text stringlengths 8 5.77M |
|---|
Effect of pomegranate (Punica granatum) juice intake on hepatic oxidative stress.
Pomegranate juice (PJ) possesses a high antioxidant activity, which has been related to beneficial health properties. However, in vivo confirmation and characterization of these effects on biological systems are lacking and needed. This study was performed in order to investigate the effect of prolonged PJ ingestion on general oxidation status. For this purpose, mice ingested PJ (or water in control group) during four weeks, after which damage to lipids, proteins and DNA were evaluated as oxidative cell biomarkers. Levels of hepatic glutathione and the activities and expression of enzymes involved in its metabolism were determined. Catalase and SOD activities were quantified as these enzymes have a crucial role in antioxidant defence. Protection against protein and DNA oxidation was found in PJ group. There was also a significant decrease in GSH and GSSG, without change in the GSH/GSSG ratio. All studied enzymatic activities (GPx, GST, GR, SOD and catalase) were found to be decreased by PJ treatment. Additionally, RT-PCR results showed that GST and GS transcription were also decreased in this group. These results are compatible with a protective effect of PJ against systemic oxidative stress in mice. |
Why I don’t shop at the GAP anymore
My first ever pair of blue jeans were from GAP. In the late 70’s these were flared jeans of the requisite blue denim. As a penniless ( or paisaless ) teenager I’ve had my fashion challenges. Some of these have been documented, notably in the storyThe Coconut Oil Chaperone and The Date of the Jackal. Which you’ve read, I’m sure. God knows I’ve flogged those enough. In my early 20s I oscillated between destitution and abject poverty. All I had was the love of a pretty young thing. Who bought for me, once, a white cheesecloth shirt. Which I discovered was a woman’s blouse because it buttoned up the wrong way and had poofy long sleeves and was mildly see-through. But I wore it. With those GAP jeans. And cut a dashing figure in it too.
Such was the power of my sartorial sexiness. I shall now put up a picture of me in high-waisted flared jeans and a shiny polyester shirt from my University days. Also featured are the two-tone brown suede shoes. You may avert your eyes now. Don’t blame me later, for I did warn you.
Fifteen years later on my first visit to the US, I managed to snag a couple of shirts, on sale for about $6 or so at the GAP. A couple of years later as a penniless immigrant in the late 90’s I tried many times to replicate those first cheap shirts. But deals were hard to find. Instances where the “Real Dollar Cost” met “Customer’s Perceived Value” were hard to find. The shirts were still good looking, the khakis still cut well, the t-shirts were simple and easy.
But then, I noticed that the prices started to go up and the styles started changing. Not only that, I found the quality of the clothes themselves started becoming poorer. It hit rock bottom about 6 years ago when the GAP merchandise started resembling the items available at Old Navy, it’s cheaper sister. (Old Navy became even cheaper). The clothes developed that bedraggled look as if they were apologizing for being on the shelves at all. This went on for a few years and my visits to the GAP became less frequent and more frustrating.
I looked up the figures for GAP over the years. Clearly there is something wrong. GAP is becoming irrelevant. In 2012 it changed it’s failing strategy and the clothes now in the store are closer to the look and feel of the earlier years. The really scruffy stuff was switched out and GAP started to go back to it’s earlier base of products -shabby chic, semi-preppy clothes based on jeans / khakis and shirts. (I’m ignoring the women’s section because women’s fashion is just way too weird for me to comment on. I can only talk about my personal experiences.) And sales figures seem to reflect that. After a few years of flat/falling revenues, 2012/13 saw an upward blip. However, since then sales have once again started falling off.
I see articles on the business channels about GAP “Has GAP become irrelevant?”, “GAP’s failing strategy” and similar articles can be found easily if one uses Google. I have no experience in the fashion industry and very little in the business of merchandising and retail apparel. I can tell you, though, why GAP is failing.
Here it is. The real reason GAP is failing and the reason I no longer shop at the GAP.
The shirts are tight, too tight for me. The t-shirts are too tight, slim-fit seems to the only option. GAP has decided that it no longer needs to sell to middle-aged paunchy men, the men with the income, the baby-boomers. So the shirts and t-shirts are out. But that’s only 25% of the story.
The 75%: GAP is building it’s clothes for slim androids. And I can prove it.
The GAP pants ( all of them) are being made now with fly openings that are less than 2.5 inches long. And getting smaller every day. I looked it up. Apparently, modern young men are slimmer than ever and like to pull their pants down to pee. Like kids. And women. |
The mission of the Program Development Research Group (PDRG) is to carry out a program of basic and applied research supportive of and complementary to the new drug discovery research and development programs of the National Cancer Institute. To this end, PDRG investigators have made substantial progress in a number of interrelated areas, in cellular pharmacology, ultrastructure, immunochemistry, tissue culture, and tumor cell biology, and natural products chemistry. Highlighted in this year's report are studies aimed at the further refinement of the screening models and assay methodologies used in the NCI's high-flux, in vitro antitumor and anti-HIV primary drug screens. Also described are model-development and applications efforts aimed at the detailed, follow-up evaluation of new lead compounds identified in the screens. Detailed biochemical characterizations of human tumor cell lines have included prostanoid biosynthesis, metabolic activation of 4-ipomeanol and molecular genetic approaches to the elucidation of the human lung cytochrome P450 hemoprotein monooxygenase system. New methodology has been defined for the establishment and propagation of certain "normal" (nontumor) lines in vitro. Extensive efforts have been made to develop an in vivo microencapsulation model for anti-HIV drug evaluations; however, results to date indicate this approach will not likely be feasible. Detailed studies of new lead prototype antitumor and anti-HIV compounds, both of synthetic and natural origin, have been underway; however, a more detailed report of these efforts is being deferred until the 1991 Annual Report (i.e., pending declassification of discreet structures). |
You're viewing an article in TMO's historic archive vault. Here, we've preserved the comments and how the site looked along with the article. Use this link to view the article on our current site:Remembering 1993: Who & What Is Newton?
Remembering 1993: Who & What Is Newton?
This concludes our three-part series on some abandoned TV commercials for the Newton. So far, we have brought you two ads called The "Meeting" and "Gotham," followed by two more ads called "The Candidate" and "Where is Newton?" You can find links to those below. We are actually going to end this mini-series with the two most important questions, "Who Is Newton?" and "What Is Newton?" We are including the text from last week's piece for your reference.
The Newton was one of the most exciting technologies to come out of Apple during the reign of John Sculley. The Newton was a handheld computer that stemmed from a vision of Mr. Sculley's, then CEO of Apple, called the Knowledge Navigator. The Knowledge Navigator was actually more of tablet computer, but one of the products that came out of that project's R&D was the handheld Newton.
Unlike today's PDAs, a category of devices that the Newton itself gave birth too, the Newton was a true handheld computer. It did just about everything, including handwriting recognition at a time when Macs and PCs were running at 33 MHz, and while that made the Newton extraordinary, it also helped doom it to the dust bin of history. Its extraordinary features dictated a high price tag, especially for a new class of computing devices, and the fact that it didn't do everything perfectly upon release made it the butt of late-night jokes everywhere (Think The Tonight Show). The first Newton MessagePad released suffered from poor handwriting recognition, and though this was corrected, the Newton was never able to outlive that reputation.
By the time Apple had made the Newton just about perfect with the Newton 2000 and 2100, Steve Jobs had come back to the company and killed the product. This has widely been seen as having happened because the Newton was the brainchild of John Sculley, the man who stabbed Mr. Jobs in the back and fired him, even though Mr. Jobs had brought him to Apple in the first place. That's the popular mythology in any case. In reality, it is probably more a matter of Mr. Jobs thinking that the Newton was not Insanely Great Enough mixed with a bit of NIBS (Not Invented By Steve). Whatever the case, though Apple promised to replace the Newton with some other device "soon," we still are Apple handheld-less today. Hopefully the company is working on something along these lines, but Newton fans still number in the many thousands today.
Enter today's Remembering piece.
We received six old Newton TV commercials that Observer Jacob Fisher thinks weren't shown enough. Had they been shown more, he thinks we never would have heard of a li'l company called Palm. After watching the commercials, we are forced to agree. From Observer Jacob Fisher:
The first Newtons were introduced in August of 1993. The model shown in the ad is the original Newton MessagePad. This was replaced by the 100, 110, 120, and 130. Apple then introduced the 2000 and 2100, which in my opinion is the most useful computer Apple ever made.
Jacob Fisher
We conclude the series with Who Is Newton? and What Is Newton?
Who Is Newton?
Click the Thumbnail for the movie
(320 x 240 @ 4.2 MB)
What Is Newton?
Click the Thumbnail for the movie
(320 x 240 @ 4.1 MB)
In our last installment, we offered The Candidate and Where is Newton?
The Candidate
Click the Thumbnail for the movie
(320 x 240 @ 4.2 MB)
Where Is Newton?
Click the Thumbnail for the movie
(320 x 240 @ 4.1 MB)
Our first two Newston ads were Gotham and Meeting.
Gotham
Click the Thumbnail for the movie
(320 x 240 @ 4.2 MB)
Meeting
Click the Thumbnail for the movie
(320 x 240 @ 4.1 MB)
Many thanks to Jacob Fisher!
If you have an old Apple ad for the Mac, the Apple ][ (or clones such as the Franklin), the Lisa, or any other Apple product, scan them in and send them to us, so that we can share them with other Mac fans. We are also looking for ads from the Mac cloners of the mid-90's such as Power Computing, Motorola, Umax, MacTell, Marathon Computer, PowerTools, and any others we have not mentioned. Feel free to make your scans quite large (high resolution) as we have had many Observers ask for printable versions. Check out our other Remembering articles too. |
Q:
Working of the compiler directive in C++
The #define compiler directive seems rather strange to me. I have read that no memory is allocated to it .
#include <iostream>
#define test 50
int main()
{
cout<<test;
return 0;
}
The above function displays 50 even though no memory is allocated to the compiler directive #define
How does compiler know that 50 is stored in it (test) without having any memory.
A:
Macros are not the same thing as variables.
Your compiler will translate the program
#include <iostream>
#define test 50
int main()
{
cout << test;
return 0;
}
to
#include <iostream>
int main()
{
cout << 50;
return 0;
}
by replacing the name test by its value given at your #define statement. You might want to take a look at some tutorials you can find on the internet e.g.:
#define getmax(a,b) ((a)>(b)?(a):(b))
This would replace any occurrence of getmax followed by two arguments
by the replacement expression, but also replacing each argument by its
identifier, exactly as you would expect if it was a function:
// function macro
#include <iostream>
using namespace std;
#define getmax(a,b) ((a)>(b)?(a):(b))
int main()
{
int x=5, y;
y= getmax(x,2);
cout << y << endl;
cout << getmax(7,x) << endl;
return 0;
}
A:
Effectively, test is going to be replaced by 50 whereever it's encountered in the code prior to compilation. Because the replacement's not done at runtime there's no overhead.
|
After an exhaustive web search and several attempts at ordeylring replica 18" Style 308 wheels both in US and Europe, I finally gave up and ordered the real deal from my local BMW dealer. The best online price was from Circle BMW in NJ at $338.86 per wheel w/o stems or TP sensors. The TP sensor (not like the ABS-based TPM in my M5) is roughly $100 per wheel, so even if you save a bit by going aftermarket, you're going to be paying another $400 for four sensors and rougly $60 for the special stems from BMW, although my tire dealer quoted me $72 per wheel for the sensors and $12 per wheel for stems. Claims they are BMW-supplied. My local BMW dealer and I haggled a bit over the wheel price, but agreed to $366 per wheel to account for not paying Circle to ship to Portland, OR. Wheels should be in middle of next week. Mounting Dunlop Winter 3D RFTs to deal with frequent black ice at elevation and for skiing on Mt. Hood. We don't get that much snow in the Willamette valley. |
Age and responding-hand related changes in performance of neurologically normal subjects on the line-bisection and chimeric-faces tasks.
This study investigated age and responding-hand (left, right, and bimanual) related changes in visuospatial attention. Two tasks were completed by 107 neurologically normal right-handed subjects ranging in age from 5 to 70 years and distributed across four age groups. Task-specific differences between groups were apparent. In the line-bisection task, the younger and older groups displayed symmetrical neglect while the young and middle groups displayed pseudoneglect. In the chimeric-faces task the leftward bias was less pronounced in the older group and more susceptible to responding-hand effects in the middle and older groups. Whilst results, especially those of the bimanual method, provided strong support for an activation model, they imposed an age limitation on its appropriateness as an explanation for performance on the chimeric-faces task. Results are discussed as reflecting changes in the corpus callosum and right hemisphere. |
Help Leah, founder of Libreboot, get Gender Reassignment Surgery Leah Rowe
I spoke with Andrew Robbins and Swift Geek on #libreboot IRC. These are two other members of the core Libreboot community. This news post was submitted to Pull Request, subject to their approval before publishing on libreboot.org.
My name is Leah Rowe, and I’m the founder of the Libreboot project. I’m a 26 year old British trans woman, living in the UK. After a lifetime of repression and denial, I came out as transgender in June 2016; I began living full-time as my true self for the first time. This was my coming out message to the Libreboot community: https://lists.nongnu.org/archive/html/libreboot/2016-05/msg00004.html
I need help from the community in order to to pay for my Gender Reassignment Surgery. Here is my fundraiser: https://vimuser.org/surgery/
I’m unable to pay for it myself. 2 years ago, I paid 90,000 USD to Raptor Engineering to port the ASUS KGPE-D16 and KCMA-D8 to Libreboot as well as 4000 AUD to Damien Zammit for the Gigabyte GA-G41M-ES2L and Intel D510MO ports. Besides this, I’ve spent huge amounts of money in general on development of my own and I’ve dedicated countless hours to this project. I love Libreboot and I love working on it. For instance, I ported the ThinkPad X200 (later T400, T500 etc) to Libreboot myself, working alongside Steve Shenton to free it from the Intel ME firmware. Unfortunately, this has left me severely out of pocket and, even now, I can’t afford to pay for the things I need for myself such as this.
As a direct result of my contributions, the Free Software community is in a much better state than it was. The Free Software Foundation now hosts fsf.org and gnu.org, as well as GNU Savannah (used by many GNU projects, for code hosting and collaboration) on ASUS KGPE-D16 servers, running Libreboot. Additionally, both the Free Software Foundation and Software Freedom Conservancy use Libreboot laptops almost exclusively in their offices. Thousands of people now use Libreboot. Projects inspired by Libreboot have also appeared such as the TALOS II workstation.
I greatly appreciate any help that the community can give me, no matter how big or small. It will mean a great deal to me, and allow me to focus on my passions, including Libreboot.
Edit this page – License – Template – Authors – Conduct Guidelines – Governance – Peers Community |
Prospect-Gaylord Historic District
The Prospect—Gaylord Historic District is a historic district encompassing a residential area built up mostly in the late 19th century just outside the central business district of Amherst, Massachusetts. Contributing properties include most of the houses on Prospect Street, which parallels Pleasant Street, as well as properties on Gaylord and Amity Streets running west from Prospect. These houses are generally in late Victorian styles such as Queen Anne, although some, for example a workman's house at 24 Gaylord Street, are in a more vernacular style. A central element of the district is the Hope Community Church, a historically African American church built in 1912 for a congregation whose history dates to 1869. Funds for its construction were raised in part through the efforts of W.E.B. Du Bois. The district was listed on the National Register of Historic Places in 1993.
Amherst, settled in the 17th century, remained a scattered agricultural community until the early 19th century. At that time, the town center began to take on a more pronounced commercial character, and its importance in the town was cemented by the establishment of Amherst College in 1825. Prospect Street was laid out in 1824 between Amity Street (1703) and Northampton Street, the original main road to the Connecticut River. This area was built up with modest Greek Revival houses set on small lots, while North Prospect Street, north of Amity Street, was developed later, with larger lots and more typical Victorian styling. Gaylord Street was laid out as a private lane in the early 1880s, and was subsequently lined with Queen Anne and later styles of housing.
See also
National Register of Historic Places listings in Hampshire County, Massachusetts
References
Category:Amherst, Massachusetts
Category:Historic districts in Hampshire County, Massachusetts
Category:National Register of Historic Places in Hampshire County, Massachusetts
Category:Historic districts on the National Register of Historic Places in Massachusetts |
/* TEMPLATE GENERATED TESTCASE FILE
Filename: CWE127_Buffer_Underread__malloc_char_ncpy_61b.c
Label Definition File: CWE127_Buffer_Underread__malloc.label.xml
Template File: sources-sink-61b.tmpl.c
*/
/*
* @description
* CWE: 127 Buffer Under-read
* BadSource: Set data pointer to before the allocated memory buffer
* GoodSource: Set data pointer to the allocated memory buffer
* Sinks: ncpy
* BadSink : Copy data to string using strncpy
* Flow Variant: 61 Data flow: data returned from one function to another in different source files
*
* */
#include "std_testcase.h"
#include <wchar.h>
#ifndef OMITBAD
char * CWE127_Buffer_Underread__malloc_char_ncpy_61b_badSource(char * data)
{
{
char * dataBuffer = (char *)malloc(100*sizeof(char));
memset(dataBuffer, 'A', 100-1);
dataBuffer[100-1] = '\0';
/* FLAW: Set data pointer to before the allocated memory buffer */
data = dataBuffer - 8;
}
return data;
}
#endif /* OMITBAD */
#ifndef OMITGOOD
/* goodG2B() uses the GoodSource with the BadSink */
char * CWE127_Buffer_Underread__malloc_char_ncpy_61b_goodG2BSource(char * data)
{
{
char * dataBuffer = (char *)malloc(100*sizeof(char));
memset(dataBuffer, 'A', 100-1);
dataBuffer[100-1] = '\0';
/* FIX: Set data pointer to the allocated memory buffer */
data = dataBuffer;
}
return data;
}
#endif /* OMITGOOD */
|
---
abstract: 'A broad class of imaging modalities involve the resolution of an inverse-scattering problem. Among them, three-dimensional optical diffraction tomography (ODT) comes with its own challenges. These include a limited range of views, a large size of the sample with respect to the illumination wavelength, and optical aberrations that are inherent to the system itself. In this work, we present an accurate and efficient implementation of the forward model. It relies on the exact (nonlinear) Lippmann-Schwinger equation. We address several crucial issues such as the discretization of the Green function, the computation of the far field, and the estimation of the incident field. We then deploy this model in a regularized variational-reconstruction framework and show on both simulated and real data that it leads to substantially better reconstructions than the approximate models that are traditionally used in ODT.'
author:
- |
Thanh-an Pham$^1$, Emmanuel Soubies$^2$, Ahmed Ayoub$^3$, Joowon Lim$^3$, Demetri Psaltis$^3$, and Michael Unser$^1$\
$^1$ Biomedical Imaging Group, École polytechnique fédérale de Lausanne, Lausanne, Switzerland.\
$^2$ IRIT, Université de Toulouse, CNRS, Toulouse, France.\
$^3$ Optics Laboratory, École polytechnique fédérale de Lausanne, Lausanne, Switzerland.\
e-mail: thanh-an.pham@epfl.ch.
bibliography:
- 'ODT.bib'
title: 'Three-Dimensional Optical Diffraction Tomography with Lippmann-Schwinger Model'
---
Introduction
============
Optical diffraction tomography (ODT) is a noninvasive quantitative imaging modality [@wolf1969three; @jin2017tomographic]. This label-free technique allows one to determine a three-dimensional map of the refractive index (RI) of samples, which is of particular interest for applications that range from biology [@liu2016cell] to nanotechnologies [@zhang2016far]. The acquisition setup sequentially illuminates the sample from different angles. For each illumination, the outgoing complex wave field ([*i.e.,* ]{} the scattered field) is recorded by a digital-holography microscope [@goodman1967digital; @kim2010principle]. Then, from this set of measurements, the RI of the sample can be reconstructed by solving an inverse-scattering problem. However, its resolution is very challenging due to the nonlinear nature of the interaction between the light and the sample.
Related Works {#sec:relworks}
-------------
To simplify the reconstruction problem, pioneering works focused on linearized models. These include Born [@wolf1969three] and Rytov [@devaney1981inverse] approximations, which are valid for weakly scattering samples [@chen1998validity]. Although originally used to deploy direct inversion methods, these linearized models have been later combined with iterative regularization techniques to improve their robustness to noise and to alleviate the missing-cone problem [@sung2009optical; @lim2015comparative].
Nonlinear models that adhere more closely to the physic of the acquisition are needed to recover samples with higher variations of their refractive index. For instance, beam-propagation methods (BPM) [@kamilov2015learning; @kamilov2016optical; @lim2017assessment; @lim2019high] rely on a slice-by-slice propagation model that accounts for multiple scatterings within the direction of propagation (no reflection). Other nonlinear models include the contrast source-inversion method [@Abubakar2002] or the recursive Born approximation [@Kamilov2016]. Although more accurate, all these models come at the price of a large computational cost.
The theory of scalar diffraction recognizes the Lippmann-Schwinger (LS) model to be the most faithful. It accounts for multiple scatterings, both in transmission and reflection. Iterative forward models that solve the LS equation have been successfully used in [@liu2017seagle; @soubies2017efficient; @ma2018accelerated] to reconstruct two-dimensional samples from data acquired in the radio-frequency regime. An alternative approach is known as the discrete dipole approximation (DDA) which, in addition, can account for polarized light [@draine1994discrete; @girard2010nanometric; @zhang2016far].
Finally, it is noteworthy to mention that the aforementioned approaches have been extended to the phaseless ([*i.e.,* ]{}intensity-only) inverse-scattering problem [@maiden2012ptychographic; @tian20153d; @horstmeyer2016diffraction; @pham2018versatile; @unger2019versatile].
Challenges in Three-Dimensional ODT
-----------------------------------
So far, the use of the more sophisticated LS model and DDA has been mostly limited to microwave imaging [@chaumet2009three; @abubakar2012application; @maire2013high] (see also the numerous references listed in [@litman2009testing]). Although led by the same underlying physics, ODT differs from microwave imaging on several aspects that further increases the difficulty of the reconstruction problem.
- The direction of propagation of the incident wave is restricted to a small cone around the optical axis (see Figure \[fig:ODT\]). This lack of measurements leads to the well-known missing-cone problem [@lim2015comparative].
- In typical ODT applications such as biology, the size of the sample is significantly larger ([*e.g.,* ]{}$100 \times$) than the wavelength of the incident wave. This requires a fine discretization that entails very large memory requirements.
- The large size of the detector leads to numerical challenges for the computation of the far-field.
- The benefit of a theoretical expression of the incident wave field, as used in microwave imaging [@litman2009testing], is made unlikely in ODT due to unknown distortions that are inherent to the system.
These challenges hindered the adoption of sophisticated models in ODT, with notable exceptions [@zhang2016far; @girard2010nanometric] that focused on the reflective mode and considered relatively simple non-biological samples.
Contributions and Outline {#sec:contributions}
-------------------------
This paper builds upon the prior works [@liu2017seagle; @soubies2017efficient; @ma2018accelerated] that are dedicated to the resolution of the 2D inverse scattering problem using an iterative LS forward model. We propose to extend these works to the 3D ODT problem. Our main contribution is the development of an accurate and efficient implementation of the forward model in 3D. This is crucial to obtain good reconstructions while keeping the computational burden of the method reasonable for large-scale volumes.
More precisely, we provide a description on how to implement the iterative LS forward model by tackling three challenging difficulties.
- *Discretization of the Green function (Section \[sec:vainikko\]).* Following an idea proposed by Vainikko [@vainikko1997fast], we derive an accurate discretization of the Green function and analyze the errors that are produced when convolving it with a given vector (Theorem \[th:DiscG\]). Moreover, we propose a new way of building the discrete Green kernel that avoids a large memory overhead (Proposition \[th:ReducedMem\]).
- *Computation of the far field (Sections \[sec:far-field\] and \[sec:defocus\]).* We combine the convolutional nature of the model with the fact that the measurements lie on a plane to derive an efficient method to evaluate the far field.
- *Estimation of the incident field (Section \[sec:uin3D\]).* We build the volume of the incident field through numerical propagation of a real acquisition of it at the detector plane. In particular, we propose a strategy that results in significantly reduced numerical errors.
Let us emphasize that, to the best of our knowledge, the present paper is the first to provide practical details ([*e.g.,* ]{}discretization, speedup, and memory-saving strategies) concerning the implementation of the iterative LS model in ODT.
Finally, to deal with the missing-cone problem, we deploy a regularized variational reconstruction approach (Section \[sec:probform\]). We then present in Section \[sec:results\] reconstructions of biological samples for both simulated and real data, and compare them to those of baselines methods.
Notations {#sec:notations}
---------
Scalar and continuously defined functions are denoted by italic letter ([*e.g.,* ]{}$\eta \in \R$, $g \in L_2(\R)$). Vectors and matrices are denoted by bold lowercase and bold uppercase letters, respectively ([*e.g.,* ]{}${\mathbf{f}}\in \R^{N}$, ${\mathbf{G}}\in \C^{{N}\times {N}}$). For a vector ${\mathbf{f}}\in \R^N$, $\|{\mathbf{f}}\|$ stands for its $\ell_2$-norm. Other $p$-norms will be specified with an index ([*i.e.,* ]{}$\|\cdot \|_p$). The $n$th element of a vector is denoted as ${\mathbf{f}}[n]$. Then, we denote by $\mathbf{F}$ the discrete Fourier transform (DFT) defined in 1D by $(\mathbf{F}\mathbf{v})[k] = \sum_{n=-N/2+1}^{N/2} \mathbf{v}[n] \mathrm{e}^{\frac{-2{\mathrm{j}}\pi}{N}nk}$. (The higher-dimension DFT follows by recursive application of the 1D DFT along each dimension.) The notations $\hat{f}$ and $\hat{{\mathbf{f}}}$ refer to the continuous Fourier transform of $f$ and the discrete Fourier transform of ${\mathbf{f}}$, respectively. Finally, $\odot$ stands for the Hadamard product and $[\![1;N]\!] := [1\ldots N]$.
(3.2,0.75) – (5,-0.5) – (5,1.5) – (3.2,2.75) –cycle; at (3,2.8) [$\Gamma$]{}; (0.9,0.1) – (-0.35,-0.3) – (1,-1.2) – (2.25,-0.8) –cycle; (0.9,0.1) – (2.25,-0.8) – (2.25,0.7) – (0.9,1.6) –cycle; (0.9,0.1) – (2.25,-0.8) – (2.25,0.7) – (0.9,1.6) –cycle; (0.9,0.1) – (0.9,1.6) – (-0.35,1.2) – (-0.35,-0.3) –cycle; (0.9,0.1) – (0.9,1.6) – (-0.35,1.2) – (-0.35,-0.3) –cycle; (0,0) pic \[rotate=-165,scale=1.5\][cone=gray]{}; at (1,0.3) [![Principle of optical diffraction tomography. The arrows represent the wave vectors $\{\mathbf{k}^\mathrm{in}_q \}_{q=1}^Q \in \R^3$ of the $Q$ incident plane waves $\{u^\mathrm{in}_q\}_{q=1}^Q$ which are limited to a cone around the optical axis.[]{data-label="fig:ODT"}](Figures/RBC_transp.png "fig:")]{}; (-0.35,-0.3) – (1,-1.2) – (1,0.37) – (-0.35,1.2) –cycle; (1,-1.2) – (1,0.37) – (2.25,0.7) –(2.25,-0.8) –cycle; at (-0.6,1.3) [$\Omega$]{}; (-0.45,-0.4) – (0.9,-1.3) ; at (0.05,-1) [$L$]{}; (3.1,0.65) – (4.9,-0.6) ; at (3.8,-0.1) [$\tilde{L}$]{}; at (1.55,-0.75) [$\eta({\mathbf{x}})$]{}; at (-2.4,0.5) [${\mathbf{k}}_q^\mathrm{in}$]{};
Physical Model {#sec:physical}
==============
Continuous-Domain Formulation
-----------------------------
Let $\eta : \Omega \rightarrow \R$ denotes the continuously-defined refractive index of a sample whose support is assumed to be included in the region of interest $\Omega \subset \R^3$. Without loss of generality and to simplify the presentation, let us consider that $\Omega = [-L/2,L/2]^3$ for $L>0$. The interaction of the sample with a monochromatic incident field ${u^\mathrm{in}}: \Omega \rightarrow \C$ of wavelength ${\lambda}$ produces a scattered field ${u^\mathrm{sc}}: \Omega \rightarrow \C$. The resulting total field $u = {u^\mathrm{sc}}+ {u^\mathrm{in}}$ is governed by the Lippmann-Schwinger equation $$\label{eq:lipp}
u({\mathbf{x}}) = {u^\mathrm{in}}({\mathbf{x}}) + \int_\Omega g({\mathbf{x}}- {\mathbf{z}}) f({\mathbf{z}}) u({\mathbf{z}}) \, {\mathrm{d}}{{\mathbf{z}}},$$ where $f({\mathbf{x}}) = {k_\mathrm{b}}^2 \left({\eta({\mathbf{x}})^2}/{{\eta_\mathrm{b}}^2} - 1\right)$ is the scattering potential. Here, ${k_\mathrm{b}}= {2\pi {\eta_\mathrm{b}}}/{{\lambda}}$ is the wavenumber in the surrounding medium and ${\eta_\mathrm{b}}$ the corresponding refractive index. Finally, $g: \Omega \rightarrow \C$ is the free-space Green function which, under Sommerfeld’s radiation condition, is given by [@Schmalz2010] $$\label{def:Green}
g({\mathbf{x}}) = \frac{\exp\left( {\mathrm{j}}{k_\mathrm{b}}\|{\mathbf{x}}\| \right)}{4\pi \|{\mathbf{x}}\|}.$$ Equation completely characterizes the image formation model in ODT. Using an interferometric setup, the total field $u$ is recorded at the focal plane $\Gamma = [-\tilde{L}/2,\tilde{L}/2]^2$, $\tilde{L} \geq L$, of the camera. This focal plane lies outside $\Omega$ at a distance denoted by $x_\Gamma>0$. Finally, we denote by $M=m^2$ the number of pixels of the detector.
Discrete Formulation {#sec:discreteForm}
--------------------
To numerically solve the ODT inverse problem, has to be properly discretized. To do so, we first discretize $\Omega$ into ${N}= n^3$ voxels[^1]. Then, the computation of the scattered field ${\mathbf{y}}^\mathrm{sc} \in \C^{M}$ at the camera plane $\Gamma$ follows a two-step process [@liu2017seagle; @soubies2017efficient], $$\begin{aligned}
\label{eq:lipp1}
{\mathbf{u}}&= \left({\mathbf{I}}- {\mathbf{G}}\, {\mathbf{diag}({\mathbf{f}})}\right)^{-1}{\mathbf{u}^\mathrm{in}}\\
{\mathbf{y}}^\mathrm{sc} &= {\mathbf{P}}{\mathbf{{\tilde{G}}}}\, {\mathbf{diag}({\mathbf{f}})}{\mathbf{u}},\label{eq:lipp2}\end{aligned}$$ where ${\mathbf{I}}\in \R^{{N}\times {N}}$ is the identity matrix, is a diagonal matrix formed out of the entries of ${\mathbf{f}}$, and ${\mathbf{f}}\in \R^N$, ${\mathbf{u}^\mathrm{in}}\in \C^{N}$, and ${\mathbf{u}}\in \C^{N}$ are sampled version of $f$, ${u^\mathrm{in}}$, and $u$ within $\Omega$, respectively. The matrix ${\mathbf{G}}\in \C^{{N}\times {N}}$ is the discrete counterpart of the continuous convolution with the Green function in (see Section \[sec:vainikko\]). Similarly, ${\mathbf{{\tilde{G}}}}\in \C^{{M}\times {N}}$ is a matrix that, given ${\mathbf{u}}$ and ${\mathbf{f}}$ inside $\Omega$, gives the total field at the measurement plane $\Gamma$ (see Section \[sec:far-field\]). Finally, ${\mathbf{P}}\in \C^{{M}\times {M}}$ models the effect of the pupil function of the microscope and can also encode the contribution of a free-space propagation to account for an optical refocus of the measurements.
One will have noticed that requires the resolution of a linear system. This can be efficiently performed using a conjugate-gradient method [@soubies2017efficient] or a biconjugate-gradient stabilized method [@horst1992BiCGSTAB]. Yet, carries the main computational complexity of the forward process -. To obtain the scattered field at the camera plane $\Gamma$, a naive approach would be to compute the total field ${\mathbf{u}}$ in on a large region that includes $\Gamma$. Here, the introduction of ${\mathbf{{\tilde{G}}}}$ allows one to restrict the computation of ${\mathbf{u}}$ to the smaller region $\Omega$ as soon as it fully contains the support of the sample [@liu2017seagle; @soubies2017efficient]. This significantly reduces the computational burden of the forward process.
Needless to say, the matrices ${\mathbf{G}}$, ${\mathbf{{\tilde{G}}}}$, and ${\mathbf{P}}$ are never explicitly built. Instead, we exploit the fact that the application of the corresponding linear operators can be efficiently performed using the fast Fourier transform (FFT).
Accurate and Efficient Implementation of the Forward Model
==========================================================
Green’s Function Discretization for the Volume: ${\mathbf{G}}$ {#sec:vainikko}
--------------------------------------------------------------
Because of the singularity of the Green function as well as of its Fourier transform ([*i.e.,* ]{}$\hat{g}({\bm{\upomega}}) ={1}/({{k_\mathrm{b}}^2 - \|{\bm{\upomega}}\|^2})$), ${\mathbf{G}}$ in cannot be defined through a naive discretization of $g$. In this section, we describe how ${\mathbf{G}}$ has to be defined in order to minimize the approximation error with respect to the continuous model .
First, let us recall that we aim at computing the total field $u$ only inside $\Omega$ and that the support of $f$ is itself assumed to be included in $\Omega$. Hence, can be equivalently written as, $\forall {\mathbf{x}}\in \Omega$, $$\label{eq:lippTrunc}
u({\mathbf{x}}) = {u^\mathrm{in}}({\mathbf{x}}) + \int_\Omega g_{\mathrm{t}}({\mathbf{x}}- {\mathbf{z}}) f({\mathbf{z}}) u({\mathbf{z}}) \, {\mathrm{d}}{{\mathbf{z}}},$$ where $g_{\mathrm{t}}$ is a truncated version of the Green function. More precisely, $g_{\mathrm{t}}$ is defined by $$g_{\mathrm{t}}({\mathbf{x}}) = \mathrm{rect}\left(\frac{\| {\mathbf{x}}\|}{2\sqrt{3}L}\right) g({\mathbf{x}}),$$ where $\mathrm{rect}(x) = \{ 1, |x|\leq 1/2; \, 0, \text{ otherwise}\}$. With this definition, one easily gets the equivalence between and , as illustrated in Figure \[fig:LippTrunc\].
(1,1) circle (0.4); at (1,1) [$f$]{}; (2,2) circle (2.8284); (0,0) rectangle (2,2); at (0.3,1.7) [$\Omega$]{}; (0,-0.1) – (2,-0.1); at (1,-0.4) [$L$]{}; (2,2) – (4,4); at (3.25,2.75) [$\sqrt{d}L$]{}; at (1.8,3.5) [$\mathrm{supp}(g_t)$]{};
To the best of our knowledge, this observation has to be attributed to Vainikko [@vainikko1997fast] but has then been revitalized by Vico *et al.* [@vico2016fast]. It is essential to a proper discretization of the Lippmann-Schwinger equation . Specifically, we have that $$\label{eq:GreenL}
\widehat{g_{\mathrm{t}}}({\bm{\upomega}}) = \frac{1}{\|{\bm{\upomega}}\|^2 - {k_\mathrm{b}}^2}\bigg(1 - \mathrm{e}^{{\mathrm{j}}\sqrt{3} L {k_\mathrm{b}}}( \cos(\sqrt{3}L \|{\bm{\upomega}}\|) + {\mathrm{j}}{k_\mathrm{b}}\sqrt{3}L \,\mathrm{sinc}( \sqrt{3}L\|{\bm{\upomega}}\|) ) \bigg)$$ for $\|{\bm{\upomega}}\| \neq {k_\mathrm{b}}$, which can be extended by continuity as $$\label{eq:GreenL2}
\widehat{g_{\mathrm{t}}}({\bm{\upomega}}) ={\mathrm{j}}\left(\frac{\sqrt{3}L}{2{k_\mathrm{b}}} - \frac{\mathrm{e}^{{\mathrm{j}}\sqrt{3} L {k_\mathrm{b}}}}{2{k_\mathrm{b}}^2}\sin(\sqrt{3} L{k_\mathrm{b}}) \right)$$ when $\|{\bm{\upomega}}\| = {k_\mathrm{b}}$. The practical outcome is that can now be discretized in the Fourier domain since $\widehat{g_{\mathrm{t}}}$ is a smooth function.
We now show how $g_\mathrm{t} \ast v$, for $v \in L_2(\R^3)$, can be numerically evaluated using FFTs and we provide error bounds on the approximation. The proof is provided in Appendix \[proof:thDiscG\].
(Mie3D) at (0,0) ; (labelMie) at ($(Mie3D.north) - (0,0.5em)$) [Analytical solution]{};
(Born3D) at ($(Mie3D.east) + (0.5cm,0)$) ; (labelBorn) at ($(Born3D.north) - (0,0.5em)$) [Born]{};
(BPM3D) at ($(Mie3D.south) - (0,0.05cm)$) ; (labelBPM) at ($(BPM3D.north) - (0,0.5em)$) [BPM]{};
(Lipp3D) at ($(BPM3D.east) + (0.5cm,0)$) ; (labelLipp) at ($(Lipp3D.north) - (0,0.5em)$) [LS model]{};
\[th:DiscG\] Let $v \in L_2\left([-\frac{L}{2},\frac{L}{2}]^3\right)$ and $\mathbf{v} \in \C^N$ be the sampled version of $v$ using $n>{k_\mathrm{b}}L / \pi$ sampling points in each dimension ($N=n^3$). Let $\mathbf{v}_p$ be the $p$-times zero-padded version of $\mathbf{v}$. Define $h=L/n$ and $\delta = 2\pi/(Lp)$. Then, $\forall {\mathbf{k}}\in [\![\frac{-n}{2}+1;\frac{n}{2}]\!]^3$ $$\label{th:DiscG-eq}
(\mathbf{G} \mathbf{v})[{\mathbf{k}}] = \big(\mathbf{F}^{-1}(\widehat{\mathbf{g}_{\mathrm{t}}} \odot \widehat{\mathbf{v}_p}) \big)[{\mathbf{k}}],$$ where $\widehat{\mathbf{g}_{\mathrm{t}}} = (\widehat{g_{\mathrm{t}}}(\delta {\mathbf{q}}))_{{\mathbf{q}}\in [\![\frac{-np}{2}+1;\frac{np}{2}]\!]^3}$ and $\widehat{\mathbf{v}_p} = \mathbf{F}\mathbf{v}_p$.
Moreover, if $v$ has ($q-1$) continuous derivatives for $q\geq 3$ and a qth derivative of bounded variations, we have the error bound $$\label{th:DiscG-error}
|(g_\mathrm{t} \ast v)(h{\mathbf{k}}) - (\mathbf{G} \mathbf{v})[{\mathbf{k}}]| \leq \frac{C^\mathrm{tr}}{n^q} + \frac{C^\mathrm{al}}{n^{q-2}} + \frac{C^\mathrm{tp}}{p^2},$$ where $C^\mathrm{al}$, $C^\mathrm{tr}$, and $C^\mathrm{tp}$ are positive constants that are associated to the errors due to the aliasing in $\mathbf{v}$, the truncation of the Fourier integral, and the trapezoidal quadrature rule used to approximate this integral, respectively.
Equation is hiding a cropping operation. Indeed, the result of $\mathbf{F}^{-1}(\widehat{\mathbf{g}_{\mathrm{t}}} \odot \widehat{\mathbf{v}_p})$ is defined on the grid $[\![\frac{-np}{2}+1;\frac{np}{2}]\!]^3$ but we only retain the elements that belong to $ [\![\frac{-n}{2}+1;\frac{n}{2}]\!]^3$.
The assumption that $n>{k_\mathrm{b}}L / \pi \Leftrightarrow {k_\mathrm{b}}< \pi /h$ ensures that the “peaks” of $|\hat{g_{\mathrm{t}}}({\bm{\upomega}})|$ for $\|{\bm{\upomega}}\| = {k_\mathrm{b}}$ are included in the frequency domain associated to the DFT ([*i.e.,* ]{}$[-\pi/h,\pi/h]^3$). This is a natural and minimal requirement to reduce the approximation error.
From Theorem \[th:DiscG\], one sees that the number of sampling points $n$ controls both the aliasing error and the error due to the truncation of the Fourier integral. It is noteworthy that these bounds decrease with the smoothness of $v$ ([*i.e.,* ]{}$q$). On the other hand, the padding factor $p$ controls the error that results from the trapezoidal quadrature rule.
\[remark:p4\] A simple argument suggests that the padding factor should be at least $p=4$ to properly capture the oscillations of $\widehat{g_{\mathrm{t}}}$. Indeed, in the spatial domain, the diameter of the support of $g_{\mathrm{t}}$ is $2\sqrt{3}L \approx 3.4 L$. Hence, in order to satisfy the Shannon-Nyquist criterion, the considered spatial domain should be at least of size $4L$, which corresponds to a padding factor $p=4$.
To assess the practical accuracy of the implementation of ${\mathbf{G}}$ provided by Theorem \[th:DiscG\], we consider the interaction of a plane wave with a bead. For this particular setting, an analytical expression of the scattered field is known [@devaney2012mathematical]. In Figure \[fig:Mie\] we compare the theoretical scattered field with the scattered field obtained through the Born linearization, the BPM, and the resolution of with ${\mathbf{G}}$ implemented according to Theorem \[th:DiscG\]. One can appreciate the gain in accuracy that the proposed method brings over the standard approximations used in ODT.
### Memory Savings {#memory-savings .unnumbered}
According to Theorem \[th:DiscG\], an accurate computation of the field inside $\Omega$ requires one to zero-pad the volume $\mathbf{v}$. From Remark \[remark:p4\], we should set at least $p=4$. This can lead to severe computational and memory issues for the reconstruction of large 3D volumes. Fortunately, as mentioned in [@vico2016fast], this computation can be reformulated as a discrete convolution with a modified kernel that only involves the twofold padding $p=2$. We summarize this result in Proposition \[th:ReducedMem\] and provide a detailed proof in Appendix \[proof:thReducedMem\]. Moreover, we provide an expression of the modified kernel that reveals how one can build it directly on the grid $[\![-n+1;n]\!]^3$.
\[th:ReducedMem\] Let $p \in 2 \N \setminus \{0\}$. Then, $\forall {\mathbf{k}}\in [\![\frac{-n}{2}+1;\frac{n}{2}]\!]^3$, we have that $$\big(\mathbf{F}^{-1}(\widehat{\mathbf{g}_{\mathrm{t}}} \odot \widehat{\mathbf{v}_{\mathrm{p}}}) \big) [{\mathbf{k}}] = \big(\mathbf{F}^{-1}(\widehat{{\mathbf{g}}^\mathrm{m}_{\mathrm{t}}} \odot \widehat{\mathbf{v}_2}) \big) [{\mathbf{k}}] ,$$ where ${\mathbf{v}_2}$ is a twofold zero-padded version of $\mathbf{v}$, and ${\mathbf{g}}^\mathrm{m}_{\mathrm{t}}$ is the modified kernel $$\mathbf{g}_{\mathrm{t}}^\mathrm{m}[{\mathbf{k}}]= \frac{8}{p^3} \mkern-10mu \sum_{{\mathbf{s}}\in [\![0; \frac{p}{2}-1]\!]^3} \mkern-10mu \mathbf{F}^{-1}(\widehat{\mathbf{g}_{\mathrm{t}}}[\textstyle \frac{p}{2}\cdot-{\mathbf{s}}] )[{\mathbf{k}}] \, \mathrm{e}^{ \frac{-2 {\mathrm{j}}\pi}{np} {\mathbf{k}}^T {\mathbf{s}}} ,$$
Green’s Function Discretization for the Measurements: $\mathbf{G}$ {#sec:far-field}
------------------------------------------------------------------
In works dedicated to the 2D ODT problem, ${\mathbf{{\tilde{G}}}}\in \C^{M \times N}$ is sometimes accessible explicitly [@liu2017seagle; @soubies2017efficient; @ma2018accelerated]. By contrast, the scale of the 3D ODT problem prevents this in the present work. Fortunately, we are only interested in the evaluation of the total field at the $M$ voxels of the camera plane. By exploiting this planarity, we can significantly reduce the memory and the computational burden of the evaluation of ${\mathbf{{\tilde{G}}}}\mathbf{v}$.
Let $x_{\Gamma} >0$ be the axial position of the measurement plane $\Gamma$ ([*i.e.,* ]{}$\forall {\mathbf{x}}\in \Gamma$, $x_3 = x_\Gamma$). Then, letting $v=f \cdot u$ and expressing the integral in using a numerical quadrature along the third dimension, we get, $\forall {\mathbf{x}}=(x_1,x_2,x_\Gamma) \in \Gamma$, $$\label{eq:Gtild-1}
(g \ast v)({\mathbf{x}}) = \mkern-15mu \sum_{k=-\frac{n}{2}+1}^{\frac{n}{2}} h \int_{[\frac{-L}{2},\frac{L}{2}]^2} \mkern-5mu g ({\mathbf{x}}- {\mathbf{z}}_k) v({\mathbf{z}}_k) \,{\mathrm{d}}{z_{k_1}} {\mathrm{d}}{z_{k_2}},$$ where ${\mathbf{z}}_k = (z_{k_1},z_{k_2},kh)$.
From , $g \ast v$ is computed as a sum of 2D aperiodic convolutions. Considering that the sampling step at the camera plane $\Gamma$ is identical to that of the volume $\Omega$, the 2D convolutions in is evaluated in the same way as described in Theorem \[th:DiscG\]. This strategy reduces the computational complexity of the application of ${\mathbf{{\tilde{G}}}}$ to $\mathcal{O}(nM\log(M))$. Note that, if the sampling step at the camera plane is $q$ times that of the volume ([*i.e.,* ]{}$h'= qh$, $q \in \N$), one can simply downsample the result of the above procedure by $q$.
[width=0.475]{}
(-2,-2.5) – (-2,1) – (-0.5,3) – (-0.5,-0.5) – (-2,-2.5); (-0.3,3) node\[anchor=south\] [$y^\mathrm{in}=a(\cdot)\mathrm{e}^{{\mathrm{j}}(\cdot)^T\tilde{{\mathbf{k}}}^\mathrm{in} }$]{}; (0,0) node\[anchor=east\] – (3.5,0) node\[anchor=west\]; (1.75, -1.2) node\[anchor=south\] [Propagation]{};
(4,-2.5) – (4,1) – (5.5,3) – (5.5,-0.5) – (4,-2.5); (5,3) node\[anchor=south\] (target) [$u^\mathrm{in}_\mathrm{prop}$]{};
(ideal) at (6.5,0) [ ]{};($(ideal.north)+(0,0.1)$) node\[align=center,anchor=south\] [$\mathrm{Arg}(u^\mathrm{in}_\mathrm{true})$]{};
(diff1) at ($(-2.5,-9.3)$) [ ]{}; ($(diff1.north) + (0,0.2)$) node\[anchor=south,align=center\] (diff1text) [AS without tilt transfer]{};
(diff2) at ($(diff1.east) + (1.7,0)$) [ ]{}; ($(diff2.north) + (0,0.2)$) node\[anchor=south,align=center\] (diff2text) [AS with tilt transfer]{};
coordinates [(0,0)]{};
Free-Space Propagation and Pupil Function: ${\mathbf{P}}$ {#sec:defocus}
---------------------------------------------------------
The last matrix to describe in is ${\mathbf{P}}$. It models the lowpass filtering behavior of the microscope and can also be used to perform a free-space propagation of the field. For instance, this is required for the acquisition setup described in Section \[sec:ReconsReal\]. Hence, $\mathbf{P}$ corresponds to the discrete convolution operator associated to the continuously defined kernel $p \in L_2(\R^2)$ that depends on the point-spread function (PSF) of the system as well as the considered propagation kernel. Although the output of ${\mathbf{{\tilde{G}}}}$ (scattered field on $\Gamma$) is not compactly supported, it enjoys fast decay, which allows us to apply ${\mathbf{P}}$ via a FFT with suitable padding.
Computation of the 3D Incident Field: ${\mathbf{u}^\mathrm{in}}$ {#sec:uin3D}
----------------------------------------------------------------
The evaluation of the forward model and at a given point ${\mathbf{f}}\in \R^{N}$ requires the knowledge of the 3D incident field ${\mathbf{u}^\mathrm{in}}\in \C^N$. Here, we propose to build this volume through the free-space propagation of the 2D measurement ${\mathbf{y}}^\mathrm{in}\in \C^M$ of this field at the detector plane $\Gamma$. This is possible as the area of $\Gamma$ is assumed to be larger than that of a face of the volume $\Omega$ since $L \leq \tilde{L}$.
Let us denote by $y^\mathrm{in} : \Gamma \rightarrow \C$ the continuous version of ${\mathbf{y}}^\mathrm{in}$ to simplify the presentation. Then, we get from the angular spectrum method [@goodman2005introduction] that, $\forall {\mathbf{x}}= (x_1,x_2,x_3) \in \Omega$, $$\label{eq:propUin}
u^\mathrm{in}({\mathbf{x}}) =( p_{x_3} \ast y^\mathrm{in})(x_1,x_2).$$ There, $p_{x_3}$ is the propagation kernel that is defined in the Fourier domain by $$\hat{p}_z({\bm{\upomega}})= \exp \left(-{\mathrm{j}}(x_{\Gamma}-z)\sqrt{ {k_\mathrm{b}}-(\omega_1^2+\omega_2^2)} \right),$$ where $x_{\Gamma}$ denotes the position of the measurement plane $\Gamma$.
Because both the propagation kernel and the measured incident field are not compactly supported, a naive computation of the aperiodic convolution in would introduce significant errors within the estimated volume $u^\mathrm{in}$. The difficulty lies in the way of properly extending the measured field $y^\mathrm{in}$ outside $\Gamma$ to ensure that the result of the convolution inside $\Omega$ is valid. For instance, a zero padding or a simple periodization are not satisfactory as they would introduce large discontinuities in the amplitude and/or the phase of $y^\mathrm{in}$.
Instead, let us inject in the expression of $y^\mathrm{in}({\mathbf{x}}) = a({\mathbf{x}}) \exp({\mathrm{j}}{\mathbf{x}}^T\tilde{{\mathbf{k}}}^\mathrm{in})$, where $a : \Gamma \rightarrow \C$ is the complex amplitude of the field and $\tilde{{\mathbf{k}}}^\mathrm{in} = (k^\mathrm{in}_{1},k^\mathrm{in}_{2})$ corresponds to the restriction of the wave vector ${\mathbf{k}}^\mathrm{in} \in \R^3$ to its first two components, leading to $$\begin{aligned}
u^\mathrm{in}({\mathbf{x}}) &= \left(p_{x_3} \ast a(\cdot) \mathrm{e}^{{\mathrm{j}}(\cdot)^T \tilde{{\mathbf{k}}}^\mathrm{in}}\right)(\tilde{{\mathbf{x}}}) \notag \\
&= \frac{1}{(2\pi)^2}\int_{\R^2} \widehat{p_{x_3}}({\bm{\upomega}})\hat{a}({\bm{\upomega}}-\tilde{{\mathbf{k}}}^\mathrm{in})\mathrm{e}^{{\mathrm{j}}{\bm{\upomega}}^T \tilde{{\mathbf{x}}}}{\mathrm{d}}{\bm{\upomega}}\notag \\
&=\frac{\mathrm{e}^{{\mathrm{j}}\tilde{{\mathbf{x}}}^T \tilde{{\mathbf{k}}}^\mathrm{in}}}{(2\pi)^2}\int_{\R^d} \widehat{p_{x_3}}({\bm{\upomega}}+ \tilde{{\mathbf{k}}}^\mathrm{in})
\hat{a}({\bm{\upomega}})\mathrm{e}^{{\mathrm{j}}{\bm{\upomega}}^T \tilde{{\mathbf{x}}}}{\mathrm{d}}{\bm{\upomega}}\notag \\
&= \mathrm{e}^{{\mathrm{j}}\tilde{{\mathbf{x}}}^T \tilde{{\mathbf{k}}}^\mathrm{in} } \left( a \ast p_{x_3}(\cdot)\mathrm{e}^{-{\mathrm{j}}(\cdot)^T \tilde{{\mathbf{k}}}^\mathrm{in}} \right)(\tilde{{\mathbf{x}}}),\label{eq:propUin-2}\end{aligned}$$ with $\tilde{{\mathbf{x}}}=(x_1,x_2)$ and ${\bm{\upomega}}= (\omega_1,\omega_2) \in \R^2$. Hence, can be equivalently expressed as a 2D aperiodic convolution of the complex amplitude $a$ with the kernel $p_{x_3}(\cdot)\mathrm{e}^{-{\mathrm{j}}(\cdot)^T \tilde{{\mathbf{k}}}^\mathrm{in}}$, followed by a modulation in the space domain. This approach is called tilt transfer because the shift of $y^\mathrm{in}$ in the Fourier domain is transferred to the propagation kernel [@ritter2014modified; @guo2014diffraction]. The advantage of this formulation is that, by contrast to $y^\mathrm{in}$, the complex amplitude $a$ is not far from a constant signal, up to some noise and optical aberrations. Hence,we compute using a periodic convolution with minor discretization artifacts.
The advantage of this approach is illustrated in Figure \[fig:3dinc\] where we propagate a slice of an ideal tilted plane wave $y^\mathrm{in}$ using the angular spectrum method with and without tilt transfer. The difference between the expected incident field $u^\mathrm{in}_\mathrm{true}$ and the propagated field $u^\mathrm{in}_\mathrm{prop}$ is depicted in the bottom panel. Clearly, the tilt transfer allows one to significantly reduce the discretization errors and attenuate the aliasing artifacts.
Reconstruction Framework {#sec:probform}
========================
Problem Formulation
-------------------
We adopt a standard variational formulation to recover the scattering potential ${\mathbf{f}}$ from the $Q$ scattered fields $\{{\mathbf{y}}^\mathrm{sc}_q\}_{q=1}^Q$ that are recorded when the sample is impinged with the incident fields $\{{\mathbf{u}^\mathrm{in}}_q\}_{q=1}^Q$. Specifically, the reconstructed ${\mathbf{f}}^\ast$ is specified as $$\label{eq:prob}
{\mathbf{f}}^\ast \in \bigg\lbrace {\arg\,\underset{{\mathbf{f}}\in \R^N}{\min} \, \bigg( \sum_{q=1}^Q \frac{1}{2\|{\mathbf{y}}_q^\mathrm{sc}\|^2}\|\mathbf{H}_q({\mathbf{f}}) - {\mathbf{y}}_q^\mathrm{sc} \|^2 + \tau\mathcal{R}({\mathbf{f}}) + i_{\geq 0}({\mathbf{f}}) \bigg)} \bigg\rbrace.$$ In , $\mathbf{H}_q : \R^N \rightarrow \C^M$ denotes the forward model described by and for the $q$th incident wave ${\mathbf{u}^\mathrm{in}}_q$, $\mathcal{R}:\R^N \mapsto \R_{\geq 0}$ is a regularization functional, and $\tau >0$ balances between data fidelity and regularization. The term $i_{\geq 0}({\mathbf{f}}) = \{ 0, {\mathbf{f}}\in (\R_{\geq 0})^{N}; \, +\infty, \text{ otherwise}\}$ is a nonnegativity constraint that is suitable for our applications. For other applications that involve inverse scattering, this term is modified to constrain the scattering potential to a given range of values. Such priors have been shown to significantly improve the quality of the reconstruction [@lim2015comparative; @sung2009optical]. Finally, we consider as regularizer $\mathcal{R}$ either the total-variation seminorm [@Rudin1992] or the Hessian-Schatten norm [@Lefkimmiatis2013].
Optimization {#sec:opti}
------------
Following [@liu2017seagle; @soubies2017efficient; @ma2018accelerated], we deploy an accelerated forward-backward splitting (FBS) algorithm [@beck2009fast; @Nesterov2013] to solve the optimization problem . The iterates are summarized in Algorithm \[Algo:FISTA\], with some further details below.
${\mathbf{f}}^0 \in \R^N$, $(\gamma_k >0)_{k \in \N \setminus \{0\}} $ $\mathbf{v}^1={\mathbf{f}}^0$ $\alpha_1=1$ $k=1$ Select a subset $\mathcal{Q} \subset [1 \ldots Q]$ \[alg:stochastic\] ${\displaystyle}\mathbf{d}^{k}= \sum_{q \in \mathcal{Q}} \frac{1}{\|{\mathbf{y}}_q^\mathrm{sc}\|^2}\Re\left( \mathbf{J}_{\mathbf{H}_q}^\ast({\mathbf{f}}^k) \left(\mathbf{H}_q({\mathbf{f}}^k) - {\mathbf{y}}_q^\mathrm{sc} \right) \right)$ \[alg:grad\] ${\mathbf{f}}^{k}=\mathrm{prox}_{\gamma_k \tau \mathcal{R} + i_{\geq 0}}\left( \mathbf{v}^k - \gamma_k \mathbf{d}^k \right)$ \[alg:prox\] $\displaystyle \alpha_{k+1} \leftarrow \frac{1 + \sqrt{1+4\alpha_k^2}}{2}$ $\displaystyle \mathbf{v}^{k+1} = {\mathbf{f}}^k + \left(\frac{\alpha_k-1}{\alpha_{k+1} }\right)({\mathbf{f}}^k - {\mathbf{f}}^{k-1}) $ $k \leftarrow k+1$
- As in [@soubies2017efficient], we implemented a stochastic-gradient version of the algorithm by selecting a subset of of the measurements $\{{\mathbf{y}}^\mathrm{sc}_q\}_{q=1}^Q$ at each iteration (Line \[alg:stochastic\]). This allows us to reduce the computational burden of the method.
- Line \[alg:grad\] corresponds to the evaluation of the gradient of $\frac{1}{2\|{\mathbf{y}}_q^\mathrm{sc}\|^2} \sum_{q \in \mathcal{Q}} \|\mathbf{H}_q(\cdot) - {\mathbf{y}}^\mathrm{sc}_q\|^2$. An explicit expression of the Jacobian matrix $\mathbf{J}_{\mathbf{H}_q}({\mathbf{f}}^k)$ of $\mathbf{H}_q$ can be found in [@soubies2017efficient; @ma2018accelerated]. Similarly to the forward model , the application of this Jacobian matrix to a given vector of $\C^M$ requires the inversion of $({\mathbf{I}}- {\mathbf{diag}({\mathbf{f}})} {\mathbf{{\tilde{G}}}}^\ast)$. Again, this inversion is performed using a conjugate-gradient-based algorithm.
- For both the TV and Hessian-Schatten-norm regularizers, no known closed-form expression exists for the proximity operator of $\gamma_k \tau \mathcal{R} + i_{\geq 0}$ (Line \[alg:prox\]). However, there exist efficient algorithms to evaluate them. Specifically, we use the fast gradient-projection method for TV [@beck2009fast2] and its extension to the Hessian-Schatten-norm regularizer [@Lefkimmiatis2013].
- We set the sequence of step sizes to $\gamma_k = \gamma_0 /\sqrt{k}$ for $\gamma_0>0$. This is standard and ensures the convergence of incremental proximal-gradient methods [@bertsekas2011incremental].
The whole reconstruction pipeline is implemented within the framework of the GlobalBioIm library[^2] [@soubies2018pocket] and will be made available online.
Numerical Results {#sec:results}
=================
In this section , we present two types of experiments. First we validate our computational pipeline on simulated data. Then, we deploy the proposed approach on some real data. For both cases, we provide comparison with existing algorithms.
Simulated Data
--------------
### Simulation Setting
We simulated red blood cells (RBCs) with a maximal RI of $1.05$ (see Figure \[fig:sim\_slice\] top row). This sample is immersed in air (${\eta_\mathrm{b}}= 1$) and is illuminated by tilted plane waves with wavelength $\lambda = 600$. To simulate the ODT measurements, we used the discrete dipole approximation model on a grid with a resolution of $75$. To probe the sample, we generated 40 views within a cone of illumination whose half-angle is $45^\degree$. This corresponds to severely restricted angles of view and makes the reconstruction problem very challenging. Each view has $512^2$ measurements (resolution of $150$). Finally, we have simulated, independently for each view, an acquisition of the incident field on $\Gamma$. We simulated a cell with a maximal RI of $1.485$ (see Figure \[fig:ODT\] and Figure \[fig:sim\_slice\] top row). This sample is immersed in water (${\eta_\mathrm{b}}= 1.3388$) and is illuminated by tilted plane waves with wavelength $\lambda = 532$. To simulate the ODT measurements, we used the LS model on a grid with a resolution of $99.2$. To probe the sample, we generated 61 views within a cone of illumination whose half-angle is $35^\degree$. This corresponds to severely restricted angles of view and makes the reconstruction problem very challenging. Each view has $150^2$ measurements. They lie on a plane set at the distance $x_\Gamma = 4.8139$ from the center of the sample. We have added Gaussian noise separately on the real and imaginary parts of the total field, which yields a $30.07$dB signal-to-noise ratio. Finally, we have simulated, independently for each view, a noisy acquisition of the incident field on $\Gamma$.
Method Rytov BPM
------------------------------------------------------------------------------------------- ------------------------- ------------------------- ---------------------------------
$\frac{\|\hat{\mathbf{n}} - \mathbf{n}_\mathrm{gt} \|^2}{\| \mathbf{n}_\mathrm{gt} \|^2}$ $1.8231 \times 10^{-4}$ $2.4585 \times 10^{-5}$ $\mathbf{9.0120\times 10^{-6}}$
: Relative error of the RBCs reconstructions.
\[tab:relerr\]
(ryt\_xz) at (0,0) ; at (ryt\_xz.north east) [XY]{};
(ryt\_xy\_1) at (ryt\_xz.east) [![Error maps of the reconstructed RBCs with Rytov, BPM, and the proposed method (LS model). []{data-label="fig:sim_max"}](Figures/ryt_XZ_60_diff.eps "fig:"){width="\szsub\textwidth"}]{}; at (ryt\_xy\_1.north east) [YZ]{};
(ryt\_xy\_2) at (ryt\_xy\_1.east) ; at (ryt\_xy\_2.north east) [XZ]{};
(bpm\_xz) at (0,0) ;
(bpm\_xy\_1) at (bpm\_xz.east) [![Error maps of the reconstructed RBCs with Rytov, BPM, and the proposed method (LS model). []{data-label="fig:sim_max"}](Figures/bpm_XZ_60_diff.eps "fig:"){width="\szsub\textwidth"}]{}; (bpm\_xy\_2) at (bpm\_xy\_1.east) ;
(lipp\_xz) at (0,0) ; (lipp\_xy\_1) at (lipp\_xz.east) [![Error maps of the reconstructed RBCs with Rytov, BPM, and the proposed method (LS model). []{data-label="fig:sim_max"}](Figures/lipp_XZ_60_diff.eps "fig:"){width="\szsub\textwidth"}]{}; (lipp\_xy\_2) at (lipp\_xy\_1.east) ;
(ryt\_xz) at (0,0) ; at (ryt\_xz.north east) [XY]{};
(ryt\_xy\_1) at (ryt\_xz.east) [![Maximum-error projection of the reconstructed RBCs with Rytov, BPM, and the proposed method (LS model). []{data-label="fig:sim_max"}](Figures/ryt_max_new_1.eps "fig:"){width="\szsub\textwidth"}]{}; at (ryt\_xy\_1.north east) [YZ]{};
(ryt\_xy\_2) at (ryt\_xy\_1.east) ; at (ryt\_xy\_2.north east) [XZ]{};
(bpm\_xz) at (0,0) ;
(bpm\_xy\_1) at (bpm\_xz.east) [![Maximum-error projection of the reconstructed RBCs with Rytov, BPM, and the proposed method (LS model). []{data-label="fig:sim_max"}](Figures/bpm_max_new_1.eps "fig:"){width="\szsub\textwidth"}]{}; (bpm\_xy\_2) at (bpm\_xy\_1.east) ;
(lipp\_xz) at (0,0) ; (lipp\_xy\_1) at (lipp\_xz.east) [![Maximum-error projection of the reconstructed RBCs with Rytov, BPM, and the proposed method (LS model). []{data-label="fig:sim_max"}](Figures/lipp_max_new_1.eps "fig:"){width="\szsub\textwidth"}]{}; (lipp\_xy\_2) at (lipp\_xy\_1.east) ;
(gt\_xy\_1) at (0,0) ; at (gt\_xy\_1.north east) [XY]{}; (0,72- 30)–(72,72 - 30); (30,0)–(30,72); (gt\_xy\_2) at (gt\_xy\_1.east) ; at (gt\_xy\_2.north east) [XZ]{}; (72 ,72- 30)–(72 + 72,72 - 30); (72 + 36,0)–(72 + 36,72); (72 + 67, 57)– (72 + 61, 54);
(gt\_xy\_3) at (gt\_xy\_2.east) [\[-1\]]{}; at (gt\_xy\_3.north east) [YZ]{}; (72\*2 + 72 - 36,0)–(72\*2 + 72 - 36,72); (72\*2+0,30)–(72\*2+72,30); (2\*72 + 35, 22)– (2\*72 + 31, 27);
(ryt\_xy\_1) at (0,0) ; (ryt\_xy\_2) at (ryt\_xy\_1.east) ; (72 + 67, 57)– (72 + 61, 54);
(ryt\_xy\_3) at (ryt\_xy\_2.east) [\[-1\]]{}; (2\*72 + 35, 22)– (2\*72 + 31, 27);
(bpm\_xy\_1) at (0,0) ; (bpm\_xy\_2) at (bpm\_xy\_1.east) ; (72 + 67, 57)– (72 + 61, 54);
(bpm\_xy\_3) at (bpm\_xy\_2.east) [\[-1\]]{}; (2\*72 + 35, 22)– (2\*72 + 31, 27);
(lipp\_xy\_1) at (0,0) ; (lipp\_xy\_2) at (lipp\_xy\_1.east) ; (72 + 67, 57)– (72 + 61, 54);
(lipp\_xy\_3) at (lipp\_xy\_2.east) [\[-1\]]{}; (2\*72 + 35, 22)– (2\*72 + 31, 27);
(gt\_xy\_1) at (0,0) ; at (gt\_xy\_1.north east) [$z_1 = -0.695$]{}; ( 45,40) – ( 40, 44); ( 45,15) – ( 43, 20);
(gt\_xy\_2) at (gt\_xy\_1.east) ; at (gt\_xy\_2.north east) [$z_2 = 0$]{}; (72 + 9,17) – (72 + 13, 22);
(gt\_xy\_3) at (gt\_xy\_2.east) ; at (gt\_xy\_3.north east) [$z_3 = 0.695$]{}; (2\*72 + 6, 48)– (2\*72 + 12, 46); (2\*72 + 27, 4)– (2\*72 + 32, 8); (2\*72 + 43, 19)– (2\*72 + 38, 23);
(ryt\_xy\_1) at (0,0) ; (45,40) – (40, 44); (45,13) – (43, 20);
(ryt\_xy\_2) at (ryt\_xy\_1.east) ; (72 + 9,17) – (72 + 13, 22);
(ryt\_xy\_3) at (ryt\_xy\_2.east) ; (2\*72 + 6, 48)– (2\*72 + 12, 46); (2\*72 + 27, 4)– (2\*72 + 32, 8); (2\*72 + 43, 19)– (2\*72 + 38, 23);
(bpm\_xy\_1) at (0,0) ; ( 45,40) – ( 40, 44); (45,13) – (43, 20);
(bpm\_xy\_2) at (bpm\_xy\_1.east) ; (72 + 9,17) – (72 + 13, 22);
(bpm\_xy\_3) at (bpm\_xy\_2.east) ; (2\*72 + 6, 48)– (2\*72 + 12, 46); (2\*72 + 27, 4)– (2\*72 + 32, 8); (2\*72 + 43, 19)– (2\*72 + 38, 23);
(lipp\_xy\_1) at (0,0) ; (45,40) – (40, 44); (45,13) – (43, 20);
(lipp\_xy\_2) at (lipp\_xy\_1.east) ; (72 + 9,17) – (72 + 13, 22);
(lipp\_xy\_3) at (lipp\_xy\_2.east) ; (2\*72 + 6, 48)– (2\*72 + 12, 46); (2\*72 + 27, 4)– (2\*72 + 32, 8); (2\*72 + 43, 19)– (2\*72 + 38, 23);
(ryt\_xz) at (0,0) ; at (ryt\_xz.north east) [XZ]{};
(25,0)–(25,66.5) node \[anchor = south,align=center,inner sep = 0\] [$z_1$]{}; (31,0)–(31,66.5) node \[anchor = south,align=center,inner sep = 0\] [$z_2$]{}; (36,0)–(36,66.5) node \[anchor = south,align=center, inner sep = 0\] [$z_3$]{};
(ryt\_xy\_1) at (ryt\_xz.east) ; (72 + 10, 48)– (72 + 16, 46); at (ryt\_xy\_1.north east) [$z_1 = -1.092$]{};
(ryt\_xy\_2) at (ryt\_xy\_1.east) ; (2\*72 + 6, 48)– (2\*72 + 12, 46); at (ryt\_xy\_2.north east) [$z_2 = -0.496$]{};
(ryt\_xy\_3) at (ryt\_xy\_2.east) ; at (ryt\_xy\_3.north east) [$z_3 = 0$]{};
(bpm\_xz) at (0,0) ; (bpm\_xy\_1) at (bpm\_xz.east) ; (72 + 10, 48)– (72 + 16, 46);
(bpm\_xy\_2) at (bpm\_xy\_1.east) ; (2\*72 + 41,36) – (2\*72 + 36, 40); (2\*72 + 6, 48)– (2\*72 + 12, 46);
(bpm\_xy\_3) at (bpm\_xy\_2.east) ; (3\*72 + 41,36) – (3\*72 + 36, 40);
(lipp\_xz) at (0,0) ; (lipp\_xy\_1) at (lipp\_xz.east) ; (72 + 10, 48)– (72 + 16, 46);
(lipp\_xy\_2) at (lipp\_xy\_1.east) ; (2\*72 + 41,36) – (2\*72 + 36, 40); (2\*72 + 6, 48)– (2\*72 + 12, 46);
(lipp\_xy\_3) at (lipp\_xy\_2.east) ; (3\*72 + 41,36) – (3\*72 + 36, 40);
### Comparisons
We compare our LS-based reconstruction method with the direct back-propagation algorithm that is based on the Rytov model. In addition, we do compare it to BPM. For each iterative method (BPM and ours), we used TV regularization together with a nonnegativity constraint. Finally, the regularization parameter $\tau > 0$ was optimized through grid search in each scenario to maximize the performance with respect to the ground truth.
In Figure \[fig:sim\_slice\], one observes that our method faithfully recovers RBCs at several orientations. In comparison with the considered baselines, we observe that the LS model allows to recover more accurately the RBCs shape (and RI) as pointed out by the white arrows. In Table \[tab:relerr\], we present the relative error of the RBCs reconstructions. As expected, the more sophisticated LS model obtains the lowest relative error.
Real Data {#sec:ReconsReal}
---------
### Acquisition Setup
We acquired real data using the experimental tomographic setup described in [@ayoub2019method]. The sample is a yeast cell immersed in water (${\eta_\mathrm{b}}=1.338$) and is illuminated by tilted incident waves with wavelength $\lambda=532$. As in our simulation setup, we acquired 61 views within a cone of illumination whose half-angle is $35^\degree$. The measurements lie on a plane that is centered and perpendicular to the optical axis. The complex fields with and without the sample were acquired for each view, thus providing the total and incident field, respectively. The pixel size is $99$.
The reconstructions are performed on a grid of the same resolution than that of the measurements. We used the Hessian-Schatten-norm regularization as we found it more suitable for this type of sample. Finally, we model ${\mathbf{P}}$ as the composition of a linear filtering by an ideal pupil function (binary disk in Fourier domain with radius $2\mathrm{NA} /\lambda$, $\mathrm{NA}=1.45$) and a free-space propagation to the center of the sample.
(ryt) at (0,0) ; at (ryt.north) [Rytov]{};
(bpm) at (ryt.east) ; at (bpm.north) [BPM]{};
(lipp) at (bpm.east) ; at (lipp.north) [LS model]{};
### Reconstruction Results and Discussion
The reconstructed volumes obtained with the Rytov method, the BPM, and the proposed approach are presented in Figure \[fig:real\_slice\]. Once again, nonlinear models clearly outperform the (linear) Rytov reconstruction. Moreover, the reconstruction of the RI obtained by the LS model does not suffer from the artefacts indicated in BPM slices $z_2, z_3$ with thick white arrows. Also, the areas with higher RI are better resolved ($z_1, z_2$, thin red arrows) when the LS model is deployed. Finally, one can appreciate in Figure \[fig:realiso\] that the inner areas with higher RI (green) are more resolved for the LS model than for BPM.
Conclusion
==========
Three-dimensional optical diffraction tomography reconstruction is a challenging inverse problem. Its success depends on the accuracy of the implementation of the physical model. In this work, we proposed an accurate and efficient implementation of the forward model that is based on the exact Lippmann-Schwinger model. To that end, we tackled important difficulties that are related to the discretization of the model, the computational and memory burden, as well as the calibration of the incident field. Finally, we showed on both simulated and real data that the use of the proposed model improves the quality/faithfulness of the reconstructions.
Acknowledgments
===============
This research was supported by the European Research Council (ERC) under the European Union’s Horizon 2020 research and innovation programme, Grant Agreement No. 692726 GlobalBioIm: Global integrative framework for computational bio-imaging.
The authors would like to thank Ferréol Soulez and Harshit Gupta for fruitful discussions.
Preliminary Lemmas
==================
\[lemma:DecayFourier\] Let $v \in L_2(\R^3)$ have $(q-1)$ continuous derivatives in $L_2(\R^3)$ for some $q\geq 1$ and a $q$th derivative of bounded variations. Then, $$|\hat{v}({\bm{\upomega}})| \leq \frac{C_1}{\|{\bm{\upomega}}\|^{q+1}}\quad \forall {\bm{\upomega}}\text{ s.t. } \|{\bm{\upomega}}\| \geq C_2,$$ where $C_1$ and $C_2$ are positive constants.
It is an extension of the well known result in one-dimension, see for instance [@briggs1995dft Theorems 6.1 and 6.2].
\[lemma:aliasing\] Let $v \in L_2([-L/2,L/2]^3)$ be compactly supported, have $(q-1)$ continuous derivatives in $L_2(\R^3)$ for some $q\geq 3$, and a $q$th derivative of bounded variations. Let $\mathbf{v} \in \R^{N}$ ($N=n^3$) be a sampled version of $v$ with sampling step $h=L/n$. Finally, denote by $\delta = 2\pi /(hn)$ the frequency sampling step of $\hat{\mathbf{v}}$, the DFT of $\mathbf{v}$. Then, for all ${\mathbf{q}}\in [\![\frac{-n}{2}+1;\frac{n}{2}]\!]^3$ $$\left|\hat{v}(\delta {\mathbf{q}}) -
h^3 \widehat{\mathbf{v}}[{\mathbf{q}}]\right| \leq C h^{q+1}$$ for a positive constant $C>0$.
From Poisson’s summation formula and the compact support of $v$, we have that $$\label{eq:Poisson}
\sum_{{\mathbf{k}}\in [\![\frac{-n}{2}+1;\frac{n}{2}]\!]^3} \mkern-15mu \mathbf{v}[{\mathbf{k}}] \mathrm{e}^{- {\mathrm{j}}h {\mathbf{k}}^T {\bm{\upomega}}} = \frac{1}{h^3}\sum_{{\mathbf{m}}\in \Z^3} \hat{v}({\bm{\upomega}}+ 2\pi {\mathbf{m}}/h).$$ Setting ${\bm{\upomega}}= \delta {\mathbf{q}}= 2 \pi {\mathbf{q}}/(hn) $ in , one recognizes that the left-hand side is the DFT of $\mathbf{v}$. Hence, we obtain that $$\label{eq:Poisson2}
\hat{v}(\delta {\mathbf{q}}) =
h^3 \widehat{\mathbf{v}}[{\mathbf{q}}] - \sum_{\substack{{\mathbf{m}}\in \Z^3 \\ {\mathbf{m}}\neq \mathbf{0}}} \hat{v}\left( \delta {\mathbf{q}}+ 2\pi {\mathbf{m}}/h \right).$$ Then, from Lemma \[lemma:DecayFourier\], we obtain that there exists $C>0$ such that $$\begin{aligned}
\left|\hat{v}(\delta {\mathbf{q}}) -
h^3 \widehat{\mathbf{v}}[{\mathbf{q}}]\right| & \leq \sum_{\substack{{\mathbf{m}}\in \Z^3 \\ {\mathbf{m}}\neq \mathbf{0}}} \frac{C}{\| \delta {\mathbf{q}}+ 2\pi {\mathbf{m}}/h \|^{q+1}} \notag \\
& \leq \frac{C h^{q+1}}{(2\pi)^{q+1} }\sum_{\substack{{\mathbf{m}}\in \Z^3 \\ {\mathbf{m}}\neq \mathbf{0}}} \frac{1}{\| {\mathbf{q}}/n + {\mathbf{m}}\|^{q+1}}\label{eq:ProofLemmaA2-1}\end{aligned}$$ Let us now study the convergence of the series in . Using the fact that $\| \cdot \|_2 \leq \|\cdot\|_1 \leq \sqrt{N} \|\cdot\|_2$, we obtain that $$\sum_{\substack{{\mathbf{m}}\in \Z^3 \\ {\mathbf{m}}\neq \mathbf{0}}} \frac{1}{\| {\mathbf{q}}/n + {\mathbf{m}}\|^{q+1}_2} \leq \sum_{\substack{{\mathbf{m}}\in \Z^3 \\ {\mathbf{m}}\neq \mathbf{0}}} \frac{\sqrt{N}}{\| {\mathbf{q}}/n + {\mathbf{m}}\|^{q+1}_1}.\label{eq:ProofLemmaA2-2}$$ Then, for ${\mathbf{q}}\in [\![\frac{-n}{2}+1;\frac{n}{2}]\!]^3$ and $m \in \N$ we introduce the set $$S_{{\mathbf{q}}}^m = \left\lbrace {\mathbf{m}}\in \Z^3 : m \leq \|{\mathbf{q}}/n + {\mathbf{m}}\|_1< m +1 \right\rbrace.$$ Using the fact that ${\mathbf{q}}\in [\![\frac{-n}{2}+1;\frac{n}{2}]\!]^3 \Rightarrow {\mathbf{q}}/n \in (-1/2,1/2]^3$, we have that $$\|{\mathbf{m}}\|_1 - 3/2 \leq \|{\mathbf{q}}/n + {\mathbf{m}}\|_1 \leq \|{\mathbf{m}}\|_1 + 3/2,$$ which implies that $$\begin{aligned}
|S_{{\mathbf{q}}}^m| & \leq \sum_{m'=m-2}^{m+2} |S_{\bm{0}}^{m'}| \notag \\
& \leq 5 |S_{\bm{0}}^{m+2}| = 5\left( 4(m+2)^2 + 2\right),\label{eq:ProofLemmaA2-3}\end{aligned}$$ where $|\cdot|$ stands for the cardinality of the set. Using the inequality , we can bound the right-hand side of as $$\begin{aligned}
\sum_{\substack{{\mathbf{m}}\in \Z^3 \\ {\mathbf{m}}\neq \mathbf{0}}} \frac{\sqrt{N}}{\| {\mathbf{q}}/n + {\mathbf{m}}\|^{q+1}_1} & \leq \sum_{m=1}^{+\infty} \frac{\sqrt{N} |S_{{\mathbf{q}}}^m|}{m^{q+1}} \notag \\
& \leq \sum_{m=1}^{+\infty} \frac{5\sqrt{N} \left( 4(m+2)^2 + 2\right)}{m^{q+1}},\end{aligned}$$ which is a convergent series when $q\geq 3$. This completes the proof.
Proof of Theorem \[th:DiscG\] {#proof:thDiscG}
=============================
From the Fourier-convolution theorem, we have that $$\begin{aligned}
(g_\mathrm{t} \ast v)({\mathbf{x}}) & = \int_\Omega g_{\mathrm{t}}({\mathbf{x}}- {\mathbf{z}})v({\mathbf{z}}) \, {\mathrm{d}}{{\mathbf{z}}} \notag \\
& = \frac{1}{(2\pi)^3} \int_{\R^3} \widehat{g_{\mathrm{t}}}({\bm{\upomega}}) \hat{v}({\bm{\upomega}}) \mathrm{e}^{ {\mathrm{j}}{\bm{\upomega}}^T {\mathbf{x}}} \, {\mathrm{d}}{{\bm{\upomega}}}. \label{eq:intFourier}\end{aligned}$$
Let $n = \in 2 \N \setminus \{0\}$ and $h=L/n$ be the spatial sampling step of the volume $\Omega$ in each dimension. It follows that the frequency domain that is associated to the DFT is $\widehat{\Omega}=[-\pi /h, \pi /h]^3$. Then, the padding factor $p \in \N_{>0}$ enlarges the spatial domain to $[-pL/2, pL/2]^3$, resulting in the frequency sampling step $\delta = 2\pi /(hnp)=2 \pi /(Lp)$, so that $\widehat{\Omega}$ is sampled using $np$ equally spaced points in each dimension.
We are now equipped to discretize the integral in . To that end, we use a trapezoidal quadrature rule on $\widehat{\Omega}$ and write that $$\label{eq:quadrature}
(g_\mathrm{t} \ast v)({\mathbf{x}}) \approx \frac{\delta^3}{(2\pi)^3} \mkern-10mu \sum_{{\mathbf{q}}\in [\![\frac{-np}{2};\frac{np}{2}]\!]^3} \mkern-10mu w_{{\mathbf{q}}} \, \widehat{g_{\mathrm{t}}}\left(\delta{\mathbf{q}}\right) \hat{v}\left(\delta{\mathbf{q}}\right) \mathrm{e}^{ {\mathrm{j}}\delta {\mathbf{q}}^T {\mathbf{x}}}.$$ There, the weights $w_{{\mathbf{q}}}$ are equal to $1$, $1/2$, $1/4$, and $1/8$ when ${\mathbf{q}}$ belongs to the interior, the interior of the faces, the interior of the edges, and the corners of the cube $[\![\frac{-np}{2};\frac{np}{2}]\!]^3$, respectively.
The approximation we made in generates two error terms.
1. The error $\varepsilon^\mathrm{tp}$ that is due to the trapezoidal quadrature rule used to approximate the integral over the domain $\widehat{\Omega}$. This error is well documented in the literature [@ralston2001first]. For integrand that are twice differentiable, such as ${\bm{\upomega}}\mapsto \widehat{g_{\mathrm{t}}}({\bm{\upomega}}) \hat{v}({\bm{\upomega}}) \mathrm{e}^{ {\mathrm{j}}{\bm{\upomega}}^T {\mathbf{x}}} $, we have that $$|\varepsilon^\mathrm{tp}| \leq C \delta^2 = C \left( \frac{2\pi}{Lp} \right)^2$$ for a positive constant $C>0$.
2. The error $\varepsilon^\mathrm{tr}$ that is due to the truncation of the integral in to the domain $\widehat{\Omega}$, bounded as $$\begin{aligned}
|\varepsilon^\mathrm{tr}| & = \frac{1}{(2\pi)^3} \left|\int_{\R^3 \setminus \widehat{\Omega}} \widehat{g_{\mathrm{t}}}({\bm{\upomega}}) \hat{v}({\bm{\upomega}}) \mathrm{e}^{ {\mathrm{j}}{\bm{\upomega}}^T {\mathbf{x}}} \, {\mathrm{d}}{{\bm{\upomega}}} \right| \notag \\
& \leq \frac{1}{(2\pi)^3} \int_{\R^3 \setminus \widehat{\Omega}} \left| \widehat{g_{\mathrm{t}}}({\bm{\upomega}}) \hat{v}({\bm{\upomega}}) \mathrm{e}^{ {\mathrm{j}}{\bm{\upomega}}^T {\mathbf{x}}} \right| \, {\mathrm{d}}{{\bm{\upomega}}} \notag \\
& \leq \frac{C}{(2\pi)^3} \int_{\R^3 \setminus \widehat{\Omega}} \frac{2}{(\|{\bm{\upomega}}\| - {k_\mathrm{b}}) \|{\bm{\upomega}}\|^{q+2}} \, {\mathrm{d}}{{\bm{\upomega}}},\label{eq:truncErrBound}
\end{aligned}$$ for a constant $C>0$.
The last inequality in has been established in two steps. First, the assumption that ${k_\mathrm{b}}< \pi /h$ implies that $\forall {\bm{\upomega}}\in \R^3 \setminus \widehat{\Omega}$, $\|{\bm{\upomega}}\| > {k_\mathrm{b}}$. Then, one gets from that, $\forall {\bm{\upomega}}\in \R^3 \setminus \widehat{\Omega}$, $$|\widehat{g_{\mathrm{t}}}({\bm{\upomega}})| \leq \frac{2}{(\|{\bm{\upomega}}\|-{k_\mathrm{b}})\|{\bm{\upomega}}\|}.$$ Second, Lemma \[lemma:DecayFourier\], along with the fact that $v$ has ($q-1$) continuous derivatives with a $q$th derivative of bounded variations, implies that its Fourier transform decays as $$|\hat{v}({\bm{\upomega}}) |\leq \frac{C}{\|{\bm{\upomega}}\|^{q+1}}$$ for a constant $C>0$. Combining these two bounds with $| \mathrm{e}^{ {\mathrm{j}}{\bm{\upomega}}^T {\mathbf{x}}} |= 1$ finally leads to .
A further refinement of the bound is needed to recover the statement of Theorem \[th:DiscG\]. Denoting by $\mathcal{B}_{\pi/h}^2 = \{ {\bm{\upomega}}\in \R^3 : \|{\bm{\upomega}}\| \leq \pi /h \}$ the $\ell_2$-ball of radius $\pi/h$, one sees that the integral in is upper-bounded by the integration of the same integrand over the larger domain $\R^3 \setminus \mathcal{B}_{\pi/h}^2$. This bound is easier to evaluate using spherical coordinates, as in $$\begin{aligned}
|\varepsilon^\mathrm{tr}| & \leq \frac{2C}{(2\pi)^3} \int_{\R^3 \setminus \mathcal{B}_{\pi/h}^2} \frac{1}{(\|{\bm{\upomega}}\| - {k_\mathrm{b}}) \|{\bm{\upomega}}\|^{q+2}} \, {\mathrm{d}}{{\bm{\upomega}}} \notag \\
& = \frac{2C}{(2\pi)^3} \int_0^{2\pi} \mkern-10mu \int_0^{\pi} \mkern-10mu \int_{\pi/h}^{+\infty} \frac{r^2 \sin(\theta)}{(r-{k_\mathrm{b}})r^{q+2}} \, {\mathrm{d}}{r} \, {\mathrm{d}}{\theta} \, {\mathrm{d}}{\phi} \notag \\
& = \frac{C}{\pi^2} \int_{\pi/h}^{+\infty} \frac{1}{(r-{k_\mathrm{b}})r^{q}} \, {\mathrm{d}}{r} . \label{eq:intProof1}
\end{aligned}$$ To evaluate , we use the partial fraction decomposition $$\frac{1}{(r-{k_\mathrm{b}})r^{q}} = \frac{1}{{k_\mathrm{b}}^q(r-{k_\mathrm{b}})} - \sum_{m=0}^{q-1} \frac{1}{{k_\mathrm{b}}^{q-m}r^{m+1}}.$$ Hence, we have that $$\begin{aligned}
\mkern-10mu |\varepsilon^\mathrm{tr}| & \leq \frac{C}{\pi^2} \bigg( \frac{1}{{k_\mathrm{b}}^q} \log(r-{k_\mathrm{b}}) \Big|_{r=\frac{\pi}{h}}^{+\infty} - \frac{1}{{k_\mathrm{b}}^q} \log(r) \Big|_{r=\frac{\pi}{h}}^{+\infty} \notag \\
& \qquad \qquad \qquad - \sum_{m=1}^{q-1} \frac{1}{{k_\mathrm{b}}^{q-m}} \left(- \frac{1}{m r^m} \right) \Bigg|_{r=\frac{\pi}{h}}^{+\infty} \bigg) \notag \\
& = \frac{-C}{{k_\mathrm{b}}^q \pi^2} \left( \log\left(1 - \frac{{k_\mathrm{b}}h}{\pi} \right)\mkern-5mu + \mkern-5mu \sum_{m=1}^{q-1} \frac{1}{m} \left(\frac{{k_\mathrm{b}}h}{\pi} \right)^m \right) \label{eq:intProof2} \\
& = \frac{C}{{k_\mathrm{b}}^q \pi^2} \sum_{m=q}^{+\infty} \frac{1}{m} \left(\frac{{k_\mathrm{b}}h}{\pi} \right)^m \label{eq:intProof3} \\
& = \frac{C}{{k_\mathrm{b}}^q \pi^2} \left(\frac{{k_\mathrm{b}}h}{\pi} \right)^q \sum_{m=0}^{+\infty} \left(\frac{{k_\mathrm{b}}h}{\pi} \right)^m \frac{1}{m+q} . \label{eq:intProof4}
\end{aligned}$$ To obtain from , we used the fact that ${k_\mathrm{b}}h/\pi < 1$ together with $\log(1-x) = (- \sum_{m=1}^{+\infty} x^m / m)$ for $|x| < 1$. Finally, we get the bound $C^\mathrm{tr}/n^q$ from the convergence of the series in and $h=L/n$.
Let us focus on aliasing. As opposed to $\widehat{g_\mathrm{t}}$ for which we have access to an explicit expression in –, the samples $\hat{v}(\delta {\mathbf{q}})$ in have to be approximated by the DFT coefficients of a $p$-times zero-padded version of the sampled signal $\mathbf{v}\in \C^N$, denoted $\mathbf{v}_p \in \C^{Np^3}$, and defined by, $\forall {\mathbf{k}}\in [\![\frac{-np}{2}+1;\frac{np}{2}]\!]^3$, $$\label{eq:padV}
\mathbf{v}_p[{{\mathbf{k}}}] = \left\lbrace \begin{array}{ll}
\mathbf{v}[{{\mathbf{k}}}] = v(h{\mathbf{k}}), & {\mathbf{k}}\in [\![\frac{-n}{2}+1;\frac{n}{2} ]\!]^3 \\
0, & \text{ otherwise} .
\end{array} \right.$$ We then replace $\hat{v}(\delta {\mathbf{q}})$ in by $h^3\widehat{\mathbf{v}_p}[{\mathbf{q}}]$ and obtain that $$\label{eq:quadrature2}
(g_\mathrm{t} \ast v)({\mathbf{x}}) \approx \frac{1}{(np)^3} \mkern-10mu \sum_{{\mathbf{q}}\in [\![\frac{-np}{2};\frac{np}{2}]\!]^3} \mkern-10mu w_{{\mathbf{q}}} \, \widehat{g_{\mathrm{t}}}\left(\delta{\mathbf{q}}\right) \widehat{\mathbf{v}_p}[{\mathbf{q}}] \mathrm{e}^{ {\mathrm{j}}\delta {\mathbf{q}}^T {\mathbf{x}}}.$$ This approximation introduces an error term $\varepsilon^\mathrm{al}$ that is due to aliasing. More precisely, we have that $$\begin{aligned}
|\varepsilon^\mathrm{al}| & \leq \frac{\delta^3}{(2\pi)^3} \mkern-10mu \sum_{{\mathbf{q}}\in [\![\frac{-np}{2};\frac{np}{2}]\!]^3} \mkern-10mu w_{{\mathbf{q}}} \left|\widehat{g_{\mathrm{t}}}\left(\delta{\mathbf{q}}\right) \right| \left|\hat{v}(\delta {\mathbf{q}}) -
h^3 \widehat{\mathbf{v}_p}[{\mathbf{q}}]\right| \notag \\
& \leq \frac{\delta^3 }{(2\pi)^3} \mkern-10mu \sum_{{\mathbf{q}}\in [\![\frac{-np}{2};\frac{np}{2}]\!]^3} \mkern-10mu w_{{\mathbf{q}}} \left|\widehat{g_{\mathrm{t}}}\left(\delta{\mathbf{q}}\right) \right| C h^{q+1} \label{eq:aliasingErr-1}\\
& \leq \frac{\delta^3 C h^{q+1} }{(2\pi)^3} (np)^3 \|\widehat{g}_\mathrm{t}\|_{\infty} \notag \\
& = C \|\widehat{g}_\mathrm{t}\|_{\infty} h^{q-2} = \frac{C \|\widehat{g}_\mathrm{t}\|_{\infty} L^{q-2}}{n^{q-2}},\end{aligned}$$ where comes from Lemma \[lemma:aliasing\].
To complete the proof, it remains to recognize an inverse DFT within . Let $\{{\mathbf{q}}_i\}_{i=1}^8$ denotes the eight corners of the cube $[\![\frac{-np}{2};\frac{np}{2}]\!]^3$. Then, because $\widehat{g_\mathrm{t}}$ is radially symmetric (see and ), and by periodicity of $\widehat{\mathbf{v}_p}$, we have that $$\widehat{g_{\mathrm{t}}}\left(\delta{\mathbf{q}}_i\right) \widehat{\mathbf{v}_p}[{\mathbf{q}}_i] = \widehat{g_{\mathrm{t}}}\left(\delta{\mathbf{q}}_1\right) \widehat{\mathbf{v}_p}[{\mathbf{q}}_1], \; \forall i \in \{2,\ldots,8\}.$$ Hence we can factorize the corresponding terms in as $$\sum_{{\mathbf{q}}\in \{{\mathbf{q}}_i\}^8_{i=1}} \frac18 \widehat{g_{\mathrm{t}}}\left(\delta{\mathbf{q}}_i\right) \widehat{\mathbf{v}_p}[{\mathbf{q}}_i] = \widehat{g_{\mathrm{t}}}\left(\delta{\mathbf{q}}_1\right) \widehat{\mathbf{v}_p}[{\mathbf{q}}_1].$$ Finally, using the same arguments for points within the faces and edges of the cube $[\![\frac{-np}{2};\frac{np}{2}]\!]^3$, and sampling at points $h{\mathbf{k}}$, ${\mathbf{k}}\in [\![\frac{-n}{2}+1;\frac{n}{2}]\!]^3$, we obtain that $$\label{eq:quadrature3}
({\mathbf{G}}\mathbf{v})[{\mathbf{k}}] = \frac{1}{(np)^3} \mkern-10mu \sum_{{\mathbf{q}}\in [\![\frac{-np}{2}+1;\frac{np}{2}]\!]^3} \mkern-10mu \widehat{\mathbf{g}_{\mathrm{t}}}[{\mathbf{q}}] \widehat{\mathbf{v}_p}[{\mathbf{q}}] \mathrm{e}^{ \frac{2 {\mathrm{j}}\pi}{np} {\mathbf{q}}^T {\mathbf{k}}},$$ where $\widehat{\mathbf{g}_{\mathrm{t}}} = (\widehat{g_{\mathrm{t}}}(\delta {\mathbf{q}}))_{{\mathbf{q}}\in [\![\frac{-np}{2}+1;\frac{np}{2}]\!]^3}$. We recognize an inverse DFT, which completes the proof.
Proof of Proposition \[th:ReducedMem\] {#proof:thReducedMem}
======================================
First, let us introduce the notation $\Omega_n = [\![\frac{-n}{2}+1;\frac{n}{2}]\!]^3$. Then, we have that, for all ${\mathbf{k}}\in \Omega_n$, $$\begin{aligned}
\mkern-15mu & \left( \mathbf{F}^{-1} (\widehat{\mathbf{g}_{\mathrm{t}}} \odot \widehat{\mathbf{v}_{\mathrm{p}}}) \right)[{\mathbf{k}}] \notag \\ \mkern-15mu
&= \mkern-5mu \frac{1}{(np)^3} \sum_{{\mathbf{q}}\in \Omega_{np}} \widehat{\mathbf{g}_{\mathrm{t}}}[{\mathbf{q}}] \widehat{\mathbf{v}_p}[{\mathbf{q}}] \, \mathrm{e}^{ \frac{2 {\mathrm{j}}\pi}{np} {\mathbf{q}}^T {\mathbf{k}}} \notag \\ \mkern-15mu
&= \mkern-5mu\frac{1}{(np)^3} \sum_{{\mathbf{q}}\in \Omega_{np}} \widehat{\mathbf{g}_{\mathrm{t}}}[{\mathbf{q}}] \sum_{\tilde{{\mathbf{q}}} \in \Omega_{np}} \mathbf{v}_p[\tilde{{\mathbf{q}}}] \, \mathrm{e}^{ \frac{-2 {\mathrm{j}}\pi}{np} \tilde{{\mathbf{q}}}^T \mkern-2mu {\mathbf{q}}} \, \mathrm{e}^{ \frac{2 {\mathrm{j}}\pi}{np} {\mathbf{q}}^T {\mathbf{k}}} \notag \\ \mkern-15mu
& = \mkern-5mu\frac{1}{(np)^3} \sum_{\tilde{{\mathbf{q}}} \in \Omega_{2n}} \mathbf{v}_2[\tilde{{\mathbf{q}}}] \sum_{{\mathbf{q}}\in \Omega_{np}} \widehat{\mathbf{g}_{\mathrm{t}}}[{\mathbf{q}}] \, \mathrm{e}^{ \frac{2 {\mathrm{j}}\pi}{np} ({\mathbf{k}}- \tilde{{\mathbf{q}}})^T {\mathbf{q}}} \label{eq:proofthReducedMem-1} \notag \\ \mkern-15mu
& = \mkern-5mu\frac{1}{(np)^3} \sum_{\tilde{{\mathbf{q}}} \in \Omega_{2n}} \mkern-13mu \mathbf{v}_2[\tilde{{\mathbf{q}}}] \mkern-10mu \sum_{\substack{\bm{s} \in [\![0;\frac{p}{2}-1]\!]^3 \\ {\mathbf{q}}\in \Omega_{2n}}} \mkern-10mu \widehat{\mathbf{g}_{\mathrm{t}}}[{\textstyle \frac{p}{2}}{\mathbf{q}}\mkern-3mu-\mkern-3mu\bm{s}] \, \mathrm{e}^{ \frac{2 {\mathrm{j}}\pi}{np} ({\mathbf{k}}- \tilde{{\mathbf{q}}})^T ({\textstyle \frac{p}{2}}{\mathbf{q}}-\bm{s})} \mkern-30mu \notag \\ \mkern-15mu
& = \mkern-5mu \frac{8}{p^3} \mkern-10mu \sum_{\tilde{{\mathbf{q}}} \in \Omega_{2n}} \mkern-10mu \mathbf{v}_2[\tilde{{\mathbf{q}}}] \mkern-20mu \sum_{\bm{s} \in [\![0;\frac{p}{2}-1]\!]^3} \mkern-23mu \mathbf{F}^{-1}(\widehat{\mathbf{g}_{\mathrm{t}}}[{\textstyle \frac{p}{2}}\cdot \mkern-5mu - \mkern-3mu\bm{s}] )[{\mathbf{k}}\mkern-2mu - \mkern-2mu \tilde{{\mathbf{q}}}] \, \mathrm{e}^{ \frac{-2 {\mathrm{j}}\pi}{np} ({\mathbf{k}}- \tilde{{\mathbf{q}}})^T \mkern-5mu \bm{s}} \mkern-10mu\end{aligned}$$ where we have used the fact that $\mathrm{supp}(\mathbf{v}_p) =\mathrm{supp}(\mathbf{v}) \subseteq \Omega_n \subseteq \Omega_{2n}$. Hence, we have shown that $\big(\mathbf{F}^{-1}(\widehat{\mathbf{g}_{\mathrm{t}}} \odot \widehat{\mathbf{v}_{\mathrm{p}}})\big) \big|_{\Omega_n}$ can be obtained as the valid part of the discrete convolution between $\mathbf{v}_2$, defined as $\mathbf{v}$ padded with $p=2$, and a modified truncated Green function given by, $\forall {\mathbf{k}}\in \Omega_{2n}$, $$\mathbf{g}_{\mathrm{t}}^\mathrm{m}[{\mathbf{k}}]= \frac{8}{p^3} \sum_{\bm{s} \in [\![0;{\textstyle \frac{p}{2}}-1]\!]^3} \mkern-10mu \mathbf{F}^{-1}(\widehat{\mathbf{g}_{\mathrm{t}}}[{\textstyle \frac{p}{2}}\cdot-\bm{s}] )[{\mathbf{k}}] \, \mathrm{e}^{ \frac{-2 {\mathrm{j}}\pi}{np} {\mathbf{k}}^T \bm{s}} ,$$ which completes the proof.
[^1]: The generalization to the case where there is a different number of points in each dimension is straightforward.
[^2]: http://bigwww.epfl.ch/algorithms/globalbioim/
|
Tírame de la lengua
Tirame de la Lengua (Make Me Speak or, literally, Pull Me From the Tongue) is a TV gameshow broadcast on Televisión Española (TVE) and TVE Internacional. The teams are the Lenguetazos and Lenguetones. Children between 9 and 12 years old participate, and slide down an enormous tongue. During the half hour show, the contestants play games like Letter Soup and Trabalenguas (tongue twisters) with a lollipop in their mouths. An animated Cervantes judges the results of the teams.
The emcee is Ana Belen Roy. She is a journalist from Madrid and was born on 24 August 1977. She has been employed by Televisión Española since 1997, where she has worked as an announcer and a reporter. She is currently a reporter for "La Suerte Está en Tus Manos, ("Fate is in Your Hands")
References
https://web.archive.org/web/20061214080236/http://www.inicia.es/de/tvlocales/news/localia_news/2004/0101_localia_tiramelengua.htm
Category:RTVE shows
Category:Spanish children's television series
Category:Spanish game shows |
Iran’s recently re-elected President Hassan Rouhani addressed all of Iran’s “enemies” in a statement that is as much provocative as frightening.
Coming just days after President Trump called out Iran for its ballistic missile program and support of terrorism, Rouhani remarked that Iran “needs missiles”.
He is quoted as having said the following:
“We need missiles and the enemy should know that we make everything we need and we don’t pay an iota of attention to your words . . . he remarks by the enemies of the Iranian nation against Iran’s missile power are out of ignorance.”
Rouhani’s comments reaffirm what Iranian military officials have repeated over and over again, that Iran will never stop developing ballistic missiles, which could eventually be used to carry a nuclear weapon.
TRENDING: RUTH BADER GINSBURG DEAD! Supreme Court Justice Dies at Home Surrounded by Family
The Washington Free Beacon reports: |
Q:
Python variable assignment order of operations
Is there a way to do a variable assignment inside a function call in python? Something like
curr= []
curr.append(num = num/2)
A:
Nopey. Assignment is a statement. It is not an expression as it is in C derived languages.
A:
I'm pretty certain I remember one of the reasons Python was created was to avoid these abominations, instead preferring readability over supposed cleverness :-)
What, pray tell, is wrong with the following?
curr= []
num = num/2
curr.append(num)
|
TOP DRAFT pick Sam Walsh appears a certain starter for Carlton's round one clash against Richmond, with the gun youngster starring in the club's unofficial scratch match against Hawthorn on Thursday afternoon.
JAEGER ON FIRE Find out who else starred for the Hawks
Walsh produced a scintillating display at Ikon Park, playing the entirety of the game and showcasing his talent during a series of electrifying passages of play.
A hardworking contest in front of a packed Richard Pratt Stand late in the third term, where Walsh outbattled three Hawthorn players to singlehandedly force a stoppage, was a highlight. But it was hardly the youngster's only defining moment in the match.
His endless running power, willingness to receive the ball on the overlap and superb kicking ability were all appreciated by a large band of home fans, with the teenager pressing a strong case for a round one debut in a month's time.
Here's a bit of Sammy Walsh for your afternoon! #BoundByBlue pic.twitter.com/nGGiMi8KxN — Carlton FC (@CarltonFC) February 21, 2019
But Walsh was one of few standouts in a new-look Carlton team featuring six fresh faces, who fell to a comprehensive 12.5 (77) to 8.5 (53) defeat to Hawthorn.
"The intensity he trains at, it allows him to play like that," Carlton assistant coach David Teague said of Walsh after the game.
"You saw him today, he just competes. He works hard and competes. If you do that and you bring a bit of talent, you're going to go a fair way.
"I don't watch what they do as under 18s, but the way he's applied himself and the way he trains, I've never seen a first-year player train at that intensity. Whether that turns into form, generally the guys that train well are the guys who can follow it up.
"I think he's prepared himself really well and I look forward to watching his season."
Walsh attempts to break clear of a tackle. Picture: Getty Images
Spending the majority of the match on a wing, Walsh was part of an experimental Blues midfield that featured a series of untried centre clearance partnerships.
Former skipper Marc Murphy was prolific on a wing, but didn't feature in the final quarter after copping a knock to his knee. He was later seen icing the injury, though the Blues remain adamant his withdrawal was simply precautionary.
Notable absentees that included co-captain Patrick Cripps and young midfielder Zac Fisher, who are both on AFLX duty, forced new faces to rotate through the middle.
AFLX FIXTURES Bolts and Rampage kick it off
Charlie Curnow and Jack Silvagni were all handed extended runs through the midfield, though looked raw in their new positions, with Sam Petrevski-Seton shouldering the brunt of the workload and taking his opportunity with both hands.
Jack Silvagni fends off a Jarman Impey tackle. Picture: Getty Images
Petrevski-Seton, set to enter his third season at the club this year, was alongside Walsh as Carlton's best as he won a handful of skilful centre clearances and used the ball effectively going forward.
Having spent periods both across half-back and half-forward in his first two campaigns, Petrevski-Seton looks set to make a midfield spot his own in 2019.
Right foot? Left foot? Doesn't matter for Samo.
A classy bit of play to find Ed for the Blues' first goal of the day.#BoundByBlue pic.twitter.com/TQYPA54ORd — Carlton FC (@CarltonFC) February 21, 2019
Will Setterfield could join him in the engine room as he continued his recovery from a ruptured ACL sustained early last year. The former Giant played just the second half on Thursday, but spent the entirety of his game-time in the midfield.
Mitch McGovern was alongside Walsh and Setterfield as one of the six new Blues to be featuring, but was withdrawn early at the main change as he recovers from a back injury.
Carlton's prized recruit during the NAB AFL Trade Period took a couple of strong marks, but failed to make a significant impact and couldn't hit the scoreboard in the first half.
FULL INJURY LIST Who's racing the clock for round one?
Nic Newman was busy across half-back following his move from Sydney, while new rookie Michael Gibbons had his moments in the forward line having signed for the club earlier this month. Hugh Goddard played just the second half, rounding out Carlton's new recruits.
Instead, it was his defensive partner Jacob Weitering who was the standout down back, with his intercepting, spoiling and positioning a highlight throughout the game.
Jarrod Garlett was one of a number of players trialled in a new role across half-back but struggled and turned the ball over a series of times in dangerous places on the ground.
At the other end, the Blues unveiled their three-pronged tall forward line, with McGovern partnering Curnow and Harry McKay as the deepest inside 50.
Levi Casboult also featured, but spent the entire match in the ruck with Matthew Kreuzer, Matthew Lobbe and Andrew Phillips sidelined.
McKay kicked two goals, while Curnow took a series of nice marks, but it was Carlton's brigade of small forwards who looked the most potent.
Charlie Curnow showing his strength on the ground. Picture: Getty Images
David Cuningham looked dangerous throughout the match and kicked two classy goals, while Ed Curnow also chipped in with another major in his new role as a pressure forward.
One of a series of Carlton first-round draft picks set to enter their fourth season this year, Cuningham looks likely to be charged with more responsibility in 2019. He went into the midfield throughout the second half, where he also looked lively.
CARLTON 1.1 4.2 4.2 8.5 (53)
HAWTHORN 5.0 7.3 11.4 12.5 (77)
BEST: Petrevski-Seton, Walsh, Weitering, C.Curnow, Cuningham
GOALS: Cuningham 2, McKay 2, E.Curnow, C.Curnow, Casboult, J.Silvagni |
Courthouse Records
Judge Daniel M. WrennAdam M. Tillison, 28, of 11 High St., Northbridge, was sentenced to 3 to 5 years in Walpole state prison after pleading guilty to assault and battery with a dangerous weapon (double-bladed spearhead). He was sentenced to a concurrent term of 2½ years in the House of Correction after pleading guilty to assault and battery on a police officer. He was sentenced to a concurrent term of 2 years in the House of Correction after pleading guilty to driving recklessly. He was placed on two concurrent terms of 3 years' probation, to begin upon his release, after pleading guilty to assault with a dangerous weapon (double-bladed spearhead) and driving recklessly. As conditions of probation, he was ordered to remain drug-free, to undergo mental health and substance abuse evaluations with treatment and counseling as recommended by the Probation Department, to submit to random drug tests, to stay out of Northbridge and to attend the VA Domiciliary Residential Program and all other programs as recommended by the VA. Charges of armed assault with intent to murder and two counts of failing to stop for police were dismissed.
Matthew Spear, 29, of 191 Charles St., Fitchburg, was sentenced to 6 months in the House of Correction after pleading guilty to possession of ammunition without a Firearm ID Card. The charge was amended from firearm violation with two prior violent or drug crimes. He was sentenced to 2½ years in the House of Correction, to begin upon his release from the first sentence, after pleading guilty to possession of a firearm while not at home or work. The charge was amended from firearm violation with two prior violent or drug crimes. A charge of carrying a firearm with ammunition was dismissed.
Judge James R. LemireJose Francisco Paulino-Cruz, 34, of Main Street, Worcester, was charged with trafficking in cocaine and drug violation near a school or park. The charges were dismissed without prejudice.
Alfredo A. Encarnacion, 28, of Charlestown, was charged with possession of marijuana and drug violation near a school or park. The charges were nol prossed. A nol pros or nolle prosequi is a court filing reflecting a prosecutor's decision not to proceed with a criminal case after charges have been brought.
Worcester Central District Court
Criminal and Traffic Sessions
Judge David B. LockeJeremy K. Hayes, 30, of 28 Woodside Road, Spencer, charged with attempting to commit a crime (armed robbery), continued to Dec. 6 on $12,500 cash bail; armed and masked robbery (handgun), continued to Dec. 6 on $12,500 cash bail; armed and masked robbery (firearm), continued to Dec. 6 on $12,500 cash bail; and armed and masked robbery (handgun), continued to Dec. 6 on $12,500 cash bail.
Matthew J. Nims, 23, of 6 Catalpa St., Worcester, charged with two counts of possession of a firearm without a Firearm ID Card, two counts of receiving stolen property over $250, and larceny under $250, continued to Dec. 6 on $12,500 cash bail; armed robbery (large capacity firearm), assault with a dangerous weapon (firearm), carrying a firearm without a license, two counts of possession of a large capacity firearm, carrying a loaded firearm without a license, and receiving stolen property over $250, continued to Dec. 6 on $12,500 cash bail.
William B. Wilson, 48, of 98 Elm St., Worcester, charged with assault and battery with a dangerous weapon (shoe), continued to Dec. 5 on $1,000 cash bail; and shoplifting, continued to Dec. 5.
Kelvin Yera-Cruz, 23, of 104 Dorchester St., Worcester, charged with two counts of driving with a suspended license and license plate violation to conceal ID, sentenced to three concurrent terms of 10 days in the House of Correction; vehicle lights violation, license not in possession, and registration not in possession, found responsible, filed.
Angel R. Santos, 31, of 16 Oakview St., Worcester, charged with assault and battery, continued to Jan. 8 on $1,500 cash bail.
Earl E. Davis, 27, of 10 Russell St., Worcester, charged with assault and battery, continued to Dec. 3 on $500 cash bail.
Robert J. Ferguson Jr., 46, of 8 Alpine St., Worcester, charged with violation of an abuse prevention order, continued to Dec. 5 on $1,000 cash bail.
Peter R. Rano, 26, of 156 Apricot St., Worcester, charged with driving with a suspended license, dismissed, $50 costs; license plate violation and driving an unregistered vehicle, found not responsible.
Cherise Deloris Hill, 29, of 21 May St., Worcester, charged with giving a false name or Social Security number to police, trespassing, disorderly conduct and disturbing the peace, continued to Dec. 3 on $100 cash bail.
Symere H. McClain, 31, of 183 Austin St., Worcester, charged with possession of marijuana with intent to distribute (subsequent offense) and conspiracy to violate a drug law, continued to Jan. 9 on $200 cash bail.
Alicia M. Cotto, 27, of 69 Outlook Drive, Worcester, charged with driving with a suspended license, possession of marijuana with intent to distribute, and conspiracy to violate a drug law, continued to Jan. 9.
Erika A. Hernandez, 28, of 61 Great Brook Valley Ave., Worcester, charged with using a vehicle without authority and larceny over $250, continued to Dec. 4 on $500 cash bail.
Wanda L. Diaz, 37, of 25 Queen St., Worcester, charged with larceny over $250 and using a vehicle without authority, continued to Dec. 4 on $500 cash bail.
Michael H. Heney, 49, of 1819 Providence Road, Northbridge, charged with driving under the influence of alcohol or .08 percent (second offense), continued to Jan. 10.
Matthew C. Melvin, 24, of 11 Eaglehead Terrace, Shrewsbury, charged with driving under the influence of alcohol or .08 percent and marked lanes violation, continued to Dec. 19.
Lauren F. Gibbons, 30, of 25 Montague St., Worcester, charged with assault and battery with a dangerous weapon (knife), continued to Jan. 13.
Ara H. Derderian, 24, of 15 Dubiel Drive, Worcester, charged with driving under the influence of alcohol or .08 percent, marked lanes violation, and two counts of license plate violation, continued to Jan. 10.
Joel J. Rosario, 22, of 28 Rodney St., Worcester, charged with driving with a suspended license, fined $625, $50 victim witness fee; motorcycle equipment violation, found responsible, filed; and failing to stop or yield, found not responsible.
Cameron N. Bennett, 23, of 115 Dana Road, Oxford, charged with larceny over $250 and receiving stolen property over $250, continued to Jan. 9.
Mallory T. Fitzsimmons, 22, of 113 Lake Ave., Worcester, charged with driving under the influence of alcohol or .08 percent, marked lanes violation, and disorderly conduct, continued to Jan. 10.
Marvin Aguilar, 42, of 266 Belmont St., Worcester, charged with assault and battery, continued to Jan. 13 on $500 cash bail.
Craig M. Herron, 46, of 751 Washington St., Auburn, charged with driving with a suspended license, dismissed, $100 costs.
Landal Williams, 45, of 125 Sterling St., Worcester, charged with driving with a suspended license (subsequent offense) and driving an unregistered vehicle, continued to Jan. 10.
Amber L. Laferriere, 22, of 62 Chino Ave., Worcester, charged with assault and battery, continued to Jan. 15 on $500 cash bail.
Emily Rosa, 22, of 35 Edgeworth St., Worcester, charged with assault and battery and malicious destruction of property over $250, continued to Jan. 16 on $500 cash bail.
Daniel P. Kwakye, 26, of 285 Plantation St., Worcester, charged with unarmed robbery, continued to Jan. 8.
Lester Taylor, 44, of 26 Valley Hill Drive, Worcester, charged with driving with a suspended license, dismissed, $100 costs; and speeding, found responsible, fined $180.
Isabel Gomez, 31, of 190 Millbury St., Worcester, charged with driving without a license and failing to stop or yield, continued to Jan. 10.
Federico Adorno, 34, of 1 Sycamore St., Worcester, charged with driving with a suspended license, driving with a suspended registration, and driving an uninsured vehicle, continued to Jan. 17.
Eduardo Pagan, 22, of 48 Barnes Ave., Worcester, charged with driving with q suspended license, dismissed, $50 costs; and failing to yield at an intersection, found not responsible.
Stephanie Bergeron, 27, of 132 Maywood St., Worcester, charged with larceny over $250 and receiving stolen property over $250, continued to Jan. 8.
Tameiko Milligan, 22, of 1 Orne St., Worcester, charged with driving with a suspended license (subsequent offense) and marked lanes violation, continued to Jan. 9.
Christopher M. Suprenant, 26, of Framingham, charged with driving with a suspended license, dismissed, $300 costs.
Christopher M. Sullivan, 32, of 32 Burncoat St., Leicester, charged with having no inspection sticker on a vehicle and driving with a suspended license, continued to Dec. 20.
Judge Andrew M. D'AngeloEdwin B. Rivera, 49, of 33 Winter St., Southbridge, charged with indecent assault and battery on a child under 14, dismissed.
Paris R. Matthews, 56, of 7 Dayton St., Worcester, charged with sexual conduct for a fee, fined $250.
Jose A. Echevarria, 53, of 82 Providence St., Worcester, charged with assault and battery, dismissed.
Sylvestine Barjolo, 27, of 8 Princeton St., Worcester, charged with permitting the operation of a vehicle by an unlicensed or suspended driver, dismissed, $50 costs; and having no inspection sticker on a vehicle, found not responsible.
Josiah G. Stratman, 24, of 130 Mendon St., Uxbridge, charged with possession of marijuana, amended from possession of marijuana with intent to distribute, found responsible, fined $100.
Ediualdo A. Lagares, 45, of 11 Cutler St., Worcester, charged with driving without a license, found responsible, fined $100.
Jose Figueroa, 47, of 25 Denmark St., Worcester, charged with assault with a dangerous weapon (knife), sentenced to 1 year in the House of Correction, suspended for 2 years, ordered to pay $90 victim witness fee; assault and battery, placed on probation for 2 years, ordered to remain alcohol-free, to submit to random drug tests, to attend a batterers' program, and not to abuse the victim; and defacing property, dismissed.
Bardhyl G. Cami, 56, of 85 Tarrytown Lane, Worcester, charged with threatening to commit a crime and assault and battery on a person over 60 or disabled with an injury, continued without a plea or finding and placed on pretrial probation for 3 months, ordered to complete five private anger-management counseling sessions.
Kevin Cabrera, 23, of 31 Willard Ave., Worcester, charged with possession of marijuana, amended from possession of marijuana with intent to distribute (subsequent offense), continued without a finding for 6 months, ordered to remain drug-free, to submit to random drug tests, and to pay $50 victim witness fee; having no inspection sticker on a vehicle and failing to wear a seat belt, found responsible, filed.
Stephen M. Antinovitch, 36, of 9 Snell St., Sturbridge, charged with shoplifting (second offense), fined $100; and receiving stolen property under $250, dismissed.
Devin J. Mongeau, 21, of 19 Brook St., Webster, charged with driving with a suspended license, dismissed, $100 costs; and vehicle equipment violation, found responsible, filed.
Judge Michael L. FabbriChristopher Carmona-Figueroa, 21, of 57 Great Brook Valley Ave., Worcester, charged with assault and battery and assault and battery with a dangerous weapon (wall), sentenced to two concurrent terms of 2 years in the House of Correction, with 9 months to be served, balance suspended for 18 months with probation, ordered to attend a batterers' program, to undergo a mental health evaluation with treatment and counseling as recommended by the Probation Department, to take medications as prescribed, to abide by a restraining order, to stay away and have no contact with the victim, and to seek and maintain employment; and assault with a dangerous weapon (knife), placed on probation for 18 months.
Judge Paul L. McGillHad-Zhe Zhang, 55, court records list addresses as 19 Florence St. and 3 Mount Hope Terrace, Worcester, charged with driving without a license, found responsible, fined $50; and marked lanes violation, found not responsible.
Lisa J. Schmidt, 41, of 106 Harrington Way, Worcester, charged with driving an uninsured vehicle, dismissed, $100 costs; and driving with a suspended registration, dismissed.
Yajaira L. Almodovar, 25, of 11 Allen St., Worcester, charged with armed robbery (large capacity firearm), receiving stolen property over $250, two counts of possession of a large capacity firearm, carrying a loaded firearm without a license, and carrying a firearm without a license, continued to Dec. 6.
Sara-Ellen D. Demers, 24, of 19 June St., Auburn, charged with assault and battery, continued to Nov. 26.
Jamil A. Bernal, 23, of 56 Catharine St., Worcester,charged with possession of MDMA with intent to distribute, continued to Nov. 21.
Judge David P. DespotopulosBruce Nevils, 56, of Boston, charged with armed assault with intent to murder (scissors), nol prossed. A nol pros or nolle prosequi is a court filing reflecting a prosecutor's decision not to proceed with a criminal case after charges have been brought. |
Q:
Project CRS not being respected by QGIS
I have a button in a QGIS (3.4.1) plugin that should: create a new project; set it's CRS to EPSG:4326', then import various maps.
However, when I run it for the first time after QGIS has loaded, the maps are show with their own CRS of EPSG:3857(confirmed in the bottom right of the GUI). If I click the button a second time/run the code again, the maps are shown in the intended CRS of EPSG:4326 (again, confirmed in the bottom right).
The minimum code I can find to replicate the behavior is below:
# Create new project
iface.newProject(promptToSaveFlag=False)
project = QgsProject.instance()
# Create map tile layer (which by default uses EPSG:3857)
map_uri = 'type=xyz&url=http://a.tile.openstreetmap.org/{z}/{x}/{y}.png'
raster_layer = QgsRasterLayer(map_uri, 'openstreetmap.org', 'wms')
if raster_layer.isValid():
project.addMapLayer(raster_layer)
# Set CRS to EPSG:4326
project.setCrs(QgsCoordinateReferenceSystem('EPSG:4326'))
Copy/pasting into the Python console seems to have the same results (i.e. first time after QGIS has loaded it doesn't work, second time it does).
Is this a bug in QGIS?
Can anyone propose a workaround?
A:
EDIT: So it turns out using QApplication.instance().processEvents() could well be dangerous (and quite possibly evil!)
It seems using QTimer.singleShot() is a better approach.
As such, I adopted my code below, which now works as expected.
def reset_and_load()
# Create new project
iface.newProject(promptToSaveFlag=False)
project = QgsProject.instance()
# Create map tile layer (which by default uses EPSG:3857)
map_uri = 'type=xyz&url=http://a.tile.openstreetmap.org/{z}/{x}/{y}.png'
raster_layer = QgsRasterLayer(map_uri, 'openstreetmap.org', 'wms')
if raster_layer.isValid():
project.addMapLayer(raster_layer)
# Call QTimer with 10ms delay (adjust to suit) to set CRS
QTimer.singleShot(10, set_project_crs)
def set_project_crs():
# Set CRS to EPSG:4326
QgsProject.instance().setCrs(QgsCoordinateReferenceSystem('EPSG:4326'))
For further reading see also the GIS answer here, and comments here.
Warning: Answer/code below is being left because it works, though could be dangerous - see edit above
Thanks to the related section, I came across @Kezhas answer here - who seemed to be suffering experiencing the same issue as me.
Essentially a QApplication.instance().processEvents() is required after adding the layer (and before setting the CRS), as follows:
# Create new project
iface.newProject(promptToSaveFlag=False)
project = QgsProject.instance()
# Create map tile layer (which by default uses EPSG:3857)
map_uri = 'type=xyz&url=http://a.tile.openstreetmap.org/{z}/{x}/{y}.png'
raster_layer = QgsRasterLayer(map_uri, 'openstreetmap.org', 'wms')
if raster_layer.isValid():
project.addMapLayer(raster_layer)
# Process events before setting CRS - Use at own risk (see above)!
QApplication.instance().processEvents()
# Set CRS to EPSG:4326
project.setCrs(QgsCoordinateReferenceSystem('EPSG:4326'))
|
For some of us, anger and frustration begin early in the day. Cut off by the guy in the Pinto. Then stuck behind a slow truck -- what is wrong with that guy? Got around the truck, but still missed every single light. Almost there, but reached the final intersection just as road construction began -- why do they have to do this during rush hour, anyway? Spilled the coffee reaching for the parking pass. Why can't they have automatic parking gates? Arrived at work ten minutes late, frustrated and mad at the world. If this is your typical morning, you are not going to like what we have to say next.
Repeated bouts of anger are associated with thickening of the arteries and development of plaque, possible precursors to heart attacks. Over time, people who are frequently angry appear to have an increased risk of developing coronary heart disease. The stronger and more frequent the bouts of anger, the greater the risk of heart disease.
Some scientists argue that expressing anger, rather than holding it in, is better for the heart. This is unproven. Yelling might make you feel better for a moment, but it will probably endanger your job or your relationships -- leading to further stress and anger. A more effective strategy includes avoiding situations that trigger anger, and managing anger when it does occur. People who anger easily are frequently also pessimistic and cynical, and pessimism is bad for your heart. In an observational study of nearly 100,000 women, those with a pessimistic, cynical disposition developed more coronary heart disease, had more heart attacks, and died earlier than optimists. Cynical women were also more likely to develop cancer.
ANXIETY
Like anger, anxiety may forecast the development of coronary heart disease. We all know the tight feeling that we get in the chest when we become very anxious, so we should not be surprised to learn that this emotion can affect heart health. The circumstantial evidence supporting anxiety as a marker of heart risk is strong. In an observational study of 50,000 18- to 20-year-old Swedish men, those with high levels of anxiety substantially increased their risk of developing coronary heart disease over the next 37 years. A recent meta-analysis incorporating twenty studies and nearly 250,000 individuals also found that anxiety is associated with development of coronary heart disease.
Once again, the more frequent and intense the anxiety and worry, the more likely the development of heart disease. Veterans with post-traumatic stress disorder, which is characterized by intense anxiety, tend to have more calcium (a marker of coronary blockages) in their hearts' arteries than do soldiers without the disorder. On the civilian front, people who suffer from panic disorders face an increased risk of developing heart problems.
Excerpted from Heart 411: The Only Guide to Heart Health You'll Ever Need (Three Rivers Press)
We want to hear what you think about this article. Submit a letter to the editor or write to letters@theatlantic.com.
Marc Gillinov is a cardiac surgeon at the Sydell and Arnold Miller Family Heart & Vascular Institute at Cleveland Clinic. |
It has a campy 8 speed Record Titanium rear derailleur, record cranks,record brakes,record front derailleur, record hubs,record headset, Campy seat post,and Campy Moskva 80 hp rims.The headstem is a profile with corrosion.I want to sell it and give him the money as I was given it from an old Mate for doing some trenching at his horse property.We use to ride together back in the nineties but he has hardly ridden this bike.He bought it almost new from a local bike shop mechanic.I have lusted after this for a long time but it is too small for me and I have an em mx leader from the same vintage.
Who is online
About the Australian Cycling Forums
The largest cycling discussion forum in Australia for all things bike; from new riders to seasoned bike nuts, the Australian Cycling Forums are a welcoming community where you can ask questions and talk about the type of bikes and cycling topics you like. |
Home
We are immensely excited to reveal the films in competition at the 59th San Francisco International Film Festival! This year, 23 countries are represented in our Golden Gate Award New Directors and Documentary Feature slates. All in all, the Film Society will distribute nearly $40,000 in total prizes through SFIFF competitions. This is a major way that we recognize emerging talents from around the globe.
With more than a thousand new films hitting the major festival circuit each year, inevitably some important voices go unheard.
— Noah Cowan, San Francisco Film Society Executive Director
Among the most significant awards for emerging global film artists in the United States, these awards bring attention to innovative and quality filmmaking, regardless of their participation in other festivals. The GGA New Directors Prize winner will receive a cash prize of $10,000; the GGA Documentary Feature winner will receive $10,000; and the GGA Bay Area Documentary Feature winner will receive $5,000. The Golden Gate Awards will also include competitors in six short film categories. These short film nominees will be announced at the Festival press conference on Tuesday, March 29.
More than cash prizes, the Golden Gate Awards exist to celebrate independent artists and their work, providing an chance for international exposure and recognition amidst the mayhem of the festival circuit. Without further ado, meet the films that we are thrilled to present in competition this year.
2016 GGA NEW DIRECTORS PRIZE (NARRATIVE FEATURE) COMPETITION
As I Open My Eyes, Leyla Bouzid, Tunisia/France/BelgiumHer family assumes that Farah, a high-achieving student in Tunis, will continue her studies, but she just wants to sing. When her mom hears that she’s performing politically provocative material with a group of male friends, a powerful story unfolds of female independence that stands in the face of conservative Muslim beliefs.
The Demons, Philippe Lesage, CanadaDocumentary filmmaker Philippe Lesage’s narrative debut is an exquisitely observed portrait of a delicate 10-year-old Quebec boy grappling with the insecurities and confusion of impending adolescence. The fragility of innocence is foregrounded through minor humiliations and petty cruelties that unfold in pastel, sun-soaked locations. Infused with an unsettling air of ambiguity and dread that portends terrible crimes to follow, this restrained and coolly beautiful film is an unforgettable portrait a child forced to confront the dangers of growing up.
From Afar, Lorenzo Vigas, Venezuela/MexicoWhen a middle-aged single man, who cruises his Caracas neighborhood for rough trade, takes a tough young boy into his home, a gritty exploration ensues as these two angry men negotiate a relationship that resides somewhere between lover and friend and a paternal father/son dynamic. Winner of the Golden Lion at the Venice Film Festival, Lorenzo Vigas’s debut feature is a tour-de-force exploration of a relationship's darker side.
Home Care, Slávek Horák, Czech Republic/SlovakiaDedicated home-care nurse Vlasta (Karlovy Vary winner Alena Mihulová) traipses around the south Moravia countryside on bus and foot tending to (and bantering with) patients too infirm or elderly to travel. When she herself is diagnosed with a serious illness, she turns to alternative therapies and the company of women healers. The Czech Republic’s Oscar submission for Best Foreign Language Film is a rueful, touching mix of realism, absurdity, irony and daring gallows humor.
Mountain, Yaelle Kayam, Israel/DenmarkYaelle Kayam’s debut feature is strikingly shot against the tombstones of Jerusalem’s Mount of Olives, where an Orthodox woman’s longing for her husband’s love sets in motion a transformational journey into a nocturnal world of pimps and prostitutes. A mesmerizing performance by Shani Klein keeps viewers riveted to a character study that is by turns tender and startling.
Neither Heaven Nor Earth, Clément Cogitore, France/BelgiumIn this suspenseful war film that uses fear of the dark to great effect, a French army contingent operating in Afghanistan is beset by mysterious disappearances. While Captain Antarès (Jérémie Renier) initially and understandably blames local villagers for the loss of his men, the real cause could be something supernatural, a force that implies the profound wrongness of these men being on soil that doesn’t belong to them.
Thirst, Svetla Tsotsorkova, BulgariaWhen water becomes scarce due to drought, a laundress living in rural southwest Bulgaria with her husband and son invites a dowser and his spirited daughter onto their property to search for hidden springs. Wonderfully atmospheric, the film gracefully depicts how the teenaged girl’s combative nature and the oppressive heat surrounding them all upset the family’s balance, for good and bad.
Thithi, Raam Reddy, India/USAIn a small South Indian village, a cantankerous centenarian keels over and dies, setting the stage for a capricious comedy of errors among three generations of dissimilar sons. Conflict, confusion, corruption and a series of ill-conceived actions all come to a head at the funeral celebration (the titular thithi). With its charming cast of non-professional actors—both human and ovine—director Raam Reddy’s feature film offers a playful portrait of intergenerational conflicts and differences.
Very Big Shot, Mir-Jean Bou Chaaya, Lebanon/QatarTwo brothers are bitten by the movie bug when they conceive an idea to smuggle drugs in empty film canisters in this often hilarious satire of politics and filmmaking. With an easily manipulated director on board, their controversial storyline involving forbidden love catches the eye of local authorities and their original plan takes a backseat to their cinematic ambitions.
2016 GOLDEN GATE AWARDS DOCUMENTARY FEATURE COMPETITION
Cameraperson,Kirsten Johnson, USA Simultaneously an astute observation of nonfiction filmmaking’s dilemmas, and a wonderfully creative autobiographical collage, Cameraperson is a must-see for all documentary enthusiasts. Acclaimed cinematographer Kirsten Johnson, who has lensed such acclaimed films as Citizenfour, Very Semi-Serious and Darfur Now, assembles moments from 25 years of location shoots—including a birthing clinic in Nigeria, a Bosnian farm, a detention center in Yemen and a boxing ring in Brooklyn—and stiches together an illuminating, emotional patchwork memoir.
Dead Slow Ahead, Mauro Herce, Spain/FranceWe are embedded on a massive cargo freighter as it chugs slowly across the vast Atlantic ocean in this haunting, meditative and expansively ambient film. Humanized by the melancholy of a hard-working crew as they struggle against the elements, Mauro Herce's insightful and poetic cinematography emphasizes the smallness of human experience against the crushing and mighty mechanical grind of the ship, and the unknowable vastness of the open sea.
haveababy, Amanda Micheli, USAAmanda Micheli's stirring and suspenseful documentary follows several aspiring parents who desperately want to have a baby but are struggling with infertility and the high cost of treatments. They place themselves in the hands of Las Vegas doctor Geoffrey Sher and his annual contest offering a prize of a free round of in-vitro fertilization treatments—with no guarantee of pregnancy. A rollercoaster of hope and despair awaits them all.
The Joneses, Moby Longinotto, USA/UKFilmmaker Moby Longinotto's fascinating, thoroughly candid documentary invites audiences to pull up a chair at the never-dull family table in a Mississippi trailer park home. Everything is on the menu: dashed dreams, seething resentments, sexual awakenings and dollops of unconditional love. Overseeing all the tumult is unflappable, 73-year-old transgender matriarch Jheri Jones, whose dedicated ministrations keep her family going.
National Bird, Sonia Kennebeck, USAExecutive produced by Wim Wenders and Errol Morris, this elegant and chilling documentary provides a glimpse of what the US government doesn’t want you to know about drone warfare by focusing on three veterans whose service experience caused them to question the usage of drones in overseas combat.
Notes on Blindness, Peter Middleton, James Spinney, UK/FranceA taped journal that theologian John Hull kept after the onset of blindness in 1980 forms the basis of this elegant and moving depiction of struggle and transcendence. Hull's own voice provides the audio, though an actor plays the deceased writer, as he learns to negotiate his condition and endures a crisis of faith. Sublime sound design further enhances this evocative documentary, making manifest Hull's discovery that the loss of one sense leads to the sharpening of others.
NUTS!, Penny Lane, USAPenny Lane’s documentary—comprised of archival material, animated sequences and the occasional talking head—blooms into an incredible almanac of early 20th-century quackery and innovation as she focuses on JR Brinkley, an early broadcasting baron, direct-mail pioneer and an evangelical proponent of goat-testicle implants. An empire built on spurious claims and fear mongering seems unstoppable—until an obscure regional newspaper dares to question its foundations.
The Return, Kelly Duane de la Vega, Katie Galloway, USAAfter California voters reversed the state's Three Strikes law, thousands of inmates became suddenly eligible for resentencing and release. This provocative and touching documentary chronicles what happened next. Filmmakers Kelly Duane De la Vega and Katie Galloway (Better this World, SFIFF 2011) focus on the journeys of the newly free and their families, as well as the Stanford-based lawyers working on behalf of nonviolent offenders, illuminating the multifaceted struggle behind every transition from incarceration to freedom.
Salero, Mike Plunkett, USA/BoliviaMoises Chambi Yucra and his family stand at the crossroads of time. For generations, they have has made a humble living harvesting salt from Bolivia’s Salar de Uyuni, the world’s largest salt flat, but beneath Uyuni sit massive amounts of lithium, a mineral instrumental in powering smartphones and electric vehicles. With stunning cinematography that captures both the vibrancy and the solitude of the land and life, director Mike Plunkett captures the final days of an age-old way of life.
Under the Sun, Vitaly Mansky, Russia/Latvia/Germany/Czech Republic/North KoreaShot with the permission and supervision of North Korean authorities, Russian director Vitaly Mansky’s film turns a propaganda effort into a deep-cover documentary about life inside one of the world’s most repressive nations. Its subjects—a young girl in Pyongyang and her family—rigorously stick to the ideological script, but by keeping the camera rolling between takes of their carefully staged “real life,” Mansky reveals the grinding gears of the totalitarian message machine.
A Young Patriot, Du Haibin, China/USA/FranceDu Haibin’s insightful documentary captures five years in the life of a young Maoist zealot in northern China and provides an unforgettable portrait of China in transition. As the tumult of the country's recent history unfolds, cracks in the armor of Zhao's patriotism appear on multiple fronts. Communist Party corruption scandals, the rise of capitalism and the inhumane treatment of his family due to a reclamation project erode his bright optimism.
The 59th San Francisco International Film Festival runs April 21–May 5 at the Castro Theatre, the Alamo Drafthouse New Mission, the Roxie Theater and the Victoria Theatre in San Francisco and BAMPFA in Berkeley. Held each spring for 15 days, SFIFF is an extraordinary showcase of cinematic discovery and innovation in one of the country’s most beautiful cities, featuring nearly 200 films and live events, 14 juried awards with nearly $40,000 in cash prizes and upwards of 100 participating filmmaker guests.
Perfect way to start the new year: an amazing #SFFILM member screening of #PhantomThread at @castrotheatre with @paulthomasanderson in person. “I️ definitely think about the Castro as I’m making my movies. We’ve made quite a wonderful habit of coming here when we’ve made a new one, and I️ love it in this theater.” 📷 Pamela Gentile
SFFILM stands with women across every industry to say #TIMESUP on abuse, harassment, marginalization, and underrepresentation. We encourage you to sign the statement of solidarity and donate to the Times Up Now Legal Defense Fund: https://www.timesupnow.com
Follow Time's Up Now: @timesupnow
Co-stars #margotrobbie & #AllisonJanney in #sf for a special screening of #ITonya!
🎥 Only 3 weeks left to submit your film to the 2018 San Francisco International Film Festival! FINAL DEADLINE: Monday, December 4, 2017 ⇨ Visit sffilm.org for more information.⠀
⠀
#SFFILMFestival #filmmaking
I offered you peace. I showed you mercy. But now you are here to finish us off for good.
Happening Now: #PlanetoftheApes triple feature with Andy Serkis and Joe Letteri
Tomorrow! Join us for a Planet of the Apes triple feature and a special onstage conversation with actor Andy Serkis and VFX wizard Joe Letteri as they reveal the secrets behind the groundbreaking Planet of the Apes films. 🎟 's ⇨ sffilm.org
Tickets provide access to all three films and the onstage conversation.
#planetoftheapes #andyserkis
🎟 Win a pair of tickets to tomorrow's screening of ‘Darkest Hour' with #Gary Oldman in person.
Rules:
1. ❤️ this post
2. Follow us (if you aren't already 😃)
3. Tag a friend you want to bring below in comments. (Tag as many as you want for more chances to win)
Contest ends tomorrow 11/6 at 1pm.
Screening is Mon, 11/6 • 6:30 pm at the Castro Theatre
#giveaway #wintickets #sf #sanfrancisco #oakland #berkeley #DarkestHour #KristinScottThomas #WinstonChurchill #JoeWright |
CYP-mediated resistance and cross-resistance to pyrethroids and organophosphates in Aedes aegypti in the presence and absence of kdr.
Aedes aegypti thrives in urban environments and transmits several debilitating human viral diseases. Thus, our ability to control this mosquito species in endemic areas is of utmost importance. The use of insecticides, mostly pyrethroids and organophosphates (OPs), has long been the primary means of controlling A. aegypti, but widespread insecticide resistance has emerged. The two main mechanisms of pyrethroid resistance in A. aegypti are CYP-mediated detoxification and mutations in the target site, voltage-sensitive sodium channel (Vssc), referred to as knockdown resistance (kdr). Knowledge about the contributions and interactions of these mechanisms to resistance is important for the understanding of the molecular and evolutionary basis of insecticide resistance, and to determine the effectiveness of insecticides. In this study, we address two aims: 1) determine the patterns of CYP-mediated cross-resistance to pyrethroid and OP insecticides, both in the presence and absence of kdr (S989P + V1016G), and 2) determine whether the interaction between the two mechanisms yields a greater than, less than, or additive effect on resistance. We tested seven pyrethroids and four OPs against three congenic strains of A. aegypti: ROCK (susceptible), CYP:ROCK (CR) (resistant due to CYP-mediated detoxification without kdr), and CYP + KDR:ROCK (CKR) (resistant due to both CYPs and kdr), and compared these to the congenic KDR:ROCK strain that was previously reported. We found that resistance ratios (RRs) were variable between pyrethroids and strains, ranging from 6.2- to 42-fold for CR, and 70- to 261-fold for CKR. In general, we found that CYP-mediated resistance alone contributes less to resistance than kdr. The effect of the combined mechanisms on resistance was significantly greater than additive for all pyrethroids except (1R)-trans-fenfluthrin. CYP-mediated pyrethroid resistance conferred cross-resistance to both methyl paraoxon and fenitrothion, and negative cross-resistance to methyl parathion and naled. Based on our results, we recommend that etofenprox and cyfluthrin be avoided for A. aegypti control in areas where these two resistance mechanisms are prevalent. |
The development of drug delivery devices for implantation into a pre-selected locus in mammals has been extensively studied. To date, a variety of surgically implantable drug delivery devices have been developed and patented, and are discussed below.
U.S. Pat. Nos. 6,217,895; 6,001,386; 5,902,598; and 5,836,935, Ashton et al. describe a surgically implantable device for local deliver of low solubility therapeutic agents in an internal portion of the body. The device comprises an inner core containing the drug isolated from the surrounding environment by a permeable coating polymer which controls the release rate of the drug. The device delivers the drug in a multidirectional way from the implantation site, exposing all the structures in the site to the delivered agent. Moreover, the drug release occurs and is through a complex technology of a coating polymer that is non-bioerodible and permeable to the drug.
U.S. Pat. No. 4,378,016, to Loeb, describes a surgically implantable device for delivering an active factor to a mammalian site. The device comprises a fluid permeable membranous sack for implantation within the mammal and an impermeable hollow tube having one end connected to an opening in the sack and the other end designed to remain outside the body of the mammal. The tube provides an access passageway to the membranous sack, such that after the sack has been surgically implanted into the mammal, a cell-containing envelope may be introduced into the sack via the tube. Upon insertion of the cell-containing envelope into the sack the cells may produce an active factor which subsequently may diffuse into the surrounding tissue or organ of the recipient.
U.S. Pat. No. 5,182,111, to Aebischer et al., describes a surgically implantable device for delivering an active factor to a pre-selected site, for example, a tissue or organ in a mammal. The device comprises a semi-permeable membrane enclosing at least one cell type that produces a specific active-factor and a second cell type that produces an augmentory factor. The augmenting factor produced by the second cell type subsequently induces the first cell type to produce the active-factor.
U.S. Pat. No. 4,479,796, to Kallok, describes a surgically implantable dispenser for infusing a pre-selected drug directly into the blood stream. Briefly, the dispenser is surgically spliced in line with a blood vessel. The dispenser encloses a replaceable cartridge of cells, micro-organisms, which produce and secrete the drug into blood flowing past the cartridge.
U.S. Pat. No. 4,309,776, to Berguer, describes an intravascular drug delivery device having a chamber containing transplanted cells for surgical implantation into the wall of a blood vessel. The device comprises a porous wall that permits a hormone produced by the transplanted cells to diffuse out of the chamber and into the blood stream U.S. Pat. Nos. 6,251,090; 5,830,173 and 5,725,493, to Avery et al., describe a drug delivery device, comprising a refillable reservoir connected to the vitreous cavity through a tube. This concept requires intraocular invasion, which limits its application to situations when the integrity of the targeted tissue is not an issue.
U.S. Pat. Nos. 6,416,777 and 6,413,540 disclose a device that once positioned underneath the Tenon's capsule, in contact to the sclera, is supposed to deliver agents to the eye. Such system is composed of an outer layer impermeable to the delivered therapeutic agent, diminishing its wash out by the periocular fluids. The device has a geometry that facilitates its insertion and placement in the sub-Tenon's space, and reference is made to a method to place and hold it under the inferior oblique muscle, avoiding its dislocation from its original location and proportioning its positioning near the macula area. No references are made to methods to hermetically seal it to the sclera or to the targeted tissue. Moreover, the design of those devices does not accommodate methods to carry more than one agent, as in a bi-compartmental reservoir neither it refers to refilling ports to allow reposition of the liquid therapeutic agents.
The necessity of the use of a hermetically sealed device arises from characteristics determined by the drugs and tissues. Among the drug-related factors are: narrow difference in the efficacious-toxic concentration; high instability or susceptibility to inactivation before reaching the aimed tissue; the requirement of prolonged and steady release curves, particularly in chronic diseases; and availability in liquid or gel state. The tissue factors are mainly related to the level of topographic specificity that is required from that agent, and not less importantly to the harms and susceptibility of the surrounding tissues to the drug toxic effects.
The possibility of drug leakage through the device-tissue junction sharply excludes the use of some important therapeutic agents, not only cytotoxic drugs, but other more specific agents. Angiogenic peptides could never be applied and exposed to other tissues other than where aimed to act. If aimed to the choroid by increasing the blood flow and stimulating capillary growth, its possible exposure to the vascularized periocular tissue before even crossing the sclera, beyond dissipating the angiogenic effect, could increase the flux of blood and plasma around the implant and speed up the degradation or neutralization of its active agent. Moreover, biological processes occurring in that location may alter significantly the release pattern of any agent from the delivery device whether the agent is still active or not.
Inflammatory reactions are the basis of the healing process in mammalians, involving the release of a wide range of chemical, biological and cellular factors that ultimately lead to a reorganization of the tissue. Scar formation and foreign body reactions are common responses from an organism to traumatic and surgical injuries, particularly if there is exposure to inert or immunogenic materials. These responses are created to reconstitute the affected or exposed tissue through a series of reactions that frequently culminate with strengthening of the affected tissue and isolation or extrusion of the foreign body.
Over the past decades significant experience with periocular implants has been achieved through the well established practice of encircling elements for treating retinal detachment and by the proliferation of filtration devices for the surgical therapy of glaucoma. Many polymers were tested for that purpose and the experience accumulated over the years showed that the encapsulation of the implant invariably happens after periocular implantation. Indeed, even for largely used medical products such as silicone, it was shown that the encapsulation process starts as soon as 3 days following insertion. Nevertheless, a fibrotic reaction to a prosthesis or to a structural implant is not so harmful. Instead, it is even desired to provide mechanical stability to the implant and enhance its structural function19,20,21,22.
The lack of a way to hermetically seal the device to the tissue would not only affect the way the carried agent would act and react with the surrounding tissues, but also the way the surrounding tissues would respond to the agent and the system. The encapsulation of such system, and the formation of a layer of scar tissue between the drug reservoir and the organ surface would change significantly the pattern of drug release altering the main determinants of diffusion through that surface, which is primarily composed by a membrane with known characteristics, and diffusion coefficients for certain molecules.
In Ophthalmology, several studies were carried out to characterize the sclera, the most external layer of the eyeball, as a membrane. Many experiments justified the use of periocular injections to deliver drugs to the eye. Edelhauser et al. studied extensively the properties of the sclera as a permeable membrane. His in vitro studies were further enhanced by in vivo studies to show how periocular injections can deliver agents to the internal eye tissues. It was shown that molecules as large as 70 KDa can diffuse across the sclera and reach the intraocular space, even against a pressure gradient. Such properties are partially explained by porous characteristics of the scleral collagen, although the whole mechanism is still not totally understood, particularly the mechanisms these large molecules can reach the intravitreal space, bypassing tight junctions of very selective barriers such as the outer blood-retinal barrier. Indeed, the unprotected transcleral route has been used for many years and has proved to be effective with the administration of certain drugs. Anti-inflammatory steroids are injected through the conjuctiva into the subTenon space and put directly in contact with the sclera, which allows the diffusion of the drug toward the intraocular space, providing high therapeutic levels of the drug to the various layers of the eye. Deposit formulas of steroids are available with demonstrated safety and equivalency, or superior effectiveness to the systemic route, but without its inconvenient side effects. However, because these injections are unprotected from the surrounding orbital tissue, much of the injected dose is absorbed systemically and carried away from the site. The therapeutic effect is short-lived7,8,9.
Some other drugs cannot be administered by this periocular route because of significant irritation and toxicity to the adjacent tissues at the high levels necessary to permeate the layers of the eye. High concentrations of agents are necessary because of dissipation of the drug in the periocular tissue. This is mainly attributed to a washout mechanism by the periocular soft tissue or inactivation of the agents by inflammatory cells, immunoglobulins and plasma components before they reach the targeted structure.
In certain conditions, such as in endophthamitis, the intraocular use of the drug is appropriate by providing high levels of the antibiotic available in a short period of time. However, for chronic use, repeated intraocular injections bring an unnecessary high risk of complications, either from the injection procedure or from high drug concentrations instantaneously provided by the direct injection. Intraocular procedures are not always possible. Inflammatory conditions such as uveitis, particularly in the severe disorders, such as in Behcet's disease, even minimally invasive intraocular procedures can lead to a severe and prolonged hypotony. Intraocular cancers also require non-invasive approaches due to the risk of cancer cells being disseminated throughout the orbit. Retinoblastoma, most common primary intraocular tumor in childhood, is an ideal disorder for the local delivery of chemotherapeutics. One of its clinical presentations, characterized by seeding of tumor cells in the vitreous gel, is currently treated by systemic chemotherapy. The failure of systemic treatment is frequently due to limited achievement of therapeutic levels of the drugs in that location, and often leads to removal of the eye. Administering the drug directly into the vitreous is impossible because of the risk of tumor cell dissemination, directly leading to death.
Regional therapy is an alternative and is currently under clinical trials. Promising efficacy has been achieved but some toxic side effects were reported as well. In this specific situation high levels of cytotoxic drugs, such as carboplatin in the orbit, can result in unpredictable side effects during the patient's lifetime, particularly in the retinoblastoma population which is more susceptible to secondary neoplasias due to gene mutations. Similar therapeutic levels of the drug in the eye could be achieved if the periocularly injected drug was isolated or protected from the extraocular connective tissue, which offers potential advantages of prolonged release time and certainly fewer side effects to the orbital structures and optic nerve. Furthermore, a controlled release of those agents could be achieved since the interface area with the drug is well defined, a main predictor of drug diffusion rates across the sclera. The positioning of the drug in contact with a specific area of the sclera would also avoid exposure of more sensitive structures, e.g. optic nerve, to potentially toxic drugs at high concentrations.
Regional therapy has been extensively studied and has proved to be efficacious in several conditions. Although drug delivery systems based on polymer technology have improved the bioavailability and pharmacokinetics of therapeutic agents in the targeted sites, lack of local specificity is still a major limitation to its clinical applicability.
New classes of therapeutic agents have demonstrated promise, but the inability to efficiently and specifically deliver such agents to the target limited the achievement of successful results to the in vitro studies. A number of those when tested in vivo, fail to produce the same results as in vitro.
Moreover, tumor cells as well as infectious agents can spread to other organs or even systemically, once the natural barriers of the organ are surgically broken. The systems aforementioned, when not delivering the agent directly to the interstice of the aimed tissue, can still provide therapeutic levels by releasing the agent to the cavity or the surrounding space and fluids. This ultimately can lead to uptake from the organ and from any of the adjacent structures. Such perfusion systems lack specificity and are not suitable for clinical use when the drugs are toxic to the surrounding structures. This problem becomes more prominent when the agent may trigger other pathologic processes. This is more frequent when using viral gene vectors, inhibitors of biological factors and non-specific sensitizers.
Patched delivery systems have been developed for transdermal or transmucosal release of drugs. Such systems are designed to have one interface with the dermal or mucosal epithelium through which the diffusion of drug occurs. The other interface is usually external of the target body tissue, e.g. the external environment in the case of a transdermal patch, or the intestinal lumen or oral cavity, in transmucosal models. The main concern in designing those devices is to protect the carried agent from the secretions of the gastrointestinal, oral and nasal tracts and consequently to allow more drug to reach the systemic circulation, instead of directly acting in a targeted organ or tissue1,2,3.
With transmucosal devices any release from the external surface will be neutralized by luminal enzymes, flora or physical inactivation, or will reach the systemic circulation after distal absorption what is ultimately the goal of most of these drug delivery systems. Neither transdermal or transmucosal delivery systems were conceptualized to be surgically implanted nor designed to meet the level of biocompatibility necessary to be exposed to internal body fluids, e.g. blood, connective tissue, or any internal cellular response. Their application is under exposure to body secretions, therefore, they are not usually subject to severe inflammatory reactions and do not require high levels of biocompatibility, factors that make them unsuitable for surgical implantation1,2.
Systems like polymer shields for drug release as the ones available for ocular use, share some of the characteristics of the transdermal and transmucosal systems. They do not aim to deliver the drug directly to the cornea or conjunctiva or to any specific ocular structure, but release the agent to a body secretion fluid as the the lacrimal film, in a multidirectional way. From the tear film agent diffusion occurs throughout the ocular surface and later to the lacrimal drainage system and nasopharyngeal mucosa, again exposing other tissues to side toxic effects. These systems can provide a sustained release of an agent, but in a non-selective way, dissipating its effects to all the surrounding structures, e.g. conjunctiva, lid skin, cornea, lacrimal system. As with the transdermal and transmucosal systems, those systems were designed to offer the advantage of non-invasive sustained release, not be implanted through surgical procedures, but just attachment to body or mucosal surfaces.4,5
Experimental and clinical evidences suggest that organ surfaces exposed to high levels of drugs can lead to internal therapeutic levels even higher than those achieved by systemic administration. The potential diffusion properties of organs and tissues are discussed, as well as the advantages of its exploration as a therapeutic route.
Bioactive peptides are agents necessary and naturally present in biological process, but may also be undesirably present in pathogenic situations, e.g. tumors, choroidal neovascular membranes, and absent as well, e.g. ischemic areas of the myocardium. The over or down regulation of such factors can lead to the improvement of pathologic conditions, and their efficient use as therapeutic agents, require the ability to provide to the target tissue the desired quantity in a sustained and prolonged fashion. The same protected regulated delivery is required for gene vectors, antisense agents, antibiotics, cytotoxic drugs, enzymes, certain hormones, etc. Other agents known as sensitizers also require a specific action, and the drug uptake by the targeted tissue will later define the efficiency of the definitive treatment, e.g. chemo, laser, radio or thermal therapies, in restricting and enhancing its effects, as well as side effects, to that site.
Local drug delivery is also under clinical studies for the treatment of intracranial tumors. Some neural origin tumors, such as malignant glioma have received most of the attention. These tumors are treated by a standard combination of surgical resection and external beam radiation. Due to the ability of this tumor to invade the normal adjacent brain it often recurs in the adjacent margins of resection. Based on those characteristics and the tumor unresponsiveness to systemic chemotherapy, the local delivery of drugs, sensitizers and peptide vectors started to be considered and studied as a treatment option, with potential effects on the quality of life of affected subjects.
Brem et al. have reported prolonged survival using polymers containing BCNU in controlled trial for recurrent glioblastoma. Such polymers are prepared to release 50% of the drug in the first 24 hours, and 95% by 120 hours10,11.
Another study reported a high incidence of perioperative complications, such as wound infection and seizures, without showing advantages over the conventional treatment12. Exposing tissues to higher concentrations of a therapeutic agent increases the chance of a greater efficacy without systemic side effects, but also increases the risk of local side effects, usually dose-related.
The prior art did not recognize that a selective and protected local delivery system could substantially improve the effectiveness of the treatment, as well as make available other agents never accepted for that use because of potential toxicity to the adjacent structures, and prior art systems designed to deliver drugs to the site where they are implanted provide no protection for other sensitive normal structures nearby.
For example, regional therapy to deliver bioactive agent to the myocardium and epicardial space has been extensively explored. Pericardial effusion syndrome and metastatic tumors were shown to respond very well to local delivery of chemotherapeutics by intrapericardial perfusion of 5-Fluorouracil and cisplatin through a catheter. This technique is efficacious in providing the epicardium space with high levels of drug, but imposes the risk of secondary infection if used in a chronic basis.13,14
An elegant study by Darsinos et al. showed the pharmacokinetics of digoxin and lidocain in the various heart tissues, including valves. Their study showed that these compounds follow an irregular distribution among cardiac tissues, after pericardium injection. Again, specificity of an agent to a determined region of the same organ is desirable for conditions such arrythmias and dysfunctional cardiopathies. Absorption of digoxin by the atria and absorption of both drugs by intrapericardial aorta were higher than that of other heart tissues, between 20 and 60 minutes. At 30 and 60 minutes, lidocaine was evenly distributed across the LV wall while digoxin 50 micrograms was mainly concentrated subepicardially. This distribution limits the intrapericardial route for administering those agents to situations where higher levels in those areas are desired15. The same author showed in another study that the concentration of amiodarone injected into the pericardium was higher in the subepicardium compared to deeper layers of the left ventricule, without measurable concentration in the blood16. The preferential distribution of those agents is due to an increased uptake of the drug by certain areas. Since this injection exposes the whole area of the myocardium surface to the agent, it is susceptible to different uptake rates between regions, and consequently to a non-controlled preferential delivery.
The effectiveness of bioactive agents as therapeutics depends on their delivery routes. For some bioactive reagents, their natural biological occurrence make them subject to inactivation or saturation by a variety of factors normally present in fluids and tissues before they reach their targets. Some growth factors and other compounds were shown to increase the vascularization of infarcted areas of the myocardium. Uchida et al. showed in a dog model of myocardial infarction, that the transcatheter intrapericardial injection of basic Fibroblast Growth Factor (bFGF) plus heparin sulfate is effective in causing angiogenesis and myocardial salvage more in the subepicardial infarcted area than in the subendocardial area. Further studies done in porcine model of chronic myocardial infaction confirmed the effectiveness of intrapericardial injection of b-FGF in inducing vascularization of myocardium.17,18. Although this shows promising results in animal studies, it is still questionable whether this route will be feasible in patients with prior instrumentation, including bypass surgeries.
The intravenous route was also considered and clinically studied, but did not show benefits compared to placebo. The use of this delivery route imposes concerns about a potential acceleration of retinal vascular diseases and occult neoplasias.
Vascular growth factors tend to bind to their receptors or be inactivated, so they are subject to saturation before reaching deeper layers of the tissues. Consequently, if vascular growth factors are unequally distributed among different layers of the tissue, their effects are expected to be as well. To allow them to reach deeper layers of the myocardium, it is necessary to protect them from unaffected areas, and limit their action to a defined pathologic area, where they will have a better chance to reach deeper after a longer period of exposure. A method for delivering the agent in a localized, sustained, protected and very selective manner, would more likely perform those tasks, with less side effects, through a minimally invasive implantation procedure, potentially benefiting a significant affected population that is not eligible for more morbid procedures. This strategy offers the advantages of the intrapericardial procedures, with comparable efficacy to intramyocardial approaches.
The use of bioactive agents locally has been subject to a number of studies. Inhibitors of vasculogenesis are potential tools for treating angioproliferative eye diseases such as retinopathy of prematurity and age-related macular degeneration, two leading causes of blindness in premature newborns and the elderly population. |
Q:
Why does the melodic minor scale turn into natural minor when descending?
I understand the construction of the scales; natural minor, harmonic minor (raises the 7th) and melodic minor (raises both 6&7 when ascending).
What I don't understand is why, when I play melodic minor descending, it flattens the 6&7 ,giving me the natural minor. So my questions is: Why is a descending melodic minor scale the same as a natural minor scale? Thanks.
A:
The main “purpose” of the raised degrees in ascending melodic and harmonic minor is to create a strong leading note:
X:1
L:1/4
M:
K:Am
V:1 clef=treble
e ^f "V₇ ↗"^g "i"a
%
Clearly, this leading tone only makes sense if you actually do resolve it upwards. If you go down instead, this can rather leave a feeling of unresolved tension.
X:1
L:1/4
M:
K:Am
V:1 clef=treble
a "↗"^g "?"^f "??"e
%
In harmonic minor, this unresolvedness is not as apparent because the attention will be more drawn to the exotic (if not somewhat jarring) 1½ tone step:
X:1
L:1/4
M:
K:Am
V:1 clef=treble
a (^g "!↘"f) e
%
Melodic minor avoids these 1½ tone steps to create smoother melody lines. When going up, you still want the leading tone, hence you raise the ⅶ and also the ⅵ. But when going down, it's more sensible to just leave both of them natural.
Of course that doesn't mean you can't use raised ⅵ and ⅶ degrees when going downwards. In particular if one voice already has one of these raised tones, it would be problematic to un-raise them in another voice. For example, the fugue that RRR brought up has this passage:
X:1
L:1/16
M:C
K:Am
%%score (T1 T2) (B1)
V:T1 clef=treble
V:T2 clef=treble
V:B1 clef=bass
% 1
[V:T1] (d8 d2 )
[V:T2] A,2dc BA^G^F E2
[V:B1] G,2^F,E,F,2^G,2 A,2
Here, the bass is already going up in melodic minor to the A root, and especially if the bass does this you really want the leading note effect, so it is F♯-G♯-A. At the same time, the alto needs to cross the ⅵ / ⅶ territory to get down to the Ⅴ (e). Using a g-natural there would cause a pretty bad clash between the voices:
X:1
L:1/16
M:C
K:Am
%%score (T1 T2) (B1)
V:T1 clef=treble
V:T2 clef=treble
V:B1 clef=bass
% 1
[V:T1] (d8 d2 )
[V:T2] A,2dc BA"⚡"GF E2
[V:B1] G,2^F,E,F,2^G,2 A,2
On alternative would be to use harmonic-descending there
X:1
L:1/16
M:C
K:Am
%%score (T1 T2) (B1)
V:T1 clef=treble
V:T2 clef=treble
V:B1 clef=bass
% 1
[V:T1] (d8 d2 )
[V:T2] A,2dc BA^G"¿¡"F E2
[V:B1] G,2^F,E,F,2^G,2 A,2
but again, that sounds a bit Spanish. Especially in a middle voice it's more innocuous to just adapt to the context of melodic-minor from the bass voice there, even if it means traversing the scale in the “wrong” direction.
A:
Because it gives a smoother melodic line when running up and down the scale. hence "melodic" minor.
Is this maybe arising from the common misconception that there's "a scale for a chord" and you're meant to stick to it? Not so, and you've just discovered one example!
A:
As already mentioned, a strong leading tone, one semitone lower than the root note, sounds better with a smaller change. This then made a tone and a half gap between notes 6 and 7, so 6 was also put up a semitone (from where it was in the natural minor). The natural minor contains all of the notes found in the relative major. Hence the same key sig. When, in early music, the melody went down, it sounded fine to use the notes from the natural minor, but ascending melodies were thought to be better sounding using the sharpened notes.
As an aside, all three minors use the same first 5 notes in their scales: natural then continues with notes from the relative major; harmonic continues with natural minor notes, except the raised leading tone; melodic continues with the parallel major notes ascending. There is also the jazz melodic, which favours the old ascending melodic notes both ways.
Modal minors are for another day...
|
BERLIN (Reuters) - German police hunting for a Syrian-born man suspected of planning a bomb attack found explosives in an apartment they raided while looking for him on Saturday, officials said.
Police appealed to the public to call them with any information on Jaber Albakr, 22, who was last seen in the eastern city of Chemnitz wearing a black hooded top with a bright pattern on the front.
“The search for the suspect is ongoing,” Saxony state police tweeted. “At the moment, however, we do not know where he is and what he is carrying with him. Be careful.”
Police detained three people in Chemnitz who they said were known to Albakr, but he remained at large.
“Questioning (of the detainees) is continuing. The results are still to come,” said Tom Bernhardt, spokesman for the Saxony state criminal investigation office.
Slideshow ( 11 images )
Bernhardt said police did not immediately find the several hundred grams of explosives when searching the apartment as they were well hidden.
Hundreds of police including specialist commandos combed a residential area in Chemnitz looking for Albakr.
The police deployment followed a tip-off from the domestic intelligence service, though the “where, when, how and why” of the planned attack remained unclear, said Bernhardt.
Police asked local residents to remain indoors and began evacuating more people after discovering the explosives. Bernhardt said it was unclear how many suspects might be involved.
In late July, Islamic State claimed responsibility for attacks on a train near Wuerzburg and at a music festival in Ansbach which wounded 20 people. |
More Coverage
Beer lovers have a reason to toast this year’s provincial budget but oenophiles won’t be able to pick up their preferred alcoholic beverage at their local supermarket just yet, Premier Kathleen Wynne has suggested.
The Premier’s Advisory Council on Government Assets, led by banker Ed Clark, will release its final report Thursday with recommendations to maximize the value of Hydro One, Ontario Power Generation (OPG) and the LCBO.
One of the first issues to stick in Clark’s craw was the private Beer Store monopoly and market access for Ontario’s craft brewers.
Wynne had earlier stated that her spring budget, which will put Clark’s recommendations into effect, would likely allow beer and wine sales in large grocery stores.
The government is now stepping back from that commitment, saying that it’s only ready to put beer on supermarket shelves.
“The fact is we do have wine that’s being sold already in some grocery stores,” Wynne said. “We need to build on that ... but the beer store was the entry point into levelling the playing field, creating more convenience and more fairness.”
More “conversations” are needed with the wine sector before that product will appear in grocery stores, except for small private outfits like the Wine Rack, she said.
Progressive Conservative Interim Leader Jim Wilson said many other countries around the world manage to sell wine in grocery stores but apparently it’s too difficult a feat for the Ontario Liberal government.
“They’ve once again set out on a course that they haven’t thoroughly thought out,” Wilson said. “I think at the end of the day they won’t get this right.”
Clark is also expected to report on a controversial proposal to sell off a portion of Hydro One.
CUPE Ontario released a legal opinion Wednesday that argued such a move would violate provincial laws that require proceeds from any sale of Hydro One be used to pay down electricity system debt.
Wynne intends to put the funds into a Trillium Trust that would invest in infrastructure such as roads and transit.
On a recent trade mission to China, the need for more infrastructure was a topic of conversation, Wynne said.
“I heard from businesses and government officials in China that one of the reasons that they might look askance at actually investing in Ontario is because they’re not sure that the commitment to infrastructure is there,” she said. “So we cannot sacrifice our future prosperity and our future economic health by not investing in infrastructure.” |
Parking Information
Parking
Cost
Attached Garages
Parking Garage
Directions
Cross Streets are N Buckner and Garland
About Reserve at White Rock
Reserve at White Rock stands out for its excellent location in Dallas and fantastic, botanical views. This well-kept property filled with tall trees and beautiful plants offers tenants a tranquil oasis right at home. With its ideal location, renters can quickly drive to White Rock Lake for recreation and relaxation and enjoy such activities such as taking a brief walk. Getting on the 635 or I-30 is only minutes away, and local transportation is walking distance.
Tenants can also enjoy an abundance of amenities such as 24-hour maintenance and a resort-style pool with plenty of beach seats, making luxury a standard. An on-site business center also offers ample seating and excellent quarters for conducting business meetings. The property also has a well-equipped gym that offers residents a sanctuary for carrying out their weekly workouts. After a workout, renters can take a small jog on the property's jogging trail.
Each floor plan comes with a cozy fireplace to help keep tenants warm on cold nights. Reserve at White Rock provides units from one to three-bedroom units that offer a garage in select units, perfect for keeping out the elements.
Why UMoveFree?
Over 2 Million Users Use the most popular apartment finding service in Texas...
Absolutely Free Access is free and we never ask for payment info...
More Apartment Listings View photos, pricing and details on nearly twice as many listings as other websites... |
Amanda Ferguson, 33, imagines Toronto’s astronomical rents are dinner-party fodder for people of her parents’ generation and her contemporaries living in small-town Ontario.
But renting is a longer-term and costly reality for more young professionals like Ferguson.
“It’s what you do to survive and balance the books,” she said.
At their own dinner parties, Ferguson and her friends talk about solutions to the high cost of housing — the possibility of commuting to Hamilton or moving to a smaller city — amid the mounting impossibility of owning in the Toronto region where the average detached or semi-detached home costs about $1 million.
A slavish devotion to home ownership in Canada, which has one of the highest rates in the world, and the growing gap between household incomes of tenants and homeowners in the Toronto region have helped attach a stigma to renting.
But with home ownership rates dipping in Canada, there’s a move afoot to normalize renting by pushing for policy and regulations that would give tenants the kind of security and control normally attached to home ownership.
Generation Squeeze, a Vancouver lobby group led by University of British Columbia professor Paul Kershaw, focuses on the economic plight of adults in their 20s, 30s and 40s struggling to pay for housing and child care. It has launched a petition and campaign called We Rent, to push politicians to level the playing field between renters and homeowners.
The most obvious way to do that is by increasing the stock of affordable and market-rate, purpose-built rentals that provide tenants with the security and professional management that provides them with security of tenure, says Generation Squeeze.
Have your say:
It wants the government to help by making the business model for rental development competitive with condos by using tax incentives such as GST rebates.
The guiding principle of We Rent is that “renters are not second-class citizens.”
It’s a cultural phenomenon that we prioritize home ownership, said Kershaw. For a long time it wasn’t as challenging to own a home in Canada as it is today in cities, particularly the two least affordable centres, Toronto and Vancouver.
“It became a sign of adulthood — you left the nest, you’ve got your own space and there’s some autonomy that comes with home ownership,” he said.
It’s not just about whether you can own a pet or paint your apartment. It’s about knowing that, as a renter, your child can access a particular school and stay there until they graduate in the same way that a homeowner is secure they can stay in the neighbourhood.
In the five years she has lived in Toronto, Ferguson, a communications professional, has been evicted twice. In both cases the landlords said they were moving her out to move in their relatives. Both instances followed conversations about illegal rent increases, she said.
When she moved to Toronto, Ferguson paid $1,350 for a one-bedroom apartment. The next place cost $1,450. Forced out again into the city’s 1 per cent vacancy rate in August, the average price was about $2,000, she said.
The average rent for a one-bedroom apartment in Toronto in the third quarter of this year was $2,056, according to market research firm Urbanation.
“They say you’re supposed to spend 30 per cent of your income on housing. That number is no longer realistic in Toronto unless you roommate up,” she said.
Loading... Loading... Loading... Loading... Loading... Loading...
She cites cities like London, England, where even established adults have flatmates as the only feasible way of affording a home.
After the second eviction Ferguson and her boyfriend decided to look for a place together. They lucked out with an older-large two-bedroom place for $2,450.
Growing up in Amhertsburg, a town of about 22,000 half an hour south of Windsor, Ferguson remembers a big house with a lawn and being able to run to her to her friends’ houses nearby.
Owning a home “is something that’s instilled in me as the next step,” she said. “It’s kind of sad that it’s potentially off the table or, in order to get that, I’d be looking at a three-hour commute round trip from Hamilton.”
The benefits of renting are often underrated, said Chris Spoke, who rents part of a Leslieville house with his wife and baby daughter, and is a founder of Toronto advocacy group, Housing Matters.
“When you think about things like labour mobility, being flexible enough to move to where the opportunity is, you’re less tied down. That’s something that you see as we extoll the virtues and benefits of home ownership — you do see less labour mobility and less flexibility on these fronts than societies that have higher rental rates,” he said.
Canadians have subscribed to the notion that housing is an investment. Increasing the value of that investment is incompatible with creating more affordable housing, Spoke said.
About the same time builders stopped making purpose-built rentals in the Toronto region, municipalities enshrined zoning rules that protect established neighbourhoods from denser, more affordable housing such as apartments, duplexes or triplexes.
For many Canadians, home ownership is a retirement fund — a way of paying yourself — Kershaw said.
“We’ve distorted that to say you’re going to pay yourself in an asset that we want to grow faster than the economy. We want it to be the best part of your portfolio. That has gone hand in hand in many big cities in Canada with home prices escalating far faster than economic growth and as a result leaving earnings behind,” he said.
A generation ago it took five years of full-time work to save a 20 per cent down payment on an average priced home in Vancouver and across Canada.
“If you flash forward to today . . . it would take 13 years to save a 20 per cent payment on an average priced home in Canada,” said Kershaw. “In Ontario it is 16 years. In British Columbia it’s 19 years. In the GTA, it is 22 years and in Metro Vancouver it is 27 years.”
Given how horrifying those statistics are, he said, “We just have to anticipate that we are on a route where more and more people are going to be renters for longer periods of their lives.”
Read more about: |
Q:
Duplicating Linux-like user account permissions in Windows 7
I'd like to know what are the best practices for creating a limited user account in a Windows 7 system, much like the user environment in Linux, where you have the superuser and the other normal users. Ultimately I'd like the normal Windows user to be restricted to touch anything on the partition where the Windows install is (this includes the WIN folders, Program Files, etc), to be locked only in something like a home folder and permissions to be required for everything that is more advanced (installation, configuration, etc).
A:
Left in it's default configuration, running an account with USER permissions on Windows 7 will have essentially the effect you're describing, gmunk.
User Access Control (UAC) and the default rights of a USER account set account permissions more or less exactly as you describe. No special configuration necessary.
UPDATE:
It depends. As always.
Depending on what you're doing with the computer your security requirements will change.
Is this a home computer that will be the only computer in the house? Add some antivirus software and you're pretty much OK.
Is this a corporate workstation? If the corporate network is secured properly, the security of individual workstations within the network is less important and is usually turned down a little to enable communication with the rest of the network.
Is this a desktop that will not move and will always be connected to the same network? Probably somewhere between the corporate setup and the single-computer home setup. You'll want to be able to share printers and maybe files and media between the computers, so you'll want to make sure they trust each other but don't accept communication from non-trusted computers as well as more robust antivirus.
Is this a laptop that will be traveling? You'll want really, really strong security. A local firewall installed on the computer (the Windows firewall is OK, you may prefer something else though) and good antivirus software.
Does the user need to be able to install stuff? Probably not based on your question.
A:
To further elaborate on my comment, your question leaves me somewhat confused as I assumed, what your're asking to be fact with Windows 7.
In Windows 7 the Administrator account (equivalent to root on Linux) is not available for direct use by default. So usually you have an account with administrative privileges (equivalent to being in /etc/sudoers). That user can perform tasks as the Administrator by confirming a UAC prompt.
Normal users will not be able to perform any administrative actions. Additionally, you can control access rights on the file system for every user account or user group, just as you would on Linux.
Regarding your wish to secure privilege elevation with a password. To my knowledge that is not possible (by design). As you may know, on Linux systems, your privilege elevation authorization is cached for a while. So if you use sudo and authorize yourself, if you use sudo again a few seconds later, you don't need to enter your password again.
On Windows, that's not the case. You have to confirm that prompt every. single. time.
So it's already annoying as hell (also by design). I guess the Windows architects decided against requesting a password. The only time you have to provide your credentials is when you log into your account. The Windows architects decided that to be enough.
Of course there can be times where your credentials are requested again. Like when you access resources over the network or when logging into certain services (SharePoint, SQL Server, ...) but that is to be expected.
Also, please note that there is a command line utility in Windows which is equivalent to sudo called runas which might be of interest to you (I, personally, hardly ever use it).
|
using System;
using System.ComponentModel;
using System.Drawing;
using System.Drawing.Drawing2D;
using System.Drawing.Imaging;
using System.Windows.Forms;
using SDRSharp.Radio;
namespace SDRSharp.PanView
{
public enum BandType
{
Lower,
Upper,
Center
}
public delegate void ManualFrequencyChange(object sender, FrequencyEventArgs e);
public delegate void ManualBandwidthChange(object sender, BandwidthEventArgs e);
public class Waterfall : UserControl
{
private const float TrackingFontSize = 16.0f;
private const float TimestampFontSize = 14.0f;
private const int CarrierPenWidth = 1;
private const int AxisMargin = 30;
public const int CursorSnapDistance = 4;
public const float MaxZoom = 4.0f;
public const int RightClickSnapDistance = 500; // Snap distance in Hz, for Ellie
private double _attack;
private double _decay;
private bool _performNeeded;
private Bitmap _buffer;
private Bitmap _buffer2;
private Graphics _graphics;
private Graphics _graphics2;
private BandType _bandType;
private int _filterBandwidth;
private int _filterOffset;
private float _xIncrement;
private byte[] _temp;
private byte[] _powerSpectrum;
private byte[] _scaledPowerSpectrum;
private long _centerFrequency;
private long _spectrumWidth;
private int _stepSize;
private long _frequency;
private float _lower;
private float _upper;
private float _scale = 1f;
private long _displayCenterFrequency;
private bool _changingBandwidth;
private bool _changingFrequency;
private bool _changingCenterFrequency;
private bool _mouseIn;
private int _oldX;
private long _oldFrequency;
private long _oldCenterFrequency;
private int _oldFilterBandwidth;
private int[] _gradientPixels;
private int _contrast;
private int _zoom;
private bool _useSmoothing;
private bool _useSnap;
private int _trackingY;
private int _trackingX;
private long _trackingFrequency;
private bool _useTimestamps;
private int _scanlines;
private int _timestampInterval;
private int _displayRange = 130;
private int _displayOffset;
private LinearGradientBrush _gradientBrush;
private ColorBlend _gradientColorBlend = GetGradientBlend();
public Waterfall()
{
_powerSpectrum = new byte[ClientRectangle.Width - 2 * AxisMargin];
_temp = new byte[_powerSpectrum.Length];
_buffer = new Bitmap(ClientRectangle.Width, ClientRectangle.Height, PixelFormat.Format32bppPArgb);
_buffer2 = new Bitmap(ClientRectangle.Width, ClientRectangle.Height, PixelFormat.Format32bppPArgb);
_graphics = Graphics.FromImage(_buffer);
_graphics2 = Graphics.FromImage(_buffer2);
_gradientBrush = new LinearGradientBrush(new Rectangle(AxisMargin / 2, AxisMargin / 2, ClientRectangle.Width - AxisMargin / 2, ClientRectangle.Height - AxisMargin / 2), Color.White, Color.Black, LinearGradientMode.Vertical);
_gradientBrush.InterpolationColors = _gradientColorBlend;
SetStyle(ControlStyles.OptimizedDoubleBuffer, true);
SetStyle(ControlStyles.DoubleBuffer, true);
SetStyle(ControlStyles.UserPaint, true);
SetStyle(ControlStyles.AllPaintingInWmPaint, true);
UpdateStyles();
}
public static ColorBlend GetGradientBlend()
{
return Utils.GetGradientBlend(255);
}
~Waterfall()
{
_buffer.Dispose();
_buffer2.Dispose();
_graphics.Dispose();
_graphics2.Dispose();
_gradientBrush.Dispose();
}
public void Perform()
{
if (_performNeeded && _mouseIn)
{
CopyMainBuffer();
DrawCursor();
Invalidate();
_performNeeded = false;
}
}
public event ManualFrequencyChange FrequencyChanged;
public event ManualFrequencyChange CenterFrequencyChanged;
public event ManualBandwidthChange BandwidthChanged;
[Browsable(false)]
[DesignerSerializationVisibility(DesignerSerializationVisibility.Hidden)]
public ColorBlend GradientColorBlend
{
get
{
return _gradientColorBlend;
}
set
{
if (_gradientColorBlend != value)
{
_gradientColorBlend = value;
_gradientBrush.Dispose();
_gradientBrush = new LinearGradientBrush(new Rectangle(AxisMargin / 2, AxisMargin / 2, ClientRectangle.Width - AxisMargin / 2, ClientRectangle.Height - AxisMargin / 2), Color.White, Color.Black, LinearGradientMode.Vertical);
_gradientPixels = null;
_gradientBrush.InterpolationColors = _gradientColorBlend;
DrawGradient();
BuildGradientVector();
_performNeeded = true;
}
}
}
public long CenterFrequency
{
get
{
return _centerFrequency;
}
set
{
if (_centerFrequency != value)
{
_displayCenterFrequency += value - _centerFrequency;
_centerFrequency = value;
_performNeeded = true;
}
}
}
public int SpectrumWidth
{
get
{
return (int) _spectrumWidth;
}
set
{
if (_spectrumWidth != value)
{
_spectrumWidth = value;
ApplyZoom();
}
}
}
public long Frequency
{
get
{
return _frequency;
}
set
{
if (_frequency != value)
{
_frequency = value;
_performNeeded = true;
}
}
}
public int FilterBandwidth
{
get
{
return _filterBandwidth;
}
set
{
if (_filterBandwidth != value)
{
_filterBandwidth = value;
_performNeeded = true;
}
}
}
public int DisplayRange
{
get { return _displayRange; }
set { _displayRange = value; }
}
public int DisplayOffset
{
get { return _displayOffset; }
set { _displayOffset = value; }
}
public int FilterOffset
{
get
{
return _filterOffset;
}
set
{
if (_filterOffset != value)
{
_filterOffset = value;
_performNeeded = true;
}
}
}
public BandType BandType
{
get
{
return _bandType;
}
set
{
if (_bandType != value)
{
_bandType = value;
_performNeeded = true;
}
}
}
public int Contrast
{
get
{
return _contrast;
}
set
{
_contrast = value;
}
}
public int Zoom
{
get
{
return _zoom;
}
set
{
if (_zoom != value)
{
_zoom = value;
ApplyZoom();
}
}
}
public bool UseSmoothing
{
get { return _useSmoothing; }
set { _useSmoothing = value; }
}
public double Decay
{
get { return _decay; }
set { _decay = value; }
}
public double Attack
{
get { return _attack; }
set { _attack = value; }
}
public int StepSize
{
get { return _stepSize; }
set
{
_performNeeded = true;
_stepSize = value;
}
}
public bool UseSnap
{
get { return _useSnap; }
set { _useSnap = value; }
}
public bool UseTimestamps
{
get { return _useTimestamps; }
set
{
_useTimestamps = value;
_scanlines = 0;
}
}
public int TimestampInterval
{
get { return _timestampInterval; }
set { _timestampInterval = value; }
}
private void ApplyZoom()
{
_scale = (float) Math.Pow(10, _zoom * MaxZoom / 100.0f);
_displayCenterFrequency = GetDisplayCenterFrequency();
if (_spectrumWidth > 0)
{
_xIncrement = _scale * (ClientRectangle.Width - 2 * AxisMargin) / _spectrumWidth;
_performNeeded = true;
}
}
public void CenterZoom()
{
_displayCenterFrequency = GetDisplayCenterFrequency();
}
private long GetDisplayCenterFrequency()
{
var f = _frequency;
switch (_bandType)
{
case BandType.Lower:
f -= _filterBandwidth / 2 + _filterOffset;
break;
case BandType.Upper:
f += _filterBandwidth / 2 + _filterOffset;
break;
}
var lowerLeadingSpectrum = (long) ((_centerFrequency - _spectrumWidth / 2) - (f - _spectrumWidth / _scale / 2));
if (lowerLeadingSpectrum > 0)
{
f += lowerLeadingSpectrum + 10;
}
var upperLeadingSpectrum = (long) ((f + _spectrumWidth / _scale / 2) - (_centerFrequency + _spectrumWidth / 2));
if (upperLeadingSpectrum > 0)
{
f -= upperLeadingSpectrum + 10;
}
return f;
}
public unsafe void Render(float* powerSpectrum, int length)
{
if (_scaledPowerSpectrum == null || _scaledPowerSpectrum.Length != length)
{
_scaledPowerSpectrum = new byte[length];
}
fixed (byte* scaledPowerSpectrumPtr = _scaledPowerSpectrum)
{
var displayOffset = _displayOffset / 10 * 10;
var displayRange = _displayRange / 10 * 10;
Fourier.ScaleFFT(powerSpectrum, scaledPowerSpectrumPtr, length, displayOffset - displayRange, displayOffset);
}
var scaledLength = (int)(length / _scale);
var offset = (int)((length - scaledLength) / 2.0 + length * (double)(_displayCenterFrequency - _centerFrequency) / _spectrumWidth);
if (_useSmoothing)
{
Fourier.SmoothCopy(_scaledPowerSpectrum, _temp, length, _scale, offset);
for (var i = 0; i < _powerSpectrum.Length; i++)
{
var ratio = _powerSpectrum[i] < _temp[i] ? Attack : Decay;
_powerSpectrum[i] = (byte) Math.Round(_powerSpectrum[i] * (1 - ratio) + _temp[i] * ratio);
}
}
else
{
Fourier.SmoothCopy(_scaledPowerSpectrum, _powerSpectrum, length, _scale, offset);
}
Draw();
Invalidate();
}
private void Draw()
{
#region Draw only if needed
if (ClientRectangle.Width <= AxisMargin || ClientRectangle.Height <= AxisMargin)
{
return;
}
#endregion
#region Shift image
ShiftImage();
#endregion
#region Draw Spectrum
DrawSpectrum();
#endregion
#region Timestamps
if (_useTimestamps && ++_scanlines >= TimestampInterval)
{
_scanlines = 0;
DrawTimestamp();
}
#endregion
#region Draw gradient
DrawGradient();
#endregion
#region Draw cursor
if (_mouseIn)
{
CopyMainBuffer();
DrawCursor();
}
#endregion
}
private unsafe void ShiftImage()
{
var bmpData = _buffer.LockBits(ClientRectangle, ImageLockMode.ReadWrite, _buffer.PixelFormat);
void* src;
void* dest;
if (bmpData.Stride > 0)
{
src = (void*) bmpData.Scan0;
dest = (void*) ((long) bmpData.Scan0 + bmpData.Stride);
}
else
{
dest = (void*) bmpData.Scan0;
src = (void*) ((long) bmpData.Scan0 - bmpData.Stride);
}
Utils.Memmove(dest, src, (bmpData.Height - 1) * Math.Abs(bmpData.Stride));
_buffer.UnlockBits(bmpData);
}
private unsafe void DrawSpectrum()
{
if (_powerSpectrum == null || _powerSpectrum.Length == 0)
{
return;
}
var bits = _buffer.LockBits(ClientRectangle, ImageLockMode.ReadWrite, _buffer.PixelFormat);
int* ptr;
if (bits.Stride > 0)
{
ptr = (int*) bits.Scan0 + AxisMargin;
}
else
{
ptr = (int*) ((long) bits.Scan0 - bits.Stride * (bits.Height - 1)) + AxisMargin;
}
for (var i = 0; i < _powerSpectrum.Length; i++)
{
var colorIndex = (int)((_powerSpectrum[i] + _contrast * 50.0 / 25.0) * _gradientPixels.Length / byte.MaxValue);
colorIndex = Math.Max(colorIndex, 0);
colorIndex = Math.Min(colorIndex, _gradientPixels.Length - 1);
*ptr++ = _gradientPixels[colorIndex];
}
_buffer.UnlockBits(bits);
}
private void DrawTimestamp()
{
using (var fontFamily = new FontFamily("Arial"))
using (var path = new GraphicsPath())
using (var outlinePen = new Pen(Color.Black))
{
var timestamp = DateTime.Now.ToString();
path.AddString(timestamp, fontFamily, (int) FontStyle.Regular, TimestampFontSize, new Point(AxisMargin, 0), StringFormat.GenericTypographic);
var smoothingMode = _graphics.SmoothingMode;
var interpolationMode = _graphics.InterpolationMode;
_graphics.SmoothingMode = SmoothingMode.AntiAlias;
_graphics.InterpolationMode = InterpolationMode.HighQualityBicubic;
outlinePen.Width = 2;
_graphics.DrawPath(outlinePen, path);
_graphics.FillPath(Brushes.White, path);
_graphics.SmoothingMode = smoothingMode;
_graphics.InterpolationMode = interpolationMode;
}
}
private void DrawCursor()
{
_lower = 0f;
float bandpassOffset;
var bandpassWidth = 0f;
var cursorWidth = Math.Max((_filterBandwidth + _filterOffset) * _xIncrement, 2);
var xCarrier = (float) ClientRectangle.Width / 2 + (_frequency - _displayCenterFrequency) * _xIncrement;
switch (_bandType)
{
case BandType.Upper:
bandpassOffset = _filterOffset * _xIncrement;
bandpassWidth = cursorWidth - bandpassOffset;
_lower = xCarrier + bandpassOffset;
break;
case BandType.Lower:
bandpassOffset = _filterOffset * _xIncrement;
bandpassWidth = cursorWidth - bandpassOffset;
_lower = xCarrier - bandpassOffset - bandpassWidth;
break;
case BandType.Center:
_lower = xCarrier - cursorWidth / 2;
bandpassWidth = cursorWidth;
break;
}
_upper = _lower + bandpassWidth;
using (var transparentBrush = new SolidBrush(Color.FromArgb(80, Color.DarkGray)))
using (var hotTrackPen = new Pen(Color.Red))
using (var carrierPen = new Pen(Color.Red))
using (var fontFamily = new FontFamily("Arial"))
using (var path = new GraphicsPath())
using (var outlinePen = new Pen(Color.Black))
{
carrierPen.Width = CarrierPenWidth;
if (cursorWidth < ClientRectangle.Width)
{
_graphics2.FillRectangle(transparentBrush, (int) _lower + 1, 0, (int) bandpassWidth, ClientRectangle.Height);
if (xCarrier >= AxisMargin && xCarrier <= ClientRectangle.Width - AxisMargin)
{
_graphics2.DrawLine(carrierPen, xCarrier, 0, xCarrier, ClientRectangle.Height);
}
}
if (_trackingX >= AxisMargin && _trackingX <= ClientRectangle.Width - AxisMargin)
{
if (!_changingFrequency && !_changingCenterFrequency && !_changingBandwidth)
{
_graphics2.DrawLine(hotTrackPen, _trackingX, 0, _trackingX, ClientRectangle.Height);
}
string fstring;
if (_changingFrequency)
{
fstring = "VFO = " + SpectrumAnalyzer.GetFrequencyDisplay(_frequency);
}
else if (_changingBandwidth)
{
fstring = "BW = " + SpectrumAnalyzer.GetFrequencyDisplay(_filterBandwidth);
}
else if (_changingCenterFrequency)
{
fstring = "Center Freq. = " + SpectrumAnalyzer.GetFrequencyDisplay(_centerFrequency);
}
else
{
fstring = SpectrumAnalyzer.GetFrequencyDisplay(_trackingFrequency);
}
path.AddString(fstring, fontFamily, (int) FontStyle.Regular, TrackingFontSize, Point.Empty, StringFormat.GenericTypographic);
var stringSize = path.GetBounds();
var currentCursor = Cursor.Current;
var xOffset = _trackingX + 15.0f;
var yOffset = _trackingY + (currentCursor == null ? SpectrumAnalyzer.DefaultCursorHeight : currentCursor.Size.Height) - 8.0f;
xOffset = Math.Min(xOffset, ClientRectangle.Width - stringSize.Width - 5);
yOffset = Math.Min(yOffset, ClientRectangle.Height - stringSize.Height - 5);
path.Reset();
path.AddString(fstring, fontFamily, (int) FontStyle.Regular, TrackingFontSize, new Point((int) xOffset, (int) yOffset), StringFormat.GenericTypographic);
var smoothingMode = _graphics2.SmoothingMode;
var interpolationMode = _graphics2.InterpolationMode;
_graphics2.SmoothingMode = SmoothingMode.AntiAlias;
_graphics2.InterpolationMode = InterpolationMode.HighQualityBicubic;
outlinePen.Width = 2;
_graphics2.DrawPath(outlinePen, path);
_graphics2.FillPath(Brushes.White, path);
_graphics2.SmoothingMode = smoothingMode;
_graphics2.InterpolationMode = interpolationMode;
}
}
}
private unsafe void CopyMainBuffer()
{
var rect = new Rectangle(0, 0, _buffer.Width, _buffer.Height);
var data1 = _buffer.LockBits(rect, ImageLockMode.ReadOnly, _buffer.PixelFormat);
var data2 = _buffer2.LockBits(rect, ImageLockMode.WriteOnly, _buffer2.PixelFormat);
Utils.Memcpy((void*) data2.Scan0, (void*) data1.Scan0, Math.Abs(data1.Stride) * data1.Height);
_buffer.UnlockBits(data1);
_buffer2.UnlockBits(data2);
}
protected override void OnPaint(PaintEventArgs e)
{
SpectrumAnalyzer.ConfigureGraphics(e.Graphics);
e.Graphics.DrawImageUnscaled(_mouseIn ? _buffer2 : _buffer, 0, 0);
}
protected override void OnResize(EventArgs e)
{
base.OnResize(e);
if (ClientRectangle.Width <= AxisMargin || ClientRectangle.Height <= AxisMargin)
{
return;
}
var temp = new byte[ClientRectangle.Width - 2 * AxisMargin];
Fourier.SmoothCopy(_powerSpectrum, temp, _powerSpectrum.Length, (_temp.Length + temp.Length) / (float)_temp.Length, 0);
_powerSpectrum = temp;
_temp = new byte[_powerSpectrum.Length];
var oldBuffer = _buffer;
_buffer = new Bitmap(ClientRectangle.Width, ClientRectangle.Height, PixelFormat.Format32bppPArgb);
var oldBuffer2 = _buffer2;
_buffer2 = new Bitmap(ClientRectangle.Width, ClientRectangle.Height, PixelFormat.Format32bppPArgb);
_graphics.Dispose();
_graphics = Graphics.FromImage(_buffer);
SpectrumAnalyzer.ConfigureGraphics(_graphics);
_graphics2.Dispose();
_graphics2 = Graphics.FromImage(_buffer2);
SpectrumAnalyzer.ConfigureGraphics(_graphics2);
_graphics.Clear(Color.Black);
var rect = new Rectangle(AxisMargin, 0, _buffer.Width - 2 * AxisMargin, _buffer.Height);
_graphics.DrawImage(oldBuffer, rect, AxisMargin, 0, oldBuffer.Width - 2 * AxisMargin, oldBuffer.Height, GraphicsUnit.Pixel);
oldBuffer.Dispose();
oldBuffer2.Dispose();
if (_spectrumWidth > 0)
{
_xIncrement = _scale * (ClientRectangle.Width - 2 * AxisMargin) / _spectrumWidth;
}
_gradientBrush.Dispose();
_gradientBrush = new LinearGradientBrush(new Rectangle(AxisMargin / 2, AxisMargin / 2, Width - AxisMargin / 2, ClientRectangle.Height - AxisMargin / 2), Color.White, Color.Black, LinearGradientMode.Vertical);
_gradientPixels = null;
_gradientBrush.InterpolationColors = _gradientColorBlend;
DrawGradient();
BuildGradientVector();
_performNeeded = true;
var oldMouseIn = _mouseIn;
_mouseIn = true;
Perform();
_mouseIn = oldMouseIn;
}
private void DrawGradient()
{
using (var pen = new Pen(_gradientBrush, 10))
{
_graphics.FillRectangle(Brushes.Black,
ClientRectangle.Width - AxisMargin,
0,
AxisMargin,
ClientRectangle.Height);
_graphics.DrawLine(pen,
ClientRectangle.Width - AxisMargin / 2,
ClientRectangle.Height - AxisMargin / 2,
ClientRectangle.Width - AxisMargin / 2,
AxisMargin / 2);
}
}
private void BuildGradientVector()
{
if (_gradientPixels == null || _gradientPixels.Length != ClientRectangle.Height - AxisMargin)
{
_gradientPixels = new int[ClientRectangle.Height - AxisMargin - 1];
}
for (var i = 0; i < _gradientPixels.Length; i++)
{
_gradientPixels[_gradientPixels.Length - i - 1] = _buffer.GetPixel(ClientRectangle.Width - AxisMargin / 2, i + AxisMargin / 2 + 1).ToArgb();
}
}
protected override void OnPaintBackground(PaintEventArgs e)
{
// Prevent default background painting
}
protected virtual void OnFrequencyChanged(FrequencyEventArgs e)
{
if (FrequencyChanged != null)
{
FrequencyChanged(this, e);
}
}
protected virtual void OnCenterFrequencyChanged(FrequencyEventArgs e)
{
if (CenterFrequencyChanged != null)
{
CenterFrequencyChanged(this, e);
}
}
protected virtual void OnBandwidthChanged(BandwidthEventArgs e)
{
if (BandwidthChanged != null)
{
BandwidthChanged(this, e);
}
}
private void UpdateFrequency(long f, FrequencyChangeSource source)
{
var min = (long)(_displayCenterFrequency - _spectrumWidth / _scale / 2);
if (f < min)
{
f = min;
}
var max = (long)(_displayCenterFrequency + _spectrumWidth / _scale / 2);
if (f > max)
{
f = max;
}
if (_useSnap)
{
f = (f + Math.Sign(f) * _stepSize / 2) / _stepSize * _stepSize;
}
if (f != _frequency)
{
var args = new FrequencyEventArgs(f, source);
OnFrequencyChanged(args);
if (!args.Cancel)
{
_frequency = args.Frequency;
_performNeeded = true;
}
}
}
private void UpdateCenterFrequency(long f)
{
if (f < 0)
{
f = 0;
}
if (_useSnap)
{
f = (f + Math.Sign(f) * _stepSize / 2) / _stepSize * _stepSize;
}
if (f != _centerFrequency)
{
var args = new FrequencyEventArgs(f, FrequencyChangeSource.Scroll);
OnCenterFrequencyChanged(args);
if (!args.Cancel)
{
var delta = args.Frequency - _centerFrequency;
_displayCenterFrequency += delta;
_centerFrequency = args.Frequency;
_performNeeded = true;
}
}
}
private void UpdateBandwidth(int bw)
{
bw = 10 * (bw / 10);
if (bw < 10)
{
bw = 10;
}
if (bw != _filterBandwidth)
{
var args = new BandwidthEventArgs(bw);
OnBandwidthChanged(args);
if (!args.Cancel)
{
_filterBandwidth = args.Bandwidth;
_performNeeded = true;
}
}
}
protected override void OnMouseDown(MouseEventArgs e)
{
base.OnMouseDown(e);
if (e.Button == MouseButtons.Left)
{
var cursorWidth = Math.Max(_filterBandwidth * _xIncrement, 2);
if (e.X > _lower && e.X < _upper && cursorWidth < ClientRectangle.Width)
{
_oldX = e.X;
_oldFrequency = _frequency;
_changingFrequency = true;
}
else if ((Math.Abs(e.X - _lower + CursorSnapDistance) <= CursorSnapDistance &&
(_bandType == BandType.Center || _bandType == BandType.Lower))
||
(Math.Abs(e.X - _upper - CursorSnapDistance) <= CursorSnapDistance &&
(_bandType == BandType.Center || _bandType == BandType.Upper)))
{
_oldX = e.X;
_oldFilterBandwidth = _filterBandwidth;
_changingBandwidth = true;
}
else
{
_oldX = e.X;
_oldCenterFrequency = _centerFrequency;
_changingCenterFrequency = true;
}
}
else if (e.Button == MouseButtons.Right)
{
UpdateFrequency(_frequency / RightClickSnapDistance * RightClickSnapDistance, FrequencyChangeSource.Click);
}
}
protected override void OnMouseUp(MouseEventArgs e)
{
base.OnMouseUp(e);
if (_changingCenterFrequency && e.X == _oldX)
{
var f = (long)((_oldX - ClientRectangle.Width / 2) * _spectrumWidth / _scale / (ClientRectangle.Width - 2 * AxisMargin) + _displayCenterFrequency);
UpdateFrequency(f, FrequencyChangeSource.Click);
}
_changingCenterFrequency = false;
_performNeeded = true;
_changingBandwidth = false;
_changingFrequency = false;
}
protected override void OnMouseMove(MouseEventArgs e)
{
base.OnMouseMove(e);
_trackingX = e.X;
_trackingY = e.Y;
_trackingFrequency = (long)((e.X - ClientRectangle.Width / 2) * _spectrumWidth / _scale / (ClientRectangle.Width - 2 * AxisMargin) + _displayCenterFrequency);
if (_useSnap)
{
_trackingFrequency = (_trackingFrequency + Math.Sign(_trackingFrequency) * _stepSize / 2) / _stepSize * _stepSize;
}
if (_changingFrequency)
{
var f = (long) ((e.X - _oldX) * _spectrumWidth / _scale / (ClientRectangle.Width - 2 * AxisMargin) + _oldFrequency);
UpdateFrequency(f, FrequencyChangeSource.Drag);
}
else if (_changingCenterFrequency)
{
var f = (long) ((_oldX - e.X) * _spectrumWidth / _scale / (ClientRectangle.Width - 2 * AxisMargin) + _oldCenterFrequency);
UpdateCenterFrequency(f);
}
else if (_changingBandwidth)
{
var bw = 0;
switch (_bandType)
{
case BandType.Upper:
bw = e.X - _oldX;
break;
case BandType.Lower:
bw = _oldX - e.X;
break;
case BandType.Center:
bw = (_oldX > (_lower + _upper) / 2 ? e.X - _oldX : _oldX - e.X) * 2;
break;
}
bw = (int) (bw * _spectrumWidth / _scale / (ClientRectangle.Width - 2 * AxisMargin) + _oldFilterBandwidth);
UpdateBandwidth(bw);
}
else if ((Math.Abs(e.X - _lower + CursorSnapDistance) <= CursorSnapDistance &&
(_bandType == BandType.Center || _bandType == BandType.Lower))
||
(Math.Abs(e.X - _upper - CursorSnapDistance) <= CursorSnapDistance &&
(_bandType == BandType.Center || _bandType == BandType.Upper)))
{
Cursor = Cursors.SizeWE;
}
else
{
Cursor = Cursors.Default;
}
_performNeeded = true;
}
protected override void OnMouseEnter(EventArgs e)
{
Focus();
base.OnMouseEnter(e);
_mouseIn = true;
_performNeeded = true;
CopyMainBuffer();
}
protected override void OnMouseLeave(EventArgs e)
{
base.OnMouseLeave(e);
_performNeeded = true;
Perform();
_mouseIn = false;
}
protected override void OnMouseWheel(MouseEventArgs e)
{
base.OnMouseWheel(e);
UpdateFrequency(_frequency + _stepSize * Math.Sign(e.Delta), FrequencyChangeSource.Scroll);
}
}
public enum FrequencyChangeSource
{
Scroll,
Drag,
Click
}
public class FrequencyEventArgs : EventArgs
{
public long Frequency { get; set; }
public FrequencyChangeSource Source { get; set; }
public bool Cancel { get; set; }
public FrequencyEventArgs(long frequency, FrequencyChangeSource source)
{
Frequency = frequency;
Source = source;
}
}
public class BandwidthEventArgs : EventArgs
{
public int Bandwidth { get; set; }
public bool Cancel { get; set; }
public BandwidthEventArgs(int bandwidth)
{
Bandwidth = bandwidth;
}
}
} |
Q:
Name of this month (Date.today.month as name)
I'm using Date.today.month to display the month number. Is there a command to get the month name, or do I need to make a case to get it?
A:
Date::MONTHNAMES[Date.today.month] would give you "January". (You may need to require 'date' first).
A:
You can also use I18n:
I18n.t("date.month_names") # [nil, "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December"]
I18n.t("date.abbr_month_names") # [nil, "Jan", "Feb", "Mar", "Apr", "May", "Jun", "Jul", "Aug", "Sep", "Oct", "Nov", "Dec"]
I18n.t("date.month_names")[Date.today.month] # "December"
I18n.t("date.abbr_month_names")[Date.today.month] # "Dec"
A:
You can use strftime:
Date.today.strftime("%B") # -> November
http://www.ruby-doc.org/stdlib-1.9.3/libdoc/date/rdoc/Date.html#strftime-method
|
This Is Us (season 3)
The third season of the American television series This Is Us continues to follow the lives and connections of the Pearson family across several time periods. The season is produced by Rhode Island Ave. Productions, Zaftig Films, and 20th Century Fox Television, with Dan Fogelman, Isaac Aptaker, and Elizabeth Berger serving as showrunners.
A third season was ordered, alongside a second season, in January 2017, with production for season three beginning in July 2018. The season stars an ensemble cast featuring Milo Ventimiglia, Mandy Moore, Sterling K. Brown, Chrissy Metz, Justin Hartley, Susan Kelechi Watson, Chris Sullivan, Jon Huertas, Melanie Liburd, Niles Fitch, Logan Shroyer, Hannah Zeile, Mackenzie Hancsicsak, Parker Bates, Eris Baker, Faithe Herman, Lonnie Chavis, and Lyric Ross.
The third season premiered on September 25, 2018 and concluded on April 2, 2019. The season consisted of 18 episodes.
Cast and characters
Main
Milo Ventimiglia as Jack Pearson
Mandy Moore as Rebecca Pearson
Sterling K. Brown as Randall Pearson
Niles Fitch as teenage Randall Pearson
Lonnie Chavis as young Randall Pearson
Chrissy Metz as Kate Pearson
Hannah Zeile as teenage Kate Pearson
Mackenzie Hancsicsak as young Kate Pearson
Justin Hartley as Kevin Pearson
Logan Shroyer as teenage Kevin Pearson
Parker Bates as young Kevin Pearson
Susan Kelechi Watson as Beth Pearson
Chris Sullivan as Toby Damon
Jon Huertas as Miguel Rivas
Melanie Liburd as Zoe Baker
Eris Baker as Tess Pearson
Faithe Herman as Annie Pearson
Lyric Ross as Deja
Recurring
Caitlin Thompson as Madison
Sumalee Montano as Dr. Gail Jasper
Rob Morgan as Solomon Brown
Michael Angarano as young adult Nicholas "Nick" Pearson
Porter Duong as Hien
Peter Onorati as Stanley Pearson
Guest
Ron Cephas Jones as William H. "Shakespeare" Hill
Jane Kaczmarek as Mrs. Philips
Charlie Robinson as present-day Donald Robinson
Wendie Malick as Mary Damon, Toby's mother.
Dan Lauria as Mr. Damon, Toby's father.
Tim Jo as Jae-Won Yoo
Joy Brunson as Shauna, Deja's mother.
Denis O'Hare as Jessie
Griffin Dunne as Nicholas "Nick" Pearson
Phylicia Rashad as Carol Clarke, Beth's mother.
Carl Lumbly as Abe Clarke, Beth's father.
Akira Akbar as young Beth Pearson
Rachel Hilson as teenage Beth Pearson
Dakota Baccelli as young Zoe Baker
Brianna Reed as teenage Zoe Baker
Goran Visnjic as Vincent Kelly, Beth's ballet teacher.
Alexandra Breckenridge as Sophie
Episodes
Production
Development
On January 18, 2017, NBC renewed the series for a second and third season of 18 episodes each, for a total of 36 additional episodes.
Casting
Main cast members Milo Ventimiglia, Mandy Moore, Sterling K. Brown, Chrissy Metz, Justin Hartley, Susan Kelechi Watson, Chris Sullivan, Jon Huertas and Ron Cephas Jones return from the second season as Jack Pearson, Rebecca Pearson, Randall Pearson, Kate Pearson, Kevin Pearson, Beth Pearson, Toby Damon, Miguel Rivas, and William H. Hill, respectively. Lyric Ross, who recurred as Deja throughout the second season, was subsequently promoted to the principal cast in the third season. In August 2018, Michael Angarano was cast to recur as Nick Pearson, Jack Pearson's brother; the character was first mentioned in the second season, and previously was depicted only briefly as a child. Melanie Liburd was promoted to series regular after guest starring in the second season as Zoe, Beth Pearson's cousin and Kevin Pearson's new love interest.
Filming
Production on the season officially began on July 10, 2018, in Los Angeles.
Reception
Ratings
References
General references
External links
Category:2018 American television seasons
Category:2019 American television seasons
Category:This Is Us |
require 'terraform_landscape/constants'
require 'terraform_landscape/version'
require 'terraform_landscape/output'
require 'terraform_landscape/errors'
require 'terraform_landscape/printer'
require 'terraform_landscape/terraform_plan'
require 'terraform_landscape/cli'
|
Q:
How can I import namespaces (e.g. using System.Linq) in Anltr4 / C#
I have created a simple .g4 (Antlr4) grammar & lexer file.
It generates my lexer/parser code fine.
But after adding some custom code that require Linq extensions I now need to get the custom statement "using System.Linq;" injected at the top of my generated lexer code file.
I am aware that there are some options for injecting code (from the .g4 file), e.g.
@lexer::members {
... {custom lexer code goes here}
Can someone please point me to the correct (.g4) syntax that will render the necessary "using" statements in the rendered lexer/parser.
UPDATE:
LexLi made a good point .. why do I need that? I'm supposed to write my code in visitor or listener. Answer to that: I am trying to implement INDENT and DEDENT tokens in C# (analogue to the the Java code posted here under "ANTLR4":
ANTLR What is simpliest way to realize python like indent-depending grammar?
Thanks!
A:
You can control what is written to your file in the classic way,
@parser::header
{
#pragma warning disable 3001, 3003, 3005, 3009, 1591
}
@lexer::header
{
#pragma warning disable 3001, 3003, 3005, 3009, 1591
}
@parser::namespace { Lextm.Namespace }
@lexer::namespace { Lextm.Namespace }
@parser::footer
{
#pragma warning restore 3001, 3003, 3005, 3009, 1591
}
@lexer::footer
{
#pragma warning restore 3001, 3003, 3005, 3009, 1591
}
So in your case, add the using statements to header.
|
New Final Fantasy XIII-2 Screenshots Including Throwing a Moogle [Trailer]
Square Enix has released some new screenshots for Final Fantasy XIII-2. These images include Serah Farron, Lightning’s younger sister and Snow’s fiancee, and shows off a new move called the Moogle Throw. Yeah, I don’t think the Moogles would be happy with this move, but hey, if you gain one of the Moogle character’s trust enough, you’ll be able to unlock it. Throwing a Moogle will help you in reaching hard to reach items, like chests. Remember to use it sparingly, as you might tick them off.
The move will allow players to aim the poor Moogle, as it’s trying to struggle, at a distant spot and toss them to retrieve power ups and special items. A display will show the trajectory of the Moogle Throw to help with aiming.
Final Fantasy XIII-2 will be available for PS3 and Xbox 360 in January 2012. |
Comments 1
Basically, everybody knew this was going to happen, and quite frankly, the federal government couldn’t be more happier. It opens the door to the “single payer” system which is why the chaos is happening. Obama and his ilk knew exactly what they were doing: there would be a full government take-over of the nations’ healthcare system with the purposes of redistribution of wealth, complete control of our lives including our individual medical histories, and taxes, more and more taxes; massive tax increases on everybody who pays taxes. It is his crowning glory if I may say, of him furthering his agenda to “fundamentally change America.” Voila!! Here it is! He knew the initial implemented system would not work for long because it wasn’t designed to work. What most of the nation feared the most has come upon us.
Will the people of this nation never learn? You truly get what you vote for and elections really do have consequences–dire consequences for years to come. May God have mercy on America. |
Gilles de Maistre
Gilles de Maistre (born 8 May 1960) is a French screenwriter, director, producer, journalist and actor who was nominated for a César Award.
Personal life
He is married and has six children.
Filmography
References
External links
Category:1960 births
Category:Living people
Category:French film directors
Category:French male screenwriters
Category:French screenwriters
Category:French producers
Category:French-language film directors
Category:People from Boulogne-Billancourt |
Current Record Visual Attribute problem
If you have a multi-record block, and you use the handy Current Record Visual Attribute (CRVA) to set, say, a different background colour on all the items in the currently selected record, you may have run into this problem.
If you want to conditionally switch the visual attribute for certain items, at the item instance (i.e. record) level, this causes the CRVA to be overwritten, and the current record won’t be consistently highlighted. To get around this problem, a bit more code is required.
For example, let’s say you have a multi-record block called EMP, and it has two items that are sometimes gray, sometimes white – SALARY and ROLE. You have defined the following visual attributes:
EDITABLE_ITEM – white background
READONLY_ITEM – gray background
CURRENT_RECORD – blue background |
############################
# GRAYLOG CONFIGURATION FILE
############################
#
# This is the Graylog configuration file. The file has to use ISO 8859-1/Latin-1 character encoding.
# Characters that cannot be directly represented in this encoding can be written using Unicode escapes
# as defined in https://docs.oracle.com/javase/specs/jls/se8/html/jls-3.html#jls-3.3, using the \u prefix.
# For example, \u002c.
#
# * Entries are generally expected to be a single line of the form, one of the following:
#
# propertyName=propertyValue
# propertyName:propertyValue
#
# * White space that appears between the property name and property value is ignored,
# so the following are equivalent:
#
# name=Stephen
# name = Stephen
#
# * White space at the beginning of the line is also ignored.
#
# * Lines that start with the comment characters ! or # are ignored. Blank lines are also ignored.
#
# * The property value is generally terminated by the end of the line. White space following the
# property value is not ignored, and is treated as part of the property value.
#
# * A property value can span several lines if each line is terminated by a backslash (‘\’) character.
# For example:
#
# targetCities=\
# Detroit,\
# Chicago,\
# Los Angeles
#
# This is equivalent to targetCities=Detroit,Chicago,Los Angeles (white space at the beginning of lines is ignored).
#
# * The characters newline, carriage return, and tab can be inserted with characters \n, \r, and \t, respectively.
#
# * The backslash character must be escaped as a double backslash. For example:
#
# path=c:\\docs\\doc1
#
# If you are running more than one instances of Graylog server you have to select one of these
# instances as master. The master will perform some periodical tasks that non-masters won't perform.
is_master = true
# The auto-generated node ID will be stored in this file and read after restarts. It is a good idea
# to use an absolute file path here if you are starting Graylog server from init scripts or similar.
node_id_file = /etc/graylog/server/node-id
# You MUST set a secret to secure/pepper the stored user passwords here. Use at least 64 characters.
# Generate one by using for example: pwgen -N 1 -s 96
password_secret =
# The default root user is named 'admin'
#root_username = admin
# You MUST specify a hash password for the root user (which you only need to initially set up the
# system and in case you lose connectivity to your authentication backend)
# This password cannot be changed using the API or via the web interface. If you need to change it,
# modify it in this file.
# Create one by using for example: echo -n yourpassword | shasum -a 256
# and put the resulting hash value into the following line
root_password_sha2 =
# The email address of the root user.
# Default is empty
#root_email = ""
# The time zone setting of the root user. See http://www.joda.org/joda-time/timezones.html for a list of valid time zones.
# Default is UTC
#root_timezone = UTC
# Set the bin directory here (relative or absolute)
# This directory contains binaries that are used by the Graylog server.
# Default: bin
bin_dir = bin
# Set the data directory here (relative or absolute)
# This directory is used to store Graylog server state.
# Default: data
data_dir = data
# Set plugin directory here (relative or absolute)
plugin_dir = plugin
###############
# HTTP settings
###############
#### HTTP bind address
#
# The network interface used by the Graylog HTTP interface.
#
# This network interface must be accessible by all Graylog nodes in the cluster and by all clients
# using the Graylog web interface.
#
# If the port is omitted, Graylog will use port 9000 by default.
#
# Default: 127.0.0.1:9000
#http_bind_address = 127.0.0.1:9000
#http_bind_address = [2001:db8::1]:9000
#### HTTP publish URI
#
# The HTTP URI of this Graylog node which is used to communicate with the other Graylog nodes in the cluster and by all
# clients using the Graylog web interface.
#
# The URI will be published in the cluster discovery APIs, so that other Graylog nodes will be able to find and connect to this Graylog node.
#
# This configuration setting has to be used if this Graylog node is available on another network interface than $http_bind_address,
# for example if the machine has multiple network interfaces or is behind a NAT gateway.
#
# If $http_bind_address contains a wildcard IPv4 address (0.0.0.0), the first non-loopback IPv4 address of this machine will be used.
# This configuration setting *must not* contain a wildcard address!
#
# Default: http://$http_bind_address/
#http_publish_uri = http://192.168.1.1:9000/
#### External Graylog URI
#
# The public URI of Graylog which will be used by the Graylog web interface to communicate with the Graylog REST API.
#
# The external Graylog URI usually has to be specified, if Graylog is running behind a reverse proxy or load-balancer
# and it will be used to generate URLs addressing entities in the Graylog REST API (see $http_bind_address).
#
# When using Graylog Collector, this URI will be used to receive heartbeat messages and must be accessible for all collectors.
#
# This setting can be overriden on a per-request basis with the "X-Graylog-Server-URL" HTTP request header.
#
# Default: $http_publish_uri
#http_external_uri =
#### Enable CORS headers for HTTP interface
#
# This is necessary for JS-clients accessing the server directly.
# If these are disabled, modern browsers will not be able to retrieve resources from the server.
# This is enabled by default. Uncomment the next line to disable it.
#http_enable_cors = false
#### Enable GZIP support for HTTP interface
#
# This compresses API responses and therefore helps to reduce
# overall round trip times. This is enabled by default. Uncomment the next line to disable it.
#http_enable_gzip = false
# The maximum size of the HTTP request headers in bytes.
#http_max_header_size = 8192
# The size of the thread pool used exclusively for serving the HTTP interface.
#http_thread_pool_size = 16
################
# HTTPS settings
################
#### Enable HTTPS support for the HTTP interface
#
# This secures the communication with the HTTP interface with TLS to prevent request forgery and eavesdropping.
#
# Default: false
#http_enable_tls = true
# The X.509 certificate chain file in PEM format to use for securing the HTTP interface.
#http_tls_cert_file = /path/to/graylog.crt
# The PKCS#8 private key file in PEM format to use for securing the HTTP interface.
#http_tls_key_file = /path/to/graylog.key
# The password to unlock the private key used for securing the HTTP interface.
#http_tls_key_password = secret
# Comma separated list of trusted proxies that are allowed to set the client address with X-Forwarded-For
# header. May be subnets, or hosts.
#trusted_proxies = 127.0.0.1/32, 0:0:0:0:0:0:0:1/128
# List of Elasticsearch hosts Graylog should connect to.
# Need to be specified as a comma-separated list of valid URIs for the http ports of your elasticsearch nodes.
# If one or more of your elasticsearch hosts require authentication, include the credentials in each node URI that
# requires authentication.
#
# Default: http://127.0.0.1:9200
#elasticsearch_hosts = http://node1:9200,http://user:password@node2:19200
# Maximum amount of time to wait for successfull connection to Elasticsearch HTTP port.
#
# Default: 10 Seconds
#elasticsearch_connect_timeout = 10s
# Maximum amount of time to wait for reading back a response from an Elasticsearch server.
#
# Default: 60 seconds
#elasticsearch_socket_timeout = 60s
# Maximum idle time for an Elasticsearch connection. If this is exceeded, this connection will
# be tore down.
#
# Default: inf
#elasticsearch_idle_timeout = -1s
# Maximum number of total connections to Elasticsearch.
#
# Default: 20
#elasticsearch_max_total_connections = 20
# Maximum number of total connections per Elasticsearch route (normally this means per
# elasticsearch server).
#
# Default: 2
#elasticsearch_max_total_connections_per_route = 2
# Maximum number of times Graylog will retry failed requests to Elasticsearch.
#
# Default: 2
#elasticsearch_max_retries = 2
# Enable automatic Elasticsearch node discovery through Nodes Info,
# see https://www.elastic.co/guide/en/elasticsearch/reference/5.4/cluster-nodes-info.html
#
# WARNING: Automatic node discovery does not work if Elasticsearch requires authentication, e. g. with Shield.
#
# Default: false
#elasticsearch_discovery_enabled = true
# Filter for including/excluding Elasticsearch nodes in discovery according to their custom attributes,
# see https://www.elastic.co/guide/en/elasticsearch/reference/5.4/cluster.html#cluster-nodes
#
# Default: empty
#elasticsearch_discovery_filter = rack:42
# Frequency of the Elasticsearch node discovery.
#
# Default: 30s
# elasticsearch_discovery_frequency = 30s
# Enable payload compression for Elasticsearch requests.
#
# Default: false
#elasticsearch_compression_enabled = true
# Graylog will use multiple indices to store documents in. You can configured the strategy it uses to determine
# when to rotate the currently active write index.
# It supports multiple rotation strategies:
# - "count" of messages per index, use elasticsearch_max_docs_per_index below to configure
# - "size" per index, use elasticsearch_max_size_per_index below to configure
# valid values are "count", "size" and "time", default is "count"
#
# ATTENTION: These settings have been moved to the database in 2.0. When you upgrade, make sure to set these
# to your previous 1.x settings so they will be migrated to the database!
# This configuration setting is only used on the first start of Graylog. After that,
# index related settings can be changed in the Graylog web interface on the 'System / Indices' page.
# Also see http://docs.graylog.org/en/2.3/pages/configuration/index_model.html#index-set-configuration.
rotation_strategy = count
# (Approximate) maximum number of documents in an Elasticsearch index before a new index
# is being created, also see no_retention and elasticsearch_max_number_of_indices.
# Configure this if you used 'rotation_strategy = count' above.
#
# ATTENTION: These settings have been moved to the database in 2.0. When you upgrade, make sure to set these
# to your previous 1.x settings so they will be migrated to the database!
# This configuration setting is only used on the first start of Graylog. After that,
# index related settings can be changed in the Graylog web interface on the 'System / Indices' page.
# Also see http://docs.graylog.org/en/2.3/pages/configuration/index_model.html#index-set-configuration.
elasticsearch_max_docs_per_index = 20000000
# (Approximate) maximum size in bytes per Elasticsearch index on disk before a new index is being created, also see
# no_retention and elasticsearch_max_number_of_indices. Default is 1GB.
# Configure this if you used 'rotation_strategy = size' above.
#
# ATTENTION: These settings have been moved to the database in 2.0. When you upgrade, make sure to set these
# to your previous 1.x settings so they will be migrated to the database!
# This configuration setting is only used on the first start of Graylog. After that,
# index related settings can be changed in the Graylog web interface on the 'System / Indices' page.
# Also see http://docs.graylog.org/en/2.3/pages/configuration/index_model.html#index-set-configuration.
#elasticsearch_max_size_per_index = 1073741824
# (Approximate) maximum time before a new Elasticsearch index is being created, also see
# no_retention and elasticsearch_max_number_of_indices. Default is 1 day.
# Configure this if you used 'rotation_strategy = time' above.
# Please note that this rotation period does not look at the time specified in the received messages, but is
# using the real clock value to decide when to rotate the index!
# Specify the time using a duration and a suffix indicating which unit you want:
# 1w = 1 week
# 1d = 1 day
# 12h = 12 hours
# Permitted suffixes are: d for day, h for hour, m for minute, s for second.
#
# ATTENTION: These settings have been moved to the database in 2.0. When you upgrade, make sure to set these
# to your previous 1.x settings so they will be migrated to the database!
# This configuration setting is only used on the first start of Graylog. After that,
# index related settings can be changed in the Graylog web interface on the 'System / Indices' page.
# Also see http://docs.graylog.org/en/2.3/pages/configuration/index_model.html#index-set-configuration.
#elasticsearch_max_time_per_index = 1d
# Disable checking the version of Elasticsearch for being compatible with this Graylog release.
# WARNING: Using Graylog with unsupported and untested versions of Elasticsearch may lead to data loss!
#elasticsearch_disable_version_check = true
# Disable message retention on this node, i. e. disable Elasticsearch index rotation.
#no_retention = false
# How many indices do you want to keep?
#
# ATTENTION: These settings have been moved to the database in 2.0. When you upgrade, make sure to set these
# to your previous 1.x settings so they will be migrated to the database!
# This configuration setting is only used on the first start of Graylog. After that,
# index related settings can be changed in the Graylog web interface on the 'System / Indices' page.
# Also see http://docs.graylog.org/en/2.3/pages/configuration/index_model.html#index-set-configuration.
elasticsearch_max_number_of_indices = 20
# Decide what happens with the oldest indices when the maximum number of indices is reached.
# The following strategies are availble:
# - delete # Deletes the index completely (Default)
# - close # Closes the index and hides it from the system. Can be re-opened later.
#
# ATTENTION: These settings have been moved to the database in 2.0. When you upgrade, make sure to set these
# to your previous 1.x settings so they will be migrated to the database!
# This configuration setting is only used on the first start of Graylog. After that,
# index related settings can be changed in the Graylog web interface on the 'System / Indices' page.
# Also see http://docs.graylog.org/en/2.3/pages/configuration/index_model.html#index-set-configuration.
retention_strategy = delete
# How many Elasticsearch shards and replicas should be used per index? Note that this only applies to newly created indices.
# ATTENTION: These settings have been moved to the database in Graylog 2.2.0. When you upgrade, make sure to set these
# to your previous settings so they will be migrated to the database!
# This configuration setting is only used on the first start of Graylog. After that,
# index related settings can be changed in the Graylog web interface on the 'System / Indices' page.
# Also see http://docs.graylog.org/en/2.3/pages/configuration/index_model.html#index-set-configuration.
elasticsearch_shards = 4
elasticsearch_replicas = 0
# Prefix for all Elasticsearch indices and index aliases managed by Graylog.
#
# ATTENTION: These settings have been moved to the database in Graylog 2.2.0. When you upgrade, make sure to set these
# to your previous settings so they will be migrated to the database!
# This configuration setting is only used on the first start of Graylog. After that,
# index related settings can be changed in the Graylog web interface on the 'System / Indices' page.
# Also see http://docs.graylog.org/en/2.3/pages/configuration/index_model.html#index-set-configuration.
elasticsearch_index_prefix = graylog
# Name of the Elasticsearch index template used by Graylog to apply the mandatory index mapping.
# Default: graylog-internal
#
# ATTENTION: These settings have been moved to the database in Graylog 2.2.0. When you upgrade, make sure to set these
# to your previous settings so they will be migrated to the database!
# This configuration setting is only used on the first start of Graylog. After that,
# index related settings can be changed in the Graylog web interface on the 'System / Indices' page.
# Also see http://docs.graylog.org/en/2.3/pages/configuration/index_model.html#index-set-configuration.
#elasticsearch_template_name = graylog-internal
# Do you want to allow searches with leading wildcards? This can be extremely resource hungry and should only
# be enabled with care. See also: http://docs.graylog.org/en/2.1/pages/queries.html
allow_leading_wildcard_searches = false
# Do you want to allow searches to be highlighted? Depending on the size of your messages this can be memory hungry and
# should only be enabled after making sure your Elasticsearch cluster has enough memory.
allow_highlighting = false
# Analyzer (tokenizer) to use for message and full_message field. The "standard" filter usually is a good idea.
# All supported analyzers are: standard, simple, whitespace, stop, keyword, pattern, language, snowball, custom
# Elasticsearch documentation: https://www.elastic.co/guide/en/elasticsearch/reference/2.3/analysis.html
# Note that this setting only takes effect on newly created indices.
#
# ATTENTION: These settings have been moved to the database in Graylog 2.2.0. When you upgrade, make sure to set these
# to your previous settings so they will be migrated to the database!
# This configuration setting is only used on the first start of Graylog. After that,
# index related settings can be changed in the Graylog web interface on the 'System / Indices' page.
# Also see http://docs.graylog.org/en/2.3/pages/configuration/index_model.html#index-set-configuration.
elasticsearch_analyzer = standard
# Global request timeout for Elasticsearch requests (e. g. during search, index creation, or index time-range
# calculations) based on a best-effort to restrict the runtime of Elasticsearch operations.
# Default: 1m
#elasticsearch_request_timeout = 1m
# Global timeout for index optimization (force merge) requests.
# Default: 1h
#elasticsearch_index_optimization_timeout = 1h
# Maximum number of concurrently running index optimization (force merge) jobs.
# If you are using lots of different index sets, you might want to increase that number.
# Default: 20
#elasticsearch_index_optimization_jobs = 20
# Time interval for index range information cleanups. This setting defines how often stale index range information
# is being purged from the database.
# Default: 1h
#index_ranges_cleanup_interval = 1h
# Time interval for the job that runs index field type maintenance tasks like cleaning up stale entries. This doesn't
# need to run very often.
# Default: 1h
#index_field_type_periodical_interval = 1h
# Batch size for the Elasticsearch output. This is the maximum (!) number of messages the Elasticsearch output
# module will get at once and write to Elasticsearch in a batch call. If the configured batch size has not been
# reached within output_flush_interval seconds, everything that is available will be flushed at once. Remember
# that every outputbuffer processor manages its own batch and performs its own batch write calls.
# ("outputbuffer_processors" variable)
output_batch_size = 500
# Flush interval (in seconds) for the Elasticsearch output. This is the maximum amount of time between two
# batches of messages written to Elasticsearch. It is only effective at all if your minimum number of messages
# for this time period is less than output_batch_size * outputbuffer_processors.
output_flush_interval = 1
# As stream outputs are loaded only on demand, an output which is failing to initialize will be tried over and
# over again. To prevent this, the following configuration options define after how many faults an output will
# not be tried again for an also configurable amount of seconds.
output_fault_count_threshold = 5
output_fault_penalty_seconds = 30
# The number of parallel running processors.
# Raise this number if your buffers are filling up.
processbuffer_processors = 5
outputbuffer_processors = 3
# The following settings (outputbuffer_processor_*) configure the thread pools backing each output buffer processor.
# See https://docs.oracle.com/javase/8/docs/api/java/util/concurrent/ThreadPoolExecutor.html for technical details
# When the number of threads is greater than the core (see outputbuffer_processor_threads_core_pool_size),
# this is the maximum time in milliseconds that excess idle threads will wait for new tasks before terminating.
# Default: 5000
#outputbuffer_processor_keep_alive_time = 5000
# The number of threads to keep in the pool, even if they are idle, unless allowCoreThreadTimeOut is set
# Default: 3
#outputbuffer_processor_threads_core_pool_size = 3
# The maximum number of threads to allow in the pool
# Default: 30
#outputbuffer_processor_threads_max_pool_size = 30
# UDP receive buffer size for all message inputs (e. g. SyslogUDPInput).
#udp_recvbuffer_sizes = 1048576
# Wait strategy describing how buffer processors wait on a cursor sequence. (default: sleeping)
# Possible types:
# - yielding
# Compromise between performance and CPU usage.
# - sleeping
# Compromise between performance and CPU usage. Latency spikes can occur after quiet periods.
# - blocking
# High throughput, low latency, higher CPU usage.
# - busy_spinning
# Avoids syscalls which could introduce latency jitter. Best when threads can be bound to specific CPU cores.
processor_wait_strategy = blocking
# Size of internal ring buffers. Raise this if raising outputbuffer_processors does not help anymore.
# For optimum performance your LogMessage objects in the ring buffer should fit in your CPU L3 cache.
# Must be a power of 2. (512, 1024, 2048, ...)
ring_size = 65536
inputbuffer_ring_size = 65536
inputbuffer_processors = 2
inputbuffer_wait_strategy = blocking
# Enable the disk based message journal.
message_journal_enabled = true
# The directory which will be used to store the message journal. The directory must be exclusively used by Graylog and
# must not contain any other files than the ones created by Graylog itself.
#
# ATTENTION:
# If you create a seperate partition for the journal files and use a file system creating directories like 'lost+found'
# in the root directory, you need to create a sub directory for your journal.
# Otherwise Graylog will log an error message that the journal is corrupt and Graylog will not start.
message_journal_dir = data/journal
# Journal hold messages before they could be written to Elasticsearch.
# For a maximum of 12 hours or 5 GB whichever happens first.
# During normal operation the journal will be smaller.
#message_journal_max_age = 12h
#message_journal_max_size = 5gb
#message_journal_flush_age = 1m
#message_journal_flush_interval = 1000000
#message_journal_segment_age = 1h
#message_journal_segment_size = 100mb
# Number of threads used exclusively for dispatching internal events. Default is 2.
#async_eventbus_processors = 2
# How many seconds to wait between marking node as DEAD for possible load balancers and starting the actual
# shutdown process. Set to 0 if you have no status checking load balancers in front.
lb_recognition_period_seconds = 3
# Journal usage percentage that triggers requesting throttling for this server node from load balancers. The feature is
# disabled if not set.
#lb_throttle_threshold_percentage = 95
# Every message is matched against the configured streams and it can happen that a stream contains rules which
# take an unusual amount of time to run, for example if its using regular expressions that perform excessive backtracking.
# This will impact the processing of the entire server. To keep such misbehaving stream rules from impacting other
# streams, Graylog limits the execution time for each stream.
# The default values are noted below, the timeout is in milliseconds.
# If the stream matching for one stream took longer than the timeout value, and this happened more than "max_faults" times
# that stream is disabled and a notification is shown in the web interface.
#stream_processing_timeout = 2000
#stream_processing_max_faults = 3
# Length of the interval in seconds in which the alert conditions for all streams should be checked
# and alarms are being sent.
#alert_check_interval = 60
# Since 0.21 the Graylog server supports pluggable output modules. This means a single message can be written to multiple
# outputs. The next setting defines the timeout for a single output module, including the default output module where all
# messages end up.
#
# Time in milliseconds to wait for all message outputs to finish writing a single message.
#output_module_timeout = 10000
# Time in milliseconds after which a detected stale master node is being rechecked on startup.
#stale_master_timeout = 2000
# Time in milliseconds which Graylog is waiting for all threads to stop on shutdown.
#shutdown_timeout = 30000
# MongoDB connection string
# See https://docs.mongodb.com/manual/reference/connection-string/ for details
mongodb_uri = mongodb://localhost/graylog
# Authenticate against the MongoDB server
#mongodb_uri = mongodb://grayloguser:secret@localhost:27017/graylog
# Use a replica set instead of a single host
#mongodb_uri = mongodb://grayloguser:secret@localhost:27017,localhost:27018,localhost:27019/graylog
# Increase this value according to the maximum connections your MongoDB server can handle from a single client
# if you encounter MongoDB connection problems.
mongodb_max_connections = 1000
# Number of threads allowed to be blocked by MongoDB connections multiplier. Default: 5
# If mongodb_max_connections is 100, and mongodb_threads_allowed_to_block_multiplier is 5,
# then 500 threads can block. More than that and an exception will be thrown.
# http://api.mongodb.com/java/current/com/mongodb/MongoOptions.html#threadsAllowedToBlockForConnectionMultiplier
mongodb_threads_allowed_to_block_multiplier = 5
# Email transport
#transport_email_enabled = false
#transport_email_hostname = mail.example.com
#transport_email_port = 587
#transport_email_use_auth = true
#transport_email_auth_username = you@example.com
#transport_email_auth_password = secret
#transport_email_subject_prefix = [graylog]
#transport_email_from_email = graylog@example.com
# Encryption settings
#
# ATTENTION:
# Using SMTP with STARTTLS *and* SMTPS at the same time is *not* possible.
# Use SMTP with STARTTLS, see https://en.wikipedia.org/wiki/Opportunistic_TLS
#transport_email_use_tls = true
# Use SMTP over SSL (SMTPS), see https://en.wikipedia.org/wiki/SMTPS
# This is deprecated on most SMTP services!
#transport_email_use_ssl = true
# Specify and uncomment this if you want to include links to the stream in your stream alert mails.
# This should define the fully qualified base url to your web interface exactly the same way as it is accessed by your users.
#transport_email_web_interface_url = https://graylog.example.com
# The default connect timeout for outgoing HTTP connections.
# Values must be a positive duration (and between 1 and 2147483647 when converted to milliseconds).
# Default: 5s
#http_connect_timeout = 5s
# The default read timeout for outgoing HTTP connections.
# Values must be a positive duration (and between 1 and 2147483647 when converted to milliseconds).
# Default: 10s
#http_read_timeout = 10s
# The default write timeout for outgoing HTTP connections.
# Values must be a positive duration (and between 1 and 2147483647 when converted to milliseconds).
# Default: 10s
#http_write_timeout = 10s
# HTTP proxy for outgoing HTTP connections
# ATTENTION: If you configure a proxy, make sure to also configure the "http_non_proxy_hosts" option so internal
# HTTP connections with other nodes does not go through the proxy.
# Examples:
# - http://proxy.example.com:8123
# - http://username:password@proxy.example.com:8123
#http_proxy_uri =
# A list of hosts that should be reached directly, bypassing the configured proxy server.
# This is a list of patterns separated by ",". The patterns may start or end with a "*" for wildcards.
# Any host matching one of these patterns will be reached through a direct connection instead of through a proxy.
# Examples:
# - localhost,127.0.0.1
# - 10.0.*,*.example.com
#http_non_proxy_hosts =
# Disable the optimization of Elasticsearch indices after index cycling. This may take some load from Elasticsearch
# on heavily used systems with large indices, but it will decrease search performance. The default is to optimize
# cycled indices.
#
# ATTENTION: These settings have been moved to the database in Graylog 2.2.0. When you upgrade, make sure to set these
# to your previous settings so they will be migrated to the database!
# This configuration setting is only used on the first start of Graylog. After that,
# index related settings can be changed in the Graylog web interface on the 'System / Indices' page.
# Also see http://docs.graylog.org/en/2.3/pages/configuration/index_model.html#index-set-configuration.
#disable_index_optimization = true
# Optimize the index down to <= index_optimization_max_num_segments. A higher number may take some load from Elasticsearch
# on heavily used systems with large indices, but it will decrease search performance. The default is 1.
#
# ATTENTION: These settings have been moved to the database in Graylog 2.2.0. When you upgrade, make sure to set these
# to your previous settings so they will be migrated to the database!
# This configuration setting is only used on the first start of Graylog. After that,
# index related settings can be changed in the Graylog web interface on the 'System / Indices' page.
# Also see http://docs.graylog.org/en/2.3/pages/configuration/index_model.html#index-set-configuration.
#index_optimization_max_num_segments = 1
# The threshold of the garbage collection runs. If GC runs take longer than this threshold, a system notification
# will be generated to warn the administrator about possible problems with the system. Default is 1 second.
#gc_warning_threshold = 1s
# Connection timeout for a configured LDAP server (e. g. ActiveDirectory) in milliseconds.
#ldap_connection_timeout = 2000
# Disable the use of SIGAR for collecting system stats
#disable_sigar = false
# The default cache time for dashboard widgets. (Default: 10 seconds, minimum: 1 second)
#dashboard_widget_default_cache_time = 10s
# For some cluster-related REST requests, the node must query all other nodes in the cluster. This is the maximum number
# of threads available for this. Increase it, if '/cluster/*' requests take long to complete.
# Should be http_thread_pool_size * average_cluster_size if you have a high number of concurrent users.
proxied_requests_thread_pool_size = 32 |
Uncoupling protein-1 is not leaky.
The activity of uncoupling protein-1 (UCP1) is rate-limiting for nonshivering thermogenesis and diet-induced thermogenesis. Characteristically, this activity is inhibited by GDP experimentally and presumably mainly by cytosolic ATP within brown-fat cells. The issue as to whether UCP1 has a residual proton conductance even when fully saturated with GDP/ATP (as has recently been suggested) has not only scientific but also applied interest, since a residual proton conductance would make overexpressed UCP1 weight-reducing even without physiological/pharmacological activation. To examine this question, we have here established optimal conditions for studying the bioenergetics of wild-type and UCP1-/- brown-fat mitochondria, analysing UCP1-mediated differences in parallel preparations of brown-fat mitochondria from both genotypes. Comparing different substrates, we find that pyruvate (or palmitoyl-L-carnitine) shows the largest relative coupling by GDP. Comparing albumin concentrations, we find the range 0.1-0.6% optimal; higher concentrations are inhibitory. Comparing basic medium composition, we find 125 mM sucrose optimal; an ionic medium (50-100 mM KCl) functions for wild-type but is detrimental for UCP1-/- mitochondria. Using optimal conditions, we find no evidence for a residual proton conductance (not a higher post-GDP respiration, a lower membrane potential or an altered proton leak at highest common potential) with either pyruvate or glycerol-3-phosphate as substrates, nor by a 3-4-fold alteration of the amount of UCP1. We could demonstrate that certain experimental conditions, due to respiratoty inhibition, could lead to the suggestion that UCP1 possesses a residual proton conductance but find that under optimal conditions our experiments concur with implications from physiological observations that in the presence of inhibitory nucleotides, UCP1 is not leaky. |
Section: European Voice (EU)
Donald Trump, whose “American First†instincts and Euroskeptic campaign rhetoric rattled his European allies, made his first official visit to Brussels Thursday to meet top EU officials ahead of a summit at NATO — an alliance he once described as “obsolete.” While EU leaders are pleased he decided to visit them...
When German Chancellor Angela Merkel visited President Donald Trump at the White House in March, she brought a visual aid to help Trump understand the menace posed by his would-be friend, Russian President Vladimir Putin. Merkel brought out a 1980s map of the former Soviet Union and noted the way its borders stretched for hundreds of miles to the...
Analysts of U.S. President Donald Trump’s initial budget plan are slamming it as built on fuzzy math. But if Trump’s numbers are fuzzy, his proposal on military spending has NATO Secretary-General Jens Stoltenberg feeling all warm and cuddly toward the White House. Trump’s fiscal blueprint, released in Washington just as...
GENEVA — Tedros Adhanom Ghebreyesus overcame late attacks on his record in Ethiopia to become Africa’s first director general of the World Health Organization. A charismatic former health minister and diplomat, Tedros, 52, pointed to his track record of developing a vast network of health centers in his country and...
The Ukrainian parliament on Tuesday backed a law that requires major TV channels to broadcast three-quarters of their programs in Ukrainian, AFP reported. “Once again, the Verkhovna Rada [parliament] has demonstrated that it is a Ukrainian Verkhovna Rada, one eliminating the remnants of the Soviet imperialist past,” Andriy Parubiy, the speaker of...
PODGORICA, Montenegro — It has the plot of a thriller, even if it doesn’t read like one. In long, tangled sentences, an indictment filed by the chief prosecutor in Montenegro lays out a story of Russian agents recruiting mercenaries to storm parliament on election day and stop the small Balkan state from joining NATO....
WARSAW â The right-wing Polish government is under fierce pressure from the EU to finally begin accepting asylum seekers. But itâs the countryâs leading opposition party thatâs paying the political price. Poland, along with Hungary, has flatly refused to take in any refugees under a 2015 deal that...
The new special counsel investigation into possible collusion between associates of President Donald Trump and Russia is just getting started â and it could take years to resolve. But Trumpâs Oval Office boast to Russian officials May 10 about why he fired FBI Director James Comey will almost certainly trigger a more...
President Donald Trump is facing new pressure over his decision to abruptly fire FBI Director James Comey after the New York Times revealed on Friday that the president told Russian officials in the Oval Office last week that Comeyâs ouster takes âgreat pressureâ off him. Meanwhile, the federal investigation...
Working in President Donald Trumpâs White House is about to get a whole lot harder. Robert Mueller, the former FBI director named Wednesday as the special counsel for investigations into Russian interference in the 2016 election, starts his job with an unlimited time and budget to pursue leads wherever they go. Veterans of previous... |
Miller Homes - Eaton Meadow,
CW12
Development info
Congleton Park, with its play area and gardens, and the adjacent Town Wood, an important conservation site for wild plants, are just half a mile from Eaton Meadow, and the town's outdoor paddling pool opens during the summer months. On the southern edge of the town, Astbury Mere Country Park features a large lake used for sailing and fishing. Westlow Mere, to the west of Eaton Meadow, is also used by anglers, and there are two golf clubs nearby, the picturesque nine-hole Congleton Golf Club and an 18-hole parkland course at Astbury, both within around two miles of the development.
Indoor amenities include Congleton Leisure Centre, with its 25m swimming pool, teaching pool, sports hall, fitness suite and sauna. There is a good selection of historic inns, restaurants, cafes and pubs in and around the town, and the local Daneside Theatre is used by several local groups to present entertainments ranging from amateur drama and concert performances to film screenings. The area's more unexpected attractions include Clonter Opera Theatre, a few miles north of Congleton, which supplements operatic performances with other live entertainments.
Directions
From Manchester and the North
Approaching Congleton by the A34 Congleton Road, after turning left to enter the one-way system, at the next junction turn left following signs for Macclesfield then immediately turn right into Jackson Road, signposted for Eaton Bank. Carry straight on at the crossroads then, after around 300 yards, the entrance to Eaton Meadow is on the left.
From the M6 and South
Entering Congleton, follow signs for the Town Centre through a series of roundabouts. After passing a Tesco supermarket on the left, at the next junction carry straight on following signs for Manchester. Half a mile on, enter the one-way system and follow signs for Macclesfield through two junctions then, immediately after the second, turn right into Jackson Road, signposted for Eaton Bank. Carry straight on at the crossroads then, after around 300 yards, the entrance to Eaton Meadow is on the left.
Sat Nav: CW12 1PH
Disclaimers
The house plans shown above, including the room specifications, may vary from development to development and are provided for general guidance only. For more accurate and detailed plans for a specific plot, please check with your local Miller Homes sales adviser. Carpets and floor coverings are not included in our homes as standard. |
Phillips: Dez Bryant among most talented I've ever seen
So I’m currently flying somewhere over Utah, on my way back home from a wedding, trying to decide if in-flight wi-fi is awesome or just a sneaky way to make sure I’m never again off my computer.
I’ve spent the last 30 minutes catching up with our PFT coverage over the weekend — holy crap, Sean Payton — and found no fewer than nine mentions of Dez Bryant.
Let’s make it an even ten.
Bryant wrapped up his first weekend in a Cowboys uniform by twisting his ankle at the end of Sunday’s minicamp practice and walking “gingerly” to the team bus.
The injury is a reminder that perhaps Bryant’s biggest challenge as a rookie will be getting in football shape, and staying healthy after so much time away from football. Wade Phillips didn’t sound worried about the injury, and is even less concerned about Bryant’s ability.
List of 1000 yard receivers Wade Phillips has coached:
Anthony Miller
Eric Moulds
Terrell Owens
Miles Austin
That’s really not a lot to compare to. Even if you count teams he wasn’t head coach of, you can only add Vance Johnson and one year of Andre Reed.
So I wouldn’t say he’s really the authority on wide receiver talent.
It’s like Jon Gruden calling a QB the most talented one he’s ever seen.
Haters will still come on here with something bitter and angry to say about Dez any minute now…
Its not Dez Bryant, its the Cowboys declaring everyone they have/Draft is the better then they could have ever imagined!!!???
Get over yourselves Dallas…….0 Bowls in what 17yrs? let alone playoff success
If Dez can do what Roy was supposed to do then the cowboy offense could really take off next season. Romo’s numbers should benefit too. I’m more worried about the o-tackle position than if dez will produce, I think dez will be fine.
it has to do with being in football shape because when you are not in great conditioning you are more likely to have these injuries…its why rookie receivers almost always tweak their hamstrings and/or ankles in these early practices before the season
First of all, I am a huge Dez Bryant fan and I really think he could become one of the best receivers in the NFL. I only verify my Dez Bryant fan status to show that I am not some “hater” just trying to taint Dez’s image.
Anyway, the reason his ankle injury could have something to do with being out of shape is because when you aren’t in shape, you tend to tire more easily, and one of the first aspects of anyone’s game to go is footwork. Therefore, there is speculation that Dez being out of shape and his footwork deteriorating as the practice session wore on presents a situation where it would be easy to twist an ankle.
I don’t think there was ever a question about his talent. Based on all the scouting reports, one could safely conclude that
a) Des Bryant would come into the league catching everything thrown his way and look good doing it,
b) He would probably show up out of shape, and
c) He would be answering a lot of questions not related to his play on the field. Bingo.
I’ve maintained all along that Bryant was one of the two best players in this class (Suh being the other). Cowboys got an absolute steal. There are the Moss comparrisons but as a player, he’s more like T.O. or Andre Johnson. He’s going to be that good.
Hey dj43, what team do you root for?
As far as Dez’s “injury,” yes it could be as a result of not being in football shape after such a long absence. However, like it was said, it’s not even a sprain and the only reason it’s news is because it’s Dez Bryant. He jumped up for a deep pass thrown behind him, and just landed a little awkwardly on his ankle. Ever played basketball and went up for a rebound and land a little funny and roll your ankle? It’s not a sprain, you hobble around for a bit and after an hour it’s like it never happened.
Anyhow, I love the attention from tools like Voxy Moron and dj43. Goes to show just how successful the Cowboys really are. No one would bash them if nobody cared about them like the Cleveland Browns.
GOOOOD MORNIN’ hate-hate-hataaaz!
I hope Dez exceeds everyones expectations… Here’s a kid from a definitely less than ideal background, who has a chance to do very well. Rags-to-Riches story. Overcoming odds that were stacked against him from the very beginning. There are so many he could be an inspiration to. Yet some have nothing to say except to try and tear him down before he even gets started.
dez was a man amongst boys in college. i couldnt believe how far he fell in the draft. i was really scared the pats would take him, instead they traded down so they can stock pile even more 7th round picks haha
# TFBuckFutter says: May 2, 2010 7:43 PM
List of 1000 yard receivers Wade Phillips has coached:
Anthony Miller
Eric Moulds
Terrell Owens
Miles Austin
That’s really not a lot to compare to. Even if you count teams he wasn’t head coach of, you can only add Vance Johnson and one year of Andre Reed.
So I wouldn’t say he’s really the authority on wide receiver talent.
It’s like Jon Gruden calling a QB the most talented one he’s ever seen.
—————————-
hahahah
JJCheesehead says:
you didnt play many sports did you edgy?
being out of shape = prone to injury
****************************
Bzzz- WRONG – thank you for playing out game, here are your parting gifts. Being out of shape is NOT going to make you prone to ankle sprains, genius. Hamstring pulls but NOT ankle sprains (Foot work, my ass, to the other guy). I played football and basketball in the summer and ALWAYS showed up in shape but I had a couple of sprains when I landed wrong on the field (once in a hole that was supposed to have been filled the day before).
All the idiots saying Dez is gonna be a bust and especially the moron saying that he is gonna be the next Jamarcus Russel, there is a huge difference between Bryant and Russel. Dez Bryant wasnt selected first overall and didnt sign a contract that would guarantee him $30+ retard. Dez Bryant was selected near the back of the first round, and if he doesnt turn out to be a top 5 reciever like he is supposed to be, trust me, it aint a big deal, at all. The problem for every other NFL team out there is, this guy is going to be a beast on the field. And what a value for Dallas at #24, he is gonna be shitting on everyone for the next 12 years. So hate on bums, hate on…. You would all love to have Dez Bryant on your team. Too bad youll have to settle for that Olinemen your team drafted in the first round. And thanks for the gift. We’ll take him.
Bigd88 – … and NOBODY cares about the overrated Cowboys outside the Dallas city limits. “America’s Team” my ass…they’re probably one of the most hated teams in america! Dez Bryant is a talent, for sure, but let’s see him in a REAL game before the entire Dallas fanbase lines up on their knees…
TheDPR says:
May 2, 2010 7:57 PM
“Nothing bad to say about Dez but I won’t pass up the chance to point out that Wade Phillips doesn’t know jack about offense or offensive players.”
Yeah, it’s not like he ever game planned to stop Jerry Rice…or Michael Irvin…or Randy Moss…or Cris Carter…or Marvin Harrison…or Larry Fitzgerald…
@Hordak
I think that guy meant more as a talent evaluator. Either way there is no logic to your argument. He already knew all those great players were talented its not like he drafted Jerry Rice.
I am just sick of the people that read stuff like this or something like “Mike Singletary thinks Vernon Davis is a good TE.” Yeah of course he is going to say something like this. Why wouldn’t he? This doesn’t matter at all until Dez has played a down of actual football.
Two things I also want to add. First of all, why is it this guy got so hyped? I have been watching his youtube highlights and stats and he doesn’t seem that special. That doesn’t mean that he can’t be a great NFL player but I think its just stupid to make any type of comaprrison between him and Moss, TO, Johnson ect.
Also; why is it Michael Oher gets a freaking movie and Dez doesn’t? He built the success he has now from the ground up. I am just sick of the Michael Oher hype for a mediocre linemen just because he had a rough up bringing. So did a lot of NFL players. Like I said, Dez, google Patrick Willis’ story. There are plenty of guys who have had tough roads to the NFL and I am sick of people talking about the blind side.
This is a great strategy — lets make sure his ego and head are as swelled up to huge proportions as early as possible and make sure he feels he is so gifted he doesn’t need to put in a ton of work to be great. This should work out really awesome for the other 31 teams!
I meant $30+ Million by the way.
Dez Bryant, I hope you beat out Roy to be the #2 on this team ASAP this year so you can start your rampage as early as possible. Romo needs to get you the ball at least 40% of the time on offense. You’re a force.
We’re gonna eat good this year baby! =D
Wow, I sure did see a lot of hate in here…lol. Trying to discuss football with haters is like talking politics to a liberal in a political chat room, no facts just smack…lmao. You can be in football shape and still sprain the ankle. what do you think happens in the games half the time?…duhhhhh. Heck, there’s more injuries half the time during the season than in a practice session.
Those that use the term HATER, no matter the spelling.
1) MTV and BET are on your favorite channel list.
2) If collegiate completion is a part of your resume, it’s of the technical matter.
3) You think diamond earrings on a guy is “classy”.
4) Your musical collection is biased solely on what popular society deems “good music”.
5) Books? What are those?
6) It be pissin u off when dem hatas be hatin on dem dallus cowboyz yo!!!
Not to mention, Dez kept playing afterward. He finished the 1 on 1 drills and capped it off by beating 6th round pick Jamar Wall on a triple-move route (guess that ankle didn’t hurt him too much) (a slant-go-out). And then as a precaution the coaches held him out of the sprints afterward.
Again, if this were anyone else, it would be a non story since it isn’t even a sprain. But since it’s Dez Bryant, it is a story because the writers know that most guys here flock out of the woodworks, which gives their site many hits, to say something bad about the kid they’ve never met, who overcame an environment that would break down 90% of those of us who follow him.
this class sucks says:
May 2, 2010 9:43 PM
“@Hordak
I think that guy meant more as a talent evaluator. Either way there is no logic to your argument. He already knew all those great players were talented its not like he drafted Jerry Rice.”
If he meant “as a talent evaluator”, he should have said that. He specifically said that Wade knows neither offense nor offensive players, which is an asinine thing to say about someone who has spent the past three decades studying offenses and devising ways to beat them, including the ones with those great receivers.
And, yeah, of course Wade would say good things about the Cowboys’ top pick. It doesn’t make it true, it doesn’t make it untrue.
# TFBuckFutter says: May 2, 2010 7:43 PM
It’s like Jon Gruden calling a QB the most talented one he’s ever seen.
————————————————————————
Jon Gruden worked with the Alpha and Omega, the king of kings, the lord of lords BRETT FAVRE
Dez will be a beast….no other reciever in the draft is even being mentioned but Dallas IS Dallas and if i lived somewhere else than Dallas i would talk down and hate every move the Cowboys made even if your tam was in the position the Cowboys were in the draft coming off a season Dallas did they wouldve done the same thing and taken a “problem” at 24 they did it with Moss in Minny but no one talked as much cuz well…its Minnesota…but this is Dallas and we expect this from every other NFL town in the country….the only coverage the Super Bowl champs get is a prescription scandal…The Cowboys run a football squad that breeds envy around the country and i love it and i wouldnt have any other owner in my city other then Jerry Jones…so let the envy continue after this
GO COYBOYS
(primetime games because everyone wants to watch the show hate it or love it)
this class sucks says:
Two things I also want to add. First of all, why is it this guy got so hyped? I have been watching
****************************
You need to contact that NFL because you’re obviously what they’re looking for in a talent scout…….
This guy goes over the middle and makes catches, even knowing that he’s going to get hit. THAT is more than a lot of WRs are willing to do. He’s NOT afraid to take or give a hit and his elusiveness makes him a dangerous YAC receiver and return man. If you can’t see why this guy is so good, you shouldn’t quit your day job. My best friend and I argued over him and Crabtree as to who was better but NOT as to whether they would be stars in the NFL.
@edgy1957
I’m not saying he won’t be a star in the NFL but Crabtree (stat wise) was worlds ahead of Dez in college so he deserved the hype. I agree that Dez has a lot of positive intangibles but so does Jordan Shipley. I also don’t see your logic where you think my opinion is completely unjustified and yours is dead on. I’m sure your NFL experience is just as deep as mine.
@Hordak
So by your logic any coach that has been in the league for a long period of time in any capacity is capable of spotting great offensive talent without the player having played a single NFL down. That makes sense. I’m sure thats not what you meant but you should go back to the junior college you dropped out from and take an english class so you can properly convey what you do mean.
@djruetune
I am sure you think of your self as very intelligent, well rounded person. And your stereotyping is very well thought out, and I appreciate the time you spent on it. But you don’t come off as a smart witty person as much as you come off as an up tight elitist douche bag. I just thought I would let you know. Have fun spending your life alone because you talk down to every person you want to have a relationship with.
@Badatitude08
You want facts? Republicans want to decrease government spending and size but want to increase the size of the military and security. The military is funded by the government. Ok there are some facts. Now counter them by calling me a socialist quick!
this class sucks says:
I’m not saying he won’t be a star in the NFL but Crabtree (stat wise) was worlds ahead of Dez in
******************************
Again, don’t quit your day job. Crabtree accomplished everything he did in an offense that passed the ball 1725 times in his two years while Bryant did in an offense that passed it 712 times or less than 1/2 that of Texas Tech. In addition to that, Tech lost their top two receivers due to graduation before Crabtree hit the field while OSU only lost their #2 WR. In addition to all that, Crabtree was a REDSHIRT freshman while Bryant as a TRUE freshman. Crabtree had the advantage as “freshmen” but as “sophomores”, Bryant had an edge and a BIG one, when you consider the offenses.Crabtree was better but NOT worlds better.
this class sucks says:
I also don’t see your logic where you think my opinion is completely unjustified and yours is dead on. I’m sure your NFL experience is just as deep as mine
************************
I forgot to mention that I didn’t have to go to Youtube to see Dez Bryant’s highlights as I saw both him and Crabtree play on a weekly basis. I also got to see Lance Alworth, Bob Hayes, Warren Wells, John Stallworth and many others LIVE and not on Youtube.
@Edgy1957
So you concede the point that Crabtree was better in college and thus to assume he would be the worse pro would be doing so based on nothing.
“I forgot to mention that I didn’t have to go to Youtube to see Dez Bryant’s highlights as I saw both him and Crabtree play on a weekly basis. I also got to see Lance Alworth, Bob Hayes, Warren Wells, John Stallworth and many others LIVE and not on Youtube.”
So your logic is completely flawed unless you think that talent evaluation can only happen when a player is watched lived. I am sure you have an opinion on how good Tebow, Clasuen, Bradford, and McCoy will be. But it is impossible that you saw all their games live. So should your opinion be worth less than, say, a Florida fan? No of course not. Just because you saw players live doesn’t mean you know anything more than me about football.
Here is one of the reasons why I think Dez is over hyped. I have seen people compare him to TO, Randy Moss, Marvin Harrison, and Andre Johnson. Idk about you but I am pretty sure those 4 guys have completely different styles of WR. That makes me think that the people who are making these comparisons either don’t understand that WRs are different or have no clue what they are talking about and are just playing the name association game. From what I have seen, I would have to say he reminds me of Josh Morgan from the 49ers and Virginia Tech. He doesn’t have blazing speed and his route running is far from perfect but he can catch the ball in traffic and understand how to get up field once he has it. I am not saying he will be as good, better, or worse, than Morgan. That is just who he reminds me of. If I had to guess I think he will have the same type of success as Roy Williams (before he came to Dallas). I think he will be good but not great and very overhyped. I think Crabtree will be better, but be undervalued.
this class sucks says
**********************
Wow, you must have been a very poor student because you sure as hell can’t read or comprehend. Just where in the hell do you see me saying that Bryant would make a better pro than Crabtree? Crabtree had a slightly better college career based on his freshman year but Bryant had a better sophomore year. That being said, I believe that both will be outstanding professional WRs BUT I do believe that based on what the Cowboys are doing compared to the 49ers and Romo vs Smith, Bryant will end up having a few more catches but a lot more yards. Now, should Singletary change his mind or get replaced with a guy that wants to pass more, that could change. Both guys are capable of 70-90 for 1200 or more yards.
Look, you could go to Youtube all you want and you will NOT see his full game. My God, I could put together a highlight reel for Darrius Heyward-Beyfrom college that would knock your socks off but if you ever saw him play, you saw him drop passes in college and that’s one of the reasons why so many people were so down on the Raiders taking him so high.
Live not only means being there but also actually watching a game or two and not a bunch of highlights. Had you ever watched an actual game involving Dez Bryant, you’d have seen everything that has people raving about him. All you have is Youtube and the ravings of people who want to make a big deal about his mom and dad.
Now, he’s closer to TO than he is Moss, in that he has good size and decent speed but isn’t a burner. The comparisons to Moss have NOTHING to do with their play but the fact that they were supposedly troubled players but that really pertains more to Randy, who ended up at Marshall ON HIS WAY DOWN after lost his scholarship to Notre Dame and was kicked off of the Florida State team because of marijuna.
Morgan – are you nuts? Just in his first two years, Bryant had more of EVERYTHING than Morgan did in 4 years at Virginia Tech and the Hokies threw the ball for an average of about 330 times a year (about 26 less than OSU) and yet, he only led the team in receptions ONCE. Oh and as slow as you say that he is, he’s FASTER than Crabtree AND Morgan and gee, Morgan lost his job to — wait for it — Crabtree. Again, don’t quit your day job.
@Ben in AZ
Quite possibly the least intelligent comment posted in a long time. Ben, dude, Tony Romo is the 8th most accurate passer in the HISTORY of the NFL. For active QBs, Romo ranks 3rd all time in passer rating. You sir, are either a complete moron or just a hater.
@this class sucks
Still trying to pump up that 9er receiving corps I see. Sorry guy, but your WR group is Michael Crabtree and a bunch of guys named Herb. One of the people comparing Bryant to Randy Moss is Dez’s position coach from college who also happens to be Randy Moss’ former position coach. He said Bryant is “better” at tracking and adjusting to the ball than Randy. Why don’t you send him a bunch of those youtube highlights and see if he changes his mind.
this class sucks says:
May 3, 2010 4:53 PM
@Hordak
So by your logic any coach that has been in the league for a long period of time in any capacity is capable of spotting great offensive talent without the player having played a single NFL down. That makes sense. I’m sure thats not what you meant but you should go back to the junior college you dropped out from and take an english class so you can properly convey what you do mean.
I made myself perfectly clear, your sarcasm notwithstanding. I won’t accuse you of lacking the intelligence needed to comprehend since I’m sure that you understand my point. What you do lack is the decency to not be deliberately obtuse. |
Covalent binding of cyclosporine inhibits irreversibly T-lymphocyte activation.
A diazirine derivative of cyclosporine (PL-CS) was used to photolabel recombinant human cyclophilin (rhCyp), the cytosolic receptor for the immunosuppressant cyclosporine. The affinity of PL-CS for rhCyp and the immunosuppressive activity were 10-fold reduced as compared to cyclosporine A. Whereas cyclosporine immunosuppression was fully reversible, UV cross-linking of PL-CS resulted in permanent inhibition of lymphocyte activation as shown by proliferation of anti-CD3 stimulated human peripheral lymphocyte, interleukin (IL)-2 gene transcription and IL-2 synthesis in the human T-leukemia cell line Jurkat. In vivo photolabeling of viable Jurkat cells revealed that a 21-kDa complex was the major radiolabeled product which was identified as a cyclophilin-cyclosporine complex. In addition, cyclophilin B (25 kDa) and proteins of an unidentified nature at 40, 46 and 60 kDa were observed in Jurkat cells. The cyclosporine-resistant human fibroblast cell line MRC5 displayed a different labeling pattern: cyclophilin B (25 kDa) and a 65-kDa protein were the major labeled products, while the 46- and 60-kDa components were not detectable and cyclophilin was only faintly labeled. In summary, covalent cyclosporine binding caused irreversible lymphocyte inactivation and revealed in addition to cyclophilin other specifically labeled proteins in lymphoid cells. The role and identity of these proteins is presently unknown. |
News : Insider
INU - The Iranian Regime is facing a major threat from anti-regime protesters and could fall by the end of 2018, according to one Iranian dissident and defence expert.
B. Taghvaee told the Daily Star Online that the Iranian Regime is facing three key uprisings this year, from anti-regime groups, women's rights groups, and religious minority groups, which threaten to bring the Regime down sooner rather than later.
Taghvaee, an aviation and military expert, said that the Regime was on its way down.
He said: "The Iranian regime is dying, it's a matter of when not if. It might be next year, it might be in the next five years. But they are dying."
The expert, who lives in Malta and cannot return to Iran for fear of arrest or worse, explained that it is the very ideology of the Iranian Regime that spells its downfall.
He said: "Iran is based on an ideology of exporting Shia Islam, and expanding the "Axis of Resistance" to Israel. In order to show that Iran is a model Islamic country, they have enforced Sharia law and made women wear the hijab. And in order to win this battle to show themselves as the ideal Islamic society, they have spent billions of Iran's natural resources and bankrupted the country."
The Iranian Regime has been trying to compete with Saudi Arabia for decades, which has ruined the Iranian economy. These economic problems brought protesters into the streets in the first place and have kept them coming back day after day.
He said that female protesters in Iran have done more than any other group to bring together opposition groups for these ongoing protests.
He said: "To tell you the truth women have more courage than the men in Iran. Every Wednesday for the past few months, women have been taking part in the White Wednesday campaign, where they remove their hijab in protest at the laws on compulsory Islamic dress. Almost 20 million Iranian women have been arrested at some point in their life for wearing the hijab wrong.”
He continued: "And the reason that the regime can't let women wear what they want is that this regime is based on a strict interpretation of Islam. If they lose this battle, that day will be the day that the regime falls."
Furthermore he warned that the Regime may lash out militarily in an effort to distract from its domestic problems, by starting a proxy war with Israel since Iran has been already caught smuggling weapons into Syria and an Iranian general threatened to "open the gates of hell" on Israel after downing an Israeli F16 fighter jet.
This should, however, be seen as weakness by the Regime, not strength. |
Concurrent carbogen and radiation therapy in children with high-risk brainstem gliomas.
In an attempt to improve local control, we assessed the feasibility of the addition of 4 min of carbogen inhalation (as a radiosensitizer) to daily fractionated radiotherapy in pediatric patients with high grade and/or diffuse brainstem gliomas. Ten patients inhaled carbogen for >90% of the radiation treatments. Median survival time from start of therapy was 0.80 years. Carbogen inhalation did not appear to improve the dismal prognosis. |
Q:
Django db transaction set_autocommit and CONN_MAX_AGE
I want to make an atomic transaction and my database is PostgreSQL.
Here's how I've been making transaction so far:
transaction.set_autocommit(False)
try:
do_stuff()
transaction.commit()
except:
transaction.rollback()
raise
finally:
transaction.set_autocommit(True)
Doc says I could do it like this:
with transaction.atomic():
do_stuff()
Are both code the same?
I have a connection pool CONN_MAX_AGE=60 in my settings.py.
What happens with the following scenario:
first request sets autocommit to False
second request makes db updates
first request raises and exception, rollbacks, and sets autocommit back to True
Will my updates in 2. survive?
Would it be different with transaction.atomic()?
A:
I would recommend using transaction.atomic(), since its purpose is to do exactly the thing you want.
You can see the implementation here. The most obvious difference is that Django's version has support for "nested" transactions using savepoints. You can trust that this code is well-tested and widely used.
Regarding your scenario, your updates in step 2 should survive in either case, since autocommit applies at the database connection level, and the two concurrent requests will be using different database connections.
|
Q:
Java libraries for reading meta data from .img, .osc and .mccd files
I need to read meta data from .img, .osc and .mccd files.
Can you anyone recommend any libraries or provide any pointers as to how I would go about doing this. Eventually I need to put that meta-data into an XML file so it can be harvested by a repository.
A:
Find documentation on the file header for these formats and simply read these bytes in. AFAIK no libraries exist sorry.
|
Speaking for myself, I see no logical reason why Boyce’s wife and children deserve oil money any more than they deserve to keep living in their old house. If they were victimized, it was by Boyce.
Still, something smells funny to anyone who recalls how tax foreclosure was supposed to work.
Back in 1999, legislation passed in Lansing to “streamline” handling of property with delinquent taxes. For the first time, counties received power to foreclose directly on private property, replacing a previous system involving tax liens sold to investors.
Even within Jackson County government, the expansion of power seemed potentially troubling.
“I didn’t run for this job so I can take people’s houses away from them,” said former Jackson County Treasurer Janet Rochefort in 2000.
Supporters of the change said the intent was to speed up a slow response to tax deadbeats, so properties can go back on tax rolls as quickly as possible.
The Boyce property would have returned to tax rolls two years ago, except county commissioners prevented it. Instead of allowing the property to be sold at tax sale in the normal flow of events, commissioners voted to take ownership by paying the $18,500 tax bill.
Treasurer Karen Coffman then questioned the legality of county ownership because no public use, such as a park, is planned.
Regardless, the county listed the property for sale at $300,000, a profit margin of 1,521 percent. A buyer offered the asking price, but the county backed out in July because an oil strike by then appeared likely.
Now the county intends to let oil revenues roll in so it can properly assess the windfall.
So Jackson County has twice deliberately kept the formerly private property off the tax rolls so government can extract maximum wealth from it.
That may not be an injustice to any one person in particular, but the funny smell lingers. |
Germany: Freiburg gang rapists to spend years in prison
Ten of 11 men accused in the gang rape of a woman in the southern city of Freiburg in 2018 have been sentenced to jail terms. The case was seized upon by anti-immigration populists, as most of the men are refugees. |
Q:
Dynamically inserting stylesheet into IFRAME
I have done the following:
<iframe id="portal" src="page-on-my-domain.php"></iframe>
$(document).ready(function() {
$('#portal').load(function(){
$('#portal').contents().find('head').append('<link href="/css/iframe.css" rel="stylesheet" type="text/css" />');
});
});
This is working fine, however the problem is whenever I update the stylesheet, the updated styles are not being applied in the IFRAME. I have tried reloading the page and the iframe but it is still picking up the old styles.
A:
Could it be the browser cache? Appending a timestamp to the URL could help:
$(document).ready(function() {
$('#portal').load(function(){
var timestamp = +(new Date());
$('#portal').contents().find('head').append('<link href="/css/iframe.css?'+ timestamp +'" rel="stylesheet" type="text/css" />');
});
});
|
//-----------------------------------------------------------------------------
// CLIENT_BASE.VPC
//
// Project Script
//-----------------------------------------------------------------------------
$Macro OUTBINNAME "client"
$Macro OUTBINDIR "$SRCDIR\..\game\$GAMENAME\bin"
$Macro DEVKITBINDIR "$GAMENAME\bin" [$X360]
// It's important to include $GAMENAME in the generated_proto directory
// to avoid race conditions when multiple games are in one solution.
$Macro GENERATED_PROTO_DIR "$SRCDIR\game\client\generated_proto_$GAMENAME"
$MacroRequired "GAMENAME"
$Include "$SRCDIR\vpc_scripts\source_dll_base.vpc"
$include "$SRCDIR\vpc_scripts\protobuf_builder.vpc"
$Include "$SRCDIR\vpc_scripts\source_replay.vpc" [$TF]
$Include "$SRCDIR\game\protobuf_include.vpc"
$Configuration "Debug"
{
$General
{
$OutputDirectory ".\Debug_$GAMENAME" [$WIN32]
$IntermediateDirectory ".\Debug_$GAMENAME" [$WIN32]
$OutputDirectory ".\Debug_$GAMENAME_360" [$X360]
$IntermediateDirectory ".\Debug_$GAMENAME_360" [$X360]
}
}
$Configuration "Release"
{
$General
{
$OutputDirectory ".\Release_$GAMENAME" [$WIN32]
$IntermediateDirectory ".\Release_$GAMENAME" [$WIN32]
$OutputDirectory ".\Release_$GAMENAME_360" [$X360]
$IntermediateDirectory ".\Release_$GAMENAME_360" [$X360]
}
}
$Configuration
{
$General
{
$OutputDirectory ".\$GAMENAME" [$OSXALL]
}
$Compiler
{
$AdditionalIncludeDirectories ".\;$BASE;$SRCDIR\vgui2\include;$SRCDIR\vgui2\controls;$SRCDIR\game\shared;.\game_controls;$SRCDIR\thirdparty\sixensesdk\include"
$PreprocessorDefinitions "$BASE;NO_STRING_T;CLIENT_DLL;VECTOR;VERSION_SAFE_STEAM_API_INTERFACES;PROTECTED_THINGS_ENABLE;strncpy=use_Q_strncpy_instead;_snprintf=use_Q_snprintf_instead"
$PreprocessorDefinitions "$BASE;fopen=dont_use_fopen" [$WIN32]
$PreprocessorDefinitions "$BASE;USE_WEBM_FOR_REPLAY;" [$LINUXALL]
$PreprocessorDefinitions "$BASE;CURL_STATICLIB" [$WIN32 && $BUILD_REPLAY]
$Create/UsePrecompiledHeader "Use Precompiled Header (/Yu)"
$Create/UsePCHThroughFile "cbase.h"
$PrecompiledHeaderFile "$(IntDir)/client.pch"
}
$Linker
{
$SystemLibraries "iconv" [$OSXALL]
$SystemFrameworks "Carbon" [$OSXALL]
$SystemLibraries "rt" [$LINUXALL]
$IgnoreImportLibrary "TRUE"
$AdditionalDependencies "$BASE winmm.lib" [$WIN32]
$AdditionalDependencies "$BASE wsock32.lib Ws2_32.lib" [$BUILD_REPLAY]
}
}
$Project
{
$Folder "Replay"
{
$File "replay/replaycamera.cpp"
$File "replay/replaycamera.h"
$File "replay/cdll_replay.cpp"
$File "replay/cdll_replay.h"
$File "replay/gamedefs.h" [$BUILD_REPLAY]
$File "replay/gamedefs.cpp" [$BUILD_REPLAY]
$File "replay/replay_ragdoll.cpp" [$BUILD_REPLAY]
$File "replay/replay_ragdoll.h" [$BUILD_REPLAY]
$File "replay/replay_screenshot.cpp" [$BUILD_REPLAY]
$File "replay/replay_screenshot.h" [$BUILD_REPLAY]
$File "replay/replayperformanceplaybackhandler.h" [$BUILD_REPLAY]
$File "replay/replayperformanceplaybackhandler.cpp" [$BUILD_REPLAY]
$File "replay/replayrenderer.cpp" [$BUILD_REPLAY]
$File "replay/replayrenderer.h" [$BUILD_REPLAY]
$File "replay/replayvideo.cpp" [$BUILD_REPLAY]
$File "replay/replayvideo.h" [$BUILD_REPLAY]
$File "replay/genericclassbased_replay.cpp" [$BUILD_REPLAY]
$File "replay/genericclassbased_replay.h" [$BUILD_REPLAY]
$File "$SRCDIR\game\shared\replay_gamestats_shared.cpp" [$BUILD_REPLAY]
$File "$SRCDIR\game\shared\replay_gamestats_shared.h" [$BUILD_REPLAY]
$File "$SRCDIR\game\client\youtubeapi.h" [$BUILD_REPLAY]
$File "$SRCDIR\game\client\youtubeapi.cpp" [$BUILD_REPLAY]
{
$Configuration
{
$Compiler
{
$Create/UsePrecompiledHeader "Not Using Precompiled Headers"
}
}
}
$Folder "UI" [$BUILD_REPLAY]
{
$File "replay\vgui\replaybrowserbasepage.cpp"
$File "replay\vgui\replaybrowserbasepage.h"
$File "replay\vgui\replaybrowserbasepanel.cpp"
$File "replay\vgui\replaybrowserbasepanel.h"
$File "replay\vgui\replayconfirmquitdlg.cpp"
$File "replay\vgui\replayconfirmquitdlg.h"
$File "replay\vgui\replaybrowserdetailspanel.cpp"
$File "replay\vgui\replaybrowserdetailspanel.h"
$File "replay\vgui\replaybrowseritemmanager.cpp"
$File "replay\vgui\replaybrowseritemmanager.h"
$File "replay\vgui\replaybrowserlistitempanel.cpp"
$File "replay\vgui\replaybrowserlistitempanel.h"
$File "replay\vgui\replaybrowserlistpanel.cpp"
$File "replay\vgui\replaybrowserlistpanel.h"
$File "replay\vgui\replaybrowsermainpanel.cpp"
$File "replay\vgui\replaybrowsermainpanel.h"
$File "replay\vgui\replaybrowsermovieplayerpanel.cpp"
$File "replay\vgui\replaybrowsermovieplayerpanel.h"
$File "replay\vgui\replaybrowserpreviewpanel.cpp"
$File "replay\vgui\replaybrowserpreviewpanel.h"
$File "replay\vgui\replaybrowserrenderdialog.cpp"
$File "replay\vgui\replaybrowserrenderdialog.h"
$File "replay\vgui\replayinputpanel.cpp"
$File "replay\vgui\replayinputpanel.h"
$File "replay\vgui\replaymessagepanel.cpp"
$File "replay\vgui\replaymessagepanel.h"
$File "replay\vgui\replayperformanceeditor.cpp"
$File "replay\vgui\replayperformanceeditor.h"
$File "replay\vgui\replayperformancesavedlg.cpp"
$File "replay\vgui\replayperformancesavedlg.h"
$File "replay\vgui\replayrenderoverlay.cpp"
$File "replay\vgui\replayrenderoverlay.h"
$File "replay\vgui\replayreminderpanel.cpp"
$File "replay\vgui\replayreminderpanel.h"
$File "replay\replayyoutubeapi.cpp"
$File "replay\replayyoutubeapi.h"
$File "replay\replayyoutubeapi_key.cpp" [!$SOURCESDK]
$File "replay\replayyoutubeapi_key_sdk.cpp" [$SOURCESDK]
$File "game_controls\slideshowpanel.cpp"
$File "game_controls\slideshowpanel.h"
$File "$SRCDIR\common\movieobjects\timeutils.cpp"
{
$Configuration
{
$Compiler
{
$Create/UsePrecompiledHeader "Not Using Precompiled Headers"
}
}
}
$File "$SRCDIR\public\movieobjects\timeutils.h"
}
}
$Folder "Source Files"
{
$File "hl2\C_Func_Monitor.cpp"
$File "geiger.cpp"
$File "history_resource.cpp"
$File "hud_weapon.cpp"
$File "train.cpp"
$File "$SRCDIR\game\shared\weapon_parse_default.cpp"
$File "$SRCDIR\game\shared\achievement_saverestore.cpp"
$File "$SRCDIR\game\shared\achievement_saverestore.h"
$File "$SRCDIR\game\shared\achievementmgr.cpp"
$File "$SRCDIR\game\shared\achievementmgr.h"
$File "$SRCDIR\game\shared\achievements_and_stats_interface.h"
$File "$SRCDIR\game\shared\achievements_hlx.cpp"
$File "achievement_notification_panel.cpp"
$File "achievement_notification_panel.h"
$File "$SRCDIR\game\shared\activitylist.cpp"
$File "alphamaterialproxy.cpp"
$File "$SRCDIR\game\shared\ammodef.cpp"
$File "animatedentitytextureproxy.cpp"
$File "animatedoffsettextureproxy.cpp"
$File "animatedtextureproxy.cpp"
$File "AnimateSpecificTextureProxy.cpp"
$File "$SRCDIR\game\shared\animation.cpp"
$File "$SRCDIR\game\shared\base_playeranimstate.cpp"
$File "$SRCDIR\game\shared\baseachievement.cpp"
$File "$SRCDIR\game\shared\baseachievement.h"
$File "baseanimatedtextureproxy.cpp"
$File "baseclientrendertargets.cpp"
$File "$SRCDIR\game\shared\basecombatcharacter_shared.cpp"
$File "$SRCDIR\game\shared\basecombatweapon_shared.cpp"
$File "$SRCDIR\game\shared\baseentity_shared.cpp"
$File "$SRCDIR\game\shared\basegrenade_shared.cpp"
$File "$SRCDIR\game\shared\baseparticleentity.cpp"
$File "$SRCDIR\game\shared\baseplayer_shared.cpp"
$File "$SRCDIR\game\shared\baseprojectile.cpp"
$File "$SRCDIR\game\shared\baseprojectile.h"
$File "$SRCDIR\game\shared\baseviewmodel_shared.cpp"
$File "beamdraw.cpp"
$File "$SRCDIR\game\shared\beam_shared.cpp"
$File "$SRCDIR\public\bone_accessor.cpp"
$File "bone_merge_cache.cpp"
$File "c_ai_basehumanoid.cpp"
$File "c_ai_basenpc.cpp"
$File "c_baseanimating.cpp"
$File "c_baseanimatingoverlay.cpp"
$File "c_basecombatcharacter.cpp"
$File "c_basecombatweapon.cpp"
$File "c_basedoor.cpp"
$File "c_baseentity.cpp"
$File "c_baseflex.cpp"
$File "c_baseplayer.cpp"
$File "c_baseviewmodel.cpp"
$File "c_breakableprop.cpp"
$File "c_colorcorrection.cpp"
$File "c_colorcorrectionvolume.cpp"
$File "c_dynamiclight.cpp"
$File "c_entitydissolve.cpp"
$File "c_entityparticletrail.cpp"
$File "c_env_fog_controller.cpp"
$File "c_env_particlescript.cpp"
$File "c_env_projectedtexture.cpp"
$File "c_env_screenoverlay.cpp"
$File "c_env_tonemap_controller.cpp"
$File "c_fire_smoke.cpp"
$File "c_fish.cpp"
$File "c_func_areaportalwindow.cpp"
$File "c_func_breakablesurf.cpp"
$File "c_func_conveyor.cpp"
$File "c_func_dust.cpp"
$File "c_func_lod.cpp"
$File "c_func_occluder.cpp"
$File "c_func_reflective_glass.cpp"
$File "c_func_rotating.cpp"
$File "c_func_smokevolume.cpp"
$File "c_func_tracktrain.cpp"
$File "c_gib.cpp"
$File "c_hairball.cpp"
$File "c_info_overlay_accessor.cpp"
$File "c_lightglow.cpp"
$File "C_MaterialModifyControl.cpp"
$File "c_particle_system.cpp"
$File "c_physbox.cpp"
$File "c_physicsprop.cpp"
$File "c_physmagnet.cpp"
$File "c_pixel_visibility.cpp"
$File "c_plasma.cpp"
$File "c_playerresource.cpp"
$File "c_point_camera.cpp"
$File "c_point_commentary_node.cpp"
$File "c_props.cpp"
$File "c_props.h"
$File "c_ragdoll_manager.cpp"
$File "c_rope.cpp"
$File "c_rumble.cpp"
$File "c_sceneentity.cpp"
$File "c_shadowcontrol.cpp"
$File "c_slideshow_display.cpp"
$File "c_slideshow_display.h"
$File "c_soundscape.cpp"
$File "c_spotlight_end.cpp"
$File "c_sprite.cpp"
$File "c_sprite_perfmonitor.cpp"
$File "c_sun.cpp"
$File "c_team.cpp"
$File "c_tesla.cpp"
$File "c_test_proxytoggle.cpp"
$File "c_user_message_register.cpp"
$File "c_vehicle_choreo_generic.cpp"
$File "c_vehicle_jeep.cpp"
$File "c_vguiscreen.cpp"
$File "hl2\c_waterbullet.cpp"
$File "hl2\hud_autoaim.cpp"
$File "C_WaterLODControl.cpp"
$File "c_world.cpp"
$File "$SRCDIR\game\shared\cam_thirdperson.cpp"
$File "$SRCDIR\game\shared\cam_thirdperson.h"
$File "camomaterialproxy.cpp"
$File "cdll_client_int.cpp"
$File "cdll_bounded_cvars.cpp"
$File "cdll_bounded_cvars.h"
$File "cdll_util.cpp"
$File "cl_mat_stub.cpp"
$File "classmap.cpp"
$File "client_factorylist.cpp"
$File "client_thinklist.cpp"
$File "client_virtualreality.cpp"
$File "client_virtualreality.h"
$File "clienteffectprecachesystem.cpp"
$File "cliententitylist.cpp"
$File "clientleafsystem.cpp"
$File "clientmode_shared.cpp"
$File "clientshadowmgr.cpp"
$File "clientsideeffects.cpp"
$File "clientsideeffects_test.cpp"
$File "clientsteamcontext.cpp"
$File "clientsteamcontext.h"
$File "colorcorrectionmgr.cpp"
$File "commentary_modelviewer.cpp"
$File "commentary_modelviewer.h"
$File "$SRCDIR\game\shared\collisionproperty.cpp"
$File "$SRCDIR\game\shared\death_pose.cpp"
$File "$SRCDIR\game\shared\debugoverlay_shared.cpp"
$File "$SRCDIR\game\shared\decals.cpp"
$File "detailobjectsystem.cpp"
$File "dummyproxy.cpp"
$File "$SRCDIR\game\shared\effect_dispatch_data.cpp"
$File "EffectsClient.cpp"
$File "$SRCDIR\game\shared\ehandle.cpp"
$File "$SRCDIR\game\shared\entitylist_base.cpp"
$File "entityoriginmaterialproxy.cpp"
$File "$SRCDIR\game\shared\EntityParticleTrail_Shared.cpp"
$File "$SRCDIR\game\shared\env_detail_controller.cpp"
$File "$SRCDIR\game\shared\env_wind_shared.cpp"
$File "$SRCDIR\game\shared\eventlist.cpp"
$File "flashlighteffect.cpp"
$File "$SRCDIR\game\shared\func_ladder.cpp"
$File "functionproxy.cpp"
$File "fx_blood.cpp"
$File "fx_cube.cpp"
$File "fx_explosion.cpp"
$File "fx_fleck.cpp"
$File "fx_impact.cpp"
$File "fx_interpvalue.cpp"
$File "fx_quad.cpp"
$File "fx_shelleject.cpp"
$File "fx_staticline.cpp"
$File "fx_tracer.cpp"
$File "fx_trail.cpp"
$File "fx_water.cpp"
$File "$SRCDIR\game\shared\gamemovement.cpp"
$File "$SRCDIR\game\shared\gamerules.cpp"
$File "$SRCDIR\game\shared\gamerules_register.cpp"
$File "$SRCDIR\game\shared\GameStats.cpp"
$File "$SRCDIR\game\shared\gamestringpool.cpp"
$File "gametrace_client.cpp"
$File "$SRCDIR\game\shared\gamevars_shared.cpp"
$File "glow_outline_effect.cpp"
$File "glow_overlay.cpp"
$File "$SRCDIR\game\shared\hintmessage.cpp"
$File "$SRCDIR\game\shared\hintsystem.cpp"
$File "hltvcamera.cpp"
$File "hud.cpp"
$File "hud_animationinfo.cpp"
$File "hud_basechat.cpp"
$File "hud_basetimer.cpp"
$File "hud_bitmapnumericdisplay.cpp"
$File "hud_closecaption.cpp"
$File "hud_crosshair.cpp"
$File "hud_element_helper.cpp"
$File "hl2\hud_filmdemo.cpp"
$File "hl2\hud_hdrdemo.cpp"
$File "hud_hintdisplay.cpp"
$File "hud_msg.cpp"
$File "hud_numericdisplay.cpp"
$File "hud_pdump.cpp"
$File "hud_redraw.cpp"
$File "hud_vehicle.cpp"
$File "$SRCDIR\game\shared\igamesystem.cpp"
$File "in_camera.cpp"
$File "in_joystick.cpp"
$File "in_main.cpp"
$File "initializer.cpp"
$File "interpolatedvar.cpp"
$File "IsNPCProxy.cpp"
$File "lampbeamproxy.cpp"
$File "lamphaloproxy.cpp"
$File "$SRCDIR\game\shared\mapentities_shared.cpp"
$File "mathproxy.cpp"
$File "matrixproxy.cpp"
$File "menu.cpp"
$File "message.cpp"
$File "movehelper_client.cpp"
$File "$SRCDIR\game\shared\movevars_shared.cpp"
$File "$SRCDIR\game\shared\multiplay_gamerules.cpp"
$File "$SRCDIR\game\shared\obstacle_pushaway.cpp"
$File "panelmetaclassmgr.cpp"
$File "particle_collision.cpp"
$File "particle_litsmokeemitter.cpp"
$File "$SRCDIR\game\shared\particle_parse.cpp"
$File "$SRCDIR\game\shared\particle_parse.h"
$File "$SRCDIR\game\shared\particle_property.cpp"
$File "$SRCDIR\game\shared\particle_property.h"
$File "particle_proxies.cpp"
$File "particle_simple3d.cpp"
$File "particlemgr.cpp"
$File "particles_attractor.cpp"
$File "particles_ez.cpp"
$File "particles_localspace.cpp"
$File "particles_new.cpp"
$File "particles_simple.cpp"
$File "$SRCDIR\game\shared\particlesystemquery.cpp"
$File "perfvisualbenchmark.cpp"
$File "physics.cpp"
$File "physics_main_client.cpp"
$File "$SRCDIR\game\shared\physics_main_shared.cpp"
$File "$SRCDIR\game\shared\physics_saverestore.cpp"
$File "$SRCDIR\game\shared\physics_shared.cpp"
$File "physpropclientside.cpp"
$File "playerandobjectenumerator.cpp"
$File "playerspawncache.cpp"
$File "$SRCDIR\game\shared\point_bonusmaps_accessor.cpp"
$File "$SRCDIR\game\shared\point_bonusmaps_accessor.h"
$File "$SRCDIR\game\shared\point_posecontroller.cpp"
$File "$SRCDIR\game\shared\precache_register.cpp"
$File "$SRCDIR\game\shared\predictableid.cpp"
$File "prediction.cpp"
$File "$SRCDIR\game\shared\predictioncopy.cpp"
$File "$SRCDIR\game\shared\props_shared.cpp"
$File "proxyentity.cpp"
$File "ProxyHealth.cpp"
$File "proxyplayer.cpp"
$File "proxypupil.cpp"
$File "ragdoll.cpp"
$File "$SRCDIR\game\shared\ragdoll_shared.cpp"
$File "recvproxy.cpp"
$File "basepresence.cpp" [$WIN32||$POSIX]
$File "basepresence_xbox.cpp" [$X360]
$File "$SRCDIR\game\shared\rope_helpers.cpp"
$File "$SRCDIR\game\shared\saverestore.cpp"
$File "$SRCDIR\game\shared\sceneentity_shared.cpp"
$File "ScreenSpaceEffects.cpp"
$File "$SRCDIR\game\shared\sequence_Transitioner.cpp"
$File "simple_keys.cpp"
$File "$SRCDIR\game\shared\simtimer.cpp"
$File "$SRCDIR\game\shared\singleplay_gamerules.cpp"
$File "$SRCDIR\game\shared\SoundEmitterSystem.cpp"
$File "$SRCDIR\game\shared\soundenvelope.cpp"
$File "$SRCDIR\public\SoundParametersInternal.cpp"
$File "splinepatch.cpp"
$File "$SRCDIR\game\shared\Sprite.cpp"
$File "spritemodel.cpp"
$File "$SRCDIR\game\shared\SpriteTrail.cpp"
$File "$SRCDIR\game\shared\studio_shared.cpp"
$File "studio_stats.cpp"
$File "studio_stats.h"
$File "$SRCDIR\game\shared\takedamageinfo.cpp"
$File "$SRCDIR\game\shared\teamplay_gamerules.cpp"
$File "$SRCDIR\game\shared\teamplayroundbased_gamerules.cpp"
$File "$SRCDIR\game\shared\test_ehandle.cpp"
$File "text_message.cpp"
$File "texturescrollmaterialproxy.cpp"
$File "timematerialproxy.cpp"
$File "toggletextureproxy.cpp"
$File "$SRCDIR\game\shared\usercmd.cpp"
$File "$SRCDIR\game\shared\usermessages.cpp"
$File "$SRCDIR\game\shared\util_shared.cpp"
$File "$SRCDIR\game\shared\vehicle_viewblend_shared.cpp"
$File "vgui_avatarimage.cpp"
$File "vgui_avatarimage.h"
$File "vgui_basepanel.cpp"
$File "vgui_bitmapbutton.cpp"
$File "vgui_bitmapimage.cpp"
$File "vgui_bitmappanel.cpp"
$File "vgui_schemevisualizer.cpp"
$File "vgui_centerstringpanel.cpp"
$File "vgui_consolepanel.cpp"
$File "vgui_debugoverlaypanel.cpp"
$File "vgui_fpspanel.cpp"
$File "vgui_game_viewport.cpp"
$File "vgui_grid.cpp"
$File "vgui_int.cpp"
$File "vgui_loadingdiscpanel.cpp"
$File "vgui_messagechars.cpp"
$File "vgui_netgraphpanel.cpp"
$File "vgui_slideshow_display_screen.cpp"
$File "view.cpp"
$File "view_beams.cpp"
$File "view_effects.cpp"
$File "view_scene.cpp"
$File "viewangleanim.cpp"
$File "ViewConeImage.cpp"
$File "viewdebug.cpp"
$File "viewdebug.h"
$File "viewpostprocess.cpp"
$File "viewpostprocess.h"
$File "viewrender.cpp"
$File "$SRCDIR\game\shared\voice_banmgr.cpp"
$File "$SRCDIR\game\shared\voice_status.cpp"
$File "warp_overlay.cpp"
$File "WaterLODMaterialProxy.cpp"
$File "$SRCDIR\game\shared\weapon_parse.cpp"
$File "weapon_selection.cpp"
$File "weapons_resource.cpp"
$File "WorldDimsProxy.cpp"
$File "vgui_video.cpp"
$File "vgui_video_player.cpp"
$File "$SRCDIR\game\shared\mp_shareddefs.cpp"
$File "$SRCDIR\game\client\c_vote_controller.h"
$File "$SRCDIR\game\client\c_vote_controller.cpp"
//Haptics
$File "$SRCDIR\public\haptics\haptic_msgs.cpp" [!$X360]
$File "$SRCDIR\public\haptics\haptic_utils.cpp" [$WIN32&&!$X360]
$Folder "Sixense"
{
$File "sixense\in_sixense.cpp"
$File "sixense\in_sixense.h"
$File "sixense\in_sixense_gesture_bindings.cpp"
$File "sixense\in_sixense_gesture_bindings.h"
$File "$SRCDIR\game\shared\sixense\sixense_convars.cpp"
$File "$SRCDIR\game\shared\sixense\sixense_convars_extern.h"
}
// Files not using precompiled header cbase.h
$File "$SRCDIR\public\bone_setup.cpp" \
"$SRCDIR\public\posedebugger.cpp" \
"$SRCDIR\public\client_class.cpp" \
"$SRCDIR\common\compiledcaptionswap.cpp" \
"$SRCDIR\public\collisionutils.cpp" \
"$SRCDIR\public\crtmemdebug.cpp" \
"$SRCDIR\public\dt_recv.cpp" \
"$SRCDIR\public\dt_utlvector_common.cpp" \
"$SRCDIR\public\dt_utlvector_recv.cpp" \
"$SRCDIR\public\filesystem_helpers.cpp" \
"$SRCDIR\public\interpolatortypes.cpp" \
"$SRCDIR\game\shared\interval.cpp" \
"$SRCDIR\common\language.cpp" \
"$SRCDIR\public\networkvar.cpp" \
"$SRCDIR\common\randoverride.cpp" \
"$SRCDIR\public\rope_physics.cpp" \
"$SRCDIR\public\scratchpad3d.cpp" \
"$SRCDIR\public\ScratchPadUtils.cpp" \
"$SRCDIR\public\sentence.cpp" \
"$SRCDIR\game\shared\sheetsimulator.cpp" \
"$SRCDIR\public\simple_physics.cpp" \
"$SRCDIR\public\stringregistry.cpp" \
"$SRCDIR\public\studio.cpp" \
"$SRCDIR\public\vallocator.cpp" \
"$SRCDIR\public\vgui_controls\vgui_controls.cpp" \
"$SRCDIR\public\jigglebones.cpp" \
"hud_lcd.cpp" \
"in_mouse.cpp" \
"mumble.cpp" \
"$SRCDIR\public\renamed_recvtable_compat.cpp" \
"rendertexture.cpp"
{
$Configuration
{
$Compiler
{
$Create/UsePrecompiledHeader "Not Using Precompiled Headers"
}
}
}
$Folder "Precompiled Header"
{
$File "stdafx.cpp"
{
$Configuration
{
$Compiler
{
$Create/UsePrecompiledHeader "Create Precompiled Header (/Yc)"
}
}
}
}
$Folder "Temporary Entities"
{
$File "c_basetempentity.cpp"
$File "c_effects.cpp"
$File "c_impact_effects.cpp"
$File "c_movie_explosion.cpp"
$File "c_particle_fire.cpp"
$File "c_particle_smokegrenade.cpp"
$File "c_prop_vehicle.cpp"
$File "c_recipientfilter.cpp"
$File "c_smoke_trail.cpp"
$File "c_smokestack.cpp"
$File "c_steamjet.cpp"
$File "c_stickybolt.cpp"
$File "c_te.cpp"
$File "c_te_armorricochet.cpp"
$File "c_te_basebeam.cpp"
$File "c_te_beamentpoint.cpp"
$File "c_te_beaments.cpp"
$File "c_te_beamfollow.cpp"
$File "c_te_beamlaser.cpp"
$File "c_te_beampoints.cpp"
$File "c_te_beamring.cpp"
$File "c_te_beamringpoint.cpp"
$File "c_te_beamspline.cpp"
$File "c_te_bloodsprite.cpp"
$File "c_te_bloodstream.cpp"
$File "c_te_breakmodel.cpp"
$File "c_te_bspdecal.cpp"
$File "c_te_bubbles.cpp"
$File "c_te_bubbletrail.cpp"
$File "c_te_clientprojectile.cpp"
$File "c_te_decal.cpp"
$File "c_te_dynamiclight.cpp"
$File "c_te_effect_dispatch.cpp"
$File "c_te_energysplash.cpp"
$File "c_te_explosion.cpp"
$File "c_te_fizz.cpp"
$File "c_te_footprint.cpp"
$File "c_te_glassshatter.cpp"
$File "c_te_glowsprite.cpp"
$File "c_te_impact.cpp"
$File "c_te_killplayerattachments.cpp"
$File "c_te_largefunnel.cpp"
$File "c_te_legacytempents.cpp"
$File "c_te_muzzleflash.cpp"
$File "c_te_particlesystem.cpp"
$File "c_te_physicsprop.cpp"
$File "c_te_playerdecal.cpp"
$File "c_te_projecteddecal.cpp"
$File "c_te_showline.cpp"
$File "c_te_smoke.cpp"
$File "c_te_sparks.cpp"
$File "c_te_sprite.cpp"
$File "c_te_spritespray.cpp"
$File "c_te_worlddecal.cpp"
$File "c_testtraceline.cpp"
$File "c_tracer.cpp"
$File "fx.cpp"
$File "fx_discreetline.cpp"
$File "fx_envelope.cpp"
$File "fx_line.cpp"
$File "fx_sparks.cpp"
$File "particlesphererenderer.cpp"
$File "smoke_fog_overlay.cpp"
}
$Folder "game_controls"
{
$File "game_controls\baseviewport.cpp"
$File "game_controls\basemodelpanel.cpp"
$File "game_controls\basemodelpanel.h"
$File "game_controls\basemodel_panel.cpp"
$File "game_controls\basemodel_panel.h"
$File "game_controls\ClientScoreBoardDialog.cpp"
$File "game_controls\commandmenu.cpp"
$File "game_controls\intromenu.cpp"
$File "game_controls\MapOverview.cpp"
$File "game_controls\NavProgress.cpp"
$File "game_controls\SpectatorGUI.cpp"
$File "game_controls\teammenu.cpp"
$File "game_controls\vguitextwindow.cpp"
$File "game_controls\IconPanel.cpp"
}
}
$Folder "MP3" [$WIN32||$POSIX]
{
$File "mp3player.cpp"
$File "mp3player.h"
}
$Folder "Tool Framework"
{
$File "$SRCDIR\public\tools\bonelist.cpp"
$File "$SRCDIR\public\tools\bonelist.h"
$File "entity_client_tools.cpp"
$File "toolframework_client.cpp"
$File "toolframework_client.h"
}
$Folder "Header Files"
{
$File "animationlayer.h"
$File "baseanimatedtextureproxy.h"
$File "baseclientrendertargets.h"
$File "beamdraw.h"
$File "bone_merge_cache.h"
$File "c_ai_basenpc.h"
$File "c_baseanimating.h"
$File "c_baseanimatingoverlay.h"
$File "c_basecombatcharacter.h"
$File "c_basecombatweapon.h"
$File "c_basedoor.h"
$File "c_baseentity.h"
$File "c_baseflex.h"
$File "c_baseplayer.h"
$File "c_basetempentity.h"
$File "c_baseviewmodel.h"
$File "c_breakableprop.h"
$File "c_effects.h"
$File "c_entitydissolve.h"
$File "c_env_fog_controller.h"
$File "c_fire_smoke.h"
$File "c_func_dust.h"
$File "c_func_reflective_glass.h"
$File "c_gib.h"
$File "c_impact_effects.h"
$File "c_physbox.h"
$File "c_physicsprop.h"
$File "c_pixel_visibility.h"
$File "c_playerlocaldata.h"
$File "c_playerresource.h"
$File "c_point_camera.h"
$File "c_prop_vehicle.h"
$File "c_recipientfilter.h"
$File "c_rope.h"
$File "c_rumble.h"
$File "c_sceneentity.h"
$File "c_smoke_trail.h"
$File "c_soundscape.h"
$File "c_sprite.h"
$File "c_sun.h"
$File "c_te_basebeam.h"
$File "c_te_effect_dispatch.h"
$File "c_te_legacytempents.h"
$File "c_te_particlesystem.h"
$File "c_team.h"
$File "c_tesla.h"
$File "c_tracer.h"
$File "c_vehicle_jeep.h"
$File "c_user_message_register.h"
$File "c_vguiscreen.h"
$File "c_weapon__stubs.h"
$File "c_world.h"
$File "cbase.h"
$File "cdll_client_int.h"
$File "cdll_util.h"
$File "cl_animevent.h"
$File "cl_mat_stub.h"
$File "client_factorylist.h"
$File "client_thinklist.h"
$File "clienteffectprecachesystem.h"
$File "cliententitylist.h"
$File "clientleafsystem.h"
$File "clientmode.h"
$File "clientmode_shared.h"
$File "clientsideeffects.h"
$File "colorcorrectionmgr.h"
$File "detailobjectsystem.h"
$File "enginesprite.h"
$File "flashlighteffect.h"
$File "fontabc.h"
$File "functionproxy.h"
$File "fx.h"
$File "fx_blood.h"
$File "fx_discreetline.h"
$File "fx_envelope.h"
$File "fx_explosion.h"
$File "fx_fleck.h"
$File "fx_impact.h"
$File "fx_interpvalue.h"
$File "fx_line.h"
$File "fx_quad.h"
$File "fx_sparks.h"
$File "fx_staticline.h"
$File "fx_trail.h"
$File "fx_water.h"
$File "$SRCDIR\game\shared\GameEventListener.h"
$File "glow_outline_effect.h"
$File "glow_overlay.h"
$File "$SRCDIR\game\shared\hintmessage.h"
$File "$SRCDIR\game\shared\hintsystem.h"
$File "history_resource.h"
$File "hltvcamera.h"
$File "hud.h"
$File "hud_basechat.h"
$File "hud_basetimer.h"
$File "hud_bitmapnumericdisplay.h"
$File "hud_chat.h"
$File "hud_closecaption.h"
$File "hud_crosshair.h"
$File "hud_element_helper.h"
$File "hud_lcd.h"
$File "hud_macros.h"
$File "hud_numericdisplay.h"
$File "hud_pdump.h"
$File "basepresence.h"
$File "hud_vehicle.h"
$File "hudelement.h"
$File "hudtexturehandle.h"
$File "iclassmap.h"
$File "icliententityinternal.h"
$File "iclientmode.h"
$File "iclientshadowmgr.h"
$File "iclientvehicle.h"
$File "iconsole.h"
$File "idebugoverlaypanel.h"
$File "ifpspanel.h"
$File "$SRCDIR\game\shared\econ\ihasowner.h"
$File "ihudlcd.h"
$File "ipresence.h"
$File "iinput.h"
$File "iloadingdisc.h"
$File "imessagechars.h"
$File "in_main.h"
$File "inetgraphpanel.h"
$File "initializer.h"
$File "input.h"
$File "interpolatedvar.h"
$File "iprofiling.h"
$File "itextmessage.h"
$File "ivieweffects.h"
$File "iviewrender.h"
$File "iviewrender_beams.h"
$File "ivmodemanager.h"
$File "kbutton.h"
$File "$SRCDIR\common\language.h"
$File "lerp_functions.h"
$File "menu.h"
$File "movehelper_client.h"
$File "mumble.h"
$File "networkstringtable_clientdll.h"
$File "panelmetaclassmgr.h"
$File "particle_collision.h"
$File "particle_iterators.h"
$File "particle_litsmokeemitter.h"
$File "particle_prototype.h"
$File "particle_simple3d.h"
$File "particle_util.h"
$File "particledraw.h"
$File "particlemgr.h"
$File "particles_attractor.h"
$File "particles_ez.h"
$File "particles_localspace.h"
$File "particles_new.h"
$File "particles_simple.h"
$File "particlesphererenderer.h"
$File "perfvisualbenchmark.h"
$File "physics.h"
$File "physpropclientside.h"
$File "playerandobjectenumerator.h"
$File "playerenumerator.h"
$File "playerspawncache.h"
$File "prediction.h"
$File "prediction_private.h"
$File "proxyentity.h"
$File "ragdoll.h"
$File "ragdollexplosionenumerator.h"
$File "recvproxy.h"
$File "rendertexture.h"
$File "ScreenSpaceEffects.h"
$File "simple_keys.h"
$File "smoke_fog_overlay.h"
$File "splinepatch.h"
$File "$SRCDIR\public\steam\steam_api.h"
$File "TeamBitmapImage.h"
$File "tempent.h"
$File "text_message.h"
$File "timedevent.h"
$File "toggletextureproxy.h"
$File "vgui_basepanel.h"
$File "vgui_bitmapbutton.h"
$File "vgui_bitmapimage.h"
$File "vgui_bitmappanel.h"
$File "vgui_schemevisualizer.h"
$File "vgui_entityimagepanel.h"
$File "vgui_entitypanel.h"
$File "vgui_grid.h"
$File "vgui_helpers.h"
$File "vgui_imagehealthpanel.h"
$File "vgui_int.h"
$File "vguicenterprint.h"
$File "view.h"
$File "view_scene.h"
$File "viewangleanim.h"
$File "ViewConeImage.h"
$File "viewrender.h"
$File "weapon_selection.h"
$File "weapons_resource.h"
$File "vgui_video.h"
$File "vgui_video_player.h"
}
$Folder "Public Header Files"
{
$File "$SRCDIR\public\mathlib\amd3dx.h"
$File "$SRCDIR\public\vgui_controls\AnimationController.h"
$File "$SRCDIR\public\basehandle.h"
$File "$SRCDIR\public\tier0\basetypes.h"
$File "$SRCDIR\public\tier1\bitbuf.h"
$File "$SRCDIR\public\bitvec.h"
$File "$SRCDIR\public\bone_accessor.h"
$File "$SRCDIR\public\bone_setup.h"
$File "$SRCDIR\public\bspfile.h"
$File "$SRCDIR\public\bspflags.h"
$File "$SRCDIR\public\bsptreedata.h"
$File "$SRCDIR\public\mathlib\bumpvects.h"
$File "$SRCDIR\public\vgui_controls\Button.h"
$File "$SRCDIR\public\cdll_int.h"
$File "$SRCDIR\public\tier1\characterset.h"
$File "$SRCDIR\public\tier1\checksum_md5.h"
$File "$SRCDIR\public\client_class.h"
$File "$SRCDIR\public\client_render_handle.h"
$File "$SRCDIR\public\client_textmessage.h"
$File "$SRCDIR\public\clientstats.h"
$File "$SRCDIR\public\cmodel.h"
$File "$SRCDIR\public\vphysics\collision_set.h"
$File "$SRCDIR\public\collisionutils.h"
$File "$SRCDIR\public\Color.h"
$File "$SRCDIR\public\vgui_controls\ComboBox.h"
$File "$SRCDIR\public\tier0\commonmacros.h"
$File "$SRCDIR\public\mathlib\compressed_light_cube.h"
$File "$SRCDIR\public\mathlib\compressed_vector.h"
$File "$SRCDIR\public\con_nprint.h"
$File "$SRCDIR\public\const.h"
$File "$SRCDIR\public\vphysics\constraints.h"
$File "$SRCDIR\public\vgui_controls\Controls.h"
$File "$SRCDIR\public\tier1\convar.h"
$File "$SRCDIR\public\coordsize.h"
$File "$SRCDIR\public\crtmemdebug.h"
$File "$SRCDIR\public\vgui\Cursor.h"
$File "$SRCDIR\public\vgui\Dar.h"
$File "$SRCDIR\public\datamap.h"
$File "$SRCDIR\public\tier0\dbg.h"
$File "$SRCDIR\public\dlight.h"
$File "$SRCDIR\public\dt_common.h"
$File "$SRCDIR\public\dt_recv.h"
$File "$SRCDIR\public\dt_send.h"
$File "$SRCDIR\public\dt_utlvector_common.h"
$File "$SRCDIR\public\dt_utlvector_recv.h"
$File "$SRCDIR\public\edict.h"
$File "$SRCDIR\public\vgui_controls\EditablePanel.h"
$File "$SRCDIR\public\tier0\fasttimer.h"
$File "$SRCDIR\public\filesystem.h"
$File "$SRCDIR\public\filesystem_helpers.h"
$File "$SRCDIR\public\tier1\fmtstr.h"
$File "$SRCDIR\public\vgui_controls\FocusNavGroup.h"
$File "$SRCDIR\public\vphysics\friction.h"
$File "$SRCDIR\public\gamebspfile.h"
$File "$SRCDIR\public\gametrace.h"
$File "$SRCDIR\public\globalvars_base.h"
$File "$SRCDIR\public\vgui_controls\HTML.h"
$File "$SRCDIR\public\iachievementmgr.h"
$File "$SRCDIR\public\appframework\IAppSystem.h"
$File "$SRCDIR\public\icliententity.h"
$File "$SRCDIR\public\icliententitylist.h"
$File "$SRCDIR\public\engine\IClientLeafSystem.h"
$File "$SRCDIR\public\iclientnetworkable.h"
$File "$SRCDIR\public\vgui\IClientPanel.h"
$File "$SRCDIR\public\iclientrenderable.h"
$File "$SRCDIR\public\game\client\iclientrendertargets.h"
$File "$SRCDIR\public\iclientthinkable.h"
$File "$SRCDIR\public\iclientunknown.h"
$File "$SRCDIR\public\engine\ICollideable.h"
$File "$SRCDIR\public\tier0\icommandline.h"
$File "$SRCDIR\public\icvar.h"
$File "$SRCDIR\public\iefx.h"
$File "$SRCDIR\public\engine\IEngineSound.h"
$File "$SRCDIR\public\engine\IEngineTrace.h"
$File "$SRCDIR\public\ienginevgui.h"
$File "$SRCDIR\public\igameevents.h"
$File "$SRCDIR\public\igameresources.h"
$File "$SRCDIR\public\IGameUIFuncs.h"
$File "$SRCDIR\public\ihandleentity.h"
$File "$SRCDIR\public\vgui\IHTML.h"
$File "$SRCDIR\public\vgui\IImage.h"
$File "$SRCDIR\public\vgui\IInput.h"
$File "$SRCDIR\public\vgui\IInputInternal.h"
$File "$SRCDIR\public\vstdlib\IKeyValuesSystem.h"
$File "$SRCDIR\public\vgui\ILocalize.h"
$File "$SRCDIR\public\vgui_controls\Image.h"
$File "$SRCDIR\public\vgui_controls\ImageList.h"
$File "$SRCDIR\public\vgui_controls\ImagePanel.h"
$File "$SRCDIR\public\imapoverview.h"
$File "$SRCDIR\public\materialsystem\imaterial.h"
$File "$SRCDIR\public\materialsystem\imaterialproxy.h"
$File "$SRCDIR\public\materialsystem\imaterialsystem.h"
$File "$SRCDIR\public\materialsystem\imaterialsystemhardwareconfig.h"
$File "$SRCDIR\public\materialsystem\imaterialsystemstub.h"
$File "$SRCDIR\public\materialsystem\imaterialvar.h"
$File "$SRCDIR\public\VGuiMatSurface\IMatSystemSurface.h"
$File "$SRCDIR\public\materialsystem\imesh.h"
$File "$SRCDIR\public\inetchannelinfo.h"
$File "$SRCDIR\public\tier1\interface.h"
$File "$SRCDIR\public\interpolatortypes.h"
$File "$SRCDIR\public\vgui\IPanel.h"
$File "$SRCDIR\public\iprediction.h"
$File "$SRCDIR\public\irecipientfilter.h"
$File "$SRCDIR\public\isaverestore.h"
$File "$SRCDIR\public\vgui\IScheme.h"
$File "$SRCDIR\public\iscratchpad3d.h"
$File "$SRCDIR\public\iserverentity.h"
$File "$SRCDIR\public\iservernetworkable.h"
$File "$SRCDIR\public\iserverunknown.h"
$File "$SRCDIR\public\engine\ishadowmgr.h"
$File "$SRCDIR\public\SoundEmitterSystem\isoundemittersystembase.h"
$File "$SRCDIR\public\ispatialpartition.h"
$File "$SRCDIR\public\engine\IStaticPropMgr.h"
$File "$SRCDIR\public\istudiorender.h"
$File "$SRCDIR\public\vgui\ISurface.h"
$File "$SRCDIR\public\vgui\ISystem.h"
$File "$SRCDIR\public\materialsystem\itexture.h"
$File "$SRCDIR\public\engine\ivdebugoverlay.h"
$File "$SRCDIR\public\vgui\IVGui.h"
$File "$SRCDIR\public\ivguicenterprint.h"
$File "$SRCDIR\public\game\client\iviewport.h"
$File "$SRCDIR\public\engine\ivmodelinfo.h"
$File "$SRCDIR\public\engine\ivmodelrender.h"
$File "$SRCDIR\public\ivrenderview.h"
$File "$SRCDIR\public\jigglebones.h"
$File "$SRCDIR\public\vgui\KeyCode.h"
$File "$SRCDIR\public\tier1\KeyValues.h"
$File "$SRCDIR\public\tier0\l2cache.h"
$File "$SRCDIR\public\vgui_controls\Label.h"
$File "$SRCDIR\public\vgui_controls\ListPanel.h"
$File "$SRCDIR\public\mathlib\mathlib.h"
$File "$SRCDIR\public\tier0\mem.h"
$File "$SRCDIR\public\tier0\memalloc.h"
$File "$SRCDIR\public\tier0\memdbgoff.h"
$File "$SRCDIR\public\tier0\memdbgon.h"
$File "$SRCDIR\public\tier1\mempool.h"
$File "$SRCDIR\public\vgui_controls\Menu.h"
$File "$SRCDIR\public\vgui_controls\MenuItem.h"
$File "$SRCDIR\public\vgui_controls\MessageMap.h"
$File "$SRCDIR\public\model_types.h"
$File "$SRCDIR\public\vgui\MouseCode.h"
$File "$SRCDIR\public\mouthinfo.h"
$File "$SRCDIR\public\networkstringtabledefs.h"
$File "$SRCDIR\public\networkvar.h"
$File "$SRCDIR\public\vphysics\object_hash.h"
$File "$SRCDIR\public\overlaytext.h"
$File "$SRCDIR\public\vgui_controls\Panel.h"
$File "$SRCDIR\public\vgui_controls\PanelAnimationVar.h"
$File "$SRCDIR\public\vgui_controls\PanelListPanel.h"
$File "$SRCDIR\public\vgui_controls\PHandle.h"
$File "$SRCDIR\public\pixelwriter.h"
$File "$SRCDIR\public\tier0\platform.h"
$File "$SRCDIR\public\PlayerState.h"
$File "$SRCDIR\public\tier1\processor_detect.h"
$File "$SRCDIR\public\tier0\protected_things.h"
$File "$SRCDIR\public\mathlib\polyhedron.h"
$File "$SRCDIR\public\r_efx.h"
$File "$SRCDIR\public\vstdlib\random.h"
$File "$SRCDIR\public\tier1\rangecheckedvar.h"
$File "$SRCDIR\public\renamed_recvtable_compat.h"
$File "$SRCDIR\public\vgui_controls\RichText.h"
$File "$SRCDIR\public\rope_physics.h"
$File "$SRCDIR\public\rope_shared.h"
$File "$SRCDIR\public\saverestoretypes.h"
$File "$SRCDIR\public\scratchpad3d.h"
$File "$SRCDIR\public\ScratchPadUtils.h"
$File "$SRCDIR\public\vgui_controls\ScrollBar.h"
$File "$SRCDIR\public\vgui_controls\SectionedListPanel.h"
$File "$SRCDIR\public\sentence.h"
$File "$SRCDIR\public\server_class.h"
$File "$SRCDIR\public\shake.h"
$File "$SRCDIR\public\shattersurfacetypes.h"
$File "$SRCDIR\public\simple_physics.h"
$File "$SRCDIR\public\tier1\smartptr.h"
$File "$SRCDIR\public\soundchars.h"
$File "$SRCDIR\public\soundflags.h"
$File "$SRCDIR\public\soundinfo.h"
$File "$SRCDIR\public\string_t.h"
$File "$SRCDIR\public\tier1\stringpool.h"
$File "$SRCDIR\public\stringregistry.h"
$File "$SRCDIR\public\tier1\strtools.h"
$File "$SRCDIR\public\studio.h"
$File "$SRCDIR\public\surfinfo.h"
$File "$SRCDIR\public\vgui_controls\TextEntry.h"
$File "$SRCDIR\public\vgui_controls\TextImage.h"
$File "$SRCDIR\public\texture_group_names.h"
$File "$SRCDIR\public\vgui_controls\TreeView.h"
$File "$SRCDIR\public\tier1\utlbidirectionalset.h"
$File "$SRCDIR\public\tier1\utlbuffer.h"
$File "$SRCDIR\public\tier1\utldict.h"
$File "$SRCDIR\public\tier1\utlfixedmemory.h"
$File "$SRCDIR\public\tier1\utlhash.h"
$File "$SRCDIR\public\tier1\utllinkedlist.h"
$File "$SRCDIR\public\tier1\utlmap.h"
$File "$SRCDIR\public\tier1\utlmemory.h"
$File "$SRCDIR\public\tier1\utlmultilist.h"
$File "$SRCDIR\public\tier1\utlpriorityqueue.h"
$File "$SRCDIR\public\tier1\utlqueue.h"
$File "$SRCDIR\public\tier1\utlrbtree.h"
$File "$SRCDIR\public\tier1\utlstack.h"
$File "$SRCDIR\public\tier1\utlsymbol.h"
$File "$SRCDIR\public\tier1\utlvector.h"
$File "$SRCDIR\public\vallocator.h"
$File "$SRCDIR\public\vcollide.h"
$File "$SRCDIR\public\vcollide_parse.h"
$File "$SRCDIR\public\mathlib\vector.h"
$File "$SRCDIR\public\mathlib\vector2d.h"
$File "$SRCDIR\public\mathlib\vector4d.h"
$File "$SRCDIR\public\vgui\VGUI.h"
$File "$SRCDIR\public\view_shared.h"
$File "$SRCDIR\public\mathlib\vmatrix.h"
$File "$SRCDIR\public\vphysics_interface.h"
$File "$SRCDIR\public\mathlib\vplane.h"
$File "$SRCDIR\public\tier0\vprof.h"
$File "$SRCDIR\public\vstdlib\vstdlib.h"
$File "$SRCDIR\public\vtf\vtf.h"
$File "$SRCDIR\public\vgui_controls\WizardPanel.h"
$File "$SRCDIR\public\vgui_controls\WizardSubPanel.h"
$File "$SRCDIR\public\worldsize.h"
$File "$SRCDIR\public\zip_uncompressed.h"
//Haptics
$File "$SRCDIR\public\haptics\ihaptics.h" [$WIN32]
$File "$SRCDIR\public\haptics\haptic_utils.h" [$WIN32]
}
$Folder "Game Shared Header Files"
{
$File "$SRCDIR\game\shared\activitylist.h"
$File "$SRCDIR\game\shared\ai_activity.h"
$File "$SRCDIR\game\shared\ai_debug_shared.h"
$File "$SRCDIR\game\shared\ammodef.h"
$File "$SRCDIR\game\shared\animation.h"
$File "$SRCDIR\game\shared\apparent_velocity_helper.h"
$File "$SRCDIR\game\shared\base_playeranimstate.h"
$File "$SRCDIR\game\shared\baseentity_shared.h"
$File "$SRCDIR\game\shared\basegrenade_shared.h"
$File "$SRCDIR\game\shared\hl2\basehlcombatweapon_shared.h"
$File "$SRCDIR\game\shared\baseparticleentity.h"
$File "$SRCDIR\game\shared\baseplayer_shared.h"
$File "$SRCDIR\game\shared\baseviewmodel_shared.h"
$File "$SRCDIR\game\shared\beam_flags.h"
$File "$SRCDIR\game\shared\beam_shared.h"
$File "$SRCDIR\game\shared\choreoactor.h"
$File "$SRCDIR\game\shared\choreochannel.h"
$File "$SRCDIR\game\shared\choreoevent.h"
$File "$SRCDIR\game\shared\choreoscene.h"
$File "$SRCDIR\game\shared\collisionproperty.h"
$File "$SRCDIR\game\shared\death_pose.h"
$File "$SRCDIR\game\shared\decals.h"
$File "$SRCDIR\game\shared\effect_color_tables.h"
$File "$SRCDIR\game\shared\effect_dispatch_data.h"
$File "$SRCDIR\game\shared\ehandle.h"
$File "$SRCDIR\game\shared\entitydatainstantiator.h"
$File "$SRCDIR\game\shared\entitylist_base.h"
$File "$SRCDIR\game\shared\entityparticletrail_shared.h"
$File "$SRCDIR\game\shared\env_detail_controller.h"
$File "$SRCDIR\game\shared\env_wind_shared.h"
$File "$SRCDIR\game\shared\eventlist.h"
$File "$SRCDIR\game\shared\func_dust_shared.h"
$File "$SRCDIR\game\shared\func_ladder.h"
$File "$SRCDIR\game\shared\gameeventdefs.h"
$File "$SRCDIR\game\shared\gamemovement.h"
$File "$SRCDIR\game\shared\gamerules.h"
$File "$SRCDIR\game\shared\gamerules_register.h"
$File "$SRCDIR\game\shared\gamestats.h"
$File "$SRCDIR\game\shared\gamestringpool.h"
$File "$SRCDIR\game\shared\gamevars_shared.h"
$File "$SRCDIR\game\shared\groundlink.h"
$File "$SRCDIR\game\shared\hl2\hl2_player_shared.h"
$File "$SRCDIR\game\shared\hl2\hl_movedata.h"
$File "$SRCDIR\game\shared\ichoreoeventcallback.h"
$File "$SRCDIR\game\shared\IEffects.h"
$File "$SRCDIR\game\shared\igamemovement.h"
$File "$SRCDIR\game\shared\igamesystem.h"
$File "$SRCDIR\game\shared\imovehelper.h"
$File "$SRCDIR\game\shared\in_buttons.h"
$File "$SRCDIR\game\shared\interval.h"
$File "$SRCDIR\game\shared\iplayeranimstate.h"
$File "$SRCDIR\game\shared\ipredictionsystem.h"
$File "$SRCDIR\game\shared\itempents.h"
$File "$SRCDIR\game\shared\IVehicle.h"
$File "$SRCDIR\game\shared\mapdata_shared.h"
$File "$SRCDIR\game\shared\mapentities_shared.h"
$File "$SRCDIR\game\shared\movevars_shared.h"
$File "$SRCDIR\game\shared\multiplay_gamerules.h"
$File "$SRCDIR\game\shared\npcevent.h"
$File "$SRCDIR\game\shared\obstacle_pushaway.h"
$File "$SRCDIR\game\shared\physics_saverestore.h"
$File "$SRCDIR\game\shared\physics_shared.h"
$File "$SRCDIR\game\shared\playernet_vars.h"
$File "$SRCDIR\game\shared\point_posecontroller.h"
$File "$SRCDIR\game\shared\positionwatcher.h"
$File "$SRCDIR\game\shared\precache_register.h"
$File "$SRCDIR\game\shared\precipitation_shared.h"
$File "$SRCDIR\game\shared\predictable_entity.h"
$File "$SRCDIR\game\shared\predictableid.h"
$File "$SRCDIR\game\shared\predictioncopy.h"
$File "$SRCDIR\game\shared\ragdoll_shared.h"
$File "$SRCDIR\game\shared\rope_helpers.h"
$File "$SRCDIR\game\shared\saverestore.h"
$File "$SRCDIR\game\shared\saverestore_bitstring.h"
$File "$SRCDIR\game\shared\saverestore_utlclass.h"
$File "$SRCDIR\game\shared\saverestore_utlsymbol.h"
$File "$SRCDIR\game\shared\saverestore_utlvector.h"
$File "$SRCDIR\game\shared\sceneentity_shared.h"
$File "$SRCDIR\game\shared\scriptevent.h"
$File "$SRCDIR\game\shared\sequence_Transitioner.h"
$File "$SRCDIR\game\shared\shared_classnames.h"
$File "$SRCDIR\game\shared\shareddefs.h"
$File "$SRCDIR\game\shared\sharedInterface.h"
$File "$SRCDIR\game\shared\sheetsimulator.h"
$File "$SRCDIR\game\shared\shot_manipulator.h"
$File "$SRCDIR\game\shared\simtimer.h"
$File "$SRCDIR\game\shared\singleplay_gamerules.h"
$File "$SRCDIR\game\shared\smoke_fog_overlay_shared.h"
$File "$SRCDIR\game\shared\solidsetdefaults.h"
$File "$SRCDIR\game\shared\soundenvelope.h"
$File "$SRCDIR\game\shared\Sprite.h"
$File "$SRCDIR\game\shared\SpriteTrail.h"
$File "$SRCDIR\game\shared\sun_shared.h"
$File "$SRCDIR\game\shared\takedamageinfo.h"
$File "$SRCDIR\game\shared\teamplay_gamerules.h"
$File "$SRCDIR\game\shared\teamplayroundbased_gamerules.h"
$File "$SRCDIR\game\shared\tempentity.h"
$File "$SRCDIR\game\shared\touchlink.h"
$File "$SRCDIR\game\shared\usercmd.h"
$File "$SRCDIR\game\shared\usermessages.h"
$File "$SRCDIR\game\shared\util_shared.h"
$File "$SRCDIR\game\shared\vehicle_choreo_generic_shared.h"
$File "$SRCDIR\game\shared\vehicle_viewblend_shared.h"
$File "$SRCDIR\game\shared\vgui_defaultinputsignal.h"
$File "$SRCDIR\game\shared\viewport_panel_names.h"
$File "$SRCDIR\game\shared\voice_banmgr.h"
$File "$SRCDIR\game\shared\voice_common.h"
$File "$SRCDIR\game\shared\voice_gamemgr.h"
$File "$SRCDIR\game\shared\voice_status.h"
$File "$SRCDIR\game\shared\vphysics_sound.h"
$File "$SRCDIR\game\shared\weapon_parse.h"
$File "$SRCDIR\game\shared\weapon_proficiency.h"
$File "$SRCDIR\game\shared\weapon_ifmsteadycam.h"
$File "$SRCDIR\game\shared\mp_shareddefs.h"
}
$Folder "game_controls Header Files"
{
$File "game_controls\baseviewport.h"
$File "game_controls\clientscoreboarddialog.h"
$File "game_controls\commandmenu.h"
$File "game_controls\imagemouseoverbutton.h"
$File "game_controls\intromenu.h"
$File "game_controls\mapoverview.h"
$File "game_controls\mouseoverhtmlbutton.h"
$File "game_controls\mouseoverpanelbutton.h"
$File "game_controls\spectatorgui.h"
$File "game_controls\teammenu.h"
$File "game_controls\vguitextwindow.h"
$File "game_controls\IconPanel.h"
}
$Folder "Link Libraries"
{
$Lib bitmap
$Lib choreoobjects
$Lib dmxloader
$Lib mathlib
$Lib matsys_controls
$Lib particles
$Lib tier1
$Lib tier2
$Lib tier3
$Lib vgui_controls
$Lib vtf
$ImpLib steam_api
$Libexternal $LIBCOMMON/libcrypto [$OSXALL]
$Libexternal "$SRCDIR\lib\common\$(CRYPTOPPDIR)\libcrypto" [$LINUXALL]
$ImpLib "$LIBCOMMON\curl" [$OSXALL]
$Lib "$LIBCOMMON\libcurl" [$WIN32]
$Lib "libz" [$WIN32]
$Libexternal libz [$LINUXALL]
$Libexternal "$LIBCOMMON/libcurl" [$LINUXALL]
$Libexternal "$LIBCOMMON/libcurlssl" [$LINUXALL]
$Libexternal "$SRCDIR\lib\common\$(CRYPTOPPDIR)\libssl" [$LINUXALL]
}
}
|
This invention relates to a tape measure capable to be uncoiled and coiled.
Tape measures, which are stored coiled in a housing and pulled out therefrom for the measuring operation while the tape measure is uncoiled from a reel or the like in the housing, so-called number meters, are well-known. The tape measure, in order to have a certain self-supporting capacity in pulled-out state, in the horizontal plane, is made of metal and has a curved cross-sectional shape.
A conventional tape measure of this kind is self-supporting when the length pulled out is shorter than about 1 m. When the length pulled out is longer, a fold is formed in the tape transverse to its longitudinal direction. When the housing or the tape are treated with slight incautiousness, said self-supporting length is only about 0.5 m. These stated lengths, of course, vary from one case to another. It is, however, a very great disadvantage that the tape cannot be pulled out to its entire length, which most often is 2 m or longer, without giving rise to fold formation in the tape. The said disadvantage implies above all, that measurements of a length exceeding that at which the tape is self-supporting, are carried out with great difficulty. |
NMR methods for metabolomics of mammalian cell culture bioreactors.
Metabolomics has become an important tool for measuring pools of small molecules in mammalian cell cultures expressing therapeutic proteins. NMR spectroscopy has played an important role, largely because it requires minimal sample preparation, does not require chromatographic separation, and is quantitative. The concentrations of large numbers of small molecules in the extracellular media or within the cells themselves can be measured directly on the culture supernatant and on the supernatant of the lysed cells, respectively, and correlated with endpoints such as titer, cell viability, or glycosylation patterns. The observed changes can be used to generate hypotheses by which these parameters can be optimized. This chapter focuses on the sample preparation, data acquisition, and analysis to get the most out of NMR metabolomics data from CHO cell cultures but could easily be extended to other in vitro culture systems. |
Keep your energy up until the finish line with Clifbar's Clif Shot Energy Gels. This 24 Pack of energy gels are quickly digested and deliver new carbohydrates to your body within two to ten minutes of consumption. Packed with simple and complex carbs, the Clif Shot Energy Gels also deliver much needed electrolytes to your blood. Filled with essentials like sodium, potassium, and magnesium, these gels help you stay hydrated and keep your muscles pumping until you're done with them. |
Ulster Footballer of the Year
The Ulster Footballer of the Year is the older of two association football player of the year awards in Northern Ireland. (The other is the Northern Ireland Football Writers' Association award.) It is awarded by Castlereagh Glentoran Supporters' Club to the player who is adjudged by an independent committee to have been the best of the season in the IFA Premiership. The award has been presented since the 1950–51 season, when the inaugural winner was Kevin McGarry of Cliftonville. The current holder of the award is Jamie Mulgrew, of Linfield. Glenn Ferguson has won the award most often: on three separate occasions.
Winners
Breakdown of winners by club
References
Category:Association footballers in Northern Ireland
Northern Ireland
Category:Annual events in Northern Ireland
Category:1951 establishments in Northern Ireland
Category:Awards established in 1951
Category:Awards of Northern Ireland
Category:Annual sporting events in the United Kingdom
Category:Association football player non-biographical articles |
Rappahannock River (New Zealand)
The Rappahannock River is a river of the Tasman Region of New Zealand's South Island. It flows predominantly north from its sources east of Maruia, reaching the Warwick River five kilometres from the latter's outflow into the Maruia River.
See also
List of rivers of New Zealand
References
Category:Rivers of the Tasman District
Category:Rivers of New Zealand |
// Copyright 2016 The Bazel Authors. All rights reserved.
//
// Licensed under the Apache License, Version 2.0 (the "License");
// you may not use this file except in compliance with the License.
// You may obtain a copy of the License at
//
// http://www.apache.org/licenses/LICENSE-2.0
//
// Unless required by applicable law or agreed to in writing, software
// distributed under the License is distributed on an "AS IS" BASIS,
// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
// See the License for the specific language governing permissions and
// limitations under the License.
package com.google.devtools.build.lib.rules.android;
import com.google.devtools.build.lib.actions.Artifact;
import com.google.devtools.build.lib.analysis.TransitiveInfoCollection;
import com.google.devtools.build.lib.collect.nestedset.Depset;
import com.google.devtools.build.lib.collect.nestedset.NestedSet;
import com.google.devtools.build.lib.collect.nestedset.NestedSetBuilder;
import com.google.devtools.build.lib.packages.BuiltinProvider;
import com.google.devtools.build.lib.packages.NativeInfo;
import com.google.devtools.build.lib.starlarkbuildapi.android.AndroidLibraryResourceClassJarProviderApi;
import net.starlark.java.eval.EvalException;
/**
* A provider which contains the resource class jars from android_library rules. See {@link
* AndroidRuleClasses#ANDROID_RESOURCES_CLASS_JAR}.
*/
public final class AndroidLibraryResourceClassJarProvider extends NativeInfo
implements AndroidLibraryResourceClassJarProviderApi<Artifact> {
public static final Provider PROVIDER = new Provider();
private final NestedSet<Artifact> resourceClassJars;
private AndroidLibraryResourceClassJarProvider(NestedSet<Artifact> resourceClassJars) {
super(PROVIDER);
this.resourceClassJars = resourceClassJars;
}
public static AndroidLibraryResourceClassJarProvider create(
NestedSet<Artifact> resourceClassJars) {
return new AndroidLibraryResourceClassJarProvider(resourceClassJars);
}
public static AndroidLibraryResourceClassJarProvider getProvider(
TransitiveInfoCollection target) {
return (AndroidLibraryResourceClassJarProvider)
target.get(AndroidLibraryResourceClassJarProvider.PROVIDER.getKey());
}
@Override
public Depset /*<Artifact>*/ getResourceClassJarsForStarlark() {
return Depset.of(Artifact.TYPE, resourceClassJars);
}
public NestedSet<Artifact> getResourceClassJars() {
return resourceClassJars;
}
/** Provider class for {@link AndroidLibraryResourceClassJarProvider} objects. */
public static class Provider extends BuiltinProvider<AndroidLibraryResourceClassJarProvider>
implements AndroidLibraryResourceClassJarProviderApi.Provider<Artifact> {
private Provider() {
super(NAME, AndroidLibraryResourceClassJarProvider.class);
}
public String getName() {
return NAME;
}
@Override
public AndroidLibraryResourceClassJarProvider create(Depset jars) throws EvalException {
return new AndroidLibraryResourceClassJarProvider(
NestedSetBuilder.<Artifact>stableOrder()
.addTransitive(Depset.cast(jars, Artifact.class, "jars"))
.build());
}
}
}
|
Earl David Price
Officer Earl Price was struck and killed by a vehicle being operated by an intoxicated driver.
Officer Price was involved in a pursuit with a vehicle that ended in the suspect's vehicle crashing at 1:30 am. When Officer Price and his partner exited their patrol car to investigate, a 10-ton grain truck, which was being operated by an intoxicated driver, struck their patrol car pushing it into both officers. Officer Price was killed and his partner was injured, but recovered.
The driver of the grain truck was never charged because the state's attorney's office indicated they did not have sufficient evidence to prosecute on charges of driving under the influence or reckless homicide.
Officer Price had served with the Pawnee Police Department for 13 years. He was survived by his wife, son and daughter. |
Q:
Typescript break vs return behavior in recursive function
Below are two Typescript functions used to recursively walk a source file's abstract syntax tree (AST). I have managed to identify the problem that caused my program to only visit part of the tree, but I do not understand why the solution works.
The walkTree1 function is the valid solution that walks the entire tree. The walkTree2 function only visits part of the tree. The two functions differ only by one line (marked with comment), and obviously the return behavior ties into this somehow, but I didn't find anything useful online.
function walkTree1(firstNode: ts.SourceFile, visitor: (node: ts.Node) => void): void {
visitInterfacesRecursive(firstNode);
function visitInterfacesRecursive(node: ts.Node): void {
switch (node.kind) {
case ts.SyntaxKind.InterfaceDeclaration:
visitor(node); break; // correct
default:
ts.forEachChild(node, visitInterfacesRecursive);
}
}
}
function walkTree2(firstNode: ts.SourceFile, visitor: (node: ts.Node) => void): void {
visitInterfacesRecursive(firstNode);
function visitInterfacesRecursive(node: ts.Node): void {
switch (node.kind) {
case ts.SyntaxKind.InterfaceDeclaration:
return visitor(node); // offending change
default:
ts.forEachChild(node, visitInterfacesRecursive);
}
}
}
At long last, I am stumped. I feel like I'm missing something obvious here. I have inspected the generated source and there doesn't seem to be any surprises there (no real difference except type erasure). For now I'm posting the original code; if necessary I'll put together something more reproducible when I get home later.
Additional details:
node -v : v8.5.0
tsc -v : Version 2.3.4
ts.forEachChild source
A:
It's because ts.forEachChild() doesn't actually run over each child in all cases. From the linked source:
// Invokes a callback for each child of the given node. The 'cbNode' callback is invoked for all child nodes
// stored in properties. If a 'cbNodes' callback is specified, it is invoked for embedded arrays; otherwise,
// embedded arrays are flattened and the 'cbNode' callback is invoked for each element. If a callback returns
// a truthy value, iteration stops and that value is returned. Otherwise, undefined is returned.
So since you are returning visitor(node), it must sometimes be truthy. That can presumably happen at runtime even though you have declared visitor() as a void-returning function, I guess? (You've left out the particular visitor() you used, so I'm not sure) Since you don't care about the return value of visitor() it's best not to return it from visitInterfacesRecursive().
Hope that helps; good luck!
|
So begins a New York Times Sunday magazine story that features Hada Flores, a 22-year-old Houstonian of El Salvadoran origin who graduated from YES College Prep in 2003, went on to Stanford and has since returned to H-Town to teach at YES.
It’s the sort of inspiring story that we have come to expect from YES, an extraordinarily successful homegrown charter school that caters to predominantly poor, minority students. |
Article content continued
Photo by Sean Kilpatrick / THE CANADIAN PRESS
The downward trend will almost certainlycontinue next year, when the rebuilding team is once again expected to reside at or near the bottom of the NHL standings.
That is, unless tailgating catches on like we fully expect it will.
Now, going to a Senators game will be about much more than watching your team suffer through its growing pains. It will become a social event you’ll look forward to with great anticipation.
The team owner should be clicking his heels.
On Saturdays, you won’t head all the way out to Kanata at 5:30 p.m. You’ll get to CTC at noon, with grill, propane, beer, steaks, lawn chairs and drinking games.
You will also make sure to bring a designated driver.
If you’ve been to an NFL game, you know how good this is going to be. The Buffalo Bills have never won a Super Bowl — they’ve played a single playoff game in 19 years and haven’t hosted one since 1996 — and the lots around New Era Field in Orchard Park are among the best tailgating parties in the league.
Pittsburgh has great tailgating. So does New England, Chicago, Philadelphia, Cleveland, Kansas City and every other city in which we’ve attended a NFL game. The tradition is also big before U.S. college games, and we’ve also witnessed some great tailgating at Nassau Coliseum before Islanders games andtheWells Fargo Center prior to the Flyers taking the ice.
A friend suggested the Senators might not be so hyped about tailgating because it will mean fans don’t buy beer inside the building. But he doesn’t drink. On the contrary, if you have a few over the course of the afternoon, you’re not going to stop once you get inside the building for a live sporting event. You’re going to be fired up and you’re going to have a couple more. |
#A* -------------------------------------------------------------------
#B* This file contains source code for the PyMOL computer program
#C* copyright 1998-2000 by Warren Lyford Delano of DeLano Scientific.
#D* -------------------------------------------------------------------
#E* It is unlawful to modify or remove this copyright notice.
#F* -------------------------------------------------------------------
#G* Please see the accompanying LICENSE file for further information.
#H* -------------------------------------------------------------------
#I* Additional authors of this source file include:
#-*
#-*
#-*
#Z* -------------------------------------------------------------------
from chempy.models import Indexed
from chempy import Storage,Atom,Bond
#
# THIS MODULE IS OBSOLETE PLEASE DO NOT USE
#
import string
atNum = {
'H' : 1,
'C' : 6,
'N' : 7,
'O' : 8,
'F' : 9,
'P' : 15,
'S' : 16,
'Cl' : 17,
'Br' : 35,
'I' : 53,
}
class GMS(Storage):
def toList(self,model,runtyp='OPTIMIZE',exetyp='RUN',
gbasis='N31',ngauss=6,ndfunc=1,dirscf=1):
gmsList = []
# write header records
nzvar = (model.nAtom*3)-6
chg = 0
for a in model.atom:
chg = chg + a.formal_charge
chg = int(chg)
if chg==0:
icharg=''
diffsp=''
else:
icharg='ICHARG=%d' % chg
if chg<0:
diffsp='DIFFSP=.TRUE.'
else:
diffsp=''
gmsList.append(
" $CONTRL RUNTYP=%s COORD=UNIQUE EXETYP=%s NZVAR=%d %s $END\n" %
(runtyp,exetyp,nzvar,icharg))
if ndfunc>0:
gmsList.append(" $BASIS GBASIS=%s NGAUSS=%d NDFUNC=%d %s $END\n" %
(gbasis,ngauss,ndfunc,diffsp))
else:
gmsList.append(" $BASIS GBASIS=%s NGAUSS=%d %s $END\n",
(gbasis,ngauss,diffsp))
if dirscf:
gmsList.append(" $SCF DIRSCF=.TRUE. $END\n")
gmsList.append(" $DATA\n")
gmsList.append(model.molecule.title+" 6-31G* optimization\n")
gmsList.append("C1\n")
# write atom records in an ordering compatible with internal
# coordinate generation
c = 1
for z in model.get_internal_tuples():
a = model.atom[z[0]]
if not len(a.name):
name = a.symbol + "%02d"%c
else:
name = a.name
gmsList.append("%4s %5.2f %12.6f %12.6f %12.6f\n" %
(name,atNum[a.symbol],a.coord[0],
a.coord[1],a.coord[2]))
c = c + 1
gmsList.append(" $END\n")
gmsList.append(" $ZMAT DLC=.TRUE. AUTO=.TRUE. $END\n")
if runtyp=='OPTIMIZE':
gmsList.append(" $STATPT NPRT=-2 NPUN=-2 NSTEP=50 $END\n")
gmsList.append(" $ELPOT IEPOT=1 WHERE=PDC $END\n")
gmsList.append(" $PDC PTSEL=GEODESIC CONSTR=CHARGE $END\n")
return(gmsList)
|
In the aftermath of a disappointing day at Lake O’Hara, I had hopes for better luck on Day 3. My plan was to shoot sunrise at Moraine Lake, about a 20-25 minute drive from where I was staying at Lake Louise Village. The forecast was for mostly cloudy conditions, but I was hoping that I’d get lucky. As I made the drive, in the dark, down the winding Moraine Lake Road, I could see no stars when I glanced out the window. As a result, I expected no sunrise this morning.
There was some ambient light when I reached Moraine Lake itself, and because of the time I took to scout the location on Day 1 , I immediately headed to a spot along the lake shore, rather than climbing up to the rock pile, as many photographers automatically do. The sky was indeed mostly cloudy, but there was… |
Omega Updates
RISCWorld takes a brief look at Omega developments...
It's been some time since we did an update on the Omega in RISCWorld. As so much has happened over the last few months we thought it would be worth providing readers with a quick update on the current state of play from MicroDigital.
Networking
The first upgrade that we really should mention is the network card. This started shipping on the 17th of May this year to customers who had pre-ordered. The card was on show at Wakefield on the Liquid Silicon stand and was working perfectly. One of the main complaints about the Omega from potential customers (as opposed to those who put their money where their mouth was and actually purchased one and were quite happy) was the lack of networking (this was my gripe with the Omega - ED). Now Omegas can be networked just like any other RISC OS Computer. RISCWorld has seen the networking in use with both RISC OS 4 and RISC OS Adjust and it's performance and stability seem excellent.
Omega Network Card
1GB of RAM.
At the start of July MicroDigital confirmed that the Omega will now run with up to 1GB of main memory when using RISC OS Adjust. At the moment this is for development machines only, however once RISCOS Ltd have made a few changes to the Adjust ROM all Omegas with RISC OS Adjust will be able to support up to 1GB of memory. For those using applications like PhotoDesk this will make a lot of actions much faster, as there will be no need to use virtual memory when handling large files. This also means that you could, for example, have a machine set up to have a huge RAM disc for storing temporary files. In theory the Omega will be able to support up to 4GB of RAM, once the chips become available.
More free upgrades
Since the Omega was first launched there have been a multitude of free upgrades available from MicroDigital. Over the last year or so users Omegas have become faster and faster as each upgrade is installed. The upgrades actually reprogram the FPGA (Field Programmable Gate Array) chips on the motherboard, effectively changing the hardware in the machine. This might sound a bit odd but the Omega is a "soft" hardware design, meaning that instead of having a fixed chip set, the chip set is actually programmed in software, into the FPGA on startup. So you can update the program code, that "makes" the hardware. So an update provided over the internet can actually replace and upgrade your hardware.
One of the benefits of the latest upgrade issued earlier in July was an 8 to 10% speed improvement. Indeed according to postings on NewsNet the updated Omega is now almost as fast as the Iyonix, even though the Omega has a processor that is almost half the rated speed.
A desktop Omega
In RISCWorld's view the Omega is now developing nicely, the network interface improves the machines usability no end, as does support for large amount of RAM, and of course free speed improvements are always welcome! So what's coming next? Well we spoke to MicroDigital who were being rather coy on the subject. Basically we all know what comes next, and when it does RISCWorld will be there. In the meantime to keep up to ate with Omega developments why not visit the MicroDigital website. |
Q:
Django form wizard 'NoneType' object has no attribute 'rsplit' error
Hi hope someone can help, I've been trying out form wizard for a project and have been following the documentation closely, but keep getting this error:
'NoneType' object has no attribute 'rsplit'
forms.py:
from django import forms
class ContactForm1(forms.Form):
subject = forms.CharField()
sender = forms.CharField()
class ContactForm2(forms.Form):
message = forms.CharField()
views.py:
class ContactWizard(WizardView):
def done(self, form_list, **kwargs):
return render_to_response('done.html', {
'form_data': [form.cleaned_data for form in form_list],
})
and urls.py (atestapp is 'woo')
urlpatterns = [
url(r'^admin/', include(admin.site.urls)),
url(r'^woo/', ContactWizard.as_view([ContactForm1, ContactForm2]))
]
Traceback:
Environment:
Request Method: GET
Request URL: http://127.0.0.1:8000/woo/
Django Version: 1.8.4
Python Version: 3.4.0
Installed Applications:
('django.contrib.admin',
'django.contrib.auth',
'django.contrib.contenttypes',
'django.contrib.sessions',
'django.contrib.messages',
'django.contrib.staticfiles',
'formtools')
Installed Middleware:
('django.contrib.sessions.middleware.SessionMiddleware',
'django.middleware.common.CommonMiddleware',
'django.middleware.csrf.CsrfViewMiddleware',
'django.contrib.auth.middleware.AuthenticationMiddleware',
'django.contrib.auth.middleware.SessionAuthenticationMiddleware',
'django.contrib.messages.middleware.MessageMiddleware',
'django.middleware.clickjacking.XFrameOptionsMiddleware',
'django.middleware.security.SecurityMiddleware')
Traceback:
File "C:\Python34\lib\site-packages\django\core\handlers\base.py" in get_response
132. response = wrapped_callback(request, *callback_args, **callback_kwargs)
File "C:\Python34\lib\site-packages\django\views\generic\base.py" in view
71. return self.dispatch(request, *args, **kwargs)
File "C:\Users\pdelarosa\AppData\Roaming\Python\Python34\site-packages\formtools\wizard\views.py" in dispatch
235. getattr(self, 'file_storage', None))
File "C:\Users\pdelarosa\AppData\Roaming\Python\Python34\site-packages\formtools\wizard\storage\__init__.py" in get_storage
13. storage_class = import_string(path)
File "C:\Python34\lib\site-packages\django\utils\module_loading.py" in import_string
21. module_path, class_name = dotted_path.rsplit('.', 1)
Exception Type: AttributeError at /woo/
Exception Value: 'NoneType' object has no attribute 'rsplit'
whenever I go to the woo/ url it just shows the nonetype error split. I've tried redoing the whole thing but still get the same error. Hope someone can help.
A:
Instead of subclassing WizardView, try subclassing SessionWizardView:
from formtools.wizard.views import SessionWizardView
class ContactWizard(SessionWizardView):
...
The documentation isn't very clear on this, but in most cases you shouldn't subclass WizardView directly - instead there are a number of sub-views that you should use:
SessionWizardView
CookieWizardView
NamedUrlWizardView etc.
|
Q:
No text shown in JTextArea upon event
I am unsure in how to fix this bug I have. It runs fine with no errors when I use it, but no input shows when i click one of the buttons.
I am using eclipse with JDK 1.7.1, and Windows 7.
Code is basically creating 3 buttons with a TextArea that displays the input of each button when clicked.
public class Main implements ActionListener{
public JTextArea text;
public JButton b1;
public JButton b2;
public JButton b3;
public String choices[] = {"Rock", "Paper", "Scissors"};
public static void main(String[] args){
Main gui = new Main();
gui.go();
}
public void go(){
JFrame frame = new JFrame("Rock Paper Scissors");
text = new JTextArea(13,20);
JPanel panel1 = new JPanel();
JPanel panel2 = new JPanel();
JButton b1 = new JButton(choices[0]);
JButton b2 = new JButton(choices[1]);
JButton b3 = new JButton(choices[2]);
b1.addActionListener(this);
b2.addActionListener(this);
b3.addActionListener(this);
text.setEditable(false);
JScrollPane scroller = new JScrollPane(text);
scroller.setVerticalScrollBarPolicy(ScrollPaneConstants.VERTICAL_SCROLLBAR_ALWAYS);
panel1.add(scroller);
panel2.add(b1);
panel2.add(b2);
panel2.add(b3);
frame.getContentPane().add(BorderLayout.CENTER,panel1);
frame.getContentPane().add(BorderLayout.SOUTH, panel2);
frame.setSize(350,300);
frame.setVisible(true);
}
public void actionPerformed(ActionEvent e) {
if (e.getSource() == b1) {
text.setText("Your choice was" + choices[0]);
}
if (e.getSource() == b2) {
text.setText("Your choice was" + choices[1]);
}
if (e.getSource() == b3) {
text.setText("Your choice was" + choices[2]);
}
}
}
A:
You're never initializing the instance variables b1, b2, and b3. So the equals operator won't work, because the instance variables are still null. I would recommend that in your go() method, you don't create new local variables b1, b2 and b3, but instead initialize the instance variables. I changed your code:
public void go(){
JFrame frame = new JFrame("Rock Paper Scissors");
text = new JTextArea(13,20);
JPanel panel1 = new JPanel();
JPanel panel2 = new JPanel();
b1 = new JButton(choices[0]);
b2 = new JButton(choices[1]);
b3 = new JButton(choices[2]);
b1.addActionListener(this);
b2.addActionListener(this);
b3.addActionListener(this);
text.setEditable(false);
JScrollPane scroller = new JScrollPane(text);
scroller.setVerticalScrollBarPolicy(ScrollPaneConstants.VERTICAL_SCROLLBAR_ALWAYS);
panel1.add(scroller);
panel2.add(b1);
panel2.add(b2);
panel2.add(b3);
frame.getContentPane().add(BorderLayout.CENTER,panel1);
frame.getContentPane().add(BorderLayout.SOUTH, panel2);
frame.setSize(350,300);
frame.setVisible(true);
}
|
MOSCOW (Reuters) - Russia said its war planes had joined forces with Turkish jets for the first time on Wednesday to target Islamic State militants holding the town of al-Bab in northern Syria, evidence of increasingly close cooperation between Moscow and Ankara.
Chief of the Main Operational Directorate of the General Staff of the Russian Armed Forces Lieutenant General Sergei Rudskoy attends a news briefing in Moscow, Russia, October 17, 2016. REUTERS/Maxim Zmeyev
Russia and Turkey are the main organizers of a new round of Syrian peace talks due to take place in Kazakhstan on Jan. 23 and have set aside their differences over the political fate of President Bashar al-Assad to try to forge a wider Syria deal.
Moscow backs Assad, while Ankara has diluted its demands for the Syrian leader to urgently step down as part of what some sources say is a backroom deal aimed at dividing Syria into informal zones of regional power influence.
Lieutenant-General Sergei Rudskoi, a senior Russian Defence Ministry official, said that nine Russian jets and eight Turkish war planes had together struck targets in al-Bab, which is located around 40 km (25 miles) northeast of Aleppo.
“Today the Russian and Turkish air forces are conducting their first joint air operation to strike Islamic State in the suburbs of al-Bab,” Rudskoi said.
“The assessment of the initial results ... showed the strikes were highly effective.”
Turkish President Tayyip Erdogan wants Turkish-backed rebels to capture al-Bab to prevent Kurdish militias from doing so. Rudskoi said the joint mission had been conducted in agreement with the Syrian government.
He said the Russian air force was also providing air support to Syrian government troops trying to fight off an Islamic State assault around the town of Deir al-Zor.
The town’s civilian population could be massacred if Islamic State took Deir al-Zor, he said.
Russian jets were also backing a Syrian army offensive near the town of Palmyra, said Rudskoi, who added that Islamic State militants were planning to blow up more of the ancient city’s historical monuments.
“We have received information, confirmed by several sources, that a large amount of explosives has been brought into the Palmyra area and that the terrorists plan on destroying the city’s world-class historical legacy,” he said.
Significant numbers of Islamic State militants fleeing the U.S.-led coalition offensive against Mosul in neighboring Iraq were streaming into Syria “almost unobstructed,” Rudskoi said. |
Bob Dylan Basement Tapes
Right now there have been forms and various sorts of Bob Dylan Basement Tapes which might be sold the like the market. Nevertheless, if your preferences are not matched by the cupboards while in the home in the form so that hasbeen on the market, guide yourself from your producers or artisans would be the way that is best. You should be certain to cover awareness of the budget that you have made. It is possible to pick cabinets while in the home that may be assembled to lessen the budget if you find a budget exceeds the limit.
Your kitchen units are assembled will give precisely the same be a consequence of the construction place that is wardrobe but with a value that is cheaper, be sure to make all the vital gear plus a guidebook to exhibit just how to build kitchen cupboards. it provides a factor that is very successful to produce Bob Dylan Basement Tapes, although the last details might appear straightforward. Find the handle and penis is most beneficial for that design and style of units within your home. You have various products to choose from.
For instance, handle made-of nickel to the gates of the home cupboards can give a vintage look, whilst the handle bronze offer a contemporary effect, and handle opera is the greatest alternative for a gleaming look, or you can pick a stylish fashion using gem product so as to make your kitchen in your home will look more desirable and elegant feel. |
Måns Olström
Måns Olström (born 1 November 1996) is a Swedish footballer who plays for IFK Berga on loan from Kalmar FF as a midfielder.
References
External links
Category:1996 births
Category:Living people
Category:Association football defenders
Category:Allsvenskan players
Category:Kalmar FF players
Category:Swedish footballers |
Figidini has Downtown Fired Up
Neapolitan-style pizza from a wood-burning oven? Yes, please
Posted
Thursday, June 13, 2013 10:08 am
Frankie Cecchinelli in the kitchen at Figidini
Katie Poor
Sarah Frazier
Some people just have to do things a certain way. You try to shake and break them, but they stay stubbornly cemented to their certainty. While for many this may seem a sort of stunted growth, for Kara and Frankie Cecchinelli it’s taken them from the shores of Cape Cod to the streets of Providence. Raised in the traditional wonders of wood fire grilled cooking, Frankie continues to uphold the culinary customs of his family.
Once owners of a catering company based out of Cape Cod, operating out of the back of their trailer on a makeshift wood fire grill, the Cecchinellis saw the potential for their business to grow and began looking for a more permanent location. The search originally had them seeking in-state, towards more metropolitan locations like Boston. However, as Kara explains, “Boston just didn’t feel right,” and so they eventually found themselves in Providence. Brought into contact with Cornish Associates, who are developing in the Biltmore Garage, the realtors informed them, to their surprise, that a pizzeria was being actively sought for that location. As if sanctioned by the fates, the signals couldn’t have been clearer. From a tiny trailer in Cape Cod, the Cecchinellis have now built a new hip location for pizza lovers in Providence, Figidini Wood Fire Eatery.
Currently seeking VPN pizza certification for their margherita and marinara pizzas, Figidini takes their reputation as a premier pizza establishment very seriously. VPN certification, which is essentially a legally documented seal of approval from a group of pizza masters out of Naples, based on the use of authentic Neapolitan pizza ingredients and preparation (seriously, look it up), shows how dedicated Kara and Frankie are to providing quality and authenticity to their customers. Figidini’s assortment of pizzas, from a simple Margherita to specialties like Sweet Potato and Fresh Ricotta, demonstrate with every bite the genuine Neapolitan-style approach that the Cecchinellis strove for from their days in Cape Cod. And everything, literally everything, is grilled on their wood fire grill.
Figidini’s also has a variety of unique salads, and of course other grilled items such as shrimp, calamari, brandt skirt steak, sausage, lamb and grilled asparagus and broccoli rabe. Offering one creatively delivered dessert per night, usually consisting of wood grilled fruit with homemade yogurt or some other delicious concoction, every experience is unique, with menus changing every season. |
Maggie Smith, "Private Lives"
A great deal of Noel Coward's "Private Lives" is given over to characters being frightfully rude to one another, and perhaps, Maggie Smith thinks, that has a lot to do with the play's perennial appeal.
"I think it rather intrigues an audience," she was musing the other day. "Perhaps they're rather envious that people can behave in such a way.
"Of course, the rudeness, that blunt honesty for comic effect, was a very Coward thing. I did his 'Hay Fever' too, and that was full of people being beastly. I think, too, that a play like 'Private Lives' must have been very shocking when it first appeared; people weren't so used to marriage being bandied about like this."
While she talked, Miss Smith made herself up in her dressing room, for a matinee of "Private Lives," which opened Tuesday in an elegantly mounted revival at the Blackstone. This production was first staged in London in 1972 (with direction by John Gielgud) and is at the midpoint of an American tour.
"'Private Lives' has been revived several times in this country," she said. "But it hadn't been done in Britain for a while, and of course it's a play every actor wants to do. It's very witty, even after all the times I've appeared in it, I still find the lines so funny. I've tended to appear mostly in classical plays. . . . But then I imagine 'Private Lives' is a classic by now, isn't it?"
The play involves a good deal of verbal and physical abuse among its four main characters. Miss Smith plays Amanda, John Standing plays her former husband, Elyot, and they meet again in France while on honeymoons with their new spouses. They elope, the rejected spouses follow and both the second and third acts end in pitched battles.
"If you read the original text," Miss Smith said, "it actually reads even more violently than the way we're doing it. People get thrown about the stage and all that sort of thing." She thought she had a copy of the original text in her dressing room somewhere, rummaged around for it, couldn't find it and promised to get organized by this time next week.
"In those days," she said, "plays in Britain had to be approved by the lord chamberlain, and he was very much disturbed by all the physical stuff, the violence, in 'Private Lives.' Noel had to go and act it all out for him, a scene I would very much have liked to witness."
Noel Coward starred with Gertrude Lawrence in the original production of his play, and one of the problems, Miss Smith said, "is to get the sound and rhythm of Coward out of one's head. I keep trying desperately to forget that phonograph record he made of the play!"
Wondering aloud why the play has retained so much of its appeal 44 years after its first production, she said it was well to remember that it came out, "not in the Roaring '20s, but in 1930, with bad times just around the corner and a real hunger for some sort of desperate gaiety. in fact, perhaps that's something of the appeal it has now."
Subscribe to our mailing list
Enter Your Email Address
Advertisement
The Ebert Club is our hand-picked selection of content for Ebert fans. You will receive a weekly newsletter full of movie-related tidbits, articles, trailers, even the occasional streamable movie. Club members also get access to our members-only section on RogerEbert.com |
About 1,000 windows in Jewish houses and shops have been smashed in Radom and many in Jewish foodshops have been looted, says a report published here to-day by the “Nasz Glos”, which has been confiscated in consequence by the authorities, who declare that the report is untrue. The local Sick Fund has had to treat scores of wounded Jews, the “Nasz Glos” further wrote, ten of them having sustained serious injuries, and one, a Jewish schoolboy named Litvak, being in a critical condition. Complete order has now been restored in the town, it added, however.
The District Chief of Radom has assured a Jewish delegation that order is now completely guaranteed in the town. Those pupils of the schools who participated in the excesses will be expelled, the J.T.A. is given to understand. The official Polish Telegraphic Agency, Pat, states that seven persons have been arrested by the Police in connection with the disturbances, and that everything is now quiet in Radom. |
Change in brain network connectivity during PACAP38-induced migraine attacks: A resting-state functional MRI study.
To investigate resting-state functional connectivity in the salience network (SN), the sensorimotor network (SMN), and the default mode network (DMN) during migraine attacks induced by pituitary adenylate cyclase-activating polypeptide-38 (PACAP38). In a double-blind, randomized study, 24 female migraine patients without aura received IV PACAP38 or vasoactive intestinal polypeptide (VIP) over 20 minutes. Both peptides are closely related and cause vasodilation, but only PACAP38 induces migraine attacks. VIP was therefore used as active placebo. Resting-state functional MRI was recorded before and during PACAP38-induced migraine attacks and before and after VIP infusion. We analyzed data by Statistical Parametric Mapping 8 and the Resting-State fMRI Data Analysis Toolkit for Matlab in a seed-based fashion. PACAP38 (n = 16) induced migraine attacks and increased connectivity with the bilateral opercular part of the inferior frontal gyrus in the SN. In SMN, there was increased connectivity with the right premotor cortex and decreased connectivity with the left visual cortex. Several areas showed increased (left primary auditory, secondary somatosensory, premotor, and visual cortices) and decreased (right cerebellum and left frontal lobe) connectivity with DMN. We found no resting-state network changes after VIP (n = 15). PACAP38-induced migraine attack is associated with altered connectivity of several large-scale functional networks of the brain. |
Psychiatric test for suspect in NYC subway death
NEW YORK (AP) - A woman charged in the death of an immigrant who was pushed off a New York City subway platform has been ordered to undergo a psychiatric evaluation.
Erika Menendez was arraigned Saturday night on a charge of murder as a hate crime. Judge Gia Morris has ordered that the 31-year-old be held without bail and be given a mental health exam.
Menendez is charged in the death of Sunando Sen, who was crushed by a train in Queens on Thursday night.
Authorities say Menendez admitted shoving Sen, who was pushed from behind. She was arrested after a tip by a passer-by who saw her on a street and thought she looked like the woman in a surveillance video released by police.
A call to Menendez's attorney has not been returned.
(Copyright 2012 The Associated Press. All rights reserved. This material may not be published, broadcast, rewritten or redistributed.) |
<?xml version="1.0" encoding="utf-8" standalone="no"?>
<!--Generated by crowdin.com-->
<resources>
<string name="restoring_purchases">جارِ استعادة المشتريات…</string>
<string name="uh_oh">أوبس</string>
<string name="reload">إعادة التحميل</string>
</resources>
|
Mountaindale
Mountain Dale or Mountaindale is the name of several places in the USA:
Mountain Dale, Missouri
Mountain Dale, New York
Mountaindale, Oregon
Mountaindale, Pennsylvania |
List of current first-class cricket teams
This is a list of current first-class cricket teams, organised first by country and then alphabetically. For a clear explanation of first-class status, see first-class cricket. Where a team plays at more than one home ground, only their main ground is listed here.
Afghanistan
National team: Afghanistan national cricket team1
From February 2017, Afghanistan domestic matches are granted first-class status. This will take effect in the next season of the Ahmad Shah Abdali tournament in September 2017. Afghanistan has six domestic teams that play in first-class and T20 competitions. They do not have a 50 over tournament.
Note:
1 first-class only when playing in the ICC Intercontinental Cup or when playing against Test nations.
Australia
National team: Australia national cricket team
Bangladesh
National team: Bangladesh national cricket team
Notes:
Bangladesh A and Bangladeshis matches are also considered first-class.
England and Wales
National team: England cricket team
India
National team: India national cricket team
Notes:
1 Rest of India (in the Irani Trophy), India A, and various President's XIs are also adjudged first-class.
2 Makeshift zonal teams are also made and guest teams like England lions also play.
Ireland
Ireland's Inter-Provincial Championship received first-class status in October 2016 from the ICC. The first-class status for the matches came into effect with the 2017 Inter-Provincial Championship.
National team: Ireland cricket team
New Zealand
National team: New Zealand national cricket team
Pakistan
National team: Pakistan national cricket team
South Africa
National team: South Africa national cricket team
Notes:
1 Also considered first-class when playing in the ICC Intercontinental Cup.
Sri Lanka
National team: Sri Lanka national cricket team
West Indies
National team: West Indies cricket team
Note: West Indies 'A' and West Indian XI matches are also considered first-class.
Zimbabwe
National team: Zimbabwe national cricket team
Countries with international first-class cricket
The following countries play first-class cricket as an international team in certain circumstances.
Hong Kong
National team: Hong Kong national cricket team1
Note:
1 first-class only when playing in the ICC Intercontinental Cup.
Namibia
National team: Namibia national cricket team1
Note:
1 first-class only when playing in the ICC Intercontinental Cup and in the South African SAA Provincial Challenge against South African first-class teams.
Netherlands
National team: Netherlands national cricket team1
Note:
1 first-class only when playing in the ICC Intercontinental Cup.
Papua New Guinea
National team: Papua New Guinea national cricket team1
Note:
1 first-class only when playing in the ICC Intercontinental Cup.
Scotland
National team: Scotland national cricket team1
Note:
1 first-class only when playing in the ICC Intercontinental Cup or when playing against Ireland or English first-class county teams.
United Arab Emirates
National team: United Arab Emirates national cricket team1
Note:
1 first-class only when playing in the ICC Intercontinental Cup.
Former first-class cricket teams
Bermuda
National team: Bermuda national cricket team
Note:
1 first-class only when playing in the ICC Intercontinental Cup.
Canada
National team: Canada national cricket team1
Note:
1 first-class only when playing in the ICC Intercontinental Cup.
Cayman Islands
National team: Cayman Islands national cricket team1
Note:
1 first-class only when playing in the ICC Intercontinental Cup.
Kenya
National team: Kenya national cricket team 1
Note:
1 first-class only when playing in the ICC Intercontinental Cup and against touring first-class teams.
Malaysia
National team: Malaysia national cricket team1
Note:
1 first-class only when playing in the ICC Intercontinental Cup.
Nepal
National team: Nepal national cricket team1
Note:
1first-class only when playing in the ICC Intercontinental Cup.
Uganda
National team: Uganda national cricket team1
Note:
1 first-class only when playing in the ICC Intercontinental Cup.
United States of America
National team: United States national cricket team1
Note:
1 first-class only when playing in the ICC Intercontinental Cup.
External links
cricinfo
cricketarchive
References
Category:First-class cricket teams
FIrst-class
Cricket |
--TEST--
Tests numeric values: Leading zeros
--CSS--
a { font-size:0001em; foo:00.1em; line-height:00.1; bar:-00.1;}
--EXPECT--
array (
'a' =>
array (
'font-size' => '1em',
'foo' => '.1em',
'line-height' => '.1',
'bar' => '-.1',
),
)
|
Monumental District
This small lode-gold district is in northern Del Norte County about 45 miles northeast of Crescent City. Most of the work here has been done at the Monumental Consolidated mine, which has been intermittently developed since about 1900. Several quartz veins in greenstone and slate contain some gold, pyrite, chalcopyrite, and hematite. The greatest depth attained here is about 250 feet. |
// Licensed to the .NET Foundation under one or more agreements.
// The .NET Foundation licenses this file to you under the MIT license.
using Microsoft.Build.Framework;
using Microsoft.Build.Tasks;
using Microsoft.DotNet.VersionTools.Automation;
using System;
using System.Collections.Generic;
using System.IO;
using System.Linq;
using System.Net.Http;
using System.Threading;
using System.Threading.Tasks;
using MSBuild = Microsoft.Build.Utilities;
namespace Microsoft.DotNet.Build.Tasks.Feed
{
/// <summary>
/// Run a command and retry if the exit code is not 0.
/// </summary>
public class ExecWithRetriesForNuGetPush : MSBuild.Task
{
[Required]
public string Command { get; set; }
public int MaxAttempts { get; set; } = 5;
/// <summary>
/// Base, in seconds, raised to the power of the number of retries so far.
/// </summary>
public double RetryDelayBase { get; set; } = 6;
/// <summary>
/// A constant, in seconds, added to (base^retries) to find the delay before retrying.
///
/// The default is -1 to make the first retry instant, because ((base^0)-1) == 0.
/// </summary>
public double RetryDelayConstant { get; set; } = -1;
/// <summary>
/// The "IgnoredErrorMessagesWithConditional" item collection
/// allows you to specify error messages which you want to ignore. If you
/// specify the "ConditionalErrorMessage" metadata on the Item, then the error message is
/// only ignored if the "conditional" error message was detected in a previous (or current)
/// Exec attempt.
///
/// Example: <IgnoredErrorMessagesWithConditional Include="publish failed" />
/// Specifying this item would tell the task to report success, even if "publish failed" is detected
/// in the Exec output
///
/// <IgnoredErrorMessagesWithConditional Include="Overwriting existing packages is forbidden according to the package retention settings for this feed.">
/// <ConditionalErrorMessage>Pushing took too long</ConditionalErrorMessage>
/// </IgnoredErrorMessagesWithConditional>
/// This tells the task to report success if "Overwriting existing packages is forbidden..." is detected
/// in the Exec output, but only if a previous Exec attempt failed and reported "Pushing took too long".
/// </summary>
public ITaskItem[] IgnoredErrorMessagesWithConditional { get; set; }
/// <summary>
/// Package file that is pushed by the given command. Required if PassIfIdenticalV2Feed
/// is set: it is read to compare against the copy of the package on the feed.
/// </summary>
public string PackageFile { get; set; }
/// <summary>
/// If this property specifies a v2 feed endpoint, for example
/// "https://dotnet.myget.org/F/dotnet-core/api/v2", all errors are ignored if the feed
/// contains the package and it's byte-for-byte identical to the one being pushed.
/// </summary>
public string PassIfIdenticalV2Feed { get; set; }
private CancellationTokenSource _cancelTokenSource = new CancellationTokenSource();
private Exec _runningExec;
public void Cancel()
{
_runningExec?.Cancel();
_cancelTokenSource.Cancel();
}
public override bool Execute()
{
HashSet<string> activeIgnorableErrorMessages = new HashSet<string>();
// Add any "Ignore" messages that don't have conditionals to our active list.
if (IgnoredErrorMessagesWithConditional != null)
{
foreach (var message in IgnoredErrorMessagesWithConditional)
{
string conditional = message.GetMetadata("ConditionalErrorMessage");
if (string.IsNullOrEmpty(conditional))
{
activeIgnorableErrorMessages.Add(message.ItemSpec);
}
}
}
for (int i = 0; i < MaxAttempts; i++)
{
string attemptMessage = $"(attempt {i + 1}/{MaxAttempts})";
_runningExec = new Exec
{
BuildEngine = BuildEngine,
Command = Command,
LogStandardErrorAsError = false,
IgnoreExitCode = true,
ConsoleToMSBuild = true
};
if (!_runningExec.Execute())
{
Log.LogError("Child Exec task failed to execute.");
break;
}
int exitCode = _runningExec.ExitCode;
if (exitCode == 0 || FeedContainsIdenticalPackage())
{
return true;
}
if (_runningExec.ConsoleOutput != null &&
IgnoredErrorMessagesWithConditional != null &&
_runningExec.ConsoleOutput.Length > 0)
{
var consoleOutput = _runningExec.ConsoleOutput.Select(c => c.ItemSpec);
// If the console output contains a "conditional" message, add the item to the active list.
var conditionMessages = IgnoredErrorMessagesWithConditional.Where(m =>
consoleOutput.Any(n =>
n.Contains(m.GetMetadata("ConditionalErrorMessage"))));
foreach (var condition in conditionMessages)
{
activeIgnorableErrorMessages.Add(condition.ItemSpec);
}
// If an active "ignore" message is present in the console output, then return true instead of retrying.
foreach (var ignoreMessage in activeIgnorableErrorMessages)
{
if (consoleOutput.Any(c => c.Contains(ignoreMessage)))
{
Log.LogMessage(MessageImportance.High, $"Error detected, but error condition is valid, ignoring error \"{ignoreMessage}\"");
return true;
}
}
}
string message = $"Exec FAILED: exit code {exitCode} {attemptMessage}";
if (i + 1 == MaxAttempts || _cancelTokenSource.IsCancellationRequested)
{
Log.LogError(message);
break;
}
Log.LogMessage(MessageImportance.High, message);
TimeSpan delay = TimeSpan.FromSeconds(
Math.Pow(RetryDelayBase, i) + RetryDelayConstant);
Log.LogMessage(MessageImportance.High, $"Retrying after {delay}...");
try
{
Task.Delay(delay, _cancelTokenSource.Token).Wait();
}
catch (AggregateException e) when (e.InnerException is TaskCanceledException)
{
break;
}
}
return false;
}
private bool FeedContainsIdenticalPackage()
{
if (string.IsNullOrEmpty(PassIfIdenticalV2Feed) ||
string.IsNullOrEmpty(PackageFile))
{
return false;
}
var packageInfo = new NupkgInfo(PackageFile);
string packageUrl =
$"{PassIfIdenticalV2Feed}/package/{packageInfo.Id}/{packageInfo.Version}";
byte[] localBytes = File.ReadAllBytes(PackageFile);
bool identical = false;
try
{
Log.LogMessage(
MessageImportance.High,
$"Downloading package from '{packageUrl}' " +
$"to check if identical to '{PackageFile}'");
using (var client = new HttpClient
{
Timeout = TimeSpan.FromMinutes(10)
})
using (var response = client.GetAsync(packageUrl).Result)
{
byte[] remoteBytes = response.Content.ReadAsByteArrayAsync().Result;
identical = localBytes.SequenceEqual(remoteBytes);
}
}
catch (Exception e)
{
Log.LogWarningFromException(e, true);
}
if (identical)
{
Log.LogMessage(
MessageImportance.High,
$"Package '{PackageFile}' is identical to feed download: ignoring push error.");
}
else
{
Log.LogMessage(
MessageImportance.High,
$"Package '{PackageFile}' is different from feed download.");
}
return identical;
}
}
}
|
Published: July 17, 2020
Introduction {#sec1}
============
The coronavirus disease 2019 (COVID-19) pandemic is a tremendous threat globally. As of July 3, 2020, 216 countries have reported COVID-19 cases, with more than 10 million confirmed cases and approximately 518,000 deaths (<https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports/>). The causative agent of COVID-19, SARS-CoV-2 causes a lower respiratory tract infection that can progress to severe acute respiratory syndrome and even multiple organ failure ([@bib23]; [@bib44]).
SARS-CoV-2 is a single-stranded positive-strand RNA virus whose genome encodes four structural proteins: spike (S), small protein (E), matrix (M), and nucleocapsid (N) ([@bib3]). The S protein is a type I fusion protein that forms trimers on the surface of the virion. It is composed of two subunits, with S1 responsible for receptor binding and S2 for membrane fusion ([@bib36]; [@bib41]). The SARS-CoV-2 utilizes angiotensin-converting enzyme 2 (ACE2) as the receptor for entry into target cells ([@bib20]). Therefore, the S protein determines the infectivity of the virus and its transmissibility in the host ([@bib14]). As this protein is the major antigen inducing protective immune responses ([@bib8]; [@bib11]; [@bib21]; [@bib36]), all vaccines under development are directed against it. Clearly, it is pivotal to closely monitor antigenic evolution of the spike in the circulating viruses. As it is a heavily glycosylated protein, investigation of the effects of the site-specific glycans on infectivity and immune escape is also of unquestionable importance.
RNA viruses are known to have higher mutation rates than DNA viruses ([@bib9]; [@bib19]). Amino acid changes in the surface protein can significantly alter viral function and/or interactions with neutralizing antibodies. For example, A226V of Chikungunya virus E1 protein facilitated its adaptability in the vector *Aedesalbopictus*, resulting in an increased transmissibility ([@bib31]). Similarly, A82V of Ebola virus GP protein led to increased viral infectivity and mortality ([@bib6]; [@bib32]). Moreover, the highly pathogenic avian influenza H5N1 with 4 amino acid changes demonstrated enhanced transmission ([@bib12]), whereas in H7N9, the combined amino acid change A143V/R148K of hemagglutinin decreased the sensitivity of the virus to neutralizing antibodies by more than 10 times ([@bib26]; [@bib27]).
Although SARS-CoV-2 was only discovered in humans recently, mutations in the gene encoding Spike (S) protein are being continuously reported ([@bib4]; [@bib17]; [@bib28]; [@bib29]; [@bib34]). As of May 6, 2020, 329 naturally occurring variants in S protein have been reported in public domain. Notably, there were only 13 amino acid sites with a rate of more than 0.1%. Preliminary study suggested that the increased fatality rate may be associated with the most dominant variant D614G. Presumably, this change may have induced a conformational change in the S protein, thereby resulting in the increased infectivity ([@bib1]). However, it remains largely unclear as to whether these reported variants could influence viral infectivity, transmissibility, or reactivity with neutralizing antibodies.
It is also well documented that mutations affecting glycosylation of viral proteins could also profoundly affect viral life cycle and its interaction with the host. For example, N-glycosylation at specific sites of the HIV-1 Env protein is critical for Env expression and assembly ([@bib10]; [@bib16]; [@bib37]). Deletion of certain glycosylation sites could decrease the binding of Env protein to the CD4 receptor, abolishing the infectivity of the resulting viral particles ([@bib10]). Moreover, glycosylation site mutations are also known to render the virus resistant to neutralization by the antibodies ([@bib37]; [@bib38]), whereas deletion of certain glycosylation sites in the H5N1 HA protein has been found to affect HA cleavage, replication, stability, and antigenicity ([@bib45]). It is of note that although the S protein of SARS-CoV-2 is much more heavily glycosylated, with 22 potential N-glycosylation sites ([@bib18]; [@bib35]), how these glycosylation sites could affect viral infectivity and antibody-mediated neutralization remains unknown.
In this study, we investigated the biological significance of natural variants with amino acid change(s) as well as mutants at the putative N-linked glycosylation sites in the SARS-CoV-2 S protein. To achieve these, we generated 106 S mutants reported in the public domain or mutants at putative N-linked glycosylation sites and analyzed their infectivity and reactivity to neutralizing antibodies using the high-throughput pseudotyped virus system ([@bib25]). We report that some natural variants and N-linked glycan deleted mutants have evolved to possess remarkable alterations in their infectivity and antigenicity.
Results {#sec2}
=======
Construction of Pseudotyped Viruses with Natural Variants and Deletions of the Glycosylation Sites {#sec2.1}
--------------------------------------------------------------------------------------------------
For ease of description in this communication, variants are referred to as those that occurred naturally (reported in GISAID) and mutants (investigational or experimental mutants) for those we introduced experimentally. For the analyses of variants, we first retrieved all S sequences reported in GISAID database up to May 6, 2020. Following removal of incomplete, redundant, and ambiguous sequences, a total of 13,406 sequences of the S protein were selected for alignment analyses. Using Wuhan-1 strain (GenBank: [MN_908947](ncbi-n:MN_908947){#interref55}) as a template, we have selected three groups of variants and mutants to construct the pseudotyped viruses. As shown in [Figure 1](#fig1){ref-type="fig"} , group A represents all high-frequency variants and combined variants with D614G across the entire S gene (29 strains) excluding receptor-binding domain (RBD) region. Group B includes variants in RBD (51 strains). Although the eight single mutations (i.e., Q239K, V341I, A435S, K458R, I472V, H519P, A831V, and S943T) in both groups A and B do not exist by themselves, they were found to occur in combination with D614G. Therefore, the pseudotyped viruses for the eight single mutants were also constructed to compare with the double mutants with D614G. Group C is comprised of 26 mutants at the putative glycosylation sites (22 sites). This group includes both variants (N74K, N149H, and T719A) and investigational mutants that we made for the analyses of the effects of glycosylation. Specifically, all 22 sites (N to Q) were made in the lab to generate 22 individual mutants; we also made a combination by deleting the two glycosylation sites in RBD.Figure 1Illustration of Amino Acid Changes Selected for This Study(A) Variants and combined variants with D614G across the entire S gene excluding the RBD region.(B) Variants in RBD.(C) Mutants at the putative glycosylation sites (22 sites). This group include mutations we introduced at all 22 putative glycosylation sites (N to Q), a combination of two glycosylation site mutations in RBD, and three naturally occurring variants, N74K, N149H, and T719A, with ablated glycosylation sites.High-frequency amino acid change sites (frequency \> 0.1%) are highlighted in red. See also [Table S1](#mmc1){ref-type="supplementary-material"}.
In total, we have generated 106 pseudotyped viruses (i.e., 80 variants and 26 glycosylation mutants) ([Figure 1](#fig1){ref-type="fig"}). These viruses were prepared as described previously ([@bib25]; see [STAR Methods](#sec4){ref-type="sec"}).
Significantly Altered Infectivity of Variants and Deletions of the Glycosylation Site Mutants {#sec2.2}
---------------------------------------------------------------------------------------------
To determine the infectivity of these variants and mutants, we first infected 26 cell lines with pseudotyped viruses with either SARS-CoV-2 S protein or VSV G protein (see [STAR Methods](#sec4){ref-type="sec"}). As expected, the two types of pseudotyped viruses are different in the infection efficiency in the 26 cell lines ([Figure 2](#fig2){ref-type="fig"} ). Although almost all cell lines were generally susceptible to infection by VSV G pseudotyped virus, SARS-CoV-2 pseudotyped virus could efficiently infect certain cell lines including three human cell lines (293T-hACE2, 293T, and Huh-7) and three non-human primate cell lines (Vero, VeroE6, and LLC-MK2). As such, we selected these four out of the six cell lines in subsequent experiments, including 293T-hACE2, Huh-7, Vero, and LLC-MK2.Figure 2Selection of Susceptible Cell LinesA total of 26 different cell lines were infected with pseudotyped viruses with either SARS-CoV-2 S (A) or VSV G (B). The infected cell lysates were diluted by 10× and analyzed for luminescence activities (RLU). All results were obtained from three independent experiments (mean ± SEM). When the RLU for the tested cell reached 1% of that for Huh-7, it was deemed as a permissive cell line. The dash line indicates the 1% RLU value of Huh-7 cell.
We first tested the infectivity of 106 pseudotyped viruses (80 natural variants and 26 glycosylation mutants) in 293T-hACE2 cells, where a difference by 4-fold in RLU compared with the reference Wuhan-1 strain (GenBank: MN_908947) was deemed as being significant ([Figure S1](#figs1){ref-type="fig"} ). Of all 106 pseudotyped viruses, 24 were determined as low-infectivity (17 natural mutants and 7 glycosylation mutants), with RLU reading decreased by 4- to 100-fold ([Figure S1](#figs1){ref-type="fig"}). Among them, 13 were located in the RBD region. Variant V341I and investigational glycosylation mutant (N331Q+N343Q) were deemed as no-infectivity as demonstrated by over 100-fold decrease in RLU values compared with the reference strain. Both of them were located in RBD. It is worth noting that double glycosylation deletions at N331 and N343 resulted in a drastic reduction in viral infectivity (1,200-fold), whereas single deletion at each site caused modest reduction in viral infectivity, with the infectivity of N331Q reduced by only 3-fold and N343Q by 20-fold. Moreover, the non-natural double glycosylation mutations in RBD (N331Q and N343Q) resulted in significantly reduced infectivity, suggesting that the two glycosylation sites in the RBD region may participate in the binding of the receptor or maintain the conformation of the RBD region.Figure S1Infectivity Analysis of Variants and Mutants in 293T-ACE2 Cell, Related to [Figure 3](#fig3){ref-type="fig"}RLU values resulting from infection with variant pseudotyped viruses were quantified by luminescence meter and normalized to the reference strain (Wuhan-1) produced in parallel, with the difference by 4-fold being considered as significant; all experiments were conducted three times (mean ± SEM) unless specified. The horizontal dashed lines indicate the threshold of 4-fold difference.
The remaining 63 variants were tested further with other three cell lines for infectivity. Notably, single D614G and combined variants with D614G (D614G+L5F, D614G+V341I, D614G+K458R, D614G+I472V, D614G+D936Y, D614G+S939F, and D614G+S943T) demonstrated increased infectivity compared to the reference strain in all the four cell lines ([Figures 3](#fig3){ref-type="fig"}A--3D), whereas no difference was found between single D614G and D614G combined variants, suggesting that the enhanced infectivity was more likely ascribed to D614G itself.Figure 3Infectivity Analysis of Variants and Deletions of the Glycosylation Site MutantsInfectivity of natural variants and experimental mutants conducted in 293T-ACE2 (A), Huh-7 (B), Vero (C), and LLC-MK2 (D). RLU values generated with the infection of the variants or mutants, as measured by luminescence meter, were compared with the reference strain (Wuhan-1). A difference by 4-fold is considered significant; all experiments were conducted three times (mean ± SEM) unless specified. See also [Figure S1](#figs1){ref-type="fig"}.
Differential Antigenicity of Natural Variants and Experimental Mutants with Monoclonal Antibodies {#sec2.3}
-------------------------------------------------------------------------------------------------
Having identified the variants with altered infectivity, we next set out to investigate the antigenicity of the infectious mutants using 13 neutralizing monoclonal antibodies (mAbs) (see [STAR Methods](#sec4){ref-type="sec"}). It was noted that some changes in RBD region demonstrated altered sensitivity to neutralizing mAbs ([Figures 4](#fig4){ref-type="fig"} and [S2](#figs2){ref-type="fig"} ). Specifically, A475V reduced the sensitivity to mAbs 157, 247, CB6, P2C-1F11, B38, and CA1, whereas F490L reduced the sensitivity to mAbs X593, 261-262, H4, and P2B-2F6. Moreover, V483A became resistant to mAbs X593 and P2B-2F6, and L452R to mAbs X593 and P2B-2F6. Finally, Y508H reduced the sensitivity to mAb H014, N439K to mAb H00S022, A831V to mAb B38, D614G+I472V to mAb X593, and D614G+A435S to mAb H014 by more than 4 times. In addition, some changes in the RBD region, including V367F, Q409E, Q414E, I468F, I468T, Y508H, and A522V, were observed to be more susceptible to neutralization mediated by mAbs.Figure 4Analyses of Antigenicity of the Natural Variants and Experimental Mutants Using a Panel of Neutralizing mAbsSerial dilutions of mAb preparations were pre-incubated with the pseudotyped viruses at 37°C for 1 h before they were added to Huh-7 cells. Luciferase activity was measured 24 h later to calculate EC~50~ of each antibody. The ratio of EC~50~ between the variant or mutant strains and the reference strain (Wuhan-1) was calculated and analyzed to generate heatmap using Hem I ([@bib5]). The data were the results from 3--5 replicates. The red and blue boxes indicate the increase or decrease of the neutralization activity as shown in the scale bar. See also [Figure S2](#figs2){ref-type="fig"}.Figure S2Analyses of Antigenicity of Natural Variants and Experimental Mutants Using a Panel of Neutralizing mAbs, Related to [Figure 4](#fig4){ref-type="fig"}Serial dilutions of mAb preparations were pre-incubated with the virus at 37°C for one hour before they were added to Huh-7 cells. Luciferase activity was measured 24 hours later to calculate EC~50~ of each antibody. The y axis represents the ratio of EC~50~ between the variant/mutant strain and the reference strain (Wuhan-1). The data (mean ± SEM) were the results from 3-5 replicates. The vertical dashed lines indicate the threshold of 4-fold difference. The significant changes were marked with colored symbols, blue for decreased, red for increased.
We next determine how infectious glycosylation mutants reacted to the same panel of mAbs. Mutant N165Q actually became more sensitive to mAb P2B-2F6, whereas N234Q reduced the neutralization sensitivity to different set of mAbs including 157, 247, CB6, P2C-1F11, H00S022, B38, AB35, and H014. These results confirmed that these two glycosylation sites are important for receptor binding.
These mAbs have proven to be valuable in our analyses of the amino acid changes. As shown in [Figure 4](#fig4){ref-type="fig"}, five mAbs (i.e., 157, 247, CB6, P2C-1F11 and B38) were unable to effectively neutralize both A475V and N234Q. Neither X593 nor P2B-2F6 was effective in neutralizing L452R, V483A, and F490L, whereas P2B-2F6 was more effective in neutralizing N165Q. In addition, mAb H014 was incapable of neutralizing N234Q, Y508H, and D614G+A435S, whereas mAbs H4 and 261-262 were found not to neutralize F490L. Furthermore, H00S022 was unable to neutralizing N439K and N234Q.
Altered Reactivity of Natural Variants and Experimental Mutants to Human Convalescent Sera {#sec2.4}
------------------------------------------------------------------------------------------
Finally, we determined the sensitivity of the strains with amino acid changes to ten COVID-19 convalescent sera (see [STAR Methods](#sec4){ref-type="sec"}). None of the variants and mutants demonstrated significantly altered sensitivity to all 10 convalescent sera, i.e., the EC~50~ values were not altered by more than 4-fold, irrespective of an increase or decrease, when compared with the reference strain ([Figures 5](#fig5){ref-type="fig"} A and [S3](#figs3){ref-type="fig"} ). However, the neutralization sensitivity of both F490L and H519P to three of ten patient sera were found to have decreased by more than 4 times, while six variants and mutants (N149H, N149Q, N165Q, N354D, N709Q, and N1173Q) became over 4-fold sensitive to one or two of the ten tested sera. Notably, five out of the six were glycan deletion mutants.Figure 5Differential Sensitivity of the Natural Variants and Experimental Mutants to a Panel of Convalescent Serum Samples(A) Serial dilutions of 10 patient serum samples were individually mixed with the pseudotyped viruses at 37°C for 1 h before added to Huh-7 cells for incubation of 24 h to determine the EC~50~. The experiments were repeated at least 3 times. Hem I software was used to analyze the data and draw the heatmap. The red and blue boxes indicate the increase or decrease of the neutralization activity as shown in the scale bar.(B) Summary of the data from ten serum samples, with the values presented as mean ± SEM. The horizontal dashed lines indicate the threshold of 4-fold difference. ^∗^p \< 0.05, ^∗∗^p \< 0.01, ^∗∗∗^p \< 0.005, ^∗∗∗∗^p \< 0.001.See also [Figure S3](#figs3){ref-type="fig"}.Figure S3Analyses of Antigenicity of the Natural Variants and Experimental Mutants Using Ten Convalescent Serum Samples, Related to [Figure 5](#fig5){ref-type="fig"}The data (mean ± SEM) were the results from 3-5 replicates. The vertical dashed lines indicate the threshold of 4-fold difference. The significant changes were marked with colored symbols, blue for decreased, red for increased.
As shown in [Figure 5](#fig5){ref-type="fig"}B, when the data of individual convalescent sera were pooled together to analyze the sensitivity of all variants, no marked difference was observed (\>4-fold). However, modest differences between some variants and reference strain (within 4-fold) were observed in their reactivity to grouped convalescent sera. These differences were statistically significant (p \< 0.05). It is worth mentioning that some variants including F338L, V367F, I468F, I468T, and V615L ([Figure 5](#fig5){ref-type="fig"}B) were even more sensitive to the convalescent sera compared with reference strain, whereas more variants were found to be resistant to the convalescent sera. These variants include single amino acid change such as Y145del, Q414E, N439K, G446V, K458N, I472V, A475V, T478I, V483I, F490L, and A831V, as well as the double amino acid changes including D614G+Q321L, D614G+I472V, D614G+A831V, D614G+A879S and D614G+M1237I.
Similar to natural variants, although the magnitude of some glycosylation deletions in sensitivity to the sera is less than 4-fold, the differences between mutants and the reference strain (Wuhan-1) were found to be still several-fold and statistically significant, i.e., glycosylation mutants N331Q and N709Q significantly increased the sensitivity to convalescent sera ([Figure 5](#fig5){ref-type="fig"}B).
Discussion {#sec3}
==========
As an RNA virus, SARS-CoV-2 virus is expected to continue evolving over time in human populations. Close monitoring of circulating virus strains is of unquestionable importance to inform research and development of vaccines and therapeutics. Here, we analyzed all spike sequences (over 13,000) reported to GISAID database. After filtering out incomplete, redundant, and ambiguous sequences, we narrowed down to 80 variants. Moreover, as glycosylation of viral protein is well documented to affect viral replication and immune response and SARS-CoV-2 S protein is heavily glycosylated, we also made 26 substitutional mutations at all 22 putative glycosylation sites. In total, we made 106 pseudotyped viruses, allowing us to characterize them using the established method ([@bib25]; see [STAR Methods](#sec4){ref-type="sec"}).
[Table 1](#tbl1){ref-type="table"} summarizes the characteristics of variants and investigational mutants. Of all variants, D614G is of particular note. This variant has been shown to rapidly accumulating since its emergence and linked to more clinical presentations ([@bib17]). At the beginning of this study (May 6, 2020), it accounted for 62.8% ([Table S1](#mmc1){ref-type="supplementary-material"}) of all circulating strains, but by July 3, it had reached 75.7%. This dominant strain could effectively infect the four cell lines tested, being 10-fold more infectious than the original Wuhan-1 strain ([Figure 3](#fig3){ref-type="fig"}).Table 1Characteristics of Variants and MutantsGroup AGroup BGroup CNumber of variants or mutants295126Increased infectivityD614G, D614G+L5F, D614G+D936Y, D614G+S939F, D614G+S943TD614G+V341I, D614G+K458R, D614G+I472V[a](#tblfn1){ref-type="table-fn"}noneDecreased infectivityQ239K, D839Y, P1263L, D614G+Q675HV341I, D364Y, 385-387del, D405V, Q414P, I434K, S438F, D467V, P491R, V503F, R509K, V510L, P521SN122Q, N343Q, N717Q, T719A, N801Q, N1074Q, N331Q+N343QIncreased sensitivity to neutralizing mAbsnoneV367F, Q409E, Q414E, I468F, I468T, Y508H, A522VN165Q, N709QDecreased sensitivity to neutralizing mAbsA831VN439K, L452R, A475V, V483A, F490L, Y508H, D614G+A435S, D614G+I472V[a](#tblfn1){ref-type="table-fn"}N234QIncreased sensitivity to convalescent seraV615LF338L, V367F, I468F, I468TN149H, N149Q, N165Q, N331Q, N354D, N709Q, N1173QDecreased sensitivity to convalescent seraY145del, A831V, D614G+A831V, D614G+A879S, D614G+M1237IQ414E, N439K, G446V, K458N, I472V, A475V, T478I, V483I, F490L, H519P, D614G+Q321L, D614G+I472V[a](#tblfn1){ref-type="table-fn"}none[^3]
Another important finding is that natural variants capable of affecting the reactivity to neutralizing mAbs were almost all located in the RBD region (except A831V) because all antibodies used in this study were targeting the RBD ([@bib2]; [@bib15]; [@bib24]; [@bib30]). Specifically, P2B-2F6 and P2C-1F11 were obtained using RBD as a bait to isolate RBD-specific B cells in peripheral blood mononuclear cells (PBMCs) of SARS-CoV-2 patients ([@bib15]). P2C-1F11 and P2B-2F6 actually bind to overlapping epitope, with the latter being better characterized. Specifically, P2B-2F6 is involved in three hydrophobic interaction sites on RBD (Y449, L452, and F490) ([Figures 6](#fig6){ref-type="fig"}A and 6B). Indeed, both L452R and F490L were natural variants, with decreased sensitivity to neutralization by P2B-2F6 mAb; because both L452R and F490L remain sensitive to P2C-1F11, suggesting this mAb is not derived from the same clone for P2B-2F6. Moreover, both mutants displayed decreased sensitivity to another neutralizing mAb X593 by 10-fold compared with the reference strain ([Figure 4](#fig4){ref-type="fig"}).Figure 6mAb Epitopes and Antigenicity-Related Sites(A and B) Epitope of the mAb P2B-2F6 on the trimer (A) and RBD (B).(C and D) Epitope of the mAb CB6 on the trimer (C) and RBD (D).(E and F) Epitope of the mAb H014 on the trimer (E) and RBD (F).The monoclonal antibody epitope is indicated in purple. The glycosylation sites are indicated in light blue. The sugar chain is shown in orange. The amino acid sites that coincide with the epitopes of monoclonal antibodies are indicated in green. Amino acid sites that do not coincide with the monoclonal antibody epitope are indicated in dark blue.
Although we identified multiple variants with decreased sensitivity to neutralizing mAbs, we need to look at how frequent these variants are in the field. V483A in RBD is one of the two variants with a mutation frequency of over 0.1%. It showed decreased reactivity to the two mAbs (P2B-2F6 and X593) ([Figures 6](#fig6){ref-type="fig"}A and 6B; [@bib15]). Another RBD variant A475V sits in the binding epitope of RBD. It is significantly resistant to several neutralizing mAbs including P2C-1F11, CA1, 247, and CB6. It is noteworthy that CB6 mAb targets the receptor binding epitope ([Figures 6](#fig6){ref-type="fig"}C and 6D; [@bib30]). Specifically, Y508 was buried in the epitope targeted by mAb H014 ([Figures 6](#fig6){ref-type="fig"}E and 6F; [@bib24]). Indeed, the Y508H was found to be resistant to this mAb.
It is worth mentioning that D614G+I472V has shown increased infectivity and more resistance to neutralizing antibodies ([Table 1](#tbl1){ref-type="table"}), but only one sequence (originated from Canada) was reported in GISAID. Moreover, some variants, including N439K, L452R, A475V, V483A, F490L, and Y508H, do have decreased sensitivity to neutralizing mAbs. However, only V483A exceeded 0.1% in frequency at the beginning of the study, all of which were found in the United States, with 28 sequences reported as of May 6, 2020, and 36 up to July 3, 2020. Variants containing N439K showed a significant increase in circulation, i.e., with 5 cases reported as of May 6, 2020 (all in the United Kingdom) to 47 by July 3, 2020 (45 in the United Kingdom and 2 in Romania). In addition, only one sequence from France containing Y508H was deposited in GIRSAID as of May 6, whereas four sequences reported as of July 3, 2020, of which two originated from Netherlands, one from Sweden, and one from France. Only one or two isolates were reported for other variants, which have not been observed to have increased during the time frame we have been monitoring. Nevertheless, as RNA viruses mutate all the time and some variants may only appears during certain period of time, whereas others could emerge in an unpredictable fashion, continued analyses of the circulating strains in terms of the mutation frequency and temporal pattern are warranted.
Our results suggest that the 13 mAbs used in this study could be divided into seven groups, because they appear to be different in the inhibitory effects on the variants. As such, it would be interesting to formulate a therapeutic regimen comprised of at least two mAbs. For example, a combination of P2C-1F11 and X593 should be effective to inhibit all variants in this study. It would be of interest to test more neutralizing antibodies that could be targeting epitopes outside RBD.
With regard to the glycosylation mutants analyzed in this study, N165Q increased the sensitivity to mAb P2b-2F6 whereas N234Q displayed resistance to neutralizing mAbs such CA1, CB6, 157, and others. Although neither of them is found in circulation, the reactivity of these two mutants to neutralizing mAb is still worth noting. As N165 and N234 are located near the RBD region ([@bib40]), these mutants may affect some epitopes targeted by neutralizing mAbs. Specifically, N165 glycosylation site is involved in the binding of mAb to the RBD region of S protein ([@bib2]). It is likely that the sugar chain can mask the epitope targeted by the antibody. This type of glycan shield has been observed in other viruses such as HIV-1. Specifically, the deletion of the N197 sugar chain of HIV-1 gp120 could enhance neutralization by targeting this epitope ([@bib22]; [@bib33]; [@bib37]). In this study, the other glycosylation mutant N234Q, which is also close to the RBD, is resistant to several mAbs. Nevertheless, we cannot exclude the possibility that the sugar chains themselves are the targets of the neutralizing mAbs, similar to observations made in other viruses. Specifically, the sugar chain at residues 142 and 144 in influenza virus H1N1 is essential for the induction of neutralizing antibodies ([@bib13]), while the broadly neutralizing antibodies against the epitopes of HIV-1 gp120, 2G12, PGT121, and PG9 have been found to target the sugar chains ([@bib7]). Because COVID-19 vaccines are being developed in different platform such as bacteria, mammalian cells, and plant expression systems, it is important to consider that different glycosylation profiles could affect the immunogenicity of the vaccines.
The use of sera from 10 convalescent patients in neutralizing assay largely confirmed the results obtained with the well-characterized neutralizing mAbs. It is understood that the magnitude of altered reactivity is slightly smaller with human sera than that with mAbs, given that polyclonal antibodies from convalescent patents are directed against multi-epitopes on the full-length S protein; as a result, these polyclonal antibodies could complement one another. However, the differences in their reactivity to the human antibodies were found to be by several fold in most cases and all determined as statistically significant. Notably, some RBD variants such as A475V and F490L have been confirmed to have decreased sensitivity to both human sera and multiple neutralizing mAbs. A475V reduced the sensitivity to 6 mAb out of the 13 mAb used in this study, whereas F490L reduced the sensitivity to neutralization by 3 mAbs. It is possible that antibodies in convalescent sera are able to neutralize these critical epitopes targeted by these mAbs that are known to disrupt the binding of the S protein to hACE2 receptor ([@bib15]; [@bib30]; [@bib36]; [@bib39]). The A475V could weaken the hydrogen bond and hydrophobic interaction ([@bib30]), whereas F490L may erode the hydrophobic interaction between molecules ([@bib15]).
In summary, we have analyzed over 100 pseudotyped viruses in terms of their infectivity and sensitivity to neutralization by well-characterized mAbs or human sera from convalescent patients. Amino acid changes have been observed across the entire spike protein. An amino acid change (D614G) outside the RBD was found to be more infectious, but no evidence of being resistant to neutralizing antibodies has been demonstrated. However, the increasing dominance of D614G particularly deserves attention. Although some strains with amino acid changes at RBD studied here lost their infectivity, suggesting they may not likely become widespread, the RBD natural variants with increased resistance to antibody-mediated neutralization should be closely watched. Moreover, ablation of glycosylation sites affected their reactivity to neutralizing antibodies, along with their infectivity, enforcing the notion that the glycan could substantially affect SARS-CoV-2 viral replication and vaccine-induced immune responses. Collectively, our findings help shed light on the implications of some evolving strains in circulating viruses with respect to enhanced infectivity and altered antigenicity.
STAR★Methods {#sec4}
============
Key Resources Table {#sec4.1}
-------------------
REAGENT or RESOURCESOURCEIDENTIFIER**Antibodies**X593Laboratory of X. Sunney XieN/ACA1Laboratory of Jinghua Yan; [@bib30]N/ACB6Laboratory of Jinghua Yan; [@bib30]N/AH014Laboratory of Dr. Liangzhi XieN/AH00S022Laboratory of Dr. Liangzhi XieN/AP2C-1F11Laboratory of Linqi Zhang; [@bib15]N/AP2B-2F6Laboratory of Linqi Zhang; [@bib15]N/AAB35Laboratory of Linqi ZhangN/A261-262Laboratory of Linqi ZhangN/A157Laboratory of Linqi ZhangN/A247Laboratory of Linqi ZhangN/AH4Laboratory of Fu Gao; [@bib42]N/AB38Laboratory of Fu Gao; [@bib42]N/A**Bacterial and Virus Strains**DH5α Chemically Competent CellInvitrogenCat\#12034013G^∗^ΔG-VSVKerafastCat\#EH1020-PM**Biological Samples**Convalescent patient serum, CS1This paperN/AConvalescent patient serum, CS2This paperN/AConvalescent patient serum, CS3This paperN/AConvalescent patient serum, CS4This paperN/AConvalescent patient serum, CS6This paperN/AConvalescent patient serum, CS7This paperN/AConvalescent patient serum, CS8This paperN/AConvalescent patient serum, CS10This paperN/AConvalescent patient serum, CS86This paperN/AConvalescent patient serum, CS87This paperN/A**Critical Commercial Assays**Britelite plus reporter gene assay systemPerkinElmerCat\#6066769**Experimental Models: Cell Lines**293TATCCCat\#CRL-3216; RRID: CVCL_0063293T-hACE2Sino Biological CompanyN/AA549ATCCCat\#CCL-185; RRID: CVCL_0023BHK21ATCCCat\#CCL-10; RRID: CVCL_1915Cf2THATCCCat\#CRL-1430; RRID: CVCL_3363CHOATCCCat\#CCL-61; RRID: CVCL_0214CRFKATCCCat\#CCL-94; RRID: CVCL_2426DC2.4MilliporeCat\#SCC142; RRID: CVCL_J409HeLaATCCCat\#CCL-2; RRID: CVCL_0030HepG2ATCCCat\#HB-8065; RRID: CVCL_0027Huh-7JCRBCat\#0403; RRID: CVCL_0336JASWIIATCCCat\#CRL-11904; RRID: CVCL_3727_K562ATCCCat\#CCL-243; RRID: CVCL_0004LLC-MK2ATCCCat\#CCL-7; RRID: CVCL_3009MDBKATCCCat\#CCL-22;; RRID: CVCL_0421MDCKATCCCat\#CCL-34; RRID: CVCL_0422MdKiLaboratory of Dr. Zhengli Shi; [@bib43]N/AMRC-5ATCCCat\#CCL-171; RRID: CVCL_0440Mv 1 LuATCCCat\#CCL-64; RRID: CVCL_0593PK15ATCCCat\#CCL-33; RRID: CVCL_2160RAW264.7ATCCCat\#TIB-71; RRID: CVCL_0493RlKiTLaboratory of Dr. Zhengli Shi; [@bib43]N/ASK-N-MCATCCCat\#HTB-10; RRID: CVCL_0530STATCCCat\#CRL-1746; RRID: CVCL_2204VeroATCCCat\#CCL-81; RRID: CVCL_0059VeroE6ATCCCat\#CRL-1586; RRID: CVCL_0574**Oligonucleotides**VSV (P protein)-F:TCTCGTCTGGATCAGGCGGGENEWIZN/AVSV (P protein)-R: TGCTCTTCCACTCCA\
TCCTCTTGGGENEWIZN/APrimers design for mutagenesis were located in [Table S2](#mmc2){ref-type="supplementary-material"}N/AN/A**Recombinant DNA**Plasmid:pcDNA3.1.S2 (codon-optimized S gene of SARS-CoV-2, GenBank: [MN_908947](ncbi-n:MN_908947){#interref60})[@bib25]Addgene ID: [149457](ncbi-tnm:149457){#intref0015}Plasmid:pcDNA3.1.S2-L5FThis paperN/APlasmid:pcDNA3.1.S2-L8VThis paperN/APlasmid:pcDNA3.1.S2-L8WThis paperN/APlasmid:pcDNA3.1.S2-H49YThis paperN/APlasmid:pcDNA3.1.S2-Y145delThis paperN/APlasmid:pcDNA3.1.S2-Q239KThis paperN/APlasmid:pcDNA3.1.S2-F338LThis paperN/APlasmid:pcDNA3.1.S2-V341IThis paperN/APlasmid:pcDNA3.1.S2-A348TThis paperN/APlasmid:pcDNA3.1.S2-N354DThis paperN/APlasmid:pcDNA3.1.S2-N354KThis paperN/APlasmid:pcDNA3.1.S2-S359NThis paperN/APlasmid:pcDNA3.1.S2-D364YThis paperN/APlasmid:pcDNA3.1.S2-V367FThis paperN/APlasmid:pcDNA3.1.S2-K378RThis paperN/APlasmid:pcDNA3.1.S2-P384LThis paperN/APlasmid:pcDNA3.1.S2-385-387delThis paperN/APlasmid:pcDNA3.1.S2-D405VThis paperN/APlasmid:pcDNA3.1.S2-R408IThis paperN/APlasmid:pcDNA3.1.S2-Q409EThis paperN/APlasmid:pcDNA3.1.S2-Q414EThis paperN/APlasmid:pcDNA3.1.S2-Q414PThis paperN/APlasmid:pcDNA3.1.S2-I434KThis paperN/APlasmid:pcDNA3.1.S2-A435SThis paperN/APlasmid:pcDNA3.1.S2-S438FThis paperN/APlasmid:pcDNA3.1.S2-N439KThis paperN/APlasmid:pcDNA3.1.S2-G446VThis paperN/APlasmid:pcDNA3.1.S2-L452RThis paperN/APlasmid:pcDNA3.1.S2-K458RThis paperN/APlasmid:pcDNA3.1.S2-K458NThis paperN/APlasmid:pcDNA3.1.S2-D467VThis paperN/APlasmid:pcDNA3.1.S2-I468FThis paperN/APlasmid:pcDNA3.1.S2-I468TThis paperN/APlasmid:pcDNA3.1.S2-I472VThis paperN/APlasmid:pcDNA3.1.S2-A475VThis paperN/APlasmid:pcDNA3.1.S2-G476SThis paperN/APlasmid:pcDNA3.1.S2-T478IThis paperN/APlasmid:pcDNA3.1.S2-V483AThis paperN/APlasmid:pcDNA3.1.S2-V483IThis paperN/APlasmid:pcDNA3.1.S2-F490LThis paperN/APlasmid:pcDNA3.1.S2-P491RThis paperN/APlasmid:pcDNA3.1.S2-V503FThis paperN/APlasmid:pcDNA3.1.S2-Y508HThis paperN/APlasmid:pcDNA3.1.S2-R509KThis paperN/APlasmid:pcDNA3.1.S2-V510LThis paperN/APlasmid:pcDNA3.1.S2-H519QThis paperN/APlasmid:pcDNA3.1.S2-H519PThis paperN/APlasmid:pcDNA3.1.S2-A520SThis paperN/APlasmid:pcDNA3.1.S2-P521SThis paperN/APlasmid:pcDNA3.1.S2-A522SThis paperN/APlasmid:pcDNA3.1.S2-A522VThis paperN/APlasmid:pcDNA3.1.S2-D614GThis paperN/APlasmid:pcDNA3.1.S2-V615LThis paperN/APlasmid:pcDNA3.1.S2-A831VThis paperN/APlasmid:pcDNA3.1.S2-D839EThis paperN/APlasmid:pcDNA3.1.S2-D839YThis paperN/APlasmid:pcDNA3.1.S2-D936YThis paperN/APlasmid:pcDNA3.1.S2-S943TThis paperN/APlasmid:pcDNA3.1.S2-S943RThis paperN/APlasmid:pcDNA3.1.S2-G1124VThis paperN/APlasmid:pcDNA3.1.S2-P1263LThis paperN/APlasmid:pcDNA3.1.S2-Y145del+R408IThis paperN/APlasmid:pcDNA3.1.S2-D614G+L5FThis paperN/APlasmid:pcDNA3.1.S2-D614G+Q239KThis paperN/APlasmid:pcDNA3.1.S2-D614G+Q321LThis paperN/APlasmid:pcDNA3.1.S2-D614G+V341IThis paperN/APlasmid:pcDNA3.1.S2-D614G+A435SThis paperN/APlasmid:pcDNA3.1.S2-D614G+K458RThis paperN/APlasmid:pcDNA3.1.S2-D614G+I472VThis paperN/APlasmid:pcDNA3.1.S2-D614G+H519PThis paperN/APlasmid:pcDNA3.1.S2-D614G+Q675HThis paperN/APlasmid:pcDNA3.1.S2-D614G+A831VThis paperN/APlasmid:pcDNA3.1.S2-D614G+A845SThis paperN/APlasmid:pcDNA3.1.S2-D614G+A879SThis paperN/APlasmid:pcDNA3.1.S2-D614G+D936YThis paperN/APlasmid:pcDNA3.1.S2-D614G+S939FThis paperN/APlasmid:pcDNA3.1.S2-D614G+S943TThis paperN/APlasmid:pcDNA3.1.S2-D614G+M1229IThis paperN/APlasmid:pcDNA3.1.S2-D614G+M1237IThis paperN/APlasmid:pcDNA3.1.S2-D614G+P1263LThis paperN/APlasmid:pcDNA3.1.S2-N17QThis paperN/APlasmid:pcDNA3.1.S2-N61QThis paperN/APlasmid:pcDNA3.1.S2-N74QThis paperN/APlasmid:pcDNA3.1.S2-N122QThis paperN/APlasmid:pcDNA3.1.S2-N149QThis paperN/APlasmid:pcDNA3.1.S2-N165QThis paperN/APlasmid:pcDNA3.1.S2-N234QThis paperN/APlasmid:pcDNA3.1.S2-N282QThis paperN/APlasmid:pcDNA3.1.S2-N331QThis paperN/APlasmid:pcDNA3.1.S2-N343QThis paperN/APlasmid:pcDNA3.1.S2-N603QThis paperN/APlasmid:pcDNA3.1.S2-N616QThis paperN/APlasmid:pcDNA3.1.S2-N657QThis paperN/APlasmid:pcDNA3.1.S2-N709QThis paperN/APlasmid:pcDNA3.1.S2-N717QThis paperN/APlasmid:pcDNA3.1.S2-N801QThis paperN/APlasmid:pcDNA3.1.S2-N1074QThis paperN/APlasmid:pcDNA3.1.S2-N1098QThis paperN/APlasmid:pcDNA3.1.S2-N1134QThis paperN/APlasmid:pcDNA3.1.S2-N1158QThis paperN/APlasmid:pcDNA3.1.S2-N1173QThis paperN/APlasmid:pcDNA3.1.S2-N1194QThis paperN/APlasmid:pcDNA3.1.S2-N74KThis paperN/APlasmid:pcDNA3.1.S2-N149HThis paperN/APlasmid:pcDNA3.1.S2-T719AThis paperN/APlasmid:pcDNA3.1.S2-N331Q+N343QThis paperN/A**Software and Algorithms**GraphPad Prism version 8.0.1(244)GraphPad Software<https://www.graphpad.com>Microsoft Office Home and Student 2019Microsoft Corporation<https://www.microsoft.com/microsoft-365>Heatmap Illustrator (HemI) version 1.0.3.7[@bib5]<http://ccd.biocuckoo.org>BioEdit version 7.2BioEidt Software<https://bioedit.software.informer.com>Adobe Illustrator CC 2018Adobe<https://www.adobe.com>
Resource Availability {#sec4.2}
---------------------
### Lead Contact {#sec4.2.1}
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Dr. Youchun Wang (<wangyc@nifdc.org.cn>).
### Materials Availability {#sec4.2.2}
All the unique reagents generated in this study are available from the Lead Contact with a completed Materials Transfer Agreement.
### Data and Code Availability {#sec4.2.3}
This study did not generate any unique datasets or code.
Experimental Models and Subject Details {#sec4.3}
---------------------------------------
### Cell lines {#sec4.3.1}
Most cell lines were cultured in Dulbecco's modified Eagle medium (DMEM, high glucose; Hyclone, Cat\#SH30243.01). They include 293T(*Homo sapiens*, embryonic kidney), 293T-hACE2 (293T cells stably expressed hACE2), A549 (*Homo sapiens*, liver), BHK21 (*Mesocricetus auratus*, kidney), Cf2TH (*Canis familiaris*, thymus), CHO (*Cricetulus griseus*, ovary), CRFK (*Felis catus*, kidney), HeLa (*Homo sapiens*, cervix), HepG2 (*Homo sapiens*, liver), Huh-7 (*Homo sapiens*, liver, gallbladder), LLC-MK2 (*Macaca mulatta*, kidney), MDBK (*Bos taurus*, kidney), MDCK (*Canis familiaris*, kidney), MRC-5 (*Homo sapiens*, lung), MV1-Lu (Neovison vison, lung), PK15 (*Sus scrofa*, kidney), RAW264.7 (*Mus musculus*, leukemia, ascites), SK-N-MC (*Homo sapiens*, brain), ST (Sus scrofa, testis), Vero (Cercopithecus aethiops, kidney), and VeroE6 (*Cercopithecus aethiops*, kidney) cells. DC2.4 (*Mus musculus*, bone marrow derived dendritic cells), K562 (*Homo sapiens*, bone marrow) and MdKi (*Myotis davidii*, kidney) and cells were incubated in RPMI medium modified (Hyclone, Cat\#SH30809.01). RlKiT(R. leschenaultii, kidney) were cultured in DMEM/F-12, GlutaMAX (GIBCO, Cat\#10565-018). JASWII (*Mus musculus*, bone marrow) were cultured in MEMα, nucleosides (GIBCO, Cat\#12571063) with 5 ng/ml Recombinant Murine GM-CSF (Peprotech, Cat\#315-03). All the cells were cultured in media supplemented with 100 U/mL of Penicillin-Streptomycin solution (GIBCO, Cat\#15140163), 20mM N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid (HEPES, GIBCO, Cat\#15630080) and 10% fetal bovine serum (FBS, Pansera ES, PAN-Biotech GmbH, Cat\#ST30-2602), a humidified atmosphere with 5% CO~2~ at 37°C, with the exception of JASWII cells which were cultured in medium with 20% FBS. 0.25% Trypsin-EDTA (GIBCO, Cat\#25200056) were used to detach cells for subculture.
### Human sera {#sec4.3.2}
Human serum samples from 10 convalescent patients in Wuhan (CS1, CS2, CS3, CS4, CS6, CS7, CS8 and CS10) and Shandong (CS86 and CS87) were collected on Feb 18, 2020 and Mar 5, 2020. All volunteers signed informed consent forms.
Method Details {#sec4.4}
--------------
### Site-directed mutagenesis {#sec4.4.1}
pcDNA3.1.S2 recombinant plasmid (GenBank: [MT_613044](ncbi-n:MT_613044){#interref65}), constructed by inserted the codon-optimized S gene of SARS-CoV-2 (GenBank: [MN_908947](ncbi-n:MN_908947){#interref70}) into pcDNA3.1 ([@bib25]), was used as the template to generate the plasmid with mutagenesises in S gene. Following procedure of circular PCR, 15 to 20 nucleotides before and after the target mutation site were selected as forward primers, while the reverse complementary sequences were selected as reverse primers. Following site-directed mutagenesis PCR, the template chain was digested using *Dpn*I restriction endonuclease (NEB, USA). Afterward, the PCR product was directly used to transform *E. coli* DH5α competent cells; single clones were selected and then sequenced. The primers designed for the specific mutation sites are listed in [Table S2](#mmc2){ref-type="supplementary-material"}, and the frequency of different variants in the epidemic population is listed in [Table S1](#mmc1){ref-type="supplementary-material"}.
### Production and titration of pseudotyped viruses {#sec4.4.2}
Pseudotyped viruses incorporated with spike protein from either SARS-CoV-2, variants or mutants were constructed using a procedure described by us recently ([@bib25]). On day before transfection, 293T cells were prepared and adjusted to the concentration of 5 −7 × 10^5^ cell/ml, 15 mL of which were transferred into a T75 cell culture flask and incubated overnight at 37°C in an incubator conditioned with 5% CO~2~. The cells generally reach 70%--90% confluence after overnight incubation. Thirty microgram of DNA plasmid expressing the spike protein was transfected according to the user's instruction manual. The transfected cells were subsequently infected with G^∗^ΔG-VSV (VSV G pseudotyped virus) at concentration of 7.0 × 10^4^TCID50/ml. These cells were incubated at 37°C for 6-8 hours in the presence of in 5% CO~2~. Afterward, cell supernatant was discarded, followed by rinsing the cells gently with PBS +1% FBS. Next, 15ml fresh complete DMEM was added to the flask and cultured for 24 h. Twenty-four hours post infection, SARS-CoV-2 pseudotyped viruses containing culture supernatants were harvested, filtered (0.45-μm pore size, Millipore, Cat\#SLHP033RB) and stored at −70°C in 2 mL aliquots until use.
The 50% tissue culture infectious dose (TCID50) of SARS-CoV-2 pseudovirus was determined using a single-use aliquot from the pseudovirus bank to avoid inconsistencies resulted from repeated freezing-thawing cycles.
For titration of the pseudotyped virus, a 2-fold initial dilution with six replicates was made in 96-well culture plates followed by serial 3-fold dilutions. The last column was employed as the cells control without pseudotyped virus. Subsequently, the 96-well plates were seeded with Huh-7 cells adjusted to 2 × 10^5^cells/ml. After 24 h incubation at 37°C in a humidified atmosphere with 5% CO~2~, the supernatant was aspirated and discarded gently to leave 100 μL in each well; next, 100 μL of luciferase substrate (Perkinelmer, Cat\#6066769) was added to each well. After 2-min incubation at room temperature in the dark, 150 μL of lysate was transferred to white 96-well plates for the detection of luminescence using a luminometer (PerkinElmer, Ensight). Positive was determined to be ten-fold higher than the negative (cells only) in terms of relative luminescence unit (RLU) values. The 50% tissue culture infectious dose (TCID50) was calculated using the Reed--Muench method ([@bib25]).
### Quantification of pseudotyped virus particles using RT-PCR {#sec4.4.3}
Before quantification, all the pseudotyped viruses were purified through a 25% sucrose cushion by ultra-centrifugation at 100,000 × g for 3 h ([@bib25]). Viral RNA was extracted from 140 μL of purified pseudotyped viruses using the QIAamp Viral RNA Mini Kit (QIAGEN, Cat\#52906), and served as template for reverse transcription using the SuperScript III First-Strand Synthesis System for RT-PCR kit reagent (Invitrogen, Cat\#18080-051). Virus quantification by real-time PCR was performed using the TB Green Premix Ex TaqII (TaKaRa, Cat\#RR820A), following the supplier's instruction. The P protein gene of VSV virus was cloned into the vector pCDNA3.1(+) as a plasmid standard, with the viral copy number calculated accordingly. See primers in the [Key Resources Table](#sec4.1){ref-type="sec"}.
### Infection assay {#sec4.4.4}
Using the quantitative RT-PCR, we normalized the pseudotyped virus particles to the same amount. After normalization, 100 μL of the pseudotyped virus with 10-fold dilution was added to wells in 96-well cell culture plate. After the cells were trypsin-digested, 2 × 10^4^/100 μL cells were added to each well in the 96-well plates. The plates were then incubated at 37°C in a humidified atmosphere with 5% CO~2~. After incubation for 24 hours, chemiluminescence detection was performed as described in the titration of pseudotyped viruses. Each group contained 3-5 replicates.
### Neutralization assay {#sec4.4.5}
The virus neutralization assay was conducted as described previously ([@bib25]). Briefly, 100 μL serial dilutions of human sera or monoclonal antibody preparations were added into 96-well plates. After that, 50 μL pseudoviruses with concentration of 1300 TCID50/ml were added into the plates, followed by incubation at 37°C for 1 hour. Afterward, Huh-7 cells were added into the plates (2 × 10^4^ cells/100 μL cells per well), followed by incubation at 37°C in a humidified atmosphere with 5% CO~2~. Chemiluminescence detection was performed after 24 hours incubation. The Reed-Muench method was used to calculate the virus neutralization titer. The results are based on 3-5 replicates unless specified. In order to validate the test operation process, the Coefficient of Variance (CV) control of replicates is set within 30% of six wells, so is the CV for the duplicate sample wells.
Quantification and Statistical Analysis {#sec4.5}
---------------------------------------
GraphPad Prism 8 was used for plotting and statistical analysis; the values were expressed as mean ± SEM. One-way ANOVA and Holm-Sidak's multiple comparisons test was used to analyze the differences between groups. A p value of less than 0.05 was considered to be significant. ^∗^p \< 0.05, ^∗∗^p \< 0.01, ^∗∗∗^p \< 0.005, ^∗∗∗∗^p \< 0.001, ns represents no significant difference.
Supplemental Information {#app2}
========================
Table S1. Rates of Variants, Related to Figure 1 Table S2. Primers Design for Mutagenesis, Related to Key Resources Table
We would like to thank Prof. X. Sunney Xie of Peking University for providing mAb X593; Prof. JinghuaYan of the Institute of Microbiology, Chinese Academy of Sciences for mAbs CA1 and CB6; Dr. Liangzhi Xie from Sino Biological Company for mAbs H014 and H00S022 and the 293T-hACE2 cell line; Prof. Linqi Zhang of Tsinghua University for mAbs P2C-1F11, P2B-2F6, AB35, 261-262, 157, and 247; and Prof. Yan Wu of the Institute of Microbiology, Chinese Academy of Sciences for H4 and B38. We would like to thank Dr. Xiaoming Yang from China National Biotec Group Company Ltd. for providing convalescent sera (CS1, CS2, CS3, CS4, CS6, CS7, CS8, and CS10) and Ms. Fangyu Dong from China Biologic Products Holdings, Inc. for convalescent sera CS86 and CS87. This work was supported by the National Science and Technology Major Projects of Drug Discovery (2018ZX09101001), the National Science and Technology Major Projects of Infectious Disease (2017ZX10304402), and the 10.13039/100000865Bill and Melinda Gates Foundation (INV-006379).
Author Contributions {#sec5}
====================
Y.W. and W.H. conceived, designed, and supervised the experiments. J.N., Li Zhang, Y.W., Xuguang Li, and W.H. wrote the manuscript. Q. Li, J.W., H.H., S.L., C.Z., H.L., H.Q., L.N., J.L., M.W., Q.S., Q. Lu, and Xiaoyu Li performed the experiments. Linqi Zhang and Q.Z. provided some mAbs and analyzed them. All of the authors have read and approved the final manuscript.
Declaration of Interests {#sec6}
========================
The authors declare no competing interests.
Supplemental Information can be found online at <https://doi.org/10.1016/j.cell.2020.07.012>.
[^1]: These authors contributed equally
[^2]: Lead Contact
[^3]: D614G+I472V is the only variant with increased infectivity and decreased sensitivity to neutralizing mAb and convalescent sera. It is of note only one sequence is recorded in GISAID.
|
Q:
Trying to use EJS with Node.js
I'm trying to setup my first app using EJS (Normally use Jade) and I've got it all setup and my pages are loading, I followed a tutorial on how to do it, this is my layout
<!DOCTYPE html>
<html lang="en">
<head>
<meta charset="utf8">
<title>
<%= title %>
</title>
<link href="//netdna.bootstrapcdn.com/twitter-bootstrap/2.3.1/css/bootstrap-combined.min.css" rel="stylesheet">
<script src="//netdna.bootstrapcdn.com/twitter-bootstrap/2.3.1/js/bootstrap.min.js"></script>
<!-- HTML5 shim, for IE6-8 support of HTML elements -->
<!--[if lt IE 9]>
<script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script>
<![endif]-->
</head>
<body>
<%- body %>
</body>
</html>
and this is my Home page
<div class='title'>
<%= title %>
</div>
But when I load the home page, and view page source, all I see is the Home page elements, I don't see html, body, head, title any of that stuff. Not sure why, this is my app.js
app.set('views', __dirname + '/views');
app.set('view engine', 'ejs');
and my 2 files are layout.ejs, index.ejs
Thanks in advance!
Following: http://robdodson.me/blog/2012/05/31/how-to-use-ejs-in-express/
A:
Recent versions of Express (3.x) don't support layouts anymore (see this migration page).
Instead (also suggested by the migration page), you can use ejs-locals to get back that functionality. The GitHub page of ejs-locals gives some easy examples how to get layouts working with Express 3.
|
Filmmaker, musician, performer, and all-around Renaissance guy Rob Zombie is coming out with another horror film, called, simply, 31. It takes place in the five days leading up to Halloween and follows the fates of five people who’ve disappeared.
31 is set in a place called “Murder World,” and so of course, me being the 70s cinema geek I am, my first question to Rob was whether or not he was influenced by Michael Critchton’s Westworld. He shut me down on that one, stating, “No, not at all.”
So then I asked if it was inspired by haunted houses or Halloween mazes. I was getting warmer. He replied, “The movie’s not really inspired by this, but what kicked off the idea was the Great American Nightmare I was running and promoting [last year]. I was just watching the crowds running in terror from clowns running around with chainsaws and things. And I thought, ‘Oh, man, it’s so funny watching people be scared and be chased. People hate being chased.’ And they know it’s totally fake. I was like, ‘I don’t know; people certainly hate clowns.’ So I was inspired by that. That was what we were thinking; [it was] the light bulb moment about something that could be our next movie.”
After months of teasing fans with video clips and mysterious messages, Zombie unveiled via Rolling Stone a crowd-funding campaign for his new film at RZ-31.com.
Rolling Stone noted, “The director is offering up a variety of high-quality rewards to people who want to support the movie, including autographed posters, a chance for Zombie to follow a winner on Twitter, a winner’s name in the credits, a lifetime laminate to see Zombie on tour at any show, and a gig as an extra in 31. Zombie will also offer selected props from his movies, including Halloween masks and giant crosses from House of 1000 Corpses.”
Rob said, “I’m crowd-funding because I realize that it’s an incredible opportunity to engage the fans. They’ve always been the most important thing for me because, with metal and horror, the fans aren’t just fans – it’s their life, their lifestyle. They live and breathe it, as I do, and any way that you can bring the people that are as passionate about it as you are into the process is a win-win for everybody.”
When I talked to him, I asked what he thought about the stigma associated with crowd-funding. Although it’s definitely becoming more acceptable, some people do still see it as a virtual tin cup. Asking him to tell us a little bit about what pushed him over the edge to go ahead and try it for the first time, Rob replied, “Yeah, I mean, I felt the same way, you know, because I didn’t really know too much about it. When the idea to do this came up, I was like, ‘I don’t know; it seems kind of weird.’ And I wrestled with it for a long time. And the way that I kind of got my head around was it that well, we’re not asking for free money. That’s not the case. Actually, it’s people are donating money and then receiving something that’s basically equal that value in return. It’s more just kind of running an online 31 store in advance of the film. And in that case it didn’t really bother me. You know… it’s not mandatory. If someone wants to do it, they could do it; and if they don’t, they don’t have to… There are things that people have mentioned to me over the years, but they usually mentioned them too late. You know, ‘Oh, can I get an autographed this or that, or how do I be an extra? Or how could I do this?’ And I’m like, ‘Well, we can do all those questions I always get asked now.’ And when we put it all together, that was the thing… it was like, okay, this seems cool; this doesn’t seem too weird. I mean, if I was a kid and something was happening that I could be a part of, cool! So that stigma didn’t seem appropriate in this case.”
If you’d like to check it out, “It’s pretty easy to find,” says Zombie. “It’s at RZ-31.com, and it’s all over my Facebook page and Twitter. They could go there and see all kinds of stuff. Some of it’s original prop stuff left over from Halloween and some other movies and things, some used stuff. There’s a variety of things… these are the common sections though. I always look at that, and if anyone mentions a lot that they would like [something], we would try to add it. So it’s very fan-involved. It has been since day one. It ends on Halloween.”
Dread Central: As horror fans we, of course, do have the Halloween franchise to go to, but relatively speaking there are not that many horror films centered around the holiday. Is that the basic concept for 31 then?
Rob Zombie: Yeah, it’s very simple. It’s Halloween, [but what’s] another good term for it? That’s when I thought about 31, that’s a nice symbol for October 31st. And really the concept is very simple. Five people are kidnapped the day before Halloween, taken to a location, they don’t know where they are, and forced to fight for their lives in a sort of a ‘Most Dangerous Game’ scenario until one second past midnight, when it becomes November 1st. And if they’re alive, they’re released; if they’re dead, well, obviously they’re dead. And so that’s the simple concept. And what killed it was I was doing some research and Halloween is the number one day of the year that people go missing.
DC: Really? I had no idea.
RZ: Which is understandable. Since everyone’s in costume, it would be pretty easy to kidnap somebody on Halloween. And I thought, wow, that’s really kind of scary. That thought was actually one of the big inspirations.
DC: Will you be working with your favorite actors again in the film? Will we get to see Bill Moseley and Sid Haig and Sheri?
RZ: I don’t know if they’ll be in this one. You know, I’m still working on it. I’m not sure. There’ll probably be some recognizable faces from the past, and there will be a lot of new faces. That would be my guess.
DC: As a fan, of course, you watch horror movies all year round. But I’m wondering, what does Rob Zombie like to watch on Halloween? Do you have a favorite holiday film?
RZ: I like going back to all the classic stuff… I think it’s because that’s what I would watch when I was a little kid when it was Halloween. So any early Universal stuff, you know, when I’m in the mood. But, of course, ‘The Great Pumpkin, Charlie Brown.’ If that does not play, Halloween did not happen.
Synopsis
31 is the story of five random people kidnapped during the five days leading up to Halloween and held hostage in a place called Murder World. While trapped inside this man-made Hell, they must fight to survive by playing the most violent game known to man… a game called 31. |
Q:
Get all entities in which at least one part of its field starts with some string parameter
I have an entity with a dept field that is an undefined number of strings representing postal codes, delimited by the character -.
Example:
35000-35200-35700
How could I get all entities in which at least one part of dept field starts with some string parameter?
class Town {
/**
* @var integer
*
* @ORM\Column(name="id", type="integer")
* @ORM\Id
* @ORM\GeneratedValue(strategy="AUTO")
* @Serializer\Expose
*/
private $id;
/**
* @var string
*
* @ORM\Column(name="dept", type="string", length=255, nullable=true)
*/
private $dept;
}
I would like to have something like this, with 35 as $str parameter for example:
$em->getRepository("Town")->findByDeptAutoComplete($str);
A:
I were you, I would store these postal codes in another entity. (I'm assuming your strings delimited by - are postal codes.)
But to respond to your question about finding entities in which at least one part of dept field starts with some string parameter, you can test if town.dept contains -35 (the delimiter + the department 35, in example), then test the start of the string (to catch the first postal code):
public function findByDeptAutoComplete($dept) {
$queryResult = $this->createQueryBuilder('town')
->select('town')
->where("LOCATE(CONCAT('-', :dept), town.dept) > 0 OR SUBSTRING(town.dept, 1, LENGTH(:dept)) = :dept")
->setParameter('dept', $dept)
->getQuery()
->getResult()
;
return $queryResult;
}
|
I'verealized that there is a loopback dependency between the audioinput/output dependency with the 2.6.38 kernel running on a gumstix overo and also using the 2.6.35 kernel running on the Beaglenboard.
You can replicate this issue by plugging some music into the Line injack and then fire up alsamixer. Then you would need to modify theDAC2 Dig level, the one on the right no the left. As you lower thevolume you'll hear your music input decreasing and as you increase itthe music level would increase. If you lower it enough you can captureaudio from the input jack without hearing it out of your speaker butthe bad thing is that also controls your speaker output so if you tryto play some sound out of gumstix/beagleboard you won't be able to do because youneed to increase your DAC2 Dig level in alsamixer ... it's a catch22!! I couldn't find any solutions readily.
I am running a console-only Angstrom image on both boards. I've used the Beagleboard's line in/out capabilities with no issues using the 2.6.29 kernel in the past so is there an update in the TWL4030 ALSA driver that I should take into account? thanks
al fayez |
Can Lyme Disease Come Back in Dogs?
Deer ticks are the most common vector of Lyme disease in the United States.
Ablestock.com/AbleStock.com/Getty Images
One tick bite can change your pet's life forever. As carriers of the Borrelia burgdorferi bacteria, these tiny arachnids can spread Lyme disease to canines and people alike. While canine infections usually are resolved with simple medical treatment, there still is a possibility of a resurgent infection in your pet.
Phantom Symptoms
Dogs are more resistant to Lyme disease than humans. Most dogs in high-risk regions, like New England and the mid-Atlantic states, are exposed to the bacteria, but only a fraction develop an active infection during their lifetime. Infected canines may show signs of illness within weeks, but some don't develop visible symptoms for several months. This makes prompt detection and treatment difficult, as you may not notice any strange behavior from your furry friend until the infection is fully underway. Joint pain, lameness and other symptoms may emerge and fade periodically. While some dogs recover from active infections spontaneously, the subsiding of symptoms does not necessarily mean your dog's infection is gone.
A Lifelong Condition
Some studies suggest that prompt treatment reduces the chances of a recurring infection of Lyme disease. Declining health and immune system function also may allow latent bacteria to produce fresh symptoms during the months or years after the initial infection. Chronic Lyme is a serious condition in humans. Fortunately, most relapsing infections in canines respond to antibiotic treatment, according to Companion Animal Parasite Council. Standard symptoms of a recurring infection include depressed energy levels, diminished appetite and joint pain. Blood tests following treatment may offer your vet some insight on the scope of your dog's recovery, but a relapse in symptoms is the only way to confirm if your dog has a chronic infection or not.
Infected Again
Some diseases only strike once, leaving survivors immune to the pathogen in the future. This is not the case with Lyme disease. Even if your pet recovers from the infection, the antibodies produced by his immune system diminish over time. Current vaccines only protect against a certain strain of the bacteria, and are not foolproof in reducing the risk of an active infection, according to the Cornell University College of Veterinary Medicine. Your dog's Lyme disease can resurface in the form of a new infection, which is why owners in high-risk areas should take measures to keep parasites off of their pets.
Cure Controversy
While most dogs respond to antibiotic treatment and make a full recovery from Lyme disease once diagnosed by a veterinarian, some canines suffer from repeated episodes of infection throughout their lives. Chronic infections are rare in dogs and still are not fully understood by researchers. Remnants of the Lyme bacteria linger inside of the body after treatment. Some researchers suggest that the bacteria cannot be removed completely with treatment, while other scientists believe that a complete cure is possible, according to VCA Animal Hospitals.
Photo Credits
Ablestock.com/AbleStock.com/Getty Images
About the Author
Quentin Coleman has written for various publications, including All Pet News and Safe to Work Australia. He spent more tan 10 years nursing kittens, treating sick animals and domesticating semi-feral cats for a local animal shelter. He graduated from the University of Delaware with a bachelor's degree in journalism. |
Before I even get started here, let me just quickly point out the fact that, as of writing this, Bruce Jenner has not, in any way, said he was transgender or that he was transitioning or anything. No amount of media speculation, obsession, or bullying can decide who Bruce Jenner is. Maybe he is trans. Maybe he’ll ask us to use female pronouns and we will welcome him to our community. Or maybe he’s not trans. It doesn’t matter. If there is something to tell, he will tell us when he is ready. His identity is his to share, not anyone else’s to determine.
That, itself, is an important enough concept to warrant its own post, but this post is about Jill Soloway, not Bruce Jenner. Everyone’s favorite cisgender (not-transgender) teller of trans stories. Jill Soloway, creator of Amazon’s Golden Globe winning Transparent. The show with everyone’s favorite “Moppa.”
I’ll admit it, up until yesterday, I was a big Transparent fan. When I first heard about the show, before it was available for streaming via Amazon Prime, I went through my normal reaction to a cisgender (male) actor, Jeffrey Tambor, playing a transgender woman. I was angry. Trans characters should be played by trans actors. And trans stories should be written and told by trans people. These are our stories to tell. Our lives and stories are not for cis entertainment or appropriation or profit.
But I watched Transparent anyway. I gave it a chance. And I liked it. A lot actually. I liked it not because of the trans story it was telling, but because it _didn’t _feel like it was telling a trans story. It was telling a cis story. It was telling the story of Maura’s family and how fucked they are. She was the grounded parent of three selfish adult children. Then the show won at the Golden Globes. Speeches were made by both Soloway and Tambor. Good speeches, actually, saying all the “right things.” They talked about trans people, mentioned Leelah Alcorn, etc etc. I overlooked the stuff that was problematic about the show and gave it a pass. I even vouched for it and recommended it to friends.
I regret this now.
The one time I’ve given a pass instead of sticking to my gut, I got burned.
Yesterday, Jill Soloway posted this gem to Facebook:
Yes, that’s ally-of-the-year Jill Soloway poking fun at Bruce Jenner’s gender and the speculation of him being trans. Using being transgender as a joke. Some ally. She should know better. She should be speaking out against others doing this. Instead, she’s joining in.
Now, I’m sure straight cisgender men everywhere will go ahead and break this down for us trans people that we have no sense of humor and she’s an ally and she has a trans parent whom she supports very deeply and blah blah blah, but the reality is this shit hurts. A lot. “With friends like these” and all that. If she truly cared about trans people beyond her own “Moppa,” this post never would have happened.
Trans people are constantly the punchline to jokes. In most cases, there isn’t even a fully formed joke. The formula is little more than ”trans = lolz.” Why does this relatively tame joke hurt so much? It hurts because she was supposed to be our ally. She conned many of us into trusting her, albeit begrudgingly.
When you’re transgender, you go through every day of your life with the fear that all your friends, family, and coworkers who are nice to you and “completely support” you are actually laughing at you behind your back. You never truly shake feeling like you’re their joke. Jill Soloway’s post yesterday confirms all those fears and suspicions. They are talking about you and they _are_ laughing about your life. You are their joke. It’s not just in your head, it’s real.
Is it really so much to ask to not be a punchline? To not have our lives be a joke? To be treated be as human? If even our “friends,” can’t resit, then I guess we are just asking too much.
I learned something from Jill Soloway. I will never ever trust or give a pass to a cisgender person telling trans stories. I will never say “but she gets it!“ She doesn’t. And the next cis person who comes along won’t either. |
/*
* Library attribute type test program
*
* Copyright (C) 2006-2020, Joachim Metz <joachim.metz@gmail.com>
*
* Refer to AUTHORS for acknowledgements.
*
* This program is free software: you can redistribute it and/or modify
* it under the terms of the GNU Lesser General Public License as published by
* the Free Software Foundation, either version 3 of the License, or
* (at your option) any later version.
*
* This program is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU General Public License for more details.
*
* You should have received a copy of the GNU Lesser General Public License
* along with this program. If not, see <https://www.gnu.org/licenses/>.
*/
#include <common.h>
#include <file_stream.h>
#include <types.h>
#if defined( HAVE_STDLIB_H ) || defined( WINAPI )
#include <stdlib.h>
#endif
#include "ewf_test_libcerror.h"
#include "ewf_test_libewf.h"
#include "ewf_test_macros.h"
#include "ewf_test_memory.h"
#include "ewf_test_rwlock.h"
#include "ewf_test_unused.h"
#include "../libewf/libewf_attribute.h"
#include "../libewf/libewf_lef_extended_attribute.h"
uint8_t ewf_test_attribute_data1[ 37 ] = {
0x01, 0x00, 0x00, 0x00, 0x00, 0x07, 0x00, 0x00, 0x00, 0x05, 0x00, 0x00, 0x00, 0x48, 0x00, 0x69,
0x00, 0x64, 0x00, 0x64, 0x00, 0x65, 0x00, 0x6e, 0x00, 0x00, 0x00, 0x74, 0x00, 0x72, 0x00, 0x75,
0x00, 0x65, 0x00, 0x00, 0x00 };
#if defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT )
/* Tests the libewf_attribute_initialize function
* Returns 1 if successful or 0 if not
*/
int ewf_test_attribute_initialize(
void )
{
libcerror_error_t *error = NULL;
libewf_attribute_t *attribute = NULL;
libewf_lef_extended_attribute_t *lef_extended_attribute = NULL;
int result = 0;
#if defined( HAVE_EWF_TEST_MEMORY )
int number_of_malloc_fail_tests = 1;
int number_of_memset_fail_tests = 1;
int test_number = 0;
#endif
#if defined( HAVE_EWF_TEST_MEMORY ) && defined( HAVE_EWF_TEST_RWLOCK )
number_of_malloc_fail_tests += 1;
#endif
/* Initialize test
*/
result = libewf_lef_extended_attribute_initialize(
&lef_extended_attribute,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"lef_extended_attribute",
lef_extended_attribute );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
/* Test regular cases
*/
result = libewf_attribute_initialize(
&attribute,
lef_extended_attribute,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"attribute",
attribute );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
result = libewf_attribute_free(
&attribute,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
1 );
EWF_TEST_ASSERT_IS_NULL(
"attribute",
attribute );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
/* Test error cases
*/
result = libewf_attribute_initialize(
NULL,
lef_extended_attribute,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
attribute = (libewf_attribute_t *) 0x12345678UL;
result = libewf_attribute_initialize(
&attribute,
lef_extended_attribute,
&error );
attribute = NULL;
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
result = libewf_attribute_initialize(
&attribute,
NULL,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
#if defined( HAVE_EWF_TEST_MEMORY )
for( test_number = 0;
test_number < number_of_malloc_fail_tests;
test_number++ )
{
/* Test libewf_attribute_initialize with malloc failing
*/
ewf_test_malloc_attempts_before_fail = test_number;
result = libewf_attribute_initialize(
&attribute,
lef_extended_attribute,
&error );
if( ewf_test_malloc_attempts_before_fail != -1 )
{
ewf_test_malloc_attempts_before_fail = -1;
if( attribute != NULL )
{
libewf_attribute_free(
&attribute,
NULL );
}
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NULL(
"attribute",
attribute );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
}
for( test_number = 0;
test_number < number_of_memset_fail_tests;
test_number++ )
{
/* Test libewf_attribute_initialize with memset failing
*/
ewf_test_memset_attempts_before_fail = test_number;
result = libewf_attribute_initialize(
&attribute,
lef_extended_attribute,
&error );
if( ewf_test_memset_attempts_before_fail != -1 )
{
ewf_test_memset_attempts_before_fail = -1;
if( attribute != NULL )
{
libewf_attribute_free(
&attribute,
NULL );
}
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NULL(
"attribute",
attribute );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
}
#endif /* defined( HAVE_EWF_TEST_MEMORY ) */
/* Clean up
*/
result = libewf_lef_extended_attribute_free(
&lef_extended_attribute,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
1 );
EWF_TEST_ASSERT_IS_NULL(
"lef_extended_attribute",
lef_extended_attribute );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
return( 1 );
on_error:
if( error != NULL )
{
libcerror_error_free(
&error );
}
if( attribute != NULL )
{
libewf_attribute_free(
&attribute,
NULL );
}
if( lef_extended_attribute != NULL )
{
libewf_lef_extended_attribute_free(
&lef_extended_attribute,
NULL );
}
return( 0 );
}
#endif /* defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT ) */
/* Tests the libewf_attribute_free function
* Returns 1 if successful or 0 if not
*/
int ewf_test_attribute_free(
void )
{
libcerror_error_t *error = NULL;
int result = 0;
#if defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT ) && defined( HAVE_EWF_TEST_RWLOCK )
libewf_attribute_t *attribute = NULL;
libewf_lef_extended_attribute_t *lef_extended_attribute = NULL;
#endif
/* Test error cases
*/
result = libewf_attribute_free(
NULL,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
#if defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT ) && defined( HAVE_EWF_TEST_RWLOCK )
/* Initialize test
*/
result = libewf_lef_extended_attribute_initialize(
&lef_extended_attribute,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"lef_extended_attribute",
lef_extended_attribute );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
result = libewf_attribute_initialize(
&attribute,
lef_extended_attribute,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"attribute",
attribute );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
/* Test libewf_attribute_free with pthread_rwlock_destroy failing in libcthreads_read_write_lock_free
*/
ewf_test_pthread_rwlock_destroy_attempts_before_fail = 0;
result = libewf_attribute_free(
&attribute,
&error );
if( ewf_test_pthread_rwlock_destroy_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_destroy_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NULL(
"attribute",
attribute );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
/* Clean up
*/
result = libewf_lef_extended_attribute_free(
&lef_extended_attribute,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
1 );
EWF_TEST_ASSERT_IS_NULL(
"lef_extended_attribute",
lef_extended_attribute );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
#endif /* defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT ) && defined( HAVE_EWF_TEST_RWLOCK ) */
return( 1 );
on_error:
if( error != NULL )
{
libcerror_error_free(
&error );
}
#if defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT ) && defined( HAVE_EWF_TEST_RWLOCK )
if( attribute != NULL )
{
libewf_attribute_free(
&attribute,
NULL );
}
if( lef_extended_attribute != NULL )
{
libewf_lef_extended_attribute_free(
&lef_extended_attribute,
NULL );
}
#endif
return( 0 );
}
#if defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT )
/* Tests the libewf_attribute_get_utf8_name_size function
* Returns 1 if successful or 0 if not
*/
int ewf_test_attribute_get_utf8_name_size(
libewf_attribute_t *attribute )
{
libcerror_error_t *error = NULL;
size_t utf8_string_size = 0;
int result = 0;
int utf8_name_size_is_set = 0;
/* Test regular cases
*/
result = libewf_attribute_get_utf8_name_size(
attribute,
&utf8_string_size,
&error );
EWF_TEST_ASSERT_NOT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
utf8_name_size_is_set = result;
/* Test error cases
*/
result = libewf_attribute_get_utf8_name_size(
NULL,
&utf8_string_size,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
if( utf8_name_size_is_set != 0 )
{
result = libewf_attribute_get_utf8_name_size(
attribute,
NULL,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#if defined( HAVE_EWF_TEST_RWLOCK )
/* Test libewf_attribute_get_utf8_name_size with pthread_rwlock_rdlock failing in libcthreads_read_write_lock_grab_for_read
*/
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf8_name_size(
attribute,
&utf8_string_size,
&error );
if( ewf_test_pthread_rwlock_rdlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
/* Test libewf_attribute_get_utf8_name_size with pthread_rwlock_unlock failing in libcthreads_read_write_lock_release_for_read
*/
ewf_test_pthread_rwlock_unlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf8_name_size(
attribute,
&utf8_string_size,
&error );
if( ewf_test_pthread_rwlock_unlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_unlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#endif /* defined( HAVE_EWF_TEST_RWLOCK ) */
return( 1 );
on_error:
if( error != NULL )
{
libcerror_error_free(
&error );
}
return( 0 );
}
/* Tests the libewf_attribute_get_utf8_name function
* Returns 1 if successful or 0 if not
*/
int ewf_test_attribute_get_utf8_name(
libewf_attribute_t *attribute )
{
uint8_t utf8_string[ 64 ];
libcerror_error_t *error = NULL;
int result = 0;
int utf8_name_is_set = 0;
/* Test regular cases
*/
result = libewf_attribute_get_utf8_name(
attribute,
utf8_string,
64,
&error );
EWF_TEST_ASSERT_NOT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
utf8_name_is_set = result;
/* Test error cases
*/
result = libewf_attribute_get_utf8_name(
NULL,
utf8_string,
64,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
if( utf8_name_is_set != 0 )
{
result = libewf_attribute_get_utf8_name(
attribute,
NULL,
64,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
result = libewf_attribute_get_utf8_name(
attribute,
utf8_string,
0,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
result = libewf_attribute_get_utf8_name(
attribute,
utf8_string,
(size_t) SSIZE_MAX + 1,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#if defined( HAVE_EWF_TEST_RWLOCK )
/* Test libewf_attribute_get_utf8_name with pthread_rwlock_rdlock failing in libcthreads_read_write_lock_grab_for_read
*/
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf8_name(
attribute,
utf8_string,
64,
&error );
if( ewf_test_pthread_rwlock_rdlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
/* Test libewf_attribute_get_utf8_name with pthread_rwlock_unlock failing in libcthreads_read_write_lock_release_for_read
*/
ewf_test_pthread_rwlock_unlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf8_name(
attribute,
utf8_string,
64,
&error );
if( ewf_test_pthread_rwlock_unlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_unlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#endif /* defined( HAVE_EWF_TEST_RWLOCK ) */
return( 1 );
on_error:
if( error != NULL )
{
libcerror_error_free(
&error );
}
return( 0 );
}
/* Tests the libewf_attribute_get_utf16_name_size function
* Returns 1 if successful or 0 if not
*/
int ewf_test_attribute_get_utf16_name_size(
libewf_attribute_t *attribute )
{
libcerror_error_t *error = NULL;
size_t utf16_string_size = 0;
int result = 0;
int utf16_name_size_is_set = 0;
/* Test regular cases
*/
result = libewf_attribute_get_utf16_name_size(
attribute,
&utf16_string_size,
&error );
EWF_TEST_ASSERT_NOT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
utf16_name_size_is_set = result;
/* Test error cases
*/
result = libewf_attribute_get_utf16_name_size(
NULL,
&utf16_string_size,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
if( utf16_name_size_is_set != 0 )
{
result = libewf_attribute_get_utf16_name_size(
attribute,
NULL,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#if defined( HAVE_EWF_TEST_RWLOCK )
/* Test libewf_attribute_get_utf16_name_size with pthread_rwlock_rdlock failing in libcthreads_read_write_lock_grab_for_read
*/
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf16_name_size(
attribute,
&utf16_string_size,
&error );
if( ewf_test_pthread_rwlock_rdlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
/* Test libewf_attribute_get_utf16_name_size with pthread_rwlock_unlock failing in libcthreads_read_write_lock_release_for_read
*/
ewf_test_pthread_rwlock_unlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf16_name_size(
attribute,
&utf16_string_size,
&error );
if( ewf_test_pthread_rwlock_unlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_unlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#endif /* defined( HAVE_EWF_TEST_RWLOCK ) */
return( 1 );
on_error:
if( error != NULL )
{
libcerror_error_free(
&error );
}
return( 0 );
}
/* Tests the libewf_attribute_get_utf16_name function
* Returns 1 if successful or 0 if not
*/
int ewf_test_attribute_get_utf16_name(
libewf_attribute_t *attribute )
{
uint16_t utf16_string[ 64 ];
libcerror_error_t *error = NULL;
int result = 0;
int utf16_name_is_set = 0;
/* Test regular cases
*/
result = libewf_attribute_get_utf16_name(
attribute,
utf16_string,
64,
&error );
EWF_TEST_ASSERT_NOT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
utf16_name_is_set = result;
/* Test error cases
*/
result = libewf_attribute_get_utf16_name(
NULL,
utf16_string,
64,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
if( utf16_name_is_set != 0 )
{
result = libewf_attribute_get_utf16_name(
attribute,
NULL,
64,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
result = libewf_attribute_get_utf16_name(
attribute,
utf16_string,
0,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
result = libewf_attribute_get_utf16_name(
attribute,
utf16_string,
(size_t) SSIZE_MAX + 1,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#if defined( HAVE_EWF_TEST_RWLOCK )
/* Test libewf_attribute_get_utf16_name with pthread_rwlock_rdlock failing in libcthreads_read_write_lock_grab_for_read
*/
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf16_name(
attribute,
utf16_string,
64,
&error );
if( ewf_test_pthread_rwlock_rdlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
/* Test libewf_attribute_get_utf16_name with pthread_rwlock_unlock failing in libcthreads_read_write_lock_release_for_read
*/
ewf_test_pthread_rwlock_unlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf16_name(
attribute,
utf16_string,
64,
&error );
if( ewf_test_pthread_rwlock_unlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_unlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#endif /* defined( HAVE_EWF_TEST_RWLOCK ) */
return( 1 );
on_error:
if( error != NULL )
{
libcerror_error_free(
&error );
}
return( 0 );
}
/* Tests the libewf_attribute_get_utf8_value_size function
* Returns 1 if successful or 0 if not
*/
int ewf_test_attribute_get_utf8_value_size(
libewf_attribute_t *attribute )
{
libcerror_error_t *error = NULL;
size_t utf8_string_size = 0;
int result = 0;
int utf8_value_size_is_set = 0;
/* Test regular cases
*/
result = libewf_attribute_get_utf8_value_size(
attribute,
&utf8_string_size,
&error );
EWF_TEST_ASSERT_NOT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
utf8_value_size_is_set = result;
/* Test error cases
*/
result = libewf_attribute_get_utf8_value_size(
NULL,
&utf8_string_size,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
if( utf8_value_size_is_set != 0 )
{
result = libewf_attribute_get_utf8_value_size(
attribute,
NULL,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#if defined( HAVE_EWF_TEST_RWLOCK )
/* Test libewf_attribute_get_utf8_value_size with pthread_rwlock_rdlock failing in libcthreads_read_write_lock_grab_for_read
*/
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf8_value_size(
attribute,
&utf8_string_size,
&error );
if( ewf_test_pthread_rwlock_rdlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
/* Test libewf_attribute_get_utf8_value_size with pthread_rwlock_unlock failing in libcthreads_read_write_lock_release_for_read
*/
ewf_test_pthread_rwlock_unlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf8_value_size(
attribute,
&utf8_string_size,
&error );
if( ewf_test_pthread_rwlock_unlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_unlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#endif /* defined( HAVE_EWF_TEST_RWLOCK ) */
return( 1 );
on_error:
if( error != NULL )
{
libcerror_error_free(
&error );
}
return( 0 );
}
/* Tests the libewf_attribute_get_utf8_value function
* Returns 1 if successful or 0 if not
*/
int ewf_test_attribute_get_utf8_value(
libewf_attribute_t *attribute )
{
uint8_t utf8_string[ 64 ];
libcerror_error_t *error = NULL;
int result = 0;
int utf8_value_is_set = 0;
/* Test regular cases
*/
result = libewf_attribute_get_utf8_value(
attribute,
utf8_string,
64,
&error );
EWF_TEST_ASSERT_NOT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
utf8_value_is_set = result;
/* Test error cases
*/
result = libewf_attribute_get_utf8_value(
NULL,
utf8_string,
64,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
if( utf8_value_is_set != 0 )
{
result = libewf_attribute_get_utf8_value(
attribute,
NULL,
64,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
result = libewf_attribute_get_utf8_value(
attribute,
utf8_string,
0,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
result = libewf_attribute_get_utf8_value(
attribute,
utf8_string,
(size_t) SSIZE_MAX + 1,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#if defined( HAVE_EWF_TEST_RWLOCK )
/* Test libewf_attribute_get_utf8_value with pthread_rwlock_rdlock failing in libcthreads_read_write_lock_grab_for_read
*/
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf8_value(
attribute,
utf8_string,
64,
&error );
if( ewf_test_pthread_rwlock_rdlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
/* Test libewf_attribute_get_utf8_value with pthread_rwlock_unlock failing in libcthreads_read_write_lock_release_for_read
*/
ewf_test_pthread_rwlock_unlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf8_value(
attribute,
utf8_string,
64,
&error );
if( ewf_test_pthread_rwlock_unlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_unlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#endif /* defined( HAVE_EWF_TEST_RWLOCK ) */
return( 1 );
on_error:
if( error != NULL )
{
libcerror_error_free(
&error );
}
return( 0 );
}
/* Tests the libewf_attribute_get_utf16_value_size function
* Returns 1 if successful or 0 if not
*/
int ewf_test_attribute_get_utf16_value_size(
libewf_attribute_t *attribute )
{
libcerror_error_t *error = NULL;
size_t utf16_string_size = 0;
int result = 0;
int utf16_value_size_is_set = 0;
/* Test regular cases
*/
result = libewf_attribute_get_utf16_value_size(
attribute,
&utf16_string_size,
&error );
EWF_TEST_ASSERT_NOT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
utf16_value_size_is_set = result;
/* Test error cases
*/
result = libewf_attribute_get_utf16_value_size(
NULL,
&utf16_string_size,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
if( utf16_value_size_is_set != 0 )
{
result = libewf_attribute_get_utf16_value_size(
attribute,
NULL,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#if defined( HAVE_EWF_TEST_RWLOCK )
/* Test libewf_attribute_get_utf16_value_size with pthread_rwlock_rdlock failing in libcthreads_read_write_lock_grab_for_read
*/
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf16_value_size(
attribute,
&utf16_string_size,
&error );
if( ewf_test_pthread_rwlock_rdlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
/* Test libewf_attribute_get_utf16_value_size with pthread_rwlock_unlock failing in libcthreads_read_write_lock_release_for_read
*/
ewf_test_pthread_rwlock_unlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf16_value_size(
attribute,
&utf16_string_size,
&error );
if( ewf_test_pthread_rwlock_unlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_unlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#endif /* defined( HAVE_EWF_TEST_RWLOCK ) */
return( 1 );
on_error:
if( error != NULL )
{
libcerror_error_free(
&error );
}
return( 0 );
}
/* Tests the libewf_attribute_get_utf16_value function
* Returns 1 if successful or 0 if not
*/
int ewf_test_attribute_get_utf16_value(
libewf_attribute_t *attribute )
{
uint16_t utf16_string[ 64 ];
libcerror_error_t *error = NULL;
int result = 0;
int utf16_value_is_set = 0;
/* Test regular cases
*/
result = libewf_attribute_get_utf16_value(
attribute,
utf16_string,
64,
&error );
EWF_TEST_ASSERT_NOT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
utf16_value_is_set = result;
/* Test error cases
*/
result = libewf_attribute_get_utf16_value(
NULL,
utf16_string,
64,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
if( utf16_value_is_set != 0 )
{
result = libewf_attribute_get_utf16_value(
attribute,
NULL,
64,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
result = libewf_attribute_get_utf16_value(
attribute,
utf16_string,
0,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
result = libewf_attribute_get_utf16_value(
attribute,
utf16_string,
(size_t) SSIZE_MAX + 1,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#if defined( HAVE_EWF_TEST_RWLOCK )
/* Test libewf_attribute_get_utf16_value with pthread_rwlock_rdlock failing in libcthreads_read_write_lock_grab_for_read
*/
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf16_value(
attribute,
utf16_string,
64,
&error );
if( ewf_test_pthread_rwlock_rdlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_rdlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
/* Test libewf_attribute_get_utf16_value with pthread_rwlock_unlock failing in libcthreads_read_write_lock_release_for_read
*/
ewf_test_pthread_rwlock_unlock_attempts_before_fail = 0;
result = libewf_attribute_get_utf16_value(
attribute,
utf16_string,
64,
&error );
if( ewf_test_pthread_rwlock_unlock_attempts_before_fail != -1 )
{
ewf_test_pthread_rwlock_unlock_attempts_before_fail = -1;
}
else
{
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
-1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"error",
error );
libcerror_error_free(
&error );
}
#endif /* defined( HAVE_EWF_TEST_RWLOCK ) */
return( 1 );
on_error:
if( error != NULL )
{
libcerror_error_free(
&error );
}
return( 0 );
}
#endif /* defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT ) */
/* The main program
*/
#if defined( HAVE_WIDE_SYSTEM_CHARACTER )
int wmain(
int argc EWF_TEST_ATTRIBUTE_UNUSED,
wchar_t * const argv[] EWF_TEST_ATTRIBUTE_UNUSED )
#else
int main(
int argc EWF_TEST_ATTRIBUTE_UNUSED,
char * const argv[] EWF_TEST_ATTRIBUTE_UNUSED )
#endif
{
#if defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT )
libcerror_error_t *error = NULL;
libewf_attribute_t *attribute = NULL;
libewf_lef_extended_attribute_t *lef_extended_attribute = NULL;
ssize_t read_count = 0;
int result = 0;
#endif /* defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT ) */
EWF_TEST_UNREFERENCED_PARAMETER( argc )
EWF_TEST_UNREFERENCED_PARAMETER( argv )
#if defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT )
EWF_TEST_RUN(
"libewf_attribute_initialize",
ewf_test_attribute_initialize );
#endif /* defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT ) */
EWF_TEST_RUN(
"libewf_attribute_free",
ewf_test_attribute_free );
#if defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT )
#if !defined( __BORLANDC__ ) || ( __BORLANDC__ >= 0x0560 )
/* Initialize attribute for tests
*/
result = libewf_lef_extended_attribute_initialize(
&lef_extended_attribute,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"lef_extended_attribute",
lef_extended_attribute );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
read_count = libewf_lef_extended_attribute_read_data(
lef_extended_attribute,
ewf_test_attribute_data1,
37,
&error );
EWF_TEST_ASSERT_EQUAL_SSIZE(
"read_count",
read_count,
(ssize_t) 37 );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
result = libewf_attribute_initialize(
&attribute,
lef_extended_attribute,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
1 );
EWF_TEST_ASSERT_IS_NOT_NULL(
"attribute",
attribute );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
/* Run tests
*/
EWF_TEST_RUN_WITH_ARGS(
"libewf_attribute_get_utf8_name_size",
ewf_test_attribute_get_utf8_name_size,
attribute );
EWF_TEST_RUN_WITH_ARGS(
"libewf_attribute_get_utf8_name",
ewf_test_attribute_get_utf8_name,
attribute );
EWF_TEST_RUN_WITH_ARGS(
"libewf_attribute_get_utf16_name_size",
ewf_test_attribute_get_utf16_name_size,
attribute );
EWF_TEST_RUN_WITH_ARGS(
"libewf_attribute_get_utf16_name",
ewf_test_attribute_get_utf16_name,
attribute );
EWF_TEST_RUN_WITH_ARGS(
"libewf_attribute_get_utf8_value_size",
ewf_test_attribute_get_utf8_value_size,
attribute );
EWF_TEST_RUN_WITH_ARGS(
"libewf_attribute_get_utf8_value",
ewf_test_attribute_get_utf8_value,
attribute );
EWF_TEST_RUN_WITH_ARGS(
"libewf_attribute_get_utf16_value_size",
ewf_test_attribute_get_utf16_value_size,
attribute );
EWF_TEST_RUN_WITH_ARGS(
"libewf_attribute_get_utf16_value",
ewf_test_attribute_get_utf16_value,
attribute );
/* Clean up
*/
result = libewf_attribute_free(
&attribute,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
1 );
EWF_TEST_ASSERT_IS_NULL(
"attribute",
attribute );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
result = libewf_lef_extended_attribute_free(
&lef_extended_attribute,
&error );
EWF_TEST_ASSERT_EQUAL_INT(
"result",
result,
1 );
EWF_TEST_ASSERT_IS_NULL(
"lef_extended_attribute",
lef_extended_attribute );
EWF_TEST_ASSERT_IS_NULL(
"error",
error );
#endif /* !defined( __BORLANDC__ ) || ( __BORLANDC__ >= 0x0560 ) */
#endif /* defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT ) */
return( EXIT_SUCCESS );
on_error:
#if defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT )
if( error != NULL )
{
libcerror_error_free(
&error );
}
if( attribute != NULL )
{
libewf_attribute_free(
&attribute,
NULL );
}
if( lef_extended_attribute != NULL )
{
libewf_lef_extended_attribute_free(
&lef_extended_attribute,
NULL );
}
#endif /* defined( __GNUC__ ) && !defined( LIBEWF_DLL_IMPORT ) */
return( EXIT_FAILURE );
}
|
Musculoskeletal findings in obese subjects before and after weight loss following bariatric surgery.
To determine the point prevalence of painful musculoskeletal (MSK) conditions in obese subjects before and after weight loss following bariatric surgery. Longitudinal, interventional, unblended. Forty-eight obese subjects (47 women, one man, mean age 44+/-9 years; mean body mass index (BMI) 51+/-8 kg/m(2)) recruited from an academic medical center bariatric surgery program. Comorbid medical conditions; MSK findings; BMI; Western Ontario McMaster Osteoarthritis Index (WOMAC) for pain, stiffness and function; and SF-36 for quality of life. Consecutive subjects were recruited from the University Hospitals of Cleveland Bariatric Surgery Program. Musculoskeletal signs and symptoms and non-MSK comorbid conditions were documented at baseline and at follow-up. SUBJECTS completed the SF-36 and the WOMAC questionnaires. Analyses were carried out for each MSK site, fibromyalgia syndrome (FMS) and for the cumulative effect on the spine, upper and lower extremities. The impact of change in comorbid medical conditions, BMI, physical and mental health domains of the SF-36 on the WOMAC pain subscale score was evaluated. SF-36 outcomes were compared to normal published controls. Forty-eight subjects were available for baseline and a follow-up assessment 6-12 months after gastric bypass surgery. They lost an average of 41+/-15 kg and the mean BMI decreased from 51+/-8 to 36+/-7 kg/m(2). Baseline comorbid medical conditions were present in 96% before surgery and 23% after weight loss. There was an increased prevalence of painful MSK conditions at baseline compared to general population frequencies. Musculoskeletal complaints had been present in 100% of obese subjects before, and 23% after weight loss. The greatest improvements occurred in the cervical and lumbar spine, the foot and in FMS (decreased by 90, 83, 83 and 92%, respectively). Seventy-nine percent had upper extremity MSK conditions before and 40% after weight loss. Before surgery, 100% had lower extremity MSK conditions and only 37% did after weight loss. The WOMAC subscale and composite scores all improved significantly, as did the SF-36((R)). Change in BMI was the main factor impacting the WOMAC pain score. There was a higher frequency of multiple MSK complaints, including non-weight-bearing sites compared to historical controls, before surgery, which decreased significantly at most sites following weight loss and physical activity. These benefits may improve further, as weight loss may continue for up to 24 months. The benefits seen with weight loss indicate that prevention and treatment of obesity can improve MSK health and function. |
Q:
How to use Windows Authentication in WPF?
I'm not finding much documentation on how to use Windows Authentication in a WPF app. I wouldn't have thought that it would be any different than in any non-WPF app, but it seems that it is. I want to go into my project Properties -> Application and ensure that Windows Authentication is on, but that option is not available in a WPF app (as the following document confirms).
http://msdn.microsoft.com/en-us/library/tzdks800.aspx
If I ignore all that and just look at My.User.Name (VB), it is empty. This tells me that somehow Windows Authentication is not enabled.
Seems like there is a concept I am missing; could someone point me in the right direction?
My plan is to use a PrincipalPermission attribute to restrict access to certain parts of my app (or perhaps the entire app, by applying it to Application_Startup()).
A:
Itowlson's answer was correct, but also, in order to use the PrincipalPermissionAttribute on any method, you have to first make the windows principal the current principal by calling:
AppDomain.CurrentDomain.SetPrincipalPolicy(PrincipalPolicy.WindowsPrincipal)
A:
The reason this doesn't work in WPF is that these services are implemented in VB's WindowsFormsApplicationBase class, which isn't used in WPF applications. To do the same thing yourself:
Call WindowsIdentity.GetCurrent() to get the Windows user identity. You can get the name from this.
If you specifically want to set the thread principal the way the VB Windows Authentication option does, call Thread.CurrentPrincipal = new WindowsPrincipal(WindowsIdentity.GetCurrent()) -- this is exactly what WindowsFormsApplicationBase does internally.
EDIT: If you prefer the My.User API, it looks like you should be able to do the same thing by calling My.User.InitializeWithWindowsUser(). I haven't tested this though.
|
Photocontact dermatitis.
Photocontact dermatitis is not a common condition, but neither is it rare. Both photo-irritant contact dermatitis (PICD) and photoallergic contact dermatitis (PACD) are seen by most dermatologists in general practice. PICD is diagnosed on clinical grounds and is usually caused by furocoumarins in plants like limes and celery. PACD is caused primarily by sunscreens but can also be the result of fragrances and antibacterial agents. PACD can only be diagnosed by photo-patch testing that most dermatologists, even those who patch test and give phototherapy in their office, do not perform. The procedure as outlined in this manuscript is relatively simple and can easily be accomplished in the dermatologist's office. |
// Copyright 2015 The Chromium Authors. All rights reserved.
// Use of this source code is governed by a BSD-style license that can be
// found in the LICENSE file.
#include "services/preferences/tracked/device_id.h"
#include <windows.h>
#include <sddl.h> // For ConvertSidToStringSidA.
#include <memory>
#include "base/logging.h"
#include "base/macros.h"
MachineIdStatus GetDeterministicMachineSpecificId(std::string* machine_id) {
DCHECK(machine_id);
wchar_t computer_name[MAX_COMPUTERNAME_LENGTH + 1] = {};
DWORD computer_name_size = arraysize(computer_name);
if (!::GetComputerNameW(computer_name, &computer_name_size))
return MachineIdStatus::FAILURE;
DWORD sid_size = SECURITY_MAX_SID_SIZE;
char sid_buffer[SECURITY_MAX_SID_SIZE];
SID* sid = reinterpret_cast<SID*>(sid_buffer);
DWORD domain_size = 128; // Will expand below if needed.
std::unique_ptr<wchar_t[]> domain_buffer(new wchar_t[domain_size]);
SID_NAME_USE sid_name_use;
// Although the fifth argument to |LookupAccountNameW()|,
// |ReferencedDomainName|, is annotated as |_Out_opt_|, if a null
// value is passed in, zero is returned and |GetLastError()| will
// return |ERROR_INSUFFICIENT_BUFFER| (assuming that nothing else went
// wrong). In order to ensure that the call to |LookupAccountNameW()|
// has succeeded, it is necessary to include the following logic and
// obtain the domain name.
if (!::LookupAccountNameW(nullptr, computer_name, sid, &sid_size,
domain_buffer.get(), &domain_size, &sid_name_use)) {
// If the initial size of |domain_buffer| was too small, the
// required size is now found in |domain_size|. Resize and try
// again.
if (::GetLastError() != ERROR_INSUFFICIENT_BUFFER)
return MachineIdStatus::FAILURE;
domain_buffer.reset(new wchar_t[domain_size]);
if (!::LookupAccountNameW(nullptr, computer_name, sid, &sid_size,
domain_buffer.get(), &domain_size,
&sid_name_use)) {
return MachineIdStatus::FAILURE;
}
}
// Ensure that the correct type of SID was obtained. The
// |LookupAccountNameW()| function seems to always return
// |SidTypeDomain| instead of |SidTypeComputer| when the computer name
// is passed in as its second argument and therefore both enum values
// will be considered acceptable. If the computer name and user name
// coincide, |LookupAccountNameW()| seems to always return the machine
// SID and set the returned enum to |SidTypeDomain|.
DCHECK(sid_name_use == SID_NAME_USE::SidTypeComputer ||
sid_name_use == SID_NAME_USE::SidTypeDomain);
char* sid_string = nullptr;
if (!::ConvertSidToStringSidA(sid, &sid_string))
return MachineIdStatus::FAILURE;
*machine_id = sid_string;
::LocalFree(sid_string);
return MachineIdStatus::SUCCESS;
}
|
(Valter Campanato/Agência Brasil)
SÃO PAULO – A sessão é de forte alta para o Ibovespa após uma queda expressiva na véspera em meio às notícias negativas sobre as negociações comerciais entre Estados Unidos e China e com o discurso inicial de Jair Bolsonaro em Davos não ajudando a empolgar os investidores por aqui. Contudo, o cenário mais tranquilo no exterior e as novas falas do governo em Davos ajudaram a impulsionar os mercados, apesar do presidente Jair Bolsonaro cancelar entrevista coletiva que concederia durante o evento.
Às 17h22 (horário de Brasília), o Ibovespa registrava alta de 1,28%, aos 96.317 pontos. Na máxima do dia, o índice chegou aos 96.559 pontos, renovando a máxima histórica intradiária registrada na última sexta-feira, de 96.396 pontos.
O dólar futuro com vencimento em fevereiro tinha queda de 1,44%, a R$ 3,764, enquanto o dólar comercial fechou com perdas de 1,11%, a R$ 3,7633, na mínima do dia.
PUBLICIDADE
Ontem, as bolsas americanas tiveram forte queda com a notícia do Financial Times de que os EUA rejeitaram uma oferta da China nas negociações comerciais e a realização de um novo encontro.
Contudo, hoje, os índices em Wall Street registram ganhos após o diretor do Conselho Econômico Nacional da Casa Branca, Larry Kudlow, negar as informações e dizer que não havia nenhuma outra reunião planejada além da visita do vice-primeiro-ministro chinês, Liu He, na próxima semana. As bolsas também sobem na esteira dos resultados corporativos positivos como da P&G e da IBM.
Já as bolsas asiáticas fecharam perto da estabilidade, após a China prometer hoje ampliar gastos fiscais este ano, focando no corte de impostos para pequenas empresas, de forma a impulsionar sua economia, que no ano passado cresceu no ritmo mais fraco desde 1990. Em 2018, os gastos fiscais do governo chinês avançaram 8,7%, a 22,09 trilhões de yuans (US$ 3,26 trilhões), enquanto a receita cresceu 6,2%, a 18,34 trilhões de yuans, de acordo com dados do Ministério de Finanças chinês.
Em meio a essas notícias de estímulo, blue chips como Vale (VALE3) e Petrobras (PETR3;PETR4) registram uma sessão de recuperação. A estatal repercute ainda a alta do petróleo de cerca de 0,8%. A commodity se recupera após maior queda em mais de uma semana, com sinais de que crescimento da oferta de xisto dos EUA está desacelerando e expectativas de que cortes na produção da Opep estejam a caminho de equilibrar o mercado.
Já no noticiário doméstico, o mercado repercute o tom mais incisivo do presidente Jair Bolsonaro sobre a reforma da previdência em entrevista à Bloomberg, além da fala de Paulo Guedes sobre taxação de JCP e dividendos. A notícia poderia ter impacto negativo para os bancos; contudo, em meio ao ânimo generalizado do mercado, a sessão é de estabilidade para as ações do setor.
Em entrevista à Bloomberg, Bolsonaro prometeu reformar a Previdência, adotando a idade mínima, e afirmando que a mudança será substancial. Ele disse ainda que a situação dos estados aponta para a aprovação da reforma, que interessa aos governadores. Por outro lado, perguntado sobre a participação dos militares, o presidente afirmou o sistema de aposentadoria das Forças Armadas entraria apenas “numa segunda parte da reforma”.
PUBLICIDADE
Proteja seu dinheiro. Invista com a ajuda da melhor assessoria do Brasil: abra uma conta na XP – é de graça!
Vale destacar ainda que Bolsonaro, que seguiria com a sua agenda em Davos, cancelou entrevista coletiva que faria com o ministro da Economia Paulo Guedes e o ministro da Justiça e Segurança Pública Sérgio Moro às 13h (horário de Brasília).
Ainda sobre Davos, em almoço fechado promovido pelo Itaú, Paulo Guedes afirmou que o governo quer simplificar a tributação e diminuir a taxação para pessoa jurídica de 34% para 15%, enquanto pretende taxar os dividendos e juros sobre capital próprio.
Desde a campanha de Bolsonaro existe a temática da tributação de dividendos. A novidade diz respeito aos JCP – outro formato de distribuição de lucro a acionistas, no qual o Imposto de Renda, hoje, é retido diretamente na fonte.
Em entrevista para a Bloomberg, Guedes ainda afirmou que irá zerar o déficit fiscal de 2019 e que o governo pretende levantar US$ 20 bilhões só com privatizações neste ano, cerca de R$ 75 bilhões. A partir daí, a continuidade do equilíbrio do orçamento dependerá da aprovação de outras reformas, segundo o ministro.
A prioridade é a reforma da Previdência, inclusive com transição para um sistema de capitalização. “Temos um grande buraco fiscal, temos um sistema obsoleto, sistema antigo já está quebrado, temos de consertar o antigo e criar um novo.”
Guedes também pretende reduzir subsídios futuramente, mas sabe que essa iniciativa demandará mais tempo, já que precisa de aprovação do Congresso Nacional. Hoje os subsídios concedidos pelo governo estão em US$ 100 bilhões. “Se cortarmos 10%, já são US$ 10 bi”.
Sobre o movimento de queda dos contratos de juros futuros, com baixa de 8 pontos para o contrato de janeiro de 2021, a 7,22% e baixa de 9 pontos-base para o vencimento em janeiro de 2023, a 8,34%. Os investidores repercutem o IPCA-15, que ficou em 0,30% em janeiro na comparação mensal, ante estimativa de alta de 0,35%.
PUBLICIDADE
Ontem à tarde, os contratos foram impactados pela entrevista do presidente do Banco Central, Ilan Goldfajn, à Reuters, que destacou que o BC sempre olhará se os juros estão estimulativos. Isso fez os juros futuros reverterem alta por volta das 16h, com o mercado interpretando a fala como dovish, uma vez que para a política monetária ficar mais estimulativa a Selic poderia ter de cair.
Mais tarde, o BC afirmou em nota de esclarecimento que “a mensagem de política monetária não se alterou desde a última reunião do Copom”. “A autoridade monetária continua priorizando a cautela, a perseverança e a serenidade”, destacou.
Altas e baixas da bolsa
Além de Petrobras e Vale em alta, a sessão é animada para praticamente todas as ações do Ibovespa, que registram uma sessão de ganhos.
Um dos destaques de alta é a Sabesp. O secretário da Fazenda de São Paulo, Henrique Meirelles, afirmou que o estado utilizará a estatal para cumprir orçamento este ano. Bandeira do governador de São Paulo, João Doria (PSDB), o programa de desestatização poderá contribuir de forma importante para o Estado cumprir o Orçamento em 2019.
A capitalização da Sabesp, estimada em R$ 5 bilhões, junto com o contingenciamento de R$ 6 bilhões em recursos do Orçamento, ajudaria o Estado a cobrir R$ 10 bilhões em receitas consideradas incertas.
Enquanto isso, a BRF se recupera após a queda de 5% e sobe cerca de 2%. A companhia informou que o impacto efetivo das restrições de plantas brasileiras pela Arábia Saudita será apenas para as exportações da planta de Lajeado, que vinha operando com um volume de aproximadamente 6,5 mil toneladas/mês de exportação para o país árabe.
A empresa já iniciou os ajustes necessários em sua cadeia produtiva e estima que, em no máximo 3 meses, retomará o mesmo patamar de embarques para a Arábia Saudita. “Assim, a perda de receita líquida não é material, visto que a estimativa de empresa é que poderá atingir no máximo 0,1% da receita líquida auferida nos últimos 12 meses encerrados em setembro de 2018, ou R$45 milhões nesse período de três meses”, destacou a empresa. Veja mais sobre o caso clicando aqui.
As maiores altas dentre as ações que compõem o Ibovespa são:
Cód. Ativo Cot R$ % Dia % Ano Vol1 KROT3 KROTON ON 10,78 +6,73 +21,53 254,28M EGIE3 ENGIE BRASILON 40,96 +5,19 +24,05 78,08M CSNA3 SID NACIONALON 10,29 +5,11 +16,40 108,96M VVAR3 VIAVAREJO ON 5,15 +4,46 +17,31 107,41M MRVE3 MRV ON 14,48 +3,95 +17,15 75,73M
PUBLICIDADE
As maiores baixas dentre as ações que compõem o Ibovespa são:
Cód. Ativo Cot R$ % Dia % Ano Vol1 ABEV3 AMBEV S/A ON 17,16 -2,17 +11,57 343,97M CIEL3 CIELO ON 10,28 -1,15 +15,64 118,30M LOGG3 LOG COM PROPON 19,02 -0,73 +5,55 9,42M CYRE3 CYRELA REALTON 16,98 -0,35 +9,76 28,85M USIM5 USIMINAS PNA 9,74 -0,20 +6,47 253,21M
* – Lote de mil ações
1 – Em reais (K – Mil | M – Milhão | B – Bilhão)
(Com Agência Estado e Bloomberg) |
Although scientists are unable to definitively uncover all of the 944 chemical constituents in fracking fluid, they have been able to identify some of the more prominent pollutants. [Source: Earthworks]
As expected the CDPHE report downplays the public health impacts from exposure to oil & gas operations and calls for more monitoring and analysis, rather than immediate public health action.
“This report evaluates the existing science about whether you’re at risk if you live near oil and gas operations,” said Dr. Larry Wolk, executive director and chief medical officer at the department. “Going forward, we will continue to evaluate health risks using more comprehensive, relevant data currently being collected.”
The health risk portion of the study combined more than 10,000 air quality samples to evaluate how 62 substances in those samples compare to an identified “safe” level for human exposure. The report concludes:
The concentrations of a small number of substances (benzene, formaldehyde, acetaldehyde) in the air surrounding oil and gas operations are four to five times lower than standard health limits set for short- and long-term exposure.
The concentrations of the other substances are five to 10,000 times lower than the standard health limits set for short- and long-term exposure.
Cancer risks for all substances are within the “acceptable risk” range established by the U.S. Environmental Protection Agency.
Overall, the current assessment suggests the risk of harmful health effects is low for residents living at distances 500 feet or more from oil and gas operations.
How much of a chemical is present in an environmental medium (e.g., soil, water, air),
How much contact (exposure) a person or ecological receptor has with the contaminated environmental medium, and
The inherent toxicity of the chemical.
Variability and uncertainly are two other important factors which must be considered. Variability refers to the range of toxic response or exposure since toxin exposures can affect individuals differently. Uncertainty refers to the lack of certain knowledge due to incomplete data because toxicology tests are usually conducted on laboratory rats, and not humans. For that reason it’s important for researchers to fill in the gaps by continuing to include more data.
With the CDPHE’s acknowledgment that conclusions are based on “current assessments,” there appears to be some hope that the door has been opened a crack for further assessments.
The report also reviewed 12 previous epidemiological studies that looked at potential health effects from living near oil and gas operations. Overall, the review concluded that studies of populations living near oil and gas operations provide limited evidence of the possibility for harmful health effects, which needs to be confirmed or disputed with higher-quality studies. The authors also developed evidence statements for each of the 27 health effects in these studies and found:
No substantial or moderate evidence for any health effects.
Limited evidence for two health effects: self-reported skin symptoms and exacerbation of asthma. Limited evidence means modest scientific findings that support an association, but there are significant limitations.
Mixed evidence for 11 health effects, including four different birth outcomes; hematological childhood cancers; hospitalizations for cancer, migraines, self-reported respiratory symptoms and musculoskeletal symptoms; and hospitalizations for neurological and hematological/immune diseases. Mixed evidence means there are findings that both support and oppose an association between the exposure and the outcome, with neither direction dominating.
A lack of evidence for three health effects, including respiratory hospitalizations and self-reported psychological symptoms and gastrointestinal symptoms. A lack of evidence means that the outcome has been researched without evidence of an association.
All of the above emphasizes the need for more evidence and more research. As frustrating as it is for those of us living with the health impacts from oil & gas development my own experience and research has convinced me of the need for more evidence and more research.
What I know for certain is that the human body responds to exposure from oil & gas operations according to individual DNA. More human health studies are needed and those studies must include individual DNA analysis, as well as blood and urine testing. Current health studies are based on the CDPHE’s public health data. We need studies based on individual human testing. Physicians should be encouraged to collect specific health data and report to the CDPHE.
The report’s conclusions included in the Executive Summary reveal a recognition on the part of the CDPHE that the possibility for harmful health effects does indeed exist:
Conclusions
Based on currently available air monitoring data, the risk of harmful health effects is low for residents living near oil and gas operations.
Studies of populations living near oil and gas operations provide limited evidence of the possibility for harmful health effects. This needs to be confirmed or disputed with higher quality studies.
At this time, results from exposure and health effect studies do not indicate the need for immediate public health action, but rather indicate the need for more detailed exposure monitoring and systematic analyses of health effects of residents living near oil and gas operation.
However the recommendations are specific and definitely the most significant part of this report:
Recommendations
Continued monitoring of exposures to people living near oil and gas including:
Continued evaluation of ambient air levels of priority substances in areas with substantial oil and gas operations to assess the potential for community-wide health impacts.
Collection of air samples in communities near oil and gas operations using our Colorado Air Mobile Monitoring Laboratory to better characterize short-term exposures for those living in close proximity to oil and gas oerations.
Continued evaluation of health risk using more comprehensive exposure data such as data from the Colorado State University studies that directly measured emissions of substances from oil and gas operations in Garfield County and the north Front Range and data collected by the Colorado Air Mobile Monitoring Laboratory.
Continued monitoring of health effects in areas with substantial oil and gas operations including:
High-quality epidemiological studies with improved characterization of exposures to directly assess the possibility of health effects in communities with substantial oil and gas operations.
Continued citizen reporting of health concerns to the CDPHE Oil and Gas Health Information and Response Program to monitor for trends in health effects that may be related to exposure.
As someone who has been beating the drum of health impacts from oil and gas operations for more than a decade, I believe these recommendations represent progress, albeit deliberately slow, from CDPHE. I remember a time when Dr. Chris Urbina was at the helm, the official position when it came to oil & gas health impacts was “hear no evil, see no evil, speak no evil.” Total denial.
The recognition of possible harm within the report’s conclusion and the list of specific recommendations are more “acknowledgment” than we’ve seen up till now. Moving forward, it will be up to the citizens of Colorado to put the pressure on the CDPHE to follow through with more monitoring, more evaluations, and more analysis.
This report looked at existing data. The state health department currently is conducting a health-risk assessment specific to oil and gas emissions, using newly released data from Colorado State University. That study will be completed in 2018.
One Comment on “CDPHE report recommends more monitoring and analysis for fracking health impacts”
As the CDPHE study was not initiated until after so recommended by the Governor’s special scam I mean taskforce in 2015. which was at-least a year after the price of oil and natural gas had crashed. my guess is that the CDPHE findings are substantially below study findings from previous to the fall of 2014 entirely due to the greatly-reduced number of fracking rigs operating in Colorado.
Before June of 2014 when the price of oil began to drop there were as many as 125 drilling rigs operating across Colorado, however, from the summer of 2015 through the summer of 2016 that number had been reduced to just 15-20 rigs operating, which would have caused air quality impacts to be substantially lessened.
Given the fact that CDPHE doesn’t have the money to come out and investigate poor construction practices at the pipeline construction site near Battlement Mesa that have led to silt and sand runoff damage due to a lack of proper silt prevention, I question how the same organization could afford to do a thorough job with this study.
With the State desperate for more fracking income thanks to TABOR, which gives the State a reason to falsify this study, I would feel much better about the study if it was peer-reviewed, considering that CDPHE has endlessly tried to poke holes in previous peer-reviewed science finding fault with fracking.
I am also the owner of the Facebook page Coloradans for Responsible Energy and Environmental Policy in Broomfield |
Llama .32 auto
I have a Llama .32 auto and want to know how much it is worth. It has GABILONDO Y CIA-ELGOIBAR(ESPAŅA) CAL. 7,65m/m (32) "LLAMA" on the left side of the slide and BABY LOU on the right side. It looks exactly like a miniature 1911 .45.
The Llama Micro Max is a very nice little pistol. I bought mine for $149.00 a few years back. Really lays in the hands nice. also easy to conceal . Hard to find extra mags tho.
The 380's are more common then the 32acp |
Activation of a K+ conductance by bradykinin and by inositol-1,4,5-trisphosphate in rat glioma cells: involvement of intracellular and extracellular Ca2+.
Extracellular application of bradykinin and injection of inositol-1,4,5-trisphosphate (Ins-P3) induced a hyperpolarization in polyploid rat glioma cells. Ins-1,4,5-P3 and Ins-2,4,5-P3 were effective but not Ins-4,5-P2, Ins-1,3,4,5-P4 and Ins-1,3,4,5,6-P5. The reversal potential of the hyperpolarizing response induced by bradykinin or by Ins-P3 increased to a comparable degree with increasing the extracellular K+ concentration. Certain blockers of K+ channels, for example charybdotoxin (5-50 nM), Ba2+ (5-20 mM), 4-aminopyridine (5-10 mM) and quinidine (0.1-0.5 mM) reversibly suppressed the membrane potential response to bradykinin or to Ins-P3; however, apamin (1 microM) and D-tubocurarine (0.5 mM) had no effect. Intracellular injection of EGTA made the glioma cells unresponsive to bradykinin. Superfusion of the cells with Ca2(+)-free medium gradually and reversibly abolished the response to bradykinin, but only slightly reduced the effect of Ins-P3. The Ca2+ channel blockers Co2+ (1-5 mM), Mn2+ (2-6 mM) and nifedipine (1-20 microM), but not desmethoxyverapamil (100 microM) inhibited the hyperpolarizing effect of bradykinin. The hyperpolarization induced by Ins-P3, however, was not influenced by Mn2+ (1-5 mM) or by Co2+ (7 mM). Injection of Ca2+ into the glioma cells induced a hyperpolarization susceptible to Ba2+ and quinidine. Treatment of glioma cells with an activator or with inhibitors of protein kinase C or with pertussis toxin did not affect the response to bradykinin. Incubation of the cells with the Ca2+ ionophore A23187 (0.1-1 microM) made the cells unresponsive to bradykinin and, somewhat less, to Ins-P3. At these concentrations the Ca2+ ionophore primarily depletes intracellular Ca2+ stores. In summary, bradykinin, via B2-receptors (blocked by [Thi5,8, D-Phe7]-bradykinin) activates a K+ conductance in glioma cells following a rise of cytosolic Ca2+ activity most likely due to Ins-P3-mediated release of Ca2+ from internal stores. Entry of extracellular Ca2+ appears also to be involved in this process. |
+ 34*l**2. Solve o(t) = 0.
-3, -1, -2/5, 0, 3
Let j(k) be the second derivative of 1/30*k**6 - 13*k + 0*k**2 + 0*k**3 + 0*k**5 + 0 - 1/12*k**4. Suppose j(r) = 0. Calculate r.
-1, 0, 1
What is o in 27 + 81*o - 6*o**2 + 1/3*o**4 - 18*o**3 + o**5 = 0?
-3, -1/3, 3
Let s(m) be the third derivative of -m**5/15 + m**4/2 - 4*m**3/3 - 276*m**2. Factor s(z).
-4*(z - 2)*(z - 1)
Factor 8 - 2/3*r - 1/3*r**2.
-(r - 4)*(r + 6)/3
Let b(q) be the third derivative of q**7/42 + 73*q**6/24 + 71*q**5/12 - 365*q**4/24 - 60*q**3 + 334*q**2. Factor b(o).
5*(o - 1)*(o + 1)**2*(o + 72)
Factor -2/5*i**2 + 0 + 12/5*i.
-2*i*(i - 6)/5
Let j(x) be the third derivative of x**5/15 - x**4/3 - 11*x**2. Let j(u) = 0. What is u?
0, 2
Let a be (-1)/(-27)*-3 + (-1)/(-9). Let z(p) be the first derivative of -1 + a*p**3 + 0*p - 3/5*p**5 + 0*p**2 - 3/2*p**4. Determine l so that z(l) = 0.
-2, 0
Let x = 21 + -19. Find j, given that -11*j + 7*j - 4*j**x + j - j**3 = 0.
-3, -1, 0
Let p(j) be the third derivative of -j**6/180 - 37*j**5/90 + 19*j**4/18 + 115*j**2. Solve p(c) = 0 for c.
-38, 0, 1
Let x = -4 + 8. Let v(j) = -57*j - 285. Let h be v(-5). Let f**x + 1/2*f**5 + 1/2*f**3 + 0*f + h*f**2 + 0 = 0. Calculate f.
-1, 0
Suppose -2*m - 9 = -0*m + 3*p, 3*p = m - 18. Factor 8 + 3*t**2 - m + 10*t + 2*t + 4.
3*(t + 1)*(t + 3)
Let z(t) be the first derivative of -3/35*t**5 + 2/7*t**3 - 19 + 0*t**4 + 0*t**2 - 3/7*t. Factor z(l).
-3*(l - 1)**2*(l + 1)**2/7
Let i(x) be the third derivative of x**5/240 - 7*x**4/8 + 83*x**3/24 + 5*x**2 - 28*x. Solve i(h) = 0.
1, 83
Let f(p) be the third derivative of 0 + 2/39*p**4 - 1/78*p**5 + 0*p - 4/39*p**3 - 38*p**2 + 1/780*p**6. Suppose f(k) = 0. Calculate k.
1, 2
Let g(u) be the third derivative of -u**8/84 + 16*u**7/105 - 11*u**6/15 + 28*u**5/15 - 17*u**4/6 + 8*u**3/3 + 9*u**2 + 13*u. Factor g(x).
-4*(x - 4)*(x - 1)**4
Suppose 4*s - 2*g + 57 + 193 = 0, -2*s + 5*g - 121 = 0. Let j = s - -191/3. Solve j*z - 2/3*z**3 + 2/3 - 2/3*z**2 = 0 for z.
-1, 1
Suppose 0 = 11*w - 30*w + 95. Suppose -11*b + 12 = -w*b. Determine t, given that -2*t - 2 - 1/2*t**b = 0.
-2
Find a, given that -48*a**2 - 2*a**2 - 62*a**3 + 288*a + 2*a**2 + 22*a**3 - 4*a**4 = 0.
-6, 0, 2
Let n be (-51)/(-85) + 2/(-10) + 0. Factor 4*i + 10 + n*i**2.
2*(i + 5)**2/5
Let s = 5/5764 + 2877/5764. Solve -5/4*h**2 + s - 3/4*h = 0.
-1, 2/5
Suppose 0*b = 3*b - 9. Suppose -j + 1 + 1 = 0. Factor 2*t**j - 2*t**b - t**4 + 2*t + 0*t**3 - t**4.
-2*t*(t - 1)*(t + 1)**2
Let i(m) be the second derivative of 3*m + 0 - 3/20*m**4 + 0*m**5 - 1/5*m**3 + 0*m**2 + 1/50*m**6. Let i(j) = 0. Calculate j.
-1, 0, 2
Let g(r) = 2*r**2 - 98*r - 4. Let v(t) = 5*t**2 - 286*t - 11. Let q(o) = 11*g(o) - 4*v(o). Determine w so that q(w) = 0.
-33, 0
Let u(m) be the third derivative of -m**6/120 - m**5/20 + 2*m**3/3 - 49*m**2. Find c, given that u(c) = 0.
-2, 1
Let o(r) be the second derivative of 7/48*r**4 + 0*r**2 + 1/40*r**5 - 7/120*r**6 - 1/12*r**3 - 3*r + 0. Factor o(f).
-f*(f - 1)*(f + 1)*(7*f - 2)/4
Suppose -53*n = 57*n. Let b(w) be the third derivative of 2/105*w**7 + n - 5*w**2 + 0*w - 1/6*w**4 - 1/5*w**5 + 1/30*w**6 + 4/3*w**3. Factor b(g).
4*(g - 1)**2*(g + 1)*(g + 2)
Let 5/3*u**4 + u - u**3 - 7/3*u**2 + 2/3 = 0. Calculate u.
-1, -2/5, 1
Suppose 6*k - k + 5 = -3*m, -13 = k + 3*m. Determine x so that 0 - 2/3*x + 1/3*x**k = 0.
0, 2
Let r be (-2)/(2*(-3)/9). Suppose 0 = 2*v + r*v. Determine s, given that v*s**5 - s**3 + 3*s**3 - 3*s**2 + 3*s**5 - 9*s**4 + 7*s**3 = 0.
0, 1
Suppose 12 = 15*z + 12. Solve -2/11*p + z + 6/11*p**2 + 8/11*p**3 = 0.
-1, 0, 1/4
Let y(o) be the second derivative of -o**6/10 - 3*o**5/5 - 3*o**4/2 - 2*o**3 - 3*o**2/2 + 59*o. Factor y(d).
-3*(d + 1)**4
Let x = -1/116072 + 45848783/39812696. Let t = -3/343 + x. Solve 6/7*c**3 + t*c - 16/7 + 20/7*c**2 = 0 for c.
-2, 2/3
Let t(r) be the first derivative of 4*r**7/21 + r**6/5 - r**5/10 + 15*r + 14. Let c(v) be the first derivative of t(v). Factor c(n).
2*n**3*(n + 1)*(4*n - 1)
Let v be (0*16/288)/(2*1). Factor -2/3*q + q**4 + 1/3*q**3 + v + 1/3*q**5 - q**2.
q*(q - 1)*(q + 1)**2*(q + 2)/3
Let n = 20 + -17. Let r be -27*n/(-54)*3. Factor 27/2*i - r*i**4 + 33/2*i**3 - 3 - 45/2*i**2.
-3*(i - 1)**3*(3*i - 2)/2
Let r(l) = l**3 - 2*l**2 + 1. Let a be r(4). Let 33 - a - 5*w**2 - 15*w = 0. Calculate w.
-3, 0
Suppose 23*g**2 - 260*g + 3380 - g**2 - 8*g**2 - 9*g**2 = 0. What is g?
26
Determine f so that 2/15*f**4 + 0 + 56/15*f**3 - 8*f**2 + 0*f = 0.
-30, 0, 2
Let s(j) be the second derivative of j**6/40 + 3*j**5/80 - 3*j**4/8 - j**3/2 + 3*j**2 - 112*j + 1. Factor s(r).
3*(r - 2)*(r - 1)*(r + 2)**2/4
Suppose -8 = 5*f - 28. Suppose 3*y = -f*a + 2*y, -2*a - 2*y = 0. Factor -6*v + 2 + a*v**2 + 4*v**2 + 0*v.
2*(v - 1)*(2*v - 1)
Let t(l) be the third derivative of l**5/150 + l**4/15 + 80*l**2. Factor t(g).
2*g*(g + 4)/5
Let n(z) be the third derivative of z**5/60 + z**4/12 - 4*z**3/3 - 5*z**2 + z. Suppose n(y) = 0. What is y?
-4, 2
Let r(b) be the second derivative of 7*b**4/12 - 10*b**3 + 16*b**2 + 2*b + 142. What is a in r(a) = 0?
4/7, 8
Let o(i) = -3 + 11 - 2*i**2 + 7*i**2 - 4*i**2 - 6*i. Let g be o(2). Factor -2/3*z**2 + g + 0*z + 2/3*z**3.
2*z**2*(z - 1)/3
Suppose -11 + 5 = -3*x. Let w be 17/3 + x/(-3). Suppose -13*y**2 + 24*y - 12 - 5*y**w + 17*y**4 - 11*y**3 + 8 - 8*y = 0. Calculate y.
-1, 2/5, 1, 2
Let i(d) = 2*d**4 - d**3 - d - 1. Let h(n) = -n**4 + 3*n**3 + 5*n**2 - 7*n - 2. Let v(w) = h(w) - 2*i(w). Factor v(m).
-5*m*(m - 1)**2*(m + 1)
Let t(s) = -s. Let h(i) = -4*i**2 - 12*i - 19*i - 16 - 20 + 5*i. Let m(n) = -h(n) + 2*t(n). What is o in m(o) = 0?
-3
Let -5*q**2 + 80476 - 27576 + 2*q**2 + 7*q**2 + 920*q = 0. What is q?
-115
Let t(y) = 80*y**2 + 46710*y + 4040360. Let p(b) = -3*b**2 - 1730*b - 149643. Let x(k) = 55*p(k) + 2*t(k). Solve x(z) = 0.
-173
Let i = 2/38465 - -307694/500045. Factor -6/13*z**2 - 2/13 - i*z.
-2*(z + 1)*(3*z + 1)/13
Factor 11*w - 23*w - 7*w - 80*w**2 - 30*w**4 - 5*w**5 - 10 - 70*w**3 - 26*w.
-5*(w + 1)**4*(w + 2)
Find o such that 8/19*o**2 - 6/19*o**5 - 20/19*o**4 + 0 + 8/19*o - 14/19*o**3 = 0.
-2, -1, 0, 2/3
Let z(c) = -11*c**2 + 17*c. Let y(q) = 6*q**2 - 9*q. Let w = -15 - -20. Let k(o) = w*y(o) + 3*z(o). Find r, given that k(r) = 0.
0, 2
Factor 0*c - 2093*c**2 + 4*c + 2077*c**2.
-4*c*(4*c - 1)
Factor -1309 + 15*v**2 + 65*v + 1234 - 2*v**3 - 3*v**3.
-5*(v - 5)*(v - 1)*(v + 3)
Let l be 0/((-22)/6*-3). Let t(v) be the first derivative of l*v - 9/2*v**2 - 14 + 4*v**3 - 3/4*v**4. Factor t(u).
-3*u*(u - 3)*(u - 1)
Suppose g = -4*g + 30. Let x(k) = 6*k**3 + 7*k**2 + k + 7. Let y(b) = -5*b**3 - 6*b**2 - b - 6. Let p(a) = g*x(a) + 7*y(a). Suppose p(z) = 0. Calculate z.
-1, 0, 1
Let r(i) be the second derivative of 2/15*i**3 - 19/100*i**5 + 7/150*i**6 + 0*i**2 + 20*i + 1/70*i**7 + 0 + 1/12*i**4. Find d, given that r(d) = 0.
-4, -1/3, 0, 1
Let q be (2770/3324)/((-5)/(-3)). Suppose -q*h**2 - 9/2 - 5*h = 0. Calculate h.
-9, -1
Let w(u) = -12*u**3 + 84*u**2 - 87*u - 15. Let h(d) = 3*d**3 - 21*d**2 + 22*d + 4. Let j(t) = 15*h(t) + 4*w(t). Suppose j(q) = 0. Calculate q.
0, 1, 6
Let n be (-2)/56 - (-6)/21. Let v be (24/(-144))/(6/(-9)). Find b such that 0*b - n*b**2 + v*b**3 + 1/4*b**4 - 1/4*b**5 + 0 = 0.
-1, 0, 1
Let d be (4 - 4)/(-4)*-1. Let o(c) = 3*c**2 + 3. Let w be o(d). Factor -2/11*g**w + 0 + 2/11*g**2 - 2/11*g**4 + 2/11*g.
-2*g*(g - 1)*(g + 1)**2/11
Let q be 140/7 + -8 - 10. Factor 3*w**q - 1/3*w**3 + 9 - 9*w.
-(w - 3)**3/3
Let r(w) be the first derivative of 2*w**6/3 + 21*w**5/5 + 21*w**4/4 + 4*w**3/3 + 234. Factor r(t).
t**2*(t + 1)*(t + 4)*(4*t + 1)
Let g be (12/16 + -2)*-4. What is i in 2*i**5 - 10*i**3 + 10*i**4 + 14*i**2 - 8*i**3 - 4*i - 4*i**g = 0?
0, 1, 2
Let n(v) be the second derivative of -2/15*v**3 + 12*v + 0 - 1/10*v**2 - 1/25*v**5 - 1/10*v**4 - 1/150*v**6. Determine t so that n(t) = 0.
-1
Suppose 473*s - 417*s - 3*s**2 + 60 - s**2 = 0. What is s?
-1, 15
Solve -722/5 - 76/5*q - 2/5*q**2 = 0.
-19
Let d(g) = -12*g**3 + g**2 - g + 1. Let t(x) = 214*x**3 - 212*x**2 + 18*x - 18. Let h(u) = 36*d(u) + 2*t(u). Factor h(y).
-4*y**2*(y + 97)
Let k(w) be the third derivative of 0 + 0*w + 0*w**3 + 0*w**4 - w**2 + 1/30*w**5. Let y(r) = -r**2. Let b(m) = -4*k(m) - 7*y(m). Factor b(z).
-z**2
Let a(z) be the third derivative of -z**5/390 + 11*z**4 |
Q:
IPTABLES forward all ports except ssh
I have nat and packet routing working just fine, but I'd like to forward all ports except SSH to a static ip(192.168.0.3)
What would be the correct iptables syntax to do this?
A:
Since the iptables rules are executed in order (the first match applies, the following rules are not even tested), you can do it as follows:
iptables -t nat -A PREROUTING -i eth0 -d 192.168.0.2 -j DNAT --to 192.168.0.3
iptables -t nat -A PREROUTING -i eth0 -d 192.168.0.2 -j DNAT --to 192.168.0.3
iptables -A FORWARD -i eth0 -d 192.168.0.2 --dport 22 -j REJECT
iptables -A FORWARD -i eth0 -d 192.168.0.2 -j ACCEPT
iptables -t nat -A POSTROUTING -o eth0 -j MASQUERADE
having assumed that the pc on which you are doing this has IP address 192.168.0.2, otherwise change it accordingly. THe last rule is needed to assure connectivity of the pc with IP address 192.168.0.3.
|
Intraocular postoperative infections are a permanent concern for every eye surgeon. Although postoperative endophthalmitis is infrequent, with an incidence rate of 0.06% to 0.09% in the last decade,^[@R1]--[@R7]^ it represents a devastating complication in ophthalmic surgery.^[@R8]^ For this reason, the search for optimal procedures that will help reduce its incidence is a constant challenge.
Although the incidence of postoperative infections has a low rate, an increasing number of cases are now occurring after intravitreal injections of antivascular endothelial growth factor (VEGF) medications for choroidal neovascularization related to age-related macular degeneration,^[@R9]--[@R11]^ diabetic cystoid macular edema,^[@R12],[@R13]^ and retinal vein occlusion.^[@R14]^ In fact, current protocols for the treatment of neovascular age-related macular degeneration dictate monthly or near-monthly injections of anti-VEGF.^[@R15]^ The risk of endophthalmitis reported after intravitreal injections is between 0.022% and 0.16%.^[@R16],[@R17]^
The etiologic agents of acute postoperative endophthalmitis are generally microorganisms of the eyelid margin, conjunctiva, and tear film.^[@R18]^ The normal microbiota from the eyelid and conjunctiva has already been described.^[@R19]^ The most common bacteria isolated from the eyelids, conjunctiva, and tears are gram-positive bacteria, mostly coagulase-negative *Staphylococcus* spp. Depending on the study, the frequency of isolation of bacteria ranges from 16% to 100%, with microbial growth shown in approximately 50% of swabs from the conjunctiva and tears, and more than 50% of swabs from eyelids.^[@R19]^ The most commonly isolated microbes are *Staphylococcus epidermidis*, *Corynebacterium* spp, *Staphylococcus aureus*, *Pseudomonas* spp, or *Proteus* spp, which also have been isolated from intraocular infections. Bacteria present on the eyelid are responsible for acute postoperative endophthalmitis.^[@R18],[@R20]^
To prevent the onset of postoperative endophthalmitis, several prophylactic strategies have been used. These approaches, which often feature use of topical antibiotics, are focused on reducing the bacterial load on the ocular surface assuming this could reduce the risk of endophthalmitis.^[@R8],[@R21]^ The most commonly used treatments are perioperative topical antibiotics, preoperative topical antibiotics, intracameral antibiotics, antibiotics at the end of the surgery, and postoperative topical antibiotics.^[@R22]^ In addition to antibiotics, the antiseptic povidone--iodine (PVI) 5% to 10% is topically applied to the cornea, the conjunctival sac, and to the periorbital area. Several studies have demonstrated that PVI reduces the microbiota in the conjunctiva.^[@R7],[@R8],[@R21],[@R23]^
This study tested the efficacy of lid hygiene using commercially available cleansing wipes to reduce the ocular surface microbiota in patients before ocular surgery.
METHODS {#s1}
=======
This study adhered to the Helsinki Declaration and the Good Clinical Practice (GCP) guidance and was approved by the Research Ethics Committee of the Hospital Clínico San Carlos (Madrid, Spain). All patients gave written informed consent.
This single-center, prospective, single-blind phase IV study included adults of either sex, who were scheduled for ocular surgery after the treatment. Exclusion criteria included any kind of ocular or systemic disease, past or present, and any ocular and/or systemic treatments/antibiotics within the last 6 months.
The study lasted 5 days and the patients were examined at day 0 (D0), day 3 (D3), and day 5 (D5). The 5-day treatment was applied to only 1 eye that is, the eye selected for surgery; the other eye served as control with no treatment applied. Patients were instructed to apply heat over the eye for 4 min. A small towel was heated in a microwave on full power for 10 to 15 sec (which rises towel temperature to approximately 40°C) which was repeated every 2 min. It was applied to the closed eye area with sufficient pressure to ensure that the towel remained in contact with the eyelids. Then patients massage, applying a gently pressure, the upper lid "inward--downward" and the lower lid "inward--upward," to mobilize the debris adhered to the eyelashes and meibum, and finally they use a sterile eyelid wipe and slide it across the eyelid from the inside to the outside, to clean the upper and lower lids. The Blephaclean (Laboratoires Théa, Clermont-Ferrant, France) sterile wipes contain a solution of hyaluronic acid, capryloyl glycine, iris florentine, and centella asiatica. Hyaluronic acid can influence cell proliferation, differentiation, and dermal tissue repair.^[@R24]^ Capryloyl glycine and iris florentine extracts are natural emollients show antibacterial activity and present a sebum-regulator effect and centella asiatica acts repairing dermal tissue, increasing collagen production, and activating blood circulation.^[@R25]^
They were used twice-a-day for 5 days in the selected eye. Visual acuity was measured at D0 and D5, and a slit-lamp examination was performed in each visit, to ensure there was no adverse reaction on the treated tissues.
Procedures and Assessments {#s1-1}
--------------------------
Microbiota samples were taken from the surface of the lower lid and the inferior conjunctival sac fundus of both eyes at D0, D3, and D5 using sterile swabs moistened with saline solution without administering topical anesthesia. The nontreated eye was used as a control and microbiota samples were obtained in the same way. Sterile gloves were used when taking the samples.
Samples were cultured in specific media on blood and chocolate agar plates and incubated aerobically for 48 hr at 37°C. Sterile cotton swabs (Materlab SL, Madrid, Toledo, Spain) were used wet with 50 µL of saline solution. The volume of saline was controlled and applied by a pipette. Initially a sample from the eyelid was taken and spread onto 1 semipart of the dish and, by the same procedure, another cotton swab was taken from the conjunctival sac of the conjunctiva and seeded onto the other semipart of the dish. Dishes were divided in two semiparts; the left side corresponding to the eyelid culture and the right side to the conjunctiva. Grown colonies were photographed with a high-resolution digital camera, and the total area of microbial growth on the plates was analyzed by ImageJ software.
The percentage of the area occupied by the colonies was determined as follows: (1) The original image of the plate, shown on the left side of Figures [1](#F1){ref-type="fig"} and [2](#F2){ref-type="fig"}, is a full RGB TIFF, which was converted to 8-bit grayscale. Figure [2](#F2){ref-type="fig"} shows full images of the dishes. The upper plates belong to the right eye and the lower plates to the left eye. (2) A mask was created by marking out the region where the colonies may grow. The mask is a semicircle covering half the plate, corresponding to the region in which the colonies from the lid or the colonies from the conjunctiva were grown. (3) The selected region is transformed to 1-bit image by selecting an adequate threshold. The contrast between the colonies and the background (culture medium) was very good and a sharp contour of the colonies was achieved. The final image is shown in Figure [1](#F1){ref-type="fig"} (right). Black pixels correspond to colonies, and white pixels correspond to the culture medium. (4) The ratio of the area occupied by the colonies and the total available growing region was obtained as the ratio of the number of pixels set to 0 and the number of pixels set to 1.
{#F1}
{#F2}
Once the photographs of the dishes were taken, microorganisms were identified by Gram staining, catalase, coagulase, DNase, and mannitol fermentation tests.
Statistical Analyses {#s1-2}
--------------------
Data are presented as mean±SD. Differences in microbiota numbers between D0, D3, and D5 were assessed using the Student *t* test, assuming a significance level of 0.05.
RESULTS {#s2}
=======
The study included 45 consecutive patients (17 men, 28 women) with a mean age of 53.8±6.3 years (range 45--73 years). Visual acuity in the treated eye was in a range between 1.0 and 0.54 logMAR and remained stable during the treatment, and the slit-lamp examination showed no adverse reaction on the treated tissues.
Microorganisms Present in the Eyelid and Conjunctiva {#s2-1}
----------------------------------------------------
At D0, microbial analysis demonstrated similar profiles for eyelid and conjunctiva. Identified microbiota is shown in Table [1](#T1){ref-type="table"}. The eyelid showed the presence of *S*. *epidermidis* and *Corynebacterium* spp (94.7% and 32.98% of the plates, respectively) as the most frequent microorganisms. In a smaller percentage, *S*. *aureus*, *Micrococcus* spp, and *Bacillus* spp (6.38%, 8.51%, and 1.06%, respectively) were isolated. From the conjunctival swabs, *S*. *epidermidis* and *Corynebacterium* spp (54.26% and 38.29%) were identified as well as *S*. *aureus* and *Micrococcus* spp (5.32% and 1.06%).
######
Microbiota Profiles for Eyelid and Conjunctiva Before Treatment
Microbiota Reduction {#s2-2}
--------------------
The microbial area of growth on the plates was measured according to the method described in the methods section. A photograph of a typical petri dish, along with the mask used for measuring the area occupied by the colonies is shown in Figure [1](#F1){ref-type="fig"}. The colonies\' area analysis yielded a higher microbial load from the eyelids (17.9%) compared with the conjunctiva (1.4%) in most of the samples, as it is seen in Figure [2](#F2){ref-type="fig"}. Percent reduction in microbial load on the eyelid in the treated eyes was 58% at D3 and 63% at D5 63% (*P*=0.001) (Fig. [3](#F3){ref-type="fig"}). The microbiota of the conjunctiva was lower than that of the eyelid. There was a reduction, although nonsignificant, of 72% and 69% at D3 and D5, respectively (Fig. [4](#F4){ref-type="fig"}) in the numbers of microbes on the conjunctiva. Table [2](#T2){ref-type="table"} and Figures [1](#F1){ref-type="fig"} and [2](#F2){ref-type="fig"} show the microbiota growing areas from eyelid and conjunctiva in all groups. There were no differences by sex.
{#F3}
{#F4}
######
Mean Values of Microbiota Growing Areas From Eyelid and Conjunctiva for Days 0, 3, and 5
DISCUSSION {#s3}
==========
In addition to the classical procedures such as cataract surgery, the number of intraocular interventions is increasing because of the development of new therapies. Endophthalmitis caused by microorganisms present on the ocular surface may occur as a consequence of these treatments. The results obtained in this study demonstrated a significant reduction in the microbiota present on the lids and conjunctiva after 3 days of rubbing the lids with the wipes, demonstrating the importance of lid hygiene before ocular surgery or an intraocular procedure, as a complementary prophylactic approach.
The percentages of microorganisms existing on the eyelids and conjunctiva in the study were similar to that described previously with the most commonly isolated bacteria being coagulase-negative staphylococci and, more specifically, *S*. *epidermidis* followed by *Corynebacterium* spp Between 20% and 80% of swabs from the conjunctiva and between 30% and 100% of swabs from the lids showed growth of the bacteria *S. epidermidis*.^[@R19]^ Carron et al.^[@R26]^ found the most common bacteria were coagulase-negative staphylococci (66.7%), followed by *Corynebacterium* spp (11.5%) from the conjunctiva, and Li et al.^[@R27]^ described a prevalence of 62.9% and 32.4% for *S*. *epidermidis* and *Corynebacterium* spp, respectively, from the conjunctiva. Vasavada et al.^[@R28]^ detected between 90.4% and 94.4% of *Staphylococcus* species from the conjunctiva, of which 71% were *S*. *epidermidis*. The rate of isolation of the same bacteria in the study by Höfling-Lima et al.^[@R29]^ ranged between 50% and 80% for the conjunctiva and between 76% and 100% for the eyelids.
The microbial isolation of the conjunctiva was reduced on presurgical prophylaxis of wiping the eye after briefly heating the eye. Hueso Abancens et al.^[@R30]^ presented a similar study analyzing the use of palpebral cleansing solution with capryloyl glycine over the conjunctiva microbiota. A clinical reduction was seen from the third day of applying the cleansing solution that lasted until day 5. In the study of Hueso Abancens et al.,^[@R30]^ the maximum reduction obtained after 5 days of treatment was approximately 10% and the main bacteria was *Staphylococcus* spp coagulase-negative. The smaller reduction found by Hueso Abancens et al.^[@R30]^ than this study could be due to the hygiene protocol used to clean the lids. In the study by Hueso Abancens et al.,^[@R30]^ the patients were not told to apply heat and massage the lids before using the cleansing solution.
In addition, many studies have been conducted on the reduction of eyelid and conjunctiva microbiota after the application of different antibiotics on their own or in combination with PVI. Höfling-Lima et al.^[@R29]^ examined the efficacy of topical lomefloxacin 0.3% and tobramicin 0.3% 3 days before cataract surgery in reducing biota, and showed statistical reductions in conjunctiva of 66.7% and in lid biota of 3.9% with lomefloxacin, and of 75% and 34.5%, respectively, with tobramicin.
Carron et al.^[@R26]^ described a 4.3% reduction in conjunctiva biota after the administration of ciprofloxacin 0.3% 1 day before cataract surgery that increased to 60.9% after the application of PVI. The use of PVI before cataract surgery has become a standard of care and a mandatory step in reducing ocular surface microbiota. Apt et al.^[@R31]^ showed a 91% reduction in the number of colonies of the conjunctiva after the application of PVI. Halachmi-Eyal et al.^[@R32]^ reported a 38% reduction after the application of PVI 3 min before surgery and a 34% reduction with the topical application of moxifloxacin 0.5% 2 hr before surgery and PVI 3 min before surgery.
The percentage reductions in the microbiota from this study are comparable in some ways to those obtained after the application of topical antibiotics. Eyelid hygiene did not sterilize the tissue, it just decreased the number of bacteria present in the external tissue of the eye without modifying the composition of saprophytic biota on both eyelids and conjunctiva. The reason for these reduced values is probably due to the hygiene protocol that patients followed of cleaning their eyelids after the application of heat and the massage.
Although microbiota is present in eyelids and conjunctiva, the percentage of area covered by colonies shows an important microbial load from the eyelids, which highlights the need to maintain preoperative and postoperative asepsis of both eyelid and conjunctiva.
Results obtained from bacteria cultures can indicate the type of antibiotic prophylaxis to use for minimizing ocular postoperative infections: broad-spectrum antibiotics or, preferably, antibiotics with specific activity against gram-positive bacteria.
Eyelid hygiene cannot replace general preoperative procedures focused on preventing contamination, such as the use of PVI solutions for eyelids and conjunctiva or antibiotics. Nevertheless, eyelid hygiene can be used as a complementary prophylactic approach to prevent endophthalmitis.
The use of cleansing eyelid wipes may help in the case of undiagnosed blepharitis before cataract surgery or other kinds of ocular surgery, as they could also reduce the risk of postoperative endophthalmitis.
Further studies are needed regarding the convenience of the medical regimen of use 3 and 5 days before surgery; the time the microbiota takes to recover itself after the use of the eyelid wipes; and what occurs if the patient uses the wipes more than 5 days. Another aspect worthy of study is the usefulness of applying the eyelid wipes as a postoperative prophylaxis or the medical regimen of use. This study demonstrated that the application of heat and a massage to the eyelids before the use of the eyelid wipe improves the reduction in the microbiota present in the ocular surface in 5 days, and eyelid hygiene can be use as a complementary prophylactic approach to prevent ocular infections.
The authors have no conflicts of interest to disclose.
Supported by the eyelid wipes were supplied by Thea Laboratories (Barcelona, Spain).
Presented at the Association for Research in Vision and Ophthalmology (ARVO) 2014 Annual Meeting, May 4--8, 2014, Orlando, FL.
|
Q:
Error retrieving parent for item: No resource found
How to debug the error that I've encountered right now., I am creating an app which is can locate the current location with google map then i've got some tutorial on how to do it., but the errors came up.
*Error:(2) Error retrieving parent for item: No resource found that matches the given name 'android:TextAppearance.Material.Widget.Button.Inverse'.
<style name="Base.TextAppearance.AppCompat.Widget.Button.Inverse"
parent="android:TextAppearance.Material.Widget.Button.Inverse"/>
*Error:(2) Error retrieving parent for item: No resource found that matches the given name 'android:Widget.Material.Button.Colored'.`
<style name="Base.Widget.AppCompat.Button.Colored"
parent="android:Widget.Material.Button.Colored"/>
they are belong in
*C:\Users\rifrancisco\Desktop\androidprojects\MapsII\app\build\intermediates\exploded-aar\com.android.support\appcompat-v7\23.1.1\res\values-v23\values-v23.xml
i'm using Android Studio 1.3 with the SDK Platforms up to 5.x(MNC) and all the SDK tools were installed
how can I resolve this ? i've also try to change the version to v23 in project structure but still the same.. here are my codes
MyActivity
import android.content.Context;
import android.location.Criteria;
import android.location.Location;
import android.location.LocationManager;
import android.support.v4.app.FragmentActivity;
import android.os.Bundle;
import com.google.android.gms.maps.CameraUpdateFactory;
import com.google.android.gms.maps.GoogleMap;
import com.google.android.gms.maps.SupportMapFragment;
import com.google.android.gms.maps.model.LatLng;
import com.google.android.gms.maps.model.MarkerOptions;
public class MapsActivity extends FragmentActivity {
private GoogleMap mMap; // Might be null if Google Play services APK is not available.
@Override
protected void onCreate(Bundle savedInstanceState) {
super.onCreate(savedInstanceState);
setContentView(R.layout.activity_maps);
setUpMapIfNeeded();
}
@Override
protected void onResume() {
super.onResume();
setUpMapIfNeeded();
}
/**
* Sets up the map if it is possible to do so (i.e., the Google Play services APK is correctly
* installed) and the map has not already been instantiated.. This will ensure that we only ever
* call {@link #setUpMap()} once when {@link #mMap} is not null.
* <p/>
* If it isn't installed {@link SupportMapFragment} (and
* {@link com.google.android.gms.maps.MapView MapView}) will show a prompt for the user to
* install/update the Google Play services APK on their device.
* <p/>
v* A user can return to this FragmentActivity after following the prompt and correctly
* installing/updating/enabling the Google Play services. Since the FragmentActivity may not
* have been completely destroyed during this process (it is likely that it would only be
* stopped or paused), {@link #onCreate(Bundle)} may not be called again so we should call this
* method in {@link #onResume()} to guarantee that it will be called.
*/
private void setUpMapIfNeeded() {
// Do a null check to confirm that we have not already instantiated the map.
if (mMap == null) {
// Try to obtain the map from the SupportMapFragment.
mMap = ((SupportMapFragment) getSupportFragmentManager().findFragmentById(R.id.map))
.getMap();
// Check if we were successful in obtaining the map.
if (mMap != null) {
setUpMap();
}
}
}
/**
* This is where we can add markers or lines, add listeners or move the camera. In this case, we
* just add a marker near Africa.
* <p/>
* This should only be called once and when we are sure that {@link #mMap} is not null.
*/
private void setUpMap() {
mMap.addMarker(new MarkerOptions().position(new LatLng(0, 0)).title("Marker").snippet("Snippet"));
// Enable MyLocation Layer of Google Map
mMap.setMyLocationEnabled(true);
// Get LocationManager object from System Service LOCATION_SERVICE
LocationManager locationManager;
locationManager = (LocationManager) getSystemService(Context.LOCATION_SERVICE);
// Create a criteria object to retrieve provider
Criteria criteria = new Criteria();
// Get the name of the best provider
String provider = locationManager.getBestProvider(criteria, true);
// Get Current Location
Location myLocation = locationManager.getLastKnownLocation(provider);
// set map type
mMap.setMapType(GoogleMap.MAP_TYPE_NORMAL);
// Get latitude of the current location
double latitude = myLocation.getLatitude();
// Get longitude of the current location
double longitude = myLocation.getLongitude();
// Create a LatLng object for the current location
LatLng latLng = new LatLng(latitude, longitude);
// Show the current location in Google Map
mMap.moveCamera(CameraUpdateFactory.newLatLng(latLng));
// Zoom in the Google Map
mMap.animateCamera(CameraUpdateFactory.zoomTo(14));
mMap.addMarker(new MarkerOptions().position(new LatLng(latitude, longitude)).title("You are here!").snippet("Consider yourself located"));
}
and here is the codes under values-v23.xml
<?xml version="1.0" encoding="utf-8"?>
<resources>
<!-- From: file:/usr/local/google/buildbot/src/googleplex-android/mnc- supportlib-release/frameworks/support/v7/appcompat/res/values- v23/styles_base_text.xml -->
<eat-comment/>
<style name="Base.TextAppearance.AppCompat.Widget.Button.Inverse" parent="android:TextAppearance.Material.Widget.Button.Inverse"/>
<!-- From: file:/usr/local/google/buildbot/src/googleplex-android/mnc- supportlib-release/frameworks/support/v7/appcompat/res/values- v23/themes_base.xml -->
<eat-comment/>
<style name="Base.Theme.AppCompat" parent="Base.V23.Theme.AppCompat"/>
<style name="Base.Theme.AppCompat.Light" parent="Base.V23.Theme.AppCompat.Light"/>
<style name="Base.V23.Theme.AppCompat" parent="Base.V22.Theme.AppCompat">
<!-- We can use the platform drawable on v23+ -->
<item name="actionBarItemBackground">? android:attr/actionBarItemBackground</item>
<!-- We can use the platform styles on v23+ -->
<item name="actionMenuTextColor">?android:attr/actionMenuTextColor</item>
<item name="actionMenuTextAppearance">? android:attr/actionMenuTextAppearance</item>
<item name="controlBackground">@drawable/abc_control_background_material</item>
</style>
<style name="Base.V23.Theme.AppCompat.Light" parent="Base.V22.Theme.AppCompat.Light">
<!-- We can use the platform drawable on v23+ -->
<item name="actionBarItemBackground">?android:attr/actionBarItemBackground</item>
<!-- We can use the platform styles on v23+ -->
<item name="actionMenuTextColor">?android:attr/actionMenuTextColor</item>
<item name="actionMenuTextAppearance">?android:attr/actionMenuTextAppearance</item>
<item name="controlBackground">@drawable/abc_control_background_material</item>
</style>
<!-- From: file:/usr/local/google/buildbot/src/googleplex-android/mnc- supportlib-release/frameworks/support/v7/appcompat/res/values- v23/styles_base.xml -->
<eat-comment/>
<style name="Base.Widget.AppCompat.Button.Colored" parent="android:Widget.Material.Button.Colored"/>
</resources>
A:
Check your build.gradle file. Most probably your targetSdkVersion is below 23. Change it according to your level API.
android {
defaultConfig {
minSdkVersion 14
targetSdkVersion 23
versionCode 1
versionName "1.0"
}
...
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.