]^. Furthermore, our previous study showed that prenatal exposure to DEHP increased the gonadal weight of F1 male mice^[@CR33]^. Indeed, a previous study showed the first evidence that the obesity-resistant phenotypes are transmitted through the paternal lineage, but not the maternal lineage using an obesity-resistant 6C2d congenic strain^[@CR63]^.
We also observed that paternal lineage F3 males from the 20 μg/kg/day and 200 μg/kg/day DEHP treatment groups had lower serum testosterone levels than the controls. In contrast, in the maternal lineage F3 males, only the 20 µg/kg/day group showed a decrease in testosterone level compared to controls. These findings are in agreement with previous reports documenting the transgenerational effects of DEHP on testosterone production^[@CR65]^. Previous studies showed that prenatal exposure to DEHP causes androgen deficiency during embryogenesis in both animals and humans^[@CR66]^, and that the DEHP impact on testosterone production mainly results from excessive production of reactive oxygen species (ROS), contributing to Leydig cell dysfunction^[@CR66]--[@CR68]^.Figure 7The effects of prenatal DEHP exposure on Y-and X-chromosome genes of Maternal and Paternal F3 males. (**A**) Clustering analysis heat map showing log fold change of Y-chromosome genes of DEHP F3 maternal and paternal males relative to average control expression. Each row represents a sample, and each column represents a gene. **(B)** Principal coordinate analysis (PCoA) of the differentially expressed genes in located in Y chromosome, the percent of variation explained by each principal coordinate is indicated on the axes. **(C)** Clustering analysis heat map showing log fold change of X-chromosome genes of DEHP F3 maternal and paternal males relative to average control expression. **(D)** Principal coordinate analysis (PCoA) of the differentially expressed genes in located in X chromosome, the percent of variation explained by each principal coordinate is indicated on the axes. The points represent individual mouse data from each group (n = 3 males/treatment) as: control (blue), F3 DEHP maternal group (red), and F3 DEHP paternal group (green).
Fertility of the F3 generation males was tested to determine the ultimate consequence of ancestral DEHP exposure on reproductive function. Paternal lineage F3 males in the 20 µg/kg/day DEHP group showed lower fertility compared to controls, whereas no changes were found in the higher dose group (200 µg/kg/day) **(**Fig. [2D](#Fig2){ref-type="fig"}**)**. Notably, there was no change in the fertility of maternal lineage F3 DEHP males compared to controls, indicating a lineage-dependent transmission of the phenotype. This result is in line with the findings of our previous study that examined the impact of prenatal exposure to DEHP on the F1 male fertility in mice^[@CR33]^. The lower fertility in the paternal line may be caused by a problem in sperm motility or sperm DNA fragmentation as a recent study showed that DEHP exposure leads to reduced sperm motility and increased sperm DNA fragmentation^[@CR69]^. Another possibility is decreased sperm capacitation, a process that is regulated by the cholesterol contents in the sperm membrane^[@CR70]^. In support, in the paternal lineage F3 DEHP males, *Tspo* expression was downregulated, indicating altered cholesterol contents in the sperm membrane and therefore, sperm capacitation. Taken together, the decreased epididymal sperm motility, the histopathological changes seen in seminiferous tubules, and potentially decreased sperm capacitation may collectively contribute to the lower fertility in the paternal lineage F3 DEHP males.
Previous studies showed that treatment of pregnant females with DEHP resulted in nonlinear, U-shaped, dose-response effects on number of pups and sex ratio in newborn offspring^[@CR24],[@CR33],[@CR71]--[@CR74]^. Our findings indicate that the pattern of nonlinear dose-response seen in the first generation is transmitted to the future generations. Of note, the effects of EDCs are dependent on dose, and importantly, low (physiological) doses can be more effective at altering some endpoints compared with high (toxicological) doses^[@CR75]^. EDCs, including DEHP, have been shown to exhibit both low-dose and non-monotonic (non-linear) dose effects^[@CR75]^, possibly by different mechanisms of action at each dose^[@CR75]^. EDCs mimic endogenous hormones and therefore at low doses, EDCs may act by binding to hormone receptors in a manner similar to that for endogenous ligands^[@CR75]^. Many well-characterized mechanisms for these dose-specific effects include receptor down-regulation at high doses versus up-regulation at low doses^[@CR76]^. Although transgenerational exposure to phthalates has been shown to have both low-dose and non-monotonic effects, the mechanism for these effects is still largely understudied^[@CR33],[@CR34],[@CR77]--[@CR79]^.
The low testosterone levels seen along with low fertility in the F3 DEHP males led us to examine whether their machinery for testosterone production was impaired in those males. Testicular steroidogenesis is an important process for synthesizing testosterone, and any dysfunction on this pathway could impact male fertility^[@CR52],[@CR80]--[@CR82]^. The paternal lineage F3 males in the 20 µg/kg/day and 200 μg/kg/day DEHP groups had significantly lower *Star* and *Hsd17β1* mRNA expression levels than controls. In contrast, in the maternal lineage F3 males, only those from the 20 µg/kg/day DEHP group showed a significantly lower *Hsd17β1* expression compared to controls. Collectively, these results indicate that paternal F3 DEHP males may have higher transgenerational impact on steroidogenic capacity than F3 maternal lineage males. *Star* is responsible for cholesterol transport into the inner mitochondria and its down-regulation is associated with reduced cholesterol uptake, leading to decreased testosterone synthesis^[@CR83],[@CR84]^. Taken together, these results suggest that the low serum testosterone levels seen in the paternal F3 DEHP lineage males may be primarily due to adversely affected testicular steroidogenesis. Our results are consistent with the results of a previous report that observed transgenerational decrease in steroidogenic enzyme expression in DEHP exposed groups^[@CR35],[@CR36]^.
The decreased testosterone level and steroidogenic gene expression prompted us to determine if the cAMP signaling pathway was transgenerationally affected by the DEHP exposure in a lineage-dependent manner. Our results showed that the cAMP signaling pathway was transgenerationally affected by prenatal exposure to the DEHP in a lineage-dependent manner. The expression levels of *Prkg1* and *Tspo* were down-regulated in paternal lineage F3 DEHP males **(**Fig. [6](#Fig6){ref-type="fig"}**)**. Importantly, TSPO is involved mainly in regulating cholesterol transport across the mitochondrial membranes^[@CR57]^. It has been shown that the levels of the TSPO protein in Leydig cells were decreased in testes of adult mice exposed to DEHP compared to controls^[@CR85],[@CR86]^. Furthermore, *PRKG1* in Leydig cells plays an important role in phosphoprotein and activation of *Star* initiate testicular steroidogenesis^[@CR58],[@CR59]^. Our results indicate that prenatal DEHP exposure transgenerationally impacts *Tspo* and *Prkg1* expression in Leydig cell, which may alter testosterone synthesis in paternal lineage F3 DEHP males. However, *Prkg1* and *Tspo* gene expression in the testes of maternal lineage F3 DEHP males was not different from those of the controls, indicating that ancestral exposure to DEHP disrupts the cAMP signaling pathway in DEHP paternal lineage F3 males, but not in maternal lineage males, showing a lineage dependent transmission of the exposure effect.
We examined the possibility of impaired BTB as a factor contributing to the decreased fertility in the F3 DEHP males. Particularly, we were interested in tight junction proteins because they are the key components of BTB, and any disruption of BTB function or integrity leads to testicular injury and infertility^[@CR87]^. As a result, the expression levels of *claudin 11, occludin, ZO-1*, and *F11R* were decreased in the paternal lineage F3 DEHP males compared to the controls **(**Fig. [3B](#Fig3){ref-type="fig"}**)**. In contrast, in the maternal F3 lineage males, only the 20 μg/kg/day group had a lower *Occludin* expression compared to controls, indicating that DEHP F3 paternal lineage males may have more severe impact in their BTB gene expression than maternal F3 lineage males. Indeed, when we stained testis tissue sections with anti-SOX9 antibody (Sertoli cell marker), fewer SOX9-positive cells were seen in the testes of paternal lineage F3 males compared to control testes, and the distribution of the SOX9-positive cells was disorganized (Fig. [S2](#MOESM1){ref-type="media"}). Interconnected Sertoli cells constitute BTB in the testis. Therefore, fewer and disorganized Sertoli cells indicate that the BTB might be disrupted in the paternal lineage DEHP males, consequently affecting spermatogenesis. Interestingly, the testes of paternal lineage F3 DEHP males had more pathological abnormalities than those of maternal lineage males **(**Table [1](#Tab1){ref-type="table"}**)**, suggesting a paternal transmission of the phenotypes to the F3 males. These results are consistent with a recent rat study that found that DEHP exposure led to decreased occludin expression compared to control in the F1 generation^[@CR88]^. Because adequate testosterone levels are required for germ cell attachment in seminiferous tubules^[@CR88]^, the decreased testosterone levels and impaired BTB might contribute to the germ cell detachment and subsequent germ cell apoptosis as seen in previous studies^[@CR32],[@CR89],[@CR90]^. Indeed, paternal lineage F3 DEHP males had a lower number of sperm with progressive motility and higher numbers of immotile sperm compared to controls. However, the sperm motility of maternal lineage F3 males was not different from that of the controls **(**Fig. [5](#Fig5){ref-type="fig"}**)**. Furthermore, sperm concentrations were lower in the paternal and maternal F3 DEHP males than in the controls **(**Fig. [5](#Fig5){ref-type="fig"}**)**. Testosterone level affects sperm motility^[@CR91]^, hence it is likely that decreased testosterone caused by ancestral DEHP exposure may be partly responsible for the decreased sperm motility. The decreased epididymal sperm motility and the histopathological changes seen in seminiferous tubules could be a factor contributing to the lower fertility observed in the paternal F3 lineage DEHP males. Collectively, DEHP exposure appears to give a lineage-dependent transgenerational impact on BTB integrity that results in more testicular dysfunction and impaired sperm motility on paternal lineage F3 DEHP males compared to those of maternal lineage.
The impaired fertility in the paternal F3 DEHP males led us to examine if the testicular gene expression was impaired in those males. Testicular *Dynlt1a* gene expression was significantly decreased in the paternal lineage F3 DEHP males compared to controls. Interestingly, *Dynlt1a* gene expression of maternal lineage F3 DEHP males was not different from the controls. *Dynlt1a* gene is present in sperm tails, and it is expressed mainly in testis at 200-fold higher levels than in other adult tissues^[@CR92]--[@CR94]^. Furthermore, the *Dynlt1a* gene has been linked with male germ cell development and function in mice, and any defects in *Dynlt1a* expression have been linked to defective spermatogenesis in both mouse and Drosophila^[@CR55]^. Because germ cell maintenance and function are affected by *Dynlt1a* expression, it is likely that decreased *Dynt1a* resulting from ancestral DEHP exposure may be partly responsible for the decreased sperm motility and fertility in paternal F3 DEHP males. Furthermore, testicular zinc finger protein (*Zfp33b, Zfp811, Zfp354b*) was significantly decreased in the paternal lineage F3 DEHP males compared to controls **(**Table [2](#Tab2){ref-type="table"}**)**. Interestingly, *Zfp* gene expression of maternal lineage F3 DEHP males was not different from the controls. Testicular zinc finger protein is a polypeptide comprising 924 amino acid residues^[@CR95]^, and its transcript is expressed during spermatogenesis^[@CR96]^. ZFP genes have been found to participate in various biological processes, including signal transduction, transcriptional regulation, RNA binding and morphogenesis, and stress response^[@CR97]^. A previous study reported that deficiency of *Zfp* in pachytene spermatocytes resulted in undifferentiated spermatogenic cells and decreased male fertility^[@CR97]^. Additionally, testicular kallikrein 1-related peptide (*Klk1*) expression was significantly decreased in the maternal and paternal lineage F3 DEHP males compared to controls **(**Tables [2](#Tab2){ref-type="table"}, [3](#Tab3){ref-type="table"}**)**. Kallikrein is a glycoprotein involved in the enzymatic activation of kininogens that play a role in sperm motility by stimulating sperm metabolism^[@CR98]^. Whether this male reproductive dysfunction is an outcome of the defective gene expression of *Dynlt1* and *Zfp* in the paternal germline is yet to be determined.
Collectively, reproductive phenotyping of F3 males shows that prenatal DEHP exposure impacts male fertility, testicular steroidogenesis, and BTB integrity in future generations, preferentially via paternal lineage over maternal lineage. This paternal lineage-dependent transmission strongly supports our hypothesis that the Y chromosome serves as a carrier of the ancestral exposure impact to the future generations. Indeed, in the paternal lineage F3 DEHP males, the mRNA expression of *Sry* was down-regulated, whereas other Y chromosome genes such as *Eif2s3y*, *Cdyl*, and Z*fy2* genes were up-regulated compared to the controls. In contrast, the expression of these genes was not altered in maternal lineage F3 DEHP males. On the contrary, the expression patterns of X- chromosomal genes in the paternal lineage F3 males and maternal lineage F3 DEHP males were not different from controls. Altered expression of Y-chromosomal genes in the paternal F3 DEHP males is likely associated with the lineage-dependent transgenerational transmission phenotype. Notably, male-specific regions of the Y chromosome have been shown to play a critical role in maintaining the fertility through regulation of spermatogenesis^[@CR99]^. The *Sry* gene is essential for testis development and differentiation and it is expressed in adult testis and even in ejaculated spermatozoa^[@CR100]^. The *Cdy1* gene is expressed only in testis and it is involved in hyperacetylation of histones during the maturation of spermatids at the final stage of spermatogenesis^[@CR101]^. Furthermore, *Zfy2* is required for multiple aspects of spermatogenesis, especially for spermatocyte function^[@CR102]^. Alteration of Y-chromosomal gene expression has been linked to defective spermatogenesis, which could impact testicular development and function^[@CR103]^. Indeed, early-life DEHP exposure is known to involve epigenomic reprogramming during gonadal development^[@CR104]^. Therefore, when DEHP-induced epigenetic changes are introduced during early development, they may permanently alter the epigenome in the germ line (both eggs and sperm), and these changes can be transmitted to subsequent generations^[@CR36]^.
Collectively, F3 DEHP males from both paternal and maternal lineages had lower testosterone levels and sperm concentrations. However, paternal lineage F3 DEHP males exhibited lower fertility, testicular steroidogenic capacity, and spermatogenesis than those of maternal lineage males. These lineage-independent as well as lineage-dependent transgenerational effects suggest that while autosomes and X-chromosomes may serve as the carriers of the impact of the exposure, the Y-chromosome is a definite carrier of the exposure impact. Future studies should examine if Y chromosomal genes undergo epigenetic changes upon embryonic exposure to DEHP and if so, how that happens.
Materials and Methods {#Sec13}
=====================
Chemicals {#Sec14}
---------
DEHP (99% purity) was purchased from Sigma-Aldrich (CAS Number, 117-81-7; St. Lois, USA). Tocopherol-stripped corn oil (the vehicle) was purchased from MP Bio Medicals (Solon, OH). Stock solutions of DEHP were prepared by diluting it in the vehicle to obtain the desired concentrations. The lowest DEHP dose (20 µg/kg/day) was selected because it is the US Environmental Protection Agency (EPA) reference dose for human exposure^[@CR15]^, and this dose has been previously shown to affect female reproductive parameters^[@CR105]^. The 200 µg/kg/day was selected because prenatal exposure to these levels has been shown to affect reproduction and induce premature reproductive senescence in male mice^[@CR33],[@CR65],[@CR106]^. Further, occupational exposure has been shown to reach these levels^[@CR107]^.
Animals and dosing regimen {#Sec15}
--------------------------
All animal procedures were conducted in accordance with the NIH Guide for the Care and Use of Laboratory Animals and approved by the Institutional Animal Care and Use Committee of the University of Illinois at Urbana-Champaign (UIUC). Animal handling and procedures were approved by the UIUC Institutional Animal Care and Use Committee (Animal Protocol ID \#: 14144). Adult male and female CD-1 mice were purchased from Charles River Laboratories (Wilmington, MA). Mice were acclimated to the UIUC animal care facility for at least two weeks before use under 12-hour light/dark cycles. The mice were provided with Teklad Rodent Diet 8604 (Harlan) and had free access to food and high-purity water (reverse osmosis filtered) *ad libitum*. 21 pregnant female dams (F0) were prepared by mating two-month-old females with proven breeder males. A female was considered pregnant when a vaginal sperm plug was detected, at which point females were separated from males and individually housed. These dams were considered to be the F0 generation. On GD 11, F0 dams were randomly assigned to three different treatment groups (7 F0 dams/treatment group) and then they were dosed every morning at the same time until the dams gave birth to pups. The pregnant female mice (F0) were orally dosed with the vehicle control (tocopherol-stripped corn oil), 20 µg/kg/day, or 200 µg/kg/day of DEHP by placing a pipette tip into the mouth as previously described^[@CR105]^. We chose to dose between GD 11 and birth because this is a critical time for epigenetic remodeling and gonadal development in mice^[@CR50],[@CR51]^. Therefore, this exposure time provided a vulnerability for the disruption of normal epigenetic signals and the appearance of adverse effects from DEHP exposure. The pups born to the F0 dams were considered the F1 generation. Therefore, the F1 generation was exposed to DEHP *in utero*.
To examine DEHP transgenerational transmission through the paternal lineage, seven adult F1 males from different litters were randomly selected and naturally mated with non-treated females to generate F2 males for the paternal lines. When the F2 generation males were three months old, seven males from different litters were mated with non-treated females to create the F3 generation from the paternal lineage. By the same pattern, to examine the DEHP transgenerational transmission through the maternal lineage, seven adult F1 females were mated with non-treated males to generate F2 males from the maternal lineage. When the F2 generation females were three months old, seven females from different litters were randomly selected and mated with non-treated males to create the F3 generation males from the maternal lineage **(**Fig. [1](#Fig1){ref-type="fig"}**)**. The F3 generations of maternal and paternal lineages were not exposed directly to DEHP. The paternal and maternal F3 generation males were used to assess the transgenerational impact of DEHP exposure. Our previous study showed that prenatal exposure to DEHP accelerates reproductive aging and induces premature reproductive senescence in male mice^[@CR33]^. We followed the F1 generation males to 22 months old, as no obvious phenotype was seen at younger ages. Therefore, in this study, we kept the F3 males for more than one year so that we could follow their reproductive function at similar time-points as assessed in the F1 generation.
Body weight and tissue collection {#Sec16}
---------------------------------
At 15 months of age, F3 mice were euthanized by CO~2~ asphyxiation followed by cervical dislocation, and tissues were collected. Body weight (g) and gonadal (mg) weight were determined. After the mice were euthanized, the testes and epididymis were removed, cleaned, and weighed. One testis was fixed in Bouin's solution to use for histological evaluation as described below. The other testis was snap-frozen and stored for genomic analysis. Blood was also obtained during collections, and sera were used for hormone assays as described below.
Measurement of serum testosterone concentration {#Sec17}
-----------------------------------------------
Peripheral blood was collected at 15 months of age by cardiac puncture. The blood was centrifuged at 2000 × g, and then serum was collected and preserved at −20 °C until further analyses. ELISA kits (DRG Diagnostic) with a reportable range of 0.06--25 ng/ml were used to measure the concentrations of circulating testosterone. The intra- and inter-assay coefficients of variability were less than 10%.
Fertility test (mating study) {#Sec18}
-----------------------------
To assess fertility, three-month-old proven breeder female CD-1 mice were purchased from Jackson Laboratory (Bar Harbor, Maine) and given a week-long acclimation period. At six months of age, each F3 male mouse of maternal or paternal lineage was housed with a breeder female for two weeks or until a vaginal sperm plug was observed. The fertility percent (number of males that produce litter/total number of males × 100), litter size (number of pups per litter), and sex ratio (numbers of female/numbers of male pups) were recorded as described in previous studies^[@CR108]^.
Steroidogenic gene and blood testes barrier gene expression analysis {#Sec19}
--------------------------------------------------------------------
Testes were collected at 15 months of age and snap-frozen for quantitative real-time polymerase chain reaction (qPCR) analysis. Total RNA was extracted using TrizolVR solution (Ambion, Carlsbad, CA) and then purified with a RNeasy Kit (Qiagen, Valencia, CA). Concentration and quality of total RNA was analyzed using a Nanodrop (Thermo Scientific, Waltham, MA) and stored at −80 °C until use. Complementary DNA was generated by M-MLV Reverse Transcriptase (Thermo Scientific). PCR reactions were performed with Power SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer's protocol. Fluorescence was measured using the ABI prism 7500 quantitative real-time thermocycler (Applied Biosystems). PCR primers used in this study are presented in Table [4](#Tab4){ref-type="table"}.Table 4Primer sequences used for RT-PCR.Gene nameSymbolForward primer (5′-3′)Reverse primer (5′-3′)Fragment size (bp)Steroidogenic acute regulatory protein*Star*CAGGGAGAGGTGGCTATGCACCGTGTCTTTTCCAATCCTCTG262 bpCytochrome P450 11A1*Cyp11a1*AGATCCCTTCCCCTGGTGACAATGCGCATGAGAAGAGTATCGACGCATC192 bp3β-hydroxysteroid dehydrogenase 1*Hsd3b1*CAGGAGAAAGAACTGCAGGAGGTCGCACACTTGCTTGAACACAGGC280 bp17β-hydroxysteroid dehydrogenase 1*Hsd17b1*ACTGTGCCAGCAAGTTTGCGAAGCGGTTCGTGGAGAAGTAG310 bpCytochrome P450 17A1*Cyp17a1*CCAGGACCCAAGTGTGTTCTCCTGATACGAAGCACTTCTCG250 bp*Claudin 11*CLDN11GCCATCTTGCTGCTGTTGACCGGTGGGCACATACAGGAAA158 bpOccludin*OCLN*TTGAACTGTGGATTGGCAGCAAGATAAGCGAACCTTGGC90 bpTight Junction Protein *ZO*-*1ZO-1*GCGGGGTCGGATCGCCTTAAACCCAGGAGCCCTGTGAA289 bp*F11 ReceptorF11R*AACTGTAATGGGCACCGAGGTAGGGAGCTGTGATCTGGCT252 bpRibosomal Protein L19*Rpl19*CCTGAAGGTCAAAGG GAATGTCTGCCTTCAGCTTGTG GA73 bp
The mRNA expression levels of steroidogenic acute regulatory protein (*Star*), cytochrome P450 cholesterol side-chain cleavage (*Cyp11a1*), 3β-hydroxysteroid dehydrogenase 1 (*Hsd3b1*), 17β-hydroxysteroid dehydrogenase 1 (*Hsd17b1*), and cytochrome P450 aromatase (*Cyp17a1*) were measured by real-time PCR. The blood-testis barrier gene expressions (*claudin 11, occludin, ZO-1*, and *F11R*)^[@CR87]^ was also examined. Expression data were generated using the mathematical standard comparative (ΔΔCt) method. Data from each gene were normalized to the corresponding value of ribosomal protein *L19* (*Rpl19*) and used as the internal control to calculate relative fold changes, which were used for statistical analysis. The ΔCt was calculated by subtracting the *L19* Ct value from the Ct value for the gene of interest^[@CR109],[@CR110]^. The ΔΔCt was calculated from the difference between the ΔCt between the treatment groups and the control group. The relative fold-change of expression was then equated to 2(−ΔΔCt) for each group^[@CR109],[@CR110]^.
Testicular histopathology {#Sec20}
-------------------------
The testis and epididymis were collected at 15 months of age, then fixed in Bouins solution (Ricca chemical Co.) for 24 hours, then transferred to 70% ethyl alcohol until tissue processing. The tissues were embedded in paraffin, sectioned at 7 µm thickness, stained with hematoxylin and eosin, and examined using light microscopy (Olympus BX 51)^[@CR33]^. Of note, one mouse from the 20 µg/kg/day DEHP F3 males of paternal lineage had testicular atrophy, spermatocele, and sperm stasis with complete absence of sperm in the epididymis **(**Fig. [4C](#Fig4){ref-type="fig"}**)**. We considered this mouse that showed major disruption in the testes as an outlier and excluded it from further analysis in an effort to avoid confusion. Quantitative analysis of histopathological abnormalities was done by counting these abnormalities in each testis and epididymis from each mouse in all groups and calculating the percent of affected mice for each abnormality (affected litters /total number of litters)^[@CR33],[@CR78]^. The expression of anti-DDX4 (germ cell marker) antibody in the epididymis and anti-SOX9 (Sertoli cell marker) in the testes was determined by immunohistochemistry. Antigen retrieval for IHC was done using citrate buffer (pH 6.0) and microwaved at 10% power for 15 minutes. Endogenous peroxidase activity was blocked using 3% H~2~O~2~ for 20 minutes, slides were blocked with 5% goat serum for 1 hour before incubating with primary antibodies overnight at 4 °C. DDX4/MVH (Rabbit-anti-DDX4/MVH, AB13840 Abcam) or SOX 9 (Rabbit anti-Sox9, Abcam) primary antibodies were used at 1:2000 concentration. Peroxidase conjugated goat anti-rabbit secondary antibodies were used at 1:200 concentration and detected using a DAB kit (VectorLabs).
Semen analysis {#Sec21}
--------------
Semen was analyzed at 15 months of age in the F3 generations of paternal and maternal lineages. For semen analysis, the cauda of the left epididymis was excised and minced with fine scissors in a warm (37 °C) phosphate-buffered saline. The sperm suspension was incubated at 37 °C for 10 minutes to allow spermatozoa to swim out of the minced epididymis. Sperm motility was then analyzed by a computer-assisted sperm analyzer (CASA; Sperm Vision II, Minitube of America, Vernon, WI, USA). Sperm suspensions were loaded onto pre-warmed chamber slides (depth, 100 μm) (Leja slide, Spectrum Technologies, USA) and placed on a warmed microscope stage at 37 °C. At least ten microscopic fields, covering the entire viewable area of the semen analysis chamber without overlapping successive fields, were examined^[@CR33]^. Sperm motility was measured by the percentage of motile sperm, percent of progressive motile sperm, and percentage of immotile sperm^[@CR111]^.
For total sperm counts, two aliquots of semen samples were collected from each mouse and diluted in 1:200 of formalin for immobilization. Sperm numbers were counted using a hemocytometer and the average number of sperm concentration per milliliter was calculated and reported as million sperm/mL^[@CR111]^. To determine the degree of morphological abnormalities, wet mount sperm slides were prepared on clean, grease-free slides containing buffered formalin with eosin nigrosine stain. We then examined 100 sperm per sample under an oil immersion lens using a light microscope^[@CR112]^.
RNA sequencing analysis {#Sec22}
-----------------------
Frozen testes collected at 15 months of age from the control group and the 20 µg/kg/day group (n = 3 testes/treatment group) from the maternal and paternal F3 males were used for RNA sequencing. Total RNA was extracted using TRIzol Reagent (Invitrogen, Carlsbad, CA) and purified through RNeasy columns (Qiagen, Valencia, CA) according to the manufacturer's directions. The integrity of total RNA was verified by visualizing the intact and distinct 28S and 18S rRNA bands on a 1.5% agarose gel. Concentrations of RNA were measured with a NanoDrop 1000 spectrophotometer (Thermo Scientific, Waltham, MA). RNA sequencing was then performed at the Genomic Services laboratory of the Roy J. Carver Biotechnology Center at the University of Illinois at Urbana-Champaign.
Raw reads were checked for quality using FASTQC (v 0.11.5), then trimmed and filtered using Trimmomatic (v 0.36) to remove residual adapter content, low-quality bases (Phred quality score \<28), and resulting reads shorter than 30 nt. Trimmed/filtered reads were aligned to NCBI's Mus musculus GRCm38.p6 genome and gene model annotation release 106 using STAR (v 2.5.3a). Post-alignment gene counts were then determined for each NCBI EntrezGene ID using feature Counts from Subread (v 1.5.2-pl) with multi-mapping reads excluded. The raw read counts were input into R (v 3.4.3)^[@CR113]^ for pre-processing and analysis together using Bioconductor packages^[@CR114]^ as listed below. There were \~25 million reads aligned uniquely within the 41,595 M. musculus genes. The read counts were normalized by log2 counts per million (log-CPM) values followed by the exclusion of very lowly expressed genes with a negative log-CPM value using edgeR package (v 3.20.5)^[@CR115]^. Differential expression analysis was conducted using the Voom-limma pipeline with empirical Bayes moderation^[@CR116]^. The resulting P-values were adjusted using the Benjamini-Hochberg method. Results were expressed as the fold change (FC) of the average expression. A gene was identified as a DEG if its log2 (FC) was higher than 1 and false discovery rate (FDR; adjusted p-value) was lower than 0.05. Principle components analysis and clustering of the differential expression genes on different pathway were analyzed by using JMP 13 software (SAS Institute Inc., North Carolina, USA).
Statistical analysis {#Sec23}
--------------------
The data were analyzed using the statistical software package SPSS version 22. The comparison was between control and treated groups and the same age point, and the statistical sampling unit was the litter. Multiple comparisons between normally distributed continuous experimental groups were analyzed by the one-way analysis of variance (ANOVA) as a parametric test followed by the Dunnett (two-sided) post hoc test. Multiple comparisons between non-normally distributed experimental groups were analyzed by Kruskal-Wallis as a nonparametric test. Fertility data in each treatment group were statistically compared to the control group using Fisher's exact test for each treatment group against the control group. The number of animals used for statistical analyses ranged between five to seven mice during the entire experimental period. The data are presented as mean ± SEM. Statistical significance was accepted when *P* values were less than or equal to 0.05.
Supplementary information
=========================
{#Sec24}
Supplementary data.
**Publisher's note** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
=========================
is available for this paper at 10.1038/s41598-020-62584-w.
This work was supported by the Environmental Protection Agency \[RD83 543401\] National Institutes of Health \[P01 ES 022848 (C.J.K., J.A.F.)\], and Billie A. Field Fellowship in Reproductive Biology; F31 ES030467, and T32 ES007326 (S.R.). We appreciate Ms. Jennifer Shima for critical reading of the manuscript.
R.B. designed and performed experiments, analyzed and interpreted data and wrote the manuscript. P.L., S.Z., M.Z. and C.P. performed some analyses. J.A.F. designed dosing scheme and supervised S.R. and E.B. in dosing the animals. C.J.K. designed the entire study, led the project, interpreted data and wrote the manuscript. All authors read and approved the manuscript.
The authors declare no competing interests.
|
Flight 1052 departed from San Juan, Puerto Rico, to Tampa, Florida on Sunday
It had to divert paths and land in Fort Lauderdale after damage to a windshield
A flight attendant is seen on video telling passengers they weren't in any danger
Passengers were put on a different flight and arrived in Tampa that afternoon
A Jetblue flight en route to Tampa had to make an emergency landing in Fort Lauderdale after a windshield cracked.
Flight 1052 departed from San Juan, Puerto Rico, on Sunday morning and was forced to change its route 'in an abundance of caution' after one of the outer layers of the cockpit windscreen was damaged, according to a statement from the airline.
ADVERTISEMENT
Video recorded by a WFTS reporter shows a flight attendant explaining the situation to passengers.
'It happens, I wouldn't say frequently, but I've actually had this happen before,'he's heard saying.
Flight 1052 departed from San Juan, Puerto Rico, on Sunday morning and was forced to change its route 'in an abundance of caution' after one cockpit windscreen was damaged
Windshield in cockpit shattered 3/4 of way home on our @JetBlue flight to #Tampa from #PuertoRico. Thank you pilots for getting us to Fort Lauderdale safely! Be home in Tampa soon! @abcactionnews pic.twitter.com/7Rjo8ouOI9 — Michael Paluska (@MichaelPaluska) May 6, 2018
'There's multiple, multiple layers in the windscreen and it's the outer layer that shattered. ... Like I said, we're not in any grave danger.'
The airplane's pressure was not affected by the incident and people on the plane appear calm as they're informed of the incident.
Passengers were given tickets for a different flight and arrived at their final destination, Tampa, at 3.31pm.
Last month a similar incident resulted in a more tragic outcome when a woman aboard a Southwest flight to New Mexico died after being partially sucked out of a plane when the window was completely cracked by debris from an engine explosion. |
---
abstract: 'Although quantum correlations in a quantum system are characterized by the evolving quantities (which are entanglement and discord usually), we reveal such basis (i.e. the set of virtual particles) for the representation of the density matrix that the entanglement and/or discord between any two virtual particles in such representation are stationary. In particular, dealing with the nearest neighbor approximation, this system of virtual particles is represented by the $\beta$-fermions of the Jordan-Wigner transformation. Such systems are important in quantum information devices because the evolution of quantum entanglement/discord leads to the problems of realization of quantum operations. The advantage of stationary entanglement/discord is that they are completely defined by the initial density matrix and by the Hamiltonian governing the quantum dynamics in the system under consideration. Moreover, using the special initial condition together with the special system’s geometry, we construct large cluster of virtual particles with the same pairwise entanglement/discord. In other words, the measure of quantum correlations is stationary in this system and correlations are uniformly “distributed” among all virtual particles. As examples, we use both homogeneous and non-homogeneous spin-1/2 open chains with XY-interaction although other types of interactions might be also of interest.'
---
[**[ Systems with stationary distribution of quantum correlations: open spin-1/2 chains with $XY$ interaction ]{}** ]{}
[ E.B.Fel’dman and A.I. Zenchuk ]{}
[*Institute of Problems of Chemical Physics, RAS, Chernogolovka, Moscow reg., 142432, Russia*]{},\
e-mail: efeldman@icp.ac.ru, zenchuk@itp.ac.ru
Introduction {#Sec:Introduction}
============
An attractive problem in quantum information processing is that of revealing of quantum correlations in a system. Presently, two measures are most acknowledged as characteristics of quantum correlations: the quantum entanglement [@Wootters; @HWootters; @P; @AFOV; @DPF] and the quantum discord [@Z0; @HV; @OZ; @Z]. The so-called quantum entanglement must be noted as the first quantitative measure of quantum correlations. However, it was shown that the quantum discord involves more quantum correlations. As justification of this statement, there are quantum systems with zero entanglement revealing the non-zero discord. Therefore it is considered [@DSC] that namely discord is a proper measure responsible for advantages of quantum information devices (quantum speed-up and others).
In general, the calculation of discord is a very cumbersome optimization problem. In spite of intensive study of discord, only very special cases have been treated analytically [@L; @ARA; @Xu; @BXH]. Nevertheless, namely these cases correspond to the reduced binary density matrix in spin-1/2 chains governed by different Hamiltonians with either the thermal equilibrium initial state [@G; @KZ], the initial state with the single excited node [@Bose] and the initial state with the single polarized node [@ZME; @FBE; @FZ_2012].
Let us notice, that the problem of a proper initial state is one of the fundamental problems in study of quntum correlations in different physical systems because of the technical difficulties in realization of a particular state. The so-called thermal equilibrium initial state [@G] is most popular because of its simple realization. However, the initial state with a single excited node is more relative, for instance, to quantum communication lines [@Bose; @CDEL; @ACDE; @KS; @GKMT; @FKZ]. Another example is the state with a single polarized node which was produced experimentally [@ZME]. The evolution of a quantum system with this initial state at high temperatures was studied, for instance, in [@FBE], where the quantum echo was found.
In spite of intensive study, the problem of identification of quantum correlations is not resolved yet. In particular, the measure of quantum correlations depends on the basis which is taken for the density matrix representation. The reason is that, considering different bases, we involve different types of virtual particles. A possible way to avoid this ambiguity is suggested in ref.[@Z_a], where the unitary invariant discord is introduced. This measure takes into account correlations among all possible virtual particles so that there is no privilege of any particular density matrix representation.
In [@FZ_2012], instead of counting the correlations among all virtual particles (like in the unitary invariant discord [@Z_a]), the problem of preferable virtual particles was formulated. Namely, the quantum correlations among three types of particles are considered separately and compared with each other. These particles are following: (i) the fermions, which appear in a spin-1/2 system with the nearest neighbor interaction after the diagonalization via the Jordan-Wigner transformation [@JW] (we call them as the $\beta$-fermions), (ii) the fermions which are the Fourier representations of the $\beta$-fermions (the $c$-fermions), and (iii) the physical spin-1/2 particles with the basis of eigenvectors of the operators $I_{jz}$ ($z$-projection of the $j$th spin, $j=1,\dots, N$). It is shown, that the distributions of quantum correlations among eigenstates corresponding to three above bases are completely different. Remind that the $\beta$-representation is most attractive owing to its several remarkable properties. First of all, it yields the stationary pairwise discord (i.e. the discord between any two nodes $n$ and $m$), which might be convenient for the realization of quantum operations. Second, the discord might be nonzero even between the states with zero entanglement, which confirms the privilege of the discord as a measure of quantum correlations. Third, the stationary discord is completely defined by the initial density matrix (for the given type of quantum interactions) [@FZ_2012], which provides a simple tool to handle the stationary discord distribution. Thus, if the first node in the odd-node spin chain is initially polarized, then all nodes of the chain are correlated and the pairwise stationary discord increases to the center node of the chain [@FZ_2012]. If the middle node is initially polarized, then the system of odd nodes forms a cluster of correlated fermions with equal pairwise discord. This is the remarkable fact which was not observed in the systems of real physical particles and may be useful for formation of large quantum registers.
It is interesting to note that the dependence of quantum correlations on the particular basis of eigenstates is considered in [@DJ; @DJD; @AJDD; @DAJD; @AJDD2; @Lych] from another standpoint. Namely, the whole space of quantum states of a given system (the open spin-1/2 chain in the above case) may be splitted into two subspaces. The quantum correlations are considered in the first one (the subsystem $A$) while another subsystem $B$ is refereed to as the environment. In the above references, the dependence of quantum correlations on the particularly selected subsystem of quantum states is demonstrated. In our case the subsystem $A$ is represented by the eigenstates of two virtual particles of a particular density matrix representation, while the eigenstates of the rest of particles" form the environment.
This paper is devoted to the problem of study of such system of virtual particles in a given quantum system that possesses the stationary discord. We substantially extend a particular rather qualitative result of ref.[@FZ_2012] concerning the stationary discord in the system of Jordan-Wigner $\beta$-fermions corresponding to the single initially polarized node in a homogeneous spin-1/2 chain governed by the XY Hamiltonian with the nearest neighbor interactions. Namely
1. Along with the single initially polarized node, we consider the single initially excited node in a spin-1/2 chain.
2. We show analytically that the pairwise discord/entanglement are stationary in the system of virtual particles corresponding to the eigenstates of the Hamiltonian if only the initial state with the single excited/polarized node is considered. If we deal with the nearest neighbor interactions, then this virtual particles are the $\beta$-fermions of the Jordan-Wigner representation, which agrees with ref.[@FZ_2012].
3. We find out that both entanglement and discord are stationary and nonzero in the above basis if the initial state with the single excited node is taken (remember that the entanglement is zero in the $\beta$-fermion system considered in ref.[@FZ_2012]).
4. We represent the detailed analytical and numerical study of the discord/entanglement distribution in dependence on the position of the initially excited/polarized node in the chain. Subsystems with (almost) uniform pairwise discord/entanglement distribution have been revealed with analytical formulas for some of them. Examples of large subsystems are among them.
5. We refer to the inhomogeneous chains (alternating, 3-alternating and completely inhomogeneous chain of ref.[@CDEL]) and have found several peculiar subsystems with nonzero discord/entanglement. The diamerization effect is studied in the alternating chain.
6. Along with the approximation of nearest neighbor interaction, we consider the case of dipole-dipole interactions among all nodes (the case of a single initially excited node) and show that the remote interactions do not significantly deform the overall pairwise discord/entanglement distribution. Emphasize that this is an important advantage in comparison with the discord/entanglement in the system of usual spin-1/2 particles, where the remote interactions crucially change this distribution. The reason is that the remote interactions significantly affect the spin dynamics and, consequently, on the dynamics of quantum correlations. However, these correlations are stationary in our system of virtual particles.
Systems with the stationary discord/entanglement are important for construction of the quantum information devices where the stationary distribution of quantum correlations simplifies the realization of quantum operations. The matter is that the quantum operations in a given cluster of correlated particles may be performed only during the period of its existence (which is defined by the decoherence time associated with a given quantum system) and only provided that the quantum correlations are properly distributed among all nodes of a cluster. However, even if the quantum correlations are properly distributed at some instant $t_0$, this distribution will be destroyed owing to the quantum evolution. Alternately, in a system with the stationary discord, we only have to take care about the proper initial quantum correlations. Consequently, we receive the relatively simple tool to handle the quantum correlations varying the initial state and perhaps the type of quantum interactions in a system.
Note that the nodes in the system of the above virtual particles with stationary pairwise discord/entanglement are not localized in the physical space, which makes obstacles in organization of the impact on the state of a particular virtual particle using the classical environment. For this reason, the interface between the operator and quantum device must be significantly modified, which is a subject of further study. However, all representations are equivalent from the standpoint of interactions inside of a quantum system. Thus, we assume that the systems of virtual particles with stationary distribution of discord/entanglement will be useful in organization of those parts of quantum algorithms where the interaction with the operator is absent (“inner” quantum algorithms).
The paper is organized as follows. In Sec.\[Section:gen\], we formulate general statements on the existence of systems of virtual particles with the stationary pairwise discord in an arbitrary quantum system. Generalizing the idea of ref.[@FZ_2012], we show that the stationary entanglement/discord is associated with the system of virtual particles whose eigenstates diagonalize the Hamiltonian governing the dynamics of a quantum system. In Sec.\[Section:dyn\], we consider the spin dynamics in the spin-1/2 system governed by the XY-Hamiltonian and reveal general properties of the stationary entanglement/discord in this case. Then, in Sec.\[Section:num\], using the numerical simulations, we construct the stationary pairwise discord distributions among the virtual particles in the open spin-1/2 chain of $N=41$ nodes (odd $N$) governed by the XY Hamiltonian using two types of initial conditions: (i) a single initially excited node and (ii) a single initially polarized node. In the case of a single initially excited node, we consider both the approximation of nearest neighbor interactions and the model with the dipole-dipole interactions (DDIs) among all nodes and demonstrate that the later does not significantly deform the distribution of the stationary pairwise quantum entanglement/discord in the system. In the case of a single initially polarized node, we consider only the nearest neighbor approximation. In this case the entanglement is zero for the long chains $N>4$ [@FZ_2012] so that the discord is a proper measure of quantum correlations in this case. We discuss our results in Sec.\[Section:conclusions\]. Some auxiliary calculations are given in the Appendix, Sec.\[Section:app\].
Basis of virtual particles with stationary pairwise discord {#Section:gen}
===========================================================
The discord and entanglement in a quantum system are evolving quantities in general. Their evolution is determined by the Hamiltonian $H$ governing the dynamics of a quantum system. However, there is a basis of virtual particles possessing the stationary discord. Below we consider the Hamiltonian commuting with the $z$-projection of the total spin momentum $I_z$ and show that such basis is that of eigenvectors of Hamiltonian $H$ provided that one of two following types of initial density matrices $\rho_0$ is considered: (i) the initial state with a single excited spin and (ii) the initial state with a single polarized spin.
First, we represent the evolution of the density matrix as $$\begin{aligned}
\label{rhoevH}
\rho(t)=e^{-i Ht} \rho_0 e^{iHt},\end{aligned}$$ where $\rho_0$ is the initial density matrix. Diagonalizing $H$ we have $$\begin{aligned}
H=U \Lambda U^+,\end{aligned}$$ where $\Lambda$ is the diagonal matrix of eigenvalues of the Hamiltonian $H$ and $U^+$ is the matrix of its eigenvectors. In the basis of these eigenvectors, the evolution of the density matrix reads $$\begin{aligned}
&&\rho^H(t) = \hat E \rho^H_0 \hat E^+, \;\; \rho^H_0 =U^+ \rho_0 U,
\;\; \hat E =e^{-i \Lambda t}.\end{aligned}$$ To proceed further one has to fix a particular initial density matrix $\rho_0$.
Single initially excited node in system of spin-1/2 particles {#Section:one_exc}
-------------------------------------------------------------
In this section we derive the formulas for the stationary entanglement/discord in a system of spin-1/2 particles with a single initially excited spin. The dynamics of the quantum system of $N$ nodes governed by any Hamiltonian commuting with $I_z$ (the $z$-projection of the total spin) can be described in the $N$-dimensional basis $|n\rangle$, $n=1,\dots,N$, where $n$ means that $n$th spin is excited (i.e. directed opposite to the strong magnetic field) while other spins are arranged along the magnetic field. The initial density matrix $\rho_0$ corresponding to the $j$th initially excited spin is defined by its elements as $$\begin{aligned}
(\rho_0)_{nm}=\delta_{nj}\delta_{mj}.
\end{aligned}$$ Then we can write $$\begin{aligned}
(\rho^H_0)_{nm} = U_{jn}^* U_{jm}.
\end{aligned}$$ As a consequence, we have the relation $$\begin{aligned}
\label{rho0}
| (\rho^{H}_0)_{nm}|^2 = (\rho^{H}_0)_{nn}(\rho^{H}_0)_{mm} .
\end{aligned}$$ Since the evolution of the density matrix elements $\rho^{H}_{nm}$ reads as $$\begin{aligned}
\rho^{H}_{nm}(t) = (\rho^{H}_0)_{nm} \exp(-i (\Lambda_n -\Lambda_m) t),
\end{aligned}$$ then, taking into account eq.(\[rho0\]), we have $$\begin{aligned}
\label{rHH}
| \rho^{H}_{nm}|^2 = \rho^{H}_{nn} \rho^{H}_{mm} ,
\end{aligned}$$ so that the diagonal elements do not evolve as well as $|\rho^{H}_{nm}|$ for any $n$ and $m$. This property of the density matrix $\rho^{H}$ results in the stationary discord and entanglement.
Next, we reduce the density matrix $\rho^{H}$ with respect to all nodes except for the $n$th and $m$th ones. Emphasize that now we deal with the system of virtual particles rather then with the system of spin-1/2 particles. Introduce the standard notations for the basis of two particles $$\begin{aligned}
\label{basis}
\{|00\rangle,|01\rangle,|10\rangle, |11\rangle\},
\end{aligned}$$ where $n$ and $m$ in $|nm\rangle$ mean the different filling numbers for the fermion-like particles. In this basis, the reduced density matrix reads [@DFZ]: $$\begin{aligned}
\label{rhonm}
\rho^{(nm)} = \left(
\begin{array}{cccc}
\sigma_{nm} &0&0&0\cr
0&\rho_{nn}&\rho_{nm}&0\cr
0&\rho_{mn}&\rho_{mm}&0\cr
0&0&0&0
\end{array}
\right),\;\;\sigma_{nm}=\sum_{i\neq n,m} \rho_{ii} = 1-\rho_{nn} -
\rho_{mm},\;\;n\neq m.
\end{aligned}$$ Note that the last zero in the main diagonal of the reduced density matrix $\rho^{(nm)}$ appears because the single node was excited initially and the total projection $I_z$ commutes with the XY Hamiltonian.
### Concurrence
We characterize the entanglement by the Wootters criterion in terms of the concurrence [@HWootters; @Wootters]. According to [@HWootters; @Wootters], one needs to construct the spin-flip density matrix $$\begin{aligned}
\label{trho2}
\tilde\rho_{(nm)}(\tau) =(\sigma_{y}\otimes \sigma_y) (\rho^{(nm)})^*(\tau)
(\sigma_y\otimes \sigma_y),\end{aligned}$$ where the asterisk denotes the complex conjugation and the Pauli matrix $\sigma_y= 2 I_y$. The concurrence for the density matrix $\rho_{(nm)}(\tau)$ is equal to $$\begin{aligned}
\label{C}
C=\max(0,2\lambda
-\lambda_1-\lambda_2-\lambda_3-\lambda_4),\;\;\lambda=\max(\lambda_1,\lambda_2,
\lambda_3,\lambda_4),\end{aligned}$$ where $\lambda_1$, $\lambda_2$, $\lambda_3$ and $\lambda_4$ are the square roots of the eigenvalues of the matrix product $\rho_{(nm)}(\tau) \tilde \rho_{(nm)}(\tau)$. For the density matrix $\rho$ given by eq.(\[rhonm\]) we have only one nonzero $\lambda$: $$\begin{aligned}
\label{lambdas}
&&
\lambda=\lambda_1=2 \sqrt{\rho_{nn}\rho_{mm}} \end{aligned}$$ Substituting eqs.(\[lambdas\]) into eq.(\[C\]) we obtain $$\begin{aligned}
\label{C2}
C_{nm}=\max\left(0,2\sqrt{\rho_{nn}\rho_{mm} } \right),\;\;n\neq m.\end{aligned}$$
### Discord
The matrix (\[rhonm\]) is so-called the X-matrix whose discord has been studied in [@ARA]. Although this reference contains a mistake concerning the number of arbitrary optimization parameters in the calculation of the classical part of mutual correlations (see erratum in ref.[@ARA] and ref.[@H]), this mistake has no value in our case because the element $\rho_{14}$ is zero in all density matrices considered below and relation (\[rHH\]) holds. As a consequence, we have only one optimization parameter, which we denote by $\eta$ (see eqs.(\[p\],\[theta\])). Thus, we use the algorithm developed in the above reference for the calculation of discord. Remind that the discord between the particles $n$ and $m$ of a biparticle quantum system may be calculated as $$\begin{aligned}
\label{Q}
Q_m={\cal{I}}(\rho) -{\cal{C}}^m (\rho),\end{aligned}$$ provided that the von Neumann type measurements are performed over the particle $m$. Here ${\cal{I}}(\rho)$ is the total mutual information [@OZ] which may be written as follows: $$\begin{aligned}
\label{I}
&&
{\cal{I}}(\rho) =S(\rho^{(n)}) + S(\rho^{(m)}) + \sum_{j=0}^1 \lambda_j \log_2
\lambda_j,\\\nonumber\end{aligned}$$ where $\lambda_j$ ($j=0,1$) are the non-zero eigenvalues of the density matrix $\rho^{(nm)}$, $$\begin{aligned}
\lambda_0= \rho_{mm}+\rho_{nn},\;\;\lambda_1=1-\lambda_0,\end{aligned}$$ $\rho^{(n)}={\mbox{Tr}}_m \rho^{(nm)}$ and $\rho^{(m)}={\mbox{Tr}}_n
\rho^{(nm)}$ are the reduced density matrices and the appropriate entropies $S(\rho^{(n)})$ and $S(\rho^{(m)})$ are given by the following formulas: $$\begin{aligned}
\label{SAB}
&&S(\rho^{(n)})=-(1- \rho_{mm} ) \log_2(1-\rho_{mm}) -
\rho_{mm} \log_2\rho_{mm} ,\\\nonumber
&&S(\rho^{(m)})=-(1-\rho_{nn} ) \log_2(1-\rho_{nn}) -
\rho_{nn} \log_2\rho_{nn} .\end{aligned}$$ The so-called classical counterpart ${\cal{C}}^B (\rho^{(nm)})$ of the mutual information can be found considering the minimization over the projective measurements performed on the subsystem $B$ as follows [@ARA]: $$\begin{aligned}
\label{CB2}
&&
{\cal{C}}^{(m)} (\rho)=S(\rho^{(n)}) -\min\limits_{\eta\in[0,1]}(p_0 S_0 + p_1
S_1),\end{aligned}$$ where $$\begin{aligned}
\label{S}
&&S(\theta_i)\equiv S_i = -\frac{1-\theta_i}{2}\log_2\frac{1-\theta_i}{2}-
\frac{1+\theta_i}{2}\log_2\frac{1+\theta_i}{2},
\\\label{p}
&&p_i=\frac{1}{2} \Big(1+(-1)^i\eta(1-2\rho_{nn}) \Big),\\\label{theta}
&&\theta_i=\frac{1}{p_i}\Big[(1-\eta^2) \rho_{nn} \rho_{mm} +\\\nonumber
&&
\frac{1}{4}
\Big(
1-2\rho_{mm} +(-1)^i \eta(1-2(\rho_{nn}+\rho_{mm}))\Big)^2
\Big]^{1/2},
\\\nonumber
&&
i=0,1.\end{aligned}$$ Here we introduce the parameter $\eta$ instead of $k$ in [@ARA], $k=(1+\eta)/2$. It is simple to show that the quantum discord $Q_n$ obtained performing the von Neumann type measurements on the particle $n$ can be calculated as follows: $$\begin{aligned}
\label{QA}
Q_n=Q_m|_{\rho^{(nn)}\leftrightarrow \rho^{(mm)}}\end{aligned}$$ for the system with the density matrix $\rho^{(nm)}$ given by eq.(\[rhonm\]). Then we define the discord $Q_{nm}$ as the minimum of $Q_{n}$ and $Q_{m}$ [@FZ] $$\begin{aligned}
\label{def_discord}
Q_{nm}=
\min(Q_n,Q_m), \;\; n\neq m\end{aligned}$$ with the obvious property $Q_{nm}=Q_{mn}$. We see that, since $\rho_{nn}$ and $\rho_{mm}$ do not depend on time, the discord does not evolve as well.
Similar to [@FZ_2012], we can show that the minimum in eq.(\[CB2\]) corresponds to $\eta=0$ (the proof of this statement is given in Appendix \[Section:app\]), so that we result in the following explicit formula for the discord between any two nodes: $$\begin{aligned}
\label{final_discord_ex}
&&
Q_m=1 -\rho_{nn} \log_2 \rho_{nn} - (1-\rho_{nn})\log_2(1-\rho_{nn})
+(\rho_{nn}+\rho_{mm}) \log_2 (\rho_{nn}+\rho_{mm})+\\\nonumber
&&
(1-\rho_{nn}-\rho_{mm})\log_2(1-\rho_{nn}-\rho_{mm}) -\\\nonumber
&&\frac{1}{2}
\Big(1-\sqrt{1-4\rho_{mm}(1-\rho_{nn}-\rho_{mm})}\Big)\log_2
(1-\sqrt{1-4\rho_{mm}(1-\rho_{nn}-\rho_{mm})}) -
\\\nonumber
&&
\frac{1}{2}
\Big(1+\sqrt{1-4\rho_{mm}(1-\rho_{nn}-\rho_{mm})}\Big)\log_2
(1+\sqrt{1-4\rho_{mm}(1-\rho_{nn}-\rho_{mm})})\end{aligned}$$ We see that both the discord $Q_m$ and the concurrence $C_{m}$ are zero if either $\rho_{nn}$ or $\rho_{mm}$ is zero.
Single initially polarized node {#Section:pol}
-------------------------------
The initial state with a single excited spin considered in Sec.\[Section:one\_exc\] is hard for the realization in the experiment and is associated with low temperatures. On the contrary, the initial state with a single polarized node is realizable even at high temperatures [@ZME; @FBE]. This is a motivation to consider the discord in a chain with the initially polarized spin.
The stationary discord in the homogeneous spin-1/2 chain with single initially polarized node governed by the XY-Hamiltonian was introduced in [@FZ_2012]. Here we represent the more detailed analysis of that case and generalize results on the non-homogeneous spin-1/2 chain keeping the approximation of nearest neighbor interactions.
For a non-homogeneous chain, similar to ref.[@FZ_2012], we take advantage of the Jordan-Wigner transformation [@JW]. Let us emphasize that this transformation is applicable to any Hamiltonian at the approximation of the nearest neighbor interactions. Let $I_{i\alpha}$ ($i=1,\dots,N$, $\alpha=x,y,z$) be the $i$th spin projection on the $\alpha$-axis. The initial density matrix $\rho_0$ corresponding to the initial state of the spin system with the single polarized $j$th node ($1\le j \le N$ ) at arbitrary temperature reads [@FBE; @FZ_2012] $$\begin{aligned}
\rho_0=\frac{e^{\beta I_{jz}}}{Z}=
\frac{1}{2^N}\left(1+2 I_{jz}\tanh \frac{\beta}{2}\right),\;\;Z={\mbox{Tr}}
(e^{\beta I_{jz}}) = 2^N \cosh\frac{\beta}{2},\end{aligned}$$ where $\beta=\frac{\hbar \omega_0}{kT}$ is the dimensionless inverse temperature, $\hbar$ is the Planck constant, $k$ is the Boltzmann constant, and $T$ is the temperature of the system. The evolution of the density matrix reads: $$\begin{aligned}
\label{rho_t}
\rho(t)= e^{-i t H} \rho_0 e^{i t H}=
\frac{1}{2^N} e^{-iH t} (1+2 I_{jz} \tanh\frac{\beta}{2}) e^{iH t}.\end{aligned}$$ Diagonalizing the Hamiltonian using the Jordan-Wigner transformation method [@JW] we result in the following operator representation of the Hamiltonian $H$: $$\begin{aligned}
H=\sum_{k} \varepsilon_k \beta_k^+\beta_k,\end{aligned}$$ where the fermion operators $\beta_k$ are defined in terms of the other fermion operators $c_j$ by means of the transformation (which reduces to the Fourier transformation in the case of homogeneous spin-1/2 chain) $$\begin{aligned}
\beta_k = \sum_{j=1}^N U_{kj} c_j,\end{aligned}$$ and the fermion operators $c_j$ are defined as [@JW] $$\begin{aligned}
c_j=(-2)^{j-1} I_{1z}I_{2z}\dots I_{z(j-1)} I^-_j.\end{aligned}$$ Here the eigenvalues $\varepsilon_k$ and the matrix of eigenvectors $U_{kj}$ depend on the particular Hamiltonian. Then the density matrix (\[rho\_t\]) can be transformed to the following form [@FBE] $$\begin{aligned}
\label{rhot}
\rho(t)=\frac{1-\tanh\frac{\beta}{2}}{2^N} +
\frac{\tanh\frac{\beta}{2}}{2^{N-1}} \sum_{k,k'}
e^{-i t(\varepsilon_k-\varepsilon_{k'})} U_{kj} U_{k'j} \beta^+_k\beta_{k'}\end{aligned}$$ (here we take into account reality of $U_{kj}$). Similar to [@FZ_2012], we will study the quantum correlations between any two $\beta$-fermions.
The first step in calculation of the discord between the $n$th and $m$th nodes is the construction of the reduced density matrix with respect to all nodes except for the $n$th and $m$th ones. We use notations (\[basis\]) for the vectors of the $\beta$-fermion basis. Reducing density matrix (\[rhot\]) we obtain: $$\begin{aligned}
\rho^{(nm)} = \frac{1}{4} - \frac{\tanh\frac{\beta}{2} }{4} (U_{nj}^2 +U_{mj}^2)
+
\frac{\tanh\frac{\beta}{2} }{2} \sum_{k,k'=n,m} e^{-i
t(\varepsilon_k-\varepsilon_k')} U_{kj}U_{k'j} \beta^+_k \beta_{k'}.
\end{aligned}$$ Its matrix representation in the basis (\[basis\]) reads $$\begin{aligned}
\label{rhonm_matr}
\rho^{(nm)}= \left(
\begin{array}{cccc}
J^\beta_{00} + J^\beta_{mm}+ J^\beta_{nn}&0&0&0\cr
0&J^\beta_{00} + J^\beta_{mm}&J^\beta_{mn}&0\cr
0&J^\beta_{nm} &J^\beta_{00} + J^\beta_{nn}&0\cr
0&0&0&J^\beta_{00}
\end{array}
\right),\end{aligned}$$ where $$\begin{aligned}
\label{J_bet}
&&
J^\beta_{00}= \frac{1}{4} - \frac{\tanh\frac{\beta}{2} }{4} (U_{nj}^2 +U_{mj}^2)
,
\\\nonumber
&&
J^\beta_{nm}=\frac{\tanh\frac{\beta}{2} }{2} e^{-i
t(\varepsilon_n-\varepsilon_m)} U_{nj} U_{mj}\end{aligned}$$ It is obvious that $$\begin{aligned}
\label{J_nn_beta}
J^\beta_{nn}=\frac{\tanh\frac{\beta}{2} }{2} U_{nj}^2,\end{aligned}$$ which does not depend on the time $t$. Then [@FZ_2012] $$\begin{aligned}
\label{finaldiscord}
Q_m&=&-\frac{1}{2}\Big(
(1-2 J_{nn}) \log_2 (1-2 J_{nn})+(1+2 J_{nn}) \log_2 (1+2 J_{nn})-\\\nonumber
&&
(1-2 J_{mm} - 2 J_{nn}) \log_2(1-2 J_{mm} - 2 J_{nn})-\\\nonumber
&&
(1+2 J_{mm} + 2 J_{nn}) \log_2(1+2 J_{mm} + 2 J_{nn})+\\\nonumber
&&
(1-2 \sqrt{J_{mm}(J_{mm}+J_{nn})})\log_2(1-2 \sqrt{J_{mm}(J_{mm}+J_{nn})})
+\\\nonumber
&&
(1+2 \sqrt{J_{mm}(J_{mm}+J_{nn})})\log_2(1+2 \sqrt{J_{mm}(J_{mm}+J_{nn})})\Big).\end{aligned}$$ The discord $Q_{nm}$ is defined by eq. (\[def\_discord\]) with $Q_n$ from eq.(\[QA\]). Similar to Sec.\[Section:one\_exc\], the discord $Q_{nm}$ is zero if either $J_{nn}$ or $J_{mm}$ is zero. Emphasize, that the formula (\[finaldiscord\]) for the pairwise discord $Q_{n}$ in the arbitrary non-homogeneous chain coincides with that derived for the homogeneous chain in [@FZ_2012] up to the definition of elements $J_{nn}$ (\[J\_nn\_beta\]) where $U_{nj}$ are the elements of the $j$th eigenvector of the Hamiltonian $H$ governing the dynamics of the non-homogeneous chain.
Dynamics in spin-1/2 chain with XY Hamiltonian and general properties of stationary discord {#Section:dyn}
===========================================================================================
We consider a one-dimensional open chain of spin-1/2 particles in the strong external magnetic field governed by the XY Hamiltonian
$$\begin{aligned}
\label{HamiltonianXY}
&&
{\cal{H}}=\sum_{{i,j=1}\atop{j>i}}^{N}
D_{i,j}(I_{i,x}I_{j,x} + I_{i,y}I_{j,y}),
\;\;\;D_{i,j}=\frac{\gamma^2 \hbar}{2r_{i,j}^3}.\end{aligned}$$
Here $D_{i,j}$ is the coupling constant between the $i$th and the $j$th nodes. Hereafter we will use the dimensionless time $\tau$, distances $\xi_{n,m}$, coupling constants $d_{n,m}$ defined as follows: $$\begin{aligned}
\label{tau}
&&
\tau= D_{1,2} t,\;\;\xi_{n,m}=\frac{r_{n,m}}{r_{1,2}},
\;\;
d_{n,m}=\frac{D_{n,m}}{D_{1,2}}=\frac{1}{\xi_{n,m}^3},\;\;d_{1,2}=1.\end{aligned}$$ Using definitions (\[tau\]), the Hamiltonian (\[HamiltonianXY\]) may be written as follows: $$\begin{aligned}
\label{HamiltonianXYdimles}
&&
{\cal{H}}=D_{1,2} H,\;\;\;
H=\sum_{{i,j=1}\atop{j>i}}^{N}
d_{i,j}(I_{i,x}I_{j,x} + I_{i,y}I_{j,y}).\end{aligned}$$ For the nearest neighbor interaction approximation we write $d_{i,j}= d_i \delta_{j,i+1}$, $j>i$.
Homogeneous chain with nearest neighbor interaction approximation {#Section:1excited}
-----------------------------------------------------------------
First, we consider the homogeneous spin-1/2 chain, i.e. $d_i=d\equiv 1$, $i=1,\dots,N-1$. In this case we have the following formulas for the eigenvalues and eigenvectors of the Hamiltonian [@FBE]: $$\begin{aligned}
\label{hom}
\varepsilon_k = \cos\;\frac{\pi k}{N+1},\;\;
U_{kj} = \sqrt{\frac{2}{N+1}} \sin \frac{\pi k j}{N+1},\end{aligned}$$ which hold for the initial state with both a single excited node and a single polarized node. Consequently, $$\begin{aligned}
\label{rho}
\rho_{nn} = U_{nj}^2 = \frac{2}{N+1} \sin^2 \frac{\pi n j}{N+1},\\\label{J}
J_{nn} = \frac{\tanh\frac{\beta}{2}}{2} U_{nj}^2 =
\frac{\tanh\frac{\beta}{2}}{N+1} \sin^2 \frac{\pi n j}{N+1},\end{aligned}$$ These expressions must be substituted into eqs.(\[C2\]), (\[final\_discord\_ex\]) and (\[finaldiscord\]). The most simple is the expression for the concurrence in the case of the XY Hamiltonian with a single excited node (remember that the concurrence in the case of a single polarized node is zero for long chains [@FZ_2012]): $$\begin{aligned}
\label{CJ}
C_{nm}(j) = \frac{4}{N+1}\left|\sin \frac{\pi n j}{N+1}\sin \frac{\pi m
j}{N+1}\right|.\end{aligned}$$ Now we reveal some properties of the pairwise entanglement/discord distribution among the virtual particles. We can always write $$\begin{aligned}
\frac{j}{N+1}=\frac{m_1}{m_2} ,\;\;\end{aligned}$$ where $m_1$ and $m_2$ are integers. If $m_2<N+1$, i.e. the integers $j$ and $N+1$ have the common factor, then the discord and the concurrence reveal the periodic behavior with zeros at such nodes $n$ that $$\begin{aligned}
\frac{n j}{N+1} =1.\end{aligned}$$ In the periodic case, the concurrence $C_{nm}$ and/or the discord $Q_{nm}$ take several different values depending on $n$ and $m$. The number of these values is defined by the number of different pairs of values of $\rho_{nn}$ and $\rho_{mm}$ (\[rho\]), $n,m=1,\dots,N$.
For our convenience, let us use superscripts $ex$ and $pol$ to mark quantities associated with the initially excited and the initially polarized single node respectively, i.e. we will write $Q^{ex}_{nm}$, $Q^{pol}_{nm}$, $C^{ex}_{nm}$ (while $C^{pol}_{nm} \equiv 0$ for long chains). Next, we formulate several statements on existence of large clusters of nodes with equal pairwise discord (concurrence) for odd $N$.
1. If $N$ is odd and $j=(N+1)/2$, then eq.(\[rho\]) yields only one non-zero value for $\rho_{nn}$: $$\begin{aligned}
\label{rho_1}
\rho_1\equiv \rho_{nn}=
\frac{2}{N+1},\;\;\; n=1,3,5,\dots.\end{aligned}$$ In this case the nonzero pairwise discord appears only among the odd nodes and its value is the same for any pair of odd nodes: $$\begin{aligned}
\label{Q_1}
Q^{ex,pol}_1\equiv
Q^{ex,pol}_{2k_1+1,2k_2+1}=Q^{ex,pol}_{13},\;\;k_1,k_2=1,3,\dots,\;k_2>k_1\end{aligned}$$ (we do not represent the explicit formula for discord). The concurrence reads in this case: $$\begin{aligned}
\label{C_1}
C^{ex}_1\equiv C^{ex}_{2k_1+1,2k_2+1}=C^{ex}_{13}
=\frac{4}{N+1},\;\;k_1,k_2=0,1,2,\dots,\;k_2>k_1.\end{aligned}$$
2. If $N=5 + 6i$, $i=1,2,\dots$, and $j=\frac{N+1}{3}=2(i+1)$, then again we have only one nonzero value for $\rho_{nn}$, $$\begin{aligned}
\label{rho_2}
\rho_1\equiv \rho_{nn}=
\frac{2}{N+1}\sin^2\frac{\pi}{3}= \frac{3}{2(N+1)},& n = 3k-1,
\;3k-2,\;\;k=0,1,2,\dots,2 i +2,\end{aligned}$$ The nonzero discord will be only among the nodes from the set $\{3k-1,
\;3k-2,\;k=1,\dots, 2 i +2\}$ and is the same for any pair from this set. It reads: $$\begin{aligned}
\label{Q_2}
Q^{ex,pol}_1=Q^{ex,pol}_{12},\end{aligned}$$ and is given by eqs.(\[QA\],\[def\_discord\],\[final\_discord\_ex\],\[finaldiscord\]) with proper substitutions for $J_{ii}$, $\rho_{ii}$, $i=n,m$. The concurrence between any pair from this set reads: $$\begin{aligned}
\label{C_2}
C^{ex}_1=C^{ex}_{12}=\frac{3}{N+1}.\end{aligned}$$
3. In general, if $\frac{j}{N+1}=\frac{m_1}{m_2}$, then $$\begin{aligned}
\label{rho_3}
\rho_{nn}=\frac{2}{N+1}\sin^2 \frac{\pi n m_1}{m_2},\end{aligned}$$ which is nonzero if the ratio $\frac{nm_1}{m_2}$ is not integer. Therewith for any $n_1$ and $n_2$ such that $\frac{n_1 m_1}{m_2} = 1\pm \frac{n_2 m_1}{m_2}$ we have $\rho_{n_1n_1}=\rho_{n_2n_2}$.
Alternating chain with odd $N$ and nearest neighbor interaction approximation {#Section:alt_ch}
-----------------------------------------------------------------------------
In this case $d_1=d_{2n-1}=1$, $d_2=d_{2n}$, $n=1,2,\dots$ and we use the parameter $\delta=d_2/d_1\equiv d_2$ as the dimerization degree. It is known that the Hamiltonian is analytically diagonalizable in this case for both odd [@FR] and even $N$ [@KF]. It can be readily shown that, if $N$ is odd and the excited node $j$ is even, then the discord coincides with that calculated for the homogeneous chain [@FZ_2012]. In fact, using formulas for the eigenvalues and the eigenvectors of the XY Hamiltonian derived in ref.[@FR], we conclude that both eigenvalues and eigenvectors of the XY Hamiltonian involved in the calculation of the concurrence/discord in this case coincide with those used for the calculation of the pairwise discord in the homogeneous chain, see eqs.(\[hom\]). If $j$ is odd, then the discord depends on the dimerization degree $\delta$. However, we have found that if $\delta \to 0$ (the limit of the non-interacting dimers) then the following expressions for the eigenvalues follow from the formulas of ref.[@FR] $$\begin{aligned}
\label{del_e}
2 \varepsilon_k = \lambda_k=\left\{\begin{array}{ll}\displaystyle
d_1, &\displaystyle k=1,2,\dots,\frac{N-1}{2}\cr\displaystyle
0,& \displaystyle k=\frac{N+1}{2}\cr\displaystyle
-d_1, &\displaystyle k=\frac{N+1}{2} +1,\frac{N+1}{2} +2,\dots, N\cr
\end{array}\right..
\end{aligned}$$ For the elements of the eigenvectors at $k\neq \frac{N+1}{2}$ we have $$\begin{aligned}
\label{del_U}
U_{kj}= \left\{
\begin{array}{ll}\displaystyle
\frac{ d_1}{\lambda_k}\sqrt{\frac{2}{N+1}}
\sin\Big(\frac{
\pi k(j+1)}{N+1}
\Big)
,&j=1,3,5,\dots,N\cr\displaystyle
\sqrt{\frac{2}{N+1} }\sin\Big(
\frac{\pi k j}{N+1}
\Big),& j=2,4,\dots,N-1
\end{array}\right. ,\end{aligned}$$ Finally, at $k= \frac{N+1}{2}$, we obtain $$\begin{aligned}
\label{del_U2}
U_{j,(N+1)/2} =\left\{
\begin{array}{ll}
1,& j=N\cr
0,& j\neq N
\end{array}\right. .\end{aligned}$$ Formulas (\[del\_U\],\[del\_U2\]) demonstrate that, in this case, the eigenvectors corresponding to the odd and even initially excited node $j$ are very similar up to the shift $j\to j+1$. Consequently, for small dimerization parameter $\delta$, discords corresponding to $j=2 n$ and $j=2n-1$ are very similar. In addition, the discord vanishes if $j=N$.
We shall emphasize that, considering the stationary discord in the basis of the Hamiltonian eigenstates, we obtain quantum correlations even in a system of non-interacting dimers, $\delta\to 0$. This is consequence of the diagonalization process, which involves all nodes regardless of the values of their interactions.
Numerical simulations of the dynamics in spin chain with odd $N$, $N=41$ {#Section:num}
========================================================================
All calculations of this section are performed for the spin chain with odd $N$. The stationary pairwise discord distribution for the even $N$ is essentially the same. Both models with the nearest neighbor interaction approximation and with the dipole-dipole interactions (DDIs) among all nodes are considered. In this regard, it is important to note that the interactions among the remote nodes effect significantly on the entanglement between the spin-1/2 particles and on the state transfer process along the spin-1/2 chains [@FKZ]. However, the stationary discord is much less sensitive to the remote node interactions, which only deform the distribution of the pairwise stationary discord among the nodes, see Sec.\[Section:excited\_num\]. This happens because the time evolution of the entanglement (and the polarization) is very sensitive to the interactions of the remote nodes. In general, these interactions speed up the signal propagation. However, the evolution is “averaged” in the stationary discord so that the effect of remote nodes is suppressed.
Hereafter we study the pairwise discord using different initial states with either single excited or single polarized spin. We say that two nodes are correlated if the corresponding concurrence and/or discord are non-vanishing.
Single excited node: homogeneous spin chain {#Section:excited_num}
-------------------------------------------
Now we apply formulas (\[rho\_1\]-\[rho\_3\]) to the homogeneous spin chain of $N=41$ nodes. Because of the symmetry, it is enough to consider the initially excited nodes $j\le \frac{N+1}{2}$ (for odd $N$). First we calculate the discord using the nearest neighbor interaction approximation. The basic results are following:
1\. If $j=1$, then all nodes are correlated. Both the discord and the concurrence increase to the center of the chain of virtual particles, Fig. \[Fig:disc\_hom\]a.
2\. From eqs.(\[rho\]-\[CJ\]) it follows that the discord and the concurrence are the periodic function of $n$ if $j=6$, $7$, 12, 14, 18, 21. For instance, if $j=7$ (see Fig.\[Fig:disc\_hom\]b) than we have three different values for $\rho_{nn}$: $$\begin{aligned}
\label{rhoexj7}
&&
\rho_{nn}=\rho_1=\frac{1}{84},\;\;n = 6 i +1, 6 i +5,\;\;
i=0,1,\dots,6,\\\nonumber
&&
\rho_{nn}=\rho_2=\frac{1}{28},\;\;n= 6 i +2, 6 i +4,\;\;
i=0,1,\dots,6,\\\nonumber
&&
\rho_{nn}=\rho_3=\frac{1}{21},\;\;n= 6 i +3, \;\;i=0,1,\dots,6.\end{aligned}$$ They produce 6 different values of the discord $$\begin{aligned}
\label{Qex}
&&
Q^{ex}_1=Q^{ex}_{15}\approx 0.023,\;\;Q^{ex}_2=Q^{ex}_{24}\approx 0.067,\;\;
Q^{ex}_3=Q^{ex}_{39}\approx 0.088,\\\nonumber
&&
Q^{ex}_4=Q^{ex}_{12}\approx 0.036,\;\;Q^{ex}_5=Q^{ex}_{13}\approx 0.040,\;\;
Q^{ex}_6=Q^{ex}_{23}\approx 0.076\end{aligned}$$ and of the concurrence $$\begin{aligned}
\label{Cex}
&&
C^{ex}_1=C^{ex}_{15}=\frac{1}{42},\;\;C^{ex}_2=C^{ex}_{24}=\frac{1}{14},\;\;
C^{ex}_3=C^{ex}_{39}=\frac{2}{21},\\\nonumber
&&
C^{ex}_4=C^{ex}_{12}=\frac{1}{14\sqrt{3}},\;\;C^{ex}_5=C^{ex}_{13}=\frac{1}{21},
\;\;
C^{ex}_6=C^{ex}_{23}=\frac{1}{7\sqrt{3}}.\end{aligned}$$ We see that the correlations are most strong among the nodes from the set $\{6 i +3; \;\;i=0,1,\dots,6\}$. The set of nodes $\{6 i +2, 6 i +4;\;\;
i=0,1,\dots,6\}$ is less correlated with the first one. The correlations with the set $\{6 i
+1, 6 i +5;\;\; i=0,1,\dots,6\}$ are minimal. Nevertheless, all nodes are correlated accept for the nodes $n=6i$, $i=1,\dots,6$ because all the pairwise discords involving these nodes are zeros.
3\. If $j=14$, then we have one nonzero value for the elements $\rho_{nn}$ with $n=3i-1, 3i-2$, $i=1,\dots,13$: $$\begin{aligned}
\label{rhoexj14}
\rho_{nn}=\rho_1=\frac{1}{28}\end{aligned}$$ The appropriate nonzero discord and concurrence are following: $$\begin{aligned}
Q^{ex}_1=0.067, \;\;
C^{ex}(\rho_1,\rho_1)=\frac{1}{14}.\end{aligned}$$ Thus, the pairwise concurrences and/or discords are nonzero and take the same values for any pair of nodes from the cluster $\{3 i-1,3i-2; \; i=1,2,\dots,13\}$.
4\. If $j=21$, then, again, there is only one nonzero value $\rho_{nn}$ for all odd $n$: $$\begin{aligned}
\label{rhoexj21}
\rho_1\equiv \rho_{nn}=\frac{1}{21} ,\;\;\;
n=2i -1,\;\;i=0,1,\dots,21 .\end{aligned}$$ The appropriate values of the discord and concurrence are $$\begin{aligned}
Q^{ex}_1=0.088,\;\;
C^{ex}_1=\frac{2}{21}.\end{aligned}$$ Thus, the pairwise concurrences/discords are nonzero and equal each other for any pair from the family of odd nodes.
It is remarkable, that the concurrence has the same distribution among nodes as discord. For this reason we do not represent the figures with the concurrence distribution. In addition, we verify that, involving the interactions among all nodes, the discord distribution does not become significantly deformed, which confirms the arguments given in the beginning of Sec.\[Section:num\]. As an example, in Fig.\[Fig:disc\_hom\_all\], we represent the discord distribution corresponding to the $7$th initially excited spin (i.e. $j=7$) and the Hamiltonian involving the DDIs among all nodes of the spin chain.
Single excited node: non-homogeneous spin chains
------------------------------------------------
In this section we show that varying either the coupling constants in the Hamiltonian or the initially excited node we may handle the size of the cluster of the correlated particles. Having this possibility, we may select the cluster of required nodes from the whole chain of virtual particles which is necessary for flexibility of the quantum algorithms. In this regards we notice that the problem of variation of the coupling constants may be effectively resolved using, for instance, the optical lattice [@PK]. In addition, the effect of variable coupling constants in spin chains may be effectively replaced with the variable magnetic field [@DZ] surrounding the spin chain.
### Alternating spin chain {#Section:alt}
As was mentioned in Sec.\[Section:alt\_ch\], the diagonalization of the alternating XY Hamiltonian $H$ describing the nearest neighbor interaction approximation may be performed analytically [@FR; @KF]. Remember also that, for even initially excited nodes $j$, the discord/entanglement distribution coincides with that obtained for the homogeneous spin-1/2 chain. The basic novelty of the alternating chain is that related with the small dimerization parameter $\delta$. We verify the conclusion of Sec.\[Section:alt\_ch\] that the discord distributions corresponding to $j=2
i$ and $2i-1$ are very similar, $i=1,2,\dots,20$. As an example, in Fig.\[Fig:disc\_hom01\]a, we represent the discord distribution corresponding to $j=14$ for the small dimerization parameter $\delta=0.1$. To confirm that this distribution is very similar to the distribution found for $j=13$, we turn to Fig. \[Fig:disc\_hom01\]b, where the distribution of the absolute values of the differences between both discords, ${\mbox{abs}}(Q_{nm}|_{j=14}-Q_{nm}|_{j=13})$, is depicted. In both cases, the strongly correlated nodes are $3 i-1$, $3i-2$, $i=1,2,\dots$. Again, taking into account the DDIs among all nodes we only deform the stationary pairwise discord distribution.
### 3-alternating chain
Consider the 3-alternating chain $d_{3i+1} =d_1\equiv 1$, $d_{3i+2}=d_2=1/2$ and $d_{3i}=d_3=1/4$, $i=0,1,2,\dots,13$ [@K_F]. We show only the discord distributions corresponding to such excited nodes $j$ that reveal some new features of the spin cluster with respect to the clusters in the homogeneous chain.
1\. $j=2$, nodes $n=14-28$ are excluded from the cluster of correlated virtual particles (i.e. from the cluster with non-vanishing pairwise discord), see Fig.\[Fig:disc\_alt3\]a
2\. $j=20$, strongly correlated nodes (i.e. the nodes with the pairwise discord significantly larger then the pairwise discord between other nodes) are $n=1,3,5,7,9,11,13,15,29,31,33,35,37,39,41$, see Fig.\[Fig:disc\_alt3\]b
3\. $j=21$, strongly correlated nodes are $n=15,17,19,21,23,25,27$, see Fig.\[Fig:disc\_alt3\]c
4\. $j=40$, strongly correlated nodes are only two nodes $n=14$ and $n=28$, see Fig.\[Fig:disc\_alt3\]d
Thus, adding one more parameter (the coupling constant $d_3$) allows us to create additional types of the correlated clusters.
\
### Symmetric chain with $ \displaystyle d_i=\sqrt{\frac{i (N-i)} {{N-1}}} $, $1\le i \le 20$ [@CDEL]
Considering other variants of alternating chains we may achieve a large variety of different clusters of virtual particles. We represent one more example of the spin chain introduced in [@CDEL] for the purpose of realization of the perfect state transfer along the long spin-1/2 chain governed by the XY Hamiltonian at the nearest neighbor interaction approximation. It is remarkable that the dimensionless time interval needed for the perfect excited state transfer between end nodes does not depend on the length of the chain and equals $\pi$.
The most interesting pairwise discord distributions are following.
1\. $j=1$, the cluster of nodes $n=11-29$ is formed, Fig.\[Fig:disc\_symE\]a, which is similar (but smaller) to the cluster in Figs.\[Fig:disc\_hom\]a and \[Fig:disc\_alt3\]a
2 $j=21$, the cluster of odd nodes is formed, Fig.\[Fig:disc\_symE\]b, but, unlike the homogeneous chain with the initially excited spin $j=21$, the pairwise discord is not the same for all pairs.
Spin-1/2 chains with a single initially polarized node {#Section:chain}
------------------------------------------------------
As mentioned in Sec.\[Section:pol\], this initial state is more realistic and may be created at high temperatures. However, one has to remember the overall effect of the temperature on the value of the discord and entanglement. It is well known that both vanish with the increase in the temperature, i.e. the quantum correlations are significant only at low temperatures. In our calculations we take the dimensionless inverse temperature $\beta=10$.
Notice that the distribution of the pairwise discord among the virtual particles is very similar to that obtain for the single initially excited spin in Sec.\[Section:excited\_num\]. This fact simplifies study of the discord for this more practically realizable initial state. Nevertheless, we underline basic differences of the discord distribution in this case to show that initially polarized state can be preferable in some situations. In addition, unlike the initial state with the single excited spin, the entanglement is identical to zero for long chains in this case, which was proven in [@FZ_2012] for the homogeneous chains with $N>4$. This fact is in favor of the discord as a measure of quantum correlations revealing more quantum properties than the entanglement.
### Homogeneous chain
First, we consider the homogeneous chain (Fig.\[Fig:disc\_homECHO\]) and compare the discord distribution with that obtained in Sec.\[Section:1excited\], Fig.\[Fig:disc\_hom\].
Obviously, the shapes of the discord distributions are similar in both cases with the following quantitative differences.
1\. The initially polarized node $j=1$, Fig.\[Fig:disc\_homECHO\]a. All nodes are correlated, and the minimum pairwise discords correspond to pairs involving the end nodes. Comparing Figs.\[Fig:disc\_homECHO\]a and \[Fig:disc\_hom\]a we conclude that the discord is steeper in the case of initially polarized node, which means that the edge nodes are less correlated with the center nodes in this case. Consequently, the center nodes are better correlated with each other and the edge nodes are less sensitive to the perturbations of the center nodes. These perturbations must be large enough to effect the edge nodes.
2\. If the initially polarized node is $j=7$, we have (see Fig.\[Fig:disc\_homECHO\]b) three nonzero values for the elements $\rho_{nn}$, (i.e. $\rho_i$, $i=1,2,3$) given by eq.(\[rhoexj7\]) and, consequently, three different values $J_i$, $i=1,2,3$, for $J_{nn}$: $$\begin{aligned}
\label{Jj7}
&&
J_i=\frac{\tanh \,5}{2} \rho_i,\;\;i=1,2,3.\end{aligned}$$ Therewith $$\begin{aligned}
\label{Qpol}
&&
Q^{pol}_1=Q^{pol}_{15}\approx 0.00010,\;\;Q^{pol}_2=Q^{pol}_{24}\approx
0.00092,\;\;
Q^{pol}_3=Q^{pol}_{39}\approx 0.00164,\\\nonumber
&&
Q^{pol}_4=Q^{pol}_{12}\approx 0.00031,\;\;Q^{pol}_5=Q^{pol}_{13}\approx
0.00041,\;\;
Q^{pol}_6=Q^{pol}_{23}\approx 0.00123\end{aligned}$$ All nodes are correlated accept for the nodes $n=6i$, $i=1,\dots,6$ because all the pairwise discords involving these nodes are zeros.
Notice that the spread of the discord (i.e. the ratio of the difference between the maximum and minimal nonzero discords to the maximal discord) is larger in the case of a single polarized node, which follows from the comparison of Figs.\[Fig:disc\_hom\]b and \[Fig:disc\_homECHO\]b. This means, in particular, that the nodes from the set $\{6 i +1, 6 i +5,\;\; i=0,1,\dots,6\}$ are less sensitive to the perturbations of other virtual particles in the case of the initially polarized 7th node.
3\. If the initially polarized node is $j=14$, we have the only nonzero value $\rho_{nn}$ (i.e. $\rho_1$) given by eq.(\[rhoexj14\]) and $$\begin{aligned}
&&J_1=\frac{\tanh \,5}{2} \rho_1=\frac{\tanh \,5}{56} ,\\\nonumber
&&
Q^{pol}_1=0.00092,\;\;n=3i-1, 3i-2, \;\;i=1,\dots,13
.\end{aligned}$$ The cluster of correlated nodes is formed by the nodes $\{3 i-1,3i-2; \; i=1,2,\dots,13\}$.
4\. If $j=21$, then the only nonzero value of $\rho_{nn}$ (i.e. $\rho_1$) is given by eq.(\[rhoexj21\]) and $$\begin{aligned}
&&
J_1=\frac{\tanh \,5}{42},\\\nonumber
&&
Q^{pol}_1=0.00164\;\;n=2i -1,\;\;i=0,1,\dots,21 .\end{aligned}$$ Thus, the cluster of correlated nodes is represented by the family of odd nodes.
In general, the absolute value of the discord is significantly less in the case of a single initially polarized node, as follows from the comparison of the both graphs in Figs.\[Fig:disc\_hom\] and \[Fig:disc\_homECHO\].
### Alternating chain
Similar to Sec.\[Section:alt\], the discord does not depend on the dimerization parameter $\delta$ if the initially polarized node $j$ is even. Comparing this discord with the discord for the alternating chain with initially excited node we conclude that the same remarks as for the homogeneous chain are valid in this case. Namely, the discord is steeper if $j=1$, the spread of the discord is larger and the value of discord is smaller. A novelty is that at $j=41$, unlike the discord in the chain with the initially excited spin $j=41$, the node $n=21$ is correlated with all other nodes, while other correlations are negligible, as demonstrated in Fig.\[Fig:disc\_altECHO\] for the chain with $\delta=1/2$.
Conclusions {#Section:conclusions}
===========
We study such representations of the density matrix associated with a quantum system of spin-1/2 particles which reveal the stationary distributed pairwise discord. This system is a system of virtual particles associated with the eigenstates of the Hamiltonian. In particular, if the nearest neighbor interaction approximation is used, this system of virtual particles is the system of $\beta$-fermions [@FZ_2012]. The systems with the stationary discord are convenient for the realization of the quantum operations. In addition, it is much simpler to prepare the desirable distribution of the discord, since it does not evolves. Using different coupling constants, different initial states and different Hamiltonians governing the spin dynamics we may handle the size of the cluster of coherent particles.
Emphasize, that the above virtual particles are not localized in the physical space, which creates a problem of “interaction” with these particles using the classical tools. However, this problem disappears in so-called “inner” parts of quantum algorithms where such interaction is absent. We assume that systems with stationary discord are most suitable namely for these algorithms.
Examples of homogeneous and non-homogeneous spin-1/2 chains (alternating, 3-alternating and completely inhomogeneous chain of ref. [@CDEL]) are considered with two types of the initial conditions: the single initially excited and single initially polarized node. The peculiarity of the initial state with the single initially excited node is that the both discord and entanglement are non zero in the above system of virtual particles in this case. We found (both analytically and numerically) that the stationary discord/entanglement distribution is defined by the position of the initially excited/polarized node. It is interesting that the shapes of discord and entanglement distributions are essentially the same in the case of initially excited node. In addition, this shapes remain essentially the same for the discord distribution in the case of initially polarized node. Set of peculiar subsystem of correlated virtual particles have been found. It is important that the subsystems of large numbers of virtual particles with equal pairwise discord are among them. Such subsystems might be proper candidates for the quantum registers.
It is shown that the remote DDIs only slightly deform the distribution of the discord in a quantum system, unlike the evolution of the pairwise quantum correlations in the system of physical spins and the state transfer process along the spin chains, which significantly depend on the interactions among remote nodes.
This work is supported by the Program of the Presidium of RAS No.8 ”Development of methods of obtaining chemical compounds and creation of new materials” and by the Russian Foundation for Basic Research, grant No.13-03-00017.
Appendix: Minimization in eq.(\[CB2\]) {#Section:app}
=======================================
Let us show that the minimum in eq.(\[CB2\]) corresponds to $\eta=0$, similar to ref.[@FZ_2012]. Eqs.(\[p\]) and (\[theta\]) at $\eta=0$ yield $$\begin{aligned}
&&
p_i(0) \equiv p_i|_{\eta=0}=\frac{1}{2},\\
&&
\theta_i(0)\equiv \theta_i|_{\eta=0}=2 \sqrt{\rho_{nn}\rho_{mm}
+\frac{1}{4}(1-2\rho_{mm})^2},\;\;i=0,1.
\end{aligned}$$ Consequently, using the definition of $S_i$ given by eq.(\[S\]), we conclude that $S_1|_{\eta=0}=S_0|_{\eta=0} \equiv S(\theta_0(0))$ and $$\begin{aligned}
(p_0S_0 +p_1 S_1)|_{\eta=0} = 2 p_0(0) S(\theta_0(0))= S(\theta_0(0)) =
S\left( 2 \sqrt{\rho_{nn}\rho_{mm} +\frac{1}{4}(1-2\rho_{mm})^2} \right)
\end{aligned}$$
Similarly, Eqs.(\[p\]) and (\[theta\]) at $\eta=1$ yield $$\begin{aligned}
&&
p_0(1)=1-\rho_{nn},\;\; p_1(1)=\rho_{nn},\\
&&
\theta_0(1)= \frac{|1-2\rho_{mm}-\rho_{nn}|}{1-\rho_{nn}}
\\
&&\theta_1(1)=1
\end{aligned}$$ Again, using the definition of $S_i$ given by eq.(\[S\]) we have $S_1|_{\eta=1}=0$ and we can write $$\begin{aligned}
(p_0S_0 +p_1 S_1)|_{\eta=1} = p_0(1) S(\theta_0(1)) = (1-\rho_{nn})
S\left(\frac{|1-2\rho_{mm}-\rho_{nn}|}{1-\rho_{nn}}\right).
\end{aligned}$$ Thus we have to find the minimum of two quantities: $$\begin{aligned}
\min\left(
S\left( 2 \sqrt{\rho_{nn}\rho_{mm} +\frac{1}{4}(1-2\rho_{mm})^2} \right),
(1-\rho_{nn}) S\left(\frac{|1-2\rho_{mm}-\rho_{nn}|}{1-\rho_{nn}}\right)
\right)
\end{aligned}$$ Representing the ratio of these two quantities as a two-dimensional surface in the space of the parameters $\rho_{nn}$ and $\rho_{mm}$ ($\rho_{nn},\rho_{mm}\le
1$, $\rho_{nn}+\rho_{mm} \le 1$) we conclude that the first of them (corresponding to $\eta=0$) is always less than the second one. Consequently the minimum in eq.(\[CB2\]) is always at $\eta=0$.
[99]{}
W. K. Wootters, Phys. Rev. Lett. [**80**]{}, 2245 (1998)
S.Hill and W.K.Wootters, Phys. Rev. Lett. [**78**]{}, 5022 (1997) A.Peres, Phys. Rev. Lett. [**77**]{}, 1413 (1996)
L.Amico, R.Fazio, A.Osterloh and V.Vedral, Rev. Mod. Phys. [**80**]{}, 517 (2008)
S.I.Doronin, A.N.Pyrkov and E.B.Fel’dman, JETP Letters [**85**]{}, 519 (2007)
W. H. Zurek, Ann. Phys.(Leipzig), [**9**]{}, 855 (2000)
L.Henderson and V.Vedral J.Phys.A:Math.Gen. [**34**]{}, 6899 (2001)
H.Ollivier and W.H.Zurek, Phys.Rev.Lett. [**88**]{}, 017901 (2001)
W. H. Zurek, Rev. Mod. Phys. [**75**]{}, 715 (2003)
A. Datta, A. Shaji, and C. M. Caves, Phys. Rev. Lett. [**100**]{}, 050502 (2008).
S.Luo, Phys.Rev.A [**77**]{}, 042303 (2008)
M.Ali, A.R.P.Rau, G.Alber, Phys.Rev.A [**81**]{}, 042105 (2010); Erratum: Phys.Rev.A [**82**]{}, 069902(E) (2010)
J.-W. Xu, arXiv:1101.3408 \[quant-ph\]
D.Bang-Fu, W.Xiao-Yun and Zh.He-Ping, Chin.Phys.B, [**20**]{} No.10 (2011) 100302
M.Goldman, [*Spin temperature and nuclear magnetic resonance in solids*]{}, Oxford, Clarendon Press, 1970
E.I.Kuznetsova and A.I.Zenchuk, Phys.Lett.A [**376**]{}, 1029 (2012)
S.Bose, Phys.Rev.Lett, [**91**]{} 207901 (2003)
S.Zhang, B.H. Meier and R.R.Ernst, Phys.Rev.Lett. [**69**]{}, 2149 (1992)
E.B.Fel’dman, R.Brüschweiler and R.R.Ernst, Chem.Phys.Lett. [**294**]{}, 297 (1998)
E.B.Fel’dman and A.I. Zenchuk, spin-1/2 open Phys.Rev.A V. 86, 012303 (2012)
M.Christandl, N.Datta, A.Ekert and A.J.Landahl, Phys.Rev.Lett. [**92**]{}, 187902 (2004)
C.Albanese, M.Christandl, N.Datta and A.Ekert, Phys.Rev.Lett. [**93**]{}, 230502 (2004)
P.Karbach and J.Stolze, Phys.Rev.A [**72**]{}, 030301(R) (2005)
G.Gualdi, V.Kostak, I.Marzoli and P.Tombesi, Phys.Rev. A [**78**]{}, 022325 (2008)
E.B.Fel’dman, E.I.Kuznetsova and A.I.Zenchuk, Phys.Rev. A [**82**]{}, 022332 (2010) approaches
A.I.Zenchuk, Quant.Inf.Proc. [**11**]{}, No.6, 1551 (2012) P.Jordan, E.Wigner, Z.Phys. [**47**]{}, 631 (1928)
M. Dugić, J. Jeknić Int.J.Theor.Phys, [**45**]{}, No.12, 2249 (2006)
M. Dugić, J. Jeknić-Dugić, Int.J.Theor.Phys. [**47**]{} 805 (2008) M. Arsenijevic, J. Jeknic-Dugic, M. Dugic, Chin.Phys.B [**22**]{}, 020302 (2013)
M. Dugic, M. Arsenijevic, J. Jeknic-Dugic, Sci China-Phys Mech Astron [**56**]{}, 732 (2013)
M. Arsenijevic, J. Jeknic-Dugic, M. Dugic, arXiv:1301.1005 \[quant-ph\]
O.Lychkovskiy, Phys.Rev.A [**87**]{} 022112 (2013)
S.I.Doronin, E.B.Fel’dman and A.I.Zenchuk, Phys.Rev. A [**79**]{}, 042310 (2009)
Y.Huang, Phys.Rev.A [**88**]{}, 014302 (2013)
E.B.Fel’dman and A.I.Zenchuk, JETP Lett. [**93**]{}, 459 (2011)
E.B.Fel’dman, M.G.Rudavets, JETP Lett. [**81**]{}, 47 (2005)
J. K. Pachos and P. L. Knight, Phys. Rev. Lett. [**91**]{}, 107902 (2003).
S. I. Doronin and A. I. Zenchuk Phys.Rev.A [**81**]{}, 022321 (2010)
E.I. Kuznetsova, E.B. Fel’dman, J. Exp. Theor. Phys. [**102**]{}, 882 (2006)
K.E.Feldman, J.Phys.A:Math.Gen. [**39**]{}, No.5, 1039 (2006)
|
Birth weight in pregnancies after induction of ovulation with pituitary gonadotrophins.
Birth weights offer a means of determining normality of babies born after induction of ovulation with human pituitary gonadotrophins. A study of 62 patients treated under the auspices of the Australian Human Pituitary Advisory Committee shows that birth weights of the babies were not significantly different from those in two large Australian obstetric populations. Multiple pregnancies are more common after ovulation induction. Birth weights in twins are approximately 85% of those in singleton pregnancies. |
Q:
How can I use dapper to return a type that contains a list of some other type?
How can I use dapper to select all SpaceShips and their Sightings in one query?
I have the following objects:
public class SpaceShip
{
public int Id { get; set; }
public string DriveType { get; set; }
public List<Sighting> Sightings { get; set; }
}
public class Sighting
{
public int Id { get; set; }
public double Lat { get; set; }
public double Lon { get; set; }
}
With the following schema:
If Exists(Select * from sysobjects where name = 'Sightings')
Drop Table Sightings
If Exists(Select * from sysobjects where name = 'SpaceShips')
Drop Table SpaceShips
CREATE TABLE [dbo].[SpaceShips](
[Id] [int] IDENTITY(1,1) NOT NULL,
[DriveType] [varchar](max) NOT NULL,
CONSTRAINT [PK_SpaceShips] PRIMARY KEY CLUSTERED
([Id] ASC) WITH (PAD_INDEX = OFF, STATISTICS_NORECOMPUTE = OFF, IGNORE_DUP_KEY = OFF, ALLOW_ROW_LOCKS = ON, ALLOW_PAGE_LOCKS = ON) ON [PRIMARY]) ON [PRIMARY]
GO
CREATE TABLE [dbo].[Sightings](
[Id] [int] IDENTITY(1,1) NOT NULL,
[SpaceShipId] [int] NOT NULL,
[Lat] [decimal](18, 0) NOT NULL,
[Lon] [decimal](18, 0) NOT NULL,
CONSTRAINT [PK_Sightings] PRIMARY KEY CLUSTERED
([Id] ASC) WITH (PAD_INDEX = OFF, STATISTICS_NORECOMPUTE = OFF, IGNORE_DUP_KEY = OFF, ALLOW_ROW_LOCKS = ON, ALLOW_PAGE_LOCKS = ON) ON [PRIMARY]) ON [PRIMARY]
GO
ALTER TABLE [dbo].[Sightings] WITH CHECK ADD CONSTRAINT [FK_Sightings_SpaceShips] FOREIGN KEY([SpaceShipId]) REFERENCES [dbo].[SpaceShips] ([Id])
GO
ALTER TABLE [dbo].[Sightings] CHECK CONSTRAINT [FK_Sightings_SpaceShips]
GO
Insert into SpaceShips (DriveType) Values ('X18-9'),('PV-276M')
Insert into Sightings (SpaceShipId, Lat, Lon) Values (1, 10, 90), (1, 20, 80), (1, 30, 70), (1, 40, 60)
Insert into Sightings (SpaceShipId, Lat, Lon) Values (2, 104, 64), (2, 105, 63), (2, 106, 62), (2, 107, 61)
I'm trying to use dapper to select a list of SpaceShip including their associated Sightings like this:
using (var con = MuzakiFactory.OpenPortal())
{
try
{
var sql = @"Select * From SpaceShips ship left join Sightings s on s.SpaceShipId = ship.id";
var result = con.Query<SpaceShip, List<Sighting>, SpaceShip>
(sql, (ship, sightings) => {
ship.Sightings = sightings;
return ship;
});
return result;
}
catch (Exception ex)
{
Captains.Log(ex);
throw;
}
}
But the result is a list of SpaceShips with empty Sightings.
Update
It seemed easier to use Marc's suggestion of QueryMultiple and wire it myself. To make this work I had to add public int SpaceShipId {get;set;} to my Sighting class. I ended up with this:
var sql = @"Select * From SpaceShips; Select * from Sightings;";
using (var multi = con.QueryMultiple(sql))
{
var ships = multi.Read<SpaceShip>().ToList();
var sightings = multi.Read<Sighting>().ToList();
foreach(var ship in ships)
{
ship.Sightings = new List<Sighting>(sightings.Where(x => x.SpaceShipId == ship.Id));
}
return ships;
}
Note: You'll obviously want to include parent id in the where clause for each query.
A:
Firstly, you would have to use <SpaceShip, Sighting, SpaceShip>, and write your own identity manager (read: a dictionary) to make the duplicated data unique. Pseudo-code:
(ship, sighting) => {
SpaceShip actualShip;
if(!ships.TryGetValue(ship.Id, out actualShip)) {
ships.Add(ship.Id, actualShip = ship);
}
actualShip.Sightings.Add(sighting);
return actualShip;
}
where ships is a Dictionary<int, SpaceShip> or similar. If you think this is a common case, it is certainly something we could consider as an inbuilt option.
However! this may require a lot of extra columns. Personally I'd be tempted to consider a multi-result query here, with QueryMultiple and tie the two together as post-processing.
|
import os
import sys
from importlib.abc import MetaPathFinder
from importlib.machinery import PathFinder
# Remove the first entry, because it's simply a directory entry that equals
# this directory.
del sys.path[0]
def _get_paths():
# Get the path to jedi.
_d = os.path.dirname
_jedi_path = _d(_d(_d(_d(_d(__file__)))))
_parso_path = sys.argv[1]
# The paths are the directory that jedi and parso lie in.
return {'jedi': _jedi_path, 'parso': _parso_path}
class _ExactImporter(MetaPathFinder):
def __init__(self, path_dct):
self._path_dct = path_dct
def find_module(self, fullname, path=None):
if path is None and fullname in self._path_dct:
p = self._path_dct[fullname]
loader = PathFinder.find_module(fullname, path=[p])
return loader
return None
# Try to import jedi/parso.
sys.meta_path.insert(0, _ExactImporter(_get_paths()))
from jedi.inference.compiled import subprocess # noqa: E402
sys.meta_path.pop(0)
# Retrieve the pickle protocol.
host_sys_version = [int(x) for x in sys.argv[2].split('.')]
# And finally start the client.
subprocess.Listener().listen()
|
@comment $NetBSD: PLIST,v 1.1 2014/12/30 17:23:46 adam Exp $
lib/pkgconfig/Qt5MacExtras.pc
qt5/include/QtMacExtras/${PKGVERSION}/QtMacExtras/private/qmacfunctions_p.h
qt5/include/QtMacExtras/${PKGVERSION}/QtMacExtras/private/qmactoolbar_p.h
qt5/include/QtMacExtras/${PKGVERSION}/QtMacExtras/private/qmactoolbardelegate_p.h
qt5/include/QtMacExtras/${PKGVERSION}/QtMacExtras/private/qmactoolbaritem_p.h
qt5/include/QtMacExtras/${PKGVERSION}/QtMacExtras/private/qnstoolbar_p.h
qt5/include/QtMacExtras/QMacPasteboardMime
qt5/include/QtMacExtras/QMacToolBar
qt5/include/QtMacExtras/QMacToolBarItem
qt5/include/QtMacExtras/QtMac
qt5/include/QtMacExtras/QtMacExtras
qt5/include/QtMacExtras/QtMacExtrasDepends
qt5/include/QtMacExtras/QtMacExtrasVersion
qt5/include/QtMacExtras/qmacextrasglobal.h
qt5/include/QtMacExtras/qmacfunctions.h
qt5/include/QtMacExtras/qmacpasteboardmime.h
qt5/include/QtMacExtras/qmactoolbar.h
qt5/include/QtMacExtras/qmactoolbaritem.h
qt5/include/QtMacExtras/qtmacextrasversion.h
qt5/lib/cmake/Qt5MacExtras/Qt5MacExtrasConfig.cmake
qt5/lib/cmake/Qt5MacExtras/Qt5MacExtrasConfigVersion.cmake
qt5/lib/libQt5MacExtras.la
qt5/lib/libQt5MacExtras.prl
qt5/lib/pkgconfig/Qt5MacExtras.pc
qt5/mkspecs/modules/qt_lib_macextras.pri
qt5/mkspecs/modules/qt_lib_macextras_private.pri
|
Why I hate the first part of relationships
March 4, 2016
Am I the only person who detests the first part of relationships? Sometimes it feels like it. You know the part I mean, the part where you’ve first gotten together and everything is new, sexual tension is heightened and it all feels so exciting. Does it really, though?
We tend to look back on those first few months from the safety of a long term relationship and romanticise the hell out of them. Why? Because we know it turned out ok because we’re in a long term relationship now. But what in hindsight looks to be excitement was actually nervous terror as you exposed your tender underbelly to someone and hoped for a gentle tickling in return, but risked a sharp poking.
Letting someone know you like them enough to potentially want to do somewhat squelchy things with them in a dark room is terrifying. What if they don’t like you that way? What if they’re just happy to keep your relationship as one of pleasant chats about cat videos with the lights on?
Even once you’re in the relationship and everyone likes everyone else regardless of the lighting situation it’s still terrifying at the start. Typical new relationship thought process:
“Should I text? Stupid question. I texted. When’s he texting back? Is he busy or should I have not said that thing about the armpit? He’s avoiding me. Oh god I texted 15 minutes ago and he hasn’t answered me even though I’m pretty sure he’s not busy. How can he be? I’m never busy when he texts me I can always make myself available to answer straight away. Wow, I’m really employee of the month, aren’t I? Oh god, now something has happened and I need to change the plans tonight but that means texting him again, even though he hasn’t texted me back since I last texted. Am I allowed to text twice? Ok it’s technically three times. But this is important. I will now text everyone I know to gauge the situation instead of just letting him know the new plan”
That shit ain’t exciting. It’s exhausting.
It just seems exhilarating in hindsight because you know he did eventually text back and he used the heart emoji and seventeen “x”s and it was all ok. You can remember the joyous rush of validation you received when that happened and it made all the pent up “OMG what if this goes down the gurgler” angst seem ok. That’s hindsight for you. At the time it was pure shite.
It could have easily gone wrong, and then you wouldn’t remember it as thrilling, rather as the agonizing stress fest it actually was. Being in love with someone before you know them well enough to know they’re just as weird as you are is a necessary evil, but there’s no need to go on about it like we do.
You know my favourite part of relationships? The part where you know each other well enough to text as many times as you bloody well please, safe in the knowledge that this won’t have any bearing on your future chances at shared nudity. The part where you can say stupid things and disagree with the stupid things he says and argue all night about aforementioned stupid things before deciding to make cheese toasties and go to bed happy as Larry in each other’s company. The part where everyone wears stretchy pants on Sunday. The part where you still get excited coming home at night when you’re only a block away from your house because you love him so much and you can’t wait to see him again. The part where you still feel that way after a stupid number of years together.
That’s the best part of relationships. The part in the beginning is mostly nipple tugging stress. |
Studies on the charge transfer band in high spin state of ferric myoglobin and hemoglobin by low temperature optical and magnetic circular dichroism spectroscopy.
The behavior of charge transfer band, appearing at 600-650 nm in ferric high spin derivatives of myoglobin and hemoglobin, was studied under various conditions by low temperature optical and magnetic circular dichroism spectroscopy. Optical absorption spectra have demonstrated that: (1) The charge transfer band at 630 nm of myoglobin (Fe3+)-H2O (pH 7.0) at room temperature split into three bands, 627 nm, 645 nm and 664 nm (shoulder) at 77 degrees K, whereas that of hemoglobin (Fe3+)-H2O showed no splitting. (2) By lowering the pH value from 7.5 to 4.3 this splitting in myoglobin was observed to disappear only in the presence of a small amount of phosphate ion, accompanying a midpoint at pH 6.7 +/- 0.1. This does not originate from the released hemin. (3) Hemin (pH 7.55) showed no splitting of the charge transfer band at 77 degrees K. (4) This splitting depended on the species of 6th ligand. For myoglobin-F- the splitting could scarcely be observed, whereas the proton-donating ligands such as HCOOH and CH3OH exhibit the splitting as well as H2O. Magnetic circular dichroism spectra have demonstrated that: (5) The charge transfer band at 600-500 nm indicated Faraday A term and B term. (6) A negative B term band was observed at 650 nm for myoglobin-H2O in the glassic solvent of potassium glycerophosphate-glycerol, whereas it was not observed for hemoglobin-H2O. Several discussions were performed on the origin of splitting of the charge transfer band in myoglobin-H2O. It is now concluded that the hydrogen bond between the 6th ligand and the distal histidine contributes to the splitting of the charge transfer band around 630 nm for myoglobin Fe3+)-H2O at low temperature and that disappearance of the splitting at low pH is originated from the presence of phosphate ion. |
Q:
How to count text fields that are not empty with JQuery?
How to count text fields that are not empty with JQuery?
Here's how I thought:
var cnt = 0;
$.each($("input[name=items]"), function(i){
if($(this).val() != ""){
cnt++;
}
});
If I use this codes, I have to write each function unconditionally. This is a waste of somehow, but is there any other way? Or is this the best way?
A:
There's no selector to retrieve empty input elements, so the only way to achieve what you require is through a loop. You can use an implicit loop, though, by using filter() instead of each(), like this:
var cnt = $('input[name="items"]').filter(function() {
return this.value.trim() == '';
}).length;
|
Price: $279.95—Roamer unit; $69.95—Roamer software (PC only), single copy. A wide variety of accessories can be purchased, ranging in price from $14.95 to $79.95.
Audience: K-8.
Description: The Roamer is a battery-operated, disc-shaped "robot" made of sturdy plastic that can be programmed to move forward or backward, turn, play music, and leave a trail.
Reviewer Comments:
Installation: The unit requires two "lantern" batteries or the Valiant Rechargeable Battery Pack. The batteries are easy to install, using a coin to open the cover.
The company cautions that the Valiant rechargeable batteries incorporate features essential for the safety and protection of the Roamer. The use of unapproved rechargeable batteries may damage the device and will void the warranty. Installation Rating: A
Features: The Roamer moves on a set of wheels over a variety of surfaces, including flooring or carpeting. A keypad on the top controls movements. Users operate the Roamer by pressing an operation/function key, followed by a number key (0-9).
The device can be programmed in two ways: in a short-term memory process (known as the Go Program) or in a long-term memory storage process (known as Procedures).
The Go Program is made up of a list of instructions that are carried out when the user presses the Go key. When the unit is operated for the first time, the Go Program accesses a demonstration that shows the Roamer's basic functions.
A Clear Memory button clears previous Go Program instructions and allows the user to enter a new Go Program.
The Procedures are made up of lists of user-defined instructions, each identified with a number. A selected procedure is carried out when the appropriate number is selected. The Roamer can remember up to 59 instructions and can carry out hundreds of actions.
The device moves forward and backward in units equal to its body length and turns in angular units of one degree. These units of distance and turn can be redefined and saved as needed.
Roamer sounds can be played at one of five tempos and one of three octaves.
The Roamer Activity Book contains a variety of tasks and games to be used with students. An extensive list of additional activities and lesson plans are available on the company's Web site.
The Activity Book and online lesson plans offer a variety of tasks that complement math, science, and language arts instruction in the classroom.
The additional accessories available for purchase greatly extend the capabilities of the Roamer. Many scientific investigations can be undertaken using the optional sensor, light, and motor packs.
Classroom Applications: I sponsor a Lego Robotics Club that enjoyed the challenge of programming the Roamer robot. Introducing Roamer first to my club members greatly aided their understanding of the concepts necessary to program our Lego robot for our county's FIRST (First in Recognition of Science and Technology) Competition.
The Roamer's demonstration program built my students' interest and excitement. After the demonstration, the students were enchanted by the Roamer and couldn't wait to learn the programming.
The device is especially useful when teaching measurement skills of area and perimeter. We spent one class teaching the Roamer to make various geometric shapes.
The robot makes it easy to present an introduction to angular units (including cardinal directions, angles, and degrees) and to linear units using the metric system. Children can explore the ideas of perimeter and area through programming by taking measurements and performing calculations.
My students enjoyed creating original games and functions for the Roamer to perform. One student created an original obstacle course and invited his classmates to program the Roamer to navigate it.
We also included the Roamer in our annual Family Robotics Night, to the delight of all who attended. Features Rating: A
Ease of Use: The simplicity of operation is definitely the unit's most attractive feature. The user simply turns it on, presses two keys, and the Roamer moves.
Without looking at the manual, my students were executing complex movements in a very short time. Once they were familiar with the keys, I showed them more advanced techniques and the students became quite adept at operating the Roamer.
The keypad is simple and easy to use by students of all ages. The included User Guide provides clear and concise instructions that make operation easy and quick. Ease of Use Rating: A
Product Support: Product support is provided through product manuals included with the device and in curriculum ideas available online. Basic instructions and a detailed user guide are also available online. In addition, e-mail support is available at info[at]valiantusa.com. Product Support Rating: A
Recommendation: The Roamer promotes critical thinking skills as students program the robot to do a variety of tasks. Students learn to think sequentially.
All children—including second language learners, the gifted, and students with special needs—can experience success using the Roamer.
Note that the Roamer uses lantern batteries with spring terminals that can be costly to replace. The optional battery charger and rechargeable batteries would be a good investment in the long run.
If you're looking for an innovative strategy to challenge your students, the Roamer will provide hours of stimulating activities to enhance your curriculum. In my classroom, the unit has turned out to be a highly successful motivational and educational tool. Highly recommended. |
Induction of homologous virus neutralizing antibodies in guinea-pigs immunized with two human immunodeficiency virus type 1 glycoprotein gp120-iscom preparations. A comparison with other adjuvant systems.
The immunogenicity in guinea-pigs of the human immunodeficiency virus type 1 envelope glycoprotein gp120 in immune stimulating complex (iscom) was compared to that of gp120 adjuvanted with QuilA-matrix (iscom without attached antigen), aluminium hydroxide (alum) and the Ribi adjuvant system. Gp120 was either incorporated into iscoms by covalent conjugation (iscom(c)) or by acid treatment of gp120 (iscom(a) and both these preparations induced high ELISA antibody titres to gp120. Virus neutralizing (VN) antibodies were most frequently induced by gp120 in iscom(c), iscom(a) or in alum and correlated to high titres to the V3-region of gp120. Further, antibodies induced by gp120-iscom(c) most efficiently inhibited binding of a VN monoclonal antibody GP13 to the CD4 binding region of gp120 whereas gp120-iscom(a) induced the highest mean titre of antibodies blocking the binding of [125I]gp120 to CD4. These results suggest that the gp120-iscom preparations efficiently induced high levels of gp120 specific antibodies and that the adjuvant formulation of gp120 affect the specificity and functional properties of elicited antibodies. |
The most convenient, foolproof way to grow your own delicious tomatoes
Self-watering to provide a steady supply of moisture for optimal tomato production
Container growing reduces weeding and chances of soil-borne disease
Includes planter, cage support, soil mix and fertilizer
For easy mobility, add a set of optional casters, sold separately
Our exclusive Tomato Success Kits have helped thousands of gardeners grow big crops of healthier, tastier tomatoes. The self-watering planter has a generous, 4-gallon reservoir that provides a steady flow of moisture to plants. This eliminates the "drought and drown" cycle that stresses plants, helping your tomatoes outperform garden-grown plants by 30% or more. The kit includes a two-part stacking tomato cage and 40 quarts of our exclusive Self-Watering Container Mix. It also includes 1-1/2 lbs. of Gardener's Best Organic Tomato Fertilizer, an 8-5-5 slow-release fertilizer that is fortified with 4-1/2% calcium to help prevent blossom end rot.
I bought three. Decided to grow tomatoes in one and eggplants and peppers in the other two. Pictures will show how wonderfully all three are producing. So don't stop at tomatoes, you can grow most anything in these wonderful containers. I will be buying three more for next year.
this is my first foray into gardening and it was very simple and easy to grow great tasting tomatoes. The product was easy to put together and once the plans were established, in our hot Colorado sun it was nice to have the reservoir for water. even for a new be like me this product was fail proof.I took it down at the end of last season, and was able to set it up again easily.
I loved my raised vegetable beds and grew quite a variety of veggies. However, I soon moved to a smaller condo and desperately missed my fresh organically grown crops. A sunny second floor deck offered me the opportunity to try a different kind of gardening that would give me my delicious tomatoes, peppers, egg plants, onions and chard. I researched different planters and found the self watering variety that you offered. No dripping, easy watering, and now I have my healthy, home grown veggies on the table. My gift to.my grandson was his own tomato planter and now he can share his success with early girl and better boy vArieties with grandma.
I have 2 of these and they were the best investment I ever made for my deck garden. I recommend getting the casters to make movement easier. My friends, family and neighbors always comment on my tomatoes. I usually have several pounds of tomatoes from my kits every season. I love these so much I have bought several as gifts for others that want to garden but don't have space or time do to the upkeep on a full fledged garden.
We bought this to grow tomatoes. We moved here from the Midwest where gardening was no problem. We gardened all our lives. Because of the sandy soil, it is not so easy down here to get plants to grow here. We ordered the planter, bought some tomatoes, and planted them. In less than a month, our cherry tomatoes have grown to over 6 feet tall. The watering system keeps the soil moist but not flooded. We like it so much we are going to get another system so we will have two next year.
I will be adding four or five more of these to my garden collection for next summer
By Tomato lady
from Coeur D' Alene, ID
Pros
Durable
Easy
Fast delivery
Looks presentable
Saves space
Simple to set up
Will Definitely Add A Few More To My Collection Next Year
Cons
No Cons So Far It's Working Perfectly
Best Uses
Deck Patios
Perfect
I have absolutely no complaints about this product!I will definitely be adding them to my garden collection next year. Using this on my deck makes a perfect little package, doesn't take up much room at all. Easy to keep the plants watered, not worried about leaving for one or two days.
Articles
Learn the best way to start your own tomato seedlings. Quick to germinate and grow, tomato seeds are best sown indoors about six weeks before your average last frost date.
<!-- Made unsearchable because this is almost the same as 7902, which has the video. Redirect in place. DJG, 1/7/15 -->
There are no special shipping restrictions or charges associated with this item. For detailed information about our delivery methods and charges, click here.
We're proud of the fact that this item is shipped to you directly from our warehouse in Vermont, by one of our 250 employee-owners. In-stock items are packed with care and shipped within the next business day to ensure prompt delivery to your home and garden!
Satisfaction Guaranteed
Learn and Share
Our website is packed with how-tos and inspiration, as well as opportunities to share with fellow gardeners. Check back often to view new articles, videos, blog posts and Facebook updates and join our online community.
Good Works
Gardener's Supply is committed to improving the world through gardening. We support nonprofit gardening, hunger-relief and community organizations with volunteer time and donations of 8% of our pre-tax profits. |
Introduction {#s1}
============
Gradual accumulation of evidence for or against different choices has been implicated in many types of decision-making, including value-based decisions ([@bib2]; [@bib55]; [@bib13]; [@bib41]; [@bib76]), social decisions ([@bib48]), economic decisions ([@bib28]), gambling decisions ([@bib11]), memory-based decisions ([@bib65]), numerical comparison decisions ([@bib75]), visual search decisions ([@bib62]; [@bib35]), and perceptual ([@bib30]; [@bib67]; [@bib52]) decisions. It is therefore considered a core decision-making process. Although neural correlates of evidence accumulation have been reported in several interconnected primate brain regions---such as PPC ([@bib74]; [@bib72]; [@bib41]), prefrontal cortex ([@bib41]) including frontal eye fields (FEF; [@bib45]; [@bib62]; [@bib23]; [@bib35]; [@bib52]), striatum ([@bib22]), and superior colliculus ([@bib40]; [@bib67])---the specific roles of these different brain regions in decisions driven by accumulation of evidence have not yet been distinguished.
We recently developed a rat model of gradual accumulation of evidence for decision-making, using a task that allows detailed quantitative modeling of the accumulation and decision processes ('Poisson Clicks' task; [@bib7]). In separate work from our laboratory using the Poisson Clicks task, electrophysiological recordings in rat PPC and Frontal Orienting Fields (FOF; [@bib24]) revealed classic neural correlates of evidence accumulation ([Figure 1](#fig1){ref-type="fig"} of [@bib33]). Specifically, we found neurons in these rat regions that ramp up their activity during the stimulus, and the slope of that ramp is correlated with the strength of the momentary evidence just as one would expect from neurons whose firing rates represent the accumulation of evidence over time, and just as previously reported in monkey regions that have been suggested as analogous to the rat PPC and FOF (primate PPC: [@bib73], [@bib74]; [@bib72]; and monkey FEF: [@bib23]; [@bib52]; for PPC analogy, see [@bib87]; [@bib68]; [@bib88]; for FOF/FEF analogy see [@bib24]).10.7554/eLife.05457.003Figure 1.Poisson clicks accumulation task trials and interleaved side LED trials.Each accumulation task trial begins with the onset of the center LED, which signals to the rat to enter the center port. The subject holds his nose in the center port for 2 s, until the center LED offset, which is the go cue. The majority of trials (90%) are accumulation trials. On accumulation trials, clicks play from the right and left speakers (right + left click rate = 40 clicks/s), terminating with the go cue. After the go cue reward is available at the side port associated with the greater number of clicks. The stimulus duration on each trial is set by the experimenter to be in the range 0.1--1 s. On Side LED trials, no sound is played during the fixation period and one of the side ports is illuminated once the rat withdraws from the center port to indicate that reward is available there. Accumulation and side LED trials are randomly interleaved, as are left and right trials.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.003](10.7554/eLife.05457.003)
In addition to having neural correlates of accumulating evidence ([@bib33]), several properties of the rat FOF suggest it as a candidate for a causal role in decisions driven by accumulation of evidence. Accumulation of evidence involves both maintaining a memory of evidence accrued so far and addition of new evidence to the memory, and is therefore linked to short-term memory processes. The rat FOF has delay activity that correlates with short-term memory, and plays a causal role in short-term memory for future orienting responses ([@bib24]). Furthermore, the rat FOF is well-situated to play an important role in perceptual decision-making, since it receives inputs from multiple sensory cortices ([@bib16]), and it projects to the superior colliculus (SC; [@bib78]), a subcortical region that, in both rodents and primates, is involved in controlling orienting motions ([@bib42]; [@bib27]) and is thought to be involved in decisions reported through such orienting motions. Moreover, the rat FOF is reciprocally connected with the rat PPC ([@bib71], [@bib69]), which is currently considered a critical, central node in rodent perceptual decision-making ([@bib12]). The rodent PPC itself also has neural correlates of accumulating evidence ([@bib33]), and it shares with the FOF some of the key properties that suggest a causal role in decisions driven by accumulation of evidence. The rodent PPC has delay activity that correlates with performance on short-term memory tasks ([@bib57]; [@bib34]), and, as shown through inactivations, plays a causal role in short-term memory for orienting acts ([@bib34]) and like FOF receives input from many sensory cortices as well as top-down input from prefrontal cortex, including FOF ([@bib88]). For these reasons, the FOF and the PPC are the most prominent candidate regions in rodent association cortex for being important nodes in orienting decisions guided by accumulation of evidence. We focus on these two areas here.
We implanted bilateral cannula in both FOF and PPC of rats trained to perform the Poisson Clicks task, and inactivated these regions with the GABA-A agonist muscimol while the rats performed the task. Consistent with expectations drawn from neural correlates in the rat FOF, inactivation of the FOF impaired performance in the task. We used quantitative modeling to characterize which aspect of the accumulation and decision process was impacted by inactivation of the FOF. The results of these analyses revealed a specific location for the FOF in the causal circuit underlying the Poisson Clicks behavior: the behavioral impairment caused by FOF infusions could be parsimoniously and quantitatively explained as an impairment in the premotor output pathway of an evidence accumulator with a long accumulation time constant (240 ms or more). It is possible that the decision itself (i.e., the categorization of the graded accumulator value into a discrete choice, which is a process subsequent to graded evidence accumulation) could occur in the FOF.
In contrast, we found that PPC inactivations had a relatively minor effect on the Poisson Clicks task. This was true even while the same PPC inactivations had strong effects on interleaved 'free-choice' trials, in which no sensory evidence was provided and rats were rewarded regardless of their choice of response. Our data thus suggest that the PPC plays a minimal causal role in decisions guided by accumulation of auditory evidence, while playing an important role in internally-guided decisions.
Together, our findings from inactivations of the PPC and the FOF provide important constraints on the neural circuitry underlying decisions guided by accumulation of auditory evidence in the rat.
Results {#s2}
=======
Behavior {#s2-1}
--------
We trained male Long-Evans rats (n = 14 rats) on the Poisson Clicks accumulation task ([Figure 1](#fig1){ref-type="fig"}, [@bib7]). On each trial of this task, illumination of the center LED indicated that the rat should place its nose in the center port and remain there while click trains with Poisson-generated inter-click-intervals were played from the left and right speakers. The rats learned to report which side had played the greater total number of clicks by nose-poking into the corresponding side port ([Figure 2A](#fig2){ref-type="fig"}). We refer to these trials as 'accumulation trials'.10.7554/eLife.05457.004Figure 2.Behavioral evidence of accumulation.(**A**) Behavior as a function of total right minus total left clicks. For very easy trials (large click differences) performance is ≈90% correct. The circles (with very small error bars) are the mean ±95% binomial confidence intervals across accumulator trials from all rats 1 day before an infusion session (n = 47,580 trials across 14 rats). The thick line is the psychometric curve generated by the accumulator model fit to these trials. (**B**) The time-constant of accumulation as fit by the model for each rat in the experiment. The median (810 ms) is marked by a thin gray line. (**C**) Chronometric plot generated using the same data as in panel (**A**). The rats\' performance increases with longer duration stimuli, consistent with an accumulation strategy. The circles and error bars are the mean ±95% binomial confidence intervals across trials on the easiest (blue), middle (purple) and hardest (magenta) thirds of trials defined by the absolute value of the ratios of left vs right click rates. The thick lines are the model generated chronometric curves. (**D**) Reverse correlation analyses showing that clicks throughout the stimulus were used in the rats\' decision process, supporting the long accumulation time constants in (**B**). The thick dark red and green lines are the means ± std. err. across trials for where the rats went right and left. Thin light red and green lines are the model generated reverse correlation.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.004](10.7554/eLife.05457.004)Figure 2---figure supplement 1.9-parameter Accumulator Model (reproduced from [@bib7]).At each timepoint, the accumulator memory *a* (black trace) represents an estimate of the 'Right' vs 'Left' evidence accrued so far. At stimulus end, the model decides 'Right' if *a* \> Þ, the decision boundary, and 'Left' otherwise, where Þ is a free parameter. Light grey traces indicate alternate runs with different instantiase.*a* The decision variable. Right ↑ (left ↓) pulses change the value of *a* by positive (negative) impulses of magnitude *C*.$\sigma_{i}^{2}$ parameterizes noise in the initial value of *a*.$\sigma_{a}^{2}$ a diffusion constant, parameterizing noise in *a*.$\sigma_{s}^{2}$ parameterizes noise when adding the evidence from a Right or Left pulse: variance $\sigma_{s}^{2}$ is added to the amplitude *C* of the evidence contributed by each click.*λ* parameterizes consistent drift in the memory *a*. In the 'leaky' or forgetful case (*λ* \< 0, illustrated), drift is towards *a* = 0, and later pulses impact the decision more than earlier pulses. In the 'unstable' or impulsive case (*λ* \> 0), drift is away from *a* = 0, and earlier pulses impact the decision more than later pulses. The memory\'s time constant *τ* = 1/*λ*.*B* the height of the 'sticky' decision bounds and parameterizes the amount of evidence necessary to commit to a decision.*φ*, *τ*~*ϕ*~ parameterize sensory adaptation by defining the dynamics of *C*. Immediately after a click, the magnitude *C* is multiplied by *φ*. *C* then recovers towards an unadapted value of 1 with time constant *τ*~*ϕ*~. Facilitation is thus represented by *ϕ* \> 1, while depression is represented by *ϕ* \< 1 (inset).Þ the decision boundary. These properties are implemented by the following equations: if \|*a*\| ≥ *B* then *da*/*dt* = 0; else$$da = \sigma_{a}dW + \left( {\delta_{t,t_{R}} \cdot \eta_{R} \cdot C - \delta_{t,t_{L}} \cdot \eta_{L} \cdot C} \right)dt + \lambda adt,$$where*δ*~*t*,*tR*,*L*~ are delta functions at the times of the pulses.*η* are i.i.d. gaussian variables drawn from $\mathit{N}\left( {1,\sigma_{s}} \right)$.*dW* is a white noise Wiener process.The initial condition *a*(*t* = 0) is drawn from the gaussian $\mathit{N}\left( {0,\sigma_{i}} \right)$.Adaptation dynamics are given by:$$\frac{dC}{dt} = \frac{1 - C}{\tau_{\phi}} + \left( {\phi - 1} \right)C\left( {\delta_{t,t_{R}} + \delta_{t,t_{L}}} \right).$$In addition, a lapse rate parameterizes the fraction of trials on which a random response is made.Ideal performance (*a* = \#right clicks − \#left clicks) would be achieved by $\lambda = 0,B = \infty,\sigma_{a}^{2} = \sigma_{s}^{2} = \sigma_{i}^{2} = 0,\phi = 1,$ Þ = 0.© 2013 AAAS. All Rights Reserved.2013AAASFigure 2---figure supplement 1 and legend text reproduced from Brunton BW, Botvinick MM, Brody CD. 2013. Rats and humans can optimally accumulate evidence for decision-making. *Science* 340, 95--98. [doi:10.1126/science.1233912](http://dx.doi.org/10.1126/science.1233912). Reprinted with permission.10.7554/eLife.05457.005Figure 2---figure supplement 2.Behavioral evidence of accumulation in individual rats.(**A**) Behavior as a function of total right minus total left clicks. For very easy trials (large click differences) performance is ≈90% correct. The thick line is the average performance of the 14 rats in the study, the thin gray lines are the performance of individual rats. (**B**) The time-constant of accumulation as fit by the model for each rat in the experiment. The median (810 ms) is marked by a thin gray line. (**C**) Chronometric plot showing that rats performance increases with longer duration stimuli, consistent with an accumulation strategy. The thin lines are the performance of individual rats (n = 14) on the easiest (blue), middle (purple) and hardest (magenta) thirds of trials defined by the absolute value of the ratios of left vs right click rates. The thick lines show the means across rats. (**D**) Reverse correlation analyses showing that clicks throughout the stimulus were used in the rats\' decision process supporting the long accumulation time constants in (**B**). Thin light red and green lines are the reverse click rate correlation of individual rats (n = 14). The thick dark red and green lines are the means across rats.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.005](10.7554/eLife.05457.005)
In order to control for motor effects of inactivations, the accumulation trials were randomly interleaved, in most sessions, with trials that we refer to as 'side LED' trials. On side LED trials no sounds were played during fixation. Immediately after the end of fixation, one of the two side ports was illuminated, indicating availability of reward at the lit port ([Figure 1](#fig1){ref-type="fig"}). The right and left side LED trials, together, comprised ≈10% of the total trials.
To demonstrate that subjects accumulated the sensory evidence provided by the auditory clicks, we fit an accumulator model using the individual click times and the rats\' choices on each trial ([Figure 2---figure supplement 1](#fig2s1){ref-type="fig"}; see also [@bib7]). Different parameter value regimes of this model can implement many different strategies, such as responding based on the first few clicks, or last few clicks, or to a burst of clicks, and many others. Consistent with previous results, maximum likelihood fits resulted in best-fit parameters associated with a gradual evidence accumulation strategy. Most importantly for this study, this strategy was characterized by a long accumulator time-constant, just under 1 s ([Figure 2B](#fig2){ref-type="fig"}, [Table 1](#tbl1){ref-type="table"}), which is the duration of the longest stimuli used here. As expected for a gradual accumulation strategy in which clicks from the entire stimulus are weighted equally, performance improved for longer stimuli with the same underlying click rates ([Figure 2C](#fig2){ref-type="fig"}; [@bib66]; [@bib82]; [@bib7]), and a psychophysical reverse correlation analysis ([@bib43]; [@bib64]; [@bib7]) indicates that rats used clicks from all times of the stimuli to make their decision ([Figure 2D](#fig2){ref-type="fig"}).10.7554/eLife.05457.006Table 1.Best-fit parameters**DOI:** [http://dx.doi.org/10.7554/eLife.05457.006](10.7554/eLife.05457.006)Ratname*λ*$\sigma_{a}^{2}$$\sigma_{s}^{2}$$\sigma_{init}^{2}$*Bϕτ*~*ϕ*~Þ*lapse*B1151.4090.113102.1300.52314.8490.1750.0640.1570.094T0551.2260.00111.2480.04316.0140.2530.3510.1180.078T0570.8100.03174.4780.02715.0600.1560.0930.0200.075T0581.0870.00017.6120.00015.8750.0250.276−0.1220.051T0610.6200.00096.5450.50216.0380.3800.0410.2360.066T062−0.0980.00049.3610.61915.7610.1390.0470.5180.083A0652.0470.00037.6850.20715.7290.1470.092−0.4650.031A0660.3490.00015.5650.00012.7050.0720.4620.0410.170A077−2.7390.197128.58622.8019.2530.1840.0310.8860.001A078−2.0700.000104.6880.00018.0860.2830.0260.0620.063A060−1.5420.00054.7860.00015.4160.0100.1150.1800.245A0622.2580.296156.8600.48616.8390.5270.0760.4660.119A083−0.79047.44131.7881.38416.2820.0150.0590.0330.107A0841.3710.06470.2671.69015.0110.0160.0860.4670.110Meta-Rat1.2270.00157.6140.04316.0420.2210.1090.0650.102BiFOF−4.144[\*](#tblfn1){ref-type="table-fn"}62.423237.6421.75422.0130.0820.0390.737[\*](#tblfn1){ref-type="table-fn"}0.010BiPPC1.3310.53142.1750.00014.8600.5120.175−0.2490.321[^1][^2]
Inactivations {#s2-2}
-------------
We report the results of five different types of inactivations: unilateral FOF, bilateral FOF, unilateral PPC, bilateral PPC, and combined bilateral FOF + unilateral PPC inactivations, for a total of 26,521 trials from 161 infusions into the FOF and PPC of 14 rats ([Figure 3A](#fig3){ref-type="fig"} and [Figure 3---figure supplement 1](#fig3s1){ref-type="fig"}). We initially performed muscimol inactivations of the FOF and PPC in 6 rats performing the Poisson Clicks Task (group 1). In order to verify the results and perform follow-up and control experiments, we performed inactivations in two further groups (group 2, n = 4; group 3, n = 4). The specific order and outcome of the infusions in each rat is shown in [Figure 3---figure supplement 2](#fig3s2){ref-type="fig"}.10.7554/eLife.05457.007Figure 3.FOF Infusions.(**A**) Top-down view of rat cortex with the locations of the FOF and the PPC, into which cannulae were implanted. (**B**) Bilateral infusion of muscimol into the FOF results in a substantial impairment on accumulation trials but has no effect on side LED trials. In black are data from control sessions 1 day before an infusion (n = 8 sessions, 4 rats). In blue are data from bilateral FOF infusions (n = 8 sessions, 4 rats, 75 ng per side). The circles with error bars indicate the mean ± s.e. across sessions. Accumulation trials are binned by \#R − \#L clicks, spaced so there are equal number of trials in each bin. The lines are a 4-parameter sigmoid fit to the data. (**C**) Unilateral infusion of muscimol into the FOF results in a profound ipsilateral bias on accumulation trials but has no effect on side LED trials. In black are data from control sessions 1 day before an infusion (n = 34 sessions, 12 rats). In red are data from right FOF infusions (n = 17 sessions, 12 rats, 150 or 300 ng). In green are data from left FOF infusions (n = 17 sessions, 12 rats, 150 or 300 ng).**DOI:** [http://dx.doi.org/10.7554/eLife.05457.007](10.7554/eLife.05457.007)10.7554/eLife.05457.008Figure 3---figure supplement 1.Cannula coordinates and histology.(**A**--**C**) The targets of cannula implants for group 1,2, and 3 with the list of the rats in each group. (**D**) A birds-eye view of rat T061\'s brain after fixation and removal from the skull. The AP and ML locations of the cannula are clearly visible by eye. Each line of the brain blocker marks 1 mm. The blue cross marks the approximate location of Bregma. (**E**) Coronal section of a rat brain that had been infused through the implanted FOF cannula with two colors ('red' on the left and 'blue' on the right) of Alexa Fluor-conjugated cholera toxin-B subunit, a fluorescent tracer. The rat was perfused 1 week after infusion of tracer. The tracer has labelled cells along the AP axis of the FOF. Shown here is a section from 2.5 mm anterior to Bregma ([@bib61]). Note, that in the nomenclature of [@bib61] the area that we describe as the FOF is considered to be part of M2. In the bottom left corner, the top of another coronal section overlaps with the shown section.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.008](10.7554/eLife.05457.008)10.7554/eLife.05457.009Figure 3---figure supplement 2.Timeline of bias for each rat.Each point of the figure is the bias for a single session (%Right − %Left Correct). The number at the beginning of the x-axis indicates the days passed since surgical implantation with cannula. Control non-infusion days are shown as black dots. Right infusions are shown in red, Left infusions are shown in green. Bilateral infusions are shown in blue. For the simultaneous bilateral FOF and unilateral PPC infusions, the color indicates the side of the PPC infusion as in [Figure 4C](#fig4){ref-type="fig"}. Stars indicated PPC infusions, Diamonds indicate FOF infusions. Hollow markers indicate an infusion session where the subject did not perform enough trials to analyze. The bottom x-labels describe the details (side, region and dose) of each infusion. The top x-labels indicate the number of days passed from cannula surgery. If infusions generate an ipsilateral bias then red markers should be above zero and green markers below zero.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.009](10.7554/eLife.05457.009)10.7554/eLife.05457.010Figure 3---figure supplement 3.FOF infusions cause profound impairment in the clicks task.The psychometric data and GLMM model fits for bilateral FOF infusions in each rat (n = 4). Open circles are binned data from accumulation trials and the small points are the predictions of the GLMM fits at sampled data points. (**A**) In black are the isoflurane control fits and in blue are the bilateral infusion fits. In every rat the slope of the bilateral infusions is shallower than in the isoflurane controls. In three of four rats there was also a shift, likely due to the challenge of performing perfectly balanced bilateral infusions. In three of four rats (All but A066) the difference between performance between bilateral FOF and isoflurane is significantly different. (**B**) The psychometric data and GLMM model fits for unilateral FOF infusions in each rat (n = 12). Open circles are binned data from accumulation trials and the small points are the predictions of the GLMM fits at sampled data points. In red are the right infusion data and fits and in green are the left infusion data and fits. In every rat the right infusions result in more rightward responses on accumulation trials than the left infusions.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.010](10.7554/eLife.05457.010)
FOF inactivations {#s2-3}
-----------------
We placed cannulae in the center of the location currently identified as FOF (+2.0 mm AP, ±1.3 mm ML from Bregma, [Figure 3---figure supplement 1A](#fig3s1){ref-type="fig"}). These are the same coordinates used by [@bib24], and are also the coordinates at which neural correlates of accumulation of evidence were observed in the Poisson Clicks task ([@bib33]). For the first bilateral FOF inactivation session we infused 300 ng of muscimol per side, for a total of 600 ng. After these infusions rats did not perform the task. We subsequently used a smaller dose of 75 ng per side (Note: this is half the dose used in the bilateral PPC experiment described below). This resulted in a significant 10.3% decrement on performance on accumulation trials (p = 0.018, GLMM test; [Figure 3B](#fig3){ref-type="fig"}). The effect was individually significant in 3/4 rats ([Figure 3---figure supplement 3A](#fig3s3){ref-type="fig"}). Side LED trials were unimpaired (p \> 0.5; [Figure 3B](#fig3){ref-type="fig"}), indicating that the impairment on accumulation trials was not simply a motor effect.
Unilateral infusions of muscimol into the FOF resulted in a profound bias towards ipsilateral responses in the Poisson Clicks task ([Figure 3C](#fig3){ref-type="fig"}). Averaged across all unilateral FOF infusion sessions, the ipsilateral bias (defined as ipsilateral % correct − contralateral % correct), was 52 ± 7% (mean ± s.e.) for accumulation trials (*t*-test across 12 rats *t*~11~ = 7.27, p \< 10^−4^; two rats in group 3 failed to perform sufficient numbers of trials during FOF inactivations to be included in this analysis). Unilateral FOF infusions reduced performance to chance on even the easiest contralateral accumulation trials ([Figure 3C](#fig3){ref-type="fig"}; green data points for \#R − \#L ≫ 0, and red data points for \#R − \#L ≪ 0). The ipsilateral bias induced by FOF inactivation was highly reproducible: 87% (26/30) of individual infusion sessions resulted in a positive ipsilateral bias (sign-test, p \< 0.001), and in every single rat there were more rightward responses after rightward infusions than leftward infusions ([Figure 3---figure supplement 3B](#fig3s3){ref-type="fig"}).
Importantly, as in the bilateral inactivations, there was no significant effect on side LED trials (*t*-test *t*~5~ = 1.55, p \> 0.15; [Figure 3C](#fig3){ref-type="fig"}, side LED Trials), nor did unilateral FOF inactivations have an effect on the response time on side LED trials (repeated-measures ANOVA, F(1,3) = 0.65, p \> 0.4). This indicates that the effect of FOF inactivation was not simply an overall motor effect. Furthermore, the inactivations produced no observable effects outside of the behavioral task. Infused animals appeared normal in their home cages both immediately after the infusion and after the behavioral session. Our localized inactivations thus contrast with previous literature, in which large permanent unilateral lesions of the rat prefrontal cortex (including but extending well beyond the FOF), produced persistent, ipsiversive circling in the lesioned animals ([@bib19]).
Bilateral FOF inactivations reduce the subjects\' accumulation time constant {#s2-4}
----------------------------------------------------------------------------
Which aspects of the evidence accumulation and decision process were impaired by the FOF inactivations? To address this question, we took advantage of the accumulator model of [@bib7], which uses the knowledge the precise time of each click in each individual trial, as well as the rat\'s decision on each trial, to estimate 9 parameters that characterize the accumulation and decision processes ([Figure 2---figure supplement 1](#fig2s1){ref-type="fig"}). Each parameter quantifies a specific aspect of the decision process. For example, *τ*, the time constant of the accumulator (also described by the parameter *λ* = 1/*τ*), characterizes the time period over which the subject accumulates evidence. A negative value of *λ* indicates a leaky accumulator, a positive value of *λ* indicates an unstable accumulator, and perfect accumulation would have *τ* = ∞ (i.e., *λ* = 0). Another example parameter is the lapse rate, which quantifies the fraction of trials in which the subject behaves as if it had ignored the clicks that were played and had instead made its decision randomly. Deviations from the perfect values (*λ* = 0, lapse = 0) in either of these parameters can give rise to psychometric curves with shallow slopes, and both types of imperfections can produce curves qualitatively similar to the experimental curve obtained after bilateral FOF inactivation ([Figure 4A](#fig4){ref-type="fig"}). But the similarity between the psychometric curves for the two imperfections is partly due to the fact that these psychometric curves ignore the specific timing of individual clicks. In contrast, because the two imperfections would have very different signatures in terms of how clicks at different times affect the rats\' decisions, and click timing is fully taken into account in the behavioral model, the model can clearly distinguish the two imperfections. Using the control data, the best-fitting parameter values for the behavioral model had *τ* ≈ 0.8 s--indicating that subjects accumulated information over almost the entire stimulus duration but were on average slightly unstable--and a lapse rate of ≈0.1 (black cross, [Figure 4B](#fig4){ref-type="fig"}). For data from bilateral inactivation sessions, the maximum likelihood parameter values (center of blue likelihood peak, [Figure 4B](#fig4){ref-type="fig"}) changed significantly. The inactivation data now had a dramatically different and much shorter accumulation time constant of the opposite sign to the control data, *τ* ≈ −0.24 s (leaky accumulation over only a quarter of a second). In contrast, the best-fitting lapse rate remained essentially unchanged from control. As described above, attempting to fit the inactivation data by keeping the time constant unchanged and increasing the lapse rate could qualitatively match the psychometric curve (magenta line, [Figure 4A](#fig4){ref-type="fig"}), but it produced an extremely poor fit relative to the full behavioral model (magenta cross in low likelihood region, [Figure 4B](#fig4){ref-type="fig"}). Thus, after bilateral FOF inactivation, the subjects behaved as if their lapse rate was unchanged, and their accumulator had become much leakier ([Table 1](#tbl1){ref-type="table"}).10.7554/eLife.05457.011Figure 4.Bilateral FOF inactivation is best fit as a reduction in the time-constant of accumulation.(**A**) When analyzed in terms of the psychometric function, changes to either lapse rate alone or accumulation time constant alone can match the bilateral FOF inactivation data. The black line shows the psychometric curve from control data, collected 1 day before bilateral FOF sessions (n = 1526 trials). Blue dots with error bars show the experimental data from bilateral FOF inactivation sessions (n = 1809 trials). The magenta line is the psychometric curve obtained by fitting only the lapse rate parameter to the inactivation data, while keeping all other parameters at their control values (corresponds to magenta cross in panel **B**). The blue line shows the psychometric curve from the accumulator model fit to the inactivation data (corresponds to peak of blue likelihood surface in panel **B**), which has a change w.r.t. control in accumulation time constant *τ* (=1/*λ*), but no change in lapse rate. (**B**) Fitting the detailed click-by-click, trial-by-trial accumulator model ([@bib7]) to the inactivation data clearly distinguishes between lapse and *λ*. The panel shows the normalized likelihood surface, indicating quality of the model fit to the inactivation data as a function of the lapse and the *λ* (=1/*τ*) parameters. The black cross shows parameter values for the control data. The best fit to the inactivation data is at the peak of the blue likelihood surface (*λ* = −4.15, lapse = 0.048), significantly different from control for *λ*, but not different from control for lapse. This best-fit lambda corresponds to *λ* = −0.241 s, a substantially leaky integrator. (**C**) Performance as a function of stimulus duration for bilateral FOF sessions (blue, mean ± std. err.) and the control sessions 1 day before (black, mean ± std. err.). The lines are the chronometric curves generated by the accumulator model (for inactivation data, parameter values at peak of blue likelihood surface in panel **B**). (**D**) Reverse correlation showing the relative contribution of clicks from different times to the rats\' decisions for data from bilateral FOF inactivation sessions. Compare to [Figure 2D](#fig2){ref-type="fig"}. The thick dark shading shows the mean ± std. err. across trials based on the rats\' choices. The thin bright lines are the reverse correlation traces generated by the accumulator model (parameter values at peak of blue likelihood surface in panel **B**).**DOI:** [http://dx.doi.org/10.7554/eLife.05457.011](10.7554/eLife.05457.011)10.7554/eLife.05457.012Figure 4---source data 1.MATLAB file containing resampled bilateral FOF model fits.This MATLAB file contains three variables. BF: a 300 × 9 matrix. Each row is the set of parameters which maximized the likelihood of the accumulator model fit to a resampling of the bilateral FOF data. Each column is a parameter. LL: a 300 × 1 vector with the negative log likelihood of the corresponding row of BF. parameter_names: a 9 × 1 cell with the names of the columns of BF.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.012](10.7554/eLife.05457.012)
To further validate these results we resampled the trials (with replacement) and refit the model on the resampled trials 300 times. Based on this analysis, only two parameters shifted significantly from the control data: *λ* (95% C.I. = \[−7.91 −1.31\]; control value was 1.22) and Þ (95% C.I. = \[0.10 1.50\]; control value was 0.065). The change in *λ* is both significant and substantial, and accounts for most of the change in performance. The change in decision boundary, Þ (pronounced 'sho') is significant but very small, corresponding a horizontal shift in the psychometric curve of only one click. It is largely due to the difficulty of performing a perfectly balanced bilateral infusion. In particular, one rat, A077, was strongly biased during the bilateral FOF inactivations ([Figure 3---figure supplement 3A](#fig3s3){ref-type="fig"}). On average, the noise and lapse parameters also increased but due to large covariance between these parameters, it is not possible to say which of them was significantly shifted ([Figure 4---source data 1](#SD1-data){ref-type="supplementary-material"}).
To further examine the relative contributions of the *λ* and Þ changes we fit two 1-parameter models. First, we fit the bilateral FOF data with a 1-parameter Þ model where only the decision boundary could change and the other 8 parameters were fixed at their best control data values. The log likelihood of the best Þ model was −1221.6, substantially worse than the model in which all 9 parameters were allowed to vary (−1102.5). Using Bayesian or Akaike Information Criteria (BIC or AIC; [@bib10]), we find that the extra parameters are indeed justified ([Table 2](#tbl2){ref-type="table"}). Second, we fit the bilateral FOF data to a 1-parameter *λ* model where only the accumulation time-constant could change. For this model, the best-fit value of *λ* was −12.4 and the log likelihood of the model was −1121.1 compared to −1102.5 for the best 9-parameter model, a difference of only 18.5. According to BIC, the 1-parameter model is the more likely model, supporting the idea that the major effect of bilateral FOF inactivation was a change in the time constant of accumulation ([Table 2](#tbl2){ref-type="table"}).10.7554/eLife.05457.013Table 2Bilateral FOF model comparison**DOI:** [http://dx.doi.org/10.7554/eLife.05457.013](10.7554/eLife.05457.013)Model\# of param.Log likelihoodBICAICfull model9−1102.52272.52223[†](#tblfn3){ref-type="table-fn"}Þ model1−1221.62450.72445.2*λ* model1−1121.12249.7[\*](#tblfn2){ref-type="table-fn"}2244.2[^3][^4][^5][^6]
To probe the conclusions derived from the trial-by-trial model fit, we used model-free analyses of the data ([@bib7]). Leaky accumulation with a time constant *τ* ≈ −0.24 s would result in short trials (with a stimulus duration less than a quarter of a second) being essentially unimpaired, while long duration trials would be more strongly impaired. This was indeed observed in the data, with a tight correspondence between the quantitative model and experimental data (chronometric curves, shown in [Figure 4C](#fig4){ref-type="fig"}). A further property of a leaky accumulator is that the more recent the clicks are, with respect to the end of the stimulus, the bigger their impact on the subject\'s decision. This was also observed in the data, again with a tight correspondence between quantitative model and experimental data (reverse correlation analysis, shown in [Figure 4D](#fig4){ref-type="fig"}).
These results indicate that the FOF is either (a) itself directly involved in the process of accumulating evidence, and the inactivations made the accumulator leaky; or (b) the FOF is a requisite component in the output pathway of an accumulator with a long time constant, that is, the FOF is part of the chain of regions that transform evidence accumulated with a time-constant longer than 0.24 s into an orienting decision.
Unilateral FOF inactivations produce a post-categorization bias {#s2-5}
---------------------------------------------------------------
We also used an accumulator model to analyze the strong ipsilateral bias induced by unilateral FOF inactivations. The original model of Brunton et al. ([Figure 2---figure supplement 1](#fig2s1){ref-type="fig"}) contains only one parameter, the decision boundary Þ, that can generate a left/right bias. We therefore extended the model with three additional parameters, each of which represented a possible imperfection that could generate a side bias. Simultaneously fitting all 12 parameters substantially increased the computational difficulty of the fitting process. In particular, efficiently fitting the original model was made possible by analytical computation of the gradient ([@bib7]). Determining the gradient for 12 parameter model was outside the scope of this manuscript. We consequently took the strategy of first fitting the original 9-parameter model to the control data from 1 day before infusion sessions, and then, starting from those best-fitting parameter values, asking which of the bias-inducing single-parameter changes would best fit the data from the unilateral FOF inactivations (other parameters were held fixed at the control data best-fit values). In other words, we asked, 'if we changed only one parameter, which one would it be to best fit the data?' Finding the maximum likelihood value was made practical by the fact that each of the four fits performed was a single-parameter fit.
The four single-parameter changes we considered corresponded to hypotheses regarding possible functions of the FOF, and are conceptually illustrated in [Figure 5](#fig5){ref-type="fig"}. (a) First, we considered the possibility that the FOF is part of the output pathway of the accumulator, perhaps part of computing or representing the animal\'s discrete choice after having categorized the accumulator value (into 'Go Right' vs 'Go Left' categories) ([@bib33]), potentially in the service of preparing a motor action ([@bib24]). Unilaterally perturbing the FOF might then bias this post-categorization representation. To implement this idea in the model, we added a parameter that biased outcomes after the R/L decision was made on each trial. Independently of the stimulus that led to the decision, we let a randomly-chosen fraction, *κ*~*R*~, of right decisions and a randomly-chosen fraction *κ*~*L*~ of left decisions be reversed (i.e., R → L and L → R; see [Figure 5A](#fig5){ref-type="fig"}). These reversals scale the vertical endpoints of the psychometric curve towards the Went Right = 50% level. The scaling is biased when *κ*~*R*~ ≠ *κ*~*L*~. (b) Next, we considered the possibility that since the FOF has been suggested as analogous to primate FEF, perturbing it might affect attentional processes, perhaps causing a lateralized sensory neglect that would bias the perceptual impact of auditory clicks from the two different sides. In other words, during unilateral inactivation, right and left clicks could have different magnitudes of their impact on the accumulating evidence (*C*~*R*~ and *C*~*L*~, instead of the single common *C* of [Equation 1](#equ4){ref-type="disp-formula"} in [Figure 2---figure supplement 1](#fig2s1){ref-type="fig"}). We described this as a 'unbalanced input gain' (see [Figure 5B](#fig5){ref-type="fig"}). (c) We next considered the possibility that the FOF plays a role in the accumulation process itself, and quantified biases in accumulation through an 'accumulation shift' that shifts the value of the accumulator, *a*, at the end of the stimulus (see [Figure 5C](#fig5){ref-type="fig"}, equivalent to Þ in [Figure 2---figure supplement 1](#fig2s1){ref-type="fig"}). Changes in this parameter will cause horizontal shifts in the psychometric curve. (d) In the fourth and final model, we considered a second possible form of lateralized sensory neglect, in the form of 'unbalanced input noise' (see [Figure 5D](#fig5){ref-type="fig"}). In this version of the model, right and left clicks could have different signal-to-noise ratios by having different values of the sensory noise parameter ($\sigma_{s,R}^{2}$ and $\sigma_{s,L}^{2}$, instead of the single common $\sigma_{s}^{2}$ of [Figure 2---figure supplement 1](#fig2s1){ref-type="fig"}). For each of models (a), (b), and (d), the original fit to the control data was constrained to be balanced. To fit the bias generated by unilateral FOF inactivation, that constraint was relaxed. For each model, we kept the corresponding ipsilateral parameter fixed, and let the contralateral parameter be free to best fit the data. The difference between the best-fitting contralateral parameter minus the ipsilateral parameter was then defined as the bias for that model.10.7554/eLife.05457.014Figure 5.Conceptual illustration of four model parameters, used to quantify different sources of a lateralized bias.(**A**) Post-categorization bias: after categorizing the accumulator value into 'Go Left' or 'Go Right' decisions, a fraction, *κ*~*L*~, of Left decisions are reversed into Right decisions, and a fraction, *κ*~*R*~, are reversed from Right to Left. (**B**) Biased input gain, which can be thought of as a form of sensory neglect: Left and Right clicks have different impact magnitudes on the value of the accumulator. In this illustration left clicks have a much stronger impact, and decisions will consequently be biased to the left. (**C**) Accumulation shift: before categorizing the accumulator into 'Go Left' vs 'Go Right' decisions (by comparing the accumulator\'s value to 0), a constant is added to the value of the accumulator. (**D**) Biased sensory noise, which by differentially affecting signal-to-noise rations from the two sides, can be thought of as a form of sensory neglect distinct from biased input gain: Left and Right clicks have different magnitudes of noise in their impact. In this illustration, left clicks are more variable than right clicks, which biases decisions to the right.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.014](10.7554/eLife.05457.014)
Of these four models, the one that best fit the experimental data was (a), the post-categorization bias model in which the FOF is part of the output pathway of the accumulator ([Figure 6A](#fig6){ref-type="fig"}, [Figure 6---figure supplement 1B](#fig6s1){ref-type="fig"}). The value of *κ* contralateral to the inactivation (*κ*~*C*~) that best fit the data was 0.52, suggesting that on over 50% of trials rats reversed their contra-choices to ipsi-choices. The next best model (which was worse by ≈50 log-units than the post-decision model, [Figure 6A](#fig6){ref-type="fig"}) was (b), the biased input gain model. This model failed to accurately fit the data on difficult trials (in which \|\#Contra − \#Ipsi Clicks\| is small, [Figure 6---figure supplement 1C](#fig6s1){ref-type="fig"}). The best-fit model for (c), the accumulator shift model, was clearly a poor fit even when analyzed through psychometric curves, fitting particularly poorly for trials with a preponderance of contralateral clicks ([Figure 6---figure supplement 1D](#fig6s1){ref-type="fig"}). The worst fitting model was (d), the unbalanced input noise model ([Figure 6---figure supplement 1E](#fig6s1){ref-type="fig"}).10.7554/eLife.05457.015Figure 6.Unilateral FOF inactivation is best fit as a post-categorization bias.(**A**) A comparison of the likelihoods (i.e., best model fits) for the four different bias mechanisms illustrated in [Figure 5](#fig5){ref-type="fig"}. The post-categorization bias model is better than the next best model (biased input gain) by 50 log-units. (**B**) The 2-dimensional normalized likelihood surface for the two best single-parameter models: post-categorization bias and input gain bias. For visualization, we plot the contra-ipsi bias for the two parameters. That is, the difference between the contralateral and ipsilateral values for each parameter. The y-axis is *κ*~*C*~ − *κ*~*I*~. The x-axis is *C*~*C*~ − *C*~*I*~. By definition, in the control model (black marker) these biases are 0. The peak of the magenta likelihood surface for the inactivation data is significantly different from control for post-categorization bias (from 0 to 0.4588) but not significantly different from control for input gain bias. (**C**) Psychometric curves for control and inactivation data. The black line is the model fit to the control data (see [Figure 2A](#fig2){ref-type="fig"} for the data points). The magenta circles with error bars are experimental data from unilateral FOF inactivation sessions, and indicate fraction of Contra choice trials (mean ± binomial 95% conf. int.) across trial groups, with different groups having different \#Contra − \#Ipsi clicks. The magenta line is the psychometric curve generated by the post-categorization bias model. (**D**) Performance as a function of stimulus duration for data from control sessions 1 day before (black), and for data from unilateral FOF sessions (magenta, mean ± std. err.). The lines are the chronometric curves generated by the corresponding model (**E**) Reverse correlation analyses showing the relative contributions of clicks throughout the stimulus in the rats\' decision process. The thick dark red and green lines are the means ± std. err. across trials for contralateral and ipsilateral trials. Thin light red and green lines are the reverse correlation traces generated by the post-categorization bias model. (**F**) Psychometric curves for single-sided trials in control (black), right FOF infusion (red) and left FOF infusion (green) sessions, demonstrate that even for very easy trials FOF infusions produce a vertical scaling, consistent with post-categorization bias.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.015](10.7554/eLife.05457.015)10.7554/eLife.05457.016Figure 6---figure supplement 1.Psychometric and reverse correlation comparisons of data and model for unilateral FOF inactivations.Top row: For all curves, the circles with error bars indicate fraction of Contra choice trials (mean ± se) across trial groups, with different groups having different \#Contra − \#Ipsi clicks. The lines are model fits that differ from the control data in a single parameter (see main text). Magenta data points in (**B**--**E**) are data from unilateral FOF infusions. Middle row: Reverse correlation analyses showing the relative contributions of clicks throughout the stimulus in the rats\' decision process. The thick dark red and green lines are the means ± std. err. across trials for contralateral and ipsilateral trials. Thin light red and green lines are the reverse correlations predicted by the same accumulator models that were used to plot psychometric fits in corresponding column of the top row. Bottom Row: Likelihood as a function of model parameter value. This demonstrates that there was a single global maximum for each 1-parameter model. The magenta cross in each plot indicates the best-fit value of the corresponding parameter (on the x-axis) and the log likelihood of that model (on the y-axis) and corresponds to the model used to generate the psychometric curve and reverse correlations in the top and middle rows. (**A**) Data (black circles) from control sessions 1 day before an infusion session and a 9-parameter accumulator model fit (line). (**B**) Post-categorization bias model. (**C**) Unbalanced Input model. (**D**) Accumulator Shift model. (**E**) Unbalanced input noise model.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.016](10.7554/eLife.05457.016)10.7554/eLife.05457.017Figure 6---figure supplement 2.Distribution of sample from 8-parameter model of unilateral FOF inactivation.Using the Metropolis--Hastings algorithm we collected 40,000 samples from an 8-parameter model of the unilateral FOF inactivation. The parameters are the rows and columns of this matrix of plots. The histograms along the diagonal show the marginal distributions of individual parameters which were used to non-parametrically assess whether individual parameters were significantly different from control values. Each other plot is a scatter plot that gives an estimate of the marginal distribution for each pair of parameters. From left to right: *λ* and $\sigma_{a}^{2}$ are the accumulation parameters from the original 9-parameter model. $\sigma_{s}^{2}$, I is the variance associated with ipsilateral clicks. The accumulator shift parameter is labeled bias here, as in the original model. Post-Cat~I~ (i.e., *κ*~*I*~) is the proportion of ipsilateral choices that are flipped to contralateral choices. $\sigma_{s}^{2}$, C is the variance associated with contralateral clicks. Gain~C~ is the amplitude of contralateral clicks (i.e., C~L~). Ipsilateral clicks are assigned a gain of 1. Post-Cat~C~ (i.e., *κ*~*C*~) is the proportion of contralateral choices that are flipped to ipsilateral choices. Note the plot showing the 2D marginal distribution of Post-Cat~C~ vs Gain~C~ shows the same shape as the likelihood surface in [Figure 6B](#fig6){ref-type="fig"}, validating the sampling method.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.017](10.7554/eLife.05457.017)
We verified that the post-categorization model was best by using a leave-one-session-out cross validation. For each of the 30 unilateral FOF infusion sessions, we fit the 4 models to the 29 other sessions and then evaluated the likelihood of the fit on the left-out session. Using this approach we found a significant main effect of model on likelihood/trial (repeated-measures ANOVA F(3,87) = 10.76, p \< 10^−5^) and Bonferroni-Holm corrected post-hoc *t*-tests reveal that all models were significantly different from each other (p \< 0.005) except the noise and accumulator shift models (p \> 0.4).
To ask whether a combination of changes to two parameters could provide a significantly better description of the data than our single-parameter fits, we estimated the 2-dimensional likelihood surface for the two best models. This surface ([Figure 6B](#fig6){ref-type="fig"}) clearly demonstrated that fitting the data requires a large shift away from the balanced control value in the post-categorization bias, but not in input gain. Thus, the dominant effect of unilateral FOF inactivation could be parsimoniously explained by a post-categorization bias, consistent with the known role of the FOF in movement planning ([@bib24]). As described above, a feature of the post-categorization model is that the psychometric curve after unilateral inactivations should be a vertical scaling of the control psychometric curve. This scaling was found in the data, with a tight correspondence between the curve generated by the quantitative model and the experimental psychometric curve ([Figure 6C](#fig6){ref-type="fig"}). A similar tight correspondence between model and data were also found for the chronometric curves ([Figure 6D](#fig6){ref-type="fig"}) and the reverse correlation ([Figure 6E](#fig6){ref-type="fig"}).
Although computationally challenging, we have also explored whether higher dimensional models might reveal a different set of results. Using the Metropolis--Hastings algorithm, we estimated the best-fit posterior distribution for an 8-parameter model. This model contains the four bias parameters, as well as *λ*, $\sigma_{a}^{2}$, $\sigma_{S,I}^{2}$, and *κ*~*I*~. For computational tractability, the remaining 4 parameters (initial noise, bounds, and the two click adaptation parameters) were fixed at the values of the best-fit control model. With 40,000 samples of this 8 dimensional distribution ([Figure 6---figure supplement 2](#fig6s2){ref-type="fig"}), we estimate that four parameters changed significantly from their control values. First, accumulator noise increased from 5 × 10^−4^ to 0.746 (95% C.I. = \[0.125 12.123\], p = 10^−4^), which is still a small value and would have a negligible impact on behavioral performance. Second, accumulator shift changed from 0.065 to 0.323 (\[0.136 0.890\], p = 0.013), which would also have a minimal effect on overall reward rate. Third, *κ*~*I*~, the changes from ipsi to contra choices decreased from 0.102 to 0.029 (\[0.002 0.071\], p = 10^−4^). Finally, supporting our earlier analysis, *κ*~*C*~, increased from 0 to 0.498 (\[0.176 0.536\], p \< 10^−3^) which results in a very substantial behavioral impact, since this sets the asymptotic performance on the easiest contralateral trials to ≈50%. As in the 2D model ([Figure 6B](#fig6){ref-type="fig"}) the gain of contralateral clicks increased (although not significantly). The likelihood of the best 8-parameter model was only marginally higher than the best 1-parameter post-categorization model ([Table 3](#tbl3){ref-type="table"}), consistent with the small shifts in the other parameters (log likelihood of the 8-D model: −1957.52; log likelihood of the 1-D model: −1963.08). Using AIC and BIC we find that the increase in likelihood is too small to justify the increase in number of parameters.10.7554/eLife.05457.018Table 3.Unilateral FOF model comparison**DOI:** [http://dx.doi.org/10.7554/eLife.05457.018](10.7554/eLife.05457.018)Model\# of parametersLog likelihoodBICAICPost-categorization bias1−1963.13934.4[\*](#tblfn4){ref-type="table-fn"}3928.2[†](#tblfn5){ref-type="table-fn"}Unbalanced input gain1−2013.14034.44028.2Accumulator shift1−2217.44443.04436.8Unbalanced input noise1−2272.74553.74547.48-parameter model8−1957.53981.13949.9[^7][^8][^9][^10]
One of the characteristics of a post-categorization bias model is that since the biasing process occurs after the accumulated evidence has been categorized into 'Go Right' or 'Go Left', the bias is independent of whether trials are easy (large value of \|\#*R* − \#*L clicks*\|) or difficult (small value of \|\#*R* − \#*L clicks*\|). To further probe this hypothesis, we randomly intermixed regular accumulation trials with a new set of unusually easy 'single-sided' trials ([Figure 6F](#fig6){ref-type="fig"}). In these trials the speaker from only one side produced clicks at 100 clicks/s (noticeably higher than the 40 Hz rate on accumulation trials), lasting until the 'Go' signal indicating the end of center port fixation. Consistent with the post-categorization bias hypothesis, the unilateral FOF inactivations produced a vertically-scaled ipsilateral bias in these single-sided trials that was similar to that seen during the accumulation trials ([Figure 6F](#fig6){ref-type="fig"}, compare to [Figure 6C](#fig6){ref-type="fig"} data): that is, the bias was independent of how easy or how difficult the trials were.
Unilateral PPC inactivations and comparison to unilateral FOF inactivations {#s2-6}
---------------------------------------------------------------------------
Given that unilateral PPC lesions in rats lead to contralateral neglect ([@bib20]; [@bib70]), that PPC has been posited as central to rodent perceptual decision-making ([@bib34]; [@bib12]), and that neural correlates of the gradually accumulating evidence are found in PPC in our task ([@bib33]), we predicted that unilateral PPC inactivations would cause a strong contralateral impairment (or, in other words, in the context of our binary forced-choice task, an ipsilateral bias, similar to that seen with the FOF inactivations). Surprisingly, our unilateral PPC inactivations resulted in a small effect that was ≈10× smaller than the effect in the FOF. The average ipsilateral bias was 4.2 ± 2.4% (mean ± s.e.) ([Figure 7A](#fig7){ref-type="fig"}; *t*-test *t*~13~ = 1.76, p \> 0.1). Moreover, this small bias was largely due to data from the first infusion session in group 1 rats ([Figure 2---figure supplement 2A](#fig2s2){ref-type="fig"}) which led to a small but significant shift in rightward responding in right vs left infusions in the group 1 rats (p = 0.024, GLMM test). No consistent effects of unilateral PPC infusions were found in 10 subsequent infusion sessions with group 1 (a total of 11 group 1 unilateral PPC infusion sessions, [Figure 3---figure supplement 2](#fig3s2){ref-type="fig"}), even when the muscimol dose was substantially increased, to 600 ng ([Figure 7B](#fig7){ref-type="fig"}).10.7554/eLife.05457.019Figure 7.PPC Infusions.(**A**) As in [Figure 3B](#fig3){ref-type="fig"}, but for unilateral infusions of muscimol into the PPC, which result in a minimal impairment. In black are data from control sessions 1 day before an infusion (n = 65 sessions, 14 rats). In red are data from right PPC infusions (n = 31 sessions, 14 rats, 150 or 300 ng). In green are data from left PPC infusions (n = 34 sessions, 14 rats, 150 or 300 ng). (**B**) As in (**A**), but using very high doses of muscimol. Only very small effects are seen. In black are data from control sessions 1 day before an infusion (n = 11 sessions, 9 rats). In red are data from right PPC infusions (n = 3 sessions, 3 rats, 600 or 2500 ng muscimol). In green are data from left PPC infusions (n = 8 sessions, 8 rats, 600 or 2500 ng). (**C**) Bilateral infusion of muscimol into the PPC does not produce a markedly bigger impairment. In black are data from control sessions 1 day before an infusion (n = 8 sessions, 4 rats). In blue are data from bilateral PPC infusions (n = 8 sessions, 4 rats, 150 ng per side). (**D**) Schematic view of the brain, duplicated from [Figure 3A](#fig3){ref-type="fig"} to remind readers of the location of FOF and PPC on the cortical surface.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.019](10.7554/eLife.05457.019)10.7554/eLife.05457.020Figure 7---figure supplement 1.PPC infusions have nominal effects on the Poisson Clicks task.(**A**) The psychometric data for accumulation trials and GLMM model fits for bilateral PPC infusions in each rat (n = 4). Open circles are binned data and the small points are the predictions of the GLMM fits at sampled data points. (**A**) In black are the isoflurane control data and fits and in blue are the bilateral infusion data and fits. (**B**) The psychometric data and GLMM model fits for unilateral PPC infusions in each rat (n = 14). Open circles are binned data and the small points are the generated by the GLMM fits at sampled data points. In red are the right infusion data and fits and in green are the left infusion data and fits. The difference between right and left infusions is markedly smaller in the PPC than in the FOF.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.020](10.7554/eLife.05457.020)
To test whether PPC inactivation could produce a quickly adapting effect (i.e., perhaps an effect from muscimol inactivation is observable only in the first session), we repeated our unilateral PPC inactivations using a second group of rats. However, no significant effect was found in any of the PPC infusion sessions in group 2 rats even on the first day of infusion (GLMM test, p = 0.92; [Figure 2---figure supplement 2B](#fig2s2){ref-type="fig"}). Notably, even extremely high doses (up to 2500 ng) of muscimol in PPC, were ineffective at biasing the rats on accumulation trials ([Figure 7B](#fig7){ref-type="fig"}). Thus, our data from group 2 suggest that the bias on the first day in group 1 occurred by chance.
Our PPC coordinates for group 1 and 2 (At 3.8 mm posterior and ≈3 mm lateral to Bregma) were based on the Paxinos and Watson rat atlas, the neural correlates of accumulation found at this location ([@bib33]) and several published studies of rat PPC ([@bib61]; [@bib59]; [@bib86]). Nevertheless, some authors have suggested that PPC is slightly more posterior: 4--6 mm posterior to Bregma ([@bib46]; [@bib88]). We therefore repeated the PPC experiments with a third group of rats, this time implanting cannulae at 4.5 mm posterior to Bregma ([Figure 3---figure supplement 1C](#fig3s1){ref-type="fig"}). Once again, as in group 2, there was no ipsilateral bias due to muscimol (at 300 ng) in the PPC (GLMM test, p = 0.47), nor was there a detectable effect on the first inactivation session.
Performance of side LED trials at regular muscimol doses (150 or 300 ng) was not significantly affected by PPC infusions ([Figure 7A](#fig7){ref-type="fig"}; *t*-test *t*~7~ = 1.0, p \> 0.35), and the response times on these trials were also unaffected (repeated-measures ANOVA, F(1,6) = 2.48, p \> 0.15). At very large doses, a significant effect on side LED trials led to a small correlation between dose and bias for side LED trials (*r* = 0.43, p = 0.032; [Figure 8](#fig8){ref-type="fig"} yellow circles). Given the very large muscimol doses used, and the fact that visual cortical areas lie immediately posterior to PPC ([@bib61]), this weak correlation on side LED trials may be a result of spread of muscimol to the adjacent visual cortex.10.7554/eLife.05457.021Figure 8.Summary of dose-bias relationship for all unilateral infusions.Infusions into the FOF are in magenta and into the PPC are in yellow. Circles indicate bias on LED trials, squares indicate bias on accumulation trials. The magenta line is the linear fit between signed dose of FOF infusion (+for right infusions, −for left infusions) and performance bias (right − left % correct) on accumulation trials (r = 0.85, p \< 10^−9^). The yellow line is the linear fit between signed dose of PPC infusion and performance bias on accumulation trials (r = 0.19, p \> 0.05). The plotted x-location of the side LED trials are slightly offset for visualization.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.021](10.7554/eLife.05457.021)
To summarize, unilateral inactivation of PPC did not reliably bias accumulation trials in three separately tested groups of rats. Based on the large doses used we suspected that the lack of effect was not due to a failure to inactivate PPC. There was no correlation between dose and bias magnitude in our PPC infusions on accumulation trials ([Figure 8](#fig8){ref-type="fig"}, yellow squares; p \> 0.09), strongly contrasting with the significant correlation between dose of muscimol infused into the FOF and bias on accumulation trials (accumulation trials *r* = 0.85, p \< 10^−9^; [Figure 8](#fig8){ref-type="fig"}, magenta squares). The correlation in the FOF data was specific to accumulation trials (p \> 0.5 for side LED trials; [Figure 8](#fig8){ref-type="fig"}, magenta circles).
Bilateral PPC inactivations {#s2-7}
---------------------------
It is possible that during unilateral inactivations, the silenced PPC may be compensated for by the PPC of the opposite hemisphere. In this case, bilateral inactivations of the PPC should produce a behavioral impairment markedly larger than any small impairment found after unilateral inactivations. To probe this hypothesis, we initially used a high dose (300 ng per side) for bilateral PPC infusions in group 1 rats, but only 2 of 6 rats completed trials, with inconsistent results. The maximum dose at which subjects still performed substantial numbers of trials was 150 ng per side, double the dose per side for the bilateral FOF inactivations described above. During the bilateral PPC inactivation sessions there was a very small but significant 3.6% decrease in performance on accumulation trials ([Figure 7B](#fig7){ref-type="fig"}, p \< 0.02 vs isoflurane, GLMM test). This effect was not individually significant in any rat (0/4). Critically, the effect size we found was not bigger--in fact, it was slightly smaller--than the average unilateral PPC effect, and thus does not provide support for the hypothesis of hemispheric compensation. Performance on side LED trials was not significantly different between bilateral PPC infusion and control sessions (*t*-test, p \> 0.4; [Figure 7B](#fig7){ref-type="fig"}). Fitting the accumulator model to the bilateral PPC data, we find that the only parameter to change was the lapse (but the confidence intervals overlapped with the control value), suggesting that the effects on performance were unrelated to any specific aspect of the accumulation process.
Free-choice trials {#s2-8}
------------------
Our results from PPC contrasted with previous studies that found a strong effect of PPC inactivations in a mouse memory-guided navigation task ([@bib34]) and a strong effect of permanent unilateral PPC lesions in inducing contralateral neglect in rats ([@bib20]; [@bib70]). This motivated us to seek a positive control task. The primate literature suggested an internally-guided decision task whose trials could be readily intermixed with our evidence accumulation task. [@bib89] interspersed regular memory-guided saccade trials ('instructed' trials), in which a single saccade target was presented on each trial, with internally-guided 'free choice' trials, in which both an ipsilateral and a contralateral target were presented, and the monkey was rewarded regardless of its response choice. By design, subjects were free to respond as they pleased in free choice trials, and they typically displayed a bias towards one side or another in these trials. Wilke et al. found that muscimol inactivation of area LIP within PPC produced no effect on choices in the instructed memory-guided saccade trials, but produced a profound ipsilateral bias during intermixed free choice trials. Inspired by Wilke et al.\'s results, we modified the task for seven of our group 2 and group 3 cannulated rats (The six group 1 rats and one group 3 rat had been already sacrificed for histology). We randomly intermixed 25% free choice trials with 65% accumulation trials and 10% Side LED trials ([Figure 9A](#fig9){ref-type="fig"}). Free-choice trials were indicated by a lack of auditory click stimuli, and by illumination of both side LEDs after the animals had withdrawn from the center port. We refer to sessions with interleaved accumulation, side LED, and free-choice trials as 'free-choice' sessions. After a few free-choice sessions with no infusions, rats performed the mix of trials reliably, and expressed a consistent bias on free choice trials but no detectable bias on accumulation trials.10.7554/eLife.05457.022Figure 9.Unilateral PPC inactivations induce a strong ipsilateral bias during internally guided decisions, and can induce a strong bias on accumulation trials if the FOF is bilaterally inactivated.(**A**--**D**) Effect of unilateral PPC or FOF inactivations on free choice trials intermixed with regular accumulation trials. (**A**) A schematic of the three interleaved trial types: Accumulation, Side LED and Free Choice trials. Accumulation and side LED trials proceeded as described in [Figure 1](#fig1){ref-type="fig"}. On free choice trials (25% of all trials), after withdrawal from the center port both side LEDs were illuminated and rats were rewarded for going to either port. (**B**) After a few sessions, rats quickly developed an intrinsic bias on free choice trials even while showing no bias on instructed trials (Accumulation and side LED trials). When muscimol was infused into the PPC free choices were significantly biased toward the side of the infusion. This panel shows an example from a single infusion day where the side of the infusions was chosen to be opposite to their intrinsic free-choice bias, together with data from the previous and subsequent control day. (**C**) Unilateral PPC infusions generated a significant 26 ± 9% (mean ± s.e. across rats, n = 7) ipsilateral bias on free choice trials compared to control sessions (the day earlier). During infusion sessions there was a small 8 ± 4% (mean ± s.e., n = 7 rats) contralateral bias on accumulation trials, perhaps compensatory to the free choice ipsilateral bias. There was no effect on side LED trials (**D**). Unilateral FOF infusions generated significant ipsilateral biases on free choice and accumulation trials, but not on side LED trials. One rat (A077) was extremely biased (90% Ipsilateral choices) on Side LED trials during FOF inactivation, indicated as an outlier. \*p \< 0.01. (n = 25 session, 7 rats) (**E**) Combined bilateral infusion of muscimol into the FOF with unilateral infusion of muscimol into the PPC results in a substantial ipsilateral bias on accumulation trials. In black are data from control sessions 1 day before an infusion (n = 32 sessions, 4 rats). In red are data from bilateral FOF infusions with right PPC infusion (n = 8 sessions, 4 rats, 75 ng per side in the FOF, 300 ng in right PPC). In green are data from bilateral FOF infusions with left PPC infusion (n = 8 sessions, 4 rats, 75 ng per side in the FOF, 300 ng in left PPC). See [Figure 9---figure supplement 1](#fig9s1){ref-type="fig"} for the individual rat results and GLMM fits.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.022](10.7554/eLife.05457.022)10.7554/eLife.05457.023Figure 9---figure supplement 1.Simultaneous infusion data for each rat.The psychometric data for accumulation trials and GLMM model fits for bilateral FOF infusions in each rat (n = 4). Open circles are binned data and the small points are the predictions of the GLMM fits at sampled data points. In red are the bilateral FOF + right PPC infusion data and fits and in green are the bilateral FOF + left PPC infusion data and fits. In three of four rats the right infusions lead to significantly more rightward responses than left infusions. There is substantial variability in the overall bias of individual rats in this experiment likely due to the difficulty of performing a perfectly balanced bilateral inactivation of FOF. However, the contribution of the PPC infusion was reliable (3/4 rats) despite an underlying bias.**DOI:** [http://dx.doi.org/10.7554/eLife.05457.023](10.7554/eLife.05457.023)
In remarkable parallel to Wilke et al.\'s results in primates, unilateral PPC inactivations (300 ng of muscimol) during free-choice sessions produced a very strong and reliable ipsilateral bias on free choice trials ([Figure 9B,C](#fig9){ref-type="fig"}; *t*-test *t*~26~ = 3.70, p = 0.001). The strong ipsilateral bias in free choice trials was observed even while, consistent with our previous PPC inactivations, there was no ipsilateral bias on the intermixed accumulation trials (*t*-test *t*~26~ = −0.99, p = 0.329) nor on the Side LED trials (*t*-test *t*~8~ = 1.42, p = 0.194; [Figure 9C](#fig9){ref-type="fig"}). The free-choice bias was highly reproducible: 85% (23/27, sign-test, p \< 0.001) individual rat PPC inactivation sessions produced an increased fraction of ipsilateral free choices when compared to free choices on immediately preceding control days (see [Figure 9B](#fig9){ref-type="fig"} for an example of PPC infusions that were selected to 'push' the rats away from their innate preference seen on the day before and the day after the infusion). The effect on free choice trials was thus similar in its robustness and reproducibility to the effect of unilateral FOF inactivation on accumulation trials. These free choice trial inactivation results provide a clear positive control for our PPC inactivations. Moreover, they are consistent with the parietal neglect literature in both rats ([@bib20]; [@bib70]) and primates ([@bib54]).
Inactivation of FOF, like the PPC, also induced an ipsilateral bias on free choice trials (*t*-test, *t*~24~ = 3.86, p = 0.001). Consistent with our previous experiments, FOF inactivations in free-choice sessions continued to produce an ipsilateral bias on accumulation trials (*t*-test *t*~24~ = 4.85, p \< 0.001) but not on side LED trials (*t*-test *t*~18~ = 1.65, p = 0.117; [Figure 9D](#fig9){ref-type="fig"}).
Simultaneous FOF and PPC inactivation {#s2-9}
-------------------------------------
Are there any conditions under which silencing the PPC could affect choices in auditory click accumulation trials? To probe whether inactivation of the FOF could reveal an effect of PPC inactivation, we bilaterally inactivated the FOF while simultaneously infusing 300 ng of muscimol unilaterally into the PPC. This combination of infusions produced a significant 15.1% bias ipsilateral to the side of the PPC infusion ([Figure 9E](#fig9){ref-type="fig"}, p \< 0.0012, GLMM test). These data constitute a second positive control for our unilateral PPC inactivations. The data furthermore suggest that during auditory evidence accumulation the PPC may have a real but weak influence on choice that is normally overridden by a stronger signal from the FOF.
Discussion {#s3}
==========
In two-alternative forced choice tasks driven by accumulation of sensory evidence, such as the random dots task used with primates ([@bib58]) or the Poisson Clicks task used here with rats ([@bib7]), subjects gradually accumulate evidence over time; make a decision by categorizing the graded value of the accumulated evidence into a binary choice; use their decision to prepare a movement; and finally execute their decision-reporting motor act (these different components could potentially overlap). In primates, five recurrently interconnected brain regions have been associated with the overall process (superior colliculus, striatum, PPC, FEF, and dlPFC; [@bib40]; [@bib45]; [@bib74]; [@bib72]; [@bib67]; [@bib22], [@bib23]; [@bib35]; [@bib52]), but despite some theoretical suggestions ([@bib51]), the specific contributions of each brain region to the different aspects of the overall process, and the circuit logic of the network, remain unclear. Here we focused on the role of two rat cortical areas, posterior parietal cortex (PPC) and frontal orienting fields (FOF), that are considered critical for rodent decision-making ([@bib24]; [@bib79]; [@bib34]; [@bib12]), and that display neural correlates of gradually accumulating auditory evidence ([@bib33]). As in primates, the specific roles of each of these rat areas within the overall evidence accumulation and decision process remain undetermined.
Using a within-subject design, we implanted cannulae in both of these areas, and carried out pharmacological inactivations, quantifying the impairments by fitting to the data detailed models of the decision-making process for the Poisson Clicks task. Different parameters of the models quantified different possible variations from control behavior. We also compared inactivation effects on the Poisson Clicks task ('accumulation trials') to three types of control trials: free-choice (in which the animal was free to choose either of two visual stimuli to obtain a reward); single-sided (in which decisions were guided by a simple auditory stimulus that did not require gradual evidence accumulation, and rats had to withhold their response for several hundred milliseconds after receiving enough information to make their decision); and side LED trials (in which decisions were guided by a simple visual stimulus that did not require gradual evidence accumulation, and rats were free to report their decision as soon as they made it).
In other studies with the same behavioral task, we have used optogenetic inactivation ([@bib33]). Although optogenetics allows high temporal resolution inactivation, its radius of effect in our hands is only ≈750 μm (see Extended Data [Figure 7](#fig7){ref-type="fig"} of [@bib33]). In contrast, inactivating larger regions is much more readily achieved with muscimol, for which the radius of inactivation can be increased simply by increasing the infusion dose. In addition, muscimol directly inactivates all neurons within its radius of effect, not only infected neurons. Moreover, in some tasks, including the Poisson Clicks task, we find that the behavioral effect of optogenetic silencing begins to decay after a few weeks, while the effect of muscimol is stable. This stability in particular was essential for the current study, which used within-subject manipulations over hundreds of days. Optogenetic and pharmacological silencing therefore have complementary advantages and disadvantages. Here we focused on pharmacological inactivation.
Role of FOF {#s3-1}
-----------
Our results demonstrate that the FOF is an essential part of the circuit for decisions driven by accumulating evidence ([Figure 3](#fig3){ref-type="fig"}). Unilateral FOF inactivations had a strong effect on both accumulation trials, signaled by auditory clicks, and on free choice trials, signaled by a bilateral visual stimulus ([Figure 9](#fig9){ref-type="fig"}), indicating that the effects are not specific to a single sensory modality. Critically, the model-based analyses suggested a specific location for the FOF within the functional process chain required by our accumulation of evidence task. The specific suggestion is that the FOF is not part of the accumulator but is instead part of the premotor output pathway that leads from the graded evidence accumulator to the decision-reporting motor act. This suggestion is derived from (a) the sharp reduction in the accumulation time constant induced by bilateral FOF inactivations (from slightly unstable *τ* ≈ +0.8, to very leaky *τ* ≈ −0.24 s), which demonstrates that the FOF is either involved in the accumulation process itself, or is part of the output pathway of the accumulator ([Figure 4](#fig4){ref-type="fig"}); (b) the effects induced by unilateral inactivation of the FOF, which are captured in quantitative detail, for both accumulation trials and single-side trials, as having induced a post-categorization bias that is subsequent to the accumulation process ([Figure 6](#fig6){ref-type="fig"}); and (c) the lack of an effect of FOF inactivations on side LED trials, which rules out a simple motor role for the FOF ([Figure 3](#fig3){ref-type="fig"}). A parsimonious explanation of this set of results is thus that the FOF is a requisite premotor component of the output pathway of an evidence accumulator with a long time constant (\>0.24 s). This suggestion is different from, but consistent with, the FOF\'s known role in short-term memory, as well as the FOF\'s greater importance in memory-guided (i.e., long time constant) vs sensory-guided (short time constant) orienting decisions ([@bib24]). In decisions driven by gradual accumulation of evidence, the gradual accumulation process occurs prior to the binary decision. An intriguing possibility suggested by our results that the decision process itself--that is, the categorization of the gradually accumulated evidence into a binary choice--might be performed in the FOF, perhaps in conjunction with the superior colliculus ([@bib51]).
It is possible that unilateral FOF inactivations would induce a hemispheric imbalance so strong that a real but nuanced role for the FOF in gradual accumulation might have been obscured by a strong post-categorization bias. We nevertheless currently favor the interpretation of the FOF\'s role as subsequent to, not part of, the graded accumulator. We favor this interpretation first, because of its parsimony; second, because parallel electrophysiological work from our laboratory found that the representation of the accumulated evidence in the FOF could be approximately described as the answer to the categorical question 'if the GO signal came now, which side port should I choose?'; third, using AAV-CaMKII-eNpHR3.0 for optogenetic inactivation we found that transient unilateral silencing of the FOF was unable to cause an effect on behavior if it occurred during the evidence accumulation period, sufficiently prior to the GO signal ([@bib33]).
Those results, in combination with the pharmacological data, three control trial types, and model-based analyses reported here, all consistently support the interpretation of the FOF as a requisite component of the output pathway of an evidence accumulator with a long time constant (\>0.24 s). This view is consistent with the fact that side LED trials, which involve decisions that do not require gradual evidence accumulation or storing a motor plan in short-term memory, are not impacted by FOF inactivations. Such decisions, including perhaps decisions that require auditory evidence accumulation over only short times (\<0.24 s), may depend on pathways that bypass the FOF, perhaps involving direct connections from auditory cortex to the striatum ([@bib91]).
With pharmacological infusions, one concern is spread of inactivation to other structures. We based the volume and concentration of our infusions on previous literature to achieve inactivation volumes of 1 mm radius for our small doses and 3 mm radius for our largest doses ([@bib53]; [@bib49]). This spread is within the anterior-posterior bounds of FOF, but could have spread medially to cingulate cortex (CG1) or laterally to M1 ([@bib61]). The white matter below FOF prevent spread ventrally into the basal ganglia. In a previous study, we directly tested the effects of M1 inactivation and found them to be weaker than FOF inactivations and also they affected sensory-guided and single-sided trials equally ([@bib24]). As such, it is unlikely that the effects we are attributing to FOF are due to M1 inactivation. We targeted our inactivations to 2 mm anterior and 1.25 mm lateral to Bregma. According to the Rat Atlas ([@bib61]) CG1 may be within the spread of the drug. However, according to a recent cell-based mapping technique the medial boundary of FOF has been underestimated ([@bib6]), suggesting that most of spread of drug would be within FOF. Moreover, the CG1 is thought to play a role in cost-benefit decisions ([@bib36]; [@bib39]), cognitive flexibility ([@bib63]), or emotional reactivity ([@bib5]), not in movement planning. Therefore, the effects observed are more likely due to changes in FOF rather than an adjacent cortical region.
Role of PPC {#s3-2}
-----------
Given the view that the PPC plays a key causal role in rodent perceptual decisions ([@bib34]; [@bib12]) and that neural activity in PPC displays correlates of accumulating auditory evidence ([@bib33]), we were surprised to find that unilateral inactivation of the PPC did not cause a side bias on accumulation, side LED, or single-sided trials. Compensation from the unperturbed hemisphere did not explain the lack of an effect, because bilateral inactivation of the PPC caused a minimal decrease in performance (3.6%) that was not significantly different from unilateral inactivations. Thus, the PPC seems to play a far more subtle role than the FOF in choice behavior during decisions guided by auditory evidence accumulation.
Unilateral PPC inactivations did cause a strong ipsilateral bias under two conditions: in internally-guided decisions (free choice trials, signaled by a visual stimulus, [Figure 9A--C](#fig9){ref-type="fig"}), and when the FOF was simultaneously bilaterally inactivated in accumulation trials (auditory stimulus, [Figure 9E](#fig9){ref-type="fig"}). These results suggest that in the intact brain, weak but real side choice signals from the PPC may be overridden by stronger signals from the FOF. They also suggest that the PPC\'s role may not be specific to a particular sensory modality.
The PPC is relatively extended in the medial-lateral direction (≈4 mm) but it is thin (≈0.75 mm) in the anterior-posterior direction ([@bib61]; but see [@bib88]). The anatomical characteristics of the PPC pose two possible confounds: insufficient inactivation of the PPC in the medial-lateral direction and potential spread to adjacent regions in the anterior-posterior direction. If we assume the spread of muscimol across the cortical is isotropic (white matter acts as a physical barrier, so we assume that the ventral spread is restricted), then an individual injection, due to the wide and thin shape of PPC, will either fail to inactivate all of PPC or spread to adjacent regions. Based on the literature ([@bib53]; [@bib49]) we expect our smallest infusion to have a ≈1 mm radius and our largest to have a \>3 mm radius. This technical limitation would have posed a serious challenge for our results if we observed very different effects of our small and large infusions. However, despite using a wide range of doses, we observed no significant dose--response effect with unilateral PPC infusions ([Figure 8](#fig8){ref-type="fig"}). A clear dose--response relationship (as we found in the FOF) would indicate that bigger infusions were silencing more and more PPC neurons required for behavior in the task. Instead, the fraction of inactivated PPC neurons had no impact on the magnitude of the behavioral effect, which is what we would expect if PPC neurons were not required for choice behavior in the task. Nonetheless, further experiments would be required to completely rule out the possibility that a small number of PPC neurons, in the most medial or lateral edge of the PPC, were spared and that these few neurons were sufficient to support intact behavioral performance on the Clicks task.
Spread of muscimol into areas immediately anterior or posterior to the PPC was inevitable with our largest doses, and, in the two cases where positive effects were observed, this raises concerns about region specificity. Immediately anterior to the PPC is the somatosensory cortex (for the trunk). Particularly in light of the intact motor capacities, as indicated by the intact side LED trials, the somatosensory cortex is not expected to have caused any of the observed effects. Immediately posterior to the PPC are a set of individually small visual areas, collectively referred to as secondary visual cortex (V2; [@bib15]; [@bib56]; [@bib83]). These visual areas are unlikely to be involved in auditory click accumulation trials, and are therefore not expected to have caused the effects we saw after simultaneous unilateral PPC and bilateral FOF inactivations ([Figure 9E](#fig9){ref-type="fig"}). However, the bias we observed on free-choice trials may have been partly due to an effect in one or more of these small secondary visual areas. Nevertheless, ipsilateral biases in untrained orienting responses (potentially analogous to the free-choice task) due to PPC lesions have been observed in the rat even when those choices were to tactile or auditory stimuli ([@bib17]; [@bib8], [@bib9]). We also note that our free choice results closely parallel the results from primate PPC free choice experiments ([@bib89]), which do not suffer from this spillover concern.
A minimal effect following PPC inactivation in our rat auditory click accumulation task is reminiscent of Guo et al.\'s, finding of no effect after PPC inactivation in a mouse somatosensory-cued, memory-guided task ([@bib31]). But it contrasts with Harvey et al.\'s finding of a severe performance impairment after PPC inactivation in a mouse visually-cued, memory-guided navigation task ([@bib34]). Following our own preliminary reports of PPC inactivations in the Poisson Clicks task ([@bib26], [@bib25]), [@bib63a] reported an impairment after rat PPC inactivations in a visual, but not in an auditory, version of a closely related task. This contrasts with a preliminary report from Yates et al. that suggested no effect from primate PPC inactivation in a visual accumulation of evidence task ([@bib90]), as well as with multiple reports of no effect from primate PPC inactivation in visual memory-guided saccade tasks ([@bib14]; [@bib85]; [@bib50]; [@bib89]). The Raposo et al. results therefore suggest that rodent PPC may be unlike primate PPC in being required for accumulation of evidence for a specific modality, vision. Nevertheless, the precise location of the border between rodent PPC and visual cortex, as well as the amount of inter-animal variability in this location, remain active research questions ([@bib88]; see, for example, [@bib69]; [@bib18] for definitions from the same authors, based on the same data, that alternately describe the border as located at −5.0 mm from Bregma or −4.4 mm from Bregma). The uncertainty in the location of the PPC/visual cortex border raises an alternative possibility, which is that the impairments in memory-guided visual tasks observed by Harvey et al. and Raposo et al. (and potentially the free-choice effects seen here) could have been due to inactivation spillover into one of the immediately adjacent small secondary visual areas, as described above, rather than inactivation of the PPC itself. This would make all the inactivation results ([@bib34]; [@bib31]; [@bib63a]; [@bib90]; and the results presented here.), including mouse, rat, and primate, fully consistent with each other. While such a reconciliation of results across multiple species may have some intellectual appeal, we emphasize that experiments that would either clearly support or rule out this possibility remain to be done.
Comparison to primates {#s3-3}
----------------------
To date, the accumulation of evidence literature is mostly composed of electrophysiological experiments with primates. Based on a number of criteria, the rat PPC and FOF have been suggested as analogous to the primate PPC and FEF, respectively ([@bib46]; [@bib68]; [@bib24]), and accumulation of evidence signals very similar to those in primates have been found in these two rat areas ([@bib33]). It is therefore tempting to speculate that our results in rat might also hold in primate, and to consider potential interpretations that would be consistent across mammalian model systems.
There have been no published inactivation experiments in primate PPC or FEF during accumulation of evidence tasks. There have, however, been inactivation experiments in related tasks, which in general are in agreement with our findings: prefrontal perturbations strongly bias behavior while posterior parietal perturbations do not. In memory-guided saccade tasks, LIP inactivations have no effect on the choice of saccading either towards or away from the correct hemifield ([@bib14]; [@bib85]; [@bib50]; [@bib89]), while FEF and prefrontal inactivations reliably generate profound ipsilateral choice biases ([@bib77]; [@bib21]; [@bib14]). Similarly, in a covert visual search task, LIP inactivation has no effect on error rates ([@bib85]), while inactivation of the FEF generates significant increase in error rates for contralateral targets ([@bib84]). Again similarly, in a memory-guided task with distractors, [@bib80] found no errors after LIP inactivations while finding significant contralateral errors after prefrontal cortex inactivations.
We are aware of only a few studies where LIP inactivation produces choice biases ([@bib85]; [@bib1]; [@bib89]). One of these studies ([@bib89]) inspired our intermixing free choice trials with accumulation trials. Consistent with a good analogy between rat PPC and primate PPC, our results in rats closely paralleled Wilke et al.\'s results in primates, with our accumulation of evidence trials playing the role of their memory-guided saccade trials ([Figure 8](#fig8){ref-type="fig"}). Also consistent with our rat data and with a good analogy between rat and primate PPC, a preliminary report has suggested that unilateral primate PPC inactivations have no effect on accumulation of evidence trials, while causing an ipsilateral bias on free choice trials ([@bib90]).
There has been one perturbation study in the primate FEF during an accumulation of evidence task ([@bib29]). This microstimulation study concluded that 'developing oculomotor commands may reflect the formation of the monkey\'s direction judgement' (i.e., its decision). Our results in rat FOF are consistent with those of Gold and Shadlen, but go considerably further in specifically suggesting the FOF as a requisite premotor component of the output pathway of a long time constant (\>0.24 s) evidence accumulator.
There has been one perturbation study in the primate PPC during an accumulation of evidence task ([@bib32]). This microstimulation study used a reaction time version of the Random Dots task, and found a pattern of results following LIP microstimulation that could be quantitatively explained in an accumulation-to-bound model if the microstimulation added a small constant offset to the value of the accumulator ([@bib32]). Unlike the task used by Hanks et al., our task (and that of [@bib90]) was not a reaction time task, which could explain the difference in results. An alternative possibility, noted in their discussion ([@bib32]), and which would reconcile our results with theirs, is that microstimulation may activate axon terminals or fibers of passage ([@bib37], [@bib38]; but see [@bib81]). The behavioral effects produced by microstimulation of LIP may thus have been due to activation of neurons with somata not in LIP, but in regions of the brain that project to LIP. Since muscimol does not affect axons or fibers of passage, this possibility would be consistent with our data.
If the PPC plays a causal role in internally-guided decisions, but does not play a causal role in choice behavior during accumulation of evidence tasks, what role is then played by the firing rate correlates of evidence accumulation signals observed in PPC, in both rats and primates? Accumulation signals are also correlated with confidence ([@bib44]; [@bib47]). One possibility is that, instead of being used to drive choice behavior, the accumulation signals observed in the PPC are used for computing choice confidence ([@bib44]). Confidence could be part of a process for optimizing behavior over many trials, or, in a reaction time version of the task, confidence could be part of determining when the subject chooses to commit to a decision.
Conclusion {#s3-4}
----------
In the rat, our data now suggests a specific functional role for the FOF in decisions driven by accumulation of evidence: the FOF appears to be a requisite component of the output pathway of an evidence accumulator with a long time constant (\>0.24 s). Decisions with shorter processing times may involve circuits that bypass the FOF. It is possible that categorizing the graded accumulator\'s value into a discrete choice--the final decision itself--could occur in the FOF. In contrast, the PPC seems to play a surprisingly minimal, or subtle, role in choice behavior during decisions guided by accumulation of evidence, even while it plays an important role in internally-guided decisions. Neither region appears likely to play a major causal role in the gradual evidence accumulation process per se.
Materials and methods {#s4}
=====================
Subjects {#s4-1}
--------
Animal use procedures were approved by the Princeton University Institutional Animal Care and Use Committee and carried out in accordance with National Institutes of Health standards. All subjects were male Long-Evans rats (Taconic, NY). Rats were placed on a restricted water schedule to motivate them to work for water reward. Rats were kept on a reversed 12 hr light--dark cycle and were trained in their dark cycle.
Behavior {#s4-2}
--------
We trained 14 male Long-Evans rats on the Poisson Clicks accumulation task ([Figure 1](#fig1){ref-type="fig"}). Training took place in a behavior box with three nose ports (left, center and right), and with two speakers, placed above the right and left nose ports. Each accumulation trial began with a visible light-emitting diode (LED) turning on in the center port. This cued the trained rat to place its nose in the center port, and keep it there until the LED was turned off. We refer to this period as the 'nose in center' or 'fixation' period. The duration of fixation was 2 s for all accumulation trials. During the fixation period a variable duration auditory stimulus (0.1--1 s, experimenter controlled) would play, consisting of two randomly timed trains of clicks, playing simultaneously, one from the left and one from the right speaker. At the end of the auditory stimulus, the LED in the center port would extinguish, which was the signal to the rat to make their response by poking into one of the side ports. The timing of the clicks from each speaker was generated by two independent Poisson processes. The total generative click rate (left + right rate) was held constant at 40 clicks/s, and trial difficulty was controlled by adjusting the relative left vs right rates, as well as the duration of the stimulus. Trials where rats exited the center port during the fixation period were considered violation trials, aborted, and a new trial was started. These trials are not included in any analyses.
To test whether the apparent vertical scaling of the psychometric curve after unilateral FOF inactivations was due to a lack of asymptotically easy trials, we interleaved 'single-sided' trials with accumulation trials (and side LED trials in some sessions). A single-sided trial was much like an accumulation trial, but all the clicks came from one speaker and were played at a Poisson rate of 100 Hz. Since the 100 Hz stimuli were easily distinguished from 40 Hz stimuli and these trials did not require accumulation (all clicks on one side), rats probably made their decision quickly. However, they were still required to wait until the go cue. These trials comprised ≈8% of a trials in a session.
In order to control for motor effects of inactivations, in group 2 and 3 rats, we included, randomly interleaved with other trial-types, 'side LED' trials. On side LED trials no sounds were played during fixation, which lasted 1 s. Immediately after the end of fixation, one of the two side ports was illuminated, indicating availability of reward at the lit port ([Figure 1](#fig1){ref-type="fig"}). The right and left side LED trials, together, comprised ≈10% of the total trials.
In order to find a task that was sensitive to inactivation of the PPC, we randomly interleaved 'free-choice' trials with the other trial-types. Free-choice trials were similar to side LED trials except at the end of fixation both side LEDs were illuminated and rats were rewarded regardless of whether they poked in the right or left nose port. These sessions took place after all of the experiments presented in [Figures 3--7, 8E](#fig3 fig4 fig5 fig6 fig7 fig8){ref-type="fig"}.
Control non-infusion sessions (used to generate [Figure 2---figure supplement 2](#fig2s2){ref-type="fig"}) with poor performance (\<70% correct overall or fewer than eight correct trials on each side without fixation violations) were excluded from analyses. These sessions were rare and were usually caused by problems with the hardware (e.g., a clogged water-reward valve or a dirty IR-photodetector). We collected ≈145,000 control trials (range \[57692 265332\]) over ≈450 (range \[291640\]) sessions from each rat (n = 14) from sessions without intracranial infusions or pre-session anesthesia for a total of 2,057,074 control trials.
Surgery {#s4-3}
-------
Surgical methods were identical to those described previously ([@bib24]). Briefly, rats were anesthetized with isoflurane and placed in a stereotax. The scalp was deflected and the skull was cleaned of tissue and blood. The stereotax was used to mark the locations of craniotomies for the FOF and PPC on the skull. Craniotomies and durotomies were performed and then the skull was coated with a thin coat of C&B Metabond (Parkell Inc., NY). Guide cannula (Plastics One, VA) were lowered to brain surface with dummy cannula extending 0.5 mm into the brain. The guide cannula were placed and secured to the skull one at a time with a small amount of Absolute Dentin (Parkell Inc., NY). After the three guide cannula were in place (One bilateral FOF cannula and one cannula for each PPC) dental acrylic (Duralay, Reliance Dental Mfg. Co, IL) was then used to cover the skull and further secure the cannula. Rats were given 5 days to recover on free water before resuming training.
Cannula {#s4-4}
-------
Group 1 rats (n = 6) were implanted bilaterally in FOF (+2 AP, ±1.25 ML mm from Bregma) with 22 AWG guide cannula (C232G-2.5, Plastics One, VA) and the medial (3.8 mm posterior, 2.2 mm lateral to Bregma) and lateral (3.8 mm posterior, 3.4 mm lateral to Bregma) PPC with 26 AWG guide cannula (6 cannula per rat total). Group 2 rats (n = 4) were implanted in FOF and in PPC (3.8 mm posterior, ±2.8 mm lateral to Bregma; a total of 4 cannulae per animal) with bilateral 22 AWG guide cannula. Group 3 rats (n = 4) were implanted with bilateral 22 AWG guide cannula in FOF and in PPC (4.5 mm posterior, ±3.0 mm lateral to Bregma; 4 cannulae per animal).
The tip of the guide sat at brain surface and the dummy extended 0.5 mm into cortex. The injector for the 22 AWG guide cannula was a 28 AWG cannula that extended 1.5 mm below the bottom of the guide cannula. The injector for the 26 AWG guide cannula was a 33 AWG cannula that extended 1.5 mm below the bottom of the guide cannula.
Infusions {#s4-5}
---------
In general, infusions were performed once a week with control training days taking place on all other days of the week in order to minimize adaptation to the effects of the muscimol and to have good stable performance in the sessions immediately before infusion sessions. On an infusion day, the rat was placed into an induction chamber with 2% isoflurane, and then transferred to a nose cone with 2% isoflurane for the infusion procedure. Caps and dummy cannula were removed and cleaned. Injectors were placed into the relevant guide cannula and extended 1.5 mm past the end of the guide, into cortex. We used a hamilton syringe connected via tubing filled with mineral oil to the injector to infuse 0.3 µl of muscimol (of various concentrations--see 'Results' and [Figure 3---figure supplement 2](#fig3s2){ref-type="fig"}) into cortex. After injection, we left the injector in the brain for 4 min to allow diffusion before removal. After 4 min, cleaned dummies were placed into the guide cannula and capped and the rat was removed from isoflurane. After 30 min of recovery from isoflurane the rat was placed into a behavior box as usual. See [Figure 3---figure supplement 2](#fig3s2){ref-type="fig"} for the complete list of all infusion doses, regions, and order for each rat. Previous experiments in rat cortex, performing autoradiographic estimates ([@bib53]), as well as simultaneous muscimol inactivation and recordings ([@bib49]), suggest that at the doses of muscimol we used, the expected area of inactivation would have an approximately ≈1 mm radius for the smallest doses and \>3 mm radius for the largest doses.
Since the only difference between left and right infusions (and FOF and PPC infusions) are the location of the infusion any differences in behavior can only be attributed to the infusion and not to handling. For bilateral infusions, we were interested in non-lateralized impairments compared to baseline performance. To rule out the possibility that the handling of rats for the infusion procedure could affect performance we did isoflurane-only sessions where rats were handled as they would be for an infusion (taken to the infusion room, placed into an induction chamber with 2% isoflurane, dummies removed, cleaned and replaced, etc) but given no infusion. These isoflurane-only sessions were used as a baseline to compare with the bilateral infusion sessions.
Analysis and statistics {#s4-6}
-----------------------
All analysis and statistics were computed either in Matlab (version 7 or better, The Mathworks, MA) or R (version 2.15.2, R Foundation for Statistical Computing, Vienna, Austria). Sessions where there were too few trials, or otherwise had problems during the infusions were excluded. We only included the first 250 trials of a session because the effect of muscimol can decrease after a few hours, although the results are robust to including all trials.
The accumulator model uses 9-parameters (described in [Figure 2---figure supplement 1](#fig2s1){ref-type="fig"}) to transform the stimulus on each trial (input to the model as the left and right click times) into a probability distribution about the choice of the rat. For example, if for a given set of parameter, the model predicts that trial 1 will result in 75% chance of the rat going right, and the rat in fact went right, that trial would be assigned a likelihood of 0.75. In the case that the rat went left, the trial would be assigned a likelihood of 0.25. We fit the model assuming that the trials are independent. Therefore, for a model with parameters *θ* for all decisions D, the likelihood is given by:$$P\left( D \middle| \theta \right) = \prod\limits_{i}P\left( d_{i} \middle| t_{i,R},t_{i,L},\theta \right),$$the product of the likelihoods of the decisions on trial *i*, *d*~*i*~, given the times of the right clicks *t*~*i*,*R*~, times of the left clicks *t*~*i*,*L*~, and the set of 9 parameters, *θ*. A detailed description of the procedure for fitting the accumulator model can be found in the Modeling Methods section of the supplement of [@bib7]. For panels A, C, and D in [Figure 2](#fig2){ref-type="fig"} we first concatenated 47,580 trials across sessions and rats from sessions 1 day before an infusion session. The values of the parameters that maximized *P*(*D*\|*θ*) for these concatenated data are described as 'Meta-Rat' in [Table 1](#tbl1){ref-type="table"}. Since the model is fit to the individual trials, we emphasize that the psychometric, chronometric and reverse correlations plot for a given model are not generated using a curve-fitting procedure for each panel. We also fit each rat individually and show the best-fit parameters for each rat in [Table 1](#tbl1){ref-type="table"}.
Even at the very easiest trials, rat behavior in our task often asymptotes at ≈90% correct. To fit this, the model includes a 'lapse' parameter, which represents a fraction of trials in which subjects will ignore the stimulus and choose randomly. The presence of the lapse parameter also puts a lower bound on the likelihood of any individual trial, and thus no individual trial can dominate the results and the consequent fits of the model.
In [Figures 3, 4E, 6, 8E](#fig3 fig4 fig6 fig8){ref-type="fig"}, [Figure 2---figure supplement 2A](#fig2s2){ref-type="fig"} the psychometric curves were generated by concatenating trial data across sessions for each rat and fitting (using Matlab\'s nlinfit) a 4-parameter sigmoid as follows:$$y = y_{0} + \frac{a}{1 + e^{\frac{- {({x - x + 0})}}{b}}}.$$
For these fits, *x* is the click difference on each trial (\#Right Clicks − \#Left Clicks), *y* is 'P(Went Right)', and the four parameters to be fit are: *x*~0~, the inflection point of the sigmoid; *b*, the slope of the sigmoid; *y*~0~, the minimum 'P(Went Right)'; and *a* + *y*~0~ is the maximum 'P(Went Right)'. These fits are for visualization only.
For chronometric analyses ([Figures 2C](#fig2){ref-type="fig"}, [4C](#fig4){ref-type="fig"}, [6D](#fig6){ref-type="fig"} and [Figure 2---figure supplement 2C](#fig2s2){ref-type="fig"}), we concatenated trials for each rat across sessions and binned trials into easy, medium and hard quantiles with equal number of trials based on the relative generative left-right click rate. For each of these three difficulty levels we binned trials by stimulus duration.
The detailed methods of generating the psychophysical reverse correlations ([Figures 2D, 4D, 5D](#fig2 fig4 fig5){ref-type="fig"} and [Figure 6---figure supplement 1](#fig6s1){ref-type="fig"}) can be found in the [@bib7]. For this analysis separation of right (red lines) and left (green lines) trials at each time in the trial indicates that there was a difference in local click rate at that time for trials in which the rat responded to the right vs to the left. If rats only used the early clicks for their decision (a primacy strategy), the lines would begin separated and come together. Likewise, if they only used the clicks at the end of the stimulus (a recency strategy) the lines would start together and separate towards the end of the trial. To generate the accumulator model\'s reverse correlation, each trial was assigned as the left and right trial, according to the model\'s prediction for that trial. For example, if the model predicted that a trial had a 67% chance of a rightward choice, this trial would contribute 0.67 to the right trials and 0.33 to the left trials psychophysical kernel.
The unilateral infusion experiments are designed specifically to test for lateralized effects. On left and right infusion days animals are handled in the exact same way: taken into the room where the infusions happen, placed under light isoflurane anesthesia, etc (described in detail in the Infusions section of the 'Materials and methods'). The only difference is the side of the infusion. As such, this within-subject design is effective at testing biases to respond toward or away from the side of the infusion. The simplest way to estimate bias resulting from unilateral inactivations is to subtract the contralateral % correct from the ipsilateral % correct for each infusion session. To compute the overall bias we averaged the bias across sessions for each rat and then tested using a *t*-test whether the bias across rats was significantly different from 0. However, this statistical test is conservative, since it collapses across all trials of differing difficulty levels and different sessions. As well, this overall bias measure was inappropriate for testing the effects within each group, since the n per group was low.
To avoid false negative results (type II error), as a more sensitive measure of inactivation effects we used a Generalized Linear Mixed-Model (GLMM) as implemented in the function 'lmer' in package 'lme4' ([@bib3]; [@bib4]). For unilateral infusions we specified a mixed-effects model where the rats\' choice on each trial was a logistic function of \#Right − \#Left Clicks (Δ Clicks), infusion side and their interaction as fixed effects. The rat and an interaction of rat, infusion side, and Δ Clicks were modeled as within-subject random effects. The statistic reported in the text for unilateral infusions was the p value for the infusion side fixed effect. The plots in [Figure 3---figure supplement 3](#fig3s3){ref-type="fig"} (FOF) and [Figure 7---figure supplement 1](#fig7s1){ref-type="fig"} (PPC) show that the model fits for each rat are quite good, and reflect how the random effects of the model allow for each rats\' data to be fit, while also finding significant fixed effects. The logistic fit sometimes misses the end point performance, which, for the FOF inactivations, was generally worse than the GLMM fit.
For bilateral infusions we specified a similar model comparing bilateral infusions to isoflurane-only sessions. For these models the relevant statistic was the significance of the interaction between infusion and Δ Clicks, that is, a change in the slope of the logistic. Details of the data and code used to generate and compare the models is described in [Supplementary file 1](#SD2-data){ref-type="supplementary-material"} 'Using the lme4 package to fit generalized-linear mixed models in R'.
To test whether there were effects of unilateral infusions on response times (RT) on side LED trials, measured as time from go cue to side port response, we took the mean RT for each rat for left and right choices on left and right infusion days. We separated leftward and rightward responses because there can be large differences from rat to rat in the left vs right response times. We then did a repeated-measures ANOVA (Rat X \[Left vs Right\] X \[Ipsi vs Contra\]) to test whether there was an effect of muscimol on RTs. Since ANOVA must be balanced, only 4 rats (out of a possible 8 group 2 and 3 rats) performed enough side LED trials from FOF infusions for this analysis. For the PPC infusions 7 of 8 rats performed enough trials to be included.
For the analyses of biases during free-choice sessions we compared the bias (ipsilateral − contralateral % correct) on the infusion day with the control session 1 day before and performed *t*-tests across sessions for each region (PPC or FOF) and trial-type (free-choice, accumulation or side LED). Some free-choice sessions had no side LED trials which is why there are fewer sessions in the *t*-tests for that trial-type. Side LED trials were also not analyzed for sessions if the bias in the side LED trials during the preceding control day was greater than 20%.
To fit the 9-parameter accumulator model to the bilateral FOF infusion data we concatenated all 1809 trials across all rats. We validated the error in these fits by bootstrapping. Specifically, we generated 300 sets of 1809 trials data by randomly sampling with replacement from the original data set. We then fit the 9-parameter model to each of these 300 data sets, generating 300 sets of 9 best-fit parameters. We used this distribution of fits to generate confidence intervals for each of the parameters. In order for a parameter to be considered as significantly different from the control value, the control value from the meta-rat fit had to be outside of the 95% confidence interval of the bootstrapped marginal distribution for that parameter.
To better understand what aspect of the task was impaired by unilateral FOF inactivation we took advantage of the knowledge of the times of all the clicks and the rats\' choices using our previous modeling work ([Figure 2---figure supplement 1](#fig2s1){ref-type="fig"}, [@bib7]) to fit four constrained Accumulator Models to the unilateral FOF infusion data. For all of these analyses we relabeled the trials for left/right trials to ipsi/contra trials based on the side of the infusion. For the infusion meta-rat we combined all 3836 trials from unilateral FOF sessions. Second, to avoid computing the gradient for a 12-parameter model, we fit constrained Accumulator Models that had one parameter free and the other parameters fixed to the best-fit parameters from the control meta-rat Accumulator Model. The details of the free parameter of each model are described in the results section.
We used MALTAB\'s built-in Metropolis--Hastings sampler (mhsample.m in the Statistics Toolbox) to sample from the 8-parameter distribution (described in the 'Results'). We generated 4 separate Markov chains of 10,000 samples each, starting from the best-fit control parameters with a burnin of 100. For the proposal distribution we used a uniform distribution with the range selected for each parameter (e.g., a smaller range for input gain than for input noise). We used a thin of 4, based on test runs with known gaussian distributions. [Figure 6---figure supplement 2](#fig6s2){ref-type="fig"} shows the samples generated by this sampling process.
To compare models with different numbers of parameters we used two commonly used metrics, the Bayesian and Akaike information criterion (BIC and AIC). The BIC is defined as, *BIC* = −2 × *LL* + *k* × *ln*(*n*). Where LL is the maximum log likelihood of a model with *k* free parameters on n data points. The AIC is similarly defined, *AIC* = −2 × *LL* + 2 × *k*. The main difference being that AIC is not a function of the size of the data set. Since the cost of additional parameters in AIC is only 2*k*, the AIC favors more complicated models compared to BIC.
Funding Information
===================
This paper was supported by the following grants:
- http://dx.doi.org/10.13039/100000011Howard Hughes Medical Institute (HHMI) International Student Research fellow to Chunyu A Duan.
- http://dx.doi.org/10.13039/100000011Howard Hughes Medical Institute (HHMI) Investigator to Carlos D Brody.
- http://dx.doi.org/10.13039/100000002National Institutes of Health (NIH) F32MH098572 to Timothy D Hanks.
We thank A Begelfer, K Osorio and J Teran for animal and laboratory support. TDH was supported by National Institutes of Health (NIH) Award Number F32MH098572. CAD was supported by a Howard Hughes Medical Institute International Student Research Fellowship.
Additional information {#s5}
======================
The authors declare that no competing interests exist.
JCE, Participated in all aspects of this project.
BWB, Collaborated with TDH and JCE in adapting the model from Brunton et al. (2013) for this project.
CAD, Participated in data collection and provided comments on the manuscript.
TDH, Collaborated with BWB and JCE in adapting the model from Brunton et al. (2013) for this project, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article.
CDB, Conception and design, Analysis and interpretation of data, Drafting or revising the article.
Animal experimentation: This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to approved institutional animal care and use committee (IACUC) protocol (\#1853) of Princeton University. All surgery was performed under isoflurane anesthesia and analgesics were given for 5 days after surgery, as recommended by the institute veterinarian. Every effort was made to minimize suffering.
Additional files {#s6}
================
10.7554/eLife.05457.024
######
Using the lme4 package to fit generalized-liner mixed models in R. This file contains the code (and links to our data) which shows how we used the lme4 package, in R, to fit generalized linear mixed models (GLMM). We also include the output of each of the GLMM we described in the main text. This allows the interested reader to regenerate our main results and also, by providing the data, allows the reader to perform additional statistical tests.
**DOI:** [http://dx.doi.org/10.7554/eLife.05457.024](10.7554/eLife.05457.024)
10.7554/eLife.05457.025
Decision letter
Carandini
Matteo
Reviewing editor
University College London
,
United Kingdom
eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see [review process](http://elifesciences.org/review-process)). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.
Thank you for sending your work entitled "Distinct effects of prefrontal and parietal cortex inactivations on an accumulation of evidence task in the rat" for consideration at *eLife*. Your article has been favorably evaluated by Eve Marder (Senior editor) and 4 reviewers, one of whom, Matteo Carandini, is a member of our Board of Reviewing Editors.
The Reviewing editor and the other reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission.
This is a timely report on a topic of great interest, with impressive behavioral data and analysis. It stands to make a significant contribution to the decision-making literature. The manuscript investigates the causal contributions of rat prefrontal cortex (PFC) and posterior parietal cortex (PPC) in accumulation-based decision making. It provides a strong synthesis of many kinds of inactivations (bilateral vs unilateral, PFC vs PPC, and some combinations) with a detailed computational model of the decision making process. Despite some important caveats (described below) with the inactivation experiments and with their modeling, the experiments make up a very useful data set. Moreover, the follow-up manipulations to test predictions from the results of the analyses (single-sided trials, free choice trials) demonstrate the success of the method and the depth of understanding of the role of these structures.
This approach maximizes what one can learn from the rodent relative to the primate -- flexible and creative application of causal techniques, coupled with detailed modeling of the behavior that allows them to transcend some concerns about rodent psychophysics, for example, the high lapse rates. In many regards, this work leads the primate research and will be an important reference point as corresponding investigations of primate PPC and PFC catch up.
The main finding is quite compelling: large effects of PFC inactivation on decision-making, little or no effect of PPC inactivation. These results are not entirely surprising given what we know about the roles of FOF from the Brody lab and others ([@bib24]; Guo et al., 2013; Hanks et al), and given the results seen in PPC with binary decision tasks (Guo et al., 2013). However, the nuances and follow-ups raise the rigor of the work and unpack the mechanism in a satisfying way.
Specifically, the modeling suggests that inactivation of the Frontal Orienting Field (FOF) largely changes the integration time constant, which is a central aspect of the accumulation mechanism -- and which is a strong contrast from less-central effects, such as, say, the lapse rate.
The apparent lack of effect in PPC during the evidence accumulation task is intriguing, since PPC has been at the center of research on evidence accumulation in primates. The suggestion that it may not be necessary for performing evidence accumulation is important. However, given the prominence of this finding, one would need to see a bit more characterization of PPC infusions before being confident of these claims. Moreover, as discussed below, these findings need to be better described in the context of the literature, as PPC inactivation does have major effects during different kind of perceptual decisions: those based on vision ([@bib63a]).
1\) Use of muscimol
The manuscript should explain the advantages of using muscimol inactivation over the better-characterized optogenetic approach used in the same lab (Hanks et al.). Muscimol infusion has much poorer spatial and temporal resolution, and given the depth of these injections (1.5 mm below the cortical surface), one worries that muscimol could be affecting basal ganglia in the FOF infusions (e.g., the single example provided in [Figure 3--figure supplements 3-1](#fig3s1 fig3s2 fig3s3){ref-type="fig"} seems to show some subcortical spread). These limitations should be discussed.
2\) Incomplete PPC inactivations?
The paper discusses the lack of consensus regarding the stereotaxic location of PPC, and addresses this by infusing multiple locations in different groups of animals. This is unconvincing, especially given the importance of the negative results in PPC to the main points of the paper. It would be useful to see more anatomical characterization to show that what is being called PPC has the appropriate input characteristics. This could be done fairly easily in a few naïve animals using retrograde tracers showing that their identified region receives inputs from multiple sensory regions, lateral posterior thalamus, prefrontal cortex, and contralateral PPC.
Indeed, a major concern is that PPC inactivations may be only partial, given the large medial-lateral extent of rat PPC (as the paper notes, ∼4mm), the muscimol infusions are likely only partially inactivating PPC, and the lack of effect could be due to compensation by the spared neurons. It is nice that there is a positive control in the \'free choice\' experiments, but it is not clear that one can rule out a more subtle influence of PPC in the evidence accumulation task. The experiment one would really like to see is a characterization of the extent of PPC using anatomical tracers, followed by inactivation of the entire region. This would require significantly more work, and may be beyond the scope of a reasonable revision of this paper, but at the very least the paper should address this issue in the Discussion and reduce the strength of the claims accordingly.
3\) Relationship with visual study
In its current version, the paper states that PPC plays no role in perceptual decisions. A revision should clarify that this applies to "auditory" perceptual decisions. The recent paper by [@bib63a] shows similar lack of effects on an auditory task, but profound effects in a visual task. The manuscript relates to this study in one paragraph (eighth paragraph of Discussion) to suggest that PPC may be mostly visual rather than auditory, but seems to prefer the rather harsh interpretation that other investigators had results in visual tasks due to experimental error. It is dangerous to criticize others for possible technical errors (muscimol spreading unintentionally far) when one\'s paper may suffer from the same limitations. It would be interesting to see a more balanced discussion of those results, perhaps starting in the Introduction. For instance, there may be some tension about whether those results point to an evidence accumulation deficit for visual information, or just a visual deficit. More generally, this paper should make sure not to overreach in its conclusions about the role of PPC in all sorts of perceptual decisions, and limit itself to auditory ones.
4\) Fitting unilateral FOF infusion data
When fitting the unilateral FOF infusion data, the current approach seems to be to allow only the bias parameters to vary, while constraining the remaining parameters to the values obtained when fitting control data. However, bilateral FOF inactivation had a large effect on several of those fixed parameters (accumulation time constant, sensory noise, etc.). These parameters (particularly accumulation time constant) could reasonably be expected to change during unilateral FOF inactivation. Thus, assuming incorrect "control" values for these parameters could lead to incorrect fitting of the bias parameters.
It seems that any parameters likely to be affected by unilateral FOF inactivation (e.g., those strongly affected by bilateral inactivation) should be free to vary. This could be done through nested model fits, and given that the model fits are based on likelihoods, statistical nested-model comparison could be performed (e.g., likelihood ratio test) in addition to direct visualization of the likelihood surfaces.
An additional suggestion is to repeat the analysis (testing four versions of bias parameters) but do it multiple times, each time leaving eight of the nine original parameters fixed and one unconstrained. If indeed each of these nine tests shows that the unconstrained original parameter took the same value as in the control data, then the method of fixing the nine would be more justified.
Finally, when comparing four alternative explanations for unilateral FOF results, is there any way to be sure that a local maximum has not been found in the parameter space? For instance, perhaps given one solution for the original 9 model parameters, the Post-Cat-Bias manipulation accounts for unilateral FOF inactivations best, but given another solution the Input Gain would fit best. In the original paper about the model the authors stated that the model is not proven concave, so in a case like this it seems like one must worry that a local maximum may have been found (or, even if a global maximum was found, one may consider that another peak of comparable likelihood exists).
5\) Distinguishing effects on lapse rate and accumulation time
Another concern regards the possibility of bolstering the model-based inferences from the behavioral data. The ability to distinguish between effects on lapse rate and accumulation time constant is critical to this paper. There are two related components one would like to see strengthened. First, [Figure 4](#fig4){ref-type="fig"} would be bolstered by an elaboration of the analysis shown in panel D. The reverse-correlation analysis compares the data and the model (the latter, relying on an effect on the time-constant of accumulation). Consideration of how the rev-co kernel would look for the alternate model (lapse rate) may provide a complementary perspective on why this model is insufficient, perhaps broadening the support beyond the likelihood-based metric.
A related concern regards likelihood-based fits. These are of course statistically principled, but in practice the metric can explode at the extremes: the most common instance is for binomial data with 0% or 100% accuracy (i.e., the extremes of a nice psychometric function). Now, these extremes may not be at play in the key analysis here, so the concern is not particularly strong, and in general the notion of showing the likelihood space as a function of parameters is powerful and richer than the usual reliance on p-values. But fleshing out whether (and if so, how), extremes were handled would be helpful.
6\) Unclear results of the side LED experiments
There seems to be a disagreement between the average data obtained in the side LED experiments ([Figure 3C](#fig3){ref-type="fig"}), and the data in individual trials ([Figure 3--figure supplement 3](#fig3s3){ref-type="fig"}). This is hard to tell, because [Figure 3--figure supplement 3](#fig3s3){ref-type="fig"} is insufficiently labelled. Specifically, are the two end points in these curves the side LED trials? This in unlabeled but seems to be true since there are eight points per plot, matching the six click differences + two side LED types from main [Figure 3](#fig3){ref-type="fig"}. If so, then one can hardly understand how the side LED trials are unaffected in the average ([Figure 3C](#fig3){ref-type="fig"}) because it\'s clear from looking at individuals ([Figure 3--figure supplement 3B](#fig3s3){ref-type="fig"}) that in almost all cases these trials are massively shifted. If the data plotted in [Figure 3--figure supplement 3](#fig3s3){ref-type="fig"} are only click trials, then plotting the side LED trials as well would be helpful, and also it would be helpful to explain why eight click-rate-differences are plotted for each individual in [Figure 3--figure supplement 3](#fig3s3){ref-type="fig"} but only six in main [Figure 3](#fig3){ref-type="fig"}. It is important to clarify this because much of the interpretation rests on the result that unilateral FOF inactivations do not influence performance on side LED trials (to rule out a motor explanation).
7\) Unsatisfactory model comparison
In the comparison of Input Gain and Post-Categorization-Bias models, a look at the data suggest the paper dismisses the input gain model too quickly. First, it seems to fit the reverse correlation plots slightly better (while fitting the psychometric functions slightly worse); [Figure 6-figure supplement 1](#fig6s1){ref-type="fig"}. Second, there is no metric for interpreting how impactful (on behavioral performance and/or fit quality) a shift of 0.4 in post-cat-bias relative to a shift of 0.3 in input gain might be (visually estimating 0.3 from [Figure 6B](#fig6){ref-type="fig"}). Similarly, the statement that post-cat-bias is "50 log-units better" than input gain sounds impressive but is difficult to interpret. Is it possible to do a cross-validation test? Using the parameters fit \[with the post-cat-bias, input gain, or both\] from 90% of the trials, predict behavior on the other 10% (or leave-one-out, or however one wishes to do this)? This would be clearer to interpret and would also allow for the comparison of the model including both parameter shifts to the models including only one. Finally, if each model is fit to each animal (or session), then it seems that [Figure 6A](#fig6){ref-type="fig"} can have error bars, which would be further helpful. Somewhat related to this: Can the post-cat-bias be understood in the same way as the bilateral effects, namely as a shortened memory? That is, even in the single-sided trials, perhaps the rat forgets his choice in the quarter second between the go cue and the start of his movement? I.e. even this massive click train still decays with tau=-0.24 s.
8\) Unclear design of the free-choice trials
On the free-choice trials, it is unclear whether muscimol was injected into a side of the brain specifically chosen to be contralateral to the bias from the previous day, or whether it was injected into a random side. If random, why is there such a strong contralateral bias in control? If chosen based on previous day\'s bias, this effect could reflect regression to the mean; indeed the muscimol points in [Figure 9B](#fig9){ref-type="fig"} appear to have somewhat close to zero mean. An appropriate control would be to make the same selection of which side is defined as ipsilateral, but then do a control ("isoflurane") injection session instead of muscimol. (The legend seems to indicate that the points labeled "Control" in [Figure 9B](#fig9){ref-type="fig"} are not control injections but rather data from the previous day relative to the muscimol points; if this was an incorrect understanding then the legend could be clarified.)
10.7554/eLife.05457.026
Author response
We believe we have sufficiently addressed all the issues brought up by the reviewers. First, we have edited the text of the manuscript to better reflect the conclusions and limitations of our results. Second, we have updated figures and captions to avoid confusion and address the potential confounds that reviewers addressed. Finally, we did extensive additional analyses to support our model-based conclusions about the role of the FOF. All of our additional analyses support our original claims, and we are grateful to the reviewers for helping us to make the paper stronger.
1\) Use of muscimol
*The manuscript should explain the advantages of using muscimol inactivation over the better-characterized optogenetic approach used in the same lab (Hanks et al.). Muscimol infusion has much poorer spatial and temporal resolution, and given the depth of these injections (1.5 mm below the cortical surface), one worries that muscimol could be affecting basal ganglia in the FOF infusions (e.g., the single example provided in* [*Figure 3--figure supplements 3-1*](#fig3s1 fig3s2 fig3s3){ref-type="fig"} *seems to show some subcortical spread). These limitations should be discussed*.
Muscimol versus halorhodopsin: Thank you for the excellent question. We should have described the rationale for our choice in the manuscript. When we began using halorhodopsin in the lab, we thought it would entirely replace our use of muscimol. However, we came to understand that instead of one technique replacing the other, the two complement each other. The reviewers' question made us further realize that other labs facing a similar choice between inactivation techniques might find our rationale to be of interest. We thus now write in the manuscript:
"Although optogenetics allows high temporal resolution inactivation, its radius of effect in our hands is only ∼750 um (Hanks, Kopec, et al. 2015). In contrast, inactivating larger regions is much more readily achieved with muscimol, for which the radius of inactivation can be increased simply by increasing the infusion dose. In addition, muscimol directly inactivates all neurons within its radius of effect, not only infected neurons. Moreover, in some tasks, including the Poisson Clicks task, we find that the behavioral effect of optogenetic silencing begins to decay after a few weeks, while the effect of muscimol is stable. This stability in particular was essential for the current study, which used within-subject manipulations over hundreds of days. Optogenetic and pharmacological silencing therefore have complementary advantages and disadvantages. Here we focused on pharmacological inactivation."
Subcortical spread of muscimol: There is little risk of muscimol spread from the FOF into the basal ganglia. We should point out that the thick white matter bundle (∼ 1 mm) separating FOF from the striatum below provides an effective barrier to the spread of muscimol in the ventral direction. We should also emphasize that [Figure 3--figure supplements 3-1](#fig3s1 fig3s2 fig3s3){ref-type="fig"}, referred to by the reviewers, is not an image of muscimol spread, but of an anatomical tracer infused into the FOF cannula of one animal. This tracer (cholera-toxin-B conjugated to a fluorophore) is mostly retrograde but also has some anterograde transport. Thus, in contrast to muscimol, which will be blocked by greasy white matter, the CTB will follow axons projecting into the white matter. What is seen in [Figure 3--figure supplements 3-1](#fig3s1 fig3s2 fig3s3){ref-type="fig"} is CTB going into the most superficial part of the white matter bundle. We apologize for making it easy to confuse CTB spread with muscimol spread, and we have now made sure to clarify and emphasize the difference in both [Figure 3--figure supplements 3-1](#fig3s1 fig3s2 fig3s3){ref-type="fig"} and its caption.
Other spread of muscimol: We wholly agree that spread of muscimol is important to discuss. We discuss spread from FOF to adjacent cortical regions in the Discussion (from second paragraph of subsection headed "Role of FOF"); we have now added a sentence to that section explaining that the white matter blocks spread ventrally into the basal ganglia. We also discussed issues of spread of muscimol from PPC in subsection headed "Role of PPC"(and see response below).
2\) Incomplete PPC inactivations?
*The paper discusses the lack of consensus regarding the stereotaxic location of PPC, and addresses this by infusing multiple locations in different groups of animals. This is unconvincing, especially given the importance of the negative results in PPC to the main points of the paper. It would be useful to see more anatomical characterization to show that what is being called PPC has the appropriate input characteristics. This could be done fairly easily in a few naïve animals using retrograde tracers showing that their identified region receives inputs from multiple sensory regions, lateral posterior thalamus, prefrontal cortex, and contralateral PPC*.
Our bregma coordinates receive input from regions that match those expected from PPC. Although we used bregma coordinates routinely described as "PPC" in the rat literature (e.g., [@bib59]; [@bib63a]), we agree that that anatomical data demonstrating that these coordinates have the connectivity one would expect from PPC would be very appropriate. A recent study from the McNaghuton lab provides these data (Wilber, A. A., Clark, B. J. et al., Cortical connectivity maps reveal anatomically distinct areas in the parietal cortex of the rat. Frontiers in Neural Circuits*,* January 2015). The authors used several tracing techniques to examine the inputs to the rat PPC, and report that the bregma coordinates we used receive input from the expected regions, including the lateral posterior thalamus, multiple sensory cortices, prefrontal cortex, contralateral PPC, and FOF (which is a subregion of M2). Interestingly, in their [Figure 6](#fig6){ref-type="fig"}, they should that only the region that we have targeted as PPC (which they consider "rostral" parietal cortex) has input from FOF. We have updated the manuscript in several places to include this important reference.
*Indeed, a major concern is that PPC inactivations may be only partial, given the large medial-lateral extent of rat PPC (as the paper notes, ∼4mm), the muscimol infusions are likely only partially inactivating PPC, and the lack of effect could be due to compensation by the spared neurons. It is nice that there is a positive control in the \'free choice\' experiments, but it is not clear that one can rule out a more subtle influence of PPC in the evidence accumulation task*.
Even our largest inactivations may be only partial. Based on our largest doses and the existing literature that has examined the spread of muscimol in rat cortex (Krupa, 1999) we believe that our largest doses should cover the entire PPC. But as the reviewers point out, it nevertheless remains possible that there might be some spared neurons in the PPC that compensate for the inactivated neurons. However, even if this were true, we would expect a dose-response relationship for unilateral muscimol PPC and bias magnitude. No such relationship is seen for accumulation trials (square yellow data points, [Figure 8](#fig8){ref-type="fig"}). Furthermore, the accumulation task contains trials that are at psychophysical threshold (i.e. 50% performance). If unilateral PPC inactivations had a behavioral effect, we would have expected it to be revealed on those trials. On balance, then, we feel the evidence leans towards a lack of effect from unilateral PPC inactivations alone. But we acknowledge in the Discussion that we cannot completely rule out the possibility that unilateral inactivations could produce an effect. Note that lack of an effect after unilateral PPC inactivations alone is different, as we discuss in the next paragraph, from a subtle role for PPC in the accumulation task.
We agree, and the data indeed show, that PPC has a subtle but real effect on the accumulation task. The reviewers suggest that we acknowledge that there may be a subtle influence of the PPC in the accumulation task. We very much agree, and that is what we would have liked to portray. In the abstract, we use the term "minimal" for the role of PPC, which seems close in spirit to "subtle". Nevertheless, we fear that our original writing may have been too strong, and may have instead conveyed a "no PPC effect whatsoever" message. If so, that was our mistake, and we thank the reviewers for pushing us into making sure to correct it.
The evidence, included in the original submission, for a subtle but significant effect of PPC inactivations on the accumulation task comes from two findings: (1) there was a weak, but statistically significant effect of 150ng of muscimol bilaterally infused into PPC ([Figure 7B](#fig7){ref-type="fig"}). (2) unilateral inactivation of 300ng of muscimol into the PPC during simultaneous bilateral inactivation of the FOF produced a small, but clear and measurable bias ([Figure 9E](#fig9){ref-type="fig"}). We note that both of these effects were produced at doses of muscimol substantially lower than the higher 600ng and 2500ng doses used in the unilateral PPC experiments. This suggests to us that the lack of effects that we saw in the unilateral PPC experiments were not due to spared neurons. Nonetheless, we have softened our language in the Discussion ( paragraph three of subsection headed "Role of PPC").
*The experiment one would really like to see is a characterization of the extent of PPC using anatomical tracers, followed by inactivation of the entire region. This would require significantly more work, and may be beyond the scope of a reasonable revision of this paper, but at the very least the paper should address this issue in the Discussion and reduce the strength of the claims accordingly*.
We agree that that would indeed require far more work than would fit within a revision, and we thank the reviewers for the opportunity to address the issue in the Discussion and reduce the strength of the claims appropriately. See subsection headed "Role of PPC".
3\) Relationship with visual study
*In its current version, the paper states that PPC plays no role in perceptual decisions. A revision should clarify that this applies to "auditory" perceptual decisions. The recent paper by* [@bib63a] *shows similar lack of effects on an auditory task, but profound effects in a visual task. The manuscript relates to this study in one paragraph (eighth paragraph of Discussion) to suggest that PPC may be mostly visual rather than auditory, but seems to prefer the rather harsh interpretation that other investigators had results in visual tasks due to experimental error. It is dangerous to criticize others for possible technical errors (muscimol spreading unintentionally far) when one\'s paper may suffer from the same limitations. It would be interesting to see a more balanced discussion of those results, perhaps starting in the Introduction. For instance, there may be some tension about whether those results point to an evidence accumulation deficit for visual information, or just a visual deficit. More generally, this paper should make sure not to overreach in its conclusions about the role of PPC in all sorts of perceptual decisions, and limit itself to auditory ones*.
We agree that the bulk of our data, from an auditory accumulation of evidence task, provides evidence only about accumulation of auditory evidence, and that we should correct our writing wherever it gives a misleading impression. Consequently, throughout the manuscript, beginning with and including the abstract, we have endeavored to replace statements about "evidence accumulation" with statements about "auditory evidence accumulation". We hope this will clarify the issue, and thank the reviewers for pointing out the problem.
We also fully agree that issues of muscimol spillover could apply to our own study. In our original submission we tried to discuss these issues directly, and specifically with respect to our own data and conclusions. We have kept all those sections in this resubmission. If the reviewers think that those sections are insufficient, and that a more in-depth discussion of how the issue affects our own data is necessary, we would be happy to expand those sections.
With respect to the Raposo et al. visual+auditory study, our concerns regarding spillover are a reflection of concerns that we have with data from our own lab: we have recently begun using a visual variant of the Poisson Clicks task (Scott et al., SFN 2014, Constantinople et al., SFN 2014), and following Raposo et al., we find, as they did, that infusing muscimol into "standard" PPC coordinates impairs rats performing the visual task even while it leaves rats performing the auditory task intact (Scott et al., unpublished preliminary data). Nevertheless, the literature regarding the location of PPC seems to us unclear with respect to the PPC/visual cortex border. This has made us very reluctant to firmly conclude that our inactivation at PPC coordinates avoids inactivation of visual cortex, and our concerns with our own data seem to us to also apply to the data in Raposo et al.
Raposo et al. cited a single study (Reep at al. 1994) to define the posterior border of PPC at -5.0 mm from Bregma. This definition was critical to their conclusion that their inactivations, which were centered at -- 3.8mm from Bregma, had not gone past -5.0, and had thus not invaded visual cortex. However, based on and specifically citing the very same data (originally reported in Chandler, King, Corwin, and Reep 1992) that led [@bib69] to define PPC as extending to -5.0mm from Bregma, Corwin and Reep, the very same authors, four years later defined PPC as extending only to -4.4mm from Bregma ([@bib18], page 90). In other words, there is substantial uncertainty in the location of the border even within a single data set from a single set of authors. Using a -4.4mm definition, the Raposo et al. inactivations would have extended well into visual cortex. Our point is not that the Raposo et al. inactivations necessarily extended into visual cortex. Our point is that our reading of the current state of the literature, suggests that it is very difficult to rule out the possibility that they did.
Another, less direct, example of the lack of consensus or precision in the literature regarding the PPC/visual cortex border is that the standard rat atlas (Paxinos and Watson, 6th edition), places the PPC/V2 border even *more* anterior, at ∼-4.14mm from Bregma, making the problem even more acute.
This problem is much less of a concern for the auditory tasks, since we do not expect visual cortex to play a major role in those.
We also believe that it is interesting to maintain a comparison and a dialogue with results from similar primate research. That motivates us to consider possible interpretations that reconcile results across species, which is what the spillover hypothesis would achieve. All this said, we certainly do not intend to be "harsh" with respect to the Raposo et al. study (to quote the word used by the reviewers). We are strong supporters of that lab's line of work, and we thank the reviewers for pointing out that our writing came across as harsh, thus giving us the opportunity to correct that. We have now tried, in that discussion section, to both clarify our thinking about the uncertainty in the location of the border, and to soften our language, clearly labeling the spillover possibility as intellectually appealing because it reconciles results across species, but nevertheless undoubtedly speculative. That section now reads
"[@bib63a] reported an impairment after rat PPC inactivations in a visual, but not in an auditory, version of a closely related task. This contrasts with a preliminary report from Yates et al. that suggested no effect from primate PPC inactivation in a visual accumulation of evidence task ([@bib90]), as well as with multiple reports of no effect from primate PPC inactivation in visual memory-guided saccade tasks ([@bib14]; [@bib85]; [@bib50]; [@bib89]). \[...\] While such a reconciliation of results across multiple species could have some intellectual appeal, we emphasize that experiments that would either clearly support or rule out this possibility remain to be done."
We hope this sounds much less harsh, while still laying out all the issues for discussion. We also hope that highlighting the uncertainty in the PPC/visual cortex border may help motivate further studies to pin down its location, which could have significant impact on future studies that attempt to target PPC specifically.
4\) Fitting unilateral FOF infusion data
*When fitting the unilateral FOF infusion data, the current approach seems to be to allow only the bias parameters to vary, while constraining the remaining parameters to the values obtained when fitting control data. However, bilateral FOF inactivation had a large effect on several of those fixed parameters (accumulation time constant, sensory noise, etc.). These parameters (particularly accumulation time constant) could reasonably be expected to change during unilateral FOF inactivation. Thus, assuming incorrect "control" values for these parameters could lead to incorrect fitting of the bias parameters*.
Motivated to address the reviewers concerns we used the Metropolis-Hastings algorithm to sample from an 8-parameter model that included the 4 bias parameters, as well as 4-parameters of interest from the original model (accumulation time constant, accumulator noise, sensory noise and lapse). This technique is computationally expensive and not guaranteed to find the global optimum. Nonetheless, allowing all 8 parameters to vary simultaneously, the post-categorization parameter still had the biggest change, small changes in other parameters that gave a higher likelihood than the 1-parameter post-categorization model. However, the improvement was small and using bayesian information criteria we conclude that the 1-parameter model is better. Please see the section on modeling the unilateral FOF data for more details.
Finally, when comparing four alternative explanations for unilateral FOF results, is there any way to be sure that a local maximum has not been found in the parameter space?
We had the same concern as the reviewer and had previously examined the shape of the likelihood distribution for each of the 1-parameter models. As it turns out, there is a single maximum for each of the 1-parameter models. We now include those plots in [Figure 6--figure supplement 1](#fig6s1){ref-type="fig"}.
5\) Distinguishing effects on lapse rate and accumulation time
*Another concern regards the possibility of bolstering the model-based inferences from the behavioral data. The ability to distinguish between effects on lapse rate and accumulation time constant is critical to this paper. There are two related components one would like to see strengthened. First,* [*Figure 4*](#fig4){ref-type="fig"} *would be bolstered by an elaboration of the analysis shown in panel D. The reverse-correlation analysis compares the data and the model (the latter, relying on an effect on the time-constant of accumulation). Consideration of how the rev-co kernel would look for the alternate model (lapse rate) may provide a complementary perspective on why this model is insufficient, perhaps broadening the support beyond the likelihood-based metric*.
The lapse model is used as an example of how the psychometric curve is a narrow lens which which to examine deficits, compared to the full model. We could also have used increases in accumulator noise, sensory noise, or initial noise to generate a similar psychometric curve. As such, and motivated by the concerns of the reviewer regarding the reliability of the bilateral FOF fits, we have added several extra model comparison analyses to the paper. We have estimated the confidence intervals of the parameters by resampling the bilateral FOF trials and fitting the model to this resampled data. Given our current computational resources we have managed to fit the model to 300 resamples. This analysis supported our existing conclusion - the time-constant of accumulation became significantly leaky after bilateral FOF inactivation. Please see the Results section on bilateral FOF modeling for more details (subsection headed "Bilateral FOF inactivations reduce the subject's accumulation time constant") and the results of the resampling ([Figure 4--source data 1](#SD1-data){ref-type="supplementary-material"}).
*A related concern regards likelihood-based fits. These are of course statistically principled, but in practice the metric can explode at the extremes: the most common instance is for binomial data with 0% or 100% accuracy (i.e., the extremes of a nice psychometric function). Now, these extremes may not be at play in the key analysis here, so the concern is not particularly strong, and in general the notion of showing the likelihood space as a function of parameters is powerful and richer than the usual reliance on p-values. But fleshing out whether (and if so, how), extremes were handled would be helpful*.
Indeed, we encountered this very issue of fitting extremes when developing what later became the [@bib7] model, which we use heavily in the current manuscript. As the reviewer points out, if the model predicts that a particular choice in one trial will occur with near 100% certainty, and the rat makes the opposite choice, that the single trial will have an infinite negative log likelihood. That single trial could thus, on its own, completely skew the results. To address this issue, the model includes a "lapse" parameter, a fraction of trials in which the animal appears to ignore the stimuli and performs randomly. At the very easiest trials, rat behavior in our task seems to asymptote at 90% correct, so the lapse parameter typically has values of ∼ 0.1. This puts a bound on how low the likelihood of a trial can be. For example, with a lapse parameter of 0.1, the log likelihood will never be less than log(0.1), and thus no single trial can dominate the results.
We now write, in the "Analysis and Statistics" section of the Methods,
Even at the very easiest trials, rat behavior in our task often asymptotes at ∼90% correct. To fit this, the model includes a "lapse" parameter, which represents a fraction of trials in which subjects will ignore the stimulus and choose randomly. The presence of the lapse parameter also puts a lower bound on the likelihood of any individual trial, and thus no individual trial can dominate the results and the consequent fits of the model.
6\) Unclear results of the side LED experiments
*There seems to be a disagreement between the average data obtained in the side LED experiments (*[*Figure 3C*](#fig3){ref-type="fig"}*), and the data in individual trials (*[*Figure 3--figure supplement 3*](#fig3s3){ref-type="fig"}*). This is hard to tell, because* [*Figure 3--figure supplement 3*](#fig3s3){ref-type="fig"} *is insufficiently labelled. Specifically, are the two end points in these curves the side LED trials? This in unlabeled but seems to be true since there are eight points per plot, matching the six click differences + two side LED types from main* [*Figure 3*](#fig3){ref-type="fig"}*. If so, then one can hardly understand how the side LED trials are unaffected in the average (*[*Figure 3C*](#fig3){ref-type="fig"}*) because it\'s clear from looking at individuals (*[*Figure 3--figure supplement 3B*](#fig3s3){ref-type="fig"}*) that in almost all cases these trials are massively shifted. If the data plotted in* [*Figure 3--figure supplement 3*](#fig3s3){ref-type="fig"} *are only click trials, then plotting the side LED trials as well would be helpful, and also it would be helpful to explain why eight click-rate-differences are plotted for each individual in* [*Figure 3--figure supplement 3*](#fig3s3){ref-type="fig"} *but only six in main* [*Figure 3*](#fig3){ref-type="fig"}*. It is important to clarify this because much of the interpretation rests on the result that unilateral FOF inactivations do not influence performance on side LED trials (to rule out a motor explanation)*.
We apologize to the reviewer for the confusion. There are no side LED trials in [Fig 3-figure supplement 3](#fig3s3){ref-type="fig"} (or any of the supplements showing the GLMM fits). We have edited the figure caption to make this more clear. These supplemental figures serve two purposes. 1) They show the reliability of the muscimol inactivation across rats on the Clicks task. 2) They show the logistic GLMM fits. Because those plots show data and also the logistic "fit" which visualized the GLMM we think having the side LED trials there would be confusing. The choice of eight vs. six points is not important since those points are for visualization and all statistics were done on unbinned data.
7\) Unsatisfactory model comparison
*In the comparison of Input Gain and Post-Categorization-Bias models, a look at the data suggest the paper dismisses the input gain model too quickly. First, it seems to fit the reverse correlation plots slightly better (while fitting the psychometric functions slightly worse);* [*Figure 6-figure supplement 1*](#fig6s1){ref-type="fig"}*. Second, there is no metric for interpreting how impactful (on behavioral performance and/or fit quality) a shift of 0.4 in post-cat-bias relative to a shift of 0.3 in input gain might be (visually estimating 0.3 from* [*Figure 6B*](#fig6){ref-type="fig"}*). Similarly, the statement that post-cat-bias is "50 log-units better" than input gain sounds impressive but is difficult to interpret. Is it possible to do a cross-validation test? Using the parameters fit \[with the post-cat-bias, input gain, or both\] from 90% of the trials, predict behavior on the other 10% (or leave-one-out, or however one wishes to do this)? This would be clearer to interpret and would also allow for the comparison of the model including both parameter shifts to the models including only one. Finally, if each model is fit to each animal (or session), then it seems that* [*Figure 6A*](#fig6){ref-type="fig"} *can have error bars, which would be further helpful. Somewhat related to this: Can the post-cat-bias be understood in the same way as the bilateral effects, namely as a shortened memory? That is, even in the single-sided trials, perhaps the rat forgets his choice in the quarter second between the go cue and the start of his movement? I.e. even this massive click train still decays with tau=-0.24 s*.
We performed cross-validation, leaving out individual sessions. We described this in the caption of a figure, which we realize was easy to miss. We have moved the description of the cross-validation to the main text. In addition, in response to this comment and also major comment \#4 we have performed new analyses using the Metropolis-Hastings sampler to further examine the unilateral FOF model fits. Although there was a shift toward negative taus, this was not significant. This new analysis is described starting in the fifth paragraph of the subsection headed "Unilateral FOF inactivations produce a post-categorization bias".
8\) Unclear design of the free-choice trials
*On the free-choice trials, it is unclear whether muscimol was injected into a side of the brain specifically chosen to be contralateral to the bias from the previous day, or whether it was injected into a random side. If random, why is there such a strong contralateral bias in control? If chosen based on previous day\'s bias, this effect could reflect regression to the mean; indeed the muscimol points in* [*Figure 9B*](#fig9){ref-type="fig"} *appear to have somewhat close to zero mean. An appropriate control would be to make the same selection of which side is defined as ipsilateral, but then do a control ("isoflurane") injection session instead of muscimol. (The legend seems to indicate that the points labeled "Control" in* [*Figure 9B*](#fig9){ref-type="fig"} *are not control injections but rather data from the previous day relative to the muscimol points; if this was an incorrect understanding then the legend could be clarified*.*)*
We apologize to the reviewers for the confusion. Infusions were done on both sides, but a session where all the infusions were done to "push" the subjects away from their biases was shown as an extreme example. Since the innate biases are quite large, it is hard to push subjects much in the direction of their existing biases. However, the population panels are based on infusions on both sides and the results are consistent. In order to show this more clearly we have added the day after the infusion to the example session. The infusion day is significantly different from both the day before and the day after. If the finding were simply regressing toward the mean, the bias on the following day would not be expected to return to the control levels of bias.
[^1]: This table shows the values of the parameters which maximize the likelihood of the full 9-parameter accumulator model for each rat, as well as for the 'meta-rat' (made from taking all of the control days that were 1 day before an infusion, n = 47,580 trials), the fit to the bilateral FOF data (n = 1809), and the fit to the bilateral PPC data (n = 1569).
[^2]: indicate parameters that were significantly different from the control 'Meta-Rat'.
[^3]: This table shows the three models fit to the bilateral FOF data (n = 1809 trials).
[^4]: indicates the model with the lowest (the most likely) Bayesian information criterion (BIC).
[^5]: indicates the model with the lowest (most informative) Akaike information criterion (AIC).
[^6]: In this case, the AIC and BIC select different models, suggesting a better model may be somewhere in between. That is, a model that includes the accumulator time-constant and perhaps a few additional parameters from the full model.
[^7]: This table shows the three models fit to the unilateral FOF data (n = 3836 trials).
[^8]: indicates the model with the lowest Bayesian information criteria (BIC), that is, the most likely model.
[^9]: indicates the model with the lowest Akaike information criteria (AIC), that is, the most informative model.
[^10]: The 1-parameter post-categorization model has the lowest AIC and BIC, supporting the view that the major effect of unilateral FOF inactivation is not related to the accumulation process per se.
|
The latest Obama-Xi announcement sends a strong message: the two nations are acting fast to enable a global low carbon transition. Friday’s joint announcement is an unprecedented step by the world’s #1 and #2 emitters to commit, at the highest levels, to a strong set of domestic policies and to reinforce global mechanisms that will help to engage peers ahead of the upcoming landmark climate change negotiations in Paris.
Pricing Carbon
Xi has committed China to launching a national emissions trading system for CO2 in 2017. An emissions trading system will directly constrain a large share of China’s CO2 emissions and, by putting a price on emissions, encourage reductions where they cost least. This is impressive in that China is pledging to reduce emissions at a time when its per-capita income is less than one-fifth of the U.S. and its economy faces headwinds. It recognizes the long-term benefits of action now—for local air quality, global climate, and its own long-term leadership in delivering innovative solutions that all nations will eventually need. While China is not the first to establish an emissions trading system, China’s is likely to be the largest when it comes online in 2017. While the European Union has built an emissions trading system over the past two decades, the U.S. has so far not been successful in adopting a national system for greenhouse gases. In 2009 the Waxman-Markey Bill, which would have established an emissions trading system in the U.S., failed to pass Congress, leaving the U.S. to rely on a piecemeal approach that largely repurposed existing regulations, such as vehicle fuel economy standards and power plant emissions limits established under the Clean Air Act, to mandate CO2 emissions reduction. Indeed, these measures formed the cornerstone of the U.S. domestic action pledged on Friday, and they will have impact. However, an emissions trading system that could deliver the same reductions at lower aggregate cost has so far proven politically unpalatable. China’s latest move could prompt a rethink on emissions trading in the U.S.
Valerie J. Karplus is the Class of 1943 Career Development Professor and an Assistant Professor of Global Economics and Management at the MIT Sloan School of Management and Director of the Tsinghua-MIT China Energy and Climate Project (CECP) in the MIT Joint Program on the Science and Policy of Global Change. |
Goodlettsville’s Humane Animal Trapping Services
Free Qualified Removal for Raccoons, Opossums & Bats in the Attic!
24/7 Emergency Service Call 615-510-4400
Customer Service 1-888-444-0513
Raccoon Removal in Goodlettsville TN
humane Raccoon trapping and relocation in Goodlettsville
We humanely trap and relocate raccoons in the Goodlettsville area. Raccoons cause a tremendous amount of damage and can spread diseases. Complete Animal Removal in Goodlettsville will provide raccoon removal under the house in Goodlettsville, get raccoons out of the attic in Goodlettsville, trap raccoons getting in the trash in Goodlettsville, remove a dead raccoon out of the wall in Goodlettsville, remove baby raccoons from the ceiling in Goodlettsville, get rid of raccoons from the basement in Goodlettsville, trap raccoons off of the roof in Goodlettsville, raccoon removal from the garage in Goodlettsville, get raccoons out of the shed in Goodlettsville, trap raccoons digging in the yard or remove a raccoon nest from the attic in Goodlettsville. We specialize in raccoon removal in Goodlettsville TN and surrounding areas.
Once the raccoons have been removed from the attic or crawl space in Goodlettsville, then Complete Animal Removal will clean up the raccoon feces and treat for the raccoon diseases.
Noises in the attic? It could be raccoons. We humanely remove raccoons from the attic in Goodlettsville TN
In Goodlettsville rats get in the attic and leave their feces and urine on the insulation and drywall.
Goodlettsville Rat Control
rodent control experts for Goodlettsville
Rats in in Goodlettsville, TN are very destructive rodents and need to be trapped and removed as soon as possible. When a rat gets into the attic in Goodlettsville, the rat will chew through electrical wires, leave feces and urine in the insulation, get in the A/C duct work and damage the drywall. Part of Complete Animal Removal’s rat control program in Goodlettsville is inspecting for rat damage and providing solutions to restore your attic to its original state.
In Goodlettsville Tennessee we provide home exclusions for rats, using only concrete and metal based products. Complete Animal Removal will never use foam for rats. Rats in Goodlettsville can chew through foam within days and is not a permanent solution. Our professional rat exclusion techniques in Goodlettsville makes our work look like part of your home.
Goodlettsville Bat Removal
Humane Bat Removal & bat exclusions in Goodlettsville
Bats in Goodlettsville are protected and play a beneficial role in our ecosystem. One bat in Goodlettsville can consume its bodyweight in mosquitos in a single night. However Goodlettsville bats also carry diseases that can be transmitted to humans and pets. When bats get in the attic of a Goodlettsville home or business the bats become a major health hazard. Because of how important bats are for the environment and the health risk the bats pose in Goodlettsville, bats need to be removed humanely.
We close off all entry points for bats in Goodlettsville and use a one-way door system to allow the bats to leave and never come back. Once we get rid of the bats in the attic of a Goodlettsville home, we will clean up the bat feces and disinfect for bat diseases. We proudly provide bat removal in Goodlettsville and surrounding Goodlettsville areas.
When bats get into a Goodlettsville attic they leave their feces behind. This bat guano is a hazard to one’s health.
How to get rid of opossums from the attic in Goodlettsville? Call Complete Animal Removal 24/7
Humane Opossum Trapping in Goodlettsville
Opossums in the attic in Goodlettsville?
Opossums are the only North American marsupial and the mother opossum carries her baby opossums in a pouch. Opossums are the #1 carrier of the cat flea which means if you have opossums, then you have fleas. The opossums need to be removed from the property to get rid of the fleas.
Opossums are notorious for getting in the attic of homes and business. Opossums also get into basements, under sheds, and under the home. Complete Animal Removal will remove and get rid of the opossums using humane techniques and live relocation. Our expert opossum trappers will trap opossums out of the attic, remove opossums from under the house, get opossums off of the roof, remove opossums from the wall, get a dead opossum from the yard, humanely remove opossums in the ceiling and provide opossum control in Goodlettsville, Franklin, Brentwood, Murfreesboro and surrounding areas.
Goodlettsville Bird Control
Pigeon, starling and sparrow removal in Goodlettsville tn
Most birds in Goodlettsville are protected by the Migrator Bird Act and for those birds we cannot provide our services. However, in Goodlettsville there are 3 nuisance birds we can remove; pigeons, starlings and sparrows.
Pigeons, starlings and sparrows roost on roofs, ledges, building signs, lawn furniture, gutters and many other man-made structures in Goodlettsville TN. These birds get in attics in Goodlettsville and build their bird nest. Once the birds are in the attic they leave behind guano, or bird feces, which is a major health hazard in Goodlettsville Tennessee. When they roost on the home or business the droppings from the birds can cause staining and grow a fungus that transmits a respiratory disease. Complete Animal Removal will get rid of pigeons, starlings and sparrows by implementing our bird control program in Goodlettsville TN. We install a variety of bird prevention products to make sure the Goodlettsville birds do not return.
The Cottonmouth or Water Moccasin must be trapped or removed from your yard to prevent humans and pets from getting hurt in Goodlettsville.
Goodlettsville Snake Removal
Removing snakes by live capture and trapping in Goodlettsville
In Goodlettsville Tennessee, Complete Animal Removal removes both venomous snakes and non-venomous snakes. We have the fastest response times in the industry in Goodlettsville. Even though we are fast, if the snake has disappeared by the we get to your Goodlettsville home we can set up traps to get the snakes. Snake trapping in Goodlettsville is very effective to reduce the snake population in your yard. Our snake control in Goodlettsville involves a thorough inspection of the property, looking for eggs, babies and adults. When we find the snake nest we will remove the snake nest and any snake babies with it. If the snake gets in your Goodlettsville house we will find the snake and get the snake out of the house.
Snakes in Goodlettsville are difficult to identify by comparing pictures. There are many snakes that mimic other snakes, so leave snake identification up to a professional Goodlettsville snake trapper. Complete Animal Removal’s snake trapper in Goodlettsville TN will inspect the property for snakes, catch the snakes and remove the snake nests in Goodlettsville and any of the surrounding Goodlettsville Tennessee areas.
GOODLETTSVILLE Humane Squirrel Removal
Squirrel removal and live relocation for Goodlettsville
Just like rats and mice, squirrels are mammals of the order Rodentia. In Goodlettsville these rodents all have teeth that continuously grow unless filed down. This is why if you have squirrels, rats or mice in your attic in Goodlettsville, you hear scratching noises. Scratching noises in the attic in Goodlettsville is usually from rodents gnawing on the wood or drywall in the attic. When squirrels nest in the attic in Goodlettsville the squirrels need to be removed to prevent further damage. Goodlettsville squirrel removal is necessary when squirrels get in the attic or in the wall. Complete Animal Removal will humanely trap the squirrels from the attic in Goodlettsville and relocate them to one of our properties.
Because of the squirrels need to file their teeth, they also do damage to the outside of the Goodlettsville home or business. In Goodlettsville squirrels chew on the fascia board, siding, soffit, shingles and roof decking. We have also had customers in Goodlettsville get squirrels in their vehicle engine compartment and chew wires. We provide squirrel control in Goodlettsville and the surrounding areas of Goodlettsville, TN.
Chipmunk CONTROL in GOODLETTSVILLE
We get rid of chipmunks in Goodlettsville Tennessee
Chipmunks in Goodlettsville prefer to dig and burrow in the ground. This nuisance rodent can destroy lawns and cause structural damage to foundations, patios, driveways, stairs, and sidewalks in Goodlettsville TN. When chipmunks in Goodlettsville burrow near the foundation, they often find themselves in your basement. When chipmunks get in the basement Complete Animal Removal of Goodlettsville TN will trap the chipmunks to prevent any damage to the basement. We will also trap chipmunks out of your Goodlettsville yard to prevent any structural damage.
Chipmunks can also become a nuisance in Goodlettsville by eating the flower bulbs and select items of your garden. When chipmunks destroy your flower bed or garden, Complete Animal Removal of Goodlettsville will get rid of the chipmunks fast.
lizard removal for GOODLETTSVILLE
lizard trapping and population control for Goodlettsville
Lizard control may be necessary in Goodlettsville TN when lizards get into the house, building or attic. Most lizards in Goodlettsville only become a nuisance when they defecate, or leave feces, on windows or inside the house. Lizard poop can be mistaken for rat feces. In Goodlettsville, Lizard feces has a white tip on them and rat feces does not.
Whether you are worried about sanitization or just have a fear of lizards, Complete Animal Removal will trap the lizards for you in Goodlettsville and the surrounding Goodlettsville areas.
Goodlettsville Skunk Removal
humane skunk trapping and control in Goodlettsville
We all know skunks in Goodlettsville can spray a liquid with a strong and unbearable odor. In addition to that defense mechanism, skunks in Goodlettsville carry rabies and can transmit diseases through their skunk feces and urine.
When skunks get in the attic or under the house in Goodlettsville they need to be removed immediately. Skunk damage in Goodlettsville is very severe and must be repaired by a professional skunk removal expert. Diseases from skunks in Goodlettsville can spread to humans and pets. In Goodlettsville, a thorough treatment will be necessary to prevent transmission of any diseases. We will trap skunks in Goodlettsville and all surrounding Goodlettsville Tennessee areas.
armadillo removal in Goodlettsville TN
Humane Armadillo trapping experts in Goodlettsville
Armadillos digging in the yard can destroy a lawn in Goodlettsville in a matter of weeks. In search of food, armadillos dig for grubs and earthworms. in Goodlettsville, armadillos have burrows that lead to an armadillo den. These armadillo dens can be 10ft x 15ft and are the cause of many sinkholes in Goodlettsville. Armadillos cause A/C units to cave in, sidewalks and driveways to cave in and cracks in the foundation of a Goodlettsville home or business.
Armadillos in Goodlettsville are also very common road kill. If the armadillo is in the street then your local animal control will pick up the dead armadillo. If the armadillo dies on your Goodlettsville area property then Complete Animal Removal will perform a dead animal removal for the dead armadillo.
Rodents like mice and rats get in the attic and cause tremendous rodent damage in Goodlettsville.
Goodlettsville Mice CONTROL
mouse trapping and removal in Goodlettsville Tennessee
In Goodlettsville, a full grown mouse looks similar to a juvenile roof rat. Mice will crawl up a wall and get in the attic of a Goodlettsville home or business. In Goodlettsville, not only do mice get in attics but they also infest inside the house or business. When mice infest a kitchen in Goodlettsville they will eat your food and find a water source. In the process the mice leave feces and urine behind which can transmit a variety of diseases in Goodlettsville.
When mice get in the attic in Goodlettsville they will chew wires creating a fire hazard. Whether you have a mouse in the house in Goodlettsville, mice in the attic in Goodlettsville, a mouse in the kitchen in Goodlettsville or mice in a commercial building in Goodlettsville, Complete Animal Removal will trap mice and keep mice from coming back by performing our Goodlettsville mouse control program.
Goodlettsville TN Mole Removal
Getting rid of moles and mole prevention for Goodlettsville
The key to eliminating moles in Goodlettsville is our mole control program. First we flatten all existing mole tunnels. Then we come back and find the new mole activity in the Goodlettsville yard. We then trap for moles in the Goodlettsville yard, getting rid of the existing population. Once the moles have been removed from your Goodlettsville lawn we can come on a monthly basis to prevent future mole infestations.
Complete Animal Removal’s expert mole trappers in Goodlettsville will trap the moles and prevent moles from coming back in Goodlettsville and surrounding Goodlettsville Tennessee locations.
Goodlettsville Gopher Trapping
gopher removal and control for Goodlettsville tennessee
Gophers are a common pest in the Goodlettsville area. Gophers in Goodlettsville are found in lawns and dig tunnels underground which causes the dirt to raise up. Goodlettsville gophers eat vegetation, especially the roots of plants and shrubs. When the gophers in Goodlettsville feed on the roots this process kills the plant. Trees, shrubs and flowers in Goodlettsville are all affected by gopher damage.
In Goodlettsville TN, Gopher control is necessary and needs to be set up as soon as gopher damage is spotted. Gophers in Goodlettsville can destroy a lawn and all vegetation growing on it in very little time. Complete Animal Removal will trap gophers and get rid of the gophers in Goodlettsville and surrounding Goodlettsville areas.
Beaver Removal in Goodlettsville
Beaver trapping and beaver damage in Goodlettsville TN
Beavers in Goodlettsville are the largest North American rodent weighing up to 100 pounds. Luckily this is one rodent you will not see in your Goodlettsville attic. Beavers in Goodlettsville are found in rivers, streams, ponds and lakes. A beaver’s strong jaw and sharp teeth are used to cut down trees in Goodlettsville by gnawing on the wood. In Goodlettsville, beavers burrow into dams and banks and are very persistent. If a beaver’s den is destroyed in Goodlettsville, the beaver will work fast to rebuild it. Complete Animal Removal’s beaver trapping experts in Goodlettsville will trap and remove the beavers out of your Goodlettsville area property.
Beavers in Goodlettsville can be difficult to trap. How to get rid of beavers in Goodlettsville depends on multiple factors. Each Goodlettsville beaver trapping session is different and is approached with multiple unique strategies.
Muskrat REmvoal in Goodlettsville
Expert Muskrat trappers for Goodlettsville
Muskrats in Goodlettsville are similar to beavers only smaller. The muskrat also damages ponds in Goodlettsville by burrowing into dams and banks to make their dens. This increases erosion and over time can cause sever damage to a Goodlettsville property. Den openings in Goodlettsville are 4 to 6 inches in diameter and are close to the surface.
Muskrat trapping in Goodlettsville needs to take place as soon as muskrat damage is visible. Muskrats in Goodlettsville give birth to 2-3 litters per year and yield an average of 4-8 pups. In Goodlettsville, a major muskrat infestation can occur if left untouched. Complete Animal Removal will trap the muskrats and get rid of the muskrats in Goodlettsville and surrounding Goodlettsville areas.
Goodlettsville fox Removal
humane fox trapping and removal in Goodlettsville tn
Foxes prey on chickens, rabbits and small pets in Goodlettsville. In Goodlettsville, you can also find a fox digging through your garbage can or eating cat food. When a fox becomes a nuisance animal in Goodlettsville then Complete Animal Removal will humanely trap the fox and relocate the fox to one of our properties.
If you have a fox den on your Goodlettsville property we will get rid of the foxes for a flat fee. We do not charge per fox or per trip. We have flat rate trapping sessions.
Although foxes rarely approach humans in Goodlettsville TN, they do carry rabies and should be left alone. Call the professional fox trappers at Complete Animal Removal to get rid of foxes in Goodlettsville and surrounding Goodlettsville areas.
coyote REmvoal in Goodlettsville TN
Missing outdoor cats in Goodlettsville? you could have a coyote issue
Coyotes in Goodlettsville Tennessee are highly adaptable and thrive in urban environments. A coyote in Goodlettsville can survive on human trash and outdoor or stray cats. Coyotes in Goodlettsville adjust their hunting style to what food source is available. Being omnivores, coyotes in Goodlettsville will even eat vegetation if necessary.
Coyotes in Goodlettsville live in burrows dug into the ground called dens. In Goodlettsville, a coyote den is used for rearing pups and sleeping. Coyotes in Goodlettsville TN will be very protective of their den so do not approach a coyote’s den. The rabies virus is prevalent in coyotes in Goodlettsville and a bite from a coyote must be treated for rabies. Rabies is fatal if left untreated. Complete Animal Removal will trap coyotes on your Goodlettsville property to ensure the safety of your pets and family.
nutria Removal for Goodlettsville
nutria trapping for Goodlettsville TN
Nutria in Goodlettsville are large rodents that are similar in appearance to beavers with long, thin tails. The most a nutria in Goodlettsville will weigh is 20 pounds where a beaver in Goodlettsville can weigh up to 100 pounds. In Goodlettsville, nutria are nocturnal animals but when their food source is scarce they will hunt during the day. Like beavers, you will never see a nutria in your Goodlettsville attic. Nutria in Goodlettsville live in freshwater rivers, marshes, bayous and ponds.
Nutria are not native to the Goodlettsville area and breed all year long. The juvenile nutria reach sexual maturity at just 4 months and each litter can have up to 13 baby nutria. Complete Animal Removal’s expert nutria trapper in Goodlettsville TN will trap the nutria before the population gets out of hand.
Goodlettsville snapping turtle REmvoal
finding and catching nuiance sanpping turtles in Nasville TN
Snapping turtles in Goodlettsville can become a nuisance pest problem in waterfowl sanctuaries and aquaculture facilities. If you have snapping turtles in a Goodlettsville pond you are stocking fish then you may want snapping turtle removal. Alligator snapping turtles are protected in Goodlettsville and can not be removed. Common snapping turtles in Goodlettsville can be trapped and relocated to one of Complete Animal Removal’s Goodlettsville area properties.
Snapping turtle control in Goodlettsville involves live trapping and relocation. We only use humane trapping techniques in Goodlettsville for snapping turtles. Complete Animal Removal will trap and remove snapping turtles in Goodlettsville and surrounding Goodlettsville TN areas.
Dead Animal Removal for Goodlettsville
dead animal in the wall in Goodlettsville TN?
When an animal dies on your Goodlettsville property then Complete Animal Removal will complete a full dead animal removal. Our dead animal removal process in Goodlettsville involves removing the dead animal, treating the area for diseases and deodorizing to neutralize the bad smell. When you have a dead rat in the attic in Goodlettsville, a dead squirrel in the wall in Goodlettsville TN, a dead opossum in the yard in Goodlettsville, a dead skunk under the house in Goodlettsville, a dead bat in the building in Goodlettsville, a dead mouse in the kitchen in Goodlettsville Tennessee, a dead raccoon in the ceiling in Goodlettsville, a dead armadillo in the lawn in Goodlettsville, a dead chipmunk in the basement or dead birds on the roof, Complete Animal Removal of Goodlettsville will get rid of the dead animal, the diseases and bad smell.
Opossums play dead as a defense mechanism. If the opossum is dead then Complete Animal Removal of Goodlettsville will complete a dead opossum removal
Animal feces cleanup and attic restoration in Goodlettsville. Animal droppings removed and the attic disinfected for any diseases.
attic restorations in Goodlettsville tn
when the animals in Goodlettsville leave a mess, we clean it up
Nuisance animals in Goodlettsville carry diseases, leave behind urine and feces, destroy insulation, chew wires and get in the A/C duct work. Complete Animal Removal specializes in attic restorations in Goodlettsville TN and will fix the damage the animals left behind. When rats, raccoons, squirrels, opossums, skunks, bats, mice, flying squirrels, other rodents and nuisance animals get in the attic in Goodlettsville, Complete Animal Removal will clean up the animal feces by doing a complete attic restoration in your Goodlettsville home or business. The treatment process of our attic restoration in Goodlettsville TN includes an antifungul, antibacterial, antiviral, antimicrobial, disinfectant and deodorizer. We will kill all the diseases in the attic of your Goodlettsville home and restore the attic as if the animals were never there.
Home Exclusions in Goodlettsville TN
full exclusions and home repairs in Goodlettsville
Animals gain access in homes and businesses of Goodlettsville by finding or creating entry points. These nuisance animals in Goodlettsville will squeeze through existing entry points or chew their way in through vulnerable spots in the home or building. When Complete Animal Removal of Goodlettsville does our initial inspection we will find the entry points the animal are currently using, as well as any entry points they could use in the future. A full home exclusion in Goodlettsville consists of closing all entry points with metal and concrete. We never use foam for an exclusion for rodents, raccoons, opossums or any other Goodlettsville nuisance wildlife that can easily chew through it. We guarantee our work so you can feel at ease knowing your Goodlettsville home or business is nuisance animal free.
Full home exclusions in Goodlettsville TN are completed using only metal and concrete based products. We never use foam to close off entry points for nuisance animals.
More info on the nuisance wildlife Complete Animal Removal humanely traps and removes in Goodlettsville Tennessee
Raccoon Control in Goodlettsville
Raccoons in Goodlettsville are highly intelligent animals, but can be extremely destructive to your home, building or property. Goodlettsville raccoons carry multiple diseases including Baylisascaris procyonis, which is a raccoon roundworm that can be transmitted to humans. This raccoon roundworm affects the central nervous system and can be fatal if left untreated. Raccoons in Goodlettsville can transmit Leptospirosis, which is a bacterial infection spread through their urine and other secretions. Salmonella is spread through raccoons in Goodlettsville, which can cause a severely painful illness. Whether you have raccoon in the house, in the attic, in the garage, in the yard or in the ceiling in Goodlettsville, all raccoons have to be considered dangerous. Any bite or scratch from a raccoon in the Goodlettsville area has to be treated as the raccoon had rabies. Rabies is 100% fatal so any bite or scratch needs to be treated immediately. When a raccoon gets in the attic in Goodlettsville it leaves its feces buried in the insulation, inside the A/C ductwork and on the drywall. From the first day the raccoon enters the attic it urinates around the perimeter marking it’s territory. The damage raccoons in Goodlettsville do to the attic and yard can be devastating. Complete Animal Removal in Goodlettsville will humanely trap the raccoons and relocate them far enough away so they will never come back to your Goodlettsville home or business. We also fix and cleanup all damage caused by the raccoons in Goodlettsville. Full home exclusions for raccoons in Goodlettsville are Complete Animal Removal’s specialty. We only use metal and concrete and never use foam to exclude raccoons from a Goodlettsville home or business.
Bat Control in Goodlettsville
Bats play a vital role in the ecosystem of Goodlettsville and consume their body weight in mosquitos every night. Bats are protected by the state of Tennessee and can only be removed in Goodlettsville between August 15th and April 15th. The blackout period in between these months are to allow the bat’s babies to develop to the point of being able to fly. Bats cannot be exterminated, trapped or poisoned. Bats in Goodlettsville have to be excluded from the home or building using bat valves or netting. Although bats are great for the environment they are dangerous to have living in a Goodlettsville home or business. Bat feces, or bat guano, can transmit a disease called Histoplasmosis which is a disease caused by the fungus Histoplasma capulatum. When bats get in the attic of a Goodlettsville home they need to be removed and their feces cleaned out and disinfected.
Opossum Control in Goodlettsville
Opossums are the only North American marsupial and can be quite the pest here in Goodlettsville. Opossums in Goodlettsville get into attics, under mobile homes, in the walls, under the house, in the shed and in the garage. There are over 60 species of opossum in the world, which are often called possums. We only have one species of opossum, or possum, in Goodlettsville Tennessee called the Virginia opossum or Common opossum. Opossums are the #1 carrier of the cat flea in Goodlettsville and can infest your property with them just by being there. When you have a dead opossum in the yard, in the attic or under the home it needs to be treated for ectoparasites and deodorized. When opossums wander the yard in Goodlettsville they can attack and injure domestic animals. Opossums are commonly found eating cat food and garbage left outside. Complete Animal Removal will humanely trap and relocate all opossums off of your Goodlettsville property.
Rat – Mice – Mouse – Rodent Control in Goodlettsville
Rodents are a series problem here in Goodlettsville Tennessee and are major vectors of many diseases. Rats are more common than mice in Goodlettsville but both can be found here. The two common species of rats in Goodlettsville found in the attics and under the homes are the Norway rat and Roof rat. Roof rats, also called fruit rats or black rats, are great climbers and are more commonly found in the attics of Goodlettsville homes and buildings. When you hear scratching in the attic in Goodlettsville the chances are good that it is a family of roof rats. Norway rats, also called brown rats or sewer rats, are more commonly found under the home in Goodlettsville Tennessee. When you hear scratching under your floor or scratching under your bathtub it could be Norway rats. House mice are found in Goodlettsville but are not as common as roof rats. A house mouse can populate an attic in Goodlettsville and cause a major mouse infestation in very little time. Both mice and rat infestations can be difficult to eliminate but Complete Animal Removal find a solution to every rodent problem.
Squirrel Control in Goodlettsville
Squirrels are also rodents and are a major pest problem when they enter a Goodlettsville home. Goodlettsville squirrel removal is always necessary when the squirrel gets in the attic. Squirrels in Goodlettsville chew on electrical wiring, leave urine on the drywall, leave their feces in the insulation and get inside the A/C ductwork. Scratching in the attic or in the walls during the daytime in Goodlettsville is most likely from squirrels. Call Complete Animal Removal’s Goodlettsville squirrel trapper to get rid of the scratching in the attic by humanely trapping and relocating the squirrels.
Snake Control in Goodlettsville
There are 6 different species of venomous snakes in Tennessee and most of them are found right here in Goodlettsville. The four species of venomous snakes are the copperhead, timber rattlesnake, water moccasin and the pigmy rattlesnake. Timber Rattlesnakes are commonly found in Goodlettsville in the yard near woodpiles. The water moccasin, or cottonmouth snake, are found near ponds and rivers in Goodlettsville. Western pigmy rattlesnakes in Goodlettsville commonly need to be removed from bushes near the home. Copperhead and Timber rattlesnakes are mostly found in the swamps. Pigmy rattlesnakes in Goodlettsville can be found in the bushes, under the home, in the yard or even in the house. In Goodlettsville, a trained professional should always identify snakes. There are many snakes that mimic venomous snakes in Goodlettsville so call Complete Animal Removal to have a Goodlettsville snake removal specialist humanely trap the snake, catch the snake and remove the snake from your property. We will inspect for snake nests and remove any snake eggs or snake babies from the property or home.
Armadillo Control in Goodlettsville
Armadillos are destructive animals and are found throughout Goodlettsville. When an armadillo invades your Goodlettsville yard it will tear up the grass looking for grubs and earthworms. Goodlettsville armadillos dig in the garden and destroy plants and vegetables. When an armadillo in Goodlettsville digs a burrow it can go down 10ft deep and be 20ft wide. Sinkholes and property damage can occur from an armadillo den. The species of armadillo that we have here in Goodlettsville always gives birth to quadruplets so there could be up to six armadillos per burrow. Complete Animal Removal will humanely trap and relocate armadillos in Goodlettsville.
Dead Animal in Goodlettsville
The homeowner is responsible for removal when an animal dies in the attic, under the home or in the yard in Goodlettsville. The city of Goodlettsville is only responsible for dead animal removal when the dead animal is in the street or on city property. When an animal dies in Goodlettsville the ectoparasites that were living on the dead animal will leave the dead carcass to infest a new living host. Fleas, ticks and mites are some examples of these ectoparasites that will leave the dead animal and cause an infestation wherever the animal died. Dead animal removal in Goodlettsville needs to include removal of the dead animal, treatment for the ectoparasites and deodorizing to reduce the bad smell. We do dead squirrel removal in Goodlettsville, dead opossum removal in Goodlettsville, dead raccoon removal in Goodlettsville, dead skunk removal in Goodlettsville, dead rat removal in Goodlettsville, dead mouse removal in Goodlettsville, dead bird removal in Goodlettsville, dead bat removal in Goodlettsville, dead nutria removal in Goodlettsville, dead armadillo removal in Goodlettsville, dead chipmunk removal in Goodlettsville, dead lizard removal in Goodlettsville, dead snake removal in Goodlettsville, dead mice removal in Goodlettsville, dead rodent removal in Goodlettsville, dead coyote removal in Goodlettsville, dead fox removal in Goodlettsville and any other dead animal removal in Goodlettsville Tennessee. We remove dead animals in the wall in Goodlettsville, dead animals in the ceiling in Goodlettsville, dead animals under the home in Goodlettsville, dead animals in the attic in Goodlettsville, dead animals in the yard in Goodlettsville, dead animals under the shed in Goodlettsville, dead animals in the garage in Goodlettsville, dead animals in the insulation in Goodlettsville, dead animals on the roof in Goodlettsville and more. Complete Animal Removal’s dead animal removal experts in Goodlettsville will remove, treat and deodorize for all dead animals.
Pigeon Control in Goodlettsville
Pigeons in Goodlettsville can be a major health hazard as they spread diseases that can be as severe as death. Pigeon guano, or pigeon feces, can grow a fungus Histoplasma capulatum, which can cause Histoplasmosis. When pigeons in Goodlettsville get in the attic or roost on the roof the pigeons need to be removed and their feces cleaned up and disinfected. In Goodlettsville pigeons get into the rafters of warehouses and commercial buildings and present a danger to all employees inside. When a pigeon flies into a grocery store in Goodlettsville the pigeon droppings can fall into produce and cause customers to become ill. Whether the pigeon gets into the attic, on the rafters, on the roof, in the store, in a commercial building or a residential house in Goodlettsville Complete Animal Removal’s pigeon removal experts will get rid of the pigeons and cleanup their guano.
Bird Control in Goodlettsville
Other birds that can be removed in Goodlettsville TN include sparrows, starlings and some species of ducks. Sparrows are the most common invader of grocery stores in Goodlettsville. When a sparrow flies into a grocery store it needs to be removed before the bird defecates on the produce. When starlings and sparrows get in the attic of a Goodlettsville home our building, bird control is necessary for the safety of the residents inside. Muscovy ducks in Goodlettsville are not native and are considered a major nuisance as their feces can cause illness and stain and damage property. Bird removal and bird control in Goodlettsville is necessary when you are dealing with pigeons, sparrows, starlings and Muscovy ducks. Complete Animal Removal’s bird control and bird removal experts will get rid of birds including pigeons, starlings, sparrows and Muscovy ducks 24/7.
Moles – Voles – Pocket Gopher Control in Goodlettsville
There are a few major animals that dig and live in the ground in Goodlettsville which include moles, voles, pocket gophers and armadillos. Moles in Goodlettsville live in tunnels just under the ground and constantly dig searching for food. They leave your lawn feeling squishy and eventually kill the grass above everywhere they dig. Mole trapping in Goodlettsville is not easy but a Complete Animal Removal’s mole trapper will trap the moles and allow your lawn to get back to normal.
Skunk Control in Goodlettsville
Skunks in Goodlettsville are a nuisance animal that can be dangerous to pets, humans and your property. Goodlettsville skunks are well known for the bad smelling spray they use as a defensive mechanism. This spray is made of a thick oily liquid containing sulfur compounds that leave a horrific smell and can cause temporary blindness. Skunks in Goodlettsville are a large carrier of the rabies virus. Skunks are 2nd only behind raccoons in number of rabies cases in the United States. Rabies is 100% fatal and any bite or scratch from a skunk must be treated as if it has the rabies virus. Goodlettsville skunk removal is necessary even if the skunk is just in the yard. When a skunk in Goodlettsville gets in the attic Complete Animal Removal will get rid of the skunk, clean up the skunk damage and close off the entry points created by the skunks so the skunks cannot get back in.
Lizard Control in Goodlettsville
Complete Animal Removal receives calls for Lizard removal in Goodlettsville Tennessee for many different species of lizards. Iguanas are one of the fastest growing invasive lizard species in Goodlettsville and are breeding at a rapid rate. We provide iguana trapping for both residential and commercial properties in Goodlettsville. Removing iguanas in Goodlettsville involves getting creative since the number of iguanas varies for each property. In Goodlettsville getting rid of iguanas is one of Complete Animal Removal’s specialty. Other lizard removal involves getting rid of and trapping geckos, anoles and monitor lizards.
Fox Control in Goodlettsville
Complete Animal Removal can humanely complete Goodlettsville fox trapping by live trapping and relocating. When a fox in Goodlettsville becomes a nuisance we can trap the foxes and relocate them to a safe place where they will not come back. Getting rid of a fox involves patience and experience. Complete Animal Removal’s fox trappers in Goodlettsville are the experts in fox trapping.
We specialize in trapping raccoons in the attic in Goodlettsville TN, opossums in the attic in Goodlettsville Tennessee, rat control in Goodlettsville TN, Goodlettsville animal removal, nuisance wildlife removal in Goodlettsville TN, snake removal in Goodlettsville Tennessee, bee removal in Goodlettsville TN, bats out of the attic in Goodlettsville TN, bird removal in Goodlettsville Tennessee, noises in the attic in Goodlettsville Tennessee, Goodlettsville animal control, bees in the wall in Goodlettsville Tennessee, opossums in attic in Goodlettsville Tennessee, snake removal in the house in Goodlettsville TN, Goodlettsville raccoon removal, Goodlettsville rat control, Goodlettsville snake control, Goodlettsville rat removal, Goodlettsville opossum removal, Goodlettsville rodent control, Goodlettsville snake removal, Goodlettsville bee removal, Goodlettsville bird removal, Goodlettsville squirrel removal, Goodlettsville dead animal removal, Goodlettsville mice removal, Goodlettsville armadillo removal, Goodlettsville skunk removal, Goodlettsville wasp removal, Goodlettsville gopher removal, humane bat removal in Goodlettsville, Goodlettsville lizard removal, Goodlettsville duck removal, Goodlettsville yellow jacket removal, Goodlettsville wildlife removal, Goodlettsville animal control, ducks in the attic in Goodlettsville Tennessee, squirrels in the roof in Goodlettsville TN, moles in the yard in Goodlettsville TN, rat trapping in Goodlettsville Tennessee, Goodlettsville animal trapper, raccoons in the roof in Goodlettsville Tennessee, mice removal in Goodlettsville TN, pigeon removal in Goodlettsville TN, snake control in Goodlettsville Tennessee, rodent control in Goodlettsville TN, rats in the house in Goodlettsville, trapping animals in the attic in Goodlettsville TN, Goodlettsville opossum trapper, Goodlettsville squirrel trapper, armadillo removal in Goodlettsville TN, raccoon in the house in Goodlettsville, scratching in the attic in Goodlettsville TN, something walking in the attic in Goodlettsville TN, squirrels in the wall in Goodlettsville, Tennessee, live bee removal in Goodlettsville, live capture of raccoons in Goodlettsville, mouse removal in Goodlettsville, mice in the attic in Goodlettsville TN, iguana removal in Goodlettsville, snake in the house in Goodlettsville, armadillo in the yard in Goodlettsville TN, scratching noises in Goodlettsville, Goodlettsville humane animal trapping, animals removed in Goodlettsville, wildlife removal in Goodlettsville TN, wildlife control in Goodlettsville, hog removal in Goodlettsville, snake in the yard in Goodlettsville, rattlesnake removal in Goodlettsville, squirrels in the wall in Goodlettsville, catching rats in Goodlettsville TN, Goodlettsville humane animal removal, Goodlettsville humane animal control, peacock removal in Goodlettsville, attic restoration in Goodlettsville, animal feces cleanup in Goodlettsville TN, fixing holes in the home caused by animals in Goodlettsville, full home exclusions in Goodlettsville TN, opossum in the backyard on Goodlettsville, dead rat removal in Goodlettsville, live trapping for raccoons in Goodlettsville TN, relocating raccoons from the attic in Goodlettsville, getting rid of a bad smell in the attic in Goodlettsville, getting rid of a bad smell in the walls in Goodlettsville, honeycomb removal in Goodlettsville Tennessee, wasp control in Goodlettsville, animals in the attic in Goodlettsville, critter control in Goodlettsville, rodent removal in Goodlettsville, Goodlettsville dead animal removal from the attic, humane raccoon removal in Goodlettsville, dead animal removal from under the house in Goodlettsville, squirrels removed in Goodlettsville, opossum removal from the attic in Goodlettsville Tennessee, snake in the yard removed in Goodlettsville, dead rat in the wall in Goodlettsville, armadillo burrow in Goodlettsville, skunks in the attic in Goodlettsville, raccoons pooping in the pool in Goodlettsville, animal droppings in the attic in Goodlettsville, mice control in Goodlettsville Tennessee, water moccasin removal in Goodlettsville, Goodlettsville dead squirrel removal, Goodlettsville dead opossum removal, Goodlettsville dead bat removal, Goodlettsville dead armadillo removal, Goodlettsville dead raccoon removal, Goodlettsville dead mouse removal, raccoons in the yard in Goodlettsville, raccoons in the walls in Goodlettsville, critters in the walls in Goodlettsville, bee removal from the attic in Goodlettsville, Goodlettsville humane wildlife control, squirrels in the house in Goodlettsville, snake control in Goodlettsville, Africanized bees exterminated in Goodlettsville Tennessee, squirrel trapper in Goodlettsville TN, trapping opossums in Goodlettsville, live bee removal from the wall in Goodlettsville, rodents trapped from the attic in Goodlettsville, animals under the mobile home trapped in Goodlettsville, noises under the home in Goodlettsville, scratching under the floor in Goodlettsville, killer bees exterminated in Goodlettsville, squirrels nesting in the attic in Goodlettsville TN, armadillos removed from the yard in Goodlettsville, animals tearing up the yard removed in Goodlettsville, rats trapped in Goodlettsville TN, rodents removed from the walls in Goodlettsville, lizards in the house removed in Goodlettsville, live honeycomb removal in Goodlettsville TN, bats removed out of the attic Goodlettsville Tennessee, bats in the walls removed in Goodlettsville TN, pigeon removal and cleanup in Goodlettsville, pigeon guano cleanup in Goodlettsville, bat guano cleanup in Goodlettsville, Goodlettsville bat control, Goodlettsville raccoon control, Goodlettsville squirrel control, Goodlettsville rat control, Goodlettsville mouse control, Goodlettsville snake control, Goodlettsville opossum control, Goodlettsville armadillo control, Goodlettsville skunk control, Goodlettsville armadillo control, Goodlettsville bird control, Goodlettsville duck control, Goodlettsville mice control, Goodlettsville bee control, Goodlettsville wasp control, Goodlettsville yellow jacket control, Goodlettsville gopher control, Goodlettsville mole control, getting rid of moles in the yard in Goodlettsville, getting rid of yellow jackets in the ground in Goodlettsville, getting bees out of a tree in Goodlettsville, getting skunks out from under the home in Goodlettsville TN, trapping rodents in Goodlettsville TN, getting rid of raccoons in Goodlettsville, squirrels trapped in Goodlettsville Tennessee, snakes in the attic in Goodlettsville, insulation removal in Goodlettsville, droppings cleaned up in the attic in Goodlettsville, humane opossum removal in Goodlettsville, armadillos trapped in Goodlettsville, bee removal in Goodlettsville, wasp removal in Goodlettsville, raccoon removal in Goodlettsville, squirrel removal in Goodlettsville, rat removal in Goodlettsville, mice removal in Goodlettsville, mouse removal in Goodlettsville, armadillo removal in Goodlettsville, yellow jacket removal in Goodlettsville, rodent removal in Goodlettsville, animal removal in Goodlettsville, snake removal in Goodlettsville, animal control in Goodlettsville, bird removal in Goodlettsville, pigeon removal in Goodlettsville, mole removal in Goodlettsville, duck removal in Goodlettsville, skunk removal in Goodlettsville, lizard removal in Goodlettsville, wildlife removal in Goodlettsville, wildlife removed from the house in Goodlettsville, Goodlettsville animal control, Goodlettsville animal removal, humane squirrel removal in Goodlettsville, repairs to home caused by animal damage in Goodlettsville TN, small animals in the wall in Goodlettsville, small animals in the attic in Goodlettsville, Goodlettsville pest control, small animal pest control in Goodlettsville, rodent pest control in Goodlettsville, raccoon pest control in Goodlettsville TN, Goodlettsville squirrel pest control, bees removed in the yard in Goodlettsville, pest control for bees in Goodlettsville, pest control for yellow jackets in Goodlettsville TN, pest control for snakes in Goodlettsville, pest control for mice in Goodlettsville, Goodlettsville pest control for rodents, pest control for armadillos in Goodlettsville, humane animal trapper in Goodlettsville, pest control for squirrels in Goodlettsville, pest control for opossums in Goodlettsville, animals removed from the ceiling in Goodlettsville TN, noises in the attic in Goodlettsville, Goodlettsville animal control, Goodlettsville wildlife control, Goodlettsville bee control, Goodlettsville wasp control, Goodlettsville honeybee removal in Goodlettsville, honey bees removed in Goodlettsville, animals in the attic trapped in Goodlettsville, wildlife trapper in Goodlettsville TN, Goodlettsville mole control, lizard removal from the yard in Goodlettsville, bees removed from the home in Goodlettsville, animals running in the ceiling in Goodlettsville, snake in the pool removed in Goodlettsville, raccoons in the pool in Goodlettsville, squirrels trapped out of the attic in Goodlettsville, Goodlettsville mouse trapper, critter removal in Goodlettsville, bats removed out of a commercial building, bats in the ceiling in Goodlettsville, dead rodents removed from the walls, bad smell coming from the attic in Goodlettsville, complete attic restoration in Goodlettsville, wild hog removal in Goodlettsville, family of raccoons in the attic trapped and removed in Goodlettsville, opossum in the garage trapped in Goodlettsville and any other 24 hour animal control, wildlife removal and stinging insect removal in Goodlettsville Tennessee |
<?php
require_once __DIR__ . '/common/config.php';
require_once __DIR__ . '/common/functions.php';
require_once __DIR__ . '/common/CSV.class.php';
?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml">
<head>
<title>TCAT :: Source list</title>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<link rel="stylesheet" href="css/main.css" type="text/css" />
<script type="text/javascript" language="javascript">
</script>
</head>
<body>
<h1>TCAT :: Source list</h1>
<?php
validate_all_variables();
dataset_must_exist();
$dbh = pdo_connect();
pdo_unbuffered($dbh);
$collation = current_collation();
$filename = get_filename_for_export("source.list");
$csv = new CSV($filename, $outputformat);
// tweets per source
$sql = "SELECT t.source COLLATE $collation as source, count(t.id) as count, ";
$sql .= sqlInterval();
$sql .= " FROM " . $esc['mysql']['dataset'] . "_tweets t ";
$sql .= sqlSubset();
$sql .= "GROUP BY datepart, source";
$array = array();
$rec = $dbh->prepare($sql);
$rec->execute();
while ($res = $rec->fetch(PDO::FETCH_ASSOC)) {
$array[$res['datepart']][$res['source']] = $res['count'];
}
// retweets per source
$sql = "SELECT count(t.retweet_id) as count, t.source COLLATE $collation as source, ";
$sql .= sqlInterval();
$sql .= " FROM " . $esc['mysql']['dataset'] . "_tweets t ";
$sql .= sqlSubset();
$sql .= " AND retweet_id != 0 AND retweet_id != ''";
$sql .= "GROUP BY datepart, source";
$retweets = array();
$rec = $dbh->prepare($sql);
$rec->execute();
while ($res = $rec->fetch(PDO::FETCH_ASSOC)) {
$retweets[$res['datepart']][$res['source']] = $res['count'];
}
// replies per source
$sql = "SELECT count(t.in_reply_to_status_id) as count, t.source COLLATE $collation as source, ";
$sql .= sqlInterval();
$sql .= " FROM " . $esc['mysql']['dataset'] . "_tweets t ";
$sql .= sqlSubset();
$sql .= " AND in_reply_to_status_id != 0 AND in_reply_to_status_id != ''";
$sql .= "GROUP BY datepart, source";
$replies = array();
$rec = $dbh->prepare($sql);
$rec->execute();
while ($res = $rec->fetch(PDO::FETCH_ASSOC)) {
$replies[$res['datepart']][$res['source']] = $res['count'];
}
// hashtags per source
$sql = "SELECT t.source COLLATE $collation as source, count(h.text COLLATE $collation) as count, ";
$sql .= sqlInterval();
$sql .= " FROM " . $esc['mysql']['dataset'] . "_hashtags h, " . $esc['mysql']['dataset'] . "_tweets t ";
$sql .= sqlSubset();
$sql .= " AND h.tweet_id = t.id ";
$sql .= "GROUP BY datepart, source";
//print $sql . "<br>";
flush();
$hashtags = array();
$rec = $dbh->prepare($sql);
$rec->execute();
while ($res = $rec->fetch(PDO::FETCH_ASSOC)) {
$hashtags[$res['datepart']][$res['source']] = $res['count'];
}
// tweets with hashtags, per source
$sql = "SELECT t.source COLLATE $collation as source, count(distinct(h.tweet_id)) as count, ";
$sql .= sqlInterval();
$sql .= " FROM " . $esc['mysql']['dataset'] . "_hashtags h, " . $esc['mysql']['dataset'] . "_tweets t ";
$sql .= sqlSubset();
$sql .= " AND h.tweet_id = t.id ";
$sql .= "GROUP BY datepart, source";
//print $sql . "<br>";
flush();
$tweetsWithhashtags = array();
$rec = $dbh->prepare($sql);
$rec->execute();
while ($res = $rec->fetch(PDO::FETCH_ASSOC)) {
$tweetsWithhashtags[$res['datepart']][$res['source']] = $res['count'];
}
// urls per source
$sql = "SELECT t.source COLLATE $collation as source, count(u.url_followed) as count, ";
$sql .= sqlInterval();
$sql .= " FROM " . $esc['mysql']['dataset'] . "_urls u, " . $esc['mysql']['dataset'] . "_tweets t ";
$sql .= sqlSubset();
$sql .= " AND u.tweet_id = t.id ";
$sql .= "GROUP BY datepart, source";
$links = array();
$rec = $dbh->prepare($sql);
$rec->execute();
while ($res = $rec->fetch(PDO::FETCH_ASSOC)) {
$links[$res['datepart']][$res['source']] = $res['count'];
}
// tweets with urls, per source
$sql = "SELECT t.source COLLATE $collation as source, count(distinct(u.tweet_id)) as count, ";
$sql .= sqlInterval();
$sql .= " FROM " . $esc['mysql']['dataset'] . "_urls u, " . $esc['mysql']['dataset'] . "_tweets t ";
$sql .= sqlSubset();
$sql .= " AND u.tweet_id = t.id ";
$sql .= "GROUP BY datepart, source";
//print $sql . "<br>";
flush();
$tweetsWithLinks = array();
$rec = $dbh->prepare($sql);
$rec->execute();
while ($res = $rec->fetch(PDO::FETCH_ASSOC)) {
$tweetsWithLinks[$res['datepart']][$res['source']] = $res['count'];
}
// mentions per source
$sql = "SELECT t.source COLLATE $collation as source, count(m.to_user) as count, ";
$sql .= sqlInterval();
$sql .= " FROM " . $esc['mysql']['dataset'] . "_mentions m, " . $esc['mysql']['dataset'] . "_tweets t ";
$sql .= sqlSubset();
$sql .= " AND m.tweet_id = t.id ";
$sql .= "GROUP BY datepart, source";
$mentions = array();
$rec = $dbh->prepare($sql);
$rec->execute();
while ($res = $rec->fetch(PDO::FETCH_ASSOC)) {
$mentions[$res['datepart']][$res['source']] = $res['count'];
}
// tweets with mentions, per source
$sql = "SELECT t.source COLLATE $collation as source, count(distinct(m.tweet_id)) as count, ";
$sql .= sqlInterval();
$sql .= " FROM " . $esc['mysql']['dataset'] . "_mentions m, " . $esc['mysql']['dataset'] . "_tweets t ";
$sql .= sqlSubset();
$sql .= " AND m.tweet_id = t.id ";
$sql .= "GROUP BY datepart, source";
//print $sql . "<br>";
flush();
$tweetsWithMentions = array();
$rec = $dbh->prepare($sql);
$rec->execute();
while ($res = $rec->fetch(PDO::FETCH_ASSOC)) {
$tweetsWithMentions[$res['datepart']][$res['source']] = $res['count'];
}
$csv->writeheader(explode(',', "date,source,tweets,retweets,replies,total nr of hashtags,nr of tweets with hashtags,total nr of URLs,nr of tweets with URLs,total nr of mentions,nr of tweets with mentions"));
foreach ($array as $date => $sources) {
foreach ($sources as $source => $tweetcount) {
$csv->newrow();
$csv->addfield($date);
$csv->addfield($source);
$csv->addfield($tweetcount);
if (isset($retweets[$date][$source]))
$csv->addfield($retweets[$date][$source]);
else
$csv->addfield(0);
if (isset($replies[$date][$source]))
$csv->addfield($replies[$date][$source]);
else
$csv->addfield(0);
if (isset($hashtags[$date][$source]))
$csv->addfield($hashtags[$date][$source]);
else
$csv->addfield(0);
if (isset($tweetsWithhashtags[$date][$source]))
$csv->addfield($tweetsWithhashtags[$date][$source]);
else
$csv->addfield(0);
if (isset($links[$date][$source]))
$csv->addfield($links[$date][$source]);
else
$csv->addfield(0);
if (isset($tweetsWithLinks[$date][$source]))
$csv->addfield($tweetsWithLinks[$date][$source]);
else
$csv->addfield(0);
if (isset($mentions[$date][$source]))
$csv->addfield($mentions[$date][$source]);
else
$csv->addfield(0);
if (isset($tweetsWithMentions[$date][$source]))
$csv->addfield($tweetsWithMentions[$date][$source]);
else
$csv->addfield(0);
$csv->writerow();
}
}
$csv->close();
echo '<fieldset class="if_parameters">';
echo '<legend>User stats</legend>';
echo '<p><a href="' . filename_to_url($filename) . '">' . $filename . '</a></p>';
echo '</fieldset>';
?>
</body>
</html>
|
There used to be only one tragedy in Sephie's life: losing her mother. But that was before her Uncle Ilahn came to visit. Now he has set in motion events that will change uproot Sephie's peaceful life on the floating sky-city of Meridian. Ilahn, Minister of Cadador, rules the city and has his eyes on the entire world. The only one who can stop him is his niece. They may share a bloodline, and they may both bear the Sigil, but Sephie must prove they aren't the same. |
Wednesday, October 06, 2004
lab 10 - delay
NAME
DESCRIPTION
I am continuing to add signal modules to signalfs
copying the implementations from stk. Today I'm
working on the delay line, and whatever else I can
implement in two hours.
The delay line does not fit the model of signals I
have created so far. From the STK it looks like it
is used more as a utilitly class than a standalone
filter. Its used by the echo class which actually
does the mix of the current input with the delayed
input. I could of course do the same thing and
have delay as functions with the dsp module.
Trying to use the delay, or echo, brings up a
number of issues.
How am I going to stack multiple filters ontop one
another and still be able to ctrl each one
independently? To access to each ctl file I'd need
to know the conversation number. This might be
tricky to find out if I have multiple instruments
each being built from many modules.
I want to alter the effect during playback
independently of the instrument being played. But
I'm not sure how to fit it in with a simple
instrument. Where in the stack should it go? And
how will I control it if it's placed under the
instrument?
This goes back to the problem of needing some kind
of patch bay. Given a particular instrument we
need to now all the effects tied in to it. Then we
want to write to the ctl file of any of them, not
via the instrument but directly, and alter the
effect. We need to remove the exclusive access
condition on the ctl, although we could place it
on data instead.
If I didn't do this I'd need a naming convention
within the ctl file that was at the end of the
filter pipeline. But that is ridiculous because
what else am I using a fs for.
Therefore, If I put the, say, echo filter in front
of the instrument, I still send note events to the
instrument, but read sound back from the echo data
file.
Is the sequencer going to be able to manage all
this? The skini language may have to include
naming of instruments using filenames. That is,
events are sent directed to specified ctl files
(filters, instruments) but audio data is read from
only one, the one at the end of the pipeline (is
pipeline the right term here? filter chain, patch?
sink?).
I need to specify the sequencer language and a means
for retrieving all the conversation directories
for a pipeline before going further. |
CLEMSON, SC - #24 Clemson defeated Anderson 5-0 in the second match of a men’s intercollegiate double header at Clemson, SC Sunday afternoon. With the win, the Tigers are now 8-1 on the year, while Anderson falls to 0-1 this season. Clemson defeated Winthrop 7-0 earlier in the day.
“I thought it was a good day of tennis for us,” said Clemson Head Coach Chuck McCuen. “We want to continue to improve our mental and physical endurance. We must accomplish this if we are to be a legit top-25 program.
“We are excited to gain experience for our younger players. You can’t duplicate match play, and this experience is valuable to our team and individuals. I like the way we competed. We must now continue to work hard and get back to practice,” said McCuen.
Clemson’s Austin Ansari defeated Juan Carracedo at number one singles, 6-1, 6-3. He is now 7-4 on the year. The Tigers’ Fernando Sala won his 11th match of the season with a 6-2, 6-0 victory over Mateo Rivas.
The Tigers will play host to UNC Wilmington on Saturday, February 8 at 12:00 p.m. at the Hoke Sloan Tennis Center in the Tigers’ next action. |
The effect of Momordica charantia and Mucuna pruriens in experimental diabetes and their effect on key metabolic enzymes involved in carbohydrate metabolism.
The Indian traditional system of medicine prescribed traditional plant therapies. Two such plants, i.e. Momordica charantia (MC) and Mucuna pruriens (MP), earlier shown to reduce hyperglycaemia, were assessed for their anti hyperglycaemic effect on varying degrees of hyperglycaemia and diabetic complications. Alcohol and aqueous extracts of MC (50, 100 and 200 mg/kg/day) and only an alcohol extract of MP (100, 200 and 400 mg/kg/day) were evaluated in a pilot study (plasma glucose >180 mg/dL, 21 days), a chronic study in alloxanized rats (plasma glucose >280mg/dL, 120 days) and streptozotocin (STZ) mice (plasma glucose >400 mg/dL, 60 days). In the pilot study, the maximum antihyperglycaemic effect occurred with an aqueous extract of MC at week 3 and an alcohol extract of MP at week 6 at a dose of 200 mg/kg/day. In chronic alloxanized rats, the selected dose of MC led to a significant fall of 64.33%, 66.96%, 69.7% and 70.53% in plasma glucose levels at 1, 2, 3 and 4 months, respectively. MP showed a decrease of 40.71%, 45.63%, 50.33% and 51.01% at the same time period. In chronic STZ diabetic mice, MC led to a mean reduction of 15.37%, 18.68% and 22.86% in plasma glucose levels on days 40, 50 and 60 of sampling while MP had no significant effect. The alteration in hepatic and skeletal muscle glycogen content and hepatic glucokinase, hexokinase, glucose-6-phosphate and phosphofructokinase levels in diabetic mice were partially restored by MC but not by MP. The mechanism of action of MC and MP is discussed. |
Q:
Fastest way to update a TListView
I have a TListView that gets populated with data collected over a network. To collect all the data takes around 50ms, to add it to the list takes around 5 seconds. My initial guess was that it was redrawing after every addition or something like that. What should I do to get the TListView to update as quickly as possible?
Columns and items are all added via code.
I tried using BeginUpdate and EndUpdate on the items of the list but that didn't make much difference. There are around 2000 entries that are added to the list.
A:
Without seeing your actual code, there is no way to know for sure why your updates are that slow. However, if speed is an issue for you, especially with a lot of list items, you should put the TListView into virtual mode instead (set its OwnerData property to true) and store your status information elsewhere, not in the TListView itself (2000 items is a lot of overhead for a non-virtual ListView to handle). Then, simply call the ListView's Invalidate() or UpdateItems() method when needed to trigger repaints, and use the OnData event to provide the status data to TListView whenever it asks you for it. For example:
struct MyStatusInfo
{
String Status;
...
};
MyStatusInfo StatusItems[2000];
__fastcall TForm1::TForm1(TComponent *Owner)
: TForm(Owner)
{
...
ListView1->Items->Count = 2000; // you don't use Add() with a virtual ListView
...
}
void __fastcalll TForm1::UpdateStatus(int Index, const String &Status, ...)
{
MyStatusInfo &Info = StatusItems[Item->Index];
Info.Status = Status;
...
ListView1->UpdateItems(Index, Index);
}
void __fastcall TForm1::ListView1Data(TObject *Sender, TListItem *Item)
{
MyStatusInfo &Info = StatusItems[Item->Index];
Item->Caption = Info.Status;
...
}
|
A Little More on Jalen Ramsey
If you haven't had a chance to check out the feature on Jalen Ramsey from this morning's paper, you can read it here.
One of the worst parts of writing a feature with space limitations is what ends up left out of the final story. I had a chance to talk to both of Jalen's parents and his high school defensive backs coach and there were plenty of other good tidbits and insights from those interviews. Fortunately, the Herald FSU blog is a great place to put a lot of that.
For instance, there wasn't much opportunity to talk about Ramsey's competitive nature, but he thrives in competition according to Jamie Redmon, his coach at Brentwood High:
“Jalen is a very, very competitive kid. In high school you would love to play man coverage and sometimes you can’t because you don’t have the confidence to do it, [but] from the time Jalen walked on campus we started playing man coverage almost every game," said Redmon.
"He’s just a phenomenal athlete because you know he has the size, the height, the arm-length but most of all he’s very competitive, the higher the stakes he’s going to play at that level. He’s just a tremendous athlete as well.”
Redmon also mentioned that Ramsey wants to lockdown the best player on the field, he's not interested in a matchup that gives him an easy game.
“He has tremendous confidence in his abilities, big time," Redmon added. "If I told him in the game ‘hey you’ve got their best receiver,’ he wants to challenge that receiver every down. There’s no doubt in my mind
“He loves going against someone that’s very good, he doesn’t shy away from competition, at all.”
Here are a few other tidbits:
##- Jalen's mother, Margie Tidwell, was highly confident he would start from day one:
“Jalen’s very confident and he’s always been that way, we had no doubts - his father and I - had no doubts that he would be starting if he continued to work," said Tidwell. "He worked hard during the Summer, he never stopped working out, he did what he had to do to prove himself so I had no doubts that he was going to start.”
##- Without going into too many details, you got the idea that the problems at USC under Lane Kiffin may have been as big a factor in Ramsey flipping his commitment in the 11th hour as Pruitt's late push was:
“That was solely his decision and something where he felt comfortable with Coach Fisher and Coach Pruitt who were recruiting [him],' said Tidwell. "So you know there were a couple factors but that was something he decided he wanted to do."
##- Jalen's favorite player growing up was Devin Hester:
“Devin Hester, he liked him more because he was so versatile," said Lamont Ramsey, Jalen's father. "He was a wide receiver and running back also while he was in high school and actually he was ranked pretty high as a wide receiver coming out of high school too. He just liked the versatility that Devin Hester had too.”
Ramsey can also return kicks, per both his father and Redmon.
##- And finally, Lamont may be more nervous than Jalen before every Florida State game:
“I’m real proud of him, very proud but I’m [also] nervous at the beginning of every game, I want him to do so well that you get nervous about it, but very proud of him.”
For all the latest Florida State news and updates follow Patrik Nohe on Twitter... |
/*
* This file is part of the Jikes RVM project (http://jikesrvm.org).
*
* This file is licensed to You under the Eclipse Public License (EPL);
* You may not use this file except in compliance with the License. You
* may obtain a copy of the License at
*
* http://www.opensource.org/licenses/eclipse-1.0.php
*
* See the COPYRIGHT.txt file distributed with this work for information
* regarding copyright ownership.
*/
package org.jikesrvm.compilers.opt.lir2mir;
import org.jikesrvm.compilers.opt.depgraph.DepGraph;
import org.jikesrvm.compilers.opt.depgraph.DepGraphNode;
import org.jikesrvm.compilers.opt.ir.BasicBlock;
import org.jikesrvm.compilers.opt.ir.IR;
import org.jikesrvm.compilers.opt.ir.Instruction;
/**
* A special dependence graph for use by NormalBURS.<p>
*
* All nodes in this graph are NormalBURS_DepGraph nodes.
*/
public class NormalBURS_DepGraph extends DepGraph {
public NormalBURS_DepGraph(IR ir, Instruction start, Instruction end, BasicBlock currentBlock) {
super(ir, start, end, currentBlock);
}
@Override
public DepGraphNode createDepGraphNode(Instruction inst) {
return new NormalBURS_DepGraphNode(inst);
}
}
|
Buena Vista (Washington, D.C.)
Buena Vista is a residential neighborhood in Southeast Washington, D.C., in the United States. Buena Vista is located in Ward 8. The neighborhood is dominated by detached single-family housing and multi-family apartment complexes.
Buena Vista is in a hilly region. Roads in the area follow the topography, with most streets narrow and winding. Buena Vista's high elevation means that the neighborhood has expansive views of downtown Washington, including the U.S. Capitol and the Washington Monument. One of the largest condominium complexes in the neighborhood is Washington View.
Category:Neighborhoods in Southeast (Washington, D.C.) |
Q:
Implementing Int64.ToString without using string
I have a situation where I need to convert a long to a character array without allocating any new objects. I want to mimic what is done in long.ToString() without actually creating a string object, basically - instead the characters will be inserted into a predefined array. I feel like this should be pretty straightforward, but I can't find any examples - everything in C# uses something like ToString or String.Format, everything in C++ uses either stringstream, sprintf, or ltoa. Any ideas?
edit: For a little clarify, this is part of a critical section of frequently called code that cannot withstand garbage collection, hence I don't want to allocate additional strings. The output is actually placed into a byte array - but the receiver of this data expects a byte array of the character representation of this long, so I'm attempting to reduce garbage collection by doing the conversion to string format without allocating a new object.
A:
Thanks to @SLaks for the idea and @gypsoCoder for pointing me to a related answer. This does the trick:
private static byte[] chars = new byte[] { (byte)'0', (byte)'1', (byte)'2', (byte)'3', (byte)'4', (byte)'5', (byte)'6', (byte)'7', (byte)'8', (byte)'9' };
/// <summary>
/// Converts a long to a byte, in string format
///
/// This method essentially performs the same operation as ToString, with the output being a byte array,
/// rather than a string
/// </summary>
/// <param name="val">long integer input, with as many or fewer digits as the output buffer length</param>
/// <param name="longBuffer">output buffer</param>
private void ConvertLong(long val, byte[] longBuffer)
{
// The buffer must be large enough to hold the output
long limit = (long)Math.Pow(10, longBuffer.Length - 1);
if (val >= limit * 10)
{
throw new ArgumentException("Value will not fit in output buffer");
}
// Note: Depending on your output expectation, you may do something different to initialize the data here.
// My expectation was that the string would be at the "front" in string format, e.g. the end of the array, with '0' in any extra space
int bufferIndex = 1;
for (long longIndex = limit; longIndex > val; longIndex /= 10)
{
longBuffer[longBuffer.Length - bufferIndex] = 0;
++bufferIndex;
}
// Finally, loop through the digits of the input, converting them from a static buffer of byte values
while (val > 0)
{
longBuffer[longBuffer.Length - bufferIndex] = chars[val % 10];
val /= 10;
++bufferIndex;
}
}
I should note that this only accepts positive numbers and doesn't do any validation of that or anything else. Just a basic algorithm to accomplish the goal of converting a long to a string to a byte array without allocating any strings.
|
The bridge carrying Deerpath Road traffic over the Reagan Memorial Tollway (I-88) in Aurora, Ill., is scheduled to close for six weeks beginning Sunday night, July 8, to allow for bridge deck rehabilitation as part of the I-88 Rebuild and Widen Project between Deerpath Road and Illinois Route 56.
The bridge is scheduled to close just before midnight on Sunday night, July 8, and a detour will be put in place for Deerpath Road traffic. The detour will direct northbound Deerpath Road traffic east on Sullivan Road, north on Orchard Road and west on Orchard Gateway Boulevard to reach Deerpath Road. Southbound traffic will follow the same detour in reverse.
Bridge work includes full-depth concrete pavement patching, bridge deck overlay and replacement of the concrete protective barriers on the outside edges of the bridge. A full closure is necessary because the bridge is too narrow to accommodate two-way traffic while completing this work.
The Deerpath Road bridge closure was coordinated with the city of Aurora, Kane County and the North Aurora Fire Department. Up to 5,000 vehicles use this bridge daily.
The I-88 Rebuild and Widen Project between Deerpath Road in Aurora and Illinois Route 56 in North Aurora is needed to rebuild the 35-year-old, one-mile-long section of roadway and add a third lane in both directions. The $10.1 million project is scheduled to be complete by late fall. |
Iran proposes new nuclear talks with world powers
By ALI AKBAR DAREINI | December 31, 2011 | 8:15 AM EST
A member of the Iranian military takes position in a drill on the shore of the sea of Oman, on Friday, Dec. 30, 2011. Iran's navy chief has reiterated for a second time in less than a week that his country can easily close the strategic Strait of Hormuz at the mouth of the Persian Gulf, the passageway through which a sixth of the world's oil flows. (AP Photo/YJC, Mohammad Ali Marizad)
TEHRAN, Iran (AP) — Iran has proposed a new round of talks about its controversial nuclear program with the six world powers, the country's top nuclear negotiator said Saturday.
Saeed Jalili said he has formally called on the six powers — the United States, Russia, China, Britain, France and Germany — to return to the negotiating table with Iran.
The invitation comes in the wake of new sanctions recently imposed by the West over Tehran's uranium enrichment program, which is a potential pathway to making nuclear arms.
The last round of negotiations between Iran and the five permanent members of the U.N. Security Council plus Germany in January in Istanbul, Turkey, ended in failure.
The U.S. and some of its allies accuse Iran of using its civilian nuclear program as a cover to develop atomic weapons. Iran has denied the charge, saying the program is for peaceful purposes only and is geared toward generating electricity and producing medical radioisotopes to treat cancer patients.
"We formally declared to them (the intent) to return to the path of dialogue for cooperation," Jalili told Iranian diplomats in Tehran, according to the official IRNA news agency. Jalili did not say when or through what channel he issued the invitation.
However, Iran's ambassador to Germany, Ali Reza Sheikh Attar, said earlier Saturday that Jalili was to send a letter soon to EU's foreign policy chief Catherine Ashton to arrange a new round of talks.
There was no immediate comment from Brussels on Jalili's reported offer.
But it is the latest signal from Tehran that the country appears to be feeling the toll of international sanctions.
The U.N. has imposed four rounds of sanctions on Tehran over the nuclear enrichment, and separately, the U.S. and the European Union have imposed their own tough economic and financial sanctions. Washington's measures target exports of gasoline and other refined petroleum products to Iran and have banned U.S. banks from doing business with foreign banks that provide services to Iran's Revolutionary Guard.
Last month, President Mahmoud Ahmadinejad acknowledged that the current penalties were impeding Iran's financial institutions, saying, "our banks cannot make international transactions anymore."
And earlier in December, Iran reinstated an offer for U.N. nuclear agency officials to visit Tehran, though it did not say whether the International Atomic Energy Agency would be able to focus on suspicions that Iran is secretly working on nuclear arms — a key condition set by the agency.
The U.S. and Israel have not ruled out a military strike against Iran's nuclear facilities if Tehran doesn't stop its nuclear program.
But Jalili warned Tehran would make any aggressor regret a decision to attack Iran.
"We will give a response that will make the aggressor regret any threat against the Islamic Republic of Iran," Jalili said. |
Q:
Expected expression before else statement
I get an error saying Expected expression before my else-statement but I do not know why. I searched through other posts but I cant find a solution.
- (void)setDeviationSize:(double)newDeviation
{
if (newDeviation != 0) {
deviationLayer.lineWidth = 2.0 / newDeviation;
if (newDeviation * pixelPerMeter * scrollView.zoomScale < 2 * cPointRadius) {
deviationLayer.hidden = YES;
} else {
deviationLayer.hidden = NO;
deviationLayer.transform = CATransform3DMakeScale(newDeviation, newDeviation, 0);
}
} else {
deviationLayer.hidden = YES;
} else <---- EXPECTED EXPRESSION {
for(LectureModel* lecture in lectures) {
NSString *title;
if([lecture.title length] > 30) {
title = [NSString stringWithFormat:@"%@...", [lecture.title substringToIndex:30]];
} else {
title = lecture.title;
}
[alert addActionWithTitle:title handler:^(UIAlertAction * _Nonnull action) {
LectureModel* full = [LectureModel findById:lecture.id];
if (UI_USER_INTERFACE_IDIOM() == UIUserInterfaceIdiomPad) {
[self showModelInPopover:full];
} else {
[[TransitionManager shared] openModelInCatalog:full];
}
}
[self presentViewController:alert animated:YES completion:nil];
}
}
}
What am I missing?
A:
Like vadian and luk2302 pointed out you have an if statement with two else attached to it, so the compiler doesn't understand what the second else is related to and throwing the error.
Maybe you wanted something like
if (newDeviation != 0) {
/* do something */
} else if (someCondition) {
/* do something different */
} else {
/* do something else */
}
If this is not the logic you want, please explain what you want to achieve, so we can help you better.
|
cbd oil
As outcomes such as these rise, the utter criminality of Prohibition will turn out to be more evident, and change will come unexpectedly quickly. It’s highly advisable to generate cannabis oil in a lab setting,…continue reading
Cbd Oil Side Effects and Cbd Oil Side Effects – The Perfect Combination Opportunely, anxiety is a state which could be effectively treated with the assistance of all CBD oil. In reality, you can see…continue reading |
Anti-CD22 ligand-blocking antibody HB22.7 has independent lymphomacidal properties and augments the efficacy of 90Y-DOTA-peptide-Lym-1 in lymphoma xenografts.
CD22 is a membrane glycophosphoprotein found on nearly all healthy B-lymphocytes and most B-cell lymphomas. Recent in vitro studies have identified several anti-CD22 monoclonal antibodies (mAbs) that block the interaction of CD22 with its ligand. One of these mAbs, HB22.7, has been shown to effectively induce apoptosis in several B-cell lymphoma cell lines. Lymphoma xenograft studies with Raji-xenograft mice were used to assess the toxicity and efficacy of HB22.7 alone and with combined modality immunotherapy (CMIT) with yttrium (90)Y-DOTA-peptide-Lym-1 radioimmunotherapy (RIT). The effect of the sequence of these agents on the combined treatment was assessed by administering HB22.7 24 hours before, simultaneously with, or 24 hours after RIT. Within the groups treated with RIT alone or with RIT and HB22.7 (CMIT), the reduction in tumor volume was the greatest when HB22.7 was administered simultaneously with and 24 hours after RIT, and in the RIT treatment groups, this translated into the greatest overall response and survival, respectively. Overall survival rates at the end of the 84-day CMIT trial were 67% and 50% in the groups treated with HB22.7 simultaneously and 24 hours after RIT, respectively. This compared favorably with the untreated and the RIT alone groups, which had survival rates of 38% and 43% at the end of the trial. Surprisingly, when compared with untreated controls and all other treatment groups, the greatest cure and overall survival rates were observed in the group treated with HB22.7 alone, with 47% cured and 76% surviving at the end of the 84-day trial. RIT clearance was not affected by treatment with HB22.7. When compared with RIT alone, there was no significant additional hematologic (white blood cell, red blood cell, or platelet count) toxicity when HB22.7 was added to RIT. Nonhematologic toxicity (assessed as change in body weight) was also unchanged when HB22.7 was added to RIT. Thus the anti-CD22 ligand-blocking antibody HB22.7 has independent lymphomacidal properties and augments the efficacy of (90)Y-DOTA-peptide-Lym-1 in lymphoma xenografts without significant toxicity. |
Q:
Is there an "open with" command for the command line?
Does the command line have a way to get a recommended list of programs used to open a particular file, based on the file type? For example, a .pdf file would have an open with... recommendation using the programs Evince and Document Viewer.
I use the command line for most things, but sometimes I forget the name of a program that I want to use to open a particular type of file.
BTW I am using Ubuntu 13.10.
pro-tip
Thanks to @slm 's selected answer below, I made the following bash script in a file called openwith.sh:
xdg-mime query default $(xdg-mime query filetype $1)
Add as an alias or execute directly as an openwith command.
A:
There isn't a command that I've ever seen that will act as "open with..." but you can use the command xdg-open <file> to open a given <file> in the application that's associated with that particular type of file.
Examples
Opening a text file:
$ xdg-open tstfile.txt
$
Resulting in the file tstfile.txt being opened in gedit:
Opening a LibreOffice Writer document:
$ xdg-open tstfile.odt
$
Resulting in the file tstfile.odt being opened in Writer:
What apps get used?
You can use xdg-mime to query the system to find out what applications are associated to a given file type.
$ xdg-mime query default $(xdg-mime query filetype tstfile.txt)
gedit.desktop calibre-ebook-viewer.desktop
$ xdg-mime query default $(xdg-mime query filetype tstfile.odt)
libreoffice-writer.desktop calibre-ebook-viewer.desktop
This is a 2 step operation. First I'm querying for the mime-type of a given file, xdg-mime query filetype tstfile.txt, which will return text/plain. This is then used to perform another lookup to find out the list of applications that are associated with this mime-type. As you can see above I have 2 apps associated, gedit and calibre, for .txt files.
You can use xdg-mime to change the associations too. See man xdg-mime for more details.
A:
Sort of, but it will change your default application as a result. I'm not sure what other operating systems this works on, but the instructions below work for Ubuntu 12.04 - Desktop X86-64. I didn't have any pdf files handy so I tested with a .zip archive.
General Steps
Step #1
In a terminal type:
$ mimeopen -d /home/username/example.zip
screenshot #1 = https://copy.com/qfWSZaZ4FzlA
Step #2
Choose from the list by entering the # of the application you want, and pressing enter. The file will immediately open in the application you chose.
screenshot #2 = https://copy.com/um6Rf7zRdceT
screenshot #3 = https://copy.com/ytwKCqR6nv8i
Notes
Note #1
This changes the default application to the one you choose, and so any time you open that file type it will now open in whatever application you last chose from the list.
A:
If you mostly work on the command line, you could look at a curses-based file manager, like ranger or vifm. Both allow you to define default actions for filetypes.
In vifm, for example, in ~/.vifm/vifmrc you can define associations like so:
" Images
filetype *.jpg,*.jpeg,*.gif,*.tif,*.png,*.bmp sxiv
" Media
filetype *.flv,*.avi,*.mp4,*.mpeg,*.mpg,*.mov,*.ogg,*.ogv,*.mkv mpv
" Web
filetype *.html,*.htm,*.shtml /home/jason/Scripts/vimprobtab.sh
" PDF
filetype *.pdf apvlv
Hitting Enter whith the cursor on any file with one of the defined actions will see it opened by the relevant application. As you can see in the case of .html files, you can trigger a script as well as an application.
|
Introduction
============
Hyperthermia is a type of cancer treatment in which tissue is exposed to high temperatures. Previous studies have shown that high temperatures can damage and kill cancer cells, usually with minimal injury to normal tissues ([@b1-ol-07-03-0764]). As hyperthermia can kill cancer cells and damage proteins and cellular structures, it is able to shrink tumors ([@b1-ol-07-03-0764]--[@b3-ol-07-03-0764]). Conventional hyperthermia cannot precisely focus on tumors and results in fat hyperpyrexia ([@b2-ol-07-03-0764]--[@b4-ol-07-03-0764]). In order to achieve an improved clinical outcome, magnet-mediated hyperthermia was developed to induce localized heating in response to focused radio waves ([@b3-ol-07-03-0764]--[@b4-ol-07-03-0764]). This method has become a novel antitumor therapy. In this method, thermoseeds are implanted inside the tumor, followed by the application of a magnetic field to heat the thermoseeds. As a result, the heat is transferred from the thermoseeds to the surrounding tissue, causing a rise in temperature that is necessary for treating the tumor. Compared with traditional hyperthermia, thermoseed-induced hyperthermia is a reproducible process, which offers the capability to control the local temperature *in vivo* ([@b3-ol-07-03-0764]--[@b4-ol-07-03-0764]).
The abscopal effect, or remote effects, were identified during a study of hyperthermia-induced treatment of tumors. In this phenomenon, local treatment of a tumor can affect tumor growth at distant sites in the body. Previous studies using animal models have demonstrated that hyperthermia treatment for the primary tumor caused the ablation of metastatic tumors ([@b4-ol-07-03-0764]--[@b7-ol-07-03-0764]). Similarly, following the treatment of metastatic tumors, the primary tumor could also be ablated ([@b4-ol-07-03-0764]--[@b7-ol-07-03-0764]).
In 1965, Strauss *et al* ([@b8-ol-07-03-0764]) described the abscopal effect of tumor thermotherapy. Subsequently, it became clear that the immune system was also involved in this phenomenon ([@b4-ol-07-03-0764]--[@b5-ol-07-03-0764]). The magnetite thermoseed-induced hyperthermia method has been applied to investigate the effects of local hyperthermia therapy ([@b4-ol-07-03-0764]--[@b7-ol-07-03-0764]). In our previous study, we showed that magnetic induction of hyperthermia not only promoted local tumor-cell killing, but also significantly induced the metastatic tumor-cell killing effects of radiotherapy in breast cancer ([@b4-ol-07-03-0764]). In the present experiment, we established an experimental model of Walker-256 carcinosarcoma cells in Wistar rats. Sarcomas were chosen, as they are more resistant to radiotherapy and chemotherapy than carcinomas.
The present study aimed to analyze the thermodynamic and antitumor characteristics of magnet-mediated hyperthermia at two different temperature ranges (42--46°C and 50--55°C). We hypothesized that a high therapeutic temperature of magnetic-mediated hyperthermia may improve the effectiveness of hyperthermia treatment on carcinosarcomas.
Materials and methods
=====================
Materials
---------
RPMI-1640 culture medium was purchased from Invitrogen Life Technologies (Carlsbad, CA, USA), calf blood serum was obtained from Sigma-Aldrich (St. Louis, MO, USA) and formaldehyde solution was from Beijing Dongxu Factory (Beijing, China). Immunohistochemistry reagents, mouse anti-proliferating cell nuclear antigen (PCNA) primary antibody, PV6002 secondary antibody and enzyme-linked immunosorbent assay (ELISA) kits for rat interferon (IFN)-γ and interleukin (IL)-2 were purchased from Wuhan Boshide Biological Engineering Co., Ltd. (Wuhan, China), Zhongshan Jinqiao Biotechnology Co., Ltd. (Beijing, China) and Invitrogen Life Technologies, respectively. Flow cytometry reagents, phycoerythrin (PE)-conjugated anti-CD4 and -CD8 single-staining antibodies were provided from Zhongshan Jinqiao Biotechnology Co., Ltd. Thermoseeds, comprised of nickel-copper alloy (72:27%) with a Curie point of 57°C (0.9 mm in diameter and 1.1 cm in length), were fabricated by the Beijing University of Science and Technology (Beijing, China) in cooperation with the Research Laboratory of Metal Physics, Tsinghua University (Beijing, China). This study was approved by the Ethics Committee of Xiangya Medical School of Central South University (Changsha, China).
Equipment
---------
A magnet-mediated prototype machine for clinical care was provided by Shuangping Instrument Technology, Co., Ltd. (Shenzhen, China). The temperature survey and recording system were purchased from Physitemp Instruments Inc. (Clifton, NJ, USA). Other equipment included: Forma™ 3111 CO~2~ incubator (Thermo Fisher Scientific, Inc., Waltham, MA, USA), DL-CJ-1N high performance aseptic laboratory bench (Harbin Donglian Electronic Technology Development Co., Ltd., Harbin, China), electronic balance (Mettler-Toledo Instruments, Columbus, OH, USA), a vernier caliper and a Sigma 3--18K high-speed centrifuge 3--18 K (G&M Scientific, Ltd., Livingston, UK).
Establishment of the experimental animal model
----------------------------------------------
Walker-256 carcinosarcoma cells were purchased from the Institute of Pharmacology, Chinese Academy of Medical Sciences (Beijing, China) and were preserved in liquid nitrogen until use. Forty healthy male Wistar rats (age, 6 weeks; body weight, 110--130 g) were purchased from Beijing Weitong Lihua Laboratory Animal Center (Beijing, China), used under license number SCXK (Beijing) 2007-0001 and housed at a constant temperature of 23±2°C. For routine recovery of cells, the Walker-256 carcinosarcoma cells were centrifuged at 225 × g for 7 min and the supernatant was discarded. The pellet was washed twice in phosphate-buffered saline (PBS), suspended and 1 ml of the suspension was injected into the rat abdominal cavity. For tumor inoculation, ascetic fluid was removed from the rats and centrifuged at 225 × g for 7 min, and the supernatant was discarded. The cells were then resuspended in serum-free RPMI-1640 culture medium, centrifuged at 225 × g for 7 min and the supernatant was discarded. Cell pellets were resuspended in normal saline and counted; cell numbers were adjusted to 1×10^7^ and 2×10^7^ per ml. Cell suspension (0.2 ml) was administered via subcutaneous injection into the hind legs of the rats; the left leg received a higher concentration, whereas the right leg received a lower concentration. After 7--10 days, tumor growth was evident and the rats were randomly divided into five experimental groups.
Experimental groups
-------------------
The rats were randomly divided into three different control groups, groups C, M and T. Group C served as the untreated control group. Group M was the magnetic field control group and was used to compare the magnetic field treatment samples. The magnetic field was applied to the back or shoulder of the rats for 30 min. The thermoseed control group (group T) received two thermoseeds (\~1 cm in length) implanted into the largest tumor on the surface of the shoulder or back of the rat. Group T was not exposed to a magnetic field to heat the thermoseeds. For the two magnet-mediated hyperthermia treatment groups (groups H1 and H2), several thermoseeds were implanted into one of the hind legs of the rats. We then randomly divided the rats into group H1, to which a magnetic field was applied to heat the thermoseeds to 42--46°C for 30 min (Curie point, 57°C), and group H2, in which the thermoseeds were heated to 50--55°C for 10 min (Curie point, 70°C). Between 42 to 45°C, apoptosis is the main form of cell death, when the temperature is \>46°C, the number of necrotic cells is markedly increased. Basic thermal dose biological effects correlate with temperature and time. In order to allow a comparison between the conventional temperature hyperthermia group and the high temperature hyperthermia group, the Arrhenius equation, which describes the correlation between temperature and the chemical reaction rate, was used to calculate the temperature ranges for the two groups which are capable of achieving the biological heating effect at the same level: H1, thermoseeds heated to 42--46°C for 30 min; H2, thermoseeds heated to 50--55°C for 10 min. As these groups are capable of maintaining the same biological effects, they were used in the experiments. All control and experimental groups contained eight rats per group.
Implantation of the thermoseeds
-------------------------------
The thermoseeds (1.0 mm in diameter and 1.0 cm in length) were implanted in parallel and \~0.5 cm apart in a tumor (\~1.5 cm in diameter) in each rat. Following implantation, X-rays were performed to verify the location and direction of the implanted thermoseeds.
Magnet-mediated hyperthermia
----------------------------
The rats were anesthetized with 2% barbital sodium (2.3 ml/kg; Sigma-Aldrich) prior to hyperthermia treatment. The rats were then placed under the magnetic field and the body temperatures were measured rectally.
Rats in group M were exposed to the magnetic field for 30 min; rats in groups H1 and H2 were placed under the magnetic field to ensure that the major axis of the thermoseeds and the reversal magnetic field direction were parallel. Three electric thermocouples were inserted in order to monitor the temperature at the center of the tumor, at the tumor edge and the body temperature, separately. A fixed electric current (50 Hz) was applied to groups H1 and H2 to heat the thermoseeds (for \~2 min to heat to the desired temperature). The treatment was maintained for 30 min for the H1 group and 10 min for the H2 group, respectively.
Pathological observations
-------------------------
Fourteen days after the treatment, four rats were randomly selected from each group and sacrificed by an intrapertoneal injection of barbital sodium (Sigma-Aldrich). The tumors were removed, fixed in 10% formalin and paraffin-embedded sections were prepared. Hematoxylin and eosin staining of the tumor tissue was performed and the pathological changes were visualized under a microscope (Nikon Eclipse Ci-E, Nikon, Beijing, China).
Immunohistochemistry
--------------------
Paraffin-embedded tumor tissues were then examined for PCNA protein expression. Tissue sections (5-μm thick) were prepared and dewaxed using conventional techniques. Sections were incubated in 0.01 mol/l citrate buffer and microwaved for 15 min, after which, they were incubated with an anti-PCNA antibody at 4°C overnight. The subsequent immunohistochemistry steps were performed in accordance with the SP kit instructions. We performed nuclear hematoxylin staining. PCNA expression was detected in the nucleus (brown staining indicated positive cells). We counted the number of positive cells in 10 random high-power fields. The PCNA index was calculated as the number of positive tumor cells divided by the total number of tumor cells.
Flow cytometry for determination of T lymphocyte subsets
--------------------------------------------------------
An additional four rats were randomly selected from each group and sacrificed. Peripheral blood was collected in EDTA-coated tubes and separated into three samples for incubation with CD4^+^ or CD8^+^ antibodies and with one sample as the control (2 μl). The samples were incubated at room temperature in the dark for 20 min and shaken once every 3 min. Samples were then incubated with 1 ml of 1X erythrocyte lysis for 10 min and centrifuged at 626 × g for 2 min. The supernatant was discarded and the pellet was washed twice with PBS containing 2% FBS (Gibco, Beijing, China) and centrifuged at 626 × g for 2 min. The supernatant was discarded and 500 μl of 4% polyformaldehyde was added to the tubes and the samples were analyzed by flow cytometry (F500, Beckman-Coulter, Inc., Beijing, China).
Assessment of tumor growth and rat survival time
------------------------------------------------
A vernier caliper was used to determine the mean diameter of the tumors every 2 days. The tumor's largest diameter was measured in horizontal (a) and vertical (b) directions. The tumor volume was calculated as follows: V = (a × b^2^)/2. Subsequently, tumor growth curves were calculated for each group of rats. Changes in the survival were compared based on the number of days each group of tumor-bearing rats survived.
Data processing and statistical analysis
----------------------------------------
We used SPSS software, version 10.0 (SPSS, Inc., Chicago, IL, USA) for data processing and statistical analysis. The size of the tumor in each group was compared using analysis of variance and data are expressed as the means ± standard deviation. The CD4^+^, CD8^+^, CD4^+^/CD8^+^ subsets were analyzed by the log-rank test with two-sided P-values. P\<0.05 was considered to indicate a statistically significant difference.
Results
=======
Effects of applying an alternating magnetic field to thermoseeds on local temperature
-------------------------------------------------------------------------------------
By using the different Curie temperatures of the thermoseeds, it was possible to increase the temperature within the tumor to 46 or 50°C within 5 min. By controlling the electric current of the alternating magnetic fields, we were able to maintain the temperature within the ranges of 42--46°C and 50--55°C. For the H1 and H2 groups, the rectal temperature was maintained at 35--37°C ([Fig. 1A and B](#f1-ol-07-03-0764){ref-type="fig"}).
Effects of hyperthermia treatment on tumor growth in rats
---------------------------------------------------------
Following thermal treatment, tumor growth on both sides of the rats was inhibited in the H1 and H2 groups. We measured the tumor diameter every 2 days to determine the growth curves of the tumors on both sides. We identified that compared with groups C, M and T, tumor growth in groups H1 and H2 was significantly inhibited (P\<0.05) ([Table I](#tI-ol-07-03-0764){ref-type="table"}). Furthermore, compared with the control group, the inhibition of tumor growth was more effective in the H2 group than in group H1 (P\<0.01). However, there were no significant differences in tumor growth between groups C, M and T (P\>0.05) ([Fig. 1C and D](#f1-ol-07-03-0764){ref-type="fig"}, [Table I](#tI-ol-07-03-0764){ref-type="table"}).
Histological observation
------------------------
In the control group, the tumor tissues on both sides contained typical tumor cells; the nuclei were large and deeply stained. Tumor cells were mostly round or oval-shaped, showing expansive growth. The tumor showed vascular invasion in the control group ([Fig. 2A1 and B1](#f2-ol-07-03-0764){ref-type="fig"}). In the H1 group, tumor cells, which were directly exposed to heat, exhibited large areas of necrosis and karyorrhexis. On the unheated side, necrosis of the tumor cells was also visible ([Fig. 2C1 and D1](#f2-ol-07-03-0764){ref-type="fig"}). In the H2 group, tumor cells also showed a large area of necrosis. Notably, the unheated side exhibited increased necrosis compared with that of the heated side ([Fig. 2E1 and F1](#f2-ol-07-03-0764){ref-type="fig"}).
Immunohistochemistry
--------------------
Compared with groups C, M and T, the PCNA index was significantly decreased in the H1 and H2 groups (P\<0.05). In addition, compared with the H1 group, the PCNA index in the H2 group was significantly decreased (P\<0.01), but there were no significant differences in the PCNA indexes between groups C, M and T (P\>0.05) ([Table II](#tII-ol-07-03-0764){ref-type="table"}, [Figs. 2A2--F2](#f2-ol-07-03-0764){ref-type="fig"} and [3A](#f3-ol-07-03-0764){ref-type="fig"}).
Flow cytometry of T lymphocyte subpopulations
---------------------------------------------
Results of the flow cytometry for subpopulations of T lymphocytes are shown in [Fig. 3B](#f3-ol-07-03-0764){ref-type="fig"}. We demonstrated that the levels of CD4^+^ and CD8^+^ were significantly increased in the H1 and H2 groups compared with those of the three control groups; the increase in CD8^+^ cells was higher than that of the CD4^+^ cells. The CD4^+^/CD8^+^ ratio decreased in the H1 and H2 groups compared with that of the control groups. CD8^+^ T cells play a major role in immune regulation, particularly in the cytotoxic response to tumor tissues. The ratio of CD4^+^/CD8^+^ T lymphocyte subsets in the H1 and H2 groups was significantly increased (particularly in the H2 group) compared with that of groups M and C. There were also significant differences in the ratio of CD4^+^/CD8^+^ T lymphocytes between the H1 and H2 groups ([Table III](#tIII-ol-07-03-0764){ref-type="table"}).
Cytokine levels
---------------
The cytokine levels in the five groups are shown in [Fig. 3B](#f3-ol-07-03-0764){ref-type="fig"}. The levels of IFN-γ and IL-2 were significantly higher in the H1 and H2 groups compared with those of the three control groups (P\<0.05). A significant difference was also identified between groups H1 and H2 (P\<0.01) ([Table IV](#tIV-ol-07-03-0764){ref-type="table"}); the levels of IFN-γ and IL-2 in the H2 group were higher than those in the H1 group ([Fig. 3B](#f3-ol-07-03-0764){ref-type="fig"}). These results indicated that magnetic-induced hyperthermia can stimulate the immune system to release cytokines.
Effects on the survival of the rats after treatment
---------------------------------------------------
The mean survival of groups C, M and T was 27.33±1.40, 42.10±4.10 and 37.40±3.00 days, respectively. There were no significant differences between the three control groups (P\>0.05). Compared with group C, the survival time of the rats in the H1 and H2 groups was significantly prolonged (P\<0.05). The mean survival time in the H1 and H2 groups was 58.90±7.12 and 83.30±8.30 days, respectively, which were significantly different ([Fig. 4](#f4-ol-07-03-0764){ref-type="fig"}).
Discussion
==========
Magnet-mediated hyperthermia is the process of directly implanting thermoseeds into tumors and then increasing the temperature by alternating the magnetic field through the Neel relaxation mechanism. When exposed to a magnetic field, the implanted thermoseeds can be specifically heated. The heat can then be transferred to surrounding tissues and used to increase the temperature of the tumor tissue, while leaving the normal tissue mostly unaffected. To date, magnet-mediated hyperthermia may have several advantages over the conventional techniques currently employed for regional hyperthermia, including radiofrequency, microwave or ultrasound methods, which are often limited by their inability to selectively target tumor tissue. Moreover, the temperature during hyperthermia can be controlled by altering the intensity of the magnetic field, which can solidify the tumor without damaging the surrounding normal tissue. The majority of previous clinical research regarding hyperthermia treatment has focused on its effects for prostate cancer and brain cancer ([@b9-ol-07-03-0764]--[@b10-ol-07-03-0764]).
Izawa *et al* ([@b11-ol-07-03-0764]) demonstrated thermotherapy experiments at 60°C for bone tumors. An induction activity of albumen occurred in terms of bone shape, but there was no change within 10 h. Therefore, in order to treat bone tumors and kill the tumor cells, it was vital to maintain temperatures at 50--65°C for 30 min. A number of biological mechanisms have been proposed to explain these effects, in particular the role of T cells, which are closely associated with the function of natural killer (NK) cells and cell factors. It has been suggested that the p53 gene is particularly important and can stimulate inflammatory pathways to release tumor antigen and inflammatory factors, which stimulate cell death. In addition, lymphocytes, including NK cells, bind with the tumor antigens and play a major role in stimulating the abscopal effect ([@b5-ol-07-03-0764],[@b12-ol-07-03-0764],[@b13-ol-07-03-0764]). Experiments focusing on the abscopal effect are increasing in scope and corresponding changes in treatment options may introduce novel treatment methods that will greatly aid the current techniques of tumor therapy. Previous studies have reported that thermotherapy directly damages tumor cells; however, it can also stimulate the immune system to inhibit or dispel the microenvironment of the tumor and introduce antitumor immunity ([@b14-ol-07-03-0764]--[@b16-ol-07-03-0764]). Currently, it has been indicated that hyperthermia stimulates the re-emergence of immunity via the activity of heat shock protein (HSP), which is important in antigen processing, antigen binding and the formation of tumor HSP-peptide complexes. As a result of the formation of HSP-peptide complexes with major histocompatibility complex class I molecules, macrophage processing can occur and the cells become available for cytotoxic T cell recognition and, thus, generate specific immunity ([@b17-ol-07-03-0764]--[@b20-ol-07-03-0764]). It has previously been demonstrated that hyperthermia significantly increased the levels of CD4^+^ and CD8^+^ T cells compared with those of the control group, although the CD4^+^/CD8^+^ ratio was lower in the hyperthermia groups than that of the control group ([@b21-ol-07-03-0764]). In the present study, we focused on the ectopic effects of hyperthermia on the growth of carcinosarcomas and the resulting effects on the immune system. As characterized by the increased levels of CD4^+^ and CD8^+^ cells and the elevated levels of IFN-γ and IL-2, we found that hyperthermia stimulated a specific immune response and enhanced the cellular immune function. The results also showed that by applying localized hyperthermia, particularly at 50--55°C, the growth of Walker-256 hypodermic sarcomas was inhibited, with ideal abscopal effects and upregulation of the immune system. The results showed that the application of magnet-mediated hyperthermia was an effective treatment for carcinosarcomas, particularly at 50--55°C. At this temperature, the growth of the primary and ectopic tumors was better controlled compared with that of hyperthermia treatment at 42--46°C. Moreover, hyperthermia at 50--55°C improved the CD4^+^/CD8^+^ ratio, further improved the cellular immune function and increased the level of immune factors, fully stimulating the organism's antineoplastic immune response to inhibit the primary tumor and ectopic metastases.
In conclusion, the use of magnet-mediated hyperthermia offers an exciting and novel therapeutic approach for carcinosarcomas. Magnet-mediated hyperthermia induced the direct ablation of the target tumor, which was achieved by the heated thermoseeds and the abscopal effect with induction of the endogenous antitumor immunity. In this study, we investigated the effects of two temperatures using magnetic induction, which suppressed the growth of the carcinosarcoma. We found that the inhibition of tumor growth was greater in rats exposed to temperatures of 50--55°C for 10 min compared with that in rats exposed to 42--46°C for 30 min. We identified that magnet-mediated hyperthermia was effective in treating carcinosarcomas at a high temperature (50--55°C) for 10 min and improved the abscopal antitumor effects as well as stimulating significant endogenous immune responses in sarcoma-bearing rats.
This study provided novel data indicating that magnet-mediated hyperthermia can improve abscopal antitumor effects and stimulate more significant endogenous immune responses in sarcoma-bearing rats at the higher temperature of 50--55°C.
This study was supported by a the National Natural Science Foundation of China (grant nos. 10775085 and 30571779), the Science Committee Fund of Beijing (grant no. Z07000200540704) and the Yuyuan Fund of Tsinghua University (grant no. 20240000519).
{#f1-ol-07-03-0764}
{#f2-ol-07-03-0764}
{#f3-ol-07-03-0764}
{#f4-ol-07-03-0764}
######
Tumor size in each experimental group (n=10 per group).
Day
---- ------------ ----------- ----------- -------------------------------------------------------- -------------------------------------------------------- -------------------------------------------------------- -------------------------------------------------------- --------------------------------------------------------
C Left side 3.33±0.75 6.64±1.52 8.61±0.71 13.62±1.71 14.89±1.96 15.51±1.64 18.33±1.43
Right side 1.66±0.39 3.33±1.05 6.88±1.80 9.46±0.57 11.90±0.85 14.68±0.99 15.79±0.97
M Left side 2.86±0.42 4.88±0.44 8.37±0.55 14.19±1.16 16.32±1.24 18.15±1.28 19.35±0.41
Right side 2.86±0.42 4.72±0.43 7.94±0.27 12.52±0.64 14.67±0.81 16.86±0.79 18.70±0.91
T Left side 3.72±0.28 5.04±0.42 8.76±0.43 14.75±2.43 17.85±1.46 18.85±1.56 20.08±0.94
Right side 3.12±0.45 4.45±0.51 8.24±0.38 14.95±0.56 17.31±1.10 19.02±0.58 20.53±0.43
H1 Left side 2.98±0.35 2.74±0.48 2.18±0.31 2.27±0.14[a](#tfn1-ol-07-03-0764){ref-type="table-fn"} 2.64±0.22[a](#tfn1-ol-07-03-0764){ref-type="table-fn"} 2.78±0.13[a](#tfn1-ol-07-03-0764){ref-type="table-fn"} 2.45±0.22[a](#tfn1-ol-07-03-0764){ref-type="table-fn"}
Right side 2.44±0.36 2.12±0.50 2.48±0.25 2.42±0.17 2.21±0.16[c](#tfn3-ol-07-03-0764){ref-type="table-fn"} 1.78±0.16[c](#tfn3-ol-07-03-0764){ref-type="table-fn"} 1.31±0.07[c](#tfn3-ol-07-03-0764){ref-type="table-fn"}
H2 Left side 2.18±0.41 2.03±0.33 1.62±0.34 1.22±0.30 1.10±0.31[a](#tfn1-ol-07-03-0764){ref-type="table-fn"} 0.91±0.27[a](#tfn1-ol-07-03-0764){ref-type="table-fn"} 0.60±0.13[b](#tfn2-ol-07-03-0764){ref-type="table-fn"}
Right side 1.87±0.39 1.81±0.13 1.75±0.16[c](#tfn3-ol-07-03-0764){ref-type="table-fn"} 1.25±0.41[c](#tfn3-ol-07-03-0764){ref-type="table-fn"} 1.20±0.14[c](#tfn3-ol-07-03-0764){ref-type="table-fn"} 1.12±0.03[c](#tfn3-ol-07-03-0764){ref-type="table-fn"} 0.43±0.17[d](#tfn4-ol-07-03-0764){ref-type="table-fn"}
P\<0.05 and
P\<0.01, left side vs. group C;
P\<0.05 and
P\<0.01, right side vs. group C.
Group C, untreated control; group M, magnetic field control; group T, thermoseed control; group H1, thermoseeds heated to 42--46°C for 30 min; group H2, thermoseeds heated to 50--55°C for 10 min.
######
PCNA index in each group (n=10).
Groups PCNA index (mean ± SD)
-------- ---------------------------------------------------------
C 88.12±2.69
T 89.86±1.24
M 89.63±1.87
H1 65.15±3.93[b](#tfn7-ol-07-03-0764){ref-type="table-fn"}
H2 49.55±2.62[b](#tfn7-ol-07-03-0764){ref-type="table-fn"}
P\<0.05 and
P\<0.01 vs. group C.
PCNA, proliferating cell nuclear antigen. Group C, untreated control; group T, thermoseed control; group M, magnetic field control; group H1, thermoseeds heated to 42--46°C for 30 min; group H2, thermoseeds heated to 50--55°C for 10 min.
######
Flow cytometry for subpopulation of T lymphocytes.
Groups CD4+T (%) CD8+T (%) CD4+T/CD8+T (%)
-------- ---------------------------------------------------------- ---------------------------------------------------------- ---------------------------------------------------------
M 39.56±0.59 34.61±0.93 1.14±0.04
C 26.01±2.68 61.07±2.04 0.43±0.04
H1 38.36±1.36[a](#tfn9-ol-07-03-0764){ref-type="table-fn"} 50.96±2.17[a](#tfn9-ol-07-03-0764){ref-type="table-fn"} 0.75±0.03[a](#tfn9-ol-07-03-0764){ref-type="table-fn"}
H2 62.21±1.77[b](#tfn10-ol-07-03-0764){ref-type="table-fn"} 45.32±1.63[b](#tfn10-ol-07-03-0764){ref-type="table-fn"} 1.37±0.02[b](#tfn10-ol-07-03-0764){ref-type="table-fn"}
P\<0.05 and
P\<0.01 vs. group C.
Group M, magnetic field control; group C, untreated control; group H1, thermoseeds heated to 42--46°C for 30 min; group H2, thermoseeds heated to 50--55°C for 10 min.
######
Level of cytokines in each group.
Groups IFN-γ IL-2
-------- ----------------------------------------------------------- ----------------------------------------------------------
M 71.37±0.94 18.72±0.36
C 49.91±2.71 16.71±1.61
H1 77.33±1.83[a](#tfn12-ol-07-03-0764){ref-type="table-fn"} 28.97±2.03[b](#tfn13-ol-07-03-0764){ref-type="table-fn"}
H2 107.74±2.93[b](#tfn13-ol-07-03-0764){ref-type="table-fn"} 40.41±2.44[b](#tfn13-ol-07-03-0764){ref-type="table-fn"}
P\<0.05 and
P\<0.01 vs. group C.
IFN-γ, interferon-γ; IL-2, interleukin-2; group M, magnetic field control; group C, untreated control; group H1, thermoseeds heated to 42--46°C for 30 min; group H2, thermoseeds heated to 50--55°C for 10 min.
[^1]: Contributed equally
|
Q:
What does the following dmesg output means?
I am not sure what does this following means:-
[ 0.652039] ACPI: Added _OSI(Module Device)
[ 0.652044] ACPI: Added _OSI(Processor Device)
[ 0.652049] ACPI: Added _OSI(3.0 _SCP Extensions)
[ 0.652054] ACPI: Added _OSI(Processor Aggregator Device)
[ 0.656286] ACPI: EC: Look up EC in DSDT
[ 0.660361] ACPI: Executed 1 blocks of module-level executable AML code
**[ 0.720310] [Firmware Bug]: ACPI: BIOS _OSI(Linux) query ignored**
[ 0.721539] ACPI: SSDT 000000009ce70798 00727 (v01 PmRef Cpu0Cst 00003001 INTL 20100121)
[ 0.722623] ACPI: Dynamic OEM Table Load:
[ 0.722630] ACPI: SSDT (null) 00727 (v01 PmRef Cpu0Cst 00003001 INTL 20100121)
[ 0.752832] ACPI: SSDT 000000009ce71a98 00303 (v01 PmRef ApIst 00003000 INTL 20100121)
What kind of bug is this? Does this bug affects my system performance.
A:
The ACPI tables (DSDT, SSDT) are provided by the BIOS. These ACPI tables allows the OS the control the hardware through an abstraction layer (ACPI). Manufacturers can use the ACPI _OSI method (Operating System Interfaces) to query the OS for certain capabilities.
Through this mechanism, ACPI can detect the OS (and version) and apply some quirks if necessary. This is especially useful for Windows machines as newer features of a machine may not be supported by older Windows versions. However, in Linux, the philosophy is that if a feature is not supported by the Linux kernel, exclusions should not be made by the BIOS manufacturer. Instead, the community (kernel developers) have to add code to support those features from newer machines.
In the past, some BIOS manufacturers removed features if they detect a Linux system. While a feature may not be supported at the time of the BIOS release, in the future, it could. Because of that, queries for "Linux" are ignored.
A:
For what I can understand it means that a query from the Bios/Firmware related to the ACPI (If you are running a laptop it means the battery, if you are running a Desktop PC it means a UPS or similar) is not recognized.
What Ubuntu did there was ignore the query to not cause problems. Some of the stuff you might see because of this are:
Ubuntu battery state does not detect when the battery has been disconnected. Showing you still the same "Battery Connected" symbol.
Battery charging notification is not updated correctly.
This does not mean the battery will not charge correctly, or that it did not detect the state of the battery correctly, it just means that in the Desktop you will not see it correctly. This does not even mean it will not show correctly to you.
For performance related stuff, you will not suffer any performance problems. It will be running the same as always.
Basically this comes from a BIOS, first assuming that the OS is Windows and then doing a query to it to confirm some information.
Anyway don't worry about it, Ubuntu and any other Linux distro can effectively just tell the BIOS that it is in fact Windows and get the correct query from it. Dmesg and the booting system just post that message there to notify you about the BIOS asking something to the OS (Remember, it is assuming is Windows) and Linux trying to fake it so the BIOS sends the complete query. This is a reason why BIOS manufacturers should not assume that the only hardware they will work on is Windows.
|
Q:
Reshape 2D to 5D array in Matlab
I have a set of data that is 2D (M*N). The array covers rectangular grid points and contains various data with respect to time. The data is written as:
x1 y1 t1 a b c ...
x2 y1 t1 a b c ...
. . . . . . ...
x50 y1 t1 a b c ...
x1 y2 t1 a b c ...
x2 y2 t1 a b c ...
. . . . . . ...
x50 y2 t1 a b c ...
. . . . . . ...
x50 y40 t1 a b c ...
x1 y1 t2 a b c ...
.
.
.
x50 y40 t30 a b c ...
So the array advances x whilst keeping y fixed and writes the data at that point. Y is stepped to the next value, x is advanced, and the data is written. This writing pattern is repeated after the last grid point and time advances. In total, there are 9 cases of such arrays.
I'd like to convert this 2D matrix into a 5D array of such:
X , Y , DATA , TIME , CASE
So it would be 50 axial grid points, by 40 vertical grid points, by 15 sets of data at each point (x,y,time,a,b,c,etc.), by 30 time stamps, by 9 cases.
I've been playing with the reshape function in Matlab, but it just seems to be impossible to get the array reshaped into the way I would like it to be.
Could anyone provide assistance, please? Thanks!
A:
So it seems I found the answer. I tried a much smaller array and it turned out that the way to organise the reshape elements was to put it as:
B = reshape(A, [X Y TIME DATA CASE])
And then the it was a matter of permutation to get the array re-arranged to X, Y, Data, Time, Case.
B = reshape(B, [1 2 4 3 5])
|
Q:
Converting newline formatting from Mac to Windows
I need a conversion utility/script that will convert a .sql dump file generated on Mac to one readable on Windows. This is a continuation of a problem I had here. The issue seems to be with newline formatting in text files, but I can't find a tool to make the conversion...
A:
Windows uses carriage return + line feed for newline:
\r\n
Unix only uses Line feed for newline:
\n
In conclusion, simply replace every occurence of \n by \r\n.
Both unix2dos and dos2unix are not by default available on Mac OSX.
Fortunately, you can simply use Perl or sed to do the job:
sed -e 's/$/\r/' inputfile > outputfile # UNIX to DOS (adding CRs)
sed -e 's/\r$//' inputfile > outputfile # DOS to UNIX (removing CRs)
perl -pe 's/\r\n|\n|\r/\r\n/g' inputfile > outputfile # Convert to DOS
perl -pe 's/\r\n|\n|\r/\n/g' inputfile > outputfile # Convert to UNIX
perl -pe 's/\r\n|\n|\r/\r/g' inputfile > outputfile # Convert to old Mac
Code snippet from:
http://en.wikipedia.org/wiki/Newline#Conversion_utilities
A:
This is an improved version of Anne's answer -- if you use perl, you can do the edit on the file 'in-place' rather than generating a new file:
perl -pi -e 's/\r\n|\n|\r/\r\n/g' file-to-convert # Convert to DOS
perl -pi -e 's/\r\n|\n|\r/\n/g' file-to-convert # Convert to UNIX
A:
You can install unix2dos with Homebrew
brew install unix2dos
Then you can do this:
unix2dos file-to-convert
You can also convert dos files to unix:
dos2unix file-to-convert
|
HTTPS (SPDY) is faster than HTTP - wspeirs
http://www.httpvshttps.com/
======
christop
This website is basically a fancier version of
[https://http2.golang.org/gophertiles](https://http2.golang.org/gophertiles)
While cool, both websites are making an unfair comparison to the way that
HTTP/1.1 is normally deployed for such sites, as neither demo uses hostname
sharding.
------
infogulch
I noticed that for https in chrome the images load (mostly) in order, whereas
for http they're loaded in random order. However in firefox both cases load in
order.
Why does chrome load resources in random order in http?
------
dang
[https://news.ycombinator.com/item?id=8682883](https://news.ycombinator.com/item?id=8682883)
~~~
wspeirs
As the one who submitted this link... I'm curious why HN didn't simply point
me to the original post? Sorry for double-posting :-\
~~~
dang
Had you used an identical URL, it would have. Beyond that, we leave the dupe
detector fairly weak so that good stories have multiple chances to get
attention.
Better duplicate detection is one thing we hope to work on fairly soon.
------
silentbits
Firefox HTTP: 3.239 s Chrome HTTP: 11.209 s It cheated...
~~~
infogulch
In chrome I get http: 3.2-3.9s, https: 1.8-2.6s. Try it a couple more times,
maybe it was a fluke.
Edit: And for firefox: http: 2.6-3.8, https: 2.9-3.8.
Edit2: Changed times to ranges.
|
5 Benefits Of Regular Horse Stance Training
For most individuals concerned in judo, from learners to seasoned veterans, the throwing expertise are the most fascinating and thrilling part of the game. This diploma is a versatile 84-credit score program that provides students the chance to expertise different inventive strategies and abilities whereas developing a biblical worldview of the humanities. This fall or spring, consider a 4 day leadership, sports, and outdoor skills camp in your grade 7’s or 8’s.
Despite the separation of sport and the humanities in government and popular considering, numerous current initiatives at local degree present what will be achieved by bringing them collectively. You simply comply with the foundations and that’s it, nothing else that involves creativity or creativeness in contrast to artwork, music, dance, drama, and literature.
Such examples are Justin Timberlake’s “Sexyback”, Michael Jackson’s “Thriller”, BYU’s “Tremendous Mario Bro.’s Melody”, and “Come Fly With Me” as carried out by Realtime quartet. In sports and humanities we also offer Management and STEM. I am not biased, in actual fact I hate sports with a passion, however it’s clear enough to know that all the pieces and something is artwork and music.
There are countless forms of so-referred to as graffiti, much as there are many types of other artwork varieties, it can be massive or small, express or implicit, contentious, partaking, or don’t have any actual which means in any respect except to the artist who now has a platform to display their work; it has endured and grown, despite the concern of retribution, and will seemingly proceed to flourish as a brand new art of the streets.
It can present a powerful basis of data and expertise focusing on creativity, downside fixing strategies, entrepreneurship, biblical hospitality and transformational management abilities to arrange college students for future management roles. |
Colleges Can be Liable for Student Assault, Harassment
When a college student is victimized by a fellow student, our Asheville personal injury lawyers believe it’s important to analyze whether the school’s response was appropriate, and whether the institution failed in its duty to take preventative measures.
Title IX of the Education Amendments of 1972 is a federal civil rights law that bars discrimination on the basis of sex in any education program or activity in schools that receive money from the federal government. Statutorily, sex discrimination can include sexual harassment, rape and sexual assault. When a school knows about and ignores sexual harassment or assault in its programs, it can be held responsible and compelled to pay damages to the victim.
The legal standard used to prove this is called “deliberate indifference.” However, this can be a high standard of proof, as the language is broad in a way that can shield schools from culpability. This was illustrated recently in the case of Roe v. St. Louis University, et al., reviewed by the U.S. Court of Appeals for the Eighth Circuit. We share this not to discourage victims, but to stress the importance of seeking counsel from a firm with a high degree of experience.
In this case, a student who was attending school on an athletic scholarship had suffered an injury and was performing poorly in her classes at the time the alleged sexual assault occurred involving another student at an off-campus fraternity house. This information is relevant for the fact that soon after she reported the assault to her coaches, she was removed from her sports team for failure to attend classes, per the terms of her academic probation.
She subsequently left school and did not return. Police launched an investigation, but no criminal charges were filed.
She and her parents later filed a lawsuit against the school (as well as the national and local chapters of the fraternity) alleging, among other things, deliberate indifference to her allegations of assault.
Summary judgement by the district court in favor of the fraternity chapters and the school was later challenged on appeal. The U.S. Court of Appeals for the Eighth Circuit upheld the ruling, however, offering up an extensive explanation of what is required to prove deliberate indifference, and how this plaintiff failed to prove it.
In order for an institution’s actions to be deemed deliberately indifferent, the plaintiff has to show that the school either caused the harassment or made students vulnerable to it. The plaintiff needs to prove that the school had substantial control over both the harasser (or attacker) and the context in which the known harassment occurs.
Schools defending themselves in these cases have to show that they have responded to known harassment in a way that is “not clearly unreasonable.”
The court cited the case of Davis ex rel. LaShonda D. v. Monroe Cnty. Bd. of Educ., wherein students successfully sued on these grounds. There, the plaintiffs were able to show that the school failed to respond in any way over the course of five months to complaints regarding sexual harassment by another student.
In this case, the school asserts it was not indifferent to the plaintiff, and that staffers set up a meeting as soon as they learned of the incident and provided her with information on how to report the case to police and referred her to the campus counselor who handles sexual assault allegations.
The university’s response, the court concluded, was appropriate given the circumstances.
However, too often, this is not the case. Under Title IX, colleges must respond to allegations of sexual assault, even if prosecutors don’t. |
Opinionista• Bantu Holomisa • 24 March 2016
A conflicted ANC cannot probe itself
The ANC is undermining the intelligence of the South African people. Having Zuma lead an investigation into the Guptas' influence on government is tantamount to inviting the sheep to a meeting with the jackals to find a solution.
The African National Congress’s National Executive Committee (NEC) has simply swapped the Gupta corrupt influence over government under the carpet. The decision to investigate the Guptas’ allegedly corrupt behaviour by the office of ANC Secretary-General Gwede Mantashe, following a meeting that would be held between the Gupta family and ANC top brass led by the Guptas’ friend, President Jacob Zuma, is undermining the intelligence of the South African people.
It is like inviting the sheep to a meeting with the jackals to discuss the slaughtering of the sheep.
The ANC through its government and State-Owned Enterprises (SOEs) is feeding this family with huge tenders and business and in turn they benefit fromthe same family. The ANC is therefore conflicted and cannot be trusted with investigating this matter.
Until the recent past, when for the first time the Minister of Finance pulled the plug on the Guptas’ breakfast cash cow, all ANC ministers were frogmarched to these shows, manipulating SABC airtime to promote ANC propaganda. State-Owned Enterprises such as Transnet, Denel, Telkom, Eskom and others have been funding these shows while the SABC’s revenue has been on the losing end. It will be interesting also to investigate how these decisions are taken to fund the Gupta-owned New Age newspaper’s breakfast shows.
Interestingly, this family was once branded as investors into our country, yet little is known of their investment and business success back in their country of origin, India. Instead we are told that they owe some of our development institutions such as the Industrial Development Corporation (IDC).
I hope they have not joined or are not driving the apparent looting spree of the workers’ pensions in the Public Investment Corporation, helped by the same ANC which seeks to investigate its shenanigans.
As the United Democratic Movement (UDM), we suggested to the Speaker of the National Assembly that this matter be placed before the Joint Portfolio Committee on Intelligence for thorough investigation.
At best, and if the leadership of the ANC was serious about fighting corruption, they should have considered this suggestion and even asked the office of the public protector to conduct an investigation.
Their failure to provide leadership to society threatens sustainable economic development, ethical values, justice and the rule of law. Corruption has been damaging to the country’s reputation and is creating obstacles to local and foreign direct investment.
Clearly, the ANC has forgotten about key principles of good governance which include honesty, transparency, responsiveness and accountability.
For this reason, the electorate should punish them heavily come election day. DM |
4979
Put together 680034.09 and -1610588.
-930553.91
Subtract 1645447.4 from 18742658.
17097210.6
Add together -3.4022 and -59851418.
-59851421.4022
30322396074.6+18
30322396092.6
Calculate -3280416153 - -3825.
-3280412328
What is the distance between -83 and -41809.146?
41726.146
Add -0.134 and -0.057413818098.
-0.191413818098
What is 0.271 + 296.1495469?
296.4205469
Work out -5473 + 24732216.
24726743
What is 1.6730068 take away 15444?
-15442.3269932
0.2+-118250292499
-118250292498.8
Work out -19833.347653838 + -0.1.
-19833.447653838
What is 207288 less than 26245?
-181043
-12361213241491 + 0.03
-12361213241490.97
Put together -4984037.7853 and 1.132.
-4984036.6533
-0.499 + -444126415
-444126415.499
Calculate 24259 - -11180.8625.
35439.8625
What is the distance between 6068191 and -0.0140315?
6068191.0140315
Sum 251777031712 and 19.
251777031731
What is -74 minus -381859974?
381859900
What is -1693.9978 + -0.016097?
-1694.013897
What is 0.0757112 minus 1662362?
-1662361.9242888
What is 0.5 minus -29719004506330?
29719004506330.5
What is -174 take away -13.708549568?
-160.291450432
Add -46.37043947 and -2525.
-2571.37043947
What is 545 less than 5.70036883?
-539.29963117
What is 0.28 minus 13409492093?
-13409492092.72
Subtract -47 from -27229.4065321.
-27182.4065321
What is -0.3 + -78489.33861?
-78489.63861
What is the difference between -211.8624973 and -472?
260.1375027
What is 517 plus 2.2297231667?
519.2297231667
Subtract -11169.3195 from -2.421684.
11166.897816
Work out -378593268.4 - 12.
-378593280.4
-204.77+-3337375
-3337579.77
Calculate 1043145780 + -90.044.
1043145689.956
What is -34099899368226 plus 0.4?
-34099899368225.6
-1.03 - -36845.006
36843.976
425155711011+-0.1
425155711010.9
What is 49198353853 less than 2180?
-49198351673
What is -3486720.672 plus -0.43?
-3486721.102
Subtract 3 from -228820840466.
-228820840469
Add together -5763577618 and -169.
-5763577787
Calculate -5 + 482395266243.
482395266238
-28 + 12364287.04391
12364259.04391
Add together -24.8988248 and -32.942.
-57.8408248
-0.3+-0.0369673266009
-0.3369673266009
Work out -522 - 0.32151981218.
-522.32151981218
What is the distance between 17354495 and -23676794?
41031289
Calculate 15133 - 828966970.
-828951837
What is 31398.92 minus -2.05482?
31400.97482
Total of 415.65 and 117329.4.
117745.05
Work out 8209700 + -28415.
8181285
What is 155206171173 plus 0.5?
155206171173.5
What is the difference between -51512708423740 and 2?
51512708423742
What is 8024828 less than 0.211907102?
-8024827.788092898
What is 2753.19 less than -2719.502?
-5472.692
-1.69 - 15217387.9
-15217389.59
What is -23275284332 - -4?
-23275284328
Work out -3637.833 + -1051032.
-1054669.833
1914389115835+-0.01
1914389115834.99
Sum 659112964136753 and -0.1.
659112964136752.9
Add together -473 and -3010590471658.
-3010590472131
What is the difference between -5586 and -2096674843?
2096669257
0.4 + -31601028125364
-31601028125363.6
Put together -129.007525 and 2339.
2209.992475
Sum 4868864146 and -292.6.
4868863853.4
What is 654 - -0.10653882537?
654.10653882537
Sum -35249267781092 and 1.7.
-35249267781090.3
Add together -0.157 and -1356825110.
-1356825110.157
Total of 1532881531 and 112.
1532881643
Subtract -26 from -0.591214091.
25.408785909
Total of 7.1023288648 and 147.
154.1023288648
-71217220 + -4.9364
-71217224.9364
Subtract -0.4 from 1.77885668857417.
2.17885668857417
What is 1.6 less than -23052919956?
-23052919957.6
What is 126.488 take away 203221124?
-203220997.512
Work out -1120 + -55141556.96.
-55142676.96
What is -58905938 minus 31557?
-58937495
Add -17 and 51504005493.29.
51504005476.29
Add together -213815902 and 221.
-213815681
What is 88.582 + -511.185?
-422.603
What is -13383925419 - -197?
-13383925222
Subtract -23536499.94 from 31.2.
23536531.14
What is -490.9973 minus 23621078?
-23621568.9973
41895.627 - 4681553
-4639657.373
Work out -399698287 + 4441.48.
-399693845.52
What is 2209199626 plus 0.295?
2209199626.295
110.306905 + -1.94348
108.363425
Work out -3.54329 + -130531173.
-130531176.54329
Subtract 396769932 from 0.220393.
-396769931.779607
What is 1 less than 18942854.44179?
18942853.44179
Total of -3017333 and -46.1956.
-3017379.1956
What is -31 minus 40.56518002?
-71.56518002
What is 22922.849 less than 7337935?
7315012.151
Calculate 162604924003 + 9.
162604924012
What is -9831368619.2 less than 0.012?
9831368619.212
What is -3382 - -48186277387?
48186274005
Total of -15.18069178 and -469.
-484.18069178
Work out 8982119890.56 - -0.1.
8982119890.66
-1097383.4 - 34705
-1132088.4
What is 8935303598 take away 29.1?
8935303568.9
What is the difference between -88530 and 424493217?
424581747
Work out -29395298478 - -0.57.
-29395298477.43
Add together 474.8 and -393770.4.
-393295.6
Work out -8326 + -1.48435549.
-8327.48435549
What is the distance between -211.4699 and -1.426298?
210.043602
What is the distance between -15286347 and 16481225?
31767572
373 + -32614131490
-32614131117
What is the distance between 3275452603484 and 2?
3275452603482
What is -2717.617038 plus 26890?
24172.382962
What is the distance between 664963893 and -2517.7?
664966410.7
What is -38.0716641 take away 0.0055?
-38.0771641
Subtract -114.5 from -7937525594.
-7937525479.5
Work out -17.2934 - -865812.
865794.7066
What is the difference between 506.783 and 2519043?
2518536.217
What is -109281 - 1415928?
-1525209
Calculate 33825475 - 0.00802.
33825474.99198
Subtract 75 from 27476384747.
27476384672
What is 17804135 minus -0.074613963?
17804135.074613963
What is the difference between 49.99789 and 0.0118797?
49.9860103
What is 0.0057938465649 - 0.08?
-0.0742061534351
What is 192176144058 less than -0.1?
-192176144058.1
Work out 0.85 - 169442709923.
-169442709922.15
Calculate -98722029.242 - -33.85.
-98721995.392
2.01929+7723187
7723189.01929
Work out 17413520762453 + -5.
17413520762448
Work out -371936238144 - 3.4.
-371936238147.4
What is -0.2174366 plus -249.319?
-249.5364366
Work out -2 + 42008549991.56.
42008549989.56
What is -18988.33 minus 2656.59?
-21644.92
What is 235179945621 take away -0.4?
235179945621.4
What is the distance between 6640.0211501795 and 0?
6640.0211501795
What is -193.8602463 - 2898.66?
-3092.5202463
0.0485 + -188052245.68
-188052245.6315
Add together -79 and 2950534120.
2950534041
What is 5885926.60734 plus 482?
5886408.60734
What is the difference between 2373148293900 and -10?
2373148293910
What is 26667655 + -318.03?
26667336.97
Calculate 0.246 - 76661.38528.
-76661.13928
Add together 207637.278 and 0.0040593.
207637.2820593
What is -0.28 minus -1698426089?
1698426088.72
What is the difference between -0.187317 and -2266.49?
2266.302683
What is -11117771.2255 plus -351?
-11118122.2255
What is -1402018378222 plus 0.8?
-1402018378221.2
Total of 0.0608738587 and -1376685.
-1376684.9391261413
-6.5 - -375353311
375353304.5
What is -3864198889 minus 3096?
-3864201985
What is -2674137 take away 1.356314?
-2674138.356314
Work out 21045 - 177426466.
-177405421
Sum 475 and 71.960662275.
546.960662275
What is -8649585508.923 plus -1?
-8649585509.923
-2169.8513141 + -1.883
-2171.7343141
5.893956 + -5.5526
0.341356
What is -4 take away -3605876.5536834?
3605872.5536834
Add together -76584.2921 and 541.
-76043.2921
Subtract 3 from -6843489.535091.
-6843492.535091
94559414+-1581108
92978306
What is the distance between -7 and 14952267006750?
14952267006757
Calculate 4.244 - 19.2156985.
-14.9716985
Work out 203 + 1078062592865.
1078062593068
What is -20805243 plus -3390269?
-24195512
What is 0.06 take away 2011791520?
-2011791519.94
What is -873.077681 take away 16.9?
-889.977681
Work out -46 + 989580820.
989580774
Calculate -0.17651073 + 0.02416.
-0.15235073
What is the difference between -0.1 and -1388603004564?
1388603004563.9
What is -1.012570568 - -17.05?
16.037429432
What is -15835278.01909 less than -1?
15835277.01909
Work out -0.8 + 0.033608221647.
-0.766391778353
Work out -780590 + 608302.
-172288
-0.05+-95874119876
-95874119876.05
What is -8957 less than -6109329?
-6100372
What is 8322.4 less than -156790469.3?
-156798791.7
-49763 - -3626751959
3626702196
What is the distance between -8.106663 and -12.6202?
4.513537
Subtract -183.91346 from 25316.
25499.91346
Subtract -4.4771939 |
The present invention relates to a freezer in which articles to be refrigerated pass through the freezer on a porous belt. More particularly, the present invention relates to a cryogenic freezer in which the articles are refrigerated by nitrogen vapor being circulated through the belt and within the freezer. Even more particularly, the present invention relates to such a cryogenic freezer in which a bed of the article to be frozen is fluidized on the belt.
Industrial freezers incorporate a porous belt on which articles to be refrigerated are conducted through a freezing compartment from an inlet to an outlet of the freezing compartment. Various means are provided to produce refrigeration within the freezing compartment including the use of liquid and gaseous cryogens formed from liquefied carbon dioxide and nitrogen. The refrigeration is typically provided for cryogenic freezers by spraying a liquid cryogen into the freezing compartment through spray nozzles. Cryogenic vapor produced through the introduction of the liquid cryogen into the freezing compartment is circulated to refrigerate the articles. In a fluidized bed freezer, the cryogenic vapor is circulated with a sufficient velocity to fluidize a bed of articles to be frozen, passing through the freezer on the porous belt.
In prior art cryogenic freezers, some air enters the freezing compartment along with the articles to be frozen. The air contains moisture and such moisture freezes and accumulates on the belt as ice. Very often, food is frozen that has significant amount of moisture on its surface. Moisture released from the food will also enter the freezing compartment to accumulate on the belt as ice. In a fluidized bed freezer this is particularly troublesome in that the belt loses its porosity and therefore, the freezer loses its effectiveness.
Prior art methods for cleaning ice from the belt have included wire brushes to scrape off the ice and muting the belt outside of the freezer where a forced flow of ambient air is used to defrost the belt. These methods suffer from being either unreliable, overly complex, and/or thermally inefficient. Another method of belt cleaning in cryogenic freezers has been the introduction of externally vaporized cryogen into the freezer in the form of gas jets directed toward the belt. This method, however, is wasteful of the cryogen because the energy added to vaporize the cryogen represents wasted cooling potential.
As will be discussed, the present invention provides a cryogenic freezer of less complexity than the prior art and which conserves the cooling potential of the cryogen being used to freeze the articles. |
[Study on material basis of Dracocephalum moldavica for protecting cardiomyocyte against hypoxia/reoxygenation injury by traditional Chinese medicine serum chemical and pharmacological methods].
To study the material basis of Dracocephalum moldavica for protecting cardiomyocyte against hypoxia/ reoxygenation injury by using traditional Chinese medicine (TCM) serum chemical and pharmacological methods. The extract of D. moldavica (DME) and its content absorbed into blood were determined, while blank serum and medicinal serum of rats before and after intragastrical administration of DME were also compared by HPLC. The Na2S2O4 or N2-based hypoxia/reoxygenation injury model was established by cultivating primary neonate rat cardiomyocytes or H9c2 cells in vitro. Cell viability, LDH release, T-SOD activity, MDA production and apoptosis were detected to learn the effect of DME, medicated serum and different treatments of medicinal serums under different dosage and action duration of DME on cardiomyocyte against hypoxia/reoxygenation injury. Four transitional components of DME absorbed into blood after intragastrical administration were found, three of which were original components and one possible metabolite. Furthermore, compared with the model group or the blank serum group, LDH release and MDA production (P < 0.05, P < 0.01) of DME extracts, medicated serum or different treatments of medicinal serum under different dosage and action duration of DME. However, T-SOD and cell viability were improved significantly (P < 0.05, P < 0.01), while apoptosis of cardiomyocytes were also obviously inhibited. The four components absorbed into blood are probably the material basis of DME used for protecting cardiomyocyte agastin hypoxia/reoxygenation injury. |
This is a revised application. All changes are indicated by, a red line in the right margin. At the molecular level, acute myeloid leukemia (AML) is a heterogeneous disease. Recent advances with molecular-based risk stratification of AML and molecular-based therapeutics strongly suggest that elucidation of molecular mechanisms underlying each case of AML will have the greatest impact on increasing the cure rate of this disease. In the majority of AML cases, cytogenetics are either normal or only contain changes in chromosome number that limit one's ability to find leukemogenic gene fusions. Several years ago, our laboratory collaborated to discover a novel molecular defect found in 5-10 percent of AML cases with normal cytogenetics and in the majority of AML cases with trisomy 11 as a sole abnormality. The defect involves a partial tandem duplication (PTD) of the MLL gene, whereby exons 2-6 or 2-8 duplicate in tandem creating a unique self-fusions. Our laboratory has since performed an extensive characterization of the MLL PTD. We hypothesize that the MLL PTD represents a primary molecular defect in myeloid hematopoietic progenitor cells that is responsible, at least in part, for their leukemic transformation. We propose a series of in vitro and in vivo model systems to test this hypothesis and to define the genetic differences that specifically result from the MLL PTD. We have developed a targeting construct to create embryonic stem cells expressing the MLL PTD for in vitro differentiation studies as well as for creation of chimeric and heterozygous mice expressing the MLL PTD. Finally, we have utilized two techniques to study genome-wide genetic and epigenetic changes in leukemic tissue to better understand downstream effector molecules during malignant cell growth, and propose to use these technologies to better understand pathways critical to leukemogenesis in cells harboring the MLL PTD. Ultimately, we believe insights gained by the experiments proposed in this application will further our understanding of leukemogenesis and open up new therapeutic options for this subset of AML patients with a poor prognosis. |
Q:
Finite generation of stabilizers in a $G$-set
Suppose that $G$ is a finitely generated group, $X$ is a $G$-set, and $x \in X$ is a point. Are there any sorts of conditions on $X$ and $G$ that would let me conclude that $\operatorname{Stab}(x)$ is finitely generated as well?
A:
"Stabilizer of $x$" is not any more specific than "subgroup of $G$" (consider the regular action of $G$ on $G/H$). In other words, you are asking for conditions on $G$ such that its subgroups are finitely generated.
This is false, in general. It's true in nilpotent (and virtually nilpotent) groups. It's false in solvable groups (consider the lamplighter).
|
A procedure for measuring alpha 2-adrenergic receptor-mediated inhibition of cyclic AMP accumulation in rat brain slices.
The alpha 2-adrenergic receptor regulation of cyclic adenosine monophosphate (cAMP) accumulation in rat brain slices was examined. using a prelabeling technique for measuring second messenger production. The mixed alpha-adrenergic agonist 6-fluoronorepinephrine, as well as the more selective alpha 2-agonists clonidine and UK-14,304, caused a concentration-dependent inhibition of forskolin-stimulated cAMP accumulation in cerebral cortical slices, whereas phenylephrine, a selective alpha 1-adrenergic agonist, had no inhibitory effect in this system. Moreover, alpha 2-adrenergic receptor antagonists were more potent than alpha 1-adrenergic antagonists in blocking the inhibitory response to UK-14,304. Neither alpha 1- nor alpha 2-adrenergic agonists displayed any inhibitory effect when cAMP accumulation was stimulated by isoproterenol, vasoactive intestinal peptide or 2-chloroadenosine. The results provide further evidence that some alpha 2-adrenergic receptors are negatively coupled to adenylate cyclase in brain, and yield a procedure for studying this phenomenon in intact central nervous system tissue. |
Custodian of the Two Holy Mosques King Abdullah bin Abdulaziz met with Palestinian President Mahmoud Abbas at Al-Yamamah Palace in Riyadh today. The meeting focused primarily on the situation in Palestine, although bilateral relations were also discussed. Abbas was in the Kingdom for a one-day official visit.
Also on an official visit to the Kingdom is Swiss State Secretary Michael Ambuhl. Minister of Foreign Affairs Prince Saud Al-Faisal met with Ambuhl for talks about international, regional and bilateral issues in Riyadh today. |
<?php
# Copyright (c) 2003-2005, Jannis Hermanns (on behalf the Serendipity Developer Team)
# All rights reserved. See LICENSE file for licensing details
/*****************************************************************
* Nucleus Importer, by Garvin Hicking *
* ****************************************************************/
class Serendipity_Import_Nucleus extends Serendipity_Import {
var $info = array('software' => 'Nucleus');
var $data = array();
var $inputFields = array();
function __construct($data) {
$this->data = $data;
$this->inputFields = array(array('text' => INSTALL_DBHOST,
'type' => 'input',
'name' => 'host'),
array('text' => INSTALL_DBUSER,
'type' => 'input',
'name' => 'user'),
array('text' => INSTALL_DBPASS,
'type' => 'protected',
'name' => 'pass'),
array('text' => INSTALL_DBNAME,
'type' => 'input',
'name' => 'name'),
array('text' => INSTALL_DBPREFIX,
'type' => 'input',
'name' => 'prefix',
'default' => 'nucleus_'),
array('text' => CHARSET,
'type' => 'list',
'name' => 'charset',
'value' => 'native',
'default' => $this->getCharsets()),
array('text' => CONVERT_HTMLENTITIES,
'type' => 'bool',
'name' => 'use_strtr',
'default' => 'true'),
array('text' => ACTIVATE_AUTODISCOVERY,
'type' => 'bool',
'name' => 'autodiscovery',
'default' => 'false')
);
}
function validateData() {
return sizeof($this->data);
}
function getInputFields() {
return $this->inputFields;
}
function import() {
global $serendipity;
// Save this so we can return it to its original value at the end of this method.
$noautodiscovery = isset($serendipity['noautodiscovery']) ? $serendipity['noautodiscovery'] : false;
if ($this->data['autodiscovery'] == 'false') {
$serendipity['noautodiscovery'] = 1;
}
$this->getTransTable();
$this->data['prefix'] = serendipity_db_escape_string($this->data['prefix']);
$users = array();
$categories = array();
$entries = array();
if (!extension_loaded('mysqli')) {
return MYSQL_REQUIRED;;
}
$nucdb = @mysqli_connect($this->data['host'], $this->data['user'], $this->data['pass']);
if (!$nucdb || mysqli_connect_error()) {
return sprintf(COULDNT_CONNECT, serendipity_specialchars($this->data['host']));
}
if (!@mysqli_select_db($nucdb, $this->data['name'])) {
return sprintf(COULDNT_SELECT_DB, mysqli_error($nucdb));
}
/* Users */
$res = @$this->nativeQuery("SELECT mnumber AS ID, mname AS user_login, mpassword AS user_pass, memail AS user_email, madmin AS user_level FROM {$this->data['prefix']}member;", $nucdb);
if (!$res) {
return sprintf(COULDNT_SELECT_USER_INFO, mysqli_error($nucdb));
}
for ($x=0, $max_x = mysqli_num_rows($res); $x < $max_x ; $x++ ) {
$users[$x] = mysqli_fetch_assoc($res);
$data = array('right_publish' => ($users[$x]['user_level'] >= 1) ? 1 : 0,
'realname' => $users[$x]['user_login'],
'username' => $users[$x]['user_login'],
'email' => $users[$x]['user_email'],
'password' => $users[$x]['user_pass']); // Nucleus uses md5, too.
if ( $users[$x]['user_level'] < 1 ) {
$data['userlevel'] = USERLEVEL_EDITOR;
} else {
$data['userlevel'] = USERLEVEL_ADMIN;
}
if ($serendipity['serendipityUserlevel'] < $data['userlevel']) {
$data['userlevel'] = $serendipity['serendipityUserlevel'];
}
serendipity_db_insert('authors', $this->strtrRecursive($data));
$users[$x]['authorid'] = serendipity_db_insert_id('authors', 'authorid');
}
/* Categories */
$res = @$this->nativeQuery("SELECT catid AS cat_ID, cname AS cat_name, cdesc AS category_description FROM {$this->data['prefix']}category ORDER BY catid;", $nucdb);
if (!$res) {
return sprintf(COULDNT_SELECT_CATEGORY_INFO, mysqli_error($nucdb));
}
// Get all the info we need
for ($x=0, $max_x = mysqli_num_rows($res) ; $x < $max_x ; $x++) {
$categories[] = mysqli_fetch_assoc($res);
}
// Insert all categories as top level (we need to know everyone's ID before we can represent the hierarchy).
for ($x=0, $max_x = sizeof($categories) ; $x < $max_x ; $x++ ) {
$cat = array('category_name' => $categories[$x]['cat_name'],
'category_description' => $categories[$x]['category_description'],
'parentid' => 0, // <---
'category_left' => 0,
'category_right' => 0);
serendipity_db_insert('category', $this->strtrRecursive($cat));
$categories[$x]['categoryid'] = serendipity_db_insert_id('category', 'categoryid');
}
serendipity_rebuildCategoryTree();
/* Entries */
$res = @$this->nativeQuery("SELECT * FROM {$this->data['prefix']}item ORDER BY itime;", $nucdb);
if (!$res) {
return sprintf(COULDNT_SELECT_ENTRY_INFO, mysqli_error($nucdb));
}
for ($x=0, $max_x = mysqli_num_rows($res) ; $x < $max_x ; $x++ ) {
$entries[$x] = mysqli_fetch_assoc($res);
$entry = array('title' => $this->decode($entries[$x]['ititle']),
'isdraft' => ($entries[$x]['idraft'] != '1') ? 'false' : 'true',
'allow_comments' => ($entries[$x]['iclosed'] == '1' ) ? 'false' : 'true',
'timestamp' => strtotime($entries[$x]['itime']),
'extended' => $this->strtr($entries[$x]['imore']),
'body' => $this->strtr($entries[$x]['ibody']));
$entry['authorid'] = '';
$entry['author'] = '';
foreach ($users as $user) {
if ($user['ID'] == $entries[$x]['iauthor']) {
$entry['authorid'] = $user['authorid'];
$entry['author'] = $user['realname'];
break;
}
}
if (!is_int($entries[$x]['entryid'] = serendipity_updertEntry($entry))) {
return $entries[$x]['entryid'];
}
/* Entry/category */
foreach ($categories as $category) {
if ($category['cat_ID'] == $entries[$x]['icat'] ) {
$data = array('entryid' => $entries[$x]['entryid'],
'categoryid' => $category['categoryid']);
serendipity_db_insert('entrycat', $this->strtrRecursive($data));
break;
}
}
}
/* Comments */
$res = @$this->nativeQuery("SELECT * FROM {$this->data['prefix']}comment;", $nucdb);
if (!$res) {
return sprintf(COULDNT_SELECT_COMMENT_INFO, mysqli_error($nucdb));
}
while ($a = mysqli_fetch_assoc($res)) {
foreach ($entries as $entry) {
if ($entry['inumber'] == $a['citem'] ) {
$author = '';
$mail = '';
if (!empty($a['cmember'])) {
foreach($users AS $user) {
if ($user['ID'] == $a['cmember']) {
$author = $user['user_login'];
$mail = $user['user_email'];
break;
}
}
}
if (empty($author) && empty($mail)) {
$author = $a['cuser'];
$mail = $a['cmail'];
}
$comment = array('entry_id ' => $entry['entryid'],
'parent_id' => 0,
'timestamp' => strtotime($a['ctime']),
'author' => $author,
'email' => $mail,
'url' => $a['chost'],
'ip' => $a['cip'],
'status' => 'approved',
'body' => $a['cbody'],
'subscribed'=> 'false',
'type' => 'NORMAL');
serendipity_db_insert('comments', $this->strtrRecursive($comment));
$cid = serendipity_db_insert_id('comments', 'id');
serendipity_approveComment($cid, $entry['entryid'], true);
}
}
}
$serendipity['noautodiscovery'] = $noautodiscovery;
// That was fun.
return true;
}
}
return 'Serendipity_Import_Nucleus';
/* vim: set sts=4 ts=4 expandtab : */
?>
|
Q:
Difference between Minikube, Kubernetes, Docker Compose, Docker Swarm, etc
I am new to cluster container management, and this question is the basis for all the freshers over here.
I read some documentation, but still, my understanding is not too clear, so any leads.. helping to understand?
Somewhere it is mentioned, Minikube is used to run Kubernetes locally. So if we want to maintain cluster management in my four-node Raspberry Pi, then Minikube is not the option?
Does Minikube support only a one-node system?
Docker Compose is set of instructions and a YAML file to configure and start multiple Docker containers. Can we use this to start containers of the different hosts? Then for simple orchestration where I need to call container of the second host, I don't need any cluster management, right?
What is the link between Docker Swarm and Kubernetes? Both are independent cluster management. Is it efficient to use Kubernetes on Raspberry Pi? Any issue, because I was told that Kubernetes in single node takes the complete memory and CPU usage? Is it true?
Is there other cluster management for Raspberry Pi?
I think this 4-5 set will help me better.
A:
Presuming that your goal here is to run a set of containers over a number of different Raspberry Pi based nodes:
Minikube isn't really appropriate. This starts a single virtual machine on a Windows, MacOS or Linux and installs a Kubernetes cluster into it. It's generally used by developers to quickly start-up a cluster on their laptops or desktops for development and testing purposes.
Docker Compose is a system for managing sets of related containers. So for example if you had a web server and database that you wanted to manage together you could put them in a single Docker Compose file.
Docker Swarm is a system for managing sets of containers across multiple hosts. It's essentially an alternative to Kubernetes. It has fewer features than Kubernetes, but it is much simpler to set up.
If you want a really simple multi-node Container cluster, I'd say that Docker swarm is a reasonable choice. If you explicitly want to experiment with Kubernetes, I'd say that kubeadm is a good option here. Kubernetes in general has higher resource requirements than Docker Swarm, so it could be somewhat less suited to it, although I know people have successfully run Kubernetes clusters on Raspberry Pis.
A:
Docker Compose
A utility to to start multiple docker containers on a single host using a single docker-compose up. This makes it easier to start multiple containers at once, rather than having do mutliple docker run commands.
Docker swarm
A native container orchestrator for Docker. Docker swarm allows you to create a cluster of docker containers running on multiple machines. It provides features such as replication, scaling, self-healing i.e. starting a new container when one dies ...
Kubernetes
Also a container orchestrator. Kubernetes and Docker swarm can be considered as alternatives to one another. They both try to handle managing containers starting in a cluster
Minikube
Creating a real kubernetes cluster requires having multiple machines either on premise or on a cloud platform. This is not always convenient if someone is just new to Kubernetes and trying to learn by playing around with Kubernetes. To solve that minikube allows you to start a very basic Kubernetes cluster that consists of a single VM on you machine, which you can use to play around with Kubernetes.
Minikube is not for a production or multi-node cluster. There are many tools that can be used to create a multi-node Kubernetes cluster such as kubeadm
|
use num_traits::cast::FromPrimitive;
use crate::bytecode::{BytecodeOffset, BytecodeOpcode, ConstPoolIdx, Register};
use crate::vm::{ClassDefId, FieldId, GlobalId, TupleId};
pub fn read<T: BytecodeVisitor>(data: &[u8], visitor: &mut T) {
BytecodeReader::new(data, visitor).read();
}
struct BytecodeReader<'a, T: BytecodeVisitor> {
data: &'a [u8],
pos: usize,
visitor: &'a mut T,
}
impl<'a, T> BytecodeReader<'a, T>
where
T: BytecodeVisitor,
{
fn new(data: &'a [u8], visitor: &'a mut T) -> BytecodeReader<'a, T> {
BytecodeReader {
data: data,
pos: 0,
visitor: visitor,
}
}
fn read(&mut self) {
while self.pos < self.data.len() {
self.visitor
.visit_instruction(BytecodeOffset(self.pos as u32));
let wide = self.read_operand_width();
let opcode = self.read_opcode();
self.read_instruction(wide, opcode)
}
}
fn read_instruction(&mut self, wide: bool, opcode: u32) {
let inst: BytecodeOpcode = FromPrimitive::from_u32(opcode).expect("illegal opcode");
match inst {
BytecodeOpcode::Wide => unreachable!(),
BytecodeOpcode::AddInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_add_int32(dest, lhs, rhs);
}
BytecodeOpcode::AddInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_add_int64(dest, lhs, rhs);
}
BytecodeOpcode::AddFloat32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_add_float32(dest, lhs, rhs);
}
BytecodeOpcode::AddFloat64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_add_float64(dest, lhs, rhs);
}
BytecodeOpcode::SubInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_sub_int32(dest, lhs, rhs);
}
BytecodeOpcode::SubInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_sub_int64(dest, lhs, rhs);
}
BytecodeOpcode::SubFloat32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_sub_float32(dest, lhs, rhs);
}
BytecodeOpcode::SubFloat64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_sub_float64(dest, lhs, rhs);
}
BytecodeOpcode::NegInt32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_neg_int32(dest, src);
}
BytecodeOpcode::NegInt64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_neg_int64(dest, src);
}
BytecodeOpcode::NegFloat32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_neg_float32(dest, src);
}
BytecodeOpcode::NegFloat64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_neg_float64(dest, src);
}
BytecodeOpcode::MulInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_mul_int32(dest, lhs, rhs);
}
BytecodeOpcode::MulInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_mul_int64(dest, lhs, rhs);
}
BytecodeOpcode::MulFloat32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_mul_float32(dest, lhs, rhs);
}
BytecodeOpcode::MulFloat64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_mul_float64(dest, lhs, rhs);
}
BytecodeOpcode::DivInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_div_int32(dest, lhs, rhs);
}
BytecodeOpcode::DivInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_div_int64(dest, lhs, rhs);
}
BytecodeOpcode::DivFloat32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_div_float32(dest, lhs, rhs);
}
BytecodeOpcode::DivFloat64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_div_float64(dest, lhs, rhs);
}
BytecodeOpcode::ModInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_mod_int32(dest, lhs, rhs);
}
BytecodeOpcode::ModInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_mod_int64(dest, lhs, rhs);
}
BytecodeOpcode::AndInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_and_int32(dest, lhs, rhs);
}
BytecodeOpcode::AndInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_and_int64(dest, lhs, rhs);
}
BytecodeOpcode::OrInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_or_int32(dest, lhs, rhs);
}
BytecodeOpcode::OrInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_or_int64(dest, lhs, rhs);
}
BytecodeOpcode::XorInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_xor_int32(dest, lhs, rhs);
}
BytecodeOpcode::XorInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_xor_int64(dest, lhs, rhs);
}
BytecodeOpcode::NotBool => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_not_bool(dest, src);
}
BytecodeOpcode::NotInt32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_not_int32(dest, src);
}
BytecodeOpcode::NotInt64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_not_int64(dest, src);
}
BytecodeOpcode::ShlInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_shl_int32(dest, lhs, rhs);
}
BytecodeOpcode::ShrInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_shr_int32(dest, lhs, rhs);
}
BytecodeOpcode::SarInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_sar_int32(dest, lhs, rhs);
}
BytecodeOpcode::ShlInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_shl_int64(dest, lhs, rhs);
}
BytecodeOpcode::ShrInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_shr_int64(dest, lhs, rhs);
}
BytecodeOpcode::SarInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_sar_int64(dest, lhs, rhs);
}
BytecodeOpcode::RolInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_rol_int32(dest, lhs, rhs);
}
BytecodeOpcode::RorInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_ror_int32(dest, lhs, rhs);
}
BytecodeOpcode::RolInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_rol_int64(dest, lhs, rhs);
}
BytecodeOpcode::RorInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_ror_int64(dest, lhs, rhs);
}
BytecodeOpcode::ReinterpretFloat32AsInt32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_reinterpret_float32_as_int32(dest, src);
}
BytecodeOpcode::ReinterpretInt32AsFloat32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_reinterpret_int32_as_float32(dest, src);
}
BytecodeOpcode::ReinterpretFloat64AsInt64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_reinterpret_float64_as_int64(dest, src);
}
BytecodeOpcode::ReinterpretInt64AsFloat64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_reinterpret_int64_as_float64(dest, src);
}
BytecodeOpcode::ExtendUInt8ToChar => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_extend_byte_to_char(dest, src);
}
BytecodeOpcode::ExtendUInt8ToInt32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_extend_byte_to_int32(dest, src);
}
BytecodeOpcode::ExtendUInt8ToInt64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_extend_byte_to_int64(dest, src);
}
BytecodeOpcode::ExtendInt32ToInt64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_extend_int32_to_int64(dest, src);
}
BytecodeOpcode::ExtendCharToInt64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_extend_char_to_int64(dest, src);
}
BytecodeOpcode::CastCharToInt32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_cast_char_to_int32(dest, src);
}
BytecodeOpcode::CastInt32ToUInt8 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_cast_int32_to_uint8(dest, src);
}
BytecodeOpcode::CastInt32ToChar => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_cast_int32_to_char(dest, src);
}
BytecodeOpcode::CastInt64ToUInt8 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_cast_int64_to_uint8(dest, src);
}
BytecodeOpcode::CastInt64ToChar => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_cast_int64_to_char(dest, src);
}
BytecodeOpcode::CastInt64ToInt32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_cast_int64_to_int32(dest, src);
}
BytecodeOpcode::ConvertInt32ToFloat32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_convert_int32_to_float32(dest, src);
}
BytecodeOpcode::ConvertInt32ToFloat64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_convert_int32_to_float64(dest, src);
}
BytecodeOpcode::ConvertInt64ToFloat32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_convert_int64_to_float32(dest, src);
}
BytecodeOpcode::ConvertInt64ToFloat64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_convert_int64_to_float64(dest, src);
}
BytecodeOpcode::TruncateFloat32ToInt32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_truncate_float32_to_int32(dest, src);
}
BytecodeOpcode::TruncateFloat32ToInt64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_truncate_float32_to_int64(dest, src);
}
BytecodeOpcode::TruncateFloat64ToInt32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_truncate_float64_to_int32(dest, src);
}
BytecodeOpcode::TruncateFloat64ToInt64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_truncate_float64_to_int64(dest, src);
}
BytecodeOpcode::PromoteFloat32ToFloat64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_promote_float32_to_float64(dest, src);
}
BytecodeOpcode::DemoteFloat64ToFloat32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_demote_float64_to_float32(dest, src);
}
BytecodeOpcode::InstanceOf => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
let cls_id = self.read_const_pool_idx(wide);
self.visitor.visit_instance_of(dest, src, cls_id);
}
BytecodeOpcode::CheckedCast => {
let src = self.read_register(wide);
let cls_id = self.read_const_pool_idx(wide);
self.visitor.visit_checked_cast(src, cls_id);
}
BytecodeOpcode::MovBool => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_mov_bool(dest, src);
}
BytecodeOpcode::MovUInt8 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_mov_uint8(dest, src);
}
BytecodeOpcode::MovChar => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_mov_char(dest, src);
}
BytecodeOpcode::MovInt32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_mov_int32(dest, src);
}
BytecodeOpcode::MovInt64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_mov_int64(dest, src);
}
BytecodeOpcode::MovFloat32 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_mov_float32(dest, src);
}
BytecodeOpcode::MovFloat64 => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_mov_float64(dest, src);
}
BytecodeOpcode::MovPtr => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_mov_ptr(dest, src);
}
BytecodeOpcode::MovTuple => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
let tuple = self.read_tuple(wide);
self.visitor.visit_mov_tuple(dest, src, tuple);
}
BytecodeOpcode::MovGeneric => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
self.visitor.visit_mov_generic(dest, src);
}
BytecodeOpcode::MovEnum => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
let idx = self.read_const_pool_idx(wide);
self.visitor.visit_mov_enum(dest, src, idx);
}
BytecodeOpcode::LoadTupleElement => {
let dest = self.read_register(wide);
let src = self.read_register(wide);
let tuple = self.read_tuple(wide);
let element = self.read_index(wide);
self.visitor
.visit_load_tuple_element(dest, src, tuple, element);
}
BytecodeOpcode::StoreTupleElement => {
let src = self.read_register(wide);
let dest = self.read_register(wide);
let tuple = self.read_tuple(wide);
let element = self.read_index(wide);
self.visitor
.visit_store_tuple_element(src, dest, tuple, element);
}
BytecodeOpcode::LoadField => {
let dest = self.read_register(wide);
let obj = self.read_register(wide);
let field = self.read_const_pool_idx(wide);
self.visitor.visit_load_field(dest, obj, field);
}
BytecodeOpcode::StoreField => {
let src = self.read_register(wide);
let obj = self.read_register(wide);
let field = self.read_const_pool_idx(wide);
self.visitor.visit_store_field(src, obj, field);
}
BytecodeOpcode::LoadGlobal => {
let dest = self.read_register(wide);
let glob = self.read_global(wide);
self.visitor.visit_load_global(dest, glob);
}
BytecodeOpcode::StoreGlobal => {
let dest = self.read_register(wide);
let glob = self.read_global(wide);
self.visitor.visit_store_global(dest, glob);
}
BytecodeOpcode::PushRegister => {
let src = self.read_register(wide);
self.visitor.visit_push_register(src);
}
BytecodeOpcode::ConstNil => {
let dest = self.read_register(wide);
self.visitor.visit_const_nil(dest);
}
BytecodeOpcode::ConstTrue => {
let dest = self.read_register(wide);
self.visitor.visit_const_true(dest);
}
BytecodeOpcode::ConstFalse => {
let dest = self.read_register(wide);
self.visitor.visit_const_false(dest);
}
BytecodeOpcode::ConstZeroUInt8 => {
let dest = self.read_register(wide);
self.visitor.visit_const_zero_uint8(dest);
}
BytecodeOpcode::ConstZeroChar => {
let dest = self.read_register(wide);
self.visitor.visit_const_zero_char(dest);
}
BytecodeOpcode::ConstZeroInt32 => {
let dest = self.read_register(wide);
self.visitor.visit_const_zero_int32(dest);
}
BytecodeOpcode::ConstZeroInt64 => {
let dest = self.read_register(wide);
self.visitor.visit_const_zero_int64(dest);
}
BytecodeOpcode::ConstZeroFloat32 => {
let dest = self.read_register(wide);
self.visitor.visit_const_zero_float32(dest);
}
BytecodeOpcode::ConstZeroFloat64 => {
let dest = self.read_register(wide);
self.visitor.visit_const_zero_float64(dest);
}
BytecodeOpcode::ConstChar => {
let dest = self.read_register(wide);
let idx = self.read_const_pool_idx(wide);
self.visitor.visit_const_char(dest, idx);
}
BytecodeOpcode::ConstUInt8 => {
let dest = self.read_register(wide);
let value = self.read_byte();
self.visitor.visit_const_uint8(dest, value as u8);
}
BytecodeOpcode::ConstInt32 => {
let dest = self.read_register(wide);
let idx = self.read_const_pool_idx(wide);
self.visitor.visit_const_int32(dest, idx);
}
BytecodeOpcode::ConstInt64 => {
let dest = self.read_register(wide);
let idx = self.read_const_pool_idx(wide);
self.visitor.visit_const_int64(dest, idx);
}
BytecodeOpcode::ConstFloat32 => {
let dest = self.read_register(wide);
let idx = self.read_const_pool_idx(wide);
self.visitor.visit_const_float32(dest, idx);
}
BytecodeOpcode::ConstFloat64 => {
let dest = self.read_register(wide);
let idx = self.read_const_pool_idx(wide);
self.visitor.visit_const_float64(dest, idx);
}
BytecodeOpcode::ConstString => {
let dest = self.read_register(wide);
let idx = self.read_const_pool_idx(wide);
self.visitor.visit_const_string(dest, idx);
}
BytecodeOpcode::ConstGenericDefault => {
let dest = self.read_register(wide);
self.visitor.visit_const_generic_default(dest);
}
BytecodeOpcode::TestEqPtr => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_eq_ptr(dest, lhs, rhs);
}
BytecodeOpcode::TestNePtr => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ne_ptr(dest, lhs, rhs);
}
BytecodeOpcode::TestEqGeneric => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_eq_generic(dest, lhs, rhs);
}
BytecodeOpcode::TestNeGeneric => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ne_generic(dest, lhs, rhs);
}
BytecodeOpcode::TestEqBool => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_eq_bool(dest, lhs, rhs);
}
BytecodeOpcode::TestNeBool => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ne_bool(dest, lhs, rhs);
}
BytecodeOpcode::TestEqUInt8 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_eq_uint8(dest, lhs, rhs);
}
BytecodeOpcode::TestNeUInt8 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ne_uint8(dest, lhs, rhs);
}
BytecodeOpcode::TestGtUInt8 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_gt_uint8(dest, lhs, rhs);
}
BytecodeOpcode::TestGeUInt8 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ge_uint8(dest, lhs, rhs);
}
BytecodeOpcode::TestLtUInt8 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_lt_uint8(dest, lhs, rhs);
}
BytecodeOpcode::TestLeUInt8 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_le_uint8(dest, lhs, rhs);
}
BytecodeOpcode::TestEqChar => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_eq_char(dest, lhs, rhs);
}
BytecodeOpcode::TestNeChar => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ne_char(dest, lhs, rhs);
}
BytecodeOpcode::TestGtChar => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_gt_char(dest, lhs, rhs);
}
BytecodeOpcode::TestGeChar => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ge_char(dest, lhs, rhs);
}
BytecodeOpcode::TestLtChar => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_lt_char(dest, lhs, rhs);
}
BytecodeOpcode::TestLeChar => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_le_char(dest, lhs, rhs);
}
BytecodeOpcode::TestEqEnum => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_eq_enum(dest, lhs, rhs);
}
BytecodeOpcode::TestNeEnum => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ne_enum(dest, lhs, rhs);
}
BytecodeOpcode::TestEqInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_eq_int64(dest, lhs, rhs);
}
BytecodeOpcode::TestNeInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ne_int64(dest, lhs, rhs);
}
BytecodeOpcode::TestGtInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_gt_int64(dest, lhs, rhs);
}
BytecodeOpcode::TestGeInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ge_int64(dest, lhs, rhs);
}
BytecodeOpcode::TestLtInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_lt_int64(dest, lhs, rhs);
}
BytecodeOpcode::TestLeInt64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_le_int64(dest, lhs, rhs);
}
BytecodeOpcode::TestEqInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_eq_int32(dest, lhs, rhs);
}
BytecodeOpcode::TestNeInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ne_int32(dest, lhs, rhs);
}
BytecodeOpcode::TestGtInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_gt_int32(dest, lhs, rhs);
}
BytecodeOpcode::TestGeInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ge_int32(dest, lhs, rhs);
}
BytecodeOpcode::TestLtInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_lt_int32(dest, lhs, rhs);
}
BytecodeOpcode::TestLeInt32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_le_int32(dest, lhs, rhs);
}
BytecodeOpcode::TestEqFloat32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_eq_float32(dest, lhs, rhs);
}
BytecodeOpcode::TestNeFloat32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ne_float32(dest, lhs, rhs);
}
BytecodeOpcode::TestGtFloat32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_gt_float32(dest, lhs, rhs);
}
BytecodeOpcode::TestGeFloat32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ge_float32(dest, lhs, rhs);
}
BytecodeOpcode::TestLtFloat32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_lt_float32(dest, lhs, rhs);
}
BytecodeOpcode::TestLeFloat32 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_le_float32(dest, lhs, rhs);
}
BytecodeOpcode::TestEqFloat64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_eq_float64(dest, lhs, rhs);
}
BytecodeOpcode::TestNeFloat64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ne_float64(dest, lhs, rhs);
}
BytecodeOpcode::TestGtFloat64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_gt_float64(dest, lhs, rhs);
}
BytecodeOpcode::TestGeFloat64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_ge_float64(dest, lhs, rhs);
}
BytecodeOpcode::TestLtFloat64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_lt_float64(dest, lhs, rhs);
}
BytecodeOpcode::TestLeFloat64 => {
let dest = self.read_register(wide);
let lhs = self.read_register(wide);
let rhs = self.read_register(wide);
self.visitor.visit_test_le_float64(dest, lhs, rhs);
}
BytecodeOpcode::Assert => {
let value = self.read_register(wide);
self.visitor.visit_assert(value);
}
BytecodeOpcode::JumpLoop => {
let offset = self.read_offset(wide);
self.visitor.visit_jump_loop(offset);
}
BytecodeOpcode::LoopStart => {
self.visitor.visit_loop_start();
}
BytecodeOpcode::JumpIfFalse => {
let opnd = self.read_register(wide);
let offset = self.read_offset(wide);
self.visitor.visit_jump_if_false(opnd, offset);
}
BytecodeOpcode::JumpIfFalseConst => {
let opnd = self.read_register(wide);
let idx = self.read_const_pool_idx(wide);
self.visitor.visit_jump_if_false_const(opnd, idx);
}
BytecodeOpcode::JumpIfTrue => {
let opnd = self.read_register(wide);
let offset = self.read_offset(wide);
self.visitor.visit_jump_if_true(opnd, offset);
}
BytecodeOpcode::JumpIfTrueConst => {
let opnd = self.read_register(wide);
let idx = self.read_const_pool_idx(wide);
self.visitor.visit_jump_if_true_const(opnd, idx);
}
BytecodeOpcode::Jump => {
let offset = self.read_offset(wide);
self.visitor.visit_jump(offset);
}
BytecodeOpcode::JumpConst => {
let idx = self.read_const_pool_idx(wide);
self.visitor.visit_jump_const(idx);
}
BytecodeOpcode::InvokeDirectVoid => {
let fct = self.read_const_pool_idx(wide);
self.visitor.visit_invoke_direct_void(fct);
}
BytecodeOpcode::InvokeDirect => {
let dest = self.read_register(wide);
let fct = self.read_const_pool_idx(wide);
self.visitor.visit_invoke_direct(dest, fct);
}
BytecodeOpcode::InvokeVirtualVoid => {
let fct = self.read_const_pool_idx(wide);
self.visitor.visit_invoke_virtual_void(fct);
}
BytecodeOpcode::InvokeVirtual => {
let dest = self.read_register(wide);
let fct = self.read_const_pool_idx(wide);
self.visitor.visit_invoke_virtual(dest, fct);
}
BytecodeOpcode::InvokeStaticVoid => {
let fct = self.read_const_pool_idx(wide);
self.visitor.visit_invoke_static_void(fct);
}
BytecodeOpcode::InvokeStatic => {
let dest = self.read_register(wide);
let fct = self.read_const_pool_idx(wide);
self.visitor.visit_invoke_static(dest, fct);
}
BytecodeOpcode::InvokeGenericStaticVoid => {
let fct = self.read_const_pool_idx(wide);
self.visitor.visit_invoke_generic_static_void(fct);
}
BytecodeOpcode::InvokeGenericStatic => {
let dest = self.read_register(wide);
let fct = self.read_const_pool_idx(wide);
self.visitor.visit_invoke_generic_static(dest, fct);
}
BytecodeOpcode::InvokeGenericDirectVoid => {
let fct = self.read_const_pool_idx(wide);
self.visitor.visit_invoke_generic_direct_void(fct);
}
BytecodeOpcode::InvokeGenericDirect => {
let dest = self.read_register(wide);
let fct = self.read_const_pool_idx(wide);
self.visitor.visit_invoke_generic_direct(dest, fct);
}
BytecodeOpcode::NewObject => {
let dest = self.read_register(wide);
let cls = self.read_const_pool_idx(wide);
self.visitor.visit_new_object(dest, cls);
}
BytecodeOpcode::NewArray => {
let dest = self.read_register(wide);
let cls = self.read_const_pool_idx(wide);
let length = self.read_register(wide);
self.visitor.visit_new_array(dest, cls, length);
}
BytecodeOpcode::NewTuple => {
let dest = self.read_register(wide);
let tuple = self.read_tuple(wide);
self.visitor.visit_new_tuple(dest, tuple);
}
BytecodeOpcode::NilCheck => {
let obj = self.read_register(wide);
self.visitor.visit_nil_check(obj);
}
BytecodeOpcode::ArrayLength => {
let dest = self.read_register(wide);
let array = self.read_register(wide);
self.visitor.visit_array_length(dest, array);
}
BytecodeOpcode::ArrayBoundCheck => {
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_array_bound_check(array, index);
}
BytecodeOpcode::LoadArrayBool => {
let dest = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_load_array_bool(dest, array, index);
}
BytecodeOpcode::LoadArrayUInt8 => {
let dest = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_load_array_uint8(dest, array, index);
}
BytecodeOpcode::LoadArrayChar => {
let dest = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_load_array_char(dest, array, index);
}
BytecodeOpcode::LoadArrayInt32 => {
let dest = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_load_array_int32(dest, array, index);
}
BytecodeOpcode::LoadArrayInt64 => {
let dest = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_load_array_int64(dest, array, index);
}
BytecodeOpcode::LoadArrayFloat32 => {
let dest = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_load_array_float32(dest, array, index);
}
BytecodeOpcode::LoadArrayFloat64 => {
let dest = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_load_array_float64(dest, array, index);
}
BytecodeOpcode::LoadArrayPtr => {
let dest = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_load_array_ptr(dest, array, index);
}
BytecodeOpcode::LoadArrayTuple => {
let dest = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_load_array_tuple(dest, array, index);
}
BytecodeOpcode::LoadArrayGeneric => {
let dest = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_load_array_generic(dest, array, index);
}
BytecodeOpcode::LoadArrayEnum => {
let dest = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
let enum_idx = self.read_const_pool_idx(wide);
self.visitor
.visit_load_array_enum(dest, array, index, enum_idx);
}
BytecodeOpcode::StoreArrayBool => {
let src = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_store_array_bool(src, array, index);
}
BytecodeOpcode::StoreArrayUInt8 => {
let src = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_store_array_uint8(src, array, index);
}
BytecodeOpcode::StoreArrayChar => {
let src = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_store_array_char(src, array, index);
}
BytecodeOpcode::StoreArrayInt32 => {
let src = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_store_array_int32(src, array, index);
}
BytecodeOpcode::StoreArrayInt64 => {
let src = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_store_array_int64(src, array, index);
}
BytecodeOpcode::StoreArrayFloat32 => {
let src = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_store_array_float32(src, array, index);
}
BytecodeOpcode::StoreArrayFloat64 => {
let src = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_store_array_float64(src, array, index);
}
BytecodeOpcode::StoreArrayPtr => {
let src = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_store_array_ptr(src, array, index);
}
BytecodeOpcode::StoreArrayTuple => {
let src = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_store_array_tuple(src, array, index);
}
BytecodeOpcode::StoreArrayGeneric => {
let src = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
self.visitor.visit_store_array_tuple(src, array, index);
}
BytecodeOpcode::StoreArrayEnum => {
let dest = self.read_register(wide);
let array = self.read_register(wide);
let index = self.read_register(wide);
let enum_idx = self.read_const_pool_idx(wide);
self.visitor
.visit_store_array_enum(dest, array, index, enum_idx);
}
BytecodeOpcode::RetVoid => {
self.visitor.visit_ret_void();
}
BytecodeOpcode::Ret => {
let opnd = self.read_register(wide);
self.visitor.visit_ret(opnd);
}
}
}
fn read_register(&mut self, wide: bool) -> Register {
Register(self.read_index(wide) as usize)
}
fn read_class(&mut self, wide: bool) -> ClassDefId {
(self.read_index(wide) as usize).into()
}
fn read_field(&mut self, wide: bool) -> FieldId {
(self.read_index(wide) as usize).into()
}
fn read_tuple(&mut self, wide: bool) -> TupleId {
self.read_index(wide).into()
}
fn read_global(&mut self, wide: bool) -> GlobalId {
self.read_index(wide).into()
}
fn read_opcode(&mut self) -> u32 {
let first = self.read_byte();
if first == 255 {
let second = self.read_byte();
255 + second
} else {
first
}
}
fn read_const_pool_idx(&mut self, wide: bool) -> ConstPoolIdx {
(self.read_index(wide) as usize).into()
}
fn read_offset(&mut self, wide: bool) -> u32 {
self.read_index(wide)
}
fn read_index(&mut self, wide: bool) -> u32 {
if wide {
self.read_wide()
} else {
self.read_byte()
}
}
fn read_operand_width(&mut self) -> bool {
if self.data[self.pos] as u32 == BytecodeOpcode::Wide as u32 {
self.pos += 1;
true
} else {
false
}
}
fn read_byte(&mut self) -> u32 {
let value = self.data[self.pos];
self.pos += 1;
value as u32
}
fn read_wide(&mut self) -> u32 {
let v1 = self.read_byte();
let v2 = self.read_byte();
let v3 = self.read_byte();
let v4 = self.read_byte();
(v4 << 24) | (v3 << 16) | (v2 << 8) | v1
}
}
pub trait BytecodeVisitor {
fn visit_instruction(&mut self, _offset: BytecodeOffset) {}
fn visit_add_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_add_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_add_float32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_add_float64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_sub_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_sub_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_sub_float32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_sub_float64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_neg_int32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_neg_int64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_neg_float32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_neg_float64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_mul_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_mul_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_mul_float32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_mul_float64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_div_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_div_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_div_float32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_div_float64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_mod_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_mod_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_and_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_and_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_or_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_or_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_xor_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_xor_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_not_bool(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_not_int32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_not_int64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_shl_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_shr_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_sar_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_shl_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_shr_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_sar_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_rol_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_ror_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_rol_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_ror_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_reinterpret_float32_as_int32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_reinterpret_int32_as_float32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_reinterpret_float64_as_int64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_reinterpret_int64_as_float64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_extend_byte_to_char(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_extend_byte_to_int32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_extend_byte_to_int64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_extend_int32_to_int64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_extend_char_to_int64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_cast_char_to_int32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_cast_int32_to_uint8(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_cast_int32_to_char(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_cast_int64_to_uint8(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_cast_int64_to_char(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_cast_int64_to_int32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_convert_int32_to_float32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_convert_int32_to_float64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_convert_int64_to_float32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_convert_int64_to_float64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_truncate_float32_to_int32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_truncate_float32_to_int64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_truncate_float64_to_int32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_truncate_float64_to_int64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_promote_float32_to_float64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_demote_float64_to_float32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_instance_of(&mut self, _dest: Register, _src: Register, _cls_id: ConstPoolIdx) {
unimplemented!();
}
fn visit_checked_cast(&mut self, _src: Register, _cls_id: ConstPoolIdx) {
unimplemented!();
}
fn visit_mov_bool(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_mov_uint8(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_mov_char(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_mov_int32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_mov_int64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_mov_float32(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_mov_float64(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_mov_ptr(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_mov_tuple(&mut self, _dest: Register, _src: Register, _tuple_id: TupleId) {
unimplemented!();
}
fn visit_mov_generic(&mut self, _dest: Register, _src: Register) {
unimplemented!();
}
fn visit_mov_enum(&mut self, _dest: Register, _src: Register, _idx: ConstPoolIdx) {
unimplemented!();
}
fn visit_load_tuple_element(
&mut self,
_dest: Register,
_src: Register,
_tuple_id: TupleId,
_element: u32,
) {
unimplemented!();
}
fn visit_store_tuple_element(
&mut self,
_src: Register,
_dest: Register,
_tuple_id: TupleId,
_element: u32,
) {
unimplemented!();
}
fn visit_load_field(&mut self, _dest: Register, _obj: Register, _field: ConstPoolIdx) {
unimplemented!();
}
fn visit_store_field(&mut self, _src: Register, _obj: Register, _field: ConstPoolIdx) {
unimplemented!();
}
fn visit_load_global(&mut self, _dest: Register, _glob: GlobalId) {
unimplemented!();
}
fn visit_store_global(&mut self, _src: Register, _glob: GlobalId) {
unimplemented!();
}
fn visit_push_register(&mut self, _src: Register) {
unimplemented!();
}
fn visit_const_nil(&mut self, _dest: Register) {
unimplemented!();
}
fn visit_const_true(&mut self, _dest: Register) {
unimplemented!();
}
fn visit_const_false(&mut self, _dest: Register) {
unimplemented!();
}
fn visit_const_zero_uint8(&mut self, _dest: Register) {
unimplemented!();
}
fn visit_const_zero_char(&mut self, _dest: Register) {
unimplemented!();
}
fn visit_const_zero_int32(&mut self, _dest: Register) {
unimplemented!();
}
fn visit_const_zero_int64(&mut self, _dest: Register) {
unimplemented!();
}
fn visit_const_zero_float32(&mut self, _dest: Register) {
unimplemented!();
}
fn visit_const_zero_float64(&mut self, _dest: Register) {
unimplemented!();
}
fn visit_const_char(&mut self, _dest: Register, _value: ConstPoolIdx) {
unimplemented!();
}
fn visit_const_uint8(&mut self, _dest: Register, _value: u8) {
unimplemented!();
}
fn visit_const_int32(&mut self, _dest: Register, _value: ConstPoolIdx) {
unimplemented!();
}
fn visit_const_int64(&mut self, _dest: Register, _value: ConstPoolIdx) {
unimplemented!();
}
fn visit_const_float32(&mut self, _dest: Register, _value: ConstPoolIdx) {
unimplemented!();
}
fn visit_const_float64(&mut self, _dest: Register, _value: ConstPoolIdx) {
unimplemented!();
}
fn visit_const_string(&mut self, _dest: Register, _value: ConstPoolIdx) {
unimplemented!();
}
fn visit_const_generic_default(&mut self, _dest: Register) {
unimplemented!();
}
fn visit_test_eq_ptr(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ne_ptr(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_eq_generic(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ne_generic(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_eq_bool(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ne_bool(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_eq_uint8(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ne_uint8(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_gt_uint8(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ge_uint8(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_lt_uint8(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_le_uint8(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_eq_char(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ne_char(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_gt_char(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ge_char(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_lt_char(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_le_char(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_eq_enum(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ne_enum(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_eq_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ne_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_gt_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ge_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_lt_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_le_int32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_eq_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ne_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_gt_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ge_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_lt_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_le_int64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_eq_float32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ne_float32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_gt_float32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ge_float32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_lt_float32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_le_float32(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_eq_float64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ne_float64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_gt_float64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_ge_float64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_lt_float64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_test_le_float64(&mut self, _dest: Register, _lhs: Register, _rhs: Register) {
unimplemented!();
}
fn visit_assert(&mut self, _value: Register) {
unimplemented!();
}
fn visit_jump_if_false(&mut self, _opnd: Register, _offset: u32) {
unimplemented!();
}
fn visit_jump_if_false_const(&mut self, _opnd: Register, _idx: ConstPoolIdx) {
unimplemented!();
}
fn visit_jump_if_true(&mut self, _opnd: Register, _offset: u32) {
unimplemented!();
}
fn visit_jump_if_true_const(&mut self, _opnd: Register, _idx: ConstPoolIdx) {
unimplemented!();
}
fn visit_jump_loop(&mut self, _offset: u32) {
unimplemented!();
}
fn visit_loop_start(&mut self) {
unimplemented!();
}
fn visit_jump(&mut self, _offset: u32) {
unimplemented!();
}
fn visit_jump_const(&mut self, _idx: ConstPoolIdx) {
unimplemented!();
}
fn visit_invoke_direct_void(&mut self, _fct: ConstPoolIdx) {
unimplemented!();
}
fn visit_invoke_direct(&mut self, _dest: Register, _fct: ConstPoolIdx) {
unimplemented!();
}
fn visit_invoke_virtual_void(&mut self, _fct: ConstPoolIdx) {
unimplemented!();
}
fn visit_invoke_virtual(&mut self, _dest: Register, _fct: ConstPoolIdx) {
unimplemented!();
}
fn visit_invoke_static_void(&mut self, _fct: ConstPoolIdx) {
unimplemented!();
}
fn visit_invoke_static(&mut self, _dest: Register, _fct: ConstPoolIdx) {
unimplemented!();
}
fn visit_invoke_generic_static_void(&mut self, _fct: ConstPoolIdx) {
unimplemented!();
}
fn visit_invoke_generic_static(&mut self, _dest: Register, _fct: ConstPoolIdx) {
unimplemented!();
}
fn visit_invoke_generic_direct_void(&mut self, _fct: ConstPoolIdx) {
unimplemented!();
}
fn visit_invoke_generic_direct(&mut self, _dest: Register, _fct: ConstPoolIdx) {
unimplemented!();
}
fn visit_new_object(&mut self, _dest: Register, _cls: ConstPoolIdx) {
unimplemented!();
}
fn visit_new_array(&mut self, _dest: Register, _cls: ConstPoolIdx, _length: Register) {
unimplemented!();
}
fn visit_new_tuple(&mut self, _dest: Register, _tuple: TupleId) {
unimplemented!();
}
fn visit_nil_check(&mut self, _obj: Register) {
unimplemented!();
}
fn visit_array_length(&mut self, _dest: Register, _arr: Register) {
unimplemented!();
}
fn visit_array_bound_check(&mut self, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_load_array_bool(&mut self, _dest: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_load_array_uint8(&mut self, _dest: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_load_array_char(&mut self, _dest: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_load_array_int32(&mut self, _dest: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_load_array_int64(&mut self, _dest: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_load_array_float32(&mut self, _dest: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_load_array_float64(&mut self, _dest: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_load_array_ptr(&mut self, _dest: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_load_array_tuple(&mut self, _dest: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_load_array_generic(&mut self, _dest: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_load_array_enum(
&mut self,
_dest: Register,
_arr: Register,
_idx: Register,
_enum_idx: ConstPoolIdx,
) {
unimplemented!();
}
fn visit_store_array_bool(&mut self, _src: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_store_array_uint8(&mut self, _src: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_store_array_char(&mut self, _src: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_store_array_int32(&mut self, _src: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_store_array_int64(&mut self, _src: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_store_array_float32(&mut self, _src: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_store_array_float64(&mut self, _src: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_store_array_ptr(&mut self, _src: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_store_array_tuple(&mut self, _src: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_store_array_generic(&mut self, _src: Register, _arr: Register, _idx: Register) {
unimplemented!();
}
fn visit_store_array_enum(
&mut self,
_dest: Register,
_arr: Register,
_idx: Register,
_enum_idx: ConstPoolIdx,
) {
unimplemented!();
}
fn visit_ret_void(&mut self) {
unimplemented!();
}
fn visit_ret(&mut self, _opnd: Register) {
unimplemented!();
}
}
|
The impact of falling oil prices is likely to be largely negative for Texas, unlike many other states in the US. Some believe the state is destined for a regional recession
It was all going so well. Contributing 35 percent of all US crude oil production in 2014, Texas – the oil capital of the US – has long enjoyed a thriving economy as a result. Many argue that the state largely carried the US out of the depths of its economic crisis on the legs of an energy boom: one in seven jobs created in the 50 months following the recession were in Texas, and unemployment in the state is a whole percentage point lower than the national average.
But as oil prices threaten to fall below $40 a barrel after nearly five years of stability at around $110, economists have warned that 2015 could be when it all crashes and burns. While the rest of the world rejoices at the reduced cost of heating their homes or filling their cars, energy-export-dependent regions like Texas have been hit by significant revenue shortfalls.
“While the overall US economy is going to be affected in a positive way by the fall in oil prices (see Fig 1) – household income will rise overall – in places like Texas, the impact is certainly going to be negative,” said Paul Dales, a senior US economist at Capital Economics. “This is simply because so much of their money is dependent on the oil industry. Employment will likely fall, household income will shrink, there’s going to be fewer jobs and it’ll hit the housing market too.”
The oil and natural gas industry makes up a significant chunk of the US economy: it contributes around $1.2trn to GDP per year and supports more than 9.3 million permanent jobs, either directly within the sector or as a result of the multiplier effect on local economies, according to a study by the Perryman Group. And that multiplier effect is not to be underestimated – the American Petroleum Institute found that each direct job in the oil and natural gas industry supported approximately 2.7 jobs elsewhere in the US economy in 2011.
From boom to bust
The luxury homes market has been thriving in Texas for years, particularly in areas with a high concentration of well-paid energy sector jobs. Wealthy Houston residents purchased 1,194 homes valued at $1m or higher in 2014, up from 688 five years prior and a 13 percent increase from 2013, according to a report by the Texas Association of Realtors. While the highly skilled, highly paid jobs are the safest in case of a downturn, instability is bound to be on the minds of potential buyers. For example, a buyer eyeing a $3m property may opt for a $1m property instead, as a safer option.
Now predictions for job growth in the Houston area have been halved from last year, and cuts have already been announced by some of the leading oil producers in the area – Baker Hughes and Schlumberger have axed 7,000 and 9,000 respectively. More are expected well into 2015, and this kind of activity has made analysts justifiably uneasy.
Fracking in the US has boosted oil production by 90% since 2008 US oil demand growth was 1% in 2015 Average oil price per gallon was $2.60 in 2015 Which gives consumers an extra $60bn to spend in 2015 Source: CNN
In December, JPMorgan Chase’s Chief US Economist Michael Feroli warned: “We think Texas will, at least, have a rough 2015 ahead, and is at risk of slipping into a regional recession,” CNN Money reported.
But while some especially nervous market-watchers throw around speculation that the state could soon see another 1980s-style crash, when oil prices completely folded and the Texan economy was hit hard as a result, such extreme predictions are largely unfounded. Aside from that being the last time such a drastic price tumble took place – the price of oil has fallen by more than 40 percent per barrel since June 2014 – the similarities tend to end there. Not only did the price of natural gas also fall in 1986 – which rapidly exacerbated existing revenue shortfalls – but since then, the state has endeavoured to learn from the past.
Following the painful recession of that period, Texas sought to diversify its economy so as to be less dependent on an occasionally volatile commodity like shale gas. Now, it’s attracted workers from other industries including medicine, finance, education and technology. Dallas Fort Worth’s office rental market is now more saturated by tech companies than any other industry. Furthermore, the oil sector has come a long way in those almost-30 years, having undergone significant technological changes that have increased both the efficiency and profitability of extraction. When the 1986 crash happened, the effect couldn’t be prevented from seeping into the real estate market: home prices dropped 14 percent from their peak, with Houston, the most energy-concentrated area, hit the hardest. Housing permits nose dived a drastic 75 percent in the months following.
Admittedly, it might not be a dramatic crash echoing that of 30 years prior. But even so, the price has tumbled by more than 40 percent in a worryingly short period of time, and that simply cannot be ignored. “There are some reasons to think it may not be as bad this time around, but there are even better reasons not be complacent about the risk of a regional recession in Texas,” Feroli added.
While most markets remain relatively untouched at this point – real estate firm CBRE claims a strong fourth quarter in 2014 for both the residential and commercial real estate sectors – most are bracing for a tumultuous 2015. The cracks have already begun forming: evidence from the Houston Business Cycle Index shows growth to have slowed from 7.4 percent in October to six percent the following month. An excerpt from the report reads: “Lower oil prices and declines in drilling activity will likely take considerable steam out of the region’s economic engine in coming months. While prospects for the Houston region are more uncertain, the outlook is for positive, though weaker, growth.”
Keeping a watchful eye
Although warnings of a recession may be somewhat premature, the Lone Star State is certainly one to watch in 2015. Sara Rutledge, Director of Research and Analysis at CBRE and based in Texas, says that her team is keeping a close eye on the real estate market for energy-related headwinds, as they expect firms to be cutting capital expenditure and potentially streamlining their workforces.
Forecasts vary drastically. Credit Suisse warned that new-home construction could tumble by as much as 20 percent in Texas this year, while Rutledge said the figure is between two to three percent, due to the ideal position the market already finds itself in. Quarter after quarter of unabated growth in the residential real estate market has prepared it well for an eventual slowdown.
“We’ve been growing at an incredibly robust pace on multi-family rentals, at eight to 10 percent for a few years now, so we had expected that to slow down anyway, as that momentum is simply not sustainable,” Rutledge added.
According to Rutledge, the minimal impact on growth thus far is due to supply never having been able to catch up with demand throughout the industry’s peak. While six months worth of property supply is the standard recommendation for a healthy inventory, for single-family homes, Texas’ stands at three months even now. That figure drops to 2.7 months in Houston, where the highest concentration of energy companies can be found, so a decrease in activity will take even longer to throw that market into turmoil.
It may not be such a breeze for commercial real estate, however. Despite the sector also coming in to 2015 fighting with the strongest net absorption since 1997 and 5.5 million square feet of office space leased across the state, Rutledge does anticipate some fallout from the drop in oil prices in the near future. This is expected in both leasing and construction – more office space is currently in construction in Houston than anywhere else in the US, and if companies begin downsizing their operations, those new spaces will only further flood the market.
The missing detail
When considering the job cuts that have already announced, it’s important to remember that a Halliburton-Baker Hughes merger was announced in November 2014, valued at $34.6bn. Based on combined revenues, the deal will create a new company – which will trade as Halliburton – worth $67bn and with 140,000 employees. It’s undoubtedly a massive deal, but still only makes the new entity half the size of industry leader Schlumberger, which has a market capitalisation of $125bn.
What fervent analysts are failing to acknowledge, however, is that the majority of these job cuts are likely to be as a result of the merger, as opposed to falling revenues. The counter argument is that the deal itself only took place because the sudden drop in prices caused the two companies to panic: it will insulate the two from a slowdown in drilling, and may allow them to keep prices slightly higher than if they were in competition with each other.
Halliburton derives around half of its total revenue from North American operations, so a bit of nervousness is to be expected. But the more likely argument is that as the two companies have a considerable overlap in their key product segments and similar geographical footprints, it’s an ideal opportunity to cut costs and improve profit margins as a result. Halliburton estimates that the combined entity will yield annual cost synergies of around $2bn, in fact.
Plus, as Rutledge pointed out, just how many of those cuts relate to Texas-based roles has yet to be announced. In December, Halliburton said it was slashing 1,000 jobs in its Eastern Hemisphere offices amid tumbling global oil prices, affecting Europe, Asia, Africa, the Middle East and Australia, yet leaving the Americas untouched. Further takeovers are anticipated in the future, as falling prices put increasing pressure on exploration companies to cut their capital expenditure and eliminate competition. The extreme result of that would see a very limited number of gargantuan companies controlling the entire global energy market; a worryingly dystopian image, and certainly one that anti-competitiveness watchdogs will be working hard to avoid.
An alternative way of looking at the sudden drop in prices is that it could give the energy industry the makeover it needs. For decades now, a shortage of engineers and similarly highly skilled workers has seen oil companies awarding obscene bonuses and offering unfathomable benefits packages to its employees in an attempt to win over the strongest talent.
Perhaps the reduced revenues for these companies will come as a blessing in disguise, allowing them to better consolidate their outgoings. Even so, whichever way you look at it, paying staff less will have an adverse effect on household income and therefore overall domestic spending.
While the energy sector plunges into an uncertain future and a likely state of turmoil for 2015, Texas has successfully spent the last few decades shielding itself from such downturns. A slowdown can certainly be expected, and some sectors will be hit harder than others, but a strong performance from the wider US economy combined with other thriving industries within the state should help it weather the storm with minimal damage incurred. |
N-Methyl-N-(2-nitrophenyl)nitramine and N-methyl-N-(3-nitrophenyl)nitramine.
The structures of the two title isomeric compounds (systematic names: N-methyl-N,2-dinitroaniline and N-methyl-N,3-dinitroaniline, both C7H7N3O4) are slightly different because they exhibit different steric hindrances and hydrogen-bonding environments. The aromatic rings are planar. The -N(Me)NO2 and -NO2 groups are not coplanar with the rings. Comparison of the geometric parameters of the ortho, meta and para isomers together with those of N-methyl-N-phenylnitramine suggests that the position of the nitro group has a strong influence on the aromatic ring distortion. The crystal packing is stabilized by weak C-H...O hydrogen bonds to the nitramine group. |
// @flow
import * as React from 'react'
import { connect } from 'react-redux'
import { PrimaryButton } from '@opentrons/components'
import { CalibrationInfoContent } from '../CalibrationInfoContent'
import { actions as robotActions } from '../../robot'
import removeSingle from '../../assets/images/remove_tip_single.png'
import removeMulti from '../../assets/images/remove_tip_multi.png'
import type { Dispatch } from '../../types'
import type { TipProbeProps } from './types'
type OP = TipProbeProps
type DP = {| onConfirmClick: () => void |}
type Props = {| ...OP, ...DP |}
export const RemoveTipPanel: React.AbstractComponent<OP> = connect<
Props,
OP,
{||},
DP,
_,
_
>(
null,
mapDispatchToProps
)(RemoveTipPanelComponent)
function RemoveTipPanelComponent(props: Props) {
const { channels, onConfirmClick } = props
const imgSrc = channels === 1 ? removeSingle : removeMulti
return (
<CalibrationInfoContent
leftChildren={
<div>
<p>Remove tip from pipette.</p>
<PrimaryButton onClick={onConfirmClick}>
Confirm Tip Removed
</PrimaryButton>
</div>
}
rightChildren={<img src={imgSrc} alt="remove tip" />}
/>
)
}
function mapDispatchToProps(dispatch: Dispatch, ownProps: OP): DP {
const { mount } = ownProps
return {
onConfirmClick: () => {
dispatch(robotActions.confirmProbed(mount))
},
}
}
|
Q:
How count and store files from a directory in a vector
I'm trying to call all existing ".stl" files in a given directory, and use them to build my geometry in Geant4. This is a separate program I've made to test it before I add it to my Geant4 code.
As for now, I've been trying to get the number of files via system command. The problem is that it always returns the correct number of files, 32, and then it returns Zero (0). Therefore, I cannot use it in a for loop.
Furthermore, when I print the files, I have the "." and "..", which is not what I want.
#include <iostream>
#include <string>
#include <vector>
#include <algorithm>
#include <iterator>
#include <cstring>
#include <sys/types.h>
#include <dirent.h>
typedef std::vector<std::string> stringvec;
void read_directory(const std::string& name,stringvec& v)
{
DIR* dirp = opendir(name.c_str());
struct dirent * dp;
while ((dp = readdir(dirp)) != NULL) {
v.push_back(dp->d_name);
}
closedir(dirp);
}
int main()
{
int NbOfComponents;
stringvec v;
std::string Ext = ".stl";
std::string Dir = "/home/lghizoni/Geant4/SpaceRadiationFramework/Geometry/Satlab/";
std::string command = "ls -l "+Dir+"*"+Ext+"|wc -l";
const char *Command = command.c_str();
NbOfComponents = system(Command);
read_directory(Dir,v);
std::cout<<"The geometry is composed by "<<NbOfComponents<<" parts"<<std::endl;
std::copy(v.begin(),v.end(),std::ostream_iterator<std::string>(std::cout,"\n"));
First of all, I wanted to store the number of files in NbOfComponents, so I could use it in a loop later to call each of the parts. The problem is that it returns Zero as can be seen here in the output:
32
The geometry is composed by 0 parts
Assembly 5 - M2x10_TX6.stl
Assembly 5 - castor-v020 (3).stl
Assembly 5 - Sshield_bottom.stl
Assembly 5 - castor-v020 (7).stl
Assembly 5 - M2x10_TX6_1.stl
Assembly 5 - M2x10_TX6_12.stl
.
Assembly 5 - castor-v020 (2).stl
..
Assembly 5 - M2x10_TX6_14.stl
Assembly 5 - M2x10_TX6_9.stl
Assembly 5 - M2x10_TX6_7.stl
Assembly 5 - Sshield_top.stl
Assembly 5 - castor-v020 (1).stl
Assembly 5 - castor-v020 (11).stl
Assembly 5 - M2x10_TX6_13.stl
Assembly 5 - M2x10_TX6_10.stl
Assembly 5 - M2x10_TX6_3.stl
Assembly 5 - M2x10_TX6_8.stl
Assembly 5 - M2x10_TX6_5.stl
Assembly 5 - castor-v020 (12).stl
Assembly 5 - M2x10_TX6_2.stl
Assembly 5 - M2x10_TX6_11.stl
Assembly 5 - castor-v020 (5).stl
Assembly 5 - castor-v020 (13).stl
Assembly 5 - castor-v020 (6).stl
Assembly 5 - castor-v020 (14).stl
Assembly 5 - M2x10_TX6_4.stl
Assembly 5 - castor-v020 (8).stl
Assembly 5 - castor-v020 (9).stl
Assembly 5 - M2x10_TX6_6.stl
Assembly 5 - castor-v020 (4).stl
Assembly 5 - castor-v020.stl
Assembly 5 - castor-v020 (10).stl
The last point is that it returns "." and "..", which as I understand, are directories. With that I cannot call each of them from the vector v[i].
Any inputs will be most appreciated, and thanks in advance :)
A:
system command doesn't return the out of the command applid it returns error code success / failure
check this from man page
SYNOPSIS
#include <stdlib.h>
int system(const char *command);
DESCRIPTION
The system() library function uses fork(2) to create a child process that executes the shell command specified in command using execl(3) as follows:
execl("/bin/sh", "sh", "-c", command, (char *) 0);
system() returns after the command has been completed.
During execution of the command, SIGCHLD will be blocked, and SIGINT and SIGQUIT will be ignored, in the process that calls system() (these signals will be handled according to their defaults
inside the child process that executes command).
If command is NULL, then system() returns a status indicating whether a shell is available on the system
You can use popen command to get output of system command applied
FILE *fp;
char data[100];
std::string command = "ls -l "+Dir+"*"+Ext+"|wc -l";
const char *Command = command.c_str();
fp = popen(Command, "r");
while (fgets(data, sizeof(data), fp) != NULL)
{
printf("%s", data);
}
pclose(fp);
And about "." & ".." you should directly compare and ignore those two files as those will always be there presenting current and parent of current directory
|
Recent Posts:
From the breathless reporting in the financial media, you’d think the world was coming to an end just because the market has actually been correcting this month.
In truth, I can’t find any consensus among the economists, hedge fund managers, wealth managers and CEOs that I regularly speak with regarding the market. You’d think that if the Fed starts to taper, that would mean rates would rise and folks would rush out of stocks and back into bonds to find yields.
Maybe. Or maybe not.
That’s why I advise having a long-term diversified portfolio, with portions set aside for options, swing trades and stocks to buy in case of a crash. I have my own shopping list for such stocks to buy, and I’ve written about them over the past two years, demurring on purchases because they are overvalued.
In a market crash, however, you might get a chance to buy in. Here’s what I’d want to grab if it went on sale.
Stocks to Buy After a Crash: Whole Foods Market (WFM)
The verdict is in, and organic wins. Organic foods have infiltrated even the smallest markets at this point. “Organic” is, to my mind, the greatest marketing scheme since De Beers’ “Diamonds Are Forever.” In my experience, organic foods do generally taste better, but no company has leveraged this single word better than Whole Foods.
Whole Foods also runs an outstanding business, has a fantastic company culture and knows how to ream consumers via outrageously expensive organic products better than any other business.
WFM stock trades around $52, with just under $3 per share in cash. At estimates of $1.68 in earnings per share for FY14 and projections for 17% in long-term growth, and perhaps a 20% premium for its cash flow, I would assign it a fair value around $34. If WFM stock is unfortunate enough to fall that low, I’d absolutely buy around there.
Stocks to Buy After a Crash: MSC Industrial Direct (MSM)
MSC Industrial Direct (MSM) is a very boring company, which in an of itself is a good reason it belongs in a list of stocks to buy.
MSM is a marketer and distributor of a broad range of metalworking and maintenance, repair, and operations products. You should always pay attention to distribution operations. It’s something I learned while in the movie business. The manufacturers might make money, but they are nothing without distribution. If you have a wide distribution platform, you can make tons of money, and that’s why the movie studios distribute their own films.
Plus, MSC distributes really important little objects that make a lot of machines run. Again, not a sexy business, but a good one to be in.
As far as MSM stock is concerned, 13% long-term growth for me translates into a 13 P/E on FY14 earnings of $4. Fair value is $52, and MSM trades at $84.
Stocks to Buy After a Crash: Exxon Mobil (XOM)
Exxon Mobil (XOM) is what I call a “forever hold” stock. As I’ve written before, the world will always need oil, and XOM is the world-class operation in this sector. (Of course, it doesn’t hurt that it’s also deeply entrenched in natural gas, now, too.)
Exxon’s earnings can vary for many reasons, so I’ve always valued XOM stock on an EV/EBITDA ratio. It presently sits at 6.89. My historical buy-in for XOM stock has always been an EV-EBITDA ratio of 5.5, give or take a bit. Enterprise value is roughly equivalent to market cap with XOM, so that means we want to see about a 20% decline in market cap, which means a 20% decline in price.
Grab XOM stock in the mid-$80s.
Stocks to Buy After a Crash: Amazon (AMZN)
Jokes aside, the zombie apocalypse can occur and I believe you’ll still be able to get anything you want from Amazon — and get it 15%-35% cheaper than anywhere else. Seriously, I never go to stores anymore. Ever. There’s no reason to.
Amazon’s earnings will always be erratic and expectations will always be all over the place (as we saw last night), but the company is a star, as is AMZN stock. Amazon stock actually suffered a pretty substantial blow today, so it’s certainly priced better now than it was yesterday. However, it’s still difficult to say what fair value is, so that’s when I look at the technicals.
The 200-day moving average is at about $320, and that’s where I would buy. |
Monorails
With an experience from over 3000 monorail projects, Rostek engineers will help you to design the best possible facade access.
The largest monorail product portfolio
Rostek aluminium track profiles can be used to solve your demand in best possible way.
Rostek monorails can be optimized for long or short bracket spacings in best economical way without forgetting aesthetical views. Rostek’s monorail system comprises an aluminium track complete with one of our BMU cradles or suspended platforms with either manual or motorized trolleys, depending on the application and project budget.
Designed to fit with the architectural requirements
Monorails can even be hidden in the roof structure.
We have a very wide range of monorail products and offer the best solutions on the market. No building is too complex or unconventional for Rostek monorails. All of our monorails can be fitted indoors and outdoors. The monorails can be mounted to the ceiling or the parapet of a building to conceal it or to promote the architectural design.
The Roslift system for inclined monorails
The Roslift system can even climb vertically with a full load.
The Roslift trolley can be used in monorail systems in any shape of the facade, it can even climb on a vertical surface. This makes The Roslift ideal for modern buildings - Even the most complex architecture is not a challenge for the Roslift system. |
Q:
Custom post type getting wrong categories and tags
Ok i have a custom post type on my blog called videos, where i only post a video. There's a sceen cap below
On the right are the latest post from the custom post type, on the left is the video, and under the video is the date and time, category and tags.
But the problem is that it is getting the wrong, Tags, Categories, and date.
How do i fix this?
here is the code of that template page below
<?php
/*
Template Name: Single Videos
*/
?>
<?php get_header() ?>
<div id="wrapper">
<div id="container">
<div id="contentfull">
<?php the_post() ?>
<div class="entry-wide">
<center><h2 class="page-title2"><?php the_title() ?></h2> </center>
<div class="entry-videoo">
<?php the_content() ?>
<?php wp_link_pages('before=<div class="page-link">' . __( 'Pages:', 'wpbx' ) . '&after=</div>') ?>
</div>
<div id="videosidebar">
<?php
$queryObject = new WP_Query( 'post_type=videos&posts_per_page=2020&orderby=rand' );
// The Loop!
if ($queryObject->have_posts()) {
?>
<?php
while ($queryObject->have_posts()) {
$queryObject->the_post();
?>
<table width="100%" border="0" cellspacing="0" cellpadding="0">
<tbody>
<tr>
<td valign="top" width="1%">
<div id="videoimg"><a href="<?php the_permalink(); ?>" title="<?php printf(__( 'Read %s', 'wpbx' ), wp_specialchars(get_the_title(), 1)) ?>">
<?php the_post_thumbnail('video-post'); ?>
</a></div>
</td>
<td valign="top" width="90%">
<a href="<?php the_permalink(); ?>"><?php the_title(); ?></a>
</td>
</tr>
</table>
<?php
}
?>
<?php
}
?>
</div>
<div class="entry-info">
<div class="entry-meta-top">
<span class="entry-date"><font color="#e60288"><b><?php the_time(__('F jS, Y', 'kubrick')) ?></b></font></span>
<span class="entry-meta-sep">|</span>
<span class="entry-cat">Published in: <?php the_category(', '); ?> </span>
<div id="sharing">
<span class='st_facebook_hcount' st_title='<?php the_title(); ?>' st_url='<?php the_permalink(); ?>' displayText='share'></span><span class='st_twitter_hcount' st_title='<?php the_title(); ?>' st_url='<?php the_permalink(); ?>' displayText='share'></span><span class='st_plusone_hcount' st_title='<?php the_title(); ?>' st_url='<?php the_permalink(); ?>' displayText='share'></span></div>
</div>
<br>
<?php the_tags( __( '<span class="tag-links"><strong>More On:</strong> ', 'wpbx' ), ", ", "</span>\n" ) ?>
<div class="entry-content">
<?php the_excerpt(); ?>
</div>
</div>
<div class="entry-commm">
<?php comments_template(); ?></div>
</div><!-- entry -->
</div><!-- #contentfull -->
</div><!-- #container -->
</div><!-- #wrapper -->
<?php get_footer() ?>
A:
I think your issue is down to this call:
$queryObject->the_post();
overwriting the global $post variable. Your subsequent calls to (e.g.) the_title() will use the values from that loop, not for the custom post itself. Try adding
wp_reset_postdata()
in your PHP code after the $queryObject loop (i.e. before <div class="entry-info">).
And a minor thing - you're not closing your tbody tag - run the generated HTML through the w3c validator and correct any issues; it'll help resolve any CSS issues you may hit in future.
|
Mercedes Tenorio
Mercedes Tenorio (born November 11, 1956, Rivas), a Nicaraguan nurse, was Edén Pastora's running mate in the 2006 Nicaraguan general election for the Alternative for Change party. Tenorio was an active member of the Sandinista Health Workers' Federation (FETSALUD).
References
Category:1956 births
Category:Living people
Category:Alternative for Change politicians
Category:Nicaraguan women in politics
Category:21st-century women politicians |
3:14 p.m. – Caller said someone has broken into a house she is caring for. She’s unsure if anything has been taken but will be in touch with the homeowner. Caller spoke with officers who will follow up with homeowner.
12:37 a.m. – Caller said he is getting weird phone calls from someone asking when he was going to be home. He requests that his house be checked on to make sure no one is there. OCSD responded. Site checks OK.
4:51 p.m. – Medical: 89-year-old male who had a blood transfusion is bleeding, has high blood pressure and is shaking. OCA responded. Patient was transported to BRMC.
8:02 p.m. – Caller said her school bag was stolen Nov. 10, including its contents, which includes supplies, a textbook and a flute. Officer instructed caller to come to sheriff’s office with her parents to fill out a statement.
Nov. 15
9:39 a.m. – A compound bow was found on the courthouse lawn. Owner should come to sheriff’s office and identify it, and it will be returned.
12:59 p.m. – Medical: 911 caller said they need an ambulance and then said nothing else. Dispatcher called BRMC for ambulance, BRMC accepted then canceled. Dispatcher called Cox ambulance, and it is responding. Timber Knob and Pontiac first responders were also toned out.
1:29 p.m. – Vehicle backed into another vehicle in parking lot of recycling center on County Road 503. Assistance rendered.
Gainesville senior Annie Noah on Dec. 8 signed a letter of intent to play basketball for College of the Ozarks. Seated, from left: Annie’s mother Joyce Noah, Annie, and her father, Dan Noah. Back: College of the Ozarks Lady Bobcats head basketball coach Becky Vest and Gainesville High School head basketball coach Morris Jenkins. Photo by Karla Smith. |
Measuring temperature gradients over nanometer length scales.
When a quantum dot is subjected to a thermal gradient, the temperature of electrons entering the dot can be determined from the dot's thermocurrent if the conductance spectrum and background temperature are known. We demonstrate this technique by measuring the temperature difference across a 15 nm quantum dot embedded in a nanowire. This technique can be used when the dot's energy states are separated by many kT and will enable future quantitative investigations of electron-phonon interaction, nonlinear thermoelectric effects, and the efficiency of thermoelectric energy conversion in quantum dots. |
Accidental shooting in Des Allemands
Two men playing with stolen gun, police say
A Des Allemands man is in jail after allegedly shooting his friend on accident, according to the St. Charles Parish Sheriff’s Office.
Justin I. Howard, 26, of 16683 LA 631, was arrested on Oct. 18 and charged with possession of a stolen firearm, negligent injury, illegal use of a weapon and felony carrying an illegal weapon.
Howard and his friend, an 18-year-old Des Allemands man, were walking together when the silver handgun that Howard was holding accidentally went off, hitting his friend in the back of his right shoulder, according to Captain Pat Yoes with the St. Charles Parish Sheriff's Office.
Yoes said the two then hid the gun, which turned out to be stolen, before splitting up. When the friend went to University Hospital for the gunshot wound, police were called.
Police obtained a search warrant and found the weapon, and Howard was later arrested and is being held in the St. Charles Parish Jail. He was also found to be a convicted felon, according to Yoes, so it was illegal for him to be in possession of a firearm.
Subscribe Today and Save!!!
Subscribe to the St. Charles Herald-Guide.
St. Charles Herald-Guide is an award-winning newspaper that covers all aspects of St. Charles Parish - from schools and parish government news to social events, features on our local residents and sports.
featured merchant
Patella Dental - Joshua C. Patella, DDS
When you visit Dr. Joshua C. Patella and his team at Patella Dental, you are our top priority. Our entire general dentistry team is dedicated to providing you with the personalized, gentle care that you deserve. We believe that teeth should look and feel |
Superintendents Respond to the Auditor’s Report About Data Scrubbing
February 12, 2013 | 3:23 PM
This week state auditor Dave Yost announced that his investigation into data scrubbing at Ohio’s schools is complete, and a total of nine districts were found to have altered student attendance data in an attempt to boost their report card scores or cash in on more funding.
But some superintendents dispute the auditor’s findings.
Yost had already named five schools in previous reports.
The four new districts found to have taken part in scrubbing are Canton City Schools, Cincinnati City Schools, Northridge Local Schools in Montgomery County and Winton Woods City Schools in Hamilton County.
Canton City Schools
Canton Schools’ superintendnet Adrian Allison says the situation is more complicated than what auditor’s report presents.
The Canton data being questioned is from the 2010-2011 school year, and involved two schools run as community collaboratives with other districts. Both are for at-risk, often transitory students. They’re students who often don’t fit in traditional schools, nor, says Superintendent Adrian Allison, in the traditional way of coding students for on state reports.
“I am disappointed that the auditor failed to recognize the unique circumstances of these schools, failed to recognize the complex system that is EMIS, but I, without question, am confident that Canton City Schools did not engage in any intentional manipulation of its data.”
Cincinnati City Schools
In his announcement yesterday, Yost singled out Cincinnati schools as having intentionally flouted the law and defied reporting standards. Cincinnati schools superintendent Mary Ronan issued a statement yesterday saying, in part:
Based on the Auditor’s preliminary findings, the majority of “errors” that the Auditor observed at CPS relate to “building to building transfers.” We understand that the Auditor’s staff found an “error” in each case where CPS reported a break in enrollment for a student who withdrew from a CPS school and later enrolled in another CPS school. We respectfully disagree that reporting a break of enrollment or a building to building transfer necessarily constitutes an error in reporting.
The Cincinnati Enquirer reports the district’s school board president doesn’t see a problem with the way the district has been reporting its attendance data:
“I am satisfied with the way the administration chose to handle it. I’d rather have accurate information than inaccurate,” she said. “We were going to get dinged either way. Either we follow procedures or we inflate numbers.
“The real issue is mobility and how we account for it. It is very difficult with the mobility we had to not have problems.”
Winton Woods City Schools
Winton Woods superintendent Jim Smith told WLWT in Cincinnati he doesn’t think what the auditor found would really have a significant effect on the districts report card grades:
“We really don’t think there’s enough questionable submissions that would change our report card here. It simply would be very unlikely, would be my guess.”
Northridge Local Schools
Northridge Local Schools’ superintendent Dave Jackson told the Dayton Daily News he’s taking the auditor’s investigation seriously, and will work to improve the record keeping in his district:
Superintendent Dave Jackson said he has freely given the auditor access to district files, and there was no attempt made to hide information. Jackson said in a statement Monday he was concerned with the auditor’s findings.
“We will take the information in his final report seriously, and are awaiting the specific details regarding the exceptions that have been identified,” Jackson said. “Once this information is received, we will be better able to evaluate our practices and to modify those practices in order to eliminate errors in the future.”
Topics
Comments
If parents don`t send the kids to school,the bills don`t magically disappear. This seems to be just more right wing anti government propaganda. Fix the system.Bring back our jobs from China. A carrot and stick system,with no carrot is doomed.
Next Post
Previous Post
About StateImpact Ohio
StateImpact Ohio is a collaboration among WCPN, WKSU and WOSU. Reporters Amy Hansen and Mark Urycki travel the state to report on the state of education in Ohio, where it’s heading, and how it affects you. Read their reports on this site and listen to them on public radio stations across Ohio. |
A man carrying a gas cylinder walks out of the research and development centre of Sun Pharmaceutical Industries Ltd in Mumbai May 29, 2014. REUTERS/Danish Siddiqui
MUMBAI (Reuters) - Sun Pharmaceutical Industries Ltd, India’s largest drugmaker, said on Wednesday the U.S. health regulator has informed the company of more concerns found at its Halol manufacturing plant after a recent inspection.
The approval of several of Sun’s key drugs in the United States, the drugmaker’s biggest market, depends on the clearance on its Halol plant in the western Indian state of Gujarat. A warning letter issued by the U.S. Food and Drug Administration (FDA) last year over violations found at the plant has already been hurting the company’s sales.
The latest notice, a Form 483, was issued to Sun after the FDA completed an inspection of the Halol plant on Dec. 1, the company said. Such a notice is issued when the FDA finds that conditions at a drug plant violate U.S. rules.
It is unclear what violations the FDA found. Sun did not disclose them, and the FDA does not typically make such findings public.
The company’s stock took a beating on Wednesday after Indian brokerage IIFL said in a note to clients it was aware that the FDA’s findings on the Halol plant ran 14 pages long. Sun, in its statement, did not comment on the length of the notice. It said it was working on responding to the letter within 15 days.
Sun’s shares were down 5.3 percent at 0827 GMT in Mumbai. |
Q:
Does there exist a membrane that has unbalanced concentration as equilibrium?
In osmosis, there is flow of solvent particles from a region of lower solute concentration to a region of higher solute concentration, until such time that the concentration on each sides are equal.
But does there exist a membrane in which the equilibrium concentration is not necessarily equal (without applying unbalanced pressure)?
A:
1) Osmosis is more commonly defined as the diffusion of water across a membrane. Unless specifically talking about water its best to just say diffusion. (just a small clarification)
2) The solutions on either side of the selectively permeable membrane will attempt to reach the same concentration (in units of molarity = moles of solute/liter of solution) of solutes by the movement of species across the membrane. The goal is for both sides to reach the same osmotic pressure.
The membrane cannot affect the osmotic pressure of the solutions. It merely decides which species are allowed to move for the system to reach equilibrium.
3) At equillibrium, the concentration of each species in the solutions may be different, as long as both systems have the overall same concentration of solutes.
An example of this is if you have a semi-permeable membrane which allows the movement of ions but not large proteins. If the initial conditions are the same concentration of ions on both sides of the membrane, but an uneven concentration of protein across the membrane, the ions will move to balance out the uneven concentration of proteins. At equilibrium the osmotic pressure of both sides will be equal, but the individual concentration of species on each side will not be equal.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.