blob_id stringlengths 40 40 | repo_name stringlengths 5 127 | path stringlengths 2 523 | length_bytes int64 22 545k | score float64 3.5 5.34 | int_score int64 4 5 | text stringlengths 22 545k |
|---|---|---|---|---|---|---|
f81888b47c87ceefa5f458913dbcc47319dfc185 | chavadasagar/python | /fectorial.py | 204 | 3.875 | 4 | n = int(input("enter number"))
fec = 1
for x in range(1,n+1):
fec = fec * x
print(fec)
'''
# using recursion
def fec(n):
if n == 1:
return 1
else:
return n * fec(n-1)
'''
|
a1d76dd2a74db5557596f2f3da1fbb2bf70474d2 | chavadasagar/python | /reverse_string.py | 204 | 4.40625 | 4 | def reverse_str(string):
reverse_string = ""
for x in string:
reverse_string = x + reverse_string;
return reverse_string
string = input("Enter String :")
print(reverse_str(string))
|
6992e8064e8031e1b0023071471f937152b69263 | Dakarai/war-card-game | /main.py | 3,338 | 3.53125 | 4 | import random
suits = ('Clubs', 'Diamonds', 'Hearts', 'Spades')
ranks = ('2', '3', '4', '5', '6', '7', '8', '9', 'T', 'J', 'Q', 'K', 'A')
values = {'2': 2, '3': 3, '4': 4, '5': 5, '6': 6, '7': 7, '8': 8, '9': 9, 'T': 10, 'J': 11, 'Q': 12, 'K': 13, 'A': 14}
war_cards_count = 3
class Card:
def __init__(self, suit, rank):
self.suit = suit[0].lower()
self.rank = rank
self.value = values[rank]
def __repr__(self):
return self.rank + "" + self.suit
class Deck:
def __init__(self):
self.all_cards = []
for suit in suits:
for rank in ranks:
self.all_cards.append(Card(suit, rank))
def shuffle(self):
random.shuffle(self.all_cards)
def deal_one(self):
return self.all_cards.pop(0)
class Player:
def __init__(self, name):
self.name = name.capitalize()
self.all_cards = []
def remove_one(self):
return self.all_cards.pop(0)
def add_cards(self, new_cards):
if type(new_cards) == type([]):
self.all_cards.extend(new_cards)
else:
self.all_cards.append(new_cards)
def __str__(self):
return f"Player {self.name} has {len(self.all_cards)} cards."
if __name__ == '__main__':
# create players
player_one = Player("One")
player_two = Player("Two")
# create deck object and shuffle it
new_deck = Deck()
new_deck.shuffle()
# split shuffled deck between players
for x in range(26):
player_one.add_cards(new_deck.deal_one())
player_two.add_cards(new_deck.deal_one())
play_game = True
round_number = 0
while play_game:
round_number += 1
print(f"Round {round_number}")
if len(player_one.all_cards) == 0:
print('Player One has lost!')
play_game = False
break
elif len(player_two.all_cards) == 0:
print('Player Two has lost!')
play_game = False
break
# start a new round
player_one_cards = [player_one.remove_one()]
player_two_cards = [player_two.remove_one()]
end_of_round = False
while not end_of_round:
# evaluate round
if player_one_cards[-1].value > player_two_cards[-1].value:
player_one.add_cards(player_one_cards)
player_one.add_cards(player_two_cards)
end_of_round = True
print(player_one_cards)
print(player_two_cards)
print(player_one)
print(player_two)
break
elif player_one_cards[-1].value < player_two_cards[-1].value:
player_two.add_cards(player_two_cards)
player_two.add_cards(player_one_cards)
end_of_round = True
print(player_one_cards)
print(player_two_cards)
print(player_one)
print(player_two)
break
else:
for _ in range(war_cards_count):
if len(player_one.all_cards) > 0:
player_one_cards.append(player_one.remove_one())
if len(player_two.all_cards) > 0:
player_two_cards.append(player_two.remove_one())
|
4ca802795b88b9a184cb4fedd62ad242a5ba59e4 | theballkyo/GetA | /classes/gradebar.py | 1,594 | 3.53125 | 4 | from tkinter import *
class Progressbar():
obj_progress = False
def __init__(self, root, max_width, max_height, score):
bar = Label(root)
bar.place(x=60,y=30)
self.canvas = Canvas(bar, width=max_width-2, height=max_height)
self.canvas.pack()
self.color = self.get_color(score)
self.canvas_rec = self.canvas.create_rectangle(2, 2, max_width, max_height, fill=self.color, outline="black")
self.max_width = max_width
self.max_height = max_height
def get_color(self, total_score):
if total_score == 0:
color = "light grey"
elif total_score >= 80:
color = "green"
elif total_score >= 75:
color = "green yellow"
elif total_score >= 70:
color = "yellow"
elif total_score >= 65:
color = "gold"
elif total_score >= 60:
color = "dark orange"
elif total_score >= 55:
color = "red"
elif total_score >= 50:
color = "brown"
elif total_score < 50:
color = "dark red"
return color
def update(self, progress):
self.canvas.itemconfig(self.canvas_rec, fill=self.get_color(progress))
self.progress = min(max(progress, 0), 100)
self.canvas.delete(self.obj_progress)
pixel_height = self.max_height - ((self.progress * self.max_height))/100.0
if self.progress >= 0:
self.obj_progress = self.canvas.create_rectangle(3, 3, self.max_width, pixel_height, fill='lightgrey', outline='black')
|
86643c2fe7599d5b77bdcbe3e6c35aa88ba98ecc | aemperor/python_scripts | /GuessingGame.py | 2,703 | 4.25 | 4 | ## File: GuessingGame.py
# Description: This is a game that guesses a number between 1 and 100 that the user is thinking within in 7 tries or less.
# Developer Name: Alexis Emperador
# Date Created: 11/10/10
# Date Last Modified: 11/11/10
###################################
def main():
#A series of print statements to let the user know the instructions of the game.
print "Guessing Game"
print ""
print "Directions:"
print "Think of a number between 1 and 100 inclusive."
print "And I will guess what it is in 7 tries or less."
print ""
answer = raw_input ("Are you ready? (y/n): ")
#If the user inputs that "n", no, he is not ready, prompt him over and over
while (answer != "y"):
answer = raw_input ("Are you ready? (y/n): ")
#If the user inputs yes, start the program
if (answer == "y"):
count = 1
hi = 100
lo = 1
mid = (hi+lo)/2
print "Guess",count,": The number you thought was:",mid
correct = raw_input ("Enter 1 if my guess was high, -1 if low, and 0 if correct: ")
while (correct != "0"):
#Iterate a loop that resets when correct isn't equal to zero
while (count < 7):
#Iterate a loop that stops the program when count gets to 7
if (correct == "0"):
print "I win! Thank you for playing the Guessing Game."
break
#If correct == 0 then the program wins
if (correct == "1"):
#If correct == 1 then reset the values of hi and lo to take a new average
hi = mid
lo = lo + 1
mid = (hi+lo)/2
count = count + 1
print "Guess",count, ": The number you thought was:",mid
correct = raw_input ("Enter 1 if my guess was high, -1 if low, and 0 if correct: ")
if (correct == "-1"):
#If correct == -1 then reset the values of hi and lo to take a new average
hi = hi + 1
lo = mid - 1
mid = (hi+lo)/2
count = count + 1
print "Guess",count, ": The number you thought was:",mid
correct = raw_input ("Enter 1 if my guess was high, -1 if low, and 0 if correct: ")
if (count >= 7):
#If count exceeds 7 then the user is not thinking of a number between 1 and 100.
print "The number you are thinking of is not between 1 and 100."
break
main()
|
4978f92dab090fbf4862c4b6eca6db01150cf0b7 | aemperor/python_scripts | /CalcSqrt.py | 1,059 | 4.1875 | 4 | # File: CalcSqrt.py
# Description: This program calculates the square root of a number n and returns the square root and the difference.
# Developer Name: Alexis Emperador
# Date Created: 9/29/10
# Date Last Modified: 9/30/10
##################################
def main():
#Prompts user for a + number
n = input ("Enter a positive number: ")
#Checks if the number is positive and if not reprompts the user
while ( n < 0 ):
print ("That's not a positive number, please try again.")
n = input ("Enter a positive number: ")
#Calculates the initial guesses
oldGuess = n / 2.0
newGuess = ((n / oldGuess) + oldGuess) / 2.0
#Loops the algorithm until the guess is below the threshold
while ( abs( oldGuess - newGuess ) > 1.0E-6 ):
oldGuess = newGuess
newGuess = ((n / oldGuess) + oldGuess) / 2.0
#Calculates the difference between the actual square and guessed
diff = newGuess - (n ** .5)
#Prints the results
print 'Square root is: ', newGuess
print 'Difference is: ', diff
main()
|
a7eda8fb8d385472dc0be76be4a5397e7473f724 | petyakostova/Software-University | /Programming Basics with Python/First_Steps_in_Coding/06_Square_of_Stars.py | 237 | 4.15625 | 4 | '''Write a console program that reads a positive N integer from the console
and prints a console square of N asterisks.'''
n = int(input())
print('*' * n)
for i in range(0, n - 2):
print('*' + ' ' * (n - 2) + '*')
print('*' * n)
|
62e95db13611d9a6ecbdbb070b9b176d673b81f2 | petyakostova/Software-University | /Programming Basics with Python/First_Steps_in_Coding/04_Triangle_Of_55_Stars.py | 300 | 3.984375 | 4 | '''
Write a Python console program that prints a triangle of 55 asterisks located in 10 rows:
*
**
***
****
*****
******
*******
********
*********
**********
'''
for i in range(1,11):
print('*'*i)
'''
for i in range(1, 11):
for j in range(0, i):
print('*', end="")
print()
''' |
3f25e4489c087b731396677d6337e4ad8633e793 | petyakostova/Software-University | /Programming Basics with Python/Simple-Calculations/08-Triangle-Area.py | 317 | 4.3125 | 4 | '''
Write a program that reads from the console side and triangle height
and calculates its face.
Use the face to triangle formula: area = a * h / 2.
Round the result to 2 decimal places using
float("{0:.2f}".format (area))
'''
a = float(input())
h = float(input())
area = a * h / 2;
print("{0:.2f}".format(area))
|
b8e9d1e43fb13bbe5056d92687169e83393add1a | Isaac51743/Algorithms-in-Python | /src/recursion/recursion1.py | 739 | 4.0625 | 4 | # 12/18/2020
def fibonacci(index):
if index == 0 or index == 1:
return index
return fibonacci(index - 1) + fibonacci(index - 2)
print(fibonacci(4))
# assuming a and b are both integer, return type is double
def a_power_b(a, b):
if a == 0 and b <= 0:
return None
elif a == 0 and b > 0:
return 0
elif a != 0 and b < 0:
return 1 / a_power_b(a, -b)
else:
# base case
if b == 0:
return 1
elif b == 1:
return a
# recursive rules
square_root = a_power_b(a, b // 2)
if b % 2 == 1:
return square_root * square_root * a
else:
return square_root * square_root
print(a_power_b(-2, -4)) |
09ff50c23a5e27d558ed1c7769439bf28b0243e3 | Isaac51743/Algorithms-in-Python | /src/bits_probability_dfs/probability.py | 2,830 | 3.609375 | 4 | import random as r
import heapq as hq
def shuffle_poker(array):
if len(array) != 52:
return
for idx in range(52):
random_idx = r.randint(idx, 51)
array[idx], array[random_idx] = array[random_idx], array[idx]
test_array = [i for i in range(52)]
shuffle_poker(test_array)
print(test_array)
def get_random_in_flow(input, time):
if r.randint(0, time) == 0:
global random_element
random_element = input
def get_randomk_in_flow(input, time, k, random_k):
if time < k:
random_k.append(input)
else:
random_idx = r.randint(0, time)
if random_idx < k:
random_k[random_idx] = input
test_flow1 = [1, 3, 9, 5, 2, 7, 12, 21, 8, 6]
random_element = None
for index, value in enumerate(test_flow1):
get_random_in_flow(value, index)
print(random_element, end=' ')
print()
k = 3
random_k = []
for index in range(len(test_flow1)):
get_randomk_in_flow(test_flow1[index], index, k, random_k)
print(random_k, end=' ')
print()
def random_largest(input, time):
global largest,counter, largest_idx
if input == largest:
counter += 1
if r.randint(1, counter) == 1:
largest_idx = time
elif input > largest:
largest = input
counter = 1
largest_idx = time
largest_idx = -1
counter = 0
largest = float("-inf")
test_flow2 = [1, 3, 9, 5, 2, 3, 9, 2, 9, 2]
for index, value in enumerate(test_flow2):
random_largest(value, index)
print(largest_idx, end=' ')
print()
def random_5():
result = r.randint(0, 6)
while result >= 5:
result = r.randint(0, 6)
return result
def random_7():
result = 0
for i in range(2):
result = result * 5 + r.randint(0, 4)
while result >= (25 // 7 * 7):
result = 0
for i in range(2):
result = result * 5 + r.randint(0, 4)
return result % 7
for i in range(10):
print(random_5(), end=' ')
print("random 5 based on random 7")
for i in range(10):
print(random_7(), end=' ')
print("random 7 based on random 5")
def get_median(input, small_heap, big_heap):
if len(small_heap) == len(big_heap):
if not small_heap or input <= big_heap[0]:
hq.heappush(small_heap, -input)
else:
hq.heappush(small_heap, -1 * hq.heappop(big_heap))
hq.heappush(big_heap, input)
else:
if input >= -1 * small_heap[0]:
hq.heappush(big_heap, input)
else:
hq.heappush(big_heap, -1 * hq.heappop(small_heap))
hq.heappush(small_heap, -input)
if len(small_heap) == len(big_heap):
return (big_heap[0] - small_heap[0]) / 2
return -1 * small_heap[0]
s_heap = []
b_heap = []
for element in test_flow2:
print(get_median(element, s_heap, b_heap), end=' ')
print() |
21e2669bf38725d1cd712ed2b7ffd2c01dfb5ed4 | Isaac51743/Algorithms-in-Python | /src/code_review3.py | 2,409 | 3.59375 | 4 | import math
def dropped_request(time_list):
if len(time_list) == 0:
return 0
dropped_num = 0
for index in range(len(time_list)):
case1 = index >= 3 and time_list[index] - time_list[index - 3] + 1 <= 1
case2 = index >= 20 and time_list[index] - time_list[index - 20] + 1 <= 10
case3 = index >= 60 and time_list[index] - time_list[index - 60] + 1 <= 60
if case1 or case2 or case3:
dropped_num += 1
return dropped_num
time_spots = [1, 1, 1, 1, 2, 2, 2, 3, 3, 3, 4, 4, 4, 5, 5, 5, 6, 6, 6, 7, 7, 7, 7, 11, 11, 11, 11]
print(dropped_request(time_spots))
# Given a positive integer n, how many ways can we write it as a sum of consecutive positive integers?
def consecutive_numbers_sum(n):
num_of_seq = 0
for sequence_size in range(2, int(0.5 + 0.5 * math.sqrt(1 + 8 * n))):
temp = n - (sequence_size - 1) * sequence_size // 2
if temp % sequence_size == 0:
num_of_seq += 1
return num_of_seq
print(consecutive_numbers_sum(15))
def find_before_matrix(matrix):
if len(matrix) == 0 or len(matrix[0]) == 0:
return None
before_matrix = [[0] * len(matrix[0]) for _ in range(len(matrix))]
before_matrix[0][0] = matrix[0][0]
for index in range(1, len(matrix[0])):
before_matrix[0][index] = matrix[0][index] - matrix[0][index - 1]
for index in range(1, len(matrix)):
before_matrix[index][0] = matrix[index][0] - matrix[index - 1][0]
for row in range(1, len(matrix)):
for col in range(1, len(matrix[0])):
before_matrix[row][col] = matrix[row][col] - matrix[row - 1][col]\
- matrix[row][col - 1] + matrix[row - 1][col - 1]
return before_matrix
after_matrix = [[1, 2], [3, 4]]
print(find_before_matrix(after_matrix))
# assume all bids greater than 0
def get_0_allotted_user(bids, total_shares):
if len(bids) == 0:
return 0
elif total_shares == 0:
return len(bids)
bids.sort(key=lambda bid: (-1 * bid[2], bid[3]))
for index in range(len(bids)):
if total_shares <= 0:
break
total_shares -= bids[index][1]
user_list = []
while index < len(bids):
user_list.append(bids[index][0])
index += 1
return user_list
bids = [[1, 5, 5, 0], [2, 7, 8, 1], [3, 7, 5, 1], [4, 10, 3, 3]]
print(get_0_allotted_user(bids, 13))
|
b37c28841c34b9a4b44052326d39f4dd7f0c12ae | donaldex/code | /repeat_str.py | 202 | 3.984375 | 4 | def repeat_str():
s = input("Enter string: ")
t = input("Enter int>=0: ")
n = int(t)
print(n*s)
print("anni is stupid")
# return "ddddd"
##repeat_str()
print(repeat_str())
|
15e9c4495517c834dca50c81383cace908117392 | larinanatalia/class | /hw6.py | 1,875 | 3.9375 | 4 | class Animal:
satiety = 'hungry'
def __init__(self, name, weight):
self.name = name
self.weight = weight
def feed(self):
self.satiety = 'animal ate food'
class Bird(Animal):
eggs = 'dont have eggs'
def pick_eggs(self):
self.eggs = 'we picked eggs'
class Goose(Bird):
voice = 'krya-krya'
class Chicken(Bird):
voice = 'kudakh-kudakh'
class Duck(Bird):
voice = 'krya-krya'
class Cow(Animal):
voice = 'muuuu'
milk = 'we need milk'
def get_milk(self):
self.milk = 'milk received'
class Sheep(Animal):
voice = 'beeee'
wool = 'we dont have'
def cut(self):
self.wool = 'we cut the sheep'
class Goat(Animal):
voice = 'meeee'
milk = 'we need milk'
def get_milk(self):
self.milk = 'milk received'
goose_1 = Goose('Gray', 3)
goose_2 = Goose('White', 3.5)
cow = Cow('Manka', 500)
sheep_1 = Sheep('Barashek', 50)
sheep_2 = Sheep('Kudryavyy', 65)
chicken_1 = Chicken('KoKo', 1)
chicken_2 = Chicken('Kukareku', 0.8)
goat_1 = Goat('Roga', 41)
goat_2 = Goat('Kopyta', 45)
duck = Duck('Kryakva', 2)
print(3+3.5+500+50+65+1+0.8+41+45+2)
all_animal = [goose_1, goose_2, cow, sheep_1, sheep_2, chicken_1, chicken_2, goat_1, goat_2, duck]
def print_animal_data(animal_list: list) -> None:
list_animal_weight = list()
sum_animal_weight = 0
list_animal_name = []
for animal in animal_list:
list_animal_weight.append(animal.weight)
for weight in list_animal_weight:
sum_animal_weight += weight
print(sum_animal_weight)
for animal in animal_list:
list_animal_name.append(animal.name)
all_animal_dict = dict(zip(list_animal_name, list_animal_weight))
for key, value in all_animal_dict.items():
if value == max(all_animal_dict.values()):
print(key)
print_animal_data(all_animal)
|
550a70f93c012bb9255ed755c18a74a203ed480f | nkhalili/py-samples | /02/08-conditional-operators.py | 173 | 4 | 4 |
x = 5
y = True
if x == 5 and y:
print('true')
# ternary operator
hungry = 0
result = 'feed the bear now!' if hungry else 'do not feed the bear.'
print(result) |
9790fb0d75f15431ca643b1f65319a329460c902 | nkhalili/py-samples | /02/11-loops-input.py | 320 | 3.796875 | 4 | secret = "secret"
pw = ''
while pw != secret:
if pw == '123': break
pw = input('Enter secret word:')
else: # in case while breaks, else won't run
print('>Secret key is correct.')
animals = ('bear', 'bunny', 'dog', 'cat')
for pet in animals:
print(pet)
else:
print('>Items finished.') |
3197f5ebde279a17087f81362239b07685067bba | nkhalili/py-samples | /02/03-blocks.py | 307 | 3.84375 | 4 | x = 42
y = 73
# Blocks define by indentation e.g. 4 spaces
if x < y:
z = 100
print("x < y: x is {}, y is {}".format(x, y))
## in python blocks do not define scope, Functions, objects, module DO.
# z has the same scope as x and y even though its block is different!
print("z is: ", z)
|
d90948ed064194d3f86571ec3c38f3680a2a9552 | TestardR/Python-algorithms-v1 | /sentence_reversal.py | 507 | 3.9375 | 4 | def rev_word(str):
return " ".join(reversed(str.split()))
def rev_word1(str):
return " ".join(str.split()[::-1])
def rev_word2(str):
words = []
length = len(str)
space = [' ']
i = 0
while i < length:
if str[i] not in space:
word_start = i
while i < length and str[i] not in space:
i += 1
words.append(str[word_start:i])
i += 1
return ' '.join(reversed(words))
print(rev_word2('hello mamacita'))
|
bb2c102167c19e3531e76e3b29da34608283ece8 | MikolajTwarog/Artificial-Intelligence | /connect4/board.py | 3,330 | 3.6875 | 4 | #!/usr/bin/env python3
class Board:
def __init__(self):
self.board = [[0]*7 for i in range(6)]
self.moves = 0
self.end = False
def check_vertical(self, row, column, who):
line = 0
for i in range(row, 6):
if self.board[i][column] == who:
line += 1
else:
break
return line
def check_horizontal(self, row, column, who):
line = 0
for i in range(column, 7):
if self.board[row][i] == who:
line += 1
else:
break
for i in range(column-1, -1, -1):
if self.board[row][i] == who:
line += 1
else:
break
return line
def check_diagonal(self, row, column, who):
line = 1
for i in range(1, min(7 - column, 6 - row)):
if self.board[row+i][column+i] == who:
line += 1
else:
break
for i in range(1, min(column + 1, row + 1)):
if self.board[row-i][column-i] == who:
line += 1
else:
break
line2 = 1
for i in range(1, min(column + 1, 6 - row)):
if self.board[row+i][column-i] == who:
line2 += 1
else:
break
for i in range(1, min(7 - column, row + 1)):
if self.board[row-i][column+i] == who:
line2 += 1
else:
break
return max(line, line2)
def check_draw(self):
for i in range(0, 7):
if self.board[0][i] == 0:
return False
return True
def check_if_end(self, row, column, who):
line = max(self.check_vertical(row, column, who),
self.check_horizontal(row, column, who),
self.check_diagonal(row, column, who))
return line >= 4 or self.check_draw()
def make_move(self, column):
if self.board[0][column] != 0:
return False
who = (self.moves % 2) + 1
row = 5
while self.board[row][column] != 0:
row -= 1
self.board[row][column] = who
self.end = self.check_if_end(row, column, who)
self.moves += 1
return True
def get_children(self):
who = (self.moves % 2) + 1
children = []
for i in range(0, 7):
child = Board()
child.moves = self.moves
child.board = [list(x) for x in self.board]
if child.make_move(i):
children.append((child, i))
return children
def get_possible_moves(self):
moves = []
for i in range(0, 7):
if self.board[0][i] == 0:
moves.append(i)
return moves
def print_board(self):
for i in self.board:
b = ""
for j in i:
if j == 0:
b += '.'
elif j == 1:
b += 'O'
else:
b += 'X'
b += " "
print(b)
print("0 1 2 3 4 5 6")
print()
return
|
87f5fd7703bafe4891fb042de2a7f1770c602995 | BreeAnnaV/CSE | /BreeAnna Virrueta - Guessgame.py | 771 | 4.1875 | 4 | import random
# BreeAnna Virrueta
# 1) Generate Random Number
# 2) Take an input (number) from the user
# 3) Compare input to generated number
# 4) Add "Higher" or "Lower" statements
# 5) Add 5 guesses
number = random.randint(1, 50)
# print(number)
guess = input("What is your guess? ")
# Initializing Variables
answer = random.randint(1, 50)
turns_left = 5
correct_guess = False
# This describes ONE turn (This is the game controller)
while turns_left > 0 and correct_guess is False:
guess = int(input("Guess a number between 1 and 50: "))
if guess == answer:
print("You win!")
correct_guess = True
elif guess > answer:
print("Too high!")
turns_left -= 1
elif guess < answer:
print("Too low!")
turns_left -= 1
|
6a59184a4ae0cee597a190f323850bb706c09b11 | BreeAnnaV/CSE | /BreeAnna Virrueta - Hangman.py | 730 | 4.3125 | 4 | import random
import string
"""
A general guide for Hangman
1. Make a word bank - 10 items
2. Pick a random item from the list
3. Add a guess to the list of letters guessed Hide the word (use *) (letters_guessed = [...])
4. Reveal letters already guessed
5. Create the win condition
"""
guesses_left = 10
word_bank = ["Environment", "Xylophone", "LeBron James", "Kobe", "Jordan", "Stephen Curry", "Avenue", "Galaxy",
"Snazzy", "The answer is two"]
word_picked = (random.choice(word_bank))
letters_guessed = []
random_word = len(word_picked)
# print(word_picked)
guess = ''
correct = random.choice
while guess != "correct":
guess = ()
for letter in word_picked:
if letter is letters_guessed:
print()
|
392caa19570274c18bfbdffd11430f6a1180ef44 | renard162/personal_library | /general/csvmanager.py | 7,025 | 3.59375 | 4 | # -*- coding: utf-8 -*-
# %%
"""
Funções para manipular arquivos de texto contendo dados.
"""
import numpy as np
import csv
def csv_export(file_name, *lists, titles=None, separator='\t',
decimal_digit='.', number_format='sci', precision=10):
"""
Função para salvar em arquivo de texto os dados de listas ou arrays.
Args:
file_name (string):
Nome do arquivo que será criado ou sobrescrito.
Ex.: 'arquivo.txt'
*lists (múltiplas 1D-lists ou uma única list-lists):
Listas ou arrays que formarão as colunas do arquivo de saída.
Múltiplas listas ou arrays podem ser fornecidas desde que todas
possuam o mesmo número de elementos.
Esta forma de utilização facilita exportar dados simples.
Caso seja fornecida uma lista de listas, essa deve ser fornecida
única. A função não suporta múltiplas listas de listas.
Esta forma de utilização facilita exportar dados em grandes
quantidades, gerados em massa e organizados proceduralmente.
titles (string-list, optional):
Lista de strings que serão o título das colunas de dados.
Opcional de ser fornecido mas, caso seja fornecido, deve conter
o mesmo número de elementos que o número de listas fornecidas.
separator (string, optional): Defaults to TAB ('\t').
Caractere que delimitará as colunas de dados e, caso seja
fornecido, os títulos das colunas.
Por padrão adota-se o TAB como separador, porém, se for necessária
compatibilidade com algum editor de planilhas (Excel, por exemplo)
em Pt-Br, NÃO utilize vírgula (',') como separador, pois estes
softwares reconecem a vírgula como separador de casas decimais.
decimal_digit (string, optional): Defaults to '.'.
Caractere que separará os valores decimais de elementos numéricos.
Caso não seja fornecido, adota-se o padrão internacional de
separar os dígitos decimais por ponto, por motivo de compatibilidade
com outros softwares.
Caso deseja-se compatibilizar o aqruvo com qualquer editor de
planilha (Excel, por exemplo) que esteja no padrão Pt-Br, utilizar
',' (vírgula) como separador decimal.
Este caractere deve ser diferente do delimitador de colunas
'separator' para evitar conflitos.
number_format (string, optional): Defaults to 'sci'.
Formato dos dados numéricos de saída.
Valores válidos são:
- 'sci' -> Padrão científico (1,000E00).
- 'dec' -> Padrão decimal (1,000).
- Qualquer string diferente das anteriores farão os dados
numéricos serem salvos como o padrão do python.
precision (int, optional): Defaults to 10.
Número de casas decimais utilizados em dados numéricos.
Exemplo de uso 1 (múltiplas listas 1D fornecidas):
Dadas as variáveis:
I1 = [1.32, 2.65, 8.6, 0.7, 5.731]
Vo = [12.0, 10.1, 14.68, 9.8, 7.99]
Deseja-se salvar estes dados em arquivo CSV chamado "dados.csv" para
utilizar em Excel Pt-Br com os títulos "Corrente de entrada" e
"Tensão de saída", assim, define-se os títulos:
titulos = ['Corrente de entrada', 'Tensão de saída']
Aplica-se estes valores na função:
csv_export('dados.csv', I1, Vo, titles=titulos, decimal_digit=',')
Exemplo de uso 2 (Lista de listas única fornecida):
Dada a matriz de dados:
M = [[0.25, 0.6, 0.15], [35, 42, 15]]
Onde os dados da primeira lista representa "Rendimento" e da segunda
lista representa "Temperatura", deseja-se salvar estes dados em
arquivo "experimento.dat" para ser utilizado em Excel Pt-Br com as
colunas devidamente nomeadas e separadas por ";".
Então cria-se o vetor de títulos das colunas:
titulos = ['Rendimento', 'Temperatura']
Então executa-se a função:
csv_export('experimento.dat', M, titles=titulos, separator=';',
decimal_digit=',')
"""
#Checagem do tipo de entrada:
#n-listas: dimensions = 2
#lista de listas: dimensions = 3
dimensions = np.array(lists, dtype=object).ndim
if dimensions == 3:
lists = lists[0]
#Checagem dos títulos (caso fornecidos)
if (titles != None):
if (np.sum([isinstance(x, str) for x in titles]) != len(titles)):
raise Exception('Todos os títulos devem ser Strings!')
if (len(titles) != len(lists)):
raise Exception('O número de títulos é diferente do número de '\
'listas fornecidas!')
#Checagem de conflito entre separador decimal e delimitador de colunas.
if (separator == decimal_digit):
raise Exception('O caractere delimitador de colunas \'separator\' '\
'deve ser diferente do caractere separador decimal '\
'\'decimal_digit\'!')
#Como é esperado que o número de amostras seja muito, muito maior que o
#número de listas, excutar a checagem da validade das listas antes de
#processar seus elementos aumenta o desempenho do código.
data_length = len(lists[0])
for data in lists:
if (len(data) != data_length):
raise Exception('Todos os vetores de dados devem ter o mesmo tamanho!')
#Montagem da matriz de dados
str_format = '{:.' + str(precision)
if (number_format == 'sci'):
str_format += 'e}'
elif (number_format == 'dec'):
str_format += 'f}'
else: #Vetores numéricos tratados como vetores genéricos
str_format = 'generic'
data_matrix = []
for data in lists:
try: #Vetor numérico
if (str_format == 'generic'):
raise Exception()
data = np.array(data, dtype=float)
temp_data = [str_format.format(x).replace('.', decimal_digit) \
for x in data]
except: #Vetor genérico
temp_data = [str(x) for x in data]
finally: #Finalmente mesmo.... ufa
data_matrix.append(temp_data)
data_matrix = np.array(data_matrix).T.tolist()
#Escrita no arquivo
#Depois de tanto malabarismo para ajustar os dados e fazer os dumb checks,
#já estava na hora de finalmente fazer o que a função deve fazer...
with open(file_name, 'w', newline='') as file:
writer = csv.writer(file, delimiter=separator)
if (titles != None):
writer.writerow(titles)
for line in data_matrix:
writer.writerow(line)
|
a7fa12618849376c1bbc3655b9ee4e1d0061477c | gugunm/test-kumparan | /model-v2.py | 5,249 | 3.796875 | 4 | """
Kumparan's Model Interface
This is an interface file to implement your model.
You must implement `train` method and `predict` method.
`train` is a method to train your model. You can read
training data, preprocess and perform the training inside
this method.
`predict` is a method to run the prediction using your
trained model. This method depends on the task that you
are solving, please read the instruction that sent by
the Kumparan team for what is the input and the output
of the method.
In this interface, we implement `save` method to helps you
save your trained model. You may not edit this directly.
You can add more initialization parameter and define
new methods to the Model class.
Usage:
Install `kumparanian` first:
pip install kumparanian
Run
python model.py
It will run the training and save your trained model to
file `model.pickle`.
"""
# library of kumparan
from kumparanian import ds
# sastrawi library, using for stopword removal
from Sastrawi.StopWordRemover.StopWordRemoverFactory import StopWordRemoverFactory
# library to create tf-idf
from sklearn.feature_extraction.text import TfidfTransformer
# library to create words count vectorize
from sklearn.feature_extraction.text import CountVectorizer
# library to split data
from sklearn.model_selection import train_test_split
# library to remove punctuation in every content
from nltk.tokenize import RegexpTokenizer
# accuracy metrics to evaluate prediction
from sklearn.metrics import accuracy_score
# library to learn model using Support Vector Machine
from sklearn.svm import SVC
# library to read data
import pandas as pd
class Model:
def __init__(self):
"""
You can add more parameter here to initialize your model
"""
# initialize the variable for count_vectorizer function
self.count_vect = CountVectorizer()
# initialize the variable for tf-idf function
self.tfidf_transformer = TfidfTransformer()
# initialize SVM classifier method
self.svm_clf = SVC(kernel = 'linear', C = 1)
def train(self):
"""
NOTE: Implement your training procedure in this method.
"""
# read data.csv using pandas and drop nan
data = pd.read_csv("data.csv").dropna()
# get article_content and transform to list
contents = data["article_content"].values.tolist()
# get article_topic and transform to list
topics = data["article_topic"].values.tolist()
# import library to tokenize and remove punctuation
tokenizer = RegexpTokenizer(r'\w+')
# stopword removal for bahasa indonesia
stopword = StopWordRemoverFactory().create_stop_word_remover()
# list to save clean contents
clean_contents = list()
# looping the contents, and preprocess for each content
for content in contents:
# case folding the sentence to be lowcase
lowcase_word = content.lower()
# remove stopword from the content
stop_word = stopword.remove(lowcase_word)
# tokenize the content
sentence_token = tokenizer.tokenize(stop_word)
# initialize a list for clean token
clean_tokens = list()
for token in sentence_token:
# append token to the list after lower it
clean_tokens.append(token)
# transform a token to be sentence
sentence = " ".join(clean_tokens) + ''
# append clean sentence
clean_contents.append(sentence)
# count vectorizer
X_train_counts = self.count_vect.fit_transform(clean_contents)
# create tfidf from count vectorizer
X_train_tfidf = self.tfidf_transformer.fit_transform(X_train_counts)
# split data to train and test set > test 10%, train 90%
X_train, X_test, y_train, y_test = train_test_split(X_train_tfidf, topics, test_size=0.1)
# train a model
self.svm_clf.fit(X_train, y_train)
# prediction for x_test
prediction = self.svm_clf.predict(X_test)
# model accuracy for x_test
accuracy = accuracy_score(y_test, prediction)
# print accuracy
print(accuracy)
def predict(self, input):
"""
NOTE: Implement your predict procedure in this method.
"""
# put the input (string) into a list
input_test = list(input)
# count vectorize of input_test vocabulary
new_counts = self.count_vect.transform(input_test)
# create tf-idf for input test
new_tfidf = self.tfidf_transformer.transform(new_counts)
# get a prediction label
label = self.svm_clf.predict(new_tfidf)[0]
return label
def save(self):
"""
Save trained model to model.pickle file.
"""
ds.model.save(self, "model.pickle")
if __name__ == '__main__':
# NOTE: Edit this if you add more initialization parameter
model = Model()
# Train your model
model.train()
# try to predict
article_topic = model.predict("article_content")
print(article_topic)
# Save your trained model to model.pickle
model.save() |
6f3f133dbbc8fc6519c54cc234da5b367ee9e80d | stark276/Backwards-Poetry | /poetry.py | 1,535 | 4.21875 | 4 | import random
poem = """
I have half my father's face
& not a measure of his flair
for the dramatic. Never once
have I prayed & had another man's wife
wail in return.
"""
list_of_lines = poem.split("\n")
# Your code should implement the lines_printed_backwards() function.
# This function takes in a list of strings containing the lines of your
# poem as arguments and will print the poem lines out in reverse with the line numbers reversed.
def lines_printed_backwards(list_of_lines):
for lines in list_of_lines:
list_of_lines.reverse()
print(list_of_lines)
def lines_printed_random(list_of_lines):
"""Your code should implement the lines_printed_random() function which will randomly select lines from a list of strings and print them out in random order. Repeats are okay and the number of lines printed should be equal to the original number of lines in the poem (line numbers don't need to be printed). Hint: try using a loop and randint()"""
for lines in list_of_lines:
print(random.choice(list_of_lines))
def my_costum_function(list_of_lines):
""""Your code should implement a function of your choice that rearranges the poem in a unique way, be creative! Make sure that you carefully comment your custom function so it's clear what it does."""
# IT's going to delete the last line
for lines in list_of_lines:
list_of_lines.pop()
print(list_of_lines)
lines_printed_backwards(list_of_lines)
lines_printed_random(list_of_lines)
my_costum_function(list_of_lines)
|
79e2e4cb5ee662ca24a0a2e9154b5f5c5837cc60 | akhan7/fss16groupG | /code/5/maxwalksat.py | 4,532 | 3.765625 | 4 | from __future__ import print_function
import copy
import random
def r(a=0, b=1): return random.randint(a, b)
class Osyczka:
"""
Utility class to solve the Osyczka2 equation
"""
def min_max(self, tries):
"""
Args:
tries: number of tries / iterations
Returns: A tuple of the minimum and absolute maximum of Osyczka2 function
"""
i = 0
min = float('inf')
max = float('-inf')
while i < tries:
x = self.rand_list()
if self.constraints(x):
oval = self.osyczka(x)
if oval < min:
min = oval
if oval > max:
max = oval
i += 1
return min, max
def get_threshold(self, g_min, g_max, tries):
"""
Args:
g_min: Min Value (found from min_max())
g_max: Max Value (found from min_max())
tries: Number of iterations
Returns: Normalized threshold value averaged over "tries" number of iterations
"""
i = 0
aggregate_diff = 0
while i < tries:
min, max = self.min_max(1000)
if min > g_min and max < g_max:
aggregate_diff += self.get_normalized(min, g_min, g_max)
i += 1
return aggregate_diff / float(tries)
def get_normalized(self, x, g_min, g_max):
"""
Args:
x: Value to be normalized
g_min: Min value
g_max: Max value
Returns: Normalized value of x
"""
return ((x) - g_min) / float(g_max - g_min)
def osyczka(self, x):
"""
Args:
x: Independent variable
Returns:
value of Osyczka function at x
"""
return self.__f1(x) + self.__f2(x)
def constraints(self, x):
"""
Args:
x: List of 6 elements representing
Returns: True if the contraints pass, False otherwise.
"""
return self.__g1(x) >= 0 and self.__g2(x) >= 0 and self.__g3(x) >= 0 and self.__g4(x) >= 0 \
and self.__g5(x) >= 0 and self.__g6(x) >= 0
def rand_list(self):
"""
Returns: A random list of 6 integers
"""
return [r(0, 10), r(0, 10), r(1, 5), r(0, 6), r(1, 5), r(0, 10)]
def __f1(self, x):
return -(25 * pow(x[0] - 2, 2) + pow(x[1] - 2, 2) \
+ pow(x[2] - 1, 2) * pow(x[3] - 4, 2) + pow(x[4] - 1, 2))
def __f2(self, x):
sum = 0
for i in xrange(len(x)):
sum = sum + pow(x[i], 2)
return sum
def __g1(self, x):
return x[0] + x[1] - 2
def __g2(self, x):
return 6 - x[0] - x[1]
def __g3(self, x):
return 2 - x[1] + x[0]
def __g4(self, x):
return 2 - x[0] + 3 * x[1]
def __g5(self, x):
return 4 - pow(x[2] - 3, 2) - x[3]
def __g6(self, x):
return pow(x[4] - 3, 3) + x[5] - 4
class MaxWalkSat:
@staticmethod
def solve(max_tries):
o = Osyczka()
# Get min and max over thousand tries
g_min, g_max = o.min_max(1000)
print("The global min,max for normalization : ", g_min, g_max)
# Get threshold over 10 tries (Internally uses min_max(1000))
# threshold = o.get_threshold(g_min, g_max, 10)
threshold = 0.06;
print("Stopping condition (threshold) : ", threshold)
solution = o.rand_list()
while not o.constraints(solution):
solution = o.rand_list()
for i in xrange(max_tries):
# print(solution)
if o.constraints(solution) and o.get_normalized(o.osyczka(solution), g_min, g_max) < threshold:
return ("SUCCESS", solution, o.osyczka(solution),i)
c = r(0, 5)
if 0.5 < random.random():
solution[c] = o.rand_list()[c]
else:
# Throw away solution
prev_solution = copy.deepcopy(solution)
solution = o.rand_list()
while not o.constraints(solution) and o.get_normalized(o.osyczka(solution), g_min,
g_max) < o.get_normalized(
o.osyczka(prev_solution), g_min, g_max):
solution = o.rand_list()
return ("FAILURE", solution, o.osyczka(solution),i)
if __name__ == '__main__':
print(MaxWalkSat.solve(1000))
|
da6af0c09f54f044d89eaa17ab549f219deb006b | akhan7/fss16groupG | /code/6/decision.py | 325 | 3.515625 | 4 | class Decision:
"""
Class indicating Decision of a problem
"""
def __init__(self, name, low, high):
"""
@param name: Name of the decision
@param low: minimum value
@param high: maximum value
"""
self.name = name
self.low = low
self.high = high
|
7069fe6daf6fe7091471a9e4220569d58e9fcbe3 | GWANGHYUNYU/Python_Tutorial | /quiz01.py | 632 | 3.671875 | 4 | # Quiz) 변수를 이용하여 다음 문장을 출력하시오.
#
# 변수명 : station
#
# 변수값 : "사당", "신도림", "인천공항" 순서대로 입력
#
# 출력 문장 : xx 행 열차가 들어오고 있습니다.
# station = ["사당", "신도림", "인천공항"]
# for i in station:
# print(i, "행 열차가 들어오고 있습니다.")
station = "사당"
print("{} 행 열차가 들어오고 있습니다.".format(station))
station = "신도림"
print("{} 행 열차가 들어오고 있습니다.".format(station))
station = "인천공항"
print("{} 행 열차가 들어오고 있습니다.".format(station)) |
2ffa4f8025d643ad0b58f3a2f0bb30e0eec22a65 | yilia13516877583/-git | /thread_lock.py | 402 | 3.53125 | 4 | """
线程锁演示
"""
from threading import Thread,Lock
lock = Lock() # 锁对象
a = b = 0
def value():
while True:
lock.acquire()
if a != b:
print("a = %f,b = %f"%(a,b))
lock.release()
t = Thread(target=value)
t.start()
while True:
with lock: # 上锁
a += 0.1
b += 0.1
# with语句块结束自动解锁
t.join() |
36eae5a4a0f55d15e6105e24fa7d4d64a1009b2e | YatreeLadani/CompetitiveProgramming | /LeetCode/4_Valid_Anagram.py | 254 | 3.671875 | 4 | def validanagram(s,t):
if (1 <= len(s) and 1 <= len(t)) or (len(s) <= 5 * (10**4) and len(t) <= 5 * (10**4)):
if sorted(s)==sorted(t):
print("True")
else:
print("Flase")
validanagram("rat", "art") |
f356e0847e22fda7ce2621790bc4be4939f8037b | hasanahmed-eco/space-man | /**SPACEMAN FINAL**.py | 2,077 | 4.03125 | 4 | import random
# change the guess array NameError
# To DO:
# 1) Ensure user doesn't enter a value twice
letterCount = 0
word_list = [
"apple", "banana", "education", "house", "fridge", "game", "aaaaaaaab"
]
print("--------------------")
print("----SPACEMAN 2.0----")
print("--------------------")
def setUpGame():
lives = 6
word = word_list[random.randint(0, len(word_list)) - 1]
previouslyGuessedLetters = []
guess = []
for i in range(0, len(word)):
guess.append("_")
return lives, word, guess, previouslyGuessedLetters
# CHANGE GUESS GUESS ARRAY TO A DIFFERENT NAME
def Game():
lives, word, guess, previouslyGuessedLetters = setUpGame()
run = True
while (run==True and letterCount != len(word)):
printArray(guess)
playerGuess = getUserInput()
isLetterInWord = checkLetter(word, playerGuess)
if(playerGuess in previouslyGuessedLetters):
print("You have already guessed this letter")
else:
if(isLetterInWord):
guess = updateGuess(word, playerGuess, guess)
else:
lives = lives - 1
if(lives == 0):
run = False
else:
print("\nYou guessd the letter wrong, you have {} lives remaining".format(lives))
previouslyGuessedLetters.append(playerGuess)
if(letterCount == len(word)):
print("Well done, you have guessed the word correctly!")
else:
print("\nYou have ran out of lives, the word was {}".format(word))
def printArray(guess):
for letter in guess:
print(letter, end=" ")
print('\n')
def getUserInput():
playerGuess = input("Please enter a letter: ")
return playerGuess
def checkLetter(word, letter):
if letter in word:
return True
else:
return False
def updateGuess(word, userGuess, guess):
count = 0
for letter in word:
if letter == userGuess:
guess[count] = letter
global letterCount
letterCount = letterCount + 1
count = count + 1
return guess
Game()
|
ad87297b334864c573301f0aab7e1cbba65d5d33 | usf-cs-spring-2019-anita-rathi/110-project-constellation-jychan4 | /projectconstellationV5.py | 2,092 | 3.796875 | 4 | #Yew Journ Chan
#May 30, 2019
#Version 5
import turtle
#Starting with Point Alnitak
turtle.hideturtle() #this command hides arrow symbols identified as "turtle"
turtle.dot(10) #indicating the point starting at Alnitak
turtle.write("Alnitak") #label point "Alnitak"
#Point Betelgeuse
turtle.left(110) #pivoting towards direction of point Betelgeuse
turtle.forward(320) #distance between point Alnitak and point Betelgeuse
turtle.dot(10) #indicating point Betelgeuse
turtle.write("Betelgeuse") #label point "Betelgeuse"
turtle.penup() #lift pen to prevent drawing when retracing steps
turtle.backward(320) #retracing steps back to point "Alnitak"
#Point Saiph
turtle.pendown() #pen down to begin drawing again
turtle.left(135) #pivoting left towards direction of point Saiph
turtle.forward(250) #distance between point Alnitak and point Saiph
turtle.dot(10) #indicating point Saiph
turtle.write("Saiph") #label point "Saiph"
#Point Alnilam
turtle.penup() #lift pen to prevent drawing when retracing steps
turtle.backward(250) #retracing steps back to point Alnitak
turtle.pendown() #pen down to start drawing again
turtle.left(140) #pivoting left to point Alnilam
turtle.forward(70) #distance between point Alnitak and point Alnilam
turtle.dot(10) #indicating point Anilam
turtle.write("Alnilam") #label point "Alnilam"
#Point Mintaka
turtle.forward(70) #distance between point Alnilam and point Mintaka
turtle.dot(10) #indicating point Mintaka
turtle.write("Mintaka") #lavel point "Mintaka"
#Point Meissa
turtle.left(50) #pivoting left to point Meissa
turtle.forward(250) #distance between point Mintaka and point Meissa
turtle.dot(10) #indicating point Meissa
turtle.write("Meissa") #label point "Meissa"
#Point Rigel
turtle.penup() #lift pen to prevent drawing when retracing steps
turtle.backward(250) #retracing steps back to point Mintaka
turtle.pendown() #pen down to start drawing again
turtle.right(150) #pivoting right to point Rigel
turtle.forward(240) #distance between point Mintaka and point Rigel
turtle.dot(10) #indicating point Rigel
turtle.write("Rigel") #label point "Rigel"
|
4afcb0749886f9c8807b970405d13d3a4993721c | tkf/compapp | /src/compapp/descriptors/links.py | 3,978 | 3.5 | 4 | from ..core import private, Descriptor
def countprefix(string, prefix):
w = len(prefix)
n = len(string)
i = 1
while i < n and string[i * w: (i+1) * w] == prefix:
i += 1
return i
class Link(Descriptor):
"""
"Link" parameter.
It's like symbolic-link in the file system.
Examples
--------
>>> from compapp.core import Parametric
>>> class MyParametric(Parametric):
... x = 1
... broken = Link('..')
...
... class nest(Parametric):
... x = 2
... l0 = Link('')
... l1 = Link('x')
... l2 = Link('..x')
... l3 = Link('.nest.x')
... broken = Link('..broken')
...
... class nest(Parametric):
... x = 3
... l0 = Link('')
... l1 = Link('x')
... l2 = Link('..x')
... l3 = Link('.nest.x')
... broken = Link('..broken')
...
>>> par = MyParametric()
>>> par is par.nest.l0 is par.nest.nest.l0
True
>>> par.nest.l1
1
>>> par.nest.l2
1
>>> par.nest.l3
3
>>> par.nest.nest.l1
1
>>> par.nest.nest.l2
2
>>> par.nest.nest.l3
Traceback (most recent call last):
...
AttributeError: 'nest' object has no attribute 'l3'
>>> hasattr(par, 'broken')
False
>>> hasattr(par.nest, 'broken')
False
>>> hasattr(par.nest.nest, 'broken')
False
.. todo:: Should `path` use more explicit notation as in the JSON
pointer? That is to say, use ``'#'`` instead of ``''`` (an
empty string) to indicate the root. Then, for example, ``'x'``
would be written as ``'#.x'``.
"""
def __init__(self, path, adapter=None, **kwds):
super(Link, self).__init__(**kwds)
self.path = path
self.adapter = adapter
def get(self, obj):
if self.path.startswith('.'):
i = countprefix(self.path, '.')
start = obj
for _ in range(i - 1):
start = private(start).owner
if start is None:
return self.default
restpath = self.path[i:]
else:
restpath = self.path
start = private(obj).getroot()
value = start
for part in restpath.split('.') if restpath else []:
try:
value = getattr(value, part)
except AttributeError:
return self.default
if self.adapter:
value = self.adapter(value)
return value
class Root(Link):
"""
An alias of ``Link('')``.
"""
def __init__(self, **kwds):
super(Root, self).__init__('', **kwds)
class Delegate(Link):
"""
Delegate parameter to its owner.
``x = Delegate()`` is equivalent to ``x = Link('..x')``.
Examples
--------
>>> from compapp.core import Parametric
>>> class Parent(Parametric):
...
... class nest1(Parametric):
... sampling_period = Delegate()
...
... class nest2(Parametric):
... sampling_period = Delegate()
...
... sampling_period = 10.0
...
>>> par = Parent()
>>> par.sampling_period
10.0
>>> par.nest1.sampling_period
10.0
>>> par.nest2.sampling_period
10.0
>>> par.sampling_period = 20.0
>>> par.nest1.sampling_period
20.0
"""
def __init__(self, **kwds):
super(Delegate, self).__init__(None, **kwds)
def get(self, obj):
# FIXME: This is a bit hacky implementation (communicating by
# mutating shared namespace). Need refactoring.
self.path = '..' + self.myname(obj)
return super(Delegate, self).get(obj)
class MyName(Descriptor):
def get(self, obj):
return private(obj).myname
class OwnerName(Descriptor):
def get(self, obj):
return private(private(obj).owner).myname
|
e42694efe84f29d3cb96dda98e8793d7613256c0 | david-singh/Log-Analysis | /reportingtool.py | 3,203 | 3.609375 | 4 | # ! /usr/bin/env python3
import psycopg2
# What are the most popular three articles of all time?
query_1_title = ("What are the most popular three articles of all time?")
query_1 = """select articles.title, count(*) as views
from articles inner join log on log.path
like concat('%',articles.slug,'%')
where log.status like '%200%'
group by articles.title, log.path
order by views desc limit 3"""
# Who are the most popular article authors of all time?
query_2_title = ("Who are the most popular article authors of all time?")
query_2 = """select authors.name, count(*) as views from articles inner
join authors on articles.author = authors.id inner join log
on log.path like concat('%', articles.slug, '%') where
log.status like '%200%' group by authors.name order by views desc"""
# On which days did more than 1% of requests lead to errors?
query_3_title = ("On which days did more than 1% of requests lead to errors?")
query_3 = """select * from error_log_view where \"Percent Error\" > 1"""
def option():
""" Provide the options to select from """
print("Welcome")
print("Enter your option *_* \n")
print("1 : What are the most popular three articles of all time?")
print("2 : Who are the most popular article authors of all time?")
print("3 : On which days did more than 1% of requests lead to errors?\n")
while True:
opt = int(input("Enter : "))
if opt < 1 or opt > 3:
print("Please Choose between the three options")
continue
else:
break
return opt
def connection():
"""Connect to the PostgreSQL database. Returns a database connection"""
try:
db = psycopg2.connect("dbname=news")
c = db.cursor()
return db, c
except:
print("Sorry, Unable to connect to Database")
def query_results(query):
"""Return query results for given query """
db, c = connection()
c.execute(query)
return c.fetchall()
db.close()
def print_query_results(query_result):
"""Prints query results for given query """
print ('\n'+query_result[1])
for index, results in enumerate(query_result[0]):
print ('> ' + str(results[0]) + ' --- ' + str(results[1]) + ' views')
def print_error_results(query_result):
"""Prints query results for error query """
print ('\n'+query_result[1])
for results in query_result[0]:
print ('> ' + str(results[0]) + ' --- ' + str(results[1]) + "% errors")
if __name__ == '__main__':
opt = option()
if opt == 1:
# stores the result
article_result = query_results(query_1), query_1_title
# prints the output
print_query_results(article_result)
elif opt == 2:
# stores the result
author_result = query_results(query_2), query_2_title
# prints the output
print_query_results(author_result)
else:
# stores the result
error_result = query_results(query_3), query_3_title
# prints the output
print_error_results(error_result)
|
4c5923e491d8527c4a255746510c568175334701 | SamuelNarciso/Analizador_Sintactico | /AnalizadorSintactico/TreeString.py | 1,172 | 3.609375 | 4 | import Tree
import alphabet
# int v=10
# int v =10
# int v = 10
class Node:
def __init__(self, value, alphabet):
self.value = value
self.alphabet = alphabet
class TreeString:
def CreateTree(self):
alphabets = [
Node(31, [';']),
Node(40, alphabet.Alphabet().GenerateLetters()),
Node(26, [' ']),
Node(29, ['g']),
Node(30, ['n']),
Node(28, ['i']),
Node(24, ['r']),
Node(25, ['t']),
Node(23, ['S'])
]
tree = Tree.Tree()
for x in alphabets:
tree.root = tree.insert(tree.root, x.value, x.alphabet)
return tree
def TreeAssign(self):
alphabets = [
Node(30, [';']),
Node(31, ['"', "'"]),
Node(25, alphabet.Alphabet().LetterWithSimbols()),
Node(26, ['"', "'"]),
Node(23, ['=']),
Node(24, [' ']),
Node(1, alphabet.Alphabet().GenerateLetters())
]
tree = Tree.Tree()
for x in alphabets:
tree.root = tree.insert(tree.root, x.value, x.alphabet)
return tree
|
de78a9a1d734acc46b5403c9960f9ea372cfa242 | udaypatel83/FirstRepositoryforPython | /Loops1.py | 401 | 3.640625 | 4 | # 1
# 123
# 12345
# 1234567
#123456789
#
minline = 1
maxline = 5
i =1
j =5
numprint = 1
str1 = str(numprint)
a = 1
b = 2
while minline <= maxline:
while j>=i:
print (' '*j, end="")
print( str1)
while a <= b:
numprint = numprint +1
str1 = str1 + str(numprint)
a=a+1
j= j-1
a=1
minline+=1
print('')
|
637466a2c1e4300befe7497c5b1b63e530a565a4 | edagotti689/PYTHON-13-RANDOM-PREDEFINE-MODULE | /1_ramdom.py | 404 | 4 | 4 | '''
1. random module is predeined module in python used to create a random values.
2. It is used to select a random number or element from a group of elements
3. random module mainly used in games and cryptography
'''
import random
# random() is used to return a random float number b/w 0 to 1 (0<x<1)
l=random.random()
print(l)
for i in range(10):
print(random.random())
|
472c1086db3decabcded78da1b77b6a67cf6d83b | stereoabuse/euler | /problems/prob_023.py | 1,270 | 3.71875 | 4 | ################################################################################
# Project Euler Problem 023 #
# https://projecteuler.net/problem=023 #
# #
# Author: Chris B. #
# Date: November 05, 2020 #
################################################################################
def prob_023(n = 28124):
'''
Return sum of all positive integers that can NOT
be written as the sum of two abundant number
https://en.wikipedia.org/wiki/Abundant_number
'''
abundant_list, non_sum = [], []
int_list_sum = sum(range(1,n))
double_abundants = set()
for i in range(1,n):
i_divisor_sum = sum(j for j in range(1, int(i/2) + 1) if i % j == 0)
if i_divisor_sum > i:
abundant_list.append(i)
for x in abundant_list:
for y in abundant_list:
if y + x < n:
double_abundants.add(x + y)
return int_list_sum - sum(double_abundants)
prob_023() |
1f49c039dc9e5d187221cbdeb75992063e20e3b7 | zwamdurkel/2wf90-assignment-2 | /method/displayField.py | 588 | 3.75 | 4 | # Input: INTEGER mod, POLY modPoly, POLY a
# Output: STRING answer, POLY answer-poly
# Functionality: Output a representative of the field element of F that represents a,
# this means the unique polynomial f of degree less than the degree of q(x) that is congruent to a.
# Output f as pretty print string and as POLY.
from method.displayPoly import displayPoly
from method.longDivPoly import longDivPoly
def displayField(mod, modPoly, a):
x = longDivPoly(mod, a, modPoly)[3]
return displayPoly(mod, x)[0], x
#FINNEAN |
a13982d0e87fa36afa55de7d25ab68a4eab07847 | zwamdurkel/2wf90-assignment-2 | /method/divisionField.py | 761 | 3.515625 | 4 | # Input: INTEGER mod, POLY modPoly, POLY a, POLY b
# Output: STRING answer, POLY answer-poly
# Functionality: Compute the element f = a / b in F.
# Output f as pretty print string and as POLY.
from method.addPoly import addPoly
from method.displayField import displayField
from method.longDivPoly import longDivPoly
from method.displayPoly import displayPoly
def divisionField(mod, modPoly, a, b):
x = displayField(mod, modPoly, a)[1]
y = displayField(mod, modPoly, b)[1]
if y == [0]:
return 'ERROR', []
q, r = longDivPoly(mod, x, y)[2:4]
while r != [0]:
x = addPoly(mod, x, modPoly)[1]
q, r = longDivPoly(mod, x, y)[2:4]
return displayPoly(mod, q)[0], q
|
16f4516dc01599206efe6d145d6cdb5eff29f874 | CodeNeverStops/PythonChallenge | /02_ocr.py | 207 | 3.59375 | 4 | #!/usr/bin/env python
# -*- coding: utf-8 -*-
def solution(content):
chars = [char for char in content if char.isalpha()]
print "".join(chars)
content = file('02_ocr.txt').read()
solution(content)
|
14cfc68263a404e951421ddf9fa6780d8ae78de2 | niharnandan/RA-Spring2020 | /2020_1 Spring/OptimalStrategy Simulations/PYTHON - optimal strategy/Optimal Strategy/2. Data Simulation/data simulation distribution.py | 9,342 | 3.875 | 4 | # import packages
import math
import random
import numpy as np
import csv
############################### Explanation ###############################
# This is a very similar code to 'data simulation.py'. But instead of simulating 40*25 sequences,
# we simulate 100 samples, each with 25*4 sequences. We will calculate the distribution of MLE
# according to this simulation.
# IMPORTANT NOTE: four parameters that would affect the simulation results:
# lambda(k), alpha1, alpha2, stop_cost.
# If you want to change lambda(k), change in this code. To change the other three, change
# 'value functions.py' to generate a different 'value functions.csv' first.
# NOTE 2: what we need to run the code: 'value functions.csv', 'Bayes Results.csv' (experiment data)
# NOTE 3: write into csv file called 'simulation results 2.csv'
############################### helper function ###############################
# capture the randomness of decision making. prob of choosing stop, 1, 2, given lambda(k), V_stop, V_1, V_2
# input: lambda(k), V_stop, V_1, V_2
# output: prob of choosing stop, investigate 1, and investigate 2
def randomness(k,v_stop,v_red,v_blue):
try:
p_stop = 1/(1+math.exp(k*(v_red-v_stop))+math.exp(k*(v_blue-v_stop)))
except OverflowError:
p_stop = 0
try:
p_red = 1/(1+math.exp(k*(v_stop-v_red))+math.exp(k*(v_blue-v_red)))
except OverflowError:
p_red = 0
try:
p_blue = 1/(1+math.exp(k*(v_stop-v_blue))+math.exp(k*(v_red-v_blue)))
except OverflowError:
p_blue = 0
return (p_stop,p_red,p_blue)
############################### set parameters ###############################
k = 0.04 # parameter (lambda) in randomness
p_grid = np.linspace(0,1,1001,endpoint=True) # p grid
trial = 60 # total number of available trials
cost = [5,10,20,40,80] # cost per investigation
prior = [0.1,0.3,0.5,0.7,0.9] # prior probability of 1 guilty
count = 0 # keep track of the number of trial (no greater than 60)
true_state = [] # guilty state for each cost, prior
# extract the true state ('guilty_suspect_chosen') from experiment data
for c in cost: # for each cost level
for p in prior: # for each prior level
with open('Bayes Results.csv','r') as csvfile: # read the experiment file
filereader = csv.reader(csvfile, delimiter=',')
for row in filereader:
# identify the trial from part2, with cost=c and prior=p
if row[1] == 'part2' and row[2] == str(c) and row[3] == str(p):
true_state.append(row[4])
# read from csv file stored as 'value functions.csv' the following parameters:
# accuracy1 (prob of finding 1 guilty conditional on 1 guilty), accuracy2, alpha_1, alpha_2
with open('value functions.csv','r') as csvfile:
filereader = csv.reader(csvfile, delimiter=',')
accuracy1 = float(next(filereader)[1])
accuracy2 = float(next(filereader)[1])
alpha_1 = float(next(filereader)[1])
alpha_2 = float(next(filereader)[1])
# create a list of column names, same format as the experiment data csv file
column_name = ['trial_no','block_name','setup_cost','red_prior_prob',
'guilty_suspect_chosen','timing_valid','timing_error']
for i in range(1,63):
column_name.append('_'.join(['choice',str(i)]))
############################### simulation and write into csv file ###############################
# write simulation results into one single file
with open('simulation results 2.csv','w') as csvfile:
filewriter = csv.writer(csvfile, delimiter=',',
quotechar='|',quoting=csv.QUOTE_MINIMAL)
filewriter.writerow(column_name)
# below is the simulation of decision sequences
for M in range(100):
for c in cost:
# the following lines read V_stop, V_1, V_2 of the corresponding cost from 'value functions.csv'
with open('value functions.csv','r') as csvfile:
filereader = csv.reader(csvfile, delimiter=',')
for line, content in enumerate(filereader):
if content == [''.join(['cost=',str(c)])]:
line_num = line # identify the line of cost = c
break
V_stop = next(filereader)
V_stop = [float(i) for i in V_stop] # change str type to float
V_1 = next(filereader)
V_1 = [float(i) for i in V_1]
V_2 = next(filereader)
V_2 = [float(i) for i in V_2]
for p in prior:
idx = cost.index(c)*5 + prior.index(p) # index for truly guilty state of (c,p)
guilty = true_state[idx] # true state
p0 = p # instore value of p into p0, so that we can reset after break from one trial
# for each level of c(cost) and p(prior), we append the simulation result into the
# created csv file, which contains 40 simulations for each (c,p) combination, and
# each simulation consists 60 available investigation opportunities
for i in range(4): # four simulations
investigation = ['','',c,p,guilty,'',''] # for each trial, keep track of the choices made
count = 0 # keep track of the number of investigation (60 maximum)
while (count <= trial): # when we have not reached total available investigation number (60)
count += 1 # keep track of number of times we have investigated
p_index = np.argmax(-(abs(p_grid - p))) # find the position of p in p_grid
# find the value of stop, 1, 2 for that p, and the prob of stop, 1, 2 based on randomness
choice = randomness(k,V_stop[p_index],V_1[p_index],V_2[p_index])
random_action = random.random() # generate a random number
# case 1: accuse
if random_action <= choice[0]:
if p>=0.5: # red is more likely to be guilty
investigation.append('accuse_red')
investigation.append('advance_to_next_trial')
else: # blue is more likely to be guilty
investigation.append('accuse_blue')
investigation.append('advance_to_next_trial')
p = p0
break
# case 2: investigate red
elif random_action <= 1-choice[2]:
investigation.append('investigate_red')
# red is guilty and evidence is shown, then accuse red
if random.random()<=accuracy1 and guilty == 'red':
investigation.append('evidence_shown')
investigation.append('accuse_red')
investigation.append('advance_to_next_trial')
p = p0
break
else: # no evidence
posterior = p*(1-accuracy1)/(1 - p*accuracy1)
if (p >= 0.5 and posterior > p) or (p < 0.5 and posterior < p):
p = alpha_1*posterior + (1-alpha_1)*p
else:
p = alpha_2*posterior + (1-alpha_2)*p
p = min(max(p,0),1) # updated p in (0,1)
# case 3: investigate blue
else:
investigation.append('investigate_blue')
# blue is guilty and evidence is shown, then accuse blue
if random.random()<=accuracy2 and guilty == 'blue':
investigation.append('evidence_shown')
investigation.append('accuse_blue')
investigation.append('advance_to_next_trial')
p = p0
break
else: # no evidence
posterior = p/(1 - (1-p)*accuracy2)
if (p >= 0.5 and posterior > p) or (p < 0.5 and posterior < p):
p = alpha_1*posterior + (1-alpha_1)*p
else:
p = alpha_2*posterior + (1-alpha_2)*p
p = min(max(p,0),1) # updated p in (0,1)
# if we run out of investigation opportunities, but don't make a decision yet
if investigation[-1] != 'advance_to_next_trial':
if p>=0.5: # red likely to be guilty
investigation.append('accuse_red')
else: # blue likely to be guilty
investigation.append('accuse_blue')
investigation.append('advance_to_next_trial')
p = p0
# write the sequence of investigation choice of one trial into the csv
with open('simulation results 2.csv','a') as csvfile:
filewriter = csv.writer(csvfile)
filewriter.writerow(investigation)
csvfile.close()
|
055972f2b5cb0fd63f8b0e67f1bcee03950917c2 | bobotan/Python-100-Days | /Day01-15/Day08/demo1.py | 220 | 3.546875 | 4 |
class Stu (object):
def __init__(self,name,age):
self.name=name
self.age=age
def sit(self):
print(self.name)
if __name__=="__main__":
stu=Stu(name='123',age=5)
stu.sit()
|
b8f6614b03593fa4d5eb94d5d983b172f7cbb0f1 | bobotan/Python-100-Days | /Day01-15/Day07/demo.py | 517 | 3.8125 | 4 | # str1='a1b2c3d4e5'
# print(str1[1])
# print(str1[2:5])
# print(str1[2:])
# print(str1.isdigit())
# print(str1.isalpha())
# print(str1.isalnum())
# print(str1[-3:-1])
# print(str1[::-1])
# 列表
# list1=[1,3,5,7,100]
# print(list1)
# list2=['fuck']*5
# print(list2)
# print(list2[2])
# list2.append('you')
# print(list2)
fruits = ['grape', 'apple', 'strawberry', 'waxberry']
fruits += ['pitaya', 'pear', 'mango']
for fruit in fruits:
print(fruit.title(),end=' ')
print()
fruits3=fruits[:]
print(fruits3) |
ea11406cfd4cccb20fa8f1d46bc581816dde3088 | huyngopt1994/network-tool | /bit_Handler/bitreader.py | 1,853 | 3.640625 | 4 | """ Simple bitreader class and some utility functions.
Inspired by http://multimedia.cx/eggs/python-bit-classes
"""
import sys
class BitReadError(ValueError):
pass
class BitReader(object):
"""Read bits from bytestring buffer into unsigned integers."""
def __init__(self, buffer):
self.buffer = buffer
# Set the pos of bit
self.bit_pos = 7
# get the first bytestring to interger value
self.byte = ord(self.buffer[0])
self.index = 1
def get_bits(self, num_bits):
"""Read num_bits from the buffer."""
num = 0
# create a mask to filter per bit for per position
# firstly get the highest bit in byte
mask = 1 << self.bit_pos
if self.byte is None:
return None
while num_bits:
num_bits -=1
num <<= 1
if self.byte & mask:
num |= 1
mask >>= 1
self.bit_pos -= 1
print (self.bit_pos)
if self.bit_pos < 0:
if self.byte is None:
raise BitReadError("Beyond buffer doundary")
self.bit_pos = 7
mask =1 << self.bit_pos
if self.index < len(self.buffer):
self.byte = ord(self.buffer[self.index])
else:
self.byte = None
self.index += 1
print('this is where we need to plus index')
print self.index
return num
if __name__ == '__main__':
buffer = sys.argv[1]
num_bits = sys.argv[2]
bit_object = BitReader(buffer)
print('the first')
num1 = bit_object.get_bits(int(num_bits))
print('the second')
num2 = bit_object.get_bits(int(num_bits))
print('the third')
num3 = bit_object.get_bits(int(num_bits))
|
846ac682c888800252b6562b70f5d88d60151a37 | koendevolder/project-euler | /3/3.py | 636 | 3.578125 | 4 | '''
The prime factors of 13195 are 5, 7, 13 and 29.
What is the largest prime factor of the number 600851475143?
'''
n = 600851475143
i = 2
while n != i:
while n % i == 0:
n = n / i
i = i + 1
print n
'''
def prime_number (var):
for i in range(2, var):
if (var % i == 0):
return False
break
return True
---
initial solution
n = 600851475143
i = 2
while n != i:
if (n % i == 0):
n = n / i
i = 2
i = i + 1
print n
---
internet solution
n = 600851475143
i = 2
while i * i < n:
while n % i == 0:
n = n / i
i = i + 1
print n
''' |
816cfdedf274dbff93b9e23f361b5f690c6852c4 | suprateek-sc19/Caesar-Cipher-in-Python- | /cipher.py | 2,045 | 4 | 4 | import time
# encrypt and decrypt a message using Caesar Cipher
key = 'abcdefghijklmnopqrstuvwxyz'
# Encryption Function
def encrypt(n, plaintext):
"""Encrypt the string and return the ciphertext"""
#Start timer
start = time.time()
result = ''
# Convert all lettes to lowercase
#Substitute every letter
for l in plaintext.lower():
try:
i = (key.index(l) + n) % 26
result += key[i]
except ValueError:
result += l
#Stop timer
end = time.time()
#Calculate run time
run = end - start
print("Encryption took {:.5f} seconds".format(run))
return result.lower()
# Decryption function
def decrypt(n, ciphertext):
"""Decrypt the string and return the plaintext"""
start2 = time.time()
result = ''
for l in ciphertext:
try:
i = (key.index(l) - n) % 26
result += key[i]
except ValueError:
result += l
end2 = time.time()
run2 = end2 - start2
print("Decryption took {:.5f} seconds".format(run2))
return result
# Taking user input
digits=[]
text = input("Please enter the message you want to encrypt \n")
dob = input("Please enter your DOB in the format MM/DD/YYYY \n")
# Adding digits of DOB to use the sum as offset for encryption
digits.append(dob.split("/"))
offset = 0
for num in digits:
for i in num:
i = int(i)
while(i!=0):
offset += i % 10
i = int(i/10)
# Printing both encrypted and decrypted messages
encrypted = encrypt(offset, text)
print('Encrypted:', encrypted)
decrypted = decrypt(offset, encrypted)
print('Decrypted:', decrypted)
# Testing Code
# with open("tests.txt", "r", encoding="utf8") as f:
# data = f.read()
# messages = data.split("---")
# for i,j in zip(messages, range(3,11)):
# encrypted = encrypt(j, i)
# decrypted = decrypt(j, encrypted)
# print(encrypted)
# print(decrypted) |
9b1f3c8d96a19e3da776c3413d4f2239187efa54 | NguyenAnhDuc/pytemp | /src/libs/singleton/__init__.py | 1,309 | 3.75 | 4 | #!/usr/bin/python
# -*- coding: utf8 -*-
""" Author: Ly Tuan Anh
github nick: ongxabeou
mail: lytuananh2003@gmail.com
Date created: 2017/04/28
"""
class Singleton(object):
"""Singleton decorator."""
def __init__(self, cls):
self.__dict__['cls'] = cls
instances = {}
def __call__(self):
if self.cls not in self.instances:
self.instances[self.cls] = self.cls()
return self.instances[self.cls]
def __getattr__(self, attr):
return getattr(self.__dict__['cls'], attr)
def __setattr__(self, attr, value):
return setattr(self.__dict__['cls'], attr, value)
# ------------------Test------------------------
if __name__ == '__main__':
@Singleton
class bar(object):
def __init__(self):
self.val = None
@Singleton
class poo(object):
def __init__(self):
self.val = None
def activated(self, acc_id):
self.val = acc_id
x = bar()
x.val = 'sausage'
print(x, x.val)
y = bar()
y.val = 'eggs'
print(y, y.val)
z = bar()
z.val = 'spam'
print(z, z.val)
print(x is y is z)
x = poo()
x.val = 'sausage'
print(x, x.val)
y = poo()
y.val = 'eggs'
print(y, y.val)
x = poo()
x.activated(123)
print(x.val)
|
9d5b9a3d265ee3741b9f03a236003e6132a7010e | grey-area/avida-clone | /organism.py | 9,206 | 3.515625 | 4 | import random
copy_mutation_rate = 0.0025
birth_insert_mutation_rate = 0.0025
birth_delete_mutation_rate = 0.0025
number_of_instructions = 26
class organism():
def randomColour(self):
self.colour = (random.random(),random.random(),random.random())
# Determine which register to interact with
def register(self):
register = 0
# If the next instruction is a no-op, use it to set the active register and then skip over that no-op
if self.genome[(self.heads[0]+1)%len(self.genome)] < 3:
register = self.genome[(self.heads[0]+1)%len(self.genome)]
self.heads[0] = (self.heads[0]+1)%len(self.genome)
return register
# Instructions. ?A? indicates that A is the default setting, but that this can be changed by following the instruction with no-ops
#0,1,2 No-ops
def nop(self):
pass
#3 Execute the instruction after only if ?AX? doesn't equal its complement
def if_n_eq(self):
position = (self.heads[0]+1)%len(self.genome)
while self.genome[position]<3:
position = (position+1)%len(self.genome)
register = self.register()
if self.registers[register] != self.registers[(register+1)%3]:
position = (position-1)%len(self.genome)
self.heads[0] = position
#4 Execute the next non-nop instruction only if ?AX? is less than its complement
def if_less(self):
position = (self.heads[0]+1)%len(self.genome)
while self.genome[position]<3:
position = (position+1)%len(self.genome)
register = self.register()
if self.registers[register] < self.registers[(register+1)%3]:
position = (position-1)%len(self.genome)
self.heads[0] = position
#5 Remove a number from the current stack and place it in ?AX?
def pop(self):
if len(self.stack) > 0:
self.registers[self.register()] = self.stack.pop()
#6 Copy the value of ?AX? onto the top of the current stack
def push(self):
if len(self.stack) < self.stackLimit:
self.stack.append(self.registers[self.register()])
#7 Toggle the active stack
def swap_stk(self):
temp = self.otherStack
self.otherStack = self.stack
self.stack = temp
#8 Swap the contents of ?AX? with its complement
def swap(self):
register = self.register()
temp = self.registers[register]
self.registers[register] = self.registers[(register+1)%3]
self.registers[(register+1)%3] = temp
#9 Shift all the bits in ?AX? one to the right
def shift_r(self):
self.registers[self.register()] >>= 1
#10 Shift all the bits in ?AX? one to the left
def shift_l(self):
self.registers[self.register()] <<= 1
#11 Increment ?AX?
def inc(self):
self.registers[self.register()] += 1
#12 Decrement ?AX?
def dec(self):
self.registers[self.register()] -= 1
#13 Calculate the sum of AX and BX; put the result in ?AX?
def add(self):
self.registers[self.register()] = self.registers[0] + self.registers[1]
#14 Calculate AX-BX; put the result in ?AX?
def sub(self):
self.registers[self.register()] = self.registers[0] - self.registers[1]
#15 Bitwise NAND on AX and BX, put result in ?AX?
def nand(self):
self.registers[self.register()] = ~(self.registers[0] & self.registers[1])
#16 Output the value ?AX? and replace it with a new input
def IO(self):
register = self.register()
self.output = self.registers[register]
self.registers[register] = self.input
#17 Allocate memory for an offspring
def h_alloc(self):
self.genome += [26] * (self.maxSize - len(self.genome))
#18 Divide off an offspring located between the read-head and write-head.
def h_divide(self):
if self.heads[1] <= self.heads[2]:
self.offspring = self.genome[self.heads[1]:self.heads[2]]
self.genome = self.genome[:self.heads[1]]
else:
self.offspring = self.genome[self.heads[1]:]
self.genome = self.genome[:self.heads[1]]
self.registers = [0,0,0]
self.heads = [len(self.genome)-1,0,0,0]
self.stack = []
self.otherStack = []
self.complementCopied = []
#19 Copy an instruction from the read-head to the write-head and advance both.
def h_copy(self):
toCopy = self.genome[self.heads[1]]
if toCopy < 3:
self.complementCopied.append((toCopy-1)%3)
else:
self.complementCopied = []
# Wrong copy mutation
if random.random() < copy_mutation_rate:
toCopy = random.randint(0,number_of_instructions)
self.genome[self.heads[2]] = toCopy
# Duplicate copy mutation
if random.random() < copy_mutation_rate:
self.heads[2] = (self.heads[2]+1) % len(self.genome)
self.genome[self.heads[2]] = toCopy
self.heads[1] = (self.heads[1]+1) % len(self.genome)
self.heads[2] = (self.heads[2]+1) % len(self.genome)
#20 Find a complement template of the one following and place the flow head after it.
def h_search(self):
complement = []
position = (self.heads[0]+1)%len(self.genome)
self.heads[3] = position
while self.genome[position]<3:
complement.append((self.genome[position]+1)%3)
position = (position+1)%len(self.genome)
# Search for the complement. If we find it, place the flow head after the end of it, otherwise place the flow head immediately after the IP
position = (self.heads[0]+1)%len(self.genome)
while position != self.heads[0]:
test = self.genome[position:position+len(complement)]
end = position+len(complement)
if len(test) < len(complement):
end = len(complement)-len(test)
test += self.genome[:len(complement)-len(test)]
if test==complement: # we found the complement label
self.heads[3] = end%len(self.genome)
break
position = (position+1)%len(self.genome)
#21 Move the ?IP? to the position of the flow-head. (A=IP, B=read, C=write)
def mov_head(self):
register = self.register()
self.heads[register] = self.heads[3]
if register==0:
self.heads[0] = (self.heads[0]-1)%len(self.genome) # Because it's about to be incremented
#22 Move the ?IP? by a fixed amount found in CX
def jmp_head(self):
register = self.register()
self.heads[register] = (self.heads[register] + self.registers[2]) % len(self.genome)
#23 Write the position of the ?IP? into CX (A=IP, B=read, C=write)
def get_head(self):
self.registers[2] = self.heads[self.register()]
#24 The CPU remembers the last contiguous series of no-ops copied by h_copy. Execute the next instruction only if this instruction is followed by the complement of what was last copied
def if_label(self):
followingLabel = []
position = (self.heads[0]+1)%len(self.genome)
while self.genome[position]<3:
followingLabel.append(self.genome[position])
position = (position+1)%len(self.genome)
# If the labels match, put the position back a step (remember, the IP will be incremented immediately after this)
# The result is that the next instruction will be skipped if the labels don't match
if followingLabel == self.complementCopied[len(self.complementCopied)-len(followingLabel):]:
position = (position-1)%len(self.genome)
self.heads[0] = position
#25 Move the flow-head to the memory position specified by ?CX?
def set_flow(self):
self.heads[3] = self.registers[(self.register()+2)%3]%len(self.genome)
def setGenome(self, genome):
self.genome = genome
self.oldGenome = self.genome[:]
def __init__(self):
self.maxSize = 100
self.genome = [] # The program
self.registers = [0,0,0] # The registers
self.stack = [] # The stacks
self.otherStack = []
self.stackLimit = 20
self.heads = [0,0,0,0] # instruction, read, write, flow heads
self.input = 0
self.output = 0
self.complementCopied = []
self.offspring = None
self.colour = (0.0, 0.0, 0.0)
self.age = 0
self.instructions = [self.nop,self.nop,self.nop,self.if_n_eq,self.if_less,self.pop,self.push,self.swap_stk,self.swap,self.shift_r,self.shift_l,self.inc,self.dec,self.add,self.sub,self.nand,self.IO,self.h_alloc,self.h_divide,self.h_copy,self.h_search,self.mov_head,self.jmp_head,self.get_head,self.if_label,self.set_flow,self.nop]
def execute(self, input):
self.input = input
self.offspring = None
if len(self.genome) > 0:
self.instructions[self.genome[self.heads[0]]]() # Execute one instruction
if len(self.genome) > 0:
self.heads[0] = (self.heads[0] + 1) % len(self.genome) # Increment the instruction head
self.age += 1
return self.offspring
|
7ac095090e1bd5c5301b0dd06af883ee02b4a9b5 | marcinszymanski1978/training_Python_Programator | /test3.py | 236 | 3.734375 | 4 | x=9
print("X =",x)
if x<=9:
print("X nie jest większe od",x)
else:
print("X jest większe od",x)
y = "Marcin Szymański"
print(y,len(y))
if len(y)>x:
print("Napis jest dłuższy od",x)
else:
print("Napis nie jest dłuższy od",x) |
202a2c3c9310b7064966c5d7fe953fcd3a9d7c39 | marcinszymanski1978/training_Python_Programator | /while1.py | 225 | 3.84375 | 4 | x=1
for x in range(5):
print(x)
dzien_tygodnia=['poniedzialek','wtorek','sroda','czwartek','piatek','sobota','niedziela']
for x in range(len(dzien_tygodnia)):
print("Dzień tygodnia nr",x+1, "to",dzien_tygodnia[x]) |
955d4bebf2c1c01ac20c697a2bba0809a4b51b46 | patilpyash/practical | /largest_updated.py | 252 | 4.125 | 4 | print("Program To Find Largest No Amont 2 Nos:")
print("*"*75)
a=int(input("Enter The First No:"))
b=int(input("Enter The Second No:"))
if a>b:
print("The Largest No Is",a)
else:
print("The Largest No Is",b)
input("Enter To Continue") |
bdf9ee7ba513a401ed3d6b263cb6ab14f684734e | ObbieOnOblivion/Toyota-Supra-tuning | /toyota_supra_v3.py | 16,680 | 3.734375 | 4 | import random
import time
# import tkinter
import my_function_3
class ToyotaSupraInternals:
""" anything thing that cant be tuned and the features of the car
Attributes:
turbo(str): The name of the turbo
turbo_type(str): The type of the turbo
transmission(str): this shows the general type of the transmission not the exact make or model
gear1_ratio(float): this is the first gear ratio, or the trans ratio
gear2_ratio(float): this is the second gear ratio.
gear3_ratio(float): this is the third gear ratio.
gear4_ratio(float): this is the forth gear ratio.
gear5_ratio(float): this is the fifth gear ratio.
gear6_ratio(float): this is the sixth gear ratio.
dif_type(str): this shows if the differential is either opened or closed not the percentage locked or opened
dif_ratio(float): this is the ratio for the differential
engine_type(str): this is the engine type, in the first case it would be an inline 6
wheel_diameter(int): this shows the diameter of the rear tyres
weight(int): the weight of the car with the modifications
gutted_weight(int): this is the weight that you will lose if you gut the A/C and the interior
"""
"""these are other variable just to keep in mind
these are not important to the program """
DragCoefficient = .320
CurbWeight = 3434
""" drag Coefficient at 90 miles per hour"""
DC90 = 66
def __init__(self):
self.turbo = 'PT8847'
self.turbo_type = 'ball bearing'
self.transmission = 'helical gear drive'
self.gear1_ratio = 3.55
self.gear2_ratio = None
self.gear3_ratio = None
self.gear4_ratio = None
self.gear5_ratio = None
self.gear6_ratio = None
self.dif_type = 'lsd'
self.dif_ratio = 3.909
self.engine_type = 'induction performance 2jz'
self.wheel_diameter = 20
self.weight = 3599
self.gutted_weight = 400
def set_gear_ratio(self, gear, ratio):
if gear == 1:
self.gear1_ratio = ratio
if gear == 2:
self.gear2_ratio = ratio
if gear == 3:
self.gear3_ratio = ratio
if gear == 4:
self.gear4_ratio = ratio
if gear == 5:
self.gear5_ratio = ratio
if gear == 6:
self.gear6_ratio = ratio
def gut_car(self):
"""this method removes weight from the car"""
if self.weight == 3599:
self.weight -= self.gutted_weight
return True
else:
return False
def apply_interior(self):
"""this method puts back the weight that was gutted back on"""
if bool(self.gut_car) and self.weight == 3199:
self.weight += self.gutted_weight
Scotty = ToyotaSupraInternals()
Scotty.set_gear_ratio(1, 3.55)
Scotty.set_gear_ratio(2, 2.09)
Scotty.set_gear_ratio(3, 1.49)
Scotty.set_gear_ratio(4, 1.00)
Scotty.set_gear_ratio(5, .69)
Scotty.set_gear_ratio(6, .58)
class ToyotaSupra(ToyotaSupraInternals):
"""This class will be more concerning with the cars tune not as much the hardware of the car
Attributes:
spring_pressure(int): This is the minimum amount of boost you could to level with your spring
boost_level(int): This is the psi your turbo charger is running
duty_cycle(int): This hows at what percent work is the injectors doing for what its rated for
fuel_pressure(int): This is the pressure of the fuel injectors
timing_degrees(int): This is the amount of timing that is iin the car
max_boost(int): This is the most amount of boost you could give this engine before a bearing spins or rod knock
two_step_RPM(int): This is the RPM the two-step is set at
tyre_type(str): this is the the type of tyre used on the rear wheels
fuel_type(str): This shows the grade and type of fuel used
tsd1(dict): This is a dictionary is for a range of two-step RPMs
"""
def click(self):
"""opens the spring pressure window """
import tkinter as tk
mane = tk.Tk()
mane.geometry('300x300-170-50')
mane.title('spring pressure')
text1 = tk.Text(mane, relief='sunken')
text1.delete(0.0, 6.6)
text1.insert(0.0, self.spring_pressure)
mane.mainloop()
@staticmethod
def what_we_do():
"""this shows a general idea of what goes on in the use_screen method"""
import tkinter as tk
mainwindow = tk.Tk()
mainwindow.geometry('700x300-50-100')
label1 = tk.Label(mainwindow, text='tyres')
label2 = tk.Label(mainwindow, text='boost preasure')
label3 = tk.Label(mainwindow, text='duty cycle')
label4 = tk.Label(mainwindow, text='launch control')
label5 = tk.Label(mainwindow, text='boost by gear')
label6 = tk.Label(mainwindow, text='car details')
label1.config(relief='groove')
label2.config(relief='groove')
label3.config(relief='groove')
label4.config(relief='groove')
label5.config(relief='groove')
label6.config(relief='groove')
label1.grid(column=0, row=0, sticky='nesw')
label2.grid(column=1, row=0, sticky='nesw')
label3.grid(column=2, row=0, sticky='nesw')
label4.grid(column=3, row=0, sticky='nesw')
label5.grid(column=4, row=0, sticky='nesw')
label6.grid(column=5, row=0, sticky='nesw')
mainwindow.columnconfigure(0, weight=4)
mainwindow.columnconfigure(1, weight=4)
mainwindow.columnconfigure(2, weight=4)
mainwindow.columnconfigure(3, weight=4)
mainwindow.columnconfigure(4, weight=4)
mainwindow.columnconfigure(5, weight=4)
mainwindow.rowconfigure(0, weight=4)
mainwindow.mainloop()
@staticmethod
def use_screen():
"""this is the application itself """
def click_20():
my_function_3.click_20() # visit my_function_3.py for documentation
def click_19():
my_function_3.click_19() # visit my_function_3.py for documentation
def click18():
my_function_3.click_18() # visit my_function_3.py for documentation
def click17():
my_function_3.click_17() # visit my_function_3.py for documentation
def click16():
my_function_3.click_16() # visit my_function_3.py for documentation
def click15():
my_function_3.click_15() # visit my_function_3.py for documentation
def click14():
my_function_3.click_14() # visit my_function_3.py for documentation
def click13():
my_function_3.click_13() # visit my_function_3.py for documentation
def click12():
my_function_3.click_12() # visit my_function_3.py for documentation
def click11():
my_function_3.click_11() # visit my_function_3.py for documentation
def click10():
my_function_3.click_10() # visit my_function_3.py for documentation
def click9():
my_function_3.click_9() # visit my_function_3.py for documentation
def click8():
my_function_3.click_8() # visit my_function_3.py for documentation
def click7():
my_function_3.click_7() # visit my_function_3.py for documentation
def click6():
my_function_3.click_6() # visit my_function_3.py for documentation
def click5():
my_function_3.click_5() # visit my_function_3.py for documentation
def click4():
my_function_3.click_4() # visit my_function_3.py for documentation
def click3():
my_function_3.click_3() # visit my_function_3.py for documentation
def click2():
my_function_3.click_2() # visit my_function_3.py for documentation
def click1():
my_function_3.click_1() # visit my_function_3.py for documentation
def click():
my_function_3.click() # visit my_function_3.py for documentation
def kill_switch():
mainwindow.destroy()
import tkinter as tk
mainwindow = tk.Tk()
mainwindow.title("Toyota Supra Tune")
mainwindow.geometry('700x300-50-100')
mainwindow.configure(background='plum')
label1 = tk.Label(mainwindow, text='tyres')
label2 = tk.Label(mainwindow, text='boost pressure')
label3 = tk.Label(mainwindow, text='other')
label4 = tk.Label(mainwindow, text='launch control')
label5 = tk.Label(mainwindow, text='gear info')
label6 = tk.Label(mainwindow, text='car details')
label1.config(relief='groove', bg='purple')
label2.config(relief='groove', bg='purple')
label3.config(relief='groove', bg='purple')
label4.config(relief='groove', bg='purple')
label5.config(relief='groove', bg='purple')
label6.config(relief='groove', bg='purple')
label1.grid(column=0, row=0, sticky='nesw')
label2.grid(column=1, row=0, sticky='nesw')
label3.grid(column=2, row=0, sticky='nesw')
label4.grid(column=3, row=0, sticky='nesw')
label5.grid(column=4, row=0, sticky='nesw')
label6.grid(column=5, row=0, sticky='nesw')
button1 = tk.Button(mainwindow, text="tyre pressures", fg='purple', command=click2)
button2 = tk.Button(mainwindow, text="tyre type", fg='purple', command=click1)
button3 = tk.Button(mainwindow, text="spring pressure", fg='red', command=click)
button4 = tk.Button(mainwindow, text="boost pressure", fg='red', command=click4)
button5 = tk.Button(mainwindow, text="max boost psi", fg='red', command=click3)
button6 = tk.Button(mainwindow, text="duty cycle", fg='yellow', comman=click6)
button7 = tk.Button(mainwindow, text="two-step RPM", fg='orange', command=click7)
button8 = tk.Button(mainwindow, text="gear1", fg='turquoise', command=click9)
button9 = tk.Button(mainwindow, text="gear2", fg='turquoise', command=click10)
button10 = tk.Button(mainwindow, text="gear3", fg='turquoise', command=click11)
button11 = tk.Button(mainwindow, text="gear4", fg='turquoise', command=click12)
button12 = tk.Button(mainwindow, text="gear5", fg='turquoise', command=click13)
button13 = tk.Button(mainwindow, text="gear6", fg='turquoise', command=click14)
button14 = tk.Button(mainwindow, text="fuel information", fg='green', command=click8)
button15 = tk.Button(mainwindow, text="differential", fg='green', command=click15)
button16 = tk.Button(mainwindow, text="Engine", fg='green', command=click16)
button17 = tk.Button(mainwindow, text='car image', fg='green', command=click5)
button18 = tk.Button(mainwindow, text="kill", fg='blue', command=kill_switch)
button19 = tk.Button(mainwindow, text='simulator', fg='magenta', command=click18)
button20 = tk.Button(mainwindow, text='Dyno numbers', fg='crimson', command=click17)
button21 = tk.Button(mainwindow, text='Other Details', fg="lavender", command=click_19)
button22 = tk.Button(mainwindow, text="weight", fg="yellow", command=click_20)
button1.grid(column=0, row=1, sticky='news')
button2.grid(column=0, row=2, sticky='news')
button4.grid(column=1, row=1, sticky='news')
button3.grid(column=1, row=2, sticky='news')
button5.grid(column=1, row=3, sticky='news')
button6.grid(column=2, row=1, sticky='news')
button7.grid(column=3, row=1, sticky='news')
button8.grid(column=4, row=1, sticky='news')
button9.grid(column=4, row=2, sticky='news')
button10.grid(column=4, row=3, sticky='news')
button11.grid(column=4, row=4, sticky='news')
button12.grid(column=4, row=5, sticky='news')
button13.grid(column=4, row=6, sticky='news')
button14.grid(column=5, row=1, sticky='news')
button15.grid(column=5, row=2, sticky='news')
button16.grid(column=5, row=3, sticky='news')
button17.grid(column=5, row=4, sticky='news')
button18.grid(column=2, row=6, sticky='news')
button19.grid(column=1, row=6, sticky='news')
button20.grid(column=5, row=5, sticky='news')
button21.grid(column=0, row=6, sticky='news')
button22.grid(column=2, row=2, sticky='news')
mainwindow.columnconfigure(0, weight=4)
mainwindow.columnconfigure(1, weight=4)
mainwindow.columnconfigure(2, weight=4)
mainwindow.columnconfigure(3, weight=4)
mainwindow.columnconfigure(4, weight=4)
mainwindow.columnconfigure(5, weight=4)
mainwindow.rowconfigure(0, weight=4)
mainwindow.rowconfigure(1, weight=4)
mainwindow.rowconfigure(2, weight=4)
mainwindow.rowconfigure(3, weight=4)
mainwindow.rowconfigure(4, weight=4)
mainwindow.rowconfigure(5, weight=4)
mainwindow.rowconfigure(6, weight=4)
mainwindow.mainloop()
tyre_pressure = 17
def __init__(self):
super(ToyotaSupra, self).__init__()
self.spring_pressure = 5
self.boost_level = int(self.spring_pressure)
self.duty_cycle = 103
self.fuel_pressure = 90
self.timing_degrees = 10
self.max_boost = 55
self.two_step_RPM = 3900
self.tyre_type = "Drag Radials"
self.fuel_type = "89 Octane"
self.tsd1 = {}
def set_max_boost(self, max_boost_pressure):
"""this sets the max boost pressure"""
if self.spring_pressure <= max_boost_pressure <= 60:
self.max_boost = max_boost_pressure
def advance_timing(self):
"""this advances the timing to create more power """
self.timing_degrees = 14
def retard_timing(self):
"""this retards the timing to create less power or less harmful emissions"""
self.timing_degrees = 8
def inc_boost(self, boost):
"""this increases the boost pressures"""
if int(self.spring_pressure) <= self.boost_level <= int(self.max_boost):
self.boost_level += boost
else:
self.boost_level = int(self.spring_pressure) + 1
def change_fuel_type(self, fuel):
"""change the fuel type and the grade of the fuel"""
fuel = str(fuel)
fuel = fuel.strip(' ')
fuel_list = ['93 Octane', 'c16', 'ignite red', '118 Octane', '89 Octane']
while fuel in fuel_list:
for i in range(0, 5):
if fuel in fuel_list[i]:
self.fuel_type = fuel
break
break
def tsd_set1(self):
"""this sets the dictionary tsd1 indexes to dictionaries"""
for i in range(4200, 4501, 100):
dict1 = dict()
dict1["1"] = 1.32 # above 25
dict1["2"] = 1.17 # 22 - 25
dict1["3"] = 1.11 # 19 - 22
dict1["4"] = 1.05 # 17-19
dict1["5"] = 1.00 # 17
dict1["6"] = .98 # 15-17
dict1["7"] = 1.04 # 12-15
dict1["8"] = 1.14 # bellow 12
self.tsd1[i] = dict1
for i in range(4000, 4200, 100):
dict2 = dict()
dict2["1"] = 1.27 # above 25
dict2["2"] = 1.15 # 22 - 25
dict2["3"] = 1.10 # 19 - 22
dict2["4"] = 1.04 # 17-19
dict2["5"] = 1.03 # 17
dict2["6"] = 1.01 # 15-17
dict2["7"] = 1.07 # 12-15
dict2["8"] = 1.24 # bellow 12
self.tsd1[i] = dict2
for i in range(3700, 4000, 100):
dict3 = dict()
dict3["1"] = 1.17 # above 25
dict3["2"] = 1.09 # 22 - 25
dict3["3"] = 1.02 # 19 - 22
dict3["4"] = 1.009 # 17-19
dict3["5"] = 1.07 # 17
dict3["6"] = 1.11 # 15-17
dict3["7"] = 1.21 # 12-15
dict3["8"] = 1.34 # bellow 12
self.tsd1[i] = dict3
for i in range(3500, 3700, 100):
dict4 = dict()
dict4["1"] = 1.21 # above 25
dict4["2"] = 1.17 # 22 - 25
dict4["3"] = 1.11 # 19 - 22
dict4["4"] = 1.09 # 17-19
dict4["5"] = 1.03 # 17
dict4["6"] = 1.11 # 15-17
dict4["7"] = 1.27 # 12-15
dict4["8"] = 1.44 # bellow 12
self.tsd1[i] = dict4
OBBIE = ToyotaSupra()
if __name__ == '__main__':
print(ToyotaSupraInternals.__name__)
|
e6b2537be9801817e078d19cbdf34a047c1c777a | VendiolaRobin/vendiolarobin.github.io | /vendiola.py | 134 | 4.375 | 4 | x = int(input("Enter a number: "))
print(2*x)
if (x % 3) == x:
print("{x} is Even")
else:
print("your number is odd")
|
b87dedfda07df77c95d7a2ed20c1babfaaa1d763 | xmartinbr/Python-Exemples | /Ej2-ProgFuncional.py | 774 | 3.546875 | 4 | #Función de nivel superior
def saludo(idioma):
def saludo_es():
print("Hola")
def saludo_en():
print("Hello")
idioma_func={"es":saludo_es,
"en":saludo_en
}
#Devuelve el nombre de la función a utilizar en fucnión del valor
#del parámetro [idioma] pasado
return idioma_func[idioma]
#saludar hace referencia al nombre de la función [saludo_es]
saludar = saludo("es")
#Al nombre de la función [saludo_es] se le añaden los parentesisis () y
#por lo tanto saludar() = saludo_es()
saludar()
#saludar hace referencia al nombre de la función [saludo_en]
saludar = saludo("en")
#Al nombre de la función [saludo_es] se le añaden los parentesisis () y
#por lo tanto saludar() = saludo_en()
saludar()
|
b77a89b15e672b9508c4437e8b674284dd3326d4 | MinhTamPhan/LearnPythonTheHardWay | /Exercise/Day5.3/point2d.py | 703 | 3.671875 | 4 | class Point2d(object):
"""store 1 point two dim """
def __init__(self, x, y):
self.x = x
self.y = y
"""return point do or don't equal Another point"""
def Equals(self, pointOther):
if self.x == pointOther.x and self.y == pointOther.y:
return True
else:
return False
"""return Decsition Up Dow Left Right from point to another point"""
def Decisions(self, pointOther):
if self.x == pointOther.x and self.y < pointOther.y:
return "D"
elif self.x == pointOther.x and self.y > pointOther.y:
return "U"
elif self.x > pointOther.x and self.y == pointOther.y:
return "L"
elif self.x < pointOther.x and self.y == pointOther.y:
return "R"
else:
return "I don't know" |
9302fbf822224f10935dc423d35b283bf41b2609 | MinhTamPhan/LearnPythonTheHardWay | /Exercise/Day5.3/ex42.py | 1,371 | 4.34375 | 4 | ## Animal is-a object (yes, sort of confusing) look at the extra credit
class Animal(object):
pass
## Dog is-a object
class Dog(Animal):
def __init__(self, name):
## set attribul name = name
self.name = name
## Cat is-a object
class Cat(object):
def __init__(self, name):
## set name of Cat
self.name = name
## Person is-a object
class Person(object):
def __init__(self, name):
## set name of person
self.name = name
## Person has-a pet of some kind
self.pet = None
## Employee is-a object
class Employee(Person):
def __init__(self, name, salary):
## ?? hm what is this strage magic
super(Employee, self).__init__(name)
## set salary = salary
self.salary = salary
## Fish is-a object
class Fish(object):
pass
## Salmon is-a object
class Salmon(Fish):
pass
## Hailibut is-a object
class Hailibut(Fish):
pass
## rover is-a Dog
rover = Dog("Rover")
## satan is-a Cat
satan = Cat("Satan")
## mary is-a Person
mary = Person("Mary")
## mary has-a pet is satan
mary.pet = satan
## frank is-a Employee has-salary is 120000
frank = Employee("Frank", 120000)
## frank has-a pet is rover and it is a Dog
frank.pet = rover
## flipper is-a fish()
flipper = Fish()
## crouse is-a Salmon
crouse = Salmon()
## harry is-a halibut
harry = Hailibut()
print "Name: ", frank.name , "Pet: ",
print frank.pet.name ,"salary: ", frank.salary |
b939c070c0cbdfa664cea3750a0a6805af4c6a10 | Yatin-Singla/InterviewPrep | /Leetcode/RouteBetweenNodes.py | 1,013 | 4.15625 | 4 | # Question: Given a directed graph, design an algorithm to find out whether there is a route between two nodes.
# Explanation
"""
I would like to use BFS instead of DFS as DFS might pigeonhole our search through neighbor's neighbor whereas the target
might the next neighbor
Additionally I'm not using Bi-directional search because I'm not sure if there is a path from target to root,
Worst case scenario efficiency would be the same
"""
# Solution:
from queue import LifoQueue as Queue
def BFS(start, finish) -> bool:
if not start or not finish:
return False
Q = Queue()
# marked is a flag to indicate that the node has already been enqueued
start.marked = True
Q.enqueue(start)
# process all nodes
while not Q.isEmpty():
node = Q.dequeue()
if node == target:
return True
for Neighbor in node.neighbors:
if not Neighbor.marked:
Neighbor.marked = True
Q.enqueue(Neighbor)
return True
|
eba983fe4115fa01d9406bce360a1675b394c1cd | Yatin-Singla/InterviewPrep | /Leetcode/ListDepths.py | 1,351 | 4.0625 | 4 | # Question: Given a binary tree, design an algorithm which creates a linked list of all the nodes at each depth
# (eg if you have a tree with depth D, you'll have D linkedlists)
# Solution
from treeNode import Node
from queue import LifoQueue as Queue
# helper function
def Process(node, level, result):
if level > len(result) - 1:
result.append([node])
else:
result[level].append(node)
return
# BFS implementation
def ListDepths(root: Node):
if not root:
return
Q = Queue()
level, result = 0, []
Q.enqueue((root, level))
while not Q.isEmpty():
node, level = Q.dequeue()
Process(node, level, result)
if node.left:
Q.enqueue((node.left, level + 1))
if node.right:
Q.enqueue((node.right, level + 1))
return result
# DFS helper
"""
Assumption:
value of level would be atmost 1 > len(result)
passing in reference
"""
def DFSHelper(root, level, result):
if not root:
return
if level > len(result) - 1:
result.append([root])
else:
result[level].append(root)
DFSHelper(root.left, level + 1, result)
DFSHelper(root.right, level + 1, result)
return
# DFS
def DFSlistDepth(root: Node):
level, result = 0, []
DFSHelper(root, level, result)
return result
|
e92e09888bff7072f27d3d24313f3d53e37fc7dc | Yatin-Singla/InterviewPrep | /Leetcode/Primes.py | 609 | 4.1875 | 4 | '''
Write a program that takes an integer argument and returns all the rpimes between 1 and that integer.
For example, if hte input is 18, you should return <2,3,5,7,11,13,17>.
'''
from math import sqrt
# Method name Sieve of Eratosthenes
def ComputePrimes(N: int) -> [int]:
# N inclusive
ProbablePrimes = [True] * (N+1)
answer = []
for no in range(2,N+1):
if ProbablePrimes[no] == True:
answer.append(no)
for i in range(no*2, N+1, no):
ProbablePrimes[i] = False
return answer
if __name__ == "__main__":
print(ComputePrimes(100))
|
b9a12d0975be4ef79abf88df0b083da68113e76b | Yatin-Singla/InterviewPrep | /Leetcode/ContainsDuplicate.py | 730 | 4.125 | 4 | # Given an array of integers, find if the array contains any duplicates.
# Your function should return true if any value appears at least twice in the array,
# and it should return false if every element is distinct.
# * Example 1:
# Input: [1,2,3,1]
# Output: true
# * Example 2:
# Input: [1,2,3,4]
# Output: false
# * Example 3:
# Input: [1,1,1,3,3,4,3,2,4,2]
# Output: true
def isDuplicates(nums):
if not nums:
return False
if len(nums) == 1:
return False
unique = set()
for item in nums:
if item not in unique:
unique.add(item)
else:
return True
return False
def containsDuplicate(nums):
return True if len(set(nums)) < len(nums) else False
|
9fa036a40a99cf929410c823c38fec3d9b51b47a | Yatin-Singla/InterviewPrep | /Leetcode/BuyAndSellTwice.py | 913 | 3.734375 | 4 | '''
Write a program that computes the maximum profit that can be made by buying and selling a share at most twice.
The second buy must be made on another date after the first sale.
'''
#returns profit and end index
def BuyAndSell(prices, StartIndex) -> (int, int):
if StartIndex < len(prices):
return (0,-1)
Profit, minPriceSoFar, IndexSell = 0, prices[StartIndex], 0
for index in range(StartIndex, len(princes)):
ProfitToday = prices[index] - minPriceSoFar
if ProfitToday > Profit:
Profit = ProfitToday
IndexSell = index
minPriceSoFar = min(prices[index], minPriceSoFar)
return Profit, IndexSell
def BuyAndSellTwice(prices):
profit, SecondBuy = BuyAndSell(prices, 0)
SecondProfit, _ = BuyAndSell(prices, SecondBuy+1)
return profit+SecondProfit
if __name__ == "__main__":
print(BuyAndSellTwice([12,11,13,9,12,8,14,13,15]))
|
b459e8a597c655f68401d3c8c73a68decfba186e | Yatin-Singla/InterviewPrep | /Leetcode/StringCompression.py | 1,090 | 4.4375 | 4 | '''
Implement a method to perform basic string compression using the counts of repeated characters.
For example, the string aabccccaa would become a2b1c5a3.
If the compressed string would not become smaller than the original string,
you method should return the original string. Assume the string has only uppercase and lowercase letters.
'''
def StringCompression(charString):
counter = 1
result = []
for index in range(1,len(charString)):
if charString[index] == charString[index-1]:
counter += 1
else:
# doubtful if ''.join would work on int type list
result.extend([charString[index-1],str(counter)])
counter = 1
result.extend([charString[-1], str(counter)])
return ''.join(result) if len(result) < len(charString) else charString
# more efficient solution would be where we first estimate the length the length of the compressed string
# rather than forming the string and figuring out which one to return.
if __name__ == "__main__":
print(StringCompression("aabccccaaa"))
|
b2fab79f5aae295192628dd012fbe3717db2625a | Yatin-Singla/InterviewPrep | /Leetcode/Merge Sorted Array.py | 744 | 3.6875 | 4 | class Solution:
def merge(self, nums1: List[int], m: int, nums2: List[int], n: int) -> None:
"""
Do not return anything, modify nums1 in-place instead.
"""
index = 0
begPtr1 = begPtr2 = 0
tempNums1 = nums1[:m]
while begPtr1 < m and begPtr2 < n:
if tempNums1[begPtr1] < nums2[begPtr2]:
nums1[index] = tempNums1[begPtr1]
begPtr1 += 1
else:
nums1[index] = nums2[begPtr2]
begPtr2 += 1
index += 1
if begPtr1 != m:
nums1[index:] = tempNums1[begPtr1:m]
else:
nums1[index:] = nums2[begPtr2:n]
return nums1
|
195d8ee7cab08c68134a01a34c50f22b55e4b620 | lzbgithubcode/Python-Study | /Base/Python使用小结.py | 1,287 | 3.765625 | 4 | #采集一个人的身高、体重、性别、年龄 计算输出体脂率是否正常
#计算BMI
def computeBMI(weight,height):
result = weight/height*height
return result
#计算体质率
def computebodyfatrate(bmi,age,sex):
result = 1.2*bmi + 0.23*age -5.4-10.8*sex
return result
#判断是否正常
def judgeNormal(rate,sex):
if sex == 0: #女
if rate >=0.25 and rate <= 0.28:
print("这位女士您的体脂率正常")
elif rate > 0.28:
print('这位女士您的体脂率偏高')
else:
print('这位女士您的体脂率偏低')
else: #男
if rate >=0.15 and rate <= 0.18:
print("这位男士您的体脂率正常")
elif rate > 0.18:
print('这位男士您的体脂率偏高')
else:
print('这位男士您的体脂率偏低')
while True:
height = float(input("请输入您的身高是(cm):\n"))
height = height/100
weight = float(input('请输入您的体重是(kg):\n'))
age = int(input('请输入您的年龄\n'))
sex = int(input('请输入您的性别(男输入1 女输入0):\n'))
bmi = computeBMI(weight,height)
rate = computebodyfatrate(bmi,age,sex)
judgeNormal(rate,sex)
break |
2e9773b65e90e66a07c5bce018a468ac31a7b3f0 | lzbgithubcode/Python-Study | /Base/元祖操作.py | 783 | 3.84375 | 4 | '1.元祖定义:有序不可变集合'''
# 1.1 元祖的定义
# l = (1,)
# print(type(l))
# tup = 1,2,3,4,'zb'
# print(tup)
# 1.2 列表转化从元祖
# nums = [1,2,3,4,5,6]
# result = tuple(nums)
# print(result,type(result))
'''2.元祖的操作,不可变,没有增删改'''
# 2.1 查询某个元素或者多个元素
# items = (1,2,34,4,5,5,6,7,8,9)
# print(items)
# print(items[2],items[:2:],items[::-1])
# 2.2 获取元祖值
# print(items.count(5)) # 元素的个数
# print(items.index(2)) # 元素对应的索引
# print(len(items),max(items),min(items))
# 2.3 判定 in not in
# print(1 in items)
# 2.4 拼接(乘法 家法)和拆包
#
# item2 = ('a','b','c')
# print(items + item2)
# print(item2 * 2)
#
# a,b = (10,20)
# a,b = (b,a)
# print(a,b)
|
97b89fcea4f35c9d899854eb87aa1999b1f095f2 | JessicaGarson/MachineLearningFridays | /regularExpressions/regex_stepthrough.py | 123 | 3.78125 | 4 | f = open('regex_examples.txt','r')
for line in f.readlines():
enter = input('')
if enter == '':
print(line) |
d2bb5b64aa6bc8751844a356a3501f8c7af0fe55 | WojciechSobierajski/FuelCounter | /FunctionsForFuelCounter.py | 2,915 | 3.8125 | 4 | import tkinter as tk
from datetime import datetime
def displaying_calculated(distance_driven, total_cost, cost_100km, fuel_consumption):
dist=f"You've driven: {distance_driven} km"
print(dist)
trip_cost = f'It cost you: {total_cost} zł'
print(trip_cost)
cost_of_100km = f'100 km cost you: {cost_100km} zł'
print(cost_of_100km)
liters_per_100km= f'Fuel consumption is: {fuel_consumption} l/100 km'
print(liters_per_100km)
def displaying_validation_tk(fuel_consumption):
if fuel_consumption > 10:
score_tk = 'Too fast!'
if fuel_consumption < 10 and fuel_consumption > 5:
score_tk = 'consumption is good!'
if fuel_consumption < 5:
score_tk = 'Wow, very low !'
return score_tk
def displaying_validation_of_style(fuel_consumption):
if fuel_consumption > 10:
score = 'Too fast!'
if fuel_consumption < 10 and fuel_consumption > 5:
score = 'Fuel consumption is good!'
if fuel_consumption < 5:
score = 'Wow, very low !'
print(score)
def displaying_Tkinter(car_distance, distance_driven, total_cost, fuel_consumption, score_tk):
def closing():
root.destroy()
root = tk.Tk()
canvas = tk.Canvas(root, height=300, width=400, bg="dark red")
canvas.pack()
frame = tk.Frame(root, height=100, width=100, bg="brown")
frame.place(relwidth=0.8, relheight=0.8, relx=0.1, rely=0.1)
label = tk.Label(frame, text=(f"You've driven: {distance_driven} km"))
label.place(relx=0.1, rely=0.1)
label = tk.Label(frame, text=(f'It cost you: {total_cost} zl'))
label.place(relx=0.1, rely=0.2)
label = tk.Label(frame, text=(f'Fuel consumption is: {fuel_consumption} l/100km'))
label.place(relx=0.1, rely=0.3)
label = tk.Label(frame, text=(f'Therefore {score_tk}'))
label.place(relx=0.1, rely=0.4)
label = tk.Label(frame, text=(f'Overal car distance: {car_distance} km'))
label.place(relx=0.1, rely=0.5)
button = tk.Button(root, text='Click to continue', command=closing)
button.pack()
root.mainloop()
def filling_excel(sheet, wb, name, current_distance, current_price, distance_driven, total_cost, current_liters, fuel_consumption, cost_100km):
cell = sheet.cell(sheet.max_row + 1, 1)
cell.value = (datetime.date(datetime.now()))
cell = sheet.cell(sheet.max_row, 2)
cell.value = current_distance
cell = sheet.cell(sheet.max_row, 3)
cell.value = current_price
cell = sheet.cell(sheet.max_row, 4)
cell.value = current_liters
cell = sheet.cell(sheet.max_row, 5)
cell.value = distance_driven
cell = sheet.cell(sheet.max_row, 6)
cell.value = total_cost
cell = sheet.cell(sheet.max_row, 7)
cell.value = fuel_consumption
cell = sheet.cell(sheet.max_row, 8)
cell.value = cost_100km
wb.save(f'{name}.xlsx')
|
cf0bb66cb20ad4d58c749bfc362ae8577f843f62 | Indronil-Prince/Artificial-Intelligence-Project | /Utility.py | 494 | 3.609375 | 4 | import copy
def numOfValue(board, value):
return board.count(value)
def InvertedBoard(board):
invertedboard = []
for i in board:
if i == "1":
invertedboard.append("2")
elif i == "2":
invertedboard.append("1")
else:
invertedboard.append("X")
return invertedboard
def generateInvertedBoardList(pos_list):
'''
'''
result = []
for i in pos_list:
result.append(InvertedBoard(i))
return result |
1668f71546bb5de1df2f4ba55a41d4dd76f54853 | heidekrueger/f00b4r-Challenge | /Level 3.1 - b0mb-b4by/solution.py | 2,568 | 3.875 | 4 | def solution(m,f):
"""
Solution to the bomb-baby puzzle. Here, we are given some dynamical update rules,
a pair (m,f) could be succeeded either by (m+f,f) or (m,m+f). Given two numbers
(m,f), we are tasked with finding the shortest path (in generations) to generate
(m,f) from (1,1), or to determine that the outcome is impossible.
The 'real challenge' is finding an efficient implementation, in particular, avoiding
deep recursion stacks and 'skipping' recursion loops that can be determined a-priori to be
unnecessary.
Args:
m, f (str): string represenations of integers.
Returns:
(str): number of generations to generate (m,f) from initial state (1,1) or 'impossible'
Constraints:
m and f should be string represenations of integers below 10^50.
Implementation: We backpropagate through the generation graph until we hit an
edge case for which we can make a definitive decision.
"""
m = int(m)
f = int(f)
# number of accumulated generations
n = 0
## A tail-recursive implementation with constant memory usage
## is easily possible, but unfortunately Python cannot handle/optimize
## tail recursion, and is still limited by maximum recursion depth.
## We'll thus implement tail-recursion implicitly via a loop:
while True:
# The entire generation poset is symmetric,
# so we can reduce the problem to m >= f
# without affecting the output in any way
if m < f:
m, f = f, m
## Base cases:
# Base case 1: Negative or zero inputs? --> impossible
if m<1 or f<1:
return "impossible"
# Base case 2: (m, 1)
# It takes (m-1) generations to generate the tuple (m, 1), i.e.
# when always choosing the transition (m,1) -> (m+1, 1)
if f==1:
return str(n + m-1)
## Recursive case: go down the tree
# (m,f) could have been generated from (m-f, f) or (m, f-m)
# (or their symmetries) but we know that m >= f
# so f-m will be <1 and we can ignore that branch.
# As long as m will remain greater than f after the update,
# we already know that would end up in the recursive case again
# in the next step, so we can directly take multiple steps at
# once in order to avoid unnecessary iterations:
steps = m // f
n += steps
m -= steps * f
|
0d3ba1b8a0884c431f64a996c0b9a5696e5c93fc | foulp/AdventOfCode2019 | /src/Day22.py | 2,648 | 3.53125 | 4 | class Shuffle:
def __init__(self, size_of_deck):
self.deck_size = size_of_deck
@staticmethod
def cut(n):
# f(x) = ax + b % deck_size, with a=1 and b=-n
return 1, -n
@staticmethod
def deal_with_increment(n):
# f(x) = ax + b % deck_size, with a=n and b=0
return n, 0
@staticmethod
def deal_into_new_stack():
# f(x) = ax + b % deck_size, with a=-1 and b=deck_size-1
return -1, -1
def full_shuffle(self, commands):
# With f(x) = a'x + b' % deck_size, and g(x) = ax + b % deck_size
# f(g(x)) = a'ax + (a'b + b') % deck_size
full_a, full_b = 1, 0
for technique in commands:
if technique.startswith('deal with increment'):
aa, bb = self.deal_with_increment(int(technique.split()[-1]))
elif technique.startswith('cut'):
aa, bb = self.cut(int(technique.split()[-1]))
elif technique.startswith('deal into new stack'):
aa, bb = self.deal_into_new_stack()
else:
raise ValueError(f"Did not understand command: {technique}")
full_b = (bb + aa * full_b) % self.deck_size
full_a = (full_a * aa) % self.deck_size
return full_a, full_b
if __name__ == '__main__':
with open('../inputs/Day22_input.txt', 'r') as f:
commands_list = f.read().split('\n')
deck_size = 10007
start_pos = 2019
shuffle = Shuffle(deck_size)
a, b = shuffle.full_shuffle(commands_list)
answer = (a * start_pos + b) % deck_size
print(f"The result of first star is {answer}")
# Solve a*x+b = end_pos [deck_size]
# => a*x = (end_pos-b) [deck_size]
# => x = (end_pos-b) * inv_mod(a, deck_size) [deck_size] if GCD(a, deck_size) == 1
# NB : inv_mod(a, m) is x in range(0, m) such that a*x = 1 [m], exists iff GCD(a, m) = 1
# NB : inv_mod(a, deck_size) = pow(a, deck_size-2, deck_size) valid iff deck_size is prime
assert start_pos == (answer - b) * pow(a, deck_size-2, deck_size) % deck_size
n_turns = 101741582076661
deck_size = 119315717514047
end_pos = 2020
shuffle = Shuffle(deck_size)
a, b = shuffle.full_shuffle(commands_list)
# f^-1(x) = inv_mod(a, deck_size) * (x-b) % deck_size
# f^n(x) = a**n * x + b * (1 + a + a**2 + a**3 + ... + a**(n-1)) % deck_size
a_final = pow(a, n_turns, deck_size)
b_final = b * (pow(a, n_turns, deck_size) - 1) * pow(a-1, deck_size-2, deck_size) % deck_size
answer = (end_pos - b_final) * pow(a_final, deck_size-2, deck_size) % deck_size
print(f"The result of second star is {answer}")
|
74d654a737cd20199860c4a8703663780683cea4 | quanzt/LearnPythons | /src/guessTheNumber.py | 659 | 4.25 | 4 | import random
secretNumber = random.randint(1, 20)
print('I am thinking of a number between 1 and 20.')
#Ask the player to guess 6 times.
for guessesTaken in range(1, 7):
print('Take a guess.')
guess = int(input())
if guess < secretNumber:
print('Your guess is too low')
elif guess > secretNumber:
print('Your guess is too high')
else:
break
if guess == secretNumber:
print(f'Good job. You are correct. The secret number is {str(secretNumber)}')
else:
print('Sorry, your guess is wrong. The secret number is {}'.format(secretNumber))
#
# for i in range(20):
# x = random.randint(1, 3)
# print(x) |
b3e1e98d777d82610e8215a3a44ae6803f3fe502 | fucct/Algorithm-python | /leetcode/leetcode83.py | 594 | 3.5 | 4 | from leetcode.leetcode21 import ListNode
class Solution83:
def deleteDuplicates(self, head: ListNode) -> ListNode:
result = []
while head:
if not result:
result.append(head.val)
head = head.next
continue
if not head.val == result[-1]:
result.append(head.val)
head = head.next
if not result:
return
resultNode = ListNode(result.pop())
while result:
resultNode = ListNode(result.pop(), resultNode)
return resultNode
|
ea076830b85f656b4467da07eac0376eb5f9c1e3 | fucct/Algorithm-python | /leetcode/leetcode9.py | 335 | 3.734375 | 4 | import functools
class Solution9:
def isPalindrome(self, x: int) -> bool:
string = str(x)
split_list = [char for char in string]
reversed_list = split_list[:]
reversed_list.reverse()
return functools.reduce(lambda x, y: x and y, map(lambda p, q: p == q, split_list, reversed_list), True)
|
4e013101f7527171160a6b6d6e17a635557e288e | fucct/Algorithm-python | /leetcode/leetcode2.py | 1,285 | 3.59375 | 4 | from leetcode.leetcode21 import ListNode
class Solution2:
def addTwoNumbers(self, l1: ListNode, l2: ListNode) -> ListNode:
result = []
adder = 0
while l1 and l2:
num = l1.val + l2.val + adder
if num >= 10:
result.append(num-10)
adder = 1
else:
result.append(num)
adder = 0
l1 = l1.next
l2 = l2.next
while l1:
num = l1.val + adder
if num >= 10:
result.append(num - 10)
adder = 1
else:
result.append(num)
adder = 0
l1 = l1.next
while l2:
num = l2.val + adder
if num >= 10:
result.append(num - 10)
adder = 1
else:
result.append(num)
adder = 0
l2 = l2.next
if adder == 1:
result.append(adder)
if not result:
resultNode = ListNode()
return resultNode
num = result.pop()
resultNode = ListNode(num)
while result:
num = result.pop()
resultNode = ListNode(num, resultNode)
return resultNode
|
2377bc9128134917060ce847fba3a7e6a292039c | hungrytech/Practice-code | /DFS and BFS/DFS practice1.py | 533 | 3.578125 | 4 | def dfs(graph, start_node) :
visited, need_visit= list(), list()
need_visit.append(start_node)
while need_visit :
node = need_visit.pop()
if node not in visited :
visited.append(node)
need_visit.extend((graph[node]))
return visited
data=dict()
data['A'] = ['B','C']
data['B'] = ['A','D']
data['C'] = ['A','G','H','I']
data['D'] = ['E','F']
data['E'] = ['D']
data['F'] = ['D']
data['G'] = ['C']
data['H'] = ['C']
data['I'] = ['C','J']
data['J'] = ['I']
print(dfs(data, 'A')) |
a2d8ccafa4d89411f84960155771597179447ea9 | hungrytech/Practice-code | /Sort/firt print low grade.py | 490 | 3.625 | 4 | # 이것이 코딩테스트다 정렬 알고리즘 학습
# 문제를 읽고 직접 짜본 코드이다.
# 알고리즘을 구상하다 모르겠으면 해답을보고 다시 구상해본다.
# 문제: 성적이 낮은 순서로 학생 출력하기
n = int(input())
data=[]
for i in range(n) :
data_input = input().split()
data.append((data_input[0],int(data_input[1])))
result= sorted(data, key=lambda student: student[1])
for student in result :
print(student[0], end=' ') |
915bb8a872505cf0c476815b0045a36842f8687a | hungrytech/Practice-code | /python/UniversityProject2.py | 479 | 3.84375 | 4 | def slice (String) : # ACG로 시작하고 TAT로 종결되는 슬라이싱 함수
start_ACG=String.find('ACG') #ACG가 시작하는 index
start_TAT=String.find('TAT') #TAT가 시작하는 index
slice_String = String[start_ACG:start_TAT+3] #ACG시작하는 index 부터 TAT가 끝나는 index까지 slicing
return slice_String
sequence="TACTAAAACGGCCCTTGGGAACCTATAAAGGCAATATGCAGTAG"
#---------출력---------
print(slice(sequence)) #slicing한 결과값 출력
|
2d9a7d0568cdf890ebf8b3fbbce6de67a8dc3dcb | hungrytech/Practice-code | /BaekJoon/BaekJoon1427myThink.py | 169 | 3.578125 | 4 | n = int(input())
n=str(n)
data=list()
for i in n :
data.append(int(i))
data = sorted(data, reverse=True)
result=""
for i in data :
result+=str(i)
print(result) |
b2e1cce90b9e3b64a5d21e00460b69136fcf3267 | cjakuc/cs-module-project-recursive-sorting | /src/sorting/sorting.py | 3,250 | 4.0625 | 4 | # TO-DO: complete the helper function below to merge 2 sorted arrays
def merge(arrA, arrB):
elements = len(arrA) + len(arrB)
merged_arr = [0] * elements
# Your code here
if len(arrA) == 0:
return list_right
elif len(arrB) == 0:
return list_left
x = 0
y = 0
merged_idx = 0
while merged_idx < elements:
if arrA[x] <= arrB[y]:
merged_arr.append(arrA[x])
x += 1
else:
merged_arr.append(arrB[y])
y += 1
# If we are at the end of one of the lists we can take a shortcut
if y == len(arrB):
# Reached the end of right
# Append the remainder of left and break
merged_arr += arrA[x:]
break
elif x == len(arrA):
# Reached the end of left
# Append the remainder of right and break
merged_arr += arrB[y:]
break
return merged_arr
# TO-DO: implement the Merge Sort function below recursively
def merge_sort(arr):
# Your code here
# if len(arr) > 1:
# return arr
# else:
# middle = len(arr)//2
# left = arr[:middle]
# right = arr[middle:]
# return merge(mere_sort(left), merge_sort(right))
# return arr
if len(arr) > 1:
middle = len(arr)//2
left = arr[:middle]
right = arr[middle:]
merge_sort(left)
merge_sort(right)
# arr = merge(left, right)
x = 0
y = 0
merged_idx = 0
while x < len(left) and y < len(right):
if left[x] < right[y]:
arr[merged_idx] = left[x]
x += 1
else:
arr[merged_idx] = right[y]
y += 1
merged_idx += 1
while x < len(left):
arr[merged_idx] = left[x]
x += 1
merged_idx += 1
while y < len(right):
arr[merged_idx] = right[y]
y += 1
merged_idx += 1
return arr
# STRETCH: implement the recursive logic for merge sort in a way that doesn't
# utilize any extra memory
# In other words, your implementation should not allocate any additional lists
# or data structures; it can only re-use the memory it was given as input
# def merge_in_place(arr, start, mid, end):
# # Your code here
# def merge_sort_in_place(arr, l, r):
# if len(arr) > 1:
# middle = len(arr)//2
# left = arr[:middle]
# right = arr[middle:]
# merge_sort(left)
# merge_sort(right)
# # arr = merge(left, right)
# x = 0
# y = 0
# merged_idx = 0
# while x < len(left) and y < len(right):
# if left[x] < right[y]:
# arr[merged_idx] = left[x]
# x += 1
# else:
# arr[merged_idx] = right[y]
# y += 1
# merged_idx += 1
# while x < len(left):
# arr[merged_idx] = left[x]
# x += 1
# merged_idx += 1
# while y < len(right):
# arr[merged_idx] = right[y]
# y += 1
# merged_idx += 1
# return arr
|
9689376936022dc428cb1f59960ee7d920e1d031 | Great-special/sales-analysis_2 | /Data-Insight/sales_analysis.py | 7,985 | 4.1875 | 4 | import pandas as pd
import matplotlib.pyplot as plt
####### Loading Data/File #######
d_f = pd.read_csv('10000 sales records.csv')
#print(d_f.head(10))
## Getting the headers
headers = d_f.columns
# print(headers)
# print(d_f.describe())
####### Working with the loaded Data #######
## Q1: Which columns(Country) has the highest(most) sales
"""
To get the highest sales you need to multiply
the quantity with the price per unit
"""
country_HighestSales = d_f.groupby('Country').max()[['Units Sold']]
#print(country_HighestSales)
country_HighestSales.to_excel('Countries with their sales.xlsx')
## Getting the country with highest Cost Price
totalCP = d_f['Total Cost'].max()
countryTCP = d_f.loc[d_f['Total Cost'] == totalCP]
#print(countryTCP)
## Q2: Which columns(Month) has the highest sales
"""
To get the Month with the highest sales you need
to get the months and sum up each month
"""
## Adding the month column and Getting the highest sales
"""Converting the column to datetime format and adding Month column"""
d_f['Ship Date'] = pd.to_datetime(d_f['Ship Date'])
d_f['Order Date'] = pd.to_datetime(d_f['Order Date'])
d_f['Month'] = d_f['Order Date'].dt.strftime('%m')
d_f['Year'] = d_f['Order Date'].dt.strftime('%Y')
#print(d_f.head(10))
#print(d_f.iloc[0])
#print(d_f.iloc[2])
"The (groupby()) method/function is used to sort by a column"
month_HighestSales = d_f.groupby('Month').sum()[['Units Sold', 'Total Cost', 'Total Revenue', 'Total Profit']]
#print(month_HighestSales)
#month_HighestSales.to_csv('Months and their sales.csv')
## Q3: What is the most effective sales channel
"""
Find the channel with highest number of sales
To get the most effective sales channel you have to groupby the sales channel column
"""
no_of_time_online = len(d_f[d_f['Sales Channel'] == 'Online'])
no_of_time_offline = len(d_f[d_f['Sales Channel'] == 'Offline'])
#print(f'Len of online = {no_of_time_online} \n len of offline = {no_of_time_offline}')
sale_cha = d_f.groupby('Sales Channel').sum()[['Units Sold', 'Total Cost', 'Total Revenue', 'Total Profit']]
sale_cha['Total Count'] = [no_of_time_offline, no_of_time_online]
#print(sale_cha)
#sale_cha.to_csv('Most effective sales channel.csv')
## Q4: Which product is the most sold
"""
Find the product with highest number of sales
To get the most sold product, you have to groupby the product column
"""
item_sale = d_f.groupby('Item Type').sum()[['Units Sold', 'Total Cost', 'Total Revenue', 'Total Profit']]
product_most = item_sale.loc[item_sale['Units Sold'] == item_sale['Units Sold'].max()]
#print(product_most)
#item_sale.to_excel('Items and Sales.xlsx')
## Q5: Which country and region buys the most sold product
"""
Find and get the most sold product
To get the country and region, you have to locate and stort by the coutry, region column
Created a new dataframe and made a group from it
"""
""" To get product name, we need to filter by units sold, then get the index of the row and item(product)"""
max_unit = item_sale.loc[item_sale['Units Sold'] == item_sale.iloc[9][0]]
#print(max_unit)
country_item_sale = d_f[d_f['Item Type'] == 'Personal Care'][['Region', 'Country', 'Units Sold', 'Total Cost', 'Total Revenue', 'Total Profit']]
#print(country_item_sale)
p_care = country_item_sale.groupby(['Country', 'Region']).sum()[['Units Sold', 'Total Cost', 'Total Revenue', 'Total Profit']]
# print(p_care)
p_care_limit = p_care.loc[p_care ['Units Sold'] >= 30000]
# print(p_care_limit)
#p_care.to_excel('Countries & regions that buys the most sold product.xlsx')
## Q6: Which country has the highest cost price
country_TCP = country_item_sale.groupby('Country').sum()[['Total Cost']]
#print(country_TCP)
#country_TCP.to_excel('Country and cost price.xlsx')
## Q7 & 8: Which columns(Country)/ (product) has the highest profit 32454798.26
HighestProfit_country = d_f.groupby('Country').sum()[['Total Profit']]
limit_ = HighestProfit_country['Total Profit'].max() - 10000000
top_countryProfit = HighestProfit_country.loc[HighestProfit_country['Total Profit'] >= limit_ ]
#HighestProfit_country.to_excel('country, product and profit.xlsx')
HighestProfit_item = d_f.groupby('Item Type').sum()[['Total Profit']]
#print(HighestProfit_item)
#HighestProfit_item.to_excel('Product and profit.xlsx')
## Q9: Which columns(Month) has the highest sales
year_sale = d_f.groupby(['Year']).sum()[['Units Sold', 'Total Profit']]
#print(year_sale)
#year_sale.to_excel('yearly sales.xlsx')
## Q10: Which Products were sold together
ordered_together = d_f[d_f['Order ID'].duplicated(keep=False)]
print(ordered_together)
### Visualization Of Data ###
plt.style.use('seaborn')
## V1: Which columns(Country) has the highest(most) sales
# countries = [country for country, df in d_f.groupby('Country')]
# plt.bar(countries, country_HighestSales['Units Sold'])
# plt.xticks(countries, rotation='vertical', size=8)
# plt.xlabel('Countries')
# plt.ylabel('Unit Sold')
# plt.show()
# ## V2: Which columns(Month) has the highest sales
# months = range(1,13)
# plt.bar(months, month_HighestSales['Units Sold'])
# plt.xticks(months)
# plt.xlabel('Month')
# plt.ylabel('Unit Sold')
# plt.show()
## V3: What is the most effective sales channel
" In bar; (X-axis, Y-axis)"
# chan = ['Offline', 'Online']
# plt.bar(chan, sale_cha['Units Sold'])
# plt.xticks(chan)
# plt.xlabel('Sales Channel')
# plt.ylabel('Unit Sold')
# plt.show()
## V4: Which product is the most sold
# items = [item for item, df in d_f.groupby('Item Type')]
# plt.bar(items, item_sale['Units Sold'])
# plt.xticks(items, rotation='vertical', size=8)
# plt.title('Most Sold Product')
# plt.xlabel('Items')
# plt.ylabel('Units Sold')
# plt.grid(True, color='black')
# plt.show()
## V5: Which country and region buys the most sold product
# countryItemSale = [con for con, df in p_care_limit.groupby('Country')]
# plt.bar(countryItemSale, p_care_limit['Units Sold'])
# plt.xticks(countryItemSale, rotation='vertical', size=8)
# plt.title('Some Countries that buys the most sold product')
# plt.xlabel('Country')
# plt.ylabel('Units Brought')
# plt.grid(True, color='black')
# plt.show()
## V6: Which country has the highest cost price
# countryItemSale = [con for con, df in office_sup_TCP.groupby('Country')]
# plt.bar(countryItemSale, office_sup_TCP['Total Cost Price'])
# plt.xticks(countryItemSale, rotation='vertical', size=8)
# plt.xlabel('Country')
# plt.ylabel('Total Cost Price', rotation='vertical')
# plt.show()
## V7: Which country has the highest profit
# count_pro = [con for con, df in top_countryProfit.groupby('Country')]
# plt.bar(count_pro, top_countryProfit['Total Profit'])
# plt.xticks(count_pro, rotation='vertical', size=8)
# plt.title('Country And Profit')
# plt.xlabel('Country')
# plt.ylabel('Total Profit', rotation='vertical')
# plt.grid(True, color='Black')
# plt.show()
## V8: Which item has the highest profit
# _profit = [pro for pro, df in HighestProfit_item.groupby('Item Type')]
# plt.bar(_profit, HighestProfit_item['Total Profit'])
# plt.xticks(_profit, rotation='vertical', size=8)
# plt.title('Products and profit')
# plt.xlabel('Product')
# plt.ylabel('Profit', rotation='vertical')
# plt.grid(True, color='black')
# plt.show()
## V9: Which columns(Month) has the highest sales
# year_ = [year for year, df in d_f.groupby('Year')]
# fig, ax1 = plt.subplots()
# ax1.bar(year_, year_sale['Units Sold'], label='Units Sold')
# ax2 = ax1.twinx()
# ax2.plot(year_, year_sale['Total Profit'],label='Profit', color='red')
#plt.xticks(HighestProfit_item['Unit Cost'], rotation='vertical', size=8)
# ax1.set_title('Year, Sales And Profit')
# ax1.tick_params(axis='y', rotation='auto', labelcolor='blue')
# ax1.set_ylabel('Units Sold', color='blue')
# ax2.tick_params(axis='y', rotation='auto', labelcolor='red')
# ax2.set_ylabel('Profit', color='red')
# ax1.set_xlabel('Year')
# plt.grid(False)
# plt.show()
## V10: Which Products were sold together |
2cc359c82b856fe75eed2906e36f9fa18f6de8cc | BarbaraRafal/SDA_exercises | /testowanie_tdd/home_work/home_work_jadwiga.py | 1,875 | 3.734375 | 4 | from datetime import datetime
from typing import Tuple
class Book:
ALLOWED_GENRES: Tuple = (
"Fantasy",
"Science Fiction",
"Thriller",
"Historical",
"Romance",
"Horror",
)
def __init__(self, title: str, author: str, book_genre: str) -> None:
self.title = self.validate_title(title)
self.author = author
self.book_genre = self.validate_genre(book_genre)
def validate_title(self, title: str) -> str:
if not isinstance(title, str) or title == "":
raise ValueError("Title is incorrect!")
return title
def validate_genre(self, genre: str) -> str:
if genre not in self.ALLOWED_GENRES:
raise ValueError(f"Genre:{genre} is incorrect")
return genre
def __repr__(self) -> str:
return self.title
class Author:
def __init__(self, name: str, year_of_birth: int) -> None:
self._name = name
self._year_of_birth = year_of_birth
self._book_list = []
def add_book(self, title: str, book_genre: str) -> None:
self._book_list.append(self._create_book(title, book_genre))
def _create_book(self, title: str, book_genre: str) -> Book:
return Book(title, self._name, book_genre)
@property
def age(self):
author_age = datetime.now().year - self._year_of_birth
return author_age
@property
def name(self):
return self._name
@property
def book_list(self):
return self._book_list
# def get_content_from_google(self):
# """This method is used to help understanding mocks"""
# content = requests.get("https://www.google.com")
# # print(content.text)
# return content.status_code
author1 = Author("Jan Kowalski", 1985)
author1.add_book("Tytuł", "Fantasy")
# author1.get_content_from_google()
|
587d31d1aa464c529e14659857ff52d4629e5700 | BarbaraRafal/SDA_exercises | /testowanie_tdd/tdd_day1/account.py | 479 | 3.5 | 4 | class Account:
def __init__(self, balance_amount: float, user_status: str) -> None:
self.balance_amount = balance_amount
self.user_status = user_status
def transfer(self, amount_of_money: float) -> float:
try:
self.balance_amount += amount_of_money
except TypeError:
print(f"{amount_of_money} is not a float!")
return self.balance_amount
def balance(self) -> float:
return self.balance_amount
|
0a5d7f42c11be6f4fb2f9ede8340876192080d8d | Dana-Georgescu/python_challenges | /diagonal_difference.py | 631 | 4.25 | 4 | #!/bin/python3
''' Challenge from https://www.hackerrank.com/challenges/diagonal-difference/problem?h_r=internal-search'''
#
# Complete the 'diagonalDifference' function below.
#
# The function is expected to return an INTEGER.
# The function accepts 2D_INTEGER_ARRAY arr as parameter.
#
def diagonalDifference():
arr = []
diagonal1 = diagonal2 = 0
n = int(input().strip())
for s in range(n):
arr.append(list(map(int, input().rstrip().split())))
for i in range(n):
diagonal1 += arr[i][i]
diagonal2 += arr[i][-(i+1)]
return abs(diagonal1 - diagonal2)
print(diagonalDifference())
|
9ae095de08c2cf599b1d731858f3cb0ab5e5be11 | pedro-espinosa/matching_pennies | /stimuli.py | 1,285 | 3.75 | 4 | #!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""
Module containing functions for generating visual stimuli
"""
import os
#%% Welcome, instructions and first choice
welcome_text = """
Welcome! In this experiment you will play a game of 'Matching Pennies' against a computer.
Each player has a coin. Every round, the players decide which side of their coin to show.
If both coins have the same side up, you get a point. If the coins have different
sides up the computer gets a point.
Press space bar to continue.
"""
instructions_text = """
Instructions:
Press 'H' to choose Heads
Press 'T' to choose Tails
Press 'Q' at any time to quit
Now, press the space bar to start.
"""
choice_text = """
Heads or Tails?
(Q to quit)
"""
#%% Score text
score_text = "{} - {}\n spacebar to continue"
#%% filepaths for outcome images
f_hh = os.path.join('images', 'hh.jpg')
f_tt = os.path.join('images', 'tt.jpg')
f_ht = os.path.join('images', 'ht.jpg')
f_th = os.path.join('images', 'th.jpg')
#%% Final score screen
#This stimulus is in main.py under '#%% Final score screen' (for simplicity)
#%% Summary printout for experimenter to see in the console when trial is over
#This text runs in resultsPrintout() function in the class Data found in the strategy_functions module.
|
0d38d3e0de7b6950364dff49b4592cd629e26408 | lukejpie/Machine-Learning-Final-Project | /project-lpietra1/run_logistic_regression.py | 4,516 | 3.6875 | 4 | """
Run Logistic Regression:
Author: Luke Pietrantonio
Created: 5/7/19
Description: Transforming the linear regression problem into a logistic problem by
having "high" and low days, as opposed to linear regression
"""
import math as m
import matplotlib.pyplot as plt
import numpy as np
from utils import *
from dataset import Dataset
from sklearn import utils
from sklearn.linear_model import LogisticRegression
from sklearn.metrics import mean_squared_error
def create_regressions(num_regr):
"""
Description: Creates all of instances of the regressions that we need
Params: Number of regressions
Returns: List of instantiated regressions
"""
regrs = []
for i in range(num_regr):
regrs.append(LogisticRegression(solver='lbfgs',max_iter=500))
return regrs
def train_regressions(regrs,X_train,y_train):
"""
Description: Trains all of the regressions with each of the corresponding datasets
Params: regrs-List of instantiated regressions, X_train-List of X_train datasets,
y_train-List of y_train datasets
Returns: Fitted regressions
"""
i = 0
for regr in regrs:
regr.fit(X_train[i],y_train[i])
i += 1
#print('reg done')
return regrs
def predict(regrs,X_test):
"""
Description: Performs predictions for each regression on its appropriate test dataset
Params: regrs-List of trained regressions, X_test-List of X_test datasets
Returns: y_preds-List of list of predictions of y values from X_test
"""
y_preds = []
i = 0
for regr in regrs:
y_preds.append(regr.predict(X_test[i]))
i += 1
#print('pred done')
return y_preds
def score(regrs,X_test,y_test):
"""
Description: Returns the Scores of each regression
Params: X_test, y_test
Returns: List of scores
"""
scores = []
i=0
for regr in regrs:
scores.append(regr.score(X_test[i],y_test[i]))
i+=1
return scores
def linToLog(y):
"""
Description: Reclassifies linear output as high or low
Params: y-All of the y values from the dataset
Returns: Classified y values
"""
mid = y.median()
y[y<=mid] = 0
y[y> mid] = 1
return y
def featureimportances(X_train,regrs):
"""
Description: Averages all of the feature importances across all of the models
Params: regrs-List of all of the models
Returns: List of averaged feature importances
"""
numFeatures = X_train[0].shape[1]
fi = np.zeros(numFeatures)
for i in range(len(regrs)):
fiT = regrs[i].coef_.flatten()
fiT = X_train[i].std(0)*fiT
fi = np.add(fi,fiT)
fi = fi/len(regrs)
return fi
def plotFI(featureimportances):
objects = ('season','mnth','hr','holiday','weekday','workingday','weathersit','temp','atemp','hum','windspeed')
y_pos = np.arange(len(objects))
plt.bar(y_pos, featureimportances, align='center', alpha=0.5)
plt.xticks(y_pos, objects)
plt.ylabel('Importance')
plt.title('Feature Importance Over All Models')
plt.show()
def main():
divisions = 500
ds = Dataset()
ds.load("Bike-Sharing-Dataset/hour.csv")
size = ds.get_size()
X = []
y =[]
percentages = []
#Full X and y from dataset
all_X = ds.get_x()
all_y = ds.get_y()
print(all_y.median())
#Transforms linear classifications into classifications
all_y = linToLog(all_y)
#Shuffle data and split into divisons
for i in range(1,divisions+1):
percentage = (1/divisions * i)
percentages.append(percentage)
all_X,all_y = utils.shuffle(all_X,all_y)
X.append(all_X[:int(size*percentage)])
y.append(all_y[:int(size*percentage)])
#Splits training and testing data
X_train, X_test, y_train, y_test = split(X,y)
#Create List of Regressions
regrs = create_regressions(divisions)
#Train all regressions
regrs = train_regressions(regrs,X_train,y_train)
#Perform Predictions
#y_pred = predict(regrs,X_test)
# Calculate Scores from the Models
scores = score(regrs,X_test,y_test)
print('Scores:')
print(scores)
print('mean')
print(y_test[0].mean(axis=0))
# print(regrs[0].coef_)
plt.scatter(percentages,scores)
plt.ylabel('Score')
plt.xlabel('Percentage of Original Dataset')
plt.title('Percentage of Original Dataset vs Score')
plt.show()
fi = featureimportances(X_train,regrs)
plotFI(fi)
if __name__ == '__main__':
main()
|
fec59c99e4a986c3d9a09abb51e8485cc2dc739f | NIHanifah/phyton-prak9 | /nomor4.py | 399 | 3.90625 | 4 | #mengacak huruf pada kata
#menggunakan shuffle
import random
import collections
#membuat susunan huruf yang berbeda
def shuffleString(x, n):
kata = list(x)
listKata = []
k = 0
while k < n:
random.shuffle(kata)
hasil = ''.join(kata)
if hasil not in listKata:
listKata.append(hasil)
k += 1
print(listKata)
shuffleString('aku', 3) |
b25933e9e0414b96f98c600606aebcfc1e7e8d73 | chaemoong/SmartDelivery | /utils/module.py | 1,682 | 3.546875 | 4 | """
위 모듈은 개발자 뭉개구름이 제작하였으며 무단으로 사용할 경우 라이선스 위반에 해당됩니다.
"""
import json
class Module():
def __init__(self):
self.module = 'JSON 모듈입니다!'
def save(self, filename, data):
print(f'[JSON MODULE] [작업시도] {filename} 파일을 저장중입니다...')
with open(filename, encoding='utf-8', mode='w') as f:
json.dump(data, f, sort_keys=True,
separators=(',',' : '), ensure_ascii=False)
print(f'[JSON MODULE] [Success] {filename} 파일을 성공적으로 저장하였습니다!')
return data
def open(self, filename):
print(f'[JSON MODULE] [작업시도] {filename} 파일을 여는중입니다...')
with open(filename, encoding='utf-8', mode='r') as f:
data = json.load(f)
print(f'[JSON MODULE] [Success] {filename} 파일을 성공적으로 열었습니다!')
return data
def is_vaild(self, filename):
print(f'[JSON MODULE] [작업시도] {filename} 파일이 있는지 확인하는중입니다...')
try:
self.open(filename)
print(f'[JSON MODULE] [Success] {filename} 파일이 정상적으로 감지되었습니다!')
return True
except FileNotFoundError:
print(f'[JSON MODULE] [Failed] {filename} 파일이 정상적으로 감지하지 못했습니다...')
return False
except json.decoder.JSONDecodeError:
print(f'[JSON MODULE] [Failed] {filename} 파일이 정상적으로 감지하지 못했습니다...')
return False |
537eb97c8fa707e1aee1881d95b2bf497123fd67 | jeffsilverm/big_O_notation | /time_linear_searches.py | 2,520 | 4.25 | 4 | #! /usr/bin/env python
#
# This program times various search algorithms
# N, where N is the size of a list of strings to be sorted. The key to the corpus
# is the position of the value to be searched for in the list.
# N is passed as an argument on the command line.
import linear_search
import random
import sys
corpus = []
value_sought_idx = -1
def random_string( length ):
"""This function returns a random ASCII string of length length"""
s = ''
for i in range(length ):
# Generate a random printable ASCII character. This assumes that space is a
# printable character, if you don't like that, then use ! )
s = s + ( chr( random.randint(ord(' '), ord('~') ) ) )
return str( s )
def create_corpus(N):
"""This function returns a corpus to search in. It generates a sorted list
of values which are random strings. It then sorts the list. Once the corpus
is created, it gets saved as a global variable so that it will persist"""
global corpus
global value_sought_idx
for i in range(N):
corpus.append( random_string(6))
# corpus.sort() # linear search does not need the corpus to be sorted
value_sought_idx = random.randint(0,N-1)
return
def call_linear_search(value_sought):
"""Call the iterative version of the binary search"""
# We need to do make a subroutine call in the scope of time_searches so we can
# pass the global variable corpus. corpus is out of scope of the actual
# binary search routine, so we have to pass it (it gets passed by reference,
# which is fast)
linear_search.linear_search(corpus, value_sought)
N = int(sys.argv[1])
create_corpus(N)
if __name__ == '__main__':
import timeit
number = 100 # number of iterations
tq = '"""' # Need to insert a triple quote into a string
value_sought = corpus[value_sought_idx]
# This is a little pythonic trickery. The input to the timeit.timeit method is
# a snippet of code, which gets executed number of times. In order to
# parameterize the code, use string substitution, the % operator, to modify the
# string. Note that this code has to import itself in order to get the
# subroutines in scope.
linear_call_str = "time_linear_searches.call_linear_search( " + \
tq + value_sought + tq + ")"
linear_time = timeit.timeit(linear_call_str, \
setup="import time_linear_searches", number=number)
print "linear search: %.2e" % linear_time
|
abbb02f14ecbea14004de28fc5d5daddf65bb63e | jeffsilverm/big_O_notation | /iterative_binary_search.py | 1,292 | 4.1875 | 4 | #! /usr/bin/env python
#
# This program is an implementation of an iterative binary search
#
# Algorithm from http://rosettacode.org/wiki/Binary_search#Python
def iterative_binary_search(corpus, value_sought) :
"""Search for value_sought in corpus corpus"""
# Note that because Python is a loosely typed language, we generally don't
# care about the datatype of the corpus
low = 0
high = len(corpus)-1
while low <= high:
mid = (low+high)//2
if corpus[mid] > value_sought: high = mid-1
elif corpus[mid] < value_sought: low = mid+1
else: return mid # Return the index where the value was found.
return -1 # indicate value not found
if "__main__" == __name__ :
import time_searches # We need this to create the corpus and value_sought
value_sought = time_searches.corpus[time_searches.value_sought_idx]
print "The value sought is %s" % value_sought
print "The size of the corpus is %d" % len ( time_searches.corpus )
answer_idx = iterative_binary_search(time_searches.corpus, value_sought)
print "The answer is at %d and is %s" % ( answer_idx,
time_searches.corpus[answer_idx] )
print "The correct answer is %d" % time_searches.value_sought_idx
|
2b0a86e5ff0a45d03c215f3a164b2e9882613c55 | alklasil/SScript | /SScriptCompiler/src/common.py | 215 | 3.671875 | 4 | def flattenList(l):
l_flattened = []
for item in l:
if type(item) is list:
l_flattened.extend(flattenList(item))
else:
l_flattened.append(item)
return l_flattened
|
8f623a197814365cb7aa43bd2bce8f6dace96e4a | DerrickKnighton/Min-Sum-Partition | /minsumpartition.py | 3,589 | 3.671875 | 4 | # -*- coding: utf-8 -*-
"""
Created on Fri Nov 15 17:09:14 2019
@author: Derrick
Found this problem online for interview prep and it didnt
seem too bad so i gave it a try didnt take super long
"""
class Min_Sum_Partition():
import numpy as np
def create_Random_Array(self,range_Of_Ints,size_Of_Arr):
#creates random array
#range_Of_Ints is [0,num you chose)
arr = np.random.randint(range_Of_Ints, size=size_Of_Arr)
return arr
def Partition(self,arr):
#split array into 2 sub arrays such that the summation of he 2 is minimized
#Algo idea find max in the input array add it to ont of the arrays such that
#the difference of the summation of the arrays is smaller than if you added it to the other
#if the difference of them is the same add to array 2 it doesnt really mater what one you add it to
#continue until arr is size 0
sub_arr_one = np.ndarray([0])
sub_arr_two = np.ndarray([0])
#this algo works with only posiive numbers to init max to negative
max = np.argmax(arr)
num_to_add = -1000
sum1 = 0
sum2 = 0
while arr[max] != 0:
print(arr)
print(arr[max])
#####################################################
#if statements take max in arr add to one sub_arr delete the max element in
#arr and change the bool so next max is added to other sub arr
#let it be known it is completely unesscessary to add these vals to arrays
#this could be accomplished more efficiently by just summing the values
#immediately and that would take up less space i just wanted to
#do it his way to show the arrays so you can see where the values ended up
sum1_Try = sum1 + int(arr[max])
sum2_Try = sum2 + int(arr[max])
if abs(sum1_Try - sum2) < abs(sum2_Try - sum1):
num_to_add = arr[max]
sub_arr_one = np.append(sub_arr_one,[num_to_add])
sum1 += arr[max]
arr[max] = 0
elif abs(sum1_Try - sum2) > abs(sum2_Try - sum1):
num_to_add = arr[max]
sub_arr_two = np.append(sub_arr_two,[num_to_add])
sum2 += arr[max]
arr[max] = 0
elif abs(sum1_Try - sum2) == abs(sum2_Try - sum1):
num_to_add = arr[max]
sub_arr_two = np.append(sub_arr_two,[num_to_add])
sum2 += arr[max]
arr[max] = 0
max = np.argmax(arr)
#####################################################
return sub_arr_one, sub_arr_two
def Min_Sum(self,sub_arr_one, sub_arr_two):
##########################################################
#sum sub arrs and take difference
sum1 = np.sum(sub_arr_one)
sum2 = np.sum(sub_arr_two)
print(sum1,sum2)
final_Answer = np.abs(sum1 - sum2)
##########################################################
return(final_Answer)
if __name__ == "__main__":
run = Min_Sum_Partition()
arr = run.create_Random_Array(1000,100)
arr2 = [1,1,3,4,7]
sub_arr_one, sub_arr_two = run.Partition(arr)
print(run.Min_Sum(sub_arr_one,sub_arr_two))
|
ecc686dc19b4bdf92585421e6bb161e8e6b59dd8 | chrisxwan/codeboola-game | /scaffold.py | 4,382 | 3.609375 | 4 | import random
class Player(object):
max_hp = 100
current_hp = 100
# Check if the player is still alive
# by ensuring that his current hp is greater than 0
def is_alive(self):
# Fill this in!
# Return True or False depending on whether the Player's
# attack was successful
def successful_attack(self):
# Fill this in!
# Heal the Player, if his health is not full already
def rest(self):
# Fill this in!
# The player has been damaged! Decrease the Player's
# current health by the appropriate amount
def damage(self, dmg):
# Fill this in!
def print_current_health(self):
print("You currently have " + str(self.current_hp) + " health.")
def info(self):
print("You are " + self.name + " the " + self.player + "!")
print("You attack with " + str(self.accuracy * 100) + "% accuracy.")
print("Your successful attacks deal " + str(self.attack) + " damage.")
print("Every time you heal yourself, you heal " + str(self.heal) + " health")
def kill(self):
self.max_hp = 0
class Archer(Player):
# input the appropriate attributes for the Archer
def __init__(self, name):
# Fill this in!
class Swordsman(Player):
# input the appropriate attributes for the Swordsman
def __init__(self, name):
# Fill this in!
class Healer(Player):
# input the appropriate attributes for the Healer
def __init__(self, name):
# Fill this in!
class GiantSpider():
# input the appropriate attributes for the Spider
def __init__(self):
# Fill this in!
# Check if the spider is still alive
# by ensuring that its current hp is greater than 0
def is_alive(self):
# Fill this in!
# The player has been damaged! Decrease the Spider's
# current health by the appropriate amount
def damage(self, dmg):
# Fill this in!
# Return True or False depending on whether the Plaeyer's
# attack was successful
def successful_attack(self):
# Fill this in!
def print_current_health(self):
print("The enemy currently has " + str(self.hp) + " health.\n")
def fight(player, enemy):
while(player.is_alive() and enemy.is_alive()):
player.print_current_health()
enemy.print_current_health()
move = input("What is your move? ")
print("")
while(move != "a" and move != "h"):
print("Press a to attack, press h to heal\n")
move = input("What is your move? ")
print("")
if(move == "a"):
# Fill in this code!
# What happens if the user wanted to attck?
elif(move == "h"):
# Fill in this code!
# What happens if the user wanted to heal?
if(enemy.successful_attack()):
# Fill in this code!
# What happens if the spider made a successful attack?
else:
# Fill in this code!
# What happens if the spider missed its attack?
return player.is_alive
name= input("Hello! What's your name? ")
while(name == ""):
name = input("We will need your name to proceed! What is your name? ")
player_class = input("Hi " + name + "! What class of character would you want to be? ")
player = None
while(player_class != "a" and player_class != "s" and player_class != "h"):
print("")
print("Press a to be an archer, press s to be a swordsman, press h to be a healer")
player_class = input("What class of character would you want to be? ")
# Based on what the user has chosen, how should you
# initialize his/her character?
if(player_class == "a"):
# Fill this in!
elif(player_class == "s"):
# Fill this in!
elif(player_class == "h"):
# Fill this in!
print("")
player.info()
num_steps = 0
print("\nYou are in a tunnel, and you must get out! It will take 10 steps to get out, but as you walk along you may encounter some spiders that you will need to fight. \nIf at any point in the game you are unsure what the commands are, just hit enter and you'll receive some instructions. Good luck!\n")
while(player.is_alive and num_steps < 10):
step = input("What do you want to do? ")
print("")
if(step == "s"):
# Fill in this code! What happens if a player takes a step?
# Hint: In this step, the user either encounters a spider OR
# the player does not encounter anything
# What is the chance that the player encounters a spider?
num_steps += 1
print("You have made a total of " + str(num_steps) + " steps!\n")
elif(step == "q"):
player.kill()
print("Better luck next time!")
break
else:
print("Press s to take a step, press q to quit")
if(player.is_alive()):
print("You won!")
|
d8b293f25173bbee6ddaa45118640f2ed7cdb1d0 | VitorHSF/Programacao-Linear-E-Aplicacoes | /Exercicios- Matrizes III/EX03/ex03.py | 853 | 3.703125 | 4 | def getLinha(matriz, n):
return [i for i in matriz[n]]
def getColuna(matriz, n):
return [i[n] for i in matriz]
matriza = [[3, 4], [2, 3]]
matrizalin = len(matriza)
matrizacol = len(matriza[0])
matrizb = [[-1], [-1]]
matrizblin = len(matrizb)
matrizbcol = len(matrizb[0])
matRes = []
print()
print('Matriz A')
print('=-'* 5)
for j in matriza:
print(j)
print('=-'* 5)
print()
print('Matriz B')
print('=-'* 5)
for j in matrizb:
print(j)
print('=-'* 5)
print()
for i in range(matrizalin):
matRes.append([])
for j in range(matrizbcol):
listMult = [x*y for x, y in zip(getLinha(matriza, i), getColuna(matrizb, j))]
matRes[i].append(sum(listMult))
print('Multiplicação de duas matrizes:')
print('=-'* 5)
for j in matRes:
print(j)
print('=-'* 5)
print() |
09d18759aa23f1c7625ac83b5a93d4d15fd281e4 | VitorHSF/Programacao-Linear-E-Aplicacoes | /Exercicios - Matrizes/EX04/ex04.py | 865 | 3.59375 | 4 | from time import sleep
matriz = [[1, -1, 0], [2, 3, 4], [0, 1, -2]]
matrizresult = [[0, 0, 0], [0, 0, 0], [0, 0, 0]]
matrizt= list(map(list, zip(*matriz)))
print('=-=' * 20)
print('Dada a Matriz A, obtenha a matriz B tal que B = A + At')
print('\nMatriz A:')
for j in matriz:
print('{}'.format(j))
print()
print('Matriz A Transposta:')
for j in matrizt:
print(j)
for linha in range(0, 3):
for coluna in range(0, 3):
matrizresult[linha][coluna] = matriz[linha][coluna] + matrizt[linha][coluna]
print()
print('calculando.')
sleep(2.0)
print('calculando..')
sleep(1.5)
print('calculando...')
sleep(1.0)
print('\nMatriz B = A + A Transposta:')
for linha in range(0, 3):
for coluna in range(0, 3):
print('[{:^5}]'.format(matrizresult[linha][coluna]), end='')
print()
print('=-=' * 20) |
0fcbee7b0ba2d158317b40e5f47ff3242584fbef | wmackowiak/Zadania | /Zajecia07/fitmeter.py | 369 | 3.59375 | 4 | import bmi
# podaj wagę i wrost
weight = float(input("Podaj wagę w kg: "))
height = float(input("Podaj wzrost w m: "))
# wyślij wagę i wzrost do funkcji obliczjącej
result_bmi = bmi.calculate_bmi(weight, height)
state = bmi.get_state(result_bmi)
print(state)
filename = state.lower() + '.txt'
with open(filename) as fopen:
tip = fopen.read()
print(tip)
|
e5416db47f43573132d34b69c15921ce623552e9 | wmackowiak/Zadania | /Zajecia03/zad04.py | 645 | 4.03125 | 4 | #Stwórz skrypt, który przyjmuje 3 opinie użytkownika o książce. Oblicz średnią opinię o książce.
# W zależności od wyniku dodaj komunikaty. Jeśli uzytkownik ocenił książkę na ponad 7 - bardzo dobry, ocena 5-7 przeciętna, 4 i mniej - nie warta uwagi.
ocena1 = int(input("Jaka jest Twoja ocena ksążki?"))
ocena2 = int(input("Jaka jest Twoja ocena ksążki?"))
ocena3 = int(input("Jaka jest Twoja ocena ksążki?"))
srednia = round(float((ocena1 + ocena2 + ocena3) / 3),0)
print(srednia)
if srednia > 7:
print("bardzo dobry")
elif srednia >=5 and srednia <=7:
print("przeciętna")
else:
print("nie warta uwagi")
|
eb2c90826b55ccf8d43e3dba932787c72e33db74 | wmackowiak/Zadania | /Zajecia04/dom06.py | 357 | 3.953125 | 4 | # 6▹ Utwórz listę zawierającą wartości poniższego słownika, bez duplikatów.
#
days = {'Jan': 31, 'Feb': 28, 'Mar': 31, 'Apr': 30, 'May': 31, 'Jun': 30, 'Jul': 31, 'Aug': 31, 'Sept': 30}
for key in days.keys():
lista1 = list(set(days.keys()))
for value in days.values():
lista2 = list(set(days.values()))
print(lista1)
print(lista2)
|
69bd4880aac5e7c71c7fe580c11a8e2bc48361cd | wmackowiak/Zadania | /Dodatkowe/zad27.py | 202 | 3.796875 | 4 | # Proszę za pomocą pętli while napisać ciąg składający się z 5 wielokrotności liczby 6.
#
# 6
# 12
# 18
# 24
# 30
x = 6
for i in range(5):
while x <= 30:
print(x)
x = x + 6 |
cfe325d65dd4a17391dad5839290b4a2ea569127 | wmackowiak/Zadania | /Zajecia06/zad05.py | 1,053 | 3.84375 | 4 | # Rozpoznawanie kart. Utwórz plik zawierający numery kart kredytowych. Sprawdź dla każdej kart jej typ.
# Podziel kart do plików wg typów np. visa.txt, mastercard.txt, americanexpress.txt.
def is_card_number(number):
return number.isdecimal() and len(number) in (13, 15, 16)
def starts_with_correct_digits(number):
if 51 <= int(number[0:2]) <= 55:
return True
elif 2221 <= int(number[0:4]) <= 2720:
return True
else:
return False
with open('karty.txt', 'r', encoding='utf-8') as fopen:
cards = fopen.read()
cards = cards.split()
for nr_card in cards:
nr_card = input("Podaj nr karty: ")
if is_card_number(nr_card):
if len(nr_card) in [13,16] and nr_card[0] == '4':
print("To jest Visa")
elif len(nr_card) == 16 and starts_with_correct_digits(nr_card):
print("To jest Mastercard")
elif len(nr_card) == 15 and (nr_card[0:2] in ['34','37']):
print("To jest American Express")
else:
print("Nie znam typu karty")
else:
print("To nie jest nr karty") |
584d559437a74a7a34b4093d87ad6def1816c33a | wmackowiak/Zadania | /Zajecia03/dom4.py | 373 | 3.546875 | 4 | # Zapytaj użytkownika o numer od 1 do 100, jeśli użytkownik zgadnie liczbę ukrytą przez programistę wyświetl
# komunikat “gratulacje!”, w przeciwnym razie wyświetl “pudło!”.
liczba_uzytkownika = input("Podaj liczbę z przedziału od 1 do 100: ")
moja_liczba = '45'
if liczba_uzytkownika == moja_liczba:
print("Gratulacje!")
else:
print("Pudło!") |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.