instruction stringlengths 34 186 | input stringlengths 2.02k 93.8k | output stringlengths 2 418 | meta_questiontype stringclasses 6 values | meta_inputlicense stringclasses 6 values | meta_pmid stringlengths 8 8 | meta_safetyreportid int64 9.51M 21M | meta_articlepubdate stringlengths 4 10 |
|---|---|---|---|---|---|---|---|
What was the outcome of reaction 'Small intestinal perforation'? | Cessation of methotrexate and a small intestinal resection provide a good clinical course for a patient with a jejunum perforation induced by a methotrexate-associated lymphoproliferative disorder: a case report.
BACKGROUND
Methotrexate (MTX) is a frequently used drug in the treatment of rheumatoid arthritis (RA), but occurrences of lymphoproliferative disorders (LPD) have been reported in patients undergoing an MTX regimen. Almost half of the patients with methotrexate-associated lymphoproliferative disorders (MTX-LPD) have extranodal lesions; moreover, although extremely rare, digestive tract perforations resulting from the extranodal lesions of MTX-LPD have also been reported.
METHODS
We describe the case of an 81-year-old woman with RA who had been prescribed MTX at 6 mg per week for the past 11 years. She was admitted to our hospital with occasional abdominal pain and was first diagnosed with enteritis. Her abdominal pain did not improve, and a computed tomography scan showed abdominal effusion and free air in the abdominal cavity. She was diagnosed with a digestive tract perforation and underwent emergency surgery. The perforation site was identified in the jejunum, and she underwent small intestinal resection around the perforated region. The pathological findings showed an ulcer in the jejunum and infiltration of large atypical lymphocytes around the perforated region. An immunohistochemical examination revealed the expression of a cluster of differentiation 20 and latent membrane protein 1. Considering the patient's history of RA treated with MTX, she was diagnosed as having Epstein-Barr virus (EBV)-related MTX-LPD with a histological diagnosis of EBVMCU. MTX was discontinued after the surgery, and her soluble interleukin-2 receptor (sIL-2R) levels had returned to normal 1 year later. She has had a good course for the 2 years since surgery and remains asymptomatic with no recurrence of MTX-LPD, as confirmed by the sIL-2R levels.
CONCLUSIONS
We experienced a rare case of the jejunum perforation induced by MTX-LPD. Since only a few cases have been reported of a patient with small intestinal perforation induced by MTX-LPD, further research is necessary to evaluate the clinicopathological features of MTX-LPD. The patient had disease remission after surgery and by discontinuing MTX treatment; our case did not require chemotherapy. EBV-positive patients, especially those with a pathological presentation of EBVMCU, could have a higher likelihood of remission, which could have been a factor in the present case.
Background
Methotrexate (MTX) is a key drug in the treatment of rheumatoid arthritis (RA), and one of the adverse effects can be lymphoproliferative disorders (LPD). However, the incidence of methotrexate-associated lymphoproliferative disorders (MTX-LPD) is extremely rare, reported as 0.00168/person-year [1]. MTX-LPD was categorized with other iatrogenic immunodeficiency-associated lymphoproliferative disorders (Oii-LPD) in the revised 2017 fourth edition of the World Health Organization’s (WHO) Classification of Tumours of Haematopoietic and Lymphoid Tissues [2]. Almost half of the patients with MTX-LPD had extranodal lesions associated with the brain, lungs, kidneys, liver, and bone marrow [3]. Extranodal lesions in the digestive tract are rare, but a few cases of patients with small intestinal perforations resulting from extranodal lesions of MTX-LPD are reported [4]. Although chemotherapy should be administered to patients who have progressive LPD, spontaneous LPD regression after MTX cessation without chemotherapy is often achieved in up to half the cases of MTX-LPD after ending MTX treatment [5]. Here, we describe a rare case of a patient with a jejunum perforation induced by MTX-LPD who underwent a partial small-intestine resection and had a remission after cessation of MTX.
Case presentation
An 81-year-old woman was admitted to our hospital due to occasional abdominal pain. She had a medical history of RA for the previous 14 years, hypertension, and nonalcoholic fatty liver disease. To control her RA, she had been taking MTX (6 mg per week) and prednisolone (5 mg/2.5 mg every other day) for the past 11 years. A physical examination revealed pain throughout her abdomen with rebound tenderness on the left side; however, she had no fever, and her abdomen was soft and flat.
Laboratory findings included a white blood cell count, 4400/μL (reference range, 3300–8600/μL); lymphocyte count, 572/μL (13%) (reference range, 18–50%); hemoglobin, 12.8 g/dL (reference range, 11.6–14.8 g/dL); platelet count, 240,000/μL (reference range, 158,000–348,000/μL); albumin, 3.6 g/dL (reference range, 4.1–5.1 g/dL); lactate dehydrogenase, 296 U/L (reference range, 124–222 U/L); and C-reactive protein, 1.91 mg/dL (reference range, 0.00–0.14 mg/dL). An abdominal computed tomography (CT) scan showed small-intestine edema, and her initial diagnosis was enteritis.
Antibiotic therapy was administered on the second day of her hospital stay because her white blood cell count increased from 4400 to 23,000/μL and her temperature increased from 35.9 to 38.5 °C. The patient’s abdominal pain also failed to improve. On the third day, the CT scan showed abdominal effusion and free air in the abdominal cavity (Fig. 1); she was diagnosed with a digestive tract perforation and peritonitis, and emergency surgery was performed. Intraoperatively, the perforation site was identified in the jejunum (about 30 cm anal-side to the Treitz ligament); the patient underwent a partial resection of the small intestine, and intraperitoneal irrigation was performed (Fig. 2).
Fig. 1 Representative images of CT scan on hospital day 3. a Perforation site (arrow) of the small intestine and abdominal effusion. b Free air in the abdomen. CT computed tomography
Fig. 2 Intraoperative findings revealed that the perforation site (arrow) was in the jejunum, about 30 cm anal-side to the Treitz ligament
The pathology of the jejunum showed a 35 mm × 4 mm ulcer and a 1-mm pinhole-shaped perforation site; infiltration of large atypical lymphocytes with small lymphocytes was observed around the perforated region (Fig. 3a–c). The immunohistochemical examination showed the expression of clusters of differentiation (CD) CD20, CD30, CD79a, and latent membrane protein 1 (LMP1) (Fig. 3d–f) and the absence of CD3, CD5, CD10, cyclinD1, cytokeratin AE1/AE3, or epithelial membrane antigen. LMP1 is a membrane protein produced by the Epstein–Barr virus (EBV), which is expressed in multiple EBV-related malignancies, including lymphomas [6, 7]. Therefore, these atypical lymphocytes were associated with diffuse large B cell lymphoma (DLBCL), a polymorphous type with Epstein–Barr virus-positive mucocutaneous ulcer (EBVMCU).
Fig. 3 a Macroscopically, a 35 mm × 4 mm ulcer with a 1-mm perforation site in the jejunum. b Surgical specimens with perforated lesions from the ulcerated jejunum (hematoxylin and eosin staining, original magnification × 12.5). c Infiltration of large atypical lymphocytes around the perforated region (hematoxylin and eosin × 600). d Immunohistochemical staining of CD20. e Immunohistochemical staining of CD30. f Immunohistochemical staining of LMP-1 (c–f original magnification × 600). CD cluster of differentiation, LMP-1 latent membrane protein 1
Due to the patient’s pathological findings and history of RA treated with MTX, she was diagnosed as having Oii-LPD, specifically MTX-LPD, with a histological diagnosis of EBVMCU. MTX was no longer prescribed for the patient, but oral medication was resumed on day 12, which included prednisolone (5 mg/2.5 mg every other day). The patient was discharged from the hospital on day 21, and positron emission tomography–computed tomography (PET–CT) was performed to evaluate the extent of the lymphoma, and it showed no findings associated with extranodal LPD.
One month after the patient had concluded her MTX treatment, her soluble interleukin-2 receptor (sIL-2R) levels had decreased from 1460 to 730 IU/mL, and it was not necessary to initiate chemotherapy. One year later, her sIL-2R level was < 520 IU/mL. The patient has continued to have a good course for 2 years after her hospitalization: she has remained asymptomatic, and her sIL-2R levels show no recurrence of MTX-LPD (Fig. 4). Her RA is controlled by bucillamine (200 mg per day) and iguratimod (25 mg per day).
Fig. 4 A flow chart of the clinical course for methotrexate-associated lymphoproliferative disorders
Discussion and conclusions
The causes for the perforation of the small intestine can be immune-mediated, infectious- or medication-related, congenital, metabolic, vascular, or neoplastic. Medication-related causes include non-steroidal anti-inflammatory drugs; enteric-coated potassium chloride; chemotherapeutic agents, such as gefitinib and erlotinib and drug combinations containing etoposide and cisplatin; and monoclonal antibodies, such as bevacizumab, IL-2, ipilimumab, and rituximab [8, 9]. Monoclonal antibody therapeutics have been approved for several cancer and inflammatory diseases. Bevacizumab has been used in the treatment of metastatic colorectal cancer, metastatic non-small cell lung cancer, and other malignancies, including ovarian cancer, through the inhibition of vascular endothelial growth factor [9]. IL-2 has been used in patients with metastatic melanoma and renal cell carcinoma [8]. Ipilimumab is an antibody to cytotoxic T lymphocyte-associated antigen 4 that has been used in the treatment of metastatic melanoma and renal cell cancer [9]. Rituximab, an anti-CD20 monoclonal antibody, has been used to treat hematologic B cell malignancies, nephrotic syndrome, and rheumatoid arthritis [9, 10]. Several side effects associated with the use of these monoclonal antibodies have been reported, with gastrointestinal perforations reported as the rare and common adverse effects [9–12] (Table 1). Malignant neoplasms (lymphomas, enteropathy-associated T cell lymphomas, adenocarcinomas, and carcinoid tumors) can also be a causative factor of small-intestine perforation [8]. One study showed that 92 of 1062 (9%) patients with lymphoma involving the gastrointestinal tract developed a perforation [13], with large B cell lymphomas being the most common type.
Table 1 Indications and side effects of using monoclonal antibodies
Monoclonal antibody Bevacizumab Interleukin-2 Ipilimumab Rituximab
Target Vascular endothelial growth factor Interleukin-2 receptor Cytotoxic T lymphocyte antigen 4 CD20 antigen
Indications Colorectal cancer, non-small cell lung cancer, and ovarian cancer Melanoma and renal cell cancer Melanoma and renal cell cancer Hematologic B cell malignancies, nephrotic syndrome, and rheumatoid arthritis
Side effects Hypertension, proteinuria, arterial thromboembolic events, wound healing complications, bleeding diathesis, and gastrointestinal perforations Fever and chills, diarrhea, diffuse erythroderma, hyperbilirubinemia, anemia, thrombocytopenia, eosinophilia, a capillary leak syndrome, and intestinal perforation Dermatitis, endocrinopathies, particularly hypophysitis, uveitis, nephritis, inflammatory myopathies, hepatitis, colitis, and intestinal perforation Fever and chills, mucocutaneous reactions, fatal infusion reactions, progressive multifocal leukoencephalopathy, and intestinal perforation
CD20 cluster of differentiation 20
Patients who have a therapy regimen that includes MTX can develop MTX-LPD, which can present as a benign lymphoid proliferation or malignant lymphoma. MTX-LPD is categorized as Oii-LPD by the WHO; this is a group of disorders defined as lymphoid proliferations or lymphomas that develop in patients receiving immunosuppressive drugs for autoimmune diseases or conditions other than in the post-transplant setting [14]. Extranodal lesions have been found in the digestive tracts of 4.1% of affected patients, and 1.4% had small intestinal lesions [15]. Small-intestine perforations due to MTX-LPD can occur but are extremely rare, with 7 cases reported in the Japanese literature and a single case reported in the English literature [4, 16] (Table 2). All cases were diagnosed as DLBCL, and association with EBV was observed in 5 cases. Spontaneous regression was achieved in 6 cases, and 7 cases have been reported to survive. However, a survival of > 2 years was not reported in all cases. Considering the effect of MTX discontinuation on RA progression, we should follow up cautiously.
Table 2 Reported cases in Japan of perforation in the gastrointestinal tract caused by MTX-associated lymphoproliferative disorder
Case Year Age Sex Organ CD20 EBV Diagnosis Operation Chemotherapy Prognosis
1 1995 73 M Ileum Positive Negative DLBCL Rt. hemicolectomy No Dead
2 2004 87 F Ileum Positive − DLBCL Partial resection No Alive
3 2006 63 M Ileum Positive Positive DLBCL Ileo-cecum resection No Alive
4 2011 82 F Ileum Positive Positive DLBCL Ileo-cecum resection Yesa Alive
5 2016 70 F Ileum Positive Positive DLBCL Rt. hemicolectomy No Alive
6 2017 77 F Ileum Positive Negative DLBCL Partial resection No Alive
7 2018 66 F Ileum Positive Positive DLBCL Partial resection No Alive
8 2020 62 M Jejunum Positive Positive DLBCL Partial resection No Alive
Present case 2020 81 F Jejunum Positive Positive EBVMCU Partial resection No Alive
CD20 cluster of differentiation 20, EBV Epstein–Barr virus, DLBCL diffuse large B cell lymphoma, EBVMCU Epstein–Barr virus-positive mucocutaneous ulcer, Rt. hemicolectomy right hemicolectomy
aR-THP-COP 5course: rituximab (R), tetrahydropyranyl adriamycin (THP), cyclophosphamide (CPA), vincristine (VCR), and prednisolone (PSL)
The occurrence of MTX-LPD correlates with the total dose and duration of MTX administration: the median interval between initiation of MTX treatment and the development of LPD was 30–54 months, and the median cumulative dose of MTX was 940–1500 mg [17, 18]. However, another study showed that the total dose and length of MTX administration were not associated with overall survival in patients with MTX-LPD [19]. In 18–45% of cases, spontaneous recovery from MTX-LPD takes place after MTX is discontinued [3, 19], often within 2–3 months [20]. If the LPD progresses after MTX is discontinued or high sIL-2R levels persist, chemotherapy should be administered [20]. Our case achieved a disease regression without chemotherapy, although her cumulative dose (3240 mg) and duration of MTX therapy (135 months) had been much greater than the median reported in previous studies [17, 18].
Large B cell lymphoma, including DLBCL, is the major histological subtype of MTX-LPD. Other frequent subtypes are reactive lymphoid hyperplasia, classic Hodgkin lymphoma, polymorphic B cell LPD, and indolent lymphoma which includes follicular lymphoma [21]. Some studies have shown that patients who are EBV-positive and non-DLBCL histological type have a high prevalence of spontaneous remission [22]. EBV-positive DLBCL is categorized as polymorphous lymphoma and large cell lymphoma subtypes, and a number of previous reports have revealed that the polymorphous lymphoma has a good prognosis than large cell lymphoma [23]. Additionally, some patients with EBV-positive LPD exhibited mucosal or cutaneous ulcers with polymorphous infiltration of small lymphocytes, immunoblasts, and atypical large lymphocytes, which are categorized as EBVMCU. EBVMCU is typically located in the oropharynx, gastrointestinal tract, and skin [24]. Recent studies have reported that EBVMCU develops as Oii-LPD induced by MTX treatment, and nearly all EBVMCU cases showed a favorable response to conservative management approaches such as the cessation of the MTX treatment for RA [25]. Although the detection rate of EBV is 5–10% in canonical LPD, the rate increases to 27% and 30–60% in patients with MTX-LPD and rheumatoid arthritis-associated LPD, respectively [18, 22]. Among RA patients with EBV-positive MTX-LPD, a lower incidence of DNA methylation in tumors and higher expression of tumor suppressor genes were observed. Although this may explain a higher probability of spontaneous LPD regression after MTX cessation in RA patients, the causal relationship between EBV and MTX-LPD is still unclear [22]. Another study reported that the tumor microenvironment with upregulation of autophagosome may support the development of EBV-related LPD [26]. Our case had disease regression after she concluded MTX and underwent surgery for perforated jejunum. Because she had a spontaneous recovery from MTX-LPD, chemotherapy was not required; we consider that EBV-positivity played a role in the patient’s spontaneous recovery.
In conclusion, we saw a rare case of jejunum perforation induced by EBV-related MTX-LPD. Since only a few similar cases have been reported, further research is necessary to evaluate the clinicopathological features. This case study shows that successful disease management and remission can be achieved by surgery and discontinuing MTX treatment; our case did not require chemotherapy. EBV-positive patients, especially those with a pathological presentation of EBVMCU, have a higher likelihood of remission, which may have influenced the successful outcome of the present case.
Abbreviations
MTXMethotrexate
RARheumatoid arthritis
LPDLymphoproliferative disorders
MTX-LPDMethotrexate-associated lymphoproliferative disorders
Oii-LPDOther iatrogenic immunodeficiency-associated lymphoproliferative disorders
WHOThe World Health Organization
CTComputed tomography
CDCluster of differentiation
LMP-1Latent membrane protein 1
EBVEpstein–Barr virus
DLBCLDiffuse large B cell lymphoma
EBVMCUEpstein–Barr virus-positive mucocutaneous ulcer
PET–CTPositron emission tomography–computed tomography
sIL-2RSoluble interleukin-2 receptor
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
This work was supported in part by Grants-in-Aid for Research from the National Center for Global Health and Medicine (20A 3001).
Authors’ contributions
MN and RS wrote the paper; HO, TN, KK, AS, DE, and NA contributed to the paper design and coordination. All authors have read and approved the manuscript.
Funding
None.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Written consent was obtained from the patient. As this is a case report, approval from the institutional review board was not needed.
Consent for publication
Written informed consent was obtained from the patient for the publication of this report and any accompanying images.
Competing interests
The authors declare that they have no competing interests. | Recovered | ReactionOutcome | CC BY | 33388058 | 18,811,694 | 2021-01-02 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Exposure during pregnancy'. | Delivery of an Infant with Airway Compression Due to Cystic Hygroma at 37 Weeks' Gestation Requiring a Multidisciplinary Decision to Use a Combination of Ex Utero Intrapartum Treatment (EXIT) and Airway Palliation at Cesarean Section.
BACKGROUND This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks' gestation requiring a multidisciplinary decision to use a combination of ex utero intrapartum treatment (EXIT) and airway palliation at cesarean section. This infant did not require support with extracorporeal membrane oxygenation (ECMO). CASE REPORT A 22-year-old G1P0 woman with past medical history of morbid obesity underwent an EXIT procedure due to a large fetal neck mass. Anesthesia included a narcotic-only single-shot spinal, total intravenous anesthesia (TIVA) was used for maintenance, and high-dose volatile anesthetics and nitroglycerin infusion was used for complete uterine relaxation. The infant's airway was secured by the otolaryngologist, after which delivery was completed. Sevoflurane and nitroglycerin were discontinued and the previous TIVA was restarted. Uterotonics were aggressively administered to prevent uterine atony, and the patient was extubated. CONCLUSIONS This report shows the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case demonstrates the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Background
Morbidity and mortality are significantly elevated in deliveries of neonates with undiagnosed fetal neck masses [1]. Failure to secure the airway in a timely fashion, if at all, in such difficult circumstances leads to extremely poor outcomes for the neonates. The management of delivery of infants with airway obstruction differs in many ways from that of adults and has been detailed by Harless et al. [2]. While ultrasound and magnetic resonance imaging (MRI) allow for superbly detailed examination of these masses, clinically executing the delivery of these neonates remains very challenging and requires extensive collaboration among many teams. The Ex Utero Intrapartum Treatment (EXIT) procedure, the successor to the Operation on Placental Support (OOPS) intervention, is a procedure aimed at delivering infants safely that have severely debilitating congenital disorders or other disease processes which otherwise may be fatal. As described in the name of the procedure, the goal is to provide reliable airway treatment externally through the uterus to the fetus prior to delivery [3,4].
The most common indication for the EXIT procedure is congenital airway obstruction, including high airway obstructions and neck masses such as lymphangiomas and teratomas. Other indications include intrathoracic lesions, lung and mediastinal masses, severe bilateral pleural effusions, pulmonary agenesis, diaphragmatic hernias, vascular access in preparation for extracorporeal membrane oxygenation (ECMO), and conjoined twins [1,3,4]. The EXIT procedure was initially designed and performed for the fetus with airway concerns that may prevent survival upon delivery [5]. The fundamental goal is to provide continuous uteroplacental support for the fetus until a definitive airway is secured or a surgical procedure is performed [3,4]. The use of EXIT in a variety of new interventions continues to grow as there are advances in neonatal and obstetrical management. The duration of uteroplacental per-fusion continues to be pushed longer and longer, allowing for ever more sophisticated procedures to be performed on the fetus, and thus increasing the chances of survival. According to Rahbar et al., “the fetal gas exchange can be supported by ex utero placental circulation for 60 minutes [6].” Also, very importantly, advanced anesthetics are being used in a relatively safe and well-tolerated fashion on the mother of the fetus to avoid increasing the mother’s risk. Maternal anesthetic considerations during the EXIT procedure are numerous, including anxiolysis, pain control, vascular access and advanced hemo-dynamic monitoring, aspiration and PONV prophylaxis, general versus neuraxial anesthesia, uterine tone, and prevention of post-partum hemorrhage [7]. This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks’ gestation requiring a multidisciplinary decision to use a combination of EXIT and airway palliation at cesarean section. This infant did not require support with ECMO.
Case Report
We present the case of a 22-year-old G1P0 woman with past medical history of morbid obesity (body mass index of 54 kg/m2) who was admitted for an EXIT procedure due to a large fetal neck mass (Figure 1) found on 28-week ultrasound. The ultrasound prior to delivery demonstrated a rapidly growing 20.1×9.7×18.2 cm cystic hygroma or lymphangioma, involving the left cheek and extending to the chest and lower abdomen. A fetal magnetic resonance imaging (MRI) study showed a large mass that wrapped around the tracheoesophageal complex, extended into the mediastinum along the left aspect of the trachea, and had a demonstrable mass effect on the mouth, nose, and nasal cavity with rightward displacement (Figure 2).
In preparation for the patient’s delivery, a large multidisciplinary team was assembled. The patient had a score of 8 on the Tracheoesophageal Displacement Index, which measures the lateral and ventral displacements of the trachea and esophagus in relation to the cervical spine [8]. The prenatal scans were reviewed at length and there was extensive discussion regarding the most appropriate plan for delivery. Ultimately, it was decided that an EXIT procedure was to be performed due to the potential for severe fetal compromise.
The patient was scheduled for her EXIT procedure at 37 weeks. She received standard obstetrical pre-medications and was taken to the largest operating room in the institution, which in addition to the normal surgical setup, also had a neonatal surgical bed and ECMO circuit immediately available. We administered a narcotic-only spinal block with 100 mcg morphine and 15 mcg fentanyl. The patient was placed in the left uterine displacement of 30 degrees to decrease aortocaval compression and 2 large-bore intravenous lines and an arterial line were placed.
The patient was induced in rapid-sequence fashion and an endotracheal tube was successfully inserted. Maintenance of anesthesia was via total intravenous anesthesia (TIVA) with 150 mcg/kg/min propofol infusion and 0.1 mcg/kg/min remifentanil infusion. The patient’s mean arterial pressure was kept within 10% of baseline with a phenylephrine titration.
Two minutes prior to hysterotomy, the TIVA was decreased to 25 mcg/kg/min propofol and 2 minimum alveolar concentrations (MAC) of the volatile anesthetic sevoflurane were initiated in addition to a nitroglycerin drip at 100 mcg/min. A small hysterotomy incision was performed and warmed saline was inserted via a Belmont® Rapid Infuser catheter into the uterus. The hysterotomy incision was extended and the infant’s head, neck, and right shoulder were delivered, while a sterile warming blanket was placed over the remainder of the uterine incision. The infant received an intramuscular injection of atropine, vecuronium, and fentanyl and the pediatric otolaryngology surgeon began to secure the airway via the oral cavity.
Using many advanced airway tools, the time from initiation of laryngoscopy to securing the airway was 12 min. A combination of video laryngoscopy, rigid bronchoscopy, and fiberoptic advanced airway equipment were utilized with success, followed by clamping of the umbilical cord and full delivery of a baby boy. Sevoflurane and nitroglycerin were promptly discontinued and full TIVA via propofol and remifentanil infusions were resumed. The patient received an intravenous bolus of oxytocin, intramuscular carboprost tromethamine, and intramuscular methylergonovine with return of firm uterine tone within 1 min. The remainder of the cesarean section was unremarkable, with 1 L of estimated blood loss and the patient was successfully extubated at the end of the procedure. She was discharged from the hospital on postoperative day 3. The baby underwent debulking and debridement of the cystic neck mass on day 2. Unfortunately, the baby died from fulminant sepsis secondary to femoral central-line infection on day 4.
Discussion
Ex Utero Intrapartum Treatment remains a complex procedure involving significant planning and resources, and it is performed infrequently even at major medical centers across the U.S. EXIT-to-airway, EXIT-to-ECMO, EXIT-to-separation, and EXIT-to-resection are all possibilities depending on the fetal findings on hysterotomy and exposure. Although our case did not require ECMO, a potential failed EXIT-to-airway procedure still necessitated significant planning with pediatric cardiothoracic surgery and perfusionists prior to day of surgery and for these teams to be present with equipment and prepared for emergent EXIT-to-ECMO on the day of surgery. EXIT procedures are of high interest due to their infrequency, high acuity for both mother and infant, and unique anesthetic considerations for uterine tone which changes rapidly during the case.
Anesthesia for an EXIT procedure must focus on both maternal and fetal well-being. Maternal pain control intra- and post-operatively remains a high priority. Options include spinal with intrathecal opioids, CSE with intrathecal or epidural opioids, IV analgesics, and regional anesthetic blocks (e.g., Quadratus Lumborum or Transverse Abdominal Plane blocks). We chose to administer an opioid-only spinal prior to induction as the plan was to induce general anesthesia for patient comfort and anxiety, but also there would be no indwelling catheter in the event of peri-partum hemorrhage and coagulopathy. Institutionally, we routinely remove epidurals prior to leaving the operating room so longer duration analgesia is accomplished with intrathecal morphine. Arterial access remains critical for close maternal blood pressure control to ensure adequate uteroplacental oxygen delivery to the fetus. TIVA using a propofol infusion prior to hysterotomy and after delivery was chosen to help with maternal postoperative nausea and vomiting prevention as the surgery overall was expected to require a long-acting general anesthetic. Remifentanil, on the other hand, was used not only for maternal comfort and hemodynamic stability, but has been shown to have transplacental passage, thus helping with fetal analgesia and immobility during surgery or airway manipulation [9].
Uterine tone is an important anesthetic consideration as one must allow maximal uterine relaxation for surgical exposure and fetal airway manipulation with possible ECMO cannulation, but also realizing that strong uterine tone will be critical immediately following delivery to prevent severe post-partum hemorrhage secondary to atony. Therefore, inhaled volatile anesthetics were only used briefly during the surgery for complete relaxation but at a higher MAC than needed for routine surgeries under general anesthesia. Up to 3–4 MAC can accomplish uterine relaxation but with risk of fetal hypoxia and acidosis from decreased uteroplacental blood flow as shown in animal studies if maintained for even 15 min [10]. In addition, nitroglycerin was used for complete uterine relaxation as it has a quick onset and short half-life. Notably, care must be taken with a nitroglycerin infusion as tachyphylaxis can develop, thus requiring higher doses with possible maternal headaches, hypotension, dizziness, pulmonary edema, and methemoglobinemia [11].
Fetal anesthetic considerations include analgesia, fetal monitoring, proper uteroplacental blood flow via tight maternal blood pressure control, maintaining placental attachment, administering intramuscular paralytic and anti-bradycardic medications, and adequate relaxation during airway instrumentation. A Belmont Rapid Infuser® can be used to continuously fill the uterus with crystalloid fluids. This helps with temperature control inside the uterus, preventing premature placental separation and maintaining the uterine cavity to prevent umbilical cord spasm or compression, which could be detrimental to the fetus [12]. One must be aware that prolonged uterine irrigation with warmed crystalloid can lead to maternal absorption through the venous plexuses and pulmonary edema [13].
Despite careful planning and extensive measures to help fetal survival, newborn deaths following the EXIT procedure are not uncommon. In our case, a central-line infection was the cause of death following a successful EXIT-to-airway procedure. Central-line-associated bloodstream infections account for up to 28 000 deaths per year and considerable costs even with vigilant precautions [14]. More commonly, fetal deaths following EXIT procedure are related to severe pulmonary hypoplasia and immaturity [9]. Maternal outcomes following EXIT appear similar to those of a routine cesarean section but with overall increased blood loss. Ultimately, EXIT is a potentially fetal life-saving procedure that requires a multidisciplinary team, careful planning, and an anesthetic tailored to maternal and fetal comfort and outcomes.
Conclusions
This report has shown the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case has shown the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Figure 1. Delivery of an infant at 37 weeks’ gestation with airway obstruction due to cystic hygroma. The infant is shown at delivery following airway intubation. A large cystic hygroma of the neck is shown, measuring 20.1×9.7×18.2 cm by ultrasound.
Figure 2. A sagittal magnetic resonance image (MRI) of the infant at 37 weeks’ gestation. The MRI shows a large neck mass (left) consistent with a cystic hygroma, measuring 15.8×14×9 cm by MRI. | FENTANYL, MORPHINE, NITROGLYCERIN, PHENYLEPHRINE HYDROCHLORIDE, PROPOFOL, REMIFENTANIL, SEVOFLURANE | DrugsGivenReaction | CC BY-NC-ND | 33388739 | 19,167,263 | 2021-01-03 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Live birth'. | Delivery of an Infant with Airway Compression Due to Cystic Hygroma at 37 Weeks' Gestation Requiring a Multidisciplinary Decision to Use a Combination of Ex Utero Intrapartum Treatment (EXIT) and Airway Palliation at Cesarean Section.
BACKGROUND This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks' gestation requiring a multidisciplinary decision to use a combination of ex utero intrapartum treatment (EXIT) and airway palliation at cesarean section. This infant did not require support with extracorporeal membrane oxygenation (ECMO). CASE REPORT A 22-year-old G1P0 woman with past medical history of morbid obesity underwent an EXIT procedure due to a large fetal neck mass. Anesthesia included a narcotic-only single-shot spinal, total intravenous anesthesia (TIVA) was used for maintenance, and high-dose volatile anesthetics and nitroglycerin infusion was used for complete uterine relaxation. The infant's airway was secured by the otolaryngologist, after which delivery was completed. Sevoflurane and nitroglycerin were discontinued and the previous TIVA was restarted. Uterotonics were aggressively administered to prevent uterine atony, and the patient was extubated. CONCLUSIONS This report shows the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case demonstrates the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Background
Morbidity and mortality are significantly elevated in deliveries of neonates with undiagnosed fetal neck masses [1]. Failure to secure the airway in a timely fashion, if at all, in such difficult circumstances leads to extremely poor outcomes for the neonates. The management of delivery of infants with airway obstruction differs in many ways from that of adults and has been detailed by Harless et al. [2]. While ultrasound and magnetic resonance imaging (MRI) allow for superbly detailed examination of these masses, clinically executing the delivery of these neonates remains very challenging and requires extensive collaboration among many teams. The Ex Utero Intrapartum Treatment (EXIT) procedure, the successor to the Operation on Placental Support (OOPS) intervention, is a procedure aimed at delivering infants safely that have severely debilitating congenital disorders or other disease processes which otherwise may be fatal. As described in the name of the procedure, the goal is to provide reliable airway treatment externally through the uterus to the fetus prior to delivery [3,4].
The most common indication for the EXIT procedure is congenital airway obstruction, including high airway obstructions and neck masses such as lymphangiomas and teratomas. Other indications include intrathoracic lesions, lung and mediastinal masses, severe bilateral pleural effusions, pulmonary agenesis, diaphragmatic hernias, vascular access in preparation for extracorporeal membrane oxygenation (ECMO), and conjoined twins [1,3,4]. The EXIT procedure was initially designed and performed for the fetus with airway concerns that may prevent survival upon delivery [5]. The fundamental goal is to provide continuous uteroplacental support for the fetus until a definitive airway is secured or a surgical procedure is performed [3,4]. The use of EXIT in a variety of new interventions continues to grow as there are advances in neonatal and obstetrical management. The duration of uteroplacental per-fusion continues to be pushed longer and longer, allowing for ever more sophisticated procedures to be performed on the fetus, and thus increasing the chances of survival. According to Rahbar et al., “the fetal gas exchange can be supported by ex utero placental circulation for 60 minutes [6].” Also, very importantly, advanced anesthetics are being used in a relatively safe and well-tolerated fashion on the mother of the fetus to avoid increasing the mother’s risk. Maternal anesthetic considerations during the EXIT procedure are numerous, including anxiolysis, pain control, vascular access and advanced hemo-dynamic monitoring, aspiration and PONV prophylaxis, general versus neuraxial anesthesia, uterine tone, and prevention of post-partum hemorrhage [7]. This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks’ gestation requiring a multidisciplinary decision to use a combination of EXIT and airway palliation at cesarean section. This infant did not require support with ECMO.
Case Report
We present the case of a 22-year-old G1P0 woman with past medical history of morbid obesity (body mass index of 54 kg/m2) who was admitted for an EXIT procedure due to a large fetal neck mass (Figure 1) found on 28-week ultrasound. The ultrasound prior to delivery demonstrated a rapidly growing 20.1×9.7×18.2 cm cystic hygroma or lymphangioma, involving the left cheek and extending to the chest and lower abdomen. A fetal magnetic resonance imaging (MRI) study showed a large mass that wrapped around the tracheoesophageal complex, extended into the mediastinum along the left aspect of the trachea, and had a demonstrable mass effect on the mouth, nose, and nasal cavity with rightward displacement (Figure 2).
In preparation for the patient’s delivery, a large multidisciplinary team was assembled. The patient had a score of 8 on the Tracheoesophageal Displacement Index, which measures the lateral and ventral displacements of the trachea and esophagus in relation to the cervical spine [8]. The prenatal scans were reviewed at length and there was extensive discussion regarding the most appropriate plan for delivery. Ultimately, it was decided that an EXIT procedure was to be performed due to the potential for severe fetal compromise.
The patient was scheduled for her EXIT procedure at 37 weeks. She received standard obstetrical pre-medications and was taken to the largest operating room in the institution, which in addition to the normal surgical setup, also had a neonatal surgical bed and ECMO circuit immediately available. We administered a narcotic-only spinal block with 100 mcg morphine and 15 mcg fentanyl. The patient was placed in the left uterine displacement of 30 degrees to decrease aortocaval compression and 2 large-bore intravenous lines and an arterial line were placed.
The patient was induced in rapid-sequence fashion and an endotracheal tube was successfully inserted. Maintenance of anesthesia was via total intravenous anesthesia (TIVA) with 150 mcg/kg/min propofol infusion and 0.1 mcg/kg/min remifentanil infusion. The patient’s mean arterial pressure was kept within 10% of baseline with a phenylephrine titration.
Two minutes prior to hysterotomy, the TIVA was decreased to 25 mcg/kg/min propofol and 2 minimum alveolar concentrations (MAC) of the volatile anesthetic sevoflurane were initiated in addition to a nitroglycerin drip at 100 mcg/min. A small hysterotomy incision was performed and warmed saline was inserted via a Belmont® Rapid Infuser catheter into the uterus. The hysterotomy incision was extended and the infant’s head, neck, and right shoulder were delivered, while a sterile warming blanket was placed over the remainder of the uterine incision. The infant received an intramuscular injection of atropine, vecuronium, and fentanyl and the pediatric otolaryngology surgeon began to secure the airway via the oral cavity.
Using many advanced airway tools, the time from initiation of laryngoscopy to securing the airway was 12 min. A combination of video laryngoscopy, rigid bronchoscopy, and fiberoptic advanced airway equipment were utilized with success, followed by clamping of the umbilical cord and full delivery of a baby boy. Sevoflurane and nitroglycerin were promptly discontinued and full TIVA via propofol and remifentanil infusions were resumed. The patient received an intravenous bolus of oxytocin, intramuscular carboprost tromethamine, and intramuscular methylergonovine with return of firm uterine tone within 1 min. The remainder of the cesarean section was unremarkable, with 1 L of estimated blood loss and the patient was successfully extubated at the end of the procedure. She was discharged from the hospital on postoperative day 3. The baby underwent debulking and debridement of the cystic neck mass on day 2. Unfortunately, the baby died from fulminant sepsis secondary to femoral central-line infection on day 4.
Discussion
Ex Utero Intrapartum Treatment remains a complex procedure involving significant planning and resources, and it is performed infrequently even at major medical centers across the U.S. EXIT-to-airway, EXIT-to-ECMO, EXIT-to-separation, and EXIT-to-resection are all possibilities depending on the fetal findings on hysterotomy and exposure. Although our case did not require ECMO, a potential failed EXIT-to-airway procedure still necessitated significant planning with pediatric cardiothoracic surgery and perfusionists prior to day of surgery and for these teams to be present with equipment and prepared for emergent EXIT-to-ECMO on the day of surgery. EXIT procedures are of high interest due to their infrequency, high acuity for both mother and infant, and unique anesthetic considerations for uterine tone which changes rapidly during the case.
Anesthesia for an EXIT procedure must focus on both maternal and fetal well-being. Maternal pain control intra- and post-operatively remains a high priority. Options include spinal with intrathecal opioids, CSE with intrathecal or epidural opioids, IV analgesics, and regional anesthetic blocks (e.g., Quadratus Lumborum or Transverse Abdominal Plane blocks). We chose to administer an opioid-only spinal prior to induction as the plan was to induce general anesthesia for patient comfort and anxiety, but also there would be no indwelling catheter in the event of peri-partum hemorrhage and coagulopathy. Institutionally, we routinely remove epidurals prior to leaving the operating room so longer duration analgesia is accomplished with intrathecal morphine. Arterial access remains critical for close maternal blood pressure control to ensure adequate uteroplacental oxygen delivery to the fetus. TIVA using a propofol infusion prior to hysterotomy and after delivery was chosen to help with maternal postoperative nausea and vomiting prevention as the surgery overall was expected to require a long-acting general anesthetic. Remifentanil, on the other hand, was used not only for maternal comfort and hemodynamic stability, but has been shown to have transplacental passage, thus helping with fetal analgesia and immobility during surgery or airway manipulation [9].
Uterine tone is an important anesthetic consideration as one must allow maximal uterine relaxation for surgical exposure and fetal airway manipulation with possible ECMO cannulation, but also realizing that strong uterine tone will be critical immediately following delivery to prevent severe post-partum hemorrhage secondary to atony. Therefore, inhaled volatile anesthetics were only used briefly during the surgery for complete relaxation but at a higher MAC than needed for routine surgeries under general anesthesia. Up to 3–4 MAC can accomplish uterine relaxation but with risk of fetal hypoxia and acidosis from decreased uteroplacental blood flow as shown in animal studies if maintained for even 15 min [10]. In addition, nitroglycerin was used for complete uterine relaxation as it has a quick onset and short half-life. Notably, care must be taken with a nitroglycerin infusion as tachyphylaxis can develop, thus requiring higher doses with possible maternal headaches, hypotension, dizziness, pulmonary edema, and methemoglobinemia [11].
Fetal anesthetic considerations include analgesia, fetal monitoring, proper uteroplacental blood flow via tight maternal blood pressure control, maintaining placental attachment, administering intramuscular paralytic and anti-bradycardic medications, and adequate relaxation during airway instrumentation. A Belmont Rapid Infuser® can be used to continuously fill the uterus with crystalloid fluids. This helps with temperature control inside the uterus, preventing premature placental separation and maintaining the uterine cavity to prevent umbilical cord spasm or compression, which could be detrimental to the fetus [12]. One must be aware that prolonged uterine irrigation with warmed crystalloid can lead to maternal absorption through the venous plexuses and pulmonary edema [13].
Despite careful planning and extensive measures to help fetal survival, newborn deaths following the EXIT procedure are not uncommon. In our case, a central-line infection was the cause of death following a successful EXIT-to-airway procedure. Central-line-associated bloodstream infections account for up to 28 000 deaths per year and considerable costs even with vigilant precautions [14]. More commonly, fetal deaths following EXIT procedure are related to severe pulmonary hypoplasia and immaturity [9]. Maternal outcomes following EXIT appear similar to those of a routine cesarean section but with overall increased blood loss. Ultimately, EXIT is a potentially fetal life-saving procedure that requires a multidisciplinary team, careful planning, and an anesthetic tailored to maternal and fetal comfort and outcomes.
Conclusions
This report has shown the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case has shown the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Figure 1. Delivery of an infant at 37 weeks’ gestation with airway obstruction due to cystic hygroma. The infant is shown at delivery following airway intubation. A large cystic hygroma of the neck is shown, measuring 20.1×9.7×18.2 cm by ultrasound.
Figure 2. A sagittal magnetic resonance image (MRI) of the infant at 37 weeks’ gestation. The MRI shows a large neck mass (left) consistent with a cystic hygroma, measuring 15.8×14×9 cm by MRI. | FENTANYL, MORPHINE, NITROGLYCERIN, PHENYLEPHRINE HYDROCHLORIDE, PROPOFOL, REMIFENTANIL, SEVOFLURANE | DrugsGivenReaction | CC BY-NC-ND | 33388739 | 19,167,263 | 2021-01-03 |
What was the administration route of drug 'PROPOFOL'? | Delivery of an Infant with Airway Compression Due to Cystic Hygroma at 37 Weeks' Gestation Requiring a Multidisciplinary Decision to Use a Combination of Ex Utero Intrapartum Treatment (EXIT) and Airway Palliation at Cesarean Section.
BACKGROUND This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks' gestation requiring a multidisciplinary decision to use a combination of ex utero intrapartum treatment (EXIT) and airway palliation at cesarean section. This infant did not require support with extracorporeal membrane oxygenation (ECMO). CASE REPORT A 22-year-old G1P0 woman with past medical history of morbid obesity underwent an EXIT procedure due to a large fetal neck mass. Anesthesia included a narcotic-only single-shot spinal, total intravenous anesthesia (TIVA) was used for maintenance, and high-dose volatile anesthetics and nitroglycerin infusion was used for complete uterine relaxation. The infant's airway was secured by the otolaryngologist, after which delivery was completed. Sevoflurane and nitroglycerin were discontinued and the previous TIVA was restarted. Uterotonics were aggressively administered to prevent uterine atony, and the patient was extubated. CONCLUSIONS This report shows the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case demonstrates the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Background
Morbidity and mortality are significantly elevated in deliveries of neonates with undiagnosed fetal neck masses [1]. Failure to secure the airway in a timely fashion, if at all, in such difficult circumstances leads to extremely poor outcomes for the neonates. The management of delivery of infants with airway obstruction differs in many ways from that of adults and has been detailed by Harless et al. [2]. While ultrasound and magnetic resonance imaging (MRI) allow for superbly detailed examination of these masses, clinically executing the delivery of these neonates remains very challenging and requires extensive collaboration among many teams. The Ex Utero Intrapartum Treatment (EXIT) procedure, the successor to the Operation on Placental Support (OOPS) intervention, is a procedure aimed at delivering infants safely that have severely debilitating congenital disorders or other disease processes which otherwise may be fatal. As described in the name of the procedure, the goal is to provide reliable airway treatment externally through the uterus to the fetus prior to delivery [3,4].
The most common indication for the EXIT procedure is congenital airway obstruction, including high airway obstructions and neck masses such as lymphangiomas and teratomas. Other indications include intrathoracic lesions, lung and mediastinal masses, severe bilateral pleural effusions, pulmonary agenesis, diaphragmatic hernias, vascular access in preparation for extracorporeal membrane oxygenation (ECMO), and conjoined twins [1,3,4]. The EXIT procedure was initially designed and performed for the fetus with airway concerns that may prevent survival upon delivery [5]. The fundamental goal is to provide continuous uteroplacental support for the fetus until a definitive airway is secured or a surgical procedure is performed [3,4]. The use of EXIT in a variety of new interventions continues to grow as there are advances in neonatal and obstetrical management. The duration of uteroplacental per-fusion continues to be pushed longer and longer, allowing for ever more sophisticated procedures to be performed on the fetus, and thus increasing the chances of survival. According to Rahbar et al., “the fetal gas exchange can be supported by ex utero placental circulation for 60 minutes [6].” Also, very importantly, advanced anesthetics are being used in a relatively safe and well-tolerated fashion on the mother of the fetus to avoid increasing the mother’s risk. Maternal anesthetic considerations during the EXIT procedure are numerous, including anxiolysis, pain control, vascular access and advanced hemo-dynamic monitoring, aspiration and PONV prophylaxis, general versus neuraxial anesthesia, uterine tone, and prevention of post-partum hemorrhage [7]. This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks’ gestation requiring a multidisciplinary decision to use a combination of EXIT and airway palliation at cesarean section. This infant did not require support with ECMO.
Case Report
We present the case of a 22-year-old G1P0 woman with past medical history of morbid obesity (body mass index of 54 kg/m2) who was admitted for an EXIT procedure due to a large fetal neck mass (Figure 1) found on 28-week ultrasound. The ultrasound prior to delivery demonstrated a rapidly growing 20.1×9.7×18.2 cm cystic hygroma or lymphangioma, involving the left cheek and extending to the chest and lower abdomen. A fetal magnetic resonance imaging (MRI) study showed a large mass that wrapped around the tracheoesophageal complex, extended into the mediastinum along the left aspect of the trachea, and had a demonstrable mass effect on the mouth, nose, and nasal cavity with rightward displacement (Figure 2).
In preparation for the patient’s delivery, a large multidisciplinary team was assembled. The patient had a score of 8 on the Tracheoesophageal Displacement Index, which measures the lateral and ventral displacements of the trachea and esophagus in relation to the cervical spine [8]. The prenatal scans were reviewed at length and there was extensive discussion regarding the most appropriate plan for delivery. Ultimately, it was decided that an EXIT procedure was to be performed due to the potential for severe fetal compromise.
The patient was scheduled for her EXIT procedure at 37 weeks. She received standard obstetrical pre-medications and was taken to the largest operating room in the institution, which in addition to the normal surgical setup, also had a neonatal surgical bed and ECMO circuit immediately available. We administered a narcotic-only spinal block with 100 mcg morphine and 15 mcg fentanyl. The patient was placed in the left uterine displacement of 30 degrees to decrease aortocaval compression and 2 large-bore intravenous lines and an arterial line were placed.
The patient was induced in rapid-sequence fashion and an endotracheal tube was successfully inserted. Maintenance of anesthesia was via total intravenous anesthesia (TIVA) with 150 mcg/kg/min propofol infusion and 0.1 mcg/kg/min remifentanil infusion. The patient’s mean arterial pressure was kept within 10% of baseline with a phenylephrine titration.
Two minutes prior to hysterotomy, the TIVA was decreased to 25 mcg/kg/min propofol and 2 minimum alveolar concentrations (MAC) of the volatile anesthetic sevoflurane were initiated in addition to a nitroglycerin drip at 100 mcg/min. A small hysterotomy incision was performed and warmed saline was inserted via a Belmont® Rapid Infuser catheter into the uterus. The hysterotomy incision was extended and the infant’s head, neck, and right shoulder were delivered, while a sterile warming blanket was placed over the remainder of the uterine incision. The infant received an intramuscular injection of atropine, vecuronium, and fentanyl and the pediatric otolaryngology surgeon began to secure the airway via the oral cavity.
Using many advanced airway tools, the time from initiation of laryngoscopy to securing the airway was 12 min. A combination of video laryngoscopy, rigid bronchoscopy, and fiberoptic advanced airway equipment were utilized with success, followed by clamping of the umbilical cord and full delivery of a baby boy. Sevoflurane and nitroglycerin were promptly discontinued and full TIVA via propofol and remifentanil infusions were resumed. The patient received an intravenous bolus of oxytocin, intramuscular carboprost tromethamine, and intramuscular methylergonovine with return of firm uterine tone within 1 min. The remainder of the cesarean section was unremarkable, with 1 L of estimated blood loss and the patient was successfully extubated at the end of the procedure. She was discharged from the hospital on postoperative day 3. The baby underwent debulking and debridement of the cystic neck mass on day 2. Unfortunately, the baby died from fulminant sepsis secondary to femoral central-line infection on day 4.
Discussion
Ex Utero Intrapartum Treatment remains a complex procedure involving significant planning and resources, and it is performed infrequently even at major medical centers across the U.S. EXIT-to-airway, EXIT-to-ECMO, EXIT-to-separation, and EXIT-to-resection are all possibilities depending on the fetal findings on hysterotomy and exposure. Although our case did not require ECMO, a potential failed EXIT-to-airway procedure still necessitated significant planning with pediatric cardiothoracic surgery and perfusionists prior to day of surgery and for these teams to be present with equipment and prepared for emergent EXIT-to-ECMO on the day of surgery. EXIT procedures are of high interest due to their infrequency, high acuity for both mother and infant, and unique anesthetic considerations for uterine tone which changes rapidly during the case.
Anesthesia for an EXIT procedure must focus on both maternal and fetal well-being. Maternal pain control intra- and post-operatively remains a high priority. Options include spinal with intrathecal opioids, CSE with intrathecal or epidural opioids, IV analgesics, and regional anesthetic blocks (e.g., Quadratus Lumborum or Transverse Abdominal Plane blocks). We chose to administer an opioid-only spinal prior to induction as the plan was to induce general anesthesia for patient comfort and anxiety, but also there would be no indwelling catheter in the event of peri-partum hemorrhage and coagulopathy. Institutionally, we routinely remove epidurals prior to leaving the operating room so longer duration analgesia is accomplished with intrathecal morphine. Arterial access remains critical for close maternal blood pressure control to ensure adequate uteroplacental oxygen delivery to the fetus. TIVA using a propofol infusion prior to hysterotomy and after delivery was chosen to help with maternal postoperative nausea and vomiting prevention as the surgery overall was expected to require a long-acting general anesthetic. Remifentanil, on the other hand, was used not only for maternal comfort and hemodynamic stability, but has been shown to have transplacental passage, thus helping with fetal analgesia and immobility during surgery or airway manipulation [9].
Uterine tone is an important anesthetic consideration as one must allow maximal uterine relaxation for surgical exposure and fetal airway manipulation with possible ECMO cannulation, but also realizing that strong uterine tone will be critical immediately following delivery to prevent severe post-partum hemorrhage secondary to atony. Therefore, inhaled volatile anesthetics were only used briefly during the surgery for complete relaxation but at a higher MAC than needed for routine surgeries under general anesthesia. Up to 3–4 MAC can accomplish uterine relaxation but with risk of fetal hypoxia and acidosis from decreased uteroplacental blood flow as shown in animal studies if maintained for even 15 min [10]. In addition, nitroglycerin was used for complete uterine relaxation as it has a quick onset and short half-life. Notably, care must be taken with a nitroglycerin infusion as tachyphylaxis can develop, thus requiring higher doses with possible maternal headaches, hypotension, dizziness, pulmonary edema, and methemoglobinemia [11].
Fetal anesthetic considerations include analgesia, fetal monitoring, proper uteroplacental blood flow via tight maternal blood pressure control, maintaining placental attachment, administering intramuscular paralytic and anti-bradycardic medications, and adequate relaxation during airway instrumentation. A Belmont Rapid Infuser® can be used to continuously fill the uterus with crystalloid fluids. This helps with temperature control inside the uterus, preventing premature placental separation and maintaining the uterine cavity to prevent umbilical cord spasm or compression, which could be detrimental to the fetus [12]. One must be aware that prolonged uterine irrigation with warmed crystalloid can lead to maternal absorption through the venous plexuses and pulmonary edema [13].
Despite careful planning and extensive measures to help fetal survival, newborn deaths following the EXIT procedure are not uncommon. In our case, a central-line infection was the cause of death following a successful EXIT-to-airway procedure. Central-line-associated bloodstream infections account for up to 28 000 deaths per year and considerable costs even with vigilant precautions [14]. More commonly, fetal deaths following EXIT procedure are related to severe pulmonary hypoplasia and immaturity [9]. Maternal outcomes following EXIT appear similar to those of a routine cesarean section but with overall increased blood loss. Ultimately, EXIT is a potentially fetal life-saving procedure that requires a multidisciplinary team, careful planning, and an anesthetic tailored to maternal and fetal comfort and outcomes.
Conclusions
This report has shown the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case has shown the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Figure 1. Delivery of an infant at 37 weeks’ gestation with airway obstruction due to cystic hygroma. The infant is shown at delivery following airway intubation. A large cystic hygroma of the neck is shown, measuring 20.1×9.7×18.2 cm by ultrasound.
Figure 2. A sagittal magnetic resonance image (MRI) of the infant at 37 weeks’ gestation. The MRI shows a large neck mass (left) consistent with a cystic hygroma, measuring 15.8×14×9 cm by MRI. | Intravenous (not otherwise specified) | DrugAdministrationRoute | CC BY-NC-ND | 33388739 | 19,167,263 | 2021-01-03 |
What was the administration route of drug 'REMIFENTANIL'? | Delivery of an Infant with Airway Compression Due to Cystic Hygroma at 37 Weeks' Gestation Requiring a Multidisciplinary Decision to Use a Combination of Ex Utero Intrapartum Treatment (EXIT) and Airway Palliation at Cesarean Section.
BACKGROUND This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks' gestation requiring a multidisciplinary decision to use a combination of ex utero intrapartum treatment (EXIT) and airway palliation at cesarean section. This infant did not require support with extracorporeal membrane oxygenation (ECMO). CASE REPORT A 22-year-old G1P0 woman with past medical history of morbid obesity underwent an EXIT procedure due to a large fetal neck mass. Anesthesia included a narcotic-only single-shot spinal, total intravenous anesthesia (TIVA) was used for maintenance, and high-dose volatile anesthetics and nitroglycerin infusion was used for complete uterine relaxation. The infant's airway was secured by the otolaryngologist, after which delivery was completed. Sevoflurane and nitroglycerin were discontinued and the previous TIVA was restarted. Uterotonics were aggressively administered to prevent uterine atony, and the patient was extubated. CONCLUSIONS This report shows the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case demonstrates the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Background
Morbidity and mortality are significantly elevated in deliveries of neonates with undiagnosed fetal neck masses [1]. Failure to secure the airway in a timely fashion, if at all, in such difficult circumstances leads to extremely poor outcomes for the neonates. The management of delivery of infants with airway obstruction differs in many ways from that of adults and has been detailed by Harless et al. [2]. While ultrasound and magnetic resonance imaging (MRI) allow for superbly detailed examination of these masses, clinically executing the delivery of these neonates remains very challenging and requires extensive collaboration among many teams. The Ex Utero Intrapartum Treatment (EXIT) procedure, the successor to the Operation on Placental Support (OOPS) intervention, is a procedure aimed at delivering infants safely that have severely debilitating congenital disorders or other disease processes which otherwise may be fatal. As described in the name of the procedure, the goal is to provide reliable airway treatment externally through the uterus to the fetus prior to delivery [3,4].
The most common indication for the EXIT procedure is congenital airway obstruction, including high airway obstructions and neck masses such as lymphangiomas and teratomas. Other indications include intrathoracic lesions, lung and mediastinal masses, severe bilateral pleural effusions, pulmonary agenesis, diaphragmatic hernias, vascular access in preparation for extracorporeal membrane oxygenation (ECMO), and conjoined twins [1,3,4]. The EXIT procedure was initially designed and performed for the fetus with airway concerns that may prevent survival upon delivery [5]. The fundamental goal is to provide continuous uteroplacental support for the fetus until a definitive airway is secured or a surgical procedure is performed [3,4]. The use of EXIT in a variety of new interventions continues to grow as there are advances in neonatal and obstetrical management. The duration of uteroplacental per-fusion continues to be pushed longer and longer, allowing for ever more sophisticated procedures to be performed on the fetus, and thus increasing the chances of survival. According to Rahbar et al., “the fetal gas exchange can be supported by ex utero placental circulation for 60 minutes [6].” Also, very importantly, advanced anesthetics are being used in a relatively safe and well-tolerated fashion on the mother of the fetus to avoid increasing the mother’s risk. Maternal anesthetic considerations during the EXIT procedure are numerous, including anxiolysis, pain control, vascular access and advanced hemo-dynamic monitoring, aspiration and PONV prophylaxis, general versus neuraxial anesthesia, uterine tone, and prevention of post-partum hemorrhage [7]. This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks’ gestation requiring a multidisciplinary decision to use a combination of EXIT and airway palliation at cesarean section. This infant did not require support with ECMO.
Case Report
We present the case of a 22-year-old G1P0 woman with past medical history of morbid obesity (body mass index of 54 kg/m2) who was admitted for an EXIT procedure due to a large fetal neck mass (Figure 1) found on 28-week ultrasound. The ultrasound prior to delivery demonstrated a rapidly growing 20.1×9.7×18.2 cm cystic hygroma or lymphangioma, involving the left cheek and extending to the chest and lower abdomen. A fetal magnetic resonance imaging (MRI) study showed a large mass that wrapped around the tracheoesophageal complex, extended into the mediastinum along the left aspect of the trachea, and had a demonstrable mass effect on the mouth, nose, and nasal cavity with rightward displacement (Figure 2).
In preparation for the patient’s delivery, a large multidisciplinary team was assembled. The patient had a score of 8 on the Tracheoesophageal Displacement Index, which measures the lateral and ventral displacements of the trachea and esophagus in relation to the cervical spine [8]. The prenatal scans were reviewed at length and there was extensive discussion regarding the most appropriate plan for delivery. Ultimately, it was decided that an EXIT procedure was to be performed due to the potential for severe fetal compromise.
The patient was scheduled for her EXIT procedure at 37 weeks. She received standard obstetrical pre-medications and was taken to the largest operating room in the institution, which in addition to the normal surgical setup, also had a neonatal surgical bed and ECMO circuit immediately available. We administered a narcotic-only spinal block with 100 mcg morphine and 15 mcg fentanyl. The patient was placed in the left uterine displacement of 30 degrees to decrease aortocaval compression and 2 large-bore intravenous lines and an arterial line were placed.
The patient was induced in rapid-sequence fashion and an endotracheal tube was successfully inserted. Maintenance of anesthesia was via total intravenous anesthesia (TIVA) with 150 mcg/kg/min propofol infusion and 0.1 mcg/kg/min remifentanil infusion. The patient’s mean arterial pressure was kept within 10% of baseline with a phenylephrine titration.
Two minutes prior to hysterotomy, the TIVA was decreased to 25 mcg/kg/min propofol and 2 minimum alveolar concentrations (MAC) of the volatile anesthetic sevoflurane were initiated in addition to a nitroglycerin drip at 100 mcg/min. A small hysterotomy incision was performed and warmed saline was inserted via a Belmont® Rapid Infuser catheter into the uterus. The hysterotomy incision was extended and the infant’s head, neck, and right shoulder were delivered, while a sterile warming blanket was placed over the remainder of the uterine incision. The infant received an intramuscular injection of atropine, vecuronium, and fentanyl and the pediatric otolaryngology surgeon began to secure the airway via the oral cavity.
Using many advanced airway tools, the time from initiation of laryngoscopy to securing the airway was 12 min. A combination of video laryngoscopy, rigid bronchoscopy, and fiberoptic advanced airway equipment were utilized with success, followed by clamping of the umbilical cord and full delivery of a baby boy. Sevoflurane and nitroglycerin were promptly discontinued and full TIVA via propofol and remifentanil infusions were resumed. The patient received an intravenous bolus of oxytocin, intramuscular carboprost tromethamine, and intramuscular methylergonovine with return of firm uterine tone within 1 min. The remainder of the cesarean section was unremarkable, with 1 L of estimated blood loss and the patient was successfully extubated at the end of the procedure. She was discharged from the hospital on postoperative day 3. The baby underwent debulking and debridement of the cystic neck mass on day 2. Unfortunately, the baby died from fulminant sepsis secondary to femoral central-line infection on day 4.
Discussion
Ex Utero Intrapartum Treatment remains a complex procedure involving significant planning and resources, and it is performed infrequently even at major medical centers across the U.S. EXIT-to-airway, EXIT-to-ECMO, EXIT-to-separation, and EXIT-to-resection are all possibilities depending on the fetal findings on hysterotomy and exposure. Although our case did not require ECMO, a potential failed EXIT-to-airway procedure still necessitated significant planning with pediatric cardiothoracic surgery and perfusionists prior to day of surgery and for these teams to be present with equipment and prepared for emergent EXIT-to-ECMO on the day of surgery. EXIT procedures are of high interest due to their infrequency, high acuity for both mother and infant, and unique anesthetic considerations for uterine tone which changes rapidly during the case.
Anesthesia for an EXIT procedure must focus on both maternal and fetal well-being. Maternal pain control intra- and post-operatively remains a high priority. Options include spinal with intrathecal opioids, CSE with intrathecal or epidural opioids, IV analgesics, and regional anesthetic blocks (e.g., Quadratus Lumborum or Transverse Abdominal Plane blocks). We chose to administer an opioid-only spinal prior to induction as the plan was to induce general anesthesia for patient comfort and anxiety, but also there would be no indwelling catheter in the event of peri-partum hemorrhage and coagulopathy. Institutionally, we routinely remove epidurals prior to leaving the operating room so longer duration analgesia is accomplished with intrathecal morphine. Arterial access remains critical for close maternal blood pressure control to ensure adequate uteroplacental oxygen delivery to the fetus. TIVA using a propofol infusion prior to hysterotomy and after delivery was chosen to help with maternal postoperative nausea and vomiting prevention as the surgery overall was expected to require a long-acting general anesthetic. Remifentanil, on the other hand, was used not only for maternal comfort and hemodynamic stability, but has been shown to have transplacental passage, thus helping with fetal analgesia and immobility during surgery or airway manipulation [9].
Uterine tone is an important anesthetic consideration as one must allow maximal uterine relaxation for surgical exposure and fetal airway manipulation with possible ECMO cannulation, but also realizing that strong uterine tone will be critical immediately following delivery to prevent severe post-partum hemorrhage secondary to atony. Therefore, inhaled volatile anesthetics were only used briefly during the surgery for complete relaxation but at a higher MAC than needed for routine surgeries under general anesthesia. Up to 3–4 MAC can accomplish uterine relaxation but with risk of fetal hypoxia and acidosis from decreased uteroplacental blood flow as shown in animal studies if maintained for even 15 min [10]. In addition, nitroglycerin was used for complete uterine relaxation as it has a quick onset and short half-life. Notably, care must be taken with a nitroglycerin infusion as tachyphylaxis can develop, thus requiring higher doses with possible maternal headaches, hypotension, dizziness, pulmonary edema, and methemoglobinemia [11].
Fetal anesthetic considerations include analgesia, fetal monitoring, proper uteroplacental blood flow via tight maternal blood pressure control, maintaining placental attachment, administering intramuscular paralytic and anti-bradycardic medications, and adequate relaxation during airway instrumentation. A Belmont Rapid Infuser® can be used to continuously fill the uterus with crystalloid fluids. This helps with temperature control inside the uterus, preventing premature placental separation and maintaining the uterine cavity to prevent umbilical cord spasm or compression, which could be detrimental to the fetus [12]. One must be aware that prolonged uterine irrigation with warmed crystalloid can lead to maternal absorption through the venous plexuses and pulmonary edema [13].
Despite careful planning and extensive measures to help fetal survival, newborn deaths following the EXIT procedure are not uncommon. In our case, a central-line infection was the cause of death following a successful EXIT-to-airway procedure. Central-line-associated bloodstream infections account for up to 28 000 deaths per year and considerable costs even with vigilant precautions [14]. More commonly, fetal deaths following EXIT procedure are related to severe pulmonary hypoplasia and immaturity [9]. Maternal outcomes following EXIT appear similar to those of a routine cesarean section but with overall increased blood loss. Ultimately, EXIT is a potentially fetal life-saving procedure that requires a multidisciplinary team, careful planning, and an anesthetic tailored to maternal and fetal comfort and outcomes.
Conclusions
This report has shown the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case has shown the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Figure 1. Delivery of an infant at 37 weeks’ gestation with airway obstruction due to cystic hygroma. The infant is shown at delivery following airway intubation. A large cystic hygroma of the neck is shown, measuring 20.1×9.7×18.2 cm by ultrasound.
Figure 2. A sagittal magnetic resonance image (MRI) of the infant at 37 weeks’ gestation. The MRI shows a large neck mass (left) consistent with a cystic hygroma, measuring 15.8×14×9 cm by MRI. | Intravenous (not otherwise specified) | DrugAdministrationRoute | CC BY-NC-ND | 33388739 | 19,167,263 | 2021-01-03 |
What was the dosage of drug 'FENTANYL'? | Delivery of an Infant with Airway Compression Due to Cystic Hygroma at 37 Weeks' Gestation Requiring a Multidisciplinary Decision to Use a Combination of Ex Utero Intrapartum Treatment (EXIT) and Airway Palliation at Cesarean Section.
BACKGROUND This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks' gestation requiring a multidisciplinary decision to use a combination of ex utero intrapartum treatment (EXIT) and airway palliation at cesarean section. This infant did not require support with extracorporeal membrane oxygenation (ECMO). CASE REPORT A 22-year-old G1P0 woman with past medical history of morbid obesity underwent an EXIT procedure due to a large fetal neck mass. Anesthesia included a narcotic-only single-shot spinal, total intravenous anesthesia (TIVA) was used for maintenance, and high-dose volatile anesthetics and nitroglycerin infusion was used for complete uterine relaxation. The infant's airway was secured by the otolaryngologist, after which delivery was completed. Sevoflurane and nitroglycerin were discontinued and the previous TIVA was restarted. Uterotonics were aggressively administered to prevent uterine atony, and the patient was extubated. CONCLUSIONS This report shows the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case demonstrates the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Background
Morbidity and mortality are significantly elevated in deliveries of neonates with undiagnosed fetal neck masses [1]. Failure to secure the airway in a timely fashion, if at all, in such difficult circumstances leads to extremely poor outcomes for the neonates. The management of delivery of infants with airway obstruction differs in many ways from that of adults and has been detailed by Harless et al. [2]. While ultrasound and magnetic resonance imaging (MRI) allow for superbly detailed examination of these masses, clinically executing the delivery of these neonates remains very challenging and requires extensive collaboration among many teams. The Ex Utero Intrapartum Treatment (EXIT) procedure, the successor to the Operation on Placental Support (OOPS) intervention, is a procedure aimed at delivering infants safely that have severely debilitating congenital disorders or other disease processes which otherwise may be fatal. As described in the name of the procedure, the goal is to provide reliable airway treatment externally through the uterus to the fetus prior to delivery [3,4].
The most common indication for the EXIT procedure is congenital airway obstruction, including high airway obstructions and neck masses such as lymphangiomas and teratomas. Other indications include intrathoracic lesions, lung and mediastinal masses, severe bilateral pleural effusions, pulmonary agenesis, diaphragmatic hernias, vascular access in preparation for extracorporeal membrane oxygenation (ECMO), and conjoined twins [1,3,4]. The EXIT procedure was initially designed and performed for the fetus with airway concerns that may prevent survival upon delivery [5]. The fundamental goal is to provide continuous uteroplacental support for the fetus until a definitive airway is secured or a surgical procedure is performed [3,4]. The use of EXIT in a variety of new interventions continues to grow as there are advances in neonatal and obstetrical management. The duration of uteroplacental per-fusion continues to be pushed longer and longer, allowing for ever more sophisticated procedures to be performed on the fetus, and thus increasing the chances of survival. According to Rahbar et al., “the fetal gas exchange can be supported by ex utero placental circulation for 60 minutes [6].” Also, very importantly, advanced anesthetics are being used in a relatively safe and well-tolerated fashion on the mother of the fetus to avoid increasing the mother’s risk. Maternal anesthetic considerations during the EXIT procedure are numerous, including anxiolysis, pain control, vascular access and advanced hemo-dynamic monitoring, aspiration and PONV prophylaxis, general versus neuraxial anesthesia, uterine tone, and prevention of post-partum hemorrhage [7]. This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks’ gestation requiring a multidisciplinary decision to use a combination of EXIT and airway palliation at cesarean section. This infant did not require support with ECMO.
Case Report
We present the case of a 22-year-old G1P0 woman with past medical history of morbid obesity (body mass index of 54 kg/m2) who was admitted for an EXIT procedure due to a large fetal neck mass (Figure 1) found on 28-week ultrasound. The ultrasound prior to delivery demonstrated a rapidly growing 20.1×9.7×18.2 cm cystic hygroma or lymphangioma, involving the left cheek and extending to the chest and lower abdomen. A fetal magnetic resonance imaging (MRI) study showed a large mass that wrapped around the tracheoesophageal complex, extended into the mediastinum along the left aspect of the trachea, and had a demonstrable mass effect on the mouth, nose, and nasal cavity with rightward displacement (Figure 2).
In preparation for the patient’s delivery, a large multidisciplinary team was assembled. The patient had a score of 8 on the Tracheoesophageal Displacement Index, which measures the lateral and ventral displacements of the trachea and esophagus in relation to the cervical spine [8]. The prenatal scans were reviewed at length and there was extensive discussion regarding the most appropriate plan for delivery. Ultimately, it was decided that an EXIT procedure was to be performed due to the potential for severe fetal compromise.
The patient was scheduled for her EXIT procedure at 37 weeks. She received standard obstetrical pre-medications and was taken to the largest operating room in the institution, which in addition to the normal surgical setup, also had a neonatal surgical bed and ECMO circuit immediately available. We administered a narcotic-only spinal block with 100 mcg morphine and 15 mcg fentanyl. The patient was placed in the left uterine displacement of 30 degrees to decrease aortocaval compression and 2 large-bore intravenous lines and an arterial line were placed.
The patient was induced in rapid-sequence fashion and an endotracheal tube was successfully inserted. Maintenance of anesthesia was via total intravenous anesthesia (TIVA) with 150 mcg/kg/min propofol infusion and 0.1 mcg/kg/min remifentanil infusion. The patient’s mean arterial pressure was kept within 10% of baseline with a phenylephrine titration.
Two minutes prior to hysterotomy, the TIVA was decreased to 25 mcg/kg/min propofol and 2 minimum alveolar concentrations (MAC) of the volatile anesthetic sevoflurane were initiated in addition to a nitroglycerin drip at 100 mcg/min. A small hysterotomy incision was performed and warmed saline was inserted via a Belmont® Rapid Infuser catheter into the uterus. The hysterotomy incision was extended and the infant’s head, neck, and right shoulder were delivered, while a sterile warming blanket was placed over the remainder of the uterine incision. The infant received an intramuscular injection of atropine, vecuronium, and fentanyl and the pediatric otolaryngology surgeon began to secure the airway via the oral cavity.
Using many advanced airway tools, the time from initiation of laryngoscopy to securing the airway was 12 min. A combination of video laryngoscopy, rigid bronchoscopy, and fiberoptic advanced airway equipment were utilized with success, followed by clamping of the umbilical cord and full delivery of a baby boy. Sevoflurane and nitroglycerin were promptly discontinued and full TIVA via propofol and remifentanil infusions were resumed. The patient received an intravenous bolus of oxytocin, intramuscular carboprost tromethamine, and intramuscular methylergonovine with return of firm uterine tone within 1 min. The remainder of the cesarean section was unremarkable, with 1 L of estimated blood loss and the patient was successfully extubated at the end of the procedure. She was discharged from the hospital on postoperative day 3. The baby underwent debulking and debridement of the cystic neck mass on day 2. Unfortunately, the baby died from fulminant sepsis secondary to femoral central-line infection on day 4.
Discussion
Ex Utero Intrapartum Treatment remains a complex procedure involving significant planning and resources, and it is performed infrequently even at major medical centers across the U.S. EXIT-to-airway, EXIT-to-ECMO, EXIT-to-separation, and EXIT-to-resection are all possibilities depending on the fetal findings on hysterotomy and exposure. Although our case did not require ECMO, a potential failed EXIT-to-airway procedure still necessitated significant planning with pediatric cardiothoracic surgery and perfusionists prior to day of surgery and for these teams to be present with equipment and prepared for emergent EXIT-to-ECMO on the day of surgery. EXIT procedures are of high interest due to their infrequency, high acuity for both mother and infant, and unique anesthetic considerations for uterine tone which changes rapidly during the case.
Anesthesia for an EXIT procedure must focus on both maternal and fetal well-being. Maternal pain control intra- and post-operatively remains a high priority. Options include spinal with intrathecal opioids, CSE with intrathecal or epidural opioids, IV analgesics, and regional anesthetic blocks (e.g., Quadratus Lumborum or Transverse Abdominal Plane blocks). We chose to administer an opioid-only spinal prior to induction as the plan was to induce general anesthesia for patient comfort and anxiety, but also there would be no indwelling catheter in the event of peri-partum hemorrhage and coagulopathy. Institutionally, we routinely remove epidurals prior to leaving the operating room so longer duration analgesia is accomplished with intrathecal morphine. Arterial access remains critical for close maternal blood pressure control to ensure adequate uteroplacental oxygen delivery to the fetus. TIVA using a propofol infusion prior to hysterotomy and after delivery was chosen to help with maternal postoperative nausea and vomiting prevention as the surgery overall was expected to require a long-acting general anesthetic. Remifentanil, on the other hand, was used not only for maternal comfort and hemodynamic stability, but has been shown to have transplacental passage, thus helping with fetal analgesia and immobility during surgery or airway manipulation [9].
Uterine tone is an important anesthetic consideration as one must allow maximal uterine relaxation for surgical exposure and fetal airway manipulation with possible ECMO cannulation, but also realizing that strong uterine tone will be critical immediately following delivery to prevent severe post-partum hemorrhage secondary to atony. Therefore, inhaled volatile anesthetics were only used briefly during the surgery for complete relaxation but at a higher MAC than needed for routine surgeries under general anesthesia. Up to 3–4 MAC can accomplish uterine relaxation but with risk of fetal hypoxia and acidosis from decreased uteroplacental blood flow as shown in animal studies if maintained for even 15 min [10]. In addition, nitroglycerin was used for complete uterine relaxation as it has a quick onset and short half-life. Notably, care must be taken with a nitroglycerin infusion as tachyphylaxis can develop, thus requiring higher doses with possible maternal headaches, hypotension, dizziness, pulmonary edema, and methemoglobinemia [11].
Fetal anesthetic considerations include analgesia, fetal monitoring, proper uteroplacental blood flow via tight maternal blood pressure control, maintaining placental attachment, administering intramuscular paralytic and anti-bradycardic medications, and adequate relaxation during airway instrumentation. A Belmont Rapid Infuser® can be used to continuously fill the uterus with crystalloid fluids. This helps with temperature control inside the uterus, preventing premature placental separation and maintaining the uterine cavity to prevent umbilical cord spasm or compression, which could be detrimental to the fetus [12]. One must be aware that prolonged uterine irrigation with warmed crystalloid can lead to maternal absorption through the venous plexuses and pulmonary edema [13].
Despite careful planning and extensive measures to help fetal survival, newborn deaths following the EXIT procedure are not uncommon. In our case, a central-line infection was the cause of death following a successful EXIT-to-airway procedure. Central-line-associated bloodstream infections account for up to 28 000 deaths per year and considerable costs even with vigilant precautions [14]. More commonly, fetal deaths following EXIT procedure are related to severe pulmonary hypoplasia and immaturity [9]. Maternal outcomes following EXIT appear similar to those of a routine cesarean section but with overall increased blood loss. Ultimately, EXIT is a potentially fetal life-saving procedure that requires a multidisciplinary team, careful planning, and an anesthetic tailored to maternal and fetal comfort and outcomes.
Conclusions
This report has shown the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case has shown the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Figure 1. Delivery of an infant at 37 weeks’ gestation with airway obstruction due to cystic hygroma. The infant is shown at delivery following airway intubation. A large cystic hygroma of the neck is shown, measuring 20.1×9.7×18.2 cm by ultrasound.
Figure 2. A sagittal magnetic resonance image (MRI) of the infant at 37 weeks’ gestation. The MRI shows a large neck mass (left) consistent with a cystic hygroma, measuring 15.8×14×9 cm by MRI. | 15 MICROGRAM | DrugDosageText | CC BY-NC-ND | 33388739 | 19,167,263 | 2021-01-03 |
What was the dosage of drug 'MORPHINE'? | Delivery of an Infant with Airway Compression Due to Cystic Hygroma at 37 Weeks' Gestation Requiring a Multidisciplinary Decision to Use a Combination of Ex Utero Intrapartum Treatment (EXIT) and Airway Palliation at Cesarean Section.
BACKGROUND This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks' gestation requiring a multidisciplinary decision to use a combination of ex utero intrapartum treatment (EXIT) and airway palliation at cesarean section. This infant did not require support with extracorporeal membrane oxygenation (ECMO). CASE REPORT A 22-year-old G1P0 woman with past medical history of morbid obesity underwent an EXIT procedure due to a large fetal neck mass. Anesthesia included a narcotic-only single-shot spinal, total intravenous anesthesia (TIVA) was used for maintenance, and high-dose volatile anesthetics and nitroglycerin infusion was used for complete uterine relaxation. The infant's airway was secured by the otolaryngologist, after which delivery was completed. Sevoflurane and nitroglycerin were discontinued and the previous TIVA was restarted. Uterotonics were aggressively administered to prevent uterine atony, and the patient was extubated. CONCLUSIONS This report shows the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case demonstrates the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Background
Morbidity and mortality are significantly elevated in deliveries of neonates with undiagnosed fetal neck masses [1]. Failure to secure the airway in a timely fashion, if at all, in such difficult circumstances leads to extremely poor outcomes for the neonates. The management of delivery of infants with airway obstruction differs in many ways from that of adults and has been detailed by Harless et al. [2]. While ultrasound and magnetic resonance imaging (MRI) allow for superbly detailed examination of these masses, clinically executing the delivery of these neonates remains very challenging and requires extensive collaboration among many teams. The Ex Utero Intrapartum Treatment (EXIT) procedure, the successor to the Operation on Placental Support (OOPS) intervention, is a procedure aimed at delivering infants safely that have severely debilitating congenital disorders or other disease processes which otherwise may be fatal. As described in the name of the procedure, the goal is to provide reliable airway treatment externally through the uterus to the fetus prior to delivery [3,4].
The most common indication for the EXIT procedure is congenital airway obstruction, including high airway obstructions and neck masses such as lymphangiomas and teratomas. Other indications include intrathoracic lesions, lung and mediastinal masses, severe bilateral pleural effusions, pulmonary agenesis, diaphragmatic hernias, vascular access in preparation for extracorporeal membrane oxygenation (ECMO), and conjoined twins [1,3,4]. The EXIT procedure was initially designed and performed for the fetus with airway concerns that may prevent survival upon delivery [5]. The fundamental goal is to provide continuous uteroplacental support for the fetus until a definitive airway is secured or a surgical procedure is performed [3,4]. The use of EXIT in a variety of new interventions continues to grow as there are advances in neonatal and obstetrical management. The duration of uteroplacental per-fusion continues to be pushed longer and longer, allowing for ever more sophisticated procedures to be performed on the fetus, and thus increasing the chances of survival. According to Rahbar et al., “the fetal gas exchange can be supported by ex utero placental circulation for 60 minutes [6].” Also, very importantly, advanced anesthetics are being used in a relatively safe and well-tolerated fashion on the mother of the fetus to avoid increasing the mother’s risk. Maternal anesthetic considerations during the EXIT procedure are numerous, including anxiolysis, pain control, vascular access and advanced hemo-dynamic monitoring, aspiration and PONV prophylaxis, general versus neuraxial anesthesia, uterine tone, and prevention of post-partum hemorrhage [7]. This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks’ gestation requiring a multidisciplinary decision to use a combination of EXIT and airway palliation at cesarean section. This infant did not require support with ECMO.
Case Report
We present the case of a 22-year-old G1P0 woman with past medical history of morbid obesity (body mass index of 54 kg/m2) who was admitted for an EXIT procedure due to a large fetal neck mass (Figure 1) found on 28-week ultrasound. The ultrasound prior to delivery demonstrated a rapidly growing 20.1×9.7×18.2 cm cystic hygroma or lymphangioma, involving the left cheek and extending to the chest and lower abdomen. A fetal magnetic resonance imaging (MRI) study showed a large mass that wrapped around the tracheoesophageal complex, extended into the mediastinum along the left aspect of the trachea, and had a demonstrable mass effect on the mouth, nose, and nasal cavity with rightward displacement (Figure 2).
In preparation for the patient’s delivery, a large multidisciplinary team was assembled. The patient had a score of 8 on the Tracheoesophageal Displacement Index, which measures the lateral and ventral displacements of the trachea and esophagus in relation to the cervical spine [8]. The prenatal scans were reviewed at length and there was extensive discussion regarding the most appropriate plan for delivery. Ultimately, it was decided that an EXIT procedure was to be performed due to the potential for severe fetal compromise.
The patient was scheduled for her EXIT procedure at 37 weeks. She received standard obstetrical pre-medications and was taken to the largest operating room in the institution, which in addition to the normal surgical setup, also had a neonatal surgical bed and ECMO circuit immediately available. We administered a narcotic-only spinal block with 100 mcg morphine and 15 mcg fentanyl. The patient was placed in the left uterine displacement of 30 degrees to decrease aortocaval compression and 2 large-bore intravenous lines and an arterial line were placed.
The patient was induced in rapid-sequence fashion and an endotracheal tube was successfully inserted. Maintenance of anesthesia was via total intravenous anesthesia (TIVA) with 150 mcg/kg/min propofol infusion and 0.1 mcg/kg/min remifentanil infusion. The patient’s mean arterial pressure was kept within 10% of baseline with a phenylephrine titration.
Two minutes prior to hysterotomy, the TIVA was decreased to 25 mcg/kg/min propofol and 2 minimum alveolar concentrations (MAC) of the volatile anesthetic sevoflurane were initiated in addition to a nitroglycerin drip at 100 mcg/min. A small hysterotomy incision was performed and warmed saline was inserted via a Belmont® Rapid Infuser catheter into the uterus. The hysterotomy incision was extended and the infant’s head, neck, and right shoulder were delivered, while a sterile warming blanket was placed over the remainder of the uterine incision. The infant received an intramuscular injection of atropine, vecuronium, and fentanyl and the pediatric otolaryngology surgeon began to secure the airway via the oral cavity.
Using many advanced airway tools, the time from initiation of laryngoscopy to securing the airway was 12 min. A combination of video laryngoscopy, rigid bronchoscopy, and fiberoptic advanced airway equipment were utilized with success, followed by clamping of the umbilical cord and full delivery of a baby boy. Sevoflurane and nitroglycerin were promptly discontinued and full TIVA via propofol and remifentanil infusions were resumed. The patient received an intravenous bolus of oxytocin, intramuscular carboprost tromethamine, and intramuscular methylergonovine with return of firm uterine tone within 1 min. The remainder of the cesarean section was unremarkable, with 1 L of estimated blood loss and the patient was successfully extubated at the end of the procedure. She was discharged from the hospital on postoperative day 3. The baby underwent debulking and debridement of the cystic neck mass on day 2. Unfortunately, the baby died from fulminant sepsis secondary to femoral central-line infection on day 4.
Discussion
Ex Utero Intrapartum Treatment remains a complex procedure involving significant planning and resources, and it is performed infrequently even at major medical centers across the U.S. EXIT-to-airway, EXIT-to-ECMO, EXIT-to-separation, and EXIT-to-resection are all possibilities depending on the fetal findings on hysterotomy and exposure. Although our case did not require ECMO, a potential failed EXIT-to-airway procedure still necessitated significant planning with pediatric cardiothoracic surgery and perfusionists prior to day of surgery and for these teams to be present with equipment and prepared for emergent EXIT-to-ECMO on the day of surgery. EXIT procedures are of high interest due to their infrequency, high acuity for both mother and infant, and unique anesthetic considerations for uterine tone which changes rapidly during the case.
Anesthesia for an EXIT procedure must focus on both maternal and fetal well-being. Maternal pain control intra- and post-operatively remains a high priority. Options include spinal with intrathecal opioids, CSE with intrathecal or epidural opioids, IV analgesics, and regional anesthetic blocks (e.g., Quadratus Lumborum or Transverse Abdominal Plane blocks). We chose to administer an opioid-only spinal prior to induction as the plan was to induce general anesthesia for patient comfort and anxiety, but also there would be no indwelling catheter in the event of peri-partum hemorrhage and coagulopathy. Institutionally, we routinely remove epidurals prior to leaving the operating room so longer duration analgesia is accomplished with intrathecal morphine. Arterial access remains critical for close maternal blood pressure control to ensure adequate uteroplacental oxygen delivery to the fetus. TIVA using a propofol infusion prior to hysterotomy and after delivery was chosen to help with maternal postoperative nausea and vomiting prevention as the surgery overall was expected to require a long-acting general anesthetic. Remifentanil, on the other hand, was used not only for maternal comfort and hemodynamic stability, but has been shown to have transplacental passage, thus helping with fetal analgesia and immobility during surgery or airway manipulation [9].
Uterine tone is an important anesthetic consideration as one must allow maximal uterine relaxation for surgical exposure and fetal airway manipulation with possible ECMO cannulation, but also realizing that strong uterine tone will be critical immediately following delivery to prevent severe post-partum hemorrhage secondary to atony. Therefore, inhaled volatile anesthetics were only used briefly during the surgery for complete relaxation but at a higher MAC than needed for routine surgeries under general anesthesia. Up to 3–4 MAC can accomplish uterine relaxation but with risk of fetal hypoxia and acidosis from decreased uteroplacental blood flow as shown in animal studies if maintained for even 15 min [10]. In addition, nitroglycerin was used for complete uterine relaxation as it has a quick onset and short half-life. Notably, care must be taken with a nitroglycerin infusion as tachyphylaxis can develop, thus requiring higher doses with possible maternal headaches, hypotension, dizziness, pulmonary edema, and methemoglobinemia [11].
Fetal anesthetic considerations include analgesia, fetal monitoring, proper uteroplacental blood flow via tight maternal blood pressure control, maintaining placental attachment, administering intramuscular paralytic and anti-bradycardic medications, and adequate relaxation during airway instrumentation. A Belmont Rapid Infuser® can be used to continuously fill the uterus with crystalloid fluids. This helps with temperature control inside the uterus, preventing premature placental separation and maintaining the uterine cavity to prevent umbilical cord spasm or compression, which could be detrimental to the fetus [12]. One must be aware that prolonged uterine irrigation with warmed crystalloid can lead to maternal absorption through the venous plexuses and pulmonary edema [13].
Despite careful planning and extensive measures to help fetal survival, newborn deaths following the EXIT procedure are not uncommon. In our case, a central-line infection was the cause of death following a successful EXIT-to-airway procedure. Central-line-associated bloodstream infections account for up to 28 000 deaths per year and considerable costs even with vigilant precautions [14]. More commonly, fetal deaths following EXIT procedure are related to severe pulmonary hypoplasia and immaturity [9]. Maternal outcomes following EXIT appear similar to those of a routine cesarean section but with overall increased blood loss. Ultimately, EXIT is a potentially fetal life-saving procedure that requires a multidisciplinary team, careful planning, and an anesthetic tailored to maternal and fetal comfort and outcomes.
Conclusions
This report has shown the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case has shown the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Figure 1. Delivery of an infant at 37 weeks’ gestation with airway obstruction due to cystic hygroma. The infant is shown at delivery following airway intubation. A large cystic hygroma of the neck is shown, measuring 20.1×9.7×18.2 cm by ultrasound.
Figure 2. A sagittal magnetic resonance image (MRI) of the infant at 37 weeks’ gestation. The MRI shows a large neck mass (left) consistent with a cystic hygroma, measuring 15.8×14×9 cm by MRI. | 100 MICROGRAM | DrugDosageText | CC BY-NC-ND | 33388739 | 19,167,263 | 2021-01-03 |
What was the dosage of drug 'NITROGLYCERIN'? | Delivery of an Infant with Airway Compression Due to Cystic Hygroma at 37 Weeks' Gestation Requiring a Multidisciplinary Decision to Use a Combination of Ex Utero Intrapartum Treatment (EXIT) and Airway Palliation at Cesarean Section.
BACKGROUND This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks' gestation requiring a multidisciplinary decision to use a combination of ex utero intrapartum treatment (EXIT) and airway palliation at cesarean section. This infant did not require support with extracorporeal membrane oxygenation (ECMO). CASE REPORT A 22-year-old G1P0 woman with past medical history of morbid obesity underwent an EXIT procedure due to a large fetal neck mass. Anesthesia included a narcotic-only single-shot spinal, total intravenous anesthesia (TIVA) was used for maintenance, and high-dose volatile anesthetics and nitroglycerin infusion was used for complete uterine relaxation. The infant's airway was secured by the otolaryngologist, after which delivery was completed. Sevoflurane and nitroglycerin were discontinued and the previous TIVA was restarted. Uterotonics were aggressively administered to prevent uterine atony, and the patient was extubated. CONCLUSIONS This report shows the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case demonstrates the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Background
Morbidity and mortality are significantly elevated in deliveries of neonates with undiagnosed fetal neck masses [1]. Failure to secure the airway in a timely fashion, if at all, in such difficult circumstances leads to extremely poor outcomes for the neonates. The management of delivery of infants with airway obstruction differs in many ways from that of adults and has been detailed by Harless et al. [2]. While ultrasound and magnetic resonance imaging (MRI) allow for superbly detailed examination of these masses, clinically executing the delivery of these neonates remains very challenging and requires extensive collaboration among many teams. The Ex Utero Intrapartum Treatment (EXIT) procedure, the successor to the Operation on Placental Support (OOPS) intervention, is a procedure aimed at delivering infants safely that have severely debilitating congenital disorders or other disease processes which otherwise may be fatal. As described in the name of the procedure, the goal is to provide reliable airway treatment externally through the uterus to the fetus prior to delivery [3,4].
The most common indication for the EXIT procedure is congenital airway obstruction, including high airway obstructions and neck masses such as lymphangiomas and teratomas. Other indications include intrathoracic lesions, lung and mediastinal masses, severe bilateral pleural effusions, pulmonary agenesis, diaphragmatic hernias, vascular access in preparation for extracorporeal membrane oxygenation (ECMO), and conjoined twins [1,3,4]. The EXIT procedure was initially designed and performed for the fetus with airway concerns that may prevent survival upon delivery [5]. The fundamental goal is to provide continuous uteroplacental support for the fetus until a definitive airway is secured or a surgical procedure is performed [3,4]. The use of EXIT in a variety of new interventions continues to grow as there are advances in neonatal and obstetrical management. The duration of uteroplacental per-fusion continues to be pushed longer and longer, allowing for ever more sophisticated procedures to be performed on the fetus, and thus increasing the chances of survival. According to Rahbar et al., “the fetal gas exchange can be supported by ex utero placental circulation for 60 minutes [6].” Also, very importantly, advanced anesthetics are being used in a relatively safe and well-tolerated fashion on the mother of the fetus to avoid increasing the mother’s risk. Maternal anesthetic considerations during the EXIT procedure are numerous, including anxiolysis, pain control, vascular access and advanced hemo-dynamic monitoring, aspiration and PONV prophylaxis, general versus neuraxial anesthesia, uterine tone, and prevention of post-partum hemorrhage [7]. This report describes a case of delivery of an infant with airway compression due to cystic hygroma at 37 weeks’ gestation requiring a multidisciplinary decision to use a combination of EXIT and airway palliation at cesarean section. This infant did not require support with ECMO.
Case Report
We present the case of a 22-year-old G1P0 woman with past medical history of morbid obesity (body mass index of 54 kg/m2) who was admitted for an EXIT procedure due to a large fetal neck mass (Figure 1) found on 28-week ultrasound. The ultrasound prior to delivery demonstrated a rapidly growing 20.1×9.7×18.2 cm cystic hygroma or lymphangioma, involving the left cheek and extending to the chest and lower abdomen. A fetal magnetic resonance imaging (MRI) study showed a large mass that wrapped around the tracheoesophageal complex, extended into the mediastinum along the left aspect of the trachea, and had a demonstrable mass effect on the mouth, nose, and nasal cavity with rightward displacement (Figure 2).
In preparation for the patient’s delivery, a large multidisciplinary team was assembled. The patient had a score of 8 on the Tracheoesophageal Displacement Index, which measures the lateral and ventral displacements of the trachea and esophagus in relation to the cervical spine [8]. The prenatal scans were reviewed at length and there was extensive discussion regarding the most appropriate plan for delivery. Ultimately, it was decided that an EXIT procedure was to be performed due to the potential for severe fetal compromise.
The patient was scheduled for her EXIT procedure at 37 weeks. She received standard obstetrical pre-medications and was taken to the largest operating room in the institution, which in addition to the normal surgical setup, also had a neonatal surgical bed and ECMO circuit immediately available. We administered a narcotic-only spinal block with 100 mcg morphine and 15 mcg fentanyl. The patient was placed in the left uterine displacement of 30 degrees to decrease aortocaval compression and 2 large-bore intravenous lines and an arterial line were placed.
The patient was induced in rapid-sequence fashion and an endotracheal tube was successfully inserted. Maintenance of anesthesia was via total intravenous anesthesia (TIVA) with 150 mcg/kg/min propofol infusion and 0.1 mcg/kg/min remifentanil infusion. The patient’s mean arterial pressure was kept within 10% of baseline with a phenylephrine titration.
Two minutes prior to hysterotomy, the TIVA was decreased to 25 mcg/kg/min propofol and 2 minimum alveolar concentrations (MAC) of the volatile anesthetic sevoflurane were initiated in addition to a nitroglycerin drip at 100 mcg/min. A small hysterotomy incision was performed and warmed saline was inserted via a Belmont® Rapid Infuser catheter into the uterus. The hysterotomy incision was extended and the infant’s head, neck, and right shoulder were delivered, while a sterile warming blanket was placed over the remainder of the uterine incision. The infant received an intramuscular injection of atropine, vecuronium, and fentanyl and the pediatric otolaryngology surgeon began to secure the airway via the oral cavity.
Using many advanced airway tools, the time from initiation of laryngoscopy to securing the airway was 12 min. A combination of video laryngoscopy, rigid bronchoscopy, and fiberoptic advanced airway equipment were utilized with success, followed by clamping of the umbilical cord and full delivery of a baby boy. Sevoflurane and nitroglycerin were promptly discontinued and full TIVA via propofol and remifentanil infusions were resumed. The patient received an intravenous bolus of oxytocin, intramuscular carboprost tromethamine, and intramuscular methylergonovine with return of firm uterine tone within 1 min. The remainder of the cesarean section was unremarkable, with 1 L of estimated blood loss and the patient was successfully extubated at the end of the procedure. She was discharged from the hospital on postoperative day 3. The baby underwent debulking and debridement of the cystic neck mass on day 2. Unfortunately, the baby died from fulminant sepsis secondary to femoral central-line infection on day 4.
Discussion
Ex Utero Intrapartum Treatment remains a complex procedure involving significant planning and resources, and it is performed infrequently even at major medical centers across the U.S. EXIT-to-airway, EXIT-to-ECMO, EXIT-to-separation, and EXIT-to-resection are all possibilities depending on the fetal findings on hysterotomy and exposure. Although our case did not require ECMO, a potential failed EXIT-to-airway procedure still necessitated significant planning with pediatric cardiothoracic surgery and perfusionists prior to day of surgery and for these teams to be present with equipment and prepared for emergent EXIT-to-ECMO on the day of surgery. EXIT procedures are of high interest due to their infrequency, high acuity for both mother and infant, and unique anesthetic considerations for uterine tone which changes rapidly during the case.
Anesthesia for an EXIT procedure must focus on both maternal and fetal well-being. Maternal pain control intra- and post-operatively remains a high priority. Options include spinal with intrathecal opioids, CSE with intrathecal or epidural opioids, IV analgesics, and regional anesthetic blocks (e.g., Quadratus Lumborum or Transverse Abdominal Plane blocks). We chose to administer an opioid-only spinal prior to induction as the plan was to induce general anesthesia for patient comfort and anxiety, but also there would be no indwelling catheter in the event of peri-partum hemorrhage and coagulopathy. Institutionally, we routinely remove epidurals prior to leaving the operating room so longer duration analgesia is accomplished with intrathecal morphine. Arterial access remains critical for close maternal blood pressure control to ensure adequate uteroplacental oxygen delivery to the fetus. TIVA using a propofol infusion prior to hysterotomy and after delivery was chosen to help with maternal postoperative nausea and vomiting prevention as the surgery overall was expected to require a long-acting general anesthetic. Remifentanil, on the other hand, was used not only for maternal comfort and hemodynamic stability, but has been shown to have transplacental passage, thus helping with fetal analgesia and immobility during surgery or airway manipulation [9].
Uterine tone is an important anesthetic consideration as one must allow maximal uterine relaxation for surgical exposure and fetal airway manipulation with possible ECMO cannulation, but also realizing that strong uterine tone will be critical immediately following delivery to prevent severe post-partum hemorrhage secondary to atony. Therefore, inhaled volatile anesthetics were only used briefly during the surgery for complete relaxation but at a higher MAC than needed for routine surgeries under general anesthesia. Up to 3–4 MAC can accomplish uterine relaxation but with risk of fetal hypoxia and acidosis from decreased uteroplacental blood flow as shown in animal studies if maintained for even 15 min [10]. In addition, nitroglycerin was used for complete uterine relaxation as it has a quick onset and short half-life. Notably, care must be taken with a nitroglycerin infusion as tachyphylaxis can develop, thus requiring higher doses with possible maternal headaches, hypotension, dizziness, pulmonary edema, and methemoglobinemia [11].
Fetal anesthetic considerations include analgesia, fetal monitoring, proper uteroplacental blood flow via tight maternal blood pressure control, maintaining placental attachment, administering intramuscular paralytic and anti-bradycardic medications, and adequate relaxation during airway instrumentation. A Belmont Rapid Infuser® can be used to continuously fill the uterus with crystalloid fluids. This helps with temperature control inside the uterus, preventing premature placental separation and maintaining the uterine cavity to prevent umbilical cord spasm or compression, which could be detrimental to the fetus [12]. One must be aware that prolonged uterine irrigation with warmed crystalloid can lead to maternal absorption through the venous plexuses and pulmonary edema [13].
Despite careful planning and extensive measures to help fetal survival, newborn deaths following the EXIT procedure are not uncommon. In our case, a central-line infection was the cause of death following a successful EXIT-to-airway procedure. Central-line-associated bloodstream infections account for up to 28 000 deaths per year and considerable costs even with vigilant precautions [14]. More commonly, fetal deaths following EXIT procedure are related to severe pulmonary hypoplasia and immaturity [9]. Maternal outcomes following EXIT appear similar to those of a routine cesarean section but with overall increased blood loss. Ultimately, EXIT is a potentially fetal life-saving procedure that requires a multidisciplinary team, careful planning, and an anesthetic tailored to maternal and fetal comfort and outcomes.
Conclusions
This report has shown the importance of a multidisciplinary approach to the management of delivery of infants with airway obstruction. This case has shown the approach to the decision for the use of EXIT combined with airway palliation, as ECMO was not combined with EXIT in this case.
Figure 1. Delivery of an infant at 37 weeks’ gestation with airway obstruction due to cystic hygroma. The infant is shown at delivery following airway intubation. A large cystic hygroma of the neck is shown, measuring 20.1×9.7×18.2 cm by ultrasound.
Figure 2. A sagittal magnetic resonance image (MRI) of the infant at 37 weeks’ gestation. The MRI shows a large neck mass (left) consistent with a cystic hygroma, measuring 15.8×14×9 cm by MRI. | 100 MICROGRAM/MIN | DrugDosageText | CC BY-NC-ND | 33388739 | 19,167,263 | 2021-01-03 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Haematoma muscle'. | Two Cases of Severe COVID-19 Pneumonia Effectively Treated with Extracorporeal Membrane Oxygenation in Addition to Favipiravir and Corticosteroid.
Case 1: A 65-year-old man with novel coronavirus infection (COVID-19) complicated with acute respiratory failure. On admission, the patient was started on favipiravir and corticosteroid. However, due to a lack of significant improvement, he was introduced to mechanical ventilation and extracorporeal membrane oxygenation (ECMO). Although iliopsoas hematoma occurred as a complication, the patient recovered. Case 2: A 49-year-old man with COVID-19 had been started on favipiravir and corticosteroid. Due to progressive respiratory failure, the patient underwent mechanical ventilation and ECMO. The patient recovered without complications. We successfully treated these severe cases with a multimodal combination of pharmacological and non-pharmacological supportive therapy.
Introduction
Coronavirus disease 2019 (COVID-19) was first identified in December 2019 in Wuhan, China, and has since rapidly spread globally. At present, there are few established treatments for COVID-19 with confirmed efficacy, resulting in numerous deaths.
Globally, as of August 1, 2020, 17,396,943 confirmed cases and 675,060 deaths related to COVID-19 have been reported to WHO, and the mortality rate is 3.9% (1). The overall hospital mortality rate from COVID-19 is approximately 15% to 20%, increasing to 40% among patients requiring ICU admission. By age, the hospital mortality rate is 35% for patients 70 to 79 years old and 60% for patients 80 to 89 years old (2). The mortality in COVID-19 patients who develope severe respiratory compromise and require mechanical ventilation is high.
Favipiravir obtained manufacturing and marketing approval in March 2014 for “new or re-emerging influenza virus infections (provided that other anti-influenza virus drugs were ineffective)”. With regard to the mechanism of action of this drug, favipiravir taken up into cells is metabolized and converted by intracellular enzymes to become favipiravir ribofuranosyl triphosphate, which selectively inhibits viral RNA-dependent RNA polymerase. Therefore, this agent may also be effective against RNA viruses other than influenza virus, and indeed, nonclinical studies have reported its efficacy against several RNA viruses, including Ebola virus (3), Arenaviridae and Bunyaviridae (4). In an open-label, controlled trial in China, the time to viral clearance of mild to moderate COVID-19 treated with favipiravir and interferon alfa was significantly shorter than that of lobinavir ritonavir and interferon alfa (5).
There have been several reports of the efficacy of administering corticosteroids for COVID-19 patients, although opinions on this approach were initially negative (6,7). Corticosteroids are a viable therapeutic strategy for modulating the inflammatory response in patients with COVID-19.
The high mortality rate in severe cases is important, given the potential access to extracorporeal membrane oxygenation of venous blood, which may serve as a life-saving emergency treatment. Although the efficacy of ECMO in COVID-19 is controversial, ECMO is a proposed as a treatment option in the interim guidance document published by the WHO and interim guidance for clinical management of COVID-19 patients provided by the United States Centers for Disease Control (8).
We herein report two cases of COVID-19 in which the early introduction of ECMO was extremely effective for managing patients whose pneumonia was aggravated even under the use of favipiravir and corticosteroid.
Case Reports
Case 1
A 65-year-old Japanese man with no significant medical history developed malaise at the end of March, 2020, and eventually developed pyrexia, cough and dyspnea. He visited a local clinic 9 days later. Because the patient presented with decreased percutaneous oxygen saturation (SpO2) and ground-glass opacities in both lungs, he was suspected of having COVID-19 pneumonia. On the same day, he was taken to our hospital by an ambulance, where he was immediately admitted. He had neither a history of close contact with COVID-19-positive patients nor any recent travel history. He was a former smoker (37.5 packs per year).
At the time of admission, the patient had no disorientation, with a body temperature of 37.5℃, blood pressure of 140/78 mmHg, pulse rate of 72 beats per minute (regular), respiratory rate of 24 breaths per minute and SpO2 of 82% on room air. At the time of admission, a marked increase was observed in lactate dehydrogenase and C-reactive protein (CRP), being 628 U/L and 24.99 mg/dL, respectively. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were detected. Surfactant protein D increased to 221 ng/mL (Table 1).
Table 1. Case 1: Laboratory Findings at the Time of Hospital Admission.
TP 6.1 g/dL WBC 8,300 /μL
alb 2.6 g/dL neutro 87.4 %
T-bil 0.5 mg/dL lymph 6.9 %
AST 66 U/L mono 5.4 %
ALT 33 U/L eosino 0.1 %
LDH 628 U/L Hb 16.3 g/dL
γ-GTP 27 U/L Hct 47.5 %
CK 69 U/L Plt 27.9 ×104/μL
BUN 13.8 mg/dL
Cr 0.76 mg/dL PT-INR 1.16
UA 4.2 mg/dL APTT 35.8 sec
Na 136 mEq/L D-dimer 8.8 pg/mL
K 4.8 mEq/L fibrinogen 774 mg/dL
Cl 102 mEq/L
glu 99 mg/dL
CRP 24.99 mg/dL
IgG 846 mg/dL
IgA 157 mg/dL
IgM 36 mg/dL
IgE 92 mg/dL influenza A negative
SPA 92.8 ng/mL B negative
SPD 221 ng/mL
KL-6 370 U/mL
β-D-glucan 12.0 pg/mL
NT-proBNP 125 pg/mL
PCT 0.20 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
At the time of hospital admission, chest radiography showed diffuse ground-glass opacities in both lungs (Fig. 1a), and plain chest computed tomography (CT) showed diffuse ground-glass opacities in nearly all layers of both lungs (Fig. 1b).
Figure 1. Case 1: Imaging findings at the time of hospital admission. (a) Chest radiography shows diffuse ground-glass opacities in both lungs. (b) Chest CT shows diffuse ground-glass opacities in nearly all layers of both lungs.
The patient was found to have progressive acute respiratory failure and started to receive high-flow nasal cannula oxygen therapy [delivery of 50 L of flow; fraction of inspired oxygen (FiO2) of 50%]. Methylprednisolone pulse therapy (administered at 1 g/day for 3 days) was started to treat the progressive acute respiratory failure as empirical treatment for severe pneumonia and acute interstitial pneumonia. Intravenous infusion of meropenem (1 g every 8 hours) and azithromycin (500 mg every 24 hours) was started under suspicion of severe bacterial pneumonia, and continuous intravenous infusion of sivelestat (400 mg/day) was also started to treat acute respiratory distress syndrome (ARDS).
A COVID-19 real-time polymerase chain reaction (RT-PCR) test was performed, and the patient was found to be positive for COVID-19 on Day 3 of hospitalization. With the patient's consent, treatment with favipiravir was started on a compassionate-use basis. On Day 5, further progression of respiratory failure required the patient to be intubated and moved to mechanical ventilation. On the same day, veno-venous (V-V) ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease because mechanical ventilation was considered insufficient to sustain the cardiorespiratory system due to the patient's poor oxygenation even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.0 L/min. From days 3 to 5, platelets decreased from 24.5×104 to 17.8×104/μL, fibrinogen decreased from 426 to 54 mg/dL, and D-dimer increased from 68.1 to 98.2 μg/mL. No bleeding tendency, circulatory failure due to microthrombus, or multiple organ failure was observed. Since the criteria established by the Japanese Association for Acute Medicine for disseminated intravascular coagulation (DIC) were met, we administered recombinant thrombomodulin. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: pressure-controlled ventilation (PCV), FiO2 of 0.35, positive end-expiratory pressure (PEEP) of 9 cmH2O, inspiratory pressure of 7 cmH2O and respiratory frequency of 10 per minute. After introduction of mechanical ventilation and ECMO, the patient's blood pressure decreased. Based on the echocardiographic and electrocardiographic findings, the patient was diagnosed with concurrent takotsubo cardiomyopathy, for which treatment with noradrenaline was started.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received through ECMO was reduced. Therefore, he was weaned from ECMO on Day 12. He was extubated on Day 14. As an adverse event, the patient developed left iliopsoas bleed that required a number of blood transfusions, which resulted in transfusion-associated circulatory overload. The patient was re-intubated and placed on mechanical ventilation on Day 15. His condition improved after fluid management, and he was extubated again on Day 23. The radio-opaque areas in the lung fields became smaller. The flow of supplemental oxygen was decreased to 1 L/min/cannula on Day 33. The patient was discharged on Day 41 (Fig. 2).
Figure 2. Case 1: Clinical course after hospital admission.
Case 2
A 49-year-old Japanese man with bronchial asthma presented with pyrexia, malaise and dyspnea at the middle of April, 2020, and visited a local clinic. Due to his poor response to any symptomatic treatments given, the patient was taken by ambulance to our hospital 3 days later. He had had close contact with his wife, who had contracted COVID-19 pneumonia. He was suspected of also having COVID-19 pneumonia based on chest CT findings and was admitted to the hospital on the same day. He had no smoking history.
At the time of admission, the patient had no disorientation, with a body temperature of 39.9℃, blood pressure of 142/88 mmHg, pulse rate of 126 beats per minute, regular, respiratory rate of 22 breaths per minute and percutaneous oxygen saturation (SpO2) of 97% on room air, and a slight increase in CRP (0.70) was observed. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were noted (Table 2).
Table 2. Case 2: Laboratory Findings at the Time of Hospital Admission.
TP 7.1 g/dL WBC 5,500 /μL
alb 4.1 g/dL neutro 80.6 %
T-bil 0.52 mg/dL lymph 11.2 %
AST 22 U/L mono 8.2 %
ALT 32 U/L eosino 0 %
LDH 190 U/L Hb 16.0 g/dL
γ-GTP 17 U/L Hct 46.2 %
CK 65 U/L Plt 20.2 ×104/μL
BUN 8.8 mg/dL
Cr 0.99 mg/dL PT-INR 1.07
UA 6.4 mg/dL APTT 35.0 sec
Na 139 mEq/L D-dimer 0.4 pg/mL
K 3.4 mEq/L fibrinogen 334 mg/dL
Cl 107 mEq/L
glu 112 mg/dL
CRP 0.70 mg/dL
IgG 1,186 mg/dL influenza A negative
IgA 297 mg/dL B negative
IgM 37 mg/dL
IgE 223 mg/dL Pneumococcal urinary antigen test negative
SPA 16.1 ng/mL
SPD 25.6 ng/mL Legionella urinary antigen test negative
KL-6 165 U/mL
β-D-glucan 5.1 pg/mL
NT-proBNP 16 pg/mL
PCT 0.04 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
Chest radiography at admission showed nodular opacity in the right upper lobe (Fig. 3a), and plain chest CT showed numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side (Fig. 3b).
Figure 3. Case 2: Imaging findings at the time of hospital admission. (a) Chest radiography shows nodular opacity in the right upper lobe. (b) Chest CT shows numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side.
Treatment was started with intravenous infusion of methylprednisolone (80 mg/day) and azithromycin (500 mg every 24 hours) to alleviate inflammation, ceftriaxone (2 g every 24 hours) in consideration of bacterial pneumonia and peramivir (600 mg/day on Day 1 and 300 mg/day from Day 2 onward) as an antiviral agent (Fig. 4). The patient showed positive results of a COVID-19 RT-PCR test on Day 3 of hospitalization when treatment with favipiravir was started. Pyrexia in the patient persisted, and respiratory failure progressed even after the initiation of favipiravir. The dose of methylprednisolone was increased to 250 mg/day from Day 6 onward. On Day 7, continuous intravenous infusion of sivelestat (400 mg/day) was started. Since the platelet count had decreased to 13.9×104/μL and COVID-19 often causes abnormal coagulation, intravenous infusion of recombinant thrombomodulin (32,000 U/day) was also started. The D-dimer level slightly increased to 1.8 μg/mL on Day 10 but improved thereafter.
Figure 4. Case 2: Clinical course after hospital admission.
The further progression of respiratory failure necessitated noninvasive intermittent positive-pressure ventilation on Day 8 and intubation and mechanical ventilation on Day 9. On Day 10, V-V ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease and poor oxygenation, even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.5 L/min. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: PCV, FiO2 of 0.21, PEEP of 8 cmH2O, inspiratory pressure of 8 cmH2O and respiratory frequency of 12 per minute.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received ECMO was reduced. Therefore, he was weaned from ECMO on Day 15. He was extubated on Day 19. No ECMO-associated adverse events were observed. The patient no longer required supplemental oxygen supply on Day 23. The patient was discharged on Day 32 (Fig. 4).
Discussion
Although the majority of cases of COVID-19 result in mild, reversible symptoms, some patients develop dyspnea and hypoxemia within about a week of the onset of the disease. Wang et al. reported that 26.1% of patients hospitalized with COVID-19 pneumonia required treatment in the intensive-care unit (ICU); 61.1% of these patients in the ICU had ARDS, and the mortality rate was approximately 4.3% (9). A total of 60 patients with COVID-19 pneumonia had been admitted to our hospital as of the middle of May, 2020. Eight of these 60 patients required intubation and mechanical ventilation, including the 2 presently reported patients who also required the use of ECMO.
ARDS is characterized by excessive local inflammation in the lung, which can progress to an “out-of-control” state. Excessive production of mediators, such as cytokines (e.g., interleukin-6, tumor necrosis factor alpha, interleukin-8) and arachidonate metabolites (i.e., cytokine storm), interstitial lung edema caused by enhanced pulmonary vascular permeability, and diffuse alveolar damage induce a rapid decrease in oxygenation and the accumulation of carbon dioxide (10). Antiviral treatment and pharmacological and non-pharmacological supportive therapies are considered to serve as important therapeutic strategies for COVID-19 pneumonia patients with ARDS.
It was previously reported that the fulminant activation of coagulation and consumption of clotting factors occur in severe cases of COVID-19. Inflammation of lung tissues and endothelial cells causes microthrombi formation, leading to thrombotic complications, such as deep venous thrombosis, pulmonary embolism and thrombotic arterial complications (11). T tD-dimer and fibrinogen degradation product (FDP) levels were increased in both of the present cases. Furthermore, in Case 1, the patient developed DIC and pulmonary thromboembolism despite the use of anticoagulants.
DIC in patients with COVID-19 has previously been described, and its characteristics include a lack of bleeding risk, mildly low platelet counts and elevated plasma fibrinogen levels, none of which are seen in typical DIC. Therefore, instead of DIC, these data might more closely resemble complement-mediated thrombotic microangiopathy (TMA) syndromes. Importantly, another essential aspect of DIC seen in COVID-19 is the detection of both COVID-19 and complement components in regions of TMA. Mediators of TMA syndromes overlap with those released by cytokine storm, suggesting close connections between ineffective immune responses to COVID-19, severe pneumonia and life-threatening microangiopathy (12). Although the diagnostic criteria for DIC were met in case 1, TMA syndrome might have occurred in both cases (particularly in case 2) because of the lack of typical symptoms of DIC.
For the two cases presented in this report, favipiravir administration was started as an antiviral treatment immediately after the diagnosis of COVID-19. At a meeting of the Japanese Association for Infectious Diseases, we presented an immediate report on cases of COVID-19 pneumonia with progressive respiratory failure, for which favipiravir may have worked promptly and effectively (13). However, rapid progression of respiratory failure was observed in the patients in this report despite the initiation of treatment with favipiravir. This can be interpreted as suggesting that the clinical benefit of treatment with an antiviral agent alone is limited in patients with concurrent ARDS. At present, multiple clinical trials of favipiravir are underway in patients with mild to severe COVID-19 pneumonia. Future data from these trials may provide new insights into the drug's clinical benefits.
As a pharmacological supportive therapy, we administered methylprednisolone (an anti-inflammatory agent for inhibiting cytokine storm), sivelestat (a neutrophil elastase inhibitor) and macrolide antibiotics with an immunoregulatory function (14) effective for suppressing hyperimmunization and excessive inflammation. The World Health Organization (WHO) has advised against the use of corticosteroids to treat COVID-19. The interim WHO guidance on the management of patients with severe acute respiratory infection caused by COVID-19 presents negative views on the use of steroids in the treatment of this patient population (“routine use of steroids should be avoided unless the patient has symptoms including bronchial asthma, aggravated chronic obstructive pulmonary disease, and septic shock”) based on data from studies of steroid therapy in patients with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) or influenza (15). However, a study by the RECOVERY Collaborative Group showed that the use of dexamethasone in hospitalized COVID-19 patients resulted in a lower 28-day mortality than in those who were solely receiving either invasive mechanical ventilation or oxygen (6). In addition, Wu et al. performed a retrospective cohort study in patients with COVID-19 pneumonia and reported that the mortality in a cohort using methylprednisolone was lower than that in a cohort not using methylprednisolone, although the number of severe cases included in the former cohort was larger than that in the latter cohort (7). In our hospital, we have actively used steroids in patients with hypoxemia and achieved good outcomes. Based on these experiences, we are considering participating in a clinical study conducted to evaluate the efficacy of steroids in patients with COVID-19 pneumonia to verify the clinical effects of steroids in this patient population. Regarding macrolides, some researchers have reported that macrolide therapy was effective for reducing mortality in patients with ARDS (16). Although the mechanism underlying this reduction in mortality has not been fully elucidated, macrolides are likely to have effects on cytokine production and the neutrophil function (16).
As non-pharmacological supportive therapy, intubation, mechanical ventilation and ECMO were employed. ECMO is a life-supporting method used in patients with severe respiratory or cardiac failure (used particularly as a resuscitative measure taken for patients in cardiopulmonary arrest), called “respiratory ECMO” and “cardiac ECMO”, respectively. Respiratory ECMO is indicated for patients with reversible acute respiratory failure. Its use is considered for patients for whom conventional mechanical ventilation is insufficient for sustaining life or in whom continuous use of the mechanical ventilation system can result in irreversible damage to the lung. Respiratory ECMO is regarded as a treatment of ARDS (17). In the treatment of novel influenza A (H1N1) 2009, the results of ECMO database-based cohort studies (18,19) and the study on conventional ventilatory support vs. ECMO for severe adult respiratory failure (CESAR study) (20) demonstrated the efficacy of ECMO therapy based on the finding that the mortality in patients using ECMO was significantly lower than that in patients not using ECMO. In a retrospective study in MERS patients with refractory respiratory failure in 2018, the use of ECMO was required as an emergency treatment. The mortality in MERS patients with refractory hypoxemia in the ECMO cohort was significantly lower than that in the non-ECMO cohort (65% vs. 100%; p = 0.02) (21). Although little evidence for the efficacy of ECMO has been obtained with respect to COVID-19 pneumonia, results from two retrospective studies have been reported. In a retrospective study by Yang et al., of 52 patients admitted to the ICU with severe COVID-19 pneumonia, 32 died within 28 days of admission. ECMO was introduced to 6 patients, of whom 5 died, while the other was still on ECMO at the time of the endpoint assessment (22). In a retrospective study by Zhang et al., 48 of 221 patients with COVID-19 pneumonia had concurrent ARDS, and 10 of these 48 patients required mechanical ventilation and ECMO therapy. Of these 10 patients, 2 were successfully treated and discharged from the hospital, and 3 died. The other five patients were still on ECMO at the time of the endpoint assessment (23). According to the interim WHO guidance, ECMO, despite little evidence for its efficacy, is regarded as an emergency treatment of COVID-19 patients who have concurrent refractory hypoxemia even after being treated with lung-protective ventilation strategy (15). The condition of the two patients in the present case report was improved by intubation, mechanical ventilation and the prompt introduction of ECMO. COVID-19 pneumonia with ARDS is associated with high mortality. Pulmonary protection initiated before obtaining clinical benefits of antiviral treatment and pharmacological supportive therapy is considered to contribute to a reduction in mortality. Concerning complications, iliopsoas hematoma was identified in Case 1. In general, hemorrhagic complications, such as cannulation site bleeding, occur in approximately 50% of patients undergoing ECMO (17). ECMO-associated bleeding, which is attributed to the effect of heparinization as well as circuit-related consumption of coagulation factors, can be severe. It may be difficult to arrest bleeding if no measures other than monitoring the patient are taken. In Case 1, although the patient required blood transfusion, bleeding was arrested during the observation of the patient's condition. Infection is another critical complication said to occur in approximately 20% of patients on ECMO (17). However, the two patients in this report were able to safely receive ECMO therapy with no ECMO-related infectious complications.
Our two patients were already suffering from severe respiratory failure at the time of the diagnosis of COVID-19. They were successfully treated by a combination of antiviral treatment with favipiravir, corticosteroid, mechanical ventilation and ECMO. The positive outcomes of these cases underscore the importance of promptly treating severe COVID-19 pneumonia after the diagnosis with non-pharmacological supportive therapy, such as mechanical ventilation and ECMO, in combination with pharmacological supportive therapy, notably favipiravir for antiviral treatment and corticosteroid for anti-inflammatory treatment.
The authors state that they have no Conflict of Interest (COI). | AZITHROMYCIN ANHYDROUS, FAVIPIRAVIR, HEPARIN SODIUM, MEROPENEM, SIVELESTAT, THROMBOMODULIN ALFA | DrugsGivenReaction | CC BY-NC-ND | 33390469 | 18,811,755 | 2021 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Transfusion-related circulatory overload'. | Two Cases of Severe COVID-19 Pneumonia Effectively Treated with Extracorporeal Membrane Oxygenation in Addition to Favipiravir and Corticosteroid.
Case 1: A 65-year-old man with novel coronavirus infection (COVID-19) complicated with acute respiratory failure. On admission, the patient was started on favipiravir and corticosteroid. However, due to a lack of significant improvement, he was introduced to mechanical ventilation and extracorporeal membrane oxygenation (ECMO). Although iliopsoas hematoma occurred as a complication, the patient recovered. Case 2: A 49-year-old man with COVID-19 had been started on favipiravir and corticosteroid. Due to progressive respiratory failure, the patient underwent mechanical ventilation and ECMO. The patient recovered without complications. We successfully treated these severe cases with a multimodal combination of pharmacological and non-pharmacological supportive therapy.
Introduction
Coronavirus disease 2019 (COVID-19) was first identified in December 2019 in Wuhan, China, and has since rapidly spread globally. At present, there are few established treatments for COVID-19 with confirmed efficacy, resulting in numerous deaths.
Globally, as of August 1, 2020, 17,396,943 confirmed cases and 675,060 deaths related to COVID-19 have been reported to WHO, and the mortality rate is 3.9% (1). The overall hospital mortality rate from COVID-19 is approximately 15% to 20%, increasing to 40% among patients requiring ICU admission. By age, the hospital mortality rate is 35% for patients 70 to 79 years old and 60% for patients 80 to 89 years old (2). The mortality in COVID-19 patients who develope severe respiratory compromise and require mechanical ventilation is high.
Favipiravir obtained manufacturing and marketing approval in March 2014 for “new or re-emerging influenza virus infections (provided that other anti-influenza virus drugs were ineffective)”. With regard to the mechanism of action of this drug, favipiravir taken up into cells is metabolized and converted by intracellular enzymes to become favipiravir ribofuranosyl triphosphate, which selectively inhibits viral RNA-dependent RNA polymerase. Therefore, this agent may also be effective against RNA viruses other than influenza virus, and indeed, nonclinical studies have reported its efficacy against several RNA viruses, including Ebola virus (3), Arenaviridae and Bunyaviridae (4). In an open-label, controlled trial in China, the time to viral clearance of mild to moderate COVID-19 treated with favipiravir and interferon alfa was significantly shorter than that of lobinavir ritonavir and interferon alfa (5).
There have been several reports of the efficacy of administering corticosteroids for COVID-19 patients, although opinions on this approach were initially negative (6,7). Corticosteroids are a viable therapeutic strategy for modulating the inflammatory response in patients with COVID-19.
The high mortality rate in severe cases is important, given the potential access to extracorporeal membrane oxygenation of venous blood, which may serve as a life-saving emergency treatment. Although the efficacy of ECMO in COVID-19 is controversial, ECMO is a proposed as a treatment option in the interim guidance document published by the WHO and interim guidance for clinical management of COVID-19 patients provided by the United States Centers for Disease Control (8).
We herein report two cases of COVID-19 in which the early introduction of ECMO was extremely effective for managing patients whose pneumonia was aggravated even under the use of favipiravir and corticosteroid.
Case Reports
Case 1
A 65-year-old Japanese man with no significant medical history developed malaise at the end of March, 2020, and eventually developed pyrexia, cough and dyspnea. He visited a local clinic 9 days later. Because the patient presented with decreased percutaneous oxygen saturation (SpO2) and ground-glass opacities in both lungs, he was suspected of having COVID-19 pneumonia. On the same day, he was taken to our hospital by an ambulance, where he was immediately admitted. He had neither a history of close contact with COVID-19-positive patients nor any recent travel history. He was a former smoker (37.5 packs per year).
At the time of admission, the patient had no disorientation, with a body temperature of 37.5℃, blood pressure of 140/78 mmHg, pulse rate of 72 beats per minute (regular), respiratory rate of 24 breaths per minute and SpO2 of 82% on room air. At the time of admission, a marked increase was observed in lactate dehydrogenase and C-reactive protein (CRP), being 628 U/L and 24.99 mg/dL, respectively. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were detected. Surfactant protein D increased to 221 ng/mL (Table 1).
Table 1. Case 1: Laboratory Findings at the Time of Hospital Admission.
TP 6.1 g/dL WBC 8,300 /μL
alb 2.6 g/dL neutro 87.4 %
T-bil 0.5 mg/dL lymph 6.9 %
AST 66 U/L mono 5.4 %
ALT 33 U/L eosino 0.1 %
LDH 628 U/L Hb 16.3 g/dL
γ-GTP 27 U/L Hct 47.5 %
CK 69 U/L Plt 27.9 ×104/μL
BUN 13.8 mg/dL
Cr 0.76 mg/dL PT-INR 1.16
UA 4.2 mg/dL APTT 35.8 sec
Na 136 mEq/L D-dimer 8.8 pg/mL
K 4.8 mEq/L fibrinogen 774 mg/dL
Cl 102 mEq/L
glu 99 mg/dL
CRP 24.99 mg/dL
IgG 846 mg/dL
IgA 157 mg/dL
IgM 36 mg/dL
IgE 92 mg/dL influenza A negative
SPA 92.8 ng/mL B negative
SPD 221 ng/mL
KL-6 370 U/mL
β-D-glucan 12.0 pg/mL
NT-proBNP 125 pg/mL
PCT 0.20 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
At the time of hospital admission, chest radiography showed diffuse ground-glass opacities in both lungs (Fig. 1a), and plain chest computed tomography (CT) showed diffuse ground-glass opacities in nearly all layers of both lungs (Fig. 1b).
Figure 1. Case 1: Imaging findings at the time of hospital admission. (a) Chest radiography shows diffuse ground-glass opacities in both lungs. (b) Chest CT shows diffuse ground-glass opacities in nearly all layers of both lungs.
The patient was found to have progressive acute respiratory failure and started to receive high-flow nasal cannula oxygen therapy [delivery of 50 L of flow; fraction of inspired oxygen (FiO2) of 50%]. Methylprednisolone pulse therapy (administered at 1 g/day for 3 days) was started to treat the progressive acute respiratory failure as empirical treatment for severe pneumonia and acute interstitial pneumonia. Intravenous infusion of meropenem (1 g every 8 hours) and azithromycin (500 mg every 24 hours) was started under suspicion of severe bacterial pneumonia, and continuous intravenous infusion of sivelestat (400 mg/day) was also started to treat acute respiratory distress syndrome (ARDS).
A COVID-19 real-time polymerase chain reaction (RT-PCR) test was performed, and the patient was found to be positive for COVID-19 on Day 3 of hospitalization. With the patient's consent, treatment with favipiravir was started on a compassionate-use basis. On Day 5, further progression of respiratory failure required the patient to be intubated and moved to mechanical ventilation. On the same day, veno-venous (V-V) ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease because mechanical ventilation was considered insufficient to sustain the cardiorespiratory system due to the patient's poor oxygenation even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.0 L/min. From days 3 to 5, platelets decreased from 24.5×104 to 17.8×104/μL, fibrinogen decreased from 426 to 54 mg/dL, and D-dimer increased from 68.1 to 98.2 μg/mL. No bleeding tendency, circulatory failure due to microthrombus, or multiple organ failure was observed. Since the criteria established by the Japanese Association for Acute Medicine for disseminated intravascular coagulation (DIC) were met, we administered recombinant thrombomodulin. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: pressure-controlled ventilation (PCV), FiO2 of 0.35, positive end-expiratory pressure (PEEP) of 9 cmH2O, inspiratory pressure of 7 cmH2O and respiratory frequency of 10 per minute. After introduction of mechanical ventilation and ECMO, the patient's blood pressure decreased. Based on the echocardiographic and electrocardiographic findings, the patient was diagnosed with concurrent takotsubo cardiomyopathy, for which treatment with noradrenaline was started.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received through ECMO was reduced. Therefore, he was weaned from ECMO on Day 12. He was extubated on Day 14. As an adverse event, the patient developed left iliopsoas bleed that required a number of blood transfusions, which resulted in transfusion-associated circulatory overload. The patient was re-intubated and placed on mechanical ventilation on Day 15. His condition improved after fluid management, and he was extubated again on Day 23. The radio-opaque areas in the lung fields became smaller. The flow of supplemental oxygen was decreased to 1 L/min/cannula on Day 33. The patient was discharged on Day 41 (Fig. 2).
Figure 2. Case 1: Clinical course after hospital admission.
Case 2
A 49-year-old Japanese man with bronchial asthma presented with pyrexia, malaise and dyspnea at the middle of April, 2020, and visited a local clinic. Due to his poor response to any symptomatic treatments given, the patient was taken by ambulance to our hospital 3 days later. He had had close contact with his wife, who had contracted COVID-19 pneumonia. He was suspected of also having COVID-19 pneumonia based on chest CT findings and was admitted to the hospital on the same day. He had no smoking history.
At the time of admission, the patient had no disorientation, with a body temperature of 39.9℃, blood pressure of 142/88 mmHg, pulse rate of 126 beats per minute, regular, respiratory rate of 22 breaths per minute and percutaneous oxygen saturation (SpO2) of 97% on room air, and a slight increase in CRP (0.70) was observed. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were noted (Table 2).
Table 2. Case 2: Laboratory Findings at the Time of Hospital Admission.
TP 7.1 g/dL WBC 5,500 /μL
alb 4.1 g/dL neutro 80.6 %
T-bil 0.52 mg/dL lymph 11.2 %
AST 22 U/L mono 8.2 %
ALT 32 U/L eosino 0 %
LDH 190 U/L Hb 16.0 g/dL
γ-GTP 17 U/L Hct 46.2 %
CK 65 U/L Plt 20.2 ×104/μL
BUN 8.8 mg/dL
Cr 0.99 mg/dL PT-INR 1.07
UA 6.4 mg/dL APTT 35.0 sec
Na 139 mEq/L D-dimer 0.4 pg/mL
K 3.4 mEq/L fibrinogen 334 mg/dL
Cl 107 mEq/L
glu 112 mg/dL
CRP 0.70 mg/dL
IgG 1,186 mg/dL influenza A negative
IgA 297 mg/dL B negative
IgM 37 mg/dL
IgE 223 mg/dL Pneumococcal urinary antigen test negative
SPA 16.1 ng/mL
SPD 25.6 ng/mL Legionella urinary antigen test negative
KL-6 165 U/mL
β-D-glucan 5.1 pg/mL
NT-proBNP 16 pg/mL
PCT 0.04 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
Chest radiography at admission showed nodular opacity in the right upper lobe (Fig. 3a), and plain chest CT showed numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side (Fig. 3b).
Figure 3. Case 2: Imaging findings at the time of hospital admission. (a) Chest radiography shows nodular opacity in the right upper lobe. (b) Chest CT shows numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side.
Treatment was started with intravenous infusion of methylprednisolone (80 mg/day) and azithromycin (500 mg every 24 hours) to alleviate inflammation, ceftriaxone (2 g every 24 hours) in consideration of bacterial pneumonia and peramivir (600 mg/day on Day 1 and 300 mg/day from Day 2 onward) as an antiviral agent (Fig. 4). The patient showed positive results of a COVID-19 RT-PCR test on Day 3 of hospitalization when treatment with favipiravir was started. Pyrexia in the patient persisted, and respiratory failure progressed even after the initiation of favipiravir. The dose of methylprednisolone was increased to 250 mg/day from Day 6 onward. On Day 7, continuous intravenous infusion of sivelestat (400 mg/day) was started. Since the platelet count had decreased to 13.9×104/μL and COVID-19 often causes abnormal coagulation, intravenous infusion of recombinant thrombomodulin (32,000 U/day) was also started. The D-dimer level slightly increased to 1.8 μg/mL on Day 10 but improved thereafter.
Figure 4. Case 2: Clinical course after hospital admission.
The further progression of respiratory failure necessitated noninvasive intermittent positive-pressure ventilation on Day 8 and intubation and mechanical ventilation on Day 9. On Day 10, V-V ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease and poor oxygenation, even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.5 L/min. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: PCV, FiO2 of 0.21, PEEP of 8 cmH2O, inspiratory pressure of 8 cmH2O and respiratory frequency of 12 per minute.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received ECMO was reduced. Therefore, he was weaned from ECMO on Day 15. He was extubated on Day 19. No ECMO-associated adverse events were observed. The patient no longer required supplemental oxygen supply on Day 23. The patient was discharged on Day 32 (Fig. 4).
Discussion
Although the majority of cases of COVID-19 result in mild, reversible symptoms, some patients develop dyspnea and hypoxemia within about a week of the onset of the disease. Wang et al. reported that 26.1% of patients hospitalized with COVID-19 pneumonia required treatment in the intensive-care unit (ICU); 61.1% of these patients in the ICU had ARDS, and the mortality rate was approximately 4.3% (9). A total of 60 patients with COVID-19 pneumonia had been admitted to our hospital as of the middle of May, 2020. Eight of these 60 patients required intubation and mechanical ventilation, including the 2 presently reported patients who also required the use of ECMO.
ARDS is characterized by excessive local inflammation in the lung, which can progress to an “out-of-control” state. Excessive production of mediators, such as cytokines (e.g., interleukin-6, tumor necrosis factor alpha, interleukin-8) and arachidonate metabolites (i.e., cytokine storm), interstitial lung edema caused by enhanced pulmonary vascular permeability, and diffuse alveolar damage induce a rapid decrease in oxygenation and the accumulation of carbon dioxide (10). Antiviral treatment and pharmacological and non-pharmacological supportive therapies are considered to serve as important therapeutic strategies for COVID-19 pneumonia patients with ARDS.
It was previously reported that the fulminant activation of coagulation and consumption of clotting factors occur in severe cases of COVID-19. Inflammation of lung tissues and endothelial cells causes microthrombi formation, leading to thrombotic complications, such as deep venous thrombosis, pulmonary embolism and thrombotic arterial complications (11). T tD-dimer and fibrinogen degradation product (FDP) levels were increased in both of the present cases. Furthermore, in Case 1, the patient developed DIC and pulmonary thromboembolism despite the use of anticoagulants.
DIC in patients with COVID-19 has previously been described, and its characteristics include a lack of bleeding risk, mildly low platelet counts and elevated plasma fibrinogen levels, none of which are seen in typical DIC. Therefore, instead of DIC, these data might more closely resemble complement-mediated thrombotic microangiopathy (TMA) syndromes. Importantly, another essential aspect of DIC seen in COVID-19 is the detection of both COVID-19 and complement components in regions of TMA. Mediators of TMA syndromes overlap with those released by cytokine storm, suggesting close connections between ineffective immune responses to COVID-19, severe pneumonia and life-threatening microangiopathy (12). Although the diagnostic criteria for DIC were met in case 1, TMA syndrome might have occurred in both cases (particularly in case 2) because of the lack of typical symptoms of DIC.
For the two cases presented in this report, favipiravir administration was started as an antiviral treatment immediately after the diagnosis of COVID-19. At a meeting of the Japanese Association for Infectious Diseases, we presented an immediate report on cases of COVID-19 pneumonia with progressive respiratory failure, for which favipiravir may have worked promptly and effectively (13). However, rapid progression of respiratory failure was observed in the patients in this report despite the initiation of treatment with favipiravir. This can be interpreted as suggesting that the clinical benefit of treatment with an antiviral agent alone is limited in patients with concurrent ARDS. At present, multiple clinical trials of favipiravir are underway in patients with mild to severe COVID-19 pneumonia. Future data from these trials may provide new insights into the drug's clinical benefits.
As a pharmacological supportive therapy, we administered methylprednisolone (an anti-inflammatory agent for inhibiting cytokine storm), sivelestat (a neutrophil elastase inhibitor) and macrolide antibiotics with an immunoregulatory function (14) effective for suppressing hyperimmunization and excessive inflammation. The World Health Organization (WHO) has advised against the use of corticosteroids to treat COVID-19. The interim WHO guidance on the management of patients with severe acute respiratory infection caused by COVID-19 presents negative views on the use of steroids in the treatment of this patient population (“routine use of steroids should be avoided unless the patient has symptoms including bronchial asthma, aggravated chronic obstructive pulmonary disease, and septic shock”) based on data from studies of steroid therapy in patients with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) or influenza (15). However, a study by the RECOVERY Collaborative Group showed that the use of dexamethasone in hospitalized COVID-19 patients resulted in a lower 28-day mortality than in those who were solely receiving either invasive mechanical ventilation or oxygen (6). In addition, Wu et al. performed a retrospective cohort study in patients with COVID-19 pneumonia and reported that the mortality in a cohort using methylprednisolone was lower than that in a cohort not using methylprednisolone, although the number of severe cases included in the former cohort was larger than that in the latter cohort (7). In our hospital, we have actively used steroids in patients with hypoxemia and achieved good outcomes. Based on these experiences, we are considering participating in a clinical study conducted to evaluate the efficacy of steroids in patients with COVID-19 pneumonia to verify the clinical effects of steroids in this patient population. Regarding macrolides, some researchers have reported that macrolide therapy was effective for reducing mortality in patients with ARDS (16). Although the mechanism underlying this reduction in mortality has not been fully elucidated, macrolides are likely to have effects on cytokine production and the neutrophil function (16).
As non-pharmacological supportive therapy, intubation, mechanical ventilation and ECMO were employed. ECMO is a life-supporting method used in patients with severe respiratory or cardiac failure (used particularly as a resuscitative measure taken for patients in cardiopulmonary arrest), called “respiratory ECMO” and “cardiac ECMO”, respectively. Respiratory ECMO is indicated for patients with reversible acute respiratory failure. Its use is considered for patients for whom conventional mechanical ventilation is insufficient for sustaining life or in whom continuous use of the mechanical ventilation system can result in irreversible damage to the lung. Respiratory ECMO is regarded as a treatment of ARDS (17). In the treatment of novel influenza A (H1N1) 2009, the results of ECMO database-based cohort studies (18,19) and the study on conventional ventilatory support vs. ECMO for severe adult respiratory failure (CESAR study) (20) demonstrated the efficacy of ECMO therapy based on the finding that the mortality in patients using ECMO was significantly lower than that in patients not using ECMO. In a retrospective study in MERS patients with refractory respiratory failure in 2018, the use of ECMO was required as an emergency treatment. The mortality in MERS patients with refractory hypoxemia in the ECMO cohort was significantly lower than that in the non-ECMO cohort (65% vs. 100%; p = 0.02) (21). Although little evidence for the efficacy of ECMO has been obtained with respect to COVID-19 pneumonia, results from two retrospective studies have been reported. In a retrospective study by Yang et al., of 52 patients admitted to the ICU with severe COVID-19 pneumonia, 32 died within 28 days of admission. ECMO was introduced to 6 patients, of whom 5 died, while the other was still on ECMO at the time of the endpoint assessment (22). In a retrospective study by Zhang et al., 48 of 221 patients with COVID-19 pneumonia had concurrent ARDS, and 10 of these 48 patients required mechanical ventilation and ECMO therapy. Of these 10 patients, 2 were successfully treated and discharged from the hospital, and 3 died. The other five patients were still on ECMO at the time of the endpoint assessment (23). According to the interim WHO guidance, ECMO, despite little evidence for its efficacy, is regarded as an emergency treatment of COVID-19 patients who have concurrent refractory hypoxemia even after being treated with lung-protective ventilation strategy (15). The condition of the two patients in the present case report was improved by intubation, mechanical ventilation and the prompt introduction of ECMO. COVID-19 pneumonia with ARDS is associated with high mortality. Pulmonary protection initiated before obtaining clinical benefits of antiviral treatment and pharmacological supportive therapy is considered to contribute to a reduction in mortality. Concerning complications, iliopsoas hematoma was identified in Case 1. In general, hemorrhagic complications, such as cannulation site bleeding, occur in approximately 50% of patients undergoing ECMO (17). ECMO-associated bleeding, which is attributed to the effect of heparinization as well as circuit-related consumption of coagulation factors, can be severe. It may be difficult to arrest bleeding if no measures other than monitoring the patient are taken. In Case 1, although the patient required blood transfusion, bleeding was arrested during the observation of the patient's condition. Infection is another critical complication said to occur in approximately 20% of patients on ECMO (17). However, the two patients in this report were able to safely receive ECMO therapy with no ECMO-related infectious complications.
Our two patients were already suffering from severe respiratory failure at the time of the diagnosis of COVID-19. They were successfully treated by a combination of antiviral treatment with favipiravir, corticosteroid, mechanical ventilation and ECMO. The positive outcomes of these cases underscore the importance of promptly treating severe COVID-19 pneumonia after the diagnosis with non-pharmacological supportive therapy, such as mechanical ventilation and ECMO, in combination with pharmacological supportive therapy, notably favipiravir for antiviral treatment and corticosteroid for anti-inflammatory treatment.
The authors state that they have no Conflict of Interest (COI). | AZITHROMYCIN ANHYDROUS, FAVIPIRAVIR, HEPARIN SODIUM, MEROPENEM, SIVELESTAT, THROMBOMODULIN ALFA | DrugsGivenReaction | CC BY-NC-ND | 33390469 | 18,811,755 | 2021 |
What was the administration route of drug 'AZITHROMYCIN ANHYDROUS'? | Two Cases of Severe COVID-19 Pneumonia Effectively Treated with Extracorporeal Membrane Oxygenation in Addition to Favipiravir and Corticosteroid.
Case 1: A 65-year-old man with novel coronavirus infection (COVID-19) complicated with acute respiratory failure. On admission, the patient was started on favipiravir and corticosteroid. However, due to a lack of significant improvement, he was introduced to mechanical ventilation and extracorporeal membrane oxygenation (ECMO). Although iliopsoas hematoma occurred as a complication, the patient recovered. Case 2: A 49-year-old man with COVID-19 had been started on favipiravir and corticosteroid. Due to progressive respiratory failure, the patient underwent mechanical ventilation and ECMO. The patient recovered without complications. We successfully treated these severe cases with a multimodal combination of pharmacological and non-pharmacological supportive therapy.
Introduction
Coronavirus disease 2019 (COVID-19) was first identified in December 2019 in Wuhan, China, and has since rapidly spread globally. At present, there are few established treatments for COVID-19 with confirmed efficacy, resulting in numerous deaths.
Globally, as of August 1, 2020, 17,396,943 confirmed cases and 675,060 deaths related to COVID-19 have been reported to WHO, and the mortality rate is 3.9% (1). The overall hospital mortality rate from COVID-19 is approximately 15% to 20%, increasing to 40% among patients requiring ICU admission. By age, the hospital mortality rate is 35% for patients 70 to 79 years old and 60% for patients 80 to 89 years old (2). The mortality in COVID-19 patients who develope severe respiratory compromise and require mechanical ventilation is high.
Favipiravir obtained manufacturing and marketing approval in March 2014 for “new or re-emerging influenza virus infections (provided that other anti-influenza virus drugs were ineffective)”. With regard to the mechanism of action of this drug, favipiravir taken up into cells is metabolized and converted by intracellular enzymes to become favipiravir ribofuranosyl triphosphate, which selectively inhibits viral RNA-dependent RNA polymerase. Therefore, this agent may also be effective against RNA viruses other than influenza virus, and indeed, nonclinical studies have reported its efficacy against several RNA viruses, including Ebola virus (3), Arenaviridae and Bunyaviridae (4). In an open-label, controlled trial in China, the time to viral clearance of mild to moderate COVID-19 treated with favipiravir and interferon alfa was significantly shorter than that of lobinavir ritonavir and interferon alfa (5).
There have been several reports of the efficacy of administering corticosteroids for COVID-19 patients, although opinions on this approach were initially negative (6,7). Corticosteroids are a viable therapeutic strategy for modulating the inflammatory response in patients with COVID-19.
The high mortality rate in severe cases is important, given the potential access to extracorporeal membrane oxygenation of venous blood, which may serve as a life-saving emergency treatment. Although the efficacy of ECMO in COVID-19 is controversial, ECMO is a proposed as a treatment option in the interim guidance document published by the WHO and interim guidance for clinical management of COVID-19 patients provided by the United States Centers for Disease Control (8).
We herein report two cases of COVID-19 in which the early introduction of ECMO was extremely effective for managing patients whose pneumonia was aggravated even under the use of favipiravir and corticosteroid.
Case Reports
Case 1
A 65-year-old Japanese man with no significant medical history developed malaise at the end of March, 2020, and eventually developed pyrexia, cough and dyspnea. He visited a local clinic 9 days later. Because the patient presented with decreased percutaneous oxygen saturation (SpO2) and ground-glass opacities in both lungs, he was suspected of having COVID-19 pneumonia. On the same day, he was taken to our hospital by an ambulance, where he was immediately admitted. He had neither a history of close contact with COVID-19-positive patients nor any recent travel history. He was a former smoker (37.5 packs per year).
At the time of admission, the patient had no disorientation, with a body temperature of 37.5℃, blood pressure of 140/78 mmHg, pulse rate of 72 beats per minute (regular), respiratory rate of 24 breaths per minute and SpO2 of 82% on room air. At the time of admission, a marked increase was observed in lactate dehydrogenase and C-reactive protein (CRP), being 628 U/L and 24.99 mg/dL, respectively. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were detected. Surfactant protein D increased to 221 ng/mL (Table 1).
Table 1. Case 1: Laboratory Findings at the Time of Hospital Admission.
TP 6.1 g/dL WBC 8,300 /μL
alb 2.6 g/dL neutro 87.4 %
T-bil 0.5 mg/dL lymph 6.9 %
AST 66 U/L mono 5.4 %
ALT 33 U/L eosino 0.1 %
LDH 628 U/L Hb 16.3 g/dL
γ-GTP 27 U/L Hct 47.5 %
CK 69 U/L Plt 27.9 ×104/μL
BUN 13.8 mg/dL
Cr 0.76 mg/dL PT-INR 1.16
UA 4.2 mg/dL APTT 35.8 sec
Na 136 mEq/L D-dimer 8.8 pg/mL
K 4.8 mEq/L fibrinogen 774 mg/dL
Cl 102 mEq/L
glu 99 mg/dL
CRP 24.99 mg/dL
IgG 846 mg/dL
IgA 157 mg/dL
IgM 36 mg/dL
IgE 92 mg/dL influenza A negative
SPA 92.8 ng/mL B negative
SPD 221 ng/mL
KL-6 370 U/mL
β-D-glucan 12.0 pg/mL
NT-proBNP 125 pg/mL
PCT 0.20 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
At the time of hospital admission, chest radiography showed diffuse ground-glass opacities in both lungs (Fig. 1a), and plain chest computed tomography (CT) showed diffuse ground-glass opacities in nearly all layers of both lungs (Fig. 1b).
Figure 1. Case 1: Imaging findings at the time of hospital admission. (a) Chest radiography shows diffuse ground-glass opacities in both lungs. (b) Chest CT shows diffuse ground-glass opacities in nearly all layers of both lungs.
The patient was found to have progressive acute respiratory failure and started to receive high-flow nasal cannula oxygen therapy [delivery of 50 L of flow; fraction of inspired oxygen (FiO2) of 50%]. Methylprednisolone pulse therapy (administered at 1 g/day for 3 days) was started to treat the progressive acute respiratory failure as empirical treatment for severe pneumonia and acute interstitial pneumonia. Intravenous infusion of meropenem (1 g every 8 hours) and azithromycin (500 mg every 24 hours) was started under suspicion of severe bacterial pneumonia, and continuous intravenous infusion of sivelestat (400 mg/day) was also started to treat acute respiratory distress syndrome (ARDS).
A COVID-19 real-time polymerase chain reaction (RT-PCR) test was performed, and the patient was found to be positive for COVID-19 on Day 3 of hospitalization. With the patient's consent, treatment with favipiravir was started on a compassionate-use basis. On Day 5, further progression of respiratory failure required the patient to be intubated and moved to mechanical ventilation. On the same day, veno-venous (V-V) ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease because mechanical ventilation was considered insufficient to sustain the cardiorespiratory system due to the patient's poor oxygenation even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.0 L/min. From days 3 to 5, platelets decreased from 24.5×104 to 17.8×104/μL, fibrinogen decreased from 426 to 54 mg/dL, and D-dimer increased from 68.1 to 98.2 μg/mL. No bleeding tendency, circulatory failure due to microthrombus, or multiple organ failure was observed. Since the criteria established by the Japanese Association for Acute Medicine for disseminated intravascular coagulation (DIC) were met, we administered recombinant thrombomodulin. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: pressure-controlled ventilation (PCV), FiO2 of 0.35, positive end-expiratory pressure (PEEP) of 9 cmH2O, inspiratory pressure of 7 cmH2O and respiratory frequency of 10 per minute. After introduction of mechanical ventilation and ECMO, the patient's blood pressure decreased. Based on the echocardiographic and electrocardiographic findings, the patient was diagnosed with concurrent takotsubo cardiomyopathy, for which treatment with noradrenaline was started.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received through ECMO was reduced. Therefore, he was weaned from ECMO on Day 12. He was extubated on Day 14. As an adverse event, the patient developed left iliopsoas bleed that required a number of blood transfusions, which resulted in transfusion-associated circulatory overload. The patient was re-intubated and placed on mechanical ventilation on Day 15. His condition improved after fluid management, and he was extubated again on Day 23. The radio-opaque areas in the lung fields became smaller. The flow of supplemental oxygen was decreased to 1 L/min/cannula on Day 33. The patient was discharged on Day 41 (Fig. 2).
Figure 2. Case 1: Clinical course after hospital admission.
Case 2
A 49-year-old Japanese man with bronchial asthma presented with pyrexia, malaise and dyspnea at the middle of April, 2020, and visited a local clinic. Due to his poor response to any symptomatic treatments given, the patient was taken by ambulance to our hospital 3 days later. He had had close contact with his wife, who had contracted COVID-19 pneumonia. He was suspected of also having COVID-19 pneumonia based on chest CT findings and was admitted to the hospital on the same day. He had no smoking history.
At the time of admission, the patient had no disorientation, with a body temperature of 39.9℃, blood pressure of 142/88 mmHg, pulse rate of 126 beats per minute, regular, respiratory rate of 22 breaths per minute and percutaneous oxygen saturation (SpO2) of 97% on room air, and a slight increase in CRP (0.70) was observed. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were noted (Table 2).
Table 2. Case 2: Laboratory Findings at the Time of Hospital Admission.
TP 7.1 g/dL WBC 5,500 /μL
alb 4.1 g/dL neutro 80.6 %
T-bil 0.52 mg/dL lymph 11.2 %
AST 22 U/L mono 8.2 %
ALT 32 U/L eosino 0 %
LDH 190 U/L Hb 16.0 g/dL
γ-GTP 17 U/L Hct 46.2 %
CK 65 U/L Plt 20.2 ×104/μL
BUN 8.8 mg/dL
Cr 0.99 mg/dL PT-INR 1.07
UA 6.4 mg/dL APTT 35.0 sec
Na 139 mEq/L D-dimer 0.4 pg/mL
K 3.4 mEq/L fibrinogen 334 mg/dL
Cl 107 mEq/L
glu 112 mg/dL
CRP 0.70 mg/dL
IgG 1,186 mg/dL influenza A negative
IgA 297 mg/dL B negative
IgM 37 mg/dL
IgE 223 mg/dL Pneumococcal urinary antigen test negative
SPA 16.1 ng/mL
SPD 25.6 ng/mL Legionella urinary antigen test negative
KL-6 165 U/mL
β-D-glucan 5.1 pg/mL
NT-proBNP 16 pg/mL
PCT 0.04 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
Chest radiography at admission showed nodular opacity in the right upper lobe (Fig. 3a), and plain chest CT showed numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side (Fig. 3b).
Figure 3. Case 2: Imaging findings at the time of hospital admission. (a) Chest radiography shows nodular opacity in the right upper lobe. (b) Chest CT shows numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side.
Treatment was started with intravenous infusion of methylprednisolone (80 mg/day) and azithromycin (500 mg every 24 hours) to alleviate inflammation, ceftriaxone (2 g every 24 hours) in consideration of bacterial pneumonia and peramivir (600 mg/day on Day 1 and 300 mg/day from Day 2 onward) as an antiviral agent (Fig. 4). The patient showed positive results of a COVID-19 RT-PCR test on Day 3 of hospitalization when treatment with favipiravir was started. Pyrexia in the patient persisted, and respiratory failure progressed even after the initiation of favipiravir. The dose of methylprednisolone was increased to 250 mg/day from Day 6 onward. On Day 7, continuous intravenous infusion of sivelestat (400 mg/day) was started. Since the platelet count had decreased to 13.9×104/μL and COVID-19 often causes abnormal coagulation, intravenous infusion of recombinant thrombomodulin (32,000 U/day) was also started. The D-dimer level slightly increased to 1.8 μg/mL on Day 10 but improved thereafter.
Figure 4. Case 2: Clinical course after hospital admission.
The further progression of respiratory failure necessitated noninvasive intermittent positive-pressure ventilation on Day 8 and intubation and mechanical ventilation on Day 9. On Day 10, V-V ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease and poor oxygenation, even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.5 L/min. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: PCV, FiO2 of 0.21, PEEP of 8 cmH2O, inspiratory pressure of 8 cmH2O and respiratory frequency of 12 per minute.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received ECMO was reduced. Therefore, he was weaned from ECMO on Day 15. He was extubated on Day 19. No ECMO-associated adverse events were observed. The patient no longer required supplemental oxygen supply on Day 23. The patient was discharged on Day 32 (Fig. 4).
Discussion
Although the majority of cases of COVID-19 result in mild, reversible symptoms, some patients develop dyspnea and hypoxemia within about a week of the onset of the disease. Wang et al. reported that 26.1% of patients hospitalized with COVID-19 pneumonia required treatment in the intensive-care unit (ICU); 61.1% of these patients in the ICU had ARDS, and the mortality rate was approximately 4.3% (9). A total of 60 patients with COVID-19 pneumonia had been admitted to our hospital as of the middle of May, 2020. Eight of these 60 patients required intubation and mechanical ventilation, including the 2 presently reported patients who also required the use of ECMO.
ARDS is characterized by excessive local inflammation in the lung, which can progress to an “out-of-control” state. Excessive production of mediators, such as cytokines (e.g., interleukin-6, tumor necrosis factor alpha, interleukin-8) and arachidonate metabolites (i.e., cytokine storm), interstitial lung edema caused by enhanced pulmonary vascular permeability, and diffuse alveolar damage induce a rapid decrease in oxygenation and the accumulation of carbon dioxide (10). Antiviral treatment and pharmacological and non-pharmacological supportive therapies are considered to serve as important therapeutic strategies for COVID-19 pneumonia patients with ARDS.
It was previously reported that the fulminant activation of coagulation and consumption of clotting factors occur in severe cases of COVID-19. Inflammation of lung tissues and endothelial cells causes microthrombi formation, leading to thrombotic complications, such as deep venous thrombosis, pulmonary embolism and thrombotic arterial complications (11). T tD-dimer and fibrinogen degradation product (FDP) levels were increased in both of the present cases. Furthermore, in Case 1, the patient developed DIC and pulmonary thromboembolism despite the use of anticoagulants.
DIC in patients with COVID-19 has previously been described, and its characteristics include a lack of bleeding risk, mildly low platelet counts and elevated plasma fibrinogen levels, none of which are seen in typical DIC. Therefore, instead of DIC, these data might more closely resemble complement-mediated thrombotic microangiopathy (TMA) syndromes. Importantly, another essential aspect of DIC seen in COVID-19 is the detection of both COVID-19 and complement components in regions of TMA. Mediators of TMA syndromes overlap with those released by cytokine storm, suggesting close connections between ineffective immune responses to COVID-19, severe pneumonia and life-threatening microangiopathy (12). Although the diagnostic criteria for DIC were met in case 1, TMA syndrome might have occurred in both cases (particularly in case 2) because of the lack of typical symptoms of DIC.
For the two cases presented in this report, favipiravir administration was started as an antiviral treatment immediately after the diagnosis of COVID-19. At a meeting of the Japanese Association for Infectious Diseases, we presented an immediate report on cases of COVID-19 pneumonia with progressive respiratory failure, for which favipiravir may have worked promptly and effectively (13). However, rapid progression of respiratory failure was observed in the patients in this report despite the initiation of treatment with favipiravir. This can be interpreted as suggesting that the clinical benefit of treatment with an antiviral agent alone is limited in patients with concurrent ARDS. At present, multiple clinical trials of favipiravir are underway in patients with mild to severe COVID-19 pneumonia. Future data from these trials may provide new insights into the drug's clinical benefits.
As a pharmacological supportive therapy, we administered methylprednisolone (an anti-inflammatory agent for inhibiting cytokine storm), sivelestat (a neutrophil elastase inhibitor) and macrolide antibiotics with an immunoregulatory function (14) effective for suppressing hyperimmunization and excessive inflammation. The World Health Organization (WHO) has advised against the use of corticosteroids to treat COVID-19. The interim WHO guidance on the management of patients with severe acute respiratory infection caused by COVID-19 presents negative views on the use of steroids in the treatment of this patient population (“routine use of steroids should be avoided unless the patient has symptoms including bronchial asthma, aggravated chronic obstructive pulmonary disease, and septic shock”) based on data from studies of steroid therapy in patients with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) or influenza (15). However, a study by the RECOVERY Collaborative Group showed that the use of dexamethasone in hospitalized COVID-19 patients resulted in a lower 28-day mortality than in those who were solely receiving either invasive mechanical ventilation or oxygen (6). In addition, Wu et al. performed a retrospective cohort study in patients with COVID-19 pneumonia and reported that the mortality in a cohort using methylprednisolone was lower than that in a cohort not using methylprednisolone, although the number of severe cases included in the former cohort was larger than that in the latter cohort (7). In our hospital, we have actively used steroids in patients with hypoxemia and achieved good outcomes. Based on these experiences, we are considering participating in a clinical study conducted to evaluate the efficacy of steroids in patients with COVID-19 pneumonia to verify the clinical effects of steroids in this patient population. Regarding macrolides, some researchers have reported that macrolide therapy was effective for reducing mortality in patients with ARDS (16). Although the mechanism underlying this reduction in mortality has not been fully elucidated, macrolides are likely to have effects on cytokine production and the neutrophil function (16).
As non-pharmacological supportive therapy, intubation, mechanical ventilation and ECMO were employed. ECMO is a life-supporting method used in patients with severe respiratory or cardiac failure (used particularly as a resuscitative measure taken for patients in cardiopulmonary arrest), called “respiratory ECMO” and “cardiac ECMO”, respectively. Respiratory ECMO is indicated for patients with reversible acute respiratory failure. Its use is considered for patients for whom conventional mechanical ventilation is insufficient for sustaining life or in whom continuous use of the mechanical ventilation system can result in irreversible damage to the lung. Respiratory ECMO is regarded as a treatment of ARDS (17). In the treatment of novel influenza A (H1N1) 2009, the results of ECMO database-based cohort studies (18,19) and the study on conventional ventilatory support vs. ECMO for severe adult respiratory failure (CESAR study) (20) demonstrated the efficacy of ECMO therapy based on the finding that the mortality in patients using ECMO was significantly lower than that in patients not using ECMO. In a retrospective study in MERS patients with refractory respiratory failure in 2018, the use of ECMO was required as an emergency treatment. The mortality in MERS patients with refractory hypoxemia in the ECMO cohort was significantly lower than that in the non-ECMO cohort (65% vs. 100%; p = 0.02) (21). Although little evidence for the efficacy of ECMO has been obtained with respect to COVID-19 pneumonia, results from two retrospective studies have been reported. In a retrospective study by Yang et al., of 52 patients admitted to the ICU with severe COVID-19 pneumonia, 32 died within 28 days of admission. ECMO was introduced to 6 patients, of whom 5 died, while the other was still on ECMO at the time of the endpoint assessment (22). In a retrospective study by Zhang et al., 48 of 221 patients with COVID-19 pneumonia had concurrent ARDS, and 10 of these 48 patients required mechanical ventilation and ECMO therapy. Of these 10 patients, 2 were successfully treated and discharged from the hospital, and 3 died. The other five patients were still on ECMO at the time of the endpoint assessment (23). According to the interim WHO guidance, ECMO, despite little evidence for its efficacy, is regarded as an emergency treatment of COVID-19 patients who have concurrent refractory hypoxemia even after being treated with lung-protective ventilation strategy (15). The condition of the two patients in the present case report was improved by intubation, mechanical ventilation and the prompt introduction of ECMO. COVID-19 pneumonia with ARDS is associated with high mortality. Pulmonary protection initiated before obtaining clinical benefits of antiviral treatment and pharmacological supportive therapy is considered to contribute to a reduction in mortality. Concerning complications, iliopsoas hematoma was identified in Case 1. In general, hemorrhagic complications, such as cannulation site bleeding, occur in approximately 50% of patients undergoing ECMO (17). ECMO-associated bleeding, which is attributed to the effect of heparinization as well as circuit-related consumption of coagulation factors, can be severe. It may be difficult to arrest bleeding if no measures other than monitoring the patient are taken. In Case 1, although the patient required blood transfusion, bleeding was arrested during the observation of the patient's condition. Infection is another critical complication said to occur in approximately 20% of patients on ECMO (17). However, the two patients in this report were able to safely receive ECMO therapy with no ECMO-related infectious complications.
Our two patients were already suffering from severe respiratory failure at the time of the diagnosis of COVID-19. They were successfully treated by a combination of antiviral treatment with favipiravir, corticosteroid, mechanical ventilation and ECMO. The positive outcomes of these cases underscore the importance of promptly treating severe COVID-19 pneumonia after the diagnosis with non-pharmacological supportive therapy, such as mechanical ventilation and ECMO, in combination with pharmacological supportive therapy, notably favipiravir for antiviral treatment and corticosteroid for anti-inflammatory treatment.
The authors state that they have no Conflict of Interest (COI). | Intravenous (not otherwise specified) | DrugAdministrationRoute | CC BY-NC-ND | 33390469 | 18,811,755 | 2021 |
What was the administration route of drug 'MEROPENEM'? | Two Cases of Severe COVID-19 Pneumonia Effectively Treated with Extracorporeal Membrane Oxygenation in Addition to Favipiravir and Corticosteroid.
Case 1: A 65-year-old man with novel coronavirus infection (COVID-19) complicated with acute respiratory failure. On admission, the patient was started on favipiravir and corticosteroid. However, due to a lack of significant improvement, he was introduced to mechanical ventilation and extracorporeal membrane oxygenation (ECMO). Although iliopsoas hematoma occurred as a complication, the patient recovered. Case 2: A 49-year-old man with COVID-19 had been started on favipiravir and corticosteroid. Due to progressive respiratory failure, the patient underwent mechanical ventilation and ECMO. The patient recovered without complications. We successfully treated these severe cases with a multimodal combination of pharmacological and non-pharmacological supportive therapy.
Introduction
Coronavirus disease 2019 (COVID-19) was first identified in December 2019 in Wuhan, China, and has since rapidly spread globally. At present, there are few established treatments for COVID-19 with confirmed efficacy, resulting in numerous deaths.
Globally, as of August 1, 2020, 17,396,943 confirmed cases and 675,060 deaths related to COVID-19 have been reported to WHO, and the mortality rate is 3.9% (1). The overall hospital mortality rate from COVID-19 is approximately 15% to 20%, increasing to 40% among patients requiring ICU admission. By age, the hospital mortality rate is 35% for patients 70 to 79 years old and 60% for patients 80 to 89 years old (2). The mortality in COVID-19 patients who develope severe respiratory compromise and require mechanical ventilation is high.
Favipiravir obtained manufacturing and marketing approval in March 2014 for “new or re-emerging influenza virus infections (provided that other anti-influenza virus drugs were ineffective)”. With regard to the mechanism of action of this drug, favipiravir taken up into cells is metabolized and converted by intracellular enzymes to become favipiravir ribofuranosyl triphosphate, which selectively inhibits viral RNA-dependent RNA polymerase. Therefore, this agent may also be effective against RNA viruses other than influenza virus, and indeed, nonclinical studies have reported its efficacy against several RNA viruses, including Ebola virus (3), Arenaviridae and Bunyaviridae (4). In an open-label, controlled trial in China, the time to viral clearance of mild to moderate COVID-19 treated with favipiravir and interferon alfa was significantly shorter than that of lobinavir ritonavir and interferon alfa (5).
There have been several reports of the efficacy of administering corticosteroids for COVID-19 patients, although opinions on this approach were initially negative (6,7). Corticosteroids are a viable therapeutic strategy for modulating the inflammatory response in patients with COVID-19.
The high mortality rate in severe cases is important, given the potential access to extracorporeal membrane oxygenation of venous blood, which may serve as a life-saving emergency treatment. Although the efficacy of ECMO in COVID-19 is controversial, ECMO is a proposed as a treatment option in the interim guidance document published by the WHO and interim guidance for clinical management of COVID-19 patients provided by the United States Centers for Disease Control (8).
We herein report two cases of COVID-19 in which the early introduction of ECMO was extremely effective for managing patients whose pneumonia was aggravated even under the use of favipiravir and corticosteroid.
Case Reports
Case 1
A 65-year-old Japanese man with no significant medical history developed malaise at the end of March, 2020, and eventually developed pyrexia, cough and dyspnea. He visited a local clinic 9 days later. Because the patient presented with decreased percutaneous oxygen saturation (SpO2) and ground-glass opacities in both lungs, he was suspected of having COVID-19 pneumonia. On the same day, he was taken to our hospital by an ambulance, where he was immediately admitted. He had neither a history of close contact with COVID-19-positive patients nor any recent travel history. He was a former smoker (37.5 packs per year).
At the time of admission, the patient had no disorientation, with a body temperature of 37.5℃, blood pressure of 140/78 mmHg, pulse rate of 72 beats per minute (regular), respiratory rate of 24 breaths per minute and SpO2 of 82% on room air. At the time of admission, a marked increase was observed in lactate dehydrogenase and C-reactive protein (CRP), being 628 U/L and 24.99 mg/dL, respectively. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were detected. Surfactant protein D increased to 221 ng/mL (Table 1).
Table 1. Case 1: Laboratory Findings at the Time of Hospital Admission.
TP 6.1 g/dL WBC 8,300 /μL
alb 2.6 g/dL neutro 87.4 %
T-bil 0.5 mg/dL lymph 6.9 %
AST 66 U/L mono 5.4 %
ALT 33 U/L eosino 0.1 %
LDH 628 U/L Hb 16.3 g/dL
γ-GTP 27 U/L Hct 47.5 %
CK 69 U/L Plt 27.9 ×104/μL
BUN 13.8 mg/dL
Cr 0.76 mg/dL PT-INR 1.16
UA 4.2 mg/dL APTT 35.8 sec
Na 136 mEq/L D-dimer 8.8 pg/mL
K 4.8 mEq/L fibrinogen 774 mg/dL
Cl 102 mEq/L
glu 99 mg/dL
CRP 24.99 mg/dL
IgG 846 mg/dL
IgA 157 mg/dL
IgM 36 mg/dL
IgE 92 mg/dL influenza A negative
SPA 92.8 ng/mL B negative
SPD 221 ng/mL
KL-6 370 U/mL
β-D-glucan 12.0 pg/mL
NT-proBNP 125 pg/mL
PCT 0.20 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
At the time of hospital admission, chest radiography showed diffuse ground-glass opacities in both lungs (Fig. 1a), and plain chest computed tomography (CT) showed diffuse ground-glass opacities in nearly all layers of both lungs (Fig. 1b).
Figure 1. Case 1: Imaging findings at the time of hospital admission. (a) Chest radiography shows diffuse ground-glass opacities in both lungs. (b) Chest CT shows diffuse ground-glass opacities in nearly all layers of both lungs.
The patient was found to have progressive acute respiratory failure and started to receive high-flow nasal cannula oxygen therapy [delivery of 50 L of flow; fraction of inspired oxygen (FiO2) of 50%]. Methylprednisolone pulse therapy (administered at 1 g/day for 3 days) was started to treat the progressive acute respiratory failure as empirical treatment for severe pneumonia and acute interstitial pneumonia. Intravenous infusion of meropenem (1 g every 8 hours) and azithromycin (500 mg every 24 hours) was started under suspicion of severe bacterial pneumonia, and continuous intravenous infusion of sivelestat (400 mg/day) was also started to treat acute respiratory distress syndrome (ARDS).
A COVID-19 real-time polymerase chain reaction (RT-PCR) test was performed, and the patient was found to be positive for COVID-19 on Day 3 of hospitalization. With the patient's consent, treatment with favipiravir was started on a compassionate-use basis. On Day 5, further progression of respiratory failure required the patient to be intubated and moved to mechanical ventilation. On the same day, veno-venous (V-V) ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease because mechanical ventilation was considered insufficient to sustain the cardiorespiratory system due to the patient's poor oxygenation even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.0 L/min. From days 3 to 5, platelets decreased from 24.5×104 to 17.8×104/μL, fibrinogen decreased from 426 to 54 mg/dL, and D-dimer increased from 68.1 to 98.2 μg/mL. No bleeding tendency, circulatory failure due to microthrombus, or multiple organ failure was observed. Since the criteria established by the Japanese Association for Acute Medicine for disseminated intravascular coagulation (DIC) were met, we administered recombinant thrombomodulin. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: pressure-controlled ventilation (PCV), FiO2 of 0.35, positive end-expiratory pressure (PEEP) of 9 cmH2O, inspiratory pressure of 7 cmH2O and respiratory frequency of 10 per minute. After introduction of mechanical ventilation and ECMO, the patient's blood pressure decreased. Based on the echocardiographic and electrocardiographic findings, the patient was diagnosed with concurrent takotsubo cardiomyopathy, for which treatment with noradrenaline was started.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received through ECMO was reduced. Therefore, he was weaned from ECMO on Day 12. He was extubated on Day 14. As an adverse event, the patient developed left iliopsoas bleed that required a number of blood transfusions, which resulted in transfusion-associated circulatory overload. The patient was re-intubated and placed on mechanical ventilation on Day 15. His condition improved after fluid management, and he was extubated again on Day 23. The radio-opaque areas in the lung fields became smaller. The flow of supplemental oxygen was decreased to 1 L/min/cannula on Day 33. The patient was discharged on Day 41 (Fig. 2).
Figure 2. Case 1: Clinical course after hospital admission.
Case 2
A 49-year-old Japanese man with bronchial asthma presented with pyrexia, malaise and dyspnea at the middle of April, 2020, and visited a local clinic. Due to his poor response to any symptomatic treatments given, the patient was taken by ambulance to our hospital 3 days later. He had had close contact with his wife, who had contracted COVID-19 pneumonia. He was suspected of also having COVID-19 pneumonia based on chest CT findings and was admitted to the hospital on the same day. He had no smoking history.
At the time of admission, the patient had no disorientation, with a body temperature of 39.9℃, blood pressure of 142/88 mmHg, pulse rate of 126 beats per minute, regular, respiratory rate of 22 breaths per minute and percutaneous oxygen saturation (SpO2) of 97% on room air, and a slight increase in CRP (0.70) was observed. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were noted (Table 2).
Table 2. Case 2: Laboratory Findings at the Time of Hospital Admission.
TP 7.1 g/dL WBC 5,500 /μL
alb 4.1 g/dL neutro 80.6 %
T-bil 0.52 mg/dL lymph 11.2 %
AST 22 U/L mono 8.2 %
ALT 32 U/L eosino 0 %
LDH 190 U/L Hb 16.0 g/dL
γ-GTP 17 U/L Hct 46.2 %
CK 65 U/L Plt 20.2 ×104/μL
BUN 8.8 mg/dL
Cr 0.99 mg/dL PT-INR 1.07
UA 6.4 mg/dL APTT 35.0 sec
Na 139 mEq/L D-dimer 0.4 pg/mL
K 3.4 mEq/L fibrinogen 334 mg/dL
Cl 107 mEq/L
glu 112 mg/dL
CRP 0.70 mg/dL
IgG 1,186 mg/dL influenza A negative
IgA 297 mg/dL B negative
IgM 37 mg/dL
IgE 223 mg/dL Pneumococcal urinary antigen test negative
SPA 16.1 ng/mL
SPD 25.6 ng/mL Legionella urinary antigen test negative
KL-6 165 U/mL
β-D-glucan 5.1 pg/mL
NT-proBNP 16 pg/mL
PCT 0.04 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
Chest radiography at admission showed nodular opacity in the right upper lobe (Fig. 3a), and plain chest CT showed numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side (Fig. 3b).
Figure 3. Case 2: Imaging findings at the time of hospital admission. (a) Chest radiography shows nodular opacity in the right upper lobe. (b) Chest CT shows numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side.
Treatment was started with intravenous infusion of methylprednisolone (80 mg/day) and azithromycin (500 mg every 24 hours) to alleviate inflammation, ceftriaxone (2 g every 24 hours) in consideration of bacterial pneumonia and peramivir (600 mg/day on Day 1 and 300 mg/day from Day 2 onward) as an antiviral agent (Fig. 4). The patient showed positive results of a COVID-19 RT-PCR test on Day 3 of hospitalization when treatment with favipiravir was started. Pyrexia in the patient persisted, and respiratory failure progressed even after the initiation of favipiravir. The dose of methylprednisolone was increased to 250 mg/day from Day 6 onward. On Day 7, continuous intravenous infusion of sivelestat (400 mg/day) was started. Since the platelet count had decreased to 13.9×104/μL and COVID-19 often causes abnormal coagulation, intravenous infusion of recombinant thrombomodulin (32,000 U/day) was also started. The D-dimer level slightly increased to 1.8 μg/mL on Day 10 but improved thereafter.
Figure 4. Case 2: Clinical course after hospital admission.
The further progression of respiratory failure necessitated noninvasive intermittent positive-pressure ventilation on Day 8 and intubation and mechanical ventilation on Day 9. On Day 10, V-V ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease and poor oxygenation, even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.5 L/min. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: PCV, FiO2 of 0.21, PEEP of 8 cmH2O, inspiratory pressure of 8 cmH2O and respiratory frequency of 12 per minute.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received ECMO was reduced. Therefore, he was weaned from ECMO on Day 15. He was extubated on Day 19. No ECMO-associated adverse events were observed. The patient no longer required supplemental oxygen supply on Day 23. The patient was discharged on Day 32 (Fig. 4).
Discussion
Although the majority of cases of COVID-19 result in mild, reversible symptoms, some patients develop dyspnea and hypoxemia within about a week of the onset of the disease. Wang et al. reported that 26.1% of patients hospitalized with COVID-19 pneumonia required treatment in the intensive-care unit (ICU); 61.1% of these patients in the ICU had ARDS, and the mortality rate was approximately 4.3% (9). A total of 60 patients with COVID-19 pneumonia had been admitted to our hospital as of the middle of May, 2020. Eight of these 60 patients required intubation and mechanical ventilation, including the 2 presently reported patients who also required the use of ECMO.
ARDS is characterized by excessive local inflammation in the lung, which can progress to an “out-of-control” state. Excessive production of mediators, such as cytokines (e.g., interleukin-6, tumor necrosis factor alpha, interleukin-8) and arachidonate metabolites (i.e., cytokine storm), interstitial lung edema caused by enhanced pulmonary vascular permeability, and diffuse alveolar damage induce a rapid decrease in oxygenation and the accumulation of carbon dioxide (10). Antiviral treatment and pharmacological and non-pharmacological supportive therapies are considered to serve as important therapeutic strategies for COVID-19 pneumonia patients with ARDS.
It was previously reported that the fulminant activation of coagulation and consumption of clotting factors occur in severe cases of COVID-19. Inflammation of lung tissues and endothelial cells causes microthrombi formation, leading to thrombotic complications, such as deep venous thrombosis, pulmonary embolism and thrombotic arterial complications (11). T tD-dimer and fibrinogen degradation product (FDP) levels were increased in both of the present cases. Furthermore, in Case 1, the patient developed DIC and pulmonary thromboembolism despite the use of anticoagulants.
DIC in patients with COVID-19 has previously been described, and its characteristics include a lack of bleeding risk, mildly low platelet counts and elevated plasma fibrinogen levels, none of which are seen in typical DIC. Therefore, instead of DIC, these data might more closely resemble complement-mediated thrombotic microangiopathy (TMA) syndromes. Importantly, another essential aspect of DIC seen in COVID-19 is the detection of both COVID-19 and complement components in regions of TMA. Mediators of TMA syndromes overlap with those released by cytokine storm, suggesting close connections between ineffective immune responses to COVID-19, severe pneumonia and life-threatening microangiopathy (12). Although the diagnostic criteria for DIC were met in case 1, TMA syndrome might have occurred in both cases (particularly in case 2) because of the lack of typical symptoms of DIC.
For the two cases presented in this report, favipiravir administration was started as an antiviral treatment immediately after the diagnosis of COVID-19. At a meeting of the Japanese Association for Infectious Diseases, we presented an immediate report on cases of COVID-19 pneumonia with progressive respiratory failure, for which favipiravir may have worked promptly and effectively (13). However, rapid progression of respiratory failure was observed in the patients in this report despite the initiation of treatment with favipiravir. This can be interpreted as suggesting that the clinical benefit of treatment with an antiviral agent alone is limited in patients with concurrent ARDS. At present, multiple clinical trials of favipiravir are underway in patients with mild to severe COVID-19 pneumonia. Future data from these trials may provide new insights into the drug's clinical benefits.
As a pharmacological supportive therapy, we administered methylprednisolone (an anti-inflammatory agent for inhibiting cytokine storm), sivelestat (a neutrophil elastase inhibitor) and macrolide antibiotics with an immunoregulatory function (14) effective for suppressing hyperimmunization and excessive inflammation. The World Health Organization (WHO) has advised against the use of corticosteroids to treat COVID-19. The interim WHO guidance on the management of patients with severe acute respiratory infection caused by COVID-19 presents negative views on the use of steroids in the treatment of this patient population (“routine use of steroids should be avoided unless the patient has symptoms including bronchial asthma, aggravated chronic obstructive pulmonary disease, and septic shock”) based on data from studies of steroid therapy in patients with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) or influenza (15). However, a study by the RECOVERY Collaborative Group showed that the use of dexamethasone in hospitalized COVID-19 patients resulted in a lower 28-day mortality than in those who were solely receiving either invasive mechanical ventilation or oxygen (6). In addition, Wu et al. performed a retrospective cohort study in patients with COVID-19 pneumonia and reported that the mortality in a cohort using methylprednisolone was lower than that in a cohort not using methylprednisolone, although the number of severe cases included in the former cohort was larger than that in the latter cohort (7). In our hospital, we have actively used steroids in patients with hypoxemia and achieved good outcomes. Based on these experiences, we are considering participating in a clinical study conducted to evaluate the efficacy of steroids in patients with COVID-19 pneumonia to verify the clinical effects of steroids in this patient population. Regarding macrolides, some researchers have reported that macrolide therapy was effective for reducing mortality in patients with ARDS (16). Although the mechanism underlying this reduction in mortality has not been fully elucidated, macrolides are likely to have effects on cytokine production and the neutrophil function (16).
As non-pharmacological supportive therapy, intubation, mechanical ventilation and ECMO were employed. ECMO is a life-supporting method used in patients with severe respiratory or cardiac failure (used particularly as a resuscitative measure taken for patients in cardiopulmonary arrest), called “respiratory ECMO” and “cardiac ECMO”, respectively. Respiratory ECMO is indicated for patients with reversible acute respiratory failure. Its use is considered for patients for whom conventional mechanical ventilation is insufficient for sustaining life or in whom continuous use of the mechanical ventilation system can result in irreversible damage to the lung. Respiratory ECMO is regarded as a treatment of ARDS (17). In the treatment of novel influenza A (H1N1) 2009, the results of ECMO database-based cohort studies (18,19) and the study on conventional ventilatory support vs. ECMO for severe adult respiratory failure (CESAR study) (20) demonstrated the efficacy of ECMO therapy based on the finding that the mortality in patients using ECMO was significantly lower than that in patients not using ECMO. In a retrospective study in MERS patients with refractory respiratory failure in 2018, the use of ECMO was required as an emergency treatment. The mortality in MERS patients with refractory hypoxemia in the ECMO cohort was significantly lower than that in the non-ECMO cohort (65% vs. 100%; p = 0.02) (21). Although little evidence for the efficacy of ECMO has been obtained with respect to COVID-19 pneumonia, results from two retrospective studies have been reported. In a retrospective study by Yang et al., of 52 patients admitted to the ICU with severe COVID-19 pneumonia, 32 died within 28 days of admission. ECMO was introduced to 6 patients, of whom 5 died, while the other was still on ECMO at the time of the endpoint assessment (22). In a retrospective study by Zhang et al., 48 of 221 patients with COVID-19 pneumonia had concurrent ARDS, and 10 of these 48 patients required mechanical ventilation and ECMO therapy. Of these 10 patients, 2 were successfully treated and discharged from the hospital, and 3 died. The other five patients were still on ECMO at the time of the endpoint assessment (23). According to the interim WHO guidance, ECMO, despite little evidence for its efficacy, is regarded as an emergency treatment of COVID-19 patients who have concurrent refractory hypoxemia even after being treated with lung-protective ventilation strategy (15). The condition of the two patients in the present case report was improved by intubation, mechanical ventilation and the prompt introduction of ECMO. COVID-19 pneumonia with ARDS is associated with high mortality. Pulmonary protection initiated before obtaining clinical benefits of antiviral treatment and pharmacological supportive therapy is considered to contribute to a reduction in mortality. Concerning complications, iliopsoas hematoma was identified in Case 1. In general, hemorrhagic complications, such as cannulation site bleeding, occur in approximately 50% of patients undergoing ECMO (17). ECMO-associated bleeding, which is attributed to the effect of heparinization as well as circuit-related consumption of coagulation factors, can be severe. It may be difficult to arrest bleeding if no measures other than monitoring the patient are taken. In Case 1, although the patient required blood transfusion, bleeding was arrested during the observation of the patient's condition. Infection is another critical complication said to occur in approximately 20% of patients on ECMO (17). However, the two patients in this report were able to safely receive ECMO therapy with no ECMO-related infectious complications.
Our two patients were already suffering from severe respiratory failure at the time of the diagnosis of COVID-19. They were successfully treated by a combination of antiviral treatment with favipiravir, corticosteroid, mechanical ventilation and ECMO. The positive outcomes of these cases underscore the importance of promptly treating severe COVID-19 pneumonia after the diagnosis with non-pharmacological supportive therapy, such as mechanical ventilation and ECMO, in combination with pharmacological supportive therapy, notably favipiravir for antiviral treatment and corticosteroid for anti-inflammatory treatment.
The authors state that they have no Conflict of Interest (COI). | Intravenous (not otherwise specified) | DrugAdministrationRoute | CC BY-NC-ND | 33390469 | 18,811,755 | 2021 |
What was the administration route of drug 'SIVELESTAT'? | Two Cases of Severe COVID-19 Pneumonia Effectively Treated with Extracorporeal Membrane Oxygenation in Addition to Favipiravir and Corticosteroid.
Case 1: A 65-year-old man with novel coronavirus infection (COVID-19) complicated with acute respiratory failure. On admission, the patient was started on favipiravir and corticosteroid. However, due to a lack of significant improvement, he was introduced to mechanical ventilation and extracorporeal membrane oxygenation (ECMO). Although iliopsoas hematoma occurred as a complication, the patient recovered. Case 2: A 49-year-old man with COVID-19 had been started on favipiravir and corticosteroid. Due to progressive respiratory failure, the patient underwent mechanical ventilation and ECMO. The patient recovered without complications. We successfully treated these severe cases with a multimodal combination of pharmacological and non-pharmacological supportive therapy.
Introduction
Coronavirus disease 2019 (COVID-19) was first identified in December 2019 in Wuhan, China, and has since rapidly spread globally. At present, there are few established treatments for COVID-19 with confirmed efficacy, resulting in numerous deaths.
Globally, as of August 1, 2020, 17,396,943 confirmed cases and 675,060 deaths related to COVID-19 have been reported to WHO, and the mortality rate is 3.9% (1). The overall hospital mortality rate from COVID-19 is approximately 15% to 20%, increasing to 40% among patients requiring ICU admission. By age, the hospital mortality rate is 35% for patients 70 to 79 years old and 60% for patients 80 to 89 years old (2). The mortality in COVID-19 patients who develope severe respiratory compromise and require mechanical ventilation is high.
Favipiravir obtained manufacturing and marketing approval in March 2014 for “new or re-emerging influenza virus infections (provided that other anti-influenza virus drugs were ineffective)”. With regard to the mechanism of action of this drug, favipiravir taken up into cells is metabolized and converted by intracellular enzymes to become favipiravir ribofuranosyl triphosphate, which selectively inhibits viral RNA-dependent RNA polymerase. Therefore, this agent may also be effective against RNA viruses other than influenza virus, and indeed, nonclinical studies have reported its efficacy against several RNA viruses, including Ebola virus (3), Arenaviridae and Bunyaviridae (4). In an open-label, controlled trial in China, the time to viral clearance of mild to moderate COVID-19 treated with favipiravir and interferon alfa was significantly shorter than that of lobinavir ritonavir and interferon alfa (5).
There have been several reports of the efficacy of administering corticosteroids for COVID-19 patients, although opinions on this approach were initially negative (6,7). Corticosteroids are a viable therapeutic strategy for modulating the inflammatory response in patients with COVID-19.
The high mortality rate in severe cases is important, given the potential access to extracorporeal membrane oxygenation of venous blood, which may serve as a life-saving emergency treatment. Although the efficacy of ECMO in COVID-19 is controversial, ECMO is a proposed as a treatment option in the interim guidance document published by the WHO and interim guidance for clinical management of COVID-19 patients provided by the United States Centers for Disease Control (8).
We herein report two cases of COVID-19 in which the early introduction of ECMO was extremely effective for managing patients whose pneumonia was aggravated even under the use of favipiravir and corticosteroid.
Case Reports
Case 1
A 65-year-old Japanese man with no significant medical history developed malaise at the end of March, 2020, and eventually developed pyrexia, cough and dyspnea. He visited a local clinic 9 days later. Because the patient presented with decreased percutaneous oxygen saturation (SpO2) and ground-glass opacities in both lungs, he was suspected of having COVID-19 pneumonia. On the same day, he was taken to our hospital by an ambulance, where he was immediately admitted. He had neither a history of close contact with COVID-19-positive patients nor any recent travel history. He was a former smoker (37.5 packs per year).
At the time of admission, the patient had no disorientation, with a body temperature of 37.5℃, blood pressure of 140/78 mmHg, pulse rate of 72 beats per minute (regular), respiratory rate of 24 breaths per minute and SpO2 of 82% on room air. At the time of admission, a marked increase was observed in lactate dehydrogenase and C-reactive protein (CRP), being 628 U/L and 24.99 mg/dL, respectively. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were detected. Surfactant protein D increased to 221 ng/mL (Table 1).
Table 1. Case 1: Laboratory Findings at the Time of Hospital Admission.
TP 6.1 g/dL WBC 8,300 /μL
alb 2.6 g/dL neutro 87.4 %
T-bil 0.5 mg/dL lymph 6.9 %
AST 66 U/L mono 5.4 %
ALT 33 U/L eosino 0.1 %
LDH 628 U/L Hb 16.3 g/dL
γ-GTP 27 U/L Hct 47.5 %
CK 69 U/L Plt 27.9 ×104/μL
BUN 13.8 mg/dL
Cr 0.76 mg/dL PT-INR 1.16
UA 4.2 mg/dL APTT 35.8 sec
Na 136 mEq/L D-dimer 8.8 pg/mL
K 4.8 mEq/L fibrinogen 774 mg/dL
Cl 102 mEq/L
glu 99 mg/dL
CRP 24.99 mg/dL
IgG 846 mg/dL
IgA 157 mg/dL
IgM 36 mg/dL
IgE 92 mg/dL influenza A negative
SPA 92.8 ng/mL B negative
SPD 221 ng/mL
KL-6 370 U/mL
β-D-glucan 12.0 pg/mL
NT-proBNP 125 pg/mL
PCT 0.20 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
At the time of hospital admission, chest radiography showed diffuse ground-glass opacities in both lungs (Fig. 1a), and plain chest computed tomography (CT) showed diffuse ground-glass opacities in nearly all layers of both lungs (Fig. 1b).
Figure 1. Case 1: Imaging findings at the time of hospital admission. (a) Chest radiography shows diffuse ground-glass opacities in both lungs. (b) Chest CT shows diffuse ground-glass opacities in nearly all layers of both lungs.
The patient was found to have progressive acute respiratory failure and started to receive high-flow nasal cannula oxygen therapy [delivery of 50 L of flow; fraction of inspired oxygen (FiO2) of 50%]. Methylprednisolone pulse therapy (administered at 1 g/day for 3 days) was started to treat the progressive acute respiratory failure as empirical treatment for severe pneumonia and acute interstitial pneumonia. Intravenous infusion of meropenem (1 g every 8 hours) and azithromycin (500 mg every 24 hours) was started under suspicion of severe bacterial pneumonia, and continuous intravenous infusion of sivelestat (400 mg/day) was also started to treat acute respiratory distress syndrome (ARDS).
A COVID-19 real-time polymerase chain reaction (RT-PCR) test was performed, and the patient was found to be positive for COVID-19 on Day 3 of hospitalization. With the patient's consent, treatment with favipiravir was started on a compassionate-use basis. On Day 5, further progression of respiratory failure required the patient to be intubated and moved to mechanical ventilation. On the same day, veno-venous (V-V) ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease because mechanical ventilation was considered insufficient to sustain the cardiorespiratory system due to the patient's poor oxygenation even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.0 L/min. From days 3 to 5, platelets decreased from 24.5×104 to 17.8×104/μL, fibrinogen decreased from 426 to 54 mg/dL, and D-dimer increased from 68.1 to 98.2 μg/mL. No bleeding tendency, circulatory failure due to microthrombus, or multiple organ failure was observed. Since the criteria established by the Japanese Association for Acute Medicine for disseminated intravascular coagulation (DIC) were met, we administered recombinant thrombomodulin. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: pressure-controlled ventilation (PCV), FiO2 of 0.35, positive end-expiratory pressure (PEEP) of 9 cmH2O, inspiratory pressure of 7 cmH2O and respiratory frequency of 10 per minute. After introduction of mechanical ventilation and ECMO, the patient's blood pressure decreased. Based on the echocardiographic and electrocardiographic findings, the patient was diagnosed with concurrent takotsubo cardiomyopathy, for which treatment with noradrenaline was started.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received through ECMO was reduced. Therefore, he was weaned from ECMO on Day 12. He was extubated on Day 14. As an adverse event, the patient developed left iliopsoas bleed that required a number of blood transfusions, which resulted in transfusion-associated circulatory overload. The patient was re-intubated and placed on mechanical ventilation on Day 15. His condition improved after fluid management, and he was extubated again on Day 23. The radio-opaque areas in the lung fields became smaller. The flow of supplemental oxygen was decreased to 1 L/min/cannula on Day 33. The patient was discharged on Day 41 (Fig. 2).
Figure 2. Case 1: Clinical course after hospital admission.
Case 2
A 49-year-old Japanese man with bronchial asthma presented with pyrexia, malaise and dyspnea at the middle of April, 2020, and visited a local clinic. Due to his poor response to any symptomatic treatments given, the patient was taken by ambulance to our hospital 3 days later. He had had close contact with his wife, who had contracted COVID-19 pneumonia. He was suspected of also having COVID-19 pneumonia based on chest CT findings and was admitted to the hospital on the same day. He had no smoking history.
At the time of admission, the patient had no disorientation, with a body temperature of 39.9℃, blood pressure of 142/88 mmHg, pulse rate of 126 beats per minute, regular, respiratory rate of 22 breaths per minute and percutaneous oxygen saturation (SpO2) of 97% on room air, and a slight increase in CRP (0.70) was observed. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were noted (Table 2).
Table 2. Case 2: Laboratory Findings at the Time of Hospital Admission.
TP 7.1 g/dL WBC 5,500 /μL
alb 4.1 g/dL neutro 80.6 %
T-bil 0.52 mg/dL lymph 11.2 %
AST 22 U/L mono 8.2 %
ALT 32 U/L eosino 0 %
LDH 190 U/L Hb 16.0 g/dL
γ-GTP 17 U/L Hct 46.2 %
CK 65 U/L Plt 20.2 ×104/μL
BUN 8.8 mg/dL
Cr 0.99 mg/dL PT-INR 1.07
UA 6.4 mg/dL APTT 35.0 sec
Na 139 mEq/L D-dimer 0.4 pg/mL
K 3.4 mEq/L fibrinogen 334 mg/dL
Cl 107 mEq/L
glu 112 mg/dL
CRP 0.70 mg/dL
IgG 1,186 mg/dL influenza A negative
IgA 297 mg/dL B negative
IgM 37 mg/dL
IgE 223 mg/dL Pneumococcal urinary antigen test negative
SPA 16.1 ng/mL
SPD 25.6 ng/mL Legionella urinary antigen test negative
KL-6 165 U/mL
β-D-glucan 5.1 pg/mL
NT-proBNP 16 pg/mL
PCT 0.04 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
Chest radiography at admission showed nodular opacity in the right upper lobe (Fig. 3a), and plain chest CT showed numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side (Fig. 3b).
Figure 3. Case 2: Imaging findings at the time of hospital admission. (a) Chest radiography shows nodular opacity in the right upper lobe. (b) Chest CT shows numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side.
Treatment was started with intravenous infusion of methylprednisolone (80 mg/day) and azithromycin (500 mg every 24 hours) to alleviate inflammation, ceftriaxone (2 g every 24 hours) in consideration of bacterial pneumonia and peramivir (600 mg/day on Day 1 and 300 mg/day from Day 2 onward) as an antiviral agent (Fig. 4). The patient showed positive results of a COVID-19 RT-PCR test on Day 3 of hospitalization when treatment with favipiravir was started. Pyrexia in the patient persisted, and respiratory failure progressed even after the initiation of favipiravir. The dose of methylprednisolone was increased to 250 mg/day from Day 6 onward. On Day 7, continuous intravenous infusion of sivelestat (400 mg/day) was started. Since the platelet count had decreased to 13.9×104/μL and COVID-19 often causes abnormal coagulation, intravenous infusion of recombinant thrombomodulin (32,000 U/day) was also started. The D-dimer level slightly increased to 1.8 μg/mL on Day 10 but improved thereafter.
Figure 4. Case 2: Clinical course after hospital admission.
The further progression of respiratory failure necessitated noninvasive intermittent positive-pressure ventilation on Day 8 and intubation and mechanical ventilation on Day 9. On Day 10, V-V ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease and poor oxygenation, even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.5 L/min. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: PCV, FiO2 of 0.21, PEEP of 8 cmH2O, inspiratory pressure of 8 cmH2O and respiratory frequency of 12 per minute.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received ECMO was reduced. Therefore, he was weaned from ECMO on Day 15. He was extubated on Day 19. No ECMO-associated adverse events were observed. The patient no longer required supplemental oxygen supply on Day 23. The patient was discharged on Day 32 (Fig. 4).
Discussion
Although the majority of cases of COVID-19 result in mild, reversible symptoms, some patients develop dyspnea and hypoxemia within about a week of the onset of the disease. Wang et al. reported that 26.1% of patients hospitalized with COVID-19 pneumonia required treatment in the intensive-care unit (ICU); 61.1% of these patients in the ICU had ARDS, and the mortality rate was approximately 4.3% (9). A total of 60 patients with COVID-19 pneumonia had been admitted to our hospital as of the middle of May, 2020. Eight of these 60 patients required intubation and mechanical ventilation, including the 2 presently reported patients who also required the use of ECMO.
ARDS is characterized by excessive local inflammation in the lung, which can progress to an “out-of-control” state. Excessive production of mediators, such as cytokines (e.g., interleukin-6, tumor necrosis factor alpha, interleukin-8) and arachidonate metabolites (i.e., cytokine storm), interstitial lung edema caused by enhanced pulmonary vascular permeability, and diffuse alveolar damage induce a rapid decrease in oxygenation and the accumulation of carbon dioxide (10). Antiviral treatment and pharmacological and non-pharmacological supportive therapies are considered to serve as important therapeutic strategies for COVID-19 pneumonia patients with ARDS.
It was previously reported that the fulminant activation of coagulation and consumption of clotting factors occur in severe cases of COVID-19. Inflammation of lung tissues and endothelial cells causes microthrombi formation, leading to thrombotic complications, such as deep venous thrombosis, pulmonary embolism and thrombotic arterial complications (11). T tD-dimer and fibrinogen degradation product (FDP) levels were increased in both of the present cases. Furthermore, in Case 1, the patient developed DIC and pulmonary thromboembolism despite the use of anticoagulants.
DIC in patients with COVID-19 has previously been described, and its characteristics include a lack of bleeding risk, mildly low platelet counts and elevated plasma fibrinogen levels, none of which are seen in typical DIC. Therefore, instead of DIC, these data might more closely resemble complement-mediated thrombotic microangiopathy (TMA) syndromes. Importantly, another essential aspect of DIC seen in COVID-19 is the detection of both COVID-19 and complement components in regions of TMA. Mediators of TMA syndromes overlap with those released by cytokine storm, suggesting close connections between ineffective immune responses to COVID-19, severe pneumonia and life-threatening microangiopathy (12). Although the diagnostic criteria for DIC were met in case 1, TMA syndrome might have occurred in both cases (particularly in case 2) because of the lack of typical symptoms of DIC.
For the two cases presented in this report, favipiravir administration was started as an antiviral treatment immediately after the diagnosis of COVID-19. At a meeting of the Japanese Association for Infectious Diseases, we presented an immediate report on cases of COVID-19 pneumonia with progressive respiratory failure, for which favipiravir may have worked promptly and effectively (13). However, rapid progression of respiratory failure was observed in the patients in this report despite the initiation of treatment with favipiravir. This can be interpreted as suggesting that the clinical benefit of treatment with an antiviral agent alone is limited in patients with concurrent ARDS. At present, multiple clinical trials of favipiravir are underway in patients with mild to severe COVID-19 pneumonia. Future data from these trials may provide new insights into the drug's clinical benefits.
As a pharmacological supportive therapy, we administered methylprednisolone (an anti-inflammatory agent for inhibiting cytokine storm), sivelestat (a neutrophil elastase inhibitor) and macrolide antibiotics with an immunoregulatory function (14) effective for suppressing hyperimmunization and excessive inflammation. The World Health Organization (WHO) has advised against the use of corticosteroids to treat COVID-19. The interim WHO guidance on the management of patients with severe acute respiratory infection caused by COVID-19 presents negative views on the use of steroids in the treatment of this patient population (“routine use of steroids should be avoided unless the patient has symptoms including bronchial asthma, aggravated chronic obstructive pulmonary disease, and septic shock”) based on data from studies of steroid therapy in patients with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) or influenza (15). However, a study by the RECOVERY Collaborative Group showed that the use of dexamethasone in hospitalized COVID-19 patients resulted in a lower 28-day mortality than in those who were solely receiving either invasive mechanical ventilation or oxygen (6). In addition, Wu et al. performed a retrospective cohort study in patients with COVID-19 pneumonia and reported that the mortality in a cohort using methylprednisolone was lower than that in a cohort not using methylprednisolone, although the number of severe cases included in the former cohort was larger than that in the latter cohort (7). In our hospital, we have actively used steroids in patients with hypoxemia and achieved good outcomes. Based on these experiences, we are considering participating in a clinical study conducted to evaluate the efficacy of steroids in patients with COVID-19 pneumonia to verify the clinical effects of steroids in this patient population. Regarding macrolides, some researchers have reported that macrolide therapy was effective for reducing mortality in patients with ARDS (16). Although the mechanism underlying this reduction in mortality has not been fully elucidated, macrolides are likely to have effects on cytokine production and the neutrophil function (16).
As non-pharmacological supportive therapy, intubation, mechanical ventilation and ECMO were employed. ECMO is a life-supporting method used in patients with severe respiratory or cardiac failure (used particularly as a resuscitative measure taken for patients in cardiopulmonary arrest), called “respiratory ECMO” and “cardiac ECMO”, respectively. Respiratory ECMO is indicated for patients with reversible acute respiratory failure. Its use is considered for patients for whom conventional mechanical ventilation is insufficient for sustaining life or in whom continuous use of the mechanical ventilation system can result in irreversible damage to the lung. Respiratory ECMO is regarded as a treatment of ARDS (17). In the treatment of novel influenza A (H1N1) 2009, the results of ECMO database-based cohort studies (18,19) and the study on conventional ventilatory support vs. ECMO for severe adult respiratory failure (CESAR study) (20) demonstrated the efficacy of ECMO therapy based on the finding that the mortality in patients using ECMO was significantly lower than that in patients not using ECMO. In a retrospective study in MERS patients with refractory respiratory failure in 2018, the use of ECMO was required as an emergency treatment. The mortality in MERS patients with refractory hypoxemia in the ECMO cohort was significantly lower than that in the non-ECMO cohort (65% vs. 100%; p = 0.02) (21). Although little evidence for the efficacy of ECMO has been obtained with respect to COVID-19 pneumonia, results from two retrospective studies have been reported. In a retrospective study by Yang et al., of 52 patients admitted to the ICU with severe COVID-19 pneumonia, 32 died within 28 days of admission. ECMO was introduced to 6 patients, of whom 5 died, while the other was still on ECMO at the time of the endpoint assessment (22). In a retrospective study by Zhang et al., 48 of 221 patients with COVID-19 pneumonia had concurrent ARDS, and 10 of these 48 patients required mechanical ventilation and ECMO therapy. Of these 10 patients, 2 were successfully treated and discharged from the hospital, and 3 died. The other five patients were still on ECMO at the time of the endpoint assessment (23). According to the interim WHO guidance, ECMO, despite little evidence for its efficacy, is regarded as an emergency treatment of COVID-19 patients who have concurrent refractory hypoxemia even after being treated with lung-protective ventilation strategy (15). The condition of the two patients in the present case report was improved by intubation, mechanical ventilation and the prompt introduction of ECMO. COVID-19 pneumonia with ARDS is associated with high mortality. Pulmonary protection initiated before obtaining clinical benefits of antiviral treatment and pharmacological supportive therapy is considered to contribute to a reduction in mortality. Concerning complications, iliopsoas hematoma was identified in Case 1. In general, hemorrhagic complications, such as cannulation site bleeding, occur in approximately 50% of patients undergoing ECMO (17). ECMO-associated bleeding, which is attributed to the effect of heparinization as well as circuit-related consumption of coagulation factors, can be severe. It may be difficult to arrest bleeding if no measures other than monitoring the patient are taken. In Case 1, although the patient required blood transfusion, bleeding was arrested during the observation of the patient's condition. Infection is another critical complication said to occur in approximately 20% of patients on ECMO (17). However, the two patients in this report were able to safely receive ECMO therapy with no ECMO-related infectious complications.
Our two patients were already suffering from severe respiratory failure at the time of the diagnosis of COVID-19. They were successfully treated by a combination of antiviral treatment with favipiravir, corticosteroid, mechanical ventilation and ECMO. The positive outcomes of these cases underscore the importance of promptly treating severe COVID-19 pneumonia after the diagnosis with non-pharmacological supportive therapy, such as mechanical ventilation and ECMO, in combination with pharmacological supportive therapy, notably favipiravir for antiviral treatment and corticosteroid for anti-inflammatory treatment.
The authors state that they have no Conflict of Interest (COI). | Intravenous (not otherwise specified) | DrugAdministrationRoute | CC BY-NC-ND | 33390469 | 18,811,755 | 2021 |
What was the dosage of drug 'AZITHROMYCIN ANHYDROUS'? | Two Cases of Severe COVID-19 Pneumonia Effectively Treated with Extracorporeal Membrane Oxygenation in Addition to Favipiravir and Corticosteroid.
Case 1: A 65-year-old man with novel coronavirus infection (COVID-19) complicated with acute respiratory failure. On admission, the patient was started on favipiravir and corticosteroid. However, due to a lack of significant improvement, he was introduced to mechanical ventilation and extracorporeal membrane oxygenation (ECMO). Although iliopsoas hematoma occurred as a complication, the patient recovered. Case 2: A 49-year-old man with COVID-19 had been started on favipiravir and corticosteroid. Due to progressive respiratory failure, the patient underwent mechanical ventilation and ECMO. The patient recovered without complications. We successfully treated these severe cases with a multimodal combination of pharmacological and non-pharmacological supportive therapy.
Introduction
Coronavirus disease 2019 (COVID-19) was first identified in December 2019 in Wuhan, China, and has since rapidly spread globally. At present, there are few established treatments for COVID-19 with confirmed efficacy, resulting in numerous deaths.
Globally, as of August 1, 2020, 17,396,943 confirmed cases and 675,060 deaths related to COVID-19 have been reported to WHO, and the mortality rate is 3.9% (1). The overall hospital mortality rate from COVID-19 is approximately 15% to 20%, increasing to 40% among patients requiring ICU admission. By age, the hospital mortality rate is 35% for patients 70 to 79 years old and 60% for patients 80 to 89 years old (2). The mortality in COVID-19 patients who develope severe respiratory compromise and require mechanical ventilation is high.
Favipiravir obtained manufacturing and marketing approval in March 2014 for “new or re-emerging influenza virus infections (provided that other anti-influenza virus drugs were ineffective)”. With regard to the mechanism of action of this drug, favipiravir taken up into cells is metabolized and converted by intracellular enzymes to become favipiravir ribofuranosyl triphosphate, which selectively inhibits viral RNA-dependent RNA polymerase. Therefore, this agent may also be effective against RNA viruses other than influenza virus, and indeed, nonclinical studies have reported its efficacy against several RNA viruses, including Ebola virus (3), Arenaviridae and Bunyaviridae (4). In an open-label, controlled trial in China, the time to viral clearance of mild to moderate COVID-19 treated with favipiravir and interferon alfa was significantly shorter than that of lobinavir ritonavir and interferon alfa (5).
There have been several reports of the efficacy of administering corticosteroids for COVID-19 patients, although opinions on this approach were initially negative (6,7). Corticosteroids are a viable therapeutic strategy for modulating the inflammatory response in patients with COVID-19.
The high mortality rate in severe cases is important, given the potential access to extracorporeal membrane oxygenation of venous blood, which may serve as a life-saving emergency treatment. Although the efficacy of ECMO in COVID-19 is controversial, ECMO is a proposed as a treatment option in the interim guidance document published by the WHO and interim guidance for clinical management of COVID-19 patients provided by the United States Centers for Disease Control (8).
We herein report two cases of COVID-19 in which the early introduction of ECMO was extremely effective for managing patients whose pneumonia was aggravated even under the use of favipiravir and corticosteroid.
Case Reports
Case 1
A 65-year-old Japanese man with no significant medical history developed malaise at the end of March, 2020, and eventually developed pyrexia, cough and dyspnea. He visited a local clinic 9 days later. Because the patient presented with decreased percutaneous oxygen saturation (SpO2) and ground-glass opacities in both lungs, he was suspected of having COVID-19 pneumonia. On the same day, he was taken to our hospital by an ambulance, where he was immediately admitted. He had neither a history of close contact with COVID-19-positive patients nor any recent travel history. He was a former smoker (37.5 packs per year).
At the time of admission, the patient had no disorientation, with a body temperature of 37.5℃, blood pressure of 140/78 mmHg, pulse rate of 72 beats per minute (regular), respiratory rate of 24 breaths per minute and SpO2 of 82% on room air. At the time of admission, a marked increase was observed in lactate dehydrogenase and C-reactive protein (CRP), being 628 U/L and 24.99 mg/dL, respectively. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were detected. Surfactant protein D increased to 221 ng/mL (Table 1).
Table 1. Case 1: Laboratory Findings at the Time of Hospital Admission.
TP 6.1 g/dL WBC 8,300 /μL
alb 2.6 g/dL neutro 87.4 %
T-bil 0.5 mg/dL lymph 6.9 %
AST 66 U/L mono 5.4 %
ALT 33 U/L eosino 0.1 %
LDH 628 U/L Hb 16.3 g/dL
γ-GTP 27 U/L Hct 47.5 %
CK 69 U/L Plt 27.9 ×104/μL
BUN 13.8 mg/dL
Cr 0.76 mg/dL PT-INR 1.16
UA 4.2 mg/dL APTT 35.8 sec
Na 136 mEq/L D-dimer 8.8 pg/mL
K 4.8 mEq/L fibrinogen 774 mg/dL
Cl 102 mEq/L
glu 99 mg/dL
CRP 24.99 mg/dL
IgG 846 mg/dL
IgA 157 mg/dL
IgM 36 mg/dL
IgE 92 mg/dL influenza A negative
SPA 92.8 ng/mL B negative
SPD 221 ng/mL
KL-6 370 U/mL
β-D-glucan 12.0 pg/mL
NT-proBNP 125 pg/mL
PCT 0.20 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
At the time of hospital admission, chest radiography showed diffuse ground-glass opacities in both lungs (Fig. 1a), and plain chest computed tomography (CT) showed diffuse ground-glass opacities in nearly all layers of both lungs (Fig. 1b).
Figure 1. Case 1: Imaging findings at the time of hospital admission. (a) Chest radiography shows diffuse ground-glass opacities in both lungs. (b) Chest CT shows diffuse ground-glass opacities in nearly all layers of both lungs.
The patient was found to have progressive acute respiratory failure and started to receive high-flow nasal cannula oxygen therapy [delivery of 50 L of flow; fraction of inspired oxygen (FiO2) of 50%]. Methylprednisolone pulse therapy (administered at 1 g/day for 3 days) was started to treat the progressive acute respiratory failure as empirical treatment for severe pneumonia and acute interstitial pneumonia. Intravenous infusion of meropenem (1 g every 8 hours) and azithromycin (500 mg every 24 hours) was started under suspicion of severe bacterial pneumonia, and continuous intravenous infusion of sivelestat (400 mg/day) was also started to treat acute respiratory distress syndrome (ARDS).
A COVID-19 real-time polymerase chain reaction (RT-PCR) test was performed, and the patient was found to be positive for COVID-19 on Day 3 of hospitalization. With the patient's consent, treatment with favipiravir was started on a compassionate-use basis. On Day 5, further progression of respiratory failure required the patient to be intubated and moved to mechanical ventilation. On the same day, veno-venous (V-V) ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease because mechanical ventilation was considered insufficient to sustain the cardiorespiratory system due to the patient's poor oxygenation even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.0 L/min. From days 3 to 5, platelets decreased from 24.5×104 to 17.8×104/μL, fibrinogen decreased from 426 to 54 mg/dL, and D-dimer increased from 68.1 to 98.2 μg/mL. No bleeding tendency, circulatory failure due to microthrombus, or multiple organ failure was observed. Since the criteria established by the Japanese Association for Acute Medicine for disseminated intravascular coagulation (DIC) were met, we administered recombinant thrombomodulin. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: pressure-controlled ventilation (PCV), FiO2 of 0.35, positive end-expiratory pressure (PEEP) of 9 cmH2O, inspiratory pressure of 7 cmH2O and respiratory frequency of 10 per minute. After introduction of mechanical ventilation and ECMO, the patient's blood pressure decreased. Based on the echocardiographic and electrocardiographic findings, the patient was diagnosed with concurrent takotsubo cardiomyopathy, for which treatment with noradrenaline was started.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received through ECMO was reduced. Therefore, he was weaned from ECMO on Day 12. He was extubated on Day 14. As an adverse event, the patient developed left iliopsoas bleed that required a number of blood transfusions, which resulted in transfusion-associated circulatory overload. The patient was re-intubated and placed on mechanical ventilation on Day 15. His condition improved after fluid management, and he was extubated again on Day 23. The radio-opaque areas in the lung fields became smaller. The flow of supplemental oxygen was decreased to 1 L/min/cannula on Day 33. The patient was discharged on Day 41 (Fig. 2).
Figure 2. Case 1: Clinical course after hospital admission.
Case 2
A 49-year-old Japanese man with bronchial asthma presented with pyrexia, malaise and dyspnea at the middle of April, 2020, and visited a local clinic. Due to his poor response to any symptomatic treatments given, the patient was taken by ambulance to our hospital 3 days later. He had had close contact with his wife, who had contracted COVID-19 pneumonia. He was suspected of also having COVID-19 pneumonia based on chest CT findings and was admitted to the hospital on the same day. He had no smoking history.
At the time of admission, the patient had no disorientation, with a body temperature of 39.9℃, blood pressure of 142/88 mmHg, pulse rate of 126 beats per minute, regular, respiratory rate of 22 breaths per minute and percutaneous oxygen saturation (SpO2) of 97% on room air, and a slight increase in CRP (0.70) was observed. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were noted (Table 2).
Table 2. Case 2: Laboratory Findings at the Time of Hospital Admission.
TP 7.1 g/dL WBC 5,500 /μL
alb 4.1 g/dL neutro 80.6 %
T-bil 0.52 mg/dL lymph 11.2 %
AST 22 U/L mono 8.2 %
ALT 32 U/L eosino 0 %
LDH 190 U/L Hb 16.0 g/dL
γ-GTP 17 U/L Hct 46.2 %
CK 65 U/L Plt 20.2 ×104/μL
BUN 8.8 mg/dL
Cr 0.99 mg/dL PT-INR 1.07
UA 6.4 mg/dL APTT 35.0 sec
Na 139 mEq/L D-dimer 0.4 pg/mL
K 3.4 mEq/L fibrinogen 334 mg/dL
Cl 107 mEq/L
glu 112 mg/dL
CRP 0.70 mg/dL
IgG 1,186 mg/dL influenza A negative
IgA 297 mg/dL B negative
IgM 37 mg/dL
IgE 223 mg/dL Pneumococcal urinary antigen test negative
SPA 16.1 ng/mL
SPD 25.6 ng/mL Legionella urinary antigen test negative
KL-6 165 U/mL
β-D-glucan 5.1 pg/mL
NT-proBNP 16 pg/mL
PCT 0.04 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
Chest radiography at admission showed nodular opacity in the right upper lobe (Fig. 3a), and plain chest CT showed numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side (Fig. 3b).
Figure 3. Case 2: Imaging findings at the time of hospital admission. (a) Chest radiography shows nodular opacity in the right upper lobe. (b) Chest CT shows numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side.
Treatment was started with intravenous infusion of methylprednisolone (80 mg/day) and azithromycin (500 mg every 24 hours) to alleviate inflammation, ceftriaxone (2 g every 24 hours) in consideration of bacterial pneumonia and peramivir (600 mg/day on Day 1 and 300 mg/day from Day 2 onward) as an antiviral agent (Fig. 4). The patient showed positive results of a COVID-19 RT-PCR test on Day 3 of hospitalization when treatment with favipiravir was started. Pyrexia in the patient persisted, and respiratory failure progressed even after the initiation of favipiravir. The dose of methylprednisolone was increased to 250 mg/day from Day 6 onward. On Day 7, continuous intravenous infusion of sivelestat (400 mg/day) was started. Since the platelet count had decreased to 13.9×104/μL and COVID-19 often causes abnormal coagulation, intravenous infusion of recombinant thrombomodulin (32,000 U/day) was also started. The D-dimer level slightly increased to 1.8 μg/mL on Day 10 but improved thereafter.
Figure 4. Case 2: Clinical course after hospital admission.
The further progression of respiratory failure necessitated noninvasive intermittent positive-pressure ventilation on Day 8 and intubation and mechanical ventilation on Day 9. On Day 10, V-V ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease and poor oxygenation, even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.5 L/min. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: PCV, FiO2 of 0.21, PEEP of 8 cmH2O, inspiratory pressure of 8 cmH2O and respiratory frequency of 12 per minute.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received ECMO was reduced. Therefore, he was weaned from ECMO on Day 15. He was extubated on Day 19. No ECMO-associated adverse events were observed. The patient no longer required supplemental oxygen supply on Day 23. The patient was discharged on Day 32 (Fig. 4).
Discussion
Although the majority of cases of COVID-19 result in mild, reversible symptoms, some patients develop dyspnea and hypoxemia within about a week of the onset of the disease. Wang et al. reported that 26.1% of patients hospitalized with COVID-19 pneumonia required treatment in the intensive-care unit (ICU); 61.1% of these patients in the ICU had ARDS, and the mortality rate was approximately 4.3% (9). A total of 60 patients with COVID-19 pneumonia had been admitted to our hospital as of the middle of May, 2020. Eight of these 60 patients required intubation and mechanical ventilation, including the 2 presently reported patients who also required the use of ECMO.
ARDS is characterized by excessive local inflammation in the lung, which can progress to an “out-of-control” state. Excessive production of mediators, such as cytokines (e.g., interleukin-6, tumor necrosis factor alpha, interleukin-8) and arachidonate metabolites (i.e., cytokine storm), interstitial lung edema caused by enhanced pulmonary vascular permeability, and diffuse alveolar damage induce a rapid decrease in oxygenation and the accumulation of carbon dioxide (10). Antiviral treatment and pharmacological and non-pharmacological supportive therapies are considered to serve as important therapeutic strategies for COVID-19 pneumonia patients with ARDS.
It was previously reported that the fulminant activation of coagulation and consumption of clotting factors occur in severe cases of COVID-19. Inflammation of lung tissues and endothelial cells causes microthrombi formation, leading to thrombotic complications, such as deep venous thrombosis, pulmonary embolism and thrombotic arterial complications (11). T tD-dimer and fibrinogen degradation product (FDP) levels were increased in both of the present cases. Furthermore, in Case 1, the patient developed DIC and pulmonary thromboembolism despite the use of anticoagulants.
DIC in patients with COVID-19 has previously been described, and its characteristics include a lack of bleeding risk, mildly low platelet counts and elevated plasma fibrinogen levels, none of which are seen in typical DIC. Therefore, instead of DIC, these data might more closely resemble complement-mediated thrombotic microangiopathy (TMA) syndromes. Importantly, another essential aspect of DIC seen in COVID-19 is the detection of both COVID-19 and complement components in regions of TMA. Mediators of TMA syndromes overlap with those released by cytokine storm, suggesting close connections between ineffective immune responses to COVID-19, severe pneumonia and life-threatening microangiopathy (12). Although the diagnostic criteria for DIC were met in case 1, TMA syndrome might have occurred in both cases (particularly in case 2) because of the lack of typical symptoms of DIC.
For the two cases presented in this report, favipiravir administration was started as an antiviral treatment immediately after the diagnosis of COVID-19. At a meeting of the Japanese Association for Infectious Diseases, we presented an immediate report on cases of COVID-19 pneumonia with progressive respiratory failure, for which favipiravir may have worked promptly and effectively (13). However, rapid progression of respiratory failure was observed in the patients in this report despite the initiation of treatment with favipiravir. This can be interpreted as suggesting that the clinical benefit of treatment with an antiviral agent alone is limited in patients with concurrent ARDS. At present, multiple clinical trials of favipiravir are underway in patients with mild to severe COVID-19 pneumonia. Future data from these trials may provide new insights into the drug's clinical benefits.
As a pharmacological supportive therapy, we administered methylprednisolone (an anti-inflammatory agent for inhibiting cytokine storm), sivelestat (a neutrophil elastase inhibitor) and macrolide antibiotics with an immunoregulatory function (14) effective for suppressing hyperimmunization and excessive inflammation. The World Health Organization (WHO) has advised against the use of corticosteroids to treat COVID-19. The interim WHO guidance on the management of patients with severe acute respiratory infection caused by COVID-19 presents negative views on the use of steroids in the treatment of this patient population (“routine use of steroids should be avoided unless the patient has symptoms including bronchial asthma, aggravated chronic obstructive pulmonary disease, and septic shock”) based on data from studies of steroid therapy in patients with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) or influenza (15). However, a study by the RECOVERY Collaborative Group showed that the use of dexamethasone in hospitalized COVID-19 patients resulted in a lower 28-day mortality than in those who were solely receiving either invasive mechanical ventilation or oxygen (6). In addition, Wu et al. performed a retrospective cohort study in patients with COVID-19 pneumonia and reported that the mortality in a cohort using methylprednisolone was lower than that in a cohort not using methylprednisolone, although the number of severe cases included in the former cohort was larger than that in the latter cohort (7). In our hospital, we have actively used steroids in patients with hypoxemia and achieved good outcomes. Based on these experiences, we are considering participating in a clinical study conducted to evaluate the efficacy of steroids in patients with COVID-19 pneumonia to verify the clinical effects of steroids in this patient population. Regarding macrolides, some researchers have reported that macrolide therapy was effective for reducing mortality in patients with ARDS (16). Although the mechanism underlying this reduction in mortality has not been fully elucidated, macrolides are likely to have effects on cytokine production and the neutrophil function (16).
As non-pharmacological supportive therapy, intubation, mechanical ventilation and ECMO were employed. ECMO is a life-supporting method used in patients with severe respiratory or cardiac failure (used particularly as a resuscitative measure taken for patients in cardiopulmonary arrest), called “respiratory ECMO” and “cardiac ECMO”, respectively. Respiratory ECMO is indicated for patients with reversible acute respiratory failure. Its use is considered for patients for whom conventional mechanical ventilation is insufficient for sustaining life or in whom continuous use of the mechanical ventilation system can result in irreversible damage to the lung. Respiratory ECMO is regarded as a treatment of ARDS (17). In the treatment of novel influenza A (H1N1) 2009, the results of ECMO database-based cohort studies (18,19) and the study on conventional ventilatory support vs. ECMO for severe adult respiratory failure (CESAR study) (20) demonstrated the efficacy of ECMO therapy based on the finding that the mortality in patients using ECMO was significantly lower than that in patients not using ECMO. In a retrospective study in MERS patients with refractory respiratory failure in 2018, the use of ECMO was required as an emergency treatment. The mortality in MERS patients with refractory hypoxemia in the ECMO cohort was significantly lower than that in the non-ECMO cohort (65% vs. 100%; p = 0.02) (21). Although little evidence for the efficacy of ECMO has been obtained with respect to COVID-19 pneumonia, results from two retrospective studies have been reported. In a retrospective study by Yang et al., of 52 patients admitted to the ICU with severe COVID-19 pneumonia, 32 died within 28 days of admission. ECMO was introduced to 6 patients, of whom 5 died, while the other was still on ECMO at the time of the endpoint assessment (22). In a retrospective study by Zhang et al., 48 of 221 patients with COVID-19 pneumonia had concurrent ARDS, and 10 of these 48 patients required mechanical ventilation and ECMO therapy. Of these 10 patients, 2 were successfully treated and discharged from the hospital, and 3 died. The other five patients were still on ECMO at the time of the endpoint assessment (23). According to the interim WHO guidance, ECMO, despite little evidence for its efficacy, is regarded as an emergency treatment of COVID-19 patients who have concurrent refractory hypoxemia even after being treated with lung-protective ventilation strategy (15). The condition of the two patients in the present case report was improved by intubation, mechanical ventilation and the prompt introduction of ECMO. COVID-19 pneumonia with ARDS is associated with high mortality. Pulmonary protection initiated before obtaining clinical benefits of antiviral treatment and pharmacological supportive therapy is considered to contribute to a reduction in mortality. Concerning complications, iliopsoas hematoma was identified in Case 1. In general, hemorrhagic complications, such as cannulation site bleeding, occur in approximately 50% of patients undergoing ECMO (17). ECMO-associated bleeding, which is attributed to the effect of heparinization as well as circuit-related consumption of coagulation factors, can be severe. It may be difficult to arrest bleeding if no measures other than monitoring the patient are taken. In Case 1, although the patient required blood transfusion, bleeding was arrested during the observation of the patient's condition. Infection is another critical complication said to occur in approximately 20% of patients on ECMO (17). However, the two patients in this report were able to safely receive ECMO therapy with no ECMO-related infectious complications.
Our two patients were already suffering from severe respiratory failure at the time of the diagnosis of COVID-19. They were successfully treated by a combination of antiviral treatment with favipiravir, corticosteroid, mechanical ventilation and ECMO. The positive outcomes of these cases underscore the importance of promptly treating severe COVID-19 pneumonia after the diagnosis with non-pharmacological supportive therapy, such as mechanical ventilation and ECMO, in combination with pharmacological supportive therapy, notably favipiravir for antiviral treatment and corticosteroid for anti-inflammatory treatment.
The authors state that they have no Conflict of Interest (COI). | 500 mg (milligrams). | DrugDosage | CC BY-NC-ND | 33390469 | 18,811,755 | 2021 |
What was the dosage of drug 'FAVIPIRAVIR'? | Two Cases of Severe COVID-19 Pneumonia Effectively Treated with Extracorporeal Membrane Oxygenation in Addition to Favipiravir and Corticosteroid.
Case 1: A 65-year-old man with novel coronavirus infection (COVID-19) complicated with acute respiratory failure. On admission, the patient was started on favipiravir and corticosteroid. However, due to a lack of significant improvement, he was introduced to mechanical ventilation and extracorporeal membrane oxygenation (ECMO). Although iliopsoas hematoma occurred as a complication, the patient recovered. Case 2: A 49-year-old man with COVID-19 had been started on favipiravir and corticosteroid. Due to progressive respiratory failure, the patient underwent mechanical ventilation and ECMO. The patient recovered without complications. We successfully treated these severe cases with a multimodal combination of pharmacological and non-pharmacological supportive therapy.
Introduction
Coronavirus disease 2019 (COVID-19) was first identified in December 2019 in Wuhan, China, and has since rapidly spread globally. At present, there are few established treatments for COVID-19 with confirmed efficacy, resulting in numerous deaths.
Globally, as of August 1, 2020, 17,396,943 confirmed cases and 675,060 deaths related to COVID-19 have been reported to WHO, and the mortality rate is 3.9% (1). The overall hospital mortality rate from COVID-19 is approximately 15% to 20%, increasing to 40% among patients requiring ICU admission. By age, the hospital mortality rate is 35% for patients 70 to 79 years old and 60% for patients 80 to 89 years old (2). The mortality in COVID-19 patients who develope severe respiratory compromise and require mechanical ventilation is high.
Favipiravir obtained manufacturing and marketing approval in March 2014 for “new or re-emerging influenza virus infections (provided that other anti-influenza virus drugs were ineffective)”. With regard to the mechanism of action of this drug, favipiravir taken up into cells is metabolized and converted by intracellular enzymes to become favipiravir ribofuranosyl triphosphate, which selectively inhibits viral RNA-dependent RNA polymerase. Therefore, this agent may also be effective against RNA viruses other than influenza virus, and indeed, nonclinical studies have reported its efficacy against several RNA viruses, including Ebola virus (3), Arenaviridae and Bunyaviridae (4). In an open-label, controlled trial in China, the time to viral clearance of mild to moderate COVID-19 treated with favipiravir and interferon alfa was significantly shorter than that of lobinavir ritonavir and interferon alfa (5).
There have been several reports of the efficacy of administering corticosteroids for COVID-19 patients, although opinions on this approach were initially negative (6,7). Corticosteroids are a viable therapeutic strategy for modulating the inflammatory response in patients with COVID-19.
The high mortality rate in severe cases is important, given the potential access to extracorporeal membrane oxygenation of venous blood, which may serve as a life-saving emergency treatment. Although the efficacy of ECMO in COVID-19 is controversial, ECMO is a proposed as a treatment option in the interim guidance document published by the WHO and interim guidance for clinical management of COVID-19 patients provided by the United States Centers for Disease Control (8).
We herein report two cases of COVID-19 in which the early introduction of ECMO was extremely effective for managing patients whose pneumonia was aggravated even under the use of favipiravir and corticosteroid.
Case Reports
Case 1
A 65-year-old Japanese man with no significant medical history developed malaise at the end of March, 2020, and eventually developed pyrexia, cough and dyspnea. He visited a local clinic 9 days later. Because the patient presented with decreased percutaneous oxygen saturation (SpO2) and ground-glass opacities in both lungs, he was suspected of having COVID-19 pneumonia. On the same day, he was taken to our hospital by an ambulance, where he was immediately admitted. He had neither a history of close contact with COVID-19-positive patients nor any recent travel history. He was a former smoker (37.5 packs per year).
At the time of admission, the patient had no disorientation, with a body temperature of 37.5℃, blood pressure of 140/78 mmHg, pulse rate of 72 beats per minute (regular), respiratory rate of 24 breaths per minute and SpO2 of 82% on room air. At the time of admission, a marked increase was observed in lactate dehydrogenase and C-reactive protein (CRP), being 628 U/L and 24.99 mg/dL, respectively. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were detected. Surfactant protein D increased to 221 ng/mL (Table 1).
Table 1. Case 1: Laboratory Findings at the Time of Hospital Admission.
TP 6.1 g/dL WBC 8,300 /μL
alb 2.6 g/dL neutro 87.4 %
T-bil 0.5 mg/dL lymph 6.9 %
AST 66 U/L mono 5.4 %
ALT 33 U/L eosino 0.1 %
LDH 628 U/L Hb 16.3 g/dL
γ-GTP 27 U/L Hct 47.5 %
CK 69 U/L Plt 27.9 ×104/μL
BUN 13.8 mg/dL
Cr 0.76 mg/dL PT-INR 1.16
UA 4.2 mg/dL APTT 35.8 sec
Na 136 mEq/L D-dimer 8.8 pg/mL
K 4.8 mEq/L fibrinogen 774 mg/dL
Cl 102 mEq/L
glu 99 mg/dL
CRP 24.99 mg/dL
IgG 846 mg/dL
IgA 157 mg/dL
IgM 36 mg/dL
IgE 92 mg/dL influenza A negative
SPA 92.8 ng/mL B negative
SPD 221 ng/mL
KL-6 370 U/mL
β-D-glucan 12.0 pg/mL
NT-proBNP 125 pg/mL
PCT 0.20 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
At the time of hospital admission, chest radiography showed diffuse ground-glass opacities in both lungs (Fig. 1a), and plain chest computed tomography (CT) showed diffuse ground-glass opacities in nearly all layers of both lungs (Fig. 1b).
Figure 1. Case 1: Imaging findings at the time of hospital admission. (a) Chest radiography shows diffuse ground-glass opacities in both lungs. (b) Chest CT shows diffuse ground-glass opacities in nearly all layers of both lungs.
The patient was found to have progressive acute respiratory failure and started to receive high-flow nasal cannula oxygen therapy [delivery of 50 L of flow; fraction of inspired oxygen (FiO2) of 50%]. Methylprednisolone pulse therapy (administered at 1 g/day for 3 days) was started to treat the progressive acute respiratory failure as empirical treatment for severe pneumonia and acute interstitial pneumonia. Intravenous infusion of meropenem (1 g every 8 hours) and azithromycin (500 mg every 24 hours) was started under suspicion of severe bacterial pneumonia, and continuous intravenous infusion of sivelestat (400 mg/day) was also started to treat acute respiratory distress syndrome (ARDS).
A COVID-19 real-time polymerase chain reaction (RT-PCR) test was performed, and the patient was found to be positive for COVID-19 on Day 3 of hospitalization. With the patient's consent, treatment with favipiravir was started on a compassionate-use basis. On Day 5, further progression of respiratory failure required the patient to be intubated and moved to mechanical ventilation. On the same day, veno-venous (V-V) ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease because mechanical ventilation was considered insufficient to sustain the cardiorespiratory system due to the patient's poor oxygenation even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.0 L/min. From days 3 to 5, platelets decreased from 24.5×104 to 17.8×104/μL, fibrinogen decreased from 426 to 54 mg/dL, and D-dimer increased from 68.1 to 98.2 μg/mL. No bleeding tendency, circulatory failure due to microthrombus, or multiple organ failure was observed. Since the criteria established by the Japanese Association for Acute Medicine for disseminated intravascular coagulation (DIC) were met, we administered recombinant thrombomodulin. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: pressure-controlled ventilation (PCV), FiO2 of 0.35, positive end-expiratory pressure (PEEP) of 9 cmH2O, inspiratory pressure of 7 cmH2O and respiratory frequency of 10 per minute. After introduction of mechanical ventilation and ECMO, the patient's blood pressure decreased. Based on the echocardiographic and electrocardiographic findings, the patient was diagnosed with concurrent takotsubo cardiomyopathy, for which treatment with noradrenaline was started.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received through ECMO was reduced. Therefore, he was weaned from ECMO on Day 12. He was extubated on Day 14. As an adverse event, the patient developed left iliopsoas bleed that required a number of blood transfusions, which resulted in transfusion-associated circulatory overload. The patient was re-intubated and placed on mechanical ventilation on Day 15. His condition improved after fluid management, and he was extubated again on Day 23. The radio-opaque areas in the lung fields became smaller. The flow of supplemental oxygen was decreased to 1 L/min/cannula on Day 33. The patient was discharged on Day 41 (Fig. 2).
Figure 2. Case 1: Clinical course after hospital admission.
Case 2
A 49-year-old Japanese man with bronchial asthma presented with pyrexia, malaise and dyspnea at the middle of April, 2020, and visited a local clinic. Due to his poor response to any symptomatic treatments given, the patient was taken by ambulance to our hospital 3 days later. He had had close contact with his wife, who had contracted COVID-19 pneumonia. He was suspected of also having COVID-19 pneumonia based on chest CT findings and was admitted to the hospital on the same day. He had no smoking history.
At the time of admission, the patient had no disorientation, with a body temperature of 39.9℃, blood pressure of 142/88 mmHg, pulse rate of 126 beats per minute, regular, respiratory rate of 22 breaths per minute and percutaneous oxygen saturation (SpO2) of 97% on room air, and a slight increase in CRP (0.70) was observed. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were noted (Table 2).
Table 2. Case 2: Laboratory Findings at the Time of Hospital Admission.
TP 7.1 g/dL WBC 5,500 /μL
alb 4.1 g/dL neutro 80.6 %
T-bil 0.52 mg/dL lymph 11.2 %
AST 22 U/L mono 8.2 %
ALT 32 U/L eosino 0 %
LDH 190 U/L Hb 16.0 g/dL
γ-GTP 17 U/L Hct 46.2 %
CK 65 U/L Plt 20.2 ×104/μL
BUN 8.8 mg/dL
Cr 0.99 mg/dL PT-INR 1.07
UA 6.4 mg/dL APTT 35.0 sec
Na 139 mEq/L D-dimer 0.4 pg/mL
K 3.4 mEq/L fibrinogen 334 mg/dL
Cl 107 mEq/L
glu 112 mg/dL
CRP 0.70 mg/dL
IgG 1,186 mg/dL influenza A negative
IgA 297 mg/dL B negative
IgM 37 mg/dL
IgE 223 mg/dL Pneumococcal urinary antigen test negative
SPA 16.1 ng/mL
SPD 25.6 ng/mL Legionella urinary antigen test negative
KL-6 165 U/mL
β-D-glucan 5.1 pg/mL
NT-proBNP 16 pg/mL
PCT 0.04 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
Chest radiography at admission showed nodular opacity in the right upper lobe (Fig. 3a), and plain chest CT showed numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side (Fig. 3b).
Figure 3. Case 2: Imaging findings at the time of hospital admission. (a) Chest radiography shows nodular opacity in the right upper lobe. (b) Chest CT shows numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side.
Treatment was started with intravenous infusion of methylprednisolone (80 mg/day) and azithromycin (500 mg every 24 hours) to alleviate inflammation, ceftriaxone (2 g every 24 hours) in consideration of bacterial pneumonia and peramivir (600 mg/day on Day 1 and 300 mg/day from Day 2 onward) as an antiviral agent (Fig. 4). The patient showed positive results of a COVID-19 RT-PCR test on Day 3 of hospitalization when treatment with favipiravir was started. Pyrexia in the patient persisted, and respiratory failure progressed even after the initiation of favipiravir. The dose of methylprednisolone was increased to 250 mg/day from Day 6 onward. On Day 7, continuous intravenous infusion of sivelestat (400 mg/day) was started. Since the platelet count had decreased to 13.9×104/μL and COVID-19 often causes abnormal coagulation, intravenous infusion of recombinant thrombomodulin (32,000 U/day) was also started. The D-dimer level slightly increased to 1.8 μg/mL on Day 10 but improved thereafter.
Figure 4. Case 2: Clinical course after hospital admission.
The further progression of respiratory failure necessitated noninvasive intermittent positive-pressure ventilation on Day 8 and intubation and mechanical ventilation on Day 9. On Day 10, V-V ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease and poor oxygenation, even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.5 L/min. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: PCV, FiO2 of 0.21, PEEP of 8 cmH2O, inspiratory pressure of 8 cmH2O and respiratory frequency of 12 per minute.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received ECMO was reduced. Therefore, he was weaned from ECMO on Day 15. He was extubated on Day 19. No ECMO-associated adverse events were observed. The patient no longer required supplemental oxygen supply on Day 23. The patient was discharged on Day 32 (Fig. 4).
Discussion
Although the majority of cases of COVID-19 result in mild, reversible symptoms, some patients develop dyspnea and hypoxemia within about a week of the onset of the disease. Wang et al. reported that 26.1% of patients hospitalized with COVID-19 pneumonia required treatment in the intensive-care unit (ICU); 61.1% of these patients in the ICU had ARDS, and the mortality rate was approximately 4.3% (9). A total of 60 patients with COVID-19 pneumonia had been admitted to our hospital as of the middle of May, 2020. Eight of these 60 patients required intubation and mechanical ventilation, including the 2 presently reported patients who also required the use of ECMO.
ARDS is characterized by excessive local inflammation in the lung, which can progress to an “out-of-control” state. Excessive production of mediators, such as cytokines (e.g., interleukin-6, tumor necrosis factor alpha, interleukin-8) and arachidonate metabolites (i.e., cytokine storm), interstitial lung edema caused by enhanced pulmonary vascular permeability, and diffuse alveolar damage induce a rapid decrease in oxygenation and the accumulation of carbon dioxide (10). Antiviral treatment and pharmacological and non-pharmacological supportive therapies are considered to serve as important therapeutic strategies for COVID-19 pneumonia patients with ARDS.
It was previously reported that the fulminant activation of coagulation and consumption of clotting factors occur in severe cases of COVID-19. Inflammation of lung tissues and endothelial cells causes microthrombi formation, leading to thrombotic complications, such as deep venous thrombosis, pulmonary embolism and thrombotic arterial complications (11). T tD-dimer and fibrinogen degradation product (FDP) levels were increased in both of the present cases. Furthermore, in Case 1, the patient developed DIC and pulmonary thromboembolism despite the use of anticoagulants.
DIC in patients with COVID-19 has previously been described, and its characteristics include a lack of bleeding risk, mildly low platelet counts and elevated plasma fibrinogen levels, none of which are seen in typical DIC. Therefore, instead of DIC, these data might more closely resemble complement-mediated thrombotic microangiopathy (TMA) syndromes. Importantly, another essential aspect of DIC seen in COVID-19 is the detection of both COVID-19 and complement components in regions of TMA. Mediators of TMA syndromes overlap with those released by cytokine storm, suggesting close connections between ineffective immune responses to COVID-19, severe pneumonia and life-threatening microangiopathy (12). Although the diagnostic criteria for DIC were met in case 1, TMA syndrome might have occurred in both cases (particularly in case 2) because of the lack of typical symptoms of DIC.
For the two cases presented in this report, favipiravir administration was started as an antiviral treatment immediately after the diagnosis of COVID-19. At a meeting of the Japanese Association for Infectious Diseases, we presented an immediate report on cases of COVID-19 pneumonia with progressive respiratory failure, for which favipiravir may have worked promptly and effectively (13). However, rapid progression of respiratory failure was observed in the patients in this report despite the initiation of treatment with favipiravir. This can be interpreted as suggesting that the clinical benefit of treatment with an antiviral agent alone is limited in patients with concurrent ARDS. At present, multiple clinical trials of favipiravir are underway in patients with mild to severe COVID-19 pneumonia. Future data from these trials may provide new insights into the drug's clinical benefits.
As a pharmacological supportive therapy, we administered methylprednisolone (an anti-inflammatory agent for inhibiting cytokine storm), sivelestat (a neutrophil elastase inhibitor) and macrolide antibiotics with an immunoregulatory function (14) effective for suppressing hyperimmunization and excessive inflammation. The World Health Organization (WHO) has advised against the use of corticosteroids to treat COVID-19. The interim WHO guidance on the management of patients with severe acute respiratory infection caused by COVID-19 presents negative views on the use of steroids in the treatment of this patient population (“routine use of steroids should be avoided unless the patient has symptoms including bronchial asthma, aggravated chronic obstructive pulmonary disease, and septic shock”) based on data from studies of steroid therapy in patients with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) or influenza (15). However, a study by the RECOVERY Collaborative Group showed that the use of dexamethasone in hospitalized COVID-19 patients resulted in a lower 28-day mortality than in those who were solely receiving either invasive mechanical ventilation or oxygen (6). In addition, Wu et al. performed a retrospective cohort study in patients with COVID-19 pneumonia and reported that the mortality in a cohort using methylprednisolone was lower than that in a cohort not using methylprednisolone, although the number of severe cases included in the former cohort was larger than that in the latter cohort (7). In our hospital, we have actively used steroids in patients with hypoxemia and achieved good outcomes. Based on these experiences, we are considering participating in a clinical study conducted to evaluate the efficacy of steroids in patients with COVID-19 pneumonia to verify the clinical effects of steroids in this patient population. Regarding macrolides, some researchers have reported that macrolide therapy was effective for reducing mortality in patients with ARDS (16). Although the mechanism underlying this reduction in mortality has not been fully elucidated, macrolides are likely to have effects on cytokine production and the neutrophil function (16).
As non-pharmacological supportive therapy, intubation, mechanical ventilation and ECMO were employed. ECMO is a life-supporting method used in patients with severe respiratory or cardiac failure (used particularly as a resuscitative measure taken for patients in cardiopulmonary arrest), called “respiratory ECMO” and “cardiac ECMO”, respectively. Respiratory ECMO is indicated for patients with reversible acute respiratory failure. Its use is considered for patients for whom conventional mechanical ventilation is insufficient for sustaining life or in whom continuous use of the mechanical ventilation system can result in irreversible damage to the lung. Respiratory ECMO is regarded as a treatment of ARDS (17). In the treatment of novel influenza A (H1N1) 2009, the results of ECMO database-based cohort studies (18,19) and the study on conventional ventilatory support vs. ECMO for severe adult respiratory failure (CESAR study) (20) demonstrated the efficacy of ECMO therapy based on the finding that the mortality in patients using ECMO was significantly lower than that in patients not using ECMO. In a retrospective study in MERS patients with refractory respiratory failure in 2018, the use of ECMO was required as an emergency treatment. The mortality in MERS patients with refractory hypoxemia in the ECMO cohort was significantly lower than that in the non-ECMO cohort (65% vs. 100%; p = 0.02) (21). Although little evidence for the efficacy of ECMO has been obtained with respect to COVID-19 pneumonia, results from two retrospective studies have been reported. In a retrospective study by Yang et al., of 52 patients admitted to the ICU with severe COVID-19 pneumonia, 32 died within 28 days of admission. ECMO was introduced to 6 patients, of whom 5 died, while the other was still on ECMO at the time of the endpoint assessment (22). In a retrospective study by Zhang et al., 48 of 221 patients with COVID-19 pneumonia had concurrent ARDS, and 10 of these 48 patients required mechanical ventilation and ECMO therapy. Of these 10 patients, 2 were successfully treated and discharged from the hospital, and 3 died. The other five patients were still on ECMO at the time of the endpoint assessment (23). According to the interim WHO guidance, ECMO, despite little evidence for its efficacy, is regarded as an emergency treatment of COVID-19 patients who have concurrent refractory hypoxemia even after being treated with lung-protective ventilation strategy (15). The condition of the two patients in the present case report was improved by intubation, mechanical ventilation and the prompt introduction of ECMO. COVID-19 pneumonia with ARDS is associated with high mortality. Pulmonary protection initiated before obtaining clinical benefits of antiviral treatment and pharmacological supportive therapy is considered to contribute to a reduction in mortality. Concerning complications, iliopsoas hematoma was identified in Case 1. In general, hemorrhagic complications, such as cannulation site bleeding, occur in approximately 50% of patients undergoing ECMO (17). ECMO-associated bleeding, which is attributed to the effect of heparinization as well as circuit-related consumption of coagulation factors, can be severe. It may be difficult to arrest bleeding if no measures other than monitoring the patient are taken. In Case 1, although the patient required blood transfusion, bleeding was arrested during the observation of the patient's condition. Infection is another critical complication said to occur in approximately 20% of patients on ECMO (17). However, the two patients in this report were able to safely receive ECMO therapy with no ECMO-related infectious complications.
Our two patients were already suffering from severe respiratory failure at the time of the diagnosis of COVID-19. They were successfully treated by a combination of antiviral treatment with favipiravir, corticosteroid, mechanical ventilation and ECMO. The positive outcomes of these cases underscore the importance of promptly treating severe COVID-19 pneumonia after the diagnosis with non-pharmacological supportive therapy, such as mechanical ventilation and ECMO, in combination with pharmacological supportive therapy, notably favipiravir for antiviral treatment and corticosteroid for anti-inflammatory treatment.
The authors state that they have no Conflict of Interest (COI). | UNKNOWN | DrugDosageText | CC BY-NC-ND | 33390469 | 18,811,755 | 2021 |
What was the dosage of drug 'HEPARIN SODIUM'? | Two Cases of Severe COVID-19 Pneumonia Effectively Treated with Extracorporeal Membrane Oxygenation in Addition to Favipiravir and Corticosteroid.
Case 1: A 65-year-old man with novel coronavirus infection (COVID-19) complicated with acute respiratory failure. On admission, the patient was started on favipiravir and corticosteroid. However, due to a lack of significant improvement, he was introduced to mechanical ventilation and extracorporeal membrane oxygenation (ECMO). Although iliopsoas hematoma occurred as a complication, the patient recovered. Case 2: A 49-year-old man with COVID-19 had been started on favipiravir and corticosteroid. Due to progressive respiratory failure, the patient underwent mechanical ventilation and ECMO. The patient recovered without complications. We successfully treated these severe cases with a multimodal combination of pharmacological and non-pharmacological supportive therapy.
Introduction
Coronavirus disease 2019 (COVID-19) was first identified in December 2019 in Wuhan, China, and has since rapidly spread globally. At present, there are few established treatments for COVID-19 with confirmed efficacy, resulting in numerous deaths.
Globally, as of August 1, 2020, 17,396,943 confirmed cases and 675,060 deaths related to COVID-19 have been reported to WHO, and the mortality rate is 3.9% (1). The overall hospital mortality rate from COVID-19 is approximately 15% to 20%, increasing to 40% among patients requiring ICU admission. By age, the hospital mortality rate is 35% for patients 70 to 79 years old and 60% for patients 80 to 89 years old (2). The mortality in COVID-19 patients who develope severe respiratory compromise and require mechanical ventilation is high.
Favipiravir obtained manufacturing and marketing approval in March 2014 for “new or re-emerging influenza virus infections (provided that other anti-influenza virus drugs were ineffective)”. With regard to the mechanism of action of this drug, favipiravir taken up into cells is metabolized and converted by intracellular enzymes to become favipiravir ribofuranosyl triphosphate, which selectively inhibits viral RNA-dependent RNA polymerase. Therefore, this agent may also be effective against RNA viruses other than influenza virus, and indeed, nonclinical studies have reported its efficacy against several RNA viruses, including Ebola virus (3), Arenaviridae and Bunyaviridae (4). In an open-label, controlled trial in China, the time to viral clearance of mild to moderate COVID-19 treated with favipiravir and interferon alfa was significantly shorter than that of lobinavir ritonavir and interferon alfa (5).
There have been several reports of the efficacy of administering corticosteroids for COVID-19 patients, although opinions on this approach were initially negative (6,7). Corticosteroids are a viable therapeutic strategy for modulating the inflammatory response in patients with COVID-19.
The high mortality rate in severe cases is important, given the potential access to extracorporeal membrane oxygenation of venous blood, which may serve as a life-saving emergency treatment. Although the efficacy of ECMO in COVID-19 is controversial, ECMO is a proposed as a treatment option in the interim guidance document published by the WHO and interim guidance for clinical management of COVID-19 patients provided by the United States Centers for Disease Control (8).
We herein report two cases of COVID-19 in which the early introduction of ECMO was extremely effective for managing patients whose pneumonia was aggravated even under the use of favipiravir and corticosteroid.
Case Reports
Case 1
A 65-year-old Japanese man with no significant medical history developed malaise at the end of March, 2020, and eventually developed pyrexia, cough and dyspnea. He visited a local clinic 9 days later. Because the patient presented with decreased percutaneous oxygen saturation (SpO2) and ground-glass opacities in both lungs, he was suspected of having COVID-19 pneumonia. On the same day, he was taken to our hospital by an ambulance, where he was immediately admitted. He had neither a history of close contact with COVID-19-positive patients nor any recent travel history. He was a former smoker (37.5 packs per year).
At the time of admission, the patient had no disorientation, with a body temperature of 37.5℃, blood pressure of 140/78 mmHg, pulse rate of 72 beats per minute (regular), respiratory rate of 24 breaths per minute and SpO2 of 82% on room air. At the time of admission, a marked increase was observed in lactate dehydrogenase and C-reactive protein (CRP), being 628 U/L and 24.99 mg/dL, respectively. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were detected. Surfactant protein D increased to 221 ng/mL (Table 1).
Table 1. Case 1: Laboratory Findings at the Time of Hospital Admission.
TP 6.1 g/dL WBC 8,300 /μL
alb 2.6 g/dL neutro 87.4 %
T-bil 0.5 mg/dL lymph 6.9 %
AST 66 U/L mono 5.4 %
ALT 33 U/L eosino 0.1 %
LDH 628 U/L Hb 16.3 g/dL
γ-GTP 27 U/L Hct 47.5 %
CK 69 U/L Plt 27.9 ×104/μL
BUN 13.8 mg/dL
Cr 0.76 mg/dL PT-INR 1.16
UA 4.2 mg/dL APTT 35.8 sec
Na 136 mEq/L D-dimer 8.8 pg/mL
K 4.8 mEq/L fibrinogen 774 mg/dL
Cl 102 mEq/L
glu 99 mg/dL
CRP 24.99 mg/dL
IgG 846 mg/dL
IgA 157 mg/dL
IgM 36 mg/dL
IgE 92 mg/dL influenza A negative
SPA 92.8 ng/mL B negative
SPD 221 ng/mL
KL-6 370 U/mL
β-D-glucan 12.0 pg/mL
NT-proBNP 125 pg/mL
PCT 0.20 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
At the time of hospital admission, chest radiography showed diffuse ground-glass opacities in both lungs (Fig. 1a), and plain chest computed tomography (CT) showed diffuse ground-glass opacities in nearly all layers of both lungs (Fig. 1b).
Figure 1. Case 1: Imaging findings at the time of hospital admission. (a) Chest radiography shows diffuse ground-glass opacities in both lungs. (b) Chest CT shows diffuse ground-glass opacities in nearly all layers of both lungs.
The patient was found to have progressive acute respiratory failure and started to receive high-flow nasal cannula oxygen therapy [delivery of 50 L of flow; fraction of inspired oxygen (FiO2) of 50%]. Methylprednisolone pulse therapy (administered at 1 g/day for 3 days) was started to treat the progressive acute respiratory failure as empirical treatment for severe pneumonia and acute interstitial pneumonia. Intravenous infusion of meropenem (1 g every 8 hours) and azithromycin (500 mg every 24 hours) was started under suspicion of severe bacterial pneumonia, and continuous intravenous infusion of sivelestat (400 mg/day) was also started to treat acute respiratory distress syndrome (ARDS).
A COVID-19 real-time polymerase chain reaction (RT-PCR) test was performed, and the patient was found to be positive for COVID-19 on Day 3 of hospitalization. With the patient's consent, treatment with favipiravir was started on a compassionate-use basis. On Day 5, further progression of respiratory failure required the patient to be intubated and moved to mechanical ventilation. On the same day, veno-venous (V-V) ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease because mechanical ventilation was considered insufficient to sustain the cardiorespiratory system due to the patient's poor oxygenation even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.0 L/min. From days 3 to 5, platelets decreased from 24.5×104 to 17.8×104/μL, fibrinogen decreased from 426 to 54 mg/dL, and D-dimer increased from 68.1 to 98.2 μg/mL. No bleeding tendency, circulatory failure due to microthrombus, or multiple organ failure was observed. Since the criteria established by the Japanese Association for Acute Medicine for disseminated intravascular coagulation (DIC) were met, we administered recombinant thrombomodulin. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: pressure-controlled ventilation (PCV), FiO2 of 0.35, positive end-expiratory pressure (PEEP) of 9 cmH2O, inspiratory pressure of 7 cmH2O and respiratory frequency of 10 per minute. After introduction of mechanical ventilation and ECMO, the patient's blood pressure decreased. Based on the echocardiographic and electrocardiographic findings, the patient was diagnosed with concurrent takotsubo cardiomyopathy, for which treatment with noradrenaline was started.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received through ECMO was reduced. Therefore, he was weaned from ECMO on Day 12. He was extubated on Day 14. As an adverse event, the patient developed left iliopsoas bleed that required a number of blood transfusions, which resulted in transfusion-associated circulatory overload. The patient was re-intubated and placed on mechanical ventilation on Day 15. His condition improved after fluid management, and he was extubated again on Day 23. The radio-opaque areas in the lung fields became smaller. The flow of supplemental oxygen was decreased to 1 L/min/cannula on Day 33. The patient was discharged on Day 41 (Fig. 2).
Figure 2. Case 1: Clinical course after hospital admission.
Case 2
A 49-year-old Japanese man with bronchial asthma presented with pyrexia, malaise and dyspnea at the middle of April, 2020, and visited a local clinic. Due to his poor response to any symptomatic treatments given, the patient was taken by ambulance to our hospital 3 days later. He had had close contact with his wife, who had contracted COVID-19 pneumonia. He was suspected of also having COVID-19 pneumonia based on chest CT findings and was admitted to the hospital on the same day. He had no smoking history.
At the time of admission, the patient had no disorientation, with a body temperature of 39.9℃, blood pressure of 142/88 mmHg, pulse rate of 126 beats per minute, regular, respiratory rate of 22 breaths per minute and percutaneous oxygen saturation (SpO2) of 97% on room air, and a slight increase in CRP (0.70) was observed. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were noted (Table 2).
Table 2. Case 2: Laboratory Findings at the Time of Hospital Admission.
TP 7.1 g/dL WBC 5,500 /μL
alb 4.1 g/dL neutro 80.6 %
T-bil 0.52 mg/dL lymph 11.2 %
AST 22 U/L mono 8.2 %
ALT 32 U/L eosino 0 %
LDH 190 U/L Hb 16.0 g/dL
γ-GTP 17 U/L Hct 46.2 %
CK 65 U/L Plt 20.2 ×104/μL
BUN 8.8 mg/dL
Cr 0.99 mg/dL PT-INR 1.07
UA 6.4 mg/dL APTT 35.0 sec
Na 139 mEq/L D-dimer 0.4 pg/mL
K 3.4 mEq/L fibrinogen 334 mg/dL
Cl 107 mEq/L
glu 112 mg/dL
CRP 0.70 mg/dL
IgG 1,186 mg/dL influenza A negative
IgA 297 mg/dL B negative
IgM 37 mg/dL
IgE 223 mg/dL Pneumococcal urinary antigen test negative
SPA 16.1 ng/mL
SPD 25.6 ng/mL Legionella urinary antigen test negative
KL-6 165 U/mL
β-D-glucan 5.1 pg/mL
NT-proBNP 16 pg/mL
PCT 0.04 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
Chest radiography at admission showed nodular opacity in the right upper lobe (Fig. 3a), and plain chest CT showed numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side (Fig. 3b).
Figure 3. Case 2: Imaging findings at the time of hospital admission. (a) Chest radiography shows nodular opacity in the right upper lobe. (b) Chest CT shows numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side.
Treatment was started with intravenous infusion of methylprednisolone (80 mg/day) and azithromycin (500 mg every 24 hours) to alleviate inflammation, ceftriaxone (2 g every 24 hours) in consideration of bacterial pneumonia and peramivir (600 mg/day on Day 1 and 300 mg/day from Day 2 onward) as an antiviral agent (Fig. 4). The patient showed positive results of a COVID-19 RT-PCR test on Day 3 of hospitalization when treatment with favipiravir was started. Pyrexia in the patient persisted, and respiratory failure progressed even after the initiation of favipiravir. The dose of methylprednisolone was increased to 250 mg/day from Day 6 onward. On Day 7, continuous intravenous infusion of sivelestat (400 mg/day) was started. Since the platelet count had decreased to 13.9×104/μL and COVID-19 often causes abnormal coagulation, intravenous infusion of recombinant thrombomodulin (32,000 U/day) was also started. The D-dimer level slightly increased to 1.8 μg/mL on Day 10 but improved thereafter.
Figure 4. Case 2: Clinical course after hospital admission.
The further progression of respiratory failure necessitated noninvasive intermittent positive-pressure ventilation on Day 8 and intubation and mechanical ventilation on Day 9. On Day 10, V-V ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease and poor oxygenation, even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.5 L/min. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: PCV, FiO2 of 0.21, PEEP of 8 cmH2O, inspiratory pressure of 8 cmH2O and respiratory frequency of 12 per minute.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received ECMO was reduced. Therefore, he was weaned from ECMO on Day 15. He was extubated on Day 19. No ECMO-associated adverse events were observed. The patient no longer required supplemental oxygen supply on Day 23. The patient was discharged on Day 32 (Fig. 4).
Discussion
Although the majority of cases of COVID-19 result in mild, reversible symptoms, some patients develop dyspnea and hypoxemia within about a week of the onset of the disease. Wang et al. reported that 26.1% of patients hospitalized with COVID-19 pneumonia required treatment in the intensive-care unit (ICU); 61.1% of these patients in the ICU had ARDS, and the mortality rate was approximately 4.3% (9). A total of 60 patients with COVID-19 pneumonia had been admitted to our hospital as of the middle of May, 2020. Eight of these 60 patients required intubation and mechanical ventilation, including the 2 presently reported patients who also required the use of ECMO.
ARDS is characterized by excessive local inflammation in the lung, which can progress to an “out-of-control” state. Excessive production of mediators, such as cytokines (e.g., interleukin-6, tumor necrosis factor alpha, interleukin-8) and arachidonate metabolites (i.e., cytokine storm), interstitial lung edema caused by enhanced pulmonary vascular permeability, and diffuse alveolar damage induce a rapid decrease in oxygenation and the accumulation of carbon dioxide (10). Antiviral treatment and pharmacological and non-pharmacological supportive therapies are considered to serve as important therapeutic strategies for COVID-19 pneumonia patients with ARDS.
It was previously reported that the fulminant activation of coagulation and consumption of clotting factors occur in severe cases of COVID-19. Inflammation of lung tissues and endothelial cells causes microthrombi formation, leading to thrombotic complications, such as deep venous thrombosis, pulmonary embolism and thrombotic arterial complications (11). T tD-dimer and fibrinogen degradation product (FDP) levels were increased in both of the present cases. Furthermore, in Case 1, the patient developed DIC and pulmonary thromboembolism despite the use of anticoagulants.
DIC in patients with COVID-19 has previously been described, and its characteristics include a lack of bleeding risk, mildly low platelet counts and elevated plasma fibrinogen levels, none of which are seen in typical DIC. Therefore, instead of DIC, these data might more closely resemble complement-mediated thrombotic microangiopathy (TMA) syndromes. Importantly, another essential aspect of DIC seen in COVID-19 is the detection of both COVID-19 and complement components in regions of TMA. Mediators of TMA syndromes overlap with those released by cytokine storm, suggesting close connections between ineffective immune responses to COVID-19, severe pneumonia and life-threatening microangiopathy (12). Although the diagnostic criteria for DIC were met in case 1, TMA syndrome might have occurred in both cases (particularly in case 2) because of the lack of typical symptoms of DIC.
For the two cases presented in this report, favipiravir administration was started as an antiviral treatment immediately after the diagnosis of COVID-19. At a meeting of the Japanese Association for Infectious Diseases, we presented an immediate report on cases of COVID-19 pneumonia with progressive respiratory failure, for which favipiravir may have worked promptly and effectively (13). However, rapid progression of respiratory failure was observed in the patients in this report despite the initiation of treatment with favipiravir. This can be interpreted as suggesting that the clinical benefit of treatment with an antiviral agent alone is limited in patients with concurrent ARDS. At present, multiple clinical trials of favipiravir are underway in patients with mild to severe COVID-19 pneumonia. Future data from these trials may provide new insights into the drug's clinical benefits.
As a pharmacological supportive therapy, we administered methylprednisolone (an anti-inflammatory agent for inhibiting cytokine storm), sivelestat (a neutrophil elastase inhibitor) and macrolide antibiotics with an immunoregulatory function (14) effective for suppressing hyperimmunization and excessive inflammation. The World Health Organization (WHO) has advised against the use of corticosteroids to treat COVID-19. The interim WHO guidance on the management of patients with severe acute respiratory infection caused by COVID-19 presents negative views on the use of steroids in the treatment of this patient population (“routine use of steroids should be avoided unless the patient has symptoms including bronchial asthma, aggravated chronic obstructive pulmonary disease, and septic shock”) based on data from studies of steroid therapy in patients with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) or influenza (15). However, a study by the RECOVERY Collaborative Group showed that the use of dexamethasone in hospitalized COVID-19 patients resulted in a lower 28-day mortality than in those who were solely receiving either invasive mechanical ventilation or oxygen (6). In addition, Wu et al. performed a retrospective cohort study in patients with COVID-19 pneumonia and reported that the mortality in a cohort using methylprednisolone was lower than that in a cohort not using methylprednisolone, although the number of severe cases included in the former cohort was larger than that in the latter cohort (7). In our hospital, we have actively used steroids in patients with hypoxemia and achieved good outcomes. Based on these experiences, we are considering participating in a clinical study conducted to evaluate the efficacy of steroids in patients with COVID-19 pneumonia to verify the clinical effects of steroids in this patient population. Regarding macrolides, some researchers have reported that macrolide therapy was effective for reducing mortality in patients with ARDS (16). Although the mechanism underlying this reduction in mortality has not been fully elucidated, macrolides are likely to have effects on cytokine production and the neutrophil function (16).
As non-pharmacological supportive therapy, intubation, mechanical ventilation and ECMO were employed. ECMO is a life-supporting method used in patients with severe respiratory or cardiac failure (used particularly as a resuscitative measure taken for patients in cardiopulmonary arrest), called “respiratory ECMO” and “cardiac ECMO”, respectively. Respiratory ECMO is indicated for patients with reversible acute respiratory failure. Its use is considered for patients for whom conventional mechanical ventilation is insufficient for sustaining life or in whom continuous use of the mechanical ventilation system can result in irreversible damage to the lung. Respiratory ECMO is regarded as a treatment of ARDS (17). In the treatment of novel influenza A (H1N1) 2009, the results of ECMO database-based cohort studies (18,19) and the study on conventional ventilatory support vs. ECMO for severe adult respiratory failure (CESAR study) (20) demonstrated the efficacy of ECMO therapy based on the finding that the mortality in patients using ECMO was significantly lower than that in patients not using ECMO. In a retrospective study in MERS patients with refractory respiratory failure in 2018, the use of ECMO was required as an emergency treatment. The mortality in MERS patients with refractory hypoxemia in the ECMO cohort was significantly lower than that in the non-ECMO cohort (65% vs. 100%; p = 0.02) (21). Although little evidence for the efficacy of ECMO has been obtained with respect to COVID-19 pneumonia, results from two retrospective studies have been reported. In a retrospective study by Yang et al., of 52 patients admitted to the ICU with severe COVID-19 pneumonia, 32 died within 28 days of admission. ECMO was introduced to 6 patients, of whom 5 died, while the other was still on ECMO at the time of the endpoint assessment (22). In a retrospective study by Zhang et al., 48 of 221 patients with COVID-19 pneumonia had concurrent ARDS, and 10 of these 48 patients required mechanical ventilation and ECMO therapy. Of these 10 patients, 2 were successfully treated and discharged from the hospital, and 3 died. The other five patients were still on ECMO at the time of the endpoint assessment (23). According to the interim WHO guidance, ECMO, despite little evidence for its efficacy, is regarded as an emergency treatment of COVID-19 patients who have concurrent refractory hypoxemia even after being treated with lung-protective ventilation strategy (15). The condition of the two patients in the present case report was improved by intubation, mechanical ventilation and the prompt introduction of ECMO. COVID-19 pneumonia with ARDS is associated with high mortality. Pulmonary protection initiated before obtaining clinical benefits of antiviral treatment and pharmacological supportive therapy is considered to contribute to a reduction in mortality. Concerning complications, iliopsoas hematoma was identified in Case 1. In general, hemorrhagic complications, such as cannulation site bleeding, occur in approximately 50% of patients undergoing ECMO (17). ECMO-associated bleeding, which is attributed to the effect of heparinization as well as circuit-related consumption of coagulation factors, can be severe. It may be difficult to arrest bleeding if no measures other than monitoring the patient are taken. In Case 1, although the patient required blood transfusion, bleeding was arrested during the observation of the patient's condition. Infection is another critical complication said to occur in approximately 20% of patients on ECMO (17). However, the two patients in this report were able to safely receive ECMO therapy with no ECMO-related infectious complications.
Our two patients were already suffering from severe respiratory failure at the time of the diagnosis of COVID-19. They were successfully treated by a combination of antiviral treatment with favipiravir, corticosteroid, mechanical ventilation and ECMO. The positive outcomes of these cases underscore the importance of promptly treating severe COVID-19 pneumonia after the diagnosis with non-pharmacological supportive therapy, such as mechanical ventilation and ECMO, in combination with pharmacological supportive therapy, notably favipiravir for antiviral treatment and corticosteroid for anti-inflammatory treatment.
The authors state that they have no Conflict of Interest (COI). | UNKNOWN | DrugDosageText | CC BY-NC-ND | 33390469 | 18,811,755 | 2021 |
What was the dosage of drug 'MEROPENEM'? | Two Cases of Severe COVID-19 Pneumonia Effectively Treated with Extracorporeal Membrane Oxygenation in Addition to Favipiravir and Corticosteroid.
Case 1: A 65-year-old man with novel coronavirus infection (COVID-19) complicated with acute respiratory failure. On admission, the patient was started on favipiravir and corticosteroid. However, due to a lack of significant improvement, he was introduced to mechanical ventilation and extracorporeal membrane oxygenation (ECMO). Although iliopsoas hematoma occurred as a complication, the patient recovered. Case 2: A 49-year-old man with COVID-19 had been started on favipiravir and corticosteroid. Due to progressive respiratory failure, the patient underwent mechanical ventilation and ECMO. The patient recovered without complications. We successfully treated these severe cases with a multimodal combination of pharmacological and non-pharmacological supportive therapy.
Introduction
Coronavirus disease 2019 (COVID-19) was first identified in December 2019 in Wuhan, China, and has since rapidly spread globally. At present, there are few established treatments for COVID-19 with confirmed efficacy, resulting in numerous deaths.
Globally, as of August 1, 2020, 17,396,943 confirmed cases and 675,060 deaths related to COVID-19 have been reported to WHO, and the mortality rate is 3.9% (1). The overall hospital mortality rate from COVID-19 is approximately 15% to 20%, increasing to 40% among patients requiring ICU admission. By age, the hospital mortality rate is 35% for patients 70 to 79 years old and 60% for patients 80 to 89 years old (2). The mortality in COVID-19 patients who develope severe respiratory compromise and require mechanical ventilation is high.
Favipiravir obtained manufacturing and marketing approval in March 2014 for “new or re-emerging influenza virus infections (provided that other anti-influenza virus drugs were ineffective)”. With regard to the mechanism of action of this drug, favipiravir taken up into cells is metabolized and converted by intracellular enzymes to become favipiravir ribofuranosyl triphosphate, which selectively inhibits viral RNA-dependent RNA polymerase. Therefore, this agent may also be effective against RNA viruses other than influenza virus, and indeed, nonclinical studies have reported its efficacy against several RNA viruses, including Ebola virus (3), Arenaviridae and Bunyaviridae (4). In an open-label, controlled trial in China, the time to viral clearance of mild to moderate COVID-19 treated with favipiravir and interferon alfa was significantly shorter than that of lobinavir ritonavir and interferon alfa (5).
There have been several reports of the efficacy of administering corticosteroids for COVID-19 patients, although opinions on this approach were initially negative (6,7). Corticosteroids are a viable therapeutic strategy for modulating the inflammatory response in patients with COVID-19.
The high mortality rate in severe cases is important, given the potential access to extracorporeal membrane oxygenation of venous blood, which may serve as a life-saving emergency treatment. Although the efficacy of ECMO in COVID-19 is controversial, ECMO is a proposed as a treatment option in the interim guidance document published by the WHO and interim guidance for clinical management of COVID-19 patients provided by the United States Centers for Disease Control (8).
We herein report two cases of COVID-19 in which the early introduction of ECMO was extremely effective for managing patients whose pneumonia was aggravated even under the use of favipiravir and corticosteroid.
Case Reports
Case 1
A 65-year-old Japanese man with no significant medical history developed malaise at the end of March, 2020, and eventually developed pyrexia, cough and dyspnea. He visited a local clinic 9 days later. Because the patient presented with decreased percutaneous oxygen saturation (SpO2) and ground-glass opacities in both lungs, he was suspected of having COVID-19 pneumonia. On the same day, he was taken to our hospital by an ambulance, where he was immediately admitted. He had neither a history of close contact with COVID-19-positive patients nor any recent travel history. He was a former smoker (37.5 packs per year).
At the time of admission, the patient had no disorientation, with a body temperature of 37.5℃, blood pressure of 140/78 mmHg, pulse rate of 72 beats per minute (regular), respiratory rate of 24 breaths per minute and SpO2 of 82% on room air. At the time of admission, a marked increase was observed in lactate dehydrogenase and C-reactive protein (CRP), being 628 U/L and 24.99 mg/dL, respectively. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were detected. Surfactant protein D increased to 221 ng/mL (Table 1).
Table 1. Case 1: Laboratory Findings at the Time of Hospital Admission.
TP 6.1 g/dL WBC 8,300 /μL
alb 2.6 g/dL neutro 87.4 %
T-bil 0.5 mg/dL lymph 6.9 %
AST 66 U/L mono 5.4 %
ALT 33 U/L eosino 0.1 %
LDH 628 U/L Hb 16.3 g/dL
γ-GTP 27 U/L Hct 47.5 %
CK 69 U/L Plt 27.9 ×104/μL
BUN 13.8 mg/dL
Cr 0.76 mg/dL PT-INR 1.16
UA 4.2 mg/dL APTT 35.8 sec
Na 136 mEq/L D-dimer 8.8 pg/mL
K 4.8 mEq/L fibrinogen 774 mg/dL
Cl 102 mEq/L
glu 99 mg/dL
CRP 24.99 mg/dL
IgG 846 mg/dL
IgA 157 mg/dL
IgM 36 mg/dL
IgE 92 mg/dL influenza A negative
SPA 92.8 ng/mL B negative
SPD 221 ng/mL
KL-6 370 U/mL
β-D-glucan 12.0 pg/mL
NT-proBNP 125 pg/mL
PCT 0.20 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
At the time of hospital admission, chest radiography showed diffuse ground-glass opacities in both lungs (Fig. 1a), and plain chest computed tomography (CT) showed diffuse ground-glass opacities in nearly all layers of both lungs (Fig. 1b).
Figure 1. Case 1: Imaging findings at the time of hospital admission. (a) Chest radiography shows diffuse ground-glass opacities in both lungs. (b) Chest CT shows diffuse ground-glass opacities in nearly all layers of both lungs.
The patient was found to have progressive acute respiratory failure and started to receive high-flow nasal cannula oxygen therapy [delivery of 50 L of flow; fraction of inspired oxygen (FiO2) of 50%]. Methylprednisolone pulse therapy (administered at 1 g/day for 3 days) was started to treat the progressive acute respiratory failure as empirical treatment for severe pneumonia and acute interstitial pneumonia. Intravenous infusion of meropenem (1 g every 8 hours) and azithromycin (500 mg every 24 hours) was started under suspicion of severe bacterial pneumonia, and continuous intravenous infusion of sivelestat (400 mg/day) was also started to treat acute respiratory distress syndrome (ARDS).
A COVID-19 real-time polymerase chain reaction (RT-PCR) test was performed, and the patient was found to be positive for COVID-19 on Day 3 of hospitalization. With the patient's consent, treatment with favipiravir was started on a compassionate-use basis. On Day 5, further progression of respiratory failure required the patient to be intubated and moved to mechanical ventilation. On the same day, veno-venous (V-V) ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease because mechanical ventilation was considered insufficient to sustain the cardiorespiratory system due to the patient's poor oxygenation even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.0 L/min. From days 3 to 5, platelets decreased from 24.5×104 to 17.8×104/μL, fibrinogen decreased from 426 to 54 mg/dL, and D-dimer increased from 68.1 to 98.2 μg/mL. No bleeding tendency, circulatory failure due to microthrombus, or multiple organ failure was observed. Since the criteria established by the Japanese Association for Acute Medicine for disseminated intravascular coagulation (DIC) were met, we administered recombinant thrombomodulin. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: pressure-controlled ventilation (PCV), FiO2 of 0.35, positive end-expiratory pressure (PEEP) of 9 cmH2O, inspiratory pressure of 7 cmH2O and respiratory frequency of 10 per minute. After introduction of mechanical ventilation and ECMO, the patient's blood pressure decreased. Based on the echocardiographic and electrocardiographic findings, the patient was diagnosed with concurrent takotsubo cardiomyopathy, for which treatment with noradrenaline was started.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received through ECMO was reduced. Therefore, he was weaned from ECMO on Day 12. He was extubated on Day 14. As an adverse event, the patient developed left iliopsoas bleed that required a number of blood transfusions, which resulted in transfusion-associated circulatory overload. The patient was re-intubated and placed on mechanical ventilation on Day 15. His condition improved after fluid management, and he was extubated again on Day 23. The radio-opaque areas in the lung fields became smaller. The flow of supplemental oxygen was decreased to 1 L/min/cannula on Day 33. The patient was discharged on Day 41 (Fig. 2).
Figure 2. Case 1: Clinical course after hospital admission.
Case 2
A 49-year-old Japanese man with bronchial asthma presented with pyrexia, malaise and dyspnea at the middle of April, 2020, and visited a local clinic. Due to his poor response to any symptomatic treatments given, the patient was taken by ambulance to our hospital 3 days later. He had had close contact with his wife, who had contracted COVID-19 pneumonia. He was suspected of also having COVID-19 pneumonia based on chest CT findings and was admitted to the hospital on the same day. He had no smoking history.
At the time of admission, the patient had no disorientation, with a body temperature of 39.9℃, blood pressure of 142/88 mmHg, pulse rate of 126 beats per minute, regular, respiratory rate of 22 breaths per minute and percutaneous oxygen saturation (SpO2) of 97% on room air, and a slight increase in CRP (0.70) was observed. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were noted (Table 2).
Table 2. Case 2: Laboratory Findings at the Time of Hospital Admission.
TP 7.1 g/dL WBC 5,500 /μL
alb 4.1 g/dL neutro 80.6 %
T-bil 0.52 mg/dL lymph 11.2 %
AST 22 U/L mono 8.2 %
ALT 32 U/L eosino 0 %
LDH 190 U/L Hb 16.0 g/dL
γ-GTP 17 U/L Hct 46.2 %
CK 65 U/L Plt 20.2 ×104/μL
BUN 8.8 mg/dL
Cr 0.99 mg/dL PT-INR 1.07
UA 6.4 mg/dL APTT 35.0 sec
Na 139 mEq/L D-dimer 0.4 pg/mL
K 3.4 mEq/L fibrinogen 334 mg/dL
Cl 107 mEq/L
glu 112 mg/dL
CRP 0.70 mg/dL
IgG 1,186 mg/dL influenza A negative
IgA 297 mg/dL B negative
IgM 37 mg/dL
IgE 223 mg/dL Pneumococcal urinary antigen test negative
SPA 16.1 ng/mL
SPD 25.6 ng/mL Legionella urinary antigen test negative
KL-6 165 U/mL
β-D-glucan 5.1 pg/mL
NT-proBNP 16 pg/mL
PCT 0.04 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
Chest radiography at admission showed nodular opacity in the right upper lobe (Fig. 3a), and plain chest CT showed numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side (Fig. 3b).
Figure 3. Case 2: Imaging findings at the time of hospital admission. (a) Chest radiography shows nodular opacity in the right upper lobe. (b) Chest CT shows numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side.
Treatment was started with intravenous infusion of methylprednisolone (80 mg/day) and azithromycin (500 mg every 24 hours) to alleviate inflammation, ceftriaxone (2 g every 24 hours) in consideration of bacterial pneumonia and peramivir (600 mg/day on Day 1 and 300 mg/day from Day 2 onward) as an antiviral agent (Fig. 4). The patient showed positive results of a COVID-19 RT-PCR test on Day 3 of hospitalization when treatment with favipiravir was started. Pyrexia in the patient persisted, and respiratory failure progressed even after the initiation of favipiravir. The dose of methylprednisolone was increased to 250 mg/day from Day 6 onward. On Day 7, continuous intravenous infusion of sivelestat (400 mg/day) was started. Since the platelet count had decreased to 13.9×104/μL and COVID-19 often causes abnormal coagulation, intravenous infusion of recombinant thrombomodulin (32,000 U/day) was also started. The D-dimer level slightly increased to 1.8 μg/mL on Day 10 but improved thereafter.
Figure 4. Case 2: Clinical course after hospital admission.
The further progression of respiratory failure necessitated noninvasive intermittent positive-pressure ventilation on Day 8 and intubation and mechanical ventilation on Day 9. On Day 10, V-V ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease and poor oxygenation, even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.5 L/min. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: PCV, FiO2 of 0.21, PEEP of 8 cmH2O, inspiratory pressure of 8 cmH2O and respiratory frequency of 12 per minute.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received ECMO was reduced. Therefore, he was weaned from ECMO on Day 15. He was extubated on Day 19. No ECMO-associated adverse events were observed. The patient no longer required supplemental oxygen supply on Day 23. The patient was discharged on Day 32 (Fig. 4).
Discussion
Although the majority of cases of COVID-19 result in mild, reversible symptoms, some patients develop dyspnea and hypoxemia within about a week of the onset of the disease. Wang et al. reported that 26.1% of patients hospitalized with COVID-19 pneumonia required treatment in the intensive-care unit (ICU); 61.1% of these patients in the ICU had ARDS, and the mortality rate was approximately 4.3% (9). A total of 60 patients with COVID-19 pneumonia had been admitted to our hospital as of the middle of May, 2020. Eight of these 60 patients required intubation and mechanical ventilation, including the 2 presently reported patients who also required the use of ECMO.
ARDS is characterized by excessive local inflammation in the lung, which can progress to an “out-of-control” state. Excessive production of mediators, such as cytokines (e.g., interleukin-6, tumor necrosis factor alpha, interleukin-8) and arachidonate metabolites (i.e., cytokine storm), interstitial lung edema caused by enhanced pulmonary vascular permeability, and diffuse alveolar damage induce a rapid decrease in oxygenation and the accumulation of carbon dioxide (10). Antiviral treatment and pharmacological and non-pharmacological supportive therapies are considered to serve as important therapeutic strategies for COVID-19 pneumonia patients with ARDS.
It was previously reported that the fulminant activation of coagulation and consumption of clotting factors occur in severe cases of COVID-19. Inflammation of lung tissues and endothelial cells causes microthrombi formation, leading to thrombotic complications, such as deep venous thrombosis, pulmonary embolism and thrombotic arterial complications (11). T tD-dimer and fibrinogen degradation product (FDP) levels were increased in both of the present cases. Furthermore, in Case 1, the patient developed DIC and pulmonary thromboembolism despite the use of anticoagulants.
DIC in patients with COVID-19 has previously been described, and its characteristics include a lack of bleeding risk, mildly low platelet counts and elevated plasma fibrinogen levels, none of which are seen in typical DIC. Therefore, instead of DIC, these data might more closely resemble complement-mediated thrombotic microangiopathy (TMA) syndromes. Importantly, another essential aspect of DIC seen in COVID-19 is the detection of both COVID-19 and complement components in regions of TMA. Mediators of TMA syndromes overlap with those released by cytokine storm, suggesting close connections between ineffective immune responses to COVID-19, severe pneumonia and life-threatening microangiopathy (12). Although the diagnostic criteria for DIC were met in case 1, TMA syndrome might have occurred in both cases (particularly in case 2) because of the lack of typical symptoms of DIC.
For the two cases presented in this report, favipiravir administration was started as an antiviral treatment immediately after the diagnosis of COVID-19. At a meeting of the Japanese Association for Infectious Diseases, we presented an immediate report on cases of COVID-19 pneumonia with progressive respiratory failure, for which favipiravir may have worked promptly and effectively (13). However, rapid progression of respiratory failure was observed in the patients in this report despite the initiation of treatment with favipiravir. This can be interpreted as suggesting that the clinical benefit of treatment with an antiviral agent alone is limited in patients with concurrent ARDS. At present, multiple clinical trials of favipiravir are underway in patients with mild to severe COVID-19 pneumonia. Future data from these trials may provide new insights into the drug's clinical benefits.
As a pharmacological supportive therapy, we administered methylprednisolone (an anti-inflammatory agent for inhibiting cytokine storm), sivelestat (a neutrophil elastase inhibitor) and macrolide antibiotics with an immunoregulatory function (14) effective for suppressing hyperimmunization and excessive inflammation. The World Health Organization (WHO) has advised against the use of corticosteroids to treat COVID-19. The interim WHO guidance on the management of patients with severe acute respiratory infection caused by COVID-19 presents negative views on the use of steroids in the treatment of this patient population (“routine use of steroids should be avoided unless the patient has symptoms including bronchial asthma, aggravated chronic obstructive pulmonary disease, and septic shock”) based on data from studies of steroid therapy in patients with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) or influenza (15). However, a study by the RECOVERY Collaborative Group showed that the use of dexamethasone in hospitalized COVID-19 patients resulted in a lower 28-day mortality than in those who were solely receiving either invasive mechanical ventilation or oxygen (6). In addition, Wu et al. performed a retrospective cohort study in patients with COVID-19 pneumonia and reported that the mortality in a cohort using methylprednisolone was lower than that in a cohort not using methylprednisolone, although the number of severe cases included in the former cohort was larger than that in the latter cohort (7). In our hospital, we have actively used steroids in patients with hypoxemia and achieved good outcomes. Based on these experiences, we are considering participating in a clinical study conducted to evaluate the efficacy of steroids in patients with COVID-19 pneumonia to verify the clinical effects of steroids in this patient population. Regarding macrolides, some researchers have reported that macrolide therapy was effective for reducing mortality in patients with ARDS (16). Although the mechanism underlying this reduction in mortality has not been fully elucidated, macrolides are likely to have effects on cytokine production and the neutrophil function (16).
As non-pharmacological supportive therapy, intubation, mechanical ventilation and ECMO were employed. ECMO is a life-supporting method used in patients with severe respiratory or cardiac failure (used particularly as a resuscitative measure taken for patients in cardiopulmonary arrest), called “respiratory ECMO” and “cardiac ECMO”, respectively. Respiratory ECMO is indicated for patients with reversible acute respiratory failure. Its use is considered for patients for whom conventional mechanical ventilation is insufficient for sustaining life or in whom continuous use of the mechanical ventilation system can result in irreversible damage to the lung. Respiratory ECMO is regarded as a treatment of ARDS (17). In the treatment of novel influenza A (H1N1) 2009, the results of ECMO database-based cohort studies (18,19) and the study on conventional ventilatory support vs. ECMO for severe adult respiratory failure (CESAR study) (20) demonstrated the efficacy of ECMO therapy based on the finding that the mortality in patients using ECMO was significantly lower than that in patients not using ECMO. In a retrospective study in MERS patients with refractory respiratory failure in 2018, the use of ECMO was required as an emergency treatment. The mortality in MERS patients with refractory hypoxemia in the ECMO cohort was significantly lower than that in the non-ECMO cohort (65% vs. 100%; p = 0.02) (21). Although little evidence for the efficacy of ECMO has been obtained with respect to COVID-19 pneumonia, results from two retrospective studies have been reported. In a retrospective study by Yang et al., of 52 patients admitted to the ICU with severe COVID-19 pneumonia, 32 died within 28 days of admission. ECMO was introduced to 6 patients, of whom 5 died, while the other was still on ECMO at the time of the endpoint assessment (22). In a retrospective study by Zhang et al., 48 of 221 patients with COVID-19 pneumonia had concurrent ARDS, and 10 of these 48 patients required mechanical ventilation and ECMO therapy. Of these 10 patients, 2 were successfully treated and discharged from the hospital, and 3 died. The other five patients were still on ECMO at the time of the endpoint assessment (23). According to the interim WHO guidance, ECMO, despite little evidence for its efficacy, is regarded as an emergency treatment of COVID-19 patients who have concurrent refractory hypoxemia even after being treated with lung-protective ventilation strategy (15). The condition of the two patients in the present case report was improved by intubation, mechanical ventilation and the prompt introduction of ECMO. COVID-19 pneumonia with ARDS is associated with high mortality. Pulmonary protection initiated before obtaining clinical benefits of antiviral treatment and pharmacological supportive therapy is considered to contribute to a reduction in mortality. Concerning complications, iliopsoas hematoma was identified in Case 1. In general, hemorrhagic complications, such as cannulation site bleeding, occur in approximately 50% of patients undergoing ECMO (17). ECMO-associated bleeding, which is attributed to the effect of heparinization as well as circuit-related consumption of coagulation factors, can be severe. It may be difficult to arrest bleeding if no measures other than monitoring the patient are taken. In Case 1, although the patient required blood transfusion, bleeding was arrested during the observation of the patient's condition. Infection is another critical complication said to occur in approximately 20% of patients on ECMO (17). However, the two patients in this report were able to safely receive ECMO therapy with no ECMO-related infectious complications.
Our two patients were already suffering from severe respiratory failure at the time of the diagnosis of COVID-19. They were successfully treated by a combination of antiviral treatment with favipiravir, corticosteroid, mechanical ventilation and ECMO. The positive outcomes of these cases underscore the importance of promptly treating severe COVID-19 pneumonia after the diagnosis with non-pharmacological supportive therapy, such as mechanical ventilation and ECMO, in combination with pharmacological supportive therapy, notably favipiravir for antiviral treatment and corticosteroid for anti-inflammatory treatment.
The authors state that they have no Conflict of Interest (COI). | 1 g (grams). | DrugDosage | CC BY-NC-ND | 33390469 | 18,811,755 | 2021 |
What was the dosage of drug 'SIVELESTAT'? | Two Cases of Severe COVID-19 Pneumonia Effectively Treated with Extracorporeal Membrane Oxygenation in Addition to Favipiravir and Corticosteroid.
Case 1: A 65-year-old man with novel coronavirus infection (COVID-19) complicated with acute respiratory failure. On admission, the patient was started on favipiravir and corticosteroid. However, due to a lack of significant improvement, he was introduced to mechanical ventilation and extracorporeal membrane oxygenation (ECMO). Although iliopsoas hematoma occurred as a complication, the patient recovered. Case 2: A 49-year-old man with COVID-19 had been started on favipiravir and corticosteroid. Due to progressive respiratory failure, the patient underwent mechanical ventilation and ECMO. The patient recovered without complications. We successfully treated these severe cases with a multimodal combination of pharmacological and non-pharmacological supportive therapy.
Introduction
Coronavirus disease 2019 (COVID-19) was first identified in December 2019 in Wuhan, China, and has since rapidly spread globally. At present, there are few established treatments for COVID-19 with confirmed efficacy, resulting in numerous deaths.
Globally, as of August 1, 2020, 17,396,943 confirmed cases and 675,060 deaths related to COVID-19 have been reported to WHO, and the mortality rate is 3.9% (1). The overall hospital mortality rate from COVID-19 is approximately 15% to 20%, increasing to 40% among patients requiring ICU admission. By age, the hospital mortality rate is 35% for patients 70 to 79 years old and 60% for patients 80 to 89 years old (2). The mortality in COVID-19 patients who develope severe respiratory compromise and require mechanical ventilation is high.
Favipiravir obtained manufacturing and marketing approval in March 2014 for “new or re-emerging influenza virus infections (provided that other anti-influenza virus drugs were ineffective)”. With regard to the mechanism of action of this drug, favipiravir taken up into cells is metabolized and converted by intracellular enzymes to become favipiravir ribofuranosyl triphosphate, which selectively inhibits viral RNA-dependent RNA polymerase. Therefore, this agent may also be effective against RNA viruses other than influenza virus, and indeed, nonclinical studies have reported its efficacy against several RNA viruses, including Ebola virus (3), Arenaviridae and Bunyaviridae (4). In an open-label, controlled trial in China, the time to viral clearance of mild to moderate COVID-19 treated with favipiravir and interferon alfa was significantly shorter than that of lobinavir ritonavir and interferon alfa (5).
There have been several reports of the efficacy of administering corticosteroids for COVID-19 patients, although opinions on this approach were initially negative (6,7). Corticosteroids are a viable therapeutic strategy for modulating the inflammatory response in patients with COVID-19.
The high mortality rate in severe cases is important, given the potential access to extracorporeal membrane oxygenation of venous blood, which may serve as a life-saving emergency treatment. Although the efficacy of ECMO in COVID-19 is controversial, ECMO is a proposed as a treatment option in the interim guidance document published by the WHO and interim guidance for clinical management of COVID-19 patients provided by the United States Centers for Disease Control (8).
We herein report two cases of COVID-19 in which the early introduction of ECMO was extremely effective for managing patients whose pneumonia was aggravated even under the use of favipiravir and corticosteroid.
Case Reports
Case 1
A 65-year-old Japanese man with no significant medical history developed malaise at the end of March, 2020, and eventually developed pyrexia, cough and dyspnea. He visited a local clinic 9 days later. Because the patient presented with decreased percutaneous oxygen saturation (SpO2) and ground-glass opacities in both lungs, he was suspected of having COVID-19 pneumonia. On the same day, he was taken to our hospital by an ambulance, where he was immediately admitted. He had neither a history of close contact with COVID-19-positive patients nor any recent travel history. He was a former smoker (37.5 packs per year).
At the time of admission, the patient had no disorientation, with a body temperature of 37.5℃, blood pressure of 140/78 mmHg, pulse rate of 72 beats per minute (regular), respiratory rate of 24 breaths per minute and SpO2 of 82% on room air. At the time of admission, a marked increase was observed in lactate dehydrogenase and C-reactive protein (CRP), being 628 U/L and 24.99 mg/dL, respectively. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were detected. Surfactant protein D increased to 221 ng/mL (Table 1).
Table 1. Case 1: Laboratory Findings at the Time of Hospital Admission.
TP 6.1 g/dL WBC 8,300 /μL
alb 2.6 g/dL neutro 87.4 %
T-bil 0.5 mg/dL lymph 6.9 %
AST 66 U/L mono 5.4 %
ALT 33 U/L eosino 0.1 %
LDH 628 U/L Hb 16.3 g/dL
γ-GTP 27 U/L Hct 47.5 %
CK 69 U/L Plt 27.9 ×104/μL
BUN 13.8 mg/dL
Cr 0.76 mg/dL PT-INR 1.16
UA 4.2 mg/dL APTT 35.8 sec
Na 136 mEq/L D-dimer 8.8 pg/mL
K 4.8 mEq/L fibrinogen 774 mg/dL
Cl 102 mEq/L
glu 99 mg/dL
CRP 24.99 mg/dL
IgG 846 mg/dL
IgA 157 mg/dL
IgM 36 mg/dL
IgE 92 mg/dL influenza A negative
SPA 92.8 ng/mL B negative
SPD 221 ng/mL
KL-6 370 U/mL
β-D-glucan 12.0 pg/mL
NT-proBNP 125 pg/mL
PCT 0.20 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
At the time of hospital admission, chest radiography showed diffuse ground-glass opacities in both lungs (Fig. 1a), and plain chest computed tomography (CT) showed diffuse ground-glass opacities in nearly all layers of both lungs (Fig. 1b).
Figure 1. Case 1: Imaging findings at the time of hospital admission. (a) Chest radiography shows diffuse ground-glass opacities in both lungs. (b) Chest CT shows diffuse ground-glass opacities in nearly all layers of both lungs.
The patient was found to have progressive acute respiratory failure and started to receive high-flow nasal cannula oxygen therapy [delivery of 50 L of flow; fraction of inspired oxygen (FiO2) of 50%]. Methylprednisolone pulse therapy (administered at 1 g/day for 3 days) was started to treat the progressive acute respiratory failure as empirical treatment for severe pneumonia and acute interstitial pneumonia. Intravenous infusion of meropenem (1 g every 8 hours) and azithromycin (500 mg every 24 hours) was started under suspicion of severe bacterial pneumonia, and continuous intravenous infusion of sivelestat (400 mg/day) was also started to treat acute respiratory distress syndrome (ARDS).
A COVID-19 real-time polymerase chain reaction (RT-PCR) test was performed, and the patient was found to be positive for COVID-19 on Day 3 of hospitalization. With the patient's consent, treatment with favipiravir was started on a compassionate-use basis. On Day 5, further progression of respiratory failure required the patient to be intubated and moved to mechanical ventilation. On the same day, veno-venous (V-V) ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease because mechanical ventilation was considered insufficient to sustain the cardiorespiratory system due to the patient's poor oxygenation even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.0 L/min. From days 3 to 5, platelets decreased from 24.5×104 to 17.8×104/μL, fibrinogen decreased from 426 to 54 mg/dL, and D-dimer increased from 68.1 to 98.2 μg/mL. No bleeding tendency, circulatory failure due to microthrombus, or multiple organ failure was observed. Since the criteria established by the Japanese Association for Acute Medicine for disseminated intravascular coagulation (DIC) were met, we administered recombinant thrombomodulin. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: pressure-controlled ventilation (PCV), FiO2 of 0.35, positive end-expiratory pressure (PEEP) of 9 cmH2O, inspiratory pressure of 7 cmH2O and respiratory frequency of 10 per minute. After introduction of mechanical ventilation and ECMO, the patient's blood pressure decreased. Based on the echocardiographic and electrocardiographic findings, the patient was diagnosed with concurrent takotsubo cardiomyopathy, for which treatment with noradrenaline was started.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received through ECMO was reduced. Therefore, he was weaned from ECMO on Day 12. He was extubated on Day 14. As an adverse event, the patient developed left iliopsoas bleed that required a number of blood transfusions, which resulted in transfusion-associated circulatory overload. The patient was re-intubated and placed on mechanical ventilation on Day 15. His condition improved after fluid management, and he was extubated again on Day 23. The radio-opaque areas in the lung fields became smaller. The flow of supplemental oxygen was decreased to 1 L/min/cannula on Day 33. The patient was discharged on Day 41 (Fig. 2).
Figure 2. Case 1: Clinical course after hospital admission.
Case 2
A 49-year-old Japanese man with bronchial asthma presented with pyrexia, malaise and dyspnea at the middle of April, 2020, and visited a local clinic. Due to his poor response to any symptomatic treatments given, the patient was taken by ambulance to our hospital 3 days later. He had had close contact with his wife, who had contracted COVID-19 pneumonia. He was suspected of also having COVID-19 pneumonia based on chest CT findings and was admitted to the hospital on the same day. He had no smoking history.
At the time of admission, the patient had no disorientation, with a body temperature of 39.9℃, blood pressure of 142/88 mmHg, pulse rate of 126 beats per minute, regular, respiratory rate of 22 breaths per minute and percutaneous oxygen saturation (SpO2) of 97% on room air, and a slight increase in CRP (0.70) was observed. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were noted (Table 2).
Table 2. Case 2: Laboratory Findings at the Time of Hospital Admission.
TP 7.1 g/dL WBC 5,500 /μL
alb 4.1 g/dL neutro 80.6 %
T-bil 0.52 mg/dL lymph 11.2 %
AST 22 U/L mono 8.2 %
ALT 32 U/L eosino 0 %
LDH 190 U/L Hb 16.0 g/dL
γ-GTP 17 U/L Hct 46.2 %
CK 65 U/L Plt 20.2 ×104/μL
BUN 8.8 mg/dL
Cr 0.99 mg/dL PT-INR 1.07
UA 6.4 mg/dL APTT 35.0 sec
Na 139 mEq/L D-dimer 0.4 pg/mL
K 3.4 mEq/L fibrinogen 334 mg/dL
Cl 107 mEq/L
glu 112 mg/dL
CRP 0.70 mg/dL
IgG 1,186 mg/dL influenza A negative
IgA 297 mg/dL B negative
IgM 37 mg/dL
IgE 223 mg/dL Pneumococcal urinary antigen test negative
SPA 16.1 ng/mL
SPD 25.6 ng/mL Legionella urinary antigen test negative
KL-6 165 U/mL
β-D-glucan 5.1 pg/mL
NT-proBNP 16 pg/mL
PCT 0.04 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
Chest radiography at admission showed nodular opacity in the right upper lobe (Fig. 3a), and plain chest CT showed numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side (Fig. 3b).
Figure 3. Case 2: Imaging findings at the time of hospital admission. (a) Chest radiography shows nodular opacity in the right upper lobe. (b) Chest CT shows numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side.
Treatment was started with intravenous infusion of methylprednisolone (80 mg/day) and azithromycin (500 mg every 24 hours) to alleviate inflammation, ceftriaxone (2 g every 24 hours) in consideration of bacterial pneumonia and peramivir (600 mg/day on Day 1 and 300 mg/day from Day 2 onward) as an antiviral agent (Fig. 4). The patient showed positive results of a COVID-19 RT-PCR test on Day 3 of hospitalization when treatment with favipiravir was started. Pyrexia in the patient persisted, and respiratory failure progressed even after the initiation of favipiravir. The dose of methylprednisolone was increased to 250 mg/day from Day 6 onward. On Day 7, continuous intravenous infusion of sivelestat (400 mg/day) was started. Since the platelet count had decreased to 13.9×104/μL and COVID-19 often causes abnormal coagulation, intravenous infusion of recombinant thrombomodulin (32,000 U/day) was also started. The D-dimer level slightly increased to 1.8 μg/mL on Day 10 but improved thereafter.
Figure 4. Case 2: Clinical course after hospital admission.
The further progression of respiratory failure necessitated noninvasive intermittent positive-pressure ventilation on Day 8 and intubation and mechanical ventilation on Day 9. On Day 10, V-V ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease and poor oxygenation, even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.5 L/min. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: PCV, FiO2 of 0.21, PEEP of 8 cmH2O, inspiratory pressure of 8 cmH2O and respiratory frequency of 12 per minute.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received ECMO was reduced. Therefore, he was weaned from ECMO on Day 15. He was extubated on Day 19. No ECMO-associated adverse events were observed. The patient no longer required supplemental oxygen supply on Day 23. The patient was discharged on Day 32 (Fig. 4).
Discussion
Although the majority of cases of COVID-19 result in mild, reversible symptoms, some patients develop dyspnea and hypoxemia within about a week of the onset of the disease. Wang et al. reported that 26.1% of patients hospitalized with COVID-19 pneumonia required treatment in the intensive-care unit (ICU); 61.1% of these patients in the ICU had ARDS, and the mortality rate was approximately 4.3% (9). A total of 60 patients with COVID-19 pneumonia had been admitted to our hospital as of the middle of May, 2020. Eight of these 60 patients required intubation and mechanical ventilation, including the 2 presently reported patients who also required the use of ECMO.
ARDS is characterized by excessive local inflammation in the lung, which can progress to an “out-of-control” state. Excessive production of mediators, such as cytokines (e.g., interleukin-6, tumor necrosis factor alpha, interleukin-8) and arachidonate metabolites (i.e., cytokine storm), interstitial lung edema caused by enhanced pulmonary vascular permeability, and diffuse alveolar damage induce a rapid decrease in oxygenation and the accumulation of carbon dioxide (10). Antiviral treatment and pharmacological and non-pharmacological supportive therapies are considered to serve as important therapeutic strategies for COVID-19 pneumonia patients with ARDS.
It was previously reported that the fulminant activation of coagulation and consumption of clotting factors occur in severe cases of COVID-19. Inflammation of lung tissues and endothelial cells causes microthrombi formation, leading to thrombotic complications, such as deep venous thrombosis, pulmonary embolism and thrombotic arterial complications (11). T tD-dimer and fibrinogen degradation product (FDP) levels were increased in both of the present cases. Furthermore, in Case 1, the patient developed DIC and pulmonary thromboembolism despite the use of anticoagulants.
DIC in patients with COVID-19 has previously been described, and its characteristics include a lack of bleeding risk, mildly low platelet counts and elevated plasma fibrinogen levels, none of which are seen in typical DIC. Therefore, instead of DIC, these data might more closely resemble complement-mediated thrombotic microangiopathy (TMA) syndromes. Importantly, another essential aspect of DIC seen in COVID-19 is the detection of both COVID-19 and complement components in regions of TMA. Mediators of TMA syndromes overlap with those released by cytokine storm, suggesting close connections between ineffective immune responses to COVID-19, severe pneumonia and life-threatening microangiopathy (12). Although the diagnostic criteria for DIC were met in case 1, TMA syndrome might have occurred in both cases (particularly in case 2) because of the lack of typical symptoms of DIC.
For the two cases presented in this report, favipiravir administration was started as an antiviral treatment immediately after the diagnosis of COVID-19. At a meeting of the Japanese Association for Infectious Diseases, we presented an immediate report on cases of COVID-19 pneumonia with progressive respiratory failure, for which favipiravir may have worked promptly and effectively (13). However, rapid progression of respiratory failure was observed in the patients in this report despite the initiation of treatment with favipiravir. This can be interpreted as suggesting that the clinical benefit of treatment with an antiviral agent alone is limited in patients with concurrent ARDS. At present, multiple clinical trials of favipiravir are underway in patients with mild to severe COVID-19 pneumonia. Future data from these trials may provide new insights into the drug's clinical benefits.
As a pharmacological supportive therapy, we administered methylprednisolone (an anti-inflammatory agent for inhibiting cytokine storm), sivelestat (a neutrophil elastase inhibitor) and macrolide antibiotics with an immunoregulatory function (14) effective for suppressing hyperimmunization and excessive inflammation. The World Health Organization (WHO) has advised against the use of corticosteroids to treat COVID-19. The interim WHO guidance on the management of patients with severe acute respiratory infection caused by COVID-19 presents negative views on the use of steroids in the treatment of this patient population (“routine use of steroids should be avoided unless the patient has symptoms including bronchial asthma, aggravated chronic obstructive pulmonary disease, and septic shock”) based on data from studies of steroid therapy in patients with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) or influenza (15). However, a study by the RECOVERY Collaborative Group showed that the use of dexamethasone in hospitalized COVID-19 patients resulted in a lower 28-day mortality than in those who were solely receiving either invasive mechanical ventilation or oxygen (6). In addition, Wu et al. performed a retrospective cohort study in patients with COVID-19 pneumonia and reported that the mortality in a cohort using methylprednisolone was lower than that in a cohort not using methylprednisolone, although the number of severe cases included in the former cohort was larger than that in the latter cohort (7). In our hospital, we have actively used steroids in patients with hypoxemia and achieved good outcomes. Based on these experiences, we are considering participating in a clinical study conducted to evaluate the efficacy of steroids in patients with COVID-19 pneumonia to verify the clinical effects of steroids in this patient population. Regarding macrolides, some researchers have reported that macrolide therapy was effective for reducing mortality in patients with ARDS (16). Although the mechanism underlying this reduction in mortality has not been fully elucidated, macrolides are likely to have effects on cytokine production and the neutrophil function (16).
As non-pharmacological supportive therapy, intubation, mechanical ventilation and ECMO were employed. ECMO is a life-supporting method used in patients with severe respiratory or cardiac failure (used particularly as a resuscitative measure taken for patients in cardiopulmonary arrest), called “respiratory ECMO” and “cardiac ECMO”, respectively. Respiratory ECMO is indicated for patients with reversible acute respiratory failure. Its use is considered for patients for whom conventional mechanical ventilation is insufficient for sustaining life or in whom continuous use of the mechanical ventilation system can result in irreversible damage to the lung. Respiratory ECMO is regarded as a treatment of ARDS (17). In the treatment of novel influenza A (H1N1) 2009, the results of ECMO database-based cohort studies (18,19) and the study on conventional ventilatory support vs. ECMO for severe adult respiratory failure (CESAR study) (20) demonstrated the efficacy of ECMO therapy based on the finding that the mortality in patients using ECMO was significantly lower than that in patients not using ECMO. In a retrospective study in MERS patients with refractory respiratory failure in 2018, the use of ECMO was required as an emergency treatment. The mortality in MERS patients with refractory hypoxemia in the ECMO cohort was significantly lower than that in the non-ECMO cohort (65% vs. 100%; p = 0.02) (21). Although little evidence for the efficacy of ECMO has been obtained with respect to COVID-19 pneumonia, results from two retrospective studies have been reported. In a retrospective study by Yang et al., of 52 patients admitted to the ICU with severe COVID-19 pneumonia, 32 died within 28 days of admission. ECMO was introduced to 6 patients, of whom 5 died, while the other was still on ECMO at the time of the endpoint assessment (22). In a retrospective study by Zhang et al., 48 of 221 patients with COVID-19 pneumonia had concurrent ARDS, and 10 of these 48 patients required mechanical ventilation and ECMO therapy. Of these 10 patients, 2 were successfully treated and discharged from the hospital, and 3 died. The other five patients were still on ECMO at the time of the endpoint assessment (23). According to the interim WHO guidance, ECMO, despite little evidence for its efficacy, is regarded as an emergency treatment of COVID-19 patients who have concurrent refractory hypoxemia even after being treated with lung-protective ventilation strategy (15). The condition of the two patients in the present case report was improved by intubation, mechanical ventilation and the prompt introduction of ECMO. COVID-19 pneumonia with ARDS is associated with high mortality. Pulmonary protection initiated before obtaining clinical benefits of antiviral treatment and pharmacological supportive therapy is considered to contribute to a reduction in mortality. Concerning complications, iliopsoas hematoma was identified in Case 1. In general, hemorrhagic complications, such as cannulation site bleeding, occur in approximately 50% of patients undergoing ECMO (17). ECMO-associated bleeding, which is attributed to the effect of heparinization as well as circuit-related consumption of coagulation factors, can be severe. It may be difficult to arrest bleeding if no measures other than monitoring the patient are taken. In Case 1, although the patient required blood transfusion, bleeding was arrested during the observation of the patient's condition. Infection is another critical complication said to occur in approximately 20% of patients on ECMO (17). However, the two patients in this report were able to safely receive ECMO therapy with no ECMO-related infectious complications.
Our two patients were already suffering from severe respiratory failure at the time of the diagnosis of COVID-19. They were successfully treated by a combination of antiviral treatment with favipiravir, corticosteroid, mechanical ventilation and ECMO. The positive outcomes of these cases underscore the importance of promptly treating severe COVID-19 pneumonia after the diagnosis with non-pharmacological supportive therapy, such as mechanical ventilation and ECMO, in combination with pharmacological supportive therapy, notably favipiravir for antiviral treatment and corticosteroid for anti-inflammatory treatment.
The authors state that they have no Conflict of Interest (COI). | 400 mg (milligrams). | DrugDosage | CC BY-NC-ND | 33390469 | 18,811,755 | 2021 |
What was the dosage of drug 'THROMBOMODULIN ALFA'? | Two Cases of Severe COVID-19 Pneumonia Effectively Treated with Extracorporeal Membrane Oxygenation in Addition to Favipiravir and Corticosteroid.
Case 1: A 65-year-old man with novel coronavirus infection (COVID-19) complicated with acute respiratory failure. On admission, the patient was started on favipiravir and corticosteroid. However, due to a lack of significant improvement, he was introduced to mechanical ventilation and extracorporeal membrane oxygenation (ECMO). Although iliopsoas hematoma occurred as a complication, the patient recovered. Case 2: A 49-year-old man with COVID-19 had been started on favipiravir and corticosteroid. Due to progressive respiratory failure, the patient underwent mechanical ventilation and ECMO. The patient recovered without complications. We successfully treated these severe cases with a multimodal combination of pharmacological and non-pharmacological supportive therapy.
Introduction
Coronavirus disease 2019 (COVID-19) was first identified in December 2019 in Wuhan, China, and has since rapidly spread globally. At present, there are few established treatments for COVID-19 with confirmed efficacy, resulting in numerous deaths.
Globally, as of August 1, 2020, 17,396,943 confirmed cases and 675,060 deaths related to COVID-19 have been reported to WHO, and the mortality rate is 3.9% (1). The overall hospital mortality rate from COVID-19 is approximately 15% to 20%, increasing to 40% among patients requiring ICU admission. By age, the hospital mortality rate is 35% for patients 70 to 79 years old and 60% for patients 80 to 89 years old (2). The mortality in COVID-19 patients who develope severe respiratory compromise and require mechanical ventilation is high.
Favipiravir obtained manufacturing and marketing approval in March 2014 for “new or re-emerging influenza virus infections (provided that other anti-influenza virus drugs were ineffective)”. With regard to the mechanism of action of this drug, favipiravir taken up into cells is metabolized and converted by intracellular enzymes to become favipiravir ribofuranosyl triphosphate, which selectively inhibits viral RNA-dependent RNA polymerase. Therefore, this agent may also be effective against RNA viruses other than influenza virus, and indeed, nonclinical studies have reported its efficacy against several RNA viruses, including Ebola virus (3), Arenaviridae and Bunyaviridae (4). In an open-label, controlled trial in China, the time to viral clearance of mild to moderate COVID-19 treated with favipiravir and interferon alfa was significantly shorter than that of lobinavir ritonavir and interferon alfa (5).
There have been several reports of the efficacy of administering corticosteroids for COVID-19 patients, although opinions on this approach were initially negative (6,7). Corticosteroids are a viable therapeutic strategy for modulating the inflammatory response in patients with COVID-19.
The high mortality rate in severe cases is important, given the potential access to extracorporeal membrane oxygenation of venous blood, which may serve as a life-saving emergency treatment. Although the efficacy of ECMO in COVID-19 is controversial, ECMO is a proposed as a treatment option in the interim guidance document published by the WHO and interim guidance for clinical management of COVID-19 patients provided by the United States Centers for Disease Control (8).
We herein report two cases of COVID-19 in which the early introduction of ECMO was extremely effective for managing patients whose pneumonia was aggravated even under the use of favipiravir and corticosteroid.
Case Reports
Case 1
A 65-year-old Japanese man with no significant medical history developed malaise at the end of March, 2020, and eventually developed pyrexia, cough and dyspnea. He visited a local clinic 9 days later. Because the patient presented with decreased percutaneous oxygen saturation (SpO2) and ground-glass opacities in both lungs, he was suspected of having COVID-19 pneumonia. On the same day, he was taken to our hospital by an ambulance, where he was immediately admitted. He had neither a history of close contact with COVID-19-positive patients nor any recent travel history. He was a former smoker (37.5 packs per year).
At the time of admission, the patient had no disorientation, with a body temperature of 37.5℃, blood pressure of 140/78 mmHg, pulse rate of 72 beats per minute (regular), respiratory rate of 24 breaths per minute and SpO2 of 82% on room air. At the time of admission, a marked increase was observed in lactate dehydrogenase and C-reactive protein (CRP), being 628 U/L and 24.99 mg/dL, respectively. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were detected. Surfactant protein D increased to 221 ng/mL (Table 1).
Table 1. Case 1: Laboratory Findings at the Time of Hospital Admission.
TP 6.1 g/dL WBC 8,300 /μL
alb 2.6 g/dL neutro 87.4 %
T-bil 0.5 mg/dL lymph 6.9 %
AST 66 U/L mono 5.4 %
ALT 33 U/L eosino 0.1 %
LDH 628 U/L Hb 16.3 g/dL
γ-GTP 27 U/L Hct 47.5 %
CK 69 U/L Plt 27.9 ×104/μL
BUN 13.8 mg/dL
Cr 0.76 mg/dL PT-INR 1.16
UA 4.2 mg/dL APTT 35.8 sec
Na 136 mEq/L D-dimer 8.8 pg/mL
K 4.8 mEq/L fibrinogen 774 mg/dL
Cl 102 mEq/L
glu 99 mg/dL
CRP 24.99 mg/dL
IgG 846 mg/dL
IgA 157 mg/dL
IgM 36 mg/dL
IgE 92 mg/dL influenza A negative
SPA 92.8 ng/mL B negative
SPD 221 ng/mL
KL-6 370 U/mL
β-D-glucan 12.0 pg/mL
NT-proBNP 125 pg/mL
PCT 0.20 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
At the time of hospital admission, chest radiography showed diffuse ground-glass opacities in both lungs (Fig. 1a), and plain chest computed tomography (CT) showed diffuse ground-glass opacities in nearly all layers of both lungs (Fig. 1b).
Figure 1. Case 1: Imaging findings at the time of hospital admission. (a) Chest radiography shows diffuse ground-glass opacities in both lungs. (b) Chest CT shows diffuse ground-glass opacities in nearly all layers of both lungs.
The patient was found to have progressive acute respiratory failure and started to receive high-flow nasal cannula oxygen therapy [delivery of 50 L of flow; fraction of inspired oxygen (FiO2) of 50%]. Methylprednisolone pulse therapy (administered at 1 g/day for 3 days) was started to treat the progressive acute respiratory failure as empirical treatment for severe pneumonia and acute interstitial pneumonia. Intravenous infusion of meropenem (1 g every 8 hours) and azithromycin (500 mg every 24 hours) was started under suspicion of severe bacterial pneumonia, and continuous intravenous infusion of sivelestat (400 mg/day) was also started to treat acute respiratory distress syndrome (ARDS).
A COVID-19 real-time polymerase chain reaction (RT-PCR) test was performed, and the patient was found to be positive for COVID-19 on Day 3 of hospitalization. With the patient's consent, treatment with favipiravir was started on a compassionate-use basis. On Day 5, further progression of respiratory failure required the patient to be intubated and moved to mechanical ventilation. On the same day, veno-venous (V-V) ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease because mechanical ventilation was considered insufficient to sustain the cardiorespiratory system due to the patient's poor oxygenation even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.0 L/min. From days 3 to 5, platelets decreased from 24.5×104 to 17.8×104/μL, fibrinogen decreased from 426 to 54 mg/dL, and D-dimer increased from 68.1 to 98.2 μg/mL. No bleeding tendency, circulatory failure due to microthrombus, or multiple organ failure was observed. Since the criteria established by the Japanese Association for Acute Medicine for disseminated intravascular coagulation (DIC) were met, we administered recombinant thrombomodulin. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: pressure-controlled ventilation (PCV), FiO2 of 0.35, positive end-expiratory pressure (PEEP) of 9 cmH2O, inspiratory pressure of 7 cmH2O and respiratory frequency of 10 per minute. After introduction of mechanical ventilation and ECMO, the patient's blood pressure decreased. Based on the echocardiographic and electrocardiographic findings, the patient was diagnosed with concurrent takotsubo cardiomyopathy, for which treatment with noradrenaline was started.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received through ECMO was reduced. Therefore, he was weaned from ECMO on Day 12. He was extubated on Day 14. As an adverse event, the patient developed left iliopsoas bleed that required a number of blood transfusions, which resulted in transfusion-associated circulatory overload. The patient was re-intubated and placed on mechanical ventilation on Day 15. His condition improved after fluid management, and he was extubated again on Day 23. The radio-opaque areas in the lung fields became smaller. The flow of supplemental oxygen was decreased to 1 L/min/cannula on Day 33. The patient was discharged on Day 41 (Fig. 2).
Figure 2. Case 1: Clinical course after hospital admission.
Case 2
A 49-year-old Japanese man with bronchial asthma presented with pyrexia, malaise and dyspnea at the middle of April, 2020, and visited a local clinic. Due to his poor response to any symptomatic treatments given, the patient was taken by ambulance to our hospital 3 days later. He had had close contact with his wife, who had contracted COVID-19 pneumonia. He was suspected of also having COVID-19 pneumonia based on chest CT findings and was admitted to the hospital on the same day. He had no smoking history.
At the time of admission, the patient had no disorientation, with a body temperature of 39.9℃, blood pressure of 142/88 mmHg, pulse rate of 126 beats per minute, regular, respiratory rate of 22 breaths per minute and percutaneous oxygen saturation (SpO2) of 97% on room air, and a slight increase in CRP (0.70) was observed. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were noted (Table 2).
Table 2. Case 2: Laboratory Findings at the Time of Hospital Admission.
TP 7.1 g/dL WBC 5,500 /μL
alb 4.1 g/dL neutro 80.6 %
T-bil 0.52 mg/dL lymph 11.2 %
AST 22 U/L mono 8.2 %
ALT 32 U/L eosino 0 %
LDH 190 U/L Hb 16.0 g/dL
γ-GTP 17 U/L Hct 46.2 %
CK 65 U/L Plt 20.2 ×104/μL
BUN 8.8 mg/dL
Cr 0.99 mg/dL PT-INR 1.07
UA 6.4 mg/dL APTT 35.0 sec
Na 139 mEq/L D-dimer 0.4 pg/mL
K 3.4 mEq/L fibrinogen 334 mg/dL
Cl 107 mEq/L
glu 112 mg/dL
CRP 0.70 mg/dL
IgG 1,186 mg/dL influenza A negative
IgA 297 mg/dL B negative
IgM 37 mg/dL
IgE 223 mg/dL Pneumococcal urinary antigen test negative
SPA 16.1 ng/mL
SPD 25.6 ng/mL Legionella urinary antigen test negative
KL-6 165 U/mL
β-D-glucan 5.1 pg/mL
NT-proBNP 16 pg/mL
PCT 0.04 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
Chest radiography at admission showed nodular opacity in the right upper lobe (Fig. 3a), and plain chest CT showed numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side (Fig. 3b).
Figure 3. Case 2: Imaging findings at the time of hospital admission. (a) Chest radiography shows nodular opacity in the right upper lobe. (b) Chest CT shows numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side.
Treatment was started with intravenous infusion of methylprednisolone (80 mg/day) and azithromycin (500 mg every 24 hours) to alleviate inflammation, ceftriaxone (2 g every 24 hours) in consideration of bacterial pneumonia and peramivir (600 mg/day on Day 1 and 300 mg/day from Day 2 onward) as an antiviral agent (Fig. 4). The patient showed positive results of a COVID-19 RT-PCR test on Day 3 of hospitalization when treatment with favipiravir was started. Pyrexia in the patient persisted, and respiratory failure progressed even after the initiation of favipiravir. The dose of methylprednisolone was increased to 250 mg/day from Day 6 onward. On Day 7, continuous intravenous infusion of sivelestat (400 mg/day) was started. Since the platelet count had decreased to 13.9×104/μL and COVID-19 often causes abnormal coagulation, intravenous infusion of recombinant thrombomodulin (32,000 U/day) was also started. The D-dimer level slightly increased to 1.8 μg/mL on Day 10 but improved thereafter.
Figure 4. Case 2: Clinical course after hospital admission.
The further progression of respiratory failure necessitated noninvasive intermittent positive-pressure ventilation on Day 8 and intubation and mechanical ventilation on Day 9. On Day 10, V-V ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease and poor oxygenation, even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.5 L/min. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: PCV, FiO2 of 0.21, PEEP of 8 cmH2O, inspiratory pressure of 8 cmH2O and respiratory frequency of 12 per minute.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received ECMO was reduced. Therefore, he was weaned from ECMO on Day 15. He was extubated on Day 19. No ECMO-associated adverse events were observed. The patient no longer required supplemental oxygen supply on Day 23. The patient was discharged on Day 32 (Fig. 4).
Discussion
Although the majority of cases of COVID-19 result in mild, reversible symptoms, some patients develop dyspnea and hypoxemia within about a week of the onset of the disease. Wang et al. reported that 26.1% of patients hospitalized with COVID-19 pneumonia required treatment in the intensive-care unit (ICU); 61.1% of these patients in the ICU had ARDS, and the mortality rate was approximately 4.3% (9). A total of 60 patients with COVID-19 pneumonia had been admitted to our hospital as of the middle of May, 2020. Eight of these 60 patients required intubation and mechanical ventilation, including the 2 presently reported patients who also required the use of ECMO.
ARDS is characterized by excessive local inflammation in the lung, which can progress to an “out-of-control” state. Excessive production of mediators, such as cytokines (e.g., interleukin-6, tumor necrosis factor alpha, interleukin-8) and arachidonate metabolites (i.e., cytokine storm), interstitial lung edema caused by enhanced pulmonary vascular permeability, and diffuse alveolar damage induce a rapid decrease in oxygenation and the accumulation of carbon dioxide (10). Antiviral treatment and pharmacological and non-pharmacological supportive therapies are considered to serve as important therapeutic strategies for COVID-19 pneumonia patients with ARDS.
It was previously reported that the fulminant activation of coagulation and consumption of clotting factors occur in severe cases of COVID-19. Inflammation of lung tissues and endothelial cells causes microthrombi formation, leading to thrombotic complications, such as deep venous thrombosis, pulmonary embolism and thrombotic arterial complications (11). T tD-dimer and fibrinogen degradation product (FDP) levels were increased in both of the present cases. Furthermore, in Case 1, the patient developed DIC and pulmonary thromboembolism despite the use of anticoagulants.
DIC in patients with COVID-19 has previously been described, and its characteristics include a lack of bleeding risk, mildly low platelet counts and elevated plasma fibrinogen levels, none of which are seen in typical DIC. Therefore, instead of DIC, these data might more closely resemble complement-mediated thrombotic microangiopathy (TMA) syndromes. Importantly, another essential aspect of DIC seen in COVID-19 is the detection of both COVID-19 and complement components in regions of TMA. Mediators of TMA syndromes overlap with those released by cytokine storm, suggesting close connections between ineffective immune responses to COVID-19, severe pneumonia and life-threatening microangiopathy (12). Although the diagnostic criteria for DIC were met in case 1, TMA syndrome might have occurred in both cases (particularly in case 2) because of the lack of typical symptoms of DIC.
For the two cases presented in this report, favipiravir administration was started as an antiviral treatment immediately after the diagnosis of COVID-19. At a meeting of the Japanese Association for Infectious Diseases, we presented an immediate report on cases of COVID-19 pneumonia with progressive respiratory failure, for which favipiravir may have worked promptly and effectively (13). However, rapid progression of respiratory failure was observed in the patients in this report despite the initiation of treatment with favipiravir. This can be interpreted as suggesting that the clinical benefit of treatment with an antiviral agent alone is limited in patients with concurrent ARDS. At present, multiple clinical trials of favipiravir are underway in patients with mild to severe COVID-19 pneumonia. Future data from these trials may provide new insights into the drug's clinical benefits.
As a pharmacological supportive therapy, we administered methylprednisolone (an anti-inflammatory agent for inhibiting cytokine storm), sivelestat (a neutrophil elastase inhibitor) and macrolide antibiotics with an immunoregulatory function (14) effective for suppressing hyperimmunization and excessive inflammation. The World Health Organization (WHO) has advised against the use of corticosteroids to treat COVID-19. The interim WHO guidance on the management of patients with severe acute respiratory infection caused by COVID-19 presents negative views on the use of steroids in the treatment of this patient population (“routine use of steroids should be avoided unless the patient has symptoms including bronchial asthma, aggravated chronic obstructive pulmonary disease, and septic shock”) based on data from studies of steroid therapy in patients with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) or influenza (15). However, a study by the RECOVERY Collaborative Group showed that the use of dexamethasone in hospitalized COVID-19 patients resulted in a lower 28-day mortality than in those who were solely receiving either invasive mechanical ventilation or oxygen (6). In addition, Wu et al. performed a retrospective cohort study in patients with COVID-19 pneumonia and reported that the mortality in a cohort using methylprednisolone was lower than that in a cohort not using methylprednisolone, although the number of severe cases included in the former cohort was larger than that in the latter cohort (7). In our hospital, we have actively used steroids in patients with hypoxemia and achieved good outcomes. Based on these experiences, we are considering participating in a clinical study conducted to evaluate the efficacy of steroids in patients with COVID-19 pneumonia to verify the clinical effects of steroids in this patient population. Regarding macrolides, some researchers have reported that macrolide therapy was effective for reducing mortality in patients with ARDS (16). Although the mechanism underlying this reduction in mortality has not been fully elucidated, macrolides are likely to have effects on cytokine production and the neutrophil function (16).
As non-pharmacological supportive therapy, intubation, mechanical ventilation and ECMO were employed. ECMO is a life-supporting method used in patients with severe respiratory or cardiac failure (used particularly as a resuscitative measure taken for patients in cardiopulmonary arrest), called “respiratory ECMO” and “cardiac ECMO”, respectively. Respiratory ECMO is indicated for patients with reversible acute respiratory failure. Its use is considered for patients for whom conventional mechanical ventilation is insufficient for sustaining life or in whom continuous use of the mechanical ventilation system can result in irreversible damage to the lung. Respiratory ECMO is regarded as a treatment of ARDS (17). In the treatment of novel influenza A (H1N1) 2009, the results of ECMO database-based cohort studies (18,19) and the study on conventional ventilatory support vs. ECMO for severe adult respiratory failure (CESAR study) (20) demonstrated the efficacy of ECMO therapy based on the finding that the mortality in patients using ECMO was significantly lower than that in patients not using ECMO. In a retrospective study in MERS patients with refractory respiratory failure in 2018, the use of ECMO was required as an emergency treatment. The mortality in MERS patients with refractory hypoxemia in the ECMO cohort was significantly lower than that in the non-ECMO cohort (65% vs. 100%; p = 0.02) (21). Although little evidence for the efficacy of ECMO has been obtained with respect to COVID-19 pneumonia, results from two retrospective studies have been reported. In a retrospective study by Yang et al., of 52 patients admitted to the ICU with severe COVID-19 pneumonia, 32 died within 28 days of admission. ECMO was introduced to 6 patients, of whom 5 died, while the other was still on ECMO at the time of the endpoint assessment (22). In a retrospective study by Zhang et al., 48 of 221 patients with COVID-19 pneumonia had concurrent ARDS, and 10 of these 48 patients required mechanical ventilation and ECMO therapy. Of these 10 patients, 2 were successfully treated and discharged from the hospital, and 3 died. The other five patients were still on ECMO at the time of the endpoint assessment (23). According to the interim WHO guidance, ECMO, despite little evidence for its efficacy, is regarded as an emergency treatment of COVID-19 patients who have concurrent refractory hypoxemia even after being treated with lung-protective ventilation strategy (15). The condition of the two patients in the present case report was improved by intubation, mechanical ventilation and the prompt introduction of ECMO. COVID-19 pneumonia with ARDS is associated with high mortality. Pulmonary protection initiated before obtaining clinical benefits of antiviral treatment and pharmacological supportive therapy is considered to contribute to a reduction in mortality. Concerning complications, iliopsoas hematoma was identified in Case 1. In general, hemorrhagic complications, such as cannulation site bleeding, occur in approximately 50% of patients undergoing ECMO (17). ECMO-associated bleeding, which is attributed to the effect of heparinization as well as circuit-related consumption of coagulation factors, can be severe. It may be difficult to arrest bleeding if no measures other than monitoring the patient are taken. In Case 1, although the patient required blood transfusion, bleeding was arrested during the observation of the patient's condition. Infection is another critical complication said to occur in approximately 20% of patients on ECMO (17). However, the two patients in this report were able to safely receive ECMO therapy with no ECMO-related infectious complications.
Our two patients were already suffering from severe respiratory failure at the time of the diagnosis of COVID-19. They were successfully treated by a combination of antiviral treatment with favipiravir, corticosteroid, mechanical ventilation and ECMO. The positive outcomes of these cases underscore the importance of promptly treating severe COVID-19 pneumonia after the diagnosis with non-pharmacological supportive therapy, such as mechanical ventilation and ECMO, in combination with pharmacological supportive therapy, notably favipiravir for antiviral treatment and corticosteroid for anti-inflammatory treatment.
The authors state that they have no Conflict of Interest (COI). | UNKNOWN | DrugDosageText | CC BY-NC-ND | 33390469 | 18,811,755 | 2021 |
What was the outcome of reaction 'Haematoma muscle'? | Two Cases of Severe COVID-19 Pneumonia Effectively Treated with Extracorporeal Membrane Oxygenation in Addition to Favipiravir and Corticosteroid.
Case 1: A 65-year-old man with novel coronavirus infection (COVID-19) complicated with acute respiratory failure. On admission, the patient was started on favipiravir and corticosteroid. However, due to a lack of significant improvement, he was introduced to mechanical ventilation and extracorporeal membrane oxygenation (ECMO). Although iliopsoas hematoma occurred as a complication, the patient recovered. Case 2: A 49-year-old man with COVID-19 had been started on favipiravir and corticosteroid. Due to progressive respiratory failure, the patient underwent mechanical ventilation and ECMO. The patient recovered without complications. We successfully treated these severe cases with a multimodal combination of pharmacological and non-pharmacological supportive therapy.
Introduction
Coronavirus disease 2019 (COVID-19) was first identified in December 2019 in Wuhan, China, and has since rapidly spread globally. At present, there are few established treatments for COVID-19 with confirmed efficacy, resulting in numerous deaths.
Globally, as of August 1, 2020, 17,396,943 confirmed cases and 675,060 deaths related to COVID-19 have been reported to WHO, and the mortality rate is 3.9% (1). The overall hospital mortality rate from COVID-19 is approximately 15% to 20%, increasing to 40% among patients requiring ICU admission. By age, the hospital mortality rate is 35% for patients 70 to 79 years old and 60% for patients 80 to 89 years old (2). The mortality in COVID-19 patients who develope severe respiratory compromise and require mechanical ventilation is high.
Favipiravir obtained manufacturing and marketing approval in March 2014 for “new or re-emerging influenza virus infections (provided that other anti-influenza virus drugs were ineffective)”. With regard to the mechanism of action of this drug, favipiravir taken up into cells is metabolized and converted by intracellular enzymes to become favipiravir ribofuranosyl triphosphate, which selectively inhibits viral RNA-dependent RNA polymerase. Therefore, this agent may also be effective against RNA viruses other than influenza virus, and indeed, nonclinical studies have reported its efficacy against several RNA viruses, including Ebola virus (3), Arenaviridae and Bunyaviridae (4). In an open-label, controlled trial in China, the time to viral clearance of mild to moderate COVID-19 treated with favipiravir and interferon alfa was significantly shorter than that of lobinavir ritonavir and interferon alfa (5).
There have been several reports of the efficacy of administering corticosteroids for COVID-19 patients, although opinions on this approach were initially negative (6,7). Corticosteroids are a viable therapeutic strategy for modulating the inflammatory response in patients with COVID-19.
The high mortality rate in severe cases is important, given the potential access to extracorporeal membrane oxygenation of venous blood, which may serve as a life-saving emergency treatment. Although the efficacy of ECMO in COVID-19 is controversial, ECMO is a proposed as a treatment option in the interim guidance document published by the WHO and interim guidance for clinical management of COVID-19 patients provided by the United States Centers for Disease Control (8).
We herein report two cases of COVID-19 in which the early introduction of ECMO was extremely effective for managing patients whose pneumonia was aggravated even under the use of favipiravir and corticosteroid.
Case Reports
Case 1
A 65-year-old Japanese man with no significant medical history developed malaise at the end of March, 2020, and eventually developed pyrexia, cough and dyspnea. He visited a local clinic 9 days later. Because the patient presented with decreased percutaneous oxygen saturation (SpO2) and ground-glass opacities in both lungs, he was suspected of having COVID-19 pneumonia. On the same day, he was taken to our hospital by an ambulance, where he was immediately admitted. He had neither a history of close contact with COVID-19-positive patients nor any recent travel history. He was a former smoker (37.5 packs per year).
At the time of admission, the patient had no disorientation, with a body temperature of 37.5℃, blood pressure of 140/78 mmHg, pulse rate of 72 beats per minute (regular), respiratory rate of 24 breaths per minute and SpO2 of 82% on room air. At the time of admission, a marked increase was observed in lactate dehydrogenase and C-reactive protein (CRP), being 628 U/L and 24.99 mg/dL, respectively. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were detected. Surfactant protein D increased to 221 ng/mL (Table 1).
Table 1. Case 1: Laboratory Findings at the Time of Hospital Admission.
TP 6.1 g/dL WBC 8,300 /μL
alb 2.6 g/dL neutro 87.4 %
T-bil 0.5 mg/dL lymph 6.9 %
AST 66 U/L mono 5.4 %
ALT 33 U/L eosino 0.1 %
LDH 628 U/L Hb 16.3 g/dL
γ-GTP 27 U/L Hct 47.5 %
CK 69 U/L Plt 27.9 ×104/μL
BUN 13.8 mg/dL
Cr 0.76 mg/dL PT-INR 1.16
UA 4.2 mg/dL APTT 35.8 sec
Na 136 mEq/L D-dimer 8.8 pg/mL
K 4.8 mEq/L fibrinogen 774 mg/dL
Cl 102 mEq/L
glu 99 mg/dL
CRP 24.99 mg/dL
IgG 846 mg/dL
IgA 157 mg/dL
IgM 36 mg/dL
IgE 92 mg/dL influenza A negative
SPA 92.8 ng/mL B negative
SPD 221 ng/mL
KL-6 370 U/mL
β-D-glucan 12.0 pg/mL
NT-proBNP 125 pg/mL
PCT 0.20 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
At the time of hospital admission, chest radiography showed diffuse ground-glass opacities in both lungs (Fig. 1a), and plain chest computed tomography (CT) showed diffuse ground-glass opacities in nearly all layers of both lungs (Fig. 1b).
Figure 1. Case 1: Imaging findings at the time of hospital admission. (a) Chest radiography shows diffuse ground-glass opacities in both lungs. (b) Chest CT shows diffuse ground-glass opacities in nearly all layers of both lungs.
The patient was found to have progressive acute respiratory failure and started to receive high-flow nasal cannula oxygen therapy [delivery of 50 L of flow; fraction of inspired oxygen (FiO2) of 50%]. Methylprednisolone pulse therapy (administered at 1 g/day for 3 days) was started to treat the progressive acute respiratory failure as empirical treatment for severe pneumonia and acute interstitial pneumonia. Intravenous infusion of meropenem (1 g every 8 hours) and azithromycin (500 mg every 24 hours) was started under suspicion of severe bacterial pneumonia, and continuous intravenous infusion of sivelestat (400 mg/day) was also started to treat acute respiratory distress syndrome (ARDS).
A COVID-19 real-time polymerase chain reaction (RT-PCR) test was performed, and the patient was found to be positive for COVID-19 on Day 3 of hospitalization. With the patient's consent, treatment with favipiravir was started on a compassionate-use basis. On Day 5, further progression of respiratory failure required the patient to be intubated and moved to mechanical ventilation. On the same day, veno-venous (V-V) ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease because mechanical ventilation was considered insufficient to sustain the cardiorespiratory system due to the patient's poor oxygenation even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.0 L/min. From days 3 to 5, platelets decreased from 24.5×104 to 17.8×104/μL, fibrinogen decreased from 426 to 54 mg/dL, and D-dimer increased from 68.1 to 98.2 μg/mL. No bleeding tendency, circulatory failure due to microthrombus, or multiple organ failure was observed. Since the criteria established by the Japanese Association for Acute Medicine for disseminated intravascular coagulation (DIC) were met, we administered recombinant thrombomodulin. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: pressure-controlled ventilation (PCV), FiO2 of 0.35, positive end-expiratory pressure (PEEP) of 9 cmH2O, inspiratory pressure of 7 cmH2O and respiratory frequency of 10 per minute. After introduction of mechanical ventilation and ECMO, the patient's blood pressure decreased. Based on the echocardiographic and electrocardiographic findings, the patient was diagnosed with concurrent takotsubo cardiomyopathy, for which treatment with noradrenaline was started.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received through ECMO was reduced. Therefore, he was weaned from ECMO on Day 12. He was extubated on Day 14. As an adverse event, the patient developed left iliopsoas bleed that required a number of blood transfusions, which resulted in transfusion-associated circulatory overload. The patient was re-intubated and placed on mechanical ventilation on Day 15. His condition improved after fluid management, and he was extubated again on Day 23. The radio-opaque areas in the lung fields became smaller. The flow of supplemental oxygen was decreased to 1 L/min/cannula on Day 33. The patient was discharged on Day 41 (Fig. 2).
Figure 2. Case 1: Clinical course after hospital admission.
Case 2
A 49-year-old Japanese man with bronchial asthma presented with pyrexia, malaise and dyspnea at the middle of April, 2020, and visited a local clinic. Due to his poor response to any symptomatic treatments given, the patient was taken by ambulance to our hospital 3 days later. He had had close contact with his wife, who had contracted COVID-19 pneumonia. He was suspected of also having COVID-19 pneumonia based on chest CT findings and was admitted to the hospital on the same day. He had no smoking history.
At the time of admission, the patient had no disorientation, with a body temperature of 39.9℃, blood pressure of 142/88 mmHg, pulse rate of 126 beats per minute, regular, respiratory rate of 22 breaths per minute and percutaneous oxygen saturation (SpO2) of 97% on room air, and a slight increase in CRP (0.70) was observed. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were noted (Table 2).
Table 2. Case 2: Laboratory Findings at the Time of Hospital Admission.
TP 7.1 g/dL WBC 5,500 /μL
alb 4.1 g/dL neutro 80.6 %
T-bil 0.52 mg/dL lymph 11.2 %
AST 22 U/L mono 8.2 %
ALT 32 U/L eosino 0 %
LDH 190 U/L Hb 16.0 g/dL
γ-GTP 17 U/L Hct 46.2 %
CK 65 U/L Plt 20.2 ×104/μL
BUN 8.8 mg/dL
Cr 0.99 mg/dL PT-INR 1.07
UA 6.4 mg/dL APTT 35.0 sec
Na 139 mEq/L D-dimer 0.4 pg/mL
K 3.4 mEq/L fibrinogen 334 mg/dL
Cl 107 mEq/L
glu 112 mg/dL
CRP 0.70 mg/dL
IgG 1,186 mg/dL influenza A negative
IgA 297 mg/dL B negative
IgM 37 mg/dL
IgE 223 mg/dL Pneumococcal urinary antigen test negative
SPA 16.1 ng/mL
SPD 25.6 ng/mL Legionella urinary antigen test negative
KL-6 165 U/mL
β-D-glucan 5.1 pg/mL
NT-proBNP 16 pg/mL
PCT 0.04 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
Chest radiography at admission showed nodular opacity in the right upper lobe (Fig. 3a), and plain chest CT showed numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side (Fig. 3b).
Figure 3. Case 2: Imaging findings at the time of hospital admission. (a) Chest radiography shows nodular opacity in the right upper lobe. (b) Chest CT shows numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side.
Treatment was started with intravenous infusion of methylprednisolone (80 mg/day) and azithromycin (500 mg every 24 hours) to alleviate inflammation, ceftriaxone (2 g every 24 hours) in consideration of bacterial pneumonia and peramivir (600 mg/day on Day 1 and 300 mg/day from Day 2 onward) as an antiviral agent (Fig. 4). The patient showed positive results of a COVID-19 RT-PCR test on Day 3 of hospitalization when treatment with favipiravir was started. Pyrexia in the patient persisted, and respiratory failure progressed even after the initiation of favipiravir. The dose of methylprednisolone was increased to 250 mg/day from Day 6 onward. On Day 7, continuous intravenous infusion of sivelestat (400 mg/day) was started. Since the platelet count had decreased to 13.9×104/μL and COVID-19 often causes abnormal coagulation, intravenous infusion of recombinant thrombomodulin (32,000 U/day) was also started. The D-dimer level slightly increased to 1.8 μg/mL on Day 10 but improved thereafter.
Figure 4. Case 2: Clinical course after hospital admission.
The further progression of respiratory failure necessitated noninvasive intermittent positive-pressure ventilation on Day 8 and intubation and mechanical ventilation on Day 9. On Day 10, V-V ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease and poor oxygenation, even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.5 L/min. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: PCV, FiO2 of 0.21, PEEP of 8 cmH2O, inspiratory pressure of 8 cmH2O and respiratory frequency of 12 per minute.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received ECMO was reduced. Therefore, he was weaned from ECMO on Day 15. He was extubated on Day 19. No ECMO-associated adverse events were observed. The patient no longer required supplemental oxygen supply on Day 23. The patient was discharged on Day 32 (Fig. 4).
Discussion
Although the majority of cases of COVID-19 result in mild, reversible symptoms, some patients develop dyspnea and hypoxemia within about a week of the onset of the disease. Wang et al. reported that 26.1% of patients hospitalized with COVID-19 pneumonia required treatment in the intensive-care unit (ICU); 61.1% of these patients in the ICU had ARDS, and the mortality rate was approximately 4.3% (9). A total of 60 patients with COVID-19 pneumonia had been admitted to our hospital as of the middle of May, 2020. Eight of these 60 patients required intubation and mechanical ventilation, including the 2 presently reported patients who also required the use of ECMO.
ARDS is characterized by excessive local inflammation in the lung, which can progress to an “out-of-control” state. Excessive production of mediators, such as cytokines (e.g., interleukin-6, tumor necrosis factor alpha, interleukin-8) and arachidonate metabolites (i.e., cytokine storm), interstitial lung edema caused by enhanced pulmonary vascular permeability, and diffuse alveolar damage induce a rapid decrease in oxygenation and the accumulation of carbon dioxide (10). Antiviral treatment and pharmacological and non-pharmacological supportive therapies are considered to serve as important therapeutic strategies for COVID-19 pneumonia patients with ARDS.
It was previously reported that the fulminant activation of coagulation and consumption of clotting factors occur in severe cases of COVID-19. Inflammation of lung tissues and endothelial cells causes microthrombi formation, leading to thrombotic complications, such as deep venous thrombosis, pulmonary embolism and thrombotic arterial complications (11). T tD-dimer and fibrinogen degradation product (FDP) levels were increased in both of the present cases. Furthermore, in Case 1, the patient developed DIC and pulmonary thromboembolism despite the use of anticoagulants.
DIC in patients with COVID-19 has previously been described, and its characteristics include a lack of bleeding risk, mildly low platelet counts and elevated plasma fibrinogen levels, none of which are seen in typical DIC. Therefore, instead of DIC, these data might more closely resemble complement-mediated thrombotic microangiopathy (TMA) syndromes. Importantly, another essential aspect of DIC seen in COVID-19 is the detection of both COVID-19 and complement components in regions of TMA. Mediators of TMA syndromes overlap with those released by cytokine storm, suggesting close connections between ineffective immune responses to COVID-19, severe pneumonia and life-threatening microangiopathy (12). Although the diagnostic criteria for DIC were met in case 1, TMA syndrome might have occurred in both cases (particularly in case 2) because of the lack of typical symptoms of DIC.
For the two cases presented in this report, favipiravir administration was started as an antiviral treatment immediately after the diagnosis of COVID-19. At a meeting of the Japanese Association for Infectious Diseases, we presented an immediate report on cases of COVID-19 pneumonia with progressive respiratory failure, for which favipiravir may have worked promptly and effectively (13). However, rapid progression of respiratory failure was observed in the patients in this report despite the initiation of treatment with favipiravir. This can be interpreted as suggesting that the clinical benefit of treatment with an antiviral agent alone is limited in patients with concurrent ARDS. At present, multiple clinical trials of favipiravir are underway in patients with mild to severe COVID-19 pneumonia. Future data from these trials may provide new insights into the drug's clinical benefits.
As a pharmacological supportive therapy, we administered methylprednisolone (an anti-inflammatory agent for inhibiting cytokine storm), sivelestat (a neutrophil elastase inhibitor) and macrolide antibiotics with an immunoregulatory function (14) effective for suppressing hyperimmunization and excessive inflammation. The World Health Organization (WHO) has advised against the use of corticosteroids to treat COVID-19. The interim WHO guidance on the management of patients with severe acute respiratory infection caused by COVID-19 presents negative views on the use of steroids in the treatment of this patient population (“routine use of steroids should be avoided unless the patient has symptoms including bronchial asthma, aggravated chronic obstructive pulmonary disease, and septic shock”) based on data from studies of steroid therapy in patients with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) or influenza (15). However, a study by the RECOVERY Collaborative Group showed that the use of dexamethasone in hospitalized COVID-19 patients resulted in a lower 28-day mortality than in those who were solely receiving either invasive mechanical ventilation or oxygen (6). In addition, Wu et al. performed a retrospective cohort study in patients with COVID-19 pneumonia and reported that the mortality in a cohort using methylprednisolone was lower than that in a cohort not using methylprednisolone, although the number of severe cases included in the former cohort was larger than that in the latter cohort (7). In our hospital, we have actively used steroids in patients with hypoxemia and achieved good outcomes. Based on these experiences, we are considering participating in a clinical study conducted to evaluate the efficacy of steroids in patients with COVID-19 pneumonia to verify the clinical effects of steroids in this patient population. Regarding macrolides, some researchers have reported that macrolide therapy was effective for reducing mortality in patients with ARDS (16). Although the mechanism underlying this reduction in mortality has not been fully elucidated, macrolides are likely to have effects on cytokine production and the neutrophil function (16).
As non-pharmacological supportive therapy, intubation, mechanical ventilation and ECMO were employed. ECMO is a life-supporting method used in patients with severe respiratory or cardiac failure (used particularly as a resuscitative measure taken for patients in cardiopulmonary arrest), called “respiratory ECMO” and “cardiac ECMO”, respectively. Respiratory ECMO is indicated for patients with reversible acute respiratory failure. Its use is considered for patients for whom conventional mechanical ventilation is insufficient for sustaining life or in whom continuous use of the mechanical ventilation system can result in irreversible damage to the lung. Respiratory ECMO is regarded as a treatment of ARDS (17). In the treatment of novel influenza A (H1N1) 2009, the results of ECMO database-based cohort studies (18,19) and the study on conventional ventilatory support vs. ECMO for severe adult respiratory failure (CESAR study) (20) demonstrated the efficacy of ECMO therapy based on the finding that the mortality in patients using ECMO was significantly lower than that in patients not using ECMO. In a retrospective study in MERS patients with refractory respiratory failure in 2018, the use of ECMO was required as an emergency treatment. The mortality in MERS patients with refractory hypoxemia in the ECMO cohort was significantly lower than that in the non-ECMO cohort (65% vs. 100%; p = 0.02) (21). Although little evidence for the efficacy of ECMO has been obtained with respect to COVID-19 pneumonia, results from two retrospective studies have been reported. In a retrospective study by Yang et al., of 52 patients admitted to the ICU with severe COVID-19 pneumonia, 32 died within 28 days of admission. ECMO was introduced to 6 patients, of whom 5 died, while the other was still on ECMO at the time of the endpoint assessment (22). In a retrospective study by Zhang et al., 48 of 221 patients with COVID-19 pneumonia had concurrent ARDS, and 10 of these 48 patients required mechanical ventilation and ECMO therapy. Of these 10 patients, 2 were successfully treated and discharged from the hospital, and 3 died. The other five patients were still on ECMO at the time of the endpoint assessment (23). According to the interim WHO guidance, ECMO, despite little evidence for its efficacy, is regarded as an emergency treatment of COVID-19 patients who have concurrent refractory hypoxemia even after being treated with lung-protective ventilation strategy (15). The condition of the two patients in the present case report was improved by intubation, mechanical ventilation and the prompt introduction of ECMO. COVID-19 pneumonia with ARDS is associated with high mortality. Pulmonary protection initiated before obtaining clinical benefits of antiviral treatment and pharmacological supportive therapy is considered to contribute to a reduction in mortality. Concerning complications, iliopsoas hematoma was identified in Case 1. In general, hemorrhagic complications, such as cannulation site bleeding, occur in approximately 50% of patients undergoing ECMO (17). ECMO-associated bleeding, which is attributed to the effect of heparinization as well as circuit-related consumption of coagulation factors, can be severe. It may be difficult to arrest bleeding if no measures other than monitoring the patient are taken. In Case 1, although the patient required blood transfusion, bleeding was arrested during the observation of the patient's condition. Infection is another critical complication said to occur in approximately 20% of patients on ECMO (17). However, the two patients in this report were able to safely receive ECMO therapy with no ECMO-related infectious complications.
Our two patients were already suffering from severe respiratory failure at the time of the diagnosis of COVID-19. They were successfully treated by a combination of antiviral treatment with favipiravir, corticosteroid, mechanical ventilation and ECMO. The positive outcomes of these cases underscore the importance of promptly treating severe COVID-19 pneumonia after the diagnosis with non-pharmacological supportive therapy, such as mechanical ventilation and ECMO, in combination with pharmacological supportive therapy, notably favipiravir for antiviral treatment and corticosteroid for anti-inflammatory treatment.
The authors state that they have no Conflict of Interest (COI). | Recovered | ReactionOutcome | CC BY-NC-ND | 33390469 | 18,811,755 | 2021 |
What was the outcome of reaction 'Transfusion-related circulatory overload'? | Two Cases of Severe COVID-19 Pneumonia Effectively Treated with Extracorporeal Membrane Oxygenation in Addition to Favipiravir and Corticosteroid.
Case 1: A 65-year-old man with novel coronavirus infection (COVID-19) complicated with acute respiratory failure. On admission, the patient was started on favipiravir and corticosteroid. However, due to a lack of significant improvement, he was introduced to mechanical ventilation and extracorporeal membrane oxygenation (ECMO). Although iliopsoas hematoma occurred as a complication, the patient recovered. Case 2: A 49-year-old man with COVID-19 had been started on favipiravir and corticosteroid. Due to progressive respiratory failure, the patient underwent mechanical ventilation and ECMO. The patient recovered without complications. We successfully treated these severe cases with a multimodal combination of pharmacological and non-pharmacological supportive therapy.
Introduction
Coronavirus disease 2019 (COVID-19) was first identified in December 2019 in Wuhan, China, and has since rapidly spread globally. At present, there are few established treatments for COVID-19 with confirmed efficacy, resulting in numerous deaths.
Globally, as of August 1, 2020, 17,396,943 confirmed cases and 675,060 deaths related to COVID-19 have been reported to WHO, and the mortality rate is 3.9% (1). The overall hospital mortality rate from COVID-19 is approximately 15% to 20%, increasing to 40% among patients requiring ICU admission. By age, the hospital mortality rate is 35% for patients 70 to 79 years old and 60% for patients 80 to 89 years old (2). The mortality in COVID-19 patients who develope severe respiratory compromise and require mechanical ventilation is high.
Favipiravir obtained manufacturing and marketing approval in March 2014 for “new or re-emerging influenza virus infections (provided that other anti-influenza virus drugs were ineffective)”. With regard to the mechanism of action of this drug, favipiravir taken up into cells is metabolized and converted by intracellular enzymes to become favipiravir ribofuranosyl triphosphate, which selectively inhibits viral RNA-dependent RNA polymerase. Therefore, this agent may also be effective against RNA viruses other than influenza virus, and indeed, nonclinical studies have reported its efficacy against several RNA viruses, including Ebola virus (3), Arenaviridae and Bunyaviridae (4). In an open-label, controlled trial in China, the time to viral clearance of mild to moderate COVID-19 treated with favipiravir and interferon alfa was significantly shorter than that of lobinavir ritonavir and interferon alfa (5).
There have been several reports of the efficacy of administering corticosteroids for COVID-19 patients, although opinions on this approach were initially negative (6,7). Corticosteroids are a viable therapeutic strategy for modulating the inflammatory response in patients with COVID-19.
The high mortality rate in severe cases is important, given the potential access to extracorporeal membrane oxygenation of venous blood, which may serve as a life-saving emergency treatment. Although the efficacy of ECMO in COVID-19 is controversial, ECMO is a proposed as a treatment option in the interim guidance document published by the WHO and interim guidance for clinical management of COVID-19 patients provided by the United States Centers for Disease Control (8).
We herein report two cases of COVID-19 in which the early introduction of ECMO was extremely effective for managing patients whose pneumonia was aggravated even under the use of favipiravir and corticosteroid.
Case Reports
Case 1
A 65-year-old Japanese man with no significant medical history developed malaise at the end of March, 2020, and eventually developed pyrexia, cough and dyspnea. He visited a local clinic 9 days later. Because the patient presented with decreased percutaneous oxygen saturation (SpO2) and ground-glass opacities in both lungs, he was suspected of having COVID-19 pneumonia. On the same day, he was taken to our hospital by an ambulance, where he was immediately admitted. He had neither a history of close contact with COVID-19-positive patients nor any recent travel history. He was a former smoker (37.5 packs per year).
At the time of admission, the patient had no disorientation, with a body temperature of 37.5℃, blood pressure of 140/78 mmHg, pulse rate of 72 beats per minute (regular), respiratory rate of 24 breaths per minute and SpO2 of 82% on room air. At the time of admission, a marked increase was observed in lactate dehydrogenase and C-reactive protein (CRP), being 628 U/L and 24.99 mg/dL, respectively. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were detected. Surfactant protein D increased to 221 ng/mL (Table 1).
Table 1. Case 1: Laboratory Findings at the Time of Hospital Admission.
TP 6.1 g/dL WBC 8,300 /μL
alb 2.6 g/dL neutro 87.4 %
T-bil 0.5 mg/dL lymph 6.9 %
AST 66 U/L mono 5.4 %
ALT 33 U/L eosino 0.1 %
LDH 628 U/L Hb 16.3 g/dL
γ-GTP 27 U/L Hct 47.5 %
CK 69 U/L Plt 27.9 ×104/μL
BUN 13.8 mg/dL
Cr 0.76 mg/dL PT-INR 1.16
UA 4.2 mg/dL APTT 35.8 sec
Na 136 mEq/L D-dimer 8.8 pg/mL
K 4.8 mEq/L fibrinogen 774 mg/dL
Cl 102 mEq/L
glu 99 mg/dL
CRP 24.99 mg/dL
IgG 846 mg/dL
IgA 157 mg/dL
IgM 36 mg/dL
IgE 92 mg/dL influenza A negative
SPA 92.8 ng/mL B negative
SPD 221 ng/mL
KL-6 370 U/mL
β-D-glucan 12.0 pg/mL
NT-proBNP 125 pg/mL
PCT 0.20 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
At the time of hospital admission, chest radiography showed diffuse ground-glass opacities in both lungs (Fig. 1a), and plain chest computed tomography (CT) showed diffuse ground-glass opacities in nearly all layers of both lungs (Fig. 1b).
Figure 1. Case 1: Imaging findings at the time of hospital admission. (a) Chest radiography shows diffuse ground-glass opacities in both lungs. (b) Chest CT shows diffuse ground-glass opacities in nearly all layers of both lungs.
The patient was found to have progressive acute respiratory failure and started to receive high-flow nasal cannula oxygen therapy [delivery of 50 L of flow; fraction of inspired oxygen (FiO2) of 50%]. Methylprednisolone pulse therapy (administered at 1 g/day for 3 days) was started to treat the progressive acute respiratory failure as empirical treatment for severe pneumonia and acute interstitial pneumonia. Intravenous infusion of meropenem (1 g every 8 hours) and azithromycin (500 mg every 24 hours) was started under suspicion of severe bacterial pneumonia, and continuous intravenous infusion of sivelestat (400 mg/day) was also started to treat acute respiratory distress syndrome (ARDS).
A COVID-19 real-time polymerase chain reaction (RT-PCR) test was performed, and the patient was found to be positive for COVID-19 on Day 3 of hospitalization. With the patient's consent, treatment with favipiravir was started on a compassionate-use basis. On Day 5, further progression of respiratory failure required the patient to be intubated and moved to mechanical ventilation. On the same day, veno-venous (V-V) ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease because mechanical ventilation was considered insufficient to sustain the cardiorespiratory system due to the patient's poor oxygenation even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.0 L/min. From days 3 to 5, platelets decreased from 24.5×104 to 17.8×104/μL, fibrinogen decreased from 426 to 54 mg/dL, and D-dimer increased from 68.1 to 98.2 μg/mL. No bleeding tendency, circulatory failure due to microthrombus, or multiple organ failure was observed. Since the criteria established by the Japanese Association for Acute Medicine for disseminated intravascular coagulation (DIC) were met, we administered recombinant thrombomodulin. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: pressure-controlled ventilation (PCV), FiO2 of 0.35, positive end-expiratory pressure (PEEP) of 9 cmH2O, inspiratory pressure of 7 cmH2O and respiratory frequency of 10 per minute. After introduction of mechanical ventilation and ECMO, the patient's blood pressure decreased. Based on the echocardiographic and electrocardiographic findings, the patient was diagnosed with concurrent takotsubo cardiomyopathy, for which treatment with noradrenaline was started.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received through ECMO was reduced. Therefore, he was weaned from ECMO on Day 12. He was extubated on Day 14. As an adverse event, the patient developed left iliopsoas bleed that required a number of blood transfusions, which resulted in transfusion-associated circulatory overload. The patient was re-intubated and placed on mechanical ventilation on Day 15. His condition improved after fluid management, and he was extubated again on Day 23. The radio-opaque areas in the lung fields became smaller. The flow of supplemental oxygen was decreased to 1 L/min/cannula on Day 33. The patient was discharged on Day 41 (Fig. 2).
Figure 2. Case 1: Clinical course after hospital admission.
Case 2
A 49-year-old Japanese man with bronchial asthma presented with pyrexia, malaise and dyspnea at the middle of April, 2020, and visited a local clinic. Due to his poor response to any symptomatic treatments given, the patient was taken by ambulance to our hospital 3 days later. He had had close contact with his wife, who had contracted COVID-19 pneumonia. He was suspected of also having COVID-19 pneumonia based on chest CT findings and was admitted to the hospital on the same day. He had no smoking history.
At the time of admission, the patient had no disorientation, with a body temperature of 39.9℃, blood pressure of 142/88 mmHg, pulse rate of 126 beats per minute, regular, respiratory rate of 22 breaths per minute and percutaneous oxygen saturation (SpO2) of 97% on room air, and a slight increase in CRP (0.70) was observed. Although no increase was found in white blood cell count, an increased neutrophil fraction and decreased lymphocyte fraction were noted (Table 2).
Table 2. Case 2: Laboratory Findings at the Time of Hospital Admission.
TP 7.1 g/dL WBC 5,500 /μL
alb 4.1 g/dL neutro 80.6 %
T-bil 0.52 mg/dL lymph 11.2 %
AST 22 U/L mono 8.2 %
ALT 32 U/L eosino 0 %
LDH 190 U/L Hb 16.0 g/dL
γ-GTP 17 U/L Hct 46.2 %
CK 65 U/L Plt 20.2 ×104/μL
BUN 8.8 mg/dL
Cr 0.99 mg/dL PT-INR 1.07
UA 6.4 mg/dL APTT 35.0 sec
Na 139 mEq/L D-dimer 0.4 pg/mL
K 3.4 mEq/L fibrinogen 334 mg/dL
Cl 107 mEq/L
glu 112 mg/dL
CRP 0.70 mg/dL
IgG 1,186 mg/dL influenza A negative
IgA 297 mg/dL B negative
IgM 37 mg/dL
IgE 223 mg/dL Pneumococcal urinary antigen test negative
SPA 16.1 ng/mL
SPD 25.6 ng/mL Legionella urinary antigen test negative
KL-6 165 U/mL
β-D-glucan 5.1 pg/mL
NT-proBNP 16 pg/mL
PCT 0.04 ng/mL
TP: thyroid peroxidase, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, γ-GTP: γ-glutamyl transpeptidase, CK: creatine kinase, BUN; blood urea nitrogen, Cr: creatinine, CRP: C-reactive protein, IgG: immunoglobulinG, IgA: immunoglobulin A, IgM: immunoglobulin M, IgE: immunoglobulin E, SPA: surfactant protein A, SPD: surfactant protein D, KL-6: Krebs von den Lungen, NT-proBNP: N-terminal pro-brain natriuretic peptide, PCT: procalcitonin, WBC: white blood cells, Hb: hemoglobin, Hct: hematocrit, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time
Chest radiography at admission showed nodular opacity in the right upper lobe (Fig. 3a), and plain chest CT showed numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side (Fig. 3b).
Figure 3. Case 2: Imaging findings at the time of hospital admission. (a) Chest radiography shows nodular opacity in the right upper lobe. (b) Chest CT shows numerous circular ground-glass opacities and consolidation in the right upper lobe and left lower lobe, which were most obvious around the bronchovascular bundle on the peripheral side.
Treatment was started with intravenous infusion of methylprednisolone (80 mg/day) and azithromycin (500 mg every 24 hours) to alleviate inflammation, ceftriaxone (2 g every 24 hours) in consideration of bacterial pneumonia and peramivir (600 mg/day on Day 1 and 300 mg/day from Day 2 onward) as an antiviral agent (Fig. 4). The patient showed positive results of a COVID-19 RT-PCR test on Day 3 of hospitalization when treatment with favipiravir was started. Pyrexia in the patient persisted, and respiratory failure progressed even after the initiation of favipiravir. The dose of methylprednisolone was increased to 250 mg/day from Day 6 onward. On Day 7, continuous intravenous infusion of sivelestat (400 mg/day) was started. Since the platelet count had decreased to 13.9×104/μL and COVID-19 often causes abnormal coagulation, intravenous infusion of recombinant thrombomodulin (32,000 U/day) was also started. The D-dimer level slightly increased to 1.8 μg/mL on Day 10 but improved thereafter.
Figure 4. Case 2: Clinical course after hospital admission.
The further progression of respiratory failure necessitated noninvasive intermittent positive-pressure ventilation on Day 8 and intubation and mechanical ventilation on Day 9. On Day 10, V-V ECMO was employed for this patient with severe progressive COVID-19 pneumonia with no irreversible underlying disease and poor oxygenation, even at an FiO2 of 1.0. ECMO cannulae were placed in the superior and inferior vena cavae, draining blood from the right femoral vein and returning it to the right internal jugular vein after extracorporeal oxygenation with a flow of 3.5 L/min. His oxygenation promptly improved after the start of ECMO therapy. For pulmonary protection, the mode of the mechanical ventilator was set as follows: PCV, FiO2 of 0.21, PEEP of 8 cmH2O, inspiratory pressure of 8 cmH2O and respiratory frequency of 12 per minute.
The patient's condition gradually improved in terms of inflammatory reaction and infiltrative opacities in both lungs. His blood oxygen level stabilized even when the level of oxygen received ECMO was reduced. Therefore, he was weaned from ECMO on Day 15. He was extubated on Day 19. No ECMO-associated adverse events were observed. The patient no longer required supplemental oxygen supply on Day 23. The patient was discharged on Day 32 (Fig. 4).
Discussion
Although the majority of cases of COVID-19 result in mild, reversible symptoms, some patients develop dyspnea and hypoxemia within about a week of the onset of the disease. Wang et al. reported that 26.1% of patients hospitalized with COVID-19 pneumonia required treatment in the intensive-care unit (ICU); 61.1% of these patients in the ICU had ARDS, and the mortality rate was approximately 4.3% (9). A total of 60 patients with COVID-19 pneumonia had been admitted to our hospital as of the middle of May, 2020. Eight of these 60 patients required intubation and mechanical ventilation, including the 2 presently reported patients who also required the use of ECMO.
ARDS is characterized by excessive local inflammation in the lung, which can progress to an “out-of-control” state. Excessive production of mediators, such as cytokines (e.g., interleukin-6, tumor necrosis factor alpha, interleukin-8) and arachidonate metabolites (i.e., cytokine storm), interstitial lung edema caused by enhanced pulmonary vascular permeability, and diffuse alveolar damage induce a rapid decrease in oxygenation and the accumulation of carbon dioxide (10). Antiviral treatment and pharmacological and non-pharmacological supportive therapies are considered to serve as important therapeutic strategies for COVID-19 pneumonia patients with ARDS.
It was previously reported that the fulminant activation of coagulation and consumption of clotting factors occur in severe cases of COVID-19. Inflammation of lung tissues and endothelial cells causes microthrombi formation, leading to thrombotic complications, such as deep venous thrombosis, pulmonary embolism and thrombotic arterial complications (11). T tD-dimer and fibrinogen degradation product (FDP) levels were increased in both of the present cases. Furthermore, in Case 1, the patient developed DIC and pulmonary thromboembolism despite the use of anticoagulants.
DIC in patients with COVID-19 has previously been described, and its characteristics include a lack of bleeding risk, mildly low platelet counts and elevated plasma fibrinogen levels, none of which are seen in typical DIC. Therefore, instead of DIC, these data might more closely resemble complement-mediated thrombotic microangiopathy (TMA) syndromes. Importantly, another essential aspect of DIC seen in COVID-19 is the detection of both COVID-19 and complement components in regions of TMA. Mediators of TMA syndromes overlap with those released by cytokine storm, suggesting close connections between ineffective immune responses to COVID-19, severe pneumonia and life-threatening microangiopathy (12). Although the diagnostic criteria for DIC were met in case 1, TMA syndrome might have occurred in both cases (particularly in case 2) because of the lack of typical symptoms of DIC.
For the two cases presented in this report, favipiravir administration was started as an antiviral treatment immediately after the diagnosis of COVID-19. At a meeting of the Japanese Association for Infectious Diseases, we presented an immediate report on cases of COVID-19 pneumonia with progressive respiratory failure, for which favipiravir may have worked promptly and effectively (13). However, rapid progression of respiratory failure was observed in the patients in this report despite the initiation of treatment with favipiravir. This can be interpreted as suggesting that the clinical benefit of treatment with an antiviral agent alone is limited in patients with concurrent ARDS. At present, multiple clinical trials of favipiravir are underway in patients with mild to severe COVID-19 pneumonia. Future data from these trials may provide new insights into the drug's clinical benefits.
As a pharmacological supportive therapy, we administered methylprednisolone (an anti-inflammatory agent for inhibiting cytokine storm), sivelestat (a neutrophil elastase inhibitor) and macrolide antibiotics with an immunoregulatory function (14) effective for suppressing hyperimmunization and excessive inflammation. The World Health Organization (WHO) has advised against the use of corticosteroids to treat COVID-19. The interim WHO guidance on the management of patients with severe acute respiratory infection caused by COVID-19 presents negative views on the use of steroids in the treatment of this patient population (“routine use of steroids should be avoided unless the patient has symptoms including bronchial asthma, aggravated chronic obstructive pulmonary disease, and septic shock”) based on data from studies of steroid therapy in patients with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS) or influenza (15). However, a study by the RECOVERY Collaborative Group showed that the use of dexamethasone in hospitalized COVID-19 patients resulted in a lower 28-day mortality than in those who were solely receiving either invasive mechanical ventilation or oxygen (6). In addition, Wu et al. performed a retrospective cohort study in patients with COVID-19 pneumonia and reported that the mortality in a cohort using methylprednisolone was lower than that in a cohort not using methylprednisolone, although the number of severe cases included in the former cohort was larger than that in the latter cohort (7). In our hospital, we have actively used steroids in patients with hypoxemia and achieved good outcomes. Based on these experiences, we are considering participating in a clinical study conducted to evaluate the efficacy of steroids in patients with COVID-19 pneumonia to verify the clinical effects of steroids in this patient population. Regarding macrolides, some researchers have reported that macrolide therapy was effective for reducing mortality in patients with ARDS (16). Although the mechanism underlying this reduction in mortality has not been fully elucidated, macrolides are likely to have effects on cytokine production and the neutrophil function (16).
As non-pharmacological supportive therapy, intubation, mechanical ventilation and ECMO were employed. ECMO is a life-supporting method used in patients with severe respiratory or cardiac failure (used particularly as a resuscitative measure taken for patients in cardiopulmonary arrest), called “respiratory ECMO” and “cardiac ECMO”, respectively. Respiratory ECMO is indicated for patients with reversible acute respiratory failure. Its use is considered for patients for whom conventional mechanical ventilation is insufficient for sustaining life or in whom continuous use of the mechanical ventilation system can result in irreversible damage to the lung. Respiratory ECMO is regarded as a treatment of ARDS (17). In the treatment of novel influenza A (H1N1) 2009, the results of ECMO database-based cohort studies (18,19) and the study on conventional ventilatory support vs. ECMO for severe adult respiratory failure (CESAR study) (20) demonstrated the efficacy of ECMO therapy based on the finding that the mortality in patients using ECMO was significantly lower than that in patients not using ECMO. In a retrospective study in MERS patients with refractory respiratory failure in 2018, the use of ECMO was required as an emergency treatment. The mortality in MERS patients with refractory hypoxemia in the ECMO cohort was significantly lower than that in the non-ECMO cohort (65% vs. 100%; p = 0.02) (21). Although little evidence for the efficacy of ECMO has been obtained with respect to COVID-19 pneumonia, results from two retrospective studies have been reported. In a retrospective study by Yang et al., of 52 patients admitted to the ICU with severe COVID-19 pneumonia, 32 died within 28 days of admission. ECMO was introduced to 6 patients, of whom 5 died, while the other was still on ECMO at the time of the endpoint assessment (22). In a retrospective study by Zhang et al., 48 of 221 patients with COVID-19 pneumonia had concurrent ARDS, and 10 of these 48 patients required mechanical ventilation and ECMO therapy. Of these 10 patients, 2 were successfully treated and discharged from the hospital, and 3 died. The other five patients were still on ECMO at the time of the endpoint assessment (23). According to the interim WHO guidance, ECMO, despite little evidence for its efficacy, is regarded as an emergency treatment of COVID-19 patients who have concurrent refractory hypoxemia even after being treated with lung-protective ventilation strategy (15). The condition of the two patients in the present case report was improved by intubation, mechanical ventilation and the prompt introduction of ECMO. COVID-19 pneumonia with ARDS is associated with high mortality. Pulmonary protection initiated before obtaining clinical benefits of antiviral treatment and pharmacological supportive therapy is considered to contribute to a reduction in mortality. Concerning complications, iliopsoas hematoma was identified in Case 1. In general, hemorrhagic complications, such as cannulation site bleeding, occur in approximately 50% of patients undergoing ECMO (17). ECMO-associated bleeding, which is attributed to the effect of heparinization as well as circuit-related consumption of coagulation factors, can be severe. It may be difficult to arrest bleeding if no measures other than monitoring the patient are taken. In Case 1, although the patient required blood transfusion, bleeding was arrested during the observation of the patient's condition. Infection is another critical complication said to occur in approximately 20% of patients on ECMO (17). However, the two patients in this report were able to safely receive ECMO therapy with no ECMO-related infectious complications.
Our two patients were already suffering from severe respiratory failure at the time of the diagnosis of COVID-19. They were successfully treated by a combination of antiviral treatment with favipiravir, corticosteroid, mechanical ventilation and ECMO. The positive outcomes of these cases underscore the importance of promptly treating severe COVID-19 pneumonia after the diagnosis with non-pharmacological supportive therapy, such as mechanical ventilation and ECMO, in combination with pharmacological supportive therapy, notably favipiravir for antiviral treatment and corticosteroid for anti-inflammatory treatment.
The authors state that they have no Conflict of Interest (COI). | Recovered | ReactionOutcome | CC BY-NC-ND | 33390469 | 18,811,755 | 2021 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Immune-mediated myositis'. | Readministration of Pembrolizumab after Treatment of Tuberculosis Activated by Initial Pembrolizumab Therapy.
Increasing the T-cell immune response to Mycobacterium tuberculosis with an anti-programmed cell death 1 (anti-PD-1) antibody may ultimately have detrimental effects. We present the case of a patient with advanced non-small cell lung cancer who developed active tuberculosis (TB) after initial treatment with pembrolizumab, an anti-PD-1 antibody. Pembrolizumab was resumed after completing anti-TB treatment, and no relapse of TB was observed clinically or radiologically. Checkpoint inhibitor-related pneumonitis (CIP) is first suspected when a pulmonary shadow presents during treatment with an anti-PD-1 antibody. It is sometimes difficult to diagnose CIP using computed tomographic images alone. Careful testing, including bacterial examinations and bronchoscopic biopsy, should be performed.
Introduction
Immune checkpoint inhibitors (ICIs) targeting programmed cell death 1 (PD-1) and programmed death ligand 1 (PD-L1) have revolutionized therapy for several advanced types of cancer, including non-small cell lung cancer (NSCLC). The inhibition of the interaction between PD-1 and PD-L1 by an anti-PD-1 antibody causes the reactivation of cytotoxic T cells and stimulates antitumor immune responses (1). However, an overactivated immune response can have unique side effects, known as ‘immune-related adverse events’ (irAEs) (2). Among the reported irAEs is checkpoint inhibitor-related pneumonitis (CIP), which develops in 5-10% of patients (3-5). CIP presents as a spectrum of radiographic patterns (3-6); thus, it can be difficult to distinguish from infectious pneumonia based on radiological findings alone. It remains unclear how ICIs affect the infectious immune response; however, cases involving the reactivation of pulmonary tuberculosis (TB) during anti-PD-1 antibody immunotherapy have been reported (7). The readministration of ICIs after the improvement of irAE is associated with a risk of irAE recurrence (8) and should only be considered after careful scrutiny. The safety of resuming ICIs after TB infection has not been well evaluated because few cases have been reported (7). We herein report a case in which treatment with the anti-PD1 antibody pembrolizumab was recommenced after the completion of TB treatment in a patient with advanced NSCLC who developed TB during initial pembrolizumab therapy.
Case Report
The patient was a 73-year-old man who was diagnosed with T3N3M1a stage IV lung adenocarcinoma in the right lower lobe of the lung (Fig. 1A), without driver mutations-including epidermal growth factor receptor mutations and anaplastic lymphoma kinase translocations-but with the elevated expression of PD-L1 on 90% of tumor cells. His performance status was 0. He had no history of active TB and computed tomography (CT) scans showed no abnormalities suggestive of latent TB, such as calcification of the hilar or mediastinal lymph nodes (Fig. 2A). The patient had been treated with pembrolizumab, an anti-PD-1 monoclonal antibody (200 mg, every 3 weeks), as a first-line therapy since July 2017. After five cycles of pembrolizumab, the patient developed muscle pain in his shoulder and thigh, suggesting myositis as an irAE of pembrolizumab. Pembrolizumab was discontinued and treatment with oral prednisolone (15 mg/day for 2 weeks) was commenced, resulting in the resolution of his muscle pain after 2 weeks. No additional steroid therapy was administered and his symptoms were well controlled with nonsteroidal anti-inflammatory drugs (NSAIDs). In January 2018, a CT scan showed tumor shrinkage; however, a new faint shadow was detected in the right lower lobe (Fig. 1B, 2B). Three months later, the lesion had expanded, with ground-glass opacity and centrilobular nodules (Fig. 2C), but the patient did not present cough, sputum, fever, or other symptoms. Because CIP was suspected, steroid therapy was initiated (prednisolone, 0.5 mg/kg/day) and gradually tapered off over a period of approximately 3 months. However, the ground-glass opacity with nodular shadowing did not improve with steroidal therapy; thus, radiological follow-up was continued without drugs. In January 2019, the patient developed cough and sputum without fever. Chest CT revealed expanded consolidation and a nodular lesion in the right upper lobe (Fig. 2D). Ziehl-Neelsen staining of a sputum smear was negative; however, a mycological culture of a sputum sample was positive for acid-fast bacilli, which were confirmed by polymerase chain reaction (PCR) to be Mycobacterium tuberculosis (Mtb). Thus, the patient received standard anti-TB chemotherapy, involving a 6-month period of combination treatment with isoniazid, rifampicin, pyrazinamide, and ethambutol, followed by a regimen of isoniazid and rifampicin from February 2019. In August 2019 (Fig. 2E), the pulmonary shadows in the right upper and lower lobes had disappeared but swelling of the abdominal paraaortic lymph nodes was detected on CT, with simultaneously elevation of his carcinoembryonic antigen (a tumor marker) level, indicating the recurrence of lung cancer. Pembrolizumab was therefore resumed; after 15 cycles, no relapse of TB was observed, either clinically or radiologically, and a partial tumor response was detected on CT in April 2020.
Figure 1. Computed tomography (CT) images of the primary lesion during the patient’s clinical course. (A) A CT scan at the time of the diagnosis showed a mass lesion in the right lower lobe. (B) The tumor regressed after five cycles of pembrolizumab.
Figure 2. Computed tomography (CT) images of pulmonary opacities during the patient’s clinical course. (A) A CT scan of the right S6 segment at the time of the diagnosis. (B) A CT scan showing the development of a new faint pulmonary shadow in the right S6 segment. (C) A CT scan obtained when checkpoint inhibitor-related pneumonitis was initially suspected. (D) A CT scan at the time of the diagnosis of TB. (E) A CT scan after the completion of anti-TB treatment.
Discussion
Several reports have described the reactivation of TB during anti-PD-1 antibody immunotherapy (7). In many cases, ICI was stopped after the development of TB and anti-TB treatment was commenced. There is concern that the renewed administration of ICI could exacerbate TB. TB did not worsen in some cases in which ICIs were readministered; however, the number of these cases was small and was not sufficient to establish the safety of recommencing ICI treatment. In our patient, we recommenced pembrolizumab after the completion of TB treatment. At present, 10 months since the recommencement of pembrolizumab, this treatment is ongoing, with no recurrence of TB. The long-term safety data provided by this case support the readministration of ICI after TB treatment.
The reactivation of TB is usually attributed to an immune system weakened by disease, including by malignant tumors, or by cytotoxic chemotherapy or immunosuppressive medications, such as corticosteroids or anti-tumor necrosis factor α (anti-TNF-α) antibody (9,10). A weakened immune system can no longer contain the mycobacteria in the granuloma and the bacteria are released into the extracellular space. Our patient received prednisolone (PSL) (15 mg/day) for 2 weeks to treat his muscle pain, which was considered an irAE of pembrolizumab. However, the period of oral steroid administration was not long. We therefore assume that it had little effect on the relapse of TB. The PD-1/PD-L1 pathway has been implicated in the pathophysiology of chronic infections, including TB and fungal infections. PD-1 is expressed on T cells and the exhaustion of T-cell immunity, which is similar to cancer immunity, has been demonstrated (11,12). Based on this fact, ICIs-including anti-PD-1 antibodies-are usually expected to promote the immune response to microorganisms. Some in vitro studies have shown that the anti-PD-1 blockade imposed by human peripheral blood mononuclear cells from TB patients restores responsiveness to TB antigens and cytokine secretion (13,14). In a PD-1-deficient mouse model, increased cytokine production against Mtb-specific antigens was observed; however, survival was significantly worse than in the wild-type mice (15,16). Moreover, pathological overinflammation and excessive necrosis were also detected in PD-1-deficient mice (15). These findings indicate that enhancing T-cell immunity directed against Mtb could ultimately have detrimental effects. TNF-α is the dominant cytokine affecting Mtb growth and an excess of TNF-α accelerates Mtb growth (17). PD-1 may regulate the immune reaction to Mtb, and anti-PD-1 antibodies could exacerbate TB infections via the excessive secretion of TNF-α (17). The expression of PD-1 on Mtb-specific CD4+ T cells is associated with the bacterial load during TB infection (18). Thus, PD-1 levels decrease after the completion of anti-TB treatment relative to the pretreatment levels (18,19). It may therefore be reasonable to restart anti-PD-1 antibody therapy after the completion of anti-TB treatment in cancer patients. In a systematic review of the development of active TB after ICI therapy in 16 patients, two patients died from complications of TB infection (7). ICI therapy was continued in only one case; however, no details were given (20). In seven cases, ICI therapy was recommenced before or after the anti-TB treatment was completed (7); however, there were no cases of worsening TB. In the present case, pembrolizumab was resumed after completing anti-TB treatment because the tumor had continued to shrink until the end of anti-TB treatment. Although resuming ICI treatment during TB treatment is an alternative option, it would depend upon the condition of the cancer.
CIP shows a broad spectrum of radiographic patterns on chest CT images, which can be classified as the cryptogenic organizing pneumonia pattern, the hypersensitivity pneumonia pattern, and the diffuse alveolar damage pattern (3-5). However, some cases have shown a CT pattern with bronchitis-like centrilobular nodules (6). When such nodular patterns are present, it can be difficult to distinguish between CIP and infection. In the present case, centrilobular nodules were detected in the right lower lobe on CT scans (Fig. 2C). Based on the CT findings, infection was indisputable; however, the patient did not present cough, sputum, fever, or other symptoms. Thus, we initially suspected CIP, and the period from the appearance of nodular lesions to the diagnosis of pulmonary TB was approximately 1 year. Based on a systematic review, the median time to the diagnosis of TB after the initiation of ICI therapy was 6.3 months (range: 1-24 months) (7). In 15 of 16 cases, the diagnosis of TB was confirmed with either Mtb culture or the detection of tubercular DNA by PCR. Pathological assessments were also made in 10 patients and confirmed the presence of granulomatous inflammation. The median time for the development of CIP after the initiation of ICI therapy was approximately 2.3 months (range: 0.2-27.4) (5-21). Thus, the times at which CIP and TB develop after the initiation of ICI therapy are similar. Therefore, when bronchitis-like centrilobular nodules or pulmonary consolidation mimicking infectious disease are present in the lung field on CT, careful testing is required, such as a bacterial examination, PCR analysis of sputum samples, or a bronchoscopic biopsy.
The reactivation of TB is one of the most important complications of anti-TNF-α antibody therapy (10). An interferon-γ-release assay (IGRA), which detects the immune response to specific Mtb antigens, shows good sensitivity and specificity for the diagnosis of TB infection; thus, screening for latent TB with an IGRA is recommended before anti-TNF-α antibody therapy is initiated in patients with rheumatoid arthritis (22). Isoniazid prophylaxis is offered to patients with evidence of latent TB infection (22). However, there are no data on the risk of the reactivation of latent TB in patients treated with ICIs. The utility of screening for latent TB before commencing ICI therapy in cancer patients and whether prophylaxis can prevent the reactivation of TB are unclear. In a previous case report, a patient with a history of TB treatment showed a negative IGRA result at their first visit, but developed TB reactivation during treatment with durvalumab, an anti-PD-L1 antibody, after chemoradiotherapy for stage III NSCLC. False-negative results are a major obstacle to screening for latent TB, and approximately 8-19% of patients show a negative IGRA result even when presenting with active TB (23). Indeterminate IGRA results are frequently reported in patients with malignancies and patients undergoing immunosuppressive therapy (24).
In conclusion, we presented a case of active TB that developed after the initiation of pembrolizumab treatment in a patient with advanced NSCLC. The readministration of pembrolizumab after the completion of anti-TB treatment had no adverse effects on the course of TB. However, the safety of the readministration of ICIs after anti-TB treatment is still controversial and the exacerbation of TB after ICI treatment has been reported in patients with previously treated TB. Thus, further cases must be evaluated to establish a suitable management strategy for active TB during ICI therapy.
Author's disclosure of potential Conflicts of Interest (COI).
Terufumi Kato: Employment, MSD; Honoraria, MSD. Haruhiro Saito: Research funding, MSD. | PEMBROLIZUMAB | DrugsGivenReaction | CC BY-NC-ND | 33390489 | 18,811,732 | 2021-06-01 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Tuberculosis'. | Readministration of Pembrolizumab after Treatment of Tuberculosis Activated by Initial Pembrolizumab Therapy.
Increasing the T-cell immune response to Mycobacterium tuberculosis with an anti-programmed cell death 1 (anti-PD-1) antibody may ultimately have detrimental effects. We present the case of a patient with advanced non-small cell lung cancer who developed active tuberculosis (TB) after initial treatment with pembrolizumab, an anti-PD-1 antibody. Pembrolizumab was resumed after completing anti-TB treatment, and no relapse of TB was observed clinically or radiologically. Checkpoint inhibitor-related pneumonitis (CIP) is first suspected when a pulmonary shadow presents during treatment with an anti-PD-1 antibody. It is sometimes difficult to diagnose CIP using computed tomographic images alone. Careful testing, including bacterial examinations and bronchoscopic biopsy, should be performed.
Introduction
Immune checkpoint inhibitors (ICIs) targeting programmed cell death 1 (PD-1) and programmed death ligand 1 (PD-L1) have revolutionized therapy for several advanced types of cancer, including non-small cell lung cancer (NSCLC). The inhibition of the interaction between PD-1 and PD-L1 by an anti-PD-1 antibody causes the reactivation of cytotoxic T cells and stimulates antitumor immune responses (1). However, an overactivated immune response can have unique side effects, known as ‘immune-related adverse events’ (irAEs) (2). Among the reported irAEs is checkpoint inhibitor-related pneumonitis (CIP), which develops in 5-10% of patients (3-5). CIP presents as a spectrum of radiographic patterns (3-6); thus, it can be difficult to distinguish from infectious pneumonia based on radiological findings alone. It remains unclear how ICIs affect the infectious immune response; however, cases involving the reactivation of pulmonary tuberculosis (TB) during anti-PD-1 antibody immunotherapy have been reported (7). The readministration of ICIs after the improvement of irAE is associated with a risk of irAE recurrence (8) and should only be considered after careful scrutiny. The safety of resuming ICIs after TB infection has not been well evaluated because few cases have been reported (7). We herein report a case in which treatment with the anti-PD1 antibody pembrolizumab was recommenced after the completion of TB treatment in a patient with advanced NSCLC who developed TB during initial pembrolizumab therapy.
Case Report
The patient was a 73-year-old man who was diagnosed with T3N3M1a stage IV lung adenocarcinoma in the right lower lobe of the lung (Fig. 1A), without driver mutations-including epidermal growth factor receptor mutations and anaplastic lymphoma kinase translocations-but with the elevated expression of PD-L1 on 90% of tumor cells. His performance status was 0. He had no history of active TB and computed tomography (CT) scans showed no abnormalities suggestive of latent TB, such as calcification of the hilar or mediastinal lymph nodes (Fig. 2A). The patient had been treated with pembrolizumab, an anti-PD-1 monoclonal antibody (200 mg, every 3 weeks), as a first-line therapy since July 2017. After five cycles of pembrolizumab, the patient developed muscle pain in his shoulder and thigh, suggesting myositis as an irAE of pembrolizumab. Pembrolizumab was discontinued and treatment with oral prednisolone (15 mg/day for 2 weeks) was commenced, resulting in the resolution of his muscle pain after 2 weeks. No additional steroid therapy was administered and his symptoms were well controlled with nonsteroidal anti-inflammatory drugs (NSAIDs). In January 2018, a CT scan showed tumor shrinkage; however, a new faint shadow was detected in the right lower lobe (Fig. 1B, 2B). Three months later, the lesion had expanded, with ground-glass opacity and centrilobular nodules (Fig. 2C), but the patient did not present cough, sputum, fever, or other symptoms. Because CIP was suspected, steroid therapy was initiated (prednisolone, 0.5 mg/kg/day) and gradually tapered off over a period of approximately 3 months. However, the ground-glass opacity with nodular shadowing did not improve with steroidal therapy; thus, radiological follow-up was continued without drugs. In January 2019, the patient developed cough and sputum without fever. Chest CT revealed expanded consolidation and a nodular lesion in the right upper lobe (Fig. 2D). Ziehl-Neelsen staining of a sputum smear was negative; however, a mycological culture of a sputum sample was positive for acid-fast bacilli, which were confirmed by polymerase chain reaction (PCR) to be Mycobacterium tuberculosis (Mtb). Thus, the patient received standard anti-TB chemotherapy, involving a 6-month period of combination treatment with isoniazid, rifampicin, pyrazinamide, and ethambutol, followed by a regimen of isoniazid and rifampicin from February 2019. In August 2019 (Fig. 2E), the pulmonary shadows in the right upper and lower lobes had disappeared but swelling of the abdominal paraaortic lymph nodes was detected on CT, with simultaneously elevation of his carcinoembryonic antigen (a tumor marker) level, indicating the recurrence of lung cancer. Pembrolizumab was therefore resumed; after 15 cycles, no relapse of TB was observed, either clinically or radiologically, and a partial tumor response was detected on CT in April 2020.
Figure 1. Computed tomography (CT) images of the primary lesion during the patient’s clinical course. (A) A CT scan at the time of the diagnosis showed a mass lesion in the right lower lobe. (B) The tumor regressed after five cycles of pembrolizumab.
Figure 2. Computed tomography (CT) images of pulmonary opacities during the patient’s clinical course. (A) A CT scan of the right S6 segment at the time of the diagnosis. (B) A CT scan showing the development of a new faint pulmonary shadow in the right S6 segment. (C) A CT scan obtained when checkpoint inhibitor-related pneumonitis was initially suspected. (D) A CT scan at the time of the diagnosis of TB. (E) A CT scan after the completion of anti-TB treatment.
Discussion
Several reports have described the reactivation of TB during anti-PD-1 antibody immunotherapy (7). In many cases, ICI was stopped after the development of TB and anti-TB treatment was commenced. There is concern that the renewed administration of ICI could exacerbate TB. TB did not worsen in some cases in which ICIs were readministered; however, the number of these cases was small and was not sufficient to establish the safety of recommencing ICI treatment. In our patient, we recommenced pembrolizumab after the completion of TB treatment. At present, 10 months since the recommencement of pembrolizumab, this treatment is ongoing, with no recurrence of TB. The long-term safety data provided by this case support the readministration of ICI after TB treatment.
The reactivation of TB is usually attributed to an immune system weakened by disease, including by malignant tumors, or by cytotoxic chemotherapy or immunosuppressive medications, such as corticosteroids or anti-tumor necrosis factor α (anti-TNF-α) antibody (9,10). A weakened immune system can no longer contain the mycobacteria in the granuloma and the bacteria are released into the extracellular space. Our patient received prednisolone (PSL) (15 mg/day) for 2 weeks to treat his muscle pain, which was considered an irAE of pembrolizumab. However, the period of oral steroid administration was not long. We therefore assume that it had little effect on the relapse of TB. The PD-1/PD-L1 pathway has been implicated in the pathophysiology of chronic infections, including TB and fungal infections. PD-1 is expressed on T cells and the exhaustion of T-cell immunity, which is similar to cancer immunity, has been demonstrated (11,12). Based on this fact, ICIs-including anti-PD-1 antibodies-are usually expected to promote the immune response to microorganisms. Some in vitro studies have shown that the anti-PD-1 blockade imposed by human peripheral blood mononuclear cells from TB patients restores responsiveness to TB antigens and cytokine secretion (13,14). In a PD-1-deficient mouse model, increased cytokine production against Mtb-specific antigens was observed; however, survival was significantly worse than in the wild-type mice (15,16). Moreover, pathological overinflammation and excessive necrosis were also detected in PD-1-deficient mice (15). These findings indicate that enhancing T-cell immunity directed against Mtb could ultimately have detrimental effects. TNF-α is the dominant cytokine affecting Mtb growth and an excess of TNF-α accelerates Mtb growth (17). PD-1 may regulate the immune reaction to Mtb, and anti-PD-1 antibodies could exacerbate TB infections via the excessive secretion of TNF-α (17). The expression of PD-1 on Mtb-specific CD4+ T cells is associated with the bacterial load during TB infection (18). Thus, PD-1 levels decrease after the completion of anti-TB treatment relative to the pretreatment levels (18,19). It may therefore be reasonable to restart anti-PD-1 antibody therapy after the completion of anti-TB treatment in cancer patients. In a systematic review of the development of active TB after ICI therapy in 16 patients, two patients died from complications of TB infection (7). ICI therapy was continued in only one case; however, no details were given (20). In seven cases, ICI therapy was recommenced before or after the anti-TB treatment was completed (7); however, there were no cases of worsening TB. In the present case, pembrolizumab was resumed after completing anti-TB treatment because the tumor had continued to shrink until the end of anti-TB treatment. Although resuming ICI treatment during TB treatment is an alternative option, it would depend upon the condition of the cancer.
CIP shows a broad spectrum of radiographic patterns on chest CT images, which can be classified as the cryptogenic organizing pneumonia pattern, the hypersensitivity pneumonia pattern, and the diffuse alveolar damage pattern (3-5). However, some cases have shown a CT pattern with bronchitis-like centrilobular nodules (6). When such nodular patterns are present, it can be difficult to distinguish between CIP and infection. In the present case, centrilobular nodules were detected in the right lower lobe on CT scans (Fig. 2C). Based on the CT findings, infection was indisputable; however, the patient did not present cough, sputum, fever, or other symptoms. Thus, we initially suspected CIP, and the period from the appearance of nodular lesions to the diagnosis of pulmonary TB was approximately 1 year. Based on a systematic review, the median time to the diagnosis of TB after the initiation of ICI therapy was 6.3 months (range: 1-24 months) (7). In 15 of 16 cases, the diagnosis of TB was confirmed with either Mtb culture or the detection of tubercular DNA by PCR. Pathological assessments were also made in 10 patients and confirmed the presence of granulomatous inflammation. The median time for the development of CIP after the initiation of ICI therapy was approximately 2.3 months (range: 0.2-27.4) (5-21). Thus, the times at which CIP and TB develop after the initiation of ICI therapy are similar. Therefore, when bronchitis-like centrilobular nodules or pulmonary consolidation mimicking infectious disease are present in the lung field on CT, careful testing is required, such as a bacterial examination, PCR analysis of sputum samples, or a bronchoscopic biopsy.
The reactivation of TB is one of the most important complications of anti-TNF-α antibody therapy (10). An interferon-γ-release assay (IGRA), which detects the immune response to specific Mtb antigens, shows good sensitivity and specificity for the diagnosis of TB infection; thus, screening for latent TB with an IGRA is recommended before anti-TNF-α antibody therapy is initiated in patients with rheumatoid arthritis (22). Isoniazid prophylaxis is offered to patients with evidence of latent TB infection (22). However, there are no data on the risk of the reactivation of latent TB in patients treated with ICIs. The utility of screening for latent TB before commencing ICI therapy in cancer patients and whether prophylaxis can prevent the reactivation of TB are unclear. In a previous case report, a patient with a history of TB treatment showed a negative IGRA result at their first visit, but developed TB reactivation during treatment with durvalumab, an anti-PD-L1 antibody, after chemoradiotherapy for stage III NSCLC. False-negative results are a major obstacle to screening for latent TB, and approximately 8-19% of patients show a negative IGRA result even when presenting with active TB (23). Indeterminate IGRA results are frequently reported in patients with malignancies and patients undergoing immunosuppressive therapy (24).
In conclusion, we presented a case of active TB that developed after the initiation of pembrolizumab treatment in a patient with advanced NSCLC. The readministration of pembrolizumab after the completion of anti-TB treatment had no adverse effects on the course of TB. However, the safety of the readministration of ICIs after anti-TB treatment is still controversial and the exacerbation of TB after ICI treatment has been reported in patients with previously treated TB. Thus, further cases must be evaluated to establish a suitable management strategy for active TB during ICI therapy.
Author's disclosure of potential Conflicts of Interest (COI).
Terufumi Kato: Employment, MSD; Honoraria, MSD. Haruhiro Saito: Research funding, MSD. | PEMBROLIZUMAB | DrugsGivenReaction | CC BY-NC-ND | 33390489 | 18,811,732 | 2021-06-01 |
What was the outcome of reaction 'Immune-mediated myositis'? | Readministration of Pembrolizumab after Treatment of Tuberculosis Activated by Initial Pembrolizumab Therapy.
Increasing the T-cell immune response to Mycobacterium tuberculosis with an anti-programmed cell death 1 (anti-PD-1) antibody may ultimately have detrimental effects. We present the case of a patient with advanced non-small cell lung cancer who developed active tuberculosis (TB) after initial treatment with pembrolizumab, an anti-PD-1 antibody. Pembrolizumab was resumed after completing anti-TB treatment, and no relapse of TB was observed clinically or radiologically. Checkpoint inhibitor-related pneumonitis (CIP) is first suspected when a pulmonary shadow presents during treatment with an anti-PD-1 antibody. It is sometimes difficult to diagnose CIP using computed tomographic images alone. Careful testing, including bacterial examinations and bronchoscopic biopsy, should be performed.
Introduction
Immune checkpoint inhibitors (ICIs) targeting programmed cell death 1 (PD-1) and programmed death ligand 1 (PD-L1) have revolutionized therapy for several advanced types of cancer, including non-small cell lung cancer (NSCLC). The inhibition of the interaction between PD-1 and PD-L1 by an anti-PD-1 antibody causes the reactivation of cytotoxic T cells and stimulates antitumor immune responses (1). However, an overactivated immune response can have unique side effects, known as ‘immune-related adverse events’ (irAEs) (2). Among the reported irAEs is checkpoint inhibitor-related pneumonitis (CIP), which develops in 5-10% of patients (3-5). CIP presents as a spectrum of radiographic patterns (3-6); thus, it can be difficult to distinguish from infectious pneumonia based on radiological findings alone. It remains unclear how ICIs affect the infectious immune response; however, cases involving the reactivation of pulmonary tuberculosis (TB) during anti-PD-1 antibody immunotherapy have been reported (7). The readministration of ICIs after the improvement of irAE is associated with a risk of irAE recurrence (8) and should only be considered after careful scrutiny. The safety of resuming ICIs after TB infection has not been well evaluated because few cases have been reported (7). We herein report a case in which treatment with the anti-PD1 antibody pembrolizumab was recommenced after the completion of TB treatment in a patient with advanced NSCLC who developed TB during initial pembrolizumab therapy.
Case Report
The patient was a 73-year-old man who was diagnosed with T3N3M1a stage IV lung adenocarcinoma in the right lower lobe of the lung (Fig. 1A), without driver mutations-including epidermal growth factor receptor mutations and anaplastic lymphoma kinase translocations-but with the elevated expression of PD-L1 on 90% of tumor cells. His performance status was 0. He had no history of active TB and computed tomography (CT) scans showed no abnormalities suggestive of latent TB, such as calcification of the hilar or mediastinal lymph nodes (Fig. 2A). The patient had been treated with pembrolizumab, an anti-PD-1 monoclonal antibody (200 mg, every 3 weeks), as a first-line therapy since July 2017. After five cycles of pembrolizumab, the patient developed muscle pain in his shoulder and thigh, suggesting myositis as an irAE of pembrolizumab. Pembrolizumab was discontinued and treatment with oral prednisolone (15 mg/day for 2 weeks) was commenced, resulting in the resolution of his muscle pain after 2 weeks. No additional steroid therapy was administered and his symptoms were well controlled with nonsteroidal anti-inflammatory drugs (NSAIDs). In January 2018, a CT scan showed tumor shrinkage; however, a new faint shadow was detected in the right lower lobe (Fig. 1B, 2B). Three months later, the lesion had expanded, with ground-glass opacity and centrilobular nodules (Fig. 2C), but the patient did not present cough, sputum, fever, or other symptoms. Because CIP was suspected, steroid therapy was initiated (prednisolone, 0.5 mg/kg/day) and gradually tapered off over a period of approximately 3 months. However, the ground-glass opacity with nodular shadowing did not improve with steroidal therapy; thus, radiological follow-up was continued without drugs. In January 2019, the patient developed cough and sputum without fever. Chest CT revealed expanded consolidation and a nodular lesion in the right upper lobe (Fig. 2D). Ziehl-Neelsen staining of a sputum smear was negative; however, a mycological culture of a sputum sample was positive for acid-fast bacilli, which were confirmed by polymerase chain reaction (PCR) to be Mycobacterium tuberculosis (Mtb). Thus, the patient received standard anti-TB chemotherapy, involving a 6-month period of combination treatment with isoniazid, rifampicin, pyrazinamide, and ethambutol, followed by a regimen of isoniazid and rifampicin from February 2019. In August 2019 (Fig. 2E), the pulmonary shadows in the right upper and lower lobes had disappeared but swelling of the abdominal paraaortic lymph nodes was detected on CT, with simultaneously elevation of his carcinoembryonic antigen (a tumor marker) level, indicating the recurrence of lung cancer. Pembrolizumab was therefore resumed; after 15 cycles, no relapse of TB was observed, either clinically or radiologically, and a partial tumor response was detected on CT in April 2020.
Figure 1. Computed tomography (CT) images of the primary lesion during the patient’s clinical course. (A) A CT scan at the time of the diagnosis showed a mass lesion in the right lower lobe. (B) The tumor regressed after five cycles of pembrolizumab.
Figure 2. Computed tomography (CT) images of pulmonary opacities during the patient’s clinical course. (A) A CT scan of the right S6 segment at the time of the diagnosis. (B) A CT scan showing the development of a new faint pulmonary shadow in the right S6 segment. (C) A CT scan obtained when checkpoint inhibitor-related pneumonitis was initially suspected. (D) A CT scan at the time of the diagnosis of TB. (E) A CT scan after the completion of anti-TB treatment.
Discussion
Several reports have described the reactivation of TB during anti-PD-1 antibody immunotherapy (7). In many cases, ICI was stopped after the development of TB and anti-TB treatment was commenced. There is concern that the renewed administration of ICI could exacerbate TB. TB did not worsen in some cases in which ICIs were readministered; however, the number of these cases was small and was not sufficient to establish the safety of recommencing ICI treatment. In our patient, we recommenced pembrolizumab after the completion of TB treatment. At present, 10 months since the recommencement of pembrolizumab, this treatment is ongoing, with no recurrence of TB. The long-term safety data provided by this case support the readministration of ICI after TB treatment.
The reactivation of TB is usually attributed to an immune system weakened by disease, including by malignant tumors, or by cytotoxic chemotherapy or immunosuppressive medications, such as corticosteroids or anti-tumor necrosis factor α (anti-TNF-α) antibody (9,10). A weakened immune system can no longer contain the mycobacteria in the granuloma and the bacteria are released into the extracellular space. Our patient received prednisolone (PSL) (15 mg/day) for 2 weeks to treat his muscle pain, which was considered an irAE of pembrolizumab. However, the period of oral steroid administration was not long. We therefore assume that it had little effect on the relapse of TB. The PD-1/PD-L1 pathway has been implicated in the pathophysiology of chronic infections, including TB and fungal infections. PD-1 is expressed on T cells and the exhaustion of T-cell immunity, which is similar to cancer immunity, has been demonstrated (11,12). Based on this fact, ICIs-including anti-PD-1 antibodies-are usually expected to promote the immune response to microorganisms. Some in vitro studies have shown that the anti-PD-1 blockade imposed by human peripheral blood mononuclear cells from TB patients restores responsiveness to TB antigens and cytokine secretion (13,14). In a PD-1-deficient mouse model, increased cytokine production against Mtb-specific antigens was observed; however, survival was significantly worse than in the wild-type mice (15,16). Moreover, pathological overinflammation and excessive necrosis were also detected in PD-1-deficient mice (15). These findings indicate that enhancing T-cell immunity directed against Mtb could ultimately have detrimental effects. TNF-α is the dominant cytokine affecting Mtb growth and an excess of TNF-α accelerates Mtb growth (17). PD-1 may regulate the immune reaction to Mtb, and anti-PD-1 antibodies could exacerbate TB infections via the excessive secretion of TNF-α (17). The expression of PD-1 on Mtb-specific CD4+ T cells is associated with the bacterial load during TB infection (18). Thus, PD-1 levels decrease after the completion of anti-TB treatment relative to the pretreatment levels (18,19). It may therefore be reasonable to restart anti-PD-1 antibody therapy after the completion of anti-TB treatment in cancer patients. In a systematic review of the development of active TB after ICI therapy in 16 patients, two patients died from complications of TB infection (7). ICI therapy was continued in only one case; however, no details were given (20). In seven cases, ICI therapy was recommenced before or after the anti-TB treatment was completed (7); however, there were no cases of worsening TB. In the present case, pembrolizumab was resumed after completing anti-TB treatment because the tumor had continued to shrink until the end of anti-TB treatment. Although resuming ICI treatment during TB treatment is an alternative option, it would depend upon the condition of the cancer.
CIP shows a broad spectrum of radiographic patterns on chest CT images, which can be classified as the cryptogenic organizing pneumonia pattern, the hypersensitivity pneumonia pattern, and the diffuse alveolar damage pattern (3-5). However, some cases have shown a CT pattern with bronchitis-like centrilobular nodules (6). When such nodular patterns are present, it can be difficult to distinguish between CIP and infection. In the present case, centrilobular nodules were detected in the right lower lobe on CT scans (Fig. 2C). Based on the CT findings, infection was indisputable; however, the patient did not present cough, sputum, fever, or other symptoms. Thus, we initially suspected CIP, and the period from the appearance of nodular lesions to the diagnosis of pulmonary TB was approximately 1 year. Based on a systematic review, the median time to the diagnosis of TB after the initiation of ICI therapy was 6.3 months (range: 1-24 months) (7). In 15 of 16 cases, the diagnosis of TB was confirmed with either Mtb culture or the detection of tubercular DNA by PCR. Pathological assessments were also made in 10 patients and confirmed the presence of granulomatous inflammation. The median time for the development of CIP after the initiation of ICI therapy was approximately 2.3 months (range: 0.2-27.4) (5-21). Thus, the times at which CIP and TB develop after the initiation of ICI therapy are similar. Therefore, when bronchitis-like centrilobular nodules or pulmonary consolidation mimicking infectious disease are present in the lung field on CT, careful testing is required, such as a bacterial examination, PCR analysis of sputum samples, or a bronchoscopic biopsy.
The reactivation of TB is one of the most important complications of anti-TNF-α antibody therapy (10). An interferon-γ-release assay (IGRA), which detects the immune response to specific Mtb antigens, shows good sensitivity and specificity for the diagnosis of TB infection; thus, screening for latent TB with an IGRA is recommended before anti-TNF-α antibody therapy is initiated in patients with rheumatoid arthritis (22). Isoniazid prophylaxis is offered to patients with evidence of latent TB infection (22). However, there are no data on the risk of the reactivation of latent TB in patients treated with ICIs. The utility of screening for latent TB before commencing ICI therapy in cancer patients and whether prophylaxis can prevent the reactivation of TB are unclear. In a previous case report, a patient with a history of TB treatment showed a negative IGRA result at their first visit, but developed TB reactivation during treatment with durvalumab, an anti-PD-L1 antibody, after chemoradiotherapy for stage III NSCLC. False-negative results are a major obstacle to screening for latent TB, and approximately 8-19% of patients show a negative IGRA result even when presenting with active TB (23). Indeterminate IGRA results are frequently reported in patients with malignancies and patients undergoing immunosuppressive therapy (24).
In conclusion, we presented a case of active TB that developed after the initiation of pembrolizumab treatment in a patient with advanced NSCLC. The readministration of pembrolizumab after the completion of anti-TB treatment had no adverse effects on the course of TB. However, the safety of the readministration of ICIs after anti-TB treatment is still controversial and the exacerbation of TB after ICI treatment has been reported in patients with previously treated TB. Thus, further cases must be evaluated to establish a suitable management strategy for active TB during ICI therapy.
Author's disclosure of potential Conflicts of Interest (COI).
Terufumi Kato: Employment, MSD; Honoraria, MSD. Haruhiro Saito: Research funding, MSD. | Recovered | ReactionOutcome | CC BY-NC-ND | 33390489 | 18,811,732 | 2021-06-01 |
What was the outcome of reaction 'Tuberculosis'? | Readministration of Pembrolizumab after Treatment of Tuberculosis Activated by Initial Pembrolizumab Therapy.
Increasing the T-cell immune response to Mycobacterium tuberculosis with an anti-programmed cell death 1 (anti-PD-1) antibody may ultimately have detrimental effects. We present the case of a patient with advanced non-small cell lung cancer who developed active tuberculosis (TB) after initial treatment with pembrolizumab, an anti-PD-1 antibody. Pembrolizumab was resumed after completing anti-TB treatment, and no relapse of TB was observed clinically or radiologically. Checkpoint inhibitor-related pneumonitis (CIP) is first suspected when a pulmonary shadow presents during treatment with an anti-PD-1 antibody. It is sometimes difficult to diagnose CIP using computed tomographic images alone. Careful testing, including bacterial examinations and bronchoscopic biopsy, should be performed.
Introduction
Immune checkpoint inhibitors (ICIs) targeting programmed cell death 1 (PD-1) and programmed death ligand 1 (PD-L1) have revolutionized therapy for several advanced types of cancer, including non-small cell lung cancer (NSCLC). The inhibition of the interaction between PD-1 and PD-L1 by an anti-PD-1 antibody causes the reactivation of cytotoxic T cells and stimulates antitumor immune responses (1). However, an overactivated immune response can have unique side effects, known as ‘immune-related adverse events’ (irAEs) (2). Among the reported irAEs is checkpoint inhibitor-related pneumonitis (CIP), which develops in 5-10% of patients (3-5). CIP presents as a spectrum of radiographic patterns (3-6); thus, it can be difficult to distinguish from infectious pneumonia based on radiological findings alone. It remains unclear how ICIs affect the infectious immune response; however, cases involving the reactivation of pulmonary tuberculosis (TB) during anti-PD-1 antibody immunotherapy have been reported (7). The readministration of ICIs after the improvement of irAE is associated with a risk of irAE recurrence (8) and should only be considered after careful scrutiny. The safety of resuming ICIs after TB infection has not been well evaluated because few cases have been reported (7). We herein report a case in which treatment with the anti-PD1 antibody pembrolizumab was recommenced after the completion of TB treatment in a patient with advanced NSCLC who developed TB during initial pembrolizumab therapy.
Case Report
The patient was a 73-year-old man who was diagnosed with T3N3M1a stage IV lung adenocarcinoma in the right lower lobe of the lung (Fig. 1A), without driver mutations-including epidermal growth factor receptor mutations and anaplastic lymphoma kinase translocations-but with the elevated expression of PD-L1 on 90% of tumor cells. His performance status was 0. He had no history of active TB and computed tomography (CT) scans showed no abnormalities suggestive of latent TB, such as calcification of the hilar or mediastinal lymph nodes (Fig. 2A). The patient had been treated with pembrolizumab, an anti-PD-1 monoclonal antibody (200 mg, every 3 weeks), as a first-line therapy since July 2017. After five cycles of pembrolizumab, the patient developed muscle pain in his shoulder and thigh, suggesting myositis as an irAE of pembrolizumab. Pembrolizumab was discontinued and treatment with oral prednisolone (15 mg/day for 2 weeks) was commenced, resulting in the resolution of his muscle pain after 2 weeks. No additional steroid therapy was administered and his symptoms were well controlled with nonsteroidal anti-inflammatory drugs (NSAIDs). In January 2018, a CT scan showed tumor shrinkage; however, a new faint shadow was detected in the right lower lobe (Fig. 1B, 2B). Three months later, the lesion had expanded, with ground-glass opacity and centrilobular nodules (Fig. 2C), but the patient did not present cough, sputum, fever, or other symptoms. Because CIP was suspected, steroid therapy was initiated (prednisolone, 0.5 mg/kg/day) and gradually tapered off over a period of approximately 3 months. However, the ground-glass opacity with nodular shadowing did not improve with steroidal therapy; thus, radiological follow-up was continued without drugs. In January 2019, the patient developed cough and sputum without fever. Chest CT revealed expanded consolidation and a nodular lesion in the right upper lobe (Fig. 2D). Ziehl-Neelsen staining of a sputum smear was negative; however, a mycological culture of a sputum sample was positive for acid-fast bacilli, which were confirmed by polymerase chain reaction (PCR) to be Mycobacterium tuberculosis (Mtb). Thus, the patient received standard anti-TB chemotherapy, involving a 6-month period of combination treatment with isoniazid, rifampicin, pyrazinamide, and ethambutol, followed by a regimen of isoniazid and rifampicin from February 2019. In August 2019 (Fig. 2E), the pulmonary shadows in the right upper and lower lobes had disappeared but swelling of the abdominal paraaortic lymph nodes was detected on CT, with simultaneously elevation of his carcinoembryonic antigen (a tumor marker) level, indicating the recurrence of lung cancer. Pembrolizumab was therefore resumed; after 15 cycles, no relapse of TB was observed, either clinically or radiologically, and a partial tumor response was detected on CT in April 2020.
Figure 1. Computed tomography (CT) images of the primary lesion during the patient’s clinical course. (A) A CT scan at the time of the diagnosis showed a mass lesion in the right lower lobe. (B) The tumor regressed after five cycles of pembrolizumab.
Figure 2. Computed tomography (CT) images of pulmonary opacities during the patient’s clinical course. (A) A CT scan of the right S6 segment at the time of the diagnosis. (B) A CT scan showing the development of a new faint pulmonary shadow in the right S6 segment. (C) A CT scan obtained when checkpoint inhibitor-related pneumonitis was initially suspected. (D) A CT scan at the time of the diagnosis of TB. (E) A CT scan after the completion of anti-TB treatment.
Discussion
Several reports have described the reactivation of TB during anti-PD-1 antibody immunotherapy (7). In many cases, ICI was stopped after the development of TB and anti-TB treatment was commenced. There is concern that the renewed administration of ICI could exacerbate TB. TB did not worsen in some cases in which ICIs were readministered; however, the number of these cases was small and was not sufficient to establish the safety of recommencing ICI treatment. In our patient, we recommenced pembrolizumab after the completion of TB treatment. At present, 10 months since the recommencement of pembrolizumab, this treatment is ongoing, with no recurrence of TB. The long-term safety data provided by this case support the readministration of ICI after TB treatment.
The reactivation of TB is usually attributed to an immune system weakened by disease, including by malignant tumors, or by cytotoxic chemotherapy or immunosuppressive medications, such as corticosteroids or anti-tumor necrosis factor α (anti-TNF-α) antibody (9,10). A weakened immune system can no longer contain the mycobacteria in the granuloma and the bacteria are released into the extracellular space. Our patient received prednisolone (PSL) (15 mg/day) for 2 weeks to treat his muscle pain, which was considered an irAE of pembrolizumab. However, the period of oral steroid administration was not long. We therefore assume that it had little effect on the relapse of TB. The PD-1/PD-L1 pathway has been implicated in the pathophysiology of chronic infections, including TB and fungal infections. PD-1 is expressed on T cells and the exhaustion of T-cell immunity, which is similar to cancer immunity, has been demonstrated (11,12). Based on this fact, ICIs-including anti-PD-1 antibodies-are usually expected to promote the immune response to microorganisms. Some in vitro studies have shown that the anti-PD-1 blockade imposed by human peripheral blood mononuclear cells from TB patients restores responsiveness to TB antigens and cytokine secretion (13,14). In a PD-1-deficient mouse model, increased cytokine production against Mtb-specific antigens was observed; however, survival was significantly worse than in the wild-type mice (15,16). Moreover, pathological overinflammation and excessive necrosis were also detected in PD-1-deficient mice (15). These findings indicate that enhancing T-cell immunity directed against Mtb could ultimately have detrimental effects. TNF-α is the dominant cytokine affecting Mtb growth and an excess of TNF-α accelerates Mtb growth (17). PD-1 may regulate the immune reaction to Mtb, and anti-PD-1 antibodies could exacerbate TB infections via the excessive secretion of TNF-α (17). The expression of PD-1 on Mtb-specific CD4+ T cells is associated with the bacterial load during TB infection (18). Thus, PD-1 levels decrease after the completion of anti-TB treatment relative to the pretreatment levels (18,19). It may therefore be reasonable to restart anti-PD-1 antibody therapy after the completion of anti-TB treatment in cancer patients. In a systematic review of the development of active TB after ICI therapy in 16 patients, two patients died from complications of TB infection (7). ICI therapy was continued in only one case; however, no details were given (20). In seven cases, ICI therapy was recommenced before or after the anti-TB treatment was completed (7); however, there were no cases of worsening TB. In the present case, pembrolizumab was resumed after completing anti-TB treatment because the tumor had continued to shrink until the end of anti-TB treatment. Although resuming ICI treatment during TB treatment is an alternative option, it would depend upon the condition of the cancer.
CIP shows a broad spectrum of radiographic patterns on chest CT images, which can be classified as the cryptogenic organizing pneumonia pattern, the hypersensitivity pneumonia pattern, and the diffuse alveolar damage pattern (3-5). However, some cases have shown a CT pattern with bronchitis-like centrilobular nodules (6). When such nodular patterns are present, it can be difficult to distinguish between CIP and infection. In the present case, centrilobular nodules were detected in the right lower lobe on CT scans (Fig. 2C). Based on the CT findings, infection was indisputable; however, the patient did not present cough, sputum, fever, or other symptoms. Thus, we initially suspected CIP, and the period from the appearance of nodular lesions to the diagnosis of pulmonary TB was approximately 1 year. Based on a systematic review, the median time to the diagnosis of TB after the initiation of ICI therapy was 6.3 months (range: 1-24 months) (7). In 15 of 16 cases, the diagnosis of TB was confirmed with either Mtb culture or the detection of tubercular DNA by PCR. Pathological assessments were also made in 10 patients and confirmed the presence of granulomatous inflammation. The median time for the development of CIP after the initiation of ICI therapy was approximately 2.3 months (range: 0.2-27.4) (5-21). Thus, the times at which CIP and TB develop after the initiation of ICI therapy are similar. Therefore, when bronchitis-like centrilobular nodules or pulmonary consolidation mimicking infectious disease are present in the lung field on CT, careful testing is required, such as a bacterial examination, PCR analysis of sputum samples, or a bronchoscopic biopsy.
The reactivation of TB is one of the most important complications of anti-TNF-α antibody therapy (10). An interferon-γ-release assay (IGRA), which detects the immune response to specific Mtb antigens, shows good sensitivity and specificity for the diagnosis of TB infection; thus, screening for latent TB with an IGRA is recommended before anti-TNF-α antibody therapy is initiated in patients with rheumatoid arthritis (22). Isoniazid prophylaxis is offered to patients with evidence of latent TB infection (22). However, there are no data on the risk of the reactivation of latent TB in patients treated with ICIs. The utility of screening for latent TB before commencing ICI therapy in cancer patients and whether prophylaxis can prevent the reactivation of TB are unclear. In a previous case report, a patient with a history of TB treatment showed a negative IGRA result at their first visit, but developed TB reactivation during treatment with durvalumab, an anti-PD-L1 antibody, after chemoradiotherapy for stage III NSCLC. False-negative results are a major obstacle to screening for latent TB, and approximately 8-19% of patients show a negative IGRA result even when presenting with active TB (23). Indeterminate IGRA results are frequently reported in patients with malignancies and patients undergoing immunosuppressive therapy (24).
In conclusion, we presented a case of active TB that developed after the initiation of pembrolizumab treatment in a patient with advanced NSCLC. The readministration of pembrolizumab after the completion of anti-TB treatment had no adverse effects on the course of TB. However, the safety of the readministration of ICIs after anti-TB treatment is still controversial and the exacerbation of TB after ICI treatment has been reported in patients with previously treated TB. Thus, further cases must be evaluated to establish a suitable management strategy for active TB during ICI therapy.
Author's disclosure of potential Conflicts of Interest (COI).
Terufumi Kato: Employment, MSD; Honoraria, MSD. Haruhiro Saito: Research funding, MSD. | Recovered | ReactionOutcome | CC BY-NC-ND | 33390489 | 18,811,732 | 2021-06-01 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Disease recurrence'. | Acute Stroke Caused by Progressive Intracranial Artery Stenosis Due to Varicella Zoster Virus Vasculopathy after Chemotherapy for Malignant Lymphoma.
Decreased cell-mediated immunity can reactivate Varicella zoster virus (VZV), which can lead to various neurological complications, including vasculopathy. We herein report the case of a patient with acute stroke with progressive internal carotid artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma. Treatment for VZV vasculopathy improved the stenosis and prevented recurrent stroke. VZV vasculopathy is an important treatable cause of stroke in immunosuppressed patients.
Introduction
Varicella zoster virus (VZV) is a highly neurotropic virus. After primary infection causing chicken pox, VZV remains latent in the cranial nerve ganglia, dorsal root ganglia, and autonomic ganglia along the entire neuraxis (1). Decreased cell-mediated immunity due to aging or immunosuppression reactivates VZV and results in various neurological complications, such as vasculopathy, as well as shingles (1). Malignant lymphoma, the most common hematologic malignancy, causes immunosuppression through either the disease itself or chemotherapy, and this sometimes results in VZV reactivation (2,3).
We herein report the case of an acute stroke patient with progressive intracranial artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma.
Case Report
A 62-year-old woman with a history of follicular lymphoma was treated with chemotherapy [6 courses of bendamustine plus rituximab therapy (B-R)] and achieved complete remission. Lymphocytopenia continued after chemotherapy (Fig. 1). She developed shingles on the left buttock 5 months after the chemotherapy and was treated with amenamevir 400 mg for 7 days. Five months after the shingles, she suddenly developed transient right upper limb paralysis and arrived at our emergency room. She had no history of headache and no vascular risk factors other than dyslipidemia.
Figure 1. Changes in the lymphocyte count. The black arrow indicates one course of bendamustine plus rituximab therapy. The white arrow indicates one course of steroid pulse therapy. The black arrowhead indicates the onset of shingles. The white arrowhead indicates the onset of varicella zoster virus vasculopathy.
She had dark red scars in the left sacral distribution. She had no focal neurological symptoms. Her National Institutes of Health Stroke scale (NIHSS) score was 0. On a laboratory examination, the white blood cell count was 5,300 /μL, and the lymphocyte count was 572 /μL (Fig. 1). Serological tests other than low-density lipoprotein (LDL)-cholesterol (149 mg/dL) were normal. On immunological testing, the IgG and IgA values were low [IgG: 667 mg/dL (861-1,741 mg/dL), IgA: 51 mg/dL (93-393 mg/dL)]. Coagulation assays and autoantibodies were normal. Anti-VZV antibody and anti-cytomegalovirus (CMV) antibody showed a prior infectious pattern.
Chest X-ray, electrocardiography, and echocardiography findings were normal. Brain magnetic resonance imaging (MRI) showed a small acute cerebral infarction in the cortical region of the left frontal lobe (Fig. 2A). MR angiography (MRA) showed the loss of the blood flow signal at the top of the left internal carotid artery (ICA) (Fig. 2B), and three-dimensional (3D) rotational angiography showed severe stenosis in the lesion (Fig. 2C). However, on contrast-enhanced CT three months before admission as follow-up for malignant lymphoma, the top of the ICA had no steno-occlusive lesions (Fig. 3A). Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging; VWI) showed concentric vessel wall enhancement at the top of the left ICA (Fig. 3B-D). The wall enhancement index (WEI) of the stenotic lesion (4) was 2.66. Cerebrospinal fluid (CSF) analyses showed a slightly elevated protein level. Polymerase chain reaction (PCR) for VZV DNA in CSF was negative. In contrast, VZV-IgM was positive in CSF, and the anti-VZV IgG antibody index [4.17 (>2.0)] increased, which meant increasing intrathecal synthesis of anti-VZV IgG antibody. A diagnosis of acute ischemic stroke due to intracranial arterial stenosis caused by VZV vasculopathy was therefore made.
Figure 2. Brain imaging findings. (A) MRI was performed on admission using a 1.5-T MRI scanner. Axial DWI (TR 6,000 ms, TE 100 ms, b-value 1,000 sec/mm2) showed a small, high-intensity signal in the left middle cerebral artery (MCA) region. (B) MRA (Time of flight, TR 32 ms, TE 6.8 ms) on admission showed severe stenosis at the top of the left internal carotid artery (ICA), and the signal from the blood flow of the left MCA was lower than that of the contralateral MCA. (C) 3D-reconstruction of left ICA rotation angiography showed severe stenosis at the top of the left ICA.
Figure 3. Time course of vascular morphology in varicella zoster virus vasculopathy. (A) 3D reconstruction of contrast-enhanced CT 3 months before admission for follow-up of malignant lymphoma showed no stenosis or abnormal findings at the top of the left ICA. The reason for the blurred image is that the primary purpose was not for a vascular assessment. (B) MRA (time of flight, TOF; TR 18 ms, TE 3.9 ms) on 3-T MRI on admission. (C) T1-weighted imaging (TIWI; TR 650 ms, TE 16.5 ms) on 3-T MRI on admission showed the thickened vessel wall of the left internal carotid artery (ICA) compared with the contralateral ICA. (D) Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging, VWI; TR 550 ms, TE 17 ms) on 3-T MRI on admission showed concentric enhancement in the thickened vessel wall of the left ICA. (E) MRA (TOF, TR 18 ms, TE 3.9 ms) on 3-T MRI seven months after admission showed improvement of the signal intensity of the blood flow at the top of the left ICA. (F) T1WI (TR 650 ms, TE 16.5 ms) on 3-T MRI seven months after admission showed improvement of vessel wall thickening of the left ICA. (G) VWI (TR 550 ms, TE 17 ms) on 3-T MRI seven months after admission showed decreased enhancement in the vessel wall of the left ICA. In addition, the left ICA vessel lumen was expanded. The white arrow indicates the top of the left ICA. The white arrowhead indicates the vessel wall of the left ICA.
The patient was treated with oral aspirin 100 mg per day, rosuvastatin 2.5 mg per day, intravenous acyclovir 10 mg/kg every 8 hours for 4 days, and oral prednisone 1 mg/kg for 5 days. Despite these therapies, MRI at 17 days after admission showed recurrence of asymptomatic cerebral infarction in the left ICA region. Intravenous methylprednisolone 1,000 mg per day was then given for 3 days, and the dosage of aspirin was increased to 200 mg per day. She then had no recurrence of stroke. She was discharged 31 days from admission and continued aspirin 200 mg per day.
MRA and VWI at 7 months after admission showed improvement of the stenosis of the left ICA and reduced vessel wall enhancement (Fig. 3E-G). The WEI of the stenotic lesion had decreased to 1.22. In addition, anti-VZV antibody IgM was negative, and the anti-VZV IgG antibody index (1.19) had also decreased by 7 months after admission. She showed no further exacerbations of neurological symptoms and no recurrent stroke, and she lived her daily life at home.
Discussion
We encountered a patient with acute stroke caused by progressive severe stenosis at the top of the left ICA after chemotherapy for follicular lymphoma who was diagnosed with VZV vasculopathy by intrathecal synthesis of anti-VZV antibody (1,5).
To our knowledge, this is the first report of VZV vasculopathy after B-R. VZV reactivation occurs in 12.2% of non-Hodgkin lymphoma patients receiving chemotherapy (2). Most VZV reactivations occur within first two years after the diagnosis of lymphoma, and the risk factors are women, diabetes mellitus, and multiple courses of chemotherapy (2). The risk also depends on the kind of chemotherapy (2,6). The present patient was treated with six courses of B-R before VZV reactivation. Lymphocytopenia continued after B-R, and this reduced cell-mediated immunity caused VZV reactivation, with vasculopathy consequently developing (Fig. 1). B-R is a standard treatment for several indolent B cell lymphomas (7). Bendamustine is known to cause myelosuppression, including lymphocytopenia, mostly with decreased CD4+ T lymphocytes and a decreased cell-mediated immunity over seven to nine months (8). Rituximab causes B cell depletion and induces substantial T cell depletion, mainly of CD4+ cells (9). Thus, B-R causes both T cell and B cell depletion (8) and leads to impaired cell-mediated immunity.
The morphological changes of the ICA before and after therapy for VZV vasculopathy were observed. A limited number of studies have reported the improvement of vascular morphology after treatment for VZV vasculopathy with long-term follow-up (10), and few reports have shown the time course of VZV vasculopathy from before the onset to the recovery process. A previous study reported that VWI was useful for the follow-up of vascular morphology and evaluating the treatment effect of VZV vasculopathy (10). Furthermore, the present patient showed improvement of the WEI value (4) of stenotic lesions, which is thought to reflect the degree of vessel wall inflammation.
Although computed tomography angiography (CTA) three months before admission in the present patient showed no stenosis in the intracranial arteries, VWI on admission showed concentric severe stenosis with gadolinium enhancement, which is the characteristic finding of vasculitis at the top of the left ICA (11). Seven months after treatment, VWI showed improvement of the left ICA stenosis, a decreasing WEI, and vessel wall thickening. The patient showed deterioration and improvement of intracranial artery stenosis in association with VZV vasculopathy activity.
In the present patient, the stenosis limited to the top of ICA appeared to have been related to the pathological mechanism of VZV vasculopathy. Seventy percent of patients with VZV vasculopathy had vascular abnormalities on angiography, and 50% of them were distributed in both large and small arteries, 37% in small arteries exclusively, and 13% in large arteries exclusively (1). The trigeminal ganglia in which VZV is latently located predominantly project nerve fibers to the ipsilateral proximal middle cerebral artery (MCA), anterior cerebral artery (ACA), and the top of the ICA (12). VZV in the trigeminal ganglia reactivated without a simultaneous rash in the sacral ganglion distribution because 37% of VZV vasculopathy occurred without a rash (13), although the previous zoster infection in the current patient involved the left sacral distribution. Therefore, VZV reactivation in the trigeminal ganglia reaches the ICA wall transaxonally. After reaching the adventitia, the virus spreads transmurally, causing infection in the cerebral arteries (1). VZV-infected cells in the adventitia induce neutrophil, macrophage, and T lymphocyte chemotaxis (14), increase the levels of various soluble factors such as interleukin 6 (IL-6) and IL-8 (15), and cause disruption of the internal elastic lamina, intimal thickening, and decreased smooth muscle cells in the media (16).
In the current patient, the subclinical VZV reactivation in trigeminal ganglia caused vasculopathy five months after shingles without cranial nerve palsy. VZV reactivation can cause cranial nerve palsy, such as shingles of the trigeminal nerve and Hunt syndrome. However, our patient had vasculopathy and ischemic stroke without any cranial nerve palsies. This may be because of the different mechanisms between vasculopathy and cranial nerve palsy. Whereas vasculopathy is caused by reactivate VZV reaching transaxonally to blood vessels and inflammatory response, the major pathology of cranial nerve palsy after shingles and Hunt syndrome is viral neuritis (17,18). Shingles is generally a monophasic disease, and the recurrence rate is less than 5% (19). Therefore, the present patient did not develop neuritis of the cranial nerve, as she had already presented shingles on the sacral distribution and been treated with amenamevir.
A previous review recommended treating VZV vasculopathy with intravenous acyclovir, 10-15 mg/kg three times daily, for a minimum of 14 days, and oral prednisone 1 mg/kg/day for five days (1). In the present patient, the dose and duration of acyclovir were sufficient, as intrathecal synthesis of anti-VZV antibody remained suppressed seven months after discharge. Increasing the dose of aspirin and methylprednisolone pulse therapy might have been effective to suppress the immune response and inflammatory cascade and improved the stenotic and gadolinium-enhanced vessel wall at the top of the ICA.
Conclusion
Progressive ICA stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma caused acute ischemic stroke. Treatment for VZV vasculopathy improved the intracranial stenotic lesion.
The authors state that they have no Conflict of Interest (COI). | ACYCLOVIR, ASPIRIN, METHYLPREDNISOLONE, PREDNISONE, ROSUVASTATIN | DrugsGivenReaction | CC BY-NC-ND | 33390495 | 20,642,002 | 2021-06-01 |
What was the administration route of drug 'ACYCLOVIR'? | Acute Stroke Caused by Progressive Intracranial Artery Stenosis Due to Varicella Zoster Virus Vasculopathy after Chemotherapy for Malignant Lymphoma.
Decreased cell-mediated immunity can reactivate Varicella zoster virus (VZV), which can lead to various neurological complications, including vasculopathy. We herein report the case of a patient with acute stroke with progressive internal carotid artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma. Treatment for VZV vasculopathy improved the stenosis and prevented recurrent stroke. VZV vasculopathy is an important treatable cause of stroke in immunosuppressed patients.
Introduction
Varicella zoster virus (VZV) is a highly neurotropic virus. After primary infection causing chicken pox, VZV remains latent in the cranial nerve ganglia, dorsal root ganglia, and autonomic ganglia along the entire neuraxis (1). Decreased cell-mediated immunity due to aging or immunosuppression reactivates VZV and results in various neurological complications, such as vasculopathy, as well as shingles (1). Malignant lymphoma, the most common hematologic malignancy, causes immunosuppression through either the disease itself or chemotherapy, and this sometimes results in VZV reactivation (2,3).
We herein report the case of an acute stroke patient with progressive intracranial artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma.
Case Report
A 62-year-old woman with a history of follicular lymphoma was treated with chemotherapy [6 courses of bendamustine plus rituximab therapy (B-R)] and achieved complete remission. Lymphocytopenia continued after chemotherapy (Fig. 1). She developed shingles on the left buttock 5 months after the chemotherapy and was treated with amenamevir 400 mg for 7 days. Five months after the shingles, she suddenly developed transient right upper limb paralysis and arrived at our emergency room. She had no history of headache and no vascular risk factors other than dyslipidemia.
Figure 1. Changes in the lymphocyte count. The black arrow indicates one course of bendamustine plus rituximab therapy. The white arrow indicates one course of steroid pulse therapy. The black arrowhead indicates the onset of shingles. The white arrowhead indicates the onset of varicella zoster virus vasculopathy.
She had dark red scars in the left sacral distribution. She had no focal neurological symptoms. Her National Institutes of Health Stroke scale (NIHSS) score was 0. On a laboratory examination, the white blood cell count was 5,300 /μL, and the lymphocyte count was 572 /μL (Fig. 1). Serological tests other than low-density lipoprotein (LDL)-cholesterol (149 mg/dL) were normal. On immunological testing, the IgG and IgA values were low [IgG: 667 mg/dL (861-1,741 mg/dL), IgA: 51 mg/dL (93-393 mg/dL)]. Coagulation assays and autoantibodies were normal. Anti-VZV antibody and anti-cytomegalovirus (CMV) antibody showed a prior infectious pattern.
Chest X-ray, electrocardiography, and echocardiography findings were normal. Brain magnetic resonance imaging (MRI) showed a small acute cerebral infarction in the cortical region of the left frontal lobe (Fig. 2A). MR angiography (MRA) showed the loss of the blood flow signal at the top of the left internal carotid artery (ICA) (Fig. 2B), and three-dimensional (3D) rotational angiography showed severe stenosis in the lesion (Fig. 2C). However, on contrast-enhanced CT three months before admission as follow-up for malignant lymphoma, the top of the ICA had no steno-occlusive lesions (Fig. 3A). Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging; VWI) showed concentric vessel wall enhancement at the top of the left ICA (Fig. 3B-D). The wall enhancement index (WEI) of the stenotic lesion (4) was 2.66. Cerebrospinal fluid (CSF) analyses showed a slightly elevated protein level. Polymerase chain reaction (PCR) for VZV DNA in CSF was negative. In contrast, VZV-IgM was positive in CSF, and the anti-VZV IgG antibody index [4.17 (>2.0)] increased, which meant increasing intrathecal synthesis of anti-VZV IgG antibody. A diagnosis of acute ischemic stroke due to intracranial arterial stenosis caused by VZV vasculopathy was therefore made.
Figure 2. Brain imaging findings. (A) MRI was performed on admission using a 1.5-T MRI scanner. Axial DWI (TR 6,000 ms, TE 100 ms, b-value 1,000 sec/mm2) showed a small, high-intensity signal in the left middle cerebral artery (MCA) region. (B) MRA (Time of flight, TR 32 ms, TE 6.8 ms) on admission showed severe stenosis at the top of the left internal carotid artery (ICA), and the signal from the blood flow of the left MCA was lower than that of the contralateral MCA. (C) 3D-reconstruction of left ICA rotation angiography showed severe stenosis at the top of the left ICA.
Figure 3. Time course of vascular morphology in varicella zoster virus vasculopathy. (A) 3D reconstruction of contrast-enhanced CT 3 months before admission for follow-up of malignant lymphoma showed no stenosis or abnormal findings at the top of the left ICA. The reason for the blurred image is that the primary purpose was not for a vascular assessment. (B) MRA (time of flight, TOF; TR 18 ms, TE 3.9 ms) on 3-T MRI on admission. (C) T1-weighted imaging (TIWI; TR 650 ms, TE 16.5 ms) on 3-T MRI on admission showed the thickened vessel wall of the left internal carotid artery (ICA) compared with the contralateral ICA. (D) Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging, VWI; TR 550 ms, TE 17 ms) on 3-T MRI on admission showed concentric enhancement in the thickened vessel wall of the left ICA. (E) MRA (TOF, TR 18 ms, TE 3.9 ms) on 3-T MRI seven months after admission showed improvement of the signal intensity of the blood flow at the top of the left ICA. (F) T1WI (TR 650 ms, TE 16.5 ms) on 3-T MRI seven months after admission showed improvement of vessel wall thickening of the left ICA. (G) VWI (TR 550 ms, TE 17 ms) on 3-T MRI seven months after admission showed decreased enhancement in the vessel wall of the left ICA. In addition, the left ICA vessel lumen was expanded. The white arrow indicates the top of the left ICA. The white arrowhead indicates the vessel wall of the left ICA.
The patient was treated with oral aspirin 100 mg per day, rosuvastatin 2.5 mg per day, intravenous acyclovir 10 mg/kg every 8 hours for 4 days, and oral prednisone 1 mg/kg for 5 days. Despite these therapies, MRI at 17 days after admission showed recurrence of asymptomatic cerebral infarction in the left ICA region. Intravenous methylprednisolone 1,000 mg per day was then given for 3 days, and the dosage of aspirin was increased to 200 mg per day. She then had no recurrence of stroke. She was discharged 31 days from admission and continued aspirin 200 mg per day.
MRA and VWI at 7 months after admission showed improvement of the stenosis of the left ICA and reduced vessel wall enhancement (Fig. 3E-G). The WEI of the stenotic lesion had decreased to 1.22. In addition, anti-VZV antibody IgM was negative, and the anti-VZV IgG antibody index (1.19) had also decreased by 7 months after admission. She showed no further exacerbations of neurological symptoms and no recurrent stroke, and she lived her daily life at home.
Discussion
We encountered a patient with acute stroke caused by progressive severe stenosis at the top of the left ICA after chemotherapy for follicular lymphoma who was diagnosed with VZV vasculopathy by intrathecal synthesis of anti-VZV antibody (1,5).
To our knowledge, this is the first report of VZV vasculopathy after B-R. VZV reactivation occurs in 12.2% of non-Hodgkin lymphoma patients receiving chemotherapy (2). Most VZV reactivations occur within first two years after the diagnosis of lymphoma, and the risk factors are women, diabetes mellitus, and multiple courses of chemotherapy (2). The risk also depends on the kind of chemotherapy (2,6). The present patient was treated with six courses of B-R before VZV reactivation. Lymphocytopenia continued after B-R, and this reduced cell-mediated immunity caused VZV reactivation, with vasculopathy consequently developing (Fig. 1). B-R is a standard treatment for several indolent B cell lymphomas (7). Bendamustine is known to cause myelosuppression, including lymphocytopenia, mostly with decreased CD4+ T lymphocytes and a decreased cell-mediated immunity over seven to nine months (8). Rituximab causes B cell depletion and induces substantial T cell depletion, mainly of CD4+ cells (9). Thus, B-R causes both T cell and B cell depletion (8) and leads to impaired cell-mediated immunity.
The morphological changes of the ICA before and after therapy for VZV vasculopathy were observed. A limited number of studies have reported the improvement of vascular morphology after treatment for VZV vasculopathy with long-term follow-up (10), and few reports have shown the time course of VZV vasculopathy from before the onset to the recovery process. A previous study reported that VWI was useful for the follow-up of vascular morphology and evaluating the treatment effect of VZV vasculopathy (10). Furthermore, the present patient showed improvement of the WEI value (4) of stenotic lesions, which is thought to reflect the degree of vessel wall inflammation.
Although computed tomography angiography (CTA) three months before admission in the present patient showed no stenosis in the intracranial arteries, VWI on admission showed concentric severe stenosis with gadolinium enhancement, which is the characteristic finding of vasculitis at the top of the left ICA (11). Seven months after treatment, VWI showed improvement of the left ICA stenosis, a decreasing WEI, and vessel wall thickening. The patient showed deterioration and improvement of intracranial artery stenosis in association with VZV vasculopathy activity.
In the present patient, the stenosis limited to the top of ICA appeared to have been related to the pathological mechanism of VZV vasculopathy. Seventy percent of patients with VZV vasculopathy had vascular abnormalities on angiography, and 50% of them were distributed in both large and small arteries, 37% in small arteries exclusively, and 13% in large arteries exclusively (1). The trigeminal ganglia in which VZV is latently located predominantly project nerve fibers to the ipsilateral proximal middle cerebral artery (MCA), anterior cerebral artery (ACA), and the top of the ICA (12). VZV in the trigeminal ganglia reactivated without a simultaneous rash in the sacral ganglion distribution because 37% of VZV vasculopathy occurred without a rash (13), although the previous zoster infection in the current patient involved the left sacral distribution. Therefore, VZV reactivation in the trigeminal ganglia reaches the ICA wall transaxonally. After reaching the adventitia, the virus spreads transmurally, causing infection in the cerebral arteries (1). VZV-infected cells in the adventitia induce neutrophil, macrophage, and T lymphocyte chemotaxis (14), increase the levels of various soluble factors such as interleukin 6 (IL-6) and IL-8 (15), and cause disruption of the internal elastic lamina, intimal thickening, and decreased smooth muscle cells in the media (16).
In the current patient, the subclinical VZV reactivation in trigeminal ganglia caused vasculopathy five months after shingles without cranial nerve palsy. VZV reactivation can cause cranial nerve palsy, such as shingles of the trigeminal nerve and Hunt syndrome. However, our patient had vasculopathy and ischemic stroke without any cranial nerve palsies. This may be because of the different mechanisms between vasculopathy and cranial nerve palsy. Whereas vasculopathy is caused by reactivate VZV reaching transaxonally to blood vessels and inflammatory response, the major pathology of cranial nerve palsy after shingles and Hunt syndrome is viral neuritis (17,18). Shingles is generally a monophasic disease, and the recurrence rate is less than 5% (19). Therefore, the present patient did not develop neuritis of the cranial nerve, as she had already presented shingles on the sacral distribution and been treated with amenamevir.
A previous review recommended treating VZV vasculopathy with intravenous acyclovir, 10-15 mg/kg three times daily, for a minimum of 14 days, and oral prednisone 1 mg/kg/day for five days (1). In the present patient, the dose and duration of acyclovir were sufficient, as intrathecal synthesis of anti-VZV antibody remained suppressed seven months after discharge. Increasing the dose of aspirin and methylprednisolone pulse therapy might have been effective to suppress the immune response and inflammatory cascade and improved the stenotic and gadolinium-enhanced vessel wall at the top of the ICA.
Conclusion
Progressive ICA stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma caused acute ischemic stroke. Treatment for VZV vasculopathy improved the intracranial stenotic lesion.
The authors state that they have no Conflict of Interest (COI). | Intravenous (not otherwise specified) | DrugAdministrationRoute | CC BY-NC-ND | 33390495 | 20,642,002 | 2021-06-01 |
What was the administration route of drug 'ASPIRIN'? | Acute Stroke Caused by Progressive Intracranial Artery Stenosis Due to Varicella Zoster Virus Vasculopathy after Chemotherapy for Malignant Lymphoma.
Decreased cell-mediated immunity can reactivate Varicella zoster virus (VZV), which can lead to various neurological complications, including vasculopathy. We herein report the case of a patient with acute stroke with progressive internal carotid artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma. Treatment for VZV vasculopathy improved the stenosis and prevented recurrent stroke. VZV vasculopathy is an important treatable cause of stroke in immunosuppressed patients.
Introduction
Varicella zoster virus (VZV) is a highly neurotropic virus. After primary infection causing chicken pox, VZV remains latent in the cranial nerve ganglia, dorsal root ganglia, and autonomic ganglia along the entire neuraxis (1). Decreased cell-mediated immunity due to aging or immunosuppression reactivates VZV and results in various neurological complications, such as vasculopathy, as well as shingles (1). Malignant lymphoma, the most common hematologic malignancy, causes immunosuppression through either the disease itself or chemotherapy, and this sometimes results in VZV reactivation (2,3).
We herein report the case of an acute stroke patient with progressive intracranial artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma.
Case Report
A 62-year-old woman with a history of follicular lymphoma was treated with chemotherapy [6 courses of bendamustine plus rituximab therapy (B-R)] and achieved complete remission. Lymphocytopenia continued after chemotherapy (Fig. 1). She developed shingles on the left buttock 5 months after the chemotherapy and was treated with amenamevir 400 mg for 7 days. Five months after the shingles, she suddenly developed transient right upper limb paralysis and arrived at our emergency room. She had no history of headache and no vascular risk factors other than dyslipidemia.
Figure 1. Changes in the lymphocyte count. The black arrow indicates one course of bendamustine plus rituximab therapy. The white arrow indicates one course of steroid pulse therapy. The black arrowhead indicates the onset of shingles. The white arrowhead indicates the onset of varicella zoster virus vasculopathy.
She had dark red scars in the left sacral distribution. She had no focal neurological symptoms. Her National Institutes of Health Stroke scale (NIHSS) score was 0. On a laboratory examination, the white blood cell count was 5,300 /μL, and the lymphocyte count was 572 /μL (Fig. 1). Serological tests other than low-density lipoprotein (LDL)-cholesterol (149 mg/dL) were normal. On immunological testing, the IgG and IgA values were low [IgG: 667 mg/dL (861-1,741 mg/dL), IgA: 51 mg/dL (93-393 mg/dL)]. Coagulation assays and autoantibodies were normal. Anti-VZV antibody and anti-cytomegalovirus (CMV) antibody showed a prior infectious pattern.
Chest X-ray, electrocardiography, and echocardiography findings were normal. Brain magnetic resonance imaging (MRI) showed a small acute cerebral infarction in the cortical region of the left frontal lobe (Fig. 2A). MR angiography (MRA) showed the loss of the blood flow signal at the top of the left internal carotid artery (ICA) (Fig. 2B), and three-dimensional (3D) rotational angiography showed severe stenosis in the lesion (Fig. 2C). However, on contrast-enhanced CT three months before admission as follow-up for malignant lymphoma, the top of the ICA had no steno-occlusive lesions (Fig. 3A). Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging; VWI) showed concentric vessel wall enhancement at the top of the left ICA (Fig. 3B-D). The wall enhancement index (WEI) of the stenotic lesion (4) was 2.66. Cerebrospinal fluid (CSF) analyses showed a slightly elevated protein level. Polymerase chain reaction (PCR) for VZV DNA in CSF was negative. In contrast, VZV-IgM was positive in CSF, and the anti-VZV IgG antibody index [4.17 (>2.0)] increased, which meant increasing intrathecal synthesis of anti-VZV IgG antibody. A diagnosis of acute ischemic stroke due to intracranial arterial stenosis caused by VZV vasculopathy was therefore made.
Figure 2. Brain imaging findings. (A) MRI was performed on admission using a 1.5-T MRI scanner. Axial DWI (TR 6,000 ms, TE 100 ms, b-value 1,000 sec/mm2) showed a small, high-intensity signal in the left middle cerebral artery (MCA) region. (B) MRA (Time of flight, TR 32 ms, TE 6.8 ms) on admission showed severe stenosis at the top of the left internal carotid artery (ICA), and the signal from the blood flow of the left MCA was lower than that of the contralateral MCA. (C) 3D-reconstruction of left ICA rotation angiography showed severe stenosis at the top of the left ICA.
Figure 3. Time course of vascular morphology in varicella zoster virus vasculopathy. (A) 3D reconstruction of contrast-enhanced CT 3 months before admission for follow-up of malignant lymphoma showed no stenosis or abnormal findings at the top of the left ICA. The reason for the blurred image is that the primary purpose was not for a vascular assessment. (B) MRA (time of flight, TOF; TR 18 ms, TE 3.9 ms) on 3-T MRI on admission. (C) T1-weighted imaging (TIWI; TR 650 ms, TE 16.5 ms) on 3-T MRI on admission showed the thickened vessel wall of the left internal carotid artery (ICA) compared with the contralateral ICA. (D) Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging, VWI; TR 550 ms, TE 17 ms) on 3-T MRI on admission showed concentric enhancement in the thickened vessel wall of the left ICA. (E) MRA (TOF, TR 18 ms, TE 3.9 ms) on 3-T MRI seven months after admission showed improvement of the signal intensity of the blood flow at the top of the left ICA. (F) T1WI (TR 650 ms, TE 16.5 ms) on 3-T MRI seven months after admission showed improvement of vessel wall thickening of the left ICA. (G) VWI (TR 550 ms, TE 17 ms) on 3-T MRI seven months after admission showed decreased enhancement in the vessel wall of the left ICA. In addition, the left ICA vessel lumen was expanded. The white arrow indicates the top of the left ICA. The white arrowhead indicates the vessel wall of the left ICA.
The patient was treated with oral aspirin 100 mg per day, rosuvastatin 2.5 mg per day, intravenous acyclovir 10 mg/kg every 8 hours for 4 days, and oral prednisone 1 mg/kg for 5 days. Despite these therapies, MRI at 17 days after admission showed recurrence of asymptomatic cerebral infarction in the left ICA region. Intravenous methylprednisolone 1,000 mg per day was then given for 3 days, and the dosage of aspirin was increased to 200 mg per day. She then had no recurrence of stroke. She was discharged 31 days from admission and continued aspirin 200 mg per day.
MRA and VWI at 7 months after admission showed improvement of the stenosis of the left ICA and reduced vessel wall enhancement (Fig. 3E-G). The WEI of the stenotic lesion had decreased to 1.22. In addition, anti-VZV antibody IgM was negative, and the anti-VZV IgG antibody index (1.19) had also decreased by 7 months after admission. She showed no further exacerbations of neurological symptoms and no recurrent stroke, and she lived her daily life at home.
Discussion
We encountered a patient with acute stroke caused by progressive severe stenosis at the top of the left ICA after chemotherapy for follicular lymphoma who was diagnosed with VZV vasculopathy by intrathecal synthesis of anti-VZV antibody (1,5).
To our knowledge, this is the first report of VZV vasculopathy after B-R. VZV reactivation occurs in 12.2% of non-Hodgkin lymphoma patients receiving chemotherapy (2). Most VZV reactivations occur within first two years after the diagnosis of lymphoma, and the risk factors are women, diabetes mellitus, and multiple courses of chemotherapy (2). The risk also depends on the kind of chemotherapy (2,6). The present patient was treated with six courses of B-R before VZV reactivation. Lymphocytopenia continued after B-R, and this reduced cell-mediated immunity caused VZV reactivation, with vasculopathy consequently developing (Fig. 1). B-R is a standard treatment for several indolent B cell lymphomas (7). Bendamustine is known to cause myelosuppression, including lymphocytopenia, mostly with decreased CD4+ T lymphocytes and a decreased cell-mediated immunity over seven to nine months (8). Rituximab causes B cell depletion and induces substantial T cell depletion, mainly of CD4+ cells (9). Thus, B-R causes both T cell and B cell depletion (8) and leads to impaired cell-mediated immunity.
The morphological changes of the ICA before and after therapy for VZV vasculopathy were observed. A limited number of studies have reported the improvement of vascular morphology after treatment for VZV vasculopathy with long-term follow-up (10), and few reports have shown the time course of VZV vasculopathy from before the onset to the recovery process. A previous study reported that VWI was useful for the follow-up of vascular morphology and evaluating the treatment effect of VZV vasculopathy (10). Furthermore, the present patient showed improvement of the WEI value (4) of stenotic lesions, which is thought to reflect the degree of vessel wall inflammation.
Although computed tomography angiography (CTA) three months before admission in the present patient showed no stenosis in the intracranial arteries, VWI on admission showed concentric severe stenosis with gadolinium enhancement, which is the characteristic finding of vasculitis at the top of the left ICA (11). Seven months after treatment, VWI showed improvement of the left ICA stenosis, a decreasing WEI, and vessel wall thickening. The patient showed deterioration and improvement of intracranial artery stenosis in association with VZV vasculopathy activity.
In the present patient, the stenosis limited to the top of ICA appeared to have been related to the pathological mechanism of VZV vasculopathy. Seventy percent of patients with VZV vasculopathy had vascular abnormalities on angiography, and 50% of them were distributed in both large and small arteries, 37% in small arteries exclusively, and 13% in large arteries exclusively (1). The trigeminal ganglia in which VZV is latently located predominantly project nerve fibers to the ipsilateral proximal middle cerebral artery (MCA), anterior cerebral artery (ACA), and the top of the ICA (12). VZV in the trigeminal ganglia reactivated without a simultaneous rash in the sacral ganglion distribution because 37% of VZV vasculopathy occurred without a rash (13), although the previous zoster infection in the current patient involved the left sacral distribution. Therefore, VZV reactivation in the trigeminal ganglia reaches the ICA wall transaxonally. After reaching the adventitia, the virus spreads transmurally, causing infection in the cerebral arteries (1). VZV-infected cells in the adventitia induce neutrophil, macrophage, and T lymphocyte chemotaxis (14), increase the levels of various soluble factors such as interleukin 6 (IL-6) and IL-8 (15), and cause disruption of the internal elastic lamina, intimal thickening, and decreased smooth muscle cells in the media (16).
In the current patient, the subclinical VZV reactivation in trigeminal ganglia caused vasculopathy five months after shingles without cranial nerve palsy. VZV reactivation can cause cranial nerve palsy, such as shingles of the trigeminal nerve and Hunt syndrome. However, our patient had vasculopathy and ischemic stroke without any cranial nerve palsies. This may be because of the different mechanisms between vasculopathy and cranial nerve palsy. Whereas vasculopathy is caused by reactivate VZV reaching transaxonally to blood vessels and inflammatory response, the major pathology of cranial nerve palsy after shingles and Hunt syndrome is viral neuritis (17,18). Shingles is generally a monophasic disease, and the recurrence rate is less than 5% (19). Therefore, the present patient did not develop neuritis of the cranial nerve, as she had already presented shingles on the sacral distribution and been treated with amenamevir.
A previous review recommended treating VZV vasculopathy with intravenous acyclovir, 10-15 mg/kg three times daily, for a minimum of 14 days, and oral prednisone 1 mg/kg/day for five days (1). In the present patient, the dose and duration of acyclovir were sufficient, as intrathecal synthesis of anti-VZV antibody remained suppressed seven months after discharge. Increasing the dose of aspirin and methylprednisolone pulse therapy might have been effective to suppress the immune response and inflammatory cascade and improved the stenotic and gadolinium-enhanced vessel wall at the top of the ICA.
Conclusion
Progressive ICA stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma caused acute ischemic stroke. Treatment for VZV vasculopathy improved the intracranial stenotic lesion.
The authors state that they have no Conflict of Interest (COI). | Oral | DrugAdministrationRoute | CC BY-NC-ND | 33390495 | 20,642,002 | 2021-06-01 |
What was the administration route of drug 'METHYLPREDNISOLONE'? | Acute Stroke Caused by Progressive Intracranial Artery Stenosis Due to Varicella Zoster Virus Vasculopathy after Chemotherapy for Malignant Lymphoma.
Decreased cell-mediated immunity can reactivate Varicella zoster virus (VZV), which can lead to various neurological complications, including vasculopathy. We herein report the case of a patient with acute stroke with progressive internal carotid artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma. Treatment for VZV vasculopathy improved the stenosis and prevented recurrent stroke. VZV vasculopathy is an important treatable cause of stroke in immunosuppressed patients.
Introduction
Varicella zoster virus (VZV) is a highly neurotropic virus. After primary infection causing chicken pox, VZV remains latent in the cranial nerve ganglia, dorsal root ganglia, and autonomic ganglia along the entire neuraxis (1). Decreased cell-mediated immunity due to aging or immunosuppression reactivates VZV and results in various neurological complications, such as vasculopathy, as well as shingles (1). Malignant lymphoma, the most common hematologic malignancy, causes immunosuppression through either the disease itself or chemotherapy, and this sometimes results in VZV reactivation (2,3).
We herein report the case of an acute stroke patient with progressive intracranial artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma.
Case Report
A 62-year-old woman with a history of follicular lymphoma was treated with chemotherapy [6 courses of bendamustine plus rituximab therapy (B-R)] and achieved complete remission. Lymphocytopenia continued after chemotherapy (Fig. 1). She developed shingles on the left buttock 5 months after the chemotherapy and was treated with amenamevir 400 mg for 7 days. Five months after the shingles, she suddenly developed transient right upper limb paralysis and arrived at our emergency room. She had no history of headache and no vascular risk factors other than dyslipidemia.
Figure 1. Changes in the lymphocyte count. The black arrow indicates one course of bendamustine plus rituximab therapy. The white arrow indicates one course of steroid pulse therapy. The black arrowhead indicates the onset of shingles. The white arrowhead indicates the onset of varicella zoster virus vasculopathy.
She had dark red scars in the left sacral distribution. She had no focal neurological symptoms. Her National Institutes of Health Stroke scale (NIHSS) score was 0. On a laboratory examination, the white blood cell count was 5,300 /μL, and the lymphocyte count was 572 /μL (Fig. 1). Serological tests other than low-density lipoprotein (LDL)-cholesterol (149 mg/dL) were normal. On immunological testing, the IgG and IgA values were low [IgG: 667 mg/dL (861-1,741 mg/dL), IgA: 51 mg/dL (93-393 mg/dL)]. Coagulation assays and autoantibodies were normal. Anti-VZV antibody and anti-cytomegalovirus (CMV) antibody showed a prior infectious pattern.
Chest X-ray, electrocardiography, and echocardiography findings were normal. Brain magnetic resonance imaging (MRI) showed a small acute cerebral infarction in the cortical region of the left frontal lobe (Fig. 2A). MR angiography (MRA) showed the loss of the blood flow signal at the top of the left internal carotid artery (ICA) (Fig. 2B), and three-dimensional (3D) rotational angiography showed severe stenosis in the lesion (Fig. 2C). However, on contrast-enhanced CT three months before admission as follow-up for malignant lymphoma, the top of the ICA had no steno-occlusive lesions (Fig. 3A). Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging; VWI) showed concentric vessel wall enhancement at the top of the left ICA (Fig. 3B-D). The wall enhancement index (WEI) of the stenotic lesion (4) was 2.66. Cerebrospinal fluid (CSF) analyses showed a slightly elevated protein level. Polymerase chain reaction (PCR) for VZV DNA in CSF was negative. In contrast, VZV-IgM was positive in CSF, and the anti-VZV IgG antibody index [4.17 (>2.0)] increased, which meant increasing intrathecal synthesis of anti-VZV IgG antibody. A diagnosis of acute ischemic stroke due to intracranial arterial stenosis caused by VZV vasculopathy was therefore made.
Figure 2. Brain imaging findings. (A) MRI was performed on admission using a 1.5-T MRI scanner. Axial DWI (TR 6,000 ms, TE 100 ms, b-value 1,000 sec/mm2) showed a small, high-intensity signal in the left middle cerebral artery (MCA) region. (B) MRA (Time of flight, TR 32 ms, TE 6.8 ms) on admission showed severe stenosis at the top of the left internal carotid artery (ICA), and the signal from the blood flow of the left MCA was lower than that of the contralateral MCA. (C) 3D-reconstruction of left ICA rotation angiography showed severe stenosis at the top of the left ICA.
Figure 3. Time course of vascular morphology in varicella zoster virus vasculopathy. (A) 3D reconstruction of contrast-enhanced CT 3 months before admission for follow-up of malignant lymphoma showed no stenosis or abnormal findings at the top of the left ICA. The reason for the blurred image is that the primary purpose was not for a vascular assessment. (B) MRA (time of flight, TOF; TR 18 ms, TE 3.9 ms) on 3-T MRI on admission. (C) T1-weighted imaging (TIWI; TR 650 ms, TE 16.5 ms) on 3-T MRI on admission showed the thickened vessel wall of the left internal carotid artery (ICA) compared with the contralateral ICA. (D) Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging, VWI; TR 550 ms, TE 17 ms) on 3-T MRI on admission showed concentric enhancement in the thickened vessel wall of the left ICA. (E) MRA (TOF, TR 18 ms, TE 3.9 ms) on 3-T MRI seven months after admission showed improvement of the signal intensity of the blood flow at the top of the left ICA. (F) T1WI (TR 650 ms, TE 16.5 ms) on 3-T MRI seven months after admission showed improvement of vessel wall thickening of the left ICA. (G) VWI (TR 550 ms, TE 17 ms) on 3-T MRI seven months after admission showed decreased enhancement in the vessel wall of the left ICA. In addition, the left ICA vessel lumen was expanded. The white arrow indicates the top of the left ICA. The white arrowhead indicates the vessel wall of the left ICA.
The patient was treated with oral aspirin 100 mg per day, rosuvastatin 2.5 mg per day, intravenous acyclovir 10 mg/kg every 8 hours for 4 days, and oral prednisone 1 mg/kg for 5 days. Despite these therapies, MRI at 17 days after admission showed recurrence of asymptomatic cerebral infarction in the left ICA region. Intravenous methylprednisolone 1,000 mg per day was then given for 3 days, and the dosage of aspirin was increased to 200 mg per day. She then had no recurrence of stroke. She was discharged 31 days from admission and continued aspirin 200 mg per day.
MRA and VWI at 7 months after admission showed improvement of the stenosis of the left ICA and reduced vessel wall enhancement (Fig. 3E-G). The WEI of the stenotic lesion had decreased to 1.22. In addition, anti-VZV antibody IgM was negative, and the anti-VZV IgG antibody index (1.19) had also decreased by 7 months after admission. She showed no further exacerbations of neurological symptoms and no recurrent stroke, and she lived her daily life at home.
Discussion
We encountered a patient with acute stroke caused by progressive severe stenosis at the top of the left ICA after chemotherapy for follicular lymphoma who was diagnosed with VZV vasculopathy by intrathecal synthesis of anti-VZV antibody (1,5).
To our knowledge, this is the first report of VZV vasculopathy after B-R. VZV reactivation occurs in 12.2% of non-Hodgkin lymphoma patients receiving chemotherapy (2). Most VZV reactivations occur within first two years after the diagnosis of lymphoma, and the risk factors are women, diabetes mellitus, and multiple courses of chemotherapy (2). The risk also depends on the kind of chemotherapy (2,6). The present patient was treated with six courses of B-R before VZV reactivation. Lymphocytopenia continued after B-R, and this reduced cell-mediated immunity caused VZV reactivation, with vasculopathy consequently developing (Fig. 1). B-R is a standard treatment for several indolent B cell lymphomas (7). Bendamustine is known to cause myelosuppression, including lymphocytopenia, mostly with decreased CD4+ T lymphocytes and a decreased cell-mediated immunity over seven to nine months (8). Rituximab causes B cell depletion and induces substantial T cell depletion, mainly of CD4+ cells (9). Thus, B-R causes both T cell and B cell depletion (8) and leads to impaired cell-mediated immunity.
The morphological changes of the ICA before and after therapy for VZV vasculopathy were observed. A limited number of studies have reported the improvement of vascular morphology after treatment for VZV vasculopathy with long-term follow-up (10), and few reports have shown the time course of VZV vasculopathy from before the onset to the recovery process. A previous study reported that VWI was useful for the follow-up of vascular morphology and evaluating the treatment effect of VZV vasculopathy (10). Furthermore, the present patient showed improvement of the WEI value (4) of stenotic lesions, which is thought to reflect the degree of vessel wall inflammation.
Although computed tomography angiography (CTA) three months before admission in the present patient showed no stenosis in the intracranial arteries, VWI on admission showed concentric severe stenosis with gadolinium enhancement, which is the characteristic finding of vasculitis at the top of the left ICA (11). Seven months after treatment, VWI showed improvement of the left ICA stenosis, a decreasing WEI, and vessel wall thickening. The patient showed deterioration and improvement of intracranial artery stenosis in association with VZV vasculopathy activity.
In the present patient, the stenosis limited to the top of ICA appeared to have been related to the pathological mechanism of VZV vasculopathy. Seventy percent of patients with VZV vasculopathy had vascular abnormalities on angiography, and 50% of them were distributed in both large and small arteries, 37% in small arteries exclusively, and 13% in large arteries exclusively (1). The trigeminal ganglia in which VZV is latently located predominantly project nerve fibers to the ipsilateral proximal middle cerebral artery (MCA), anterior cerebral artery (ACA), and the top of the ICA (12). VZV in the trigeminal ganglia reactivated without a simultaneous rash in the sacral ganglion distribution because 37% of VZV vasculopathy occurred without a rash (13), although the previous zoster infection in the current patient involved the left sacral distribution. Therefore, VZV reactivation in the trigeminal ganglia reaches the ICA wall transaxonally. After reaching the adventitia, the virus spreads transmurally, causing infection in the cerebral arteries (1). VZV-infected cells in the adventitia induce neutrophil, macrophage, and T lymphocyte chemotaxis (14), increase the levels of various soluble factors such as interleukin 6 (IL-6) and IL-8 (15), and cause disruption of the internal elastic lamina, intimal thickening, and decreased smooth muscle cells in the media (16).
In the current patient, the subclinical VZV reactivation in trigeminal ganglia caused vasculopathy five months after shingles without cranial nerve palsy. VZV reactivation can cause cranial nerve palsy, such as shingles of the trigeminal nerve and Hunt syndrome. However, our patient had vasculopathy and ischemic stroke without any cranial nerve palsies. This may be because of the different mechanisms between vasculopathy and cranial nerve palsy. Whereas vasculopathy is caused by reactivate VZV reaching transaxonally to blood vessels and inflammatory response, the major pathology of cranial nerve palsy after shingles and Hunt syndrome is viral neuritis (17,18). Shingles is generally a monophasic disease, and the recurrence rate is less than 5% (19). Therefore, the present patient did not develop neuritis of the cranial nerve, as she had already presented shingles on the sacral distribution and been treated with amenamevir.
A previous review recommended treating VZV vasculopathy with intravenous acyclovir, 10-15 mg/kg three times daily, for a minimum of 14 days, and oral prednisone 1 mg/kg/day for five days (1). In the present patient, the dose and duration of acyclovir were sufficient, as intrathecal synthesis of anti-VZV antibody remained suppressed seven months after discharge. Increasing the dose of aspirin and methylprednisolone pulse therapy might have been effective to suppress the immune response and inflammatory cascade and improved the stenotic and gadolinium-enhanced vessel wall at the top of the ICA.
Conclusion
Progressive ICA stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma caused acute ischemic stroke. Treatment for VZV vasculopathy improved the intracranial stenotic lesion.
The authors state that they have no Conflict of Interest (COI). | Intravenous (not otherwise specified) | DrugAdministrationRoute | CC BY-NC-ND | 33390495 | 20,642,002 | 2021-06-01 |
What was the administration route of drug 'PREDNISONE'? | Acute Stroke Caused by Progressive Intracranial Artery Stenosis Due to Varicella Zoster Virus Vasculopathy after Chemotherapy for Malignant Lymphoma.
Decreased cell-mediated immunity can reactivate Varicella zoster virus (VZV), which can lead to various neurological complications, including vasculopathy. We herein report the case of a patient with acute stroke with progressive internal carotid artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma. Treatment for VZV vasculopathy improved the stenosis and prevented recurrent stroke. VZV vasculopathy is an important treatable cause of stroke in immunosuppressed patients.
Introduction
Varicella zoster virus (VZV) is a highly neurotropic virus. After primary infection causing chicken pox, VZV remains latent in the cranial nerve ganglia, dorsal root ganglia, and autonomic ganglia along the entire neuraxis (1). Decreased cell-mediated immunity due to aging or immunosuppression reactivates VZV and results in various neurological complications, such as vasculopathy, as well as shingles (1). Malignant lymphoma, the most common hematologic malignancy, causes immunosuppression through either the disease itself or chemotherapy, and this sometimes results in VZV reactivation (2,3).
We herein report the case of an acute stroke patient with progressive intracranial artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma.
Case Report
A 62-year-old woman with a history of follicular lymphoma was treated with chemotherapy [6 courses of bendamustine plus rituximab therapy (B-R)] and achieved complete remission. Lymphocytopenia continued after chemotherapy (Fig. 1). She developed shingles on the left buttock 5 months after the chemotherapy and was treated with amenamevir 400 mg for 7 days. Five months after the shingles, she suddenly developed transient right upper limb paralysis and arrived at our emergency room. She had no history of headache and no vascular risk factors other than dyslipidemia.
Figure 1. Changes in the lymphocyte count. The black arrow indicates one course of bendamustine plus rituximab therapy. The white arrow indicates one course of steroid pulse therapy. The black arrowhead indicates the onset of shingles. The white arrowhead indicates the onset of varicella zoster virus vasculopathy.
She had dark red scars in the left sacral distribution. She had no focal neurological symptoms. Her National Institutes of Health Stroke scale (NIHSS) score was 0. On a laboratory examination, the white blood cell count was 5,300 /μL, and the lymphocyte count was 572 /μL (Fig. 1). Serological tests other than low-density lipoprotein (LDL)-cholesterol (149 mg/dL) were normal. On immunological testing, the IgG and IgA values were low [IgG: 667 mg/dL (861-1,741 mg/dL), IgA: 51 mg/dL (93-393 mg/dL)]. Coagulation assays and autoantibodies were normal. Anti-VZV antibody and anti-cytomegalovirus (CMV) antibody showed a prior infectious pattern.
Chest X-ray, electrocardiography, and echocardiography findings were normal. Brain magnetic resonance imaging (MRI) showed a small acute cerebral infarction in the cortical region of the left frontal lobe (Fig. 2A). MR angiography (MRA) showed the loss of the blood flow signal at the top of the left internal carotid artery (ICA) (Fig. 2B), and three-dimensional (3D) rotational angiography showed severe stenosis in the lesion (Fig. 2C). However, on contrast-enhanced CT three months before admission as follow-up for malignant lymphoma, the top of the ICA had no steno-occlusive lesions (Fig. 3A). Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging; VWI) showed concentric vessel wall enhancement at the top of the left ICA (Fig. 3B-D). The wall enhancement index (WEI) of the stenotic lesion (4) was 2.66. Cerebrospinal fluid (CSF) analyses showed a slightly elevated protein level. Polymerase chain reaction (PCR) for VZV DNA in CSF was negative. In contrast, VZV-IgM was positive in CSF, and the anti-VZV IgG antibody index [4.17 (>2.0)] increased, which meant increasing intrathecal synthesis of anti-VZV IgG antibody. A diagnosis of acute ischemic stroke due to intracranial arterial stenosis caused by VZV vasculopathy was therefore made.
Figure 2. Brain imaging findings. (A) MRI was performed on admission using a 1.5-T MRI scanner. Axial DWI (TR 6,000 ms, TE 100 ms, b-value 1,000 sec/mm2) showed a small, high-intensity signal in the left middle cerebral artery (MCA) region. (B) MRA (Time of flight, TR 32 ms, TE 6.8 ms) on admission showed severe stenosis at the top of the left internal carotid artery (ICA), and the signal from the blood flow of the left MCA was lower than that of the contralateral MCA. (C) 3D-reconstruction of left ICA rotation angiography showed severe stenosis at the top of the left ICA.
Figure 3. Time course of vascular morphology in varicella zoster virus vasculopathy. (A) 3D reconstruction of contrast-enhanced CT 3 months before admission for follow-up of malignant lymphoma showed no stenosis or abnormal findings at the top of the left ICA. The reason for the blurred image is that the primary purpose was not for a vascular assessment. (B) MRA (time of flight, TOF; TR 18 ms, TE 3.9 ms) on 3-T MRI on admission. (C) T1-weighted imaging (TIWI; TR 650 ms, TE 16.5 ms) on 3-T MRI on admission showed the thickened vessel wall of the left internal carotid artery (ICA) compared with the contralateral ICA. (D) Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging, VWI; TR 550 ms, TE 17 ms) on 3-T MRI on admission showed concentric enhancement in the thickened vessel wall of the left ICA. (E) MRA (TOF, TR 18 ms, TE 3.9 ms) on 3-T MRI seven months after admission showed improvement of the signal intensity of the blood flow at the top of the left ICA. (F) T1WI (TR 650 ms, TE 16.5 ms) on 3-T MRI seven months after admission showed improvement of vessel wall thickening of the left ICA. (G) VWI (TR 550 ms, TE 17 ms) on 3-T MRI seven months after admission showed decreased enhancement in the vessel wall of the left ICA. In addition, the left ICA vessel lumen was expanded. The white arrow indicates the top of the left ICA. The white arrowhead indicates the vessel wall of the left ICA.
The patient was treated with oral aspirin 100 mg per day, rosuvastatin 2.5 mg per day, intravenous acyclovir 10 mg/kg every 8 hours for 4 days, and oral prednisone 1 mg/kg for 5 days. Despite these therapies, MRI at 17 days after admission showed recurrence of asymptomatic cerebral infarction in the left ICA region. Intravenous methylprednisolone 1,000 mg per day was then given for 3 days, and the dosage of aspirin was increased to 200 mg per day. She then had no recurrence of stroke. She was discharged 31 days from admission and continued aspirin 200 mg per day.
MRA and VWI at 7 months after admission showed improvement of the stenosis of the left ICA and reduced vessel wall enhancement (Fig. 3E-G). The WEI of the stenotic lesion had decreased to 1.22. In addition, anti-VZV antibody IgM was negative, and the anti-VZV IgG antibody index (1.19) had also decreased by 7 months after admission. She showed no further exacerbations of neurological symptoms and no recurrent stroke, and she lived her daily life at home.
Discussion
We encountered a patient with acute stroke caused by progressive severe stenosis at the top of the left ICA after chemotherapy for follicular lymphoma who was diagnosed with VZV vasculopathy by intrathecal synthesis of anti-VZV antibody (1,5).
To our knowledge, this is the first report of VZV vasculopathy after B-R. VZV reactivation occurs in 12.2% of non-Hodgkin lymphoma patients receiving chemotherapy (2). Most VZV reactivations occur within first two years after the diagnosis of lymphoma, and the risk factors are women, diabetes mellitus, and multiple courses of chemotherapy (2). The risk also depends on the kind of chemotherapy (2,6). The present patient was treated with six courses of B-R before VZV reactivation. Lymphocytopenia continued after B-R, and this reduced cell-mediated immunity caused VZV reactivation, with vasculopathy consequently developing (Fig. 1). B-R is a standard treatment for several indolent B cell lymphomas (7). Bendamustine is known to cause myelosuppression, including lymphocytopenia, mostly with decreased CD4+ T lymphocytes and a decreased cell-mediated immunity over seven to nine months (8). Rituximab causes B cell depletion and induces substantial T cell depletion, mainly of CD4+ cells (9). Thus, B-R causes both T cell and B cell depletion (8) and leads to impaired cell-mediated immunity.
The morphological changes of the ICA before and after therapy for VZV vasculopathy were observed. A limited number of studies have reported the improvement of vascular morphology after treatment for VZV vasculopathy with long-term follow-up (10), and few reports have shown the time course of VZV vasculopathy from before the onset to the recovery process. A previous study reported that VWI was useful for the follow-up of vascular morphology and evaluating the treatment effect of VZV vasculopathy (10). Furthermore, the present patient showed improvement of the WEI value (4) of stenotic lesions, which is thought to reflect the degree of vessel wall inflammation.
Although computed tomography angiography (CTA) three months before admission in the present patient showed no stenosis in the intracranial arteries, VWI on admission showed concentric severe stenosis with gadolinium enhancement, which is the characteristic finding of vasculitis at the top of the left ICA (11). Seven months after treatment, VWI showed improvement of the left ICA stenosis, a decreasing WEI, and vessel wall thickening. The patient showed deterioration and improvement of intracranial artery stenosis in association with VZV vasculopathy activity.
In the present patient, the stenosis limited to the top of ICA appeared to have been related to the pathological mechanism of VZV vasculopathy. Seventy percent of patients with VZV vasculopathy had vascular abnormalities on angiography, and 50% of them were distributed in both large and small arteries, 37% in small arteries exclusively, and 13% in large arteries exclusively (1). The trigeminal ganglia in which VZV is latently located predominantly project nerve fibers to the ipsilateral proximal middle cerebral artery (MCA), anterior cerebral artery (ACA), and the top of the ICA (12). VZV in the trigeminal ganglia reactivated without a simultaneous rash in the sacral ganglion distribution because 37% of VZV vasculopathy occurred without a rash (13), although the previous zoster infection in the current patient involved the left sacral distribution. Therefore, VZV reactivation in the trigeminal ganglia reaches the ICA wall transaxonally. After reaching the adventitia, the virus spreads transmurally, causing infection in the cerebral arteries (1). VZV-infected cells in the adventitia induce neutrophil, macrophage, and T lymphocyte chemotaxis (14), increase the levels of various soluble factors such as interleukin 6 (IL-6) and IL-8 (15), and cause disruption of the internal elastic lamina, intimal thickening, and decreased smooth muscle cells in the media (16).
In the current patient, the subclinical VZV reactivation in trigeminal ganglia caused vasculopathy five months after shingles without cranial nerve palsy. VZV reactivation can cause cranial nerve palsy, such as shingles of the trigeminal nerve and Hunt syndrome. However, our patient had vasculopathy and ischemic stroke without any cranial nerve palsies. This may be because of the different mechanisms between vasculopathy and cranial nerve palsy. Whereas vasculopathy is caused by reactivate VZV reaching transaxonally to blood vessels and inflammatory response, the major pathology of cranial nerve palsy after shingles and Hunt syndrome is viral neuritis (17,18). Shingles is generally a monophasic disease, and the recurrence rate is less than 5% (19). Therefore, the present patient did not develop neuritis of the cranial nerve, as she had already presented shingles on the sacral distribution and been treated with amenamevir.
A previous review recommended treating VZV vasculopathy with intravenous acyclovir, 10-15 mg/kg three times daily, for a minimum of 14 days, and oral prednisone 1 mg/kg/day for five days (1). In the present patient, the dose and duration of acyclovir were sufficient, as intrathecal synthesis of anti-VZV antibody remained suppressed seven months after discharge. Increasing the dose of aspirin and methylprednisolone pulse therapy might have been effective to suppress the immune response and inflammatory cascade and improved the stenotic and gadolinium-enhanced vessel wall at the top of the ICA.
Conclusion
Progressive ICA stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma caused acute ischemic stroke. Treatment for VZV vasculopathy improved the intracranial stenotic lesion.
The authors state that they have no Conflict of Interest (COI). | Oral | DrugAdministrationRoute | CC BY-NC-ND | 33390495 | 20,642,002 | 2021-06-01 |
What was the dosage of drug 'ACYCLOVIR'? | Acute Stroke Caused by Progressive Intracranial Artery Stenosis Due to Varicella Zoster Virus Vasculopathy after Chemotherapy for Malignant Lymphoma.
Decreased cell-mediated immunity can reactivate Varicella zoster virus (VZV), which can lead to various neurological complications, including vasculopathy. We herein report the case of a patient with acute stroke with progressive internal carotid artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma. Treatment for VZV vasculopathy improved the stenosis and prevented recurrent stroke. VZV vasculopathy is an important treatable cause of stroke in immunosuppressed patients.
Introduction
Varicella zoster virus (VZV) is a highly neurotropic virus. After primary infection causing chicken pox, VZV remains latent in the cranial nerve ganglia, dorsal root ganglia, and autonomic ganglia along the entire neuraxis (1). Decreased cell-mediated immunity due to aging or immunosuppression reactivates VZV and results in various neurological complications, such as vasculopathy, as well as shingles (1). Malignant lymphoma, the most common hematologic malignancy, causes immunosuppression through either the disease itself or chemotherapy, and this sometimes results in VZV reactivation (2,3).
We herein report the case of an acute stroke patient with progressive intracranial artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma.
Case Report
A 62-year-old woman with a history of follicular lymphoma was treated with chemotherapy [6 courses of bendamustine plus rituximab therapy (B-R)] and achieved complete remission. Lymphocytopenia continued after chemotherapy (Fig. 1). She developed shingles on the left buttock 5 months after the chemotherapy and was treated with amenamevir 400 mg for 7 days. Five months after the shingles, she suddenly developed transient right upper limb paralysis and arrived at our emergency room. She had no history of headache and no vascular risk factors other than dyslipidemia.
Figure 1. Changes in the lymphocyte count. The black arrow indicates one course of bendamustine plus rituximab therapy. The white arrow indicates one course of steroid pulse therapy. The black arrowhead indicates the onset of shingles. The white arrowhead indicates the onset of varicella zoster virus vasculopathy.
She had dark red scars in the left sacral distribution. She had no focal neurological symptoms. Her National Institutes of Health Stroke scale (NIHSS) score was 0. On a laboratory examination, the white blood cell count was 5,300 /μL, and the lymphocyte count was 572 /μL (Fig. 1). Serological tests other than low-density lipoprotein (LDL)-cholesterol (149 mg/dL) were normal. On immunological testing, the IgG and IgA values were low [IgG: 667 mg/dL (861-1,741 mg/dL), IgA: 51 mg/dL (93-393 mg/dL)]. Coagulation assays and autoantibodies were normal. Anti-VZV antibody and anti-cytomegalovirus (CMV) antibody showed a prior infectious pattern.
Chest X-ray, electrocardiography, and echocardiography findings were normal. Brain magnetic resonance imaging (MRI) showed a small acute cerebral infarction in the cortical region of the left frontal lobe (Fig. 2A). MR angiography (MRA) showed the loss of the blood flow signal at the top of the left internal carotid artery (ICA) (Fig. 2B), and three-dimensional (3D) rotational angiography showed severe stenosis in the lesion (Fig. 2C). However, on contrast-enhanced CT three months before admission as follow-up for malignant lymphoma, the top of the ICA had no steno-occlusive lesions (Fig. 3A). Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging; VWI) showed concentric vessel wall enhancement at the top of the left ICA (Fig. 3B-D). The wall enhancement index (WEI) of the stenotic lesion (4) was 2.66. Cerebrospinal fluid (CSF) analyses showed a slightly elevated protein level. Polymerase chain reaction (PCR) for VZV DNA in CSF was negative. In contrast, VZV-IgM was positive in CSF, and the anti-VZV IgG antibody index [4.17 (>2.0)] increased, which meant increasing intrathecal synthesis of anti-VZV IgG antibody. A diagnosis of acute ischemic stroke due to intracranial arterial stenosis caused by VZV vasculopathy was therefore made.
Figure 2. Brain imaging findings. (A) MRI was performed on admission using a 1.5-T MRI scanner. Axial DWI (TR 6,000 ms, TE 100 ms, b-value 1,000 sec/mm2) showed a small, high-intensity signal in the left middle cerebral artery (MCA) region. (B) MRA (Time of flight, TR 32 ms, TE 6.8 ms) on admission showed severe stenosis at the top of the left internal carotid artery (ICA), and the signal from the blood flow of the left MCA was lower than that of the contralateral MCA. (C) 3D-reconstruction of left ICA rotation angiography showed severe stenosis at the top of the left ICA.
Figure 3. Time course of vascular morphology in varicella zoster virus vasculopathy. (A) 3D reconstruction of contrast-enhanced CT 3 months before admission for follow-up of malignant lymphoma showed no stenosis or abnormal findings at the top of the left ICA. The reason for the blurred image is that the primary purpose was not for a vascular assessment. (B) MRA (time of flight, TOF; TR 18 ms, TE 3.9 ms) on 3-T MRI on admission. (C) T1-weighted imaging (TIWI; TR 650 ms, TE 16.5 ms) on 3-T MRI on admission showed the thickened vessel wall of the left internal carotid artery (ICA) compared with the contralateral ICA. (D) Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging, VWI; TR 550 ms, TE 17 ms) on 3-T MRI on admission showed concentric enhancement in the thickened vessel wall of the left ICA. (E) MRA (TOF, TR 18 ms, TE 3.9 ms) on 3-T MRI seven months after admission showed improvement of the signal intensity of the blood flow at the top of the left ICA. (F) T1WI (TR 650 ms, TE 16.5 ms) on 3-T MRI seven months after admission showed improvement of vessel wall thickening of the left ICA. (G) VWI (TR 550 ms, TE 17 ms) on 3-T MRI seven months after admission showed decreased enhancement in the vessel wall of the left ICA. In addition, the left ICA vessel lumen was expanded. The white arrow indicates the top of the left ICA. The white arrowhead indicates the vessel wall of the left ICA.
The patient was treated with oral aspirin 100 mg per day, rosuvastatin 2.5 mg per day, intravenous acyclovir 10 mg/kg every 8 hours for 4 days, and oral prednisone 1 mg/kg for 5 days. Despite these therapies, MRI at 17 days after admission showed recurrence of asymptomatic cerebral infarction in the left ICA region. Intravenous methylprednisolone 1,000 mg per day was then given for 3 days, and the dosage of aspirin was increased to 200 mg per day. She then had no recurrence of stroke. She was discharged 31 days from admission and continued aspirin 200 mg per day.
MRA and VWI at 7 months after admission showed improvement of the stenosis of the left ICA and reduced vessel wall enhancement (Fig. 3E-G). The WEI of the stenotic lesion had decreased to 1.22. In addition, anti-VZV antibody IgM was negative, and the anti-VZV IgG antibody index (1.19) had also decreased by 7 months after admission. She showed no further exacerbations of neurological symptoms and no recurrent stroke, and she lived her daily life at home.
Discussion
We encountered a patient with acute stroke caused by progressive severe stenosis at the top of the left ICA after chemotherapy for follicular lymphoma who was diagnosed with VZV vasculopathy by intrathecal synthesis of anti-VZV antibody (1,5).
To our knowledge, this is the first report of VZV vasculopathy after B-R. VZV reactivation occurs in 12.2% of non-Hodgkin lymphoma patients receiving chemotherapy (2). Most VZV reactivations occur within first two years after the diagnosis of lymphoma, and the risk factors are women, diabetes mellitus, and multiple courses of chemotherapy (2). The risk also depends on the kind of chemotherapy (2,6). The present patient was treated with six courses of B-R before VZV reactivation. Lymphocytopenia continued after B-R, and this reduced cell-mediated immunity caused VZV reactivation, with vasculopathy consequently developing (Fig. 1). B-R is a standard treatment for several indolent B cell lymphomas (7). Bendamustine is known to cause myelosuppression, including lymphocytopenia, mostly with decreased CD4+ T lymphocytes and a decreased cell-mediated immunity over seven to nine months (8). Rituximab causes B cell depletion and induces substantial T cell depletion, mainly of CD4+ cells (9). Thus, B-R causes both T cell and B cell depletion (8) and leads to impaired cell-mediated immunity.
The morphological changes of the ICA before and after therapy for VZV vasculopathy were observed. A limited number of studies have reported the improvement of vascular morphology after treatment for VZV vasculopathy with long-term follow-up (10), and few reports have shown the time course of VZV vasculopathy from before the onset to the recovery process. A previous study reported that VWI was useful for the follow-up of vascular morphology and evaluating the treatment effect of VZV vasculopathy (10). Furthermore, the present patient showed improvement of the WEI value (4) of stenotic lesions, which is thought to reflect the degree of vessel wall inflammation.
Although computed tomography angiography (CTA) three months before admission in the present patient showed no stenosis in the intracranial arteries, VWI on admission showed concentric severe stenosis with gadolinium enhancement, which is the characteristic finding of vasculitis at the top of the left ICA (11). Seven months after treatment, VWI showed improvement of the left ICA stenosis, a decreasing WEI, and vessel wall thickening. The patient showed deterioration and improvement of intracranial artery stenosis in association with VZV vasculopathy activity.
In the present patient, the stenosis limited to the top of ICA appeared to have been related to the pathological mechanism of VZV vasculopathy. Seventy percent of patients with VZV vasculopathy had vascular abnormalities on angiography, and 50% of them were distributed in both large and small arteries, 37% in small arteries exclusively, and 13% in large arteries exclusively (1). The trigeminal ganglia in which VZV is latently located predominantly project nerve fibers to the ipsilateral proximal middle cerebral artery (MCA), anterior cerebral artery (ACA), and the top of the ICA (12). VZV in the trigeminal ganglia reactivated without a simultaneous rash in the sacral ganglion distribution because 37% of VZV vasculopathy occurred without a rash (13), although the previous zoster infection in the current patient involved the left sacral distribution. Therefore, VZV reactivation in the trigeminal ganglia reaches the ICA wall transaxonally. After reaching the adventitia, the virus spreads transmurally, causing infection in the cerebral arteries (1). VZV-infected cells in the adventitia induce neutrophil, macrophage, and T lymphocyte chemotaxis (14), increase the levels of various soluble factors such as interleukin 6 (IL-6) and IL-8 (15), and cause disruption of the internal elastic lamina, intimal thickening, and decreased smooth muscle cells in the media (16).
In the current patient, the subclinical VZV reactivation in trigeminal ganglia caused vasculopathy five months after shingles without cranial nerve palsy. VZV reactivation can cause cranial nerve palsy, such as shingles of the trigeminal nerve and Hunt syndrome. However, our patient had vasculopathy and ischemic stroke without any cranial nerve palsies. This may be because of the different mechanisms between vasculopathy and cranial nerve palsy. Whereas vasculopathy is caused by reactivate VZV reaching transaxonally to blood vessels and inflammatory response, the major pathology of cranial nerve palsy after shingles and Hunt syndrome is viral neuritis (17,18). Shingles is generally a monophasic disease, and the recurrence rate is less than 5% (19). Therefore, the present patient did not develop neuritis of the cranial nerve, as she had already presented shingles on the sacral distribution and been treated with amenamevir.
A previous review recommended treating VZV vasculopathy with intravenous acyclovir, 10-15 mg/kg three times daily, for a minimum of 14 days, and oral prednisone 1 mg/kg/day for five days (1). In the present patient, the dose and duration of acyclovir were sufficient, as intrathecal synthesis of anti-VZV antibody remained suppressed seven months after discharge. Increasing the dose of aspirin and methylprednisolone pulse therapy might have been effective to suppress the immune response and inflammatory cascade and improved the stenotic and gadolinium-enhanced vessel wall at the top of the ICA.
Conclusion
Progressive ICA stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma caused acute ischemic stroke. Treatment for VZV vasculopathy improved the intracranial stenotic lesion.
The authors state that they have no Conflict of Interest (COI). | 10 MILLIGRAM/KILOGRAM, TID | DrugDosageText | CC BY-NC-ND | 33390495 | 20,642,002 | 2021-06-01 |
What was the dosage of drug 'METHYLPREDNISOLONE'? | Acute Stroke Caused by Progressive Intracranial Artery Stenosis Due to Varicella Zoster Virus Vasculopathy after Chemotherapy for Malignant Lymphoma.
Decreased cell-mediated immunity can reactivate Varicella zoster virus (VZV), which can lead to various neurological complications, including vasculopathy. We herein report the case of a patient with acute stroke with progressive internal carotid artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma. Treatment for VZV vasculopathy improved the stenosis and prevented recurrent stroke. VZV vasculopathy is an important treatable cause of stroke in immunosuppressed patients.
Introduction
Varicella zoster virus (VZV) is a highly neurotropic virus. After primary infection causing chicken pox, VZV remains latent in the cranial nerve ganglia, dorsal root ganglia, and autonomic ganglia along the entire neuraxis (1). Decreased cell-mediated immunity due to aging or immunosuppression reactivates VZV and results in various neurological complications, such as vasculopathy, as well as shingles (1). Malignant lymphoma, the most common hematologic malignancy, causes immunosuppression through either the disease itself or chemotherapy, and this sometimes results in VZV reactivation (2,3).
We herein report the case of an acute stroke patient with progressive intracranial artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma.
Case Report
A 62-year-old woman with a history of follicular lymphoma was treated with chemotherapy [6 courses of bendamustine plus rituximab therapy (B-R)] and achieved complete remission. Lymphocytopenia continued after chemotherapy (Fig. 1). She developed shingles on the left buttock 5 months after the chemotherapy and was treated with amenamevir 400 mg for 7 days. Five months after the shingles, she suddenly developed transient right upper limb paralysis and arrived at our emergency room. She had no history of headache and no vascular risk factors other than dyslipidemia.
Figure 1. Changes in the lymphocyte count. The black arrow indicates one course of bendamustine plus rituximab therapy. The white arrow indicates one course of steroid pulse therapy. The black arrowhead indicates the onset of shingles. The white arrowhead indicates the onset of varicella zoster virus vasculopathy.
She had dark red scars in the left sacral distribution. She had no focal neurological symptoms. Her National Institutes of Health Stroke scale (NIHSS) score was 0. On a laboratory examination, the white blood cell count was 5,300 /μL, and the lymphocyte count was 572 /μL (Fig. 1). Serological tests other than low-density lipoprotein (LDL)-cholesterol (149 mg/dL) were normal. On immunological testing, the IgG and IgA values were low [IgG: 667 mg/dL (861-1,741 mg/dL), IgA: 51 mg/dL (93-393 mg/dL)]. Coagulation assays and autoantibodies were normal. Anti-VZV antibody and anti-cytomegalovirus (CMV) antibody showed a prior infectious pattern.
Chest X-ray, electrocardiography, and echocardiography findings were normal. Brain magnetic resonance imaging (MRI) showed a small acute cerebral infarction in the cortical region of the left frontal lobe (Fig. 2A). MR angiography (MRA) showed the loss of the blood flow signal at the top of the left internal carotid artery (ICA) (Fig. 2B), and three-dimensional (3D) rotational angiography showed severe stenosis in the lesion (Fig. 2C). However, on contrast-enhanced CT three months before admission as follow-up for malignant lymphoma, the top of the ICA had no steno-occlusive lesions (Fig. 3A). Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging; VWI) showed concentric vessel wall enhancement at the top of the left ICA (Fig. 3B-D). The wall enhancement index (WEI) of the stenotic lesion (4) was 2.66. Cerebrospinal fluid (CSF) analyses showed a slightly elevated protein level. Polymerase chain reaction (PCR) for VZV DNA in CSF was negative. In contrast, VZV-IgM was positive in CSF, and the anti-VZV IgG antibody index [4.17 (>2.0)] increased, which meant increasing intrathecal synthesis of anti-VZV IgG antibody. A diagnosis of acute ischemic stroke due to intracranial arterial stenosis caused by VZV vasculopathy was therefore made.
Figure 2. Brain imaging findings. (A) MRI was performed on admission using a 1.5-T MRI scanner. Axial DWI (TR 6,000 ms, TE 100 ms, b-value 1,000 sec/mm2) showed a small, high-intensity signal in the left middle cerebral artery (MCA) region. (B) MRA (Time of flight, TR 32 ms, TE 6.8 ms) on admission showed severe stenosis at the top of the left internal carotid artery (ICA), and the signal from the blood flow of the left MCA was lower than that of the contralateral MCA. (C) 3D-reconstruction of left ICA rotation angiography showed severe stenosis at the top of the left ICA.
Figure 3. Time course of vascular morphology in varicella zoster virus vasculopathy. (A) 3D reconstruction of contrast-enhanced CT 3 months before admission for follow-up of malignant lymphoma showed no stenosis or abnormal findings at the top of the left ICA. The reason for the blurred image is that the primary purpose was not for a vascular assessment. (B) MRA (time of flight, TOF; TR 18 ms, TE 3.9 ms) on 3-T MRI on admission. (C) T1-weighted imaging (TIWI; TR 650 ms, TE 16.5 ms) on 3-T MRI on admission showed the thickened vessel wall of the left internal carotid artery (ICA) compared with the contralateral ICA. (D) Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging, VWI; TR 550 ms, TE 17 ms) on 3-T MRI on admission showed concentric enhancement in the thickened vessel wall of the left ICA. (E) MRA (TOF, TR 18 ms, TE 3.9 ms) on 3-T MRI seven months after admission showed improvement of the signal intensity of the blood flow at the top of the left ICA. (F) T1WI (TR 650 ms, TE 16.5 ms) on 3-T MRI seven months after admission showed improvement of vessel wall thickening of the left ICA. (G) VWI (TR 550 ms, TE 17 ms) on 3-T MRI seven months after admission showed decreased enhancement in the vessel wall of the left ICA. In addition, the left ICA vessel lumen was expanded. The white arrow indicates the top of the left ICA. The white arrowhead indicates the vessel wall of the left ICA.
The patient was treated with oral aspirin 100 mg per day, rosuvastatin 2.5 mg per day, intravenous acyclovir 10 mg/kg every 8 hours for 4 days, and oral prednisone 1 mg/kg for 5 days. Despite these therapies, MRI at 17 days after admission showed recurrence of asymptomatic cerebral infarction in the left ICA region. Intravenous methylprednisolone 1,000 mg per day was then given for 3 days, and the dosage of aspirin was increased to 200 mg per day. She then had no recurrence of stroke. She was discharged 31 days from admission and continued aspirin 200 mg per day.
MRA and VWI at 7 months after admission showed improvement of the stenosis of the left ICA and reduced vessel wall enhancement (Fig. 3E-G). The WEI of the stenotic lesion had decreased to 1.22. In addition, anti-VZV antibody IgM was negative, and the anti-VZV IgG antibody index (1.19) had also decreased by 7 months after admission. She showed no further exacerbations of neurological symptoms and no recurrent stroke, and she lived her daily life at home.
Discussion
We encountered a patient with acute stroke caused by progressive severe stenosis at the top of the left ICA after chemotherapy for follicular lymphoma who was diagnosed with VZV vasculopathy by intrathecal synthesis of anti-VZV antibody (1,5).
To our knowledge, this is the first report of VZV vasculopathy after B-R. VZV reactivation occurs in 12.2% of non-Hodgkin lymphoma patients receiving chemotherapy (2). Most VZV reactivations occur within first two years after the diagnosis of lymphoma, and the risk factors are women, diabetes mellitus, and multiple courses of chemotherapy (2). The risk also depends on the kind of chemotherapy (2,6). The present patient was treated with six courses of B-R before VZV reactivation. Lymphocytopenia continued after B-R, and this reduced cell-mediated immunity caused VZV reactivation, with vasculopathy consequently developing (Fig. 1). B-R is a standard treatment for several indolent B cell lymphomas (7). Bendamustine is known to cause myelosuppression, including lymphocytopenia, mostly with decreased CD4+ T lymphocytes and a decreased cell-mediated immunity over seven to nine months (8). Rituximab causes B cell depletion and induces substantial T cell depletion, mainly of CD4+ cells (9). Thus, B-R causes both T cell and B cell depletion (8) and leads to impaired cell-mediated immunity.
The morphological changes of the ICA before and after therapy for VZV vasculopathy were observed. A limited number of studies have reported the improvement of vascular morphology after treatment for VZV vasculopathy with long-term follow-up (10), and few reports have shown the time course of VZV vasculopathy from before the onset to the recovery process. A previous study reported that VWI was useful for the follow-up of vascular morphology and evaluating the treatment effect of VZV vasculopathy (10). Furthermore, the present patient showed improvement of the WEI value (4) of stenotic lesions, which is thought to reflect the degree of vessel wall inflammation.
Although computed tomography angiography (CTA) three months before admission in the present patient showed no stenosis in the intracranial arteries, VWI on admission showed concentric severe stenosis with gadolinium enhancement, which is the characteristic finding of vasculitis at the top of the left ICA (11). Seven months after treatment, VWI showed improvement of the left ICA stenosis, a decreasing WEI, and vessel wall thickening. The patient showed deterioration and improvement of intracranial artery stenosis in association with VZV vasculopathy activity.
In the present patient, the stenosis limited to the top of ICA appeared to have been related to the pathological mechanism of VZV vasculopathy. Seventy percent of patients with VZV vasculopathy had vascular abnormalities on angiography, and 50% of them were distributed in both large and small arteries, 37% in small arteries exclusively, and 13% in large arteries exclusively (1). The trigeminal ganglia in which VZV is latently located predominantly project nerve fibers to the ipsilateral proximal middle cerebral artery (MCA), anterior cerebral artery (ACA), and the top of the ICA (12). VZV in the trigeminal ganglia reactivated without a simultaneous rash in the sacral ganglion distribution because 37% of VZV vasculopathy occurred without a rash (13), although the previous zoster infection in the current patient involved the left sacral distribution. Therefore, VZV reactivation in the trigeminal ganglia reaches the ICA wall transaxonally. After reaching the adventitia, the virus spreads transmurally, causing infection in the cerebral arteries (1). VZV-infected cells in the adventitia induce neutrophil, macrophage, and T lymphocyte chemotaxis (14), increase the levels of various soluble factors such as interleukin 6 (IL-6) and IL-8 (15), and cause disruption of the internal elastic lamina, intimal thickening, and decreased smooth muscle cells in the media (16).
In the current patient, the subclinical VZV reactivation in trigeminal ganglia caused vasculopathy five months after shingles without cranial nerve palsy. VZV reactivation can cause cranial nerve palsy, such as shingles of the trigeminal nerve and Hunt syndrome. However, our patient had vasculopathy and ischemic stroke without any cranial nerve palsies. This may be because of the different mechanisms between vasculopathy and cranial nerve palsy. Whereas vasculopathy is caused by reactivate VZV reaching transaxonally to blood vessels and inflammatory response, the major pathology of cranial nerve palsy after shingles and Hunt syndrome is viral neuritis (17,18). Shingles is generally a monophasic disease, and the recurrence rate is less than 5% (19). Therefore, the present patient did not develop neuritis of the cranial nerve, as she had already presented shingles on the sacral distribution and been treated with amenamevir.
A previous review recommended treating VZV vasculopathy with intravenous acyclovir, 10-15 mg/kg three times daily, for a minimum of 14 days, and oral prednisone 1 mg/kg/day for five days (1). In the present patient, the dose and duration of acyclovir were sufficient, as intrathecal synthesis of anti-VZV antibody remained suppressed seven months after discharge. Increasing the dose of aspirin and methylprednisolone pulse therapy might have been effective to suppress the immune response and inflammatory cascade and improved the stenotic and gadolinium-enhanced vessel wall at the top of the ICA.
Conclusion
Progressive ICA stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma caused acute ischemic stroke. Treatment for VZV vasculopathy improved the intracranial stenotic lesion.
The authors state that they have no Conflict of Interest (COI). | 1000 MILLIGRAM, DAILY | DrugDosageText | CC BY-NC-ND | 33390495 | 20,642,002 | 2021-06-01 |
What was the dosage of drug 'PREDNISONE'? | Acute Stroke Caused by Progressive Intracranial Artery Stenosis Due to Varicella Zoster Virus Vasculopathy after Chemotherapy for Malignant Lymphoma.
Decreased cell-mediated immunity can reactivate Varicella zoster virus (VZV), which can lead to various neurological complications, including vasculopathy. We herein report the case of a patient with acute stroke with progressive internal carotid artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma. Treatment for VZV vasculopathy improved the stenosis and prevented recurrent stroke. VZV vasculopathy is an important treatable cause of stroke in immunosuppressed patients.
Introduction
Varicella zoster virus (VZV) is a highly neurotropic virus. After primary infection causing chicken pox, VZV remains latent in the cranial nerve ganglia, dorsal root ganglia, and autonomic ganglia along the entire neuraxis (1). Decreased cell-mediated immunity due to aging or immunosuppression reactivates VZV and results in various neurological complications, such as vasculopathy, as well as shingles (1). Malignant lymphoma, the most common hematologic malignancy, causes immunosuppression through either the disease itself or chemotherapy, and this sometimes results in VZV reactivation (2,3).
We herein report the case of an acute stroke patient with progressive intracranial artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma.
Case Report
A 62-year-old woman with a history of follicular lymphoma was treated with chemotherapy [6 courses of bendamustine plus rituximab therapy (B-R)] and achieved complete remission. Lymphocytopenia continued after chemotherapy (Fig. 1). She developed shingles on the left buttock 5 months after the chemotherapy and was treated with amenamevir 400 mg for 7 days. Five months after the shingles, she suddenly developed transient right upper limb paralysis and arrived at our emergency room. She had no history of headache and no vascular risk factors other than dyslipidemia.
Figure 1. Changes in the lymphocyte count. The black arrow indicates one course of bendamustine plus rituximab therapy. The white arrow indicates one course of steroid pulse therapy. The black arrowhead indicates the onset of shingles. The white arrowhead indicates the onset of varicella zoster virus vasculopathy.
She had dark red scars in the left sacral distribution. She had no focal neurological symptoms. Her National Institutes of Health Stroke scale (NIHSS) score was 0. On a laboratory examination, the white blood cell count was 5,300 /μL, and the lymphocyte count was 572 /μL (Fig. 1). Serological tests other than low-density lipoprotein (LDL)-cholesterol (149 mg/dL) were normal. On immunological testing, the IgG and IgA values were low [IgG: 667 mg/dL (861-1,741 mg/dL), IgA: 51 mg/dL (93-393 mg/dL)]. Coagulation assays and autoantibodies were normal. Anti-VZV antibody and anti-cytomegalovirus (CMV) antibody showed a prior infectious pattern.
Chest X-ray, electrocardiography, and echocardiography findings were normal. Brain magnetic resonance imaging (MRI) showed a small acute cerebral infarction in the cortical region of the left frontal lobe (Fig. 2A). MR angiography (MRA) showed the loss of the blood flow signal at the top of the left internal carotid artery (ICA) (Fig. 2B), and three-dimensional (3D) rotational angiography showed severe stenosis in the lesion (Fig. 2C). However, on contrast-enhanced CT three months before admission as follow-up for malignant lymphoma, the top of the ICA had no steno-occlusive lesions (Fig. 3A). Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging; VWI) showed concentric vessel wall enhancement at the top of the left ICA (Fig. 3B-D). The wall enhancement index (WEI) of the stenotic lesion (4) was 2.66. Cerebrospinal fluid (CSF) analyses showed a slightly elevated protein level. Polymerase chain reaction (PCR) for VZV DNA in CSF was negative. In contrast, VZV-IgM was positive in CSF, and the anti-VZV IgG antibody index [4.17 (>2.0)] increased, which meant increasing intrathecal synthesis of anti-VZV IgG antibody. A diagnosis of acute ischemic stroke due to intracranial arterial stenosis caused by VZV vasculopathy was therefore made.
Figure 2. Brain imaging findings. (A) MRI was performed on admission using a 1.5-T MRI scanner. Axial DWI (TR 6,000 ms, TE 100 ms, b-value 1,000 sec/mm2) showed a small, high-intensity signal in the left middle cerebral artery (MCA) region. (B) MRA (Time of flight, TR 32 ms, TE 6.8 ms) on admission showed severe stenosis at the top of the left internal carotid artery (ICA), and the signal from the blood flow of the left MCA was lower than that of the contralateral MCA. (C) 3D-reconstruction of left ICA rotation angiography showed severe stenosis at the top of the left ICA.
Figure 3. Time course of vascular morphology in varicella zoster virus vasculopathy. (A) 3D reconstruction of contrast-enhanced CT 3 months before admission for follow-up of malignant lymphoma showed no stenosis or abnormal findings at the top of the left ICA. The reason for the blurred image is that the primary purpose was not for a vascular assessment. (B) MRA (time of flight, TOF; TR 18 ms, TE 3.9 ms) on 3-T MRI on admission. (C) T1-weighted imaging (TIWI; TR 650 ms, TE 16.5 ms) on 3-T MRI on admission showed the thickened vessel wall of the left internal carotid artery (ICA) compared with the contralateral ICA. (D) Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging, VWI; TR 550 ms, TE 17 ms) on 3-T MRI on admission showed concentric enhancement in the thickened vessel wall of the left ICA. (E) MRA (TOF, TR 18 ms, TE 3.9 ms) on 3-T MRI seven months after admission showed improvement of the signal intensity of the blood flow at the top of the left ICA. (F) T1WI (TR 650 ms, TE 16.5 ms) on 3-T MRI seven months after admission showed improvement of vessel wall thickening of the left ICA. (G) VWI (TR 550 ms, TE 17 ms) on 3-T MRI seven months after admission showed decreased enhancement in the vessel wall of the left ICA. In addition, the left ICA vessel lumen was expanded. The white arrow indicates the top of the left ICA. The white arrowhead indicates the vessel wall of the left ICA.
The patient was treated with oral aspirin 100 mg per day, rosuvastatin 2.5 mg per day, intravenous acyclovir 10 mg/kg every 8 hours for 4 days, and oral prednisone 1 mg/kg for 5 days. Despite these therapies, MRI at 17 days after admission showed recurrence of asymptomatic cerebral infarction in the left ICA region. Intravenous methylprednisolone 1,000 mg per day was then given for 3 days, and the dosage of aspirin was increased to 200 mg per day. She then had no recurrence of stroke. She was discharged 31 days from admission and continued aspirin 200 mg per day.
MRA and VWI at 7 months after admission showed improvement of the stenosis of the left ICA and reduced vessel wall enhancement (Fig. 3E-G). The WEI of the stenotic lesion had decreased to 1.22. In addition, anti-VZV antibody IgM was negative, and the anti-VZV IgG antibody index (1.19) had also decreased by 7 months after admission. She showed no further exacerbations of neurological symptoms and no recurrent stroke, and she lived her daily life at home.
Discussion
We encountered a patient with acute stroke caused by progressive severe stenosis at the top of the left ICA after chemotherapy for follicular lymphoma who was diagnosed with VZV vasculopathy by intrathecal synthesis of anti-VZV antibody (1,5).
To our knowledge, this is the first report of VZV vasculopathy after B-R. VZV reactivation occurs in 12.2% of non-Hodgkin lymphoma patients receiving chemotherapy (2). Most VZV reactivations occur within first two years after the diagnosis of lymphoma, and the risk factors are women, diabetes mellitus, and multiple courses of chemotherapy (2). The risk also depends on the kind of chemotherapy (2,6). The present patient was treated with six courses of B-R before VZV reactivation. Lymphocytopenia continued after B-R, and this reduced cell-mediated immunity caused VZV reactivation, with vasculopathy consequently developing (Fig. 1). B-R is a standard treatment for several indolent B cell lymphomas (7). Bendamustine is known to cause myelosuppression, including lymphocytopenia, mostly with decreased CD4+ T lymphocytes and a decreased cell-mediated immunity over seven to nine months (8). Rituximab causes B cell depletion and induces substantial T cell depletion, mainly of CD4+ cells (9). Thus, B-R causes both T cell and B cell depletion (8) and leads to impaired cell-mediated immunity.
The morphological changes of the ICA before and after therapy for VZV vasculopathy were observed. A limited number of studies have reported the improvement of vascular morphology after treatment for VZV vasculopathy with long-term follow-up (10), and few reports have shown the time course of VZV vasculopathy from before the onset to the recovery process. A previous study reported that VWI was useful for the follow-up of vascular morphology and evaluating the treatment effect of VZV vasculopathy (10). Furthermore, the present patient showed improvement of the WEI value (4) of stenotic lesions, which is thought to reflect the degree of vessel wall inflammation.
Although computed tomography angiography (CTA) three months before admission in the present patient showed no stenosis in the intracranial arteries, VWI on admission showed concentric severe stenosis with gadolinium enhancement, which is the characteristic finding of vasculitis at the top of the left ICA (11). Seven months after treatment, VWI showed improvement of the left ICA stenosis, a decreasing WEI, and vessel wall thickening. The patient showed deterioration and improvement of intracranial artery stenosis in association with VZV vasculopathy activity.
In the present patient, the stenosis limited to the top of ICA appeared to have been related to the pathological mechanism of VZV vasculopathy. Seventy percent of patients with VZV vasculopathy had vascular abnormalities on angiography, and 50% of them were distributed in both large and small arteries, 37% in small arteries exclusively, and 13% in large arteries exclusively (1). The trigeminal ganglia in which VZV is latently located predominantly project nerve fibers to the ipsilateral proximal middle cerebral artery (MCA), anterior cerebral artery (ACA), and the top of the ICA (12). VZV in the trigeminal ganglia reactivated without a simultaneous rash in the sacral ganglion distribution because 37% of VZV vasculopathy occurred without a rash (13), although the previous zoster infection in the current patient involved the left sacral distribution. Therefore, VZV reactivation in the trigeminal ganglia reaches the ICA wall transaxonally. After reaching the adventitia, the virus spreads transmurally, causing infection in the cerebral arteries (1). VZV-infected cells in the adventitia induce neutrophil, macrophage, and T lymphocyte chemotaxis (14), increase the levels of various soluble factors such as interleukin 6 (IL-6) and IL-8 (15), and cause disruption of the internal elastic lamina, intimal thickening, and decreased smooth muscle cells in the media (16).
In the current patient, the subclinical VZV reactivation in trigeminal ganglia caused vasculopathy five months after shingles without cranial nerve palsy. VZV reactivation can cause cranial nerve palsy, such as shingles of the trigeminal nerve and Hunt syndrome. However, our patient had vasculopathy and ischemic stroke without any cranial nerve palsies. This may be because of the different mechanisms between vasculopathy and cranial nerve palsy. Whereas vasculopathy is caused by reactivate VZV reaching transaxonally to blood vessels and inflammatory response, the major pathology of cranial nerve palsy after shingles and Hunt syndrome is viral neuritis (17,18). Shingles is generally a monophasic disease, and the recurrence rate is less than 5% (19). Therefore, the present patient did not develop neuritis of the cranial nerve, as she had already presented shingles on the sacral distribution and been treated with amenamevir.
A previous review recommended treating VZV vasculopathy with intravenous acyclovir, 10-15 mg/kg three times daily, for a minimum of 14 days, and oral prednisone 1 mg/kg/day for five days (1). In the present patient, the dose and duration of acyclovir were sufficient, as intrathecal synthesis of anti-VZV antibody remained suppressed seven months after discharge. Increasing the dose of aspirin and methylprednisolone pulse therapy might have been effective to suppress the immune response and inflammatory cascade and improved the stenotic and gadolinium-enhanced vessel wall at the top of the ICA.
Conclusion
Progressive ICA stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma caused acute ischemic stroke. Treatment for VZV vasculopathy improved the intracranial stenotic lesion.
The authors state that they have no Conflict of Interest (COI). | 1 MILLIGRAM/KILOGRAM, FOR 5 DAYS | DrugDosageText | CC BY-NC-ND | 33390495 | 20,642,002 | 2021-06-01 |
What was the dosage of drug 'ROSUVASTATIN'? | Acute Stroke Caused by Progressive Intracranial Artery Stenosis Due to Varicella Zoster Virus Vasculopathy after Chemotherapy for Malignant Lymphoma.
Decreased cell-mediated immunity can reactivate Varicella zoster virus (VZV), which can lead to various neurological complications, including vasculopathy. We herein report the case of a patient with acute stroke with progressive internal carotid artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma. Treatment for VZV vasculopathy improved the stenosis and prevented recurrent stroke. VZV vasculopathy is an important treatable cause of stroke in immunosuppressed patients.
Introduction
Varicella zoster virus (VZV) is a highly neurotropic virus. After primary infection causing chicken pox, VZV remains latent in the cranial nerve ganglia, dorsal root ganglia, and autonomic ganglia along the entire neuraxis (1). Decreased cell-mediated immunity due to aging or immunosuppression reactivates VZV and results in various neurological complications, such as vasculopathy, as well as shingles (1). Malignant lymphoma, the most common hematologic malignancy, causes immunosuppression through either the disease itself or chemotherapy, and this sometimes results in VZV reactivation (2,3).
We herein report the case of an acute stroke patient with progressive intracranial artery stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma.
Case Report
A 62-year-old woman with a history of follicular lymphoma was treated with chemotherapy [6 courses of bendamustine plus rituximab therapy (B-R)] and achieved complete remission. Lymphocytopenia continued after chemotherapy (Fig. 1). She developed shingles on the left buttock 5 months after the chemotherapy and was treated with amenamevir 400 mg for 7 days. Five months after the shingles, she suddenly developed transient right upper limb paralysis and arrived at our emergency room. She had no history of headache and no vascular risk factors other than dyslipidemia.
Figure 1. Changes in the lymphocyte count. The black arrow indicates one course of bendamustine plus rituximab therapy. The white arrow indicates one course of steroid pulse therapy. The black arrowhead indicates the onset of shingles. The white arrowhead indicates the onset of varicella zoster virus vasculopathy.
She had dark red scars in the left sacral distribution. She had no focal neurological symptoms. Her National Institutes of Health Stroke scale (NIHSS) score was 0. On a laboratory examination, the white blood cell count was 5,300 /μL, and the lymphocyte count was 572 /μL (Fig. 1). Serological tests other than low-density lipoprotein (LDL)-cholesterol (149 mg/dL) were normal. On immunological testing, the IgG and IgA values were low [IgG: 667 mg/dL (861-1,741 mg/dL), IgA: 51 mg/dL (93-393 mg/dL)]. Coagulation assays and autoantibodies were normal. Anti-VZV antibody and anti-cytomegalovirus (CMV) antibody showed a prior infectious pattern.
Chest X-ray, electrocardiography, and echocardiography findings were normal. Brain magnetic resonance imaging (MRI) showed a small acute cerebral infarction in the cortical region of the left frontal lobe (Fig. 2A). MR angiography (MRA) showed the loss of the blood flow signal at the top of the left internal carotid artery (ICA) (Fig. 2B), and three-dimensional (3D) rotational angiography showed severe stenosis in the lesion (Fig. 2C). However, on contrast-enhanced CT three months before admission as follow-up for malignant lymphoma, the top of the ICA had no steno-occlusive lesions (Fig. 3A). Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging; VWI) showed concentric vessel wall enhancement at the top of the left ICA (Fig. 3B-D). The wall enhancement index (WEI) of the stenotic lesion (4) was 2.66. Cerebrospinal fluid (CSF) analyses showed a slightly elevated protein level. Polymerase chain reaction (PCR) for VZV DNA in CSF was negative. In contrast, VZV-IgM was positive in CSF, and the anti-VZV IgG antibody index [4.17 (>2.0)] increased, which meant increasing intrathecal synthesis of anti-VZV IgG antibody. A diagnosis of acute ischemic stroke due to intracranial arterial stenosis caused by VZV vasculopathy was therefore made.
Figure 2. Brain imaging findings. (A) MRI was performed on admission using a 1.5-T MRI scanner. Axial DWI (TR 6,000 ms, TE 100 ms, b-value 1,000 sec/mm2) showed a small, high-intensity signal in the left middle cerebral artery (MCA) region. (B) MRA (Time of flight, TR 32 ms, TE 6.8 ms) on admission showed severe stenosis at the top of the left internal carotid artery (ICA), and the signal from the blood flow of the left MCA was lower than that of the contralateral MCA. (C) 3D-reconstruction of left ICA rotation angiography showed severe stenosis at the top of the left ICA.
Figure 3. Time course of vascular morphology in varicella zoster virus vasculopathy. (A) 3D reconstruction of contrast-enhanced CT 3 months before admission for follow-up of malignant lymphoma showed no stenosis or abnormal findings at the top of the left ICA. The reason for the blurred image is that the primary purpose was not for a vascular assessment. (B) MRA (time of flight, TOF; TR 18 ms, TE 3.9 ms) on 3-T MRI on admission. (C) T1-weighted imaging (TIWI; TR 650 ms, TE 16.5 ms) on 3-T MRI on admission showed the thickened vessel wall of the left internal carotid artery (ICA) compared with the contralateral ICA. (D) Gadolinium-enhanced 3D black-blood T1-weighted imaging (vessel wall imaging, VWI; TR 550 ms, TE 17 ms) on 3-T MRI on admission showed concentric enhancement in the thickened vessel wall of the left ICA. (E) MRA (TOF, TR 18 ms, TE 3.9 ms) on 3-T MRI seven months after admission showed improvement of the signal intensity of the blood flow at the top of the left ICA. (F) T1WI (TR 650 ms, TE 16.5 ms) on 3-T MRI seven months after admission showed improvement of vessel wall thickening of the left ICA. (G) VWI (TR 550 ms, TE 17 ms) on 3-T MRI seven months after admission showed decreased enhancement in the vessel wall of the left ICA. In addition, the left ICA vessel lumen was expanded. The white arrow indicates the top of the left ICA. The white arrowhead indicates the vessel wall of the left ICA.
The patient was treated with oral aspirin 100 mg per day, rosuvastatin 2.5 mg per day, intravenous acyclovir 10 mg/kg every 8 hours for 4 days, and oral prednisone 1 mg/kg for 5 days. Despite these therapies, MRI at 17 days after admission showed recurrence of asymptomatic cerebral infarction in the left ICA region. Intravenous methylprednisolone 1,000 mg per day was then given for 3 days, and the dosage of aspirin was increased to 200 mg per day. She then had no recurrence of stroke. She was discharged 31 days from admission and continued aspirin 200 mg per day.
MRA and VWI at 7 months after admission showed improvement of the stenosis of the left ICA and reduced vessel wall enhancement (Fig. 3E-G). The WEI of the stenotic lesion had decreased to 1.22. In addition, anti-VZV antibody IgM was negative, and the anti-VZV IgG antibody index (1.19) had also decreased by 7 months after admission. She showed no further exacerbations of neurological symptoms and no recurrent stroke, and she lived her daily life at home.
Discussion
We encountered a patient with acute stroke caused by progressive severe stenosis at the top of the left ICA after chemotherapy for follicular lymphoma who was diagnosed with VZV vasculopathy by intrathecal synthesis of anti-VZV antibody (1,5).
To our knowledge, this is the first report of VZV vasculopathy after B-R. VZV reactivation occurs in 12.2% of non-Hodgkin lymphoma patients receiving chemotherapy (2). Most VZV reactivations occur within first two years after the diagnosis of lymphoma, and the risk factors are women, diabetes mellitus, and multiple courses of chemotherapy (2). The risk also depends on the kind of chemotherapy (2,6). The present patient was treated with six courses of B-R before VZV reactivation. Lymphocytopenia continued after B-R, and this reduced cell-mediated immunity caused VZV reactivation, with vasculopathy consequently developing (Fig. 1). B-R is a standard treatment for several indolent B cell lymphomas (7). Bendamustine is known to cause myelosuppression, including lymphocytopenia, mostly with decreased CD4+ T lymphocytes and a decreased cell-mediated immunity over seven to nine months (8). Rituximab causes B cell depletion and induces substantial T cell depletion, mainly of CD4+ cells (9). Thus, B-R causes both T cell and B cell depletion (8) and leads to impaired cell-mediated immunity.
The morphological changes of the ICA before and after therapy for VZV vasculopathy were observed. A limited number of studies have reported the improvement of vascular morphology after treatment for VZV vasculopathy with long-term follow-up (10), and few reports have shown the time course of VZV vasculopathy from before the onset to the recovery process. A previous study reported that VWI was useful for the follow-up of vascular morphology and evaluating the treatment effect of VZV vasculopathy (10). Furthermore, the present patient showed improvement of the WEI value (4) of stenotic lesions, which is thought to reflect the degree of vessel wall inflammation.
Although computed tomography angiography (CTA) three months before admission in the present patient showed no stenosis in the intracranial arteries, VWI on admission showed concentric severe stenosis with gadolinium enhancement, which is the characteristic finding of vasculitis at the top of the left ICA (11). Seven months after treatment, VWI showed improvement of the left ICA stenosis, a decreasing WEI, and vessel wall thickening. The patient showed deterioration and improvement of intracranial artery stenosis in association with VZV vasculopathy activity.
In the present patient, the stenosis limited to the top of ICA appeared to have been related to the pathological mechanism of VZV vasculopathy. Seventy percent of patients with VZV vasculopathy had vascular abnormalities on angiography, and 50% of them were distributed in both large and small arteries, 37% in small arteries exclusively, and 13% in large arteries exclusively (1). The trigeminal ganglia in which VZV is latently located predominantly project nerve fibers to the ipsilateral proximal middle cerebral artery (MCA), anterior cerebral artery (ACA), and the top of the ICA (12). VZV in the trigeminal ganglia reactivated without a simultaneous rash in the sacral ganglion distribution because 37% of VZV vasculopathy occurred without a rash (13), although the previous zoster infection in the current patient involved the left sacral distribution. Therefore, VZV reactivation in the trigeminal ganglia reaches the ICA wall transaxonally. After reaching the adventitia, the virus spreads transmurally, causing infection in the cerebral arteries (1). VZV-infected cells in the adventitia induce neutrophil, macrophage, and T lymphocyte chemotaxis (14), increase the levels of various soluble factors such as interleukin 6 (IL-6) and IL-8 (15), and cause disruption of the internal elastic lamina, intimal thickening, and decreased smooth muscle cells in the media (16).
In the current patient, the subclinical VZV reactivation in trigeminal ganglia caused vasculopathy five months after shingles without cranial nerve palsy. VZV reactivation can cause cranial nerve palsy, such as shingles of the trigeminal nerve and Hunt syndrome. However, our patient had vasculopathy and ischemic stroke without any cranial nerve palsies. This may be because of the different mechanisms between vasculopathy and cranial nerve palsy. Whereas vasculopathy is caused by reactivate VZV reaching transaxonally to blood vessels and inflammatory response, the major pathology of cranial nerve palsy after shingles and Hunt syndrome is viral neuritis (17,18). Shingles is generally a monophasic disease, and the recurrence rate is less than 5% (19). Therefore, the present patient did not develop neuritis of the cranial nerve, as she had already presented shingles on the sacral distribution and been treated with amenamevir.
A previous review recommended treating VZV vasculopathy with intravenous acyclovir, 10-15 mg/kg three times daily, for a minimum of 14 days, and oral prednisone 1 mg/kg/day for five days (1). In the present patient, the dose and duration of acyclovir were sufficient, as intrathecal synthesis of anti-VZV antibody remained suppressed seven months after discharge. Increasing the dose of aspirin and methylprednisolone pulse therapy might have been effective to suppress the immune response and inflammatory cascade and improved the stenotic and gadolinium-enhanced vessel wall at the top of the ICA.
Conclusion
Progressive ICA stenosis due to VZV vasculopathy after chemotherapy for malignant lymphoma caused acute ischemic stroke. Treatment for VZV vasculopathy improved the intracranial stenotic lesion.
The authors state that they have no Conflict of Interest (COI). | 2.5 MILLIGRAM, DAILY | DrugDosageText | CC BY-NC-ND | 33390495 | 20,642,002 | 2021-06-01 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Disease progression'. | Effective Endoscopic Closure of Cholecysto-duodenal and Transverse Colon Fistulas Due to Squamous Cell Carcinoma of the Gallbladder Using Polyglycolic Acid Sheets and a Covered Metal Stent.
An 81-year-old woman presented with abdominal distension and right hypochondrial pain. Abdominal contrast computed tomography and magnetic resonance imaging revealed an 11-cm gallbladder tumor. The patient was diagnosed with squamous cell carcinoma of the gallbladder by endoscopic ultrasound-guided fine-needle aspiration from the gastric antrum. Thereafter, the gallbladder tumor enlarged, and cholecysto-duodenal and transverse colon fistulas were formed. A covered metal stent was placed on the transverse colon, and polyglycolic acid sheets were injected into the duodenum to close the fistulas endoscopically. Endoscopic closure is less invasive than surgery and considered effective for patients with poor general health conditions.
Introduction
Squamous cell carcinoma of the gallbladder is a rare malignancy as it accounts for 0.5-2.4% of all gallbladder carcinomas. Its clinical characteristics include large tumor formation, direct invasion into adjacent organs, and probable formation of gastrointestinal tract fistulas (1-3). In cases of fistulas in which radical operation is difficult, surgical closure of these fistulas under general anesthesia is sometimes performed. However, surgery is often contraindicated for elderly patients and individuals with a poor physical condition (4,5).
The application of polyglycolic acid (PGA) sheets for perforation after endoscopic submucosal dissection (ESD) and gastrointestinal fistula due to malignant tumor has recently been reported (6-9). Furthermore, endoscopic closure with covered metal stent placement can be performed for colovesical or esophagorespiratory fistulas due to colon or esophageal carcinomas (10-12).
To our knowledge, endoscopic closure of gastrointestinal fistulas due to squamous cell carcinoma of the gallbladder has not yet been reported. We herein report a case of effective endoscopic closure with a covered metal stent and PGA sheet for cholecysto-duodenal and transverse colon fistulas due to squamous cell carcinoma of the gallbladder.
Case Report
An 81-year-old woman presented to our hospital complaining of abdominal distension and right hypochondrial pain, and she was admitted for an examination.
Mild tenderness in the right hypochondrium was revealed on a physical examination. Laboratory tests revealed elevated serum inflammatory markers (white blood cells, 13,370 /μL; C-reactive protein, 10.4 mg/dL), transaminase, transpeptidase (aspartate transaminase, 36 U/L; alanine aminotransferase, 29 U/L; γ-GTP, 61 U/L), and squamous cell carcinoma antigen (50.3 ng/mL) levels.
Abdominal contrast computed tomography (CT) and magnetic resonance imaging revealed an 11-cm solid tumor in the lower right hepatic lobe attached to the cystic duct (Fig. 1). The gallbladder was not observed despite the lack of a medical history of cholecystectomy. We therefore diagnosed the patient with a gallbladder tumor.
Figure 1. Images of abdominal contrast computed tomography (CT; a, b) and magnetic resonance imaging (MRI; c,d). a-d: CT and MRI revealed a solid tumor of 11 cm in the lower right hepatic lobe and direct invasion into the liver. The tumor was attached to the gallbladder duct and diagnosed as a gallbladder tumor.
Esophagogastroduodenoscopy (EGD) demonstrated a submucosal tumor-like extrinsic compression along the greater curvature of the gastric antrum (Fig. 2a). Endoscopic ultrasound (EUS) detected an isoechoic mass, and direct invasion into the stomach was considered because the border between the tumor and stomach wall was unclear (Fig. 2b). A histological examination by endoscopic ultrasound-guided fine-needle aspiration (EUS-FNA) revealed cell sheets of stratified squamous epithelium, abnormal keratinization, such as single-cell keratinization, and cancer pearl-like structures. Concentrated irregular nuclei of different sizes were observed in keratinized regions (Fig. 2c, d). Therefore, we diagnosed the patient with squamous cell carcinoma of the gallbladder.
Figure 2. Findings of esophagogastroduodenoscopy (EGD), endoscopic ultrasound (EUS), and a histological examination by endoscopic ultrasound-fine needle aspiration (EUS-FNA). a: EGD revealed submucosal tumor-like extrinsic compression in the greater curvature of the gastric antrum. b: EUS showed an isoechoic mass, and direct invasion into the stomach was considered because the border between the tumor and the stomach wall was unclear. c, d: A histological examination by EUS-FNA revealed sheets of stratified squamous epithelium, abnormal keratinization, such as single-cell keratinization, and cancer pearl structure. Concentrated irregular nuclei of different sizes were described in the keratinized region. Magnification: c ×200, d ×400.
She was discharged after EUS-FNA with no complications. Two weeks after discharge, she visited our hospital because a pathological definitive diagnosis was obtained. At that time, she had developed a fever (38.0°C) and reported a poor food intake and difficulty walking. Therefore, she was readmitted to our hospital. CT revealed an enlarged gallbladder tumor, surrounding lymph node metastasis, and substantial gas inside the tumor (Fig. 3a). The border between the tumor and gastroduodenal wall was unclear on CT. Furthermore, the border between the tumor and transverse colon was also unclear. Therefore, the formation of fistulas in the gastrointestinal tract was considered (Fig. 3b). EGD demonstrated a 1.5-cm fistula in the duodenal bulb (Fig. 3c). On a radiological examination using Gastrografin (contrast medium; Bayer Yakuhin, Osaka, Japan), Gastrografin flowed into the gallbladder tumor from the duodenal fistula and then flowed out into the transverse colon from the tumor (Fig. 3d).
Figure 3. Findings of computed tomography (CT), esophagogastroduodenoscopy (EGD) and a Gastrografin contrast examination at second admission. a, b: CT revealed an enlarged gallbladder tumor and a large amount of gas inside the tumor (arrowheads). The borders between the tumor and gastric antrum, duodenum, and transverse colon were unclear. Fistulas in the gastrointestinal tract were formed. c: EGD revealed a 1.5-cm fistula in the duodenal bulb (arrowheads). d: Gastrografin flowed into the gallbladder tumor from the duodenal fistula (arrow) and flowed out into the transverse colon from the transverse colon fistula (arrowhead).
Because the tumor was progressing rapidly, chemotherapy was initiated immediately, starting one week after readmission. According to the standard chemotherapy regimen for gallbladder carcinoma, cisplatin and gemcitabine administration was started. However, food intake and stool through the cholecysto-duodenal and transverse colon fistulas caused intratumoral infection, and chemotherapy was discontinued. Regarding surgical risks, the American Society of Anesthesiologists physical status (ASA-PS) was low (grade 2), while the age-adjusted Charlson comorbidity index (ACCI) was high (11 points). The patient exhibited undernutrition (total protein, 5.6 g/dL; albumin, 2.0 g/dL); furthermore, both she and her family wished to avoid surgery under general anesthesia because she was 81 years old. Based on these results, the patient was diagnosed with a poor physical status and was not considered suitable for surgery, such as fistula closure or bypass surgery.
As the patient and her family expressed a strong preference for food intake, we decided to attempt endoscopic closure of the fistulas. Closure by clipping or over-the-scope clips (OTSCs) was considered difficult because of the relatively large fistulas in this case. Therefore, we decided to perform closure using a covered metal stent and PGA sheets. Only uncovered metal stents for closure of colon fistulas are considered for insurance coverage in Japan; however, with the consent of the patient and her family, we decided to use a duodenal covered metal stent for the transverse colon fistula. Before treatment, the patient and her family provided their written informed consent.
First, a colonoscopic examination was performed after sedation and pain relief with midazolam and pentazocine. Tract stenosis due to direct invasion of the gallbladder tumor was observed in the transverse colon, along with 2 cm of the fistula (Fig. 4a). For endoscopic closure of the fistula and dilation of stenosis, a covered metal stent (Niti-S covered metal stent 20×12 cm; Taewoong Medical, Seoul, Korea) was placed to seal the fistula (Fig. 4b). Second, EGD was performed. Polygolyc acid sheets (10×5 cm, Neoveil sheet; Gunze Medical Japan, Kyoto, Japan) were cut to the appropriate sizes and applied to the duodenal fistula. Two sheets were used in total, and fibrin glue (Beriplast P Combi-Set Tissue adhesion; CSL Behring, Tokyo, Japan) was applied over the top to fix the PGA sheets in position (Fig. 4c). After application of the PGA sheet, a decrease in Gastrografin, which had been flowing into the gallbladder tumor from the duodenal fistula, was apparent on a radiological examination. Endoscopic closure was successfully completed without complications.
Figure 4. Findings of colonoscopy, esophagogastroduodenoscopy (EGD), and abdominal radiography. a: Colonoscopy demonstrated stenosis of the normal tract due to direct invasion of the gallbladder tumor and a 2-cm fistula in the transverse colon. b: A covered metal stent was placed so that the cover material sealed the fistula for fistula closure and removal of stenosis. c: Polyglycolic acid sheets, cut to the appropriate sizes, were applied to the fistula of the duodenum, and then fibrin glue was applied. d: An abdominal radiograph obtained two weeks later shows the absence of stent migration.
After performing endoscopic closure of fistulas, fecal vomiting was not observed, and the normal movement of food was achieved. An abdominal radiograph obtained two weeks later did not show stent migration (Fig. 4d). We regularly acquired abdominal radiographs to monitor the position of the stent. Consequently, the patient was able to ingest food orally with no fever. Furthermore, the intratumoral infection was cured, and chemotherapy was resumed. Although the patient died three months after hospitalization due to tumor growth, food intake was possible until one week before her death.
Discussion
Squamous cell carcinoma of the gallbladder forms large tumor lesions, directly invades adjacent organs, and forms gastrointestinal tract fistulas. However, its distant metastasis is rare (1-3). Its prognosis is poor because many cases are discovered at an advanced stage, and the resection rate is lower than that of adenocarcinoma (2). Our case demonstrated all of these characteristics and presented typical clinical features of squamous cell carcinoma of the gallbladder.
Many previous cases of squamous cell carcinoma of the gallbladder have been diagnosed by a histopathologic examination of postoperative surgical specimens. Recently, the usefulness of EUS has been reported, but there have been few reports of squamous cell carcinoma of the gallbladder being diagnosed by EUS-FNA (13-15), which was the method used to establish this diagnosis in our case.
Extended surgery is recommended in cases of squamous cell carcinoma of the gallbladder that form fistulas when there are no issues regarding surgical tolerance. Cases of squamous cell carcinoma of the gallbladder that have been cured by radical surgery were reported to achieve either the same prognosis as adenocarcinoma cases or a significantly better prognosis (16,17). Therefore, aggressive resection with extended surgery should be performed; however, the resection rate is low due to rapid tumor progression. In cases of fistulas that make radical surgery difficult, surgical closure of fistulas or colostomy under general anesthesia is sometimes performed (4,5). The ASA-PS and ACCI are often used to predict prognostic performance in patients undergoing surgery (18-20). If the ASA-PS or ACCI is high, the patient is considered to have a poor PS (21). In our case, although the ASA-PS was low (grade 2) because of the lack of severe systemic complications aside from mild hypertension, the Charlson comorbidity index was high (11 points) because of her advanced age and the presence of a metastatic solid tumor. In addition, because of undernutrition and her advanced age, the patient wished to avoid surgery, which was considered risky and unsuitable. However, a fever due to the backflow of stool persisted. In addition, the patient and her family were strongly in favor of improving her food intake. We therefore performed endoscopic closure of the fistulas.
Endoscopic closure methods for fistulas, such as clipping and OTSCs, are often used (22,23). Although clipping and OTSCs are effective for small fistulas, these methods are difficult to apply to relatively large fistulas. Recently, PGA sheets, which are often used in the closure of fistulas in respiratory and dental oral areas, have been applied for the treatment or prevention of perforation after ESD (6,7). Because PGA sheets can be cut to the appropriate size for application, they are considered useful for relatively large fistulas where clipping or OTSCs is not suitable. Therefore, we used PGA sheets to close the duodenal fistula in the present case.
Stent placement therapy for the digestive tract is used to remove stenosis due to malignancy. Covered metal stents have been used for the management of postoperative leakage and fistulas of the upper gastrointestinal tract, such as the esophagus and stomach. The usefulness of covered metal stents is also reported for postoperative leakage and fistulas of the colon (24-27). Furthermore, endoscopic closure with a covered metal stent is also used for fistulas due to malignant tumors, such as esophageal or colon carcinomas that form esophagorespiratory or colovesical fistulas (10-12). Because stenosis in the transverse colon tract was caused by tumor invasion in our case, we determined the risk of stent dislocation to be low and closed the colon fistula by placing a covered metal stent. The use of colonic covered metal stents is currently approved in Japan; however, at the time of the patient's treatment, only uncovered metal stents were covered by insurance. Therefore, we used a duodenal covered metal stent for the transverse colon fistula after obtaining the consent of the patient and family beforehand. Covered metal stents show a higher risk of migration than do uncovered metal stents. Furthermore, the metal stent may migrate when the tumor size is reduced by chemotherapy. However, the covered metal stent used for the present case has an uncovered portion measuring 15 mm at both ends to prevent migration. In our case, the large tumor compressed the colon where the covered metal stent was placed, and stent migration was prevented. If migration is discovered in the early stage, endoscopic repositioning may be possible. Therefore, it is necessary to confirm the stent position by regular monitoring on abdominal radiographs.
Covered metal stents for colon fistulas, such as those observed in this case, are effective and might be needed in the future. However, in the present case, covered metal stent placement for duodenal fistulas was difficult because the normal tract of the duodenum was not stenotic and was proximal to the pylorus. Therefore, we used PGA sheets to achieve closure of the duodenal fistula. Although complete closure with PGA sheets alone seemed difficult, intratumoral infection was resolved, and resumption of chemotherapy was possible because the backflow of fecal matter into the fistula decreased after placement of the covered metal stent.
In our case, the fever due to the backflow of stool was alleviated, and food intake became possible following endoscopic closure of the fistulas. In addition, chemotherapy was administered to reduce the fistula and tumor masses. However, chemotherapy could not suppress tumor growth, and the patient died three months after hospitalization. If reduction of the tumor had been achieved by chemotherapy, spontaneous closure of the fistulas and life prolongation may have been possible. A regimen of gemcitabine plus cisplatin has been recommended at evidence level A for unresectable gallbladder carcinoma, but the tissue type is not mentioned (28,29). There are several case reports on chemotherapy using 5-fluorouracil or FOLFOX (folinic acid, fluorouracil and oxaliplatin) as postoperative adjuvant chemotherapy for squamous cell carcinoma of the gallbladder, but no consensus has been reached so far because of the limited number of reports (30). Although gemcitabine and cisplatin, which are considered the standard chemotherapy regimen for unresectable gallbladder carcinoma, were selected in our case, the tumor was not reduced. Chemotherapy regimens for squamous cell carcinoma of the gallbladder should be investigated in future studies.
We performed endoscopic closure with a covered metal stent and PGA sheet for gastrointestinal fistulas due to squamous cell carcinoma of the gallbladder, which enabled food intake. To our knowledge, there are no previous reports of endoscopic closure of gastrointestinal fistulas due to squamous cell carcinoma of the gallbladder. Covered metal stents and PGA sheets are less invasive than surgery and are considered effective for managing relatively large fistulas in which clipping or OTSCs are not applicable.
Informed consent was obtained from the patient and her family for inclusion in the study.
The authors state that they have no Conflict of Interest (COI). | CISPLATIN, GEMCITABINE HYDROCHLORIDE | DrugsGivenReaction | CC BY-NC-ND | 33390496 | 20,387,983 | 2021-06-01 |
What was the outcome of reaction 'Disease progression'? | Effective Endoscopic Closure of Cholecysto-duodenal and Transverse Colon Fistulas Due to Squamous Cell Carcinoma of the Gallbladder Using Polyglycolic Acid Sheets and a Covered Metal Stent.
An 81-year-old woman presented with abdominal distension and right hypochondrial pain. Abdominal contrast computed tomography and magnetic resonance imaging revealed an 11-cm gallbladder tumor. The patient was diagnosed with squamous cell carcinoma of the gallbladder by endoscopic ultrasound-guided fine-needle aspiration from the gastric antrum. Thereafter, the gallbladder tumor enlarged, and cholecysto-duodenal and transverse colon fistulas were formed. A covered metal stent was placed on the transverse colon, and polyglycolic acid sheets were injected into the duodenum to close the fistulas endoscopically. Endoscopic closure is less invasive than surgery and considered effective for patients with poor general health conditions.
Introduction
Squamous cell carcinoma of the gallbladder is a rare malignancy as it accounts for 0.5-2.4% of all gallbladder carcinomas. Its clinical characteristics include large tumor formation, direct invasion into adjacent organs, and probable formation of gastrointestinal tract fistulas (1-3). In cases of fistulas in which radical operation is difficult, surgical closure of these fistulas under general anesthesia is sometimes performed. However, surgery is often contraindicated for elderly patients and individuals with a poor physical condition (4,5).
The application of polyglycolic acid (PGA) sheets for perforation after endoscopic submucosal dissection (ESD) and gastrointestinal fistula due to malignant tumor has recently been reported (6-9). Furthermore, endoscopic closure with covered metal stent placement can be performed for colovesical or esophagorespiratory fistulas due to colon or esophageal carcinomas (10-12).
To our knowledge, endoscopic closure of gastrointestinal fistulas due to squamous cell carcinoma of the gallbladder has not yet been reported. We herein report a case of effective endoscopic closure with a covered metal stent and PGA sheet for cholecysto-duodenal and transverse colon fistulas due to squamous cell carcinoma of the gallbladder.
Case Report
An 81-year-old woman presented to our hospital complaining of abdominal distension and right hypochondrial pain, and she was admitted for an examination.
Mild tenderness in the right hypochondrium was revealed on a physical examination. Laboratory tests revealed elevated serum inflammatory markers (white blood cells, 13,370 /μL; C-reactive protein, 10.4 mg/dL), transaminase, transpeptidase (aspartate transaminase, 36 U/L; alanine aminotransferase, 29 U/L; γ-GTP, 61 U/L), and squamous cell carcinoma antigen (50.3 ng/mL) levels.
Abdominal contrast computed tomography (CT) and magnetic resonance imaging revealed an 11-cm solid tumor in the lower right hepatic lobe attached to the cystic duct (Fig. 1). The gallbladder was not observed despite the lack of a medical history of cholecystectomy. We therefore diagnosed the patient with a gallbladder tumor.
Figure 1. Images of abdominal contrast computed tomography (CT; a, b) and magnetic resonance imaging (MRI; c,d). a-d: CT and MRI revealed a solid tumor of 11 cm in the lower right hepatic lobe and direct invasion into the liver. The tumor was attached to the gallbladder duct and diagnosed as a gallbladder tumor.
Esophagogastroduodenoscopy (EGD) demonstrated a submucosal tumor-like extrinsic compression along the greater curvature of the gastric antrum (Fig. 2a). Endoscopic ultrasound (EUS) detected an isoechoic mass, and direct invasion into the stomach was considered because the border between the tumor and stomach wall was unclear (Fig. 2b). A histological examination by endoscopic ultrasound-guided fine-needle aspiration (EUS-FNA) revealed cell sheets of stratified squamous epithelium, abnormal keratinization, such as single-cell keratinization, and cancer pearl-like structures. Concentrated irregular nuclei of different sizes were observed in keratinized regions (Fig. 2c, d). Therefore, we diagnosed the patient with squamous cell carcinoma of the gallbladder.
Figure 2. Findings of esophagogastroduodenoscopy (EGD), endoscopic ultrasound (EUS), and a histological examination by endoscopic ultrasound-fine needle aspiration (EUS-FNA). a: EGD revealed submucosal tumor-like extrinsic compression in the greater curvature of the gastric antrum. b: EUS showed an isoechoic mass, and direct invasion into the stomach was considered because the border between the tumor and the stomach wall was unclear. c, d: A histological examination by EUS-FNA revealed sheets of stratified squamous epithelium, abnormal keratinization, such as single-cell keratinization, and cancer pearl structure. Concentrated irregular nuclei of different sizes were described in the keratinized region. Magnification: c ×200, d ×400.
She was discharged after EUS-FNA with no complications. Two weeks after discharge, she visited our hospital because a pathological definitive diagnosis was obtained. At that time, she had developed a fever (38.0°C) and reported a poor food intake and difficulty walking. Therefore, she was readmitted to our hospital. CT revealed an enlarged gallbladder tumor, surrounding lymph node metastasis, and substantial gas inside the tumor (Fig. 3a). The border between the tumor and gastroduodenal wall was unclear on CT. Furthermore, the border between the tumor and transverse colon was also unclear. Therefore, the formation of fistulas in the gastrointestinal tract was considered (Fig. 3b). EGD demonstrated a 1.5-cm fistula in the duodenal bulb (Fig. 3c). On a radiological examination using Gastrografin (contrast medium; Bayer Yakuhin, Osaka, Japan), Gastrografin flowed into the gallbladder tumor from the duodenal fistula and then flowed out into the transverse colon from the tumor (Fig. 3d).
Figure 3. Findings of computed tomography (CT), esophagogastroduodenoscopy (EGD) and a Gastrografin contrast examination at second admission. a, b: CT revealed an enlarged gallbladder tumor and a large amount of gas inside the tumor (arrowheads). The borders between the tumor and gastric antrum, duodenum, and transverse colon were unclear. Fistulas in the gastrointestinal tract were formed. c: EGD revealed a 1.5-cm fistula in the duodenal bulb (arrowheads). d: Gastrografin flowed into the gallbladder tumor from the duodenal fistula (arrow) and flowed out into the transverse colon from the transverse colon fistula (arrowhead).
Because the tumor was progressing rapidly, chemotherapy was initiated immediately, starting one week after readmission. According to the standard chemotherapy regimen for gallbladder carcinoma, cisplatin and gemcitabine administration was started. However, food intake and stool through the cholecysto-duodenal and transverse colon fistulas caused intratumoral infection, and chemotherapy was discontinued. Regarding surgical risks, the American Society of Anesthesiologists physical status (ASA-PS) was low (grade 2), while the age-adjusted Charlson comorbidity index (ACCI) was high (11 points). The patient exhibited undernutrition (total protein, 5.6 g/dL; albumin, 2.0 g/dL); furthermore, both she and her family wished to avoid surgery under general anesthesia because she was 81 years old. Based on these results, the patient was diagnosed with a poor physical status and was not considered suitable for surgery, such as fistula closure or bypass surgery.
As the patient and her family expressed a strong preference for food intake, we decided to attempt endoscopic closure of the fistulas. Closure by clipping or over-the-scope clips (OTSCs) was considered difficult because of the relatively large fistulas in this case. Therefore, we decided to perform closure using a covered metal stent and PGA sheets. Only uncovered metal stents for closure of colon fistulas are considered for insurance coverage in Japan; however, with the consent of the patient and her family, we decided to use a duodenal covered metal stent for the transverse colon fistula. Before treatment, the patient and her family provided their written informed consent.
First, a colonoscopic examination was performed after sedation and pain relief with midazolam and pentazocine. Tract stenosis due to direct invasion of the gallbladder tumor was observed in the transverse colon, along with 2 cm of the fistula (Fig. 4a). For endoscopic closure of the fistula and dilation of stenosis, a covered metal stent (Niti-S covered metal stent 20×12 cm; Taewoong Medical, Seoul, Korea) was placed to seal the fistula (Fig. 4b). Second, EGD was performed. Polygolyc acid sheets (10×5 cm, Neoveil sheet; Gunze Medical Japan, Kyoto, Japan) were cut to the appropriate sizes and applied to the duodenal fistula. Two sheets were used in total, and fibrin glue (Beriplast P Combi-Set Tissue adhesion; CSL Behring, Tokyo, Japan) was applied over the top to fix the PGA sheets in position (Fig. 4c). After application of the PGA sheet, a decrease in Gastrografin, which had been flowing into the gallbladder tumor from the duodenal fistula, was apparent on a radiological examination. Endoscopic closure was successfully completed without complications.
Figure 4. Findings of colonoscopy, esophagogastroduodenoscopy (EGD), and abdominal radiography. a: Colonoscopy demonstrated stenosis of the normal tract due to direct invasion of the gallbladder tumor and a 2-cm fistula in the transverse colon. b: A covered metal stent was placed so that the cover material sealed the fistula for fistula closure and removal of stenosis. c: Polyglycolic acid sheets, cut to the appropriate sizes, were applied to the fistula of the duodenum, and then fibrin glue was applied. d: An abdominal radiograph obtained two weeks later shows the absence of stent migration.
After performing endoscopic closure of fistulas, fecal vomiting was not observed, and the normal movement of food was achieved. An abdominal radiograph obtained two weeks later did not show stent migration (Fig. 4d). We regularly acquired abdominal radiographs to monitor the position of the stent. Consequently, the patient was able to ingest food orally with no fever. Furthermore, the intratumoral infection was cured, and chemotherapy was resumed. Although the patient died three months after hospitalization due to tumor growth, food intake was possible until one week before her death.
Discussion
Squamous cell carcinoma of the gallbladder forms large tumor lesions, directly invades adjacent organs, and forms gastrointestinal tract fistulas. However, its distant metastasis is rare (1-3). Its prognosis is poor because many cases are discovered at an advanced stage, and the resection rate is lower than that of adenocarcinoma (2). Our case demonstrated all of these characteristics and presented typical clinical features of squamous cell carcinoma of the gallbladder.
Many previous cases of squamous cell carcinoma of the gallbladder have been diagnosed by a histopathologic examination of postoperative surgical specimens. Recently, the usefulness of EUS has been reported, but there have been few reports of squamous cell carcinoma of the gallbladder being diagnosed by EUS-FNA (13-15), which was the method used to establish this diagnosis in our case.
Extended surgery is recommended in cases of squamous cell carcinoma of the gallbladder that form fistulas when there are no issues regarding surgical tolerance. Cases of squamous cell carcinoma of the gallbladder that have been cured by radical surgery were reported to achieve either the same prognosis as adenocarcinoma cases or a significantly better prognosis (16,17). Therefore, aggressive resection with extended surgery should be performed; however, the resection rate is low due to rapid tumor progression. In cases of fistulas that make radical surgery difficult, surgical closure of fistulas or colostomy under general anesthesia is sometimes performed (4,5). The ASA-PS and ACCI are often used to predict prognostic performance in patients undergoing surgery (18-20). If the ASA-PS or ACCI is high, the patient is considered to have a poor PS (21). In our case, although the ASA-PS was low (grade 2) because of the lack of severe systemic complications aside from mild hypertension, the Charlson comorbidity index was high (11 points) because of her advanced age and the presence of a metastatic solid tumor. In addition, because of undernutrition and her advanced age, the patient wished to avoid surgery, which was considered risky and unsuitable. However, a fever due to the backflow of stool persisted. In addition, the patient and her family were strongly in favor of improving her food intake. We therefore performed endoscopic closure of the fistulas.
Endoscopic closure methods for fistulas, such as clipping and OTSCs, are often used (22,23). Although clipping and OTSCs are effective for small fistulas, these methods are difficult to apply to relatively large fistulas. Recently, PGA sheets, which are often used in the closure of fistulas in respiratory and dental oral areas, have been applied for the treatment or prevention of perforation after ESD (6,7). Because PGA sheets can be cut to the appropriate size for application, they are considered useful for relatively large fistulas where clipping or OTSCs is not suitable. Therefore, we used PGA sheets to close the duodenal fistula in the present case.
Stent placement therapy for the digestive tract is used to remove stenosis due to malignancy. Covered metal stents have been used for the management of postoperative leakage and fistulas of the upper gastrointestinal tract, such as the esophagus and stomach. The usefulness of covered metal stents is also reported for postoperative leakage and fistulas of the colon (24-27). Furthermore, endoscopic closure with a covered metal stent is also used for fistulas due to malignant tumors, such as esophageal or colon carcinomas that form esophagorespiratory or colovesical fistulas (10-12). Because stenosis in the transverse colon tract was caused by tumor invasion in our case, we determined the risk of stent dislocation to be low and closed the colon fistula by placing a covered metal stent. The use of colonic covered metal stents is currently approved in Japan; however, at the time of the patient's treatment, only uncovered metal stents were covered by insurance. Therefore, we used a duodenal covered metal stent for the transverse colon fistula after obtaining the consent of the patient and family beforehand. Covered metal stents show a higher risk of migration than do uncovered metal stents. Furthermore, the metal stent may migrate when the tumor size is reduced by chemotherapy. However, the covered metal stent used for the present case has an uncovered portion measuring 15 mm at both ends to prevent migration. In our case, the large tumor compressed the colon where the covered metal stent was placed, and stent migration was prevented. If migration is discovered in the early stage, endoscopic repositioning may be possible. Therefore, it is necessary to confirm the stent position by regular monitoring on abdominal radiographs.
Covered metal stents for colon fistulas, such as those observed in this case, are effective and might be needed in the future. However, in the present case, covered metal stent placement for duodenal fistulas was difficult because the normal tract of the duodenum was not stenotic and was proximal to the pylorus. Therefore, we used PGA sheets to achieve closure of the duodenal fistula. Although complete closure with PGA sheets alone seemed difficult, intratumoral infection was resolved, and resumption of chemotherapy was possible because the backflow of fecal matter into the fistula decreased after placement of the covered metal stent.
In our case, the fever due to the backflow of stool was alleviated, and food intake became possible following endoscopic closure of the fistulas. In addition, chemotherapy was administered to reduce the fistula and tumor masses. However, chemotherapy could not suppress tumor growth, and the patient died three months after hospitalization. If reduction of the tumor had been achieved by chemotherapy, spontaneous closure of the fistulas and life prolongation may have been possible. A regimen of gemcitabine plus cisplatin has been recommended at evidence level A for unresectable gallbladder carcinoma, but the tissue type is not mentioned (28,29). There are several case reports on chemotherapy using 5-fluorouracil or FOLFOX (folinic acid, fluorouracil and oxaliplatin) as postoperative adjuvant chemotherapy for squamous cell carcinoma of the gallbladder, but no consensus has been reached so far because of the limited number of reports (30). Although gemcitabine and cisplatin, which are considered the standard chemotherapy regimen for unresectable gallbladder carcinoma, were selected in our case, the tumor was not reduced. Chemotherapy regimens for squamous cell carcinoma of the gallbladder should be investigated in future studies.
We performed endoscopic closure with a covered metal stent and PGA sheet for gastrointestinal fistulas due to squamous cell carcinoma of the gallbladder, which enabled food intake. To our knowledge, there are no previous reports of endoscopic closure of gastrointestinal fistulas due to squamous cell carcinoma of the gallbladder. Covered metal stents and PGA sheets are less invasive than surgery and are considered effective for managing relatively large fistulas in which clipping or OTSCs are not applicable.
Informed consent was obtained from the patient and her family for inclusion in the study.
The authors state that they have no Conflict of Interest (COI). | Fatal | ReactionOutcome | CC BY-NC-ND | 33390496 | 20,387,983 | 2021-06-01 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Cardiotoxicity'. | Cardiotoxicity during long-term trastuzumab use in patients with HER2-positive metastatic breast cancer: who needs cardiac monitoring?
OBJECTIVE
Patients with HER2-positive metastatic breast cancer (MBC) usually receive many years of trastuzumab treatment. It is unknown whether these patients require continuous left ventricular ejection fraction (LVEF) monitoring. We studied a real-world cohort to identify risk factors for cardiotoxicity to select patients in whom LVEF monitoring could be omitted.
METHODS
We included patients with HER2-positive MBC who received > 1 cycle of trastuzumab-based therapy in eight Dutch hospitals between 2000 and 2014. Cardiotoxicity was defined as LVEF < 50% that declined > 10%-points and was categorized into non-severe cardiotoxicity (LVEF 40-50%) and severe cardiotoxicity (LVEF < 40%). Multivariable Cox and mixed model analyses were performed to identify risk factors associated with cardiotoxicity. Additionally, we explored the reversibility of cardiotoxicity in patients who continued trastuzumab.
RESULTS
In total, 429 patients were included. Median follow-up for cardiotoxicity was 15 months (interquartile range 8-31 months). The yearly incidence of non-severe + severe cardiotoxicity in the first and second year was 11.7% and 9.1%, respectively, which decreased thereafter. The yearly incidence of severe cardiotoxicity was low (2.8%) and stable over time. In non-smoking patients with baseline LVEF > 60% and no cardiotoxicity during prior neoadjuvant/adjuvant treatment, the cumulative incidence of severe cardiotoxicity was 3.1% after 4 years of trastuzumab. Despite continuing trastuzumab, LVEF decline was reversible in 56% of patients with non-severe cardiotoxicity and in 33% with severe cardiotoxicity.
CONCLUSIONS
Serial cardiac monitoring can be safely omitted in non-smoking patients with baseline LVEF > 60% and without cardiotoxicity during prior neoadjuvant/adjuvant treatment.
Introduction
Trastuzumab is a monoclonal antibody targeting the human epidermal growth factor receptor 2 (HER2) that has greatly improved the outcome of patients with HER2-positive breast cancer in both the primary and metastatic setting [1–3]. Trastuzumab toxicity is generally mild, although left ventricle ejection fraction (LVEF) decline (cardiotoxicity) is a well-known side effect that is mostly seen in combination with concurrent or sequential anthracycline treatment [3]. Regular LVEF monitoring at a 3-monthly interval is therefore recommended during 1 year of neoadjuvant and/or adjuvant trastuzumab treatment; however, during metastatic treatment no specific time interval of LVEF monitoring is recommended [4]. Since the median overall survival of patients with HER2-positive metastatic breast cancer (MBC) is well over 4 years with continuous use of trastuzumab, the cumulative burden of LVEF monitoring can be high [5, 6]. The incidence of cardiotoxicity during long-term treatment for HER2-positive MBC, however, is not well-known and neither are risk factors for trastuzumab-associated cardiotoxicity in this setting.
Two studies investigated cardiotoxicity over time during trastuzumab treatment in patients with MBC [7, 8]. The first study found a cumulative incidence of cardiotoxicity of 12.7% and 28.5% after 1 and 3 years of trastuzumab use, respectively [7]. They defined cardiotoxicity as LVEF decline > 20%-points from baseline or LVEF < 50% or symptoms of congestive heart failure. The LVEF recovered in a vast majority of the patients (84%) after discontinuation of trastuzumab with or without cardio-protective treatment. However, reversibility of cardiotoxicity after continuation of trastuzumab has not been described yet. A second study observed a cumulative incidence of cardiotoxicity of 5.3% after 3 years of trastuzumab use. However, they used a composite endpoint that included myocardial ischaemia, heart failure, rhythm disorder, and other cardiac diseases [8]. Data on long-term sequelae were not available. Lastly, risk factors for developing cardiotoxicity during long-term trastuzumab treatment could be similar to those causing cardiotoxicity during 1 year of trastuzumab treatment [9–11]; however, this has not been investigated yet.
Therefore, we studied cardiotoxicity during long-term trastuzumab treatment in patients with HER2-positive MBC in an observational historic multicentre cohort study and risk factors associated with cardiotoxicity in this setting to select patients in whom LVEF monitoring could be omitted. Additionally, we evaluated the reversibility of cardiotoxicity in patients who continued trastuzumab.
Methods
Patients and data collection
We included patients with HER2-positive MBC who received > 1 cycle of trastuzumab-based treatment in one of eight participating Dutch hospitals between January 2000 and December 2014, as described before [12]. Patients were identified using the Netherlands Cancer Registry. Patients were excluded in case no baseline LVEF measurement was available within 30 days before the first trastuzumab administration for MBC, baseline LVEF < 50%, no follow-up LVEF measurements were available during trastuzumab use, and in case of incomplete clinical data in the medical records.
Trained investigators systematically retrieved data on patient and tumour characteristics, treatment, and LVEF measurements from medical records. Medical Ethics Commission of all participating hospitals approved this comprehensive data collection.
Endpoints
We defined non-severe + severe cardiotoxicity and severe cardiotoxicity based on guidelines of the European Society of Cardiology (ESC) [13] and the European Society of Medical Oncology (ESMO) [4], respectively. First, non-severe + severe cardiotoxicity is defined as (1) LVEF decline > 10%-points from baseline and LVEF < 50% measured with multigated acquisition (MUGA) scan or (2) decline from good/normal cardiac function to at least mild cardiac dysfunction and at least mild cardiac dysfunction measured with echocardiography if MUGA was not available. After a decline in LVEF found with MUGA scan, in some cases this was followed by an echocardiography to exclude false negative low LVEF measurements. In case both investigations were performed, echocardiography was used to define cardiotoxicity. Second, severe cardiotoxicity is defined as (1) LVEF < 40% measured with MUGA scan or (2) moderate or severe cardiac dysfunction measured with echocardiography if MUGA was not available [13]. Since patients with LVEF < 50% at baseline were excluded, patients with LVEF < 40% had by definition a LVEF decline of > 10%-points compared to baseline. Lastly, non-severe cardiotoxicity was defined as (1) LVEF < 50% but > 40% or mild cardiac dysfunction measured with echocardiography. The time to non-severe + severe cardiotoxicity, non-severe cardiotoxicity or severe cardiotoxicity was calculated from start of trastuzumab treatment for MBC to the first occurrence of non-severe + severe cardiotoxicity.
For the analyses of reversibility, non-severe + severe cardiotoxicity was categorized into non-severe cardiotoxicity and severe cardiotoxicity. Reversibility of cardiotoxicity was defined as any LVEF increase to a value < 5% below baseline, partially reversibility as any absolute LVEF increase ≥ 10% from nadir and to a value > 5% below baseline, and irreversibility as any absolute LVEF increase < 10% from nadir and to a value > 5% below baseline [14]. The frequency of LVEF measurements was determined by the treating physician.
Statistical analyses
Continuous variables are presented as medians with interquartile range (IQR) for non-normal distribution, and as means with standard deviations for normal distribution. Categorical variables are presented as percentages.
Median follow-up for cardiotoxicity was calculated from start of trastuzumab for MBC until 6 months after last trastuzumab dose or until last LVEF measurement, whichever came first. Discontinuation of trastuzumab treatment was defined as any stop or interruption of trastuzumab treatment. The yearly incidence of cardiotoxicity was investigated. Patients were at risk for cardiotoxicity when receiving LVEF measurements during trastuzumab treatment. After the first development of non-severe cardiotoxicity, patients were no longer at risk for non-severe cardiotoxicity. However, these patients were still at risk for severe cardiotoxicity. After developing severe cardiotoxicity, patients were no longer at risk for any type of cardiotoxicity.
We used univariable and multivariable Cox proportional hazards (PH) analyses to determine which baseline variables were associated with non-severe + severe cardiotoxicity and severe cardiotoxicity, and to find a group of patients at low risk of cardiotoxicity. All variables were determined at start of trastuzumab treatment for MBC. Independent variables statistically significant at 0.10 level in univariable analysis or known risk factors for cardiotoxicity from literature were included in the multivariable analysis. The Cox PH assumption was verified using the Schoenfeld residuals test and was not violated. Multivariable cause-specific Cox PH models were built with similar variables to investigate potential competing risk from death with non-severe + severe cardiotoxicity or severe cardiotoxicity. In this analysis, patients are censored in case of death due to any cause.
The following variables were included in the analyses: age, BMI, hypertension, diabetes mellitus, smoking, history of cardiac disease, baseline LVEF < 60%, cardiotoxicity during prior neoadjuvant/adjuvant treatment with trastuzumab and/or anthracycline, prior cumulative anthracycline exposure, radiation exposure to the breast. BMI was categorized in BMI < 25 kg/m2, 25–30 kg/m2, and > 30 kg/m2. Hypertension was defined as a history of systolic blood pressure > 130 mmHg or diastolic blood pressure > 80 mmHg or the use of antihypertensive medication [15]. History of cardiac disease was defined as the history of either arrhythmia, cardiac valve deficiency, cardiomyopathy or coronary artery disease. Cardiotoxicity during prior treatment was defined LVEF decline > 10%-points to a LVEF < 50% during neoadjuvant/adjuvant treatment with trastuzumab and/or anthracycline. Prior cumulative anthracycline exposure was defined as the number of courses anthracycline before trastuzumab in palliative setting. Radiation exposure was categorized in left-sided, right-sided or unknown side. Last, de novo metastatic breast cancer was defined as metastatic disease at time of diagnosis or development of metastases within 3 months of diagnosis.
For the multivariable Cox PH analyses, missing information on diabetes mellitus, hypertension, smoking, history of cardiac disease, radiotherapy side and cardiotoxicity during prior neoadjuvant/adjuvant treatment with trastuzumab and/or anthracycline was imputed using fully conditional specification with 100 imputations. Estimates were pooled over imputed data sets using Rubin’s rules. A sensitivity analysis with a complete case analysis was conducted to investigate robustness of the imputation procedure. In the cause-specific Cox PH analyses, missing values were imputed using substantive model compatible fully conditional specification with 100 imputations. Additionally, sensitivity analyses were performed by investigating the number of LVEF measurements as a risk factor for cardiotoxicity in a Cox PH analysis to investigate detection bias. LVEF measurements up until the development of cardiotoxicity were taken into account in these analyses.
To study the relation between the independent variables and continuous LVEF measurements during total follow-up, linear mixed effects model (LMM) analysis was conducted. Risk factors that are related to a LVEF decline, but not with the definition of cardiotoxicity, were investigated in this analysis. In addition to the variables used in the Cox PH analysis, this model allows to investigate time varying variables, namely the cumulative trastuzumab exposure at each LVEF measurement calculated from start trastuzumab to each LVEF measurement (in months). The fit of the LMM was adjusted by the non-linear curve observed from the predicted values plot (data not shown) [16]. The effect of time since start trastuzumab was modelled using restricted cubic splines, with the number of knots (4) chosen using information criteria. Random intercept and random slope of time since start of trastuzumab were included to account for within-patient correlations between repeated measurements.
Inverse Kaplan–Meier curves stratified for significant risk factors were used to investigate the cumulative incidence of non-severe + severe cardiotoxicity and severe cardiotoxicity for the number of significant risk factors from the Cox PH analysis.
Data analyses were performed using SPSS (version 24.0) and R (version 3.4.3), in particular the packages “lme”, “splines”, “JointAI”, “smcfcs” and “mice”.
Results
Patient characteristics
Between January 2000 and December 2014, 745 patients with HER2-positive MBC were identified in the eight participating Dutch hospitals. After excluding patients who had no baseline LVEF measurement (n = 193), a baseline LVEF measurement < 50% (n = 41), no LVEF measurement during trastuzumab treatment (n = 55), or in whom no additional data collection was possible (n = 18), 429 patients were eligible for current analyses (Supplementary Figure S1). In general, no difference was observed between included and excluded patients, except for a lower percentage of patients receiving prior neoadjuvant/adjuvant trastuzumab in the latter (Supplementary Table S1). Patient and treatment characteristics are shown in Table 1. Of all patients, 311 (72%) had metachronous distant metastases and 118 (28%) had synchronous distant metastases at disease presentation.Table 1 Baseline characteristics of all included patients (n = 429)
Clinical and treatment characteristics No. (%), median [IQR]
Age (years)a 54 [46–61]
Hormonal receptor statusb
Positive 235 (55)
Negative 172 (40)
Unknown 22 (5)
Neoadjuvant/adjuvant chemotherapy
No 213 (50)
Anthracyclines + trastuzumab 65 (15)
Anthracyclines without trastuzumab 120 (28)
Trastuzumab without anthracyclines 19 (4)
Other 12 (3)
Duration of neoadjuvant/adjuvant trastuzumab (months) 12 [12–12]
Prior cumulative anthracycline exposure (courses)a,c,d 0 [0–4]
Adjuvant radiotherapy
No 171 (40)
Left side 126 (29)
Right side 100 (23)
Side unknown 32 (8)
Cardiotoxicity during prior neoadjuvant/adjuvant treatment with trastuzumab and/or anthracyclines
No 329 (77)
Yes 15 (4)
Unknown 85 (20)
Baseline LVEF (%)a
≥ 60 198 (46)
< 60 231 (54)
BMI (kg/m2)a
< 25 164 (49)
25–30 130 (30)
> 30 44 (10)
Unknown 91 (21)
History of cardiac disease
No 379 (88)
Yes 35 (8)
Unknown 15 (4)
Diabetes mellitusa
No 387 (90)
Yes 28 (7)
Unknown 14 (3)
Hypertensiona
No 314 (73)
Yes 98 (23)
Unknown 17% (4)
Hypercholesterolemiaa
No 210 (49)
Yes 37 (9)
Unknown 182 (42)
Smokinga
No 203 (47)
Yes 90 (21)
Unknown 136 (32)
IQR interquartile range, LVEF left ventricle ejection fraction, BMI body mass index, MUGA scan, multigated acquisition scan, MRI magnetic resonance imaging, MBC metastatic breast cancer
aAt start of palliative trastuzumab treatment; for definition see Methods section
bEstrogen and progesterone receptor positivity was defined as ≥ 10% positive nuclear staining [17]
cNumber of courses before palliative trastuzumab treatment
dCould consist of doxorubicin or epirubicin courses
Patients were followed for cardiotoxicity with a median of 15 months (IQR 8–31). The median overall survival for all patients was 42 months (IQR 25–71). Median frequency of LVEF monitoring was 4 times annually (IQR 3–5) with a median total number of LVEF measurements of 4 during follow-up (IQR 2–7). Most commonly used cardiac imaging modality for LVEF assessment was the MUGA scan in 358 patients (83%). Echocardiography (4%) or CMR (0.2%) or a combination of both (13%) was performed less often.
Incidence of non-severe + severe and severe cardiotoxicity over time
During total follow-up, 94 patients (22%) developed non-severe + severe cardiotoxicity. In the first year of trastuzumab treatment, the incidence of non-severe + severe cardiotoxicity was 11.7% (Fig. 1). The yearly incidence gradually decreased over the following years (i.e. 9.1% in year 2 to 3.6% in year 6). The median time to develop non-severe + severe cardiotoxicity from start of trastuzumab for MBC was 11 months (IQR 5–23).Fig. 1 Yearly incidence of non-severe + severe cardiotoxicity and severe cardiotoxicity during long-term trastuzumab treatment
In total, 25 patients (6%) developed severe cardiotoxicity. In the first year of trastuzumab treatment, the incidence of severe cardiotoxicity was 2.8% (Fig. 1). The yearly incidence of severe cardiotoxicity the next years remained stable (i.e. 1.9% in year 2 to 2.4% in year 6). The median time to severe cardiotoxicity was 10 months (IQR 6–25).
Risk factors associated with non-severe + severe cardiotoxicity and severe cardiotoxicity
Risk factors independently associated with non-severe + severe cardiotoxicity were BMI > 30 kg/m2 (adjusted [a]HR 2.16, 95% CI 1.15–4.06), smoking (aHR 1.73, 95% CI 1.05–2.85), cardiotoxicity during prior neoadjuvant/adjuvant treatment with trastuzumab and/or anthracyclines (aHR 4.48, 95% CI 1.56–12.87). Prior neoadjuvant/adjuvant trastuzumab (aHR 0.38, 95% CI 0.18–0.82) was associated with less non-severe + severe cardiotoxicity (Table 2).Table 2 Risk factors present at start of trastuzumab treatment for MBC associated with developing non-severe + severe cardiotoxicity
Univariable Cox PHa Multivariable Cox PHa
HR 95% CI p-value Adjusted HR 95% CI p-value
Age (years) 1.01 0.99–1.02 0.574 1.01 0.99–1.03 0.254
BMI (kg/m2)
< 25 Ref
25–30 1.29 0.76–2.17 0.340 1.24 0.73–2.12 0.423
> 30 2.05 1.13–3.73 0.018 2.16 1.15–4.06 0.017
Hypertension 1.23 0.77–1.95 0.386
Diabetes mellitus 1.20 0.55–2.64 0.651
Smoking 1.89 1.13–3.16 0.016 1.73 1.05–2.85 0.031
History of cardiac disease 1.36 0.71–2.60 0.352
Baseline LVEF (%)
≥ 60 Ref
< 60 1.60 1.05–2.44 0.030 1.52 0.97–2.40 0.071
Prior neoadjuvant/adjuvant trastuzumab 0.60 0.33–1.10 0.097 0.38 0.18–0.82 0.014
Cardiotoxicity during prior neoadjuvant/adjuvant treatment with trastuzumab and/or anthracyclines 2.36 1.05–5.30 0.037 4.48 1.56–12.87 0.005
Cumulative anthracycline exposure (total number of courses)b 1.05 0.98–1.14 0.155 1.05 0.97–1.15 0.247
Adjuvant radiotherapy
No Ref
Left side 1.01 0.62–1.65 0.977
Right side 1.00 0.57–1.73 0.987
Side unknown 1.22 0.57–2.62 0.615
De novo metastatic breast cancer 0.78 0.48–1.26 0.313 0.81 0.47–1.40 0.451
PH proportional hazards, HR hazard ratio, CI confidence interval, BMI body mass index, LVEF left ventricle ejection fraction, MBC metastatic breast cancer, REF reference category
aBased on multiple imputations with MICE of diabetes mellitus, hypertension, smoking, history of cardiac disease, local radiotherapy of the breast and prior cardiotoxicity during treatment with trastuzumab or anthracyclines, where death is a censoring event
bA course consist of doxorubicin 60 mg/m2 or epirubicin 100 mg/m2
Risk factors independently associated with severe cardiotoxicity were smoking (aHR 6.15, 95% CI 2.12–17.82), baseline LVEF < 60% (aHR 7.64, 95% CI 1.70–34.43) and cardiotoxicity during prior neoadjuvant/adjuvant treatment with trastuzumab and/or anthracycline (aHR 5.60, 95% CI 1.03–30.42, Table 3).Table 3 Risk factors present at start of trastuzumab treatment for MBC associated with developing severe cardiotoxicity
Univariable Cox PHa Multivariable Cox PHa
HR 95% CI p-value Adjusted HR 95% CI p-value
Age (years) 1.00 0.97–1.04 0.926
BMI (kg/m2)
< 25 Ref
25–30 1.02 0.76–2.17 0.975
> 30 1.99 1.13–3.73 0.188
Hypertension 1.39 0.57–3.35 0.468
Diabetes mellitus 0.65 0.09–4.82 0.673
Smoking 6.61 2.23–19.60 < 0.001 6.15 2.12–17.82 < 0.001
History of cardiac disease 2.61 0.98–6.96 0.056
Baseline LVEF(%)
≥ 60 Ref
< 60 9.91 2.34–42.05 0.002 7.64 1.70–34.43 0.008
Prior neoadjuvant/adjuvant trastuzumab 1.07 0.40–2.87 0.891
Cardiotoxicity during prior neoadjuvant/adjuvant treatment with trastuzumab and/or anthracycline 3.30 0.87–12.56 0.079 5.60 1.03–30.42 0.045
Cumulative anthracycline exposure (total number of courses)b 1.21 1.07–1.37 0.003 1.15 1.00–1.33 0.051
Adjuvant radiotherapy
No Ref
Left side 1.01 0.41–2.53 0.975
Right side 0.73 0.23–2.31 0.597
Unknown side 0.56 0.07–4.34 0.577
De novo metastatic breast cancer 0.46 0.16–1.34 0.153
PH proportional hazards, HR hazard ratio, CI confidence interval, BMI body mass index, LVEF left ventricle ejection fraction, MBC metastatic breast cancer, REF reference category
aBased on multiple imputations with MICE diabetes mellitus, hypertension, smoking, history of cardiac disease, local radiotherapy of the breast and prior cardiotoxicity during treatment with trastuzumab or anthracyclines, where death is a censoring event
bA course consist of doxorubicin 60 mg/m2 or epirubicin 100 mg/m2
Cause-specific Cox PH analyses, taking competing risk between cardiotoxicity and death into account, showed similar risk factors associated with non-severe + severe cardiotoxicity and severe cardiotoxicity (Supplementary Table S2).
LMM analysis (Table 4) also showed similar risk factors that were associated with LVEF differences over time as the Cox PH analyses (Tables 2 and 3). This means that patients who smoked on average had 2.77%-points lower LVEFs at the same time point compared to patients who did not smoke (Table 4; p < 0.001).Table 4 Risk factors present at start of trastuzumab for MBC associated with continuous LVEF differences at each time point during total follow-up
Estimated absolute LVEF difference at each time point (%)a 95% CI Tail-probability
Cumulative trastuzumab exposure (months)b 0.27 − 0.06 to 0.51 0.163
Age (years) 0.02 − 0.05 to 0.09 0.642
BMI (kg/m2)
< 25 Ref
25–30 − 1.04 − 2.90 to 0.73 0.237
> 30 − 1.09 − 3.44 to 1.30 0.389
Hypertension 0.67 − 1.13 to 2.47 0.461
Diabetes mellitus − 0.71 − 3.62 to 2.14 0.624
Smoking − 2.77 − 5.26 to − 0.66 0.013
History of cardiac disease 0.40 − 2.21 to 3.04 0.766
Baseline LVEF (%)
≥ 60 Ref
< 60 − 6.72 − 8.17 to − 5.28 < 0.001
Prior neoadjuvant/adjuvant trastuzumab 2.11 − 0.09 to 4.31 0.060
Cardiotoxicity during prior neoadjuvant/adjuvant treatment with trastuzumab and/or anthracyclines − 13.70 − 22.64 to − 5.45 < 0.001
Cumulative anthracycline exposure (total number of courses)c − 0.38 − 0.69 to 0.08 0.012
Adjuvant radiotherapy
No Ref
Left side 0.20 − 1.61 to 2.02 0.827
Right side 0.44 − 1.54 to 2.43 0.662
Side unknown 1.46 − 1.38 to 4.26 0.307
De novo metastatic breast cancer 1.39 − 0.45 to 3.24 0.144
LVEF left ventricle ejection fraction, CI credible interval, BMI body mass index, MBC metastatic breast cancer, REF reference category
aBased on multiple imputations with MICE of diabetes mellitus, hypertension, smoking, history of cardiac disease, local radiotherapy of the breast and prior cardiotoxicity during treatment with trastuzumab or anthracyclines
bFrom start of palliative trastuzumab treatment to each LVEF measurement
cA course consist of doxorubicin 60 mg/m2 or epirubicin 100 mg/m2
Cumulative incidence of cardiotoxicity per relevant risk factors
The identified significant risk factors from the Cox PH analyses (Tables 2 and 3) were used to identify a patient group at low risk for cardiotoxicity, regardless of their effect size. In total, 241 patients had no relevant risk factors, 152 patients 1 risk factor and 36 patients 2 or 3 risk factors. Regarding relevant risk factors for severe cardiotoxicity, 242 had no risk factors, 158 patients 1 risk factors and 29 patients 2 or 3 risk factors. Patients without relevant risk factors for severe cardiotoxicity had a low cumulative incidence of 3.1% after a total follow-up of 4 years (Fig. 2). The cumulative incidence for both non-severe + severe cardiotoxicity and severe cardiotoxicity increases in case of more relevant risk factors.Fig. 2 Cumulative incidence of non-severe + severe and severe cardiotoxicity with respect to the number of relevant risk factors.
Note Solid lines indicate cumulative incidence; dashed lines indicate corresponding 95% CI of the cumulative incidence. For non-severe + severe cardiotoxicity, the following risk factors were included: BMI > 30 kg/m2, smoking and cardiotoxicity during prior neoadjuvant/ adjuvant treatment with trastuzumab and/or anthracyclines (Table 2). For severe cardiotoxicity, the following risk factors were included: smoking, cardiotoxicity during prior neoadjuvant/adjuvant treatment with trastuzumab and/or anthracyclines and baseline LVEF < 60% (Table 3)
Sensitivity analyses evaluating detection bias of cardiotoxicity
Patients who received 0–2 LVEF measurements annually had lower risk of non-severe + severe cardiotoxicity and severe cardiotoxicity compared to patients who received 3–4 LVEF measurements annually (HR 0.43, 95% CI 0.24–0.78), however not of severe cardiotoxicity (HR 0.66, 95% CI 0.22–1.97). Additionally, patients who received > 4 LVEF measurements annually had higher risk of non-severe + severe cardiotoxicity (HR 6.39, 95% CI 3.57–11.41) and severe cardiotoxicity (HR 3.65, 95% CI 1.38–9.62).
Reversibility of non-severe + severe cardiotoxicity and severe cardiotoxicity
To explore the reversibility of cardiotoxicity, we categorized the patients who developed non-severe + severe cardiotoxicity into non-severe cardiotoxicity (n = 69) and severe cardiotoxicity (n = 25), of whom reversibility could be analysed in 58 patients with non-severe cardiotoxicity and 16 patients with severe cardiotoxicity (Fig. 3).Fig. 3 Swimmers plot of all patients who developed cardiotoxicity and received LVEF measurements thereafter (n = 74).
In total, the LVEF decline was reversible in 34 out of 58 patients (59%) who developed non-severe cardiotoxicity (Fig. 3 and Supplementary Figure S2). Among the 15 patients who discontinued trastuzumab for at least one cycle after non-severe cardiotoxicity, 7 patients received LVEF measurements. Of those patients, the LVEF was reversible in 4 patients (57%), partially reversible in 1 patient (14%) and irreversible in 2 patients (29%). Of the 43 patients who continued trastuzumab, 23 (56%) had normalization of LVEF, in 6 (15%) the LVEF decline was partially reversible and in 12 (29%) irreversible. Of all patients developing non-severe cardiotoxicity, 23% had cardiac symptoms including shortness of breath or angina pectoris. The reversibility was independent of the presence of cardiac symptoms.
The LVEF decline was reversible in 6 out of the 16 patients (35%) who developed severe cardiotoxicity and received LVEF measurements (Fig. 3 and Supplementary Figure S2). Among the 19 patients who discontinued trastuzumab after severe cardiotoxicity, the LVEF decline was reversible in 4 patients (40%), partially reversible in 3 patients (30%) and irreversible in 3 patients (30%). Among the 6 patients who continued trastuzumab after severe cardiotoxicity, the LVEF decline was reversible in 2 patients (33%), partially reversible in 3 patients (50%) and irreversible in 1 patient (17%). In the five patients with reversible severe cardiotoxicity, trastuzumab could be continued safely without recurring cardiotoxicity for a mean duration of 17 months (range 3–35). Of all patients who developed severe cardiotoxicity, 72% had cardiac symptoms. The reversibility was independent of the presence of cardiac symptoms.
Discussion
In this study, we showed that among patients with HER2-positive MBC the yearly incidence of non-severe + severe cardiotoxicity was highest in the first 2 years of trastuzumab (11.7% and 9.1%, respectively) and gradually decreased over time. The median time to develop non-severe + severe cardiotoxicity was 11 months. The yearly incidence of severe cardiotoxicity was low over time (range 1.2–2.8%) with a median time to develop severe cardiotoxicity of 10 months. In non-smoking patients with baseline LVEF > 60% and no cardiotoxicity during prior neoadjuvant/adjuvant treatment (i.e. no relevant risk factors), the cumulative incidence of severe cardiotoxicity was limited to 3.1% after 4 years. Physicians often continued trastuzumab treatment despite cardiotoxicity, i.e. 62% in case of non-severe cardiotoxicity and 24% in case of severe cardiotoxicity. Interestingly, reversibility was relatively high among those who continued trastuzumab (71% after non-severe cardiotoxicity and 83% after severe cardiotoxicity of whom 56% and 33% fully recovered, respectively). Taken together, our data show the limited clinical relevance of regular cardiac monitoring by LVEF measurements in patients without relevant risk factors, stressing the need for an alternative monitor schedule.
The incidence of cardiotoxicity observed in this study was lower than reported in some other studies investigating cardiotoxicity of trastuzumab in the advanced setting [3, 7, 18]. This might be explained by the fact that these studies included patients treated with concomitant and higher doses of anthracyclines than our study [3, 18]. In addition, some studies used other imaging modalities besides MUGA scan and had a less strict criteria to define cardiotoxicity [7, 18].
We aimed to identify subgroups with particular low risk of developing cardiotoxicity in order to tailor cardiac monitoring. In our study, high BMI, smoking, cardiotoxicity during prior neoadjuvant/adjuvant treatment with trastuzumab and/or anthracyclines and baseline LVEF < 60% were found to be statistically significant independent risk factors for cardiotoxicity, whereas other cardiovascular risk factors were not. This might be due to the fact that our study population consisted of relatively young patients (median age was 54 years) with a good LVEF (> 50%) before starting trastuzumab. In the study of Rossi et al., age was an important risk factor for cardiotoxicity among patients receiving trastuzumab for HER2-positive MBC [8]. In the study of Guarneri et al., baseline LVEF and time from last anthracycline administration were important risk factors [7]. In addition, a recent study indicated that polymorphism HER2-Ile655 A > G is a risk factor for developing cardiotoxicity during trastuzumab [19]. Whether this risk factor will help personalizing cardiac monitoring in patients with HER2-positive MBC remains to be investigated.
By combining the incidence of cardiotoxicity over time with an individual cardiovascular risk profile, a tailored cardiac monitoring recommendation could be given, in case a yearly incidence of severe cardiotoxicity of less than 1%, while on average in women aged ≥ 50 in Europe the yearly incidence of heart failure ranges between 0.2 and 2.2% [20], is considered acceptable. This would result in the following recommendations. First, for patients with a baseline LVEF above 60%, without cardiotoxicity during prior neoadjuvant/adjuvant treatment with trastuzumab and/or anthracycline and who do not smoke, further serial cardiac monitoring during trastuzumab treatment could be omitted, since the cumulative incidence of severe cardiotoxicity in these patients after 4 years of trastuzumab treatment is low (3.1%). Second, for patients with ≥ 1 risk factor, cardiac monitoring during the first 3 years would be recommended as the yearly increase and absolute numbers of non-severe + severe cardiotoxicity were low after 3 years. Thereafter, cardiac monitoring could be performed in case of cardiac symptoms. The high reversibility rates of cardiotoxicity in a substantial number of patients with MBC, even after continuing trastuzumab, support our proposed individualized LVEF monitoring scheme during (long-term) trastuzumab treatment.
We did not have sufficient data on the use or start of cardio-protective medication which could be of value in determining trastuzumab continuation after cardiotoxicity and in evaluating the reversibility of cardiotoxicity. Furthermore, we could not assess whether the use or start of cardio-protective medication could be helpful for the proposed individualized LVEF monitoring schemes. Medication, including ACE inhibitors (perindopril, lisinopril), beta-blockers (carvedilol, bisoprolol) or angiotensin receptor blocker (candesartan), has shown to attenuate LVEF declines and thereby potentially increase the reversibility of LVEF declines [21–25].
To the best of our knowledge, this study is the largest in number with the longest follow-up duration investigating the reversibility of cardiotoxicity during trastuzumab in patients with HER2-positive MBC. Although the historical observational design of this cohort study provided a valuable opportunity to investigate clinical practice, some limitations inherent to historic cohorts should be mentioned. First, not all variables could retrospectively be collected and therefore not all variables, for example medication use and total dose of anthracycline treatment (mg/m2) and radiation treatment (Gy), could be investigated. Although some missing data were observed for other variables as well, these variables could be used after multiple imputation as sensitivity analysis with complete case analysis showed similar risk factors associated with non-severe + severe cardiotoxicity as after multiple imputations (Supplementary Table S3). Second, due to the lack of clear cardiac monitoring guidelines, the timing of the LVEF measurements was not standardized but chosen by the treating physician. Therefore, ascertainment of cardiotoxicity could be delayed and detection bias cannot be excluded. However, information bias cannot have influenced the incidence of cardiotoxicity as LVEF measurements after cardiotoxicity were not taken into account. Third, most LVEFs (83%) were measured by MUGA scanning with a known high inter-observer and intra-observer variability in measuring the LVEF [26, 27]. However, by using a LMM analysis that takes into account all available LVEF measurements, the effect of this variability is minimized. Fourth, in estimating the cumulative incidence of cardiotoxicity per number of relevant risk factors, the effect size of the individual risk factors was not taken into account. Fifth, as the primary endpoint of the study was the development of cardiotoxicity, we did not investigate other cardiac co-morbidities that could develop over time. In addition, due to the median follow-up of the study of 15 months, we were unable to assess this. Last, only 26 patients (6%) in our cohort received dual HER2-targeted therapy, which is the current standard of first-line treatment for patients with HER2-positive MBC. However, as pertuzumab does not increases the risk of cardiotoxicity [28], the results of this study are likely to be applicable to daily clinical practice.
Conclusion
The cumulative incidence of severe cardiotoxicity in non-smoking patients with a baseline LVEF above 60% who had no cardiotoxicity during prior neoadjuvant/adjuvant treatment with trastuzumab and/or anthracycline after 4 years of trastuzumab treatment is low (3.1%). Therefore, serial cardiac monitoring can be omitted in these patients during long-term trastuzumab use.
Supplementary Information
Below is the link to the electronic supplementary material.Electronic supplementary material 1 (DOCX 199 kb)
Acknowledgements
We thank Caroline Pauwels-Heemskerk for her assistance with identifying patients in the Netherlands Cancer Institute’s tumor registry and Jorine Rigterink for her assistance with collecting data in the Netherlands Cancer Institute.
Author contributions
JJEMK, MLB, AJT, PCJ, JCD, CH, CHS, GSS and AJ were involved in patient inclusion and data acquisition. NIB, TGS and HNR extracted the data from the electronic patient files. NIB, TGS, JR, MJMK, EB, GSS, MDL and AJ advised and performed the data analysis. NIB wrote the manuscript. All authors critically reviewed and approved the final manuscript.
Funding
This study was funded by the Promotiefonds of the Albert Schweitzer Hospital, Dordrecht, The Netherlands and by Stichting A Sister’s Hope, and Stichting [Z]aan de Wandel. These foundations had no involvement in the conduct of the study.
Compliance with ethical standards
Conflict of interest
TGS received funding from Memidis Pharma outside the current project. GSS has received institutional research funding from AstraZeneca, Merck, Novartis and Roche. The other authors have no relevant financial or non-financial interests to disclose.
Ethical approval
All procedures performed in this study involving human participants were in accordance with the ethical standard of the institutional and/or national research committee and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. This article does not contain any studies with animals performed by any of the authors.
Informed consent
Informed consent was waived by institutional review boards for this retrospective study.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. | TRASTUZUMAB | DrugsGivenReaction | CC BY | 33394273 | 19,387,097 | 2021-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Drug ineffective'. | An anti-CD6 antibody for the treatment of COVID-19 patients with cytokine-release syndrome: report of three cases.
In COVID-19, the inflammatory cytokine-release syndrome is associated with the progression of the disease. Itolizumab is a monoclonal antibody that recognizes human CD6 expressed in activated T cells. The antibody has shown to be safe and efficacious in the treatment of moderate to severe psoriasis. Its effect is associated with the reduction of pro-inflammatory cytokines release, including IFN-γ, IL-6 and TNF-α. Here, we report the outcome of three severe and critically ill COVID-19 patients treated with itolizumab as part of an expanded access protocol. Itolizumab was able to reduce IL-6 concentrations in all the patients. Two of the three patients showed respiratory and radiological improvement and were fully recovered. We hypothesize this anti-inflammatory therapy in addition to antiviral and anticoagulant therapy could reduce COVID-19 associated morbidity and mortality.
A group of COVID-19 patients develops severe or critical disease accompanied by the cytokine storm syndrome. Cytokines are essential to the pathophysiology of disease and IL-6, IL-1 and TNF-α appear to be harmful, particularly in the context of the cytokine-release syndrome (CRS) [1,2].
CD6 is a membrane glycoprotein expressed primarily in mature, activated T cells. Ligand binding of CD6, increases events such as adhesion, activation, proliferation, differentiation and survival [3–6]. In addition, CD6 mediates interaction between T cells and antigen-presenting cells, contributing to the maturation of immune synapses [6]. CD6-mediated costimulation contributes to the maturation of a Th1 pattern in human T cells and preferentially promotes a pro-inflammatory response characterized by the secretion of TNF-α, IL-6 and IFN γ [7].
The activated leukocyte-cell adhesion molecule (ALCAM), also known as CD166, has been identified as the CD6 ligand [8,9]. ALCAM interaction with CD6 stabilizes the formation of the immune synapse between the lymphocytes and the antigen-presenting cells [5].
Itolizumab is a humanized monoclonal antibody developed at the Center of Molecular Immunology, in Cuba, that recognizes a region in the distal domain of the human CD6 [10,11]. The antibody reduces the expression of the intracellular proteins involved in activation and inhibits the proliferation of T cells, even in the presence of the ALCAM and IL-2 [10–12]. The effect is associated with the reduction of the secretion of pro-inflammatory cytokines including IFN-γ, IL-6 and TNF-α [13,14]. The antibody has demonstrated to be safe and efficacious in patients with moderate to severe psoriasis [15,16]. Studies from blood and tissue samples from patients with severe psoriasis showed that itolizumab reduces the proliferation of T cells and serum concentration of IL-6, TNF-α and IFN-γ [13–16]. A significant reduction of the inflammatory pattern was also observed in the tissue. On account of its well proven effect on T-cell activation and proinflammatory cytokines production, itolizumab was included as part of a Cuban expanded access protocol in critical, severe and moderate COVID-19 patients with high risk of aggravation. The study will be published soon (manuscript accepted) and here we describe in detail the outcome of three initial patients receiving the antibody.
Cases description
Patient 1: A 53-year old woman with a personal history of essential hypertension and Type 2 diabetes mellitus presented with symptoms of polypnea of more than 40 rpm, use of respiratory ancillary musculature and dry cough. She arrived from a foreign country where COVID-19 was spreading. Symptoms started on 23 March and COVID-19 was diagnosed on 26 March on the basis of positive real time PCR (RT-PCR) for SARS-CoV-2. Initial gasometry showed moderate hypoxemia and respiratory alkalosis with a partial pressure of oxygen/fraction of inspired oxygen (PO2/FiO2) ratio of 191. Chest x-rays showed interstitial lesions in both lung fields. She started therapy with lopinavir/ritonavir, chloroquine, recombinant IFN α-2b and rocephin. In spite of treatment, the illness subsequently progressed to hypoxemic respiratory failure warranting the initiation of invasive mechanical ventilation. At day 13 of her admission in the ICU, she showed radiologic worsening of the interstitial multifocal pneumonia, with elevation of ALP, LDH, erythrocyte sedimentation rate and D-dimer. Physicians administered itolizumab at a dose of 200 mg. After 48 h of the first itolizumab dose, PO2/FiO2 improved and there were evidences of radiological improvement (Figure 1A & B). Patient was extubated after the first dose of the antibody and her status changed from critical to severe. She received a second dose of the antibody (200 mg), 48 h after the first infusion. 3 days after the first administration, patient was hemodynamically stable and has spontaneous ventilation. IL-6 levels were evaluated before itolizumab administration and after 2 and 7 days of the first administration. IL-6 levels reduced overtime from 172 pg/ml to 60 pg/ml (day 7) as depicted in Figure 2A. IL-1 was evaluated at the same time intervals, but it was undetectable. In addition, aspartate amino transferase (AST) concentrations were evaluated at different time points showing a reduction from 43 U/l to 24 U/l after 7 days (Figure 2B). No adverse events related with itolizumab were reported.
Figure 1. Radiological images before and after one dose of itolizumab.
Patient 1
(A) Before itolizumab (D0): diffuse Interstitial-alveolar infiltrate in both lung fields, predominantly in the bases. Minor left pleural effusion. (B) After itolizumab (48 h): radiological improvement with decreased diffuse infiltrate and radio-opacity at the top of both lungs and in both lung bases, in less proportion. The minor pleural effusion persists. Patient 3
(C) Before itolizumab (D0): alveolar interstitial inflammatory infiltrate in both lung fields, predominantly on the right side. (D) After itolizumab (48 h): radiological improvement with significant decrease of the alveolar interstitial infiltrate of both lungs.
Figure 2. Circulating biomarkers in patient's sera.
IL-6 and AST concentrations kinetics (A & B, respectively) measured in patients during itolizumab treatment.
Patient 2: An 89-year old man with a personal history of chronic ischemic cardiopathy, permanent atrial fibrillation, hypertension and hypothyroidism. He has a previous history of alcoholism and several hospital admissions in the last 3 months on account of infectious respiratory diseases. He came to the hospital on 2 April after 7 days of shortness of breath, fever, asthenia and dry cough. He was in contact with a person who returned from a foreign country, where COVID-19 was extending. Physical examination shows signs of respiratory failure characterized by tachycardia, polypnea, intercostal and supraclavicular muscle retraction, high blood pressure, oxygen saturation of 82%, poor diuresis and drowsiness. Chest x-rays showed bilateral pulmonary inflammatory infiltrates, predominantly in the right lung. Admission ECG showed an atrial fibrillation with rapid ventricular response and the initial gasometry showed severe hypoxemia and respiratory alkalosis. Patient also had leukocytosis, altered globular sedimentation rate as well as elevated values of AST, LDH, D-dimer and positive C-reactive protein. He was admitted into the ICU requiring invasive mechanical ventilation. Treatment with lopinavir–ritonavir, chloroquine, IFN α-2b, meropenem and linezolid was initiated. 3 days after his admission into the ICU, itolizumab was prescribed, due to worsening of the bilateral pulmonary infiltrates together with a deterioration of the ventilatory function (PO2/FiO2 = 173). After the first antibody infusion, PO2/FiO2 significantly increased (PO2/FiO2 = 320) and there were evidences of radiological improvement. 3 days after, patient showed radiological worsening of the left lung, characterized by alveolar hypoventilation and atelectasis; then, a 70% pneumothorax was established. Treatment of the pneumothorax with minimal pleurotomy was very demanding and required 3 days for the resolution. The patient received a second infusion of the monoclonal antibody 72 h after the first, while a third dose was administered at the discretion of the treating physicians, 2 days after the second. In total, patient received three doses of itolizumab (200 mg) without any related adverse event. IL-6 levels were evaluated before itolizumab administration and after 2, 4 and 7 days of the first administration. IL-6 was extremely high at baseline (623 pg/ml) and even though cytokine levels reduced roughly 50%, the lowest value remained above 300 pg/ml after 7 days. IL-6 kinetics is shown in Figure 2A. Apart from IL-6, IL-1 was undetectable at this time point of the disease. Interesting, in the case of AST, a significant reduction is detecting at day 7 (pretreatment: 156 U/l, D7: 40 U/l) as is showed in Figure 2B. After 10 days of admission into the ICU, patient presented a myocardial dysfunction and shock that required vasoactive support with norepinephrine. On day 13, he finally died, on account of a mixed cardiovascular and respiratory failure.
Patient 3: An 81-year old female, who is COVID-19 positive contact was not identified at the moment of hospitalization. She started symptoms on 2 April and entered the ICU on 5 April. Patient has a previous history of hypertension, diabetes mellitus, glaucoma and smoking habit. She was admitted with frequent cough, wheezing and diarrhea. The diagnosis of viral pneumonia by COVID-19 was confirmed by RT-PCR on 7 April. Oxygen support at 5 l/min and treatment with ceftriaxone, lopinavir–ritonavir, chloroquine and IFN α-2b was indicated. Chest images showed bilateral interstitial infiltration in both lungs. Patient condition was classified as severe, although she did not require invasive mechanical ventilation. A dose of itolizumab (200 mg) was given the day after her admission into the ICU. Two days after the antibody administration, together with the rest of the therapy, there was an improvement of the respiratory distress while the chest image showed a decrease of the alveolar interstitial infiltrate of both lungs (Figure 1C & D). Patient left the ICU after a favorable clinical and radiological evolution. IL-6 concentration was measured prior and after the antibody administration. IL-6 level at baseline was lower than in previous cases (30 pg/ml), but also decreased 48 h and 168 h after itolizumab infusion, in parallel with patient recovery (Figure 2A). IL-1 and TNF-α were untraceable before and 48 h after the antibody administration. Regarding to AST concentration, the values were in the normal range during the treatment period (Figure 2B).
Materials & methods
Three patients with diagnosis of COVID-19 classified as critically ill (two) and severely ill (one) were included in an expanded access trial to receive itolizumab in addition to standard treatment (http://rpcec.sld.cu/trials/RPCEC00000311-En). The study was approved by a central ethical review board, created especially for COVID-19 and by the Cuban Regulatory Agency (CECMED). Before the treatment, informed consent was obtained from enrolled patient.
Laboratory results included blood routine, leucocyte subsets and blood biochemical parameters were collected. The level of inflammatory cytokines was measured using human validated commercially available kit from R&D Systems (MN, USA): human IL-6 Quantikine ELISA Kit (Cat# S6050), human IL-1 beta/IL-1F2 Quantikine ELISA Kit (Cat# SLB50) and human TNF-α Quantikine ELISA Kit (Cat# STA00D). In the case of IL-6, the normal range of this cytokine in sera is between 0 and 7 pg/ml [17]. We used intra-assay precision and inter-assay precision methods to evaluate precision in this study.
For intra-assay precision (precision within an assay), three samples of known concentration were tested on one plate to assess intra-assay precision.
For inter-assay precision (precision between assays), three samples of known concentration were tested in separate assays to assess inter-assay precision.
Discussion
CRS is characterized by high levels of inflammatory cytokines. Among them, IL-6 is considered a major mediator of this hyperinflammation [18,19]. Most of the COVID-19 patients-related papers showed the CRS as one of the main hallmark of the disease [20]. Additionally, IL-6 levels predict severity in COVID-19 patients [21]. There is high heterogeneity of IL-6 values among papers for classifying severe and nonsevere patients. In a large meta-analysis of 52 manuscripts, Elshazli and coworkers found that the IL-6 level associated with COVID-19 severity was 22.9 pg/ml [22]. In a series of patients treated with itolizumab a cutoff of 28 pg/ml discriminates severe patients from nonsevere (manuscript just accepted in Immunity and Aging). In the present study, the IL-6 concentration of the three patients was above this cutoff. It confirms the classification of these patients as severe and that the CRS is probably occurring.
Several anticytokine therapies have been tried for treating the hyperinflammatory phase of COVID-19 [20,23–25]. Here, we report the use of a well-known anti-inflammatory antibody targeting CD6 to treat the CRS arising in COVID-19 patients. Using an anti-CD6 antibody could reduce the concentration of several pro-inflammatory cytokines, including IL-6, IFN-γ, TNF-α and IL-17, among others, representing an advantage as compared with single-cytokine targeting antibodies. The antibody would not exacerbate lymphopenia since it does not induce complement or antibody dependent cytotoxicity [10,11].
These three SARS-CoV2 patients developed severe respiratory distress together with multifocal interstitial pneumonia. Two patients required invasive mechanical ventilation while the third patient only needed oxygen supply. They all received the anti-CD6 antibody itolizumab in combination with other drugs incorporated into the Cuban national protocol, including lopinavir/ritonavir, chloroquine and IFNα-2b. Regarding to laboratory parameters, AST is strongly associated with mortality risk compared with other parameters, reflecting liver and kidney injury [26,27]. In our cases, critically ill patients showed a significant reduction of AST concentration after the treatment suggesting an improvement in the function of these organs.
Itolizumab was very safe and did not seem to exacerbate opportunistic secondary infections. Unfortunately, we did no measure neither the frequency nor the total amount of circulating T cells in these initial patients. The impact of itolizumab on circulating T cells are being implementing in new recruited patients.
Our preliminary findings support that IL-6 levels correlated with the severity of the disease and that the antibody was capable of reducing IL-6 concentration in all three subjects. One patient died after subsequent respiratory and cardiovascular complications. In this particular case, IL-6 concentration was extremely elevated at the moment of itolizumab infusion. Although, the levels of IL-6 decreased during treatment, the values at 7 days kept still very high (above 300 pg/ml). There was a transient improvement of respiratory function but it was not enough. Presumably, the consequences of the hyperinflammatory syndrome (thrombosis, alveolar damage and severe tissue hypoxia) were irreversible at the moment of treatment and patient died as consequence of these factors.
Conclusion
In summary, in these severe and critically ill patients, itolizumab was able to reduce IL-6 concentrations. Notably, itolizumab-related adverse events were not reported. Patients with baseline IL-6 levels below 200 pg/ml, showed prompt clinical and radiological recovery. We anticipate that the timely use of this anti-inflammatory antibody in combination with the appropriate antiviral and anticoagulant therapy could reduce the mortality associated with COVID-19. The analysis of the complete-series will be published shortly.
Summary points
Inflammatory cytokine-release syndrome is associated with the progression of the coronavirus disease (COVID-19).
No current therapy has proven effective for the management of this syndrome so far.
Itolizumab is a humanized monoclonal antibody that recognizes human CD6 and its effect is associated with the reduction of pro-inflammatory cytokines release.
We present three COVID-19 cases who developed severe respiratory distress together with multifocal interstitial pneumonia.
The patients were treated with itolizumab combined with antiviral therapies.
Itolizumab reduced circulating IL-6 concentrations in the three COVID-19 patients.
Two patients showed rapid ventilatory and radiological improvement and were fully recovered.
Itolizumab-related adverse events were not reported.
These cases show that the timely use of this anti-inflammatory antibody in combination with the appropriate antiviral and anticoagulant therapy could reduce the mortality associated with COVID-19.
Author contributions
Study design and data interpretation: G Lorenzo, M Cepeda, M Ramos, D Saavedra, Z Mazorra, K Leon and T Crombet; clinical investigators (recruited and treated patients): LM Filgueira, JB Cervantes, OA Lovelle, C Herrera, C Figueredo, JA Caballero, N Sánchez, J Berrio, A Caballero; immunological assessments: D Saavedra, AL Añe-Kouri, Z Mazorra; writing and or/revision of the manuscript: T Crombet and A Caballero.
Acknowledgments
We are extremely grateful to all ICU physicians, nurses and general staff working with severe and critically ill COVID-19 patients.
Financial & competing interests disclosure
Seven authors (G Lorenzo, M Cepeda, M Ramos, D Saavedra, Z Mazorra, K Leon and T Crombet) currently work for the Center of Molecular Immunology, the institution that generated and originally patented itolizumab. The remaining authors do not have any commercial or financial relationships that could be taken as a potential conflict of interest. The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed.
No writing assistance was utilized in the production of this manuscript.
Ethical conduct of research
The authors state that they have followed the principles outlined in the Declaration of Helsinki for all human or animal experimental investigations. The study was approved by a central ethical review board, created especially for COVID-19 and by the Cuban Regulatory Agency (CECMED). Before the treatment, informed consent was obtained from enrolled patient.
Data sharing statement
The authors certify that this manuscript reports original clinical trial data on three patients, RPCEC00000311. Individual participant data that underlies the results reported in the article, after de-identification (text, tables, figures and supplement) are available along with the study protocol. The data will be available 9 months after article publication and will end 36 months following article publication. The information will be shared with investigators whose proposed use of the data has been approved by an independent review committee identified for this purpose and for individual participant data meta-analysis. Proposals may be submitted up to 36 months following article publication. After this date the data will be available in our data warehouse but without investigator support other than deposited metadata. Information regarding submitting proposal and accessing data may be found at http://rpcec.sld.cu/trials/RPCEC00000311-En | CEFTRIAXONE SODIUM, CHLOROQUINE, INTERFERON ALFA-2B, LOPINAVIR\RITONAVIR | DrugsGivenReaction | CC BY | 33397150 | 18,948,677 | 2021-03 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Off label use'. | An anti-CD6 antibody for the treatment of COVID-19 patients with cytokine-release syndrome: report of three cases.
In COVID-19, the inflammatory cytokine-release syndrome is associated with the progression of the disease. Itolizumab is a monoclonal antibody that recognizes human CD6 expressed in activated T cells. The antibody has shown to be safe and efficacious in the treatment of moderate to severe psoriasis. Its effect is associated with the reduction of pro-inflammatory cytokines release, including IFN-γ, IL-6 and TNF-α. Here, we report the outcome of three severe and critically ill COVID-19 patients treated with itolizumab as part of an expanded access protocol. Itolizumab was able to reduce IL-6 concentrations in all the patients. Two of the three patients showed respiratory and radiological improvement and were fully recovered. We hypothesize this anti-inflammatory therapy in addition to antiviral and anticoagulant therapy could reduce COVID-19 associated morbidity and mortality.
A group of COVID-19 patients develops severe or critical disease accompanied by the cytokine storm syndrome. Cytokines are essential to the pathophysiology of disease and IL-6, IL-1 and TNF-α appear to be harmful, particularly in the context of the cytokine-release syndrome (CRS) [1,2].
CD6 is a membrane glycoprotein expressed primarily in mature, activated T cells. Ligand binding of CD6, increases events such as adhesion, activation, proliferation, differentiation and survival [3–6]. In addition, CD6 mediates interaction between T cells and antigen-presenting cells, contributing to the maturation of immune synapses [6]. CD6-mediated costimulation contributes to the maturation of a Th1 pattern in human T cells and preferentially promotes a pro-inflammatory response characterized by the secretion of TNF-α, IL-6 and IFN γ [7].
The activated leukocyte-cell adhesion molecule (ALCAM), also known as CD166, has been identified as the CD6 ligand [8,9]. ALCAM interaction with CD6 stabilizes the formation of the immune synapse between the lymphocytes and the antigen-presenting cells [5].
Itolizumab is a humanized monoclonal antibody developed at the Center of Molecular Immunology, in Cuba, that recognizes a region in the distal domain of the human CD6 [10,11]. The antibody reduces the expression of the intracellular proteins involved in activation and inhibits the proliferation of T cells, even in the presence of the ALCAM and IL-2 [10–12]. The effect is associated with the reduction of the secretion of pro-inflammatory cytokines including IFN-γ, IL-6 and TNF-α [13,14]. The antibody has demonstrated to be safe and efficacious in patients with moderate to severe psoriasis [15,16]. Studies from blood and tissue samples from patients with severe psoriasis showed that itolizumab reduces the proliferation of T cells and serum concentration of IL-6, TNF-α and IFN-γ [13–16]. A significant reduction of the inflammatory pattern was also observed in the tissue. On account of its well proven effect on T-cell activation and proinflammatory cytokines production, itolizumab was included as part of a Cuban expanded access protocol in critical, severe and moderate COVID-19 patients with high risk of aggravation. The study will be published soon (manuscript accepted) and here we describe in detail the outcome of three initial patients receiving the antibody.
Cases description
Patient 1: A 53-year old woman with a personal history of essential hypertension and Type 2 diabetes mellitus presented with symptoms of polypnea of more than 40 rpm, use of respiratory ancillary musculature and dry cough. She arrived from a foreign country where COVID-19 was spreading. Symptoms started on 23 March and COVID-19 was diagnosed on 26 March on the basis of positive real time PCR (RT-PCR) for SARS-CoV-2. Initial gasometry showed moderate hypoxemia and respiratory alkalosis with a partial pressure of oxygen/fraction of inspired oxygen (PO2/FiO2) ratio of 191. Chest x-rays showed interstitial lesions in both lung fields. She started therapy with lopinavir/ritonavir, chloroquine, recombinant IFN α-2b and rocephin. In spite of treatment, the illness subsequently progressed to hypoxemic respiratory failure warranting the initiation of invasive mechanical ventilation. At day 13 of her admission in the ICU, she showed radiologic worsening of the interstitial multifocal pneumonia, with elevation of ALP, LDH, erythrocyte sedimentation rate and D-dimer. Physicians administered itolizumab at a dose of 200 mg. After 48 h of the first itolizumab dose, PO2/FiO2 improved and there were evidences of radiological improvement (Figure 1A & B). Patient was extubated after the first dose of the antibody and her status changed from critical to severe. She received a second dose of the antibody (200 mg), 48 h after the first infusion. 3 days after the first administration, patient was hemodynamically stable and has spontaneous ventilation. IL-6 levels were evaluated before itolizumab administration and after 2 and 7 days of the first administration. IL-6 levels reduced overtime from 172 pg/ml to 60 pg/ml (day 7) as depicted in Figure 2A. IL-1 was evaluated at the same time intervals, but it was undetectable. In addition, aspartate amino transferase (AST) concentrations were evaluated at different time points showing a reduction from 43 U/l to 24 U/l after 7 days (Figure 2B). No adverse events related with itolizumab were reported.
Figure 1. Radiological images before and after one dose of itolizumab.
Patient 1
(A) Before itolizumab (D0): diffuse Interstitial-alveolar infiltrate in both lung fields, predominantly in the bases. Minor left pleural effusion. (B) After itolizumab (48 h): radiological improvement with decreased diffuse infiltrate and radio-opacity at the top of both lungs and in both lung bases, in less proportion. The minor pleural effusion persists. Patient 3
(C) Before itolizumab (D0): alveolar interstitial inflammatory infiltrate in both lung fields, predominantly on the right side. (D) After itolizumab (48 h): radiological improvement with significant decrease of the alveolar interstitial infiltrate of both lungs.
Figure 2. Circulating biomarkers in patient's sera.
IL-6 and AST concentrations kinetics (A & B, respectively) measured in patients during itolizumab treatment.
Patient 2: An 89-year old man with a personal history of chronic ischemic cardiopathy, permanent atrial fibrillation, hypertension and hypothyroidism. He has a previous history of alcoholism and several hospital admissions in the last 3 months on account of infectious respiratory diseases. He came to the hospital on 2 April after 7 days of shortness of breath, fever, asthenia and dry cough. He was in contact with a person who returned from a foreign country, where COVID-19 was extending. Physical examination shows signs of respiratory failure characterized by tachycardia, polypnea, intercostal and supraclavicular muscle retraction, high blood pressure, oxygen saturation of 82%, poor diuresis and drowsiness. Chest x-rays showed bilateral pulmonary inflammatory infiltrates, predominantly in the right lung. Admission ECG showed an atrial fibrillation with rapid ventricular response and the initial gasometry showed severe hypoxemia and respiratory alkalosis. Patient also had leukocytosis, altered globular sedimentation rate as well as elevated values of AST, LDH, D-dimer and positive C-reactive protein. He was admitted into the ICU requiring invasive mechanical ventilation. Treatment with lopinavir–ritonavir, chloroquine, IFN α-2b, meropenem and linezolid was initiated. 3 days after his admission into the ICU, itolizumab was prescribed, due to worsening of the bilateral pulmonary infiltrates together with a deterioration of the ventilatory function (PO2/FiO2 = 173). After the first antibody infusion, PO2/FiO2 significantly increased (PO2/FiO2 = 320) and there were evidences of radiological improvement. 3 days after, patient showed radiological worsening of the left lung, characterized by alveolar hypoventilation and atelectasis; then, a 70% pneumothorax was established. Treatment of the pneumothorax with minimal pleurotomy was very demanding and required 3 days for the resolution. The patient received a second infusion of the monoclonal antibody 72 h after the first, while a third dose was administered at the discretion of the treating physicians, 2 days after the second. In total, patient received three doses of itolizumab (200 mg) without any related adverse event. IL-6 levels were evaluated before itolizumab administration and after 2, 4 and 7 days of the first administration. IL-6 was extremely high at baseline (623 pg/ml) and even though cytokine levels reduced roughly 50%, the lowest value remained above 300 pg/ml after 7 days. IL-6 kinetics is shown in Figure 2A. Apart from IL-6, IL-1 was undetectable at this time point of the disease. Interesting, in the case of AST, a significant reduction is detecting at day 7 (pretreatment: 156 U/l, D7: 40 U/l) as is showed in Figure 2B. After 10 days of admission into the ICU, patient presented a myocardial dysfunction and shock that required vasoactive support with norepinephrine. On day 13, he finally died, on account of a mixed cardiovascular and respiratory failure.
Patient 3: An 81-year old female, who is COVID-19 positive contact was not identified at the moment of hospitalization. She started symptoms on 2 April and entered the ICU on 5 April. Patient has a previous history of hypertension, diabetes mellitus, glaucoma and smoking habit. She was admitted with frequent cough, wheezing and diarrhea. The diagnosis of viral pneumonia by COVID-19 was confirmed by RT-PCR on 7 April. Oxygen support at 5 l/min and treatment with ceftriaxone, lopinavir–ritonavir, chloroquine and IFN α-2b was indicated. Chest images showed bilateral interstitial infiltration in both lungs. Patient condition was classified as severe, although she did not require invasive mechanical ventilation. A dose of itolizumab (200 mg) was given the day after her admission into the ICU. Two days after the antibody administration, together with the rest of the therapy, there was an improvement of the respiratory distress while the chest image showed a decrease of the alveolar interstitial infiltrate of both lungs (Figure 1C & D). Patient left the ICU after a favorable clinical and radiological evolution. IL-6 concentration was measured prior and after the antibody administration. IL-6 level at baseline was lower than in previous cases (30 pg/ml), but also decreased 48 h and 168 h after itolizumab infusion, in parallel with patient recovery (Figure 2A). IL-1 and TNF-α were untraceable before and 48 h after the antibody administration. Regarding to AST concentration, the values were in the normal range during the treatment period (Figure 2B).
Materials & methods
Three patients with diagnosis of COVID-19 classified as critically ill (two) and severely ill (one) were included in an expanded access trial to receive itolizumab in addition to standard treatment (http://rpcec.sld.cu/trials/RPCEC00000311-En). The study was approved by a central ethical review board, created especially for COVID-19 and by the Cuban Regulatory Agency (CECMED). Before the treatment, informed consent was obtained from enrolled patient.
Laboratory results included blood routine, leucocyte subsets and blood biochemical parameters were collected. The level of inflammatory cytokines was measured using human validated commercially available kit from R&D Systems (MN, USA): human IL-6 Quantikine ELISA Kit (Cat# S6050), human IL-1 beta/IL-1F2 Quantikine ELISA Kit (Cat# SLB50) and human TNF-α Quantikine ELISA Kit (Cat# STA00D). In the case of IL-6, the normal range of this cytokine in sera is between 0 and 7 pg/ml [17]. We used intra-assay precision and inter-assay precision methods to evaluate precision in this study.
For intra-assay precision (precision within an assay), three samples of known concentration were tested on one plate to assess intra-assay precision.
For inter-assay precision (precision between assays), three samples of known concentration were tested in separate assays to assess inter-assay precision.
Discussion
CRS is characterized by high levels of inflammatory cytokines. Among them, IL-6 is considered a major mediator of this hyperinflammation [18,19]. Most of the COVID-19 patients-related papers showed the CRS as one of the main hallmark of the disease [20]. Additionally, IL-6 levels predict severity in COVID-19 patients [21]. There is high heterogeneity of IL-6 values among papers for classifying severe and nonsevere patients. In a large meta-analysis of 52 manuscripts, Elshazli and coworkers found that the IL-6 level associated with COVID-19 severity was 22.9 pg/ml [22]. In a series of patients treated with itolizumab a cutoff of 28 pg/ml discriminates severe patients from nonsevere (manuscript just accepted in Immunity and Aging). In the present study, the IL-6 concentration of the three patients was above this cutoff. It confirms the classification of these patients as severe and that the CRS is probably occurring.
Several anticytokine therapies have been tried for treating the hyperinflammatory phase of COVID-19 [20,23–25]. Here, we report the use of a well-known anti-inflammatory antibody targeting CD6 to treat the CRS arising in COVID-19 patients. Using an anti-CD6 antibody could reduce the concentration of several pro-inflammatory cytokines, including IL-6, IFN-γ, TNF-α and IL-17, among others, representing an advantage as compared with single-cytokine targeting antibodies. The antibody would not exacerbate lymphopenia since it does not induce complement or antibody dependent cytotoxicity [10,11].
These three SARS-CoV2 patients developed severe respiratory distress together with multifocal interstitial pneumonia. Two patients required invasive mechanical ventilation while the third patient only needed oxygen supply. They all received the anti-CD6 antibody itolizumab in combination with other drugs incorporated into the Cuban national protocol, including lopinavir/ritonavir, chloroquine and IFNα-2b. Regarding to laboratory parameters, AST is strongly associated with mortality risk compared with other parameters, reflecting liver and kidney injury [26,27]. In our cases, critically ill patients showed a significant reduction of AST concentration after the treatment suggesting an improvement in the function of these organs.
Itolizumab was very safe and did not seem to exacerbate opportunistic secondary infections. Unfortunately, we did no measure neither the frequency nor the total amount of circulating T cells in these initial patients. The impact of itolizumab on circulating T cells are being implementing in new recruited patients.
Our preliminary findings support that IL-6 levels correlated with the severity of the disease and that the antibody was capable of reducing IL-6 concentration in all three subjects. One patient died after subsequent respiratory and cardiovascular complications. In this particular case, IL-6 concentration was extremely elevated at the moment of itolizumab infusion. Although, the levels of IL-6 decreased during treatment, the values at 7 days kept still very high (above 300 pg/ml). There was a transient improvement of respiratory function but it was not enough. Presumably, the consequences of the hyperinflammatory syndrome (thrombosis, alveolar damage and severe tissue hypoxia) were irreversible at the moment of treatment and patient died as consequence of these factors.
Conclusion
In summary, in these severe and critically ill patients, itolizumab was able to reduce IL-6 concentrations. Notably, itolizumab-related adverse events were not reported. Patients with baseline IL-6 levels below 200 pg/ml, showed prompt clinical and radiological recovery. We anticipate that the timely use of this anti-inflammatory antibody in combination with the appropriate antiviral and anticoagulant therapy could reduce the mortality associated with COVID-19. The analysis of the complete-series will be published shortly.
Summary points
Inflammatory cytokine-release syndrome is associated with the progression of the coronavirus disease (COVID-19).
No current therapy has proven effective for the management of this syndrome so far.
Itolizumab is a humanized monoclonal antibody that recognizes human CD6 and its effect is associated with the reduction of pro-inflammatory cytokines release.
We present three COVID-19 cases who developed severe respiratory distress together with multifocal interstitial pneumonia.
The patients were treated with itolizumab combined with antiviral therapies.
Itolizumab reduced circulating IL-6 concentrations in the three COVID-19 patients.
Two patients showed rapid ventilatory and radiological improvement and were fully recovered.
Itolizumab-related adverse events were not reported.
These cases show that the timely use of this anti-inflammatory antibody in combination with the appropriate antiviral and anticoagulant therapy could reduce the mortality associated with COVID-19.
Author contributions
Study design and data interpretation: G Lorenzo, M Cepeda, M Ramos, D Saavedra, Z Mazorra, K Leon and T Crombet; clinical investigators (recruited and treated patients): LM Filgueira, JB Cervantes, OA Lovelle, C Herrera, C Figueredo, JA Caballero, N Sánchez, J Berrio, A Caballero; immunological assessments: D Saavedra, AL Añe-Kouri, Z Mazorra; writing and or/revision of the manuscript: T Crombet and A Caballero.
Acknowledgments
We are extremely grateful to all ICU physicians, nurses and general staff working with severe and critically ill COVID-19 patients.
Financial & competing interests disclosure
Seven authors (G Lorenzo, M Cepeda, M Ramos, D Saavedra, Z Mazorra, K Leon and T Crombet) currently work for the Center of Molecular Immunology, the institution that generated and originally patented itolizumab. The remaining authors do not have any commercial or financial relationships that could be taken as a potential conflict of interest. The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed.
No writing assistance was utilized in the production of this manuscript.
Ethical conduct of research
The authors state that they have followed the principles outlined in the Declaration of Helsinki for all human or animal experimental investigations. The study was approved by a central ethical review board, created especially for COVID-19 and by the Cuban Regulatory Agency (CECMED). Before the treatment, informed consent was obtained from enrolled patient.
Data sharing statement
The authors certify that this manuscript reports original clinical trial data on three patients, RPCEC00000311. Individual participant data that underlies the results reported in the article, after de-identification (text, tables, figures and supplement) are available along with the study protocol. The data will be available 9 months after article publication and will end 36 months following article publication. The information will be shared with investigators whose proposed use of the data has been approved by an independent review committee identified for this purpose and for individual participant data meta-analysis. Proposals may be submitted up to 36 months following article publication. After this date the data will be available in our data warehouse but without investigator support other than deposited metadata. Information regarding submitting proposal and accessing data may be found at http://rpcec.sld.cu/trials/RPCEC00000311-En | CEFTRIAXONE SODIUM, CHLOROQUINE, INTERFERON ALFA-2B, LOPINAVIR\RITONAVIR | DrugsGivenReaction | CC BY | 33397150 | 18,948,677 | 2021-03 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Respiratory failure'. | An anti-CD6 antibody for the treatment of COVID-19 patients with cytokine-release syndrome: report of three cases.
In COVID-19, the inflammatory cytokine-release syndrome is associated with the progression of the disease. Itolizumab is a monoclonal antibody that recognizes human CD6 expressed in activated T cells. The antibody has shown to be safe and efficacious in the treatment of moderate to severe psoriasis. Its effect is associated with the reduction of pro-inflammatory cytokines release, including IFN-γ, IL-6 and TNF-α. Here, we report the outcome of three severe and critically ill COVID-19 patients treated with itolizumab as part of an expanded access protocol. Itolizumab was able to reduce IL-6 concentrations in all the patients. Two of the three patients showed respiratory and radiological improvement and were fully recovered. We hypothesize this anti-inflammatory therapy in addition to antiviral and anticoagulant therapy could reduce COVID-19 associated morbidity and mortality.
A group of COVID-19 patients develops severe or critical disease accompanied by the cytokine storm syndrome. Cytokines are essential to the pathophysiology of disease and IL-6, IL-1 and TNF-α appear to be harmful, particularly in the context of the cytokine-release syndrome (CRS) [1,2].
CD6 is a membrane glycoprotein expressed primarily in mature, activated T cells. Ligand binding of CD6, increases events such as adhesion, activation, proliferation, differentiation and survival [3–6]. In addition, CD6 mediates interaction between T cells and antigen-presenting cells, contributing to the maturation of immune synapses [6]. CD6-mediated costimulation contributes to the maturation of a Th1 pattern in human T cells and preferentially promotes a pro-inflammatory response characterized by the secretion of TNF-α, IL-6 and IFN γ [7].
The activated leukocyte-cell adhesion molecule (ALCAM), also known as CD166, has been identified as the CD6 ligand [8,9]. ALCAM interaction with CD6 stabilizes the formation of the immune synapse between the lymphocytes and the antigen-presenting cells [5].
Itolizumab is a humanized monoclonal antibody developed at the Center of Molecular Immunology, in Cuba, that recognizes a region in the distal domain of the human CD6 [10,11]. The antibody reduces the expression of the intracellular proteins involved in activation and inhibits the proliferation of T cells, even in the presence of the ALCAM and IL-2 [10–12]. The effect is associated with the reduction of the secretion of pro-inflammatory cytokines including IFN-γ, IL-6 and TNF-α [13,14]. The antibody has demonstrated to be safe and efficacious in patients with moderate to severe psoriasis [15,16]. Studies from blood and tissue samples from patients with severe psoriasis showed that itolizumab reduces the proliferation of T cells and serum concentration of IL-6, TNF-α and IFN-γ [13–16]. A significant reduction of the inflammatory pattern was also observed in the tissue. On account of its well proven effect on T-cell activation and proinflammatory cytokines production, itolizumab was included as part of a Cuban expanded access protocol in critical, severe and moderate COVID-19 patients with high risk of aggravation. The study will be published soon (manuscript accepted) and here we describe in detail the outcome of three initial patients receiving the antibody.
Cases description
Patient 1: A 53-year old woman with a personal history of essential hypertension and Type 2 diabetes mellitus presented with symptoms of polypnea of more than 40 rpm, use of respiratory ancillary musculature and dry cough. She arrived from a foreign country where COVID-19 was spreading. Symptoms started on 23 March and COVID-19 was diagnosed on 26 March on the basis of positive real time PCR (RT-PCR) for SARS-CoV-2. Initial gasometry showed moderate hypoxemia and respiratory alkalosis with a partial pressure of oxygen/fraction of inspired oxygen (PO2/FiO2) ratio of 191. Chest x-rays showed interstitial lesions in both lung fields. She started therapy with lopinavir/ritonavir, chloroquine, recombinant IFN α-2b and rocephin. In spite of treatment, the illness subsequently progressed to hypoxemic respiratory failure warranting the initiation of invasive mechanical ventilation. At day 13 of her admission in the ICU, she showed radiologic worsening of the interstitial multifocal pneumonia, with elevation of ALP, LDH, erythrocyte sedimentation rate and D-dimer. Physicians administered itolizumab at a dose of 200 mg. After 48 h of the first itolizumab dose, PO2/FiO2 improved and there were evidences of radiological improvement (Figure 1A & B). Patient was extubated after the first dose of the antibody and her status changed from critical to severe. She received a second dose of the antibody (200 mg), 48 h after the first infusion. 3 days after the first administration, patient was hemodynamically stable and has spontaneous ventilation. IL-6 levels were evaluated before itolizumab administration and after 2 and 7 days of the first administration. IL-6 levels reduced overtime from 172 pg/ml to 60 pg/ml (day 7) as depicted in Figure 2A. IL-1 was evaluated at the same time intervals, but it was undetectable. In addition, aspartate amino transferase (AST) concentrations were evaluated at different time points showing a reduction from 43 U/l to 24 U/l after 7 days (Figure 2B). No adverse events related with itolizumab were reported.
Figure 1. Radiological images before and after one dose of itolizumab.
Patient 1
(A) Before itolizumab (D0): diffuse Interstitial-alveolar infiltrate in both lung fields, predominantly in the bases. Minor left pleural effusion. (B) After itolizumab (48 h): radiological improvement with decreased diffuse infiltrate and radio-opacity at the top of both lungs and in both lung bases, in less proportion. The minor pleural effusion persists. Patient 3
(C) Before itolizumab (D0): alveolar interstitial inflammatory infiltrate in both lung fields, predominantly on the right side. (D) After itolizumab (48 h): radiological improvement with significant decrease of the alveolar interstitial infiltrate of both lungs.
Figure 2. Circulating biomarkers in patient's sera.
IL-6 and AST concentrations kinetics (A & B, respectively) measured in patients during itolizumab treatment.
Patient 2: An 89-year old man with a personal history of chronic ischemic cardiopathy, permanent atrial fibrillation, hypertension and hypothyroidism. He has a previous history of alcoholism and several hospital admissions in the last 3 months on account of infectious respiratory diseases. He came to the hospital on 2 April after 7 days of shortness of breath, fever, asthenia and dry cough. He was in contact with a person who returned from a foreign country, where COVID-19 was extending. Physical examination shows signs of respiratory failure characterized by tachycardia, polypnea, intercostal and supraclavicular muscle retraction, high blood pressure, oxygen saturation of 82%, poor diuresis and drowsiness. Chest x-rays showed bilateral pulmonary inflammatory infiltrates, predominantly in the right lung. Admission ECG showed an atrial fibrillation with rapid ventricular response and the initial gasometry showed severe hypoxemia and respiratory alkalosis. Patient also had leukocytosis, altered globular sedimentation rate as well as elevated values of AST, LDH, D-dimer and positive C-reactive protein. He was admitted into the ICU requiring invasive mechanical ventilation. Treatment with lopinavir–ritonavir, chloroquine, IFN α-2b, meropenem and linezolid was initiated. 3 days after his admission into the ICU, itolizumab was prescribed, due to worsening of the bilateral pulmonary infiltrates together with a deterioration of the ventilatory function (PO2/FiO2 = 173). After the first antibody infusion, PO2/FiO2 significantly increased (PO2/FiO2 = 320) and there were evidences of radiological improvement. 3 days after, patient showed radiological worsening of the left lung, characterized by alveolar hypoventilation and atelectasis; then, a 70% pneumothorax was established. Treatment of the pneumothorax with minimal pleurotomy was very demanding and required 3 days for the resolution. The patient received a second infusion of the monoclonal antibody 72 h after the first, while a third dose was administered at the discretion of the treating physicians, 2 days after the second. In total, patient received three doses of itolizumab (200 mg) without any related adverse event. IL-6 levels were evaluated before itolizumab administration and after 2, 4 and 7 days of the first administration. IL-6 was extremely high at baseline (623 pg/ml) and even though cytokine levels reduced roughly 50%, the lowest value remained above 300 pg/ml after 7 days. IL-6 kinetics is shown in Figure 2A. Apart from IL-6, IL-1 was undetectable at this time point of the disease. Interesting, in the case of AST, a significant reduction is detecting at day 7 (pretreatment: 156 U/l, D7: 40 U/l) as is showed in Figure 2B. After 10 days of admission into the ICU, patient presented a myocardial dysfunction and shock that required vasoactive support with norepinephrine. On day 13, he finally died, on account of a mixed cardiovascular and respiratory failure.
Patient 3: An 81-year old female, who is COVID-19 positive contact was not identified at the moment of hospitalization. She started symptoms on 2 April and entered the ICU on 5 April. Patient has a previous history of hypertension, diabetes mellitus, glaucoma and smoking habit. She was admitted with frequent cough, wheezing and diarrhea. The diagnosis of viral pneumonia by COVID-19 was confirmed by RT-PCR on 7 April. Oxygen support at 5 l/min and treatment with ceftriaxone, lopinavir–ritonavir, chloroquine and IFN α-2b was indicated. Chest images showed bilateral interstitial infiltration in both lungs. Patient condition was classified as severe, although she did not require invasive mechanical ventilation. A dose of itolizumab (200 mg) was given the day after her admission into the ICU. Two days after the antibody administration, together with the rest of the therapy, there was an improvement of the respiratory distress while the chest image showed a decrease of the alveolar interstitial infiltrate of both lungs (Figure 1C & D). Patient left the ICU after a favorable clinical and radiological evolution. IL-6 concentration was measured prior and after the antibody administration. IL-6 level at baseline was lower than in previous cases (30 pg/ml), but also decreased 48 h and 168 h after itolizumab infusion, in parallel with patient recovery (Figure 2A). IL-1 and TNF-α were untraceable before and 48 h after the antibody administration. Regarding to AST concentration, the values were in the normal range during the treatment period (Figure 2B).
Materials & methods
Three patients with diagnosis of COVID-19 classified as critically ill (two) and severely ill (one) were included in an expanded access trial to receive itolizumab in addition to standard treatment (http://rpcec.sld.cu/trials/RPCEC00000311-En). The study was approved by a central ethical review board, created especially for COVID-19 and by the Cuban Regulatory Agency (CECMED). Before the treatment, informed consent was obtained from enrolled patient.
Laboratory results included blood routine, leucocyte subsets and blood biochemical parameters were collected. The level of inflammatory cytokines was measured using human validated commercially available kit from R&D Systems (MN, USA): human IL-6 Quantikine ELISA Kit (Cat# S6050), human IL-1 beta/IL-1F2 Quantikine ELISA Kit (Cat# SLB50) and human TNF-α Quantikine ELISA Kit (Cat# STA00D). In the case of IL-6, the normal range of this cytokine in sera is between 0 and 7 pg/ml [17]. We used intra-assay precision and inter-assay precision methods to evaluate precision in this study.
For intra-assay precision (precision within an assay), three samples of known concentration were tested on one plate to assess intra-assay precision.
For inter-assay precision (precision between assays), three samples of known concentration were tested in separate assays to assess inter-assay precision.
Discussion
CRS is characterized by high levels of inflammatory cytokines. Among them, IL-6 is considered a major mediator of this hyperinflammation [18,19]. Most of the COVID-19 patients-related papers showed the CRS as one of the main hallmark of the disease [20]. Additionally, IL-6 levels predict severity in COVID-19 patients [21]. There is high heterogeneity of IL-6 values among papers for classifying severe and nonsevere patients. In a large meta-analysis of 52 manuscripts, Elshazli and coworkers found that the IL-6 level associated with COVID-19 severity was 22.9 pg/ml [22]. In a series of patients treated with itolizumab a cutoff of 28 pg/ml discriminates severe patients from nonsevere (manuscript just accepted in Immunity and Aging). In the present study, the IL-6 concentration of the three patients was above this cutoff. It confirms the classification of these patients as severe and that the CRS is probably occurring.
Several anticytokine therapies have been tried for treating the hyperinflammatory phase of COVID-19 [20,23–25]. Here, we report the use of a well-known anti-inflammatory antibody targeting CD6 to treat the CRS arising in COVID-19 patients. Using an anti-CD6 antibody could reduce the concentration of several pro-inflammatory cytokines, including IL-6, IFN-γ, TNF-α and IL-17, among others, representing an advantage as compared with single-cytokine targeting antibodies. The antibody would not exacerbate lymphopenia since it does not induce complement or antibody dependent cytotoxicity [10,11].
These three SARS-CoV2 patients developed severe respiratory distress together with multifocal interstitial pneumonia. Two patients required invasive mechanical ventilation while the third patient only needed oxygen supply. They all received the anti-CD6 antibody itolizumab in combination with other drugs incorporated into the Cuban national protocol, including lopinavir/ritonavir, chloroquine and IFNα-2b. Regarding to laboratory parameters, AST is strongly associated with mortality risk compared with other parameters, reflecting liver and kidney injury [26,27]. In our cases, critically ill patients showed a significant reduction of AST concentration after the treatment suggesting an improvement in the function of these organs.
Itolizumab was very safe and did not seem to exacerbate opportunistic secondary infections. Unfortunately, we did no measure neither the frequency nor the total amount of circulating T cells in these initial patients. The impact of itolizumab on circulating T cells are being implementing in new recruited patients.
Our preliminary findings support that IL-6 levels correlated with the severity of the disease and that the antibody was capable of reducing IL-6 concentration in all three subjects. One patient died after subsequent respiratory and cardiovascular complications. In this particular case, IL-6 concentration was extremely elevated at the moment of itolizumab infusion. Although, the levels of IL-6 decreased during treatment, the values at 7 days kept still very high (above 300 pg/ml). There was a transient improvement of respiratory function but it was not enough. Presumably, the consequences of the hyperinflammatory syndrome (thrombosis, alveolar damage and severe tissue hypoxia) were irreversible at the moment of treatment and patient died as consequence of these factors.
Conclusion
In summary, in these severe and critically ill patients, itolizumab was able to reduce IL-6 concentrations. Notably, itolizumab-related adverse events were not reported. Patients with baseline IL-6 levels below 200 pg/ml, showed prompt clinical and radiological recovery. We anticipate that the timely use of this anti-inflammatory antibody in combination with the appropriate antiviral and anticoagulant therapy could reduce the mortality associated with COVID-19. The analysis of the complete-series will be published shortly.
Summary points
Inflammatory cytokine-release syndrome is associated with the progression of the coronavirus disease (COVID-19).
No current therapy has proven effective for the management of this syndrome so far.
Itolizumab is a humanized monoclonal antibody that recognizes human CD6 and its effect is associated with the reduction of pro-inflammatory cytokines release.
We present three COVID-19 cases who developed severe respiratory distress together with multifocal interstitial pneumonia.
The patients were treated with itolizumab combined with antiviral therapies.
Itolizumab reduced circulating IL-6 concentrations in the three COVID-19 patients.
Two patients showed rapid ventilatory and radiological improvement and were fully recovered.
Itolizumab-related adverse events were not reported.
These cases show that the timely use of this anti-inflammatory antibody in combination with the appropriate antiviral and anticoagulant therapy could reduce the mortality associated with COVID-19.
Author contributions
Study design and data interpretation: G Lorenzo, M Cepeda, M Ramos, D Saavedra, Z Mazorra, K Leon and T Crombet; clinical investigators (recruited and treated patients): LM Filgueira, JB Cervantes, OA Lovelle, C Herrera, C Figueredo, JA Caballero, N Sánchez, J Berrio, A Caballero; immunological assessments: D Saavedra, AL Añe-Kouri, Z Mazorra; writing and or/revision of the manuscript: T Crombet and A Caballero.
Acknowledgments
We are extremely grateful to all ICU physicians, nurses and general staff working with severe and critically ill COVID-19 patients.
Financial & competing interests disclosure
Seven authors (G Lorenzo, M Cepeda, M Ramos, D Saavedra, Z Mazorra, K Leon and T Crombet) currently work for the Center of Molecular Immunology, the institution that generated and originally patented itolizumab. The remaining authors do not have any commercial or financial relationships that could be taken as a potential conflict of interest. The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed.
No writing assistance was utilized in the production of this manuscript.
Ethical conduct of research
The authors state that they have followed the principles outlined in the Declaration of Helsinki for all human or animal experimental investigations. The study was approved by a central ethical review board, created especially for COVID-19 and by the Cuban Regulatory Agency (CECMED). Before the treatment, informed consent was obtained from enrolled patient.
Data sharing statement
The authors certify that this manuscript reports original clinical trial data on three patients, RPCEC00000311. Individual participant data that underlies the results reported in the article, after de-identification (text, tables, figures and supplement) are available along with the study protocol. The data will be available 9 months after article publication and will end 36 months following article publication. The information will be shared with investigators whose proposed use of the data has been approved by an independent review committee identified for this purpose and for individual participant data meta-analysis. Proposals may be submitted up to 36 months following article publication. After this date the data will be available in our data warehouse but without investigator support other than deposited metadata. Information regarding submitting proposal and accessing data may be found at http://rpcec.sld.cu/trials/RPCEC00000311-En | CEFTRIAXONE SODIUM, CHLOROQUINE, INTERFERON ALFA-2B, LOPINAVIR\RITONAVIR | DrugsGivenReaction | CC BY | 33397150 | 18,948,677 | 2021-03 |
What was the administration route of drug 'LOPINAVIR\RITONAVIR'? | An anti-CD6 antibody for the treatment of COVID-19 patients with cytokine-release syndrome: report of three cases.
In COVID-19, the inflammatory cytokine-release syndrome is associated with the progression of the disease. Itolizumab is a monoclonal antibody that recognizes human CD6 expressed in activated T cells. The antibody has shown to be safe and efficacious in the treatment of moderate to severe psoriasis. Its effect is associated with the reduction of pro-inflammatory cytokines release, including IFN-γ, IL-6 and TNF-α. Here, we report the outcome of three severe and critically ill COVID-19 patients treated with itolizumab as part of an expanded access protocol. Itolizumab was able to reduce IL-6 concentrations in all the patients. Two of the three patients showed respiratory and radiological improvement and were fully recovered. We hypothesize this anti-inflammatory therapy in addition to antiviral and anticoagulant therapy could reduce COVID-19 associated morbidity and mortality.
A group of COVID-19 patients develops severe or critical disease accompanied by the cytokine storm syndrome. Cytokines are essential to the pathophysiology of disease and IL-6, IL-1 and TNF-α appear to be harmful, particularly in the context of the cytokine-release syndrome (CRS) [1,2].
CD6 is a membrane glycoprotein expressed primarily in mature, activated T cells. Ligand binding of CD6, increases events such as adhesion, activation, proliferation, differentiation and survival [3–6]. In addition, CD6 mediates interaction between T cells and antigen-presenting cells, contributing to the maturation of immune synapses [6]. CD6-mediated costimulation contributes to the maturation of a Th1 pattern in human T cells and preferentially promotes a pro-inflammatory response characterized by the secretion of TNF-α, IL-6 and IFN γ [7].
The activated leukocyte-cell adhesion molecule (ALCAM), also known as CD166, has been identified as the CD6 ligand [8,9]. ALCAM interaction with CD6 stabilizes the formation of the immune synapse between the lymphocytes and the antigen-presenting cells [5].
Itolizumab is a humanized monoclonal antibody developed at the Center of Molecular Immunology, in Cuba, that recognizes a region in the distal domain of the human CD6 [10,11]. The antibody reduces the expression of the intracellular proteins involved in activation and inhibits the proliferation of T cells, even in the presence of the ALCAM and IL-2 [10–12]. The effect is associated with the reduction of the secretion of pro-inflammatory cytokines including IFN-γ, IL-6 and TNF-α [13,14]. The antibody has demonstrated to be safe and efficacious in patients with moderate to severe psoriasis [15,16]. Studies from blood and tissue samples from patients with severe psoriasis showed that itolizumab reduces the proliferation of T cells and serum concentration of IL-6, TNF-α and IFN-γ [13–16]. A significant reduction of the inflammatory pattern was also observed in the tissue. On account of its well proven effect on T-cell activation and proinflammatory cytokines production, itolizumab was included as part of a Cuban expanded access protocol in critical, severe and moderate COVID-19 patients with high risk of aggravation. The study will be published soon (manuscript accepted) and here we describe in detail the outcome of three initial patients receiving the antibody.
Cases description
Patient 1: A 53-year old woman with a personal history of essential hypertension and Type 2 diabetes mellitus presented with symptoms of polypnea of more than 40 rpm, use of respiratory ancillary musculature and dry cough. She arrived from a foreign country where COVID-19 was spreading. Symptoms started on 23 March and COVID-19 was diagnosed on 26 March on the basis of positive real time PCR (RT-PCR) for SARS-CoV-2. Initial gasometry showed moderate hypoxemia and respiratory alkalosis with a partial pressure of oxygen/fraction of inspired oxygen (PO2/FiO2) ratio of 191. Chest x-rays showed interstitial lesions in both lung fields. She started therapy with lopinavir/ritonavir, chloroquine, recombinant IFN α-2b and rocephin. In spite of treatment, the illness subsequently progressed to hypoxemic respiratory failure warranting the initiation of invasive mechanical ventilation. At day 13 of her admission in the ICU, she showed radiologic worsening of the interstitial multifocal pneumonia, with elevation of ALP, LDH, erythrocyte sedimentation rate and D-dimer. Physicians administered itolizumab at a dose of 200 mg. After 48 h of the first itolizumab dose, PO2/FiO2 improved and there were evidences of radiological improvement (Figure 1A & B). Patient was extubated after the first dose of the antibody and her status changed from critical to severe. She received a second dose of the antibody (200 mg), 48 h after the first infusion. 3 days after the first administration, patient was hemodynamically stable and has spontaneous ventilation. IL-6 levels were evaluated before itolizumab administration and after 2 and 7 days of the first administration. IL-6 levels reduced overtime from 172 pg/ml to 60 pg/ml (day 7) as depicted in Figure 2A. IL-1 was evaluated at the same time intervals, but it was undetectable. In addition, aspartate amino transferase (AST) concentrations were evaluated at different time points showing a reduction from 43 U/l to 24 U/l after 7 days (Figure 2B). No adverse events related with itolizumab were reported.
Figure 1. Radiological images before and after one dose of itolizumab.
Patient 1
(A) Before itolizumab (D0): diffuse Interstitial-alveolar infiltrate in both lung fields, predominantly in the bases. Minor left pleural effusion. (B) After itolizumab (48 h): radiological improvement with decreased diffuse infiltrate and radio-opacity at the top of both lungs and in both lung bases, in less proportion. The minor pleural effusion persists. Patient 3
(C) Before itolizumab (D0): alveolar interstitial inflammatory infiltrate in both lung fields, predominantly on the right side. (D) After itolizumab (48 h): radiological improvement with significant decrease of the alveolar interstitial infiltrate of both lungs.
Figure 2. Circulating biomarkers in patient's sera.
IL-6 and AST concentrations kinetics (A & B, respectively) measured in patients during itolizumab treatment.
Patient 2: An 89-year old man with a personal history of chronic ischemic cardiopathy, permanent atrial fibrillation, hypertension and hypothyroidism. He has a previous history of alcoholism and several hospital admissions in the last 3 months on account of infectious respiratory diseases. He came to the hospital on 2 April after 7 days of shortness of breath, fever, asthenia and dry cough. He was in contact with a person who returned from a foreign country, where COVID-19 was extending. Physical examination shows signs of respiratory failure characterized by tachycardia, polypnea, intercostal and supraclavicular muscle retraction, high blood pressure, oxygen saturation of 82%, poor diuresis and drowsiness. Chest x-rays showed bilateral pulmonary inflammatory infiltrates, predominantly in the right lung. Admission ECG showed an atrial fibrillation with rapid ventricular response and the initial gasometry showed severe hypoxemia and respiratory alkalosis. Patient also had leukocytosis, altered globular sedimentation rate as well as elevated values of AST, LDH, D-dimer and positive C-reactive protein. He was admitted into the ICU requiring invasive mechanical ventilation. Treatment with lopinavir–ritonavir, chloroquine, IFN α-2b, meropenem and linezolid was initiated. 3 days after his admission into the ICU, itolizumab was prescribed, due to worsening of the bilateral pulmonary infiltrates together with a deterioration of the ventilatory function (PO2/FiO2 = 173). After the first antibody infusion, PO2/FiO2 significantly increased (PO2/FiO2 = 320) and there were evidences of radiological improvement. 3 days after, patient showed radiological worsening of the left lung, characterized by alveolar hypoventilation and atelectasis; then, a 70% pneumothorax was established. Treatment of the pneumothorax with minimal pleurotomy was very demanding and required 3 days for the resolution. The patient received a second infusion of the monoclonal antibody 72 h after the first, while a third dose was administered at the discretion of the treating physicians, 2 days after the second. In total, patient received three doses of itolizumab (200 mg) without any related adverse event. IL-6 levels were evaluated before itolizumab administration and after 2, 4 and 7 days of the first administration. IL-6 was extremely high at baseline (623 pg/ml) and even though cytokine levels reduced roughly 50%, the lowest value remained above 300 pg/ml after 7 days. IL-6 kinetics is shown in Figure 2A. Apart from IL-6, IL-1 was undetectable at this time point of the disease. Interesting, in the case of AST, a significant reduction is detecting at day 7 (pretreatment: 156 U/l, D7: 40 U/l) as is showed in Figure 2B. After 10 days of admission into the ICU, patient presented a myocardial dysfunction and shock that required vasoactive support with norepinephrine. On day 13, he finally died, on account of a mixed cardiovascular and respiratory failure.
Patient 3: An 81-year old female, who is COVID-19 positive contact was not identified at the moment of hospitalization. She started symptoms on 2 April and entered the ICU on 5 April. Patient has a previous history of hypertension, diabetes mellitus, glaucoma and smoking habit. She was admitted with frequent cough, wheezing and diarrhea. The diagnosis of viral pneumonia by COVID-19 was confirmed by RT-PCR on 7 April. Oxygen support at 5 l/min and treatment with ceftriaxone, lopinavir–ritonavir, chloroquine and IFN α-2b was indicated. Chest images showed bilateral interstitial infiltration in both lungs. Patient condition was classified as severe, although she did not require invasive mechanical ventilation. A dose of itolizumab (200 mg) was given the day after her admission into the ICU. Two days after the antibody administration, together with the rest of the therapy, there was an improvement of the respiratory distress while the chest image showed a decrease of the alveolar interstitial infiltrate of both lungs (Figure 1C & D). Patient left the ICU after a favorable clinical and radiological evolution. IL-6 concentration was measured prior and after the antibody administration. IL-6 level at baseline was lower than in previous cases (30 pg/ml), but also decreased 48 h and 168 h after itolizumab infusion, in parallel with patient recovery (Figure 2A). IL-1 and TNF-α were untraceable before and 48 h after the antibody administration. Regarding to AST concentration, the values were in the normal range during the treatment period (Figure 2B).
Materials & methods
Three patients with diagnosis of COVID-19 classified as critically ill (two) and severely ill (one) were included in an expanded access trial to receive itolizumab in addition to standard treatment (http://rpcec.sld.cu/trials/RPCEC00000311-En). The study was approved by a central ethical review board, created especially for COVID-19 and by the Cuban Regulatory Agency (CECMED). Before the treatment, informed consent was obtained from enrolled patient.
Laboratory results included blood routine, leucocyte subsets and blood biochemical parameters were collected. The level of inflammatory cytokines was measured using human validated commercially available kit from R&D Systems (MN, USA): human IL-6 Quantikine ELISA Kit (Cat# S6050), human IL-1 beta/IL-1F2 Quantikine ELISA Kit (Cat# SLB50) and human TNF-α Quantikine ELISA Kit (Cat# STA00D). In the case of IL-6, the normal range of this cytokine in sera is between 0 and 7 pg/ml [17]. We used intra-assay precision and inter-assay precision methods to evaluate precision in this study.
For intra-assay precision (precision within an assay), three samples of known concentration were tested on one plate to assess intra-assay precision.
For inter-assay precision (precision between assays), three samples of known concentration were tested in separate assays to assess inter-assay precision.
Discussion
CRS is characterized by high levels of inflammatory cytokines. Among them, IL-6 is considered a major mediator of this hyperinflammation [18,19]. Most of the COVID-19 patients-related papers showed the CRS as one of the main hallmark of the disease [20]. Additionally, IL-6 levels predict severity in COVID-19 patients [21]. There is high heterogeneity of IL-6 values among papers for classifying severe and nonsevere patients. In a large meta-analysis of 52 manuscripts, Elshazli and coworkers found that the IL-6 level associated with COVID-19 severity was 22.9 pg/ml [22]. In a series of patients treated with itolizumab a cutoff of 28 pg/ml discriminates severe patients from nonsevere (manuscript just accepted in Immunity and Aging). In the present study, the IL-6 concentration of the three patients was above this cutoff. It confirms the classification of these patients as severe and that the CRS is probably occurring.
Several anticytokine therapies have been tried for treating the hyperinflammatory phase of COVID-19 [20,23–25]. Here, we report the use of a well-known anti-inflammatory antibody targeting CD6 to treat the CRS arising in COVID-19 patients. Using an anti-CD6 antibody could reduce the concentration of several pro-inflammatory cytokines, including IL-6, IFN-γ, TNF-α and IL-17, among others, representing an advantage as compared with single-cytokine targeting antibodies. The antibody would not exacerbate lymphopenia since it does not induce complement or antibody dependent cytotoxicity [10,11].
These three SARS-CoV2 patients developed severe respiratory distress together with multifocal interstitial pneumonia. Two patients required invasive mechanical ventilation while the third patient only needed oxygen supply. They all received the anti-CD6 antibody itolizumab in combination with other drugs incorporated into the Cuban national protocol, including lopinavir/ritonavir, chloroquine and IFNα-2b. Regarding to laboratory parameters, AST is strongly associated with mortality risk compared with other parameters, reflecting liver and kidney injury [26,27]. In our cases, critically ill patients showed a significant reduction of AST concentration after the treatment suggesting an improvement in the function of these organs.
Itolizumab was very safe and did not seem to exacerbate opportunistic secondary infections. Unfortunately, we did no measure neither the frequency nor the total amount of circulating T cells in these initial patients. The impact of itolizumab on circulating T cells are being implementing in new recruited patients.
Our preliminary findings support that IL-6 levels correlated with the severity of the disease and that the antibody was capable of reducing IL-6 concentration in all three subjects. One patient died after subsequent respiratory and cardiovascular complications. In this particular case, IL-6 concentration was extremely elevated at the moment of itolizumab infusion. Although, the levels of IL-6 decreased during treatment, the values at 7 days kept still very high (above 300 pg/ml). There was a transient improvement of respiratory function but it was not enough. Presumably, the consequences of the hyperinflammatory syndrome (thrombosis, alveolar damage and severe tissue hypoxia) were irreversible at the moment of treatment and patient died as consequence of these factors.
Conclusion
In summary, in these severe and critically ill patients, itolizumab was able to reduce IL-6 concentrations. Notably, itolizumab-related adverse events were not reported. Patients with baseline IL-6 levels below 200 pg/ml, showed prompt clinical and radiological recovery. We anticipate that the timely use of this anti-inflammatory antibody in combination with the appropriate antiviral and anticoagulant therapy could reduce the mortality associated with COVID-19. The analysis of the complete-series will be published shortly.
Summary points
Inflammatory cytokine-release syndrome is associated with the progression of the coronavirus disease (COVID-19).
No current therapy has proven effective for the management of this syndrome so far.
Itolizumab is a humanized monoclonal antibody that recognizes human CD6 and its effect is associated with the reduction of pro-inflammatory cytokines release.
We present three COVID-19 cases who developed severe respiratory distress together with multifocal interstitial pneumonia.
The patients were treated with itolizumab combined with antiviral therapies.
Itolizumab reduced circulating IL-6 concentrations in the three COVID-19 patients.
Two patients showed rapid ventilatory and radiological improvement and were fully recovered.
Itolizumab-related adverse events were not reported.
These cases show that the timely use of this anti-inflammatory antibody in combination with the appropriate antiviral and anticoagulant therapy could reduce the mortality associated with COVID-19.
Author contributions
Study design and data interpretation: G Lorenzo, M Cepeda, M Ramos, D Saavedra, Z Mazorra, K Leon and T Crombet; clinical investigators (recruited and treated patients): LM Filgueira, JB Cervantes, OA Lovelle, C Herrera, C Figueredo, JA Caballero, N Sánchez, J Berrio, A Caballero; immunological assessments: D Saavedra, AL Añe-Kouri, Z Mazorra; writing and or/revision of the manuscript: T Crombet and A Caballero.
Acknowledgments
We are extremely grateful to all ICU physicians, nurses and general staff working with severe and critically ill COVID-19 patients.
Financial & competing interests disclosure
Seven authors (G Lorenzo, M Cepeda, M Ramos, D Saavedra, Z Mazorra, K Leon and T Crombet) currently work for the Center of Molecular Immunology, the institution that generated and originally patented itolizumab. The remaining authors do not have any commercial or financial relationships that could be taken as a potential conflict of interest. The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed.
No writing assistance was utilized in the production of this manuscript.
Ethical conduct of research
The authors state that they have followed the principles outlined in the Declaration of Helsinki for all human or animal experimental investigations. The study was approved by a central ethical review board, created especially for COVID-19 and by the Cuban Regulatory Agency (CECMED). Before the treatment, informed consent was obtained from enrolled patient.
Data sharing statement
The authors certify that this manuscript reports original clinical trial data on three patients, RPCEC00000311. Individual participant data that underlies the results reported in the article, after de-identification (text, tables, figures and supplement) are available along with the study protocol. The data will be available 9 months after article publication and will end 36 months following article publication. The information will be shared with investigators whose proposed use of the data has been approved by an independent review committee identified for this purpose and for individual participant data meta-analysis. Proposals may be submitted up to 36 months following article publication. After this date the data will be available in our data warehouse but without investigator support other than deposited metadata. Information regarding submitting proposal and accessing data may be found at http://rpcec.sld.cu/trials/RPCEC00000311-En | Oral | DrugAdministrationRoute | CC BY | 33397150 | 18,948,677 | 2021-03 |
What was the outcome of reaction 'Respiratory failure'? | An anti-CD6 antibody for the treatment of COVID-19 patients with cytokine-release syndrome: report of three cases.
In COVID-19, the inflammatory cytokine-release syndrome is associated with the progression of the disease. Itolizumab is a monoclonal antibody that recognizes human CD6 expressed in activated T cells. The antibody has shown to be safe and efficacious in the treatment of moderate to severe psoriasis. Its effect is associated with the reduction of pro-inflammatory cytokines release, including IFN-γ, IL-6 and TNF-α. Here, we report the outcome of three severe and critically ill COVID-19 patients treated with itolizumab as part of an expanded access protocol. Itolizumab was able to reduce IL-6 concentrations in all the patients. Two of the three patients showed respiratory and radiological improvement and were fully recovered. We hypothesize this anti-inflammatory therapy in addition to antiviral and anticoagulant therapy could reduce COVID-19 associated morbidity and mortality.
A group of COVID-19 patients develops severe or critical disease accompanied by the cytokine storm syndrome. Cytokines are essential to the pathophysiology of disease and IL-6, IL-1 and TNF-α appear to be harmful, particularly in the context of the cytokine-release syndrome (CRS) [1,2].
CD6 is a membrane glycoprotein expressed primarily in mature, activated T cells. Ligand binding of CD6, increases events such as adhesion, activation, proliferation, differentiation and survival [3–6]. In addition, CD6 mediates interaction between T cells and antigen-presenting cells, contributing to the maturation of immune synapses [6]. CD6-mediated costimulation contributes to the maturation of a Th1 pattern in human T cells and preferentially promotes a pro-inflammatory response characterized by the secretion of TNF-α, IL-6 and IFN γ [7].
The activated leukocyte-cell adhesion molecule (ALCAM), also known as CD166, has been identified as the CD6 ligand [8,9]. ALCAM interaction with CD6 stabilizes the formation of the immune synapse between the lymphocytes and the antigen-presenting cells [5].
Itolizumab is a humanized monoclonal antibody developed at the Center of Molecular Immunology, in Cuba, that recognizes a region in the distal domain of the human CD6 [10,11]. The antibody reduces the expression of the intracellular proteins involved in activation and inhibits the proliferation of T cells, even in the presence of the ALCAM and IL-2 [10–12]. The effect is associated with the reduction of the secretion of pro-inflammatory cytokines including IFN-γ, IL-6 and TNF-α [13,14]. The antibody has demonstrated to be safe and efficacious in patients with moderate to severe psoriasis [15,16]. Studies from blood and tissue samples from patients with severe psoriasis showed that itolizumab reduces the proliferation of T cells and serum concentration of IL-6, TNF-α and IFN-γ [13–16]. A significant reduction of the inflammatory pattern was also observed in the tissue. On account of its well proven effect on T-cell activation and proinflammatory cytokines production, itolizumab was included as part of a Cuban expanded access protocol in critical, severe and moderate COVID-19 patients with high risk of aggravation. The study will be published soon (manuscript accepted) and here we describe in detail the outcome of three initial patients receiving the antibody.
Cases description
Patient 1: A 53-year old woman with a personal history of essential hypertension and Type 2 diabetes mellitus presented with symptoms of polypnea of more than 40 rpm, use of respiratory ancillary musculature and dry cough. She arrived from a foreign country where COVID-19 was spreading. Symptoms started on 23 March and COVID-19 was diagnosed on 26 March on the basis of positive real time PCR (RT-PCR) for SARS-CoV-2. Initial gasometry showed moderate hypoxemia and respiratory alkalosis with a partial pressure of oxygen/fraction of inspired oxygen (PO2/FiO2) ratio of 191. Chest x-rays showed interstitial lesions in both lung fields. She started therapy with lopinavir/ritonavir, chloroquine, recombinant IFN α-2b and rocephin. In spite of treatment, the illness subsequently progressed to hypoxemic respiratory failure warranting the initiation of invasive mechanical ventilation. At day 13 of her admission in the ICU, she showed radiologic worsening of the interstitial multifocal pneumonia, with elevation of ALP, LDH, erythrocyte sedimentation rate and D-dimer. Physicians administered itolizumab at a dose of 200 mg. After 48 h of the first itolizumab dose, PO2/FiO2 improved and there were evidences of radiological improvement (Figure 1A & B). Patient was extubated after the first dose of the antibody and her status changed from critical to severe. She received a second dose of the antibody (200 mg), 48 h after the first infusion. 3 days after the first administration, patient was hemodynamically stable and has spontaneous ventilation. IL-6 levels were evaluated before itolizumab administration and after 2 and 7 days of the first administration. IL-6 levels reduced overtime from 172 pg/ml to 60 pg/ml (day 7) as depicted in Figure 2A. IL-1 was evaluated at the same time intervals, but it was undetectable. In addition, aspartate amino transferase (AST) concentrations were evaluated at different time points showing a reduction from 43 U/l to 24 U/l after 7 days (Figure 2B). No adverse events related with itolizumab were reported.
Figure 1. Radiological images before and after one dose of itolizumab.
Patient 1
(A) Before itolizumab (D0): diffuse Interstitial-alveolar infiltrate in both lung fields, predominantly in the bases. Minor left pleural effusion. (B) After itolizumab (48 h): radiological improvement with decreased diffuse infiltrate and radio-opacity at the top of both lungs and in both lung bases, in less proportion. The minor pleural effusion persists. Patient 3
(C) Before itolizumab (D0): alveolar interstitial inflammatory infiltrate in both lung fields, predominantly on the right side. (D) After itolizumab (48 h): radiological improvement with significant decrease of the alveolar interstitial infiltrate of both lungs.
Figure 2. Circulating biomarkers in patient's sera.
IL-6 and AST concentrations kinetics (A & B, respectively) measured in patients during itolizumab treatment.
Patient 2: An 89-year old man with a personal history of chronic ischemic cardiopathy, permanent atrial fibrillation, hypertension and hypothyroidism. He has a previous history of alcoholism and several hospital admissions in the last 3 months on account of infectious respiratory diseases. He came to the hospital on 2 April after 7 days of shortness of breath, fever, asthenia and dry cough. He was in contact with a person who returned from a foreign country, where COVID-19 was extending. Physical examination shows signs of respiratory failure characterized by tachycardia, polypnea, intercostal and supraclavicular muscle retraction, high blood pressure, oxygen saturation of 82%, poor diuresis and drowsiness. Chest x-rays showed bilateral pulmonary inflammatory infiltrates, predominantly in the right lung. Admission ECG showed an atrial fibrillation with rapid ventricular response and the initial gasometry showed severe hypoxemia and respiratory alkalosis. Patient also had leukocytosis, altered globular sedimentation rate as well as elevated values of AST, LDH, D-dimer and positive C-reactive protein. He was admitted into the ICU requiring invasive mechanical ventilation. Treatment with lopinavir–ritonavir, chloroquine, IFN α-2b, meropenem and linezolid was initiated. 3 days after his admission into the ICU, itolizumab was prescribed, due to worsening of the bilateral pulmonary infiltrates together with a deterioration of the ventilatory function (PO2/FiO2 = 173). After the first antibody infusion, PO2/FiO2 significantly increased (PO2/FiO2 = 320) and there were evidences of radiological improvement. 3 days after, patient showed radiological worsening of the left lung, characterized by alveolar hypoventilation and atelectasis; then, a 70% pneumothorax was established. Treatment of the pneumothorax with minimal pleurotomy was very demanding and required 3 days for the resolution. The patient received a second infusion of the monoclonal antibody 72 h after the first, while a third dose was administered at the discretion of the treating physicians, 2 days after the second. In total, patient received three doses of itolizumab (200 mg) without any related adverse event. IL-6 levels were evaluated before itolizumab administration and after 2, 4 and 7 days of the first administration. IL-6 was extremely high at baseline (623 pg/ml) and even though cytokine levels reduced roughly 50%, the lowest value remained above 300 pg/ml after 7 days. IL-6 kinetics is shown in Figure 2A. Apart from IL-6, IL-1 was undetectable at this time point of the disease. Interesting, in the case of AST, a significant reduction is detecting at day 7 (pretreatment: 156 U/l, D7: 40 U/l) as is showed in Figure 2B. After 10 days of admission into the ICU, patient presented a myocardial dysfunction and shock that required vasoactive support with norepinephrine. On day 13, he finally died, on account of a mixed cardiovascular and respiratory failure.
Patient 3: An 81-year old female, who is COVID-19 positive contact was not identified at the moment of hospitalization. She started symptoms on 2 April and entered the ICU on 5 April. Patient has a previous history of hypertension, diabetes mellitus, glaucoma and smoking habit. She was admitted with frequent cough, wheezing and diarrhea. The diagnosis of viral pneumonia by COVID-19 was confirmed by RT-PCR on 7 April. Oxygen support at 5 l/min and treatment with ceftriaxone, lopinavir–ritonavir, chloroquine and IFN α-2b was indicated. Chest images showed bilateral interstitial infiltration in both lungs. Patient condition was classified as severe, although she did not require invasive mechanical ventilation. A dose of itolizumab (200 mg) was given the day after her admission into the ICU. Two days after the antibody administration, together with the rest of the therapy, there was an improvement of the respiratory distress while the chest image showed a decrease of the alveolar interstitial infiltrate of both lungs (Figure 1C & D). Patient left the ICU after a favorable clinical and radiological evolution. IL-6 concentration was measured prior and after the antibody administration. IL-6 level at baseline was lower than in previous cases (30 pg/ml), but also decreased 48 h and 168 h after itolizumab infusion, in parallel with patient recovery (Figure 2A). IL-1 and TNF-α were untraceable before and 48 h after the antibody administration. Regarding to AST concentration, the values were in the normal range during the treatment period (Figure 2B).
Materials & methods
Three patients with diagnosis of COVID-19 classified as critically ill (two) and severely ill (one) were included in an expanded access trial to receive itolizumab in addition to standard treatment (http://rpcec.sld.cu/trials/RPCEC00000311-En). The study was approved by a central ethical review board, created especially for COVID-19 and by the Cuban Regulatory Agency (CECMED). Before the treatment, informed consent was obtained from enrolled patient.
Laboratory results included blood routine, leucocyte subsets and blood biochemical parameters were collected. The level of inflammatory cytokines was measured using human validated commercially available kit from R&D Systems (MN, USA): human IL-6 Quantikine ELISA Kit (Cat# S6050), human IL-1 beta/IL-1F2 Quantikine ELISA Kit (Cat# SLB50) and human TNF-α Quantikine ELISA Kit (Cat# STA00D). In the case of IL-6, the normal range of this cytokine in sera is between 0 and 7 pg/ml [17]. We used intra-assay precision and inter-assay precision methods to evaluate precision in this study.
For intra-assay precision (precision within an assay), three samples of known concentration were tested on one plate to assess intra-assay precision.
For inter-assay precision (precision between assays), three samples of known concentration were tested in separate assays to assess inter-assay precision.
Discussion
CRS is characterized by high levels of inflammatory cytokines. Among them, IL-6 is considered a major mediator of this hyperinflammation [18,19]. Most of the COVID-19 patients-related papers showed the CRS as one of the main hallmark of the disease [20]. Additionally, IL-6 levels predict severity in COVID-19 patients [21]. There is high heterogeneity of IL-6 values among papers for classifying severe and nonsevere patients. In a large meta-analysis of 52 manuscripts, Elshazli and coworkers found that the IL-6 level associated with COVID-19 severity was 22.9 pg/ml [22]. In a series of patients treated with itolizumab a cutoff of 28 pg/ml discriminates severe patients from nonsevere (manuscript just accepted in Immunity and Aging). In the present study, the IL-6 concentration of the three patients was above this cutoff. It confirms the classification of these patients as severe and that the CRS is probably occurring.
Several anticytokine therapies have been tried for treating the hyperinflammatory phase of COVID-19 [20,23–25]. Here, we report the use of a well-known anti-inflammatory antibody targeting CD6 to treat the CRS arising in COVID-19 patients. Using an anti-CD6 antibody could reduce the concentration of several pro-inflammatory cytokines, including IL-6, IFN-γ, TNF-α and IL-17, among others, representing an advantage as compared with single-cytokine targeting antibodies. The antibody would not exacerbate lymphopenia since it does not induce complement or antibody dependent cytotoxicity [10,11].
These three SARS-CoV2 patients developed severe respiratory distress together with multifocal interstitial pneumonia. Two patients required invasive mechanical ventilation while the third patient only needed oxygen supply. They all received the anti-CD6 antibody itolizumab in combination with other drugs incorporated into the Cuban national protocol, including lopinavir/ritonavir, chloroquine and IFNα-2b. Regarding to laboratory parameters, AST is strongly associated with mortality risk compared with other parameters, reflecting liver and kidney injury [26,27]. In our cases, critically ill patients showed a significant reduction of AST concentration after the treatment suggesting an improvement in the function of these organs.
Itolizumab was very safe and did not seem to exacerbate opportunistic secondary infections. Unfortunately, we did no measure neither the frequency nor the total amount of circulating T cells in these initial patients. The impact of itolizumab on circulating T cells are being implementing in new recruited patients.
Our preliminary findings support that IL-6 levels correlated with the severity of the disease and that the antibody was capable of reducing IL-6 concentration in all three subjects. One patient died after subsequent respiratory and cardiovascular complications. In this particular case, IL-6 concentration was extremely elevated at the moment of itolizumab infusion. Although, the levels of IL-6 decreased during treatment, the values at 7 days kept still very high (above 300 pg/ml). There was a transient improvement of respiratory function but it was not enough. Presumably, the consequences of the hyperinflammatory syndrome (thrombosis, alveolar damage and severe tissue hypoxia) were irreversible at the moment of treatment and patient died as consequence of these factors.
Conclusion
In summary, in these severe and critically ill patients, itolizumab was able to reduce IL-6 concentrations. Notably, itolizumab-related adverse events were not reported. Patients with baseline IL-6 levels below 200 pg/ml, showed prompt clinical and radiological recovery. We anticipate that the timely use of this anti-inflammatory antibody in combination with the appropriate antiviral and anticoagulant therapy could reduce the mortality associated with COVID-19. The analysis of the complete-series will be published shortly.
Summary points
Inflammatory cytokine-release syndrome is associated with the progression of the coronavirus disease (COVID-19).
No current therapy has proven effective for the management of this syndrome so far.
Itolizumab is a humanized monoclonal antibody that recognizes human CD6 and its effect is associated with the reduction of pro-inflammatory cytokines release.
We present three COVID-19 cases who developed severe respiratory distress together with multifocal interstitial pneumonia.
The patients were treated with itolizumab combined with antiviral therapies.
Itolizumab reduced circulating IL-6 concentrations in the three COVID-19 patients.
Two patients showed rapid ventilatory and radiological improvement and were fully recovered.
Itolizumab-related adverse events were not reported.
These cases show that the timely use of this anti-inflammatory antibody in combination with the appropriate antiviral and anticoagulant therapy could reduce the mortality associated with COVID-19.
Author contributions
Study design and data interpretation: G Lorenzo, M Cepeda, M Ramos, D Saavedra, Z Mazorra, K Leon and T Crombet; clinical investigators (recruited and treated patients): LM Filgueira, JB Cervantes, OA Lovelle, C Herrera, C Figueredo, JA Caballero, N Sánchez, J Berrio, A Caballero; immunological assessments: D Saavedra, AL Añe-Kouri, Z Mazorra; writing and or/revision of the manuscript: T Crombet and A Caballero.
Acknowledgments
We are extremely grateful to all ICU physicians, nurses and general staff working with severe and critically ill COVID-19 patients.
Financial & competing interests disclosure
Seven authors (G Lorenzo, M Cepeda, M Ramos, D Saavedra, Z Mazorra, K Leon and T Crombet) currently work for the Center of Molecular Immunology, the institution that generated and originally patented itolizumab. The remaining authors do not have any commercial or financial relationships that could be taken as a potential conflict of interest. The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed.
No writing assistance was utilized in the production of this manuscript.
Ethical conduct of research
The authors state that they have followed the principles outlined in the Declaration of Helsinki for all human or animal experimental investigations. The study was approved by a central ethical review board, created especially for COVID-19 and by the Cuban Regulatory Agency (CECMED). Before the treatment, informed consent was obtained from enrolled patient.
Data sharing statement
The authors certify that this manuscript reports original clinical trial data on three patients, RPCEC00000311. Individual participant data that underlies the results reported in the article, after de-identification (text, tables, figures and supplement) are available along with the study protocol. The data will be available 9 months after article publication and will end 36 months following article publication. The information will be shared with investigators whose proposed use of the data has been approved by an independent review committee identified for this purpose and for individual participant data meta-analysis. Proposals may be submitted up to 36 months following article publication. After this date the data will be available in our data warehouse but without investigator support other than deposited metadata. Information regarding submitting proposal and accessing data may be found at http://rpcec.sld.cu/trials/RPCEC00000311-En | Recovering | ReactionOutcome | CC BY | 33397150 | 18,948,677 | 2021-03 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Tuberculosis of eye'. | Unilateral macular serpiginous-like choroiditis as the initial manifestation of presumed ocular tuberculosis.
BACKGROUND
Classic serpiginous choroiditis (SC) usually begins in the peripapillary area and spreads centrifugally, however, in some patients, the lesion can arise in the macular region. An association between lesions resembling classic SC and tuberculosis was recognized as a possibly distinct clinical entity and named as tuberculous serpiginous-like choroiditis. The differentiation of this tuberculous entity from SC is critical because the treatment of the former with immunosuppressive drugs leads to several potential adverse effects, and such treatment can have devastating consequences because of the worsening of a concomitant tuberculous infection.
A 31-year-old woman presented with unilateral decreased vision and a fundus examination consistent with macular serpiginous choroiditis. A non-reactor tuberculin skin test and normal thoracic CT scan ruled out tuberculosis. However, after 2 months of treatment with steroids and immunosuppressive drugs, the contralateral eye developed similar lesions, further raising the suspicions of ocular tuberculosis. We conducted QuantiFERON® TB Gold, which was positive; hence, antituberculous therapy was started on the patient. The lesions started healing within a few weeks. After 1 year of finishing the therapy, the lesions remained healed without any recurrence.
CONCLUSIONS
Macular serpiginous-like choroiditis may be the initial presentation of presumed ocular tuberculosis. Nevertheless, the correct diagnosis of this entity can be challenging and delayed by the imprecise results from the currently available methods.
Introduction
Serpiginous choroiditis (SC) is a rare, usually bilateral, and chronically recurring inflammatory disease that affects the inner choroid and the retinal pigment epithelium (RPE). The classic SC usually begins in the peripapillary area and spreads centrifugally, in a snake-like manner, over a few months or years [1]. However, in some patients, the lesion can arise in the macular region. This observation led Mansur et al. to call this particular entity as “macular SC” (MSC) [2].
An association between lesions resembling classic SC and tuberculosis (TB) was recognized as a possibly distinct clinical entity and named as tuberculous serpiginous–like choroiditis (TSC) [3]. The differentiation of this tuberculous entity from SC is critical because the treatment of the former with immunosuppressive drugs leads to several potential adverse effects, and such treatment can have devastating consequences because of the worsening of a concomitant tuberculous infection [4]. On the contrary, antiTB treatment may also be associated with significant adverse events, especially in older patients with SC.
The purpose of this paper is to report the case of a young, otherwise, healthy woman who presented with unilateral decreased visual acuity initially diagnosed as MSC. A non-reactor tuberculin skin test (TST) and normal thoracic CT scan ruled out TB. However, during the treatment with steroids and immunosuppressive drugs, the contralateral eye developed SC-like lesions, further raising the suspicions of ocular TB. We conducted QuantiFERON® TB Gold (QFT-G), which was positive; therefore, antituberculous therapy (ATT) was started on the patient. After 1 year of finishing the therapy, the SC-like inflammatory lesions were healed without any recurrence.
Case report
A 31-year-old previously healthy woman had an acute loss of vision in the left eye (LE) since the last 12 days. Her corrected vision acuity was 20/20 in the right eye (RE) and 20/400 in the LE. The slit-lamp examination of the anterior segments was unremarkable. Intraocular tension was within the normal limits in both eyes. No cells were observed in the vitreous region of the LE. A pale, round, yellow-white placoid lesion at the level of the RPE and outer retina was observed inside the vascular arcades of the left macula (Fig. 1a). The optic disks and retinal vessels had a normal appearance.Fig. 1 a Color photo of the left eye showing the yellow-white placoid lesion at the level of the RPE and outer retina, centered in the fovea. b The lesion is hyperautofluorescent at the acute stage. c, d Fluorescein angiography displays typical early hypofluorescence with late staining. e SS-OCT reveals a decreased foveal thickness and disruption of the outer retina. Observe the increased thickness of the choroid as well and the pachyvessels. (RPE, retinal pigment epithelium; SS-OCT, swept source optic coherence tomography)
The lesion showed a thin hyperautofluorescent border, as well as some round regions of hypoautofluorescence inside a hyperautofluorescent background (Fig. 1b). Fluorescein angiography revealed initial hypofluorescence with later hyperfluorescence of the whole lesion, mainly at the foveal and parafoveal regions probably because of RPE atrophy (Fig. 1c, d). The retinal vessels and the optic disks remained with normal fluorescence during all the phases of the examination. Indocyanine green angiography (ICGA) revealed a hypofluorescent plaque during all the phases. Swept-source optic coherence tomography (SS-OCT) displayed a decreased thickness of the fovea, many hyper-reflective dots at the level of the RPE, with a granular appearance, as well as the destruction of the external retina; however, it did not observe the ellipsoid layer and the external limiting membrane (Fig. 1e). The lesion appeared hyper-reflective at the outer retina but 9 × 9 OCT angiography visualized it much better at the choriocapillaris slab. Both superficial and deep plexus were apparently unaffected.
We conducted VDRL, FTA-abs, TST and IgM/IgG for toxoplasmosis, and chest CT, and found that these test results were normal (including a nonreactor TST). As the most prevalent infectious diseases commonly observed in South America were ruled out by laboratory and CT scans, the patient began treatment for MSC. Thereafter, pulsotherapy (methylprednisolone 1 g/day/3 days), oral corticosteroids (1 mg/Kg/day) and azathioprine (AZA) (3 mg/Kg/day) were started on the patient.
Within 2 months, the visual acuity was recovered to 20/63 in the patient. The lesion now appeared pigmented (Fig. 2a) and, totally, hypoautofluorescent (Fig. 2b). FA showed a well-demarcated lesion with hyperfluorescent borders and the round spots of RPE atrophy inside a hypofluorescent background. OCT now revealed foveal degeneration but the external limiting membrane and the ellipsoid layer could already be observed in the perifoveal region (Fig. 2c). She continued taking AZA (150 mg/day) and oral prednisone (20 mg/day). The patient was followed up for every month.Fig. 2 a The pigmented lesion after 2 months of treatment. b The lesion showed total hypoautofluorescence after healing. c SS-OCT revealed foveal degeneration but the external limiting membrane (arrows) and the ellipsoid layer (arrow head) could already be observed at the perifoveal region. (SS-OCT, swept source optic coherence tomography)
Two months after the above-described follow-up visit, the patient was asymptomatic, but we detected two deep creamy lesions in the macular area of the RE (Fig. 3a). The superior and larger lesions showed hyperautofluorescence, which is typically observed in the active disease. The smaller one showed a mixed pattern of autofluorescence (Fig. 3b). Both lesions were hypofluorescent with late hyperfluorescence on FA (Fig. 3c, d), and hypofluorescent in all the phases of ICGA (Fig. 3e, f).Fig. 3 a Two deep creamy lesions in the macula of the right eye. b The superior lesion is hyperautofluorescent, but the other is hypoautofluorescent. c and d Fluorescein angiography shows the pattern of early hypofluorescence with late staining. Indocyanine green angiography in (e) early and (f) late phases revealed that the lesions were hypofluorescent during the whole examination
Although TB has been ruled out by a non-reactor TST and thoracic CT scan, we conducted the interferon-gamma release assay (IGRA), via QFT-G methodology, which was positive. We then initiated ATT (isoniazid, rifampin, ethambutol, and pyrazinamide) for 9 months. AZA was immediately withdrawn. A maintenance dose of corticosteroids (60 mg/day, slowly tapered within 3 months) was continued until the lesions showed total hypoautofluorescence. One year after finishing ATT, the lesions were stable with no recurrence in both the eyes (Fig. 4a–d), and the visual acuity was 20/20 in the RE and remained at 20/63 in the LE.Fig. 4 a Right and (b) left eyes 1 year after finishing ATT showing total hypoautofluorescence of the healed lesions
Discussion
TSC typically affects young- to middle-aged adults from the endemic areas of TB, with a male preponderance [5]. Bilateral involvement is a common feature of the disease, which may present as the active lesions in both the eyes simultaneously, alternate in one eye followed by the involvement of the other eye, or active in one eye with inactive scars in the other eye [5]. In the larger series so far, Bansal et al. reported that two distinct patterns may be observed in this entity. The more common form (95% of the cases) with multifocal lesions of active choroiditis that were discrete and noncontiguous, to begin with, and then progressed relentlessly to a diffuse, contiguous variety, thereby acquiring an active advancing edge resembling SC. The other one is a rare form (5% of the cases) that presents with a diffuse plaque-like choroiditis showing amoeboid spread [5]. Our patient can be classified in this latter form. However, different from those patients described by Basal et al. our case presented unilaterally and without detectable vitreous cells. These features, as well as the non-reactor TST, led us to the initial diagnosis of “idiopathic” MSC [2].
In fact, the diagnosis of intraocular TB is often problematic due to a wide spectrum of presentations and it is impractical to conduct a biopsy for culture and direct histopathological examination to provide definitive proof of ocular infection. In nearly all reported cases, the diagnosis of ocular TB was only presumptive [6]. In most studies, the diagnostic criteria for presumed ocular TB were: residence or migration from areas endemic in TB, history of contact with patients with TB infection, presence of suggestive ocular findings, exclusion of other known causes of uveitis, corroborative evidence, such as a positive TST, positive IGRAs, and a positive response to conventional ATT without recurrence [6].
Regarding the laboratory examinations, both TST and QFT seem to be equivalent to the diagnosis of ocular TB. Kurup et al. reported no demonstrable advantage of QFT-G assay over the TST in detecting latent TB infection in patients with granulomatous uveitis [7]. However, TST has the following disadvantages when it is compared with QFT-G: it is subjective, can result in false-positive in previous patients vaccinated with Bacilli Calmette-Guerin (BCG), as well as can be false-negative in immunocompromised patients. In fact, in our case, we initially ruled out TB based on a non-reactor TST. QFT-G is an interferon-gamma release assay, commonly known as an IGRA, which is an alternative to TST. Unlike TST, QFT-G is a controlled laboratory test that is unaffected by previous BCG vaccination. QFT-G is highly specific and sensitive; a positive result is strongly predictive of true infection with Mycobacterium tuberculosis [8]. However, like the TST and other IGRAs, QFT-G cannot distinguish between active TB disease and latent infection and is intended to be used for risk assessment, images, and other medical and diagnostic evaluations. Like any diagnostic aid, QFT-G cannot replace clinical judgment. We have considered the positive QFT-G presented by our patient that was associated with the retinal SC-like lesions and supported our diagnosis of presumed ocular TB. Moreover, our region is a moderate endemic area for TB, which enhanced the value of a positive QFT-G for the diagnosis. In India, where TB is highly prevalent, Babu et al. reported a significant association of serpiginous-like choroiditis and positive QFT-G [9] Mackensen et al. in their study from a low TB endemic country have also reported a 52% QFT-G positivity in serpiginous-like choroiditis subset of tubercular uveitis [10]. This association strengthens the need to rule out TB in all patients with serpiginous-like choroiditis, regardless of whether the region is endemic or not. Another important fact that can support the diagnosis of presumed ocular TB in our patient is that the lesions did not recur 1 year after finishing ATT. Intriguingly, in one study, 50 patients presented with multifocal choroiditis due to presumed TB and were treated with ATT without any concomitant use of systemic corticosteroids [11]. All patients had a favorable response, and no recurrence was observed. These findings may indicate that ocular manifestations in these patients were probably because of direct mycobacterial invasion. Therefore, it is plausible to hypothesize that this could also have been the mechanism of infection in our patient.
The failure to consider TB in the differential diagnosis of intraocular inflammation may have catastrophic consequences because the immunosuppressive agents often used to manage the intraocular inflammation may be fatal for both vision and life in patients with active TB disease [12]. In our case, the MSC-like lesion of the RE healed promptly a few weeks after the anti-inflammatory therapy, but 2 months later new lesions appeared in the contralateral eye. We immediately removed the AZA, but a maintenance dose of corticosteroids was continued until the lesions of both eyes were healed. In fact, systemic steroids, in addition to ATT, are sometimes considered for patients with persistent ocular inflammation or retinal vasculitis, but no clinical trials have proven their efficacy.
Conclusion
We believe that our report can contribute to the literature by presenting a rare form of SC-like lesion in a patient with a difficult diagnosis. Moreover, the current methods for the detection of ocular TB must be cautiously interpreted. We also stress that TB must be ruled out in all forms of presentation of SC.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
None.
Authorship
All authors attest that they meet the current ICMJE criteria for Authorship.
Authors' contributions
All authors read and approved the final manuscript.
Funding
No funding or grant support.
Patient consent
Consent to publish the case report was obtained. This report does not contain any personal information that could lead to the identification of the patient.
Competing interests
All authors have no financial disclosures. | AZATHIOPRINE, METHYLPREDNISOLONE, PREDNISONE | DrugsGivenReaction | CC BY | 33397439 | 18,956,824 | 2021-01-04 |
What was the administration route of drug 'PREDNISONE'? | Unilateral macular serpiginous-like choroiditis as the initial manifestation of presumed ocular tuberculosis.
BACKGROUND
Classic serpiginous choroiditis (SC) usually begins in the peripapillary area and spreads centrifugally, however, in some patients, the lesion can arise in the macular region. An association between lesions resembling classic SC and tuberculosis was recognized as a possibly distinct clinical entity and named as tuberculous serpiginous-like choroiditis. The differentiation of this tuberculous entity from SC is critical because the treatment of the former with immunosuppressive drugs leads to several potential adverse effects, and such treatment can have devastating consequences because of the worsening of a concomitant tuberculous infection.
A 31-year-old woman presented with unilateral decreased vision and a fundus examination consistent with macular serpiginous choroiditis. A non-reactor tuberculin skin test and normal thoracic CT scan ruled out tuberculosis. However, after 2 months of treatment with steroids and immunosuppressive drugs, the contralateral eye developed similar lesions, further raising the suspicions of ocular tuberculosis. We conducted QuantiFERON® TB Gold, which was positive; hence, antituberculous therapy was started on the patient. The lesions started healing within a few weeks. After 1 year of finishing the therapy, the lesions remained healed without any recurrence.
CONCLUSIONS
Macular serpiginous-like choroiditis may be the initial presentation of presumed ocular tuberculosis. Nevertheless, the correct diagnosis of this entity can be challenging and delayed by the imprecise results from the currently available methods.
Introduction
Serpiginous choroiditis (SC) is a rare, usually bilateral, and chronically recurring inflammatory disease that affects the inner choroid and the retinal pigment epithelium (RPE). The classic SC usually begins in the peripapillary area and spreads centrifugally, in a snake-like manner, over a few months or years [1]. However, in some patients, the lesion can arise in the macular region. This observation led Mansur et al. to call this particular entity as “macular SC” (MSC) [2].
An association between lesions resembling classic SC and tuberculosis (TB) was recognized as a possibly distinct clinical entity and named as tuberculous serpiginous–like choroiditis (TSC) [3]. The differentiation of this tuberculous entity from SC is critical because the treatment of the former with immunosuppressive drugs leads to several potential adverse effects, and such treatment can have devastating consequences because of the worsening of a concomitant tuberculous infection [4]. On the contrary, antiTB treatment may also be associated with significant adverse events, especially in older patients with SC.
The purpose of this paper is to report the case of a young, otherwise, healthy woman who presented with unilateral decreased visual acuity initially diagnosed as MSC. A non-reactor tuberculin skin test (TST) and normal thoracic CT scan ruled out TB. However, during the treatment with steroids and immunosuppressive drugs, the contralateral eye developed SC-like lesions, further raising the suspicions of ocular TB. We conducted QuantiFERON® TB Gold (QFT-G), which was positive; therefore, antituberculous therapy (ATT) was started on the patient. After 1 year of finishing the therapy, the SC-like inflammatory lesions were healed without any recurrence.
Case report
A 31-year-old previously healthy woman had an acute loss of vision in the left eye (LE) since the last 12 days. Her corrected vision acuity was 20/20 in the right eye (RE) and 20/400 in the LE. The slit-lamp examination of the anterior segments was unremarkable. Intraocular tension was within the normal limits in both eyes. No cells were observed in the vitreous region of the LE. A pale, round, yellow-white placoid lesion at the level of the RPE and outer retina was observed inside the vascular arcades of the left macula (Fig. 1a). The optic disks and retinal vessels had a normal appearance.Fig. 1 a Color photo of the left eye showing the yellow-white placoid lesion at the level of the RPE and outer retina, centered in the fovea. b The lesion is hyperautofluorescent at the acute stage. c, d Fluorescein angiography displays typical early hypofluorescence with late staining. e SS-OCT reveals a decreased foveal thickness and disruption of the outer retina. Observe the increased thickness of the choroid as well and the pachyvessels. (RPE, retinal pigment epithelium; SS-OCT, swept source optic coherence tomography)
The lesion showed a thin hyperautofluorescent border, as well as some round regions of hypoautofluorescence inside a hyperautofluorescent background (Fig. 1b). Fluorescein angiography revealed initial hypofluorescence with later hyperfluorescence of the whole lesion, mainly at the foveal and parafoveal regions probably because of RPE atrophy (Fig. 1c, d). The retinal vessels and the optic disks remained with normal fluorescence during all the phases of the examination. Indocyanine green angiography (ICGA) revealed a hypofluorescent plaque during all the phases. Swept-source optic coherence tomography (SS-OCT) displayed a decreased thickness of the fovea, many hyper-reflective dots at the level of the RPE, with a granular appearance, as well as the destruction of the external retina; however, it did not observe the ellipsoid layer and the external limiting membrane (Fig. 1e). The lesion appeared hyper-reflective at the outer retina but 9 × 9 OCT angiography visualized it much better at the choriocapillaris slab. Both superficial and deep plexus were apparently unaffected.
We conducted VDRL, FTA-abs, TST and IgM/IgG for toxoplasmosis, and chest CT, and found that these test results were normal (including a nonreactor TST). As the most prevalent infectious diseases commonly observed in South America were ruled out by laboratory and CT scans, the patient began treatment for MSC. Thereafter, pulsotherapy (methylprednisolone 1 g/day/3 days), oral corticosteroids (1 mg/Kg/day) and azathioprine (AZA) (3 mg/Kg/day) were started on the patient.
Within 2 months, the visual acuity was recovered to 20/63 in the patient. The lesion now appeared pigmented (Fig. 2a) and, totally, hypoautofluorescent (Fig. 2b). FA showed a well-demarcated lesion with hyperfluorescent borders and the round spots of RPE atrophy inside a hypofluorescent background. OCT now revealed foveal degeneration but the external limiting membrane and the ellipsoid layer could already be observed in the perifoveal region (Fig. 2c). She continued taking AZA (150 mg/day) and oral prednisone (20 mg/day). The patient was followed up for every month.Fig. 2 a The pigmented lesion after 2 months of treatment. b The lesion showed total hypoautofluorescence after healing. c SS-OCT revealed foveal degeneration but the external limiting membrane (arrows) and the ellipsoid layer (arrow head) could already be observed at the perifoveal region. (SS-OCT, swept source optic coherence tomography)
Two months after the above-described follow-up visit, the patient was asymptomatic, but we detected two deep creamy lesions in the macular area of the RE (Fig. 3a). The superior and larger lesions showed hyperautofluorescence, which is typically observed in the active disease. The smaller one showed a mixed pattern of autofluorescence (Fig. 3b). Both lesions were hypofluorescent with late hyperfluorescence on FA (Fig. 3c, d), and hypofluorescent in all the phases of ICGA (Fig. 3e, f).Fig. 3 a Two deep creamy lesions in the macula of the right eye. b The superior lesion is hyperautofluorescent, but the other is hypoautofluorescent. c and d Fluorescein angiography shows the pattern of early hypofluorescence with late staining. Indocyanine green angiography in (e) early and (f) late phases revealed that the lesions were hypofluorescent during the whole examination
Although TB has been ruled out by a non-reactor TST and thoracic CT scan, we conducted the interferon-gamma release assay (IGRA), via QFT-G methodology, which was positive. We then initiated ATT (isoniazid, rifampin, ethambutol, and pyrazinamide) for 9 months. AZA was immediately withdrawn. A maintenance dose of corticosteroids (60 mg/day, slowly tapered within 3 months) was continued until the lesions showed total hypoautofluorescence. One year after finishing ATT, the lesions were stable with no recurrence in both the eyes (Fig. 4a–d), and the visual acuity was 20/20 in the RE and remained at 20/63 in the LE.Fig. 4 a Right and (b) left eyes 1 year after finishing ATT showing total hypoautofluorescence of the healed lesions
Discussion
TSC typically affects young- to middle-aged adults from the endemic areas of TB, with a male preponderance [5]. Bilateral involvement is a common feature of the disease, which may present as the active lesions in both the eyes simultaneously, alternate in one eye followed by the involvement of the other eye, or active in one eye with inactive scars in the other eye [5]. In the larger series so far, Bansal et al. reported that two distinct patterns may be observed in this entity. The more common form (95% of the cases) with multifocal lesions of active choroiditis that were discrete and noncontiguous, to begin with, and then progressed relentlessly to a diffuse, contiguous variety, thereby acquiring an active advancing edge resembling SC. The other one is a rare form (5% of the cases) that presents with a diffuse plaque-like choroiditis showing amoeboid spread [5]. Our patient can be classified in this latter form. However, different from those patients described by Basal et al. our case presented unilaterally and without detectable vitreous cells. These features, as well as the non-reactor TST, led us to the initial diagnosis of “idiopathic” MSC [2].
In fact, the diagnosis of intraocular TB is often problematic due to a wide spectrum of presentations and it is impractical to conduct a biopsy for culture and direct histopathological examination to provide definitive proof of ocular infection. In nearly all reported cases, the diagnosis of ocular TB was only presumptive [6]. In most studies, the diagnostic criteria for presumed ocular TB were: residence or migration from areas endemic in TB, history of contact with patients with TB infection, presence of suggestive ocular findings, exclusion of other known causes of uveitis, corroborative evidence, such as a positive TST, positive IGRAs, and a positive response to conventional ATT without recurrence [6].
Regarding the laboratory examinations, both TST and QFT seem to be equivalent to the diagnosis of ocular TB. Kurup et al. reported no demonstrable advantage of QFT-G assay over the TST in detecting latent TB infection in patients with granulomatous uveitis [7]. However, TST has the following disadvantages when it is compared with QFT-G: it is subjective, can result in false-positive in previous patients vaccinated with Bacilli Calmette-Guerin (BCG), as well as can be false-negative in immunocompromised patients. In fact, in our case, we initially ruled out TB based on a non-reactor TST. QFT-G is an interferon-gamma release assay, commonly known as an IGRA, which is an alternative to TST. Unlike TST, QFT-G is a controlled laboratory test that is unaffected by previous BCG vaccination. QFT-G is highly specific and sensitive; a positive result is strongly predictive of true infection with Mycobacterium tuberculosis [8]. However, like the TST and other IGRAs, QFT-G cannot distinguish between active TB disease and latent infection and is intended to be used for risk assessment, images, and other medical and diagnostic evaluations. Like any diagnostic aid, QFT-G cannot replace clinical judgment. We have considered the positive QFT-G presented by our patient that was associated with the retinal SC-like lesions and supported our diagnosis of presumed ocular TB. Moreover, our region is a moderate endemic area for TB, which enhanced the value of a positive QFT-G for the diagnosis. In India, where TB is highly prevalent, Babu et al. reported a significant association of serpiginous-like choroiditis and positive QFT-G [9] Mackensen et al. in their study from a low TB endemic country have also reported a 52% QFT-G positivity in serpiginous-like choroiditis subset of tubercular uveitis [10]. This association strengthens the need to rule out TB in all patients with serpiginous-like choroiditis, regardless of whether the region is endemic or not. Another important fact that can support the diagnosis of presumed ocular TB in our patient is that the lesions did not recur 1 year after finishing ATT. Intriguingly, in one study, 50 patients presented with multifocal choroiditis due to presumed TB and were treated with ATT without any concomitant use of systemic corticosteroids [11]. All patients had a favorable response, and no recurrence was observed. These findings may indicate that ocular manifestations in these patients were probably because of direct mycobacterial invasion. Therefore, it is plausible to hypothesize that this could also have been the mechanism of infection in our patient.
The failure to consider TB in the differential diagnosis of intraocular inflammation may have catastrophic consequences because the immunosuppressive agents often used to manage the intraocular inflammation may be fatal for both vision and life in patients with active TB disease [12]. In our case, the MSC-like lesion of the RE healed promptly a few weeks after the anti-inflammatory therapy, but 2 months later new lesions appeared in the contralateral eye. We immediately removed the AZA, but a maintenance dose of corticosteroids was continued until the lesions of both eyes were healed. In fact, systemic steroids, in addition to ATT, are sometimes considered for patients with persistent ocular inflammation or retinal vasculitis, but no clinical trials have proven their efficacy.
Conclusion
We believe that our report can contribute to the literature by presenting a rare form of SC-like lesion in a patient with a difficult diagnosis. Moreover, the current methods for the detection of ocular TB must be cautiously interpreted. We also stress that TB must be ruled out in all forms of presentation of SC.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
None.
Authorship
All authors attest that they meet the current ICMJE criteria for Authorship.
Authors' contributions
All authors read and approved the final manuscript.
Funding
No funding or grant support.
Patient consent
Consent to publish the case report was obtained. This report does not contain any personal information that could lead to the identification of the patient.
Competing interests
All authors have no financial disclosures. | Oral | DrugAdministrationRoute | CC BY | 33397439 | 18,956,824 | 2021-01-04 |
What was the dosage of drug 'AZATHIOPRINE'? | Unilateral macular serpiginous-like choroiditis as the initial manifestation of presumed ocular tuberculosis.
BACKGROUND
Classic serpiginous choroiditis (SC) usually begins in the peripapillary area and spreads centrifugally, however, in some patients, the lesion can arise in the macular region. An association between lesions resembling classic SC and tuberculosis was recognized as a possibly distinct clinical entity and named as tuberculous serpiginous-like choroiditis. The differentiation of this tuberculous entity from SC is critical because the treatment of the former with immunosuppressive drugs leads to several potential adverse effects, and such treatment can have devastating consequences because of the worsening of a concomitant tuberculous infection.
A 31-year-old woman presented with unilateral decreased vision and a fundus examination consistent with macular serpiginous choroiditis. A non-reactor tuberculin skin test and normal thoracic CT scan ruled out tuberculosis. However, after 2 months of treatment with steroids and immunosuppressive drugs, the contralateral eye developed similar lesions, further raising the suspicions of ocular tuberculosis. We conducted QuantiFERON® TB Gold, which was positive; hence, antituberculous therapy was started on the patient. The lesions started healing within a few weeks. After 1 year of finishing the therapy, the lesions remained healed without any recurrence.
CONCLUSIONS
Macular serpiginous-like choroiditis may be the initial presentation of presumed ocular tuberculosis. Nevertheless, the correct diagnosis of this entity can be challenging and delayed by the imprecise results from the currently available methods.
Introduction
Serpiginous choroiditis (SC) is a rare, usually bilateral, and chronically recurring inflammatory disease that affects the inner choroid and the retinal pigment epithelium (RPE). The classic SC usually begins in the peripapillary area and spreads centrifugally, in a snake-like manner, over a few months or years [1]. However, in some patients, the lesion can arise in the macular region. This observation led Mansur et al. to call this particular entity as “macular SC” (MSC) [2].
An association between lesions resembling classic SC and tuberculosis (TB) was recognized as a possibly distinct clinical entity and named as tuberculous serpiginous–like choroiditis (TSC) [3]. The differentiation of this tuberculous entity from SC is critical because the treatment of the former with immunosuppressive drugs leads to several potential adverse effects, and such treatment can have devastating consequences because of the worsening of a concomitant tuberculous infection [4]. On the contrary, antiTB treatment may also be associated with significant adverse events, especially in older patients with SC.
The purpose of this paper is to report the case of a young, otherwise, healthy woman who presented with unilateral decreased visual acuity initially diagnosed as MSC. A non-reactor tuberculin skin test (TST) and normal thoracic CT scan ruled out TB. However, during the treatment with steroids and immunosuppressive drugs, the contralateral eye developed SC-like lesions, further raising the suspicions of ocular TB. We conducted QuantiFERON® TB Gold (QFT-G), which was positive; therefore, antituberculous therapy (ATT) was started on the patient. After 1 year of finishing the therapy, the SC-like inflammatory lesions were healed without any recurrence.
Case report
A 31-year-old previously healthy woman had an acute loss of vision in the left eye (LE) since the last 12 days. Her corrected vision acuity was 20/20 in the right eye (RE) and 20/400 in the LE. The slit-lamp examination of the anterior segments was unremarkable. Intraocular tension was within the normal limits in both eyes. No cells were observed in the vitreous region of the LE. A pale, round, yellow-white placoid lesion at the level of the RPE and outer retina was observed inside the vascular arcades of the left macula (Fig. 1a). The optic disks and retinal vessels had a normal appearance.Fig. 1 a Color photo of the left eye showing the yellow-white placoid lesion at the level of the RPE and outer retina, centered in the fovea. b The lesion is hyperautofluorescent at the acute stage. c, d Fluorescein angiography displays typical early hypofluorescence with late staining. e SS-OCT reveals a decreased foveal thickness and disruption of the outer retina. Observe the increased thickness of the choroid as well and the pachyvessels. (RPE, retinal pigment epithelium; SS-OCT, swept source optic coherence tomography)
The lesion showed a thin hyperautofluorescent border, as well as some round regions of hypoautofluorescence inside a hyperautofluorescent background (Fig. 1b). Fluorescein angiography revealed initial hypofluorescence with later hyperfluorescence of the whole lesion, mainly at the foveal and parafoveal regions probably because of RPE atrophy (Fig. 1c, d). The retinal vessels and the optic disks remained with normal fluorescence during all the phases of the examination. Indocyanine green angiography (ICGA) revealed a hypofluorescent plaque during all the phases. Swept-source optic coherence tomography (SS-OCT) displayed a decreased thickness of the fovea, many hyper-reflective dots at the level of the RPE, with a granular appearance, as well as the destruction of the external retina; however, it did not observe the ellipsoid layer and the external limiting membrane (Fig. 1e). The lesion appeared hyper-reflective at the outer retina but 9 × 9 OCT angiography visualized it much better at the choriocapillaris slab. Both superficial and deep plexus were apparently unaffected.
We conducted VDRL, FTA-abs, TST and IgM/IgG for toxoplasmosis, and chest CT, and found that these test results were normal (including a nonreactor TST). As the most prevalent infectious diseases commonly observed in South America were ruled out by laboratory and CT scans, the patient began treatment for MSC. Thereafter, pulsotherapy (methylprednisolone 1 g/day/3 days), oral corticosteroids (1 mg/Kg/day) and azathioprine (AZA) (3 mg/Kg/day) were started on the patient.
Within 2 months, the visual acuity was recovered to 20/63 in the patient. The lesion now appeared pigmented (Fig. 2a) and, totally, hypoautofluorescent (Fig. 2b). FA showed a well-demarcated lesion with hyperfluorescent borders and the round spots of RPE atrophy inside a hypofluorescent background. OCT now revealed foveal degeneration but the external limiting membrane and the ellipsoid layer could already be observed in the perifoveal region (Fig. 2c). She continued taking AZA (150 mg/day) and oral prednisone (20 mg/day). The patient was followed up for every month.Fig. 2 a The pigmented lesion after 2 months of treatment. b The lesion showed total hypoautofluorescence after healing. c SS-OCT revealed foveal degeneration but the external limiting membrane (arrows) and the ellipsoid layer (arrow head) could already be observed at the perifoveal region. (SS-OCT, swept source optic coherence tomography)
Two months after the above-described follow-up visit, the patient was asymptomatic, but we detected two deep creamy lesions in the macular area of the RE (Fig. 3a). The superior and larger lesions showed hyperautofluorescence, which is typically observed in the active disease. The smaller one showed a mixed pattern of autofluorescence (Fig. 3b). Both lesions were hypofluorescent with late hyperfluorescence on FA (Fig. 3c, d), and hypofluorescent in all the phases of ICGA (Fig. 3e, f).Fig. 3 a Two deep creamy lesions in the macula of the right eye. b The superior lesion is hyperautofluorescent, but the other is hypoautofluorescent. c and d Fluorescein angiography shows the pattern of early hypofluorescence with late staining. Indocyanine green angiography in (e) early and (f) late phases revealed that the lesions were hypofluorescent during the whole examination
Although TB has been ruled out by a non-reactor TST and thoracic CT scan, we conducted the interferon-gamma release assay (IGRA), via QFT-G methodology, which was positive. We then initiated ATT (isoniazid, rifampin, ethambutol, and pyrazinamide) for 9 months. AZA was immediately withdrawn. A maintenance dose of corticosteroids (60 mg/day, slowly tapered within 3 months) was continued until the lesions showed total hypoautofluorescence. One year after finishing ATT, the lesions were stable with no recurrence in both the eyes (Fig. 4a–d), and the visual acuity was 20/20 in the RE and remained at 20/63 in the LE.Fig. 4 a Right and (b) left eyes 1 year after finishing ATT showing total hypoautofluorescence of the healed lesions
Discussion
TSC typically affects young- to middle-aged adults from the endemic areas of TB, with a male preponderance [5]. Bilateral involvement is a common feature of the disease, which may present as the active lesions in both the eyes simultaneously, alternate in one eye followed by the involvement of the other eye, or active in one eye with inactive scars in the other eye [5]. In the larger series so far, Bansal et al. reported that two distinct patterns may be observed in this entity. The more common form (95% of the cases) with multifocal lesions of active choroiditis that were discrete and noncontiguous, to begin with, and then progressed relentlessly to a diffuse, contiguous variety, thereby acquiring an active advancing edge resembling SC. The other one is a rare form (5% of the cases) that presents with a diffuse plaque-like choroiditis showing amoeboid spread [5]. Our patient can be classified in this latter form. However, different from those patients described by Basal et al. our case presented unilaterally and without detectable vitreous cells. These features, as well as the non-reactor TST, led us to the initial diagnosis of “idiopathic” MSC [2].
In fact, the diagnosis of intraocular TB is often problematic due to a wide spectrum of presentations and it is impractical to conduct a biopsy for culture and direct histopathological examination to provide definitive proof of ocular infection. In nearly all reported cases, the diagnosis of ocular TB was only presumptive [6]. In most studies, the diagnostic criteria for presumed ocular TB were: residence or migration from areas endemic in TB, history of contact with patients with TB infection, presence of suggestive ocular findings, exclusion of other known causes of uveitis, corroborative evidence, such as a positive TST, positive IGRAs, and a positive response to conventional ATT without recurrence [6].
Regarding the laboratory examinations, both TST and QFT seem to be equivalent to the diagnosis of ocular TB. Kurup et al. reported no demonstrable advantage of QFT-G assay over the TST in detecting latent TB infection in patients with granulomatous uveitis [7]. However, TST has the following disadvantages when it is compared with QFT-G: it is subjective, can result in false-positive in previous patients vaccinated with Bacilli Calmette-Guerin (BCG), as well as can be false-negative in immunocompromised patients. In fact, in our case, we initially ruled out TB based on a non-reactor TST. QFT-G is an interferon-gamma release assay, commonly known as an IGRA, which is an alternative to TST. Unlike TST, QFT-G is a controlled laboratory test that is unaffected by previous BCG vaccination. QFT-G is highly specific and sensitive; a positive result is strongly predictive of true infection with Mycobacterium tuberculosis [8]. However, like the TST and other IGRAs, QFT-G cannot distinguish between active TB disease and latent infection and is intended to be used for risk assessment, images, and other medical and diagnostic evaluations. Like any diagnostic aid, QFT-G cannot replace clinical judgment. We have considered the positive QFT-G presented by our patient that was associated with the retinal SC-like lesions and supported our diagnosis of presumed ocular TB. Moreover, our region is a moderate endemic area for TB, which enhanced the value of a positive QFT-G for the diagnosis. In India, where TB is highly prevalent, Babu et al. reported a significant association of serpiginous-like choroiditis and positive QFT-G [9] Mackensen et al. in their study from a low TB endemic country have also reported a 52% QFT-G positivity in serpiginous-like choroiditis subset of tubercular uveitis [10]. This association strengthens the need to rule out TB in all patients with serpiginous-like choroiditis, regardless of whether the region is endemic or not. Another important fact that can support the diagnosis of presumed ocular TB in our patient is that the lesions did not recur 1 year after finishing ATT. Intriguingly, in one study, 50 patients presented with multifocal choroiditis due to presumed TB and were treated with ATT without any concomitant use of systemic corticosteroids [11]. All patients had a favorable response, and no recurrence was observed. These findings may indicate that ocular manifestations in these patients were probably because of direct mycobacterial invasion. Therefore, it is plausible to hypothesize that this could also have been the mechanism of infection in our patient.
The failure to consider TB in the differential diagnosis of intraocular inflammation may have catastrophic consequences because the immunosuppressive agents often used to manage the intraocular inflammation may be fatal for both vision and life in patients with active TB disease [12]. In our case, the MSC-like lesion of the RE healed promptly a few weeks after the anti-inflammatory therapy, but 2 months later new lesions appeared in the contralateral eye. We immediately removed the AZA, but a maintenance dose of corticosteroids was continued until the lesions of both eyes were healed. In fact, systemic steroids, in addition to ATT, are sometimes considered for patients with persistent ocular inflammation or retinal vasculitis, but no clinical trials have proven their efficacy.
Conclusion
We believe that our report can contribute to the literature by presenting a rare form of SC-like lesion in a patient with a difficult diagnosis. Moreover, the current methods for the detection of ocular TB must be cautiously interpreted. We also stress that TB must be ruled out in all forms of presentation of SC.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
None.
Authorship
All authors attest that they meet the current ICMJE criteria for Authorship.
Authors' contributions
All authors read and approved the final manuscript.
Funding
No funding or grant support.
Patient consent
Consent to publish the case report was obtained. This report does not contain any personal information that could lead to the identification of the patient.
Competing interests
All authors have no financial disclosures. | 3 MILLIGRAM/KILOGRAM, DAILY | DrugDosageText | CC BY | 33397439 | 18,956,824 | 2021-01-04 |
What was the dosage of drug 'METHYLPREDNISOLONE'? | Unilateral macular serpiginous-like choroiditis as the initial manifestation of presumed ocular tuberculosis.
BACKGROUND
Classic serpiginous choroiditis (SC) usually begins in the peripapillary area and spreads centrifugally, however, in some patients, the lesion can arise in the macular region. An association between lesions resembling classic SC and tuberculosis was recognized as a possibly distinct clinical entity and named as tuberculous serpiginous-like choroiditis. The differentiation of this tuberculous entity from SC is critical because the treatment of the former with immunosuppressive drugs leads to several potential adverse effects, and such treatment can have devastating consequences because of the worsening of a concomitant tuberculous infection.
A 31-year-old woman presented with unilateral decreased vision and a fundus examination consistent with macular serpiginous choroiditis. A non-reactor tuberculin skin test and normal thoracic CT scan ruled out tuberculosis. However, after 2 months of treatment with steroids and immunosuppressive drugs, the contralateral eye developed similar lesions, further raising the suspicions of ocular tuberculosis. We conducted QuantiFERON® TB Gold, which was positive; hence, antituberculous therapy was started on the patient. The lesions started healing within a few weeks. After 1 year of finishing the therapy, the lesions remained healed without any recurrence.
CONCLUSIONS
Macular serpiginous-like choroiditis may be the initial presentation of presumed ocular tuberculosis. Nevertheless, the correct diagnosis of this entity can be challenging and delayed by the imprecise results from the currently available methods.
Introduction
Serpiginous choroiditis (SC) is a rare, usually bilateral, and chronically recurring inflammatory disease that affects the inner choroid and the retinal pigment epithelium (RPE). The classic SC usually begins in the peripapillary area and spreads centrifugally, in a snake-like manner, over a few months or years [1]. However, in some patients, the lesion can arise in the macular region. This observation led Mansur et al. to call this particular entity as “macular SC” (MSC) [2].
An association between lesions resembling classic SC and tuberculosis (TB) was recognized as a possibly distinct clinical entity and named as tuberculous serpiginous–like choroiditis (TSC) [3]. The differentiation of this tuberculous entity from SC is critical because the treatment of the former with immunosuppressive drugs leads to several potential adverse effects, and such treatment can have devastating consequences because of the worsening of a concomitant tuberculous infection [4]. On the contrary, antiTB treatment may also be associated with significant adverse events, especially in older patients with SC.
The purpose of this paper is to report the case of a young, otherwise, healthy woman who presented with unilateral decreased visual acuity initially diagnosed as MSC. A non-reactor tuberculin skin test (TST) and normal thoracic CT scan ruled out TB. However, during the treatment with steroids and immunosuppressive drugs, the contralateral eye developed SC-like lesions, further raising the suspicions of ocular TB. We conducted QuantiFERON® TB Gold (QFT-G), which was positive; therefore, antituberculous therapy (ATT) was started on the patient. After 1 year of finishing the therapy, the SC-like inflammatory lesions were healed without any recurrence.
Case report
A 31-year-old previously healthy woman had an acute loss of vision in the left eye (LE) since the last 12 days. Her corrected vision acuity was 20/20 in the right eye (RE) and 20/400 in the LE. The slit-lamp examination of the anterior segments was unremarkable. Intraocular tension was within the normal limits in both eyes. No cells were observed in the vitreous region of the LE. A pale, round, yellow-white placoid lesion at the level of the RPE and outer retina was observed inside the vascular arcades of the left macula (Fig. 1a). The optic disks and retinal vessels had a normal appearance.Fig. 1 a Color photo of the left eye showing the yellow-white placoid lesion at the level of the RPE and outer retina, centered in the fovea. b The lesion is hyperautofluorescent at the acute stage. c, d Fluorescein angiography displays typical early hypofluorescence with late staining. e SS-OCT reveals a decreased foveal thickness and disruption of the outer retina. Observe the increased thickness of the choroid as well and the pachyvessels. (RPE, retinal pigment epithelium; SS-OCT, swept source optic coherence tomography)
The lesion showed a thin hyperautofluorescent border, as well as some round regions of hypoautofluorescence inside a hyperautofluorescent background (Fig. 1b). Fluorescein angiography revealed initial hypofluorescence with later hyperfluorescence of the whole lesion, mainly at the foveal and parafoveal regions probably because of RPE atrophy (Fig. 1c, d). The retinal vessels and the optic disks remained with normal fluorescence during all the phases of the examination. Indocyanine green angiography (ICGA) revealed a hypofluorescent plaque during all the phases. Swept-source optic coherence tomography (SS-OCT) displayed a decreased thickness of the fovea, many hyper-reflective dots at the level of the RPE, with a granular appearance, as well as the destruction of the external retina; however, it did not observe the ellipsoid layer and the external limiting membrane (Fig. 1e). The lesion appeared hyper-reflective at the outer retina but 9 × 9 OCT angiography visualized it much better at the choriocapillaris slab. Both superficial and deep plexus were apparently unaffected.
We conducted VDRL, FTA-abs, TST and IgM/IgG for toxoplasmosis, and chest CT, and found that these test results were normal (including a nonreactor TST). As the most prevalent infectious diseases commonly observed in South America were ruled out by laboratory and CT scans, the patient began treatment for MSC. Thereafter, pulsotherapy (methylprednisolone 1 g/day/3 days), oral corticosteroids (1 mg/Kg/day) and azathioprine (AZA) (3 mg/Kg/day) were started on the patient.
Within 2 months, the visual acuity was recovered to 20/63 in the patient. The lesion now appeared pigmented (Fig. 2a) and, totally, hypoautofluorescent (Fig. 2b). FA showed a well-demarcated lesion with hyperfluorescent borders and the round spots of RPE atrophy inside a hypofluorescent background. OCT now revealed foveal degeneration but the external limiting membrane and the ellipsoid layer could already be observed in the perifoveal region (Fig. 2c). She continued taking AZA (150 mg/day) and oral prednisone (20 mg/day). The patient was followed up for every month.Fig. 2 a The pigmented lesion after 2 months of treatment. b The lesion showed total hypoautofluorescence after healing. c SS-OCT revealed foveal degeneration but the external limiting membrane (arrows) and the ellipsoid layer (arrow head) could already be observed at the perifoveal region. (SS-OCT, swept source optic coherence tomography)
Two months after the above-described follow-up visit, the patient was asymptomatic, but we detected two deep creamy lesions in the macular area of the RE (Fig. 3a). The superior and larger lesions showed hyperautofluorescence, which is typically observed in the active disease. The smaller one showed a mixed pattern of autofluorescence (Fig. 3b). Both lesions were hypofluorescent with late hyperfluorescence on FA (Fig. 3c, d), and hypofluorescent in all the phases of ICGA (Fig. 3e, f).Fig. 3 a Two deep creamy lesions in the macula of the right eye. b The superior lesion is hyperautofluorescent, but the other is hypoautofluorescent. c and d Fluorescein angiography shows the pattern of early hypofluorescence with late staining. Indocyanine green angiography in (e) early and (f) late phases revealed that the lesions were hypofluorescent during the whole examination
Although TB has been ruled out by a non-reactor TST and thoracic CT scan, we conducted the interferon-gamma release assay (IGRA), via QFT-G methodology, which was positive. We then initiated ATT (isoniazid, rifampin, ethambutol, and pyrazinamide) for 9 months. AZA was immediately withdrawn. A maintenance dose of corticosteroids (60 mg/day, slowly tapered within 3 months) was continued until the lesions showed total hypoautofluorescence. One year after finishing ATT, the lesions were stable with no recurrence in both the eyes (Fig. 4a–d), and the visual acuity was 20/20 in the RE and remained at 20/63 in the LE.Fig. 4 a Right and (b) left eyes 1 year after finishing ATT showing total hypoautofluorescence of the healed lesions
Discussion
TSC typically affects young- to middle-aged adults from the endemic areas of TB, with a male preponderance [5]. Bilateral involvement is a common feature of the disease, which may present as the active lesions in both the eyes simultaneously, alternate in one eye followed by the involvement of the other eye, or active in one eye with inactive scars in the other eye [5]. In the larger series so far, Bansal et al. reported that two distinct patterns may be observed in this entity. The more common form (95% of the cases) with multifocal lesions of active choroiditis that were discrete and noncontiguous, to begin with, and then progressed relentlessly to a diffuse, contiguous variety, thereby acquiring an active advancing edge resembling SC. The other one is a rare form (5% of the cases) that presents with a diffuse plaque-like choroiditis showing amoeboid spread [5]. Our patient can be classified in this latter form. However, different from those patients described by Basal et al. our case presented unilaterally and without detectable vitreous cells. These features, as well as the non-reactor TST, led us to the initial diagnosis of “idiopathic” MSC [2].
In fact, the diagnosis of intraocular TB is often problematic due to a wide spectrum of presentations and it is impractical to conduct a biopsy for culture and direct histopathological examination to provide definitive proof of ocular infection. In nearly all reported cases, the diagnosis of ocular TB was only presumptive [6]. In most studies, the diagnostic criteria for presumed ocular TB were: residence or migration from areas endemic in TB, history of contact with patients with TB infection, presence of suggestive ocular findings, exclusion of other known causes of uveitis, corroborative evidence, such as a positive TST, positive IGRAs, and a positive response to conventional ATT without recurrence [6].
Regarding the laboratory examinations, both TST and QFT seem to be equivalent to the diagnosis of ocular TB. Kurup et al. reported no demonstrable advantage of QFT-G assay over the TST in detecting latent TB infection in patients with granulomatous uveitis [7]. However, TST has the following disadvantages when it is compared with QFT-G: it is subjective, can result in false-positive in previous patients vaccinated with Bacilli Calmette-Guerin (BCG), as well as can be false-negative in immunocompromised patients. In fact, in our case, we initially ruled out TB based on a non-reactor TST. QFT-G is an interferon-gamma release assay, commonly known as an IGRA, which is an alternative to TST. Unlike TST, QFT-G is a controlled laboratory test that is unaffected by previous BCG vaccination. QFT-G is highly specific and sensitive; a positive result is strongly predictive of true infection with Mycobacterium tuberculosis [8]. However, like the TST and other IGRAs, QFT-G cannot distinguish between active TB disease and latent infection and is intended to be used for risk assessment, images, and other medical and diagnostic evaluations. Like any diagnostic aid, QFT-G cannot replace clinical judgment. We have considered the positive QFT-G presented by our patient that was associated with the retinal SC-like lesions and supported our diagnosis of presumed ocular TB. Moreover, our region is a moderate endemic area for TB, which enhanced the value of a positive QFT-G for the diagnosis. In India, where TB is highly prevalent, Babu et al. reported a significant association of serpiginous-like choroiditis and positive QFT-G [9] Mackensen et al. in their study from a low TB endemic country have also reported a 52% QFT-G positivity in serpiginous-like choroiditis subset of tubercular uveitis [10]. This association strengthens the need to rule out TB in all patients with serpiginous-like choroiditis, regardless of whether the region is endemic or not. Another important fact that can support the diagnosis of presumed ocular TB in our patient is that the lesions did not recur 1 year after finishing ATT. Intriguingly, in one study, 50 patients presented with multifocal choroiditis due to presumed TB and were treated with ATT without any concomitant use of systemic corticosteroids [11]. All patients had a favorable response, and no recurrence was observed. These findings may indicate that ocular manifestations in these patients were probably because of direct mycobacterial invasion. Therefore, it is plausible to hypothesize that this could also have been the mechanism of infection in our patient.
The failure to consider TB in the differential diagnosis of intraocular inflammation may have catastrophic consequences because the immunosuppressive agents often used to manage the intraocular inflammation may be fatal for both vision and life in patients with active TB disease [12]. In our case, the MSC-like lesion of the RE healed promptly a few weeks after the anti-inflammatory therapy, but 2 months later new lesions appeared in the contralateral eye. We immediately removed the AZA, but a maintenance dose of corticosteroids was continued until the lesions of both eyes were healed. In fact, systemic steroids, in addition to ATT, are sometimes considered for patients with persistent ocular inflammation or retinal vasculitis, but no clinical trials have proven their efficacy.
Conclusion
We believe that our report can contribute to the literature by presenting a rare form of SC-like lesion in a patient with a difficult diagnosis. Moreover, the current methods for the detection of ocular TB must be cautiously interpreted. We also stress that TB must be ruled out in all forms of presentation of SC.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
None.
Authorship
All authors attest that they meet the current ICMJE criteria for Authorship.
Authors' contributions
All authors read and approved the final manuscript.
Funding
No funding or grant support.
Patient consent
Consent to publish the case report was obtained. This report does not contain any personal information that could lead to the identification of the patient.
Competing interests
All authors have no financial disclosures. | 1 GRAM, DAILY | DrugDosageText | CC BY | 33397439 | 18,956,824 | 2021-01-04 |
What was the dosage of drug 'PREDNISONE'? | Unilateral macular serpiginous-like choroiditis as the initial manifestation of presumed ocular tuberculosis.
BACKGROUND
Classic serpiginous choroiditis (SC) usually begins in the peripapillary area and spreads centrifugally, however, in some patients, the lesion can arise in the macular region. An association between lesions resembling classic SC and tuberculosis was recognized as a possibly distinct clinical entity and named as tuberculous serpiginous-like choroiditis. The differentiation of this tuberculous entity from SC is critical because the treatment of the former with immunosuppressive drugs leads to several potential adverse effects, and such treatment can have devastating consequences because of the worsening of a concomitant tuberculous infection.
A 31-year-old woman presented with unilateral decreased vision and a fundus examination consistent with macular serpiginous choroiditis. A non-reactor tuberculin skin test and normal thoracic CT scan ruled out tuberculosis. However, after 2 months of treatment with steroids and immunosuppressive drugs, the contralateral eye developed similar lesions, further raising the suspicions of ocular tuberculosis. We conducted QuantiFERON® TB Gold, which was positive; hence, antituberculous therapy was started on the patient. The lesions started healing within a few weeks. After 1 year of finishing the therapy, the lesions remained healed without any recurrence.
CONCLUSIONS
Macular serpiginous-like choroiditis may be the initial presentation of presumed ocular tuberculosis. Nevertheless, the correct diagnosis of this entity can be challenging and delayed by the imprecise results from the currently available methods.
Introduction
Serpiginous choroiditis (SC) is a rare, usually bilateral, and chronically recurring inflammatory disease that affects the inner choroid and the retinal pigment epithelium (RPE). The classic SC usually begins in the peripapillary area and spreads centrifugally, in a snake-like manner, over a few months or years [1]. However, in some patients, the lesion can arise in the macular region. This observation led Mansur et al. to call this particular entity as “macular SC” (MSC) [2].
An association between lesions resembling classic SC and tuberculosis (TB) was recognized as a possibly distinct clinical entity and named as tuberculous serpiginous–like choroiditis (TSC) [3]. The differentiation of this tuberculous entity from SC is critical because the treatment of the former with immunosuppressive drugs leads to several potential adverse effects, and such treatment can have devastating consequences because of the worsening of a concomitant tuberculous infection [4]. On the contrary, antiTB treatment may also be associated with significant adverse events, especially in older patients with SC.
The purpose of this paper is to report the case of a young, otherwise, healthy woman who presented with unilateral decreased visual acuity initially diagnosed as MSC. A non-reactor tuberculin skin test (TST) and normal thoracic CT scan ruled out TB. However, during the treatment with steroids and immunosuppressive drugs, the contralateral eye developed SC-like lesions, further raising the suspicions of ocular TB. We conducted QuantiFERON® TB Gold (QFT-G), which was positive; therefore, antituberculous therapy (ATT) was started on the patient. After 1 year of finishing the therapy, the SC-like inflammatory lesions were healed without any recurrence.
Case report
A 31-year-old previously healthy woman had an acute loss of vision in the left eye (LE) since the last 12 days. Her corrected vision acuity was 20/20 in the right eye (RE) and 20/400 in the LE. The slit-lamp examination of the anterior segments was unremarkable. Intraocular tension was within the normal limits in both eyes. No cells were observed in the vitreous region of the LE. A pale, round, yellow-white placoid lesion at the level of the RPE and outer retina was observed inside the vascular arcades of the left macula (Fig. 1a). The optic disks and retinal vessels had a normal appearance.Fig. 1 a Color photo of the left eye showing the yellow-white placoid lesion at the level of the RPE and outer retina, centered in the fovea. b The lesion is hyperautofluorescent at the acute stage. c, d Fluorescein angiography displays typical early hypofluorescence with late staining. e SS-OCT reveals a decreased foveal thickness and disruption of the outer retina. Observe the increased thickness of the choroid as well and the pachyvessels. (RPE, retinal pigment epithelium; SS-OCT, swept source optic coherence tomography)
The lesion showed a thin hyperautofluorescent border, as well as some round regions of hypoautofluorescence inside a hyperautofluorescent background (Fig. 1b). Fluorescein angiography revealed initial hypofluorescence with later hyperfluorescence of the whole lesion, mainly at the foveal and parafoveal regions probably because of RPE atrophy (Fig. 1c, d). The retinal vessels and the optic disks remained with normal fluorescence during all the phases of the examination. Indocyanine green angiography (ICGA) revealed a hypofluorescent plaque during all the phases. Swept-source optic coherence tomography (SS-OCT) displayed a decreased thickness of the fovea, many hyper-reflective dots at the level of the RPE, with a granular appearance, as well as the destruction of the external retina; however, it did not observe the ellipsoid layer and the external limiting membrane (Fig. 1e). The lesion appeared hyper-reflective at the outer retina but 9 × 9 OCT angiography visualized it much better at the choriocapillaris slab. Both superficial and deep plexus were apparently unaffected.
We conducted VDRL, FTA-abs, TST and IgM/IgG for toxoplasmosis, and chest CT, and found that these test results were normal (including a nonreactor TST). As the most prevalent infectious diseases commonly observed in South America were ruled out by laboratory and CT scans, the patient began treatment for MSC. Thereafter, pulsotherapy (methylprednisolone 1 g/day/3 days), oral corticosteroids (1 mg/Kg/day) and azathioprine (AZA) (3 mg/Kg/day) were started on the patient.
Within 2 months, the visual acuity was recovered to 20/63 in the patient. The lesion now appeared pigmented (Fig. 2a) and, totally, hypoautofluorescent (Fig. 2b). FA showed a well-demarcated lesion with hyperfluorescent borders and the round spots of RPE atrophy inside a hypofluorescent background. OCT now revealed foveal degeneration but the external limiting membrane and the ellipsoid layer could already be observed in the perifoveal region (Fig. 2c). She continued taking AZA (150 mg/day) and oral prednisone (20 mg/day). The patient was followed up for every month.Fig. 2 a The pigmented lesion after 2 months of treatment. b The lesion showed total hypoautofluorescence after healing. c SS-OCT revealed foveal degeneration but the external limiting membrane (arrows) and the ellipsoid layer (arrow head) could already be observed at the perifoveal region. (SS-OCT, swept source optic coherence tomography)
Two months after the above-described follow-up visit, the patient was asymptomatic, but we detected two deep creamy lesions in the macular area of the RE (Fig. 3a). The superior and larger lesions showed hyperautofluorescence, which is typically observed in the active disease. The smaller one showed a mixed pattern of autofluorescence (Fig. 3b). Both lesions were hypofluorescent with late hyperfluorescence on FA (Fig. 3c, d), and hypofluorescent in all the phases of ICGA (Fig. 3e, f).Fig. 3 a Two deep creamy lesions in the macula of the right eye. b The superior lesion is hyperautofluorescent, but the other is hypoautofluorescent. c and d Fluorescein angiography shows the pattern of early hypofluorescence with late staining. Indocyanine green angiography in (e) early and (f) late phases revealed that the lesions were hypofluorescent during the whole examination
Although TB has been ruled out by a non-reactor TST and thoracic CT scan, we conducted the interferon-gamma release assay (IGRA), via QFT-G methodology, which was positive. We then initiated ATT (isoniazid, rifampin, ethambutol, and pyrazinamide) for 9 months. AZA was immediately withdrawn. A maintenance dose of corticosteroids (60 mg/day, slowly tapered within 3 months) was continued until the lesions showed total hypoautofluorescence. One year after finishing ATT, the lesions were stable with no recurrence in both the eyes (Fig. 4a–d), and the visual acuity was 20/20 in the RE and remained at 20/63 in the LE.Fig. 4 a Right and (b) left eyes 1 year after finishing ATT showing total hypoautofluorescence of the healed lesions
Discussion
TSC typically affects young- to middle-aged adults from the endemic areas of TB, with a male preponderance [5]. Bilateral involvement is a common feature of the disease, which may present as the active lesions in both the eyes simultaneously, alternate in one eye followed by the involvement of the other eye, or active in one eye with inactive scars in the other eye [5]. In the larger series so far, Bansal et al. reported that two distinct patterns may be observed in this entity. The more common form (95% of the cases) with multifocal lesions of active choroiditis that were discrete and noncontiguous, to begin with, and then progressed relentlessly to a diffuse, contiguous variety, thereby acquiring an active advancing edge resembling SC. The other one is a rare form (5% of the cases) that presents with a diffuse plaque-like choroiditis showing amoeboid spread [5]. Our patient can be classified in this latter form. However, different from those patients described by Basal et al. our case presented unilaterally and without detectable vitreous cells. These features, as well as the non-reactor TST, led us to the initial diagnosis of “idiopathic” MSC [2].
In fact, the diagnosis of intraocular TB is often problematic due to a wide spectrum of presentations and it is impractical to conduct a biopsy for culture and direct histopathological examination to provide definitive proof of ocular infection. In nearly all reported cases, the diagnosis of ocular TB was only presumptive [6]. In most studies, the diagnostic criteria for presumed ocular TB were: residence or migration from areas endemic in TB, history of contact with patients with TB infection, presence of suggestive ocular findings, exclusion of other known causes of uveitis, corroborative evidence, such as a positive TST, positive IGRAs, and a positive response to conventional ATT without recurrence [6].
Regarding the laboratory examinations, both TST and QFT seem to be equivalent to the diagnosis of ocular TB. Kurup et al. reported no demonstrable advantage of QFT-G assay over the TST in detecting latent TB infection in patients with granulomatous uveitis [7]. However, TST has the following disadvantages when it is compared with QFT-G: it is subjective, can result in false-positive in previous patients vaccinated with Bacilli Calmette-Guerin (BCG), as well as can be false-negative in immunocompromised patients. In fact, in our case, we initially ruled out TB based on a non-reactor TST. QFT-G is an interferon-gamma release assay, commonly known as an IGRA, which is an alternative to TST. Unlike TST, QFT-G is a controlled laboratory test that is unaffected by previous BCG vaccination. QFT-G is highly specific and sensitive; a positive result is strongly predictive of true infection with Mycobacterium tuberculosis [8]. However, like the TST and other IGRAs, QFT-G cannot distinguish between active TB disease and latent infection and is intended to be used for risk assessment, images, and other medical and diagnostic evaluations. Like any diagnostic aid, QFT-G cannot replace clinical judgment. We have considered the positive QFT-G presented by our patient that was associated with the retinal SC-like lesions and supported our diagnosis of presumed ocular TB. Moreover, our region is a moderate endemic area for TB, which enhanced the value of a positive QFT-G for the diagnosis. In India, where TB is highly prevalent, Babu et al. reported a significant association of serpiginous-like choroiditis and positive QFT-G [9] Mackensen et al. in their study from a low TB endemic country have also reported a 52% QFT-G positivity in serpiginous-like choroiditis subset of tubercular uveitis [10]. This association strengthens the need to rule out TB in all patients with serpiginous-like choroiditis, regardless of whether the region is endemic or not. Another important fact that can support the diagnosis of presumed ocular TB in our patient is that the lesions did not recur 1 year after finishing ATT. Intriguingly, in one study, 50 patients presented with multifocal choroiditis due to presumed TB and were treated with ATT without any concomitant use of systemic corticosteroids [11]. All patients had a favorable response, and no recurrence was observed. These findings may indicate that ocular manifestations in these patients were probably because of direct mycobacterial invasion. Therefore, it is plausible to hypothesize that this could also have been the mechanism of infection in our patient.
The failure to consider TB in the differential diagnosis of intraocular inflammation may have catastrophic consequences because the immunosuppressive agents often used to manage the intraocular inflammation may be fatal for both vision and life in patients with active TB disease [12]. In our case, the MSC-like lesion of the RE healed promptly a few weeks after the anti-inflammatory therapy, but 2 months later new lesions appeared in the contralateral eye. We immediately removed the AZA, but a maintenance dose of corticosteroids was continued until the lesions of both eyes were healed. In fact, systemic steroids, in addition to ATT, are sometimes considered for patients with persistent ocular inflammation or retinal vasculitis, but no clinical trials have proven their efficacy.
Conclusion
We believe that our report can contribute to the literature by presenting a rare form of SC-like lesion in a patient with a difficult diagnosis. Moreover, the current methods for the detection of ocular TB must be cautiously interpreted. We also stress that TB must be ruled out in all forms of presentation of SC.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
None.
Authorship
All authors attest that they meet the current ICMJE criteria for Authorship.
Authors' contributions
All authors read and approved the final manuscript.
Funding
No funding or grant support.
Patient consent
Consent to publish the case report was obtained. This report does not contain any personal information that could lead to the identification of the patient.
Competing interests
All authors have no financial disclosures. | 20 MILLIGRAM, DAILY | DrugDosageText | CC BY | 33397439 | 18,956,824 | 2021-01-04 |
What was the outcome of reaction 'Tuberculosis of eye'? | Unilateral macular serpiginous-like choroiditis as the initial manifestation of presumed ocular tuberculosis.
BACKGROUND
Classic serpiginous choroiditis (SC) usually begins in the peripapillary area and spreads centrifugally, however, in some patients, the lesion can arise in the macular region. An association between lesions resembling classic SC and tuberculosis was recognized as a possibly distinct clinical entity and named as tuberculous serpiginous-like choroiditis. The differentiation of this tuberculous entity from SC is critical because the treatment of the former with immunosuppressive drugs leads to several potential adverse effects, and such treatment can have devastating consequences because of the worsening of a concomitant tuberculous infection.
A 31-year-old woman presented with unilateral decreased vision and a fundus examination consistent with macular serpiginous choroiditis. A non-reactor tuberculin skin test and normal thoracic CT scan ruled out tuberculosis. However, after 2 months of treatment with steroids and immunosuppressive drugs, the contralateral eye developed similar lesions, further raising the suspicions of ocular tuberculosis. We conducted QuantiFERON® TB Gold, which was positive; hence, antituberculous therapy was started on the patient. The lesions started healing within a few weeks. After 1 year of finishing the therapy, the lesions remained healed without any recurrence.
CONCLUSIONS
Macular serpiginous-like choroiditis may be the initial presentation of presumed ocular tuberculosis. Nevertheless, the correct diagnosis of this entity can be challenging and delayed by the imprecise results from the currently available methods.
Introduction
Serpiginous choroiditis (SC) is a rare, usually bilateral, and chronically recurring inflammatory disease that affects the inner choroid and the retinal pigment epithelium (RPE). The classic SC usually begins in the peripapillary area and spreads centrifugally, in a snake-like manner, over a few months or years [1]. However, in some patients, the lesion can arise in the macular region. This observation led Mansur et al. to call this particular entity as “macular SC” (MSC) [2].
An association between lesions resembling classic SC and tuberculosis (TB) was recognized as a possibly distinct clinical entity and named as tuberculous serpiginous–like choroiditis (TSC) [3]. The differentiation of this tuberculous entity from SC is critical because the treatment of the former with immunosuppressive drugs leads to several potential adverse effects, and such treatment can have devastating consequences because of the worsening of a concomitant tuberculous infection [4]. On the contrary, antiTB treatment may also be associated with significant adverse events, especially in older patients with SC.
The purpose of this paper is to report the case of a young, otherwise, healthy woman who presented with unilateral decreased visual acuity initially diagnosed as MSC. A non-reactor tuberculin skin test (TST) and normal thoracic CT scan ruled out TB. However, during the treatment with steroids and immunosuppressive drugs, the contralateral eye developed SC-like lesions, further raising the suspicions of ocular TB. We conducted QuantiFERON® TB Gold (QFT-G), which was positive; therefore, antituberculous therapy (ATT) was started on the patient. After 1 year of finishing the therapy, the SC-like inflammatory lesions were healed without any recurrence.
Case report
A 31-year-old previously healthy woman had an acute loss of vision in the left eye (LE) since the last 12 days. Her corrected vision acuity was 20/20 in the right eye (RE) and 20/400 in the LE. The slit-lamp examination of the anterior segments was unremarkable. Intraocular tension was within the normal limits in both eyes. No cells were observed in the vitreous region of the LE. A pale, round, yellow-white placoid lesion at the level of the RPE and outer retina was observed inside the vascular arcades of the left macula (Fig. 1a). The optic disks and retinal vessels had a normal appearance.Fig. 1 a Color photo of the left eye showing the yellow-white placoid lesion at the level of the RPE and outer retina, centered in the fovea. b The lesion is hyperautofluorescent at the acute stage. c, d Fluorescein angiography displays typical early hypofluorescence with late staining. e SS-OCT reveals a decreased foveal thickness and disruption of the outer retina. Observe the increased thickness of the choroid as well and the pachyvessels. (RPE, retinal pigment epithelium; SS-OCT, swept source optic coherence tomography)
The lesion showed a thin hyperautofluorescent border, as well as some round regions of hypoautofluorescence inside a hyperautofluorescent background (Fig. 1b). Fluorescein angiography revealed initial hypofluorescence with later hyperfluorescence of the whole lesion, mainly at the foveal and parafoveal regions probably because of RPE atrophy (Fig. 1c, d). The retinal vessels and the optic disks remained with normal fluorescence during all the phases of the examination. Indocyanine green angiography (ICGA) revealed a hypofluorescent plaque during all the phases. Swept-source optic coherence tomography (SS-OCT) displayed a decreased thickness of the fovea, many hyper-reflective dots at the level of the RPE, with a granular appearance, as well as the destruction of the external retina; however, it did not observe the ellipsoid layer and the external limiting membrane (Fig. 1e). The lesion appeared hyper-reflective at the outer retina but 9 × 9 OCT angiography visualized it much better at the choriocapillaris slab. Both superficial and deep plexus were apparently unaffected.
We conducted VDRL, FTA-abs, TST and IgM/IgG for toxoplasmosis, and chest CT, and found that these test results were normal (including a nonreactor TST). As the most prevalent infectious diseases commonly observed in South America were ruled out by laboratory and CT scans, the patient began treatment for MSC. Thereafter, pulsotherapy (methylprednisolone 1 g/day/3 days), oral corticosteroids (1 mg/Kg/day) and azathioprine (AZA) (3 mg/Kg/day) were started on the patient.
Within 2 months, the visual acuity was recovered to 20/63 in the patient. The lesion now appeared pigmented (Fig. 2a) and, totally, hypoautofluorescent (Fig. 2b). FA showed a well-demarcated lesion with hyperfluorescent borders and the round spots of RPE atrophy inside a hypofluorescent background. OCT now revealed foveal degeneration but the external limiting membrane and the ellipsoid layer could already be observed in the perifoveal region (Fig. 2c). She continued taking AZA (150 mg/day) and oral prednisone (20 mg/day). The patient was followed up for every month.Fig. 2 a The pigmented lesion after 2 months of treatment. b The lesion showed total hypoautofluorescence after healing. c SS-OCT revealed foveal degeneration but the external limiting membrane (arrows) and the ellipsoid layer (arrow head) could already be observed at the perifoveal region. (SS-OCT, swept source optic coherence tomography)
Two months after the above-described follow-up visit, the patient was asymptomatic, but we detected two deep creamy lesions in the macular area of the RE (Fig. 3a). The superior and larger lesions showed hyperautofluorescence, which is typically observed in the active disease. The smaller one showed a mixed pattern of autofluorescence (Fig. 3b). Both lesions were hypofluorescent with late hyperfluorescence on FA (Fig. 3c, d), and hypofluorescent in all the phases of ICGA (Fig. 3e, f).Fig. 3 a Two deep creamy lesions in the macula of the right eye. b The superior lesion is hyperautofluorescent, but the other is hypoautofluorescent. c and d Fluorescein angiography shows the pattern of early hypofluorescence with late staining. Indocyanine green angiography in (e) early and (f) late phases revealed that the lesions were hypofluorescent during the whole examination
Although TB has been ruled out by a non-reactor TST and thoracic CT scan, we conducted the interferon-gamma release assay (IGRA), via QFT-G methodology, which was positive. We then initiated ATT (isoniazid, rifampin, ethambutol, and pyrazinamide) for 9 months. AZA was immediately withdrawn. A maintenance dose of corticosteroids (60 mg/day, slowly tapered within 3 months) was continued until the lesions showed total hypoautofluorescence. One year after finishing ATT, the lesions were stable with no recurrence in both the eyes (Fig. 4a–d), and the visual acuity was 20/20 in the RE and remained at 20/63 in the LE.Fig. 4 a Right and (b) left eyes 1 year after finishing ATT showing total hypoautofluorescence of the healed lesions
Discussion
TSC typically affects young- to middle-aged adults from the endemic areas of TB, with a male preponderance [5]. Bilateral involvement is a common feature of the disease, which may present as the active lesions in both the eyes simultaneously, alternate in one eye followed by the involvement of the other eye, or active in one eye with inactive scars in the other eye [5]. In the larger series so far, Bansal et al. reported that two distinct patterns may be observed in this entity. The more common form (95% of the cases) with multifocal lesions of active choroiditis that were discrete and noncontiguous, to begin with, and then progressed relentlessly to a diffuse, contiguous variety, thereby acquiring an active advancing edge resembling SC. The other one is a rare form (5% of the cases) that presents with a diffuse plaque-like choroiditis showing amoeboid spread [5]. Our patient can be classified in this latter form. However, different from those patients described by Basal et al. our case presented unilaterally and without detectable vitreous cells. These features, as well as the non-reactor TST, led us to the initial diagnosis of “idiopathic” MSC [2].
In fact, the diagnosis of intraocular TB is often problematic due to a wide spectrum of presentations and it is impractical to conduct a biopsy for culture and direct histopathological examination to provide definitive proof of ocular infection. In nearly all reported cases, the diagnosis of ocular TB was only presumptive [6]. In most studies, the diagnostic criteria for presumed ocular TB were: residence or migration from areas endemic in TB, history of contact with patients with TB infection, presence of suggestive ocular findings, exclusion of other known causes of uveitis, corroborative evidence, such as a positive TST, positive IGRAs, and a positive response to conventional ATT without recurrence [6].
Regarding the laboratory examinations, both TST and QFT seem to be equivalent to the diagnosis of ocular TB. Kurup et al. reported no demonstrable advantage of QFT-G assay over the TST in detecting latent TB infection in patients with granulomatous uveitis [7]. However, TST has the following disadvantages when it is compared with QFT-G: it is subjective, can result in false-positive in previous patients vaccinated with Bacilli Calmette-Guerin (BCG), as well as can be false-negative in immunocompromised patients. In fact, in our case, we initially ruled out TB based on a non-reactor TST. QFT-G is an interferon-gamma release assay, commonly known as an IGRA, which is an alternative to TST. Unlike TST, QFT-G is a controlled laboratory test that is unaffected by previous BCG vaccination. QFT-G is highly specific and sensitive; a positive result is strongly predictive of true infection with Mycobacterium tuberculosis [8]. However, like the TST and other IGRAs, QFT-G cannot distinguish between active TB disease and latent infection and is intended to be used for risk assessment, images, and other medical and diagnostic evaluations. Like any diagnostic aid, QFT-G cannot replace clinical judgment. We have considered the positive QFT-G presented by our patient that was associated with the retinal SC-like lesions and supported our diagnosis of presumed ocular TB. Moreover, our region is a moderate endemic area for TB, which enhanced the value of a positive QFT-G for the diagnosis. In India, where TB is highly prevalent, Babu et al. reported a significant association of serpiginous-like choroiditis and positive QFT-G [9] Mackensen et al. in their study from a low TB endemic country have also reported a 52% QFT-G positivity in serpiginous-like choroiditis subset of tubercular uveitis [10]. This association strengthens the need to rule out TB in all patients with serpiginous-like choroiditis, regardless of whether the region is endemic or not. Another important fact that can support the diagnosis of presumed ocular TB in our patient is that the lesions did not recur 1 year after finishing ATT. Intriguingly, in one study, 50 patients presented with multifocal choroiditis due to presumed TB and were treated with ATT without any concomitant use of systemic corticosteroids [11]. All patients had a favorable response, and no recurrence was observed. These findings may indicate that ocular manifestations in these patients were probably because of direct mycobacterial invasion. Therefore, it is plausible to hypothesize that this could also have been the mechanism of infection in our patient.
The failure to consider TB in the differential diagnosis of intraocular inflammation may have catastrophic consequences because the immunosuppressive agents often used to manage the intraocular inflammation may be fatal for both vision and life in patients with active TB disease [12]. In our case, the MSC-like lesion of the RE healed promptly a few weeks after the anti-inflammatory therapy, but 2 months later new lesions appeared in the contralateral eye. We immediately removed the AZA, but a maintenance dose of corticosteroids was continued until the lesions of both eyes were healed. In fact, systemic steroids, in addition to ATT, are sometimes considered for patients with persistent ocular inflammation or retinal vasculitis, but no clinical trials have proven their efficacy.
Conclusion
We believe that our report can contribute to the literature by presenting a rare form of SC-like lesion in a patient with a difficult diagnosis. Moreover, the current methods for the detection of ocular TB must be cautiously interpreted. We also stress that TB must be ruled out in all forms of presentation of SC.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
None.
Authorship
All authors attest that they meet the current ICMJE criteria for Authorship.
Authors' contributions
All authors read and approved the final manuscript.
Funding
No funding or grant support.
Patient consent
Consent to publish the case report was obtained. This report does not contain any personal information that could lead to the identification of the patient.
Competing interests
All authors have no financial disclosures. | Recovered | ReactionOutcome | CC BY | 33397439 | 18,956,824 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Acute myeloid leukaemia recurrent'. | Case report of combination therapy with Azacytidine, Enasidenib and Venetoclax in primary refractory AML.
Optimal treatment of acute myeloid leukemia (AML) arising in elderly patients remains a challenge. FDA approval of Ivosidenib and Enasidenib, small molecule inhibitors of isocitrate dehydrogenase enzymes (IDH1 and 2) have opened new avenues of treatment. We present a 60-year-old woman with refractory AML, achieving complete response to the combination therapy of hypomethylating agent, Azacytidine with the IDH2 inhibitor, Enasidenib, and BCL2 inhibitor, Venetoclax. To our knowledge, this is the first case report of a patient with IDH2 mutated refractory AML achieving complete response to combination therapy with azacytidine, enasidenib and venetoclax.
Letter to the editor
Acute myeloid leukemia (AML) arising in older patients from pre-existing Myelodysplastic Syndrome (MDS) carries a poor prognosis, with limited response to standard cytotoxic therapy [1]. Novel treatments tailored to each patient’s molecular abnormalities are needed to improve outcomes. Mutations in isocitrate dehydrogenase enzymes, IDH1 (R132) and mitochondrial IDH2 (R140, R172) have been identified and lead to the production of an oncometabolite, 2-hydroxyglutarate (2-HG) [2]. Accumulation of 2-HG in hematopoietic stem cells leads to DNA hypermethylation, changes in gene expression and blocked hematopoietic differentiation [2]. Ivosidenib and Enasidenib, small molecule inhibitors of IDH1 and IDH2 enzymes, respectively, are FDA approved for treatment of adults with relapsed/refractory AML [3, 4]. The initial Phase 1/2 open-label, single arm trial of Enasidenib evaluated its efficacy as a single agent in N = 199 patients with relapsed/refractory AML and demonstrated a complete response (CR) of 23% after a median follow-up of 6.6 months [3]. Trials examining these agents in the frontline and relapsed settings, in combination with chemotherapy, are ongoing. We report here a case of a patient with IDH2 mutated refractory AML achieving complete response with the combination of Enasidenib and hypomethylating agent, Azacytidine (AZA). Subsequent relapse was managed with the addition of Venetoclax to the AZA/Enasidenib combination.
Our patient, a 60 year old female with no significant past medical history, presented with worsening fatigue, fever and sore throat. Labs demonstrated a white blood cell (WBC) count of 1.2 × 109/L with an absolute neutrophil count (ANC) of 144 cells/uL, hemoglobin of 12 g/dL, mean corpuscular value (MCV) of 108 fL, platelet count of 187 × 109/L. Initial bone marrow biopsy revealed a hypercellular marrow for age (60% cellularity) with at least 20% CD34 + , CD117 + myeloblasts, concerning for evolving AML. Patient presented to our clinic for a second opinion. Repeat bone marrow biopsy done at this time showed a hypocellular marrow (10–20% cellularity) with at least 40% CD34 + , CD33 + , CD117 + and myeloperoxidase (MPO) + myeloblasts, consistent with AML. Cytogenetic analysis demonstrated trisomy 8. Molecular profiling using a next generation sequencing (NGS) platform revealed a missense mutation in the IDH2 enzyme (c.515G > A; p.R172K) with a variant allele frequency (VAF) of 7%. Patient was also noted to have co-mutations in DNMT3A (VAF 7%).
Patient received induction chemotherapy with the standard “7 + 3” regimen of Cytarabine 100 mg/m2/dose and Idarubicin 12 mg/m2/dose. Despite receiving anti-fungal prophylaxis, post-induction course was complicated by rhinocerebral mucormycosis requiring several sinonasal debridements and a prolonged hospitalization. In an effort to decrease length of neutropenia and avoid further clinical decline, patient received growth factor support with filgastrim. Due to the severity of the infection and her immunocompromised status, patient was given granulocyte infusions. She required a prolonged course of antifungal therapy with posaconazole which patient continues at this time. Upon clinical improvement, repeat bone marrow biopsy was performed on Day 40 post induction. This revealed refractory disease, with 45% CD33 + , CD34 + , CD117 + , and MPO + myeloblasts.
We discussed the role of a salvage regimen followed by an allogeneic transplant. However, given her recent invasive fungal infection and poor performance status, patient elected not to pursue a stem cell transplant. She was started on salvage therapy with Enasidenib 100 mg daily in continuous 28 day cycles, and Decitabine 20 mg/m2/dose over five days in 28 day cycles. She did not experience any differentiation syndrome with Enasidenib therapy. However, she developed persistent neutropenia with this regimen and was switched to AZA 75 mg/m2/dose over five days in 28 day cycles. Enasidenib was continued at the initial dose. Figure 1 is a longitudinal representation of the changes in patient’s cytopenias with treatment.Fig. 1 Clinical course of primary refractory AML patient with combination therapy with DNMT inhibitors, IDH inhibitors and Venetoclax: The patient was primary refractory after induction chemotherapy. The patient went into a complete remission (CR) after starting Azacytidine and Enasidenib. Venetoclax was added upon relapse and led to trilineage count recovery. Time periods are as follows: a Induction chemotherapy with Idarubicin and Cytarabine; b Salvage with Enasidenib and Decitabine; c Maintenance with Enasidenib and Azacytidine; d Relapse and brief treatment with Venetoclax; e Count Recovery; f Relapse
Bone marrow biopsy performed after seven cycles of Enasidenib and hypomethylating agent therapy showed a hypocellular marrow (10%) with 1.4% CD34 + , CD117 + myeloblasts. Repeat NGS profiling showed a persistent IDH2 R172 clone with a VAF of 10% and a co-mutation in DNMT3A with VAF 12%. Correlative studies with multiparameter flow cytometry revealed less than < 1% phenotypic leukemia stem cells (Lineage-ve, CD34 + , CD38-, CD123 + /CD45RA + /IL1RAP +) demonstrating a deep marrow remission (Fig. 2) [5]. Labs were consistent with complete remission (CR), with a WBC count of 7.3 × 109/L with ANC of 5800 cells/uL, hemoglobin of 10.2, MCV 105 fL and platelets 349 × 109/L.Fig. 2 Leukemic stem cells analysis: Bone marrow cells were used to identify Lineage–ve, CD34 + , CD38 −, CD123 + , CD45RA + . IL1RAP + cells with multiparameter flow cytometry. Very few (< 1%) leukemic stem cells were found in remission samples
Patient remained in CR for nine months. She subsequently was noticed to have increasing peripheral blasts. Bone marrow biopsy showed a hypercellular marrow with 10–20% blasts with a new deletion of chromosome 7q22 and a translocation between chromosomes 4 and 13 involving breakpoints -4q22 and 13p12. Sequencing revealed clonal evolution with increasing allele burden of known IDH2 mutation, with VAF now at 38%, and new mutations in BCOR and RUNX1. She was started on Venetoclax at 50 mg daily for 2 weeks. However, patient developed febrile neutropenia and Venetoclax was held. Upon hematologic recovery, clearance of peripheral blasts was noted. Patient was restarted on Venetoclax, AZA and Enasidenib.
This is the first reported case of a patient with relapsed AML responding to combined therapy with a hypomethylating agent (HMA), IDH2 and BCL2 inhibitors. While the two-drug combinations of HMA/Venetoclax and HMA/Enasidenib are currently under investigation, the three-drug regimen of HMA/Venetoclax with Enasidenib has never been evaluated in a clinical trial. The recently published VIALE-A trial has established the combination of AZA/Venetoclax as a viable treatment option in patients with newly diagnosed AML, with a survival benefit noted in the AZA/Venetoclax arm, compared to control (14.7 months vs. 9.6 months, HR 0.66, CI 0.52 to 0.85, p < 0.001) [6]. The combination of AZA/IDH inhibitor is under investigation in the ongoing Phase II AG221-AML-005 trial in patients with IDH2 mutated relapsed/refractory AML. An interim analysis demonstrated an improved CR rate of 53% with AZA/Enasidenib, compared to 12% in the single-agent AZA arm (p = 0.0001) [7]. A Phase III trial of Azacitidine with Ivosidenib for newly diagnosed IDH1 mutated AML patients is also underway (AGILE study, NCT02632708).
The rationale for combining AZA and IDH inhibitors comes from a preclinical model of IDH2-R140Q mutated erythroleukemia cells [8]. RNA-sequencing of cells treated with Enasidenib and Azacitidine showed enrichment of differentiation and cell death gene signatures compared to single drug treated cells. The combination of DNMT and IDH inhibition is hypothesized to lead to a reversal of aberrant epigenetic changes, via two complementary mechanisms. Of note, in our patient, flow-cytometry analysis of bone marrow collected after seven cycles of combination therapy, did not show any remaining leukemic stem cells, as defined by phenotypic markers.
Similarly, other preclinical studies have provided the basis for combining BCL2 and IDH inhibitors. In an RNA interference screen study, IDH mutant AML cells were found to be sensitive to BCL2 inhibition, compared to wild type leukemic cells, due to the accumulation of the oncometabolite, 2-HG [9]. Interestingly, in clinical trials of Venetoclax, the objective response rate appears to be higher in patients with IDH1 or IDH2 mutations, compared to wildtype (33% compared to 10% in IDH-wildtype patients) [10]. There is an upcoming clinical trial investigating the combination of BCL2 and IDH inhibitors (NCT04092179). Taken together, these preclinical studies suggest a rationale for concurrent therapy with HMA/IDH and BCL2 inhibitors. This case is the first report of a patient with relapsed AML achieving clinical benefit with concurrent HMA/IDH/BCL2 inhibition, and merits further investigation in a randomized setting.
Of note, our patient did not experience any differentiation syndrome (DS) after initiation of either Enasidenib or Azacitidine. This phenomenon has been well described in AML patients undergoing therapy with both Enasidenib and Ivosidenib, ranging from within a few days to several months. However, the presence of DS has not been associated with clinical efficacy, contrary to what is observed in Acute Promyelocytic Leukemia (APL) [11]. In fact, studies have demonstrated lower rates of CR in patients with DS, with the reason for this being unclear. Higher peripheral blood blast percentage, fewer lines of previous therapy and an elevated LDH are thought to predict for the risk of DS [11]. In our patient, her initial relapse was soon after induction chemotherapy, and this may have accounted for the lack of DS. However, given the high mortality associated with DS, clinicians are urged to be vigilant, and initiate steroids when suspicion for the same arises.
In conclusion, we present the first report of a patient with refractory AML, ineligible for stem cell transplant, achieving CR with the concurrent three-drug regimen of AZA, Venetoclax and Enasidenib. This novel treatment combination merits further investigation in a clinical trial.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Authors' contribution
SJ, MK, NS and AV drafted the manuscript. JC carried out the molecular studies. KF, YW, IM, NK, AS, LB, MG, KG, IB, US and AS reviewed the manuscript. All authors read and approved the final manuscript. | AZACITIDINE, CYTARABINE, DECITABINE, ENASIDENIB, FILGRASTIM, IDARUBICIN, POSACONAZOLE, VENETOCLAX | DrugsGivenReaction | CC BY | 33397455 | 19,215,442 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Bone marrow failure'. | Case report of combination therapy with Azacytidine, Enasidenib and Venetoclax in primary refractory AML.
Optimal treatment of acute myeloid leukemia (AML) arising in elderly patients remains a challenge. FDA approval of Ivosidenib and Enasidenib, small molecule inhibitors of isocitrate dehydrogenase enzymes (IDH1 and 2) have opened new avenues of treatment. We present a 60-year-old woman with refractory AML, achieving complete response to the combination therapy of hypomethylating agent, Azacytidine with the IDH2 inhibitor, Enasidenib, and BCL2 inhibitor, Venetoclax. To our knowledge, this is the first case report of a patient with IDH2 mutated refractory AML achieving complete response to combination therapy with azacytidine, enasidenib and venetoclax.
Letter to the editor
Acute myeloid leukemia (AML) arising in older patients from pre-existing Myelodysplastic Syndrome (MDS) carries a poor prognosis, with limited response to standard cytotoxic therapy [1]. Novel treatments tailored to each patient’s molecular abnormalities are needed to improve outcomes. Mutations in isocitrate dehydrogenase enzymes, IDH1 (R132) and mitochondrial IDH2 (R140, R172) have been identified and lead to the production of an oncometabolite, 2-hydroxyglutarate (2-HG) [2]. Accumulation of 2-HG in hematopoietic stem cells leads to DNA hypermethylation, changes in gene expression and blocked hematopoietic differentiation [2]. Ivosidenib and Enasidenib, small molecule inhibitors of IDH1 and IDH2 enzymes, respectively, are FDA approved for treatment of adults with relapsed/refractory AML [3, 4]. The initial Phase 1/2 open-label, single arm trial of Enasidenib evaluated its efficacy as a single agent in N = 199 patients with relapsed/refractory AML and demonstrated a complete response (CR) of 23% after a median follow-up of 6.6 months [3]. Trials examining these agents in the frontline and relapsed settings, in combination with chemotherapy, are ongoing. We report here a case of a patient with IDH2 mutated refractory AML achieving complete response with the combination of Enasidenib and hypomethylating agent, Azacytidine (AZA). Subsequent relapse was managed with the addition of Venetoclax to the AZA/Enasidenib combination.
Our patient, a 60 year old female with no significant past medical history, presented with worsening fatigue, fever and sore throat. Labs demonstrated a white blood cell (WBC) count of 1.2 × 109/L with an absolute neutrophil count (ANC) of 144 cells/uL, hemoglobin of 12 g/dL, mean corpuscular value (MCV) of 108 fL, platelet count of 187 × 109/L. Initial bone marrow biopsy revealed a hypercellular marrow for age (60% cellularity) with at least 20% CD34 + , CD117 + myeloblasts, concerning for evolving AML. Patient presented to our clinic for a second opinion. Repeat bone marrow biopsy done at this time showed a hypocellular marrow (10–20% cellularity) with at least 40% CD34 + , CD33 + , CD117 + and myeloperoxidase (MPO) + myeloblasts, consistent with AML. Cytogenetic analysis demonstrated trisomy 8. Molecular profiling using a next generation sequencing (NGS) platform revealed a missense mutation in the IDH2 enzyme (c.515G > A; p.R172K) with a variant allele frequency (VAF) of 7%. Patient was also noted to have co-mutations in DNMT3A (VAF 7%).
Patient received induction chemotherapy with the standard “7 + 3” regimen of Cytarabine 100 mg/m2/dose and Idarubicin 12 mg/m2/dose. Despite receiving anti-fungal prophylaxis, post-induction course was complicated by rhinocerebral mucormycosis requiring several sinonasal debridements and a prolonged hospitalization. In an effort to decrease length of neutropenia and avoid further clinical decline, patient received growth factor support with filgastrim. Due to the severity of the infection and her immunocompromised status, patient was given granulocyte infusions. She required a prolonged course of antifungal therapy with posaconazole which patient continues at this time. Upon clinical improvement, repeat bone marrow biopsy was performed on Day 40 post induction. This revealed refractory disease, with 45% CD33 + , CD34 + , CD117 + , and MPO + myeloblasts.
We discussed the role of a salvage regimen followed by an allogeneic transplant. However, given her recent invasive fungal infection and poor performance status, patient elected not to pursue a stem cell transplant. She was started on salvage therapy with Enasidenib 100 mg daily in continuous 28 day cycles, and Decitabine 20 mg/m2/dose over five days in 28 day cycles. She did not experience any differentiation syndrome with Enasidenib therapy. However, she developed persistent neutropenia with this regimen and was switched to AZA 75 mg/m2/dose over five days in 28 day cycles. Enasidenib was continued at the initial dose. Figure 1 is a longitudinal representation of the changes in patient’s cytopenias with treatment.Fig. 1 Clinical course of primary refractory AML patient with combination therapy with DNMT inhibitors, IDH inhibitors and Venetoclax: The patient was primary refractory after induction chemotherapy. The patient went into a complete remission (CR) after starting Azacytidine and Enasidenib. Venetoclax was added upon relapse and led to trilineage count recovery. Time periods are as follows: a Induction chemotherapy with Idarubicin and Cytarabine; b Salvage with Enasidenib and Decitabine; c Maintenance with Enasidenib and Azacytidine; d Relapse and brief treatment with Venetoclax; e Count Recovery; f Relapse
Bone marrow biopsy performed after seven cycles of Enasidenib and hypomethylating agent therapy showed a hypocellular marrow (10%) with 1.4% CD34 + , CD117 + myeloblasts. Repeat NGS profiling showed a persistent IDH2 R172 clone with a VAF of 10% and a co-mutation in DNMT3A with VAF 12%. Correlative studies with multiparameter flow cytometry revealed less than < 1% phenotypic leukemia stem cells (Lineage-ve, CD34 + , CD38-, CD123 + /CD45RA + /IL1RAP +) demonstrating a deep marrow remission (Fig. 2) [5]. Labs were consistent with complete remission (CR), with a WBC count of 7.3 × 109/L with ANC of 5800 cells/uL, hemoglobin of 10.2, MCV 105 fL and platelets 349 × 109/L.Fig. 2 Leukemic stem cells analysis: Bone marrow cells were used to identify Lineage–ve, CD34 + , CD38 −, CD123 + , CD45RA + . IL1RAP + cells with multiparameter flow cytometry. Very few (< 1%) leukemic stem cells were found in remission samples
Patient remained in CR for nine months. She subsequently was noticed to have increasing peripheral blasts. Bone marrow biopsy showed a hypercellular marrow with 10–20% blasts with a new deletion of chromosome 7q22 and a translocation between chromosomes 4 and 13 involving breakpoints -4q22 and 13p12. Sequencing revealed clonal evolution with increasing allele burden of known IDH2 mutation, with VAF now at 38%, and new mutations in BCOR and RUNX1. She was started on Venetoclax at 50 mg daily for 2 weeks. However, patient developed febrile neutropenia and Venetoclax was held. Upon hematologic recovery, clearance of peripheral blasts was noted. Patient was restarted on Venetoclax, AZA and Enasidenib.
This is the first reported case of a patient with relapsed AML responding to combined therapy with a hypomethylating agent (HMA), IDH2 and BCL2 inhibitors. While the two-drug combinations of HMA/Venetoclax and HMA/Enasidenib are currently under investigation, the three-drug regimen of HMA/Venetoclax with Enasidenib has never been evaluated in a clinical trial. The recently published VIALE-A trial has established the combination of AZA/Venetoclax as a viable treatment option in patients with newly diagnosed AML, with a survival benefit noted in the AZA/Venetoclax arm, compared to control (14.7 months vs. 9.6 months, HR 0.66, CI 0.52 to 0.85, p < 0.001) [6]. The combination of AZA/IDH inhibitor is under investigation in the ongoing Phase II AG221-AML-005 trial in patients with IDH2 mutated relapsed/refractory AML. An interim analysis demonstrated an improved CR rate of 53% with AZA/Enasidenib, compared to 12% in the single-agent AZA arm (p = 0.0001) [7]. A Phase III trial of Azacitidine with Ivosidenib for newly diagnosed IDH1 mutated AML patients is also underway (AGILE study, NCT02632708).
The rationale for combining AZA and IDH inhibitors comes from a preclinical model of IDH2-R140Q mutated erythroleukemia cells [8]. RNA-sequencing of cells treated with Enasidenib and Azacitidine showed enrichment of differentiation and cell death gene signatures compared to single drug treated cells. The combination of DNMT and IDH inhibition is hypothesized to lead to a reversal of aberrant epigenetic changes, via two complementary mechanisms. Of note, in our patient, flow-cytometry analysis of bone marrow collected after seven cycles of combination therapy, did not show any remaining leukemic stem cells, as defined by phenotypic markers.
Similarly, other preclinical studies have provided the basis for combining BCL2 and IDH inhibitors. In an RNA interference screen study, IDH mutant AML cells were found to be sensitive to BCL2 inhibition, compared to wild type leukemic cells, due to the accumulation of the oncometabolite, 2-HG [9]. Interestingly, in clinical trials of Venetoclax, the objective response rate appears to be higher in patients with IDH1 or IDH2 mutations, compared to wildtype (33% compared to 10% in IDH-wildtype patients) [10]. There is an upcoming clinical trial investigating the combination of BCL2 and IDH inhibitors (NCT04092179). Taken together, these preclinical studies suggest a rationale for concurrent therapy with HMA/IDH and BCL2 inhibitors. This case is the first report of a patient with relapsed AML achieving clinical benefit with concurrent HMA/IDH/BCL2 inhibition, and merits further investigation in a randomized setting.
Of note, our patient did not experience any differentiation syndrome (DS) after initiation of either Enasidenib or Azacitidine. This phenomenon has been well described in AML patients undergoing therapy with both Enasidenib and Ivosidenib, ranging from within a few days to several months. However, the presence of DS has not been associated with clinical efficacy, contrary to what is observed in Acute Promyelocytic Leukemia (APL) [11]. In fact, studies have demonstrated lower rates of CR in patients with DS, with the reason for this being unclear. Higher peripheral blood blast percentage, fewer lines of previous therapy and an elevated LDH are thought to predict for the risk of DS [11]. In our patient, her initial relapse was soon after induction chemotherapy, and this may have accounted for the lack of DS. However, given the high mortality associated with DS, clinicians are urged to be vigilant, and initiate steroids when suspicion for the same arises.
In conclusion, we present the first report of a patient with refractory AML, ineligible for stem cell transplant, achieving CR with the concurrent three-drug regimen of AZA, Venetoclax and Enasidenib. This novel treatment combination merits further investigation in a clinical trial.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Authors' contribution
SJ, MK, NS and AV drafted the manuscript. JC carried out the molecular studies. KF, YW, IM, NK, AS, LB, MG, KG, IB, US and AS reviewed the manuscript. All authors read and approved the final manuscript. | AZACITIDINE, CYTARABINE, DECITABINE, ENASIDENIB, FILGRASTIM, IDARUBICIN, POSACONAZOLE, VENETOCLAX | DrugsGivenReaction | CC BY | 33397455 | 19,215,442 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Chromosomal deletion'. | Case report of combination therapy with Azacytidine, Enasidenib and Venetoclax in primary refractory AML.
Optimal treatment of acute myeloid leukemia (AML) arising in elderly patients remains a challenge. FDA approval of Ivosidenib and Enasidenib, small molecule inhibitors of isocitrate dehydrogenase enzymes (IDH1 and 2) have opened new avenues of treatment. We present a 60-year-old woman with refractory AML, achieving complete response to the combination therapy of hypomethylating agent, Azacytidine with the IDH2 inhibitor, Enasidenib, and BCL2 inhibitor, Venetoclax. To our knowledge, this is the first case report of a patient with IDH2 mutated refractory AML achieving complete response to combination therapy with azacytidine, enasidenib and venetoclax.
Letter to the editor
Acute myeloid leukemia (AML) arising in older patients from pre-existing Myelodysplastic Syndrome (MDS) carries a poor prognosis, with limited response to standard cytotoxic therapy [1]. Novel treatments tailored to each patient’s molecular abnormalities are needed to improve outcomes. Mutations in isocitrate dehydrogenase enzymes, IDH1 (R132) and mitochondrial IDH2 (R140, R172) have been identified and lead to the production of an oncometabolite, 2-hydroxyglutarate (2-HG) [2]. Accumulation of 2-HG in hematopoietic stem cells leads to DNA hypermethylation, changes in gene expression and blocked hematopoietic differentiation [2]. Ivosidenib and Enasidenib, small molecule inhibitors of IDH1 and IDH2 enzymes, respectively, are FDA approved for treatment of adults with relapsed/refractory AML [3, 4]. The initial Phase 1/2 open-label, single arm trial of Enasidenib evaluated its efficacy as a single agent in N = 199 patients with relapsed/refractory AML and demonstrated a complete response (CR) of 23% after a median follow-up of 6.6 months [3]. Trials examining these agents in the frontline and relapsed settings, in combination with chemotherapy, are ongoing. We report here a case of a patient with IDH2 mutated refractory AML achieving complete response with the combination of Enasidenib and hypomethylating agent, Azacytidine (AZA). Subsequent relapse was managed with the addition of Venetoclax to the AZA/Enasidenib combination.
Our patient, a 60 year old female with no significant past medical history, presented with worsening fatigue, fever and sore throat. Labs demonstrated a white blood cell (WBC) count of 1.2 × 109/L with an absolute neutrophil count (ANC) of 144 cells/uL, hemoglobin of 12 g/dL, mean corpuscular value (MCV) of 108 fL, platelet count of 187 × 109/L. Initial bone marrow biopsy revealed a hypercellular marrow for age (60% cellularity) with at least 20% CD34 + , CD117 + myeloblasts, concerning for evolving AML. Patient presented to our clinic for a second opinion. Repeat bone marrow biopsy done at this time showed a hypocellular marrow (10–20% cellularity) with at least 40% CD34 + , CD33 + , CD117 + and myeloperoxidase (MPO) + myeloblasts, consistent with AML. Cytogenetic analysis demonstrated trisomy 8. Molecular profiling using a next generation sequencing (NGS) platform revealed a missense mutation in the IDH2 enzyme (c.515G > A; p.R172K) with a variant allele frequency (VAF) of 7%. Patient was also noted to have co-mutations in DNMT3A (VAF 7%).
Patient received induction chemotherapy with the standard “7 + 3” regimen of Cytarabine 100 mg/m2/dose and Idarubicin 12 mg/m2/dose. Despite receiving anti-fungal prophylaxis, post-induction course was complicated by rhinocerebral mucormycosis requiring several sinonasal debridements and a prolonged hospitalization. In an effort to decrease length of neutropenia and avoid further clinical decline, patient received growth factor support with filgastrim. Due to the severity of the infection and her immunocompromised status, patient was given granulocyte infusions. She required a prolonged course of antifungal therapy with posaconazole which patient continues at this time. Upon clinical improvement, repeat bone marrow biopsy was performed on Day 40 post induction. This revealed refractory disease, with 45% CD33 + , CD34 + , CD117 + , and MPO + myeloblasts.
We discussed the role of a salvage regimen followed by an allogeneic transplant. However, given her recent invasive fungal infection and poor performance status, patient elected not to pursue a stem cell transplant. She was started on salvage therapy with Enasidenib 100 mg daily in continuous 28 day cycles, and Decitabine 20 mg/m2/dose over five days in 28 day cycles. She did not experience any differentiation syndrome with Enasidenib therapy. However, she developed persistent neutropenia with this regimen and was switched to AZA 75 mg/m2/dose over five days in 28 day cycles. Enasidenib was continued at the initial dose. Figure 1 is a longitudinal representation of the changes in patient’s cytopenias with treatment.Fig. 1 Clinical course of primary refractory AML patient with combination therapy with DNMT inhibitors, IDH inhibitors and Venetoclax: The patient was primary refractory after induction chemotherapy. The patient went into a complete remission (CR) after starting Azacytidine and Enasidenib. Venetoclax was added upon relapse and led to trilineage count recovery. Time periods are as follows: a Induction chemotherapy with Idarubicin and Cytarabine; b Salvage with Enasidenib and Decitabine; c Maintenance with Enasidenib and Azacytidine; d Relapse and brief treatment with Venetoclax; e Count Recovery; f Relapse
Bone marrow biopsy performed after seven cycles of Enasidenib and hypomethylating agent therapy showed a hypocellular marrow (10%) with 1.4% CD34 + , CD117 + myeloblasts. Repeat NGS profiling showed a persistent IDH2 R172 clone with a VAF of 10% and a co-mutation in DNMT3A with VAF 12%. Correlative studies with multiparameter flow cytometry revealed less than < 1% phenotypic leukemia stem cells (Lineage-ve, CD34 + , CD38-, CD123 + /CD45RA + /IL1RAP +) demonstrating a deep marrow remission (Fig. 2) [5]. Labs were consistent with complete remission (CR), with a WBC count of 7.3 × 109/L with ANC of 5800 cells/uL, hemoglobin of 10.2, MCV 105 fL and platelets 349 × 109/L.Fig. 2 Leukemic stem cells analysis: Bone marrow cells were used to identify Lineage–ve, CD34 + , CD38 −, CD123 + , CD45RA + . IL1RAP + cells with multiparameter flow cytometry. Very few (< 1%) leukemic stem cells were found in remission samples
Patient remained in CR for nine months. She subsequently was noticed to have increasing peripheral blasts. Bone marrow biopsy showed a hypercellular marrow with 10–20% blasts with a new deletion of chromosome 7q22 and a translocation between chromosomes 4 and 13 involving breakpoints -4q22 and 13p12. Sequencing revealed clonal evolution with increasing allele burden of known IDH2 mutation, with VAF now at 38%, and new mutations in BCOR and RUNX1. She was started on Venetoclax at 50 mg daily for 2 weeks. However, patient developed febrile neutropenia and Venetoclax was held. Upon hematologic recovery, clearance of peripheral blasts was noted. Patient was restarted on Venetoclax, AZA and Enasidenib.
This is the first reported case of a patient with relapsed AML responding to combined therapy with a hypomethylating agent (HMA), IDH2 and BCL2 inhibitors. While the two-drug combinations of HMA/Venetoclax and HMA/Enasidenib are currently under investigation, the three-drug regimen of HMA/Venetoclax with Enasidenib has never been evaluated in a clinical trial. The recently published VIALE-A trial has established the combination of AZA/Venetoclax as a viable treatment option in patients with newly diagnosed AML, with a survival benefit noted in the AZA/Venetoclax arm, compared to control (14.7 months vs. 9.6 months, HR 0.66, CI 0.52 to 0.85, p < 0.001) [6]. The combination of AZA/IDH inhibitor is under investigation in the ongoing Phase II AG221-AML-005 trial in patients with IDH2 mutated relapsed/refractory AML. An interim analysis demonstrated an improved CR rate of 53% with AZA/Enasidenib, compared to 12% in the single-agent AZA arm (p = 0.0001) [7]. A Phase III trial of Azacitidine with Ivosidenib for newly diagnosed IDH1 mutated AML patients is also underway (AGILE study, NCT02632708).
The rationale for combining AZA and IDH inhibitors comes from a preclinical model of IDH2-R140Q mutated erythroleukemia cells [8]. RNA-sequencing of cells treated with Enasidenib and Azacitidine showed enrichment of differentiation and cell death gene signatures compared to single drug treated cells. The combination of DNMT and IDH inhibition is hypothesized to lead to a reversal of aberrant epigenetic changes, via two complementary mechanisms. Of note, in our patient, flow-cytometry analysis of bone marrow collected after seven cycles of combination therapy, did not show any remaining leukemic stem cells, as defined by phenotypic markers.
Similarly, other preclinical studies have provided the basis for combining BCL2 and IDH inhibitors. In an RNA interference screen study, IDH mutant AML cells were found to be sensitive to BCL2 inhibition, compared to wild type leukemic cells, due to the accumulation of the oncometabolite, 2-HG [9]. Interestingly, in clinical trials of Venetoclax, the objective response rate appears to be higher in patients with IDH1 or IDH2 mutations, compared to wildtype (33% compared to 10% in IDH-wildtype patients) [10]. There is an upcoming clinical trial investigating the combination of BCL2 and IDH inhibitors (NCT04092179). Taken together, these preclinical studies suggest a rationale for concurrent therapy with HMA/IDH and BCL2 inhibitors. This case is the first report of a patient with relapsed AML achieving clinical benefit with concurrent HMA/IDH/BCL2 inhibition, and merits further investigation in a randomized setting.
Of note, our patient did not experience any differentiation syndrome (DS) after initiation of either Enasidenib or Azacitidine. This phenomenon has been well described in AML patients undergoing therapy with both Enasidenib and Ivosidenib, ranging from within a few days to several months. However, the presence of DS has not been associated with clinical efficacy, contrary to what is observed in Acute Promyelocytic Leukemia (APL) [11]. In fact, studies have demonstrated lower rates of CR in patients with DS, with the reason for this being unclear. Higher peripheral blood blast percentage, fewer lines of previous therapy and an elevated LDH are thought to predict for the risk of DS [11]. In our patient, her initial relapse was soon after induction chemotherapy, and this may have accounted for the lack of DS. However, given the high mortality associated with DS, clinicians are urged to be vigilant, and initiate steroids when suspicion for the same arises.
In conclusion, we present the first report of a patient with refractory AML, ineligible for stem cell transplant, achieving CR with the concurrent three-drug regimen of AZA, Venetoclax and Enasidenib. This novel treatment combination merits further investigation in a clinical trial.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Authors' contribution
SJ, MK, NS and AV drafted the manuscript. JC carried out the molecular studies. KF, YW, IM, NK, AS, LB, MG, KG, IB, US and AS reviewed the manuscript. All authors read and approved the final manuscript. | AZACITIDINE, CYTARABINE, DECITABINE, ENASIDENIB, FILGRASTIM, IDARUBICIN, POSACONAZOLE, VENETOCLAX | DrugsGivenReaction | CC BY | 33397455 | 19,215,442 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Febrile neutropenia'. | Case report of combination therapy with Azacytidine, Enasidenib and Venetoclax in primary refractory AML.
Optimal treatment of acute myeloid leukemia (AML) arising in elderly patients remains a challenge. FDA approval of Ivosidenib and Enasidenib, small molecule inhibitors of isocitrate dehydrogenase enzymes (IDH1 and 2) have opened new avenues of treatment. We present a 60-year-old woman with refractory AML, achieving complete response to the combination therapy of hypomethylating agent, Azacytidine with the IDH2 inhibitor, Enasidenib, and BCL2 inhibitor, Venetoclax. To our knowledge, this is the first case report of a patient with IDH2 mutated refractory AML achieving complete response to combination therapy with azacytidine, enasidenib and venetoclax.
Letter to the editor
Acute myeloid leukemia (AML) arising in older patients from pre-existing Myelodysplastic Syndrome (MDS) carries a poor prognosis, with limited response to standard cytotoxic therapy [1]. Novel treatments tailored to each patient’s molecular abnormalities are needed to improve outcomes. Mutations in isocitrate dehydrogenase enzymes, IDH1 (R132) and mitochondrial IDH2 (R140, R172) have been identified and lead to the production of an oncometabolite, 2-hydroxyglutarate (2-HG) [2]. Accumulation of 2-HG in hematopoietic stem cells leads to DNA hypermethylation, changes in gene expression and blocked hematopoietic differentiation [2]. Ivosidenib and Enasidenib, small molecule inhibitors of IDH1 and IDH2 enzymes, respectively, are FDA approved for treatment of adults with relapsed/refractory AML [3, 4]. The initial Phase 1/2 open-label, single arm trial of Enasidenib evaluated its efficacy as a single agent in N = 199 patients with relapsed/refractory AML and demonstrated a complete response (CR) of 23% after a median follow-up of 6.6 months [3]. Trials examining these agents in the frontline and relapsed settings, in combination with chemotherapy, are ongoing. We report here a case of a patient with IDH2 mutated refractory AML achieving complete response with the combination of Enasidenib and hypomethylating agent, Azacytidine (AZA). Subsequent relapse was managed with the addition of Venetoclax to the AZA/Enasidenib combination.
Our patient, a 60 year old female with no significant past medical history, presented with worsening fatigue, fever and sore throat. Labs demonstrated a white blood cell (WBC) count of 1.2 × 109/L with an absolute neutrophil count (ANC) of 144 cells/uL, hemoglobin of 12 g/dL, mean corpuscular value (MCV) of 108 fL, platelet count of 187 × 109/L. Initial bone marrow biopsy revealed a hypercellular marrow for age (60% cellularity) with at least 20% CD34 + , CD117 + myeloblasts, concerning for evolving AML. Patient presented to our clinic for a second opinion. Repeat bone marrow biopsy done at this time showed a hypocellular marrow (10–20% cellularity) with at least 40% CD34 + , CD33 + , CD117 + and myeloperoxidase (MPO) + myeloblasts, consistent with AML. Cytogenetic analysis demonstrated trisomy 8. Molecular profiling using a next generation sequencing (NGS) platform revealed a missense mutation in the IDH2 enzyme (c.515G > A; p.R172K) with a variant allele frequency (VAF) of 7%. Patient was also noted to have co-mutations in DNMT3A (VAF 7%).
Patient received induction chemotherapy with the standard “7 + 3” regimen of Cytarabine 100 mg/m2/dose and Idarubicin 12 mg/m2/dose. Despite receiving anti-fungal prophylaxis, post-induction course was complicated by rhinocerebral mucormycosis requiring several sinonasal debridements and a prolonged hospitalization. In an effort to decrease length of neutropenia and avoid further clinical decline, patient received growth factor support with filgastrim. Due to the severity of the infection and her immunocompromised status, patient was given granulocyte infusions. She required a prolonged course of antifungal therapy with posaconazole which patient continues at this time. Upon clinical improvement, repeat bone marrow biopsy was performed on Day 40 post induction. This revealed refractory disease, with 45% CD33 + , CD34 + , CD117 + , and MPO + myeloblasts.
We discussed the role of a salvage regimen followed by an allogeneic transplant. However, given her recent invasive fungal infection and poor performance status, patient elected not to pursue a stem cell transplant. She was started on salvage therapy with Enasidenib 100 mg daily in continuous 28 day cycles, and Decitabine 20 mg/m2/dose over five days in 28 day cycles. She did not experience any differentiation syndrome with Enasidenib therapy. However, she developed persistent neutropenia with this regimen and was switched to AZA 75 mg/m2/dose over five days in 28 day cycles. Enasidenib was continued at the initial dose. Figure 1 is a longitudinal representation of the changes in patient’s cytopenias with treatment.Fig. 1 Clinical course of primary refractory AML patient with combination therapy with DNMT inhibitors, IDH inhibitors and Venetoclax: The patient was primary refractory after induction chemotherapy. The patient went into a complete remission (CR) after starting Azacytidine and Enasidenib. Venetoclax was added upon relapse and led to trilineage count recovery. Time periods are as follows: a Induction chemotherapy with Idarubicin and Cytarabine; b Salvage with Enasidenib and Decitabine; c Maintenance with Enasidenib and Azacytidine; d Relapse and brief treatment with Venetoclax; e Count Recovery; f Relapse
Bone marrow biopsy performed after seven cycles of Enasidenib and hypomethylating agent therapy showed a hypocellular marrow (10%) with 1.4% CD34 + , CD117 + myeloblasts. Repeat NGS profiling showed a persistent IDH2 R172 clone with a VAF of 10% and a co-mutation in DNMT3A with VAF 12%. Correlative studies with multiparameter flow cytometry revealed less than < 1% phenotypic leukemia stem cells (Lineage-ve, CD34 + , CD38-, CD123 + /CD45RA + /IL1RAP +) demonstrating a deep marrow remission (Fig. 2) [5]. Labs were consistent with complete remission (CR), with a WBC count of 7.3 × 109/L with ANC of 5800 cells/uL, hemoglobin of 10.2, MCV 105 fL and platelets 349 × 109/L.Fig. 2 Leukemic stem cells analysis: Bone marrow cells were used to identify Lineage–ve, CD34 + , CD38 −, CD123 + , CD45RA + . IL1RAP + cells with multiparameter flow cytometry. Very few (< 1%) leukemic stem cells were found in remission samples
Patient remained in CR for nine months. She subsequently was noticed to have increasing peripheral blasts. Bone marrow biopsy showed a hypercellular marrow with 10–20% blasts with a new deletion of chromosome 7q22 and a translocation between chromosomes 4 and 13 involving breakpoints -4q22 and 13p12. Sequencing revealed clonal evolution with increasing allele burden of known IDH2 mutation, with VAF now at 38%, and new mutations in BCOR and RUNX1. She was started on Venetoclax at 50 mg daily for 2 weeks. However, patient developed febrile neutropenia and Venetoclax was held. Upon hematologic recovery, clearance of peripheral blasts was noted. Patient was restarted on Venetoclax, AZA and Enasidenib.
This is the first reported case of a patient with relapsed AML responding to combined therapy with a hypomethylating agent (HMA), IDH2 and BCL2 inhibitors. While the two-drug combinations of HMA/Venetoclax and HMA/Enasidenib are currently under investigation, the three-drug regimen of HMA/Venetoclax with Enasidenib has never been evaluated in a clinical trial. The recently published VIALE-A trial has established the combination of AZA/Venetoclax as a viable treatment option in patients with newly diagnosed AML, with a survival benefit noted in the AZA/Venetoclax arm, compared to control (14.7 months vs. 9.6 months, HR 0.66, CI 0.52 to 0.85, p < 0.001) [6]. The combination of AZA/IDH inhibitor is under investigation in the ongoing Phase II AG221-AML-005 trial in patients with IDH2 mutated relapsed/refractory AML. An interim analysis demonstrated an improved CR rate of 53% with AZA/Enasidenib, compared to 12% in the single-agent AZA arm (p = 0.0001) [7]. A Phase III trial of Azacitidine with Ivosidenib for newly diagnosed IDH1 mutated AML patients is also underway (AGILE study, NCT02632708).
The rationale for combining AZA and IDH inhibitors comes from a preclinical model of IDH2-R140Q mutated erythroleukemia cells [8]. RNA-sequencing of cells treated with Enasidenib and Azacitidine showed enrichment of differentiation and cell death gene signatures compared to single drug treated cells. The combination of DNMT and IDH inhibition is hypothesized to lead to a reversal of aberrant epigenetic changes, via two complementary mechanisms. Of note, in our patient, flow-cytometry analysis of bone marrow collected after seven cycles of combination therapy, did not show any remaining leukemic stem cells, as defined by phenotypic markers.
Similarly, other preclinical studies have provided the basis for combining BCL2 and IDH inhibitors. In an RNA interference screen study, IDH mutant AML cells were found to be sensitive to BCL2 inhibition, compared to wild type leukemic cells, due to the accumulation of the oncometabolite, 2-HG [9]. Interestingly, in clinical trials of Venetoclax, the objective response rate appears to be higher in patients with IDH1 or IDH2 mutations, compared to wildtype (33% compared to 10% in IDH-wildtype patients) [10]. There is an upcoming clinical trial investigating the combination of BCL2 and IDH inhibitors (NCT04092179). Taken together, these preclinical studies suggest a rationale for concurrent therapy with HMA/IDH and BCL2 inhibitors. This case is the first report of a patient with relapsed AML achieving clinical benefit with concurrent HMA/IDH/BCL2 inhibition, and merits further investigation in a randomized setting.
Of note, our patient did not experience any differentiation syndrome (DS) after initiation of either Enasidenib or Azacitidine. This phenomenon has been well described in AML patients undergoing therapy with both Enasidenib and Ivosidenib, ranging from within a few days to several months. However, the presence of DS has not been associated with clinical efficacy, contrary to what is observed in Acute Promyelocytic Leukemia (APL) [11]. In fact, studies have demonstrated lower rates of CR in patients with DS, with the reason for this being unclear. Higher peripheral blood blast percentage, fewer lines of previous therapy and an elevated LDH are thought to predict for the risk of DS [11]. In our patient, her initial relapse was soon after induction chemotherapy, and this may have accounted for the lack of DS. However, given the high mortality associated with DS, clinicians are urged to be vigilant, and initiate steroids when suspicion for the same arises.
In conclusion, we present the first report of a patient with refractory AML, ineligible for stem cell transplant, achieving CR with the concurrent three-drug regimen of AZA, Venetoclax and Enasidenib. This novel treatment combination merits further investigation in a clinical trial.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Authors' contribution
SJ, MK, NS and AV drafted the manuscript. JC carried out the molecular studies. KF, YW, IM, NK, AS, LB, MG, KG, IB, US and AS reviewed the manuscript. All authors read and approved the final manuscript. | AZACITIDINE, CYTARABINE, DECITABINE, ENASIDENIB, FILGRASTIM, IDARUBICIN, POSACONAZOLE, VENETOCLAX | DrugsGivenReaction | CC BY | 33397455 | 19,215,442 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Neutropenia'. | Case report of combination therapy with Azacytidine, Enasidenib and Venetoclax in primary refractory AML.
Optimal treatment of acute myeloid leukemia (AML) arising in elderly patients remains a challenge. FDA approval of Ivosidenib and Enasidenib, small molecule inhibitors of isocitrate dehydrogenase enzymes (IDH1 and 2) have opened new avenues of treatment. We present a 60-year-old woman with refractory AML, achieving complete response to the combination therapy of hypomethylating agent, Azacytidine with the IDH2 inhibitor, Enasidenib, and BCL2 inhibitor, Venetoclax. To our knowledge, this is the first case report of a patient with IDH2 mutated refractory AML achieving complete response to combination therapy with azacytidine, enasidenib and venetoclax.
Letter to the editor
Acute myeloid leukemia (AML) arising in older patients from pre-existing Myelodysplastic Syndrome (MDS) carries a poor prognosis, with limited response to standard cytotoxic therapy [1]. Novel treatments tailored to each patient’s molecular abnormalities are needed to improve outcomes. Mutations in isocitrate dehydrogenase enzymes, IDH1 (R132) and mitochondrial IDH2 (R140, R172) have been identified and lead to the production of an oncometabolite, 2-hydroxyglutarate (2-HG) [2]. Accumulation of 2-HG in hematopoietic stem cells leads to DNA hypermethylation, changes in gene expression and blocked hematopoietic differentiation [2]. Ivosidenib and Enasidenib, small molecule inhibitors of IDH1 and IDH2 enzymes, respectively, are FDA approved for treatment of adults with relapsed/refractory AML [3, 4]. The initial Phase 1/2 open-label, single arm trial of Enasidenib evaluated its efficacy as a single agent in N = 199 patients with relapsed/refractory AML and demonstrated a complete response (CR) of 23% after a median follow-up of 6.6 months [3]. Trials examining these agents in the frontline and relapsed settings, in combination with chemotherapy, are ongoing. We report here a case of a patient with IDH2 mutated refractory AML achieving complete response with the combination of Enasidenib and hypomethylating agent, Azacytidine (AZA). Subsequent relapse was managed with the addition of Venetoclax to the AZA/Enasidenib combination.
Our patient, a 60 year old female with no significant past medical history, presented with worsening fatigue, fever and sore throat. Labs demonstrated a white blood cell (WBC) count of 1.2 × 109/L with an absolute neutrophil count (ANC) of 144 cells/uL, hemoglobin of 12 g/dL, mean corpuscular value (MCV) of 108 fL, platelet count of 187 × 109/L. Initial bone marrow biopsy revealed a hypercellular marrow for age (60% cellularity) with at least 20% CD34 + , CD117 + myeloblasts, concerning for evolving AML. Patient presented to our clinic for a second opinion. Repeat bone marrow biopsy done at this time showed a hypocellular marrow (10–20% cellularity) with at least 40% CD34 + , CD33 + , CD117 + and myeloperoxidase (MPO) + myeloblasts, consistent with AML. Cytogenetic analysis demonstrated trisomy 8. Molecular profiling using a next generation sequencing (NGS) platform revealed a missense mutation in the IDH2 enzyme (c.515G > A; p.R172K) with a variant allele frequency (VAF) of 7%. Patient was also noted to have co-mutations in DNMT3A (VAF 7%).
Patient received induction chemotherapy with the standard “7 + 3” regimen of Cytarabine 100 mg/m2/dose and Idarubicin 12 mg/m2/dose. Despite receiving anti-fungal prophylaxis, post-induction course was complicated by rhinocerebral mucormycosis requiring several sinonasal debridements and a prolonged hospitalization. In an effort to decrease length of neutropenia and avoid further clinical decline, patient received growth factor support with filgastrim. Due to the severity of the infection and her immunocompromised status, patient was given granulocyte infusions. She required a prolonged course of antifungal therapy with posaconazole which patient continues at this time. Upon clinical improvement, repeat bone marrow biopsy was performed on Day 40 post induction. This revealed refractory disease, with 45% CD33 + , CD34 + , CD117 + , and MPO + myeloblasts.
We discussed the role of a salvage regimen followed by an allogeneic transplant. However, given her recent invasive fungal infection and poor performance status, patient elected not to pursue a stem cell transplant. She was started on salvage therapy with Enasidenib 100 mg daily in continuous 28 day cycles, and Decitabine 20 mg/m2/dose over five days in 28 day cycles. She did not experience any differentiation syndrome with Enasidenib therapy. However, she developed persistent neutropenia with this regimen and was switched to AZA 75 mg/m2/dose over five days in 28 day cycles. Enasidenib was continued at the initial dose. Figure 1 is a longitudinal representation of the changes in patient’s cytopenias with treatment.Fig. 1 Clinical course of primary refractory AML patient with combination therapy with DNMT inhibitors, IDH inhibitors and Venetoclax: The patient was primary refractory after induction chemotherapy. The patient went into a complete remission (CR) after starting Azacytidine and Enasidenib. Venetoclax was added upon relapse and led to trilineage count recovery. Time periods are as follows: a Induction chemotherapy with Idarubicin and Cytarabine; b Salvage with Enasidenib and Decitabine; c Maintenance with Enasidenib and Azacytidine; d Relapse and brief treatment with Venetoclax; e Count Recovery; f Relapse
Bone marrow biopsy performed after seven cycles of Enasidenib and hypomethylating agent therapy showed a hypocellular marrow (10%) with 1.4% CD34 + , CD117 + myeloblasts. Repeat NGS profiling showed a persistent IDH2 R172 clone with a VAF of 10% and a co-mutation in DNMT3A with VAF 12%. Correlative studies with multiparameter flow cytometry revealed less than < 1% phenotypic leukemia stem cells (Lineage-ve, CD34 + , CD38-, CD123 + /CD45RA + /IL1RAP +) demonstrating a deep marrow remission (Fig. 2) [5]. Labs were consistent with complete remission (CR), with a WBC count of 7.3 × 109/L with ANC of 5800 cells/uL, hemoglobin of 10.2, MCV 105 fL and platelets 349 × 109/L.Fig. 2 Leukemic stem cells analysis: Bone marrow cells were used to identify Lineage–ve, CD34 + , CD38 −, CD123 + , CD45RA + . IL1RAP + cells with multiparameter flow cytometry. Very few (< 1%) leukemic stem cells were found in remission samples
Patient remained in CR for nine months. She subsequently was noticed to have increasing peripheral blasts. Bone marrow biopsy showed a hypercellular marrow with 10–20% blasts with a new deletion of chromosome 7q22 and a translocation between chromosomes 4 and 13 involving breakpoints -4q22 and 13p12. Sequencing revealed clonal evolution with increasing allele burden of known IDH2 mutation, with VAF now at 38%, and new mutations in BCOR and RUNX1. She was started on Venetoclax at 50 mg daily for 2 weeks. However, patient developed febrile neutropenia and Venetoclax was held. Upon hematologic recovery, clearance of peripheral blasts was noted. Patient was restarted on Venetoclax, AZA and Enasidenib.
This is the first reported case of a patient with relapsed AML responding to combined therapy with a hypomethylating agent (HMA), IDH2 and BCL2 inhibitors. While the two-drug combinations of HMA/Venetoclax and HMA/Enasidenib are currently under investigation, the three-drug regimen of HMA/Venetoclax with Enasidenib has never been evaluated in a clinical trial. The recently published VIALE-A trial has established the combination of AZA/Venetoclax as a viable treatment option in patients with newly diagnosed AML, with a survival benefit noted in the AZA/Venetoclax arm, compared to control (14.7 months vs. 9.6 months, HR 0.66, CI 0.52 to 0.85, p < 0.001) [6]. The combination of AZA/IDH inhibitor is under investigation in the ongoing Phase II AG221-AML-005 trial in patients with IDH2 mutated relapsed/refractory AML. An interim analysis demonstrated an improved CR rate of 53% with AZA/Enasidenib, compared to 12% in the single-agent AZA arm (p = 0.0001) [7]. A Phase III trial of Azacitidine with Ivosidenib for newly diagnosed IDH1 mutated AML patients is also underway (AGILE study, NCT02632708).
The rationale for combining AZA and IDH inhibitors comes from a preclinical model of IDH2-R140Q mutated erythroleukemia cells [8]. RNA-sequencing of cells treated with Enasidenib and Azacitidine showed enrichment of differentiation and cell death gene signatures compared to single drug treated cells. The combination of DNMT and IDH inhibition is hypothesized to lead to a reversal of aberrant epigenetic changes, via two complementary mechanisms. Of note, in our patient, flow-cytometry analysis of bone marrow collected after seven cycles of combination therapy, did not show any remaining leukemic stem cells, as defined by phenotypic markers.
Similarly, other preclinical studies have provided the basis for combining BCL2 and IDH inhibitors. In an RNA interference screen study, IDH mutant AML cells were found to be sensitive to BCL2 inhibition, compared to wild type leukemic cells, due to the accumulation of the oncometabolite, 2-HG [9]. Interestingly, in clinical trials of Venetoclax, the objective response rate appears to be higher in patients with IDH1 or IDH2 mutations, compared to wildtype (33% compared to 10% in IDH-wildtype patients) [10]. There is an upcoming clinical trial investigating the combination of BCL2 and IDH inhibitors (NCT04092179). Taken together, these preclinical studies suggest a rationale for concurrent therapy with HMA/IDH and BCL2 inhibitors. This case is the first report of a patient with relapsed AML achieving clinical benefit with concurrent HMA/IDH/BCL2 inhibition, and merits further investigation in a randomized setting.
Of note, our patient did not experience any differentiation syndrome (DS) after initiation of either Enasidenib or Azacitidine. This phenomenon has been well described in AML patients undergoing therapy with both Enasidenib and Ivosidenib, ranging from within a few days to several months. However, the presence of DS has not been associated with clinical efficacy, contrary to what is observed in Acute Promyelocytic Leukemia (APL) [11]. In fact, studies have demonstrated lower rates of CR in patients with DS, with the reason for this being unclear. Higher peripheral blood blast percentage, fewer lines of previous therapy and an elevated LDH are thought to predict for the risk of DS [11]. In our patient, her initial relapse was soon after induction chemotherapy, and this may have accounted for the lack of DS. However, given the high mortality associated with DS, clinicians are urged to be vigilant, and initiate steroids when suspicion for the same arises.
In conclusion, we present the first report of a patient with refractory AML, ineligible for stem cell transplant, achieving CR with the concurrent three-drug regimen of AZA, Venetoclax and Enasidenib. This novel treatment combination merits further investigation in a clinical trial.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Authors' contribution
SJ, MK, NS and AV drafted the manuscript. JC carried out the molecular studies. KF, YW, IM, NK, AS, LB, MG, KG, IB, US and AS reviewed the manuscript. All authors read and approved the final manuscript. | AZACITIDINE, CYTARABINE, DECITABINE, ENASIDENIB, FILGRASTIM, IDARUBICIN, POSACONAZOLE, VENETOCLAX | DrugsGivenReaction | CC BY | 33397455 | 19,215,442 | 2021-01-04 |
What was the dosage of drug 'CYTARABINE'? | Case report of combination therapy with Azacytidine, Enasidenib and Venetoclax in primary refractory AML.
Optimal treatment of acute myeloid leukemia (AML) arising in elderly patients remains a challenge. FDA approval of Ivosidenib and Enasidenib, small molecule inhibitors of isocitrate dehydrogenase enzymes (IDH1 and 2) have opened new avenues of treatment. We present a 60-year-old woman with refractory AML, achieving complete response to the combination therapy of hypomethylating agent, Azacytidine with the IDH2 inhibitor, Enasidenib, and BCL2 inhibitor, Venetoclax. To our knowledge, this is the first case report of a patient with IDH2 mutated refractory AML achieving complete response to combination therapy with azacytidine, enasidenib and venetoclax.
Letter to the editor
Acute myeloid leukemia (AML) arising in older patients from pre-existing Myelodysplastic Syndrome (MDS) carries a poor prognosis, with limited response to standard cytotoxic therapy [1]. Novel treatments tailored to each patient’s molecular abnormalities are needed to improve outcomes. Mutations in isocitrate dehydrogenase enzymes, IDH1 (R132) and mitochondrial IDH2 (R140, R172) have been identified and lead to the production of an oncometabolite, 2-hydroxyglutarate (2-HG) [2]. Accumulation of 2-HG in hematopoietic stem cells leads to DNA hypermethylation, changes in gene expression and blocked hematopoietic differentiation [2]. Ivosidenib and Enasidenib, small molecule inhibitors of IDH1 and IDH2 enzymes, respectively, are FDA approved for treatment of adults with relapsed/refractory AML [3, 4]. The initial Phase 1/2 open-label, single arm trial of Enasidenib evaluated its efficacy as a single agent in N = 199 patients with relapsed/refractory AML and demonstrated a complete response (CR) of 23% after a median follow-up of 6.6 months [3]. Trials examining these agents in the frontline and relapsed settings, in combination with chemotherapy, are ongoing. We report here a case of a patient with IDH2 mutated refractory AML achieving complete response with the combination of Enasidenib and hypomethylating agent, Azacytidine (AZA). Subsequent relapse was managed with the addition of Venetoclax to the AZA/Enasidenib combination.
Our patient, a 60 year old female with no significant past medical history, presented with worsening fatigue, fever and sore throat. Labs demonstrated a white blood cell (WBC) count of 1.2 × 109/L with an absolute neutrophil count (ANC) of 144 cells/uL, hemoglobin of 12 g/dL, mean corpuscular value (MCV) of 108 fL, platelet count of 187 × 109/L. Initial bone marrow biopsy revealed a hypercellular marrow for age (60% cellularity) with at least 20% CD34 + , CD117 + myeloblasts, concerning for evolving AML. Patient presented to our clinic for a second opinion. Repeat bone marrow biopsy done at this time showed a hypocellular marrow (10–20% cellularity) with at least 40% CD34 + , CD33 + , CD117 + and myeloperoxidase (MPO) + myeloblasts, consistent with AML. Cytogenetic analysis demonstrated trisomy 8. Molecular profiling using a next generation sequencing (NGS) platform revealed a missense mutation in the IDH2 enzyme (c.515G > A; p.R172K) with a variant allele frequency (VAF) of 7%. Patient was also noted to have co-mutations in DNMT3A (VAF 7%).
Patient received induction chemotherapy with the standard “7 + 3” regimen of Cytarabine 100 mg/m2/dose and Idarubicin 12 mg/m2/dose. Despite receiving anti-fungal prophylaxis, post-induction course was complicated by rhinocerebral mucormycosis requiring several sinonasal debridements and a prolonged hospitalization. In an effort to decrease length of neutropenia and avoid further clinical decline, patient received growth factor support with filgastrim. Due to the severity of the infection and her immunocompromised status, patient was given granulocyte infusions. She required a prolonged course of antifungal therapy with posaconazole which patient continues at this time. Upon clinical improvement, repeat bone marrow biopsy was performed on Day 40 post induction. This revealed refractory disease, with 45% CD33 + , CD34 + , CD117 + , and MPO + myeloblasts.
We discussed the role of a salvage regimen followed by an allogeneic transplant. However, given her recent invasive fungal infection and poor performance status, patient elected not to pursue a stem cell transplant. She was started on salvage therapy with Enasidenib 100 mg daily in continuous 28 day cycles, and Decitabine 20 mg/m2/dose over five days in 28 day cycles. She did not experience any differentiation syndrome with Enasidenib therapy. However, she developed persistent neutropenia with this regimen and was switched to AZA 75 mg/m2/dose over five days in 28 day cycles. Enasidenib was continued at the initial dose. Figure 1 is a longitudinal representation of the changes in patient’s cytopenias with treatment.Fig. 1 Clinical course of primary refractory AML patient with combination therapy with DNMT inhibitors, IDH inhibitors and Venetoclax: The patient was primary refractory after induction chemotherapy. The patient went into a complete remission (CR) after starting Azacytidine and Enasidenib. Venetoclax was added upon relapse and led to trilineage count recovery. Time periods are as follows: a Induction chemotherapy with Idarubicin and Cytarabine; b Salvage with Enasidenib and Decitabine; c Maintenance with Enasidenib and Azacytidine; d Relapse and brief treatment with Venetoclax; e Count Recovery; f Relapse
Bone marrow biopsy performed after seven cycles of Enasidenib and hypomethylating agent therapy showed a hypocellular marrow (10%) with 1.4% CD34 + , CD117 + myeloblasts. Repeat NGS profiling showed a persistent IDH2 R172 clone with a VAF of 10% and a co-mutation in DNMT3A with VAF 12%. Correlative studies with multiparameter flow cytometry revealed less than < 1% phenotypic leukemia stem cells (Lineage-ve, CD34 + , CD38-, CD123 + /CD45RA + /IL1RAP +) demonstrating a deep marrow remission (Fig. 2) [5]. Labs were consistent with complete remission (CR), with a WBC count of 7.3 × 109/L with ANC of 5800 cells/uL, hemoglobin of 10.2, MCV 105 fL and platelets 349 × 109/L.Fig. 2 Leukemic stem cells analysis: Bone marrow cells were used to identify Lineage–ve, CD34 + , CD38 −, CD123 + , CD45RA + . IL1RAP + cells with multiparameter flow cytometry. Very few (< 1%) leukemic stem cells were found in remission samples
Patient remained in CR for nine months. She subsequently was noticed to have increasing peripheral blasts. Bone marrow biopsy showed a hypercellular marrow with 10–20% blasts with a new deletion of chromosome 7q22 and a translocation between chromosomes 4 and 13 involving breakpoints -4q22 and 13p12. Sequencing revealed clonal evolution with increasing allele burden of known IDH2 mutation, with VAF now at 38%, and new mutations in BCOR and RUNX1. She was started on Venetoclax at 50 mg daily for 2 weeks. However, patient developed febrile neutropenia and Venetoclax was held. Upon hematologic recovery, clearance of peripheral blasts was noted. Patient was restarted on Venetoclax, AZA and Enasidenib.
This is the first reported case of a patient with relapsed AML responding to combined therapy with a hypomethylating agent (HMA), IDH2 and BCL2 inhibitors. While the two-drug combinations of HMA/Venetoclax and HMA/Enasidenib are currently under investigation, the three-drug regimen of HMA/Venetoclax with Enasidenib has never been evaluated in a clinical trial. The recently published VIALE-A trial has established the combination of AZA/Venetoclax as a viable treatment option in patients with newly diagnosed AML, with a survival benefit noted in the AZA/Venetoclax arm, compared to control (14.7 months vs. 9.6 months, HR 0.66, CI 0.52 to 0.85, p < 0.001) [6]. The combination of AZA/IDH inhibitor is under investigation in the ongoing Phase II AG221-AML-005 trial in patients with IDH2 mutated relapsed/refractory AML. An interim analysis demonstrated an improved CR rate of 53% with AZA/Enasidenib, compared to 12% in the single-agent AZA arm (p = 0.0001) [7]. A Phase III trial of Azacitidine with Ivosidenib for newly diagnosed IDH1 mutated AML patients is also underway (AGILE study, NCT02632708).
The rationale for combining AZA and IDH inhibitors comes from a preclinical model of IDH2-R140Q mutated erythroleukemia cells [8]. RNA-sequencing of cells treated with Enasidenib and Azacitidine showed enrichment of differentiation and cell death gene signatures compared to single drug treated cells. The combination of DNMT and IDH inhibition is hypothesized to lead to a reversal of aberrant epigenetic changes, via two complementary mechanisms. Of note, in our patient, flow-cytometry analysis of bone marrow collected after seven cycles of combination therapy, did not show any remaining leukemic stem cells, as defined by phenotypic markers.
Similarly, other preclinical studies have provided the basis for combining BCL2 and IDH inhibitors. In an RNA interference screen study, IDH mutant AML cells were found to be sensitive to BCL2 inhibition, compared to wild type leukemic cells, due to the accumulation of the oncometabolite, 2-HG [9]. Interestingly, in clinical trials of Venetoclax, the objective response rate appears to be higher in patients with IDH1 or IDH2 mutations, compared to wildtype (33% compared to 10% in IDH-wildtype patients) [10]. There is an upcoming clinical trial investigating the combination of BCL2 and IDH inhibitors (NCT04092179). Taken together, these preclinical studies suggest a rationale for concurrent therapy with HMA/IDH and BCL2 inhibitors. This case is the first report of a patient with relapsed AML achieving clinical benefit with concurrent HMA/IDH/BCL2 inhibition, and merits further investigation in a randomized setting.
Of note, our patient did not experience any differentiation syndrome (DS) after initiation of either Enasidenib or Azacitidine. This phenomenon has been well described in AML patients undergoing therapy with both Enasidenib and Ivosidenib, ranging from within a few days to several months. However, the presence of DS has not been associated with clinical efficacy, contrary to what is observed in Acute Promyelocytic Leukemia (APL) [11]. In fact, studies have demonstrated lower rates of CR in patients with DS, with the reason for this being unclear. Higher peripheral blood blast percentage, fewer lines of previous therapy and an elevated LDH are thought to predict for the risk of DS [11]. In our patient, her initial relapse was soon after induction chemotherapy, and this may have accounted for the lack of DS. However, given the high mortality associated with DS, clinicians are urged to be vigilant, and initiate steroids when suspicion for the same arises.
In conclusion, we present the first report of a patient with refractory AML, ineligible for stem cell transplant, achieving CR with the concurrent three-drug regimen of AZA, Venetoclax and Enasidenib. This novel treatment combination merits further investigation in a clinical trial.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Authors' contribution
SJ, MK, NS and AV drafted the manuscript. JC carried out the molecular studies. KF, YW, IM, NK, AS, LB, MG, KG, IB, US and AS reviewed the manuscript. All authors read and approved the final manuscript. | 100 MILLIGRAM/SQ. METER PER DOSE | DrugDosageText | CC BY | 33397455 | 19,215,442 | 2021-01-04 |
What was the dosage of drug 'DECITABINE'? | Case report of combination therapy with Azacytidine, Enasidenib and Venetoclax in primary refractory AML.
Optimal treatment of acute myeloid leukemia (AML) arising in elderly patients remains a challenge. FDA approval of Ivosidenib and Enasidenib, small molecule inhibitors of isocitrate dehydrogenase enzymes (IDH1 and 2) have opened new avenues of treatment. We present a 60-year-old woman with refractory AML, achieving complete response to the combination therapy of hypomethylating agent, Azacytidine with the IDH2 inhibitor, Enasidenib, and BCL2 inhibitor, Venetoclax. To our knowledge, this is the first case report of a patient with IDH2 mutated refractory AML achieving complete response to combination therapy with azacytidine, enasidenib and venetoclax.
Letter to the editor
Acute myeloid leukemia (AML) arising in older patients from pre-existing Myelodysplastic Syndrome (MDS) carries a poor prognosis, with limited response to standard cytotoxic therapy [1]. Novel treatments tailored to each patient’s molecular abnormalities are needed to improve outcomes. Mutations in isocitrate dehydrogenase enzymes, IDH1 (R132) and mitochondrial IDH2 (R140, R172) have been identified and lead to the production of an oncometabolite, 2-hydroxyglutarate (2-HG) [2]. Accumulation of 2-HG in hematopoietic stem cells leads to DNA hypermethylation, changes in gene expression and blocked hematopoietic differentiation [2]. Ivosidenib and Enasidenib, small molecule inhibitors of IDH1 and IDH2 enzymes, respectively, are FDA approved for treatment of adults with relapsed/refractory AML [3, 4]. The initial Phase 1/2 open-label, single arm trial of Enasidenib evaluated its efficacy as a single agent in N = 199 patients with relapsed/refractory AML and demonstrated a complete response (CR) of 23% after a median follow-up of 6.6 months [3]. Trials examining these agents in the frontline and relapsed settings, in combination with chemotherapy, are ongoing. We report here a case of a patient with IDH2 mutated refractory AML achieving complete response with the combination of Enasidenib and hypomethylating agent, Azacytidine (AZA). Subsequent relapse was managed with the addition of Venetoclax to the AZA/Enasidenib combination.
Our patient, a 60 year old female with no significant past medical history, presented with worsening fatigue, fever and sore throat. Labs demonstrated a white blood cell (WBC) count of 1.2 × 109/L with an absolute neutrophil count (ANC) of 144 cells/uL, hemoglobin of 12 g/dL, mean corpuscular value (MCV) of 108 fL, platelet count of 187 × 109/L. Initial bone marrow biopsy revealed a hypercellular marrow for age (60% cellularity) with at least 20% CD34 + , CD117 + myeloblasts, concerning for evolving AML. Patient presented to our clinic for a second opinion. Repeat bone marrow biopsy done at this time showed a hypocellular marrow (10–20% cellularity) with at least 40% CD34 + , CD33 + , CD117 + and myeloperoxidase (MPO) + myeloblasts, consistent with AML. Cytogenetic analysis demonstrated trisomy 8. Molecular profiling using a next generation sequencing (NGS) platform revealed a missense mutation in the IDH2 enzyme (c.515G > A; p.R172K) with a variant allele frequency (VAF) of 7%. Patient was also noted to have co-mutations in DNMT3A (VAF 7%).
Patient received induction chemotherapy with the standard “7 + 3” regimen of Cytarabine 100 mg/m2/dose and Idarubicin 12 mg/m2/dose. Despite receiving anti-fungal prophylaxis, post-induction course was complicated by rhinocerebral mucormycosis requiring several sinonasal debridements and a prolonged hospitalization. In an effort to decrease length of neutropenia and avoid further clinical decline, patient received growth factor support with filgastrim. Due to the severity of the infection and her immunocompromised status, patient was given granulocyte infusions. She required a prolonged course of antifungal therapy with posaconazole which patient continues at this time. Upon clinical improvement, repeat bone marrow biopsy was performed on Day 40 post induction. This revealed refractory disease, with 45% CD33 + , CD34 + , CD117 + , and MPO + myeloblasts.
We discussed the role of a salvage regimen followed by an allogeneic transplant. However, given her recent invasive fungal infection and poor performance status, patient elected not to pursue a stem cell transplant. She was started on salvage therapy with Enasidenib 100 mg daily in continuous 28 day cycles, and Decitabine 20 mg/m2/dose over five days in 28 day cycles. She did not experience any differentiation syndrome with Enasidenib therapy. However, she developed persistent neutropenia with this regimen and was switched to AZA 75 mg/m2/dose over five days in 28 day cycles. Enasidenib was continued at the initial dose. Figure 1 is a longitudinal representation of the changes in patient’s cytopenias with treatment.Fig. 1 Clinical course of primary refractory AML patient with combination therapy with DNMT inhibitors, IDH inhibitors and Venetoclax: The patient was primary refractory after induction chemotherapy. The patient went into a complete remission (CR) after starting Azacytidine and Enasidenib. Venetoclax was added upon relapse and led to trilineage count recovery. Time periods are as follows: a Induction chemotherapy with Idarubicin and Cytarabine; b Salvage with Enasidenib and Decitabine; c Maintenance with Enasidenib and Azacytidine; d Relapse and brief treatment with Venetoclax; e Count Recovery; f Relapse
Bone marrow biopsy performed after seven cycles of Enasidenib and hypomethylating agent therapy showed a hypocellular marrow (10%) with 1.4% CD34 + , CD117 + myeloblasts. Repeat NGS profiling showed a persistent IDH2 R172 clone with a VAF of 10% and a co-mutation in DNMT3A with VAF 12%. Correlative studies with multiparameter flow cytometry revealed less than < 1% phenotypic leukemia stem cells (Lineage-ve, CD34 + , CD38-, CD123 + /CD45RA + /IL1RAP +) demonstrating a deep marrow remission (Fig. 2) [5]. Labs were consistent with complete remission (CR), with a WBC count of 7.3 × 109/L with ANC of 5800 cells/uL, hemoglobin of 10.2, MCV 105 fL and platelets 349 × 109/L.Fig. 2 Leukemic stem cells analysis: Bone marrow cells were used to identify Lineage–ve, CD34 + , CD38 −, CD123 + , CD45RA + . IL1RAP + cells with multiparameter flow cytometry. Very few (< 1%) leukemic stem cells were found in remission samples
Patient remained in CR for nine months. She subsequently was noticed to have increasing peripheral blasts. Bone marrow biopsy showed a hypercellular marrow with 10–20% blasts with a new deletion of chromosome 7q22 and a translocation between chromosomes 4 and 13 involving breakpoints -4q22 and 13p12. Sequencing revealed clonal evolution with increasing allele burden of known IDH2 mutation, with VAF now at 38%, and new mutations in BCOR and RUNX1. She was started on Venetoclax at 50 mg daily for 2 weeks. However, patient developed febrile neutropenia and Venetoclax was held. Upon hematologic recovery, clearance of peripheral blasts was noted. Patient was restarted on Venetoclax, AZA and Enasidenib.
This is the first reported case of a patient with relapsed AML responding to combined therapy with a hypomethylating agent (HMA), IDH2 and BCL2 inhibitors. While the two-drug combinations of HMA/Venetoclax and HMA/Enasidenib are currently under investigation, the three-drug regimen of HMA/Venetoclax with Enasidenib has never been evaluated in a clinical trial. The recently published VIALE-A trial has established the combination of AZA/Venetoclax as a viable treatment option in patients with newly diagnosed AML, with a survival benefit noted in the AZA/Venetoclax arm, compared to control (14.7 months vs. 9.6 months, HR 0.66, CI 0.52 to 0.85, p < 0.001) [6]. The combination of AZA/IDH inhibitor is under investigation in the ongoing Phase II AG221-AML-005 trial in patients with IDH2 mutated relapsed/refractory AML. An interim analysis demonstrated an improved CR rate of 53% with AZA/Enasidenib, compared to 12% in the single-agent AZA arm (p = 0.0001) [7]. A Phase III trial of Azacitidine with Ivosidenib for newly diagnosed IDH1 mutated AML patients is also underway (AGILE study, NCT02632708).
The rationale for combining AZA and IDH inhibitors comes from a preclinical model of IDH2-R140Q mutated erythroleukemia cells [8]. RNA-sequencing of cells treated with Enasidenib and Azacitidine showed enrichment of differentiation and cell death gene signatures compared to single drug treated cells. The combination of DNMT and IDH inhibition is hypothesized to lead to a reversal of aberrant epigenetic changes, via two complementary mechanisms. Of note, in our patient, flow-cytometry analysis of bone marrow collected after seven cycles of combination therapy, did not show any remaining leukemic stem cells, as defined by phenotypic markers.
Similarly, other preclinical studies have provided the basis for combining BCL2 and IDH inhibitors. In an RNA interference screen study, IDH mutant AML cells were found to be sensitive to BCL2 inhibition, compared to wild type leukemic cells, due to the accumulation of the oncometabolite, 2-HG [9]. Interestingly, in clinical trials of Venetoclax, the objective response rate appears to be higher in patients with IDH1 or IDH2 mutations, compared to wildtype (33% compared to 10% in IDH-wildtype patients) [10]. There is an upcoming clinical trial investigating the combination of BCL2 and IDH inhibitors (NCT04092179). Taken together, these preclinical studies suggest a rationale for concurrent therapy with HMA/IDH and BCL2 inhibitors. This case is the first report of a patient with relapsed AML achieving clinical benefit with concurrent HMA/IDH/BCL2 inhibition, and merits further investigation in a randomized setting.
Of note, our patient did not experience any differentiation syndrome (DS) after initiation of either Enasidenib or Azacitidine. This phenomenon has been well described in AML patients undergoing therapy with both Enasidenib and Ivosidenib, ranging from within a few days to several months. However, the presence of DS has not been associated with clinical efficacy, contrary to what is observed in Acute Promyelocytic Leukemia (APL) [11]. In fact, studies have demonstrated lower rates of CR in patients with DS, with the reason for this being unclear. Higher peripheral blood blast percentage, fewer lines of previous therapy and an elevated LDH are thought to predict for the risk of DS [11]. In our patient, her initial relapse was soon after induction chemotherapy, and this may have accounted for the lack of DS. However, given the high mortality associated with DS, clinicians are urged to be vigilant, and initiate steroids when suspicion for the same arises.
In conclusion, we present the first report of a patient with refractory AML, ineligible for stem cell transplant, achieving CR with the concurrent three-drug regimen of AZA, Venetoclax and Enasidenib. This novel treatment combination merits further investigation in a clinical trial.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Authors' contribution
SJ, MK, NS and AV drafted the manuscript. JC carried out the molecular studies. KF, YW, IM, NK, AS, LB, MG, KG, IB, US and AS reviewed the manuscript. All authors read and approved the final manuscript. | 20 MILLIGRAM/SQ. METER, QD OVER 5 DAYS IN 28 DAY CYCLES | DrugDosageText | CC BY | 33397455 | 19,215,442 | 2021-01-04 |
What was the dosage of drug 'ENASIDENIB'? | Case report of combination therapy with Azacytidine, Enasidenib and Venetoclax in primary refractory AML.
Optimal treatment of acute myeloid leukemia (AML) arising in elderly patients remains a challenge. FDA approval of Ivosidenib and Enasidenib, small molecule inhibitors of isocitrate dehydrogenase enzymes (IDH1 and 2) have opened new avenues of treatment. We present a 60-year-old woman with refractory AML, achieving complete response to the combination therapy of hypomethylating agent, Azacytidine with the IDH2 inhibitor, Enasidenib, and BCL2 inhibitor, Venetoclax. To our knowledge, this is the first case report of a patient with IDH2 mutated refractory AML achieving complete response to combination therapy with azacytidine, enasidenib and venetoclax.
Letter to the editor
Acute myeloid leukemia (AML) arising in older patients from pre-existing Myelodysplastic Syndrome (MDS) carries a poor prognosis, with limited response to standard cytotoxic therapy [1]. Novel treatments tailored to each patient’s molecular abnormalities are needed to improve outcomes. Mutations in isocitrate dehydrogenase enzymes, IDH1 (R132) and mitochondrial IDH2 (R140, R172) have been identified and lead to the production of an oncometabolite, 2-hydroxyglutarate (2-HG) [2]. Accumulation of 2-HG in hematopoietic stem cells leads to DNA hypermethylation, changes in gene expression and blocked hematopoietic differentiation [2]. Ivosidenib and Enasidenib, small molecule inhibitors of IDH1 and IDH2 enzymes, respectively, are FDA approved for treatment of adults with relapsed/refractory AML [3, 4]. The initial Phase 1/2 open-label, single arm trial of Enasidenib evaluated its efficacy as a single agent in N = 199 patients with relapsed/refractory AML and demonstrated a complete response (CR) of 23% after a median follow-up of 6.6 months [3]. Trials examining these agents in the frontline and relapsed settings, in combination with chemotherapy, are ongoing. We report here a case of a patient with IDH2 mutated refractory AML achieving complete response with the combination of Enasidenib and hypomethylating agent, Azacytidine (AZA). Subsequent relapse was managed with the addition of Venetoclax to the AZA/Enasidenib combination.
Our patient, a 60 year old female with no significant past medical history, presented with worsening fatigue, fever and sore throat. Labs demonstrated a white blood cell (WBC) count of 1.2 × 109/L with an absolute neutrophil count (ANC) of 144 cells/uL, hemoglobin of 12 g/dL, mean corpuscular value (MCV) of 108 fL, platelet count of 187 × 109/L. Initial bone marrow biopsy revealed a hypercellular marrow for age (60% cellularity) with at least 20% CD34 + , CD117 + myeloblasts, concerning for evolving AML. Patient presented to our clinic for a second opinion. Repeat bone marrow biopsy done at this time showed a hypocellular marrow (10–20% cellularity) with at least 40% CD34 + , CD33 + , CD117 + and myeloperoxidase (MPO) + myeloblasts, consistent with AML. Cytogenetic analysis demonstrated trisomy 8. Molecular profiling using a next generation sequencing (NGS) platform revealed a missense mutation in the IDH2 enzyme (c.515G > A; p.R172K) with a variant allele frequency (VAF) of 7%. Patient was also noted to have co-mutations in DNMT3A (VAF 7%).
Patient received induction chemotherapy with the standard “7 + 3” regimen of Cytarabine 100 mg/m2/dose and Idarubicin 12 mg/m2/dose. Despite receiving anti-fungal prophylaxis, post-induction course was complicated by rhinocerebral mucormycosis requiring several sinonasal debridements and a prolonged hospitalization. In an effort to decrease length of neutropenia and avoid further clinical decline, patient received growth factor support with filgastrim. Due to the severity of the infection and her immunocompromised status, patient was given granulocyte infusions. She required a prolonged course of antifungal therapy with posaconazole which patient continues at this time. Upon clinical improvement, repeat bone marrow biopsy was performed on Day 40 post induction. This revealed refractory disease, with 45% CD33 + , CD34 + , CD117 + , and MPO + myeloblasts.
We discussed the role of a salvage regimen followed by an allogeneic transplant. However, given her recent invasive fungal infection and poor performance status, patient elected not to pursue a stem cell transplant. She was started on salvage therapy with Enasidenib 100 mg daily in continuous 28 day cycles, and Decitabine 20 mg/m2/dose over five days in 28 day cycles. She did not experience any differentiation syndrome with Enasidenib therapy. However, she developed persistent neutropenia with this regimen and was switched to AZA 75 mg/m2/dose over five days in 28 day cycles. Enasidenib was continued at the initial dose. Figure 1 is a longitudinal representation of the changes in patient’s cytopenias with treatment.Fig. 1 Clinical course of primary refractory AML patient with combination therapy with DNMT inhibitors, IDH inhibitors and Venetoclax: The patient was primary refractory after induction chemotherapy. The patient went into a complete remission (CR) after starting Azacytidine and Enasidenib. Venetoclax was added upon relapse and led to trilineage count recovery. Time periods are as follows: a Induction chemotherapy with Idarubicin and Cytarabine; b Salvage with Enasidenib and Decitabine; c Maintenance with Enasidenib and Azacytidine; d Relapse and brief treatment with Venetoclax; e Count Recovery; f Relapse
Bone marrow biopsy performed after seven cycles of Enasidenib and hypomethylating agent therapy showed a hypocellular marrow (10%) with 1.4% CD34 + , CD117 + myeloblasts. Repeat NGS profiling showed a persistent IDH2 R172 clone with a VAF of 10% and a co-mutation in DNMT3A with VAF 12%. Correlative studies with multiparameter flow cytometry revealed less than < 1% phenotypic leukemia stem cells (Lineage-ve, CD34 + , CD38-, CD123 + /CD45RA + /IL1RAP +) demonstrating a deep marrow remission (Fig. 2) [5]. Labs were consistent with complete remission (CR), with a WBC count of 7.3 × 109/L with ANC of 5800 cells/uL, hemoglobin of 10.2, MCV 105 fL and platelets 349 × 109/L.Fig. 2 Leukemic stem cells analysis: Bone marrow cells were used to identify Lineage–ve, CD34 + , CD38 −, CD123 + , CD45RA + . IL1RAP + cells with multiparameter flow cytometry. Very few (< 1%) leukemic stem cells were found in remission samples
Patient remained in CR for nine months. She subsequently was noticed to have increasing peripheral blasts. Bone marrow biopsy showed a hypercellular marrow with 10–20% blasts with a new deletion of chromosome 7q22 and a translocation between chromosomes 4 and 13 involving breakpoints -4q22 and 13p12. Sequencing revealed clonal evolution with increasing allele burden of known IDH2 mutation, with VAF now at 38%, and new mutations in BCOR and RUNX1. She was started on Venetoclax at 50 mg daily for 2 weeks. However, patient developed febrile neutropenia and Venetoclax was held. Upon hematologic recovery, clearance of peripheral blasts was noted. Patient was restarted on Venetoclax, AZA and Enasidenib.
This is the first reported case of a patient with relapsed AML responding to combined therapy with a hypomethylating agent (HMA), IDH2 and BCL2 inhibitors. While the two-drug combinations of HMA/Venetoclax and HMA/Enasidenib are currently under investigation, the three-drug regimen of HMA/Venetoclax with Enasidenib has never been evaluated in a clinical trial. The recently published VIALE-A trial has established the combination of AZA/Venetoclax as a viable treatment option in patients with newly diagnosed AML, with a survival benefit noted in the AZA/Venetoclax arm, compared to control (14.7 months vs. 9.6 months, HR 0.66, CI 0.52 to 0.85, p < 0.001) [6]. The combination of AZA/IDH inhibitor is under investigation in the ongoing Phase II AG221-AML-005 trial in patients with IDH2 mutated relapsed/refractory AML. An interim analysis demonstrated an improved CR rate of 53% with AZA/Enasidenib, compared to 12% in the single-agent AZA arm (p = 0.0001) [7]. A Phase III trial of Azacitidine with Ivosidenib for newly diagnosed IDH1 mutated AML patients is also underway (AGILE study, NCT02632708).
The rationale for combining AZA and IDH inhibitors comes from a preclinical model of IDH2-R140Q mutated erythroleukemia cells [8]. RNA-sequencing of cells treated with Enasidenib and Azacitidine showed enrichment of differentiation and cell death gene signatures compared to single drug treated cells. The combination of DNMT and IDH inhibition is hypothesized to lead to a reversal of aberrant epigenetic changes, via two complementary mechanisms. Of note, in our patient, flow-cytometry analysis of bone marrow collected after seven cycles of combination therapy, did not show any remaining leukemic stem cells, as defined by phenotypic markers.
Similarly, other preclinical studies have provided the basis for combining BCL2 and IDH inhibitors. In an RNA interference screen study, IDH mutant AML cells were found to be sensitive to BCL2 inhibition, compared to wild type leukemic cells, due to the accumulation of the oncometabolite, 2-HG [9]. Interestingly, in clinical trials of Venetoclax, the objective response rate appears to be higher in patients with IDH1 or IDH2 mutations, compared to wildtype (33% compared to 10% in IDH-wildtype patients) [10]. There is an upcoming clinical trial investigating the combination of BCL2 and IDH inhibitors (NCT04092179). Taken together, these preclinical studies suggest a rationale for concurrent therapy with HMA/IDH and BCL2 inhibitors. This case is the first report of a patient with relapsed AML achieving clinical benefit with concurrent HMA/IDH/BCL2 inhibition, and merits further investigation in a randomized setting.
Of note, our patient did not experience any differentiation syndrome (DS) after initiation of either Enasidenib or Azacitidine. This phenomenon has been well described in AML patients undergoing therapy with both Enasidenib and Ivosidenib, ranging from within a few days to several months. However, the presence of DS has not been associated with clinical efficacy, contrary to what is observed in Acute Promyelocytic Leukemia (APL) [11]. In fact, studies have demonstrated lower rates of CR in patients with DS, with the reason for this being unclear. Higher peripheral blood blast percentage, fewer lines of previous therapy and an elevated LDH are thought to predict for the risk of DS [11]. In our patient, her initial relapse was soon after induction chemotherapy, and this may have accounted for the lack of DS. However, given the high mortality associated with DS, clinicians are urged to be vigilant, and initiate steroids when suspicion for the same arises.
In conclusion, we present the first report of a patient with refractory AML, ineligible for stem cell transplant, achieving CR with the concurrent three-drug regimen of AZA, Venetoclax and Enasidenib. This novel treatment combination merits further investigation in a clinical trial.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Authors' contribution
SJ, MK, NS and AV drafted the manuscript. JC carried out the molecular studies. KF, YW, IM, NK, AS, LB, MG, KG, IB, US and AS reviewed the manuscript. All authors read and approved the final manuscript. | 100 MILLIGRAM, QD FOR 28 DAY CYCLE | DrugDosageText | CC BY | 33397455 | 19,215,442 | 2021-01-04 |
What was the dosage of drug 'IDARUBICIN'? | Case report of combination therapy with Azacytidine, Enasidenib and Venetoclax in primary refractory AML.
Optimal treatment of acute myeloid leukemia (AML) arising in elderly patients remains a challenge. FDA approval of Ivosidenib and Enasidenib, small molecule inhibitors of isocitrate dehydrogenase enzymes (IDH1 and 2) have opened new avenues of treatment. We present a 60-year-old woman with refractory AML, achieving complete response to the combination therapy of hypomethylating agent, Azacytidine with the IDH2 inhibitor, Enasidenib, and BCL2 inhibitor, Venetoclax. To our knowledge, this is the first case report of a patient with IDH2 mutated refractory AML achieving complete response to combination therapy with azacytidine, enasidenib and venetoclax.
Letter to the editor
Acute myeloid leukemia (AML) arising in older patients from pre-existing Myelodysplastic Syndrome (MDS) carries a poor prognosis, with limited response to standard cytotoxic therapy [1]. Novel treatments tailored to each patient’s molecular abnormalities are needed to improve outcomes. Mutations in isocitrate dehydrogenase enzymes, IDH1 (R132) and mitochondrial IDH2 (R140, R172) have been identified and lead to the production of an oncometabolite, 2-hydroxyglutarate (2-HG) [2]. Accumulation of 2-HG in hematopoietic stem cells leads to DNA hypermethylation, changes in gene expression and blocked hematopoietic differentiation [2]. Ivosidenib and Enasidenib, small molecule inhibitors of IDH1 and IDH2 enzymes, respectively, are FDA approved for treatment of adults with relapsed/refractory AML [3, 4]. The initial Phase 1/2 open-label, single arm trial of Enasidenib evaluated its efficacy as a single agent in N = 199 patients with relapsed/refractory AML and demonstrated a complete response (CR) of 23% after a median follow-up of 6.6 months [3]. Trials examining these agents in the frontline and relapsed settings, in combination with chemotherapy, are ongoing. We report here a case of a patient with IDH2 mutated refractory AML achieving complete response with the combination of Enasidenib and hypomethylating agent, Azacytidine (AZA). Subsequent relapse was managed with the addition of Venetoclax to the AZA/Enasidenib combination.
Our patient, a 60 year old female with no significant past medical history, presented with worsening fatigue, fever and sore throat. Labs demonstrated a white blood cell (WBC) count of 1.2 × 109/L with an absolute neutrophil count (ANC) of 144 cells/uL, hemoglobin of 12 g/dL, mean corpuscular value (MCV) of 108 fL, platelet count of 187 × 109/L. Initial bone marrow biopsy revealed a hypercellular marrow for age (60% cellularity) with at least 20% CD34 + , CD117 + myeloblasts, concerning for evolving AML. Patient presented to our clinic for a second opinion. Repeat bone marrow biopsy done at this time showed a hypocellular marrow (10–20% cellularity) with at least 40% CD34 + , CD33 + , CD117 + and myeloperoxidase (MPO) + myeloblasts, consistent with AML. Cytogenetic analysis demonstrated trisomy 8. Molecular profiling using a next generation sequencing (NGS) platform revealed a missense mutation in the IDH2 enzyme (c.515G > A; p.R172K) with a variant allele frequency (VAF) of 7%. Patient was also noted to have co-mutations in DNMT3A (VAF 7%).
Patient received induction chemotherapy with the standard “7 + 3” regimen of Cytarabine 100 mg/m2/dose and Idarubicin 12 mg/m2/dose. Despite receiving anti-fungal prophylaxis, post-induction course was complicated by rhinocerebral mucormycosis requiring several sinonasal debridements and a prolonged hospitalization. In an effort to decrease length of neutropenia and avoid further clinical decline, patient received growth factor support with filgastrim. Due to the severity of the infection and her immunocompromised status, patient was given granulocyte infusions. She required a prolonged course of antifungal therapy with posaconazole which patient continues at this time. Upon clinical improvement, repeat bone marrow biopsy was performed on Day 40 post induction. This revealed refractory disease, with 45% CD33 + , CD34 + , CD117 + , and MPO + myeloblasts.
We discussed the role of a salvage regimen followed by an allogeneic transplant. However, given her recent invasive fungal infection and poor performance status, patient elected not to pursue a stem cell transplant. She was started on salvage therapy with Enasidenib 100 mg daily in continuous 28 day cycles, and Decitabine 20 mg/m2/dose over five days in 28 day cycles. She did not experience any differentiation syndrome with Enasidenib therapy. However, she developed persistent neutropenia with this regimen and was switched to AZA 75 mg/m2/dose over five days in 28 day cycles. Enasidenib was continued at the initial dose. Figure 1 is a longitudinal representation of the changes in patient’s cytopenias with treatment.Fig. 1 Clinical course of primary refractory AML patient with combination therapy with DNMT inhibitors, IDH inhibitors and Venetoclax: The patient was primary refractory after induction chemotherapy. The patient went into a complete remission (CR) after starting Azacytidine and Enasidenib. Venetoclax was added upon relapse and led to trilineage count recovery. Time periods are as follows: a Induction chemotherapy with Idarubicin and Cytarabine; b Salvage with Enasidenib and Decitabine; c Maintenance with Enasidenib and Azacytidine; d Relapse and brief treatment with Venetoclax; e Count Recovery; f Relapse
Bone marrow biopsy performed after seven cycles of Enasidenib and hypomethylating agent therapy showed a hypocellular marrow (10%) with 1.4% CD34 + , CD117 + myeloblasts. Repeat NGS profiling showed a persistent IDH2 R172 clone with a VAF of 10% and a co-mutation in DNMT3A with VAF 12%. Correlative studies with multiparameter flow cytometry revealed less than < 1% phenotypic leukemia stem cells (Lineage-ve, CD34 + , CD38-, CD123 + /CD45RA + /IL1RAP +) demonstrating a deep marrow remission (Fig. 2) [5]. Labs were consistent with complete remission (CR), with a WBC count of 7.3 × 109/L with ANC of 5800 cells/uL, hemoglobin of 10.2, MCV 105 fL and platelets 349 × 109/L.Fig. 2 Leukemic stem cells analysis: Bone marrow cells were used to identify Lineage–ve, CD34 + , CD38 −, CD123 + , CD45RA + . IL1RAP + cells with multiparameter flow cytometry. Very few (< 1%) leukemic stem cells were found in remission samples
Patient remained in CR for nine months. She subsequently was noticed to have increasing peripheral blasts. Bone marrow biopsy showed a hypercellular marrow with 10–20% blasts with a new deletion of chromosome 7q22 and a translocation between chromosomes 4 and 13 involving breakpoints -4q22 and 13p12. Sequencing revealed clonal evolution with increasing allele burden of known IDH2 mutation, with VAF now at 38%, and new mutations in BCOR and RUNX1. She was started on Venetoclax at 50 mg daily for 2 weeks. However, patient developed febrile neutropenia and Venetoclax was held. Upon hematologic recovery, clearance of peripheral blasts was noted. Patient was restarted on Venetoclax, AZA and Enasidenib.
This is the first reported case of a patient with relapsed AML responding to combined therapy with a hypomethylating agent (HMA), IDH2 and BCL2 inhibitors. While the two-drug combinations of HMA/Venetoclax and HMA/Enasidenib are currently under investigation, the three-drug regimen of HMA/Venetoclax with Enasidenib has never been evaluated in a clinical trial. The recently published VIALE-A trial has established the combination of AZA/Venetoclax as a viable treatment option in patients with newly diagnosed AML, with a survival benefit noted in the AZA/Venetoclax arm, compared to control (14.7 months vs. 9.6 months, HR 0.66, CI 0.52 to 0.85, p < 0.001) [6]. The combination of AZA/IDH inhibitor is under investigation in the ongoing Phase II AG221-AML-005 trial in patients with IDH2 mutated relapsed/refractory AML. An interim analysis demonstrated an improved CR rate of 53% with AZA/Enasidenib, compared to 12% in the single-agent AZA arm (p = 0.0001) [7]. A Phase III trial of Azacitidine with Ivosidenib for newly diagnosed IDH1 mutated AML patients is also underway (AGILE study, NCT02632708).
The rationale for combining AZA and IDH inhibitors comes from a preclinical model of IDH2-R140Q mutated erythroleukemia cells [8]. RNA-sequencing of cells treated with Enasidenib and Azacitidine showed enrichment of differentiation and cell death gene signatures compared to single drug treated cells. The combination of DNMT and IDH inhibition is hypothesized to lead to a reversal of aberrant epigenetic changes, via two complementary mechanisms. Of note, in our patient, flow-cytometry analysis of bone marrow collected after seven cycles of combination therapy, did not show any remaining leukemic stem cells, as defined by phenotypic markers.
Similarly, other preclinical studies have provided the basis for combining BCL2 and IDH inhibitors. In an RNA interference screen study, IDH mutant AML cells were found to be sensitive to BCL2 inhibition, compared to wild type leukemic cells, due to the accumulation of the oncometabolite, 2-HG [9]. Interestingly, in clinical trials of Venetoclax, the objective response rate appears to be higher in patients with IDH1 or IDH2 mutations, compared to wildtype (33% compared to 10% in IDH-wildtype patients) [10]. There is an upcoming clinical trial investigating the combination of BCL2 and IDH inhibitors (NCT04092179). Taken together, these preclinical studies suggest a rationale for concurrent therapy with HMA/IDH and BCL2 inhibitors. This case is the first report of a patient with relapsed AML achieving clinical benefit with concurrent HMA/IDH/BCL2 inhibition, and merits further investigation in a randomized setting.
Of note, our patient did not experience any differentiation syndrome (DS) after initiation of either Enasidenib or Azacitidine. This phenomenon has been well described in AML patients undergoing therapy with both Enasidenib and Ivosidenib, ranging from within a few days to several months. However, the presence of DS has not been associated with clinical efficacy, contrary to what is observed in Acute Promyelocytic Leukemia (APL) [11]. In fact, studies have demonstrated lower rates of CR in patients with DS, with the reason for this being unclear. Higher peripheral blood blast percentage, fewer lines of previous therapy and an elevated LDH are thought to predict for the risk of DS [11]. In our patient, her initial relapse was soon after induction chemotherapy, and this may have accounted for the lack of DS. However, given the high mortality associated with DS, clinicians are urged to be vigilant, and initiate steroids when suspicion for the same arises.
In conclusion, we present the first report of a patient with refractory AML, ineligible for stem cell transplant, achieving CR with the concurrent three-drug regimen of AZA, Venetoclax and Enasidenib. This novel treatment combination merits further investigation in a clinical trial.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Authors' contribution
SJ, MK, NS and AV drafted the manuscript. JC carried out the molecular studies. KF, YW, IM, NK, AS, LB, MG, KG, IB, US and AS reviewed the manuscript. All authors read and approved the final manuscript. | 12 MILLIGRAM/SQ. METER PER DOSE | DrugDosageText | CC BY | 33397455 | 19,215,442 | 2021-01-04 |
What was the dosage of drug 'VENETOCLAX'? | Case report of combination therapy with Azacytidine, Enasidenib and Venetoclax in primary refractory AML.
Optimal treatment of acute myeloid leukemia (AML) arising in elderly patients remains a challenge. FDA approval of Ivosidenib and Enasidenib, small molecule inhibitors of isocitrate dehydrogenase enzymes (IDH1 and 2) have opened new avenues of treatment. We present a 60-year-old woman with refractory AML, achieving complete response to the combination therapy of hypomethylating agent, Azacytidine with the IDH2 inhibitor, Enasidenib, and BCL2 inhibitor, Venetoclax. To our knowledge, this is the first case report of a patient with IDH2 mutated refractory AML achieving complete response to combination therapy with azacytidine, enasidenib and venetoclax.
Letter to the editor
Acute myeloid leukemia (AML) arising in older patients from pre-existing Myelodysplastic Syndrome (MDS) carries a poor prognosis, with limited response to standard cytotoxic therapy [1]. Novel treatments tailored to each patient’s molecular abnormalities are needed to improve outcomes. Mutations in isocitrate dehydrogenase enzymes, IDH1 (R132) and mitochondrial IDH2 (R140, R172) have been identified and lead to the production of an oncometabolite, 2-hydroxyglutarate (2-HG) [2]. Accumulation of 2-HG in hematopoietic stem cells leads to DNA hypermethylation, changes in gene expression and blocked hematopoietic differentiation [2]. Ivosidenib and Enasidenib, small molecule inhibitors of IDH1 and IDH2 enzymes, respectively, are FDA approved for treatment of adults with relapsed/refractory AML [3, 4]. The initial Phase 1/2 open-label, single arm trial of Enasidenib evaluated its efficacy as a single agent in N = 199 patients with relapsed/refractory AML and demonstrated a complete response (CR) of 23% after a median follow-up of 6.6 months [3]. Trials examining these agents in the frontline and relapsed settings, in combination with chemotherapy, are ongoing. We report here a case of a patient with IDH2 mutated refractory AML achieving complete response with the combination of Enasidenib and hypomethylating agent, Azacytidine (AZA). Subsequent relapse was managed with the addition of Venetoclax to the AZA/Enasidenib combination.
Our patient, a 60 year old female with no significant past medical history, presented with worsening fatigue, fever and sore throat. Labs demonstrated a white blood cell (WBC) count of 1.2 × 109/L with an absolute neutrophil count (ANC) of 144 cells/uL, hemoglobin of 12 g/dL, mean corpuscular value (MCV) of 108 fL, platelet count of 187 × 109/L. Initial bone marrow biopsy revealed a hypercellular marrow for age (60% cellularity) with at least 20% CD34 + , CD117 + myeloblasts, concerning for evolving AML. Patient presented to our clinic for a second opinion. Repeat bone marrow biopsy done at this time showed a hypocellular marrow (10–20% cellularity) with at least 40% CD34 + , CD33 + , CD117 + and myeloperoxidase (MPO) + myeloblasts, consistent with AML. Cytogenetic analysis demonstrated trisomy 8. Molecular profiling using a next generation sequencing (NGS) platform revealed a missense mutation in the IDH2 enzyme (c.515G > A; p.R172K) with a variant allele frequency (VAF) of 7%. Patient was also noted to have co-mutations in DNMT3A (VAF 7%).
Patient received induction chemotherapy with the standard “7 + 3” regimen of Cytarabine 100 mg/m2/dose and Idarubicin 12 mg/m2/dose. Despite receiving anti-fungal prophylaxis, post-induction course was complicated by rhinocerebral mucormycosis requiring several sinonasal debridements and a prolonged hospitalization. In an effort to decrease length of neutropenia and avoid further clinical decline, patient received growth factor support with filgastrim. Due to the severity of the infection and her immunocompromised status, patient was given granulocyte infusions. She required a prolonged course of antifungal therapy with posaconazole which patient continues at this time. Upon clinical improvement, repeat bone marrow biopsy was performed on Day 40 post induction. This revealed refractory disease, with 45% CD33 + , CD34 + , CD117 + , and MPO + myeloblasts.
We discussed the role of a salvage regimen followed by an allogeneic transplant. However, given her recent invasive fungal infection and poor performance status, patient elected not to pursue a stem cell transplant. She was started on salvage therapy with Enasidenib 100 mg daily in continuous 28 day cycles, and Decitabine 20 mg/m2/dose over five days in 28 day cycles. She did not experience any differentiation syndrome with Enasidenib therapy. However, she developed persistent neutropenia with this regimen and was switched to AZA 75 mg/m2/dose over five days in 28 day cycles. Enasidenib was continued at the initial dose. Figure 1 is a longitudinal representation of the changes in patient’s cytopenias with treatment.Fig. 1 Clinical course of primary refractory AML patient with combination therapy with DNMT inhibitors, IDH inhibitors and Venetoclax: The patient was primary refractory after induction chemotherapy. The patient went into a complete remission (CR) after starting Azacytidine and Enasidenib. Venetoclax was added upon relapse and led to trilineage count recovery. Time periods are as follows: a Induction chemotherapy with Idarubicin and Cytarabine; b Salvage with Enasidenib and Decitabine; c Maintenance with Enasidenib and Azacytidine; d Relapse and brief treatment with Venetoclax; e Count Recovery; f Relapse
Bone marrow biopsy performed after seven cycles of Enasidenib and hypomethylating agent therapy showed a hypocellular marrow (10%) with 1.4% CD34 + , CD117 + myeloblasts. Repeat NGS profiling showed a persistent IDH2 R172 clone with a VAF of 10% and a co-mutation in DNMT3A with VAF 12%. Correlative studies with multiparameter flow cytometry revealed less than < 1% phenotypic leukemia stem cells (Lineage-ve, CD34 + , CD38-, CD123 + /CD45RA + /IL1RAP +) demonstrating a deep marrow remission (Fig. 2) [5]. Labs were consistent with complete remission (CR), with a WBC count of 7.3 × 109/L with ANC of 5800 cells/uL, hemoglobin of 10.2, MCV 105 fL and platelets 349 × 109/L.Fig. 2 Leukemic stem cells analysis: Bone marrow cells were used to identify Lineage–ve, CD34 + , CD38 −, CD123 + , CD45RA + . IL1RAP + cells with multiparameter flow cytometry. Very few (< 1%) leukemic stem cells were found in remission samples
Patient remained in CR for nine months. She subsequently was noticed to have increasing peripheral blasts. Bone marrow biopsy showed a hypercellular marrow with 10–20% blasts with a new deletion of chromosome 7q22 and a translocation between chromosomes 4 and 13 involving breakpoints -4q22 and 13p12. Sequencing revealed clonal evolution with increasing allele burden of known IDH2 mutation, with VAF now at 38%, and new mutations in BCOR and RUNX1. She was started on Venetoclax at 50 mg daily for 2 weeks. However, patient developed febrile neutropenia and Venetoclax was held. Upon hematologic recovery, clearance of peripheral blasts was noted. Patient was restarted on Venetoclax, AZA and Enasidenib.
This is the first reported case of a patient with relapsed AML responding to combined therapy with a hypomethylating agent (HMA), IDH2 and BCL2 inhibitors. While the two-drug combinations of HMA/Venetoclax and HMA/Enasidenib are currently under investigation, the three-drug regimen of HMA/Venetoclax with Enasidenib has never been evaluated in a clinical trial. The recently published VIALE-A trial has established the combination of AZA/Venetoclax as a viable treatment option in patients with newly diagnosed AML, with a survival benefit noted in the AZA/Venetoclax arm, compared to control (14.7 months vs. 9.6 months, HR 0.66, CI 0.52 to 0.85, p < 0.001) [6]. The combination of AZA/IDH inhibitor is under investigation in the ongoing Phase II AG221-AML-005 trial in patients with IDH2 mutated relapsed/refractory AML. An interim analysis demonstrated an improved CR rate of 53% with AZA/Enasidenib, compared to 12% in the single-agent AZA arm (p = 0.0001) [7]. A Phase III trial of Azacitidine with Ivosidenib for newly diagnosed IDH1 mutated AML patients is also underway (AGILE study, NCT02632708).
The rationale for combining AZA and IDH inhibitors comes from a preclinical model of IDH2-R140Q mutated erythroleukemia cells [8]. RNA-sequencing of cells treated with Enasidenib and Azacitidine showed enrichment of differentiation and cell death gene signatures compared to single drug treated cells. The combination of DNMT and IDH inhibition is hypothesized to lead to a reversal of aberrant epigenetic changes, via two complementary mechanisms. Of note, in our patient, flow-cytometry analysis of bone marrow collected after seven cycles of combination therapy, did not show any remaining leukemic stem cells, as defined by phenotypic markers.
Similarly, other preclinical studies have provided the basis for combining BCL2 and IDH inhibitors. In an RNA interference screen study, IDH mutant AML cells were found to be sensitive to BCL2 inhibition, compared to wild type leukemic cells, due to the accumulation of the oncometabolite, 2-HG [9]. Interestingly, in clinical trials of Venetoclax, the objective response rate appears to be higher in patients with IDH1 or IDH2 mutations, compared to wildtype (33% compared to 10% in IDH-wildtype patients) [10]. There is an upcoming clinical trial investigating the combination of BCL2 and IDH inhibitors (NCT04092179). Taken together, these preclinical studies suggest a rationale for concurrent therapy with HMA/IDH and BCL2 inhibitors. This case is the first report of a patient with relapsed AML achieving clinical benefit with concurrent HMA/IDH/BCL2 inhibition, and merits further investigation in a randomized setting.
Of note, our patient did not experience any differentiation syndrome (DS) after initiation of either Enasidenib or Azacitidine. This phenomenon has been well described in AML patients undergoing therapy with both Enasidenib and Ivosidenib, ranging from within a few days to several months. However, the presence of DS has not been associated with clinical efficacy, contrary to what is observed in Acute Promyelocytic Leukemia (APL) [11]. In fact, studies have demonstrated lower rates of CR in patients with DS, with the reason for this being unclear. Higher peripheral blood blast percentage, fewer lines of previous therapy and an elevated LDH are thought to predict for the risk of DS [11]. In our patient, her initial relapse was soon after induction chemotherapy, and this may have accounted for the lack of DS. However, given the high mortality associated with DS, clinicians are urged to be vigilant, and initiate steroids when suspicion for the same arises.
In conclusion, we present the first report of a patient with refractory AML, ineligible for stem cell transplant, achieving CR with the concurrent three-drug regimen of AZA, Venetoclax and Enasidenib. This novel treatment combination merits further investigation in a clinical trial.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Authors' contribution
SJ, MK, NS and AV drafted the manuscript. JC carried out the molecular studies. KF, YW, IM, NK, AS, LB, MG, KG, IB, US and AS reviewed the manuscript. All authors read and approved the final manuscript. | 50 MILLIGRAM, QD FOR 2 WEEKS | DrugDosageText | CC BY | 33397455 | 19,215,442 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Anaemia'. | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | CYCLOPHOSPHAMIDE, MESNA, MYCOPHENOLATE MOFETIL, PREDNISONE, TACROLIMUS | DrugsGivenReaction | CC BY | 33397476 | 18,846,081 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Delayed engraftment'. | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | CYCLOPHOSPHAMIDE, MYCOPHENOLIC ACID, PREDNISONE, TACROLIMUS | DrugsGivenReaction | CC BY | 33397476 | 18,839,094 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Epstein-Barr virus infection'. | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | CYCLOPHOSPHAMIDE, MYCOPHENOLIC ACID, PREDNISONE, TACROLIMUS | DrugsGivenReaction | CC BY | 33397476 | 18,839,094 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Off label use'. | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | CYCLOPHOSPHAMIDE, CYTARABINE\DAUNORUBICIN, FLUDARABINE PHOSPHATE, MELPHALAN, MESNA, MYCOPHENOLATE MOFETIL, PREDNISOLONE, TACROLIMUS | DrugsGivenReaction | CC BY | 33397476 | 19,653,346 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Thrombocytopenia'. | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | CYCLOPHOSPHAMIDE, MESNA, MYCOPHENOLATE MOFETIL, PREDNISONE, TACROLIMUS | DrugsGivenReaction | CC BY | 33397476 | 18,846,081 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Transplant dysfunction'. | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | CYCLOPHOSPHAMIDE, MYCOPHENOLIC ACID, PREDNISONE, TACROLIMUS | DrugsGivenReaction | CC BY | 33397476 | 18,839,094 | 2021-01-04 |
What was the dosage of drug 'MYCOPHENOLATE MOFETIL'? | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | STOPPED ON DAY +35 | DrugDosageText | CC BY | 33397476 | 19,205,953 | 2021-01-04 |
What was the dosage of drug 'PREDNISOLONE'? | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | 1 MILLIGRAM/KILOGRAM | DrugDosageText | CC BY | 33397476 | 19,653,346 | 2021-01-04 |
What was the outcome of reaction 'Acute kidney injury'? | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | Recovered | ReactionOutcome | CC BY | 33397476 | 18,846,081 | 2021-01-04 |
What was the outcome of reaction 'Anaemia'? | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | Recovering | ReactionOutcome | CC BY | 33397476 | 18,846,081 | 2021-01-04 |
What was the outcome of reaction 'Cystitis haemorrhagic'? | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | Recovered | ReactionOutcome | CC BY | 33397476 | 18,789,561 | 2021-01-04 |
What was the outcome of reaction 'Epstein-Barr viraemia'? | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | Recovered | ReactionOutcome | CC BY | 33397476 | 19,653,346 | 2021-01-04 |
What was the outcome of reaction 'Epstein-Barr virus infection'? | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | Recovered | ReactionOutcome | CC BY | 33397476 | 18,839,094 | 2021-01-04 |
What was the outcome of reaction 'Thrombocytopenia'? | The utility of hyperbaric oxygen therapy in post-transplant cyclophosphamide-induced hemorrhagic cystitis: a case report and review of the literature.
BACKGROUND
To date, there are only a few case reports of cyclophosphamide (Cy)-induced hemorrhagic cystitis (HC) in adult or pediatric allogeneic stem cell transplant (SCT) patients treated successfully with hyperbaric oxygen (HBO). In all the reported cases, Cy was used as a part of the conditioning regimen, rather than post-transplant for graft-versus-host-disease (GVHD) prophylaxis. More recently, the risk of HC in allogeneic SCT is further increased by the widespread use of post-transplantation cyclophosphamide (PTCy) as a highly effective strategy for GVHD prophylaxis. This is the first case reported of PTCy-induced HC successfully treated with HBO to the best of our knowledge.
METHODS
In this article, we present a 58-year-old Caucasian male case of allogeneic SCT complicated by severe HC following PTCy, which was successfully treated with HBO, eliminating the need for cystectomy.
CONCLUSIONS
HBO can be a safe, noninvasive, alternative treatment modality for PTCy-induced HC developing in allogeneic SCT patients.
Background
Hemorrhagic cystitis (HC) affects 16.6% of patients treated with high dose cyclophosphamide (Cy) as part of the conditioning regimen in allogeneic stem cell transplant (SCT) patients [1]. More recently, the risk of HC is further increased by the widespread use of post-transplantation Cy (PTCy) as a highly effective strategy for graft-versus-host disease (GVHD) prophylaxis [2].
To date, there are only a few case reports of Cy-induced HC in adult or pediatric allogeneic SCT patients treated successfully with hyperbaric oxygen (HBO) [3–6], a review of which is summarized in Table 1. In all reported cases, Cy was used as a part of the conditioning regimen, not as PTCy.Table 1 A review of studies of Cy-induced hemorrhagic cystitis in adult or pediatric allogeneic stem cell transplant patients treated successfully with hyperbaric oxygen
Study identifier Study design Inclusion criteria/study groups Number of patients Median age (year) Gender (male: female) Cyclophosphamide dose Acute GVHD percentage Infection percentage Response rate (%)
K. Hattori et al. [11] Case report HC after allogeneic SCT in children 2 7 2:00 60 mg/kg/day for 2 days, 50 mg/kg/day for 4 days 0 0 100
S. Cesaro et al. [12] Cross sectional HC in pediatric patients after SCT 38 10.8 4:01 Not disclosed 20 71 84
M. Payandeh et al. [13] Case report HC after allogeneic SCT in AML patient 1 40 1:00 Not disclosed 100 0 100
In all reported cases, cyclophosphamide (Cy) was used as part of the conditioning regimen, not as post-transplantation Cy (PTCy). HC hemorrhagic cystitis, SCT stem cell transplant, AML acute myeloid leukemia, GVHD graft-versus-host disease
In this article, we present a case of allogeneic SCT complicated by severe HC following PTCy that was successfully treated with HBO, eliminating the need for cystectomy. To the best of our knowledge, this is the first case reported of PTCy-induced HC successfully treated with HBO.
Case presentation
A 58-year-old Caucasian male with acute myelogenous leukemia with myelodysplastic-related changes achieved a complete response following treatment with liposomal cytarabine-daunorubicin. The remission was consolidated with an allogeneic SCT from a 10/10 human leukocyte antigen (HLA)-matched unrelated donor, following a reduced-intensity conditioning regimen with fludarabine and melphalan. The graft-versus-host disease prophylaxis regimen consisted of post-transplant Cy (50 mg/kg on days +3 and +4 along with mesna at 50 mg/kg), tacrolimus (Tac) and mycophenolate mofetil (MMF). His transplant course was complicated with Epstein–Barr virus (EBV) viremia successfully treated with rituximab, delayed engraftment, and poor graft function. On day +70 post-SCT, he presented with acute kidney injury, severe gross hematuria with clots, and difficulty urinating. The patient had no history of pelvic irradiation, trauma, or urolithiasis. Physical exam was unremarkable apart from gross bloody urine with medium-sized clots (Fig. 1a). Urinalysis and culture were negative for bacteria. Viral studies in serum and urine were negative for cytomegalovirus, adenovirus, and BK virus. Regenerating islet-derived 3 alpha (REG3α) and suppression of tumorigenicity 2 (ST2) were elevated on admission, triggering the use of prednisone at 1 mg/kg for the possibility of bladder acute GVHD. MMF was stopped on day +35, and Tac was stopped due to the acute kidney injury. A bladder biopsy was not obtained due to the risk of worsening hematuria and perforation. Prednisone was discontinued 2 weeks later due to the lack of clinical benefit and absence of any other clinical signs of GVHD. Complete blood count showed severe anemia and thrombocytopenia requiring multiple blood and platelet transfusions. Computed tomography scanning of the pelvis obtained on admission showed a 1.7–cm round density at the posterior wall of the bladder consistent with a blood clot. As the patient complained of lower pelvic discomfort and difficulty urinating, an 18 Fr Foley catheter was inserted under continuous irrigation. A cystogram showed a large right-sided filling defect concerning for a large blood clot; this was followed by cystoscopy that revealed bleeding and friable bladder mucosa. Due to the severity of the hematuria and the need for multiple blood transfusions, the patient underwent bilateral urinary diversion using nephrostomy tubes. Aminocaproic acid infusion was also initiated with 4 g intravenous push followed by 1 g/hour, discontinued a week later due to lack of clinical benefit. The patient was next started on orally administered conjugated estrogen at 3.75 mg every 8 hours, consistent with a previously published report [7]. However, gross hematuria persisted. Following all these unsuccessful attempts at stopping the HC, the patient was started on daily (Monday through Friday) HBO treatment sessions with 100% oxygen at 2.4 atm for 110 minutes, with two 5-minute air breaks, on day +110 post-SCT. After 20 sessions, the frequency of required bladder irrigation decreased, and the hematuria resolved, with urine transitioning to clear yellow color (Fig. 1b). The patient completed the 40 planned sessions as the most commonly adopted HBO schedule. The Foley catheter was removed on day +139, and serial bladder scans performed confirmed the patient’s ability to void spontaneously. The patient’s transfusion requirements decreased significantly, and his urinalysis confirmed resolution of microscopic hematuria. Currently, the patient is on day +250 and remains without hematuria and transfusion-independent. Bone marrow biopsy at 6 months post-SCT confirmed disease remission with 100% donor chimerism (CD33 and T cells).Fig. 1 Comparison between the color of urine before (a) and after (b) completion of hyperbaric oxygen
HBO rarely results in barotrauma in the middle ear, sinuses [8], or lungs [9], reversible myopia [8], seizures [10], or decompression sickness [11]. Our patient had none of these manifestations but reported initial worsening of his lower pelvic discomfort, described as pressure, which eventually resolved by the completion of HBO. The patient reported significant improvement in his quality of life upon resolution of HC. He also described HBO as tolerable and actually would recommend it to other patients if they had the same clinical challenge, that is, PTCy-induced HC.
Discussion and conclusions
This case of HC following PTCy was refractory to commonly used measures, but fully recovered with HBO. The risk of HC directly correlates with the dose and cumulative amounts of cyclophosphamide [12]. Additional risk factors for HC in SCT recipients include male gender, age < 20 years, and acute GVHD [1].
Acrolein, a cyclophosphamide metabolite, is responsible for inducing the aseptic inflammatory process resulting in gross hematuria [13, 14]. Acrolein damages the urothelium by cleaving intracellular proteins and breaking DNA strands [15]. In addition, acrolein induces reactive oxygen and nitrogen species (ROS and RNS, respectively) [15]. ROS and RNS trigger proapoptotic pathways via producing superoxide radicals which break DNA cross-links, leading to cell death [15]. Mesna, a thiol compound that binds and neutralizes acrolein in the urine, is used as a preventive measure for HC [13, 14]. Unfortunately, mesna fails in 2% to 40% of cases [16], with no standard of care to further treat this complication, leading in most cases to partial or radical cystectomy.
Hyperbaric oxygen (HBO) is a well-established modality in treating radiation-induced but not Cy-induced HC [3]. HBO utilizes pressurized oxygen or air at pressures exceeding 2.8 to 3.0 atm as an adjunctive modality to treat various health conditions. HBO promotes wound healing via improved tissue oxygenation, thus reducing local hypoxia and ROS and RNS production [17].
HBO is not used in the treatment of BK-induced HC, in which reduction of immunosuppression and cidofovir administration could be a good option [18].
Our patient was initially treated with continuous bladder irrigation, urinary diversion, aminocaproic acid, conjugated estrogens, and transfusion support, without any clinical benefit. However, 40 sessions of HBO resulted in complete response. While HBO has been used in a few reported cases of Cy-induced HC in the setting of SCT, none has been reported as secondary to PTCy. With the adoption of PTCy as a new standard for GVHD prophylaxis [19], we anticipate that HC may become a more commonly encountered complication in allogeneic SCT patients. This risk might be further increased by the use of total-body irradiation and/or Cy as part of the conditioning regimen. Should this complication be encountered, HBO emerges as an acceptable, non-toxic, yet effective option that clinicians can rely on to treat HC. Ruling out other causes of hematuria such as BK virus infection, bacterial infections, tumor involvement, and urolithiasis should be completed prior to HBO. While Cy-induced HC remains a relatively uncommon complication, a prospective study is warranted as a standard tool to evaluate the efficacy of HBO in Cy- or PTCy-induced HC in the setting of allogeneic SCT.
Abbreviations
CyCyclophosphamide
PTpost-transplant
PTCyPost-transplant cyclophosphamide
HCHemorrhagic cystitis
SCTStem cell transplant
HBOHyperbaric oxygen
GVHDGraft-versus-host-disease
ROSReactive oxygen species
RNSReactive nitrogen species
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
Not applicable.
Authors’ contributions
MI, KB, and BK drafted the manuscript. KVM, NS, HS, and FS substantively revised it. All authors read and approved the final manuscript.
Funding
There was no funding for this report.
Availability of data and materials
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent
is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests. | Recovering | ReactionOutcome | CC BY | 33397476 | 18,846,081 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Drug ineffective'. | Longitudinal dynamics of gut bacteriome, mycobiome and virome after fecal microbiota transplantation in graft-versus-host disease.
Fecal microbiota transplant (FMT) has emerged as a potential treatment for severe colitis associated with graft-versus-host disease (GvHD) following hematopoietic stem cell transplant. Bacterial engraftment from FMT donor to recipient has been reported, however the fate of fungi and viruses after FMT remains unclear. Here we report longitudinal dynamics of the gut bacteriome, mycobiome and virome in a teenager with GvHD after receiving four doses of FMT at weekly interval. After serial FMTs, the gut bacteriome, mycobiome and virome of the patient differ from compositions before FMT with variable temporal dynamics. Diversity of the gut bacterial community increases after each FMT. Gut fungal community initially shows expansion of several species followed by a decrease in diversity after multiple FMTs. In contrast, gut virome community varies substantially over time with a stable rise in diversity. The bacterium, Corynebacterium jeikeium, and Torque teno viruses, decrease after FMTs in parallel with an increase in the relative abundance of Caudovirales bacteriophages. Collectively, FMT may simultaneously impact on the various components of the gut microbiome with distinct effects.
Introduction
Allogenic hematopoietic stem cell transplant (allo-HSCT) is a promising therapy for hematological disorders, however, 35–45% of recipients experience serious complications arising from allo-HSCT. These complications, termed graft-versus-host disease (GvHD), is associated with up to 25% mortality1–3. Emerging evidence suggests that changes in the gut microbiota composition are associated with the occurrence of GvHD1. Multiple factors contributed to reduced microbiota diversity in patients with allo-HSCT, including recurrent use of broad-spectrum antibiotics, administration of chemotherapy and/or radiation, and altered nutritional status1. In murine and human studies, allogeneic bone marrow transplantation (BMT) led to a loss of overall bacterial diversity, expansion of Lactobacillales and loss of Clostridiales4,5. Alterations in the gut viral community are also associated with enteric GVHD6,7. For instance, human herpesvirus 6 was detected in blood6,7, and picornaviruses were detected in stools of patients with acute GvHD post HSCT8.
Fecal microbiota transplantation (FMT), the administration of fecal suspensions from healthy donors into a patient’s gastrointestinal tract, is an effective bacteriotherapy in recurrent Clostridioides difficile infections9. FMT has been shown to be associated with restoration of diversity of gut bacterial community. Recently, small case series of up to four subjects have used FMT as a treatment for refractory GvHD10,11. FMT was associated with improved gastrointestinal symptoms, reduced diarrhea and alterations in the gut microbiota in patients with refractory enteric GvHD3,12.
Whilst larger clinical studies are required to confirm the safety and efficacy of FMT for GvHD, this life-threatening disease requires immediate attention in some patients. Most studies have focused on restoration of bacterial diversity and little is known of the role of gut fungi and viruses in FMT. Two studies recently reported that Candida albicans and bacteriophages influenced FMT efficacy in recurrent Clostridium difficile infections, suggesting that alterations in gut viruses and fungi in response to FMT are also important for treatment outcomes13,14.
Here, we investigate the longitudinal dynamics of the gut bacteriome (bacterial microbiome), mycobiome (fungal microbiome) and virome (viral microbiome) in a teenager with stage IV GvHD with four doses of FMT at weekly interval. Apart from 16 S rRNA gene and shotgun metagenomics sequencing for bacteriome profiling, we enhance fungal extraction and enrich virus like particles (VLPs) in fecal DNA preparations and perform deep metagenomic sequencing on the fungi-enriched and viruses-enriched DNA extractions respectively, to profile the gut mycobiome and virome. We show discrepant alteration patterns of the gut bacteriome, mycobiome and virome in the recipient after FMT.
Results
Clinical characteristics of patient with severe GvHD receiving FMT
A 14-year-old male suffering from myelodysplastic syndrome with monosomy 7 underwent human leukocyte antigen (HLA)-identical sibling allo-HSCT. The patient developed stage II skin GvHD (rash 25–50%), stage IV gut GvHD with profuse bloody diarrhea and significant functional impairment and overall grade IV life threatening GvHD shortly after allo-HSCT. The patient failed to respond to methylprednisolone, Anti-thymocyte globulin (ATG), cyclosporine A, infliximab, ruxolitinib and entocort (Supplementary Fig. 1a). Computed tomography imaging showed significant thickening of the small bowel and colon suggestive of severe intestinal inflammation (Supplementary Fig. 2). He received the first FMT (day 0), 77 days after allo-HSCT, followed by three additional FMTs at weekly interval after the first FMT (Fig. 1a). The first three FMTs were performed using stool from a single donor (D8) and the fourth FMT from a different donor (D4). The antibiotic history of the patient is shown in Supplementary Fig. 1b.Fig. 1 Study schematic and clinical outcome.
a GvHD patient received four FMTs. The first three (FMT1, FMT2, FMT3) were performed using stool from a single donor, D8 and the fourth (FMT4) from a different donor D4. a Timeline of HSCT, GvHD onset, FMT treatment, stool collection and sequencing strategy. b Number of bowel openings and stool volume of the patient before and after FMT. Red arrows represent fecal transplant using donor D8, black arrow represents fecal transplant using donor D4. One biological sample was examined over one experiment.
Increased diversity of gut bacterial microbiota after FMT
We assessed alterations in the gut bacterial community in the patient before and after FMTs using 16 S ribosomal RNA gene sequencing. Changes in alpha diversity and community composition over time are summarized in Fig. 2a–c. Before FMT, only two exact sequence variants (ESVs) identified as Corynebacterium were detected in the patient’s stools. This observation corresponded with alpha diversity metrics showing low species richness and diversity relative to donor and post FMT samples (Fig. 2a). On day one immediately after the first FMT, four Bacteroides and nine Enterococcus ESVs previously undetected in the patient’s stool became dominant and Corynebacterium was no longer detectable (Fig. 2c). Interestingly, most of these 13 ESVs were either absent or below detection in the corresponding donor (D8) stool. The Bacteroides ESVs persisted in the patient’s stools throughout the five days, whereas the Enterococcus ESVs generally declined to undetectable levels, most around day 3. Similarly, two other Bacteroides and one Bifidobacterium ESV detected in the donor stool (D8 lots 26 and 27, Fig. 2c) steadily declined in the patient from day 1 onwards. This loss of ESVs was reflected in the community alpha diversity in which richness and diversity declined after day 2 (Fig. 2a). These findings suggest that the gut microbiota of the patient may be altered as early as one day after FMT, and that not all donor microorganisms could establish colonization in the recipient.Fig. 2 Changes in gut bacterial community composition in GvHD patient after FMTs.
a Richness, Shannon and Simpson diversity of bacterial communities in donor stools and the patient before and after FMTs. b Principal coordinate analysis (PCOA) of bacterial community composition in the patient following FMT based on Bray-Curtis dissimilarities. c Heat map summarizing fecal bacterial community composition in donor stools and the patient. Increasing relative abundances are representing by lighter colors (black to yellow). Taxonomic labels on left of figure indicate phylum assignments (class-level for Proteobacteria), labels on right indicate genus. Pre-FMT represents stool sample collected before the first FMT. FMT1, FMT2, FMT3, and FMT4 represent stool samples collected after the 1st (days 1–5), 2nd (day 6–13), 3rd (day 14–25) and 4th (day 27–120) FMTs respectively. D8-26, D8-27, D8-28, D8-29, D8-34 indicate fecal samples collected from donor D8 on different days, whereas only one fecal sample collected from donor D4 was used in the FMT. FMT1, FMT2, FMT3, FMT4 were performed using D8-26 and D8-27, D8-28 and D8-29, D8-34, D4 respectively. All analyses were based on bacterial profiles from 16 S rRNA gene sequencing data.
After the second FMT using different stool from the same donor (D8), the richness and diversity of the patient’s gut bacteriome increased (Fig. 2a). This time, a larger variety of Firmicutes, Fusobacteria and Proteobacteria ESVs were detected in the patient immediately after the second transplant (day 7), and most persisted until the end of the study (Fig. 2c). These observations suggest that the first FMT may have a priming effect on the patient’s gut community, allowing donor microorganisms from the second FMT to colonize the recipient. Two additional FMTs were subsequently given with stool from a second donor (D4) to increase diversity of microorganisms. After the third FMT, there were no major alterations in the alpha diversity or the composition of the patient’s gut bacteriome, compared to that after the first two transplants (Fig. 2a, c). A number of Bacteroides and Faecalibacterium ESVs from the fourth donor stool (donor D4) became established in the patient’s gut (Fig. 2c). Overall changes of the patient’s gut bacteriome were depicted via principal coordinate analysis (PCoA). The first two FMTs was associated with large shifts as shown by clustering of day 1–5 and day 7–13 profiles to the exclusion of samples from subsequent days (Fig. 2b), which was also reflected by the alpha diversity values in which community richness and diversity of the patient’s stool stabilized after the second FMT (Fig. 2a). Stool bacterial communities from day 67 onward appeared to cluster away from samples immediately following the fourth FMT, suggestive of fluctuations in the patient’s gut microbial communities. Nevertheless, these post-FMT mcirobiome profiles did not resemble disease baseline microbiome profile (day 0 before FMT).
To gain high-resolution insight into the bacterial microbiota, a subset of samples were analyzed by metagenomic sequencing and the results showed similar alterations with that measured via 16 S rRNA sequencing after FMT (Supplementary Fig. 3). Three predominant species were detected in the recipient’s stool after FMTs, including Alistipes putredinis, Clostridium nexile and Ruminococcus gnavu (Supplementary Fig. 3).
Improved gut microbiome functionality after FMT
We next investigated functional alterations in the bacterial community following FMTs, total bulk DNA sequencing reads from the metagenomic dataset were queried against reference databases to identify genes and their corresponding metabolic pathways (MetaCyc annotation). In the stool collected at baseline (day 0 before FMT), a large proportion of sequences could not be classified (>95% unmapped, Supplementary Fig. 4). The richness of genes and pathways showed no great difference between donors and patient before and after FMT (Supplementary Fig. 5). However, Shannon and Simpson diversity of the genes and pathways in the patient were markedly lower than that in donor (Fig. 3a), which is consistent with a low taxonomic diversity (Fig. 2a). After the first FMT, there was a substantial increase in the proportion of classifiable genes and pathways (Supplementary Fig. 4). In contrast to taxonomic reconstitution in which only several ESVs from the genera Bacteroides and Enterococcus were detected in the patient (Fig. 2c), Shannon and Simpson diversity of genes and pathways were increased after the first FMT (Fig. 3a), and the overall functional gene composition was comparable to the donors (Fig. 3b). After the second FMT, the diversity of genes and pathway remained stable until the last follow-up, accompanied by an increase in the bacterial diversity at the taxonomical level. After FMT, genes and pathways primarily related to metabolisms of lipids, carbohydrates, amino acids, nucleotides and energy were restored (Fig. 3c). These findings suggest that functions of microbial community might be promptly reconstructed following FMT with less fluctuations in functional content when compared with taxonomic configuration.Fig. 3 Changes in bacterial community function in GvHD patient associated with FMTs.
a α-diversity (Shannon and Simpson diversity) plot of gene families and pathways. These values were calculated based on gene and pathway relative abundances. b Principal coordinate analysis of Bray-Curtis dissimilarities based on abundances of functional pathways detected in donor and patient stools. Pre-FMT represents stool sample collected before the first FMT. FMT1, FMT2, FMT3, and FMT4 represent stool samples collected after the 1st (day 1-5), 2nd (day 7-13), 3rd (day 15-25) and 4th (day 27-120) FMTs respectively. c Heat map summarizing changes in patient’s gut microbial community function following FMT. Pathways with higher relative abundances are shaded red, whereas pathways with low relative abundances are shaded blue.
Durable engraftment of donor-derived fungi after FMT
To characterize the changes of the gut mycobiota in the patient following multiple FMTs, we performed fungi-enriched fecal DNA extraction, ultra-deep metagenomic sequencing and profiled the fungal composition. Overall, the patient showed a decrease in the richness (Chao1) and diversity (both Shannon and Simpson indices) of the gut mycobiome after FMT (Fig. 4a). The fecal mycobiome compositions at later time points after serial FMTs were comparable to the fecal mycobiomes of the donor D8 (D8-26 and D8-34) (Fig. 4b).Fig. 4 Changes in gut fungal community composition in GvHD patient after FMTs.
a Richness, Shannon and Simpson diversity of fungal communities in donor stools and the patient before and after FMTs. b PCoA ordination based on Bray-Curtis dissimilarities of the patient’s gut mycobiota showing progression over time. Dots represent samples labeled according to their respective time-points and are colored to visually group samples according to FMT timeline. c Proportion of fungal taxa derived from donors in total taxa in patient’s stool samples. The proportion was calculated by using the method of fast expectation-maximization microbial source tracking (FEAST). d Species-level proportions of the fecal mycobiota in donors and the patient before and after FMT. The markedly altered species were highlighted in red color. One biological sample was examined over one experiment.
We further investigated the proportion of recipient fungal community that was derived from donors by fast expectation-maximization microbial source tracking (FEAST). Donor derived fungi instantly took up a proportion as high as 71% in the recipient’s mycobiome on day 1 after FMT (Fig. 4c), followed by a decrease down to 10.3% on day 5, indicating that most of fungal taxa showed transient colonization in the recipient. With subsequent FMTs, the proportion of donor-derived fungal taxa continued to rise followed by a marked decline to 4% on day 120 which suggest that only limited fungal taxa from donors have sustained engraftment in the recipient.
At the taxonomy level, the species Parastagonospora nodorum and Thielavia terrestris significantly dominated the patient’s fungal community before FMT but were deceased following FMT (Fig. 4d). Saccharomyces cerevisiae, which dominated the donors’ fungal community, expanded rapidly on day 1 after the first FMT and decreased after the third FMT in the patient. In contrast, Candida dubliniensis was increased after FMT and remained stable until the last follow up. After the third FMT, Sporisorium reilianum derived from the donor showed high abundance in the patient’s gut after the third FMT but was depleted after the fourth FMT (on day 35 since the first FMT). This was concomitant with a post-FMT recovery of Sclerotinia sclerotiorum, which showed a high relative abundance before FMT. We further performed quantitative PCR on a subset of these significantly altered species, Parastagonospora nodorum, Thielavia terrestris, Candida dubliniensis and Saccharomyces cerevisiae. Consistent with the sequencing results, Parastagonospora nodorum and Thielavia terrestris were significantly decreased, Candida dubliniensis was increased, whereas Saccharomyces cerevisiae was transiently expanded in the feces of the patient after FMT (Supplementary Fig. 6). These findings suggest that FMT may be associated with an expansion of multiple fungal taxa, rather than a recovery of fungal diversity.
To exclude possibility of fungal contamination, we sequenced negative control samples during DNA extraction. The most abundance species in negative controls, such as Talaromyces pinophilus, Cryptococcum neoformans and Alternaria solani, were not detected in any patient’s or in donors’ stool samples (Supplementary Fig. 7). Moreover, the significantly altered species, Parastagonospora nodorum, Thielavia terrestris, Candida dubliniensis and Saccharomyces cerevisiae were not detected in the negative control samples by quantitative PCR (Supplementary Fig. 6). These results suggest that the fungal alteration findings reported here are unlikely to be the result of contamination.
Variable and stable increase in virome diversity after FMT
To characterize alteration in the gut virome, we enriched virus like particles (VLPs) in stool samples and subsequently performed deep metagenomic sequencing on the VLP DNA. The patient’s virome exhibited a high degree of variability in virome diversity over time (Supplementary Fig. 8a) and the overall community composition structure after FMT did not resemble that of the donors’ with the exception at day 15 after the third FMT and at day 35, 48 and 67 after the fourth FMT (Supplementary Fig. 8b). We further investigated the proportion of viruses that was derived from donors in the recipient after FMT. Donor’s viruses gradually took up greater proportions in recipient after each FMT (Fig. 5a). Less than 2% of the recipient’s viral taxa was transferred from donor after the first and second FMTs, whereas after the third FMT, the proportion of donor-derived viral taxa was increased up to 29% by months 3.Fig. 5 Changes in gut viral communities in GvHD patient after FMTs.
a Proportion of viral taxa derived from donors in total taxa in patient’s stool samples. The proportion was calculated by using the method of fast expectation-maximization microbial source tracking (FEAST). One biological sample was examined over one experiment. b Relative abundances of eukaryotic and prokaryotic viruses in the donor and patient fecal samples. One biological sample was examined over one experiment. c Changes in relative abundance of a Torque teno virus in the patient. One biological sample was examined over one experiment. d Richness, Shannon and Simpson diversity of phages in donor and patient stools. e Relative abundances of Microviridae and Caudovirales phages in donor and patient stools. f Heatmap summarizing chronological alterations of 50 most dominant eukaryotic viral species in the patient’s viral community following FMTs at the species level. One biologically independent sample examined over one independent experiment. g Heatmap summarizing chronological alterations of 50 most dominant prokaryotic viral species in the patient’s viral community following FMTs at the species level. The abundance of selected species in a given sample is color-intensified according to the row z-score value, as indicated in the color bar. Blue to red color shades indicate increasing relative abundances.
At day 0, the virome predominantly was comprised of eukaryotic viruses (99.99% of total mapped reads) and few phage reads were detected (0.01%). After the first and second FMT, more than 99% of virus sequences detected were still eukaryotic viruses. Most of the reads were identified as Torque teno virus (Fig. 5c, relative abundance 99.67% in patient versus 0.0834% in donors). This eukaryotic virus, Torque teno virus, maintained high relative abundance in the gut virome after the first and second FMT but was substantially reduced after the third and fourth FMT to an average relative abundance of 53.72% over the period of day 27 to 120. The abundance of Torque teno virus in the feces of patients and donors were further quantified by qPCR, which showed a 2000-fold higher presence in the patient before FMT than that in donors. However, it was decreased shortly after each FMT, and finally maintained at lower levels after 31 day post the first FMT (average 150-fold decrease over the period of day 31 to day 120), compared to the baseline level in the patient before FMT (Supplementary Fig. 9). We reported alterations of the most dominant 50 eukaryotic viral species following FMT, and found that eukaryotic viruses other than Torque teno virus were presented in low abundances and did not display significant changes up to three months after FMT (Fig. 5f).
The relative abundances of phages (prokaryotic viruses) elevated since the third FMT and reached to 41.82% on day 120 after the first FMT (Fig. 5b). Along with slow increases in the relative abundance of phages over the treatment period, a substantial increase in phage diversity was also observed in the patient’s gut virome after the first FMT (Fig. 5d). Members of the bacteriophage lineage Microviridae occupied a large proportion of the patient’s prokaryotic virome before FMT (88.13% in relative abundance), but was subsequently replaced (<10% average relative abundance after FMT) by Caudovirales (11.86% in relative abundance before FMT, >90% in final sample) (Fig. 5e). At the species level, the patient’s prokaryotic viral community was dominated by Parabacteroides phage YZ-2015a (74.3%) and Parabacteroides phage YZ-2015a (13.9%), which both decreased to 0% on day 120 after FMT. After the second FMT, five Enterobacteria phage taxa, one Escherichia phage, two Stx2 converting phage and one Shigella virus were expanded transiently, but were depleted after the forth FMT. In contrast, the five Enterococcus phage taxa maintained at a high relative abundance from day 67 to 120 (Fig. 5g). To exclude the possibility of contamination, we sequenced a negative control sample (reagent control) during VLP extraction and amplification. Only five species were detected in the negative control, which collectively took up <0.4% of the virome across donors and recipient samples (Supplementary Fig. 10). These data suggest that viral alterations reported here are unlikely to be the result of contamination.
Discussion
Resident members of the gut microbiota including bacteria, fungi and viruses are intimately linked with host immunity and human health15,16. The basis for FMT is to alter these microorganisms and their interactions by replacing a “dysbiotic” gut microbiota with “healthy” microbes to treat gut and other non-gut diseases. GvHD is traditionally considered as an immunological disease but can be treated by FMT with promising outcomes10,11. Previous reports have focused on the bacterial community after FMT in GvHD10,11, whereas the role of gut fungi, viruses in GvHD remain unknown.
Our previous study reported that Candida albicans and bacteriophages can impact FMT efficacy in recurrent Clostridium difficile infections13,14. Here, we investigated longitudinal dynamics of the gut bacterial, fungal, and viral communities in a GvHD patient treated with multiple FMTs. We found that the bacterial, fungal, and viral communities responded differently to FMT; The bacterial community in the recipient was gradually recovered with an increased diversity after each FMT, the fungal community showed expansion of several species followed by a decrease in diversity, whereas the viral community varied substantially in composition after multiple FMTs with a stable rise in virome diversity.
Initially, the GvHD patient’s gut bacterial microbiota was characterized by a low diversity, and dominated by Corynebacterium jeikeium, which has been reported to be associated with bacteremia in catheter manipulation17. Given the toxin-producing capability of Corynebacterium which may lead to diarrhea, we performed PCR to identify diphtheria toxin encoding genes in the patient’s fecal microbiome before FMT. We found absence of diphtheria toxin encoding genes, indicating that the diarrhea in the patient might not be caused by Corynebacterium GI infection but by GvHD (Supplementary Fig. 11).
Gut bacterial-fungal interactions is important in maintaining mucosa homeostasis18. In our study, the mycobiota change is opposite to the bacterial microbiota change. We were unable to determine whether the decreased mycobiota diversity is a result of reconstitution of microbial taxa, replacement of donor’s fungal community, or a recovered host immune system. Nonetheless, several fungal species were increased after FMT, such as Candida dubliniensis and Sporisorium reilianum. Alterations of fungal composition associated with FMT warrant further mechanistic investigations to delineate their significance and implications in disease outcomes.
Both eukaryotic and prokaryotic DNA viruses (mostly phages) are constituents of the human gut microbiota, where eukaryotic DNA viruses are minor components compared to bacteriophages19. However, we found a substantial presence of eukaryotic viruses relative to bacteriophages in the patient prior to FMT, whereby the use of immunosuppressants may be associated with the expansion of Torque teno virus20. Torque teno virus was previously reported to be increased in GvHD patient21,22, but it is uncertain whether it associates with occurrence and/or cure of GvHD.
FMT was associated with an increase in the richness of viruses and the ratio of bacteriophages to eukaryotic viruses in the patient’s gut virome. However, the enrichment and/or depletion of exact viral taxa associated with recovery remains to be investigated. Caudovirales bacteriophages were overrepresented in patients with Clostridium difficile infections and were significantly reduced by FMT13. Whereas here we observed a reverse trend of FMT enriching Caudovirales phages in the GvHD patient. As the role of viruses in FMT has not been well studied, future research should focus on changes in the viral community and their relationship with FMT efficacy. Moreover, we did not study RNA viruses which could be potentially important as well in FMT. Such information will be crucial in understanding and enhancing the safety and efficacy of FMT for the treatment of various diseases. The observational nature of this single case precludes generalization of our findings and further larger sample-sized studies are needed to validate the present findings.
In conclusion, our study provides novel insight into alterations of the gut microbiome in GvHD following multiple FMTs. We showed that bacterial, fungal and viral communities responded differently to FMTs. Future FMT practice should consider the role and importance of reconstituting the gut fungi and viruses.
Methods
Ethics statement
This study was approved by Joint Chinese University of Hong Kong-New Territories East Cluster Clinical Research Ethics Committee (The Joint CUHK-NTEC CREC, CREC Ref. No.: 2017.260 and 2018.443, Clinical Trial registry, NCT04014413). The patient and his guardians consented to participate in this study and agreed for publication of research results.
Preparation of donor stools for FMT
Donor stools were obtained from the stool bank of Center for Gut Microbiota Research. To ensure donors were healthy and fit for stool donation, donors were first screened using a questionnaire followed by stool and blood tests to rule out any infectious disease such as HIV, hepatitis B or C, syphilis or any communicable diseases such as inflammatory bowel disease, irritable bowel syndrome, or gastrointestinal malignancy. Shortly after donors provided stool at the Prince of Wales Hospital, samples were diluted with sterile saline (0.9%). This solution was blended and strained through a filter to remove particulate matter. The resulting supernatant was then stored as frozen FMT solutions.
Study subject and design
A 14-year-old male suffering from myelodysplastic syndrome with monosomy 7 underwent HLA-identical sibling allo-HSCT. The patient developed itchy erythematous and maculopapular skin rash over all limbs and body covering 50% of body surface area from Day 14 post-transplant (Day -63, Fig. 1a) and at the time of neutrophil engraftment. The clinical picture was compatible with stage 2 skin GvHD according to the Glucksberg clinical stage of acute GvHD. The patient was treated with intravenous methylprednisolone 2 mg/kg/day with clinical response and the skin rash gradually subsided after steroid treatment. However, at the time of tapering of steroid to 1 mg/kg/day on Day 31 post-transplant (Day -46, Fig. 1a), the patient developed severe abdominal pain, vomiting and diarrhea. The watery diarrhea progressed to bloody diarrhea despite aggressive immunosuppressive treatment. CT scan showed abnormal mucosal enhancement and diffuse long segment inflammatory changes in the small bowel involving whole length of ileum and jejunum with intraluminal hyperdense content consistent with hemorrhage. The large bowel also showed increase in wall thickening and mucosal stratification (Supplementary Fig. 2). Sigmoidoscopy showed hemorrhage in the large colon with mucosal sloughing hence biopsies were not taken due to increased risk of perforation. All infective pathogens including clostridium difficile toxins were excluded in stool and the overall diagnosis was compatible with gastrointestinal GvHD.
The patient was administered four FMTs, and recovery was monitored through subsequent clinical follow-ups (Fig. 1a). Firstly, a pre-FMT stool sample was obtained from the patient on day 0. FMTs were then administered to the patient on day 0, day 5, day 13 and day 25 of the study. We used five stool samples (D8-26, D8-27, D8-28, D8-29, D8-34) from one donor (D8) and one stool sample from another donor (D4). The first, second, third and fourth FMTs were performed using D8-26 and D8-27, D8-28 and D8-29, D8-34, and D4 stools, respectively. During the FMT procedure, 100 ml of FMT solution was infused over 2–3 min into the distal duodenum or jejunum of the patient via oesophago-gastroduodenoscopy (OGD). Post-FMT stools were collected daily from day 1 to day 36, and every half month after the fourth FMT until day 120. The FMT treatment in this patient was experimental. The study complied with the CONSORT guidelines of N-of-1 clinical trial, and pre-specified outcomes related to this patient as part of the broader trial (NCT04014413) will be reported upon trial completion.
16 S rRNA gene sequencing and analysis
The total DNA was extracted from around 0.1 g of stool using the DNeasy PowerSoil Kit (Qiagen catalog number 12888-100) following manufacturer’s instructions. Extracted fecal DNA was used as template in a two-step PCR to amplify the V3 and V4 regions of the 16 S gene. Briefly, PCR reactions were performed in 25 µl reactions containing 1X PCR buffer, 1 mM MgCl2, 0.2 mM of each dNTP, 0.2 µM of each forward (341 F: CCTACGGGNGGCWGCAG) (Klindworth et al., 2013) and reverse (806 R: GGACTACNVGGGTWTCTAAT) (Apprill et al., 2015) primers, 0.625 U HotStarTaq Plus DNA Polymerase (Qiagen catalog number 203605), 1 µl template DNA and molecular biology grade water. Thermocycler settings were as follows: 95 °C for 15 min, followed by 15 cycles of 94 °C for 1 min, 55 °C for 1 min and 72 °C for 3 min, and then 10 cycles of 94 °C for 1 min, 60 °C for 1 min and 72 °C for 3 min, and finally 72 °C for 10 min. The second PCR to ligate sequencing adapters and barcodes to amplicons from the first PCR were performed in 25 µl reactions with the following recipe: 1X PCR buffer, 1 mM MgCl2, 0.2 mM of each dNTP, 0.2 mM each of Nextera index 1 and 2 primers, 0.1 µM each of forward and reverse Golay indexes, 0.625 U HotStarTaq Plus DNA Polymerase, 1 µl template DNA from the first PCR and molecular biology grade water. Thermocycler settings were 95 °C for 3 min, followed by seven cycles of 98 °C for 20 s, 63 °C for 30 s and 72 °C for 1 min, and finally 72 °C for 5 min. PCR amplicons were checked on an agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen catalog number 28706). Purified final products were sent to the Genomics Resource Core Facility at Cornell University for 2 × 300 bp sequencing in an Illumina MiSeq using the v3 Miseq Reagent Kit. Demultiplexed raw sequence data were imported into QIIME2 v2018.6 (https://qiime2.org/). Using the DADA2 workflow23 in QIIME2, PCR primer and low-quality sequences were trimmed, and remaining reads subsequently denoised and merged. Alpha diversity statistics were calculated using representative sequences produced by DADA2. A taxonomy classifier trained on V3 and V4 regions of reference 16S sequence24 (SILVA release 128) was then used to assign taxonomic identities to the representative sequences. The final site-by-species counts table based on exact sequence variants (ESVs)25 was exported from QIIME2, chloroplast and mitochondrial counts removed, and used as input into R for statistical analysis.
Fungi-enriched fecal DNA extraction
Fecal DNA was extracted by using Maxwell® RSC PureFood GMO and Authentication Kit (Promega) with some modifications to increase the yield of fungi DNA. Approximately 100 mg from each stool sample was prewashed with 1 ml ddH2O and pelleted by centrifugation at 13,000 × g for 1 min. The pellet was resuspended in 800 μl TE buffer (pH 7.5), supplemented with 1.6 μl 2-mercaptoethanol and 500 U lyticase (Sigma) digesting cell walls of fungi, and incubated at 37 °C for 60 min, which increase the lysis efficacy of fungal cell. The sample was then centrifuged at 13,000 × g for 2 min and the supernatant was discarded. After this pretreatment, DNA was subsequently extracted from the pellet using a Maxwell® RSC PureFood GMO and Authentication Kit (Promega) following manufacturer’s instructions. Briefly, 1 ml of CTAB buffer was added to the pellet and vortexed for 30 s, then the solution heated at 95 °C for 5 min. After that, samples were vortexed thoroughly with beads (Biospec, 0.5 mm for fungi and 0.1 mm for bacteria,1:1) at maximum speed for 15 min. Following this, 40 µl proteinase K and 20 µl RNase A were added and the mixture Incubated at 70 °C for 10 min. The supernatant was then obtained by centrifuging at 13,000 × g for 5 min and placed in a Maxwell® RSC instrument for DNA extraction. The extracted fecal DNA was used to preform metagenomics sequencing.
Virus-like particles enrichment
Virus-like particles (VLPs) were enriched and other DNA was eliminated according to a protocol described in a previous study13. A 400 μl volume of saline-magnesium buffer (0.1 M NaCl, 0.002% gelatin, 0.008 M MgSO4H2O, 0.05 M Tris pH7.5) was added to 200 mg of stool sample and vortexed for 10 min. The sample was then centrifuged at 2,000 x g and the pellet was discarded. To remove bacterial cells and other residual material, the suspension was filtered through a 0.45 μm and two 0.22 μm filters. The cleared suspension was incubated separately with lysozyme (1 mg/ml at 37 °C for 30 min) and chloroform (0.2x volume at RT for 10 min) to degrade any remaining bacterial and host cell membranes. A DNase cocktail including 1U Baseline zero DNase (Epicenter) and 10U TurboDNaseI (Ambion) was added into the sample and the mixture was incubated at 65 °C for 10 min to eliminate DNA non protected within virus particles. VLPs were lysed (4% SDS plus 38 mg/ml Proteinase K at 56 °C for 20 min), treated with CTAB (2.5% CTAB plus 0.5 M NaCl at 65 °C for 10 min), and nucleic acids were extracted with phenol: chloroform pH 8.0 (Invitrogen). The aqueous fraction was washed once with an equal volume of chloroform, purified and concentrated on a column (DNA Clean & Concentrator TM 89-5, Zymo Research). VLP DNA was amplified for 2 h using the Phi29 polymerase (GenomiPhi V2 kit, GE Healthcare) prior to sequencing. Four independent amplification reactions were performed for each sample and pooled together to reduce amplification bias.
Metagenomics sequencing and analysis
Fungi-enriched DNA and VLP-enriched DNA were sheared into fragments of 150 bp VLP by ultrasonication (Covaris), and used to construct sequencing libraries. Libraries were prepared through the processes of end repairing, A-tailing, adapter ligation, size-select library and PCR amplification. DNA libraries from fungi-enriched DNA were sequenced using the Illumina HiSeq X Ten at the Beijing Genomics Institute (BGI) to generate 150 bp paired-end reads, yielding an average 67 ± 8.1 million reads (12 G data) per sample (Supplementary Table 2). VLP-enriched DNA libraries were sequenced (also 150 bp paired-end) by on the Illumina NovaSeq 6000 at Novogene, Beijing, China. An average of 26 ± 3.3 million reads (6 G data) per sample were obtained (Supplementary Table 3).
Raw sequence reads were filtered and quality-trimmed using Trimmomatic v0.3626 as follows: 1. Trimming low quality base (quality score < 20), 2. Removing reads shorter than 50 bp, 3. Tracing and cutting off sequencing adapters. Contaminating human reads were filtering using Kneaddata v0.7.3 (https://bitbucket.org/biobakery/kneaddata/wiki/Home, Reference database: GRCh38 p12,https://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.38/) with default parameters.
Profiling of bacterial taxonomy and functional composition was extracted using humann2 v0.11.127 from metagenomes of fungi-enriched DNA, which included taxonomic identification via MetaPhlAn2 by mapping reads to clade-specific markers28, annotation of species pangenomes through Bowtie2 v2.3.529 with reference to the ChocoPhlAn database (http://huttenhower.sph.harvard.edu/humann2_data/chocophlan/chocophlan.tar.gz), translated search of unmapped reads with DIAMOND v2.0.430 against the UniRef90 universal protein reference database (https://www.uniprot.org/help/uniref)31, and pathway collection from the generated gene list with reference to the Metacyc database (https://metacyc.org/)32. Gene families and pathway abundances estimated from the data were normalized according to relative abundances of their corresponding microbial taxa reported by MetaPhlAn2 v2.96.1-0.
Taxonomic profiling of fungi was performed on metagenomes sequenced from fungi-enriched DNA, using HumanMycobiomeScan33. The database was based on the complete fungal genomes available at the NCBI website (downloaded in January 2019). A second database containing 38,000 entries, corresponding to 265 different fungal genomes, was available for download (referred to as Fungi_FULL) on the project web page (https://sourceforge.net/projects/hmscan/). Briefly, metagenomic reads were aligned to the fungal genome database using via Bowtie 2 v2.3.534 to identify candidate fungal reads. Afterwards, sequences were trimmed for low quality scores (less than 3) and reads shorter than 60 bases are discarded. To remove human and bacterial contaminations, a double filtering step was performed using BMTagger v3.101-1 against the hg19 database for human sequences (https://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.13/) and a custom bacterial database which used for ViromeScan35. Then, the filtered reads were matched again to the fungal database using Bowtie 234 for definitive taxonomic assignment. The taxonomic affiliation was deduced by matching the result of the taxonomic assignment with an annotated list of fungal species, containing the entire phylogenetic classification for each genome included in the database. At the end of the process, the results were normalized by the length of the references included in the database, and the relative abundance profiles were obtained.
Taxonomic profiling of virus was performed on metagenomes sequenced from VLP-enriched DNA, using Kraken 2 v2.0.7-beta. The complete NCBI viral RefSeq databases (accessed on October 20, 2018)36 were downloaded (https://www.ncbi.nlm.nih.gov/refseq/). Kraken 2 examined the k-mers within a query sequence and used the information within those k-mers to query a database. sequence reads were mapped to the lowest common ancestor of all reference genomes with exact k-mer matches. Each query was thereafter classified to a taxon with the highest total hits of k-mers matched by pruning the general taxonomic trees affiliated with mapped genomes.
Quantitative PCR for detection of Parastagonospora nodorum, Thielavia terrestris, Candida dubliniensis and Saccharomyces cerevisiae in fungi-enriched fecal DNA
Relative quantification was achieved using the standard curve technique.
Parastagonospora nodorum, Thielavia terrestris, Candida dubliniensis and Saccharomyces cerevisiae were quantified by SYBR Green I assays using the SYBR® Premix Ex Taq ™, and total fungi was quantified by TaqMan assays using Taqman Premix Ex Taq ™ (TaKaRa). Standard curves were established by qPCR of serial dilutions of pUC57 plasmids harboring target genes (Supplementary Table 4). The sequences of the primers and genes which were used to generate standard curve in this study are detailed in Supplementary Table 4. The mass of four target species and total fungi were obtained through interpolation from the standard curve using CT value. Then the mass of three target species in each sample can be normalized by their respective fungal mass to calculate a normalized target value (Normalized target = Mass of each fungal species/Mass of total fungi). The normalized target values in the fecal samples from patient after FMT or donor are divided by normalized target values in patient’s baseline sample to calculate the fold change (Fold change = Normalized target of post-FMT samples or donors’ sample / Normalized target pre-FMT samples).
Quantitative PCR for detection of Torque teno virus load in human fecal Virus-like particles DNA
Total Torque teno virus (TTVs) loads in patient and donor were quantified by TaqMan qPCR analysis (Premix Ex TaqTM, TaKaRa) using primers22: forward primer 5′-GTGCCGIAGGTGAGTTTA-3′; reverse primer 5′-AGCCCGGCCAGTCC-3′; probe 5′-TCAAGGGGCAATTCGGGCT-3′. The absolute copy numbers of TTVs were determined from standard curves established by qPCR of serial dilutions of pUC57 plasmids harboring target genes.
PCR detection of diphtheria toxin gene in fungi-enriched DNA
The PCR assay was performed by using Primers, Tox1(ATCCACTTTTAGTGCGAGAACCTTCGTCA) and Tox2 (GAAAACTTTTCTTCGTACCACGGGACTAA) (248 bp)37, following a condition (30 cycled at 98 °C for 10 s, 58 °C for 30 s and 72 °C 10 s). DNA extracted from C. diphtheriae ATCC 13812 and C. diphtheriae ATCC 19409 which can produce diphtheria toxin was used as positive controls.
Statistics
Counts data from bacteria, viruses and fungi were imported into R (v3.5.1). Alpha diversity metrics (richness and diversity) and rarefaction were calculated using the phyloseq package (v1.26.0). Principal coordinate analysis (PCoA) based on Bray-Curtis dissimilarities of the microbial community structure were performed using the vegan package (v2.5-3). Heat maps were generated using the pheatmap package (v1.0.10) and was based on the Pearson correlation coefficient between different pathways in terms of their abundances across all samples. The proportion of taxa derived from donors in total taxa of patient’s stool samples was calculated by fast expectation-maximization microbial source tracking (FEAST)38.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
Supplementary information
Supplementary Information
Peer Review File
Reporting Summary
Peer review information: Nature Communications thanks Marcel van den Brink and the other, anonymous reviewer(s) for their contribution to the peer review of this work. Peer review reports are available.
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
These authors contributed equally: Fen Zhang, Tao Zuo, Yun Kit Yeoh.
These authors jointly supervised this work: Paul K. S. Chan, Siew C. Ng.
Supplementary information
Supplementary information is available for this paper at 10.1038/s41467-020-20240-x.
Acknowledgements
We acknowledge a seed fund for Gut Microbiome Research provided by the Faculty of Medicine, The Chinese University of Hong Kong
Author contributions
F.Z. and T.Z. performed the experiments. F.Z., T.Z. and Y.K.Y. conducted data analysis and drafted the manuscript. F.C., C.C.M. and C.K.L. performed allogenic haemotopoietic stem cell transplantation (allo-HSCT) and fecal microbiota transplantation (FMT) in clinic and provided clinical data. W.T., K.C. and M.H. collected the clinical samples and data. K.Y., Q.L. and C.P.C. helped with DNA sample preparation and data analysis. F.K.L.C. provided critical comments on the manuscript. S.N. and P.C. designed, supervised the study and revised the manuscript.
Data availability
16 S rRNA gene sequencing data are available in the NCBI Sequence Read Archive under BioProject PRJNA515137. Metagenomic sequence data generated from fungi-enriched fecal DNA and virus like particles (VLPs)-enriched fecal viral DNA for this study are available in the NCBI Sequence Read Archive under BioProject accession PRJNA641975.
The public reference databases used in this study are as follows: GRCh38 p12 (https://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.38/), ChocoPhlAn database (http://huttenhower.sph.harvard.edu/humann2_data/chocophlan/chocophlan.tar.gz), UniRef90 universal protein reference database (https://www.uniprot.org/help/uniref), Metacyc database (https://metacyc.org/), Fungal database from HumanMycobiomeScan (https://sourceforge.net/projects/hmscan/), The complete NCBI viral RefSeq databases (https://www.ncbi.nlm.nih.gov/refseq/).
All other relevant data are available from the authors.
Competing interests
The authors declare no competing interests. | AMIKACIN, BUDESONIDE, CEFEPIME HYDROCHLORIDE, CIDOFOVIR, CYCLOSPORINE, INFLIXIMAB, MEROPENEM, METHYLPREDNISOLONE, MICAFUNGIN SODIUM, RUXOLITINIB, SULFAMETHOXAZOLE\TRIMETHOPRIM, THYMOCYTE IMMUNE GLOBULIN NOS | DrugsGivenReaction | CC BY | 33397897 | 19,108,647 | 2021-01-04 |
What was the administration route of drug 'METHYLPREDNISOLONE'? | Longitudinal dynamics of gut bacteriome, mycobiome and virome after fecal microbiota transplantation in graft-versus-host disease.
Fecal microbiota transplant (FMT) has emerged as a potential treatment for severe colitis associated with graft-versus-host disease (GvHD) following hematopoietic stem cell transplant. Bacterial engraftment from FMT donor to recipient has been reported, however the fate of fungi and viruses after FMT remains unclear. Here we report longitudinal dynamics of the gut bacteriome, mycobiome and virome in a teenager with GvHD after receiving four doses of FMT at weekly interval. After serial FMTs, the gut bacteriome, mycobiome and virome of the patient differ from compositions before FMT with variable temporal dynamics. Diversity of the gut bacterial community increases after each FMT. Gut fungal community initially shows expansion of several species followed by a decrease in diversity after multiple FMTs. In contrast, gut virome community varies substantially over time with a stable rise in diversity. The bacterium, Corynebacterium jeikeium, and Torque teno viruses, decrease after FMTs in parallel with an increase in the relative abundance of Caudovirales bacteriophages. Collectively, FMT may simultaneously impact on the various components of the gut microbiome with distinct effects.
Introduction
Allogenic hematopoietic stem cell transplant (allo-HSCT) is a promising therapy for hematological disorders, however, 35–45% of recipients experience serious complications arising from allo-HSCT. These complications, termed graft-versus-host disease (GvHD), is associated with up to 25% mortality1–3. Emerging evidence suggests that changes in the gut microbiota composition are associated with the occurrence of GvHD1. Multiple factors contributed to reduced microbiota diversity in patients with allo-HSCT, including recurrent use of broad-spectrum antibiotics, administration of chemotherapy and/or radiation, and altered nutritional status1. In murine and human studies, allogeneic bone marrow transplantation (BMT) led to a loss of overall bacterial diversity, expansion of Lactobacillales and loss of Clostridiales4,5. Alterations in the gut viral community are also associated with enteric GVHD6,7. For instance, human herpesvirus 6 was detected in blood6,7, and picornaviruses were detected in stools of patients with acute GvHD post HSCT8.
Fecal microbiota transplantation (FMT), the administration of fecal suspensions from healthy donors into a patient’s gastrointestinal tract, is an effective bacteriotherapy in recurrent Clostridioides difficile infections9. FMT has been shown to be associated with restoration of diversity of gut bacterial community. Recently, small case series of up to four subjects have used FMT as a treatment for refractory GvHD10,11. FMT was associated with improved gastrointestinal symptoms, reduced diarrhea and alterations in the gut microbiota in patients with refractory enteric GvHD3,12.
Whilst larger clinical studies are required to confirm the safety and efficacy of FMT for GvHD, this life-threatening disease requires immediate attention in some patients. Most studies have focused on restoration of bacterial diversity and little is known of the role of gut fungi and viruses in FMT. Two studies recently reported that Candida albicans and bacteriophages influenced FMT efficacy in recurrent Clostridium difficile infections, suggesting that alterations in gut viruses and fungi in response to FMT are also important for treatment outcomes13,14.
Here, we investigate the longitudinal dynamics of the gut bacteriome (bacterial microbiome), mycobiome (fungal microbiome) and virome (viral microbiome) in a teenager with stage IV GvHD with four doses of FMT at weekly interval. Apart from 16 S rRNA gene and shotgun metagenomics sequencing for bacteriome profiling, we enhance fungal extraction and enrich virus like particles (VLPs) in fecal DNA preparations and perform deep metagenomic sequencing on the fungi-enriched and viruses-enriched DNA extractions respectively, to profile the gut mycobiome and virome. We show discrepant alteration patterns of the gut bacteriome, mycobiome and virome in the recipient after FMT.
Results
Clinical characteristics of patient with severe GvHD receiving FMT
A 14-year-old male suffering from myelodysplastic syndrome with monosomy 7 underwent human leukocyte antigen (HLA)-identical sibling allo-HSCT. The patient developed stage II skin GvHD (rash 25–50%), stage IV gut GvHD with profuse bloody diarrhea and significant functional impairment and overall grade IV life threatening GvHD shortly after allo-HSCT. The patient failed to respond to methylprednisolone, Anti-thymocyte globulin (ATG), cyclosporine A, infliximab, ruxolitinib and entocort (Supplementary Fig. 1a). Computed tomography imaging showed significant thickening of the small bowel and colon suggestive of severe intestinal inflammation (Supplementary Fig. 2). He received the first FMT (day 0), 77 days after allo-HSCT, followed by three additional FMTs at weekly interval after the first FMT (Fig. 1a). The first three FMTs were performed using stool from a single donor (D8) and the fourth FMT from a different donor (D4). The antibiotic history of the patient is shown in Supplementary Fig. 1b.Fig. 1 Study schematic and clinical outcome.
a GvHD patient received four FMTs. The first three (FMT1, FMT2, FMT3) were performed using stool from a single donor, D8 and the fourth (FMT4) from a different donor D4. a Timeline of HSCT, GvHD onset, FMT treatment, stool collection and sequencing strategy. b Number of bowel openings and stool volume of the patient before and after FMT. Red arrows represent fecal transplant using donor D8, black arrow represents fecal transplant using donor D4. One biological sample was examined over one experiment.
Increased diversity of gut bacterial microbiota after FMT
We assessed alterations in the gut bacterial community in the patient before and after FMTs using 16 S ribosomal RNA gene sequencing. Changes in alpha diversity and community composition over time are summarized in Fig. 2a–c. Before FMT, only two exact sequence variants (ESVs) identified as Corynebacterium were detected in the patient’s stools. This observation corresponded with alpha diversity metrics showing low species richness and diversity relative to donor and post FMT samples (Fig. 2a). On day one immediately after the first FMT, four Bacteroides and nine Enterococcus ESVs previously undetected in the patient’s stool became dominant and Corynebacterium was no longer detectable (Fig. 2c). Interestingly, most of these 13 ESVs were either absent or below detection in the corresponding donor (D8) stool. The Bacteroides ESVs persisted in the patient’s stools throughout the five days, whereas the Enterococcus ESVs generally declined to undetectable levels, most around day 3. Similarly, two other Bacteroides and one Bifidobacterium ESV detected in the donor stool (D8 lots 26 and 27, Fig. 2c) steadily declined in the patient from day 1 onwards. This loss of ESVs was reflected in the community alpha diversity in which richness and diversity declined after day 2 (Fig. 2a). These findings suggest that the gut microbiota of the patient may be altered as early as one day after FMT, and that not all donor microorganisms could establish colonization in the recipient.Fig. 2 Changes in gut bacterial community composition in GvHD patient after FMTs.
a Richness, Shannon and Simpson diversity of bacterial communities in donor stools and the patient before and after FMTs. b Principal coordinate analysis (PCOA) of bacterial community composition in the patient following FMT based on Bray-Curtis dissimilarities. c Heat map summarizing fecal bacterial community composition in donor stools and the patient. Increasing relative abundances are representing by lighter colors (black to yellow). Taxonomic labels on left of figure indicate phylum assignments (class-level for Proteobacteria), labels on right indicate genus. Pre-FMT represents stool sample collected before the first FMT. FMT1, FMT2, FMT3, and FMT4 represent stool samples collected after the 1st (days 1–5), 2nd (day 6–13), 3rd (day 14–25) and 4th (day 27–120) FMTs respectively. D8-26, D8-27, D8-28, D8-29, D8-34 indicate fecal samples collected from donor D8 on different days, whereas only one fecal sample collected from donor D4 was used in the FMT. FMT1, FMT2, FMT3, FMT4 were performed using D8-26 and D8-27, D8-28 and D8-29, D8-34, D4 respectively. All analyses were based on bacterial profiles from 16 S rRNA gene sequencing data.
After the second FMT using different stool from the same donor (D8), the richness and diversity of the patient’s gut bacteriome increased (Fig. 2a). This time, a larger variety of Firmicutes, Fusobacteria and Proteobacteria ESVs were detected in the patient immediately after the second transplant (day 7), and most persisted until the end of the study (Fig. 2c). These observations suggest that the first FMT may have a priming effect on the patient’s gut community, allowing donor microorganisms from the second FMT to colonize the recipient. Two additional FMTs were subsequently given with stool from a second donor (D4) to increase diversity of microorganisms. After the third FMT, there were no major alterations in the alpha diversity or the composition of the patient’s gut bacteriome, compared to that after the first two transplants (Fig. 2a, c). A number of Bacteroides and Faecalibacterium ESVs from the fourth donor stool (donor D4) became established in the patient’s gut (Fig. 2c). Overall changes of the patient’s gut bacteriome were depicted via principal coordinate analysis (PCoA). The first two FMTs was associated with large shifts as shown by clustering of day 1–5 and day 7–13 profiles to the exclusion of samples from subsequent days (Fig. 2b), which was also reflected by the alpha diversity values in which community richness and diversity of the patient’s stool stabilized after the second FMT (Fig. 2a). Stool bacterial communities from day 67 onward appeared to cluster away from samples immediately following the fourth FMT, suggestive of fluctuations in the patient’s gut microbial communities. Nevertheless, these post-FMT mcirobiome profiles did not resemble disease baseline microbiome profile (day 0 before FMT).
To gain high-resolution insight into the bacterial microbiota, a subset of samples were analyzed by metagenomic sequencing and the results showed similar alterations with that measured via 16 S rRNA sequencing after FMT (Supplementary Fig. 3). Three predominant species were detected in the recipient’s stool after FMTs, including Alistipes putredinis, Clostridium nexile and Ruminococcus gnavu (Supplementary Fig. 3).
Improved gut microbiome functionality after FMT
We next investigated functional alterations in the bacterial community following FMTs, total bulk DNA sequencing reads from the metagenomic dataset were queried against reference databases to identify genes and their corresponding metabolic pathways (MetaCyc annotation). In the stool collected at baseline (day 0 before FMT), a large proportion of sequences could not be classified (>95% unmapped, Supplementary Fig. 4). The richness of genes and pathways showed no great difference between donors and patient before and after FMT (Supplementary Fig. 5). However, Shannon and Simpson diversity of the genes and pathways in the patient were markedly lower than that in donor (Fig. 3a), which is consistent with a low taxonomic diversity (Fig. 2a). After the first FMT, there was a substantial increase in the proportion of classifiable genes and pathways (Supplementary Fig. 4). In contrast to taxonomic reconstitution in which only several ESVs from the genera Bacteroides and Enterococcus were detected in the patient (Fig. 2c), Shannon and Simpson diversity of genes and pathways were increased after the first FMT (Fig. 3a), and the overall functional gene composition was comparable to the donors (Fig. 3b). After the second FMT, the diversity of genes and pathway remained stable until the last follow-up, accompanied by an increase in the bacterial diversity at the taxonomical level. After FMT, genes and pathways primarily related to metabolisms of lipids, carbohydrates, amino acids, nucleotides and energy were restored (Fig. 3c). These findings suggest that functions of microbial community might be promptly reconstructed following FMT with less fluctuations in functional content when compared with taxonomic configuration.Fig. 3 Changes in bacterial community function in GvHD patient associated with FMTs.
a α-diversity (Shannon and Simpson diversity) plot of gene families and pathways. These values were calculated based on gene and pathway relative abundances. b Principal coordinate analysis of Bray-Curtis dissimilarities based on abundances of functional pathways detected in donor and patient stools. Pre-FMT represents stool sample collected before the first FMT. FMT1, FMT2, FMT3, and FMT4 represent stool samples collected after the 1st (day 1-5), 2nd (day 7-13), 3rd (day 15-25) and 4th (day 27-120) FMTs respectively. c Heat map summarizing changes in patient’s gut microbial community function following FMT. Pathways with higher relative abundances are shaded red, whereas pathways with low relative abundances are shaded blue.
Durable engraftment of donor-derived fungi after FMT
To characterize the changes of the gut mycobiota in the patient following multiple FMTs, we performed fungi-enriched fecal DNA extraction, ultra-deep metagenomic sequencing and profiled the fungal composition. Overall, the patient showed a decrease in the richness (Chao1) and diversity (both Shannon and Simpson indices) of the gut mycobiome after FMT (Fig. 4a). The fecal mycobiome compositions at later time points after serial FMTs were comparable to the fecal mycobiomes of the donor D8 (D8-26 and D8-34) (Fig. 4b).Fig. 4 Changes in gut fungal community composition in GvHD patient after FMTs.
a Richness, Shannon and Simpson diversity of fungal communities in donor stools and the patient before and after FMTs. b PCoA ordination based on Bray-Curtis dissimilarities of the patient’s gut mycobiota showing progression over time. Dots represent samples labeled according to their respective time-points and are colored to visually group samples according to FMT timeline. c Proportion of fungal taxa derived from donors in total taxa in patient’s stool samples. The proportion was calculated by using the method of fast expectation-maximization microbial source tracking (FEAST). d Species-level proportions of the fecal mycobiota in donors and the patient before and after FMT. The markedly altered species were highlighted in red color. One biological sample was examined over one experiment.
We further investigated the proportion of recipient fungal community that was derived from donors by fast expectation-maximization microbial source tracking (FEAST). Donor derived fungi instantly took up a proportion as high as 71% in the recipient’s mycobiome on day 1 after FMT (Fig. 4c), followed by a decrease down to 10.3% on day 5, indicating that most of fungal taxa showed transient colonization in the recipient. With subsequent FMTs, the proportion of donor-derived fungal taxa continued to rise followed by a marked decline to 4% on day 120 which suggest that only limited fungal taxa from donors have sustained engraftment in the recipient.
At the taxonomy level, the species Parastagonospora nodorum and Thielavia terrestris significantly dominated the patient’s fungal community before FMT but were deceased following FMT (Fig. 4d). Saccharomyces cerevisiae, which dominated the donors’ fungal community, expanded rapidly on day 1 after the first FMT and decreased after the third FMT in the patient. In contrast, Candida dubliniensis was increased after FMT and remained stable until the last follow up. After the third FMT, Sporisorium reilianum derived from the donor showed high abundance in the patient’s gut after the third FMT but was depleted after the fourth FMT (on day 35 since the first FMT). This was concomitant with a post-FMT recovery of Sclerotinia sclerotiorum, which showed a high relative abundance before FMT. We further performed quantitative PCR on a subset of these significantly altered species, Parastagonospora nodorum, Thielavia terrestris, Candida dubliniensis and Saccharomyces cerevisiae. Consistent with the sequencing results, Parastagonospora nodorum and Thielavia terrestris were significantly decreased, Candida dubliniensis was increased, whereas Saccharomyces cerevisiae was transiently expanded in the feces of the patient after FMT (Supplementary Fig. 6). These findings suggest that FMT may be associated with an expansion of multiple fungal taxa, rather than a recovery of fungal diversity.
To exclude possibility of fungal contamination, we sequenced negative control samples during DNA extraction. The most abundance species in negative controls, such as Talaromyces pinophilus, Cryptococcum neoformans and Alternaria solani, were not detected in any patient’s or in donors’ stool samples (Supplementary Fig. 7). Moreover, the significantly altered species, Parastagonospora nodorum, Thielavia terrestris, Candida dubliniensis and Saccharomyces cerevisiae were not detected in the negative control samples by quantitative PCR (Supplementary Fig. 6). These results suggest that the fungal alteration findings reported here are unlikely to be the result of contamination.
Variable and stable increase in virome diversity after FMT
To characterize alteration in the gut virome, we enriched virus like particles (VLPs) in stool samples and subsequently performed deep metagenomic sequencing on the VLP DNA. The patient’s virome exhibited a high degree of variability in virome diversity over time (Supplementary Fig. 8a) and the overall community composition structure after FMT did not resemble that of the donors’ with the exception at day 15 after the third FMT and at day 35, 48 and 67 after the fourth FMT (Supplementary Fig. 8b). We further investigated the proportion of viruses that was derived from donors in the recipient after FMT. Donor’s viruses gradually took up greater proportions in recipient after each FMT (Fig. 5a). Less than 2% of the recipient’s viral taxa was transferred from donor after the first and second FMTs, whereas after the third FMT, the proportion of donor-derived viral taxa was increased up to 29% by months 3.Fig. 5 Changes in gut viral communities in GvHD patient after FMTs.
a Proportion of viral taxa derived from donors in total taxa in patient’s stool samples. The proportion was calculated by using the method of fast expectation-maximization microbial source tracking (FEAST). One biological sample was examined over one experiment. b Relative abundances of eukaryotic and prokaryotic viruses in the donor and patient fecal samples. One biological sample was examined over one experiment. c Changes in relative abundance of a Torque teno virus in the patient. One biological sample was examined over one experiment. d Richness, Shannon and Simpson diversity of phages in donor and patient stools. e Relative abundances of Microviridae and Caudovirales phages in donor and patient stools. f Heatmap summarizing chronological alterations of 50 most dominant eukaryotic viral species in the patient’s viral community following FMTs at the species level. One biologically independent sample examined over one independent experiment. g Heatmap summarizing chronological alterations of 50 most dominant prokaryotic viral species in the patient’s viral community following FMTs at the species level. The abundance of selected species in a given sample is color-intensified according to the row z-score value, as indicated in the color bar. Blue to red color shades indicate increasing relative abundances.
At day 0, the virome predominantly was comprised of eukaryotic viruses (99.99% of total mapped reads) and few phage reads were detected (0.01%). After the first and second FMT, more than 99% of virus sequences detected were still eukaryotic viruses. Most of the reads were identified as Torque teno virus (Fig. 5c, relative abundance 99.67% in patient versus 0.0834% in donors). This eukaryotic virus, Torque teno virus, maintained high relative abundance in the gut virome after the first and second FMT but was substantially reduced after the third and fourth FMT to an average relative abundance of 53.72% over the period of day 27 to 120. The abundance of Torque teno virus in the feces of patients and donors were further quantified by qPCR, which showed a 2000-fold higher presence in the patient before FMT than that in donors. However, it was decreased shortly after each FMT, and finally maintained at lower levels after 31 day post the first FMT (average 150-fold decrease over the period of day 31 to day 120), compared to the baseline level in the patient before FMT (Supplementary Fig. 9). We reported alterations of the most dominant 50 eukaryotic viral species following FMT, and found that eukaryotic viruses other than Torque teno virus were presented in low abundances and did not display significant changes up to three months after FMT (Fig. 5f).
The relative abundances of phages (prokaryotic viruses) elevated since the third FMT and reached to 41.82% on day 120 after the first FMT (Fig. 5b). Along with slow increases in the relative abundance of phages over the treatment period, a substantial increase in phage diversity was also observed in the patient’s gut virome after the first FMT (Fig. 5d). Members of the bacteriophage lineage Microviridae occupied a large proportion of the patient’s prokaryotic virome before FMT (88.13% in relative abundance), but was subsequently replaced (<10% average relative abundance after FMT) by Caudovirales (11.86% in relative abundance before FMT, >90% in final sample) (Fig. 5e). At the species level, the patient’s prokaryotic viral community was dominated by Parabacteroides phage YZ-2015a (74.3%) and Parabacteroides phage YZ-2015a (13.9%), which both decreased to 0% on day 120 after FMT. After the second FMT, five Enterobacteria phage taxa, one Escherichia phage, two Stx2 converting phage and one Shigella virus were expanded transiently, but were depleted after the forth FMT. In contrast, the five Enterococcus phage taxa maintained at a high relative abundance from day 67 to 120 (Fig. 5g). To exclude the possibility of contamination, we sequenced a negative control sample (reagent control) during VLP extraction and amplification. Only five species were detected in the negative control, which collectively took up <0.4% of the virome across donors and recipient samples (Supplementary Fig. 10). These data suggest that viral alterations reported here are unlikely to be the result of contamination.
Discussion
Resident members of the gut microbiota including bacteria, fungi and viruses are intimately linked with host immunity and human health15,16. The basis for FMT is to alter these microorganisms and their interactions by replacing a “dysbiotic” gut microbiota with “healthy” microbes to treat gut and other non-gut diseases. GvHD is traditionally considered as an immunological disease but can be treated by FMT with promising outcomes10,11. Previous reports have focused on the bacterial community after FMT in GvHD10,11, whereas the role of gut fungi, viruses in GvHD remain unknown.
Our previous study reported that Candida albicans and bacteriophages can impact FMT efficacy in recurrent Clostridium difficile infections13,14. Here, we investigated longitudinal dynamics of the gut bacterial, fungal, and viral communities in a GvHD patient treated with multiple FMTs. We found that the bacterial, fungal, and viral communities responded differently to FMT; The bacterial community in the recipient was gradually recovered with an increased diversity after each FMT, the fungal community showed expansion of several species followed by a decrease in diversity, whereas the viral community varied substantially in composition after multiple FMTs with a stable rise in virome diversity.
Initially, the GvHD patient’s gut bacterial microbiota was characterized by a low diversity, and dominated by Corynebacterium jeikeium, which has been reported to be associated with bacteremia in catheter manipulation17. Given the toxin-producing capability of Corynebacterium which may lead to diarrhea, we performed PCR to identify diphtheria toxin encoding genes in the patient’s fecal microbiome before FMT. We found absence of diphtheria toxin encoding genes, indicating that the diarrhea in the patient might not be caused by Corynebacterium GI infection but by GvHD (Supplementary Fig. 11).
Gut bacterial-fungal interactions is important in maintaining mucosa homeostasis18. In our study, the mycobiota change is opposite to the bacterial microbiota change. We were unable to determine whether the decreased mycobiota diversity is a result of reconstitution of microbial taxa, replacement of donor’s fungal community, or a recovered host immune system. Nonetheless, several fungal species were increased after FMT, such as Candida dubliniensis and Sporisorium reilianum. Alterations of fungal composition associated with FMT warrant further mechanistic investigations to delineate their significance and implications in disease outcomes.
Both eukaryotic and prokaryotic DNA viruses (mostly phages) are constituents of the human gut microbiota, where eukaryotic DNA viruses are minor components compared to bacteriophages19. However, we found a substantial presence of eukaryotic viruses relative to bacteriophages in the patient prior to FMT, whereby the use of immunosuppressants may be associated with the expansion of Torque teno virus20. Torque teno virus was previously reported to be increased in GvHD patient21,22, but it is uncertain whether it associates with occurrence and/or cure of GvHD.
FMT was associated with an increase in the richness of viruses and the ratio of bacteriophages to eukaryotic viruses in the patient’s gut virome. However, the enrichment and/or depletion of exact viral taxa associated with recovery remains to be investigated. Caudovirales bacteriophages were overrepresented in patients with Clostridium difficile infections and were significantly reduced by FMT13. Whereas here we observed a reverse trend of FMT enriching Caudovirales phages in the GvHD patient. As the role of viruses in FMT has not been well studied, future research should focus on changes in the viral community and their relationship with FMT efficacy. Moreover, we did not study RNA viruses which could be potentially important as well in FMT. Such information will be crucial in understanding and enhancing the safety and efficacy of FMT for the treatment of various diseases. The observational nature of this single case precludes generalization of our findings and further larger sample-sized studies are needed to validate the present findings.
In conclusion, our study provides novel insight into alterations of the gut microbiome in GvHD following multiple FMTs. We showed that bacterial, fungal and viral communities responded differently to FMTs. Future FMT practice should consider the role and importance of reconstituting the gut fungi and viruses.
Methods
Ethics statement
This study was approved by Joint Chinese University of Hong Kong-New Territories East Cluster Clinical Research Ethics Committee (The Joint CUHK-NTEC CREC, CREC Ref. No.: 2017.260 and 2018.443, Clinical Trial registry, NCT04014413). The patient and his guardians consented to participate in this study and agreed for publication of research results.
Preparation of donor stools for FMT
Donor stools were obtained from the stool bank of Center for Gut Microbiota Research. To ensure donors were healthy and fit for stool donation, donors were first screened using a questionnaire followed by stool and blood tests to rule out any infectious disease such as HIV, hepatitis B or C, syphilis or any communicable diseases such as inflammatory bowel disease, irritable bowel syndrome, or gastrointestinal malignancy. Shortly after donors provided stool at the Prince of Wales Hospital, samples were diluted with sterile saline (0.9%). This solution was blended and strained through a filter to remove particulate matter. The resulting supernatant was then stored as frozen FMT solutions.
Study subject and design
A 14-year-old male suffering from myelodysplastic syndrome with monosomy 7 underwent HLA-identical sibling allo-HSCT. The patient developed itchy erythematous and maculopapular skin rash over all limbs and body covering 50% of body surface area from Day 14 post-transplant (Day -63, Fig. 1a) and at the time of neutrophil engraftment. The clinical picture was compatible with stage 2 skin GvHD according to the Glucksberg clinical stage of acute GvHD. The patient was treated with intravenous methylprednisolone 2 mg/kg/day with clinical response and the skin rash gradually subsided after steroid treatment. However, at the time of tapering of steroid to 1 mg/kg/day on Day 31 post-transplant (Day -46, Fig. 1a), the patient developed severe abdominal pain, vomiting and diarrhea. The watery diarrhea progressed to bloody diarrhea despite aggressive immunosuppressive treatment. CT scan showed abnormal mucosal enhancement and diffuse long segment inflammatory changes in the small bowel involving whole length of ileum and jejunum with intraluminal hyperdense content consistent with hemorrhage. The large bowel also showed increase in wall thickening and mucosal stratification (Supplementary Fig. 2). Sigmoidoscopy showed hemorrhage in the large colon with mucosal sloughing hence biopsies were not taken due to increased risk of perforation. All infective pathogens including clostridium difficile toxins were excluded in stool and the overall diagnosis was compatible with gastrointestinal GvHD.
The patient was administered four FMTs, and recovery was monitored through subsequent clinical follow-ups (Fig. 1a). Firstly, a pre-FMT stool sample was obtained from the patient on day 0. FMTs were then administered to the patient on day 0, day 5, day 13 and day 25 of the study. We used five stool samples (D8-26, D8-27, D8-28, D8-29, D8-34) from one donor (D8) and one stool sample from another donor (D4). The first, second, third and fourth FMTs were performed using D8-26 and D8-27, D8-28 and D8-29, D8-34, and D4 stools, respectively. During the FMT procedure, 100 ml of FMT solution was infused over 2–3 min into the distal duodenum or jejunum of the patient via oesophago-gastroduodenoscopy (OGD). Post-FMT stools were collected daily from day 1 to day 36, and every half month after the fourth FMT until day 120. The FMT treatment in this patient was experimental. The study complied with the CONSORT guidelines of N-of-1 clinical trial, and pre-specified outcomes related to this patient as part of the broader trial (NCT04014413) will be reported upon trial completion.
16 S rRNA gene sequencing and analysis
The total DNA was extracted from around 0.1 g of stool using the DNeasy PowerSoil Kit (Qiagen catalog number 12888-100) following manufacturer’s instructions. Extracted fecal DNA was used as template in a two-step PCR to amplify the V3 and V4 regions of the 16 S gene. Briefly, PCR reactions were performed in 25 µl reactions containing 1X PCR buffer, 1 mM MgCl2, 0.2 mM of each dNTP, 0.2 µM of each forward (341 F: CCTACGGGNGGCWGCAG) (Klindworth et al., 2013) and reverse (806 R: GGACTACNVGGGTWTCTAAT) (Apprill et al., 2015) primers, 0.625 U HotStarTaq Plus DNA Polymerase (Qiagen catalog number 203605), 1 µl template DNA and molecular biology grade water. Thermocycler settings were as follows: 95 °C for 15 min, followed by 15 cycles of 94 °C for 1 min, 55 °C for 1 min and 72 °C for 3 min, and then 10 cycles of 94 °C for 1 min, 60 °C for 1 min and 72 °C for 3 min, and finally 72 °C for 10 min. The second PCR to ligate sequencing adapters and barcodes to amplicons from the first PCR were performed in 25 µl reactions with the following recipe: 1X PCR buffer, 1 mM MgCl2, 0.2 mM of each dNTP, 0.2 mM each of Nextera index 1 and 2 primers, 0.1 µM each of forward and reverse Golay indexes, 0.625 U HotStarTaq Plus DNA Polymerase, 1 µl template DNA from the first PCR and molecular biology grade water. Thermocycler settings were 95 °C for 3 min, followed by seven cycles of 98 °C for 20 s, 63 °C for 30 s and 72 °C for 1 min, and finally 72 °C for 5 min. PCR amplicons were checked on an agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen catalog number 28706). Purified final products were sent to the Genomics Resource Core Facility at Cornell University for 2 × 300 bp sequencing in an Illumina MiSeq using the v3 Miseq Reagent Kit. Demultiplexed raw sequence data were imported into QIIME2 v2018.6 (https://qiime2.org/). Using the DADA2 workflow23 in QIIME2, PCR primer and low-quality sequences were trimmed, and remaining reads subsequently denoised and merged. Alpha diversity statistics were calculated using representative sequences produced by DADA2. A taxonomy classifier trained on V3 and V4 regions of reference 16S sequence24 (SILVA release 128) was then used to assign taxonomic identities to the representative sequences. The final site-by-species counts table based on exact sequence variants (ESVs)25 was exported from QIIME2, chloroplast and mitochondrial counts removed, and used as input into R for statistical analysis.
Fungi-enriched fecal DNA extraction
Fecal DNA was extracted by using Maxwell® RSC PureFood GMO and Authentication Kit (Promega) with some modifications to increase the yield of fungi DNA. Approximately 100 mg from each stool sample was prewashed with 1 ml ddH2O and pelleted by centrifugation at 13,000 × g for 1 min. The pellet was resuspended in 800 μl TE buffer (pH 7.5), supplemented with 1.6 μl 2-mercaptoethanol and 500 U lyticase (Sigma) digesting cell walls of fungi, and incubated at 37 °C for 60 min, which increase the lysis efficacy of fungal cell. The sample was then centrifuged at 13,000 × g for 2 min and the supernatant was discarded. After this pretreatment, DNA was subsequently extracted from the pellet using a Maxwell® RSC PureFood GMO and Authentication Kit (Promega) following manufacturer’s instructions. Briefly, 1 ml of CTAB buffer was added to the pellet and vortexed for 30 s, then the solution heated at 95 °C for 5 min. After that, samples were vortexed thoroughly with beads (Biospec, 0.5 mm for fungi and 0.1 mm for bacteria,1:1) at maximum speed for 15 min. Following this, 40 µl proteinase K and 20 µl RNase A were added and the mixture Incubated at 70 °C for 10 min. The supernatant was then obtained by centrifuging at 13,000 × g for 5 min and placed in a Maxwell® RSC instrument for DNA extraction. The extracted fecal DNA was used to preform metagenomics sequencing.
Virus-like particles enrichment
Virus-like particles (VLPs) were enriched and other DNA was eliminated according to a protocol described in a previous study13. A 400 μl volume of saline-magnesium buffer (0.1 M NaCl, 0.002% gelatin, 0.008 M MgSO4H2O, 0.05 M Tris pH7.5) was added to 200 mg of stool sample and vortexed for 10 min. The sample was then centrifuged at 2,000 x g and the pellet was discarded. To remove bacterial cells and other residual material, the suspension was filtered through a 0.45 μm and two 0.22 μm filters. The cleared suspension was incubated separately with lysozyme (1 mg/ml at 37 °C for 30 min) and chloroform (0.2x volume at RT for 10 min) to degrade any remaining bacterial and host cell membranes. A DNase cocktail including 1U Baseline zero DNase (Epicenter) and 10U TurboDNaseI (Ambion) was added into the sample and the mixture was incubated at 65 °C for 10 min to eliminate DNA non protected within virus particles. VLPs were lysed (4% SDS plus 38 mg/ml Proteinase K at 56 °C for 20 min), treated with CTAB (2.5% CTAB plus 0.5 M NaCl at 65 °C for 10 min), and nucleic acids were extracted with phenol: chloroform pH 8.0 (Invitrogen). The aqueous fraction was washed once with an equal volume of chloroform, purified and concentrated on a column (DNA Clean & Concentrator TM 89-5, Zymo Research). VLP DNA was amplified for 2 h using the Phi29 polymerase (GenomiPhi V2 kit, GE Healthcare) prior to sequencing. Four independent amplification reactions were performed for each sample and pooled together to reduce amplification bias.
Metagenomics sequencing and analysis
Fungi-enriched DNA and VLP-enriched DNA were sheared into fragments of 150 bp VLP by ultrasonication (Covaris), and used to construct sequencing libraries. Libraries were prepared through the processes of end repairing, A-tailing, adapter ligation, size-select library and PCR amplification. DNA libraries from fungi-enriched DNA were sequenced using the Illumina HiSeq X Ten at the Beijing Genomics Institute (BGI) to generate 150 bp paired-end reads, yielding an average 67 ± 8.1 million reads (12 G data) per sample (Supplementary Table 2). VLP-enriched DNA libraries were sequenced (also 150 bp paired-end) by on the Illumina NovaSeq 6000 at Novogene, Beijing, China. An average of 26 ± 3.3 million reads (6 G data) per sample were obtained (Supplementary Table 3).
Raw sequence reads were filtered and quality-trimmed using Trimmomatic v0.3626 as follows: 1. Trimming low quality base (quality score < 20), 2. Removing reads shorter than 50 bp, 3. Tracing and cutting off sequencing adapters. Contaminating human reads were filtering using Kneaddata v0.7.3 (https://bitbucket.org/biobakery/kneaddata/wiki/Home, Reference database: GRCh38 p12,https://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.38/) with default parameters.
Profiling of bacterial taxonomy and functional composition was extracted using humann2 v0.11.127 from metagenomes of fungi-enriched DNA, which included taxonomic identification via MetaPhlAn2 by mapping reads to clade-specific markers28, annotation of species pangenomes through Bowtie2 v2.3.529 with reference to the ChocoPhlAn database (http://huttenhower.sph.harvard.edu/humann2_data/chocophlan/chocophlan.tar.gz), translated search of unmapped reads with DIAMOND v2.0.430 against the UniRef90 universal protein reference database (https://www.uniprot.org/help/uniref)31, and pathway collection from the generated gene list with reference to the Metacyc database (https://metacyc.org/)32. Gene families and pathway abundances estimated from the data were normalized according to relative abundances of their corresponding microbial taxa reported by MetaPhlAn2 v2.96.1-0.
Taxonomic profiling of fungi was performed on metagenomes sequenced from fungi-enriched DNA, using HumanMycobiomeScan33. The database was based on the complete fungal genomes available at the NCBI website (downloaded in January 2019). A second database containing 38,000 entries, corresponding to 265 different fungal genomes, was available for download (referred to as Fungi_FULL) on the project web page (https://sourceforge.net/projects/hmscan/). Briefly, metagenomic reads were aligned to the fungal genome database using via Bowtie 2 v2.3.534 to identify candidate fungal reads. Afterwards, sequences were trimmed for low quality scores (less than 3) and reads shorter than 60 bases are discarded. To remove human and bacterial contaminations, a double filtering step was performed using BMTagger v3.101-1 against the hg19 database for human sequences (https://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.13/) and a custom bacterial database which used for ViromeScan35. Then, the filtered reads were matched again to the fungal database using Bowtie 234 for definitive taxonomic assignment. The taxonomic affiliation was deduced by matching the result of the taxonomic assignment with an annotated list of fungal species, containing the entire phylogenetic classification for each genome included in the database. At the end of the process, the results were normalized by the length of the references included in the database, and the relative abundance profiles were obtained.
Taxonomic profiling of virus was performed on metagenomes sequenced from VLP-enriched DNA, using Kraken 2 v2.0.7-beta. The complete NCBI viral RefSeq databases (accessed on October 20, 2018)36 were downloaded (https://www.ncbi.nlm.nih.gov/refseq/). Kraken 2 examined the k-mers within a query sequence and used the information within those k-mers to query a database. sequence reads were mapped to the lowest common ancestor of all reference genomes with exact k-mer matches. Each query was thereafter classified to a taxon with the highest total hits of k-mers matched by pruning the general taxonomic trees affiliated with mapped genomes.
Quantitative PCR for detection of Parastagonospora nodorum, Thielavia terrestris, Candida dubliniensis and Saccharomyces cerevisiae in fungi-enriched fecal DNA
Relative quantification was achieved using the standard curve technique.
Parastagonospora nodorum, Thielavia terrestris, Candida dubliniensis and Saccharomyces cerevisiae were quantified by SYBR Green I assays using the SYBR® Premix Ex Taq ™, and total fungi was quantified by TaqMan assays using Taqman Premix Ex Taq ™ (TaKaRa). Standard curves were established by qPCR of serial dilutions of pUC57 plasmids harboring target genes (Supplementary Table 4). The sequences of the primers and genes which were used to generate standard curve in this study are detailed in Supplementary Table 4. The mass of four target species and total fungi were obtained through interpolation from the standard curve using CT value. Then the mass of three target species in each sample can be normalized by their respective fungal mass to calculate a normalized target value (Normalized target = Mass of each fungal species/Mass of total fungi). The normalized target values in the fecal samples from patient after FMT or donor are divided by normalized target values in patient’s baseline sample to calculate the fold change (Fold change = Normalized target of post-FMT samples or donors’ sample / Normalized target pre-FMT samples).
Quantitative PCR for detection of Torque teno virus load in human fecal Virus-like particles DNA
Total Torque teno virus (TTVs) loads in patient and donor were quantified by TaqMan qPCR analysis (Premix Ex TaqTM, TaKaRa) using primers22: forward primer 5′-GTGCCGIAGGTGAGTTTA-3′; reverse primer 5′-AGCCCGGCCAGTCC-3′; probe 5′-TCAAGGGGCAATTCGGGCT-3′. The absolute copy numbers of TTVs were determined from standard curves established by qPCR of serial dilutions of pUC57 plasmids harboring target genes.
PCR detection of diphtheria toxin gene in fungi-enriched DNA
The PCR assay was performed by using Primers, Tox1(ATCCACTTTTAGTGCGAGAACCTTCGTCA) and Tox2 (GAAAACTTTTCTTCGTACCACGGGACTAA) (248 bp)37, following a condition (30 cycled at 98 °C for 10 s, 58 °C for 30 s and 72 °C 10 s). DNA extracted from C. diphtheriae ATCC 13812 and C. diphtheriae ATCC 19409 which can produce diphtheria toxin was used as positive controls.
Statistics
Counts data from bacteria, viruses and fungi were imported into R (v3.5.1). Alpha diversity metrics (richness and diversity) and rarefaction were calculated using the phyloseq package (v1.26.0). Principal coordinate analysis (PCoA) based on Bray-Curtis dissimilarities of the microbial community structure were performed using the vegan package (v2.5-3). Heat maps were generated using the pheatmap package (v1.0.10) and was based on the Pearson correlation coefficient between different pathways in terms of their abundances across all samples. The proportion of taxa derived from donors in total taxa of patient’s stool samples was calculated by fast expectation-maximization microbial source tracking (FEAST)38.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
Supplementary information
Supplementary Information
Peer Review File
Reporting Summary
Peer review information: Nature Communications thanks Marcel van den Brink and the other, anonymous reviewer(s) for their contribution to the peer review of this work. Peer review reports are available.
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
These authors contributed equally: Fen Zhang, Tao Zuo, Yun Kit Yeoh.
These authors jointly supervised this work: Paul K. S. Chan, Siew C. Ng.
Supplementary information
Supplementary information is available for this paper at 10.1038/s41467-020-20240-x.
Acknowledgements
We acknowledge a seed fund for Gut Microbiome Research provided by the Faculty of Medicine, The Chinese University of Hong Kong
Author contributions
F.Z. and T.Z. performed the experiments. F.Z., T.Z. and Y.K.Y. conducted data analysis and drafted the manuscript. F.C., C.C.M. and C.K.L. performed allogenic haemotopoietic stem cell transplantation (allo-HSCT) and fecal microbiota transplantation (FMT) in clinic and provided clinical data. W.T., K.C. and M.H. collected the clinical samples and data. K.Y., Q.L. and C.P.C. helped with DNA sample preparation and data analysis. F.K.L.C. provided critical comments on the manuscript. S.N. and P.C. designed, supervised the study and revised the manuscript.
Data availability
16 S rRNA gene sequencing data are available in the NCBI Sequence Read Archive under BioProject PRJNA515137. Metagenomic sequence data generated from fungi-enriched fecal DNA and virus like particles (VLPs)-enriched fecal viral DNA for this study are available in the NCBI Sequence Read Archive under BioProject accession PRJNA641975.
The public reference databases used in this study are as follows: GRCh38 p12 (https://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.38/), ChocoPhlAn database (http://huttenhower.sph.harvard.edu/humann2_data/chocophlan/chocophlan.tar.gz), UniRef90 universal protein reference database (https://www.uniprot.org/help/uniref), Metacyc database (https://metacyc.org/), Fungal database from HumanMycobiomeScan (https://sourceforge.net/projects/hmscan/), The complete NCBI viral RefSeq databases (https://www.ncbi.nlm.nih.gov/refseq/).
All other relevant data are available from the authors.
Competing interests
The authors declare no competing interests. | Intravenous (not otherwise specified) | DrugAdministrationRoute | CC BY | 33397897 | 19,108,647 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Off label use'. | Potential of ultra-high-resolution photon-counting CT of bone metastases: initial experiences in breast cancer patients.
Conventional CT scanners use energy-integrating detectors (EIDs). Photon-counting detector (PCD) computed tomography (CT) utilizes a CT detector technology based on smaller detector pixels capable of counting single photons and in addition discriminating their energy. Goal of this study was to explore the potential of higher spatial resolution for imaging of bone metastases. Four female patients with histologically confirmed breast cancer and bone metastases were included between July and October 2019. All patients underwent conventional EID CT scans followed by a high resolution non-contrast experimental PCD CT scan. Ultra-high resolution (UHR) reconstruction kernels were used to reconstruct axial slices with voxel sizes of 0.3 mm × 0.3 mm (inplane) × 1 mm (z-direction). Four radiologists blinded for patient identity assessed the images and compared the quality to conventional CT using a qualitative Likert scale. In this case series, we present images of bone metastases in breast cancer patients using an experimental PCD CT scanner and ultra-high-resolution kernels. A tendency to both a smaller inter-reader variability in the structural assessment of lesion sizes and in the readers' opinion to an improved visualization of lesion margins and content was observed. In conclusion, while further studies are warranted, PCD CT has a high potential for therapy monitoring in breast cancer.
Introduction
Conventional computed tomography (CT) scanner detectors consist of distinct detector elements1, with each of these elements hosting a scintillator that converts the incoming x-ray photon’s energy into visible light and a photodiode for the light registration. The generated and registered electrical signal corresponds to the total amount of absorbed and converted energy regardless of the number and individual energy of the incoming x-ray photons. Accordingly, the measured signal corresponds to the integrated, i.e., total amount of x-ray photon energy deposited in the detector volume in the specific intervals of each subsequent measurement.
Photon-counting detectors (PCDs), on the other hand, consist of a single layer semiconductor diode without the use of a dedicated scintillator1, directly converting a photon’s energy into a measurable charge cloud, corresponding to the photon’s energy. As the resulted signal is in the range of tens of nanoseconds2,3, small-sized detector pixels and advanced read-out electronics can be constructed to successfully discriminate photons reaching the detector almost simultaneously at high clinical x-ray flux rates4,5.
Photon-counting computed tomography (PCD CT) is therefore capable of counting single x-ray photons and discriminating them according to their energy6–9. Measurement of photon energy might especially be beneficial if it is combined with potential novel contrast agents consisting of medium-to-high atomic number elements, such as iodine, gadolinium, ytterbium, and bismuth7,8,10,11. These are currently being investigated and may allow for single-acquisition multi-phase imaging12,13.
Because of the aforementioned small pixels, current PCD CT scanners achieve a higher in-plane and longitudinal spatial resolution4 than conventional clinical energy-integrating detector (EID) CT, namely, up to 150 µm14. In combination with large image matrix reconstructions, improvements in the detection and visualization of higher-order bronchi15 and small pulmonary vessels14 as well as of the human inner ear and temporal bone16,17 are reported, whereas experience in clinical benefits in oncological imaging is still pending.
Breast cancer, the most common cancer among women, has a high incidence of bone metastases (BM), which is the most common distant form of metastasis18–20. They cause significant morbidity by fractures, hypercalcemia, and spinal cord compression as well as considerable mortality21, with mortality hazard ratios of five to six when compared to breast cancer patients without BM22.
Treatment of BM is of utmost importance, as skeletal complications can determine patients’ outcome and quality of life22,23. For response assessment of BM, several imaging modalities are available24,25. In planar bone scanning, 99mTc-diphosphonate bone scanning, and positron emission tomography (PET) alone, most BMs cannot be assessed25. Hybrid imaging techniques, such as single-photon emission computed tomography/CT, PET/CT, and PET/magnetic resonance imaging (MRI) with bone-specific tracers like 18F-NaF or tumor-specific tracers like 18F-FDG achieve higher accuracies26. However, these modalities are more costly and are less widely available. Whole-body MRI acquisitions with diffusion weighted imaging and supporting T1- and T2-weighted sequences are also being investigated27 and provide valuable information about fat content and hypercellularity. These imaging modalities have acquisition times of 30–45 min28 and reveal millimetric resolution29. Because PCDs have been developed for clinical flux rates, the examination times for PCD CT do not differ significantly from EID CT, e.g., in the order of minutes for the whole procedure including positioning for whole-body acquisitions with submillimeter resolution. For osteoplastic and osteolytic bone lesions, the resolution improvement achieved with PCD CT can potentially be used to better differentiate between real tumor growth and therapy-associated sclerotic changes, i.e., pseudoprogression, as PCD CT reaches resolutions comparable with bone trabecular diameters30 and high-resolution images may allow for the detection of metastatic changes in shorter intervals.
After installation of a prototype PCD CT scanner in our institution, we are conducting an ongoing pilot study to gain insight in the potential advantages of this technique in various organs and diseases, intendedly exploiting its potential regarding resolution and signal-to-noise ratio. From this cohort, we extracted a subset of patients with advanced metastasized breast cancer to investigate the potential advantages of PCD CT imaging in assessing BMs. Examinations were performed on an experimental whole-body PCD CT (SOMATOM CounT), which is based on a SOMATOM Definition Flash dual-source CT scanner housing a prototype PCD and a conventional EID (Siemens Healthineers, Germany) that exclusively serves to obtain data from outside the limited field of view (FOV) covered by the PCD.
Results
Population characteristics
Four female patients diagnosed with late-stage osteoplastic metastasized breast cancer were examined, median age 61 years (45–68 years). The initial diagnosis was 14.5 years before the examination (2–23 years). Detailed grading and histological analysis results at the time of initial diagnosis are listed in Table 1.Table 1 Reader’s opinion on different features in EID and PCD CT images.
Item Reader’s opinion
Improved to EID CT Neutral Inferior to EID CT
Pat. 1, Osteolytic lesion (see Fig. 1a–e)
Visualization of the lesion’s margin 4 0 0
Visualization of the lesion’s content (*) 4 0 0
Assessment of iliac cortical bone 3 1 0
Pat. 2, Osteoplastic lesion (see Fig. 2) and of PC and EID CT image stack
Visualization of the lesion’s architecture 4 0 0
Assessment of the smallest focal lesions in the whole-image stack 4 0 0
Overview of tumor load and distribution in PC and EID CT image stack 3 1 0
Pat. 3, Fifth lumbar vertebra (see Fig. 3a, b)
Discrimination of trabeculae from each other 4 0 0
Assessment of ventral formation of osteophytes 4 0 0
Pat. 4, Osteoplastic metastasis (red arrow in Fig. 3d) and the left iliac bone
Visualization of the lesion’s margin 4 0 0
Assessment of Iliac spongiosa 3 1 0
Patient 1
Case history
The patient was first diagnosed in spring 2017 at the age of 42 years with a high-grade primary small cell carcinoma of the right breast, a subtype of the rare neuroendocrine breast cancer31. At diagnosis, the tumor had spread to the lymph nodes and exhibited both high estrogen receptor (ER) expression as well as high Ki-67 expression (Table 2). The patient received neoadjuvant chemotherapy consisting of etoposide and cisplatin before undergoing a modified radical mastectomy followed by radiation therapy of the resection bed and axilla 7 months after initial diagnosis. In summer 2019, she complained of increasing pain in the pelvis when receiving a routine ultrasound exam of the breast in our center. An abdominal CT demonstrated a large osteolytic BM in the left iliac bone, which was confirmed by a local biopsy. The lesion was irradiated in the following month and the patient remained on the postoperative regimen of letrozole and goserelin and was started on zoledronic acid. Eighteen months after initial diagnosis, the patient underwent both conventional CT and a PCD CT scan focused on the iliac BM in a span of 2 weeks (Fig. 1a–d). Three months later, another CT staging was performed (Fig. 1e). Since then, therapy and diagnostic follow-up has been continuing unchanged except for a 3-month course of leuprorelinacetate.Table 2 Patient and tumor characteristics at the time of initial diagnosis.
Pat. Disease ER status PR status Her2neu status Ki-67 T N M L G Chemotherapy schemes at the time of image acquisition
1 Primary small cell carcinoma Pos. Pos. Neg. 90% cT3 cN+ – – G3 Goserelin + letrozole
2 ILC Pos. Pos. Pos. 5–10% pT2 pN0 M0 – G2 Capecitabine
3 IDC Pos. Pos. Neg. 25% pT1c pN0 – – Liposomal doxorubicin
4 NST Pos. Pos. Neg. 20% pT1c pN0 – L0 G2 Liposomal doxorubicin
ILC invasive lobular carcinoma, IDC invasive ductal carcinoma, NST no special type carcinoma.
Fig. 1 Examples of PCD CT and conventional EID CT images.
a–e Unenhanced CT images of a 45-year-old patient with high-grade primary small cell carcinoma of the breast demonstrating an osteolytic lesion of the left iliac bone after radiation. a, c PCD CT images (U80f, 300 mAs, 2019/10, FOV 275 mm), b, d, e EID CT images (B80f, 124 mAs, b, d 2019/09, e 2019/12, FOV 500 mm). c, d are zoomed-in displays of a and b; c–e the small osseous defect shown in the PCD CT images (red circle) is visible to a moderate extent just in the low energy dataset (100 kV) of the dual-energy EID CT data.
Imaging discussion
Comparing conventional CT images of the osteolytic bone lesion (asterisk (*) in Fig. 1c–e) with PCD CT images demonstrates the benefit of higher spatial resolution in assessing structural bone changes and trabecular disruption. Comparing the dorsal borders of the lesion, PCD CT allows a clear depiction of trabecular lysis, while conventional CT shows only blurred border structures. In addition, the loss of trabecular density in the left ala of the sacrum can be clearly seen on PCD CT. The visualization of the lesion’s content and margin was improved in PCD CT images in comparison to EID CT images according the reader’s opinion (Table 1). Minor alterations of the iliac spongiosa, such as the small osseous defect in the medial iliac bone (red circle in the PCD CT image Fig. 1c) are hardly visible in EID CT images due to the noise grain size.
Patient 2
The patient was first diagnosed with unifocal, medium-grade breast cancer in autumn 1996 at the age of 45 years. Histological staining revealed ER and progesterone receptor expression of immune reactive score 4 and 6, respectively (Table 2). Due to the relatively young age, the low hormone receptor expression, and a small tumor size, a cyclophosphamide, methotrexate, and 5-fluorouracil scheme was started after breast-conserving surgery and corresponding radiation therapy. Fifteen years later, multiple subsolid lung nodules were discovered and histopathologically confirmed to be metastases of the original tumor. The patient was subsequently randomized to receive either fulvestrant or fulvestrant combined with ribociclib (blinded). Over the next 2 years, she developed local recurrence and osteoplastic BMs mainly to the lumbar spine and pelvis. Following, she received repeated radiotherapy of the right axilla and medical treatment was changed to letrozole, zolendronic acid, and finally to palliative oral capecitabine. In July 2019, a routine EI CT staging was performed, followed by PCD CT examination 1 week later.
Imaging discussion
As can be seen in Fig. 2a, the patient had multiple disseminated osteoplastic bone lesions of varying size. Due to the relatively coarse trabecular structure lateral to the sacroiliac joint, differentiation of small metastases and benign focal changes is compromised due to partial volume effects. PCD CT allows an accurate depiction even of small focal lesions and their content (Fig. 2b–e, g). Figure 2f, g show an osteoplastic lesion in the fifth lumbar vertebra. An inner core and an outer sclerotic border can clearly be discriminated in both CT images, while the characterization of the tissue in between is improved in PCD CT images, according to the readers’ opinion (Table 1).Fig. 2 Unenhanced PCD and EID CT images of a 68-year-old patient with unifocal, medium-grade breast cancer and histologically confirmed osseous metastases.
a–e, g PCD CT images (300 mAs, 2019/07), f EID CT image (B80f, 106 mAs, 2019/07). a Multiple osteoplastic metastases (red arrows) as small as 1 mm can be examined in detail (U80f reconstruction kernel, 1 mm slice thickness), b–e additional coronal reformations (c–e) at different positions (b) visualize the structure of a complex metastases (U70f, 0.25 mm slice thickness in z-axis). f, g Bone trabeculae of the fifth lumbar vertebra and a metastasis with sclerotic border (colored frames) can be adequately assessed in the PCD CT image (UHR reconstruction kernel U80f). CT window for all images [C = 500 HU, W = 1500 HU].
Patient 3
Case history
The female patient was originally diagnosed with unifocal, low-grade breast cancer of the right breast in 2004 at the age of 50 years (Table 2). Following breast-conserving therapy and adjuvant radiation therapy, the patient was treated with letrozole and tamoxifen. Five years later, a ductal carcinoma in situ of the left breast was removed following the same procedure. Eleven years after initial diagnosis, breast cancer metastases were found in the right axilla.
CT staging showed disseminated osteoplastic BMs. Over the next 3 years, she received different regimens, including letrozole, palbociclib, vinorelbine, 5-flourouracil, fulvestrant, and ribociclib. In addition, she underwent external radiation of the frontal bone and of a singular hepatic metastasis. Forty-three months after initial diagnosis of the osseous lesions, the patient underwent conventional CT staging followed by a PCD CT of the lumbar spine a month later.
Imaging discussion
In contrast to the previous patient, Fig. 3a, b demonstrates an almost complete infiltration of the fifth lumbar vertebral body by osteoplastic metastases leading to coarsening of the vertebral trabeculae. At the ventral border of the vertebral body, a single row of degenerative osseous outgrowth is visible. Assessment on image features is listed in Table 1. Again, the possibility of visualizing single trabeculae may allow a more accurate assessment of the metastatic process.Fig. 3 Examples of PCD CT and conventional EID CT images (top and central panel) and relative lesion area determined by the four readers (bottom panel).
a, b Osteoplastic metastasis in the fifth lumbar vertebra of a 65-year-old patient. a EID CT image (2019/07, 102 mAs, B80f), b PCD CT image (2019/08, 300 mAs, U80f). c, d Osteoplastic metastases in the left iliac bone of a 57-year-old patient. c EI CT image (2019/12, 201 mAs, B80f), d PCD CT image (2019/09, 300 mAs, U80f), FOV: 500 mm for a, c and 275 mm for b, d. CT window for all images [C = 500 HU, W = 1500 HU]. e Relative lesion area (in percent from mean) and RMSE determined by the four readers in EID CT images (Blue) and PCD CT images (Red). Box plots demonstrating the inter-reader variability for all 15 lesions in EI and PCD CT (center line, median; box limits, upper and lower quartiles; whiskers, 1.5× interquartile range). Most lesions show a decreased inter-reader variability in PCD CT.
Patient 4
Case history
The patient was initially diagnosed with unifocal hormone receptor-positive breast cancer of the right breast in summer 2005 at the age of 43 years (Table 2). After a breast-sparing mastectomy, radiation therapy, and adjuvant antihormonal therapy, the patient remained symptom-free until 2015, when she noticed increasing pain along the whole spine. A CT scan showed disseminated osseous metastases in the whole axial skeleton as well as a suspicious lung nodule, which turned out to be a metastasis of the before-mentioned breast cancer. Due to the advanced disease, palliative therapy including radiotherapy of several vertebrae and ribs and letrozole was started. Varying chemotherapy schemata followed, which failed to significantly inhibit tumor growth. Due to an increasing hepatic tumor load, the general condition worsened. Sadly the patient passed away in December 2019, 14 years after the initial cancer diagnosis.
Imaging discussion
In Fig. 3c, d, several osteoplastic metastases of varying size and structure along the left iliosacral joint are depicted. In the PCD CT image, it is clearly visible that the tumor spiculae of the central metastasis in the medial margin are oriented in parallel to the trabecular structure. According to the readers’ opinion, the fine structure of the iliac spongiosa is better assessable in the PCD CT images (Table 1).
Inter-reader variability in the assessment of lesion sizes
Lesion sizes show relative deviations from the mean in the order of 20%. In 10 out of 15 total lesions (66.7%), the root-mean-squared error (RMSE) was lower in the PCD CT images, as demonstrated in Fig. 3e.
Discussion
This case series illustrates the value of PCD detectors in assessing bone lesions in metastasized breast cancer. This detector allows, at the same dose, taking images with significantly higher spatial resolution4. Among others, this is reflected by smaller noise grain sizes. Using PCD CT high-resolution kernels, overshoots and undershoots often observed at sharp edges in EID CT using sharp kernels is reduced, resulting in a more subtle image impression that is apparently favored by the majority of the readers. Tumor margins can be depicted much clearer and assessment of the structural integrity of remaining trabecular bone becomes easier. As the remaining components including the x-ray tubes of this PCD CT scanner are identical to standard clinical CT scanners, risk of technical failure is kept at a minimum, leaving essentially no significant downsides to upgrading the detector.
Without nuclear medicine techniques, assessing the response of BMs to treatment relies mainly on morphological criteria. For example, the MD Anderson bone response criteria32 assign complete response only when the previously osteolytic lesion shows complete sclerotic fill-in, while partial response is assigned in cases of only incomplete fill-in or development of a sclerotic rim. It is therefore vital to depict structural bone changes even in small lesions, a task that remains challenging for lesions that do not exceed the standard voxel size by at least a magnitude. Still, while several studies have investigated the use of PCD for clinical applications10,15,33–35, larger clinical studies utilizing PCD are required before widespread adoption becomes possible.
This study has limitations. The examination protocol was adapted from high-resolution EID CT protocols used for temporal bone and inner ear imaging36,37 and is as such not directly transferable to whole-body examinations. Since the focus of this study was not a direct comparison with EID CT but to explore new potential clinical applications, dose levels were not matched to clinical EID CT levels. A recently published study focusing on sinus and temporal bone examination utilized comparable doses17. The current experimental implementation of the PCD into an existing dual-source EID CT scanner suffers from technical limitations, which are no general limitation of the PCD technology itself. Among others, the axial FOV and also the z-coverage, with the latter resulting in slower scan speeds, are limited. Furthermore, the available image reconstruction and post-processing options are not yet fully available and the detector elements are currently read out in groups of 2 × 2 pixels, due to restricted data transfer rates4.
Quantitative material images, such as calcium images and virtual non-calcium maps, would allow for an improved visualization38, assessment of the lesions’ content, and a precise quantification of therapy results. For longitudinal studies, the calcium density has to be corrected to a varying fat portion in the bone marrow39, which is possible by dual-energy CT40. As theoretically predicted41 and experimentally shown42,43, single-source PCD CT is inferior at least to the latest dual-source EID CT systems regarding spectral separation, due to different x-ray source spectra and prefiltration in the latter. Additionally, current PCD CT systems are compromised by spectral distortions and non-ideal physical effects44. Combining PCDs and technologies such as dual-source CTs may therefore lead to additional improvements and may facilitate further dose reductions.
In parallel with technical modifications, clinical investigations have to focus on several questions. In future follow-up examinations, morphological and spectral differences between bone lesions with vital metastases and reactive sclerosis due to systemic therapy or radiotherapy have to be investigated systematically.
In conclusion, while research into potential clinical applications is ongoing, and key applications have yet to be identified, the higher resolution and improved image quality of PCD CT images potentially offers benefits for the assessment of BMs of breast cancer.
Methods
Study design
This prospective case series was approved both by the Ethics Committee of the Medical Faculty of Heidelberg according to the Declaration of Helsinki of 2013 and the Federal Office for Radiation Protection, and all patients gave their informed consent (German Clinical Trials Register DRKS00017759). Candidates for PCD CT imaging were selected from patients undergoing regular oncological follow-up examinations in our clinic with Eastern Cooperative Oncology Group performance status45 of 0–2, histologically confirmed breast cancer, and BMs in the pelvis or lumbar spine between July and October 2019. For comparison, we used clinical routine EID CT images acquired before and after the PCD CT exams. Lesions previously detected in these EID CT scans were selected as target lesions, which were placed in the center of the scan volume in the PCD CT scans.
CT imaging and image analysis
All patients underwent routine contrast-enhanced CT staging at a SOMATOM Definition Flash (Siemens Healthineers, Germany) dual-source CT scanner operating either in single-energy mode (one patient) or dual-energy mode (three patients), as listed in Table 3. Tube current time products per source ranged from 90 to 235 mAs. For dual-energy scans, both detector signals were averaged for improving signal-to-noise ratios. PCD CT acquisitions were performed with 300 mAs using the ultra-high-resolution mode of the PCD (0.25 mm pixel size in the isocenter). Additionally, a data completion scan (120 kV, 30 mAs, 25 mGycm, CTDI of 2.1 mGy) was done to avoid truncation artifacts46 caused by the limited field of measurement of the experimental PC detector. For axial images, reconstruction was performed using a routine B80f kernel for conventional CT and a high-resolution U80f kernel for PCD CT and pixel size of 0.3 × 0.3 mm with 1 mm slice thickness. The maximal scan length was fixed at 10 cm in craniocaudal direction.Table 3 Acquisition and reconstruction parameters for this study (if not mentioned otherwise).
Scan mode EID PCD
Scan type Spiral Sequential
Rotation time 0.5 s 1.0 s
Collimation 32 × 0.6 32 × 0.25
Pitch 0.6 –
Tube voltage 100 kV/140 kV + Sn or 100 kV 120 kV
Effective tube current 90–235 mAs per source 300 mAs
CARE DOSE 4D ON OFF
CTDI 7.0–11.4 mGy 24.3 mGy
Recon algorithm wFBP wFBP
Recon kernel B80f U80f
Slice thickness 1 mm 1 mm
Slice increment 0.5 mm 0.5 mm
In-plane pixel size 0.3 mm × 0.3 mm 0.3 mm × 0.3 mm
Display window [C = 500 HU, W = 1500 HU] [C = 500 HU, W = 1500 HU]
Reader study
Two board-certified radiologists (9 and 8 years of experience in oncologic imaging) and two residents (1 year experience in oncologic imaging) assessed volumetric image stacks of PCD CT and conventional CT on a standard clinical reading console with patient identity blinded and in randomized order. Due to differences in FOV, acquisition parameters, and spatial resolution, the CT modality could not be blinded. Viewing parameters were freely adjustable and images in axial, coronal, and sagittal reformation were provided. Characteristic image sections were rated with respect to specific parameters (detailed below) and graded on a three-point Likert scale. The results of the survey are demonstrated next to the image section. Additionally, the readers were prompted to determine the area of 15 focal osteoplastic lesions (10 lesions from Pat. 2 and 5 lesions from Pat. 4, sizes ranging from 30 to 1500 mm2) by measuring the long and short axes as per RECIST guidelines47.
Statistics
All statistical analyses were performed using Python 3.8 (Python Software Foundation). Parameters were compared as absolute quantities and relative percentage points. Due to the low number of both images and readers, no significance testing was done.
For the inter-reader variability of the different lesion sizes, we calculated the relative RMSE according to RMSE=∑n=14sn−s¯24 with sn as the lesion area and s¯ as the mean lesion area over all readers.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
Supplementary information
Reporting Summary Checklist
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Supplementary information is available for this paper at 10.1038/s41523-020-00207-3.
Acknowledgements
No funding was received for this work. The authors thank Dr. Sebastian Faby, Siemens Healthineers, Erlangen, Germany for stimulating discussions and critical review of the manuscript.
Author contributions
E.W. and C.H.Z. did patient acquisition and information. E.W. and L.T.R. performed image analysis, wrote the manuscript, and participated in the reader study. P.G. and C.H.Z. participated in the reader study and critically revised the manuscript for content. S.S. and L.K. did image reconstruction, PCD CT calibration, and quality measurements. S.F., S.D., H.-P.S., M.K., and M.U. critically revised the manuscript for content. M.U. did the application for approval of the study by the Ethics Committee of the Medical Faculty of Heidelberg and the Federal Office for Radiation Protection. All authors provided critical feedback and helped shape the research, analysis, and manuscript.
Funding
Open Access funding enabled and organized by Projekt DEAL.
Data availability
The data generated and analyzed during this study are described in the following data record: 10.6084/m9.figshare.1318666148. All demonstrated CT images are available as part of the data record as pseudonymized DICOM files. The acquisition and reconstruction parameters are available (as metadata in each file) so any user will be able to adapt the CT window. These DICOM files underlie Figs. 1 and 2 and Table 3. The file names include the figures to which they apply. Additionally, the Excel spreadsheet npj_breast_cancer_PCCT_Reader-Study.xlsx, which is also part of the data record, contains the lesions diameters according to the four readers. All readers are co-authors on the related manuscript and allow the publication of their assessments. All data on the reader’s opinion on different features in EID and PCD CT images are presented in Table 1 of the related manuscript. The patient and tumor characteristics at the time of initial diagnosis, which are contained in Table 2 of the related manuscript, are data from given physicians’ letters, and so cannot be shared without jeopardizing patients’ anonymity. Any requests for access to this data should be made to the corresponding author.
Code availability
All statistical analyses were performed using standard statistical libraries in Python 3.8 (Python Software Foundation). Code is available on reasonable request from any qualified researcher.
Competing interests
The authors declare no competing interests. | LEUPROLIDE ACETATE | DrugsGivenReaction | CC BY | 33398008 | 18,808,947 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Loss of consciousness'. | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | ACETAMINOPHEN, AMLODIPINE BESYLATE, CEFAZOLIN, DESFLURANE, ENALAPRIL, FAMOTIDINE, FENTANYL, FUROSEMIDE, METOPROLOL, OLMESARTAN, PROPOFOL, REMIFENTANIL, ROCURONIUM BROMIDE, SUGAMMADEX, TRICHLORMETHIAZIDE | DrugsGivenReaction | CC BY | 33398469 | 18,811,826 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Respiratory arrest'. | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | ACETAMINOPHEN, AMLODIPINE BESYLATE, CEFAZOLIN, DESFLURANE, ENALAPRIL, FAMOTIDINE, FENTANYL, FUROSEMIDE, METOPROLOL, OLMESARTAN, PROPOFOL, REMIFENTANIL, ROCURONIUM BROMIDE, SUGAMMADEX, TRICHLORMETHIAZIDE | DrugsGivenReaction | CC BY | 33398469 | 18,811,826 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Swollen tongue'. | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | ACETAMINOPHEN, AMLODIPINE BESYLATE, CEFAZOLIN, DESFLURANE, ENALAPRIL, FAMOTIDINE, FENTANYL, FUROSEMIDE, METOPROLOL, OLMESARTAN, PROPOFOL, REMIFENTANIL, ROCURONIUM BROMIDE, SUGAMMADEX, TRICHLORMETHIAZIDE | DrugsGivenReaction | CC BY | 33398469 | 18,811,826 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Therapy non-responder'. | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | AMLODIPINE BESYLATE, DEXAMETHASONE, ENALAPRIL, FUROSEMIDE, METOPROLOL, OLMESARTAN, TRICHLORMETHIAZIDE | DrugsGivenReaction | CC BY | 33398469 | 18,791,027 | 2021-01-04 |
What is the weight of the patient? | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | 144 kg. | Weight | CC BY | 33398469 | 18,791,027 | 2021-01-04 |
What was the administration route of drug 'CEFAZOLIN'? | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | Intravenous (not otherwise specified) | DrugAdministrationRoute | CC BY | 33398469 | 18,811,826 | 2021-01-04 |
What was the dosage of drug 'AMLODIPINE BESYLATE'? | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | 5 mg (milligrams). | DrugDosage | CC BY | 33398469 | 18,791,027 | 2021-01-04 |
What was the dosage of drug 'FUROSEMIDE'? | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | 20 mg (milligrams). | DrugDosage | CC BY | 33398469 | 18,791,027 | 2021-01-04 |
What was the dosage of drug 'METOPROLOL'? | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | 60 mg (milligrams). | DrugDosage | CC BY | 33398469 | 18,791,027 | 2021-01-04 |
What was the dosage of drug 'OLMESARTAN'? | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | 20 mg (milligrams). | DrugDosage | CC BY | 33398469 | 18,791,027 | 2021-01-04 |
What was the dosage of drug 'TRICHLORMETHIAZIDE'? | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | 2 mg (milligrams). | DrugDosage | CC BY | 33398469 | 18,791,027 | 2021-01-04 |
What was the outcome of reaction 'Loss of consciousness'? | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | Recovering | ReactionOutcome | CC BY | 33398469 | 18,811,826 | 2021-01-04 |
What was the outcome of reaction 'Respiratory arrest'? | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | Recovering | ReactionOutcome | CC BY | 33398469 | 18,811,826 | 2021-01-04 |
What was the outcome of reaction 'Swollen tongue'? | Life-threatening airway obstruction caused by angioedema in a morbidly obese postoperative patient: a case report.
BACKGROUND
We report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema.
METHODS
A 50-year-old Japanese morbidly obese female was treated with enalapril for 10 years, with no history of angioedema. After 3 h of completion of breast cancer resection under general anesthesia with tracheal intubation, she developed airway obstruction and respiratory arrest. Her oral cavity was occupied with a swollen tongue. It was extremely difficult to determine the airway anatomical orientation although tracheal intubation was attempted using a videolaryngoscope. At this time, she probably started gasping respiration, which generated a faint bubble and revealed a possible airway. Her airway was established using a tracheal tube without confirming the glottis or the vocal cord.
CONCLUSIONS
Angioedema induced by angiotensin-converting enzyme (ACE) inhibitors is rare; however, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway. Considering the risk-benefit ratio, we must be careful in administering ACE inhibitor therapy in morbidly obese patients.
Background
Obesity tends to impair airway patency [1]. Therefore, it is obvious that airway edema can have a severer effect on airway patency in morbidly obese individuals than in lean individuals. Although angiotensin-converting enzyme (ACE) inhibitors have been extensively used for controlling hypertension, angioedema is one of the critical side effects. Herein, we report a case of a morbidly obese patient who developed life-threatening airway obstruction due to angioedema in the postoperative period, which was probably mediated by an ACE inhibitor.
Case presentation
Written informed consent was obtained from the patient for publication of this case report and accompanying images. A 50-year-old Japanese female with a medical history of diabetes mellitus, chronic kidney disease (stage 4), and hypertension was admitted to our hospital for surgical removal of cancer in her left breast. She was morbidly obese (height = 160 cm, weight = 144 kg), had no history of asthma and allergy to any drugs or food, and had no memory of suffering from urticarial rashes. She had been taking daily doses of enalapril 10 mg, olmesartan 20 mg, amlodipine 5 mg, metoprolol 60 mg, trichlormethiazide 2 mg, and furosemide 20 mg for the management of her hypertension for approximately 10 years. On the day of surgery, she was treated only with amlodipine. The last dose of enalapril was administered in the evening of the day before surgery. General anesthesia was induced with propofol 120 mg, fentanyl 0.15 mg, and rocuronium 80 mg, followed by successful orotracheal intubation using a videolaryngoscope (McGrath® MAC video laryngoscope, Aircraft Medical, UK). Anesthesia was maintained with desflurane 5%, remifentanil 0.1 μg/kg/min, and an additional dose of fentanyl 0.05 mg and rocuronium 20 mg. After tracheal intubation, cefazolin 1 g was administered intravenously. Resection of her breast cancer was completed uneventfully in 111 min. Muscular relaxation was reversed by administering sugammadex 600 mg. The tracheal tube was removed after confirming her response, eye opening, and sufficient spontaneous breathing. Immediately after emergence from anesthesia, she was transferred to the intensive care unit (ICU). During anesthesia, the estimated blood loss was 40 mL, urine output was 230 mL, and 560 mL of crystalloids were infused. Around the completion of anesthesia, acetaminophen 1 g was administered for 15 min. Soon after admission to the ICU, famotidine 20 mg was administered.
Approximately 3 h after admission to the ICU, the patient complained of dyspnea and was rapidly desaturated over the next 15 min. She lost her consciousness and experienced airway obstruction and respiratory arrest. Immediately, manual mask ventilation was initiated; however, it was extremely difficult. Her tongue swelled heavily and protruded from the mouth. Tracheal intubation was attempted using a videolaryngoscope; however, the oral cavity was occupied with the swollen tongue. It was extremely difficult to determine the airway anatomical orientation. Her oxygen saturation decreased to 9%, and her heart rate dropped to 30 bpm. At this time, she regained her breath or started gasping respiration, which generated a faint bubble and revealed a possible airway. Fortunately, her airway was established using an ID 7.0-mm cuffed endotracheal tube without confirming the glottis or the vocal cord (Fig. 1a). At this juncture, we just considered ourselves to be extremely fortunate because emergent surgical airway establishment would have been frightfully difficult or impossible because of the patient’s physical appearance. Her oxygenation was improved up to 99–100%; no other allergic reactions such as urticaria, bronchospasm, and hemodynamic suppression were observed.
Fig. 1 a The swollen tongue was protruding from the oral cavity after reintubation in the intensive care unit after surgery. b The massive tongue swelling was improved gradually on the next day.
Because of localized edema, she was treated for angioedema. Dexamethasone 6.6 mg/day was tentatively administered for 3 days. During the next 2 days, her massive tongue swelling was improved gradually (Fig. 1b) and the tracheal tube was removed on the second postoperative day. The later course was uneventful. Laboratory blood test approximately 1 h after reintubation demonstrated normal levels of complement component 4, complement 1 inhibitor function, and complement 1q, suggesting that it was unlikely bradykinin-induced or hereditary angioedema [2, 3]. On the basis of these laboratory results, and because of the lack of family and past history, hereditary angioedema appeared to be negative. Topical infection was also negative in the view of clinical course. Therefore, we strongly suspected that it was due to drug-induced angioedema although other causes such as gene mutations, such as the FXII gene, should be excluded in advance [2, 3]. Incidentally, the total tryptase level in the same blood sample was also within the normal limit. Although the negative predictive value (NPV) for the clinical diagnosis of anaphylaxis was not so high (NPV = 0.4) [4], it was reasonable to assume that this event was not due to anaphylaxis considering the lack of other anaphylactic reactions. Lastly, her general practitioner was notified, and the adverse effect of the ACE inhibitor was documented in her medical record.
Discussion
Angioedema is commonly mediated by histamine as a type I immunoglobulin E-mediated hypersensitivity to a variety of allergens (allergic angioedema) [2]. We initially ascribed angioedema in this case to famotidine or acetaminophen used in the ICU, because it occurred 3–4 h after surgery and for the first time in this patient. However, allergic angioedema is generally accompanied by other systemic allergic reactions such as urticaria [2], which was not observed in this patient, suggesting that it was unlikely an allergic reaction to agents used in the IUC or for anesthesia. Alternatively, we supposed bradykinin as a mediator of angioedema, based on previous reports showing that bradykinin-induced angioedema generally lacks urticaria and its onset is slower than allergic angioedema [2, 3].
ACE inhibitors are closely associated with bradykinin-related angioedema [2, 3]. It occurs from several hours to years after starting the use of ACE inhibitors. Of importance, ACE inhibitor-related angioedema occurs several months after its last dose. Our case had a long history of taking enalapril, an ACE inhibitor. Although it is difficult to determine the first episode of angioedema after starting the use of enalapril and the direct cause of it, previous reports also showed angioedema developed 15 min after extubation in a patient who started taking enalapril 10 days before surgery [4].
Although ACE inhibitors and angiotensin II receptor blockers (ARBs) contribute to improved renal outcomes [5], the blockade of the renin–angiotensin system does not have superiority over other antihypertensive medications to reduce cardiovascular and renal outcomes [6]. The possibility of inducing angioedema should always be considered particularly in the perioperative period and in morbidly obese patients. In this connection, we would like to discuss our difficult airway management in this case. We tried tracheal intubation using a videolaryngoscope under the situation that manual mask ventilation was extremely difficult. This “one best intubation” is advocated by the JSA difficult airway management guideline [7]. However, as this guideline recommends, the supraglottic airway devices might have allowed us to choose safer strategies [7]. To do so, it is very important that supraglottic airway devices are always ready to use even in the ICU.
We used only dexamethasone for treatment of angioedema. However, previous studies have shown that histamine H1 and H2 antagonists, corticosteroids, and adrenaline are unlikely effective for improving bradykinin-mediated angioedema [2, 3]. Dexamethasone might have also been ineffective in the present case, as shown by the prolonged time for extubation. Other treatments like fresh-frozen plasma, component 1 inhibitors, or icatibant, a bradykinin-2 receptor antagonist, might have facilitated the relief of symptoms [2, 3].
In conclusion, although ACE inhibitor-induced angioedema is rare, it is difficult to determine when and in whom it will occur. In addition, once it occurs, it can be potentially life threatening, especially for patients with possible difficult airway although there is still no evidence to support our message. In such patients, it has been suggested that marked obesity, resulting in airway narrowing, is a risk factor for upper airway obstruction secondary to ACE inhibitor-induced angioedema [8]. Considering the risk–benefit ratio, we must be more careful in administering ACE inhibitor therapy in morbidly obese patients.
Abbreviations
ACEAngiotensin-converting enzyme
ICUIntensive care unit
NPVNegative predictive value
ARBAngiotensin II receptor blocker
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Acknowledgements
The authors would like to thank ENAGO for the English editing of the manuscript.
Authors’ contributions
All authors contributed to the study conception and design. Material preparation and data collection and analysis were performed by Makiko Konda, Yusuke Naito, and Satoki Inoue. The first draft of the manuscript was written by Satoki Inoue and all authors, especially Junji Egawa and Masahiko Kawaguchi who commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported only by departmental funding from our institution.
Availability of data and materials
Not applicable
Ethics approval and consent to participate
Not applicable
Consent for publication
Consent to publish was obtained from the patient.
Competing interests
The authors declare having no competing interests. | Recovering | ReactionOutcome | CC BY | 33398469 | 18,811,826 | 2021-01-04 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Bacteroides test positive'. | Portal Dissemination of Fusarium graminearum in a Patient with Acute Lymphoblastic Leukemia and Febrile Neutropenia.
We present the case of a man with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, with gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene, from a liver biopsy. The infection was resolved with surgical drainage and antifungal treatment based on voriconazole. As far as we know, there are no previous reports in the literature of cases of human infection due to Fusarium graminearum.
1. Introduction
In the last decades, there has been an increase in the incidence of invasive fungal infections (IFI), related to new immunosuppressive treatments and improved diagnosis with new molecular techniques and higher diagnostic yields [1,2]. We present the case of a male patient with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, presenting an atypical clinical course, gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene from a liver biopsy. This is the first reported case of portal dissemination by Fusarium genus and the first report of Fusarium graminearum infection in humans.
2. Ethical Considerations
The case we submit for publication is about a single patient who provided his verbal consent for this purpose. We do not include any details or information that could lead to patient identification
3. Case Report
Male patient, 26 years old, kitchen assistant, originated from Taxco, Guerrero and living there until he emigrated to Texas, United States, in 2016, where he was diagnosed with B lymphoblastic leukemia in January 2017. He received four cycles of unspecified chemotherapy with apparent remission of the disease and came back to Mexico (Cuernavaca, Morelos). He was admitted to the National Institute of Cancer in Mexico City in November 2017, where he was diagnosed with early relapse. From November 2017 to January 2018, he received chemotherapy for relapse with BFM like protocol (L-Asparaginase, Vincristine, Daunorubicin, and Prednisone). He did not receive any antifungal prophylaxis. On day +23 he was presented with febrile neutropenia, with no etiologic agent identified. An empirical treatment of five days of Meropenem was administered, with resulting in fever remission. He was discharged 6 days after his admission, asymptomatic but with persistent neutropenia.
Two days later, he had come back with an acute abdomen, although afebrile. Vital constants at admission were: BP: 107/78 mmHg, HR: 90 bpm, RR: 20 rpm, T °: 36.5 °C, weight: 55 Kg, height: 1.62 m, BMI: 21 Kg/m2. His blood tests showed leukocytes of 0.32 × 103/μL, absolute neutrophils 0.0032 x103/μL, hemoglobin 5.7 g/dL, platelets 35 × 103/μL, creatinine 0.66 mg/dL, ALT 174 IU/L, AST 82 IU/L, ALP 1004 IU/L, GGT 572 IU/L, total bilirubin 8 mg/dL, conjugated bilirubin 6.4 mg/dL, unconjugated bilirubin 1.62 mg/dL, LDH 287 IU/L, albumin 1.7 mg/dL, C reactive protein 8.4 mg/dL. The patient underwent exploratory laparotomy which revealed sigmoid perforation. Sigmoidectomy and colostomy were performed. The initial pathology report was diverticulum perforation. Forty-eight hours later, he presented moderate diffuse abdominal pain, and temperature > 38 °C. The blood cultures were negative. Administration of Meropenem, caspofungin and Filgastrim was empirically initiated. Contrast abdominal tomography (CT) showed diffuse liver lesions consistent with liver abscesses (Figure 1).
A liver biopsy of the lesions was performed under ultrasound guidance; the aerobic, anaerobic and Sabouraud dextrose agar cultures were negative. The pathology showed granulomatous hepatitis with extensive necrosis; Grocott’s stain evidenced hyaline hyphae. The histopathology of the sigmoid surgical specimen was reviewed again and then reported as transmural ischemic necrosis, acute and chronic peritonitis, and positive Grocott’s stain with the same hyphae described in the liver (Figure 2).
Hyalohyphomycosis was concluded. The serum galactomannan was negative. Pulmonary involvement was not seen by tomography. The antifungal treatment was changed from caspofungin to intravenous Voriconazole on day 23. The patient had gradual clinical improvement the neutropenia was remitted and was discharged with a treatment of oral voriconazole 200 mg bid. He was, at that time, in complete remission of leukemia.
Three weeks later he was readmitted for abdominal pain in the right hypochondrium with fever without neutropenia; he reported bad adherence to oral antifungal treatment for economic reasons. The new abdominal CT showed the persistence of liver abscesses. Exploratory laparotomy plus drainage were performed finding abscesses in segments II, IV and VI. The anaerobic culture grew Bacteroides fragilis; he completed 14 days of Metronidazole. The fungal culture was negative. The pathology report was extensive granulomatous hepatitis with necrosis and negative Grocott’s stain. The patient received 2 weeks of intravenous Voriconazole plus 6 weeks of the same oral antifungal. At the end of treatment, the abdominal CT showed only one residual lesion of 16 mm. A timeline of the case is shown in Figure S1.
He did not present further complications of the infectious process. However, six months later, while undergoing hematopoietic stem-cell transplant evaluations, he presented a relapse of leukemia and he decided to stop the antineoplastic treatment. He died seven months later.
Materials and Methods for Identification of the Causative Agent
A paraffin block of the first liver biopsy was requested, and DNA extraction was performed. Genomic DNA was extracted from the paraffin-embedded tissue sample using a DNeasy blood and tissue kit (Qiagen, Ventura, CA, USA) according to the manufacturer’s instructions before preliminary removal of paraffin by extraction with xylene protocol. The molecular identification was performed by 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification using a set of primers previously reported to identify fungi species (5′-TCCGTAGGTGAACCTTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). A PCR product of 500 bp was amplified, purified and sequenced in both directions; nucleotide sequence was determined with Taq FS Dye Terminator Cycle Sequencing Fluorescence-Based Sequencing and analyzed on an Applied Biosystems 3730 DNA sequencing system (Foster City, CA, USA). The sequence was edited with Vector NTI program and homology search was performed in the GenBank database (nucleotide blast), finding a 100% identity with Fusarium graminearum complex strain HUT59 [3]. (Figure 3). The sequences used are shown in Supplementary Figure S2.
4. Discussion
In the last ten years, there has been an increasing incidence of disseminated filamentous fungal infections in patients with severe immunosuppression [1,2,4]. Hematological malignancies have a risk of 6.5% for IFI [5], mainly in the induction and consolidation phases. This increase is due to severe immunosuppression conditions by myelotoxic treatments and related clinical conditions but also to new technologies such as molecular biology [6,7] that have increased the diagnosis ability.
Hialohifomycetes are opportunistic filamentous fungi that usually cause infection after environmental exposure [6]. Infection occurs through inhalation or skin breakdown (wounds, burns) [8]. Fusarium spp. is the second cause of infections by filamentous fungi after Aspergillus spp. More than 50 Fusarium species have been identified, but only about 12 are associated with infection in humans. F. incarnatum, F. moniliforme, F. oxysporum and F. solani usually cause allergic reactions and superficial infections such as keratitis and onychomycosis in immunocompetent hosts. In immunocompromised patients, it can cause from locally invasive diseases such as sinusitis and pneumonia, to fungemia and disseminated disease [9,10]. In neutropenic patients, it usually manifests as fever not responding to empirical antibiotics. Profound and prolonged neutropenia is the most important risk factor for dissemination and death due to fusariosis [8,11]. The most frequently isolated species in this setting are F. solani (50%) and F. oxysporum (20%) [6,8].
Fusarium graminearum plays a major role as the etiological agent of one important disease of small grain cereals and corn. First identified in 1884 in England, it is considered a major threat to wheat and barley [12]. The fungi, transmitted by seed, can survive up to 10 years as spores or resting structures in and on the seed. In Mexico, F. graminearum has been found in Hidalgo, Jalisco, Mexico, Michoacán and Tlaxcala [13,14,15,16]. This fungus can produce several mycotoxins, which have shown abortive estrogenic, gastric (nausea and vomiting) and neurotoxic toxicity in swine, cattle, dogs, cats, and ducks [16,17]. Grain that has been infected with the fungus can be incorporated into basic diets and could be a source of infection in humans. So far, no infections due to F. graminareum have been reported. Considering the patient’s occupation (kitchen helper) and the high corn content in the Mexican diet, we supposed that the patient was colonized with F. graminearum through the daily ingestion and handling of corn. He possibly got the mould through oral ingestion, and symptoms were gastrointestinal due to portal dissemination, which explains why we did not document any fungemia or cutaneous infection, despite an invasive disease. Usually, in disseminated fusariosis, blood cultures are positive in more than 75% of cases [6,8].
In our patient, the diagnosis of hyalohyphomycosis was first made by pathologic specimen. The biopsy revealed the presence of septate hyaline hyphae 3–6 μm diameter, indistinguishable from other hyalohyphomycosis such as Aspergillus, Acremonium [Cephalosporium], and Pseudallescheria [17]. Recently, the Mycotic Diseases Branch, from the Center for Disease Control and Prevention in Atlanta, described a new entity of invasive fungal infections (IFI), which they called “foodborne IFI”, in a recently published systematic review [18], foodborne IFI are infections acquired through ingestion of food or water contaminated with the fungi causing the infection. Reports describe molds and yeasts as etiologic agents. Rhizopus sp is the most frequently described mold, but one case of IFI due to Fusarium moniliforme is reported in a man with acute lymphoblastic leukemia who ingested cereals. The diagnosis of foodborne IFI is difficult, clinical presentation is usually atypical, and mainly gastrointestinal. Fungi can spoil food that is ingested, and it is suggested that this category of fungal infections could be related to food insecurity. The source of the fungi should be identified to be able to classify the IFI as foodborne, which is often difficult to the ubiquitous nature of these fungi. As previously mentioned, although we suspect that our patient acquired the infection orally and this could correspond to foodborne IFI, we cannot corroborate the above because we could not have samples of the food that the patient ingested prior to his hospitalization and we did not perform stool cultures.
Today, comparative identification strategies based on gene sequencing can be considered the new gold standard for the identification of fungal species. Gene sequencing is characterized by PCR amplification of the ITS region, and sequencing of the resulting amplicon (s). The ITS region can be amplified reliably for most fungi [19]. These molecular biology techniques provide better discrimination of species morphologically indistinguishable from Fusarium spp, and can be performed on different types of materials, including paraffin blocks, which is why it is considered an emerging and promising methodology to be used in the routine identification of Fusarium spp. In our case, no other fungal species were identified in the studied specimen or in any other specimen from the patient. The Fusarium graminearum complex includes 13 species; biogeographic data suggest that the majority of the species within the complex have evolutionary origins in the Southern hemisphere and Asia. According to the surveys to date, F. austroamericanum, F. meridionale, F. cortaderiae, and F. brasilicum appear to be endemic to South America; F. acaciae-mearnsii to Australia or less likely Africa; F. asiaticum, F. vorosii and F. ussurianum to Asia; F. aethiopicum to Africa; F. boothii and F. mesoamericanum to Central America; F. gerlachii to the US and F. graminearum sensu stricto (F. graminearum s.s.) it is the most cosmopolitan species and has been found in Asia, Africa, America, Europe, and Oceania [20].
Finally, the treatment in localized disease can benefit from surgical debridement especially in disseminated disease together with the use of systemic antifungals. Fusarium species are relatively resistant in vitro to most antifungal agents, showing different susceptibility patterns between species. In general, most Fusarium isolates have lower inhibitory concentrations (MIC) for Amphotericin B higher than Aspergillus species. F. solani and F. verticillioides are usually resistant to azoles and they have higher MIC for azoles than other Fusarium species. In contrast, F. oxysporum and F. moniliforme may be susceptible to voriconazole and posaconazole [9]. Echinocandins show the highest MIC values [21]. As far as we know there are no previous reports in the medical literature of identification of F.graminearum as a pathogen in humans; therefore antifungal therapy was initiated based on is the antifungals reported in the literature for the Fusarium species and on the clinical response.
5. Conclusions
Prolonged profound neutropenia and alteration of the intestinal flora, secondary to myelotoxic chemotherapies and environmental exposure in patients with hematological neoplasms, are important risk factors for the development of invasive infections by filamentous fungi. This is the first reported case of invasive fungal infection by F. graminearum and the first case of portal dissemination of Fusarium spp. The anamnesis and exposure to environmental factors are important during clinical evaluation. F.graminearum was not identifiable by traditional methods such as culture and pathology. Access to molecular biology is extremely valuable to increase the performance of diagnostic tests in the identification of new species such as the F. graminearum reported in our paper.
Acknowledgments
To all the infectious disease fellows who participated in the approach of this case, especially to Aaron Molina. And Rodrigo Toral-Villanueva for his technical support with the edition of figures.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Materials
The following are available online at https://www.mdpi.com/2036-7449/13/1/2/s1, Supplementary material 1 (Figure S1) is a timeline of the present case. Supplementary material 2 (Figure S2) is a figure with the genetic sequences used for the identification of the etiologic agent (Fusarium graminearum complex).
Click here for additional data file.
Author Contributions
M.G.U. was in charge of the data curation of the patient; A.M.-O. and M.G.U. were in charge of the writing of the original manuscript; R.H.-C. was in charge of the methodology for the identification by molecular biology of the etiologic agent ; C.P.-J. was responsible for reviewing and editing the manuscript as well as submitting it for publication. R.H.-G. was in charge of the methodology for the identification of the agent in the pathology specimen. K.E.-B. also participated in the data curation of the patient and in the writing of the original manuscript.All authors have read and agreed to the published version of the manuscript.
Funding
No source of funding was used for the preparation of this report.
Institutional Review Board Statement
Not applicable. Due to the fact that our study is only descriptive (without any type of intervention) on the case of a single patient, and he provided his consent, the evaluation by the Institution's ethics committee was not considered necessary.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Data is contained within the article or supplementary material.
Conflicts of Interest
All authors report having no conflict of interest.
Figure 1 Abdominal CT scan with intravenous contrast, which shows: Diffuse and poorly defined hypodense lesions, one located in the liver segment II measuring 3.4 cm, another located in the caudate lobe measuring 7 cm, and another located in the hepatic segment VII with extension to segment VI measuring 7 cm; consistent with liver abscesses.
Figure 2 (A) Non-pigmented, separated hyphae with acute angle branching in liver biopsy tissue, Grocott methenamine silver-stained specimen, 40×. (B) Non-pigmented, separated hyphae with acute angle branching in intestinal tissue, Grocott methenamine silver-stained specimen, 10×.
Figure 3 The 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification. Lane 1: Molecular weight marker 100 bp DNA ladder; Lane 2: Liver biopsy sample; Lane 3: Negative control. | ASPARAGINASE, CASPOFUNGIN, DAUNORUBICIN, FILGRASTIM, MEROPENEM, METRONIDAZOLE, PREDNISONE, VINCRISTINE, VORICONAZOLE | DrugsGivenReaction | CC BY | 33401374 | 19,386,199 | 2021-01-01 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Fusarium infection'. | Portal Dissemination of Fusarium graminearum in a Patient with Acute Lymphoblastic Leukemia and Febrile Neutropenia.
We present the case of a man with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, with gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene, from a liver biopsy. The infection was resolved with surgical drainage and antifungal treatment based on voriconazole. As far as we know, there are no previous reports in the literature of cases of human infection due to Fusarium graminearum.
1. Introduction
In the last decades, there has been an increase in the incidence of invasive fungal infections (IFI), related to new immunosuppressive treatments and improved diagnosis with new molecular techniques and higher diagnostic yields [1,2]. We present the case of a male patient with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, presenting an atypical clinical course, gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene from a liver biopsy. This is the first reported case of portal dissemination by Fusarium genus and the first report of Fusarium graminearum infection in humans.
2. Ethical Considerations
The case we submit for publication is about a single patient who provided his verbal consent for this purpose. We do not include any details or information that could lead to patient identification
3. Case Report
Male patient, 26 years old, kitchen assistant, originated from Taxco, Guerrero and living there until he emigrated to Texas, United States, in 2016, where he was diagnosed with B lymphoblastic leukemia in January 2017. He received four cycles of unspecified chemotherapy with apparent remission of the disease and came back to Mexico (Cuernavaca, Morelos). He was admitted to the National Institute of Cancer in Mexico City in November 2017, where he was diagnosed with early relapse. From November 2017 to January 2018, he received chemotherapy for relapse with BFM like protocol (L-Asparaginase, Vincristine, Daunorubicin, and Prednisone). He did not receive any antifungal prophylaxis. On day +23 he was presented with febrile neutropenia, with no etiologic agent identified. An empirical treatment of five days of Meropenem was administered, with resulting in fever remission. He was discharged 6 days after his admission, asymptomatic but with persistent neutropenia.
Two days later, he had come back with an acute abdomen, although afebrile. Vital constants at admission were: BP: 107/78 mmHg, HR: 90 bpm, RR: 20 rpm, T °: 36.5 °C, weight: 55 Kg, height: 1.62 m, BMI: 21 Kg/m2. His blood tests showed leukocytes of 0.32 × 103/μL, absolute neutrophils 0.0032 x103/μL, hemoglobin 5.7 g/dL, platelets 35 × 103/μL, creatinine 0.66 mg/dL, ALT 174 IU/L, AST 82 IU/L, ALP 1004 IU/L, GGT 572 IU/L, total bilirubin 8 mg/dL, conjugated bilirubin 6.4 mg/dL, unconjugated bilirubin 1.62 mg/dL, LDH 287 IU/L, albumin 1.7 mg/dL, C reactive protein 8.4 mg/dL. The patient underwent exploratory laparotomy which revealed sigmoid perforation. Sigmoidectomy and colostomy were performed. The initial pathology report was diverticulum perforation. Forty-eight hours later, he presented moderate diffuse abdominal pain, and temperature > 38 °C. The blood cultures were negative. Administration of Meropenem, caspofungin and Filgastrim was empirically initiated. Contrast abdominal tomography (CT) showed diffuse liver lesions consistent with liver abscesses (Figure 1).
A liver biopsy of the lesions was performed under ultrasound guidance; the aerobic, anaerobic and Sabouraud dextrose agar cultures were negative. The pathology showed granulomatous hepatitis with extensive necrosis; Grocott’s stain evidenced hyaline hyphae. The histopathology of the sigmoid surgical specimen was reviewed again and then reported as transmural ischemic necrosis, acute and chronic peritonitis, and positive Grocott’s stain with the same hyphae described in the liver (Figure 2).
Hyalohyphomycosis was concluded. The serum galactomannan was negative. Pulmonary involvement was not seen by tomography. The antifungal treatment was changed from caspofungin to intravenous Voriconazole on day 23. The patient had gradual clinical improvement the neutropenia was remitted and was discharged with a treatment of oral voriconazole 200 mg bid. He was, at that time, in complete remission of leukemia.
Three weeks later he was readmitted for abdominal pain in the right hypochondrium with fever without neutropenia; he reported bad adherence to oral antifungal treatment for economic reasons. The new abdominal CT showed the persistence of liver abscesses. Exploratory laparotomy plus drainage were performed finding abscesses in segments II, IV and VI. The anaerobic culture grew Bacteroides fragilis; he completed 14 days of Metronidazole. The fungal culture was negative. The pathology report was extensive granulomatous hepatitis with necrosis and negative Grocott’s stain. The patient received 2 weeks of intravenous Voriconazole plus 6 weeks of the same oral antifungal. At the end of treatment, the abdominal CT showed only one residual lesion of 16 mm. A timeline of the case is shown in Figure S1.
He did not present further complications of the infectious process. However, six months later, while undergoing hematopoietic stem-cell transplant evaluations, he presented a relapse of leukemia and he decided to stop the antineoplastic treatment. He died seven months later.
Materials and Methods for Identification of the Causative Agent
A paraffin block of the first liver biopsy was requested, and DNA extraction was performed. Genomic DNA was extracted from the paraffin-embedded tissue sample using a DNeasy blood and tissue kit (Qiagen, Ventura, CA, USA) according to the manufacturer’s instructions before preliminary removal of paraffin by extraction with xylene protocol. The molecular identification was performed by 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification using a set of primers previously reported to identify fungi species (5′-TCCGTAGGTGAACCTTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). A PCR product of 500 bp was amplified, purified and sequenced in both directions; nucleotide sequence was determined with Taq FS Dye Terminator Cycle Sequencing Fluorescence-Based Sequencing and analyzed on an Applied Biosystems 3730 DNA sequencing system (Foster City, CA, USA). The sequence was edited with Vector NTI program and homology search was performed in the GenBank database (nucleotide blast), finding a 100% identity with Fusarium graminearum complex strain HUT59 [3]. (Figure 3). The sequences used are shown in Supplementary Figure S2.
4. Discussion
In the last ten years, there has been an increasing incidence of disseminated filamentous fungal infections in patients with severe immunosuppression [1,2,4]. Hematological malignancies have a risk of 6.5% for IFI [5], mainly in the induction and consolidation phases. This increase is due to severe immunosuppression conditions by myelotoxic treatments and related clinical conditions but also to new technologies such as molecular biology [6,7] that have increased the diagnosis ability.
Hialohifomycetes are opportunistic filamentous fungi that usually cause infection after environmental exposure [6]. Infection occurs through inhalation or skin breakdown (wounds, burns) [8]. Fusarium spp. is the second cause of infections by filamentous fungi after Aspergillus spp. More than 50 Fusarium species have been identified, but only about 12 are associated with infection in humans. F. incarnatum, F. moniliforme, F. oxysporum and F. solani usually cause allergic reactions and superficial infections such as keratitis and onychomycosis in immunocompetent hosts. In immunocompromised patients, it can cause from locally invasive diseases such as sinusitis and pneumonia, to fungemia and disseminated disease [9,10]. In neutropenic patients, it usually manifests as fever not responding to empirical antibiotics. Profound and prolonged neutropenia is the most important risk factor for dissemination and death due to fusariosis [8,11]. The most frequently isolated species in this setting are F. solani (50%) and F. oxysporum (20%) [6,8].
Fusarium graminearum plays a major role as the etiological agent of one important disease of small grain cereals and corn. First identified in 1884 in England, it is considered a major threat to wheat and barley [12]. The fungi, transmitted by seed, can survive up to 10 years as spores or resting structures in and on the seed. In Mexico, F. graminearum has been found in Hidalgo, Jalisco, Mexico, Michoacán and Tlaxcala [13,14,15,16]. This fungus can produce several mycotoxins, which have shown abortive estrogenic, gastric (nausea and vomiting) and neurotoxic toxicity in swine, cattle, dogs, cats, and ducks [16,17]. Grain that has been infected with the fungus can be incorporated into basic diets and could be a source of infection in humans. So far, no infections due to F. graminareum have been reported. Considering the patient’s occupation (kitchen helper) and the high corn content in the Mexican diet, we supposed that the patient was colonized with F. graminearum through the daily ingestion and handling of corn. He possibly got the mould through oral ingestion, and symptoms were gastrointestinal due to portal dissemination, which explains why we did not document any fungemia or cutaneous infection, despite an invasive disease. Usually, in disseminated fusariosis, blood cultures are positive in more than 75% of cases [6,8].
In our patient, the diagnosis of hyalohyphomycosis was first made by pathologic specimen. The biopsy revealed the presence of septate hyaline hyphae 3–6 μm diameter, indistinguishable from other hyalohyphomycosis such as Aspergillus, Acremonium [Cephalosporium], and Pseudallescheria [17]. Recently, the Mycotic Diseases Branch, from the Center for Disease Control and Prevention in Atlanta, described a new entity of invasive fungal infections (IFI), which they called “foodborne IFI”, in a recently published systematic review [18], foodborne IFI are infections acquired through ingestion of food or water contaminated with the fungi causing the infection. Reports describe molds and yeasts as etiologic agents. Rhizopus sp is the most frequently described mold, but one case of IFI due to Fusarium moniliforme is reported in a man with acute lymphoblastic leukemia who ingested cereals. The diagnosis of foodborne IFI is difficult, clinical presentation is usually atypical, and mainly gastrointestinal. Fungi can spoil food that is ingested, and it is suggested that this category of fungal infections could be related to food insecurity. The source of the fungi should be identified to be able to classify the IFI as foodborne, which is often difficult to the ubiquitous nature of these fungi. As previously mentioned, although we suspect that our patient acquired the infection orally and this could correspond to foodborne IFI, we cannot corroborate the above because we could not have samples of the food that the patient ingested prior to his hospitalization and we did not perform stool cultures.
Today, comparative identification strategies based on gene sequencing can be considered the new gold standard for the identification of fungal species. Gene sequencing is characterized by PCR amplification of the ITS region, and sequencing of the resulting amplicon (s). The ITS region can be amplified reliably for most fungi [19]. These molecular biology techniques provide better discrimination of species morphologically indistinguishable from Fusarium spp, and can be performed on different types of materials, including paraffin blocks, which is why it is considered an emerging and promising methodology to be used in the routine identification of Fusarium spp. In our case, no other fungal species were identified in the studied specimen or in any other specimen from the patient. The Fusarium graminearum complex includes 13 species; biogeographic data suggest that the majority of the species within the complex have evolutionary origins in the Southern hemisphere and Asia. According to the surveys to date, F. austroamericanum, F. meridionale, F. cortaderiae, and F. brasilicum appear to be endemic to South America; F. acaciae-mearnsii to Australia or less likely Africa; F. asiaticum, F. vorosii and F. ussurianum to Asia; F. aethiopicum to Africa; F. boothii and F. mesoamericanum to Central America; F. gerlachii to the US and F. graminearum sensu stricto (F. graminearum s.s.) it is the most cosmopolitan species and has been found in Asia, Africa, America, Europe, and Oceania [20].
Finally, the treatment in localized disease can benefit from surgical debridement especially in disseminated disease together with the use of systemic antifungals. Fusarium species are relatively resistant in vitro to most antifungal agents, showing different susceptibility patterns between species. In general, most Fusarium isolates have lower inhibitory concentrations (MIC) for Amphotericin B higher than Aspergillus species. F. solani and F. verticillioides are usually resistant to azoles and they have higher MIC for azoles than other Fusarium species. In contrast, F. oxysporum and F. moniliforme may be susceptible to voriconazole and posaconazole [9]. Echinocandins show the highest MIC values [21]. As far as we know there are no previous reports in the medical literature of identification of F.graminearum as a pathogen in humans; therefore antifungal therapy was initiated based on is the antifungals reported in the literature for the Fusarium species and on the clinical response.
5. Conclusions
Prolonged profound neutropenia and alteration of the intestinal flora, secondary to myelotoxic chemotherapies and environmental exposure in patients with hematological neoplasms, are important risk factors for the development of invasive infections by filamentous fungi. This is the first reported case of invasive fungal infection by F. graminearum and the first case of portal dissemination of Fusarium spp. The anamnesis and exposure to environmental factors are important during clinical evaluation. F.graminearum was not identifiable by traditional methods such as culture and pathology. Access to molecular biology is extremely valuable to increase the performance of diagnostic tests in the identification of new species such as the F. graminearum reported in our paper.
Acknowledgments
To all the infectious disease fellows who participated in the approach of this case, especially to Aaron Molina. And Rodrigo Toral-Villanueva for his technical support with the edition of figures.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Materials
The following are available online at https://www.mdpi.com/2036-7449/13/1/2/s1, Supplementary material 1 (Figure S1) is a timeline of the present case. Supplementary material 2 (Figure S2) is a figure with the genetic sequences used for the identification of the etiologic agent (Fusarium graminearum complex).
Click here for additional data file.
Author Contributions
M.G.U. was in charge of the data curation of the patient; A.M.-O. and M.G.U. were in charge of the writing of the original manuscript; R.H.-C. was in charge of the methodology for the identification by molecular biology of the etiologic agent ; C.P.-J. was responsible for reviewing and editing the manuscript as well as submitting it for publication. R.H.-G. was in charge of the methodology for the identification of the agent in the pathology specimen. K.E.-B. also participated in the data curation of the patient and in the writing of the original manuscript.All authors have read and agreed to the published version of the manuscript.
Funding
No source of funding was used for the preparation of this report.
Institutional Review Board Statement
Not applicable. Due to the fact that our study is only descriptive (without any type of intervention) on the case of a single patient, and he provided his consent, the evaluation by the Institution's ethics committee was not considered necessary.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Data is contained within the article or supplementary material.
Conflicts of Interest
All authors report having no conflict of interest.
Figure 1 Abdominal CT scan with intravenous contrast, which shows: Diffuse and poorly defined hypodense lesions, one located in the liver segment II measuring 3.4 cm, another located in the caudate lobe measuring 7 cm, and another located in the hepatic segment VII with extension to segment VI measuring 7 cm; consistent with liver abscesses.
Figure 2 (A) Non-pigmented, separated hyphae with acute angle branching in liver biopsy tissue, Grocott methenamine silver-stained specimen, 40×. (B) Non-pigmented, separated hyphae with acute angle branching in intestinal tissue, Grocott methenamine silver-stained specimen, 10×.
Figure 3 The 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification. Lane 1: Molecular weight marker 100 bp DNA ladder; Lane 2: Liver biopsy sample; Lane 3: Negative control. | ASPARAGINASE, CASPOFUNGIN, DAUNORUBICIN, FILGRASTIM, MEROPENEM, METRONIDAZOLE, PREDNISONE, VINCRISTINE, VORICONAZOLE | DrugsGivenReaction | CC BY | 33401374 | 19,386,199 | 2021-01-01 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Gastrointestinal necrosis'. | Portal Dissemination of Fusarium graminearum in a Patient with Acute Lymphoblastic Leukemia and Febrile Neutropenia.
We present the case of a man with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, with gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene, from a liver biopsy. The infection was resolved with surgical drainage and antifungal treatment based on voriconazole. As far as we know, there are no previous reports in the literature of cases of human infection due to Fusarium graminearum.
1. Introduction
In the last decades, there has been an increase in the incidence of invasive fungal infections (IFI), related to new immunosuppressive treatments and improved diagnosis with new molecular techniques and higher diagnostic yields [1,2]. We present the case of a male patient with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, presenting an atypical clinical course, gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene from a liver biopsy. This is the first reported case of portal dissemination by Fusarium genus and the first report of Fusarium graminearum infection in humans.
2. Ethical Considerations
The case we submit for publication is about a single patient who provided his verbal consent for this purpose. We do not include any details or information that could lead to patient identification
3. Case Report
Male patient, 26 years old, kitchen assistant, originated from Taxco, Guerrero and living there until he emigrated to Texas, United States, in 2016, where he was diagnosed with B lymphoblastic leukemia in January 2017. He received four cycles of unspecified chemotherapy with apparent remission of the disease and came back to Mexico (Cuernavaca, Morelos). He was admitted to the National Institute of Cancer in Mexico City in November 2017, where he was diagnosed with early relapse. From November 2017 to January 2018, he received chemotherapy for relapse with BFM like protocol (L-Asparaginase, Vincristine, Daunorubicin, and Prednisone). He did not receive any antifungal prophylaxis. On day +23 he was presented with febrile neutropenia, with no etiologic agent identified. An empirical treatment of five days of Meropenem was administered, with resulting in fever remission. He was discharged 6 days after his admission, asymptomatic but with persistent neutropenia.
Two days later, he had come back with an acute abdomen, although afebrile. Vital constants at admission were: BP: 107/78 mmHg, HR: 90 bpm, RR: 20 rpm, T °: 36.5 °C, weight: 55 Kg, height: 1.62 m, BMI: 21 Kg/m2. His blood tests showed leukocytes of 0.32 × 103/μL, absolute neutrophils 0.0032 x103/μL, hemoglobin 5.7 g/dL, platelets 35 × 103/μL, creatinine 0.66 mg/dL, ALT 174 IU/L, AST 82 IU/L, ALP 1004 IU/L, GGT 572 IU/L, total bilirubin 8 mg/dL, conjugated bilirubin 6.4 mg/dL, unconjugated bilirubin 1.62 mg/dL, LDH 287 IU/L, albumin 1.7 mg/dL, C reactive protein 8.4 mg/dL. The patient underwent exploratory laparotomy which revealed sigmoid perforation. Sigmoidectomy and colostomy were performed. The initial pathology report was diverticulum perforation. Forty-eight hours later, he presented moderate diffuse abdominal pain, and temperature > 38 °C. The blood cultures were negative. Administration of Meropenem, caspofungin and Filgastrim was empirically initiated. Contrast abdominal tomography (CT) showed diffuse liver lesions consistent with liver abscesses (Figure 1).
A liver biopsy of the lesions was performed under ultrasound guidance; the aerobic, anaerobic and Sabouraud dextrose agar cultures were negative. The pathology showed granulomatous hepatitis with extensive necrosis; Grocott’s stain evidenced hyaline hyphae. The histopathology of the sigmoid surgical specimen was reviewed again and then reported as transmural ischemic necrosis, acute and chronic peritonitis, and positive Grocott’s stain with the same hyphae described in the liver (Figure 2).
Hyalohyphomycosis was concluded. The serum galactomannan was negative. Pulmonary involvement was not seen by tomography. The antifungal treatment was changed from caspofungin to intravenous Voriconazole on day 23. The patient had gradual clinical improvement the neutropenia was remitted and was discharged with a treatment of oral voriconazole 200 mg bid. He was, at that time, in complete remission of leukemia.
Three weeks later he was readmitted for abdominal pain in the right hypochondrium with fever without neutropenia; he reported bad adherence to oral antifungal treatment for economic reasons. The new abdominal CT showed the persistence of liver abscesses. Exploratory laparotomy plus drainage were performed finding abscesses in segments II, IV and VI. The anaerobic culture grew Bacteroides fragilis; he completed 14 days of Metronidazole. The fungal culture was negative. The pathology report was extensive granulomatous hepatitis with necrosis and negative Grocott’s stain. The patient received 2 weeks of intravenous Voriconazole plus 6 weeks of the same oral antifungal. At the end of treatment, the abdominal CT showed only one residual lesion of 16 mm. A timeline of the case is shown in Figure S1.
He did not present further complications of the infectious process. However, six months later, while undergoing hematopoietic stem-cell transplant evaluations, he presented a relapse of leukemia and he decided to stop the antineoplastic treatment. He died seven months later.
Materials and Methods for Identification of the Causative Agent
A paraffin block of the first liver biopsy was requested, and DNA extraction was performed. Genomic DNA was extracted from the paraffin-embedded tissue sample using a DNeasy blood and tissue kit (Qiagen, Ventura, CA, USA) according to the manufacturer’s instructions before preliminary removal of paraffin by extraction with xylene protocol. The molecular identification was performed by 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification using a set of primers previously reported to identify fungi species (5′-TCCGTAGGTGAACCTTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). A PCR product of 500 bp was amplified, purified and sequenced in both directions; nucleotide sequence was determined with Taq FS Dye Terminator Cycle Sequencing Fluorescence-Based Sequencing and analyzed on an Applied Biosystems 3730 DNA sequencing system (Foster City, CA, USA). The sequence was edited with Vector NTI program and homology search was performed in the GenBank database (nucleotide blast), finding a 100% identity with Fusarium graminearum complex strain HUT59 [3]. (Figure 3). The sequences used are shown in Supplementary Figure S2.
4. Discussion
In the last ten years, there has been an increasing incidence of disseminated filamentous fungal infections in patients with severe immunosuppression [1,2,4]. Hematological malignancies have a risk of 6.5% for IFI [5], mainly in the induction and consolidation phases. This increase is due to severe immunosuppression conditions by myelotoxic treatments and related clinical conditions but also to new technologies such as molecular biology [6,7] that have increased the diagnosis ability.
Hialohifomycetes are opportunistic filamentous fungi that usually cause infection after environmental exposure [6]. Infection occurs through inhalation or skin breakdown (wounds, burns) [8]. Fusarium spp. is the second cause of infections by filamentous fungi after Aspergillus spp. More than 50 Fusarium species have been identified, but only about 12 are associated with infection in humans. F. incarnatum, F. moniliforme, F. oxysporum and F. solani usually cause allergic reactions and superficial infections such as keratitis and onychomycosis in immunocompetent hosts. In immunocompromised patients, it can cause from locally invasive diseases such as sinusitis and pneumonia, to fungemia and disseminated disease [9,10]. In neutropenic patients, it usually manifests as fever not responding to empirical antibiotics. Profound and prolonged neutropenia is the most important risk factor for dissemination and death due to fusariosis [8,11]. The most frequently isolated species in this setting are F. solani (50%) and F. oxysporum (20%) [6,8].
Fusarium graminearum plays a major role as the etiological agent of one important disease of small grain cereals and corn. First identified in 1884 in England, it is considered a major threat to wheat and barley [12]. The fungi, transmitted by seed, can survive up to 10 years as spores or resting structures in and on the seed. In Mexico, F. graminearum has been found in Hidalgo, Jalisco, Mexico, Michoacán and Tlaxcala [13,14,15,16]. This fungus can produce several mycotoxins, which have shown abortive estrogenic, gastric (nausea and vomiting) and neurotoxic toxicity in swine, cattle, dogs, cats, and ducks [16,17]. Grain that has been infected with the fungus can be incorporated into basic diets and could be a source of infection in humans. So far, no infections due to F. graminareum have been reported. Considering the patient’s occupation (kitchen helper) and the high corn content in the Mexican diet, we supposed that the patient was colonized with F. graminearum through the daily ingestion and handling of corn. He possibly got the mould through oral ingestion, and symptoms were gastrointestinal due to portal dissemination, which explains why we did not document any fungemia or cutaneous infection, despite an invasive disease. Usually, in disseminated fusariosis, blood cultures are positive in more than 75% of cases [6,8].
In our patient, the diagnosis of hyalohyphomycosis was first made by pathologic specimen. The biopsy revealed the presence of septate hyaline hyphae 3–6 μm diameter, indistinguishable from other hyalohyphomycosis such as Aspergillus, Acremonium [Cephalosporium], and Pseudallescheria [17]. Recently, the Mycotic Diseases Branch, from the Center for Disease Control and Prevention in Atlanta, described a new entity of invasive fungal infections (IFI), which they called “foodborne IFI”, in a recently published systematic review [18], foodborne IFI are infections acquired through ingestion of food or water contaminated with the fungi causing the infection. Reports describe molds and yeasts as etiologic agents. Rhizopus sp is the most frequently described mold, but one case of IFI due to Fusarium moniliforme is reported in a man with acute lymphoblastic leukemia who ingested cereals. The diagnosis of foodborne IFI is difficult, clinical presentation is usually atypical, and mainly gastrointestinal. Fungi can spoil food that is ingested, and it is suggested that this category of fungal infections could be related to food insecurity. The source of the fungi should be identified to be able to classify the IFI as foodborne, which is often difficult to the ubiquitous nature of these fungi. As previously mentioned, although we suspect that our patient acquired the infection orally and this could correspond to foodborne IFI, we cannot corroborate the above because we could not have samples of the food that the patient ingested prior to his hospitalization and we did not perform stool cultures.
Today, comparative identification strategies based on gene sequencing can be considered the new gold standard for the identification of fungal species. Gene sequencing is characterized by PCR amplification of the ITS region, and sequencing of the resulting amplicon (s). The ITS region can be amplified reliably for most fungi [19]. These molecular biology techniques provide better discrimination of species morphologically indistinguishable from Fusarium spp, and can be performed on different types of materials, including paraffin blocks, which is why it is considered an emerging and promising methodology to be used in the routine identification of Fusarium spp. In our case, no other fungal species were identified in the studied specimen or in any other specimen from the patient. The Fusarium graminearum complex includes 13 species; biogeographic data suggest that the majority of the species within the complex have evolutionary origins in the Southern hemisphere and Asia. According to the surveys to date, F. austroamericanum, F. meridionale, F. cortaderiae, and F. brasilicum appear to be endemic to South America; F. acaciae-mearnsii to Australia or less likely Africa; F. asiaticum, F. vorosii and F. ussurianum to Asia; F. aethiopicum to Africa; F. boothii and F. mesoamericanum to Central America; F. gerlachii to the US and F. graminearum sensu stricto (F. graminearum s.s.) it is the most cosmopolitan species and has been found in Asia, Africa, America, Europe, and Oceania [20].
Finally, the treatment in localized disease can benefit from surgical debridement especially in disseminated disease together with the use of systemic antifungals. Fusarium species are relatively resistant in vitro to most antifungal agents, showing different susceptibility patterns between species. In general, most Fusarium isolates have lower inhibitory concentrations (MIC) for Amphotericin B higher than Aspergillus species. F. solani and F. verticillioides are usually resistant to azoles and they have higher MIC for azoles than other Fusarium species. In contrast, F. oxysporum and F. moniliforme may be susceptible to voriconazole and posaconazole [9]. Echinocandins show the highest MIC values [21]. As far as we know there are no previous reports in the medical literature of identification of F.graminearum as a pathogen in humans; therefore antifungal therapy was initiated based on is the antifungals reported in the literature for the Fusarium species and on the clinical response.
5. Conclusions
Prolonged profound neutropenia and alteration of the intestinal flora, secondary to myelotoxic chemotherapies and environmental exposure in patients with hematological neoplasms, are important risk factors for the development of invasive infections by filamentous fungi. This is the first reported case of invasive fungal infection by F. graminearum and the first case of portal dissemination of Fusarium spp. The anamnesis and exposure to environmental factors are important during clinical evaluation. F.graminearum was not identifiable by traditional methods such as culture and pathology. Access to molecular biology is extremely valuable to increase the performance of diagnostic tests in the identification of new species such as the F. graminearum reported in our paper.
Acknowledgments
To all the infectious disease fellows who participated in the approach of this case, especially to Aaron Molina. And Rodrigo Toral-Villanueva for his technical support with the edition of figures.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Materials
The following are available online at https://www.mdpi.com/2036-7449/13/1/2/s1, Supplementary material 1 (Figure S1) is a timeline of the present case. Supplementary material 2 (Figure S2) is a figure with the genetic sequences used for the identification of the etiologic agent (Fusarium graminearum complex).
Click here for additional data file.
Author Contributions
M.G.U. was in charge of the data curation of the patient; A.M.-O. and M.G.U. were in charge of the writing of the original manuscript; R.H.-C. was in charge of the methodology for the identification by molecular biology of the etiologic agent ; C.P.-J. was responsible for reviewing and editing the manuscript as well as submitting it for publication. R.H.-G. was in charge of the methodology for the identification of the agent in the pathology specimen. K.E.-B. also participated in the data curation of the patient and in the writing of the original manuscript.All authors have read and agreed to the published version of the manuscript.
Funding
No source of funding was used for the preparation of this report.
Institutional Review Board Statement
Not applicable. Due to the fact that our study is only descriptive (without any type of intervention) on the case of a single patient, and he provided his consent, the evaluation by the Institution's ethics committee was not considered necessary.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Data is contained within the article or supplementary material.
Conflicts of Interest
All authors report having no conflict of interest.
Figure 1 Abdominal CT scan with intravenous contrast, which shows: Diffuse and poorly defined hypodense lesions, one located in the liver segment II measuring 3.4 cm, another located in the caudate lobe measuring 7 cm, and another located in the hepatic segment VII with extension to segment VI measuring 7 cm; consistent with liver abscesses.
Figure 2 (A) Non-pigmented, separated hyphae with acute angle branching in liver biopsy tissue, Grocott methenamine silver-stained specimen, 40×. (B) Non-pigmented, separated hyphae with acute angle branching in intestinal tissue, Grocott methenamine silver-stained specimen, 10×.
Figure 3 The 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification. Lane 1: Molecular weight marker 100 bp DNA ladder; Lane 2: Liver biopsy sample; Lane 3: Negative control. | ASPARAGINASE, CASPOFUNGIN, DAUNORUBICIN, FILGRASTIM, MEROPENEM, METRONIDAZOLE, PREDNISONE, VINCRISTINE, VORICONAZOLE | DrugsGivenReaction | CC BY | 33401374 | 19,386,199 | 2021-01-01 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Granulomatous liver disease'. | Portal Dissemination of Fusarium graminearum in a Patient with Acute Lymphoblastic Leukemia and Febrile Neutropenia.
We present the case of a man with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, with gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene, from a liver biopsy. The infection was resolved with surgical drainage and antifungal treatment based on voriconazole. As far as we know, there are no previous reports in the literature of cases of human infection due to Fusarium graminearum.
1. Introduction
In the last decades, there has been an increase in the incidence of invasive fungal infections (IFI), related to new immunosuppressive treatments and improved diagnosis with new molecular techniques and higher diagnostic yields [1,2]. We present the case of a male patient with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, presenting an atypical clinical course, gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene from a liver biopsy. This is the first reported case of portal dissemination by Fusarium genus and the first report of Fusarium graminearum infection in humans.
2. Ethical Considerations
The case we submit for publication is about a single patient who provided his verbal consent for this purpose. We do not include any details or information that could lead to patient identification
3. Case Report
Male patient, 26 years old, kitchen assistant, originated from Taxco, Guerrero and living there until he emigrated to Texas, United States, in 2016, where he was diagnosed with B lymphoblastic leukemia in January 2017. He received four cycles of unspecified chemotherapy with apparent remission of the disease and came back to Mexico (Cuernavaca, Morelos). He was admitted to the National Institute of Cancer in Mexico City in November 2017, where he was diagnosed with early relapse. From November 2017 to January 2018, he received chemotherapy for relapse with BFM like protocol (L-Asparaginase, Vincristine, Daunorubicin, and Prednisone). He did not receive any antifungal prophylaxis. On day +23 he was presented with febrile neutropenia, with no etiologic agent identified. An empirical treatment of five days of Meropenem was administered, with resulting in fever remission. He was discharged 6 days after his admission, asymptomatic but with persistent neutropenia.
Two days later, he had come back with an acute abdomen, although afebrile. Vital constants at admission were: BP: 107/78 mmHg, HR: 90 bpm, RR: 20 rpm, T °: 36.5 °C, weight: 55 Kg, height: 1.62 m, BMI: 21 Kg/m2. His blood tests showed leukocytes of 0.32 × 103/μL, absolute neutrophils 0.0032 x103/μL, hemoglobin 5.7 g/dL, platelets 35 × 103/μL, creatinine 0.66 mg/dL, ALT 174 IU/L, AST 82 IU/L, ALP 1004 IU/L, GGT 572 IU/L, total bilirubin 8 mg/dL, conjugated bilirubin 6.4 mg/dL, unconjugated bilirubin 1.62 mg/dL, LDH 287 IU/L, albumin 1.7 mg/dL, C reactive protein 8.4 mg/dL. The patient underwent exploratory laparotomy which revealed sigmoid perforation. Sigmoidectomy and colostomy were performed. The initial pathology report was diverticulum perforation. Forty-eight hours later, he presented moderate diffuse abdominal pain, and temperature > 38 °C. The blood cultures were negative. Administration of Meropenem, caspofungin and Filgastrim was empirically initiated. Contrast abdominal tomography (CT) showed diffuse liver lesions consistent with liver abscesses (Figure 1).
A liver biopsy of the lesions was performed under ultrasound guidance; the aerobic, anaerobic and Sabouraud dextrose agar cultures were negative. The pathology showed granulomatous hepatitis with extensive necrosis; Grocott’s stain evidenced hyaline hyphae. The histopathology of the sigmoid surgical specimen was reviewed again and then reported as transmural ischemic necrosis, acute and chronic peritonitis, and positive Grocott’s stain with the same hyphae described in the liver (Figure 2).
Hyalohyphomycosis was concluded. The serum galactomannan was negative. Pulmonary involvement was not seen by tomography. The antifungal treatment was changed from caspofungin to intravenous Voriconazole on day 23. The patient had gradual clinical improvement the neutropenia was remitted and was discharged with a treatment of oral voriconazole 200 mg bid. He was, at that time, in complete remission of leukemia.
Three weeks later he was readmitted for abdominal pain in the right hypochondrium with fever without neutropenia; he reported bad adherence to oral antifungal treatment for economic reasons. The new abdominal CT showed the persistence of liver abscesses. Exploratory laparotomy plus drainage were performed finding abscesses in segments II, IV and VI. The anaerobic culture grew Bacteroides fragilis; he completed 14 days of Metronidazole. The fungal culture was negative. The pathology report was extensive granulomatous hepatitis with necrosis and negative Grocott’s stain. The patient received 2 weeks of intravenous Voriconazole plus 6 weeks of the same oral antifungal. At the end of treatment, the abdominal CT showed only one residual lesion of 16 mm. A timeline of the case is shown in Figure S1.
He did not present further complications of the infectious process. However, six months later, while undergoing hematopoietic stem-cell transplant evaluations, he presented a relapse of leukemia and he decided to stop the antineoplastic treatment. He died seven months later.
Materials and Methods for Identification of the Causative Agent
A paraffin block of the first liver biopsy was requested, and DNA extraction was performed. Genomic DNA was extracted from the paraffin-embedded tissue sample using a DNeasy blood and tissue kit (Qiagen, Ventura, CA, USA) according to the manufacturer’s instructions before preliminary removal of paraffin by extraction with xylene protocol. The molecular identification was performed by 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification using a set of primers previously reported to identify fungi species (5′-TCCGTAGGTGAACCTTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). A PCR product of 500 bp was amplified, purified and sequenced in both directions; nucleotide sequence was determined with Taq FS Dye Terminator Cycle Sequencing Fluorescence-Based Sequencing and analyzed on an Applied Biosystems 3730 DNA sequencing system (Foster City, CA, USA). The sequence was edited with Vector NTI program and homology search was performed in the GenBank database (nucleotide blast), finding a 100% identity with Fusarium graminearum complex strain HUT59 [3]. (Figure 3). The sequences used are shown in Supplementary Figure S2.
4. Discussion
In the last ten years, there has been an increasing incidence of disseminated filamentous fungal infections in patients with severe immunosuppression [1,2,4]. Hematological malignancies have a risk of 6.5% for IFI [5], mainly in the induction and consolidation phases. This increase is due to severe immunosuppression conditions by myelotoxic treatments and related clinical conditions but also to new technologies such as molecular biology [6,7] that have increased the diagnosis ability.
Hialohifomycetes are opportunistic filamentous fungi that usually cause infection after environmental exposure [6]. Infection occurs through inhalation or skin breakdown (wounds, burns) [8]. Fusarium spp. is the second cause of infections by filamentous fungi after Aspergillus spp. More than 50 Fusarium species have been identified, but only about 12 are associated with infection in humans. F. incarnatum, F. moniliforme, F. oxysporum and F. solani usually cause allergic reactions and superficial infections such as keratitis and onychomycosis in immunocompetent hosts. In immunocompromised patients, it can cause from locally invasive diseases such as sinusitis and pneumonia, to fungemia and disseminated disease [9,10]. In neutropenic patients, it usually manifests as fever not responding to empirical antibiotics. Profound and prolonged neutropenia is the most important risk factor for dissemination and death due to fusariosis [8,11]. The most frequently isolated species in this setting are F. solani (50%) and F. oxysporum (20%) [6,8].
Fusarium graminearum plays a major role as the etiological agent of one important disease of small grain cereals and corn. First identified in 1884 in England, it is considered a major threat to wheat and barley [12]. The fungi, transmitted by seed, can survive up to 10 years as spores or resting structures in and on the seed. In Mexico, F. graminearum has been found in Hidalgo, Jalisco, Mexico, Michoacán and Tlaxcala [13,14,15,16]. This fungus can produce several mycotoxins, which have shown abortive estrogenic, gastric (nausea and vomiting) and neurotoxic toxicity in swine, cattle, dogs, cats, and ducks [16,17]. Grain that has been infected with the fungus can be incorporated into basic diets and could be a source of infection in humans. So far, no infections due to F. graminareum have been reported. Considering the patient’s occupation (kitchen helper) and the high corn content in the Mexican diet, we supposed that the patient was colonized with F. graminearum through the daily ingestion and handling of corn. He possibly got the mould through oral ingestion, and symptoms were gastrointestinal due to portal dissemination, which explains why we did not document any fungemia or cutaneous infection, despite an invasive disease. Usually, in disseminated fusariosis, blood cultures are positive in more than 75% of cases [6,8].
In our patient, the diagnosis of hyalohyphomycosis was first made by pathologic specimen. The biopsy revealed the presence of septate hyaline hyphae 3–6 μm diameter, indistinguishable from other hyalohyphomycosis such as Aspergillus, Acremonium [Cephalosporium], and Pseudallescheria [17]. Recently, the Mycotic Diseases Branch, from the Center for Disease Control and Prevention in Atlanta, described a new entity of invasive fungal infections (IFI), which they called “foodborne IFI”, in a recently published systematic review [18], foodborne IFI are infections acquired through ingestion of food or water contaminated with the fungi causing the infection. Reports describe molds and yeasts as etiologic agents. Rhizopus sp is the most frequently described mold, but one case of IFI due to Fusarium moniliforme is reported in a man with acute lymphoblastic leukemia who ingested cereals. The diagnosis of foodborne IFI is difficult, clinical presentation is usually atypical, and mainly gastrointestinal. Fungi can spoil food that is ingested, and it is suggested that this category of fungal infections could be related to food insecurity. The source of the fungi should be identified to be able to classify the IFI as foodborne, which is often difficult to the ubiquitous nature of these fungi. As previously mentioned, although we suspect that our patient acquired the infection orally and this could correspond to foodborne IFI, we cannot corroborate the above because we could not have samples of the food that the patient ingested prior to his hospitalization and we did not perform stool cultures.
Today, comparative identification strategies based on gene sequencing can be considered the new gold standard for the identification of fungal species. Gene sequencing is characterized by PCR amplification of the ITS region, and sequencing of the resulting amplicon (s). The ITS region can be amplified reliably for most fungi [19]. These molecular biology techniques provide better discrimination of species morphologically indistinguishable from Fusarium spp, and can be performed on different types of materials, including paraffin blocks, which is why it is considered an emerging and promising methodology to be used in the routine identification of Fusarium spp. In our case, no other fungal species were identified in the studied specimen or in any other specimen from the patient. The Fusarium graminearum complex includes 13 species; biogeographic data suggest that the majority of the species within the complex have evolutionary origins in the Southern hemisphere and Asia. According to the surveys to date, F. austroamericanum, F. meridionale, F. cortaderiae, and F. brasilicum appear to be endemic to South America; F. acaciae-mearnsii to Australia or less likely Africa; F. asiaticum, F. vorosii and F. ussurianum to Asia; F. aethiopicum to Africa; F. boothii and F. mesoamericanum to Central America; F. gerlachii to the US and F. graminearum sensu stricto (F. graminearum s.s.) it is the most cosmopolitan species and has been found in Asia, Africa, America, Europe, and Oceania [20].
Finally, the treatment in localized disease can benefit from surgical debridement especially in disseminated disease together with the use of systemic antifungals. Fusarium species are relatively resistant in vitro to most antifungal agents, showing different susceptibility patterns between species. In general, most Fusarium isolates have lower inhibitory concentrations (MIC) for Amphotericin B higher than Aspergillus species. F. solani and F. verticillioides are usually resistant to azoles and they have higher MIC for azoles than other Fusarium species. In contrast, F. oxysporum and F. moniliforme may be susceptible to voriconazole and posaconazole [9]. Echinocandins show the highest MIC values [21]. As far as we know there are no previous reports in the medical literature of identification of F.graminearum as a pathogen in humans; therefore antifungal therapy was initiated based on is the antifungals reported in the literature for the Fusarium species and on the clinical response.
5. Conclusions
Prolonged profound neutropenia and alteration of the intestinal flora, secondary to myelotoxic chemotherapies and environmental exposure in patients with hematological neoplasms, are important risk factors for the development of invasive infections by filamentous fungi. This is the first reported case of invasive fungal infection by F. graminearum and the first case of portal dissemination of Fusarium spp. The anamnesis and exposure to environmental factors are important during clinical evaluation. F.graminearum was not identifiable by traditional methods such as culture and pathology. Access to molecular biology is extremely valuable to increase the performance of diagnostic tests in the identification of new species such as the F. graminearum reported in our paper.
Acknowledgments
To all the infectious disease fellows who participated in the approach of this case, especially to Aaron Molina. And Rodrigo Toral-Villanueva for his technical support with the edition of figures.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Materials
The following are available online at https://www.mdpi.com/2036-7449/13/1/2/s1, Supplementary material 1 (Figure S1) is a timeline of the present case. Supplementary material 2 (Figure S2) is a figure with the genetic sequences used for the identification of the etiologic agent (Fusarium graminearum complex).
Click here for additional data file.
Author Contributions
M.G.U. was in charge of the data curation of the patient; A.M.-O. and M.G.U. were in charge of the writing of the original manuscript; R.H.-C. was in charge of the methodology for the identification by molecular biology of the etiologic agent ; C.P.-J. was responsible for reviewing and editing the manuscript as well as submitting it for publication. R.H.-G. was in charge of the methodology for the identification of the agent in the pathology specimen. K.E.-B. also participated in the data curation of the patient and in the writing of the original manuscript.All authors have read and agreed to the published version of the manuscript.
Funding
No source of funding was used for the preparation of this report.
Institutional Review Board Statement
Not applicable. Due to the fact that our study is only descriptive (without any type of intervention) on the case of a single patient, and he provided his consent, the evaluation by the Institution's ethics committee was not considered necessary.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Data is contained within the article or supplementary material.
Conflicts of Interest
All authors report having no conflict of interest.
Figure 1 Abdominal CT scan with intravenous contrast, which shows: Diffuse and poorly defined hypodense lesions, one located in the liver segment II measuring 3.4 cm, another located in the caudate lobe measuring 7 cm, and another located in the hepatic segment VII with extension to segment VI measuring 7 cm; consistent with liver abscesses.
Figure 2 (A) Non-pigmented, separated hyphae with acute angle branching in liver biopsy tissue, Grocott methenamine silver-stained specimen, 40×. (B) Non-pigmented, separated hyphae with acute angle branching in intestinal tissue, Grocott methenamine silver-stained specimen, 10×.
Figure 3 The 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification. Lane 1: Molecular weight marker 100 bp DNA ladder; Lane 2: Liver biopsy sample; Lane 3: Negative control. | ASPARAGINASE, CASPOFUNGIN, DAUNORUBICIN, FILGRASTIM, MEROPENEM, METRONIDAZOLE, PREDNISONE, VINCRISTINE, VORICONAZOLE | DrugsGivenReaction | CC BY | 33401374 | 19,386,199 | 2021-01-01 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Hepatic necrosis'. | Portal Dissemination of Fusarium graminearum in a Patient with Acute Lymphoblastic Leukemia and Febrile Neutropenia.
We present the case of a man with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, with gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene, from a liver biopsy. The infection was resolved with surgical drainage and antifungal treatment based on voriconazole. As far as we know, there are no previous reports in the literature of cases of human infection due to Fusarium graminearum.
1. Introduction
In the last decades, there has been an increase in the incidence of invasive fungal infections (IFI), related to new immunosuppressive treatments and improved diagnosis with new molecular techniques and higher diagnostic yields [1,2]. We present the case of a male patient with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, presenting an atypical clinical course, gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene from a liver biopsy. This is the first reported case of portal dissemination by Fusarium genus and the first report of Fusarium graminearum infection in humans.
2. Ethical Considerations
The case we submit for publication is about a single patient who provided his verbal consent for this purpose. We do not include any details or information that could lead to patient identification
3. Case Report
Male patient, 26 years old, kitchen assistant, originated from Taxco, Guerrero and living there until he emigrated to Texas, United States, in 2016, where he was diagnosed with B lymphoblastic leukemia in January 2017. He received four cycles of unspecified chemotherapy with apparent remission of the disease and came back to Mexico (Cuernavaca, Morelos). He was admitted to the National Institute of Cancer in Mexico City in November 2017, where he was diagnosed with early relapse. From November 2017 to January 2018, he received chemotherapy for relapse with BFM like protocol (L-Asparaginase, Vincristine, Daunorubicin, and Prednisone). He did not receive any antifungal prophylaxis. On day +23 he was presented with febrile neutropenia, with no etiologic agent identified. An empirical treatment of five days of Meropenem was administered, with resulting in fever remission. He was discharged 6 days after his admission, asymptomatic but with persistent neutropenia.
Two days later, he had come back with an acute abdomen, although afebrile. Vital constants at admission were: BP: 107/78 mmHg, HR: 90 bpm, RR: 20 rpm, T °: 36.5 °C, weight: 55 Kg, height: 1.62 m, BMI: 21 Kg/m2. His blood tests showed leukocytes of 0.32 × 103/μL, absolute neutrophils 0.0032 x103/μL, hemoglobin 5.7 g/dL, platelets 35 × 103/μL, creatinine 0.66 mg/dL, ALT 174 IU/L, AST 82 IU/L, ALP 1004 IU/L, GGT 572 IU/L, total bilirubin 8 mg/dL, conjugated bilirubin 6.4 mg/dL, unconjugated bilirubin 1.62 mg/dL, LDH 287 IU/L, albumin 1.7 mg/dL, C reactive protein 8.4 mg/dL. The patient underwent exploratory laparotomy which revealed sigmoid perforation. Sigmoidectomy and colostomy were performed. The initial pathology report was diverticulum perforation. Forty-eight hours later, he presented moderate diffuse abdominal pain, and temperature > 38 °C. The blood cultures were negative. Administration of Meropenem, caspofungin and Filgastrim was empirically initiated. Contrast abdominal tomography (CT) showed diffuse liver lesions consistent with liver abscesses (Figure 1).
A liver biopsy of the lesions was performed under ultrasound guidance; the aerobic, anaerobic and Sabouraud dextrose agar cultures were negative. The pathology showed granulomatous hepatitis with extensive necrosis; Grocott’s stain evidenced hyaline hyphae. The histopathology of the sigmoid surgical specimen was reviewed again and then reported as transmural ischemic necrosis, acute and chronic peritonitis, and positive Grocott’s stain with the same hyphae described in the liver (Figure 2).
Hyalohyphomycosis was concluded. The serum galactomannan was negative. Pulmonary involvement was not seen by tomography. The antifungal treatment was changed from caspofungin to intravenous Voriconazole on day 23. The patient had gradual clinical improvement the neutropenia was remitted and was discharged with a treatment of oral voriconazole 200 mg bid. He was, at that time, in complete remission of leukemia.
Three weeks later he was readmitted for abdominal pain in the right hypochondrium with fever without neutropenia; he reported bad adherence to oral antifungal treatment for economic reasons. The new abdominal CT showed the persistence of liver abscesses. Exploratory laparotomy plus drainage were performed finding abscesses in segments II, IV and VI. The anaerobic culture grew Bacteroides fragilis; he completed 14 days of Metronidazole. The fungal culture was negative. The pathology report was extensive granulomatous hepatitis with necrosis and negative Grocott’s stain. The patient received 2 weeks of intravenous Voriconazole plus 6 weeks of the same oral antifungal. At the end of treatment, the abdominal CT showed only one residual lesion of 16 mm. A timeline of the case is shown in Figure S1.
He did not present further complications of the infectious process. However, six months later, while undergoing hematopoietic stem-cell transplant evaluations, he presented a relapse of leukemia and he decided to stop the antineoplastic treatment. He died seven months later.
Materials and Methods for Identification of the Causative Agent
A paraffin block of the first liver biopsy was requested, and DNA extraction was performed. Genomic DNA was extracted from the paraffin-embedded tissue sample using a DNeasy blood and tissue kit (Qiagen, Ventura, CA, USA) according to the manufacturer’s instructions before preliminary removal of paraffin by extraction with xylene protocol. The molecular identification was performed by 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification using a set of primers previously reported to identify fungi species (5′-TCCGTAGGTGAACCTTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). A PCR product of 500 bp was amplified, purified and sequenced in both directions; nucleotide sequence was determined with Taq FS Dye Terminator Cycle Sequencing Fluorescence-Based Sequencing and analyzed on an Applied Biosystems 3730 DNA sequencing system (Foster City, CA, USA). The sequence was edited with Vector NTI program and homology search was performed in the GenBank database (nucleotide blast), finding a 100% identity with Fusarium graminearum complex strain HUT59 [3]. (Figure 3). The sequences used are shown in Supplementary Figure S2.
4. Discussion
In the last ten years, there has been an increasing incidence of disseminated filamentous fungal infections in patients with severe immunosuppression [1,2,4]. Hematological malignancies have a risk of 6.5% for IFI [5], mainly in the induction and consolidation phases. This increase is due to severe immunosuppression conditions by myelotoxic treatments and related clinical conditions but also to new technologies such as molecular biology [6,7] that have increased the diagnosis ability.
Hialohifomycetes are opportunistic filamentous fungi that usually cause infection after environmental exposure [6]. Infection occurs through inhalation or skin breakdown (wounds, burns) [8]. Fusarium spp. is the second cause of infections by filamentous fungi after Aspergillus spp. More than 50 Fusarium species have been identified, but only about 12 are associated with infection in humans. F. incarnatum, F. moniliforme, F. oxysporum and F. solani usually cause allergic reactions and superficial infections such as keratitis and onychomycosis in immunocompetent hosts. In immunocompromised patients, it can cause from locally invasive diseases such as sinusitis and pneumonia, to fungemia and disseminated disease [9,10]. In neutropenic patients, it usually manifests as fever not responding to empirical antibiotics. Profound and prolonged neutropenia is the most important risk factor for dissemination and death due to fusariosis [8,11]. The most frequently isolated species in this setting are F. solani (50%) and F. oxysporum (20%) [6,8].
Fusarium graminearum plays a major role as the etiological agent of one important disease of small grain cereals and corn. First identified in 1884 in England, it is considered a major threat to wheat and barley [12]. The fungi, transmitted by seed, can survive up to 10 years as spores or resting structures in and on the seed. In Mexico, F. graminearum has been found in Hidalgo, Jalisco, Mexico, Michoacán and Tlaxcala [13,14,15,16]. This fungus can produce several mycotoxins, which have shown abortive estrogenic, gastric (nausea and vomiting) and neurotoxic toxicity in swine, cattle, dogs, cats, and ducks [16,17]. Grain that has been infected with the fungus can be incorporated into basic diets and could be a source of infection in humans. So far, no infections due to F. graminareum have been reported. Considering the patient’s occupation (kitchen helper) and the high corn content in the Mexican diet, we supposed that the patient was colonized with F. graminearum through the daily ingestion and handling of corn. He possibly got the mould through oral ingestion, and symptoms were gastrointestinal due to portal dissemination, which explains why we did not document any fungemia or cutaneous infection, despite an invasive disease. Usually, in disseminated fusariosis, blood cultures are positive in more than 75% of cases [6,8].
In our patient, the diagnosis of hyalohyphomycosis was first made by pathologic specimen. The biopsy revealed the presence of septate hyaline hyphae 3–6 μm diameter, indistinguishable from other hyalohyphomycosis such as Aspergillus, Acremonium [Cephalosporium], and Pseudallescheria [17]. Recently, the Mycotic Diseases Branch, from the Center for Disease Control and Prevention in Atlanta, described a new entity of invasive fungal infections (IFI), which they called “foodborne IFI”, in a recently published systematic review [18], foodborne IFI are infections acquired through ingestion of food or water contaminated with the fungi causing the infection. Reports describe molds and yeasts as etiologic agents. Rhizopus sp is the most frequently described mold, but one case of IFI due to Fusarium moniliforme is reported in a man with acute lymphoblastic leukemia who ingested cereals. The diagnosis of foodborne IFI is difficult, clinical presentation is usually atypical, and mainly gastrointestinal. Fungi can spoil food that is ingested, and it is suggested that this category of fungal infections could be related to food insecurity. The source of the fungi should be identified to be able to classify the IFI as foodborne, which is often difficult to the ubiquitous nature of these fungi. As previously mentioned, although we suspect that our patient acquired the infection orally and this could correspond to foodborne IFI, we cannot corroborate the above because we could not have samples of the food that the patient ingested prior to his hospitalization and we did not perform stool cultures.
Today, comparative identification strategies based on gene sequencing can be considered the new gold standard for the identification of fungal species. Gene sequencing is characterized by PCR amplification of the ITS region, and sequencing of the resulting amplicon (s). The ITS region can be amplified reliably for most fungi [19]. These molecular biology techniques provide better discrimination of species morphologically indistinguishable from Fusarium spp, and can be performed on different types of materials, including paraffin blocks, which is why it is considered an emerging and promising methodology to be used in the routine identification of Fusarium spp. In our case, no other fungal species were identified in the studied specimen or in any other specimen from the patient. The Fusarium graminearum complex includes 13 species; biogeographic data suggest that the majority of the species within the complex have evolutionary origins in the Southern hemisphere and Asia. According to the surveys to date, F. austroamericanum, F. meridionale, F. cortaderiae, and F. brasilicum appear to be endemic to South America; F. acaciae-mearnsii to Australia or less likely Africa; F. asiaticum, F. vorosii and F. ussurianum to Asia; F. aethiopicum to Africa; F. boothii and F. mesoamericanum to Central America; F. gerlachii to the US and F. graminearum sensu stricto (F. graminearum s.s.) it is the most cosmopolitan species and has been found in Asia, Africa, America, Europe, and Oceania [20].
Finally, the treatment in localized disease can benefit from surgical debridement especially in disseminated disease together with the use of systemic antifungals. Fusarium species are relatively resistant in vitro to most antifungal agents, showing different susceptibility patterns between species. In general, most Fusarium isolates have lower inhibitory concentrations (MIC) for Amphotericin B higher than Aspergillus species. F. solani and F. verticillioides are usually resistant to azoles and they have higher MIC for azoles than other Fusarium species. In contrast, F. oxysporum and F. moniliforme may be susceptible to voriconazole and posaconazole [9]. Echinocandins show the highest MIC values [21]. As far as we know there are no previous reports in the medical literature of identification of F.graminearum as a pathogen in humans; therefore antifungal therapy was initiated based on is the antifungals reported in the literature for the Fusarium species and on the clinical response.
5. Conclusions
Prolonged profound neutropenia and alteration of the intestinal flora, secondary to myelotoxic chemotherapies and environmental exposure in patients with hematological neoplasms, are important risk factors for the development of invasive infections by filamentous fungi. This is the first reported case of invasive fungal infection by F. graminearum and the first case of portal dissemination of Fusarium spp. The anamnesis and exposure to environmental factors are important during clinical evaluation. F.graminearum was not identifiable by traditional methods such as culture and pathology. Access to molecular biology is extremely valuable to increase the performance of diagnostic tests in the identification of new species such as the F. graminearum reported in our paper.
Acknowledgments
To all the infectious disease fellows who participated in the approach of this case, especially to Aaron Molina. And Rodrigo Toral-Villanueva for his technical support with the edition of figures.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Materials
The following are available online at https://www.mdpi.com/2036-7449/13/1/2/s1, Supplementary material 1 (Figure S1) is a timeline of the present case. Supplementary material 2 (Figure S2) is a figure with the genetic sequences used for the identification of the etiologic agent (Fusarium graminearum complex).
Click here for additional data file.
Author Contributions
M.G.U. was in charge of the data curation of the patient; A.M.-O. and M.G.U. were in charge of the writing of the original manuscript; R.H.-C. was in charge of the methodology for the identification by molecular biology of the etiologic agent ; C.P.-J. was responsible for reviewing and editing the manuscript as well as submitting it for publication. R.H.-G. was in charge of the methodology for the identification of the agent in the pathology specimen. K.E.-B. also participated in the data curation of the patient and in the writing of the original manuscript.All authors have read and agreed to the published version of the manuscript.
Funding
No source of funding was used for the preparation of this report.
Institutional Review Board Statement
Not applicable. Due to the fact that our study is only descriptive (without any type of intervention) on the case of a single patient, and he provided his consent, the evaluation by the Institution's ethics committee was not considered necessary.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Data is contained within the article or supplementary material.
Conflicts of Interest
All authors report having no conflict of interest.
Figure 1 Abdominal CT scan with intravenous contrast, which shows: Diffuse and poorly defined hypodense lesions, one located in the liver segment II measuring 3.4 cm, another located in the caudate lobe measuring 7 cm, and another located in the hepatic segment VII with extension to segment VI measuring 7 cm; consistent with liver abscesses.
Figure 2 (A) Non-pigmented, separated hyphae with acute angle branching in liver biopsy tissue, Grocott methenamine silver-stained specimen, 40×. (B) Non-pigmented, separated hyphae with acute angle branching in intestinal tissue, Grocott methenamine silver-stained specimen, 10×.
Figure 3 The 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification. Lane 1: Molecular weight marker 100 bp DNA ladder; Lane 2: Liver biopsy sample; Lane 3: Negative control. | ASPARAGINASE, CASPOFUNGIN, DAUNORUBICIN, FILGRASTIM, MEROPENEM, METRONIDAZOLE, PREDNISONE, VINCRISTINE, VORICONAZOLE | DrugsGivenReaction | CC BY | 33401374 | 19,386,199 | 2021-01-01 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Leukaemia recurrent'. | Portal Dissemination of Fusarium graminearum in a Patient with Acute Lymphoblastic Leukemia and Febrile Neutropenia.
We present the case of a man with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, with gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene, from a liver biopsy. The infection was resolved with surgical drainage and antifungal treatment based on voriconazole. As far as we know, there are no previous reports in the literature of cases of human infection due to Fusarium graminearum.
1. Introduction
In the last decades, there has been an increase in the incidence of invasive fungal infections (IFI), related to new immunosuppressive treatments and improved diagnosis with new molecular techniques and higher diagnostic yields [1,2]. We present the case of a male patient with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, presenting an atypical clinical course, gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene from a liver biopsy. This is the first reported case of portal dissemination by Fusarium genus and the first report of Fusarium graminearum infection in humans.
2. Ethical Considerations
The case we submit for publication is about a single patient who provided his verbal consent for this purpose. We do not include any details or information that could lead to patient identification
3. Case Report
Male patient, 26 years old, kitchen assistant, originated from Taxco, Guerrero and living there until he emigrated to Texas, United States, in 2016, where he was diagnosed with B lymphoblastic leukemia in January 2017. He received four cycles of unspecified chemotherapy with apparent remission of the disease and came back to Mexico (Cuernavaca, Morelos). He was admitted to the National Institute of Cancer in Mexico City in November 2017, where he was diagnosed with early relapse. From November 2017 to January 2018, he received chemotherapy for relapse with BFM like protocol (L-Asparaginase, Vincristine, Daunorubicin, and Prednisone). He did not receive any antifungal prophylaxis. On day +23 he was presented with febrile neutropenia, with no etiologic agent identified. An empirical treatment of five days of Meropenem was administered, with resulting in fever remission. He was discharged 6 days after his admission, asymptomatic but with persistent neutropenia.
Two days later, he had come back with an acute abdomen, although afebrile. Vital constants at admission were: BP: 107/78 mmHg, HR: 90 bpm, RR: 20 rpm, T °: 36.5 °C, weight: 55 Kg, height: 1.62 m, BMI: 21 Kg/m2. His blood tests showed leukocytes of 0.32 × 103/μL, absolute neutrophils 0.0032 x103/μL, hemoglobin 5.7 g/dL, platelets 35 × 103/μL, creatinine 0.66 mg/dL, ALT 174 IU/L, AST 82 IU/L, ALP 1004 IU/L, GGT 572 IU/L, total bilirubin 8 mg/dL, conjugated bilirubin 6.4 mg/dL, unconjugated bilirubin 1.62 mg/dL, LDH 287 IU/L, albumin 1.7 mg/dL, C reactive protein 8.4 mg/dL. The patient underwent exploratory laparotomy which revealed sigmoid perforation. Sigmoidectomy and colostomy were performed. The initial pathology report was diverticulum perforation. Forty-eight hours later, he presented moderate diffuse abdominal pain, and temperature > 38 °C. The blood cultures were negative. Administration of Meropenem, caspofungin and Filgastrim was empirically initiated. Contrast abdominal tomography (CT) showed diffuse liver lesions consistent with liver abscesses (Figure 1).
A liver biopsy of the lesions was performed under ultrasound guidance; the aerobic, anaerobic and Sabouraud dextrose agar cultures were negative. The pathology showed granulomatous hepatitis with extensive necrosis; Grocott’s stain evidenced hyaline hyphae. The histopathology of the sigmoid surgical specimen was reviewed again and then reported as transmural ischemic necrosis, acute and chronic peritonitis, and positive Grocott’s stain with the same hyphae described in the liver (Figure 2).
Hyalohyphomycosis was concluded. The serum galactomannan was negative. Pulmonary involvement was not seen by tomography. The antifungal treatment was changed from caspofungin to intravenous Voriconazole on day 23. The patient had gradual clinical improvement the neutropenia was remitted and was discharged with a treatment of oral voriconazole 200 mg bid. He was, at that time, in complete remission of leukemia.
Three weeks later he was readmitted for abdominal pain in the right hypochondrium with fever without neutropenia; he reported bad adherence to oral antifungal treatment for economic reasons. The new abdominal CT showed the persistence of liver abscesses. Exploratory laparotomy plus drainage were performed finding abscesses in segments II, IV and VI. The anaerobic culture grew Bacteroides fragilis; he completed 14 days of Metronidazole. The fungal culture was negative. The pathology report was extensive granulomatous hepatitis with necrosis and negative Grocott’s stain. The patient received 2 weeks of intravenous Voriconazole plus 6 weeks of the same oral antifungal. At the end of treatment, the abdominal CT showed only one residual lesion of 16 mm. A timeline of the case is shown in Figure S1.
He did not present further complications of the infectious process. However, six months later, while undergoing hematopoietic stem-cell transplant evaluations, he presented a relapse of leukemia and he decided to stop the antineoplastic treatment. He died seven months later.
Materials and Methods for Identification of the Causative Agent
A paraffin block of the first liver biopsy was requested, and DNA extraction was performed. Genomic DNA was extracted from the paraffin-embedded tissue sample using a DNeasy blood and tissue kit (Qiagen, Ventura, CA, USA) according to the manufacturer’s instructions before preliminary removal of paraffin by extraction with xylene protocol. The molecular identification was performed by 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification using a set of primers previously reported to identify fungi species (5′-TCCGTAGGTGAACCTTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). A PCR product of 500 bp was amplified, purified and sequenced in both directions; nucleotide sequence was determined with Taq FS Dye Terminator Cycle Sequencing Fluorescence-Based Sequencing and analyzed on an Applied Biosystems 3730 DNA sequencing system (Foster City, CA, USA). The sequence was edited with Vector NTI program and homology search was performed in the GenBank database (nucleotide blast), finding a 100% identity with Fusarium graminearum complex strain HUT59 [3]. (Figure 3). The sequences used are shown in Supplementary Figure S2.
4. Discussion
In the last ten years, there has been an increasing incidence of disseminated filamentous fungal infections in patients with severe immunosuppression [1,2,4]. Hematological malignancies have a risk of 6.5% for IFI [5], mainly in the induction and consolidation phases. This increase is due to severe immunosuppression conditions by myelotoxic treatments and related clinical conditions but also to new technologies such as molecular biology [6,7] that have increased the diagnosis ability.
Hialohifomycetes are opportunistic filamentous fungi that usually cause infection after environmental exposure [6]. Infection occurs through inhalation or skin breakdown (wounds, burns) [8]. Fusarium spp. is the second cause of infections by filamentous fungi after Aspergillus spp. More than 50 Fusarium species have been identified, but only about 12 are associated with infection in humans. F. incarnatum, F. moniliforme, F. oxysporum and F. solani usually cause allergic reactions and superficial infections such as keratitis and onychomycosis in immunocompetent hosts. In immunocompromised patients, it can cause from locally invasive diseases such as sinusitis and pneumonia, to fungemia and disseminated disease [9,10]. In neutropenic patients, it usually manifests as fever not responding to empirical antibiotics. Profound and prolonged neutropenia is the most important risk factor for dissemination and death due to fusariosis [8,11]. The most frequently isolated species in this setting are F. solani (50%) and F. oxysporum (20%) [6,8].
Fusarium graminearum plays a major role as the etiological agent of one important disease of small grain cereals and corn. First identified in 1884 in England, it is considered a major threat to wheat and barley [12]. The fungi, transmitted by seed, can survive up to 10 years as spores or resting structures in and on the seed. In Mexico, F. graminearum has been found in Hidalgo, Jalisco, Mexico, Michoacán and Tlaxcala [13,14,15,16]. This fungus can produce several mycotoxins, which have shown abortive estrogenic, gastric (nausea and vomiting) and neurotoxic toxicity in swine, cattle, dogs, cats, and ducks [16,17]. Grain that has been infected with the fungus can be incorporated into basic diets and could be a source of infection in humans. So far, no infections due to F. graminareum have been reported. Considering the patient’s occupation (kitchen helper) and the high corn content in the Mexican diet, we supposed that the patient was colonized with F. graminearum through the daily ingestion and handling of corn. He possibly got the mould through oral ingestion, and symptoms were gastrointestinal due to portal dissemination, which explains why we did not document any fungemia or cutaneous infection, despite an invasive disease. Usually, in disseminated fusariosis, blood cultures are positive in more than 75% of cases [6,8].
In our patient, the diagnosis of hyalohyphomycosis was first made by pathologic specimen. The biopsy revealed the presence of septate hyaline hyphae 3–6 μm diameter, indistinguishable from other hyalohyphomycosis such as Aspergillus, Acremonium [Cephalosporium], and Pseudallescheria [17]. Recently, the Mycotic Diseases Branch, from the Center for Disease Control and Prevention in Atlanta, described a new entity of invasive fungal infections (IFI), which they called “foodborne IFI”, in a recently published systematic review [18], foodborne IFI are infections acquired through ingestion of food or water contaminated with the fungi causing the infection. Reports describe molds and yeasts as etiologic agents. Rhizopus sp is the most frequently described mold, but one case of IFI due to Fusarium moniliforme is reported in a man with acute lymphoblastic leukemia who ingested cereals. The diagnosis of foodborne IFI is difficult, clinical presentation is usually atypical, and mainly gastrointestinal. Fungi can spoil food that is ingested, and it is suggested that this category of fungal infections could be related to food insecurity. The source of the fungi should be identified to be able to classify the IFI as foodborne, which is often difficult to the ubiquitous nature of these fungi. As previously mentioned, although we suspect that our patient acquired the infection orally and this could correspond to foodborne IFI, we cannot corroborate the above because we could not have samples of the food that the patient ingested prior to his hospitalization and we did not perform stool cultures.
Today, comparative identification strategies based on gene sequencing can be considered the new gold standard for the identification of fungal species. Gene sequencing is characterized by PCR amplification of the ITS region, and sequencing of the resulting amplicon (s). The ITS region can be amplified reliably for most fungi [19]. These molecular biology techniques provide better discrimination of species morphologically indistinguishable from Fusarium spp, and can be performed on different types of materials, including paraffin blocks, which is why it is considered an emerging and promising methodology to be used in the routine identification of Fusarium spp. In our case, no other fungal species were identified in the studied specimen or in any other specimen from the patient. The Fusarium graminearum complex includes 13 species; biogeographic data suggest that the majority of the species within the complex have evolutionary origins in the Southern hemisphere and Asia. According to the surveys to date, F. austroamericanum, F. meridionale, F. cortaderiae, and F. brasilicum appear to be endemic to South America; F. acaciae-mearnsii to Australia or less likely Africa; F. asiaticum, F. vorosii and F. ussurianum to Asia; F. aethiopicum to Africa; F. boothii and F. mesoamericanum to Central America; F. gerlachii to the US and F. graminearum sensu stricto (F. graminearum s.s.) it is the most cosmopolitan species and has been found in Asia, Africa, America, Europe, and Oceania [20].
Finally, the treatment in localized disease can benefit from surgical debridement especially in disseminated disease together with the use of systemic antifungals. Fusarium species are relatively resistant in vitro to most antifungal agents, showing different susceptibility patterns between species. In general, most Fusarium isolates have lower inhibitory concentrations (MIC) for Amphotericin B higher than Aspergillus species. F. solani and F. verticillioides are usually resistant to azoles and they have higher MIC for azoles than other Fusarium species. In contrast, F. oxysporum and F. moniliforme may be susceptible to voriconazole and posaconazole [9]. Echinocandins show the highest MIC values [21]. As far as we know there are no previous reports in the medical literature of identification of F.graminearum as a pathogen in humans; therefore antifungal therapy was initiated based on is the antifungals reported in the literature for the Fusarium species and on the clinical response.
5. Conclusions
Prolonged profound neutropenia and alteration of the intestinal flora, secondary to myelotoxic chemotherapies and environmental exposure in patients with hematological neoplasms, are important risk factors for the development of invasive infections by filamentous fungi. This is the first reported case of invasive fungal infection by F. graminearum and the first case of portal dissemination of Fusarium spp. The anamnesis and exposure to environmental factors are important during clinical evaluation. F.graminearum was not identifiable by traditional methods such as culture and pathology. Access to molecular biology is extremely valuable to increase the performance of diagnostic tests in the identification of new species such as the F. graminearum reported in our paper.
Acknowledgments
To all the infectious disease fellows who participated in the approach of this case, especially to Aaron Molina. And Rodrigo Toral-Villanueva for his technical support with the edition of figures.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Materials
The following are available online at https://www.mdpi.com/2036-7449/13/1/2/s1, Supplementary material 1 (Figure S1) is a timeline of the present case. Supplementary material 2 (Figure S2) is a figure with the genetic sequences used for the identification of the etiologic agent (Fusarium graminearum complex).
Click here for additional data file.
Author Contributions
M.G.U. was in charge of the data curation of the patient; A.M.-O. and M.G.U. were in charge of the writing of the original manuscript; R.H.-C. was in charge of the methodology for the identification by molecular biology of the etiologic agent ; C.P.-J. was responsible for reviewing and editing the manuscript as well as submitting it for publication. R.H.-G. was in charge of the methodology for the identification of the agent in the pathology specimen. K.E.-B. also participated in the data curation of the patient and in the writing of the original manuscript.All authors have read and agreed to the published version of the manuscript.
Funding
No source of funding was used for the preparation of this report.
Institutional Review Board Statement
Not applicable. Due to the fact that our study is only descriptive (without any type of intervention) on the case of a single patient, and he provided his consent, the evaluation by the Institution's ethics committee was not considered necessary.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Data is contained within the article or supplementary material.
Conflicts of Interest
All authors report having no conflict of interest.
Figure 1 Abdominal CT scan with intravenous contrast, which shows: Diffuse and poorly defined hypodense lesions, one located in the liver segment II measuring 3.4 cm, another located in the caudate lobe measuring 7 cm, and another located in the hepatic segment VII with extension to segment VI measuring 7 cm; consistent with liver abscesses.
Figure 2 (A) Non-pigmented, separated hyphae with acute angle branching in liver biopsy tissue, Grocott methenamine silver-stained specimen, 40×. (B) Non-pigmented, separated hyphae with acute angle branching in intestinal tissue, Grocott methenamine silver-stained specimen, 10×.
Figure 3 The 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification. Lane 1: Molecular weight marker 100 bp DNA ladder; Lane 2: Liver biopsy sample; Lane 3: Negative control. | ASPARAGINASE, CASPOFUNGIN, DAUNORUBICIN, FILGRASTIM, MEROPENEM, METRONIDAZOLE, PREDNISONE, VINCRISTINE, VORICONAZOLE | DrugsGivenReaction | CC BY | 33401374 | 19,386,199 | 2021-01-01 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Liver abscess'. | Portal Dissemination of Fusarium graminearum in a Patient with Acute Lymphoblastic Leukemia and Febrile Neutropenia.
We present the case of a man with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, with gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene, from a liver biopsy. The infection was resolved with surgical drainage and antifungal treatment based on voriconazole. As far as we know, there are no previous reports in the literature of cases of human infection due to Fusarium graminearum.
1. Introduction
In the last decades, there has been an increase in the incidence of invasive fungal infections (IFI), related to new immunosuppressive treatments and improved diagnosis with new molecular techniques and higher diagnostic yields [1,2]. We present the case of a male patient with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, presenting an atypical clinical course, gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene from a liver biopsy. This is the first reported case of portal dissemination by Fusarium genus and the first report of Fusarium graminearum infection in humans.
2. Ethical Considerations
The case we submit for publication is about a single patient who provided his verbal consent for this purpose. We do not include any details or information that could lead to patient identification
3. Case Report
Male patient, 26 years old, kitchen assistant, originated from Taxco, Guerrero and living there until he emigrated to Texas, United States, in 2016, where he was diagnosed with B lymphoblastic leukemia in January 2017. He received four cycles of unspecified chemotherapy with apparent remission of the disease and came back to Mexico (Cuernavaca, Morelos). He was admitted to the National Institute of Cancer in Mexico City in November 2017, where he was diagnosed with early relapse. From November 2017 to January 2018, he received chemotherapy for relapse with BFM like protocol (L-Asparaginase, Vincristine, Daunorubicin, and Prednisone). He did not receive any antifungal prophylaxis. On day +23 he was presented with febrile neutropenia, with no etiologic agent identified. An empirical treatment of five days of Meropenem was administered, with resulting in fever remission. He was discharged 6 days after his admission, asymptomatic but with persistent neutropenia.
Two days later, he had come back with an acute abdomen, although afebrile. Vital constants at admission were: BP: 107/78 mmHg, HR: 90 bpm, RR: 20 rpm, T °: 36.5 °C, weight: 55 Kg, height: 1.62 m, BMI: 21 Kg/m2. His blood tests showed leukocytes of 0.32 × 103/μL, absolute neutrophils 0.0032 x103/μL, hemoglobin 5.7 g/dL, platelets 35 × 103/μL, creatinine 0.66 mg/dL, ALT 174 IU/L, AST 82 IU/L, ALP 1004 IU/L, GGT 572 IU/L, total bilirubin 8 mg/dL, conjugated bilirubin 6.4 mg/dL, unconjugated bilirubin 1.62 mg/dL, LDH 287 IU/L, albumin 1.7 mg/dL, C reactive protein 8.4 mg/dL. The patient underwent exploratory laparotomy which revealed sigmoid perforation. Sigmoidectomy and colostomy were performed. The initial pathology report was diverticulum perforation. Forty-eight hours later, he presented moderate diffuse abdominal pain, and temperature > 38 °C. The blood cultures were negative. Administration of Meropenem, caspofungin and Filgastrim was empirically initiated. Contrast abdominal tomography (CT) showed diffuse liver lesions consistent with liver abscesses (Figure 1).
A liver biopsy of the lesions was performed under ultrasound guidance; the aerobic, anaerobic and Sabouraud dextrose agar cultures were negative. The pathology showed granulomatous hepatitis with extensive necrosis; Grocott’s stain evidenced hyaline hyphae. The histopathology of the sigmoid surgical specimen was reviewed again and then reported as transmural ischemic necrosis, acute and chronic peritonitis, and positive Grocott’s stain with the same hyphae described in the liver (Figure 2).
Hyalohyphomycosis was concluded. The serum galactomannan was negative. Pulmonary involvement was not seen by tomography. The antifungal treatment was changed from caspofungin to intravenous Voriconazole on day 23. The patient had gradual clinical improvement the neutropenia was remitted and was discharged with a treatment of oral voriconazole 200 mg bid. He was, at that time, in complete remission of leukemia.
Three weeks later he was readmitted for abdominal pain in the right hypochondrium with fever without neutropenia; he reported bad adherence to oral antifungal treatment for economic reasons. The new abdominal CT showed the persistence of liver abscesses. Exploratory laparotomy plus drainage were performed finding abscesses in segments II, IV and VI. The anaerobic culture grew Bacteroides fragilis; he completed 14 days of Metronidazole. The fungal culture was negative. The pathology report was extensive granulomatous hepatitis with necrosis and negative Grocott’s stain. The patient received 2 weeks of intravenous Voriconazole plus 6 weeks of the same oral antifungal. At the end of treatment, the abdominal CT showed only one residual lesion of 16 mm. A timeline of the case is shown in Figure S1.
He did not present further complications of the infectious process. However, six months later, while undergoing hematopoietic stem-cell transplant evaluations, he presented a relapse of leukemia and he decided to stop the antineoplastic treatment. He died seven months later.
Materials and Methods for Identification of the Causative Agent
A paraffin block of the first liver biopsy was requested, and DNA extraction was performed. Genomic DNA was extracted from the paraffin-embedded tissue sample using a DNeasy blood and tissue kit (Qiagen, Ventura, CA, USA) according to the manufacturer’s instructions before preliminary removal of paraffin by extraction with xylene protocol. The molecular identification was performed by 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification using a set of primers previously reported to identify fungi species (5′-TCCGTAGGTGAACCTTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). A PCR product of 500 bp was amplified, purified and sequenced in both directions; nucleotide sequence was determined with Taq FS Dye Terminator Cycle Sequencing Fluorescence-Based Sequencing and analyzed on an Applied Biosystems 3730 DNA sequencing system (Foster City, CA, USA). The sequence was edited with Vector NTI program and homology search was performed in the GenBank database (nucleotide blast), finding a 100% identity with Fusarium graminearum complex strain HUT59 [3]. (Figure 3). The sequences used are shown in Supplementary Figure S2.
4. Discussion
In the last ten years, there has been an increasing incidence of disseminated filamentous fungal infections in patients with severe immunosuppression [1,2,4]. Hematological malignancies have a risk of 6.5% for IFI [5], mainly in the induction and consolidation phases. This increase is due to severe immunosuppression conditions by myelotoxic treatments and related clinical conditions but also to new technologies such as molecular biology [6,7] that have increased the diagnosis ability.
Hialohifomycetes are opportunistic filamentous fungi that usually cause infection after environmental exposure [6]. Infection occurs through inhalation or skin breakdown (wounds, burns) [8]. Fusarium spp. is the second cause of infections by filamentous fungi after Aspergillus spp. More than 50 Fusarium species have been identified, but only about 12 are associated with infection in humans. F. incarnatum, F. moniliforme, F. oxysporum and F. solani usually cause allergic reactions and superficial infections such as keratitis and onychomycosis in immunocompetent hosts. In immunocompromised patients, it can cause from locally invasive diseases such as sinusitis and pneumonia, to fungemia and disseminated disease [9,10]. In neutropenic patients, it usually manifests as fever not responding to empirical antibiotics. Profound and prolonged neutropenia is the most important risk factor for dissemination and death due to fusariosis [8,11]. The most frequently isolated species in this setting are F. solani (50%) and F. oxysporum (20%) [6,8].
Fusarium graminearum plays a major role as the etiological agent of one important disease of small grain cereals and corn. First identified in 1884 in England, it is considered a major threat to wheat and barley [12]. The fungi, transmitted by seed, can survive up to 10 years as spores or resting structures in and on the seed. In Mexico, F. graminearum has been found in Hidalgo, Jalisco, Mexico, Michoacán and Tlaxcala [13,14,15,16]. This fungus can produce several mycotoxins, which have shown abortive estrogenic, gastric (nausea and vomiting) and neurotoxic toxicity in swine, cattle, dogs, cats, and ducks [16,17]. Grain that has been infected with the fungus can be incorporated into basic diets and could be a source of infection in humans. So far, no infections due to F. graminareum have been reported. Considering the patient’s occupation (kitchen helper) and the high corn content in the Mexican diet, we supposed that the patient was colonized with F. graminearum through the daily ingestion and handling of corn. He possibly got the mould through oral ingestion, and symptoms were gastrointestinal due to portal dissemination, which explains why we did not document any fungemia or cutaneous infection, despite an invasive disease. Usually, in disseminated fusariosis, blood cultures are positive in more than 75% of cases [6,8].
In our patient, the diagnosis of hyalohyphomycosis was first made by pathologic specimen. The biopsy revealed the presence of septate hyaline hyphae 3–6 μm diameter, indistinguishable from other hyalohyphomycosis such as Aspergillus, Acremonium [Cephalosporium], and Pseudallescheria [17]. Recently, the Mycotic Diseases Branch, from the Center for Disease Control and Prevention in Atlanta, described a new entity of invasive fungal infections (IFI), which they called “foodborne IFI”, in a recently published systematic review [18], foodborne IFI are infections acquired through ingestion of food or water contaminated with the fungi causing the infection. Reports describe molds and yeasts as etiologic agents. Rhizopus sp is the most frequently described mold, but one case of IFI due to Fusarium moniliforme is reported in a man with acute lymphoblastic leukemia who ingested cereals. The diagnosis of foodborne IFI is difficult, clinical presentation is usually atypical, and mainly gastrointestinal. Fungi can spoil food that is ingested, and it is suggested that this category of fungal infections could be related to food insecurity. The source of the fungi should be identified to be able to classify the IFI as foodborne, which is often difficult to the ubiquitous nature of these fungi. As previously mentioned, although we suspect that our patient acquired the infection orally and this could correspond to foodborne IFI, we cannot corroborate the above because we could not have samples of the food that the patient ingested prior to his hospitalization and we did not perform stool cultures.
Today, comparative identification strategies based on gene sequencing can be considered the new gold standard for the identification of fungal species. Gene sequencing is characterized by PCR amplification of the ITS region, and sequencing of the resulting amplicon (s). The ITS region can be amplified reliably for most fungi [19]. These molecular biology techniques provide better discrimination of species morphologically indistinguishable from Fusarium spp, and can be performed on different types of materials, including paraffin blocks, which is why it is considered an emerging and promising methodology to be used in the routine identification of Fusarium spp. In our case, no other fungal species were identified in the studied specimen or in any other specimen from the patient. The Fusarium graminearum complex includes 13 species; biogeographic data suggest that the majority of the species within the complex have evolutionary origins in the Southern hemisphere and Asia. According to the surveys to date, F. austroamericanum, F. meridionale, F. cortaderiae, and F. brasilicum appear to be endemic to South America; F. acaciae-mearnsii to Australia or less likely Africa; F. asiaticum, F. vorosii and F. ussurianum to Asia; F. aethiopicum to Africa; F. boothii and F. mesoamericanum to Central America; F. gerlachii to the US and F. graminearum sensu stricto (F. graminearum s.s.) it is the most cosmopolitan species and has been found in Asia, Africa, America, Europe, and Oceania [20].
Finally, the treatment in localized disease can benefit from surgical debridement especially in disseminated disease together with the use of systemic antifungals. Fusarium species are relatively resistant in vitro to most antifungal agents, showing different susceptibility patterns between species. In general, most Fusarium isolates have lower inhibitory concentrations (MIC) for Amphotericin B higher than Aspergillus species. F. solani and F. verticillioides are usually resistant to azoles and they have higher MIC for azoles than other Fusarium species. In contrast, F. oxysporum and F. moniliforme may be susceptible to voriconazole and posaconazole [9]. Echinocandins show the highest MIC values [21]. As far as we know there are no previous reports in the medical literature of identification of F.graminearum as a pathogen in humans; therefore antifungal therapy was initiated based on is the antifungals reported in the literature for the Fusarium species and on the clinical response.
5. Conclusions
Prolonged profound neutropenia and alteration of the intestinal flora, secondary to myelotoxic chemotherapies and environmental exposure in patients with hematological neoplasms, are important risk factors for the development of invasive infections by filamentous fungi. This is the first reported case of invasive fungal infection by F. graminearum and the first case of portal dissemination of Fusarium spp. The anamnesis and exposure to environmental factors are important during clinical evaluation. F.graminearum was not identifiable by traditional methods such as culture and pathology. Access to molecular biology is extremely valuable to increase the performance of diagnostic tests in the identification of new species such as the F. graminearum reported in our paper.
Acknowledgments
To all the infectious disease fellows who participated in the approach of this case, especially to Aaron Molina. And Rodrigo Toral-Villanueva for his technical support with the edition of figures.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Materials
The following are available online at https://www.mdpi.com/2036-7449/13/1/2/s1, Supplementary material 1 (Figure S1) is a timeline of the present case. Supplementary material 2 (Figure S2) is a figure with the genetic sequences used for the identification of the etiologic agent (Fusarium graminearum complex).
Click here for additional data file.
Author Contributions
M.G.U. was in charge of the data curation of the patient; A.M.-O. and M.G.U. were in charge of the writing of the original manuscript; R.H.-C. was in charge of the methodology for the identification by molecular biology of the etiologic agent ; C.P.-J. was responsible for reviewing and editing the manuscript as well as submitting it for publication. R.H.-G. was in charge of the methodology for the identification of the agent in the pathology specimen. K.E.-B. also participated in the data curation of the patient and in the writing of the original manuscript.All authors have read and agreed to the published version of the manuscript.
Funding
No source of funding was used for the preparation of this report.
Institutional Review Board Statement
Not applicable. Due to the fact that our study is only descriptive (without any type of intervention) on the case of a single patient, and he provided his consent, the evaluation by the Institution's ethics committee was not considered necessary.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Data is contained within the article or supplementary material.
Conflicts of Interest
All authors report having no conflict of interest.
Figure 1 Abdominal CT scan with intravenous contrast, which shows: Diffuse and poorly defined hypodense lesions, one located in the liver segment II measuring 3.4 cm, another located in the caudate lobe measuring 7 cm, and another located in the hepatic segment VII with extension to segment VI measuring 7 cm; consistent with liver abscesses.
Figure 2 (A) Non-pigmented, separated hyphae with acute angle branching in liver biopsy tissue, Grocott methenamine silver-stained specimen, 40×. (B) Non-pigmented, separated hyphae with acute angle branching in intestinal tissue, Grocott methenamine silver-stained specimen, 10×.
Figure 3 The 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification. Lane 1: Molecular weight marker 100 bp DNA ladder; Lane 2: Liver biopsy sample; Lane 3: Negative control. | ASPARAGINASE, CASPOFUNGIN, DAUNORUBICIN, FILGRASTIM, MEROPENEM, METRONIDAZOLE, PREDNISONE, VINCRISTINE, VORICONAZOLE | DrugsGivenReaction | CC BY | 33401374 | 19,386,199 | 2021-01-01 |
Give an alphabetized list of all active substances of drugs taken by the patient who experienced 'Peritonitis'. | Portal Dissemination of Fusarium graminearum in a Patient with Acute Lymphoblastic Leukemia and Febrile Neutropenia.
We present the case of a man with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, with gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene, from a liver biopsy. The infection was resolved with surgical drainage and antifungal treatment based on voriconazole. As far as we know, there are no previous reports in the literature of cases of human infection due to Fusarium graminearum.
1. Introduction
In the last decades, there has been an increase in the incidence of invasive fungal infections (IFI), related to new immunosuppressive treatments and improved diagnosis with new molecular techniques and higher diagnostic yields [1,2]. We present the case of a male patient with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, presenting an atypical clinical course, gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene from a liver biopsy. This is the first reported case of portal dissemination by Fusarium genus and the first report of Fusarium graminearum infection in humans.
2. Ethical Considerations
The case we submit for publication is about a single patient who provided his verbal consent for this purpose. We do not include any details or information that could lead to patient identification
3. Case Report
Male patient, 26 years old, kitchen assistant, originated from Taxco, Guerrero and living there until he emigrated to Texas, United States, in 2016, where he was diagnosed with B lymphoblastic leukemia in January 2017. He received four cycles of unspecified chemotherapy with apparent remission of the disease and came back to Mexico (Cuernavaca, Morelos). He was admitted to the National Institute of Cancer in Mexico City in November 2017, where he was diagnosed with early relapse. From November 2017 to January 2018, he received chemotherapy for relapse with BFM like protocol (L-Asparaginase, Vincristine, Daunorubicin, and Prednisone). He did not receive any antifungal prophylaxis. On day +23 he was presented with febrile neutropenia, with no etiologic agent identified. An empirical treatment of five days of Meropenem was administered, with resulting in fever remission. He was discharged 6 days after his admission, asymptomatic but with persistent neutropenia.
Two days later, he had come back with an acute abdomen, although afebrile. Vital constants at admission were: BP: 107/78 mmHg, HR: 90 bpm, RR: 20 rpm, T °: 36.5 °C, weight: 55 Kg, height: 1.62 m, BMI: 21 Kg/m2. His blood tests showed leukocytes of 0.32 × 103/μL, absolute neutrophils 0.0032 x103/μL, hemoglobin 5.7 g/dL, platelets 35 × 103/μL, creatinine 0.66 mg/dL, ALT 174 IU/L, AST 82 IU/L, ALP 1004 IU/L, GGT 572 IU/L, total bilirubin 8 mg/dL, conjugated bilirubin 6.4 mg/dL, unconjugated bilirubin 1.62 mg/dL, LDH 287 IU/L, albumin 1.7 mg/dL, C reactive protein 8.4 mg/dL. The patient underwent exploratory laparotomy which revealed sigmoid perforation. Sigmoidectomy and colostomy were performed. The initial pathology report was diverticulum perforation. Forty-eight hours later, he presented moderate diffuse abdominal pain, and temperature > 38 °C. The blood cultures were negative. Administration of Meropenem, caspofungin and Filgastrim was empirically initiated. Contrast abdominal tomography (CT) showed diffuse liver lesions consistent with liver abscesses (Figure 1).
A liver biopsy of the lesions was performed under ultrasound guidance; the aerobic, anaerobic and Sabouraud dextrose agar cultures were negative. The pathology showed granulomatous hepatitis with extensive necrosis; Grocott’s stain evidenced hyaline hyphae. The histopathology of the sigmoid surgical specimen was reviewed again and then reported as transmural ischemic necrosis, acute and chronic peritonitis, and positive Grocott’s stain with the same hyphae described in the liver (Figure 2).
Hyalohyphomycosis was concluded. The serum galactomannan was negative. Pulmonary involvement was not seen by tomography. The antifungal treatment was changed from caspofungin to intravenous Voriconazole on day 23. The patient had gradual clinical improvement the neutropenia was remitted and was discharged with a treatment of oral voriconazole 200 mg bid. He was, at that time, in complete remission of leukemia.
Three weeks later he was readmitted for abdominal pain in the right hypochondrium with fever without neutropenia; he reported bad adherence to oral antifungal treatment for economic reasons. The new abdominal CT showed the persistence of liver abscesses. Exploratory laparotomy plus drainage were performed finding abscesses in segments II, IV and VI. The anaerobic culture grew Bacteroides fragilis; he completed 14 days of Metronidazole. The fungal culture was negative. The pathology report was extensive granulomatous hepatitis with necrosis and negative Grocott’s stain. The patient received 2 weeks of intravenous Voriconazole plus 6 weeks of the same oral antifungal. At the end of treatment, the abdominal CT showed only one residual lesion of 16 mm. A timeline of the case is shown in Figure S1.
He did not present further complications of the infectious process. However, six months later, while undergoing hematopoietic stem-cell transplant evaluations, he presented a relapse of leukemia and he decided to stop the antineoplastic treatment. He died seven months later.
Materials and Methods for Identification of the Causative Agent
A paraffin block of the first liver biopsy was requested, and DNA extraction was performed. Genomic DNA was extracted from the paraffin-embedded tissue sample using a DNeasy blood and tissue kit (Qiagen, Ventura, CA, USA) according to the manufacturer’s instructions before preliminary removal of paraffin by extraction with xylene protocol. The molecular identification was performed by 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification using a set of primers previously reported to identify fungi species (5′-TCCGTAGGTGAACCTTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). A PCR product of 500 bp was amplified, purified and sequenced in both directions; nucleotide sequence was determined with Taq FS Dye Terminator Cycle Sequencing Fluorescence-Based Sequencing and analyzed on an Applied Biosystems 3730 DNA sequencing system (Foster City, CA, USA). The sequence was edited with Vector NTI program and homology search was performed in the GenBank database (nucleotide blast), finding a 100% identity with Fusarium graminearum complex strain HUT59 [3]. (Figure 3). The sequences used are shown in Supplementary Figure S2.
4. Discussion
In the last ten years, there has been an increasing incidence of disseminated filamentous fungal infections in patients with severe immunosuppression [1,2,4]. Hematological malignancies have a risk of 6.5% for IFI [5], mainly in the induction and consolidation phases. This increase is due to severe immunosuppression conditions by myelotoxic treatments and related clinical conditions but also to new technologies such as molecular biology [6,7] that have increased the diagnosis ability.
Hialohifomycetes are opportunistic filamentous fungi that usually cause infection after environmental exposure [6]. Infection occurs through inhalation or skin breakdown (wounds, burns) [8]. Fusarium spp. is the second cause of infections by filamentous fungi after Aspergillus spp. More than 50 Fusarium species have been identified, but only about 12 are associated with infection in humans. F. incarnatum, F. moniliforme, F. oxysporum and F. solani usually cause allergic reactions and superficial infections such as keratitis and onychomycosis in immunocompetent hosts. In immunocompromised patients, it can cause from locally invasive diseases such as sinusitis and pneumonia, to fungemia and disseminated disease [9,10]. In neutropenic patients, it usually manifests as fever not responding to empirical antibiotics. Profound and prolonged neutropenia is the most important risk factor for dissemination and death due to fusariosis [8,11]. The most frequently isolated species in this setting are F. solani (50%) and F. oxysporum (20%) [6,8].
Fusarium graminearum plays a major role as the etiological agent of one important disease of small grain cereals and corn. First identified in 1884 in England, it is considered a major threat to wheat and barley [12]. The fungi, transmitted by seed, can survive up to 10 years as spores or resting structures in and on the seed. In Mexico, F. graminearum has been found in Hidalgo, Jalisco, Mexico, Michoacán and Tlaxcala [13,14,15,16]. This fungus can produce several mycotoxins, which have shown abortive estrogenic, gastric (nausea and vomiting) and neurotoxic toxicity in swine, cattle, dogs, cats, and ducks [16,17]. Grain that has been infected with the fungus can be incorporated into basic diets and could be a source of infection in humans. So far, no infections due to F. graminareum have been reported. Considering the patient’s occupation (kitchen helper) and the high corn content in the Mexican diet, we supposed that the patient was colonized with F. graminearum through the daily ingestion and handling of corn. He possibly got the mould through oral ingestion, and symptoms were gastrointestinal due to portal dissemination, which explains why we did not document any fungemia or cutaneous infection, despite an invasive disease. Usually, in disseminated fusariosis, blood cultures are positive in more than 75% of cases [6,8].
In our patient, the diagnosis of hyalohyphomycosis was first made by pathologic specimen. The biopsy revealed the presence of septate hyaline hyphae 3–6 μm diameter, indistinguishable from other hyalohyphomycosis such as Aspergillus, Acremonium [Cephalosporium], and Pseudallescheria [17]. Recently, the Mycotic Diseases Branch, from the Center for Disease Control and Prevention in Atlanta, described a new entity of invasive fungal infections (IFI), which they called “foodborne IFI”, in a recently published systematic review [18], foodborne IFI are infections acquired through ingestion of food or water contaminated with the fungi causing the infection. Reports describe molds and yeasts as etiologic agents. Rhizopus sp is the most frequently described mold, but one case of IFI due to Fusarium moniliforme is reported in a man with acute lymphoblastic leukemia who ingested cereals. The diagnosis of foodborne IFI is difficult, clinical presentation is usually atypical, and mainly gastrointestinal. Fungi can spoil food that is ingested, and it is suggested that this category of fungal infections could be related to food insecurity. The source of the fungi should be identified to be able to classify the IFI as foodborne, which is often difficult to the ubiquitous nature of these fungi. As previously mentioned, although we suspect that our patient acquired the infection orally and this could correspond to foodborne IFI, we cannot corroborate the above because we could not have samples of the food that the patient ingested prior to his hospitalization and we did not perform stool cultures.
Today, comparative identification strategies based on gene sequencing can be considered the new gold standard for the identification of fungal species. Gene sequencing is characterized by PCR amplification of the ITS region, and sequencing of the resulting amplicon (s). The ITS region can be amplified reliably for most fungi [19]. These molecular biology techniques provide better discrimination of species morphologically indistinguishable from Fusarium spp, and can be performed on different types of materials, including paraffin blocks, which is why it is considered an emerging and promising methodology to be used in the routine identification of Fusarium spp. In our case, no other fungal species were identified in the studied specimen or in any other specimen from the patient. The Fusarium graminearum complex includes 13 species; biogeographic data suggest that the majority of the species within the complex have evolutionary origins in the Southern hemisphere and Asia. According to the surveys to date, F. austroamericanum, F. meridionale, F. cortaderiae, and F. brasilicum appear to be endemic to South America; F. acaciae-mearnsii to Australia or less likely Africa; F. asiaticum, F. vorosii and F. ussurianum to Asia; F. aethiopicum to Africa; F. boothii and F. mesoamericanum to Central America; F. gerlachii to the US and F. graminearum sensu stricto (F. graminearum s.s.) it is the most cosmopolitan species and has been found in Asia, Africa, America, Europe, and Oceania [20].
Finally, the treatment in localized disease can benefit from surgical debridement especially in disseminated disease together with the use of systemic antifungals. Fusarium species are relatively resistant in vitro to most antifungal agents, showing different susceptibility patterns between species. In general, most Fusarium isolates have lower inhibitory concentrations (MIC) for Amphotericin B higher than Aspergillus species. F. solani and F. verticillioides are usually resistant to azoles and they have higher MIC for azoles than other Fusarium species. In contrast, F. oxysporum and F. moniliforme may be susceptible to voriconazole and posaconazole [9]. Echinocandins show the highest MIC values [21]. As far as we know there are no previous reports in the medical literature of identification of F.graminearum as a pathogen in humans; therefore antifungal therapy was initiated based on is the antifungals reported in the literature for the Fusarium species and on the clinical response.
5. Conclusions
Prolonged profound neutropenia and alteration of the intestinal flora, secondary to myelotoxic chemotherapies and environmental exposure in patients with hematological neoplasms, are important risk factors for the development of invasive infections by filamentous fungi. This is the first reported case of invasive fungal infection by F. graminearum and the first case of portal dissemination of Fusarium spp. The anamnesis and exposure to environmental factors are important during clinical evaluation. F.graminearum was not identifiable by traditional methods such as culture and pathology. Access to molecular biology is extremely valuable to increase the performance of diagnostic tests in the identification of new species such as the F. graminearum reported in our paper.
Acknowledgments
To all the infectious disease fellows who participated in the approach of this case, especially to Aaron Molina. And Rodrigo Toral-Villanueva for his technical support with the edition of figures.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Materials
The following are available online at https://www.mdpi.com/2036-7449/13/1/2/s1, Supplementary material 1 (Figure S1) is a timeline of the present case. Supplementary material 2 (Figure S2) is a figure with the genetic sequences used for the identification of the etiologic agent (Fusarium graminearum complex).
Click here for additional data file.
Author Contributions
M.G.U. was in charge of the data curation of the patient; A.M.-O. and M.G.U. were in charge of the writing of the original manuscript; R.H.-C. was in charge of the methodology for the identification by molecular biology of the etiologic agent ; C.P.-J. was responsible for reviewing and editing the manuscript as well as submitting it for publication. R.H.-G. was in charge of the methodology for the identification of the agent in the pathology specimen. K.E.-B. also participated in the data curation of the patient and in the writing of the original manuscript.All authors have read and agreed to the published version of the manuscript.
Funding
No source of funding was used for the preparation of this report.
Institutional Review Board Statement
Not applicable. Due to the fact that our study is only descriptive (without any type of intervention) on the case of a single patient, and he provided his consent, the evaluation by the Institution's ethics committee was not considered necessary.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Data is contained within the article or supplementary material.
Conflicts of Interest
All authors report having no conflict of interest.
Figure 1 Abdominal CT scan with intravenous contrast, which shows: Diffuse and poorly defined hypodense lesions, one located in the liver segment II measuring 3.4 cm, another located in the caudate lobe measuring 7 cm, and another located in the hepatic segment VII with extension to segment VI measuring 7 cm; consistent with liver abscesses.
Figure 2 (A) Non-pigmented, separated hyphae with acute angle branching in liver biopsy tissue, Grocott methenamine silver-stained specimen, 40×. (B) Non-pigmented, separated hyphae with acute angle branching in intestinal tissue, Grocott methenamine silver-stained specimen, 10×.
Figure 3 The 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification. Lane 1: Molecular weight marker 100 bp DNA ladder; Lane 2: Liver biopsy sample; Lane 3: Negative control. | ASPARAGINASE, CASPOFUNGIN, DAUNORUBICIN, FILGRASTIM, MEROPENEM, METRONIDAZOLE, PREDNISONE, VINCRISTINE, VORICONAZOLE | DrugsGivenReaction | CC BY | 33401374 | 19,386,199 | 2021-01-01 |
What is the weight of the patient? | Portal Dissemination of Fusarium graminearum in a Patient with Acute Lymphoblastic Leukemia and Febrile Neutropenia.
We present the case of a man with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, with gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene, from a liver biopsy. The infection was resolved with surgical drainage and antifungal treatment based on voriconazole. As far as we know, there are no previous reports in the literature of cases of human infection due to Fusarium graminearum.
1. Introduction
In the last decades, there has been an increase in the incidence of invasive fungal infections (IFI), related to new immunosuppressive treatments and improved diagnosis with new molecular techniques and higher diagnostic yields [1,2]. We present the case of a male patient with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, presenting an atypical clinical course, gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene from a liver biopsy. This is the first reported case of portal dissemination by Fusarium genus and the first report of Fusarium graminearum infection in humans.
2. Ethical Considerations
The case we submit for publication is about a single patient who provided his verbal consent for this purpose. We do not include any details or information that could lead to patient identification
3. Case Report
Male patient, 26 years old, kitchen assistant, originated from Taxco, Guerrero and living there until he emigrated to Texas, United States, in 2016, where he was diagnosed with B lymphoblastic leukemia in January 2017. He received four cycles of unspecified chemotherapy with apparent remission of the disease and came back to Mexico (Cuernavaca, Morelos). He was admitted to the National Institute of Cancer in Mexico City in November 2017, where he was diagnosed with early relapse. From November 2017 to January 2018, he received chemotherapy for relapse with BFM like protocol (L-Asparaginase, Vincristine, Daunorubicin, and Prednisone). He did not receive any antifungal prophylaxis. On day +23 he was presented with febrile neutropenia, with no etiologic agent identified. An empirical treatment of five days of Meropenem was administered, with resulting in fever remission. He was discharged 6 days after his admission, asymptomatic but with persistent neutropenia.
Two days later, he had come back with an acute abdomen, although afebrile. Vital constants at admission were: BP: 107/78 mmHg, HR: 90 bpm, RR: 20 rpm, T °: 36.5 °C, weight: 55 Kg, height: 1.62 m, BMI: 21 Kg/m2. His blood tests showed leukocytes of 0.32 × 103/μL, absolute neutrophils 0.0032 x103/μL, hemoglobin 5.7 g/dL, platelets 35 × 103/μL, creatinine 0.66 mg/dL, ALT 174 IU/L, AST 82 IU/L, ALP 1004 IU/L, GGT 572 IU/L, total bilirubin 8 mg/dL, conjugated bilirubin 6.4 mg/dL, unconjugated bilirubin 1.62 mg/dL, LDH 287 IU/L, albumin 1.7 mg/dL, C reactive protein 8.4 mg/dL. The patient underwent exploratory laparotomy which revealed sigmoid perforation. Sigmoidectomy and colostomy were performed. The initial pathology report was diverticulum perforation. Forty-eight hours later, he presented moderate diffuse abdominal pain, and temperature > 38 °C. The blood cultures were negative. Administration of Meropenem, caspofungin and Filgastrim was empirically initiated. Contrast abdominal tomography (CT) showed diffuse liver lesions consistent with liver abscesses (Figure 1).
A liver biopsy of the lesions was performed under ultrasound guidance; the aerobic, anaerobic and Sabouraud dextrose agar cultures were negative. The pathology showed granulomatous hepatitis with extensive necrosis; Grocott’s stain evidenced hyaline hyphae. The histopathology of the sigmoid surgical specimen was reviewed again and then reported as transmural ischemic necrosis, acute and chronic peritonitis, and positive Grocott’s stain with the same hyphae described in the liver (Figure 2).
Hyalohyphomycosis was concluded. The serum galactomannan was negative. Pulmonary involvement was not seen by tomography. The antifungal treatment was changed from caspofungin to intravenous Voriconazole on day 23. The patient had gradual clinical improvement the neutropenia was remitted and was discharged with a treatment of oral voriconazole 200 mg bid. He was, at that time, in complete remission of leukemia.
Three weeks later he was readmitted for abdominal pain in the right hypochondrium with fever without neutropenia; he reported bad adherence to oral antifungal treatment for economic reasons. The new abdominal CT showed the persistence of liver abscesses. Exploratory laparotomy plus drainage were performed finding abscesses in segments II, IV and VI. The anaerobic culture grew Bacteroides fragilis; he completed 14 days of Metronidazole. The fungal culture was negative. The pathology report was extensive granulomatous hepatitis with necrosis and negative Grocott’s stain. The patient received 2 weeks of intravenous Voriconazole plus 6 weeks of the same oral antifungal. At the end of treatment, the abdominal CT showed only one residual lesion of 16 mm. A timeline of the case is shown in Figure S1.
He did not present further complications of the infectious process. However, six months later, while undergoing hematopoietic stem-cell transplant evaluations, he presented a relapse of leukemia and he decided to stop the antineoplastic treatment. He died seven months later.
Materials and Methods for Identification of the Causative Agent
A paraffin block of the first liver biopsy was requested, and DNA extraction was performed. Genomic DNA was extracted from the paraffin-embedded tissue sample using a DNeasy blood and tissue kit (Qiagen, Ventura, CA, USA) according to the manufacturer’s instructions before preliminary removal of paraffin by extraction with xylene protocol. The molecular identification was performed by 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification using a set of primers previously reported to identify fungi species (5′-TCCGTAGGTGAACCTTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). A PCR product of 500 bp was amplified, purified and sequenced in both directions; nucleotide sequence was determined with Taq FS Dye Terminator Cycle Sequencing Fluorescence-Based Sequencing and analyzed on an Applied Biosystems 3730 DNA sequencing system (Foster City, CA, USA). The sequence was edited with Vector NTI program and homology search was performed in the GenBank database (nucleotide blast), finding a 100% identity with Fusarium graminearum complex strain HUT59 [3]. (Figure 3). The sequences used are shown in Supplementary Figure S2.
4. Discussion
In the last ten years, there has been an increasing incidence of disseminated filamentous fungal infections in patients with severe immunosuppression [1,2,4]. Hematological malignancies have a risk of 6.5% for IFI [5], mainly in the induction and consolidation phases. This increase is due to severe immunosuppression conditions by myelotoxic treatments and related clinical conditions but also to new technologies such as molecular biology [6,7] that have increased the diagnosis ability.
Hialohifomycetes are opportunistic filamentous fungi that usually cause infection after environmental exposure [6]. Infection occurs through inhalation or skin breakdown (wounds, burns) [8]. Fusarium spp. is the second cause of infections by filamentous fungi after Aspergillus spp. More than 50 Fusarium species have been identified, but only about 12 are associated with infection in humans. F. incarnatum, F. moniliforme, F. oxysporum and F. solani usually cause allergic reactions and superficial infections such as keratitis and onychomycosis in immunocompetent hosts. In immunocompromised patients, it can cause from locally invasive diseases such as sinusitis and pneumonia, to fungemia and disseminated disease [9,10]. In neutropenic patients, it usually manifests as fever not responding to empirical antibiotics. Profound and prolonged neutropenia is the most important risk factor for dissemination and death due to fusariosis [8,11]. The most frequently isolated species in this setting are F. solani (50%) and F. oxysporum (20%) [6,8].
Fusarium graminearum plays a major role as the etiological agent of one important disease of small grain cereals and corn. First identified in 1884 in England, it is considered a major threat to wheat and barley [12]. The fungi, transmitted by seed, can survive up to 10 years as spores or resting structures in and on the seed. In Mexico, F. graminearum has been found in Hidalgo, Jalisco, Mexico, Michoacán and Tlaxcala [13,14,15,16]. This fungus can produce several mycotoxins, which have shown abortive estrogenic, gastric (nausea and vomiting) and neurotoxic toxicity in swine, cattle, dogs, cats, and ducks [16,17]. Grain that has been infected with the fungus can be incorporated into basic diets and could be a source of infection in humans. So far, no infections due to F. graminareum have been reported. Considering the patient’s occupation (kitchen helper) and the high corn content in the Mexican diet, we supposed that the patient was colonized with F. graminearum through the daily ingestion and handling of corn. He possibly got the mould through oral ingestion, and symptoms were gastrointestinal due to portal dissemination, which explains why we did not document any fungemia or cutaneous infection, despite an invasive disease. Usually, in disseminated fusariosis, blood cultures are positive in more than 75% of cases [6,8].
In our patient, the diagnosis of hyalohyphomycosis was first made by pathologic specimen. The biopsy revealed the presence of septate hyaline hyphae 3–6 μm diameter, indistinguishable from other hyalohyphomycosis such as Aspergillus, Acremonium [Cephalosporium], and Pseudallescheria [17]. Recently, the Mycotic Diseases Branch, from the Center for Disease Control and Prevention in Atlanta, described a new entity of invasive fungal infections (IFI), which they called “foodborne IFI”, in a recently published systematic review [18], foodborne IFI are infections acquired through ingestion of food or water contaminated with the fungi causing the infection. Reports describe molds and yeasts as etiologic agents. Rhizopus sp is the most frequently described mold, but one case of IFI due to Fusarium moniliforme is reported in a man with acute lymphoblastic leukemia who ingested cereals. The diagnosis of foodborne IFI is difficult, clinical presentation is usually atypical, and mainly gastrointestinal. Fungi can spoil food that is ingested, and it is suggested that this category of fungal infections could be related to food insecurity. The source of the fungi should be identified to be able to classify the IFI as foodborne, which is often difficult to the ubiquitous nature of these fungi. As previously mentioned, although we suspect that our patient acquired the infection orally and this could correspond to foodborne IFI, we cannot corroborate the above because we could not have samples of the food that the patient ingested prior to his hospitalization and we did not perform stool cultures.
Today, comparative identification strategies based on gene sequencing can be considered the new gold standard for the identification of fungal species. Gene sequencing is characterized by PCR amplification of the ITS region, and sequencing of the resulting amplicon (s). The ITS region can be amplified reliably for most fungi [19]. These molecular biology techniques provide better discrimination of species morphologically indistinguishable from Fusarium spp, and can be performed on different types of materials, including paraffin blocks, which is why it is considered an emerging and promising methodology to be used in the routine identification of Fusarium spp. In our case, no other fungal species were identified in the studied specimen or in any other specimen from the patient. The Fusarium graminearum complex includes 13 species; biogeographic data suggest that the majority of the species within the complex have evolutionary origins in the Southern hemisphere and Asia. According to the surveys to date, F. austroamericanum, F. meridionale, F. cortaderiae, and F. brasilicum appear to be endemic to South America; F. acaciae-mearnsii to Australia or less likely Africa; F. asiaticum, F. vorosii and F. ussurianum to Asia; F. aethiopicum to Africa; F. boothii and F. mesoamericanum to Central America; F. gerlachii to the US and F. graminearum sensu stricto (F. graminearum s.s.) it is the most cosmopolitan species and has been found in Asia, Africa, America, Europe, and Oceania [20].
Finally, the treatment in localized disease can benefit from surgical debridement especially in disseminated disease together with the use of systemic antifungals. Fusarium species are relatively resistant in vitro to most antifungal agents, showing different susceptibility patterns between species. In general, most Fusarium isolates have lower inhibitory concentrations (MIC) for Amphotericin B higher than Aspergillus species. F. solani and F. verticillioides are usually resistant to azoles and they have higher MIC for azoles than other Fusarium species. In contrast, F. oxysporum and F. moniliforme may be susceptible to voriconazole and posaconazole [9]. Echinocandins show the highest MIC values [21]. As far as we know there are no previous reports in the medical literature of identification of F.graminearum as a pathogen in humans; therefore antifungal therapy was initiated based on is the antifungals reported in the literature for the Fusarium species and on the clinical response.
5. Conclusions
Prolonged profound neutropenia and alteration of the intestinal flora, secondary to myelotoxic chemotherapies and environmental exposure in patients with hematological neoplasms, are important risk factors for the development of invasive infections by filamentous fungi. This is the first reported case of invasive fungal infection by F. graminearum and the first case of portal dissemination of Fusarium spp. The anamnesis and exposure to environmental factors are important during clinical evaluation. F.graminearum was not identifiable by traditional methods such as culture and pathology. Access to molecular biology is extremely valuable to increase the performance of diagnostic tests in the identification of new species such as the F. graminearum reported in our paper.
Acknowledgments
To all the infectious disease fellows who participated in the approach of this case, especially to Aaron Molina. And Rodrigo Toral-Villanueva for his technical support with the edition of figures.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Materials
The following are available online at https://www.mdpi.com/2036-7449/13/1/2/s1, Supplementary material 1 (Figure S1) is a timeline of the present case. Supplementary material 2 (Figure S2) is a figure with the genetic sequences used for the identification of the etiologic agent (Fusarium graminearum complex).
Click here for additional data file.
Author Contributions
M.G.U. was in charge of the data curation of the patient; A.M.-O. and M.G.U. were in charge of the writing of the original manuscript; R.H.-C. was in charge of the methodology for the identification by molecular biology of the etiologic agent ; C.P.-J. was responsible for reviewing and editing the manuscript as well as submitting it for publication. R.H.-G. was in charge of the methodology for the identification of the agent in the pathology specimen. K.E.-B. also participated in the data curation of the patient and in the writing of the original manuscript.All authors have read and agreed to the published version of the manuscript.
Funding
No source of funding was used for the preparation of this report.
Institutional Review Board Statement
Not applicable. Due to the fact that our study is only descriptive (without any type of intervention) on the case of a single patient, and he provided his consent, the evaluation by the Institution's ethics committee was not considered necessary.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Data is contained within the article or supplementary material.
Conflicts of Interest
All authors report having no conflict of interest.
Figure 1 Abdominal CT scan with intravenous contrast, which shows: Diffuse and poorly defined hypodense lesions, one located in the liver segment II measuring 3.4 cm, another located in the caudate lobe measuring 7 cm, and another located in the hepatic segment VII with extension to segment VI measuring 7 cm; consistent with liver abscesses.
Figure 2 (A) Non-pigmented, separated hyphae with acute angle branching in liver biopsy tissue, Grocott methenamine silver-stained specimen, 40×. (B) Non-pigmented, separated hyphae with acute angle branching in intestinal tissue, Grocott methenamine silver-stained specimen, 10×.
Figure 3 The 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification. Lane 1: Molecular weight marker 100 bp DNA ladder; Lane 2: Liver biopsy sample; Lane 3: Negative control. | 55 kg. | Weight | CC BY | 33401374 | 19,386,199 | 2021-01-01 |
What was the outcome of reaction 'Fusarium infection'? | Portal Dissemination of Fusarium graminearum in a Patient with Acute Lymphoblastic Leukemia and Febrile Neutropenia.
We present the case of a man with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, with gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene, from a liver biopsy. The infection was resolved with surgical drainage and antifungal treatment based on voriconazole. As far as we know, there are no previous reports in the literature of cases of human infection due to Fusarium graminearum.
1. Introduction
In the last decades, there has been an increase in the incidence of invasive fungal infections (IFI), related to new immunosuppressive treatments and improved diagnosis with new molecular techniques and higher diagnostic yields [1,2]. We present the case of a male patient with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, presenting an atypical clinical course, gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene from a liver biopsy. This is the first reported case of portal dissemination by Fusarium genus and the first report of Fusarium graminearum infection in humans.
2. Ethical Considerations
The case we submit for publication is about a single patient who provided his verbal consent for this purpose. We do not include any details or information that could lead to patient identification
3. Case Report
Male patient, 26 years old, kitchen assistant, originated from Taxco, Guerrero and living there until he emigrated to Texas, United States, in 2016, where he was diagnosed with B lymphoblastic leukemia in January 2017. He received four cycles of unspecified chemotherapy with apparent remission of the disease and came back to Mexico (Cuernavaca, Morelos). He was admitted to the National Institute of Cancer in Mexico City in November 2017, where he was diagnosed with early relapse. From November 2017 to January 2018, he received chemotherapy for relapse with BFM like protocol (L-Asparaginase, Vincristine, Daunorubicin, and Prednisone). He did not receive any antifungal prophylaxis. On day +23 he was presented with febrile neutropenia, with no etiologic agent identified. An empirical treatment of five days of Meropenem was administered, with resulting in fever remission. He was discharged 6 days after his admission, asymptomatic but with persistent neutropenia.
Two days later, he had come back with an acute abdomen, although afebrile. Vital constants at admission were: BP: 107/78 mmHg, HR: 90 bpm, RR: 20 rpm, T °: 36.5 °C, weight: 55 Kg, height: 1.62 m, BMI: 21 Kg/m2. His blood tests showed leukocytes of 0.32 × 103/μL, absolute neutrophils 0.0032 x103/μL, hemoglobin 5.7 g/dL, platelets 35 × 103/μL, creatinine 0.66 mg/dL, ALT 174 IU/L, AST 82 IU/L, ALP 1004 IU/L, GGT 572 IU/L, total bilirubin 8 mg/dL, conjugated bilirubin 6.4 mg/dL, unconjugated bilirubin 1.62 mg/dL, LDH 287 IU/L, albumin 1.7 mg/dL, C reactive protein 8.4 mg/dL. The patient underwent exploratory laparotomy which revealed sigmoid perforation. Sigmoidectomy and colostomy were performed. The initial pathology report was diverticulum perforation. Forty-eight hours later, he presented moderate diffuse abdominal pain, and temperature > 38 °C. The blood cultures were negative. Administration of Meropenem, caspofungin and Filgastrim was empirically initiated. Contrast abdominal tomography (CT) showed diffuse liver lesions consistent with liver abscesses (Figure 1).
A liver biopsy of the lesions was performed under ultrasound guidance; the aerobic, anaerobic and Sabouraud dextrose agar cultures were negative. The pathology showed granulomatous hepatitis with extensive necrosis; Grocott’s stain evidenced hyaline hyphae. The histopathology of the sigmoid surgical specimen was reviewed again and then reported as transmural ischemic necrosis, acute and chronic peritonitis, and positive Grocott’s stain with the same hyphae described in the liver (Figure 2).
Hyalohyphomycosis was concluded. The serum galactomannan was negative. Pulmonary involvement was not seen by tomography. The antifungal treatment was changed from caspofungin to intravenous Voriconazole on day 23. The patient had gradual clinical improvement the neutropenia was remitted and was discharged with a treatment of oral voriconazole 200 mg bid. He was, at that time, in complete remission of leukemia.
Three weeks later he was readmitted for abdominal pain in the right hypochondrium with fever without neutropenia; he reported bad adherence to oral antifungal treatment for economic reasons. The new abdominal CT showed the persistence of liver abscesses. Exploratory laparotomy plus drainage were performed finding abscesses in segments II, IV and VI. The anaerobic culture grew Bacteroides fragilis; he completed 14 days of Metronidazole. The fungal culture was negative. The pathology report was extensive granulomatous hepatitis with necrosis and negative Grocott’s stain. The patient received 2 weeks of intravenous Voriconazole plus 6 weeks of the same oral antifungal. At the end of treatment, the abdominal CT showed only one residual lesion of 16 mm. A timeline of the case is shown in Figure S1.
He did not present further complications of the infectious process. However, six months later, while undergoing hematopoietic stem-cell transplant evaluations, he presented a relapse of leukemia and he decided to stop the antineoplastic treatment. He died seven months later.
Materials and Methods for Identification of the Causative Agent
A paraffin block of the first liver biopsy was requested, and DNA extraction was performed. Genomic DNA was extracted from the paraffin-embedded tissue sample using a DNeasy blood and tissue kit (Qiagen, Ventura, CA, USA) according to the manufacturer’s instructions before preliminary removal of paraffin by extraction with xylene protocol. The molecular identification was performed by 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification using a set of primers previously reported to identify fungi species (5′-TCCGTAGGTGAACCTTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). A PCR product of 500 bp was amplified, purified and sequenced in both directions; nucleotide sequence was determined with Taq FS Dye Terminator Cycle Sequencing Fluorescence-Based Sequencing and analyzed on an Applied Biosystems 3730 DNA sequencing system (Foster City, CA, USA). The sequence was edited with Vector NTI program and homology search was performed in the GenBank database (nucleotide blast), finding a 100% identity with Fusarium graminearum complex strain HUT59 [3]. (Figure 3). The sequences used are shown in Supplementary Figure S2.
4. Discussion
In the last ten years, there has been an increasing incidence of disseminated filamentous fungal infections in patients with severe immunosuppression [1,2,4]. Hematological malignancies have a risk of 6.5% for IFI [5], mainly in the induction and consolidation phases. This increase is due to severe immunosuppression conditions by myelotoxic treatments and related clinical conditions but also to new technologies such as molecular biology [6,7] that have increased the diagnosis ability.
Hialohifomycetes are opportunistic filamentous fungi that usually cause infection after environmental exposure [6]. Infection occurs through inhalation or skin breakdown (wounds, burns) [8]. Fusarium spp. is the second cause of infections by filamentous fungi after Aspergillus spp. More than 50 Fusarium species have been identified, but only about 12 are associated with infection in humans. F. incarnatum, F. moniliforme, F. oxysporum and F. solani usually cause allergic reactions and superficial infections such as keratitis and onychomycosis in immunocompetent hosts. In immunocompromised patients, it can cause from locally invasive diseases such as sinusitis and pneumonia, to fungemia and disseminated disease [9,10]. In neutropenic patients, it usually manifests as fever not responding to empirical antibiotics. Profound and prolonged neutropenia is the most important risk factor for dissemination and death due to fusariosis [8,11]. The most frequently isolated species in this setting are F. solani (50%) and F. oxysporum (20%) [6,8].
Fusarium graminearum plays a major role as the etiological agent of one important disease of small grain cereals and corn. First identified in 1884 in England, it is considered a major threat to wheat and barley [12]. The fungi, transmitted by seed, can survive up to 10 years as spores or resting structures in and on the seed. In Mexico, F. graminearum has been found in Hidalgo, Jalisco, Mexico, Michoacán and Tlaxcala [13,14,15,16]. This fungus can produce several mycotoxins, which have shown abortive estrogenic, gastric (nausea and vomiting) and neurotoxic toxicity in swine, cattle, dogs, cats, and ducks [16,17]. Grain that has been infected with the fungus can be incorporated into basic diets and could be a source of infection in humans. So far, no infections due to F. graminareum have been reported. Considering the patient’s occupation (kitchen helper) and the high corn content in the Mexican diet, we supposed that the patient was colonized with F. graminearum through the daily ingestion and handling of corn. He possibly got the mould through oral ingestion, and symptoms were gastrointestinal due to portal dissemination, which explains why we did not document any fungemia or cutaneous infection, despite an invasive disease. Usually, in disseminated fusariosis, blood cultures are positive in more than 75% of cases [6,8].
In our patient, the diagnosis of hyalohyphomycosis was first made by pathologic specimen. The biopsy revealed the presence of septate hyaline hyphae 3–6 μm diameter, indistinguishable from other hyalohyphomycosis such as Aspergillus, Acremonium [Cephalosporium], and Pseudallescheria [17]. Recently, the Mycotic Diseases Branch, from the Center for Disease Control and Prevention in Atlanta, described a new entity of invasive fungal infections (IFI), which they called “foodborne IFI”, in a recently published systematic review [18], foodborne IFI are infections acquired through ingestion of food or water contaminated with the fungi causing the infection. Reports describe molds and yeasts as etiologic agents. Rhizopus sp is the most frequently described mold, but one case of IFI due to Fusarium moniliforme is reported in a man with acute lymphoblastic leukemia who ingested cereals. The diagnosis of foodborne IFI is difficult, clinical presentation is usually atypical, and mainly gastrointestinal. Fungi can spoil food that is ingested, and it is suggested that this category of fungal infections could be related to food insecurity. The source of the fungi should be identified to be able to classify the IFI as foodborne, which is often difficult to the ubiquitous nature of these fungi. As previously mentioned, although we suspect that our patient acquired the infection orally and this could correspond to foodborne IFI, we cannot corroborate the above because we could not have samples of the food that the patient ingested prior to his hospitalization and we did not perform stool cultures.
Today, comparative identification strategies based on gene sequencing can be considered the new gold standard for the identification of fungal species. Gene sequencing is characterized by PCR amplification of the ITS region, and sequencing of the resulting amplicon (s). The ITS region can be amplified reliably for most fungi [19]. These molecular biology techniques provide better discrimination of species morphologically indistinguishable from Fusarium spp, and can be performed on different types of materials, including paraffin blocks, which is why it is considered an emerging and promising methodology to be used in the routine identification of Fusarium spp. In our case, no other fungal species were identified in the studied specimen or in any other specimen from the patient. The Fusarium graminearum complex includes 13 species; biogeographic data suggest that the majority of the species within the complex have evolutionary origins in the Southern hemisphere and Asia. According to the surveys to date, F. austroamericanum, F. meridionale, F. cortaderiae, and F. brasilicum appear to be endemic to South America; F. acaciae-mearnsii to Australia or less likely Africa; F. asiaticum, F. vorosii and F. ussurianum to Asia; F. aethiopicum to Africa; F. boothii and F. mesoamericanum to Central America; F. gerlachii to the US and F. graminearum sensu stricto (F. graminearum s.s.) it is the most cosmopolitan species and has been found in Asia, Africa, America, Europe, and Oceania [20].
Finally, the treatment in localized disease can benefit from surgical debridement especially in disseminated disease together with the use of systemic antifungals. Fusarium species are relatively resistant in vitro to most antifungal agents, showing different susceptibility patterns between species. In general, most Fusarium isolates have lower inhibitory concentrations (MIC) for Amphotericin B higher than Aspergillus species. F. solani and F. verticillioides are usually resistant to azoles and they have higher MIC for azoles than other Fusarium species. In contrast, F. oxysporum and F. moniliforme may be susceptible to voriconazole and posaconazole [9]. Echinocandins show the highest MIC values [21]. As far as we know there are no previous reports in the medical literature of identification of F.graminearum as a pathogen in humans; therefore antifungal therapy was initiated based on is the antifungals reported in the literature for the Fusarium species and on the clinical response.
5. Conclusions
Prolonged profound neutropenia and alteration of the intestinal flora, secondary to myelotoxic chemotherapies and environmental exposure in patients with hematological neoplasms, are important risk factors for the development of invasive infections by filamentous fungi. This is the first reported case of invasive fungal infection by F. graminearum and the first case of portal dissemination of Fusarium spp. The anamnesis and exposure to environmental factors are important during clinical evaluation. F.graminearum was not identifiable by traditional methods such as culture and pathology. Access to molecular biology is extremely valuable to increase the performance of diagnostic tests in the identification of new species such as the F. graminearum reported in our paper.
Acknowledgments
To all the infectious disease fellows who participated in the approach of this case, especially to Aaron Molina. And Rodrigo Toral-Villanueva for his technical support with the edition of figures.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Materials
The following are available online at https://www.mdpi.com/2036-7449/13/1/2/s1, Supplementary material 1 (Figure S1) is a timeline of the present case. Supplementary material 2 (Figure S2) is a figure with the genetic sequences used for the identification of the etiologic agent (Fusarium graminearum complex).
Click here for additional data file.
Author Contributions
M.G.U. was in charge of the data curation of the patient; A.M.-O. and M.G.U. were in charge of the writing of the original manuscript; R.H.-C. was in charge of the methodology for the identification by molecular biology of the etiologic agent ; C.P.-J. was responsible for reviewing and editing the manuscript as well as submitting it for publication. R.H.-G. was in charge of the methodology for the identification of the agent in the pathology specimen. K.E.-B. also participated in the data curation of the patient and in the writing of the original manuscript.All authors have read and agreed to the published version of the manuscript.
Funding
No source of funding was used for the preparation of this report.
Institutional Review Board Statement
Not applicable. Due to the fact that our study is only descriptive (without any type of intervention) on the case of a single patient, and he provided his consent, the evaluation by the Institution's ethics committee was not considered necessary.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Data is contained within the article or supplementary material.
Conflicts of Interest
All authors report having no conflict of interest.
Figure 1 Abdominal CT scan with intravenous contrast, which shows: Diffuse and poorly defined hypodense lesions, one located in the liver segment II measuring 3.4 cm, another located in the caudate lobe measuring 7 cm, and another located in the hepatic segment VII with extension to segment VI measuring 7 cm; consistent with liver abscesses.
Figure 2 (A) Non-pigmented, separated hyphae with acute angle branching in liver biopsy tissue, Grocott methenamine silver-stained specimen, 40×. (B) Non-pigmented, separated hyphae with acute angle branching in intestinal tissue, Grocott methenamine silver-stained specimen, 10×.
Figure 3 The 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification. Lane 1: Molecular weight marker 100 bp DNA ladder; Lane 2: Liver biopsy sample; Lane 3: Negative control. | Recovering | ReactionOutcome | CC BY | 33401374 | 19,386,199 | 2021-01-01 |
What was the outcome of reaction 'Leukaemia recurrent'? | Portal Dissemination of Fusarium graminearum in a Patient with Acute Lymphoblastic Leukemia and Febrile Neutropenia.
We present the case of a man with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, with gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene, from a liver biopsy. The infection was resolved with surgical drainage and antifungal treatment based on voriconazole. As far as we know, there are no previous reports in the literature of cases of human infection due to Fusarium graminearum.
1. Introduction
In the last decades, there has been an increase in the incidence of invasive fungal infections (IFI), related to new immunosuppressive treatments and improved diagnosis with new molecular techniques and higher diagnostic yields [1,2]. We present the case of a male patient with acute lymphoblastic leukemia and prolonged profound neutropenia, who developed an invasive infection by Fusarium graminearum, acquired via non-cutaneous entry, presenting an atypical clinical course, gastrointestinal symptoms, sigmoid perforation and liver abscesses due to portal dissemination. The etiologic agent was identified using the 18S-ITS1-5.8S-ITS2-28S rRNA sequence gene from a liver biopsy. This is the first reported case of portal dissemination by Fusarium genus and the first report of Fusarium graminearum infection in humans.
2. Ethical Considerations
The case we submit for publication is about a single patient who provided his verbal consent for this purpose. We do not include any details or information that could lead to patient identification
3. Case Report
Male patient, 26 years old, kitchen assistant, originated from Taxco, Guerrero and living there until he emigrated to Texas, United States, in 2016, where he was diagnosed with B lymphoblastic leukemia in January 2017. He received four cycles of unspecified chemotherapy with apparent remission of the disease and came back to Mexico (Cuernavaca, Morelos). He was admitted to the National Institute of Cancer in Mexico City in November 2017, where he was diagnosed with early relapse. From November 2017 to January 2018, he received chemotherapy for relapse with BFM like protocol (L-Asparaginase, Vincristine, Daunorubicin, and Prednisone). He did not receive any antifungal prophylaxis. On day +23 he was presented with febrile neutropenia, with no etiologic agent identified. An empirical treatment of five days of Meropenem was administered, with resulting in fever remission. He was discharged 6 days after his admission, asymptomatic but with persistent neutropenia.
Two days later, he had come back with an acute abdomen, although afebrile. Vital constants at admission were: BP: 107/78 mmHg, HR: 90 bpm, RR: 20 rpm, T °: 36.5 °C, weight: 55 Kg, height: 1.62 m, BMI: 21 Kg/m2. His blood tests showed leukocytes of 0.32 × 103/μL, absolute neutrophils 0.0032 x103/μL, hemoglobin 5.7 g/dL, platelets 35 × 103/μL, creatinine 0.66 mg/dL, ALT 174 IU/L, AST 82 IU/L, ALP 1004 IU/L, GGT 572 IU/L, total bilirubin 8 mg/dL, conjugated bilirubin 6.4 mg/dL, unconjugated bilirubin 1.62 mg/dL, LDH 287 IU/L, albumin 1.7 mg/dL, C reactive protein 8.4 mg/dL. The patient underwent exploratory laparotomy which revealed sigmoid perforation. Sigmoidectomy and colostomy were performed. The initial pathology report was diverticulum perforation. Forty-eight hours later, he presented moderate diffuse abdominal pain, and temperature > 38 °C. The blood cultures were negative. Administration of Meropenem, caspofungin and Filgastrim was empirically initiated. Contrast abdominal tomography (CT) showed diffuse liver lesions consistent with liver abscesses (Figure 1).
A liver biopsy of the lesions was performed under ultrasound guidance; the aerobic, anaerobic and Sabouraud dextrose agar cultures were negative. The pathology showed granulomatous hepatitis with extensive necrosis; Grocott’s stain evidenced hyaline hyphae. The histopathology of the sigmoid surgical specimen was reviewed again and then reported as transmural ischemic necrosis, acute and chronic peritonitis, and positive Grocott’s stain with the same hyphae described in the liver (Figure 2).
Hyalohyphomycosis was concluded. The serum galactomannan was negative. Pulmonary involvement was not seen by tomography. The antifungal treatment was changed from caspofungin to intravenous Voriconazole on day 23. The patient had gradual clinical improvement the neutropenia was remitted and was discharged with a treatment of oral voriconazole 200 mg bid. He was, at that time, in complete remission of leukemia.
Three weeks later he was readmitted for abdominal pain in the right hypochondrium with fever without neutropenia; he reported bad adherence to oral antifungal treatment for economic reasons. The new abdominal CT showed the persistence of liver abscesses. Exploratory laparotomy plus drainage were performed finding abscesses in segments II, IV and VI. The anaerobic culture grew Bacteroides fragilis; he completed 14 days of Metronidazole. The fungal culture was negative. The pathology report was extensive granulomatous hepatitis with necrosis and negative Grocott’s stain. The patient received 2 weeks of intravenous Voriconazole plus 6 weeks of the same oral antifungal. At the end of treatment, the abdominal CT showed only one residual lesion of 16 mm. A timeline of the case is shown in Figure S1.
He did not present further complications of the infectious process. However, six months later, while undergoing hematopoietic stem-cell transplant evaluations, he presented a relapse of leukemia and he decided to stop the antineoplastic treatment. He died seven months later.
Materials and Methods for Identification of the Causative Agent
A paraffin block of the first liver biopsy was requested, and DNA extraction was performed. Genomic DNA was extracted from the paraffin-embedded tissue sample using a DNeasy blood and tissue kit (Qiagen, Ventura, CA, USA) according to the manufacturer’s instructions before preliminary removal of paraffin by extraction with xylene protocol. The molecular identification was performed by 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification using a set of primers previously reported to identify fungi species (5′-TCCGTAGGTGAACCTTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). A PCR product of 500 bp was amplified, purified and sequenced in both directions; nucleotide sequence was determined with Taq FS Dye Terminator Cycle Sequencing Fluorescence-Based Sequencing and analyzed on an Applied Biosystems 3730 DNA sequencing system (Foster City, CA, USA). The sequence was edited with Vector NTI program and homology search was performed in the GenBank database (nucleotide blast), finding a 100% identity with Fusarium graminearum complex strain HUT59 [3]. (Figure 3). The sequences used are shown in Supplementary Figure S2.
4. Discussion
In the last ten years, there has been an increasing incidence of disseminated filamentous fungal infections in patients with severe immunosuppression [1,2,4]. Hematological malignancies have a risk of 6.5% for IFI [5], mainly in the induction and consolidation phases. This increase is due to severe immunosuppression conditions by myelotoxic treatments and related clinical conditions but also to new technologies such as molecular biology [6,7] that have increased the diagnosis ability.
Hialohifomycetes are opportunistic filamentous fungi that usually cause infection after environmental exposure [6]. Infection occurs through inhalation or skin breakdown (wounds, burns) [8]. Fusarium spp. is the second cause of infections by filamentous fungi after Aspergillus spp. More than 50 Fusarium species have been identified, but only about 12 are associated with infection in humans. F. incarnatum, F. moniliforme, F. oxysporum and F. solani usually cause allergic reactions and superficial infections such as keratitis and onychomycosis in immunocompetent hosts. In immunocompromised patients, it can cause from locally invasive diseases such as sinusitis and pneumonia, to fungemia and disseminated disease [9,10]. In neutropenic patients, it usually manifests as fever not responding to empirical antibiotics. Profound and prolonged neutropenia is the most important risk factor for dissemination and death due to fusariosis [8,11]. The most frequently isolated species in this setting are F. solani (50%) and F. oxysporum (20%) [6,8].
Fusarium graminearum plays a major role as the etiological agent of one important disease of small grain cereals and corn. First identified in 1884 in England, it is considered a major threat to wheat and barley [12]. The fungi, transmitted by seed, can survive up to 10 years as spores or resting structures in and on the seed. In Mexico, F. graminearum has been found in Hidalgo, Jalisco, Mexico, Michoacán and Tlaxcala [13,14,15,16]. This fungus can produce several mycotoxins, which have shown abortive estrogenic, gastric (nausea and vomiting) and neurotoxic toxicity in swine, cattle, dogs, cats, and ducks [16,17]. Grain that has been infected with the fungus can be incorporated into basic diets and could be a source of infection in humans. So far, no infections due to F. graminareum have been reported. Considering the patient’s occupation (kitchen helper) and the high corn content in the Mexican diet, we supposed that the patient was colonized with F. graminearum through the daily ingestion and handling of corn. He possibly got the mould through oral ingestion, and symptoms were gastrointestinal due to portal dissemination, which explains why we did not document any fungemia or cutaneous infection, despite an invasive disease. Usually, in disseminated fusariosis, blood cultures are positive in more than 75% of cases [6,8].
In our patient, the diagnosis of hyalohyphomycosis was first made by pathologic specimen. The biopsy revealed the presence of septate hyaline hyphae 3–6 μm diameter, indistinguishable from other hyalohyphomycosis such as Aspergillus, Acremonium [Cephalosporium], and Pseudallescheria [17]. Recently, the Mycotic Diseases Branch, from the Center for Disease Control and Prevention in Atlanta, described a new entity of invasive fungal infections (IFI), which they called “foodborne IFI”, in a recently published systematic review [18], foodborne IFI are infections acquired through ingestion of food or water contaminated with the fungi causing the infection. Reports describe molds and yeasts as etiologic agents. Rhizopus sp is the most frequently described mold, but one case of IFI due to Fusarium moniliforme is reported in a man with acute lymphoblastic leukemia who ingested cereals. The diagnosis of foodborne IFI is difficult, clinical presentation is usually atypical, and mainly gastrointestinal. Fungi can spoil food that is ingested, and it is suggested that this category of fungal infections could be related to food insecurity. The source of the fungi should be identified to be able to classify the IFI as foodborne, which is often difficult to the ubiquitous nature of these fungi. As previously mentioned, although we suspect that our patient acquired the infection orally and this could correspond to foodborne IFI, we cannot corroborate the above because we could not have samples of the food that the patient ingested prior to his hospitalization and we did not perform stool cultures.
Today, comparative identification strategies based on gene sequencing can be considered the new gold standard for the identification of fungal species. Gene sequencing is characterized by PCR amplification of the ITS region, and sequencing of the resulting amplicon (s). The ITS region can be amplified reliably for most fungi [19]. These molecular biology techniques provide better discrimination of species morphologically indistinguishable from Fusarium spp, and can be performed on different types of materials, including paraffin blocks, which is why it is considered an emerging and promising methodology to be used in the routine identification of Fusarium spp. In our case, no other fungal species were identified in the studied specimen or in any other specimen from the patient. The Fusarium graminearum complex includes 13 species; biogeographic data suggest that the majority of the species within the complex have evolutionary origins in the Southern hemisphere and Asia. According to the surveys to date, F. austroamericanum, F. meridionale, F. cortaderiae, and F. brasilicum appear to be endemic to South America; F. acaciae-mearnsii to Australia or less likely Africa; F. asiaticum, F. vorosii and F. ussurianum to Asia; F. aethiopicum to Africa; F. boothii and F. mesoamericanum to Central America; F. gerlachii to the US and F. graminearum sensu stricto (F. graminearum s.s.) it is the most cosmopolitan species and has been found in Asia, Africa, America, Europe, and Oceania [20].
Finally, the treatment in localized disease can benefit from surgical debridement especially in disseminated disease together with the use of systemic antifungals. Fusarium species are relatively resistant in vitro to most antifungal agents, showing different susceptibility patterns between species. In general, most Fusarium isolates have lower inhibitory concentrations (MIC) for Amphotericin B higher than Aspergillus species. F. solani and F. verticillioides are usually resistant to azoles and they have higher MIC for azoles than other Fusarium species. In contrast, F. oxysporum and F. moniliforme may be susceptible to voriconazole and posaconazole [9]. Echinocandins show the highest MIC values [21]. As far as we know there are no previous reports in the medical literature of identification of F.graminearum as a pathogen in humans; therefore antifungal therapy was initiated based on is the antifungals reported in the literature for the Fusarium species and on the clinical response.
5. Conclusions
Prolonged profound neutropenia and alteration of the intestinal flora, secondary to myelotoxic chemotherapies and environmental exposure in patients with hematological neoplasms, are important risk factors for the development of invasive infections by filamentous fungi. This is the first reported case of invasive fungal infection by F. graminearum and the first case of portal dissemination of Fusarium spp. The anamnesis and exposure to environmental factors are important during clinical evaluation. F.graminearum was not identifiable by traditional methods such as culture and pathology. Access to molecular biology is extremely valuable to increase the performance of diagnostic tests in the identification of new species such as the F. graminearum reported in our paper.
Acknowledgments
To all the infectious disease fellows who participated in the approach of this case, especially to Aaron Molina. And Rodrigo Toral-Villanueva for his technical support with the edition of figures.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Materials
The following are available online at https://www.mdpi.com/2036-7449/13/1/2/s1, Supplementary material 1 (Figure S1) is a timeline of the present case. Supplementary material 2 (Figure S2) is a figure with the genetic sequences used for the identification of the etiologic agent (Fusarium graminearum complex).
Click here for additional data file.
Author Contributions
M.G.U. was in charge of the data curation of the patient; A.M.-O. and M.G.U. were in charge of the writing of the original manuscript; R.H.-C. was in charge of the methodology for the identification by molecular biology of the etiologic agent ; C.P.-J. was responsible for reviewing and editing the manuscript as well as submitting it for publication. R.H.-G. was in charge of the methodology for the identification of the agent in the pathology specimen. K.E.-B. also participated in the data curation of the patient and in the writing of the original manuscript.All authors have read and agreed to the published version of the manuscript.
Funding
No source of funding was used for the preparation of this report.
Institutional Review Board Statement
Not applicable. Due to the fact that our study is only descriptive (without any type of intervention) on the case of a single patient, and he provided his consent, the evaluation by the Institution's ethics committee was not considered necessary.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Data is contained within the article or supplementary material.
Conflicts of Interest
All authors report having no conflict of interest.
Figure 1 Abdominal CT scan with intravenous contrast, which shows: Diffuse and poorly defined hypodense lesions, one located in the liver segment II measuring 3.4 cm, another located in the caudate lobe measuring 7 cm, and another located in the hepatic segment VII with extension to segment VI measuring 7 cm; consistent with liver abscesses.
Figure 2 (A) Non-pigmented, separated hyphae with acute angle branching in liver biopsy tissue, Grocott methenamine silver-stained specimen, 40×. (B) Non-pigmented, separated hyphae with acute angle branching in intestinal tissue, Grocott methenamine silver-stained specimen, 10×.
Figure 3 The 18S-ITS1-5.8S-ITS2-25S rRNA gene amplification. Lane 1: Molecular weight marker 100 bp DNA ladder; Lane 2: Liver biopsy sample; Lane 3: Negative control. | Fatal | ReactionOutcome | CC BY | 33401374 | 19,386,199 | 2021-01-01 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.