article
dict
reports
listlengths
1
3.97k
{ "abstract": "We conducted a prospective study to evaluate the efficacy and safety of biweekly gemcitabine and carboplatin combination treatment in patients with resected non-small cell lung cancer (NSCLC).\n\n\n\nPatients with completely resected stage IB to IIIA NSCLC were treated with four cycles of gemcitabine (1000 mg/m2, days 1 and 15) plus carboplatin [area under the time-concentration curve (AUC) 5 mg/mL/min, day 1] every 4 weeks as adjuvant chemotherapy.\n\n\n\nForty-three patients were enrolled in this study. The median number of treatment cycles was four. The completion rate of chemotherapy was 79.1%. Major grade 3/4 hematological adverse events included leukocytopenia (27.9%) and neutropenia (53.5%), whereas non-hematological toxicities were generally mild. Ten patients (23.3%) required chemotherapy treatment schedule delay, and one patient required one dose level reduction because of drug fever. Median disease-free survival was 78.6 months [95% confidence interval (CI) 39.5-not reached (NA)] and median overall survival was not reached (95% CI 83.7-NA).\n\n\n\nBiweekly administration of gemcitabine and carboplatin is effective and well tolerated for patients with completely resected NSCLC as an adjuvant chemotherapy.", "affiliations": "Department of Respiratory Medicine, Shibukawa Medical Center, Shibukawa, Gunma, Japan. m15702012@gunma-u.ac.jp.;Department of Respiratory Medicine, Shibukawa Medical Center, Shibukawa, Gunma, Japan.;Department of Respiratory Medicine, Shibukawa Medical Center, Shibukawa, Gunma, Japan.;Department of Respiratory Medicine, Shibukawa Medical Center, Shibukawa, Gunma, Japan.;Department of Respiratory Medicine, Shibukawa Medical Center, Shibukawa, Gunma, Japan.;Department of Oncology Clinical Development, Gunma University Graduate School of Medicine, Maebashi, Gunma, Japan.;Oncology Center, Gunma University Hospital, Maebashi, Gunma, Japan.;Department of Thoracic Surgery, Shibukawa Medical Center, Shibukawa, Gunma, Japan.;Division of Allergy and Respiratory Medicine, Integrative Center of Internal Medicine, Gunma University Hospital, 3-39-15, Showa-machi, Maebashi, Gunma, 371-8511, Japan.;Department of Medicine and Molecular Science, Gunma University Graduate School of Medicine, Maebashi, Gunma, Japan.;Department of Respiratory Medicine, Shibukawa Medical Center, Shibukawa, Gunma, Japan.", "authors": "Sakurai|Reiko|R|;Tomizawa|Yoshio|Y|;Yoshii|Akihiro|A|;Miura|Yosuke|Y|;Tsurumaki|Hiroaki|H|;Kaira|Kyoichi|K|;Sunaga|Noriaki|N|;Kawashima|Osamu|O|;Hisada|Takeshi|T|;Yamada|Masanobu|M|;Saito|Ryusei|R|", "chemical_list": "D003841:Deoxycytidine; C056507:gemcitabine; D016190:Carboplatin", "country": "Germany", "delete": false, "doi": "10.1007/s00280-017-3439-x", "fulltext": null, "fulltext_license": null, "issn_linking": "0344-5704", "issue": "81(1)", "journal": "Cancer chemotherapy and pharmacology", "keywords": "Adjuvant chemotherapy; Carboplatin; Gemcitabine; Non-small cell lung cancer", "medline_ta": "Cancer Chemother Pharmacol", "mesh_terms": "D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D016190:Carboplatin; D002289:Carcinoma, Non-Small-Cell Lung; D003841:Deoxycytidine; D004334:Drug Administration Schedule; D005260:Female; D006801:Humans; D008175:Lung Neoplasms; D008297:Male; D020714:Maximum Tolerated Dose; D008875:Middle Aged; D009367:Neoplasm Staging; D011446:Prospective Studies", "nlm_unique_id": "7806519", "other_id": null, "pages": "103-109", "pmc": null, "pmid": "29124327", "pubdate": "2018-01", "publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article", "references": null, "title": "A phase II study of biweekly gemcitabine and carboplatin in completely resected stage IB-IIIA non-small cell lung cancer.", "title_normalized": "a phase ii study of biweekly gemcitabine and carboplatin in completely resected stage ib iiia non small cell lung cancer" }
[ { "companynumb": "JP-CIPLA LTD.-2017JP23127", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "DEXAMETHASONE" }, "drugadditional": null, ...
{ "abstract": "Current management of heparin-induced thrombocytopenia (HIT) involves prompt discontinuation of all heparin products and concomitant initiation of a direct thrombin or anti-Xa inhibitor for anticoagulation. In the setting of HIT complicated by an urgent need for cardiopulmonary bypass (CPB), the safety and the efficacy of short-term heparin-based anticoagulation after therapeutic plasma exchange (TPE) have been previously demonstrated. Patients with HIT requiring TPE are frequently on extracorporeal circuits (either CPB, extracorporeal membrane oxygenation [ECMO] or external ventricular assist devices [VADs]). Performing TPE in parallel with these circuits involves additional consideration for circuit size, anticoagulant/citrate management, as well as flow rates, and risk of air embolus. We report a case of a patient with HIT on external biventricular assist device (BiVAD) requiring urgent CPB who experienced thrombotic and hemolytic complications related to anticoagulation management around apheresis line placement for TPE. We also present results from a national survey of academic apheresis services regarding specific practices in managing patients with HIT on extracorporeal circuits who require TPE. In addition, we demonstrate the utility of TPE in patients with HIT on extracorporeal circuits and the risks of this procedure and the need to develop practice guidelines.", "affiliations": "Department of Pathology, The University of Chicago, Chicago, Illinois.;Department of Pathology, The University of Chicago, Chicago, Illinois.;BloodCenter of Wisconsin, Department of Pathology, Medical College of Wisconsin, Milwaukee, Wisconsin.;Department of Pathology, The University of Chicago, Chicago, Illinois.", "authors": "Cho|Joseph H|JH|https://orcid.org/0000-0002-6250-1797;Parilla|Megan|M|;Treml|Angela|A|;Wool|Geoffrey D|GD|https://orcid.org/0000-0002-3335-2905", "chemical_list": "D006493:Heparin", "country": "United States", "delete": false, "doi": "10.1002/jca.21671", "fulltext": null, "fulltext_license": null, "issn_linking": "0733-2459", "issue": "34(1)", "journal": "Journal of clinical apheresis", "keywords": "cardiopulmonary bypass; case report; extracorporeal circuits; heparin-induced thrombocytopenia; survey; therapeutic plasma exchange; ventricular assist device", "medline_ta": "J Clin Apher", "mesh_terms": "D002315:Cardiopulmonary Bypass; D005112:Extracorporeal Circulation; D006353:Heart-Assist Devices; D006461:Hemolysis; D006493:Heparin; D006801:Humans; D010951:Plasma Exchange; D011795:Surveys and Questionnaires; D013921:Thrombocytopenia; D013927:Thrombosis", "nlm_unique_id": "8216305", "other_id": null, "pages": "64-72", "pmc": null, "pmid": "30407650", "pubdate": "2019-02", "publication_types": "D002363:Case Reports", "references": null, "title": "Plasma exchange for heparin-induced thrombocytopenia in patients on extracorporeal circuits: A challenging case and a survey of the field.", "title_normalized": "plasma exchange for heparin induced thrombocytopenia in patients on extracorporeal circuits a challenging case and a survey of the field" }
[ { "companynumb": "US-FRESENIUS KABI-FK201901147", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "HEPARIN SODIUM" }, "drugadditional": "1",...
{ "abstract": "Sudden sensorineural hearing loss (SSNHL) after spinal-epidural anaesthesia is a very rare complication. The patient is a 25-year-old female who developed right-sided hearing loss, unbalance, a sensation of aural fullness and tinnitus 2 days post uncomplicated spinal-epidural anaesthesia for an emergency caesarean section. Initial management by her primary care physician for suspected eustachian tube dysfunction did not relieve symptoms, and 2 weeks subsequently, audiological assessment demonstrated right Sensorineural hearing loss (SNHL). Specialist consultation was sought, and the patient was commenced on systemic corticosteroids. Microscope otoscopy and posterior fossa magnetic resonance imaging were normal. High-resolution computed tomography scan demonstrated an enlarged right cochlear aqueduct. Repeat audiology after 2 weeks revealed unchanged hearing levels and improved speech discrimination scores in the right ear (from 53 to 90%). Repeat audiogram at 4 months and at 10 months showed no further improvement. Possible physiopathology of this complication, diagnostic dilemma and review of treatment options are discussed.", "affiliations": "Department of Otorhinolaryngology, Monash Health, Melbourne, VIC, Australia.;Department of Otorhinolaryngology, Monash Health, Melbourne, VIC, Australia.", "authors": "Alwan|Mostafa|M|;Hurtado|Guillermo|G|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1093/jscr/rjz316", "fulltext": "\n==== Front\nJ Surg Case RepJ Surg Case RepjscrJournal of Surgical Case Reports2042-8812Oxford University Press 10.1093/jscr/rjz316rjz316Case ReportUnilateral permanent sudden sensorineural hearing loss after spina-epidural anaesthesia for caesarean section: a case report Alwan Mostafa 1Hurtado Guillermo 121 \nDepartment of Otorhinolaryngology, Monash Health, Melbourne, VIC, Australia2 \nAdjunct Lecturer, Monash UniversityCorrespondence address. Department of Otorhinolaryngology, Monash Health, 823-865 Centre Rd, Bentleigh East, Melbourne, VIC 3165, Australia. Tel: +61-487749509; Fax: +61-99288052; E-mail: mostafa.alwan@gmail.com12 2019 09 12 2019 09 12 2019 2019 12 rjz31627 8 2019 24 9 2019 Published by Oxford University Press and JSCR Publishing Ltd. All rights reserved. © The Author(s) 2019.2019This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.comABSTRACT\nSudden sensorineural hearing loss (SSNHL) after spinal-epidural anaesthesia is a very rare complication. The patient is a 25-year-old female who developed right-sided hearing loss, unbalance, a sensation of aural fullness and tinnitus 2 days post uncomplicated spinal-epidural anaesthesia for an emergency caesarean section. Initial management by her primary care physician for suspected eustachian tube dysfunction did not relieve symptoms, and 2 weeks subsequently, audiological assessment demonstrated right Sensorineural hearing loss (SNHL). Specialist consultation was sought, and the patient was commenced on systemic corticosteroids. Microscope otoscopy and posterior fossa magnetic resonance imaging were normal. High-resolution computed tomography scan demonstrated an enlarged right cochlear aqueduct. Repeat audiology after 2 weeks revealed unchanged hearing levels and improved speech discrimination scores in the right ear (from 53 to 90%). Repeat audiogram at 4 months and at 10 months showed no further improvement. Possible physiopathology of this complication, diagnostic dilemma and review of treatment options are discussed.\n==== Body\nINTRODUCTION\nFew cases of hearing loss following non-otological surgery have been reported, and the majority of these involve general anaesthesia and are associated with cardiopulmonary, laparoscopic, orthopaedic and urologic surgeries [1, 2]. Cases of hearing loss in association with spinal-epidural anaesthesia and lumbar puncture have been reported but are even more uncommon. The majority of patients’ hearing deficits are transient, often resolving without treatment within days; however, cases of permanent hearing loss have also been reported [3]. We present a case in which a patient developed sensorineural hearing loss (SNHL) post spinal-epidural anaesthesia for an emergency caesarean section.\n\nCASE REPORT\nA 26-year-old woman, primigravida and primipara, was admitted to the institution with spontaneous labour at full term. Emergency caesarean section was deemed necessary due to a prolonged latent phase of labour and foetal distress concerns as seen on cardiotocography. The patient was placed in an appropriate position for skin preparation with chlorhexidine, and then local infiltration was performed using 3 ml of 2% lidocaine. An 18-guage needle was used for the epidural catheter placement, and loss of resistance technique was used to identify the epidural space. The needle was inserted 5.5 cm cephalad into the epidural space at L3–4 by the midline approach. Then 12 ml of 0.2% ropivacaine and 16 micrograms of fentanyl was injected, followed by a ropivacaine and fentanyl infusion. Surgery was completed within 45 minutes, and no intraoperative complications transpired. Haemodynamic parameters remained normal throughout the perioperative period. The epidural catheter was removed within 12 hours postoperatively, with no complications. Day 1 postoperatively, the patient reported a sensation of light-headedness and dizziness but no headache. Day 2 postoperatively, she was discharged at home. No ototoxic medications were administered during admission or dispensed on discharge. On the same day, the patient noticed a constant right ear hearing loss, ongoing unbalance, a sensation of aural fullness and high-pitched non-pulsatile tinnitus. She attended her local primary care physician the same day and was treated with intranasal corticosteroids for possible eustachian tube dysfunction. Persistence of symptoms for 2 weeks prompted an audiological assessment which diagnosed a SNHL (Fig. 1). Urgent ENT specialist advice was sought over the phone, and the patient was commenced on systemic corticosteroids for 7 days (1 mg/kg of prednisone). The patient has no previous ear symptoms, no prior ear surgery, trauma or recent upper respiratory tract infection. A posterior fossa magnetic resonance imaging scan was performed but found no pathology. High-resolution temporal bone computed tomography (CT) scan demonstrated an enlarged right cochlear aqueduct (Fig. 2). Repeat audiological assessment in 2 weeks showed no pure tone audiometry change, but significant improvement in speech discrimination was present (53–90%). The patient was then seen in a specialist ENT clinic. Physical examination including microscopic otoscopy was unremarkable. Unilateral hearing loss management options were discussed with the patient, with conventional hearing amplification recommended. Repeat audiogram at 4 and 10 months’ time showed no further improvement but stabilised hearing. The patient has declined the use of amplification, and a recommendation to avoid further spinal-epidural anaesthesia was given.\n\nFigure 1 Patient’s audiological assessment 2 weeks after symptom onset.\n\nFigure 2 Patient’s CT scan showing an enlarged right cochlear aqueduct.\n\nDISCUSSION\nHearing loss following non-cardiac surgery involving combined spinal-epidural anaesthesia has been reported before; however the incidence is estimated to be very low [4]. The majority of these cases involve temporary hearing loss, which typically returns to normal in 5–15 days. Hearing loss occurring primarily in lower frequency ranges (125–1000 Hz) [5]. Permanent hearing loss post spinal anaesthesia has been documented but is often combined with vertigo and tinnitus and is extremely rare [3]. The mechanism is theorised to result from disruption of the endolymph/perilymph balance caused by the decrease in cerebrospinal fluid (CSF) pressure due to CSF leakage from the epidural site. Decrease in perilymphatic pressure is transmitted via the cochlear aqueduct, fundus of the internal auditory canal, or the modiolus of the cochlea. This displaces hair cells in the basement membrane, resulting in low frequency hearing loss [6]. Our case describes a patient who underwent a combined spinal-epidural anaesthesia for an emergency caesarean section and subsequently suffered hearing loss which did not self-resolve in the usual time expected, was not associated with headache, and did not significantly improve post systemic corticosteroid administration. To the authors’ knowledge, there is only one similar report of SNHL following spinal-epidural anaesthesia without headache [7].\n\nThere have been previous controlled trials which after monitoring patients’ hearing by audiogram before and after spinal anaesthetic have concluded that patients under 40 [8] and obstetric patients are not at risk of hearing loss following spinal anaesthesia [9]. These studies also concluded that larger calibre needles would not induce enough CSG leakage to induce hearing effects. Our case illustrates that hearing loss can occur in young obstetric patients without headache following spinal-epidural anaesthesia.\n\nTreatment of SNHL following spinal anaesthesia is controversial; however most patients recover spontaneously [10]. Treatment options for this complication are the same as with any other sudden SSNHL case and include observation, systemic corticosteroids (ideally delivered at onset of symptoms), hydration, cochlear vasodilators, betahistine, hyperbaric oxygen therapy, epidural blood patches, plasma expanders and carbogen inhalation. The results of all these treatment alternatives have been variable, and just like with sudden SSNHL, no standard treatment protocol is available at present [3, 5]. Nevertheless, it is the senior author’s preference to use initial systemic corticosteroids (prednisone 1 mg/kg daily, 7-day course), ideally within 72 hours of symptom onset, provided there are no contraindications for use of this medication. Trans-tympanic corticosteroid therapy may be considered as a salvage option in cases of failure with systemic corticosteroid therapy. In our case, systemic corticosteroid treatment was delayed by 2 weeks after the onset of symptoms, and this is likely to be a contributing factor in the limited hearing improvement experienced.\n\nCONCLUSIONS\nSNHL post spinal-epidural anaesthesia is a rare complication that is poorly understood. A high degree of suspicion is required for early diagnosis and treatment which may help prevent permanent hearing loss. It is not possible at this time to anticipate which patients are at higher risk of developing this complication post spinal-epidural anaesthesia; prompt attention and audiological assessment should be given to any patient who complains of hearing loss or tinnitus post epidural-spinal anaesthesia.\n\nConflict of interest statement\nThe authors report no conflict of interest concerning the materials or methods used in this study or the findings specified in this paper.\n\nFunding\nNone.\n==== Refs\nREFERENCES\n1. \nAhmed MCM , Islam MS , Ahmmed S \nBilateral hearing loss after spinal anaesthesia . JAFMC Bangladesh 2009 ;5 :3 .\n2. \nVilhena D , Pereira L , Duarte D , Oliveira N \nSudden sensorineural hearing loss after orthopedic surgery under combined spinal and epidural anesthesia . Case Rep Otolaryngol 2016 ;2016 :4295601 .26904339 \n3. \nKilickan L , Gurkan Y , Ozkarakas H \nPermanent sensorineural hearing loss following spinal anesthesia . Acta Anaesthesiol Scand 2002 ;46 :1155 –7 .12366513 \n4. \nSprung J , Bourke DL , Contreras MG , Warner ME , Findlay J \nPerioperative hearing impairment . Anesthesiology 2003 ;98 :241 –57 .12503003 \n5. \nYildiz TS , Solak M , Iseri M , Karaca B , Toker K \nHearing loss after spinal anesthesia: the effect of different infusion solutions . Otolaryngol Head Neck Surg 2007 ;137 :79 –82 .17599570 \n6. \nMichel O , Brusis T \nHearing loss as a sequel of lumbar puncture . Ann Otol Rhinol Laryngol 1992 ;101 :390 –4 .1570933 \n7. \nAG Benson RR \nUnilateral sudden sensorineural hearing loss after spinal anesthesia for elective Cesarean section: a case report . J Anesth Clin Res. 2012 ;3 .\n8. \nOk G , Tok D , Erbuyun K , Aslan A , Tekin I \nHearing loss does not occur in young patients undergoing spinal anesthesia . Reg Anesth Pain Med 2004 ;29 :430 –3 .15372387 \n9. \nFinegold H , Mandell G , Vallejo M , Ramanathan S \nDoes spinal anesthesia cause hearing loss in the obstetric population? Anesth Analg 2002 ;95 :198 –203 Table of contents .12088968 \n10. \nGultekin S , Ozcan S \nDoes hearing loss after spinal anesthesia differ between young and elderly patients? Anesth Analg 2002 ;94 :1318 –20 Table of contents .11973212\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2042-8812", "issue": "2019(12)", "journal": "Journal of surgical case reports", "keywords": null, "medline_ta": "J Surg Case Rep", "mesh_terms": null, "nlm_unique_id": "101560169", "other_id": null, "pages": "rjz316", "pmc": null, "pmid": "31832135", "pubdate": "2019-12", "publication_types": "D002363:Case Reports", "references": "12366513;26904339;15372387;12088968;12503003;11973212;17599570;1570933", "title": "Unilateral permanent sudden sensorineural hearing loss after spina-epidural anaesthesia for caesarean section: a case report.", "title_normalized": "unilateral permanent sudden sensorineural hearing loss after spina epidural anaesthesia for caesarean section a case report" }
[ { "companynumb": "AU-PFIZER INC-2020043056", "fulfillexpeditecriteria": "1", "occurcountry": "AU", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "CHLORHEXIDINE GLUCONATE" }, "drugadditional": ...
{ "abstract": "Intestinal obstruction is a rare complication of the administration of activated charcoal. We describe a 22-year-old patient who had received multiple-dose activated charcoal for carbamazepine intoxication. The patient presented with sudden-onset abdominal pain after discharge from the emergency room, and abdominal imaging examinations revealed findings consistent with small bowel obstruction. Laparoscopic-assisted exploration of the abdomen was offered, and a hard obstructing charcoal mass was found in the small bowel. Clinicians should be aware of the rare occurrence of gastrointestinal complication or obstruction following the administration of multiple-dose activated charcoal, especially in patients who ingested a drug that is potentially antiperistaltic.", "affiliations": "General Surgery Department, Security Forces Hospital Program, Riyadh 11481, Saudi Arabia.;General Surgery Department, Security Forces Hospital Program, Riyadh 11481, Saudi Arabia.;General Surgery Department, Security Forces Hospital Program, Riyadh 11481, Saudi Arabia.;General Surgery Department, Security Forces Hospital Program, Riyadh 11481, Saudi Arabia.", "authors": "Aljohani|Turki Khaled|TK|;Alshamrani|Abdullah Mohammed|AM|;Alzahrani|Ali Mohammed|AM|;Sairafi|Rami Abdulrahman|RA|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1093/jscr/rjz033", "fulltext": "\n==== Front\nJ Surg Case RepJ Surg Case RepjscrJournal of Surgical Case Reports2042-8812Oxford University Press 10.1093/jscr/rjz033rjz033Case ReportA rare case of small bowel obstruction secondary to activated charcoal administration Aljohani Turki Khaled Alshamrani Abdullah Mohammed Alzahrani Ali Mohammed Sairafi Rami Abdulrahman General Surgery Department, Security Forces Hospital Program, Riyadh 11481, Saudi ArabiaCorrespondence address. General Surgery Department, Security Forces Hospital Program, Riyadh 11481, Saudi Arabia. Tel: +966-55-508-5459; E-mail: jaguar656@gmail.com2 2019 08 2 2019 08 2 2019 2019 2 rjz03326 11 2018 22 1 2019 Published by Oxford University Press and JSCR Publishing Ltd. All rights reserved. © The Author(s) 2019.2019This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.comAbstract\nIntestinal obstruction is a rare complication of the administration of activated charcoal. We describe a 22-year-old patient who had received multiple-dose activated charcoal for carbamazepine intoxication. The patient presented with sudden-onset abdominal pain after discharge from the emergency room, and abdominal imaging examinations revealed findings consistent with small bowel obstruction. Laparoscopic-assisted exploration of the abdomen was offered, and a hard obstructing charcoal mass was found in the small bowel. Clinicians should be aware of the rare occurrence of gastrointestinal complication or obstruction following the administration of multiple-dose activated charcoal, especially in patients who ingested a drug that is potentially antiperistaltic.\n==== Body\nINTRODUCTION\nActivated charcoal has been used since the 1970s [1], and it is the most commonly employed method of gastrointestinal evacuation [2]. It is usually administered as a single dose, and it is thought that its large surface area allows for the adsorption of many drugs and toxins in the gastrointestinal tract, decreasing their absorption into the general circulation. While activated charcoal is generally safe, the compound is not risk-free. Adverse events, such as vomiting and aspiration into the respiratory system have been associated with its administration, precluding the routine use of the compound in clinical practice [3]. Additionally, multi-dose activated charcoal administration is reported to be more likely to cause intestinal obstruction and perforation necessitating a surgical intervention.\n\nA handful of reports describe small bowel obstruction occurring following the administration of activated charcoal [2, 4]. We present the case of a patient who developed small bowel obstruction following the administration of activated charcoal for carbamazepine intoxication.\n\nCASE PRESENTATION\nA 22-year-old male, university student presented with a history of sudden-onset abdominal pain of 1-day duration. The pain was colicky, constant and diffuse. It did not radiate and had no aggravating or relieving factor, but it was associated with vomiting. The patient also reported having no bowel movement for one day. He presented to emergency department 2 days ago complain of ataxia and slurred speech, due to a carbamazepine overdose, for which he admitted under neurology and received activated charcoal 150 g, through a nasogastric tube, over 24 h. He had charcoal-stained vomiting during admission; however, his clinical condition improved, and kept for observation then he was subsequently discharged.\n\nThe patient had no history of fever, weight loss, fatigue, night sweats or previous episodes of abdominal pain. His medical history was remarkable for dilated cardiomyopathy, for which he was receiving medications. He also had a history of sleeve gastrectomy, which had been performed four years earlier. His family history was unremarkable.\n\nOn examination, the patient was conscious, alert, and oriented, but he complained of mild pain. His vital signs were as follows: heart rate, 83 beats per minute; respiratory rate, 22 cycles per minute; blood pressure, 125/83 mmHg; temperature, 37.2°C; and oxygen saturation, 98%. A chest and lung examination was unremarkable. Similarly, a heart examination showed normal first and second heart sounds with no added sounds. His abdomen was soft and distended, with mild generalized tenderness; however, no sign of rigidity or guarding was observed. A digital rectal examination revealed an empty rectum with no blood or stool.\n\nBlood was drawn for a complete blood count, urea and electrolytes, liver function test, coagulation profile, serum glucose level, carcinoembryonic antigen and cancer antigen, and the results were all within normal limits. An initial abdominal X-ray showed multiple air fluid levels and a dilated bowel (Fig. 1A and B). A computed tomography scan of the abdomen and pelvis showed small bowel obstruction to the level of the proximal ileal loops, with a transition point between the dilated proximal loops and the collapsed terminal ileal loops (Fig. 2A and B).\n\nFigure 1: Initial abdominal x-ray showing multiple air–fluid levels (A) and a dilated bowel (B).\n\nFigure 2: A computed tomography of the abdomen and pelvis showing small bowel obstruction at the level of the proximal ileal loops, with a transition point between dilated proximal loops and the collapsed terminal ileal loops.\n\nThe patient was initially managed conservatively, but the abdominal pain and distention did not improve. Consequently, laparoscopic-assisted abdominal exploration was performed, and the charcoal plug was removed. Intra-operatively, ~40 cm from the ileocecal junction, was a transitional zone with intramural material causing small bowel obstruction (Fig. 3). A 1.5 cm enterotomy was made, and it revealed a hard charcoal plug obstructing the small bowel (Fig. 4).\n\nFigure 3: Image showing intraoperative finding of obstructing mass with transitional zone (black arrow).\n\nFigure 4: Image showing charcoal bezoars after removal from the small bowel.\n\nThe charcoal plug was removed, and the enterotomy site was closed transversely in two layers. The first layer was closed using full-thickness vicryl suture, and the second was closed using Lembert seromuscular sutures. Manual bowel decompression was performed up to the level of the duodenojejunal junction, and suctioning yielded ~1700 ml of charcoal-stained fluid (Fig. 5).\n\nFigure 5: Suction container containing charcoal-stained fluid.\n\nThe patient’s postoperative course was uneventful. He tolerated oral intake on postoperative Day 1 and was discharged on Day 2 with close follow-up care.\n\nDISCUSSION\nCases of bowel obstruction, although rare, have been reported in patients receiving activated charcoal. Patients at greater risk of developing an intestinal occlusion after the administration of activated charcoal appear to have a pre-existing gastrointestinal motility disorder. Other factors, including opioid or antimuscarinic drugs may increase a patient’s risk of gastrointestinal obstruction following the use of activated charcoal. The patient in our case suffered from carbamazepine overdose, which may have predisposed him to develop an intestinal obstruction after the administration of activated charcoal. In situations of overdose, carbamazepine can decrease gastrointestinal motility as a counter-regulatory measure to delay its own absorption [5]. This can trigger or cause paralytic ileus, and subsequently cause the charcoal to accumulate in the gastrointestinal tract and form bezoars.\n\nThe administration of activated charcoal can lead to constipation, and although some clinicians recommend concomitant fluid administration and gastric lavage to prevent this adverse effect, there is no consensus on this [6]. Our patient did not have concomitant fluid administration or gastric lavage. The total dose of activated charcoal that a patient receives may also play a role in intestinal obstruction, although the 150 g that our patient received was well within the recommended dosage [7]. Nevertheless, we believe the effects of carbamazepine overdose on the transit rate of the charcoal may have largely contributed to the small bowel obstruction.\n\nGiven that patients who receive activated charcoal have an increased risk of intestinal occlusion and are also prone to vomiting and subsequent aspiration, some investigators have recommended avoiding multiple-dose activated charcoal in the treatment of oral drug intoxication until there is clinical evidence of normal bowel movements in these patients [8]. Although there are concerns about the use of activated charcoal in the routine management of oral overdoses, some investigators argue that the use of activated charcoal should be encouraged in oral intoxications despite its adverse effects [9].\n\nThe clinician should suspect gastrointestinal obstruction in patients who received activated charcoal, especially when they present with charcoal-stained vomiting and abdominal pain, as was the case in our patient. Early recognition and management may help prevent necrosis of intestinal tissues and ensuing complications, such as intestinal perforation or peritonitis. In our case, conservative management was initially offered; however, this failed, prompting us to perform laparoscopic-assisted abdominal exploration to remove the charcoal plug. In isolated cases reports [10, 11], surgical removal was effective in alleviating bowel obstruction due to activated charcoal.\n\nIn conclusion, intestinal obstruction is a complication of activated charcoal administration, especially in patients who ingested medications that have antiperistaltic activity. Early identification and prompt management can help prevent fatal complications. Clinicians working in emergency departments should be informed of this rare but potential cause of intestinal obstruction to ensure better management and, consequently, improve outcomes.\n\nConflict of Interest statement\nNone declared.\n==== Refs\nREFERENCES\n1 \nNeuvonen PJ \nClinical pharmacokinetics of oral activated charcoal in acute intoxications . Clin Pharmacokinet 1982 ;7 :465 –89 .6761032 \n2 \nQureshia Z , Eddlestonb M. \nAdverse Effects of Activated Charcoal Used for the Treatment of Poisoning [Internet]. 2011 [cited 2018 Sep 6]. /paper/Adverse-effects-of-activated-charcoal-used-for-the-Qureshia-Eddlestonb/a7599408b42c16e6bbb53fbd2146c1d33ed214df\n3 \nJuurlink DN \nActivated charcoal for acute overdose: a reappraisal . Br J Clin Pharmacol 2016 ;81 :482 –7 .26409027 \n4 \nLohn JWG , Austin RCT , Winslet MC \nUnusual causes of small-bowel obstruction . J R Soc Med 2000 ;93 :365 –8 .10928024 \n5 \nMaan JS , Saadabadi A \nCarbamazepine [Internet]. StatPearls Publishing; 2018 [cited 2018 Nov 8]. https://www.ncbi.nlm.nih.gov/books/NBK482455/\n6 \nBope ET , Kellerman RD. \nConn’s Current Therapy 2014: Expert Consult: Online and Print Elsevier Health Sciences; 2013 .\n7 \nComer T. Patient Information Leaflet Carbomix: 2.\n8 \nvan Hoving DJ , Veale DJH , Müller GF \nClinical review: emergency management of acute poisoning . Afr J Emerg Med 2011 ;1 :69 –78 .\n9 \nCooper GM , Le Couteur DG , Richardson D , Buckley NA \nA randomized clinical trial of activated charcoal for the routine management of oral drug overdose . QJM 2005 ;98 :655 –60 .16040667 \n10 \nGomez HF , Brent JA , Munoz DC , Mimmack RF , Ritvo J , Phillips S , et al \nCharcoal stercolith with intestinal perforation in a patient treated for amitriptyline ingestion . J Emerg Med 1994 ;12 :57 –60 .8163807 \n11 \nGoulbourne KB , Cisek JE \nSmall-bowel obstruction secondary to activated charcoal and adhesions . Ann Emerg Med 1994 ;24 :108 –10 .8010540\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2042-8812", "issue": "2019(2)", "journal": "Journal of surgical case reports", "keywords": null, "medline_ta": "J Surg Case Rep", "mesh_terms": null, "nlm_unique_id": "101560169", "other_id": null, "pages": "rjz033", "pmc": null, "pmid": "30788105", "pubdate": "2019-02", "publication_types": "D002363:Case Reports", "references": "10928024;16040667;26409027;6761032;8010540;8163807", "title": "A rare case of small bowel obstruction secondary to activated charcoal administration.", "title_normalized": "a rare case of small bowel obstruction secondary to activated charcoal administration" }
[ { "companynumb": "SA-VALIDUS PHARMACEUTICALS LLC-SA-2020VAL000668", "fulfillexpeditecriteria": "1", "occurcountry": "SA", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "ACTIVATED CHARCOAL" }, ...
{ "abstract": "BACKGROUND\nWeekly paclitaxel has been shown more effective and less toxic than the conventional three-weekly administration. The GEICAM 9906 demonstrated effectiveness and safety of a dose-dense schedule of 100 mg/m(2) of paclitaxel given over 8 weeks (w). This schedule has been adopted at our institution in 2009 for HER2-negative disease, and herein, we present the first off-trial experience and compare its safety profile with that of a historical cohort of patients treated with the conventional 80 mg/m(2) over 12 w schedule.\n\n\nMETHODS\nRetrospective single-center chart review of patients with locally advanced breast cancer treated with (neo)adjuvant paclitaxel-based therapy from 2008 to 2012 with (1) 80 mg/m(2) for 12 w or (2) 100 mg/m(2) for 8 w. Adverse events were graded according to common terminology criteria for adverse events (CTCAE) 4.0.\n\n\nRESULTS\nA total of 326 patients were analyzed. Median age was 52 (±10.9). Seventy and 256 patients received schedule (1) and (2), respectively. No significant difference was observed in the incidence of grade (G) 3/4 toxicity: pneumonitis (2.8 vs 0.3 % p = 0.097); neuropathy (2.8 vs 0.7 % p = 0.303); hand-foot syndrome (1.4 vs 0.3 % p = 0.538); anemia (0 vs 0.6 % p = 0.624); and neutropenia (5.7 vs 6.2 % p = 0.408). Also, no significant difference was seen when comparing all grades toxicity. Schedule (2) had higher dose intensity: 97.72 vs 77.07 mg/m(2) per week (p < 0.0001).\n\n\nCONCLUSIONS\nWeekly paclitaxel given according to GEICAM 9906 is pragmatic and well tolerated, with safety profile consistent with the conventional schedule. In addition to being convenient to patients, it may also be cost-effective because of a lower number of clinic visits and infusions.", "affiliations": "Division of Medical Oncology, Instituto do Câncer do Estado de São Paulo (ICESP), Faculdade de Medicina, Universidade de São Paulo, Av. Dr. Arnaldo 251, 5º andar, CEP: 01246-000, São Paulo, SP, Brazil. iurisantana@gmail.com.;Division of Medical Oncology, Instituto do Câncer do Estado de São Paulo (ICESP), Faculdade de Medicina, Universidade de São Paulo, Av. Dr. Arnaldo 251, 5º andar, CEP: 01246-000, São Paulo, SP, Brazil.;Division of Medical Oncology, Instituto do Câncer do Estado de São Paulo (ICESP), Faculdade de Medicina, Universidade de São Paulo, Av. Dr. Arnaldo 251, 5º andar, CEP: 01246-000, São Paulo, SP, Brazil.;Division of Medical Oncology, Instituto do Câncer do Estado de São Paulo (ICESP), Faculdade de Medicina, Universidade de São Paulo, Av. Dr. Arnaldo 251, 5º andar, CEP: 01246-000, São Paulo, SP, Brazil.;Division of Medical Oncology, Instituto do Câncer do Estado de São Paulo (ICESP), Faculdade de Medicina, Universidade de São Paulo, Av. Dr. Arnaldo 251, 5º andar, CEP: 01246-000, São Paulo, SP, Brazil.;Division of Medical Oncology, Instituto do Câncer do Estado de São Paulo (ICESP), Faculdade de Medicina, Universidade de São Paulo, Av. Dr. Arnaldo 251, 5º andar, CEP: 01246-000, São Paulo, SP, Brazil.;Division of Medical Oncology, Instituto do Câncer do Estado de São Paulo (ICESP), Faculdade de Medicina, Universidade de São Paulo, Av. Dr. Arnaldo 251, 5º andar, CEP: 01246-000, São Paulo, SP, Brazil.", "authors": "Santana|Iuri A|IA|;Oliveira|Julia Andrade|JA|;da Silva Lima|Julianne Maria|JM|;Testa|Laura|L|;Piato|José Roberto M|JR|;Hoff|Paulo M|PM|;Mano|Max S|MS|", "chemical_list": "D000972:Antineoplastic Agents, Phytogenic; D014408:Biomarkers, Tumor; D011960:Receptors, Estrogen; D011980:Receptors, Progesterone; C508053:ERBB2 protein, human; D018719:Receptor, ErbB-2; D017239:Paclitaxel", "country": "Japan", "delete": false, "doi": "10.1007/s12282-014-0564-9", "fulltext": null, "fulltext_license": null, "issn_linking": "1340-6868", "issue": "23(2)", "journal": "Breast cancer (Tokyo, Japan)", "keywords": "Adverse events; Breast cancer; Neoadjuvant; Paclitaxel; Toxicities", "medline_ta": "Breast Cancer", "mesh_terms": "D000328:Adult; D000368:Aged; D000972:Antineoplastic Agents, Phytogenic; D014408:Biomarkers, Tumor; D001938:Brazil; D001943:Breast Neoplasms; D004334:Drug Administration Schedule; D005240:Feasibility Studies; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D007124:Immunoenzyme Techniques; D008875:Middle Aged; D009367:Neoplasm Staging; D017239:Paclitaxel; D011379:Prognosis; D018719:Receptor, ErbB-2; D011960:Receptors, Estrogen; D011980:Receptors, Progesterone; D012189:Retrospective Studies; D015996:Survival Rate", "nlm_unique_id": "100888201", "other_id": null, "pages": "261-5", "pmc": null, "pmid": "25234137", "pubdate": "2016-03", "publication_types": "D016428:Journal Article", "references": null, "title": "Feasibility of two schedules of weekly paclitaxel in HER2-negative early breast cancer in a Brazilian community setting.", "title_normalized": "feasibility of two schedules of weekly paclitaxel in her2 negative early breast cancer in a brazilian community setting" }
[ { "companynumb": "BR-JNJFOC-20160328047", "fulfillexpeditecriteria": "1", "occurcountry": "BR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CYCLOPHOSPHAMIDE" }, "drugadditional": null, ...
{ "abstract": "We herein present a rare case of acquired methemoglobinemia associated with alkaptonuria. Alkaptonuria is a congenital error of metabolism caused by the deficiency of homogentisic acid oxidase, which subsequently results in the accumulation of homogentisic acid (HGA) in body tissues. As renal dysfunction progresses, the level of HGA excretion in the urine decreases and the blood concentration of HGA increases. HGA oxidizes oxyhemoglobin to methemoglobin, which can induce multiple organ failure accompanied by tissue hypoxia, intravascular hemolysis and metabolic acidosis. The mortality of this disease is high when alkaptonuria is associated with the presence of methemoglobinemia; therefore, treatment should be carefully planned in such cases.", "affiliations": "Critical Care Medicine, University Hospital of Occupational and Environmental Health, Japan.", "authors": "Isa|Yasuki|Y|;Nihei|Shun-ichi|S|;Irifukuhama|Yuna|Y|;Ikeda|Tomoya|T|;Matsumoto|Hiroyuki|H|;Nagata|Keiji|K|;Harayama|Nobuya|N|;Aibara|Keiji|K|;Kamochi|Masayuki|M|", "chemical_list": "D006713:Homogentisic Acid", "country": "Japan", "delete": false, "doi": "10.2169/internalmedicine.53.1938", "fulltext": null, "fulltext_license": null, "issn_linking": "0918-2918", "issue": "53(16)", "journal": "Internal medicine (Tokyo, Japan)", "keywords": null, "medline_ta": "Intern Med", "mesh_terms": "D000368:Aged; D000474:Alkaptonuria; D017809:Fatal Outcome; D005260:Female; D006713:Homogentisic Acid; D006801:Humans; D007676:Kidney Failure, Chronic; D008708:Methemoglobinemia; D035583:Rare Diseases", "nlm_unique_id": "9204241", "other_id": null, "pages": "1797-800", "pmc": null, "pmid": "25130113", "pubdate": "2014", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "A rare case of acquired methemoglobinemia associated with alkaptonuria.", "title_normalized": "a rare case of acquired methemoglobinemia associated with alkaptonuria" }
[ { "companynumb": "PHHY2014JP123310", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "FUROSEMIDE" }, "drugadditional": null, "drug...
{ "abstract": "OBJECTIVE\nCombined intravenous (IV) and intra-arterial (IA) thrombolytic therapy may be faster and easier to initiate than monotherapy, and its recanalization rate may be better as well. The sequential combination of recombinant tissue plasminogen activator (rTPA) and urokinase (UK) has synergistic and complementary effects on clot lysis. We prospectively evaluated the effectiveness and safety of sequential combination of IV rTPA and IA UK in acute ischemic stroke.\n\n\nMETHODS\nIV rTPA was administered to patients with acute stroke within 3 hours of onset. Those whose condition had not improved at the end of rTPA infusion were further treated with selective IA UK. We evaluated baseline and 30-day National Institutes of Health Stroke Scale (NIHSS) scores and 90-day modified Rankin Scale scores.\n\n\nRESULTS\nThirty patients were initially treated with IV rTPA; 24 were further treated with IA UK. Four patients who had rapid reocclusion following initial successful IA therapy received IV abciximab. Fourteen of 24 patients who underwent angiography had an effective perfusion state of Thrombolysis in Myocardial Infarction grade 3 flow. Median baseline and 30-day NIHSS scores were 18 and 2, respectively. Eighteen patients improved to a modified Rankin scale score of 0 or 1 after 90 days. Symptomatic hemorrhage developed in two patients.\n\n\nCONCLUSIONS\nThe strategy of using conventional-dose IV rTPA and the sequential combination of IA UK in patients without an early clinical response to IV treatment was safe and feasible. This strategy achieved high complete arterial recanalization rates and good functional outcomes.", "affiliations": "Department of Neurology, BK21 Projects for Medical Sciences, Yonsei University College of Medicine, Seoul, Korea.", "authors": "Lee|Kyung Yul|KY|;Kim|Dong Ik|DI|;Kim|Seo Hyun|SH|;Lee|Seung Ik|SI|;Chung|Hae Woong|HW|;Shim|Yong Woon|YW|;Kim|Seung Min|SM|;Heo|Ji Hoe|JH|", "chemical_list": "D000911:Antibodies, Monoclonal; D005343:Fibrinolytic Agents; D007140:Immunoglobulin Fab Fragments; D010959:Tissue Plasminogen Activator; D014568:Urokinase-Type Plasminogen Activator; D000077284:Abciximab", "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0195-6108", "issue": "25(9)", "journal": "AJNR. American journal of neuroradiology", "keywords": null, "medline_ta": "AJNR Am J Neuroradiol", "mesh_terms": "D000077284:Abciximab; D000208:Acute Disease; D000293:Adolescent; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000911:Antibodies, Monoclonal; D002533:Cerebral Angiography; D002543:Cerebral Hemorrhage; D002544:Cerebral Infarction; D004359:Drug Therapy, Combination; D005260:Female; D005343:Fibrinolytic Agents; D005500:Follow-Up Studies; D006801:Humans; D007140:Immunoglobulin Fab Fragments; D007269:Injections, Intra-Arterial; D007275:Injections, Intravenous; D020766:Intracranial Embolism; D008297:Male; D008875:Middle Aged; D009460:Neurologic Examination; D012008:Recurrence; D019233:Retreatment; D015912:Thrombolytic Therapy; D010959:Tissue Plasminogen Activator; D014568:Urokinase-Type Plasminogen Activator", "nlm_unique_id": "8003708", "other_id": null, "pages": "1470-5", "pmc": null, "pmid": "15502123", "pubdate": "2004-10", "publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": "8427107;7563451;12566373;3124288;9368550;9445320;7477192;11779923;11844259;15017018;8303734;11901016;1907086;2963831;11156782;10472989;12750540;11402123;11062274;1902405;11872894;10373713;12297567;1430679;12771267;10591382;1642475;9158632;11994558;10366192;10582984", "title": "Sequential combination of intravenous recombinant tissue plasminogen activator and intra-arterial urokinase in acute ischemic stroke.", "title_normalized": "sequential combination of intravenous recombinant tissue plasminogen activator and intra arterial urokinase in acute ischemic stroke" }
[ { "companynumb": "KR-ROCHE-1920397", "fulfillexpeditecriteria": "1", "occurcountry": "KR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ALTEPLASE" }, "drugadditional": "3", "drugad...
{ "abstract": "Concomitant intra-arterial infusion chemoradiotherapy (IA-CRT) has been used to treat locally advanced maxillary sinus squamous cell carcinoma (MSSCC) with positive outcomes. However, an optimal predictive prognostic factor for MSSCC treated with IA-CRT remains elusive. The aim of the present study was to assess the feasibility of 18F-fluorodeoxyglucose positron emission tomography (FDG-PET), including volumetric parameters, to predict the prognosis of MSSCC treated with IA-CRT. Twenty-four patients with newly diagnosed MSSCC receiving FDG-PET imaging before IA-CRT treatment were analyzed in this retrospective study. All patients underwent radiotherapy with a total tumor dose of 60-66 Gy in a conventional fractionation schedule, using three-dimensional conformal radiation therapy or intensity-modulated radiation therapy. Radiotherapy was performed concurrently with concurrent intra-arterial infusion chemotherapy (cisplatin). The IA-CRT response rate was 83.33%. The 1- and 3-year survival rates were 81.30% and 64.34%, respectively. The 1- and 3-year local failure-free rates were 57.21% and 40.96%, respectively. Local failure was significantly associated with poor survival (P = 0.0152). Further, clinical T staging clearly stratified local control outcomes among patients with clinical T3 or less, T4a, and T4b (P = 0.0312). Moreover, patients with stage T4b showed a significantly poorer local control compared with T3 or less (P = 0.0103). However, FDG-PET parameters provided no significant predictive information regarding treatment outcome. To conclude, pretreatment T stage predicts local control by IA-CRT, which is associated with survival.", "affiliations": "Department of Radiology, Hyogo College of Medicine, Nishinomiya, Japan.;Department of Radiology, Hyogo College of Medicine, Nishinomiya, Japan.;Department of Radiology, Hyogo College of Medicine, Nishinomiya, Japan.;Department of Radiology, Hyogo College of Medicine, Nishinomiya, Japan.;Department of Otolaryngology-Head and Neck Surgery, Hyogo College of Medicine, Nishinomiya, Japan.;Department of Oral and Maxillofacial Surgery, Hyogo College of Medicine, Nishinomiya, Japan.;Department of Radiology, Hyogo College of Medicine, Nishinomiya, Japan.;Department of Radiology, Hyogo College of Medicine, Nishinomiya, Japan.;Department of Radiology, Hyogo College of Medicine, Nishinomiya, Japan.", "authors": "Doi|Hiroshi|H|;Fujiwara|Masayuki|M|;Kitajima|Kazuhiro|K|;Tanooka|Masao|M|;Terada|Tomonori|T|;Noguchi|Kazuma|K|;Ishikura|Reiichi|R|;Kamikonya|Norihiko|N|;Yamakado|Koichiro|K|", "chemical_list": "D019788:Fluorodeoxyglucose F18", "country": "Japan", "delete": false, "doi": "10.18999/nagjms.80.4.541", "fulltext": "\n==== Front\nNagoya J Med SciNagoya J Med SciNagoya Journal of Medical Science0027-76222186-3326Nagoya University 10.18999/nagjms.80.4.541Original PaperClinical T staging is superior to fluorodeoxyglucose positron emission tomography for predicting local outcomes after intra-arterial infusion chemoradiotherapy for maxillary sinus squamous cell carcinoma Doi Hiroshi 12Fujiwara Masayuki 1Kitajima Kazuhiro 13Tanooka Masao 14Terada Tomonori 5Noguchi Kazuma 6Ishikura Reiichi 1Kamikonya Norihiko 1Yamakado Koichiro 1\n1 Department of Radiology, Hyogo College of Medicine, Nishinomiya, Japan\n2 Department of Radiation Oncology, Kindai University Faculty of Medicine, Osaka-Sayama, Japan\n3 Department of Nuclear Medicine and PET center, Hyogo College of Medicine, Nishinomiya, Japan\n4 Department of Radiotherapy, Takarazuka City Hospital, Takarazuka, japan\n5 Department of Otolaryngology-Head and Neck Surgery, Hyogo College of Medicine, Nishinomiya, Japan\n6 Department of Oral and Maxillofacial Surgery, Hyogo College of Medicine, Nishinomiya, JapanCorresponding Author: Hiroshi Doi, MD, PhD\n\nDepartment of Radiology, Hyogo College of Medicine, \n\n1-1, Mukogawa-cho, Nishinomiya, Hyogo 663-8501, Japan\n\nTel: +81-798-45-6362, Fax: +81-798-45-6361, E-mail: h-doi@hyo-med.ac.jp\n\n11 2018 80 4 541 550 1 2 2018 9 5 2018 This is an Open Access article distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (http://creativecommons.org/licenses/by-nc-nd/4.0/).ABSTRACT\nConcomitant intra-arterial infusion chemoradiotherapy (IA-CRT) has been used to treat locally advanced maxillary sinus squamous cell carcinoma (MSSCC) with positive outcomes. However, an optimal predictive prognostic factor for MSSCC treated with IA-CRT remains elusive. The aim of the present study was to assess the feasibility of 18F-fluorodeoxyglucose positron emission tomography (FDG-PET), including volumetric parameters, to predict the prognosis of MSSCC treated with IA-CRT. Twenty-four patients with newly diagnosed MSSCC receiving FDG-PET imaging before IA-CRT treatment were analyzed in this retrospective study. All patients underwent radiotherapy with a total tumor dose of 60–66 Gy in a conventional fractionation schedule, using three-dimensional conformal radiation therapy or intensity-modulated radiation therapy. Radiotherapy was performed concurrently with concurrent intra-arterial infusion chemotherapy (cisplatin). The IA-CRT response rate was 83.33%. The 1- and 3-year survival rates were 81.30% and 64.34%, respectively. The 1- and 3-year local failure-free rates were 57.21% and 40.96%, respectively. Local failure was significantly associated with poor survival (P = 0.0152). Further, clinical T staging clearly stratified local control outcomes among patients with clinical T3 or less, T4a, and T4b (P = 0.0312). Moreover, patients with stage T4b showed a significantly poorer local control compared with T3 or less (P = 0.0103). However, FDG-PET parameters provided no significant predictive information regarding treatment outcome. To conclude, pretreatment T stage predicts local control by IA-CRT, which is associated with survival.\n\nKey Words\nconcurrencyintensity-modulated radiation therapyparanasal sinusintra-arterial infusion chemotherapymaxillary sinusradiotherapy\n==== Body\nINTRODUCTION\nMalignant paranasal sinus tumors are rare, accounting for approximately 3.0% of head and neck carcinomas and about 0.5% of all malignancies.1) Maxillary sinus squamous cell carcinoma (MSSCC) has the highest incidence among paranasal sinus malignancies.\n\nRadical surgery (with or without ophthalmectomy) is a standard treatment for MSSCC.2) However, radical surgery for MSSCC is sometimes challenging due to several factors, including anatomical barriers, the possibility of disfigurement, and anatomical dysfunction of tissues in proximity to the surgical margins. Radiotherapy, therefore, is a promising alternative treatment option for MSSCC.\n\nChemoradiotherapy is one of the most successful treatment options for squamous cell carcinoma in the larynx and pharynx. However, conventional chemoradiotherapy can lead to unsatisfactory outcomes for MSSCC.3) Concomitant intra-arterial infusion chemoradiotherapy (IA-CRT) has been demonstrated to have positive treatment outcomes for MSSCC.4-6) However, the optimal predictive factors for the prognosis of MSSCC treated with IA-CRT remains unknown.\n\nFluorodeoxyglucose positron emission tomography (FDG-PET) can measure glucose uptake by malignant cells and has been advocated for assessing the biological aggressiveness of tumors, as well as a factor to predict patient outcomes. Many studies have presented the metabolic activity of FDG-PET as a prognostic factor in a variety of cancer patients, including those with head and neck cancers.7-9) Volume-based quantitative FDG-PET/computed tomography (CT) parameters, including metabolic tumor volume (MTV) and total lesion glycolysis (TLG), have recently been reported as independent predictors for the outcomes of various malignancies.10,11) However, only a few studies have examined the correlation between FDG uptake by the primary tumor and the prognosis of MSSCC.9) In addition, the true clinical utility of volume-based quantitative FDG-PET/CT parameters is presently unclear.\n\nTherefore, we conducted a retrospective study to assess prognostic predictive factors, including FDG uptake using volumetric parameters, at the initial diagnosis of MSSCC before the definitive treatment for locally advanced MSSCC using IA-CRT.\n\nMATERIALS AND METHODS\nPatients\nThis retrospective study was approved by the institutional review board (Approval No. 2567). Informed consent was obtained from all individual participants in the study prior to treatment.\n\nWe analyzed the medical records of patients with newly diagnosed MSSCC who underwent FDG-PET imaging before definitive IA-CRT at Hyogo College of Medicine College Hospital between January 2007 and June 2016. These patients were required to have follow-ups longer than six months without local failure. Twenty-eight consecutive patients met these criteria, and four of them who received radiotherapy <60 Gy or had planned surgery were excluded. After applying the inclusion criteria, 24 patients remained for analysis. All patients underwent clinical staging, performed using CT and/or magnetic resonance imaging (MRI), and FDG-PET/CT according to the systematic TNM classification of the American Joint Committee on Cancer.12) A summary of the patients’ characteristics in this study is shown in Table 1. The median follow-up time was 378 days (range, 49–2865 days).\n\nTable 1 Summary of patient clinicopathological characteristics.\n\nClinicopathological characteristic\tPatients (n = 24)\t\nAge, years [median (range)]\t63.5 (31–82)\t\nSex, n (%)\t\t\n\tMale\t20 (83.33%)\t\n\tFemale\t4 (16.67%)\t\nECOG-PS, n (%)\t\t\n\t0\t23 (95.83%)\t\n\t1\t1 (4.17%)\t\nTNM classification, n (%)\t\t\nT stage\t\t\n\t~3\t6 (25.00%)\t\n\t4a\t9 (37.50%)\t\n\t4b\t9 (37.50%)\t\nN stage\t\t\n\t0\t15 (62.50%)\t\n\t1\t3 (12.50%)\t\n\t2b\t2 (8.33%)\t\n\t2c\t4 (16.67%)\t\nM stage\t\t\n\t0\t22 (91.67%)\t\n\t1\t2 (8.33%)\t\nRadiotherapeutic technique, n (%)\t\t\n\t3D-CRT\t15 (62.50%)\t\n\tVMAT\t9 (37.50%)\t\nTotal radiotherapeutic dose\t\t\n\t60 Gy\t13 (54.17%)\t\n\t66 Gy\t11 (45.83%)\t\nNumber of fractions, n (median [range])\t30 (30–33)\t\nFraction size, Gy\t2 (all patients)\t\nTreatment duration, days (median [range])\t43.5 (36–60)\t\n\t\nAbbreviations: ECOG-PS, Eastern Cooperative Oncology Group - Performance Status; 3D-CRT, three-dimensional conformal radiation therapy; VMAT, volumetric modulated arc therapy.\n\nFDG-PET/CT\nWe have described the imaging techniques in detail in a previous report.9) Briefly, FDG-PET/CT was performed before radiotherapy with a PET/CT scanner (Gemini GXL16 or a Gemini TF64; Philips Medical Systems, Eindhoven, The Netherlands). Patients were injected with 4.0 MBq/kg body weight FDG for the GXL16 scanner or 3.0 MBq/kg for the TF64 scanner. No patients had glucose levels greater than 150 mg/dL. CT images were obtained using the parameters as follows: tube voltage 120 kV, effective tube current auto-mA (up to 120 mA s for the GXL16 or 100 mA s for the TF64), gantry rotation speed 0.5 s, detector configuration 16×1.5 mm (GXL16) or 64×0.625 mm (TF64), 2-mm slice thickness, and a transverse field of view of 600 mm. PET images from the head to the mid-thigh were acquired for 90 s per bed position, and the region from the mid-thigh to the toes for 30 s per bed position immediately after the completion of CT. Then, images at 12–14 bed positions, each for 90 s, and 6–7 bed positions, each for 30 s, were taken in the three-dimensional (3D) mode. Attenuation-corrected PET images were reconstructed with a line-of-response row-action maximum likelihood algorithm for the GXL16; an ordered-subset expectation maximization iterative reconstruction algorithm (33 subsets, 3 iterations) was used for the TF64.\n\nAll FDG-PET/CT images were reviewed using commercially available software, GI-PET (AZE Co., Ltd., Tokyo, Japan), which can harmonize the SUVs across different PET/CT systems using phantom data, as well as assist clinicians in monitoring treatment response. SUVmax was defined as the maximum activity concentration in the primary tumor divided by the injected dose/body weight. SUVmax was normalized to SULmax (SUVmax×[lean body mass]/[total body mass]). SUVpeak was calculated from a 1.2 cm diameter volume region of interest (ROI) placed on the hottest site of the tumor. The SUVpeak was normalized to SULpeak (SUVpeak×[lean body mass]/[total body mass]). It was also determined if the tumor SULpeak was higher than 1.5 times the liver SUL mean + 2 SDs (using a 3 cm-diameter spherical ROI in the normal right lobe of liver). The MTV (metabolic tumor volume) was defined as the FDG-avid tumor volume and TLG (tumor lesion glycolysis) as MTV × SULmean, where SULmean represents the mean SUL.\n\nRadiotherapy\nThe chemoradiotherapy techniques have been previously described.6,13) Briefly, an Aquilion LB CT scanner (Toshiba, Ohtawara, Japan) was used to obtain the planning CT images. A XiO® treatment planning system (TPS) (Elekta, Stockholm, Sweden) was used to segment the volumes of interest in the CT dataset. A 3D conformal radiotherapy technique was performed using a Primus MD2 linear accelerator (Siemens, Munich, Germany) and a Synergy® linear accelerator (Elekta, Crawley, UK).6) Volumetric modulated arc therapy (VMAT) was used for intensity-modulated radiation therapy (IMRT). VMAT treatment plans were generated with a Monaco TPS (Elekta, Maryland Heights, MO, USA) and delivered with a Synergy® linear accelerator (Elekta, Crawley, UK).6,13) Radiotherapy was performed with daily 2-Gy fractions (Table 1). Concurrent IA-CRT using cisplatin was performed as previously described.6) Lesions of the neck were irradiated in patients with nodal metastasis.\n\nFollow-up\nOverall survival (OS) was defined as the time from the initiation of the radiotherapy course to death, or to the last follow-up. Local control (LC) was defined as the time from the initiation of the course of radiotherapy to the date of local failure based on CT, MRI, and pathological diagnosis, or the last follow-up. Local failure was defined as the pathological confirmation of a viable tumor or regrowth in images after IA-CRT. Toxicities were graded using the Common Terminology Criteria for Adverse Events (CTCAE), version 4.03.14)\n\nStatistical analysis\nData were indicated as the median values, with the associated range in parentheses, unless otherwise indicated. Each specific time was defined from the initiation of the course of radiotherapy to the day of a confirmed event. The Kaplan-Meier method was used to estimate cumulative local control (LC) and survival estimates, and statistical differences were evaluated with the log-rank test. The Cox proportional hazards model was used to examine potential predictors that may affect treatment outcomes. Results were reported as hazard ratios (HR), with corresponding 95% confidence intervals (CI). Multivariate analyses were not performed due to the small number of patients. JMP software version 12.2.0 (SAS Institute, Cary, NC, USA) was used for all statistical analyses. A P-value <0.05 was used to assess statistical significance.\n\nRESULTS\nThe response rate of IA-CRT was 83.33%, including complete and partial response in 11 and 9 patients, respectively. Of the 24 study patients, 7 (29.17%) died in the follow-up term of 24 (3–94) months. The 1-, 2-, and 3-year survival rates were 81.30%, 70.78%, and 64.34%, respectively (Fig. 1). Fourteen patients (58.33%) experienced local failure, including four residual tumors and progression after IA-CRT. The LC time was 9 (1–42) months. The 1-, 2-, and 3-year LC rates were 57.21%, 46.81%, and 40.96%, respectively (Fig. 2). Among the 14 patients experiencing local failure, eight patients received additional local salvage treatment (six salvage surgery, one re-irradiation, and one intra-arterial infused chemotherapy).\n\nFig. 1 Overall survival of 24 patients.\n\nFor the 24 patients, the median survival time was not available in this study\n\nFig. 2 Local control in 24 patients.\n\nFor the 24 patients, the median local control time was 666 days\n\nA summary of acute toxicities attributed to IA-CRT is shown in Table 2. Regarding non-hematological late toxicities, one patient had decreased visual acuity, one developed corneal ulceration, one developed blepharoptosis, one developed a cataract, one developed xerostomia, one developed osteomyelitis, four developed osteonecrosis, and one patient developed blindness due to an obstruction of the central retinal vein. In addition, no apparent symptoms were observed in 17 patients.\n\nTable 2 Summary of toxicities.\n\nToxicity\tGrade\tNumber of patients (n = 24)\t\nLeukocytopenia\tAny\t4 (16.67%)\t\n\t1\t1 (4.17%)\t\n\t3\t3 (12.50%)\t\nNeutropenia\tAny\t3 (12.50%)\t\n\t2\t2 (8.33%)\t\n\t3\t1 (4.17%)\t\nAnemia (hemoglobin)\t1\t1 (4.17%)\t\nHemorrhage\t1\t1 (4.17%)\t\nKeratitis\t1\t14 (58.33%)\t\nDermatitis\tAny\t21 (87.50%)\t\n\t1\t19 (79.17%)\t\n\t2\t1 (4.17%)\t\n\t4\t1 (4.17%)\t\nMucositis\tAny\t24 (100.00%)\t\n\t1\t1 (4.17%)\t\n\t2\t18 (75.00%)\t\n\t3\t5 (20.83%)\t\nUnivariate analysis showed that locoregional failure was associated with poor survival (Table 3 and Fig. 3). In addition, T4b disease was related with the incidence of loco-regional failure (Table 3). Clinical T stage clearly stratified local control among patients with clinical stage T3 or less, T4a, and T4b (Fig. 4). Moreover, patients with stage T4b showed significantly poorer local control when compared to those with stage T3 or less.\n\nTable 3 Univariate analysis of overall survival and local control\n\n\t\t\tOverall survival\tLocal control\t\nClinicopathological \nparameter\tPatients \n(n = 24)\t2-year \nsurvival \nrate (%)\tHR (95% CI)\tP value\tHR (95% CI)\tP value\t\nAge, years\t\n\t<65\t13\t62.86\t1\t0.7278\t1\t0.6290\t\n\t≥65\t11\t78.75\t0.7674 (0.1510–3.4846)\t0.7695 (0.4477–3.9786)\t\nSex\t\n\tMale\t20\t63.50\t1\t0.0548\t1\t0.1095\t\n\tFemale\t4\t100.00\t1.3273e-9 (1.0475–1.0475)\t0.2503 (0.0137–1.2925)\t\nBody mass index, kg/m2\n\n\n\t\n\t<20\t9\t66.67\t1\t0.3551\t1\t0.5128\t\n\t≥20\t15\t73.33\t0.4951 (0.0973–2.2515)\t0.6918 (0.2288–2.1585)\t\nTNM stage\t\t\t\t\t\t\t\n\t≤T3\t6\t75.00\t1\t0.6530\t1\t0.0462\t\n\tT4\t18\t69.11\t1.5876 (0.2682–30.1059)\t5.2089 (1.0234–94.9364)\t\n\t≤T4a\t17\t78.97\t1\t0.2044\t1\t0.0036\t\n\tT4b\t7\t50.00\t2.7694 (0.5402–12.7146)\t5.5681 (1.7907–17.8825)\t\n\tN0\t15\t76.15\t1\t0.5858\t1\t0.7566\t\n\t≥N1\t9\t60.00\t1.5258 (0.3001–6.9359)\t1.1870 (0.3828–3.4771)\t\n\tM0\t22\t72.93\t1\t0.4896\t1\t0.8439\t\n\tM1\t2\t50.00\t2.3038 (0.1197–14.4654)\t0.8185 (0.0447–4.2243)\t\nStage\t\t\t\t\t\t\t\t\n\t≤IVa\t16\t77.38\t1\t0.3427\t1\t0.0204\t\n\tIVb and c\t8\t57.14\t2.1180 (0.4136–9.7130)\t3.7867 (1.2377–11.9607)\t\nRadiotherapeutic dose, Gy\t\n\t60\t13\t74.07\t1\t0.8291\t1\t0.2296\t\n\t66\t11\t68.18\t1.1811 (0.2312–5.3956)\t0.4975 (0.1345–1.5323)\t\nPDG-PET parameters\t\t\t\t\t\t\nSUVmax\t\t\t\t\t\t\t\n\t<14.5\t12\t68.18\t1\t0.3991\t1\t0.8776\t\n\t≥14.5\t12\t72.19\t0.5264 (0.1033–2.3980)\t0.9205 (0.3133–2.7077)\t\nSULmax\t\t\t\t\t\t\t\n\t<10\n\n\n\t12\t79.55\t1\t0.9276\t1\t0.9063\t\n\t≥10\t12\t63.49\t1.0723 (0.2340–5.4927)\t1.0653 (0.3632–3.1269)\t\nSULpeak\t\t\t\t\t\t\t\n\t<9.5\t12\t79.55\t1\t0.9276\t1\t0.9063\t\n\t≥9.5\t12\t63.49\t1.0723 (0.2340–5.4927)\t1.0653 (0.3632–3.1269)\t\nMetabolic tumor volume (MTV)\t\n(primary site)\t\t\t\t\t\t\t\n\t<58\t12\t68.57\t1\t0.6474\t1\t0.9049\t\n\t≥58\t12\t72.73\t1.4161 (0.3115–7.2015)\t1.0663 (0.3633–3.1311)\t\n(primary site plus all metastatic sites)\t\n\t<58\t11\t76.19\t1\t0.2448\t1\t0.7132\t\n\t≥58\t13\t66.67\t2.5264 (0.5424–17.6793)\t1.2206 (0.4211–3.7384)\t\nTotal lesion glycolysis (TLG)\t\t\t\t\t\t\n(primary site)\t\t\t\t\t\t\t\n\t<345\t12\t68.57\t1\t0.6819\t1\t0.8634\t\n\t≥345\t12\t71.59\t1.3656 (0.3007–6.9383)\t1.097 (0.3736–3.2224)\t\n(primary site plus all metastatic sites)\t\t\t\t\t\n\t<345\t12\t68.57\t1\t0.6819\t1\t0.8634\t\n\t≥345\t12\t71.59\t1.3656 (0.3007–6.9383)\t1.097 (0.3736–3.2224)\t\t\nLocal failure\t\t\t\t\t\t\t\n\tYes\t14\t52.75\t1\t0.0035\tnot applicable\tnot applicable\t\n\tNo\t10\t100.00\t7.165e-10 (0.3738–0.3738)\tnot applicable\t\nAbbreviations: HR, hazard ratio; CI, confidence interval; FDG-PET, 18F-fluorodeoxyglucose positron emission tomography; SUV, maximum standardized uptake value; SULmax, maximum standard uptake value corrected for lean body mass; SULpeak, peak standard uptake value corrected for lean body mass.\n\nFig. 3 Local failure is associated with poor survival.\n\nPatients who developed local failure after treatment showed significantly worse survival (P = 0.0152) than those who did not.\n\nFig. 4 Pretreatment clinical T stage is associated with local control.\n\nA significant difference was found among the three groups (P = 0.0312). In addition, the pairwise comparisons of <T4 vs. T4a, <T4 vs. T4b, and T4a vs. T4b showed P values of 0.4057, 0.0103, and 0.1060, respectively.\n\nDISCUSSION\nSurgery is a well-established therapeutic strategy for tumors in the paranasal sinus. However, MSSCC may require intensive surgery, including a total maxillectomy or craniofacial resection with the complete obliteration of the components of the orbit, followed by reconstruction.2) These surgical procedures can cause marked disfigurement, and functional impairment is often intensive. In addition, postoperative radiotherapy of a locally advanced parasinus tumor might be needed since residual disease can exist macroscopically or microscopically despite intensive surgery. Further, treatment outcomes are unsatisfactory after surgical intervention.15-17) As far as we know, there is little reported evidence on the tumor staging system predicting the outcomes of maxillary sinus tumors after definitive radiotherapy.\n\nChemoradiotherapy is a treatment option for unresectable diseases, as well as for patients who refuse surgery. In addition, IA-CRT seems to be feasible and could lead to favorable tumor control in the treatment of paranasal sinus carcinomas.4-6)\n\nHomma, et al. have reported the 5-year local progression-free rates are 75.8%, 62.5%, and 59.7%, for T2-3, 4a, and 4b disease, respectively.5) In addition, our previous report has indicated consistent outcomes in the patient sub-group who received radiotherapy of ≥60 Gy.6) The present study indicated slightly inferior LC rates than in previous reports, since retrospective studies focusing on rare diseases may include relatively large biases. In addition, the present study used relatively small doses of radiotherapy (up to 66 Gy), although high doses of intra-arterial cisplatin and the definition of local evaluation were similar to those used in previous studies.5) In this retrospective study, we examined the clinical findings and images in locally advanced MSSCC patients who underwent IA-CRT. We found that local failure had a strong association with poor survival, and pretreatment T stage was correlated with the risk of local failure.\n\nMSSCC survival rates depend on disease stage, with a rapid decrease in survival as the tumor stage increases from T1 to T4, and with lymph node and distant metastases being infrequent.18,19) We have previously reported the utility of FDG-PET using SUVmax for predictions of maxillary sinus cancer.9) In the previous report, we showed that SUVmax of the primary tumor, determined by FDG-PET/CT before treatment, was a surrogate marker for the prognosis of maxillary sinus cancer. However, that report included a varied patient population, a heterogeneity of treatments, and differences in the PET/CT systems. To minimize these biases, we selected patients who received IA-CRT and PET/CT before IA-CRT. In addition, FDG-PET/CT images were normalized using GI-PET in this study. However, no superiority of FDG-PET plus morphologically-based staging was demonstrated. Large tumors can have central necrosis, with primary tumors in close proximity to the brain, possibly causing chronic inflammation.18) These features of MSSCC can complicate a precise diagnosis using PET imaging, and may affect FDG-PET uptake and morphological tumor volume.\n\nThe metabolic activity of FDG-PET has been assessed as a prognostic factor in a variety of cancer patients.7-9) Volume-based quantitative FDG-PET/ CT parameters have recently been suggested to be better predictors of the outcomes of various malignancies, including cancers in the head and neck.10,11) We have recently reported that high TLG values are independent negative predictors for malignant pleural mesothelioma, regardless of the treatment modality, namely surgery, chemotherapy alone, and trimodal treatment. Thus, we hypothesized that volume-based quantitative FDG-PET/ CT parameters can also be predictors for treatment outcomes in MSSCC, as investigated in this study. As noted above, tumors in the maxillary sinus might confound the volume-based quantitative FDG-PET/ CT parameters.11) Therefore, further analyses are needed to develop ideal detection methods using PDG-PET for parasinus tumors including MSSCC.\n\nBird, et al. have assessed the tumor response between the PET/CT scan prior to and 12 weeks after definitive CRT, to determine the need for salvage treatment following radical CRT for locally advanced oropharyngeal squamous cell carcinoma.20) Their results showed the potential for early detection of high risk groups that should be considered to receive salvage therapy. The present study showed volumetric PET/CT parameters prior to definitive IA-CRT; thus, following early scans might lead to the early prediction of treatment outcomes like recurrence and survival. The utility of PET/CT for predicting treatment outcomes has been poorly understood and, to the best of our knowledge, only there has only been one report on PET scans as a predictor of prognosis in patients with maxillary sinus tumors. Herein, this is the first report of FDG-PET to determine the volumetric parameters of maxillary sinus tumors.\n\nThere are several limitations in this retrospective study, including its relatively small number of eligible patients. Even though tumors in the paranasal sinus are rare, the treatment protocol and FDG-PET imaging data were highly controlled in this study. In addition, to minimize the inter-scanner variability of SUV measurements between the two PET scanners, an SUV equalization method was utilized. Therefore, we believe that our data is sufficiently reliable. We found no significant information regarding outcomes provided by using FDG/PET prior to IA-CRT. However, pretreatment morphologic T staging predicted local control, which was significantly associated with survival outcomes.\n\nA multimodal treatment strategy including surgery can improve loco-regional tumor control and lead to good survival outcomes, compared to those of concurrent chemoradiotherapy, with disappointing outcomes for inoperable advanced parasinus tumors.3,16) Previous reports have recently suggested that modern chemoradiotherapy, such as IMRT and IA-CRT, can improve outcomes, to the point of matching surgery-associated outcomes.4,5,15,17) A limited number of reports have compared modern chemoradiotherapy techniques, such as IMRT and high-dose chemotherapy, with surgery. The present study did not indicate an apparent benefit between 60 and 66 Gy of radiotherapy in the IA-CRT setting using cisplatin. However, 66 Gy may be a relatively small dose for definitive radiotherapy against squamous cell carcinoma in the head and neck, even in the IA-CRT setting.4,5) The present study presented poor local control in T4b tumors when compared to that of a previous report using a similar protocol, although similar results were found for <T4b stage tumors.5) Dose-responses can exist at dose ranges higher than 66 Gy (e.g. ≥70 Gy) and in locally advanced disease. We suggest that elevated doses of radiotherapy are needed to achieve better local control of T4b disease, even if radiotherapy is performed with concomitant intra-arterial (cisplatin-based) infusion. Moreover, we determined that clinical T stage can be a predictive factor of local control; however, no significant difference in survival was found in this patient population. Future clinical trials including larger patient populations with homogeneous characteristics may predict stronger prognostic factors.\n\nTo conclude, pretreatment T stage predicts local control by IA-CRT, with FDG-PET showing no significant predictive information for these patients. Dose escalation may be needed to successfully treat T4b disease.\n\nACKNOWLEDGEMENTS\nThis work was supported by a Grant-in-Aid for Young Scientists (B) Grant Number 17K16493. We would like to acknowledge Editage (www.editage.jp) for language editing.\n\nCOMPETING INTERESTS\nThere are no conflicts of interest to declare.\n==== Refs\nREFERENCES\n1) Muir CS, Nectoux J. Descriptive epidemiology of malignant neoplasms of nose, nasal cavities, middle ear and accessory sinuses. Clin Otolaryngol Allied Sci, 1980; 5: 195–211.\n2) National Comprehensive Cancer Network. Head and Neck Cancers, Version 2, 2017. Available at: http://nccn.org/professionals/physician_gls/PDF/head-and-neck.pdf Accessed August 18, 2017.\n3) Kang JH, Cho SH, Kim JP, Kang KM, Cho KS, Kim W, et al. Treatment outcomes between concurrent chemoradiotherapy and combination of surgery, radiotherapy, and/or chemotherapy in stage III and IV maxillary sinus cancer: multi-institutional retrospective analysis. J Oral Maxillofac Surg, 2012; 70: 1717–1723.\n4) Hayashi T, Nonaka S, Bandoh N, Kobayashi Y, Imada M, Harabuchi Y. Treatment outcome of maxillary sinus squamous cell carcinoma. Cancer, 2001; 92: 1495–1503.\n5) Homma A, Sakashita T, Yoshida D, Onimaru R, Tsuchiya K, Suzuki F, et al. Superselective intra-arterial cisplatin infusion and concomitant radiotherapy for maxillary sinus cancer. Br J Cancer, 2013; 109: 2980–2986.\n6) Doi H, Kitajima K, Tanooka M, Terada T, Noguchi K, Takada Y, et al. Radiotherapy in late elderly (aged 75 or older) patients with paranasal sinus carcinoma: a single institution experience. Eur Arch Otorhinolaryngol, 2016; 273: 4485–4492.\n7) Xie P, Li M, Zhao H, Sun X, Fu Z, Yu J. 18F-FDG PET or PET-CT to evaluate prognosis for head and neck cancer: a meta-analysis. J Cancer Res Clin Oncol, 2011; 137: 1085–93.\n8) Muir CS, Nectoux J. Descriptive epidemiology of malignant neoplasms of nose, nasal cavities, middle ear and accessory sinuses. Clin Otolatyngol, 1980; 5: 195–211.\n9) Doi H, Kitajima K, Fukushima K, Kawanaka Y, Mouri M, Yamamoto S, et al. SUVmax on FDG-PET is a predictor of prognosis in patients with maxillary sinus cancer. Jpn J Radiol, 2016; 34: 349–355.\n10) Hanamoto A, Tatsumi M, Takenaka Y, Hamasaki T, Yasui T, Nakahara S, et al. Volumetric PET/CT parameters predict local response of head and neck squamous cell carcinoma to chemoradiotherapy. Cancer, 2014; 3: 1368–1376.\n11) Kitajima K, Doi H, Kuribayashi K, Hashimoto M, Tsuchitani T, Tanooka M, et al. Prognostic value of pretreatment volume-based quantitative 18F-FDG PET/CT parameters in patients with malignant pleural mesothelioma. Eur J Radiol, 2017; 86: 176–183.\n12) Brierley JD, Gospodarowicz MK, Wittekind D. TNM classification of malignant tumours, 8th ed. 2016, Wiley-Blackwell; New York.\n13) Miura H, Fujiwara M, Tanooka M, Doi H, Inoue H, Takada Y, et al. Dosimetric and delivery characterizations of full-arc and half-arc volumetric- modulated arc therapy for maxillary cancer. J Radiat Res, 2012; 53: 785–790.\n14) National Cancer Institute Common Terminology Criteria for Adverse Events (CTCAE) v4.03. Available at: https://ctep.cancer.gov/protocolDevelopment/electronic_applications/ctc.htm#ctc_40 Accessed August 18, 2017.\n15) Bossi P, Farina D, Gatta G, Lombardi D, Nicolai P, Orlandi E. Paranasal sinus cancer. Crit Rev Oncol Hematol, 2016; 98: 45–61.\n16) Paulino AC, Marks JE, Bricker P, Melian E, Reddy SP, Emami B. Results of treatment of patients with maxillary sinus carcinoma. Cancer, 1998; 83: 457–465.\n17) Lund VJ, Wei WI. Endoscopic surgery for malignant sinonasal tumours: an eighteen year experience. Rhinology, 2015; 53: 204–211.\n18) Llorente JL, López F, Suárez C, Hermsen MA. Sinonasal carcinoma: clinical, pathological, genetic and therapeutic advances. Nat Rev Clin Oncol, 2014; 11: 460–472.\n19) Shen W, Sakamoto N, Yang L. Prognostic models and nomograms for predicting survival of patients with maxillary sinus carcinomas. Int Forum Allergy Rhinol, 2017; 7: 741–748.\n20) Bird T, Barrington S, Thavaraj S, Jeannon JP, Lyons A, Oakley R, et al. (18) F-FDG PET/CT to assess response and guide risk-stratified follow-up after chemoradiotherapy for oropharyngeal squamous cell carcinoma. Eur J Nucl Med Mol Imaging, 2016; 43: 1239–1247.\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "0027-7622", "issue": "80(4)", "journal": "Nagoya journal of medical science", "keywords": "concurrency; intensity-modulated radiation therapy; intra-arterial infusion chemotherapy; maxillary sinus; paranasal sinus; radiotherapy", "medline_ta": "Nagoya J Med Sci", "mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D002294:Carcinoma, Squamous Cell; D059248:Chemoradiotherapy; D005260:Female; D019788:Fluorodeoxyglucose F18; D006801:Humans; D007261:Infusions, Intra-Arterial; D008297:Male; D008443:Maxillary Sinus; D008444:Maxillary Sinus Neoplasms; D008875:Middle Aged; D049268:Positron-Emission Tomography; D012189:Retrospective Studies", "nlm_unique_id": "0412011", "other_id": null, "pages": "541-550", "pmc": null, "pmid": "30587868", "pubdate": "2018-11", "publication_types": "D016428:Journal Article", "references": "11745227;21229262;21945430;22843367;24196792;24935016;25045041;26363161;26520459;26707387;26920841;27314860;28027744;28544802;6996871;9690538", "title": "Clinical T staging is superior to fluorodeoxyglucose positron emission tomography for predicting local outcomes after intra-arterial infusion chemoradiotherapy for maxillary sinus squamous cell carcinoma.", "title_normalized": "clinical t staging is superior to fluorodeoxyglucose positron emission tomography for predicting local outcomes after intra arterial infusion chemoradiotherapy for maxillary sinus squamous cell carcinoma" }
[ { "companynumb": "JP-ACCORD-100650", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CISPLATIN" }, "drugadditional": "3", "drugad...
{ "abstract": "Variety of symptoms and atypical clinical course of Crohn's disease (CD) often create the need for additional diagnostic procedures. In the described case of woman with CD, there was a suspicion of coexistence of ovarian cancer. This issue is particularly important in patients treated with immunosuppressants and biological agents. The discussion focused on the usefulness of CA125 (cancer antigen 125, mucin 16) serum level estimation in clinical practice and draws attention to the possible reasons for the increase of its value which is not associated to ovarian cancer.", "affiliations": "Department of Gastroenterological Nursing, Medical College, Nicolaus Copernicus University, Ujejskiego 75, 85-168 Bydgoszcz, Poland ; Outpatient Department for Inflammatory Bowel Diseases, The Jan Biziel University Hospital No. 2, Ujejskiego 75, 85-168 Bydgoszcz, Poland.;Department of Gastroenterological Nursing, Medical College, Nicolaus Copernicus University, Ujejskiego 75, 85-168 Bydgoszcz, Poland ; Outpatient Department for Inflammatory Bowel Diseases, The Jan Biziel University Hospital No. 2, Ujejskiego 75, 85-168 Bydgoszcz, Poland.;Department of Gastroenterological Nursing, Medical College, Nicolaus Copernicus University, Ujejskiego 75, 85-168 Bydgoszcz, Poland.;Outpatient Department for Inflammatory Bowel Diseases, The Jan Biziel University Hospital No. 2, Ujejskiego 75, 85-168 Bydgoszcz, Poland.", "authors": "Kłopocka|Maria|M|;Liebert|Ariel|A|0000-0002-1020-4707;Bielińska|Joanna|J|0000-0002-1478-2117;Manerowski|Marcin|M|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1155/2014/981726", "fulltext": "\n==== Front\nCase Rep MedCase Rep MedCRIMCase Reports in Medicine1687-96271687-9635Hindawi Publishing Corporation 10.1155/2014/981726Case ReportDiagnostic Difficulties in Woman with Crohn's Disease, Ascites, and Elevated Value of Serum CA125 Antigen Kłopocka Maria \n1\n\n2\n\n*\nhttp://orcid.org/0000-0002-1020-4707Liebert Ariel \n1\n\n2\nhttp://orcid.org/0000-0002-1478-2117Bielińska Joanna \n1\nManerowski Marcin \n2\n1Department of Gastroenterological Nursing, Medical College, Nicolaus Copernicus University, Ujejskiego 75, 85-168 Bydgoszcz, Poland2Outpatient Department for Inflammatory Bowel Diseases, The Jan Biziel University Hospital No. 2, Ujejskiego 75, 85-168 Bydgoszcz, Poland*Maria Kłopocka: mariaklopocka@wp.plAcademic Editor: Chin-Jung Wang\n\n2014 23 11 2014 2014 9817267 9 2014 9 11 2014 Copyright © 2014 Maria Kłopocka et al.2014This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Variety of symptoms and atypical clinical course of Crohn's disease (CD) often create the need for additional diagnostic procedures. In the described case of woman with CD, there was a suspicion of coexistence of ovarian cancer. This issue is particularly important in patients treated with immunosuppressants and biological agents. The discussion focused on the usefulness of CA125 (cancer antigen 125, mucin 16) serum level estimation in clinical practice and draws attention to the possible reasons for the increase of its value which is not associated to ovarian cancer.\n==== Body\n1. Introduction\nCrohn's disease (CD) is a chronic, incurable inflammatory condition, which may be localized in any part of the gastrointestinal tract but mainly in terminal ileum and colon. Exact etiology and pathogenesis are still not clear, which makes this disease an important diagnostic and therapeutic problem [1, 2]. Correct diagnosis of this condition usually requires the cooperation of specialists from various fields of medicine, as well as different diagnostic procedures such as endoscopy with microscopic examination of tissue samples, imaging techniques, and laboratory tests. Variety of symptoms and atypical clinical course of the CD often create the need for additional diagnostic procedures [2, 3]. CA125 (cancer antigen 125, mucin 16), the protein classified as a family of mucin member, has been intensively studied because of its wide use in clinical practice as tumor marker. The increased serum concentration of this antigen occurs in over 80% of women with ovarian epithelial cancer. Changes in the serum concentration of mucin 16 are considered as a reliable indicator of response to treatment as well as progression of the disease. There is still lack of agreement among researchers on the molecular and biochemical nature of CA125 [4, 5]. This macromolecular glycoprotein, whose function is still not fully understood, is encoded by a gene MUC16 located on chromosome 19. Several studies indicate a relationship between CA125 and the immune system. It is speculated that CA125 can act as a barrier to protect epithelial cells against various infectious agents and physical injury [6–8]. Increasingly, attention is also drawn to the possibility of participation of mucin 16 in some processes resulting in progression of the disease. According to some researchers, this molecule may facilitate adhesion of cancerous cells to healthy cells, thereby accelerating the occurrence of metastasis. It has been shown that CA125 has the ability to inhibit NK (natural killers) cell response, which may result in tumor cell protection against the immune response of the organism. It is also possible that antigen positively affects the growth and motility of malignant cells and may increase their resistance to applied treatment [6, 9, 10].\n\n2. Case Report\n32-year-old woman with CD localized in the small intestine and in the ileocaecal valve has been treated in the conventional manner (azathioprine (2,5 mg/kg), mesalamine (2 g a day) and budesonide (9 mg a day)) for half a year. The diagnosis of the disease was confirmed by colonoscopy, abdominal ultrasound examination, and microscopic evaluation of samples taken during colonoscopy. In the past, the patient was treated by a gynecologist because of chronic ovaritis. She was not suffering from any other diseases and the results of laboratory tests showed only moderate anemia and elevated CRP (C-reactive protein) level.\n\nDue to the ineffectiveness of such therapy (abdominal pain, diarrhea), she received biological treatment, anti-TNFα (tumour necrosis factor α), infliximab (at a dose of 5 mg/kg) intravenously at weeks 0, 2, and 6 with the outcome of clinical and endoscopic remission. Treatment with azathioprine (2,5 mg/kg) and mesalamine (2 g a day) was continued during the remission period.\n\nAfter three years, the disease course worsened. In addition to the severity of diarrhea and abdominal pain, an increasing abdominal circumference has been observed, as well as swelling of lower extremities. The patient returned to the gynecologist for consultation. Due to suspicion of ovarian cancer with concomitant ascites, numerous laboratory tests were performed, which showed a decrease of total protein, including albumin fraction, and an increase of CRP and CA125 level, which exceeded the normal upper limits more than five times (Table 1). Abdominal ultrasonography and CT (computed tomography) showed the presence of ascites, as well as wall thickening with features of inflammation in the jejunum (Figure 1). Apart from the so far used mesalamine and azathioprine, budesonide was included to the treatment at a dose of 9 mg a day. Additional tests were performed to rule out infection, tuberculosis, kidneys and liver diseases. Within two months there was no improvement in general condition of the patient. Ascites was still present, as well as abnormal serum levels of albumin, CRP, and CA125. Due to persistence suspicion of malignancy, a diagnostic laparoscopy was ordered by gynecologist and oncologist, preceded by a transvaginal ultrasound scan, to clearly exclude ovarian cancer coexistence. During laparoscopy, the fluid was collected from the abdomen to the laboratory and microbiological evaluation. The test results indicated a transudate, with no signs of infection. A negative result of diagnostic laparoscopy influenced the decision to intensify Crohn's disease treatment. The patient received anti-TNFα, adalimumab (at a dose of 160, 80, and then 40 mg every other week). The choice of the drug was dictated by patient preference, because of everyday business activity. After a period of 14 weeks, clinical remission was achieved, as well as recovery of ascites and normalization of CA125 serum level (Table 1). Maintenance treatment with adalimumab was continued for one year. The clinical remission has been maintained for 18 months so far since the completion of biological treatment.\n\n3. Discussion\nDue to the low specificity, antigen CA125 estimation cannot be regarded as routine disease marker in women suffering from ovarian cancer. There are numerous reports of increased serum levels of mucin 16 in the course of proliferative diseases of many organs, not necessarily related to gynecological oncology. Depending on the analyzed clinical entity, there are few reports published as case reports or observations carried out on a large group of patients [7, 8, 11, 12]. The usefulness of CA125 as a biomarker for lung cancer has been reported, as well as its strong predictive value in the diagnosis of peritoneal metastasis in patients with gastric cancer [13–15]. Kouba et al. suggested the clinical usefulness of serum CA-125 levels measurement as a predictor of response to treatment in patients undergoing radical cystectomy for transitional cell carcinoma of the bladder [16]. Increased concentration of mucin 16 was also observed in the course of lymphoma, melanoma, malignant diseases of pancreas, liver, breast, colon, and rectum [7, 12]. Increase in the serum concentration of the analyzed agent was also found in numerous diseases having no neoplastic etiology, among them, in the course of renal failure, sarcoidosis, acute pancreatitis, pelvic inflammation, various pleura, and peritoneum infectious diseases and decompensated liver diseases [6–8, 12, 17]. In recent years the potential usefulness of the CA125 level measurement in cardiac diseases was reported [8, 18]. According to the authors, the serum antigen level can be used as an independent predictor of death in patients hospitalized with acute heart failure [19, 20]. Probably CA125 value can also be used as a prognostic marker of long-term hospitalization and occurrence of cardiovascular events resulting from varying degrees of heart failure [21].\n\nThe reasons for the increase of CA125 concentration in so many different diseases are still not fully understood. According to current knowledge, this mucin may be produced continuously in small amounts by different cells [12]. The existing malignancy may be a factor contributing to the increase of its production. It was also suggested that mesothelial cells can be a source of antigen, even without the accumulation of fluid in the pleural, pericardial, and peritoneal cavities [6, 8, 12]. Increased concentration of mucin 16 in the course of inflammatory diseases may result from the stimulation of the body's immune system and activation of cytokines and other inflammatory factors [19]. Probably, the increased CA125 serum level may occur in the course of every disease entity, complicated by the occurrence of ascites [8, 12, 22, 23]. In the described case of a woman with CD, exacerbated inflammatory process affected significant segments of the small intestine, leading to diarrhea, malabsorption, and excessive protein loss. Severe hypoalbuminemia was in turn the cause of fluid accumulation in the peritoneal cavity. Accumulation of fluid in peritoneal cavity increases pressure exerted on mesothelial cells which may result in higher CA125 secretion and its elevated serum level. However, the occurrence of ascites in women who required gynecological treatment in the past and who was also treated with immunomodulators and infliximab due to Crohn's disease was the reason for “oncologic anxiety,” despite the absence of changes in the ovaries imaging studies (pelvic ultrasonography, CT). There is concern that these therapies may be associated with an increased risk of malignancy [24]. Intensification of treatment, including the reintroduction of anti-TNFα, has allowed inducing and maintaining disease remission, improved the results of laboratory tests, and led to resolution of ascites. However, such decision in this case was preceded by gynecological and oncological consultations as well as invasive procedure, diagnostic laparoscopic examination.\n\n4. Conclusion\nSevere small intestine inflammation in active Crohn's disease can lead to hypoalbuminemia and ascites. Nonspecific increase of CA125 (known as ovarian cancer marker in females) serum level may be a consequence of ascites, as well as gut inflammation. Such a course of disease with increasing levels of serum CA125 creates a major diagnostic problem in women with Crohn's disease.\n\nAbbreviations\nCD:Crohn’s disease\n\nCA125:Cancer antigen 125\n\nCRP:C-reactive protein\n\nTNFα:Tumour necrosis factor α\n\n\nCT:Computed tomography.\n\nConsent\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the editor of this journal.\n\nConflict of Interests\nThe authors declare that there is no conflict of interests regarding the publication of this paper.\n\nAuthors’ Contribution\nMaria Kłopocka conceived and wrote the paper, Ariel Liebert revised the paper and wrote the paper, and Joanna Bielińska and Marcin Manerowski performed literature review and wrote the discussion. All authors approved the final revised version.\n\nFigure 1 Abdominal computed tomography (CT). CT of the abdomen shows ascites. Liver, pancreas, spleen, and kidneys look normal. Thickened wall of sigmoid and ascending colon, cecum, and a significant part of the ileum, inflammatory changes. Numerous, enlarged mesenteric lymph nodes.\n\nTable 1 Results of laboratory tests during exacerbation of the disease, follow-up, and clinical remission.\n\nParameter\tDisease\tMonth 1\tMonth 2\tRemission\tNormal values\t\nexacerbation\tMonth 6\t\nHCT\t37.9\t38.7\t39.9\t42.4\t% (37–47)\t\nHGB\t12.2\t12.3\t13.0\t13.7\tg/dL (12–16)\t\nRBC\t4.41\t4.46\t4.62\t4.72\tMillion cells/mcL (4-5)\t\nWBC\t3.87\t4.02\t4.45\t7.22\tCells/mcL (3,900–10,200)\t\nPLT\t366\t345\t331\t354\tCells/mcL (130,000–400,000)\t\nAlbumin\t2.18\t2.48\t2.57\t3.35\tg/dL (3.5–5.2)\t\nCRP\t18.77\t12.24\t10.35\t5.49\tmg/L (0-1)\t\nCA 125\t190.3\t121.2\t120.5\t35.19\tU/mL (<35)\t\nHCT: hematocrit; HGB: hemoglobin; RBC: red blood cells; WBC: white blood cells; PLT: platelets; CRP-C: reactive protein; CA125: cancer antigen 125.\n==== Refs\n1 van Assche G. Dignass A. Panes J. Beaugerie L. Karagiannis J. Allez M. Ochsenkühn T. Orchard T. Rogler G. Louis E. Kupcinskas L. Mantzaris G. Travis S. Stange E. The second European evidence-based consensus on the diagnosis and management of Crohn's disease: definitions and diagnosis Journal of Crohn's and Colitis 2010 4 1 7 27 10.1016/j.crohns.2009.12.003 2-s2.0-75149129948 \n2 Mowat C. Cole A. Windsor A. Ahmad T. Arnott I. Driscoll R. Mitton S. Orchard T. Rutter M. Younge L. Lees C. Ho G. T. Satsangi J. Bloom S. IBD Section of the British Society o f Gastroenterology. Guidelines for the managmentof inflammatory bowel disease in adults Gut 2011 60 5 571 607 21464096 \n3 Baumgart D. C. Carding S. R. Inflammatory bowel disease: cause and immunobiology The Lancet 2007 369 9573 1627 1640 10.1016/S0140-6736(07)60750-8 2-s2.0-34248136828 \n4 Perez B. H. Gipson I. K. Focus on molecules: human mucin MUC16 Experimental Eye Research 2008 87 5 400 401 10.1016/j.exer.2007.12.008 2-s2.0-54249101068 18289532 \n5 Yin B. W. T. Lloyd K. O. Molecular cloning of the CA125 ovarian cancer antigen: identification as a new mucin, MUC16 The Journal of Biological Chemistry 2001 276 29 27371 27375 10.1074/jbc.M103554200 2-s2.0-0035920171 11369781 \n6 Weiland F. Martin K. Oehler M. K. Hoffmann P. Deciphering the molecular nature of ovarian cancer biomarker CA125 International Journal of Molecular Sciences 2012 13 8 10568 10582 10.3390/ijms130810568 2-s2.0-84874047777 22949880 \n7 Moss E. L. Hollingworth J. Reynolds T. M. The role of CA125 in clinical practice Journal of Clinical Pathology 2005 58 3 308 312 10.1136/jcp.2004.018077 2-s2.0-15044354616 15735166 \n8 Sikaris K. A. CA125-A test with a change of heart Heart Lung and Circulation 2011 20 10 634 640 10.1016/j.hlc.2010.08.001 2-s2.0-80052968454 \n9 Boivin M. Lane D. Piché A. Rancourt C. CA125 (MUC16) tumor antigen selectively modulates the sensitivity of ovarian cancer cells to genotoxic drug-induced apoptosis Gynecologic Oncology 2009 115 3 407 413 10.1016/j.ygyno.2009.08.007 2-s2.0-70350572867 19747716 \n10 Comamala M. Migneault M. Beaudin J. MUC16 (CA125) regulates epithelial ovarian cancer cell growth, tumorigenesis and metastasis Gynecologic Oncology 2011 121 3 434 443 2-s2.0-79957525887 10.1016/j.ygyno.2011.02.020 21421261 \n11 Wilczak M. Rzymski P. Stryjakowska K. Stanek R. Opala T. Highly elevated levels of the antigen Ca-125 associated with inflammatory abdominal masses Archives of Medical Science 2007 3 3 278 280 2-s2.0-35448938815 \n12 Kalantri Y. Naik G. Joshi S. P. Jain A. Phatak S. Chavan R. Hemvani N. Chitnis D. S. Role of cancer antigen-125 from pleural & ascitic fluid samples in non malignant conditions Indian Journal of Medical Research 2007 125 1 25 30 2-s2.0-33947171566 17332654 \n13 Das A. K. Chakrabarti G. Dasgupta A. Dey S. K. Diagnostic role of tumor markers CEA, CA15-3, CA 19-9 and CA125 in lung cancer Indian Journal of Clinical Biochemistry 2013 28 1 24 29 10.1007/s12291-012-0257-0 24381417 \n14 Kato Y. Yamashita Y. Maeda K. Onoda N. Sawada T. Sowa M. Serum CA 125 level as a predictor of peritoneal dissemination in patients with gastric carcinoma Cancer 1998 83 12 2488 2492 9874453 \n15 Emoto S. Ishigami H. Yamashita H. Yamaguchi H. Kaisaki S. Kitayama J. Clinical significance of CA125 and CA72-4 in gastric cancer with peritoneal dissemination Gastric Cancer 2012 15 2 154 161 10.1007/s10120-011-0091-8 2-s2.0-84861526736 21892754 \n16 Kouba E. J. Lentz A. Wallen E. M. Pruthi R. S. Clinical use of serum CA-125 levels in patients undergoing radical cystectomy for transitional cell carcinoma of the bladder Urologic Oncology 2009 27 5 486 490 10.1016/j.urolonc.2008.03.019 2-s2.0-69249133874 18555706 \n17 Lee K. F. Lin C. L. Chang H. Y. Huang C. K. Tuberculous peritonitis in a haemodialysis patient with elevated serum CA 125 and hypercalcaemia International Journal of Clinical Practice 2005 59 147 56 59 10.1111/j.1368-504X.2005.00401.x 2-s2.0-33845455010 \n18 Yilmaz M. B. Nikolaou M. Solal A. C. Tumour biomarkers in heart failure: is there a role for CA-125? European Journal of Heart Failure 2011 13 6 579 583 10.1093/eurjhf/hfr022 2-s2.0-79957810943 21525015 \n19 Núñez J. Núñez E. Consuegra L. Sanchis J. Bodí V. Martínez-Brotons A. Bertomeu-González V. Robles R. Bosch M. J. Fácila L. Darmofal H. Llàcer A. Carbohydrate antigen 125: an emerging prognostic risk factor in acute heart failure? Heart 2007 93 6 716 721 10.1136/hrt.2006.096016 2-s2.0-34249278859 17164487 \n20 Monteiro S. franco F. Costa S. Monteiro P. Vieira H. Coelho L. Oliveira L. Providência L. A. Prognostic value of CA125 in advanced heart failure patients International Journal of Cardiology 2010 140 1 115 118 10.1016/j.ijcard.2008.11.023 2-s2.0-77949540833 19285353 \n21 D'Aloia A. Pezzali N. Bugatti S. Curnis A. Cas L. D. Long-term prognostic value of CA 125 serum levels in mild to moderate heart failure patients Journal of Cardiac Failure 2012 18 1 68 73 10.1016/j.cardfail.2011.09.012 2-s2.0-84855706503 22196844 \n22 Silberstein L. B. Rosenthal A. N. Coppack S. W. Noonan K. Jacobs I. J. Ascites and a raised serum Ca 125—confusing combination Journal of the Royal Society of Medicine 2001 94 11 581 582 2-s2.0-0035165370 11691896 \n23 Khalil R. B. Rassi P. E. Chammas N. Obeid J. Ghabach M. Sakr C. Itani T. Farhat S. Myxedema ascites with high CA-125: case and a review of literature World Journal of Hepatology 2013 5 2 86 89 10.4254/wjh.v5.i2.86 2-s2.0-84879168963 23646234 \n24 Mason M. Siegel C. A. Do inflammatory bowel disease therapies cause cancer? Inflammatory Bowel Diseases 2013 19 6 1306 1321 10.1097/MIB.0b013e3182807618 2-s2.0-84879195556 23470503\n\n", "fulltext_license": "CC BY", "issn_linking": null, "issue": "2014()", "journal": "Case reports in medicine", "keywords": null, "medline_ta": "Case Rep Med", "mesh_terms": null, "nlm_unique_id": "101512910", "other_id": null, "pages": "981726", "pmc": null, "pmid": "25506366", "pubdate": "2014", "publication_types": "D016428:Journal Article", "references": "17164487;21525015;17499605;15875624;9874453;11369781;21421261;23470503;21464096;17332654;19285353;19747716;20822954;18289532;15735166;21122488;21892754;24381417;23646234;22196844;11691896;22949880;18555706", "title": "Diagnostic Difficulties in Woman with Crohn's Disease, Ascites, and Elevated Value of Serum CA125 Antigen.", "title_normalized": "diagnostic difficulties in woman with crohn s disease ascites and elevated value of serum ca125 antigen" }
[ { "companynumb": "PL-JNJFOC-20141217056", "fulfillexpeditecriteria": "1", "occurcountry": "PL", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "INFLIXIMAB" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nTrabectedin has shown efficacy against soft tissue sarcomas (STS) and has manageable toxicity. Trabectedin is administered through central venous access devices (VAD), such as subcutaneous ports with tunneled catheters, Hickman catheters and PICC lines. Venous access related adverse events are common, but have not yet been reported in detail.\n\n\nMETHODS\nA retrospective analysis of patient files of STS patients receiving trabectedin monotherapy between 1999 and 2014 was performed in all five STS referral centers in the Netherlands. This survey focused on adverse events related to the VAD and the actions taken in response to these events.\n\n\nRESULTS\nIn the 127 patients included in this analysis, 102 venous access ports (VAP), 15 Hickman catheters and 10 PICC lines were used as primary means of central venous access. The most frequently reported adverse events at the VAD site were erythema (30.7%), pain (28.3%), inflammation (11.8%) and thrombosis (11.0%). Actions taken towards these adverse events include oral antibiotics (17.3%), VAD replacement (15.0%) or a wait-and-see policy (13.4%). In total, 45 patients (35.4%) with a subcutaneous port developed a varying degree of inflammation along the trajectory of the tunneled catheter. In all but three patients, this was a sterile inflammation, which was considered a unique phenomenon for trabectedin. Microscopic leakage of trabectedin along the venous access device and catheter was considered the most plausible cause for this adverse event. Placing the catheter deeper under the skin resolved the issue almost completely.\n\n\nCONCLUSIONS\nTrabectedin infusion commonly leads to central venous access related adverse events. Sterile inflammation along the catheter trajectory is one of the most common adverse events and can be prevented by placing the catheter deeper under the skin.", "affiliations": "Department of Medical Oncology, Leiden University Medical Center, Postbus 9600, 2300 RC Leiden, The Netherlands.;Department of Medical Oncology, Leiden University Medical Center, Postbus 9600, 2300 RC Leiden, The Netherlands.;Department of Medical Oncology, Antoni van Leeuwenhoek-Netherlands Cancer Institute, Postbus 90203, 1006 BE Amsterdam, The Netherlands.;Department of Radiology, Interventional Radiology Section, Leiden University Medical Center, Postbus 9600, 2300 RC Leiden, The Netherlands.;Department of Medical Oncology, Antoni van Leeuwenhoek-Netherlands Cancer Institute, Postbus 90203, 1006 BE Amsterdam, The Netherlands.;Department of Medical Oncology, Radboud University Medical Center, Postbus 9101, 6500 HB Nijmegen, The Netherlands.;Department of Medical Oncology, University of Groningen, University Medical Center Groningen, Postbus 30.001, 9700 RB Groningen, The Netherlands.;Department of Medical Oncology, Erasmus MC Cancer Institute, Postbus 2040, 3000 CA Rotterdam, The Netherlands.;Department of Medical Oncology, Leiden University Medical Center, Postbus 9600, 2300 RC Leiden, The Netherlands.", "authors": "Verboom|Michiel C|MC|;Ouwerkerk|Jan|J|;Steeghs|Neeltje|N|;Lutjeboer|Jacob|J|;Martijn Kerst|J|J|;van der Graaf|Winette T A|WTA|;Reyners|Anna K L|AKL|;Sleijfer|Stefan|S|;Gelderblom|Hans|H|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1186/s13569-017-0066-6", "fulltext": "\n==== Front\nClin Sarcoma ResClin Sarcoma ResClinical Sarcoma Research2045-3329BioMed Central London 6610.1186/s13569-017-0066-6ResearchCentral venous access related adverse events after trabectedin infusions in soft tissue sarcoma patients; experience and management in a nationwide multi-center study Verboom Michiel C. 0031715263486m.c.verboom@lumc.nl 1Ouwerkerk Jan j.ouwerkerk@lumc.nl 1Steeghs Neeltje n.steeghs@nki.nl 2Lutjeboer Jacob j.lutjeboer@lumc.nl 3Martijn Kerst J. j.kerst@nki.nl 2van der Graaf Winette T. A. winette.vandergraaf@radboudumc.nl 45Reyners Anna K. L. a.k.l.reyners@umcg.nl 6Sleijfer Stefan s.sleijfer@erasmusmc.nl 7Gelderblom Hans a.j.gelderblom@lumc.nl 11 0000000089452978grid.10419.3dDepartment of Medical Oncology, Leiden University Medical Center, Postbus 9600, 2300 RC Leiden, The Netherlands 2 grid.430814.aDepartment of Medical Oncology, Antoni van Leeuwenhoek-Netherlands Cancer Institute, Postbus 90203, 1006 BE Amsterdam, The Netherlands 3 0000000089452978grid.10419.3dDepartment of Radiology, Interventional Radiology Section, Leiden University Medical Center, Postbus 9600, 2300 RC Leiden, The Netherlands 4 0000 0004 0444 9382grid.10417.33Department of Medical Oncology, Radboud University Medical Center, Postbus 9101, 6500 HB Nijmegen, The Netherlands 5 0000 0001 1271 4623grid.18886.3fThe Institute of Cancer Research and the Royal Marsden NHS Foundation Trust, 123 Old Brompton Road, London, SW7 3RP UK 6 Department of Medical Oncology, University of Groningen, University Medical Center Groningen, Postbus 30.001, 9700 RB Groningen, The Netherlands 7 000000040459992Xgrid.5645.2Department of Medical Oncology, Erasmus MC Cancer Institute, Postbus 2040, 3000 CA Rotterdam, The Netherlands 31 1 2017 31 1 2017 2017 7 221 11 2016 9 1 2017 © The Author(s) 2017\nOpen AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nTrabectedin has shown efficacy against soft tissue sarcomas (STS) and has manageable toxicity. Trabectedin is administered through central venous access devices (VAD), such as subcutaneous ports with tunneled catheters, Hickman catheters and PICC lines. Venous access related adverse events are common, but have not yet been reported in detail.\n\nMethods\nA retrospective analysis of patient files of STS patients receiving trabectedin monotherapy between 1999 and 2014 was performed in all five STS referral centers in the Netherlands. This survey focused on adverse events related to the VAD and the actions taken in response to these events.\n\nResults\nIn the 127 patients included in this analysis, 102 venous access ports (VAP), 15 Hickman catheters and 10 PICC lines were used as primary means of central venous access. The most frequently reported adverse events at the VAD site were erythema (30.7%), pain (28.3%), inflammation (11.8%) and thrombosis (11.0%). Actions taken towards these adverse events include oral antibiotics (17.3%), VAD replacement (15.0%) or a wait-and-see policy (13.4%). In total, 45 patients (35.4%) with a subcutaneous port developed a varying degree of inflammation along the trajectory of the tunneled catheter. In all but three patients, this was a sterile inflammation, which was considered a unique phenomenon for trabectedin. Microscopic leakage of trabectedin along the venous access device and catheter was considered the most plausible cause for this adverse event. Placing the catheter deeper under the skin resolved the issue almost completely.\n\nConclusion\nTrabectedin infusion commonly leads to central venous access related adverse events. Sterile inflammation along the catheter trajectory is one of the most common adverse events and can be prevented by placing the catheter deeper under the skin.\n\nKeywords\nTrabectedinCentral venous cathetersAdverse eventsSoft tissue sarcomaissue-copyright-statement© The Author(s) 2017\n==== Body\nBackground\nCytostatic drugs infused directly into peripheral veins can have very damaging effects on these blood vessels. To ensure safe and durable administration of such agents, several methods have been developed in the past, like the arteriovenous shunt, which is no longer used for the infusion of chemotherapy [1]. In 1982, a central venous access device was introduced, that used a subcutaneous reservoir and a tunneled catheter to provide access to the superior vena cava [2]. This type of central venous catheters (CVC) allows for easy access to a patient’s circulation, incur minimal restriction in normal activities and usually at a low risk of complications [3]. Next to VAPs, other methods have also been introduced, such as the Hickman catheter and peripherally inserted CVC (PICC) lines [4, 5]. However, all devices constitute some risk of venous access related adverse events (VARAE).\n\nAs anticancer drug, trabectedin stands out as a drug with a unique mechanism of action, having effect both at the level of tumor DNA and on the tumor microenvironment [6]. It is one of the few drugs active in STS [7]. The drug has a manageable toxicity profile, but life-threatening toxicity due to uncommon adverse events has been reported [8]. Thus far several papers have mentioned VARAE, including reports on trabectedin extravasation and associated thrombi on the line tip, but no papers focusing on VARAE in detail have been published [9–12]. This article aims to systematically study VARAE observed in 127 consecutive sarcoma patients treated with trabectedin and to evaluate the measures taken to handle these problems.\n\nMethods\nA retrospective analysis of VARAE in all patients treated with trabectedin was performed in all five participating Dutch sarcoma referral centers: the Leiden University Medical Center (LUMC), the Netherlands Cancer Institute Antoni van Leeuwenhoek (NKI-AvL), the Erasmus MC Cancer Institute (EMC), the Radboud University Medical Center (RUMC) and the University Medical Center Groningen (UMCG). Patients were eligible when treated with trabectedin monotherapy for advanced STS. Data on patient characteristics were reported as well as the type of venous access device, its placement, adverse events related to its usage and the interventions to counter these events. Adverse events related to the VAD placement were ignored, as these have no direct relation with trabectedin infusions. Hence, all events described occurred after at least one cycle of trabectedin had been given.\n\nTo test for a difference in the number of cycles per VAD, a Kruskal–Wallis non-parametric test was used. To assess differences between VARAE per VAD cross tables and the Chi square were computed. All statistical analyses were performed using SPSS version 20.\n\nResults\nPatients\nIn total, 127 advanced STS patients were treated with single agent trabectedin between November 1999 and November 2014. Almost all patients were treated as part of an observational phase IV study or of the TRUSTS trial [13, 14]. Due to the inclusion criteria of these studies, trabectedin was given either as first line (15.0%), second line (59.1%), third line (16.5%), fourth line (7.1%) or as a further line of treatment (2.4%). The trabectedin treatment regimen was given at a dosage of 1.5 mg/m2 as 24 h infusion every three weeks in 89.8% of patients, the remaining patients received a lower dose (1.1–1.3 mg/m2) and/or a 3 h infusion. The most prevalent types of STS histology were leiomyosarcoma (40.9%), liposarcoma (26.0%) and synovial sarcoma (12.6%), as shown in Table 1.Table 1 Patient characteristics\n\n\tN (%)\t\nSex\t\n Female\t66 (52.0)\t\n Male\t61 (48.0)\t\nAge\t\n Median (years)\t54.3\t\n Range (years)\t25.6–79.5\t\nWHO performance score\t\n 0\t52 (40.9)\t\n 1\t66 (52.0)\t\n 2\t9 (7.1)\t\nHistology\t\n Leiomyosarcoma\t52 (40.9)\t\n Liposarcoma\t33 (26.0)\t\n Synovial sarcoma\t16 (12.6)\t\n Various others\t26 (20.5)\t\nBest response\t\n Partial response\t8 (6.3)\t\n Stable disease\t64 (50.4)\t\n Progressive disease\t45 (35.4)\t\n Not evaluable\t10 (7.9)\t\nHospital\t\n LUMC\t48 (37.8)\t\n NKI-AvL\t40 (31.5)\t\n EMC\t15 (11.8)\t\n RUMC\t12 (9.4)\t\n UMCG\t12 (9.4)\t\n\n\n\nVADs inserted\nThe VAP was used in 102 (80.3%) patients, of which 87 were identified as a Smith Medical Port-a-Cath®. Hickman catheters and PICC lines were inserted in 15 (11.8%) and 10 (7.9%) of patients, respectively. A total of 540 cycles of trabectedin were given with a median number of 4 cycles for the entire patient group. The number of cycles given did not differ significantly per VAD (data not shown).\n\nEach hospital had a clear preference for a particular type of VAD that was initially inserted; in the LUMC VAPs (100% of patients), in the NKI-AvL VAPs (95%), in the EMC the Hickman catheter (100%), in the RUMC a PICC line (66.7%) and in the UMCG VAPs (100%). VADs were inserted by a dedicated team of health care workers to ensure low incidence of complications related to the VAD placement.\n\nOf all patients, only three patients with a Hickman catheter requested their VAD to be replaced by another type of VAD. Two of these patients preferred a VAP, but did not have a VARAE at the time of replacement. In another patient, the catheter was chronically obstructed due to a thrombus at the catheter tip, which required catheter flushing by a radiologist, despite adequate antithrombotic treatment.\n\nSterile inflammation along the catheter trajectory\nOut of the 127 patients, 45 patients (35.4%) with a VAP developed a varying degree of inflammation along the catheter trajectory, which could include erythema, pain or swelling, as shown in Fig. 1. In between cycles these symptoms waned, but a few days after the following infusion a flare up was often noted. Fever was neither reported by patients, nor observed during physical examination at admission or at the outpatient clinic. The skin surrounding the port’s reservoir was not affected and the VAD could be used for infusions normally. Bacterial cultures could not identify an etiological micro-organism for these symptoms in all, but three patients.Fig. 1 Typical sterile inflammation along the venous access port catheter trajectory\n\n\n\n\nIn the first instances these symptoms were deemed a result of cellulitis and oral antibiotics were prescribed (flucloxacillin 500 mg four times daily). However, the symptoms abated only mildly and the erythema remained unchanged for weeks and existed even after the discontinuation of trabectedin therapy. Extra intravenous infusion of normal saline fluids during trabectedin infusion appeared to ease the symptoms, especially the pain.\n\nIn a single patient with port VAD, the inflammation became rampant and in the course of several weeks it led to severe skin erosion along the catheter trajectory, as shown in Fig. 2. At progression of the inflammatory aspect of the skin, the patient was treated with oral antibiotics. Due to the skin destruction, a local secondary cellulitis developed. Despite this, the patient did not feel ill. As the patient did not show symptoms of acute infection, it was decided to continue trabectedin treatment. After trabectedin was stopped due to progressive disease, the VAP remained in place and was used for dacarbazine cycles without VARAE.Fig. 2 Skin erosion along venous access port catheter trajectory due to severe sterile inflammation\n\n\n\n\nRemarkably, this complication appeared only in patients from one hospital and only after receiving several trabectedin cycles, and did not occur with any other type of cytostatic agent. As the same brand and type of VAD was used in another hospital without this complication, the dedicated teams compared their respective methods of VAD insertion. The only apparent difference found, was in the depth of the subcutaneous insertion for tunneling the catheter. Catheter insertion can be performed more or less deeper under the skin and the latter method was associated with the sterile inflammation along the catheter trajectory. Upon changing the local protocol to deepen the tunneling of the catheter, no further events of sterile inflammation of the catheter trajectory were observed.\n\nAdverse events related to VAD\nAll types of VADs used had VARAE, as shown in Table 2. For the whole patient cohort, the most common adverse events were erythema (30.7%) and pain (28.3%) at the VAD site or along the catheter trajectory. In 11.8% of patients these symptoms were diagnosed as an inflammation and/or infection, where inflammation consisted of swelling, painfulness and erythema. Blood cultures did not grow pathogenic micro-organisms. In some of these patients the ‘infection’ diagnosis could retrospectively be reclassified as the previously described sterile inflammation with near certainty. Several patients (11.0%) had a thrombus at the catheter tip at one or several instances. Often, these thrombi could be flushed with urokinase solution before proceeding to administer the trabectedin infusion without further complications. However, catheter thrombosis could also lead to VAD impairment. Remarkably, all of these patients were treated in the same hospital, which was also the hospital were VAPs were inserted with tunneled catheters deep in the epidermis. Thrombosis at the catheter tip and the sterile inflammation were not significantly associated (data not shown). The skin erosion and extravasation of trabectedin were seldom seen. Dislocation or pinch-off was not seen in any patient. Due to the small number of patients with a Hickman catheter or PICC line, no statistical differences in the incidence of VARAE could be detected. Only a single patient (0.8%), who had a Hickman catheter, had an extravasation.Table 2 Adverse events at VAD site/trajectory per venous access device\n\nN (%)\tInflammation\tErythema\tPain\tInfection\tThrombosis\tImpairment\tErosion\tExtravasation\tAll AEa\n\t\nVenous access port (102)\t35 (34.3)\t30 (29.4)\t28 (27.5)\t9 (8.8)\t11 (10.8)\t5 (4.9)\t1 (1.0)\t0 (0.0)\t44 (43.1)\t\nHickman line (15)\t5 (33.3)\t4 (26.7)\t4 (26.7)\t3 (20.0)\t1 (6.7)\t3 (20.0)\t0 (0.0)\t1 (6.7)\t7 (46.7)\t\nPICC line (10)\t5 (50.0)\t5 (50.0)\t4 (40.0)\t3 (30.0)\t2 (20.0)\t1 (10.0)\t0 (0.0)\t0 (0.0)\t5 (50.0)\t\nTotal\t45 (35.4)\t39 (30.7)\t36 (28.3)\t15 (11.8)\t14 (11.0)\t9 (7.1)\t1 (0.8)\t1 (0.8)\t56 (44.1)\t\n\naSummary of all types of adverse events per venous access device\n\n\n\n\nInterventions for VARAE\nOral antibiotics were given in 17.3% of patients, most often flucloxacillin, as shown in Table 3. Some patients received a prescription for oral antibiotics to be taken in case VAD related symptoms worsened. Although this was not sufficient to stop the erythema along the catheter trajectory, it may have helped against a secondary infection. In 5 patients (3.9%) VAD an infection necessitated IV antibiotics (2 patients with a VAP, 3 patients with a PICC line). Due to the severity of symptoms or VAD impairment VAD replacement was needed in 15.0% of patients. Patients with a VAP usually had the same type of VAP inserted at the contralateral side, patients with a Hickman catheter or PICC line most often received a VAP. As the problem of the sterile inflammation and other VARAE were better understood and recognized, in due course a wait-and-see policy was applied in a considerable number of patients (13.4%). Despite frequent complaints of pain at the VAD site, analgesics were only needed in a minority of these patients.Table 3 Interventions for VAD related adverse events per venous access device\n\nN (%)\tAntibiotics (oral)\tVAD replaced\tWait-and-see\tAnalgesics\tUrokinase (IV)\tAntibiotics (IV)\t\nVenous access port (102)\t19 (18.6)\t10 (9.8)\t13 (12.7)\t8 (7.8)\t8 (7.8)\t2 (2.0)\t\nHickman line (15)\t1 (6.7)\t6 (40.0)\t3 (20.0)\t2 (13.3)\t1 (6.7)\t0 (0.0)\t\nPICC line (10)\t2 (20.0)\t3 (30.0)\t1 (10.0)\t0 (0.0)\t0 (0.0)\t3 (30.0)\t\nTotal\t22 (17.3)\t19 (15.0)\t17 (13.4)\t10 (7.9%)\t9 (7.1)\t5 (3.9)\t\n\n\n\nDiscussion\nTrabectedin is one of the proven active drugs in the treatment of soft tissue sarcoma and is given through a central venous catheter to avoid peripheral vein damage. As treatment continues until progressive disease or unacceptable toxicity, is it important to evaluate catheter related complications. The sterile inflammation along the catheter trajectory found in this study was an unexpected VARAE and was initially poorly understood. Erythema or pain is usually taken as a sign of skin infection and treated as such. However, there were no other signs of infection such as positive cultures, and the severity of the skin complications appeared to be related to the administration of trabectedin. In addition, the erythema was most prominent along the catheter trajectory, which made a porous catheter likely to be the cause. A direct effect of trabectedin on the tissue surrounding the catheter could cause the inflammation, but this catheter porosity implies that only a small quantity of trabectedin permeates. This small quantity leads to fewer symptoms compared to a full trabectedin extravasation, as has been reported in literature [11].\n\nTo investigate the hypothesis of catheter porosity, the manufacturer of trabectedin, PharmaMar, offered to test a used catheter. A VAP was available that was previously used in a patient who had received several cycles of trabectedin with symptoms of sterile inflammation alongside the catheter trajectory and from whom the VAP was removed because of disease progression. The objective of the test was to determine if trabectedin permeates from the internal surface to the outside of the catheter during a 24 h infusion. High-performance liquid chromatography with diode array detection (HPLC–DAD) and multi-syringe flow injection system (MS-FIA) methods were used for detection of trabectedin in the dextrose 5% solution the VAP was submerged in. Neither test could detect trabectedin in samples taken from the dextrose 5% solution, which ruled out gross catheter porosity (PharmaMar communication). In our view, however, this could not rule out sub lower-limit of quantification leakage.\n\nNon-infectious inflammation of the VAD site of various severity was also reported by Hoicyk et al. in addition of thrombi at the catheter tip. It was hypothesized that increased resistance due to small thrombi may be associated with drug backspill [12]. In the current study, neither an association of sterile inflammation and thrombosis was found, nor was reduced flow through the catheter observed. Catheter thrombosis occurred in several patients, which was treated by flushing the catheter with an urokinase solution. Thrombosis prophylaxis was not initiated at the start of trabectedin therapy in any of the participating centres.\n\nIn the patient cohort only a small number of patients had PICC lines. A larger retrospective series of STS and ovarian cancer patients was reported by Martella and colleagues. Out of 45 patients with a PICC line receiving trabectedin a device dislocation was reported in two patients and an infection in another two. PICC line malfunction or VARAE requiring VAD removal did not occur [10]. This implies that PICC lines may have lower incidence of associated toxicity than our current cohort suggests. However, the number of VARAE in patients using a PORT was also lower. Due to the retrospective nature of this patient series, relative underreporting compared to our study may have occurred, as almost all patient in this cohort where treated as part of a clinical trial.\n\nThe usage of a disposable elastomeric pump to administer a 24-h trabectedin infusion has been described [9]. Patients could choose for a regular VAP or a Baxter LV10 Pump which allowed patients to spend the night at home. Out of 28 patients 21 chose the ambulatory pump. This method was considered feasible and safe. However, most patients will receive trabectedin trough conventional VAPs reported on in this paper, and no data is available comparing these different techniques.\n\nCompared to published safety data, the rate of observed trabectedin extravasation of 0.8% in our series was similar to 0.5% reported in large pooled analysis of 1132 patients who received single agent trabectedin [8].\n\nConclusions\nDespite the use of central venous access devices, trabectedin can cause local sterile inflammation along the catheter trajectory, in particular in venous access ports. Positioning the port’s catheter deeper in the subcutis appears to be the most efficient way to prevent this complication.\n\n\nAbbreviations\nSTSsoft tissue sarcomas\n\nVADvenous access devices (any type)\n\nPICC lineperipherally inserted CVC line\n\nCVCcentral venous catheter\n\nVAPvenous access ports (such as a Port-a-Cath)\n\nVARAEvenous access related adverse events\n\nAuthors’ contributions\nHG designed the study, MV collected, analysed the data and drafted the first manuscript, all authors participated in patient care and manuscript writing. All authors read and approved the final manuscript.\n\nAcknowledgements\nNot applicable.\n\nCompeting interests\nHG: PharmaMar provided a research grant to the Leiden University Medical Center to perform a health outcomes study, which was also supported by a ZonMW grant. This study is a sub-study of the health outcomes study. MV: PharmaMar provided a research grant to perform this study, as sub-study of a health outcomes study. None for the other authors.\n\nAvailability of data and materials\nThe patients information used for this study is not publicly available due to privacy regulations.\n\nConsent for publication\nFor all patients receiving trabectedin when it was an experimental drug, written informed consent was obtained. For patients who received trabectedin as standard treatment, informed consent is not necessary.\n\nEthics approval and consent to participate\nAlmost all patients were treated in a observational phase IV study or the phase IIb TRUSTS trial and written informed consent was obtained from all patients. Some patients were treated during early development pharmacokinetics studies with written informed consent. A copy of these written informed consent papers is available for review by the Editor-in-Chief of this journal. A final group was treated with trabectedin at a time when this drug was approved for clinical use in the Netherlands and this treatment was not considered experimental and no ethics approval or consent to participate is necessary.\n==== Refs\nReferences\n1. Lemmers NW Gels ME Sleijfer DT Plukker JT van der Graaf WT de Langen ZJ Complications of venous access ports in 132 patients with disseminated testicular cancer treated with polychemotherapy J Clin Oncol 1996 14 2916 2922 8918488 \n2. Niederhuber JE Ensminger W Gyves JW Liepman M Doan K Cozzi E Totally implanted venous and arterial access system to replace external catheters in cancer treatment Surgery 1982 92 706 712 7123491 \n3. Di Carlo I Pulvirenti E Mannino M Toro A Increased use of percutaneous technique for totally implantable venous access devices. Is it real progress? A 27-year comprehensive review on early complications Ann Surg Oncol 2010 17 1649 1656 10.1245/s10434-010-1005-4 20204533 \n4. Hickman RO Buckner CD Clift RA Sanders JE Stewart P Thomas ED A modified right atrial catheter for access to the venous system in marrow transplant recipients Surg Gynecol Obstet 1979 148 871 875 109934 \n5. Hoshal VL Jr Total intravenous nutrition with peripherally inserted silicone elastomer central venous catheters Arch Surg 1975 110 644 646 10.1001/archsurg.1975.01360110190032 805577 \n6. D’Incalci M Badri N Galmarini CM Allavena P Trabectedin, a drug acting on both cancer cells and the tumour microenvironment Br J Cancer 2014 111 646 650 10.1038/bjc.2014.149 24755886 \n7. Le Cesne A Cresta S Maki RG Blay JY Verweij J Poveda A A retrospective analysis of antitumour activity with trabectedin in translocation-related sarcomas Eur J Cancer 2012 48 3036 3044 10.1016/j.ejca.2012.05.012 22749255 \n8. Le Cesne A Yovine A Blay JY Delaloge S Maki RG Misset JL A retrospective pooled analysis of trabectedin safety in 1132 patients with solid tumors treated in phase II clinical trials Invest New Drugs 2012 30 1193 1202 10.1007/s10637-011-9662-0 21484250 \n9. Schoffski P Cerbone L Wolter P De Wever I Samson I Dumez H Administration of 24-h intravenous infusions of trabectedin in ambulatory patients with mesenchymal tumors via disposable elastomeric pumps: an effective and patient-friendly palliative treatment option Onkologie 2012 35 14 17 10.1159/000335879 22310339 \n10. Martella F Salutari V Marchetti C Pisano C Di NM Pietta F A retrospective analysis of trabectedin infusion by peripherally inserted central venous catheters: a multicentric Italian experience Anticancer Drugs 2015 26 990 994 10.1097/CAD.0000000000000275 26241804 \n11. Theman TA Hartzell TL Sinha I Polson K Morgan J Demetri GD Recognition of a new chemotherapeutic vesicant: trabectedin (ecteinascidin-743) extravasation with skin and soft tissue damage J Clin Oncol 2009 27 e198 e200 10.1200/JCO.2008.21.6473 19805684 \n12. Hoiczyk M Grabellus F Podleska L Ahrens M Schwindenhammer B Taeger G Trabectedin in metastatic soft tissue sarcomas: role of pretreatment and age Int J Oncol 2013 43 23 28 23652821 \n13. Bui-Nguyen B Butrynski JE Penel N Blay JY Isambert N Milhem M A phase IIb multicentre study comparing the efficacy of trabectedin to doxorubicin in patients with advanced or metastatic untreated soft tissue sarcoma: the TRUSTS trial Eur J Cancer 2015 51 1312 1320 10.1016/j.ejca.2015.03.023 25912752 \n14. Verboom M, Kerst M, Van der Graaf W, Sleijfer S, Reyners A, Steeghs N et al. Trabectedin in patients with advanced soft tissue sarcoma (STS): results from a prospective, observational phase IV study in the Netherlands. 20th CTOS Meeting 2014, abstract Poster 90.\n\n", "fulltext_license": "CC BY", "issn_linking": "2045-3329", "issue": "7()", "journal": "Clinical sarcoma research", "keywords": "Adverse events; Central venous catheters; Soft tissue sarcoma; Trabectedin", "medline_ta": "Clin Sarcoma Res", "mesh_terms": null, "nlm_unique_id": "101577890", "other_id": null, "pages": "2", "pmc": null, "pmid": "28163887", "pubdate": "2017", "publication_types": "D016428:Journal Article", "references": "19805684;20204533;26241804;805577;21484250;22310339;24755886;8918488;7123491;22749255;109934;23652821;25912752", "title": "Central venous access related adverse events after trabectedin infusions in soft tissue sarcoma patients; experience and management in a nationwide multi-center study.", "title_normalized": "central venous access related adverse events after trabectedin infusions in soft tissue sarcoma patients experience and management in a nationwide multi center study" }
[ { "companynumb": "NL-JNJFOC-20170212697", "fulfillexpeditecriteria": "1", "occurcountry": "NL", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "TRABECTEDIN" }, "drugadditional": null, ...
{ "abstract": "Congenital hyperinsulinism (CHI) is the most common cause of persistent hypoglycaemia in neonates and infants. Medical treatment includes the use of high concentrations of glucose and combinations of diazoxide, octreotide and glucagon. We report our experience of using sirolimus, a mammalian target of rapamycin (mTOR) inhibitor, in the treatment of CHI in seven newborns who are poorly responding to standard medical therapy. Majority (87%) of infants achieved euglycaemia using a combination of oral feeding and the addition of sirolimus to standard medical treatment. One infant who failed to achieve euglycaemia even after surgery managed successfully with sirolimus. Diagnosis was confirmed by genetics evaluation; in three infants, novel mutations were detected. Outcome and long-term follow-up of all cases are described.Conclusion: Sirolimus can be considered in treatment of CHI refractory to standard medical treatment or in cases unresponsive to surgical treatment. What is Known: • Congenital hyperinsulinism (CHI) or persistent hyperinsulinaemic hypoglycaemia of infancy (PHHI) associated with mutations such as the ABBC8 or KCNJ gene known to cause hypoglycaemia refractory to standard medical treatment such as diazoxide and octreotide and may need subtotal pancreatectomy (STP). • Sirolimus, a mammalian target of rapamycin (mTOR) inhibitor, was recently reported to be useful for refractory CHI cases with variable efficacy. What is New: • Our case series describes efficacy and safety of sirolimus in seven genetically proven refractory CHI cases with mainly neonatal presentation. All patients' follow-ups are described. • Out of seven infants, six infants responded well to sirolimus, and among these one infant who failed to respond to surgery (STP) also successfully managed with sirolimus. • It highlights the right patient selection and right dose to successfully manage these cases without much adverse effects.", "affiliations": "Department of Neonatology Rainbow Children's Hospital, 500034, Hyderabad, India.;Department of Neonatology Rainbow Children's Hospital, 500034, Hyderabad, India. dchirla@gmail.com.;Department of Neonatology Rainbow Children's Hospital, 500034, Hyderabad, India.;Department of Neonatology Rainbow Children's Hospital, 500034, Hyderabad, India.;Department of Neonatology Rainbow Children's Hospital, 500034, Hyderabad, India.;Department of Pediatrics Endocrinology Rainbow Children's Hospital, 500034, Hyderabad, India.", "authors": "Panigrahy|Nalinikanta|N|http://orcid.org/0000-0003-4316-0517;Chirla|Dinesh Kumar|DK|;Bagga|Nitasha|N|;Gunda|Ranjit Kumar|RK|;Sukhija|Bharat|B|;Reddy|Leenatha|L|", "chemical_list": null, "country": "Germany", "delete": false, "doi": "10.1007/s00431-021-04209-6", "fulltext": null, "fulltext_license": null, "issn_linking": "0340-6199", "issue": null, "journal": "European journal of pediatrics", "keywords": "Hyperinsulinism; Neonate; Novel ABCC8 mutation; Refractory hypoglycaemia; Sirolimus", "medline_ta": "Eur J Pediatr", "mesh_terms": null, "nlm_unique_id": "7603873", "other_id": null, "pages": null, "pmc": null, "pmid": "34304300", "pubdate": "2021-07-24", "publication_types": "D016428:Journal Article", "references": "22231386;20550977;30247666;25324442;22190679;26504125;24645945;12959935", "title": "Sirolimus in infants with congenital hyperinsulinism (CHI) - a single-centre experience.", "title_normalized": "sirolimus in infants with congenital hyperinsulinism chi a single centre experience" }
[ { "companynumb": "IN-SUN PHARMACEUTICAL INDUSTRIES LTD-2022R1-327970", "fulfillexpeditecriteria": "1", "occurcountry": "IN", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "OCTREOTIDE" }, "drug...
{ "abstract": "Selective serotonin reuptake inhibitors (SSRIs) are widely used to treat depression. We report a case of serotonin syndrome following cardiac surgery. This syndrome is rare in the cardiac literature. The clinical features, diagnosis and management of this unusual syndrome are described. In patients with polypharmacy, it is important to take cognisance of serotonergic antidepressants and anticipate their potential interactions with drugs used peri-operatively. Early recognition and treatment is important as this condition is potentially fatal.", "affiliations": "Department of Cardiac Surgery, QEII Health Sciences Centre, Halifax Infirmary, 1796 Summer Street, Halifax, Nova Scotia B3L 4P7, Canada. sgunpat@hotmail.com", "authors": "Shanmugam|Ganesh|G|;Kent|Blaine|B|;Alsaiwadi|Turki|T|;Baskett|Roger|R|", "chemical_list": "D000701:Analgesics, Opioid; D008996:Monoamine Oxidase Inhibitors; D017367:Serotonin Uptake Inhibitors", "country": "England", "delete": false, "doi": "10.1510/icvts.2007.173104", "fulltext": null, "fulltext_license": null, "issn_linking": "1569-9285", "issue": "7(4)", "journal": "Interactive cardiovascular and thoracic surgery", "keywords": null, "medline_ta": "Interact Cardiovasc Thorac Surg", "mesh_terms": "D000701:Analgesics, Opioid; D003863:Depression; D004347:Drug Interactions; D005260:Female; D019918:Heart Valve Prosthesis Implantation; D006801:Humans; D008875:Middle Aged; D008943:Mitral Valve; D008996:Monoamine Oxidase Inhibitors; D012214:Rheumatic Heart Disease; D020230:Serotonin Syndrome; D017367:Serotonin Uptake Inhibitors", "nlm_unique_id": "101158399", "other_id": null, "pages": "656-7", "pmc": null, "pmid": "18334520", "pubdate": "2008-08", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Serotonin syndrome following cardiac surgery.", "title_normalized": "serotonin syndrome following cardiac surgery" }
[ { "companynumb": "CA-BAUSCH-BL-2021-005940", "fulfillexpeditecriteria": "1", "occurcountry": "CA", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "DIAZEPAM" }, "drugadditional": "3", ...
{ "abstract": "Chronic inflammatory demyelinating polyradiculoneuropathy (CIDP) is an immune-mediated and treatable disease that may be associated with various systemic conditions. Our objective is to describe the clinical, electrophysiological and pathological data of a series of patients with both CIDP and hemopathy. In this retrospective study, we analyzed 21 patients with CIDP and various hemopathies (malignant or not), consecutively observed for almost five years. In this particular context (with a risk of neurological complications of the hemopathy), a nerve biopsy was taken from each patient (after written consent). All the patients fulfilled the EAN/PNS electrodiagnostic criteria (2021) of CIDP: 16 with 'CIDP' and 2 with 'possible CIDP' (no data for 3 patients). For each patient, pathological analysis of nerve biopsy was compatible with the diagnosis of CIDP, and there was no evidence for hematological complication of the peripheral nervous system. In cases of peripheral neuropathy and malignant hemopathy, the possibility that the peripheral neuropathy is CIDP should not be overlooked because CIDP is clearly accessible to appropriate therapies, with high potential for a positive clinical response. If the diagnosis of CIDP is usually suspected clinically and electrophysiologically, it should be confirmed by pathological study (nerve biopsy) in certain cases. The management of such patients benefits from the collaboration of neurologists, hematologists and oncologists.", "affiliations": "Department of Neurology, National Reference Center for 'Rare Peripheral Neuropathies', University Hospital of Limoges (CHU Limoges - Dupuytren Hospital), 2 avenue Martin Luther King, 87042 Limoges, France.;Department of Neurology, Nerve-Muscle Unit, AOC National Reference Center for Neuromuscular Disorders, ALS Center, University Hospital of Bordeaux (CHU Bordeaux - Pellegrin Hospital), place Amélie Raba-Léon, 33000 Bordeaux, France.;Department of Pathology, University Hospital of Limoges (CHU Limoges - Dupuytren Hospital), 2 avenue Martin Luther King, 87042 Limoges, France.;Department of Neurology, National Reference Center for 'Rare Peripheral Neuropathies', University Hospital of Limoges (CHU Limoges - Dupuytren Hospital), 2 avenue Martin Luther King, 87042 Limoges, France.;Department of Neurology, National Reference Center for 'Rare Peripheral Neuropathies', University Hospital of Limoges (CHU Limoges - Dupuytren Hospital), 2 avenue Martin Luther King, 87042 Limoges, France.;Department of Neurology, National Reference Center for 'Rare Peripheral Neuropathies', University Hospital of Limoges (CHU Limoges - Dupuytren Hospital), 2 avenue Martin Luther King, 87042 Limoges, France.;Department of Neurology, Cahors Hospital (CH Cahors), 335 rue Wilson, 46005 Cahors, France.;Department of Neurology, ALS Center, University Hospital of Tours (CHU Tours - Bretonneau Hospital), 2 boulevard Tonnellé, 37044 Tours, France.;Department of Neurology, National Reference Center for 'Rare Peripheral Neuropathies', University Hospital of Limoges (CHU Limoges - Dupuytren Hospital), 2 avenue Martin Luther King, 87042 Limoges, France.;Department of Neurology, National Reference Center for 'Rare Peripheral Neuropathies', University Hospital of Limoges (CHU Limoges - Dupuytren Hospital), 2 avenue Martin Luther King, 87042 Limoges, France. Electronic address: jean-michel.vallat@unilim.fr.", "authors": "Deschamps|Nathalie|N|;Mathis|Stéphane|S|;Duchesne|Mathilde|M|;Ghorab|Karima|K|;Gallouedec|Gaël|G|;Richard|Laurence|L|;Boulesteix|Jean-Marc|JM|;Corcia|Philippe|P|;Magy|Laurent|L|;Vallat|Jean-Michel|JM|", "chemical_list": null, "country": "Netherlands", "delete": false, "doi": "10.1016/j.jns.2021.118055", "fulltext": null, "fulltext_license": null, "issn_linking": "0022-510X", "issue": "429()", "journal": "Journal of the neurological sciences", "keywords": "CIDP; Hemopathy; Lymphoma; Monoclonal gammopathy; Nerve biopsy; Neuropathy", "medline_ta": "J Neurol Sci", "mesh_terms": "D001706:Biopsy; D006801:Humans; D010525:Peripheral Nerves; D017933:Peripheral Nervous System; D020277:Polyradiculoneuropathy, Chronic Inflammatory Demyelinating; D012189:Retrospective Studies", "nlm_unique_id": "0375403", "other_id": null, "pages": "118055", "pmc": null, "pmid": "34455207", "pubdate": "2021-10-15", "publication_types": "D016428:Journal Article", "references": null, "title": "CIDP and hemopathies, an underestimated association.", "title_normalized": "cidp and hemopathies an underestimated association" }
[ { "companynumb": "FR-BEH-2021137932", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "METHOTREXATE" }, "drugadditional": "3", "dr...
{ "abstract": "Macrophage activation syndrome (MAS) is a form of hemophagocytic lymphohistocytosis that occurs in patients with a variety of inflammatory rheumatologic conditions. Traditionally, it is noted in pediatric patients with systemic juvenile idiopathic arthritis and systemic lupus erythematous. It is a rapidly progressive and life-threatening syndrome of excess immune activation with an estimated mortality rate of 40% in children. It has become clear recently that MAS occurs in adult patients with underlying rheumatic inflammatory diseases. In this article, we describe 6 adult patients with likely underlying MAS. This case series will outline factors related to diagnosis, pathophysiology, and review present therapeutic strategies.", "affiliations": "Texas Tech University Health Sciences Center, Lubbock, TX, USA.;Texas Tech University Health Sciences Center, Lubbock, TX, USA.;Texas Tech University Health Sciences Center, Lubbock, TX, USA.;Texas Tech University Health Sciences Center, Lubbock, TX, USA.", "authors": "Warmoth|Taylor|T|;Ramesh|Malvika|M|;Iwuji|Kenneth|K|0000-0001-5489-233X;Pixley|John S|JS|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1177/23247096211026406", "fulltext": "\n==== Front\nJ Investig Med High Impact Case Rep\nJ Investig Med High Impact Case Rep\nHIC\nsphic\nJournal of Investigative Medicine High Impact Case Reports\n2324-7096\nSAGE Publications Sage CA: Los Angeles, CA\n\n34180255\n10.1177/23247096211026406\n10.1177_23247096211026406\nCase Report\nMacrophage Activation Syndrome in Adults: A Retrospective Case Series\nWarmoth Taylor MD 1*\nRamesh Malvika BS 1\nhttps://orcid.org/0000-0001-5489-233X\nIwuji Kenneth MD 1\nPixley John S. MD 1\n1 Texas Tech University Health Sciences Center, Lubbock, TX, USA\nJohn S. Pixley, MD, Department of Internal Medicine, Division of Rheumatology/Immunology, Texas Tech University Health Sciences Center, 3601 4th Street, Mailstop 9410, Lubbock, TX 79430, USA. Email: john.pixley@ttuhsc.edu\n* Current address: University of Arkansas for Medical Sciences, 4301 W. Markham Street #509, Little Rock, AR 72205, USA.\n\n28 6 2021\nJan-Dec 2021\n9 2324709621102640610 2 2021\n20 4 2021\n20 5 2021\n© 2021 American Federation for Medical Research\n2021\nAmerican Federation for Medical Research\nhttps://creativecommons.org/licenses/by-nc/4.0/ This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access page (https://us.sagepub.com/en-us/nam/open-access-at-sage).\nMacrophage activation syndrome (MAS) is a form of hemophagocytic lymphohistocytosis that occurs in patients with a variety of inflammatory rheumatologic conditions. Traditionally, it is noted in pediatric patients with systemic juvenile idiopathic arthritis and systemic lupus erythematous. It is a rapidly progressive and life-threatening syndrome of excess immune activation with an estimated mortality rate of 40% in children. It has become clear recently that MAS occurs in adult patients with underlying rheumatic inflammatory diseases. In this article, we describe 6 adult patients with likely underlying MAS. This case series will outline factors related to diagnosis, pathophysiology, and review present therapeutic strategies.\n\nmacrophage activation syndrome\nadults\nJT and Margaret Talkington Endowment cover-dateJanuary-December 2021\ntypesetterts1\n==== Body\nIntroduction\n\nMacrophage activation syndrome (MAS) is a subgroup of hemophagocytic lymphohistocytosis (HLH) syndrome occurring in patients with rheumatologic inflammatory disease. Other subgroups include familial HLH (fHLH), infection-associated HLH, and malignancy associated HLH. All share a phenotype of cytokine storm. fHLH is considered a primary disorder associated with a genetic mutation although it is now recognized it may overlap with acquired conditions. MAS is caused by immune dysregulation that causes a defect in cytotoxic pathways natural killer cells and cytotoxic T lymphocytes. Consequently, this immune dysregulation will lead to cytokine storm and accumulation of activated lymphocytes and macrophages in different organs and tissues.1-5\n\nClinical Presentation\n\nPresent understanding of the clinical presentations of MAS is primarily based on observations in systemic juvenile idiopathic arthritis (sJIA) patients and/or pediatric HLH patients. Features of MAS presentation can vary from a “subclinical” to a severe and potentially life-threatening episode. The difficulty in making the diagnosis of MAS lies in the fact that clinical presentations, even severe cases, can vary drastically as summarized in Table 1.\n\nTable 1. Clinical Presenting Features Suggestive of MAS.\n\nClinical presentation\tCorrelating laboratory findings\t\nFever of unknown origin\tNegative blood cultures, elevated ferritin\t\nLiver failure\tElevated AST\t\nThrombocytopenia/DIC/coagulopathy\tProlonged PT, elevated fibrin split products\t\nEncephalitis\tElevated CSF protein, EEG evidence of encephalopathy\t\nAbbreviations: AST, aspartate aminotransferase; DIC, disseminated intravascular coagulation; PT, prothrombin time; CSF, cerebrospinal fluid; EEG, electroencephalography.\n\nTypically, the disease presents with a continuous high fever without an identifiable source. Additional symptoms such as lymphadenopathy, rash, hemorrhagic manifestations, or neurological dysfunction including headache, lethargy, irritability, altered mental status, and even seizures or coma can occur. Hepatosplenomegaly is almost always present. Although some of these findings are present in the patient with HLH, they typically worsen acutely in the onset of MAS. More severe and often fatal cases of MAS lead to multi-organ failure.\n\nHerein, we present a retrospective series of patients with underlying inflammatory rheumatic diseases who likely developed MAS and/or cytokine storm syndrome. Informed consent for the patient information to be published in this article was not obtained because they were either deceased or unavailable to consent. The Texas Tech University Health Science Center Institutional Review Board does not require ethical approval for reporting retrospective case series. Because of the difficulty in establishing the diagnosis, an HScore was developed to assist clinicians in predicting the likelihood of having MAS (Table 2). 6\n\nTable 2. HScore Variables.\n\nVariable\t\tPoints\t\nKnown underlying immunosuppression\tNo\t0\t\nYes\t18\t\nTemperature, °F (°C)\t<101.1 (<38.4)\t0\t\n101.1-102.9 (38.4-39.4)\t33\t\n>102.9 (>39.4)\t49\t\nOrganomegaly\tNo\t0\t\nHepatomegaly or splenomegaly\t23\t\nHepatomegaly and splenomegaly\t38\t\nNumber of cytopenias\t1 lineage\t0\t\n2 lineages\t24\t\n3 lineages\t34\t\nFerritin, ng/mL (µg/L)\t<2000\t0\t\n2000-6000\t35\t\n>6000\t50\t\nTriglyceride, mg/dL (mmol/L)\t<132.7 (<1.5)\t0\t\n132.7-354 (1.5-4)\t44\t\n>354 (>4)\t64\t\nFibrinogen, mg/dL (g/L)\t>250 (>2.5)\t0\t\n≤250 (≤2.5)\t30\t\nAST, U/L\t<30\t0\t\n≥30\t19\t\nHemophagocytosis features on bone marrow aspirate\tNo\t0\t\nYes\t35\t\nAbbreviation: AST, aspartate aminotransferase.\n\nCase Presentations\n\nCase 1\n\nA 52-year-old female with a 2-year history of dermatomyositis was referred to our facility for refractory disease. Over the prior 2 years, she experienced multiple disease exacerbations. Treatment included methotrexate, mycophenolate mofetil, rituximab, intravenous immunoglobulin, and high-dose corticosteroids with no significant improvement. Within several months of her diagnosis, her ability to complete basic activities of daily living declined to the point that she required gastrostomy tube placement due to dysphagia and became wheelchair bound. One month prior to this hospitalization, she was diagnosed with splenic vein thrombosis. Physical examination revealed a diffuse macular rash on her torso and extremities. She was profoundly weak on muscle testing in all 4 extremities. Anasarca was also evident. She underwent colonoscopy to evaluate abdominal pain and fecal occult blood. Colonoscopy revealed ischemic colitis. Subsequent biopsies detected cytomegalovirus. Laboratory studies are presented in Table 3. Of note, ferritin and soluble interleukin-2 receptor levels were significantly elevated. She also had profound pancytopenia. Workup for malignancy was negative. Peripheral smear showed pancytopenia as well as schistocytes suggestive of microangiopathy. Given the severity of her illness and poor prognosis, her family asked for palliative care only. She passed away several minutes after being compassionately extubated.\n\nTable 3. Laboratory Values in 6 Presented Cases.\n\n\tCase\t\n\t1\t2\t3\t4\t5\t6\t\nAge (years)\t52\t26\t29\t27\t35\t24\t\nGender\tFemale\tFemale\tMale\tFemale\tMale\tFemale\t\nInclusion criteria\t\n Underlying rheumatic diagnosis\tDermatomyositis\tSystemic lupus erythematosus\tSystemic lupus erythematosus\tSystemic lupus erythematosus\tSystemic lupus erythematosus\tSystemic lupus erythematosus\t\n Elevated ferritin (ng/mL)\t3126\t5415\t6606\t24 608\t2937\t1844\t\n Refractory thrombocytopenia or any other cytopenia (platelet = 163 000-337 000/µL)\t18\t7\t3\t18\t13\t6\t\nD-Dimer (<500 ng/mL)\t61\t3846\tNT\t3816\tNT\t2438\t\nFibrinogen (200-393 mg/dL)\t6374\t239\t114\t121\tNT\t221\t\nProthrombin time (9.4-12.5 seconds)\t18.1\t19.8\t14.9\t36.6\t21.1\t11.5\t\nHepatic transaminases\t\n AST (5-37 IU/L)\t115\t87\t388\t2370\t35\t25\t\n ALT (5-41 IU/L)\t81\t91\t368\t2575\t30\t39\t\nsIL-2R (532-1891 pg/mL)\t10 642\t7264\t34 298\t4246\t14 360\t3499\t\nAutoantibodies\tNT\tAnti-smith, chromatin and dsDNA\tANA, anti-centromere, anti-dsDNA antibodies\tAnti-centromere and anti-dsDNA antibodies\tAnti-cardiolipin and anti-centromere antibodies\tdsDNA Smith and anti-chromatin antibodies\t\nComplement determinations\t\n C3 (88-201 mg/dL)\tNT\t7\t28\t30\t33\t80\t\n C4 (15-45 mg/dL)\tNT\t3\t5\t2\t3\t11\t\nIVIG\tYes\tNo\tNo\tNo\tYes\tYes\t\nHScore (>169 indicates great likelihood of hemophagocytic syndrome)\t235 (98% to 99%)\t306 (>99%)\t186 (70% to 80%)\t195 (80% to 88%)\t106 (1% to 3%)\t145 (16% to 25%)\t\nModified HScore (using soluble IL-2R >2× normal instead of organomegaly)\t258 (>99%)\t306 (>99%)\t209 (88% to 93%)\t218 (93% to 96%)\t129 (5% to 9%)\t168 (40% to 54%)\t\nDIC score >5 indicates overt DIC\t9\t10\t9\t9\t6\t9\t\nAbbreviations: AST, aspartate aminotransferase; ALT, alanine aminotransferase; IVIG, intravenous immunoglobulin; DIC, disseminated intravascular coagulation.\n\nThe patient had an HScore of 235 suggesting a 98% to 99% likelihood of hemophagocytic syndrome and a disseminated intravascular coagulation (DIC) score of 10 indicating overt DIC. She was thus diagnosed with MAS in the setting of both rheumatic disease and severe infection.\n\nCase 2\n\nA 26-year-old female with 8-year history of systemic lupus erythematosus (SLE) was hospitalized with refractory (>1 year) autoimmune hemolytic anemia and subsequent pancytopenia. Treatment with prednisone and azathioprine, rituximab, and cyclophosphamide failed to improve her hematologic status. Her hospital course included neutropenic fever, sepsis, and encephalopathy. Elevation in ferritin and interleukin 2 receptor and HScore suggested MAS (see Table 3). She received a short course of tocilizumab followed by etoposide. There was temporary improvement from the etoposide but she succumbed from sepsis.\n\nThe patient had an HScore of 306 indicating a >99% likelihood of a hemophagocytic syndrome and a DIC score of 10 indicating overt DIC.\n\nCase 3\n\nA 29-year-old male with 10-year history of ESRD (end-stage renal disease) secondary to systemic lupus on peritoneal dialysis presented with aplasia, severe mucositis, rash, and fever. Laboratory studies revealed pancytopenia, positive ANA, and dropping complements (see Table 3). Physical examination showed fever above 102 °F, cervical lymphadenopathy, and diffuse bullous rash. Peritoneal fluid grew Enterobacter cloacae and Enterococcus and he was started on appropriate antibiotics. Due to his serologic findings and cytopenias, he was treated with methylprednisolone, mycophenolate, and hydroxychloroquine. Ferritin was elevated at 6606 and platelets were decreased drastically at 3. Fibrinogen was low at 114 and aspartate aminotransferase was elevated at 388. He was found to have elevated soluble interleukin 2 receptor at 34 298 pg/mL (Table 3). Bone marrow evaluation demonstrated marrow aplasia. The patient’s condition continued to decline despite treatment, and he became unresponsive, eventually went into cardiac arrest and passed away.\n\nHis HScore was 186, indicating a 70% to 80% likelihood of hemophagocytic syndrome such as MAS. He was found to have a DIC score of 9 suggesting overt DIC.\n\nCase 4\n\nThe patient was a 27-year-old female with 5-year medical history of SLE who presented with deep infection to the leg. The patient was treated with mycophenolate and prednisone for her lupus. She developed renal insufficiency, respiratory failure, hypofibrinogenemia, blood loss anemia, pancytopenia (with profound thrombocytopenia), deep vein thrombosis lower extremity, lactic acidosis, and septic pulmonary embolism during her hospitalization. Bronchoscopy revealed diffuse hemorrhage. Despite various treatments, such as platelets, plasma, and packed red blood cell transfusions, the patient remained pancytopenic with diffuse bleeding. Treatment with high-dose steroids, plaquenil, and mycophenolate were to no avail. Soluble interleukin 2 receptor was elevated at 4246 (pg/mL) and aspartate aminotransferase was dramatically increased at 2370. D-dimer was elevated at 3816 and fibrinogen was decreased at 121. The patient had increased ferritin at 24 608. She had severe coagulopathy and went into cardiac arrest passing away soon after.\n\nThe patient had an HScore of 195 indicating an 80% to 88% likelihood of hemophagocytic syndrome and her DIC score was 9 suggesting overt DIC.\n\nCase 5\n\nA 35-year-old male with a long history of antiphospholipid syndrome was admitted with infarcted fingers and severe pulmonary hypertension. Laboratory evaluation suggested an overlap syndrome with the presence of anti-centromere, anti-dsDNA, and low complements (see Table 3). Treatment included high-dose steroids, hydroxychloroquine, and mycophenolate with no significant effect. The patient’s health deteriorated with multi-organ failure including refractory thrombocytopenia.\n\nIntravenous immunoglobulin was not effective despite the presence of megakaryocytes in the bone marrow. MAS was considered based on elevations in ferritin, IL-2 receptor (see Table 3), and refractory thrombocytopenia.\n\nHowever, his HScore was low due to missing data. Similarly, his DIC score was only 6 due to absence of D-dimer and fibrinogen determinations. The patient’s condition continued to deteriorate. He was unresponsive and given his poor prognosis no further interventions were attempted and he succumbed shortly thereafter.\n\nCase 6\n\nThe patient is a 24-year-old female with medical history of SLE and lupus nephritis who developed refractory thrombocytopenia and pancytopenia. Treatment included cyclophosphamide, mycophenolate mofetil, hydroxychloroquine, and prednisone.\n\nPhysical examination was negative for any bruising, rash, or fever, and the patient denied joint pain or bleeding at this time although she had excessive menstrual bleeding. Serologic status is outlined in Table 1. Peripheral smear showed schistocytes suggesting microangiopathy. Prior marrow examination confirmed adequate platelet production. In addition, standard treatment for immune thrombocytopenia was ineffective. She remained refractory with rising D-dimer, low fibrinogen, and elevated IL-2 receptor.\n\nIn view of the patient’s refractory thrombocytopenia and evidence for coagulopathy, she was placed on ruxolitinib (a Janus kinase 1 and 2 inhibitor) with resultant improvement in platelet counts and dropping serum ferritin levels. The patient has HScore of 145 indicating 16% to 25% chance of hemophagocytic syndrome and DIC score of 9 suggesting overt DIC.\n\nAs presented in Table 3, Patients 1 to 4 likely expired from ongoing cytokine storm or MAS. Patient 5 had an inadequate database but likely died of MAS with features consistent with catastrophic anti-phospholipid syndrome. Patient 6’s HScore is not diagnostic but we felt it was likely MAS as typical treatment for immune thrombocytopenia was unsuccessful over a year’s time with evidence of coagulopathy (elevated D-dimer), hyperferritinemia, and elevated sIL-2 receptor at >2× normal in the context of a normal marrow examination. In view of the above and failure to respond to vigorous immunosuppression including cyclophosphamide, we instituted therapy with ruloxitinib, a Janus 1 and 2 kinase inhibitor reported to be helpful in treating MAS. 5 Since beginning ruloxitinib, she has responded in all clinical parameters. Our observations with this heterogeneous group of patients point to consumptive coagulopathy as the underlying cause of each patients underlying refractory thrombocytopenia (except perhaps Patient 3 who was aplastic).\n\nDiscussion\n\nMacrophage activation syndrome is a hemophagocytic syndrome similar to HLH that is found in conjunction with rheumatic disease. It is most commonly associated with sJIA, although it may also occur in patients diagnosed with adult-onset Still’s disease, SLE, Kawasaki disease, 1 and auto-inflammatory diseases. 6 Its incidence in adult patients is increasingly recognized.7-16\n\nPathophysiology\n\nThe pathophysiology of MAS is unclear. Presently, it is thought that MAS is due to a combination of genetic mutations affecting the functionality of cytolysis (the destruction of the cell membrane, typically by osmotic forces) and overwhelming IL-18 signaling leading to pro-inflammatory cytokine storm1,17,18 (see Figure 1). Recent studies have found it likely that MAS and fHLH do have genetic overlap, with nearly 40% of patients diagnosed with MAS carrying the same mono-allelic mutation associated with cytotoxicity regulating genes as those with HLH.17,18 The absence of physiologic cytolysis prevents natural killer cell and cytotoxic T-cell mediated suppression of activated lymphocytes and results in cytokine storm most notably mediated by interferon-γ and interleukin-18.\n\nFigure 1. Multilayer model of pathogenic events leading to the development of macrophage activation syndrome (MAS) in the context of rheumatic diseases. Genetic factors and the inflammatory milieu created by the underlying rheumatic disease act synergistically to reach the threshold for MAS in the presence of an infectious trigger. Absence of perforin-dependent cytotoxicity in natural killer cells and cytotoxic T lymphocytes leads to unbridled macrophage and T cell expansion and cytokine release. 3\n\nBesides genetic predisposition, infectious triggers have been identified. In fact, in nearly half of all hemophagocytic cases, infection has been found to be associated. Epstein-Barr virus, tuberculosis, malaria, salmonella, and typhoid have been identified in rheumatic disease patients with MAS.15,16,19 Cases 1 and 3 were likely triggered by a combination of the patient’s rheumatic disease and infection.\n\nDiagnosis\n\nUnderstanding of the clinical presentations of MAS is primarily based on observations in sJIA patients. Disease presentation can vary from a “subclinical” presentation to a severe and potentially life-threatening episode which occurs in roughly 10% of those with sJIA. 2 The difficulty in making the diagnosis of MAS lies in the fact that clinical presentations, even severe, can vary as summarized in Table 1. For comparison, the criteria for diagnosis in sJIA are presented in Table 4. 20\n\nTable 4. Criteria for Diagnosis of MAS in sJIA.\n\nA febrile patient with known/suspected sJIA can be diagnosed with MAS if the following criteria are met:\t\n 1. A ferritin level >684 ng/mL PLUS any 2 of the following:\t\n  a. Platelet count ≤181 × 109/L\t\n  b. Aspartate aminotransferase level >48 U/L\t\n  c. Triglyceride level >156 mg/dL\t\n  d. Fibrinogen level ≤360 mg/dL\t\nAbbreviations: MAS, macrophage activation syndrome; sJIA, systemic juvenile idiopathic arthritis.\n\nOur observations note significant differences in clinical presentation of adult patients with rheumatologic disease with progression to MAS. Other reports note considerable similarity with sJIA and criteria for diagnosis in SLE has been suggested.21-23 The HScore (summarized in Table 2) was developed and validated with this in mind. However, rheumatic disease patients represented a minority of patients in that study. HScore differs from the diagnostic criteria for HLH by not including sIL-2 receptor concentrations. Based on the HScore validation study published by Debaugnies et al, a cutoff value of 169 corresponds to a sensitivity of 93% and specificity of 86%. 6\n\nOur patients did not have fever (perhaps because they were already on glucocorticoids) and organomegaly was not seen. MAS in sJIA is commonly seen after years of chronic inflammation likely leading to hepatosplenomegaly. The lowest levels of sIL-2 receptor in our patients were >2× the upper limit of normal. 2 In addition, our patient’s exhibited uniform evidence for ongoing DIC. All patients were thrombocytopenic refractory to standard therapies with evidence of adequate marrow-based platelet production.\n\nTreatment\n\nThe treatment for MAS remains problematic. While recommendations include vigorous treatment of the underlying rheumatic disease, we made the diagnosis based on refractoriness to standard therapy including high-dose steroids and in most patients, cyclophosphamide. There exist reports of improvement with IL-1 inhibition, IL-6 inhibition, cyclosporine, and other immunosuppressive agents that may represent instances of subclinical MAS.3,24-27 Unfortunately, standard vigorous immunosuppression therapies were not very successful in our patients.\n\nWe did note positive response to etoposide and ruxolitinib. 5 Unfortunately, Patient 3 could not be supported after developing severe cytopenia. Patient 6 clearly responded although her clinical criteria were less severe than the other patients her platelet counts, ferritin level, and D-dimer only responded after ruxolitinib was started.\n\nConclusion\n\nMacrophage activation syndrome is increasingly recognized in ill patients with rheumatic diseases. The presence of refractory thrombocytopenia (lack of response to glucocorticoids, intravenous immunoglobulin, and or immunosuppressive agents) should prompt a laboratory evaluation of circulating ferritin levels, ongoing fibrinolysis, and elevation in sIL-2R. Our experience suggests treatment with etoposide or ruxolitinib can at least partially reverse ongoing cytokine storm.\n\nDeclaration of Conflicting Interests: The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.\n\nFunding: The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: Support provided by the J.T. and Margaret Talkington Endowment (JSP).\n\nEthics Approval: The Texas Tech University Health Science Center Institutional Review Board does not require ethical approval for reporting retrospective case series.\n\nInformed Consent: Informed consent for the patient information to be published in this article was not obtained because the patients were either deceased or unavailable to consent.\n\nORCID iD: Kenneth Iwuji https://orcid.org/0000-0001-5489-233X\n==== Refs\nReferences\n\n1 Ravelli A Davi S Minoia F , et al . Macrophage activation syndrome. Hematol Oncol Clin North Am. 2015;29 :927-941. doi:10.1016/j.hoc.2015.06.010 26461152\n2 Risma K Jordan MB. Hemophagocytic lymphohistiocytosis: updates and evolving concepts. Curr Opin Pediatr. 2012;24 :9-15. doi:10.1097/MOP.0b013e32834ec9c1 22189397\n3 Grom AA Horne A De Benedetti F. Macrophage activation syndrome in the era of biologic therapy. Nat Rev Rheumatol. 2016;12 :259-268. doi:10.1038/nrrheum.2015.179 27009539\n4 Canna SW Behrens EM. Making sense of the cytokine storm: a conceptual framework for understanding, diagnosing, and treating hemophagocytic syndromes. Pediatr Clin North Am. 2012;59 :329-344. doi:10.1016/j.pcl.2012.03.002 22560573\n5 Fajgenbaum DC , June CH. Cytokine storm. N Engl J Med. 2020;383 :2255-2273. doi:10.1056/NEJMra2026131 33264547\n6 Fardet L Galicier L Lambotte O , et al . Development and validation of the HScore, a score for the diagnosis of reactive hemophagocytic syndrome. Arthritis Rheumatol. 2014;66 : 2613-2620. doi:10.1002/art.38690 24782338\n7 Grom AA Mellins ED . Macrophage activation syndrome: advances towards understanding pathogenesis. Curr Opin Rheumatol. 2010;22 :561-566. doi:10.1097/01.bor.0000381996.69261.71 20517154\n8 Dall’Ara F Cavazzana I Frassi M , et al . Macrophage activation syndrome in adult systemic lupus erythematosus: report of seven adult cases from a single Italian rheumatology center. Reumatismo. 2018;70 :100-105. doi:10.4081/reumatismo.2018.1023 29976044\n9 Cho J Jong SC Ng SB. A woman with fever and lymphadenopathy. JAMA. 2018;319 :2552-2553. doi:10.1001/jama.2018.6469 29946706\n10 Ruscitti P Rago C Breda L , et al . Macrophage activation syndrome in Still’s disease: analysis of clinical characteristics and survival in paediatric and adult patients. Clin Rheumatol. 2017;36 :2839-2845. doi:10.1007/s10067-017-3830-3 28914368\n11 Watanabe E Sugawara H Yamashita T , et al . Successful tocilizumab therapy for macrophage activation syndrome associated with adult-onset Still’s disease: a case-based review. Case Rep Med. 2016;2016 :5656320. doi:10.1155/2016/5656320 27688774\n12 Parisi F Paglionico A Varriano V , et al . Refractory adult-onset Still disease complicated by macrophage activation syndrome and acute myocarditis: a case report treated with high doses (8 mg/kg/d) of anakinra. Medicine (Baltimore). 2017;96 :e6656. doi:10.1097/MD.0000000000006656\n13 Junga Z Stitt R Tracy C Keith M. Novel use of rituximab in macrophage activation syndrome secondary to systemic lupus erythematosus. BMJ Case Rep. 2017;2017 :bcr2017221347. doi:10.1136/bcr-2017-221347\n14 Kumar B Aleem S Saleh H , et al . A personalized diagnostic and treatment approach for macrophage activation syndrome and secondary hemophagocytic lymphohistiocytosis in adults. J Clin Immunol. 2017;37 :638-643. doi:10.1007/s10875-017-0439-x 28871523\n15 D’Errico MM CF Biancardi C Torcoletti M , et al . YIM-P58. Macrophage activation syndrome: the role of infectious triggers. Pediatr Rheumotol. 2014;12 :Y5. doi:10.1186/1546-0096-12-S1-Y5\n16 Szolga B Filipescu I Damian L Rednic S Rednic N. A9.1 Macrophage activation syndrome after mycoplasma pneumoniae infection. Ann Rheum Dis. 2014;73 (suppl 1 ). doi:10.1136/annrheumdis-2013-205124.214\n17 Vastert SJ van Wijk R D’Urbano LE , et al . Mutations in the perforin gene can be linked to macrophage activation syndrome in patients with systemic onset juvenile idiopathic arthritis. Rheumatology (Oxford). 2010;49 :441-449. doi:10.1093/rheumatology/kep418 20019066\n18 Girard-Guyonvarc’h C Palomo J Martin P , et al . Unopposed IL-18 signalling leads to severe TLR9-induced macrophage activation syndrome in mice. Blood. 2018;131 :1430-1441.29295842\n19 Karthik R. Infectious causes of macrophage activation syndrome. J Assoc Physicians India. 2007;55 :877-878.18405143\n20 Davì S Minoia F Pistorio A , et al . Performance of current guidelines for diagnosis of macrophage activation syndrome complicating systemic juvenile idiopathic arthritis. Arthritis Rheumatol. 2014;66 :2871-2880. doi:10.1002/art.38769 25044674\n21 Parodi A Davì S Pringe AB , et al . Macrophage activation syndrome in juvenile systemic lupus erythematosus: a multinational multicenter study of thirty-eight patients. Arthritis Rheum. 2009;60 :3388-3399. doi:10.1002/art.24883 19877067\n22 Gavand PE Serio I Arnaud L , et al . Clinical spectrum and therapeutic management of systemic lupus erythematosus-associated macrophage activation syndrome: a study of 103 episodes in 89 adult patients. Autoimmun Rev. 2017;16 :743-749. doi:10.1016/j.autrev.2017.05.010 28483541\n23 Naveen R Jain A Muhammed H , et al . Macrophage activation syndrome in systemic lupus erythematosus and systemic-onset juvenile idiopathic arthritis: a retrospective study of similarities and dissimilarities. Rheumatol Int. 2021;41 :625-631. doi:10.1007/s00296-020-04763-6 33388903\n24 Ravelli A De Benedetti F Viola S Martini A. Macrophage activation syndrome in systemic juvenile rheumatoid arthritis successfully treated with cyclosporine. J Pediatr. 1996;128 :275-278. doi:10.1016/s0022-3476(96)70408-0 8636829\n25 Miettunen PM Narendran A Jayanthan A Behrens EM Cron EQ. Successful treatment of severe paediatric rheumatic disease-associated macrophage activation syndrome with interleukin-1 inhibition following conventional immunosuppressive therapy: case series with 12 patients. Rheumatology (Oxford). 2011;50 :417-419. doi:10.1093/rheumatology/keq218 20693540\n26 Canna SW Girard C Malle L , et al . Life-threatening NLRC4-associated hyperinflammation successfully treated with IL-18 inhibition. J Allergy Clin Immunol. 2017;139 :1698-1701. doi:10.1016/j.jaci.2016.10.022 27876626\n27 Shakoory B Carcillo JA Chatham WW , et al . Interleukin-1 receptor blockade is associated with reduced mortality in sepsis patients with features of macrophage activation syndrome: reanalysis of a prior phase III trial. Crit Care Med. 2016;44 :275-281. doi:10.1097/CCM.0000000000001402 26584195\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2324-7096", "issue": "9()", "journal": "Journal of investigative medicine high impact case reports", "keywords": "adults; macrophage activation syndrome", "medline_ta": "J Investig Med High Impact Case Rep", "mesh_terms": "D000328:Adult; D001171:Arthritis, Juvenile; D002648:Child; D006801:Humans; D008180:Lupus Erythematosus, Systemic; D055501:Macrophage Activation Syndrome; D012189:Retrospective Studies", "nlm_unique_id": "101624758", "other_id": null, "pages": "23247096211026406", "pmc": null, "pmid": "34180255", "pubdate": "2021", "publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": "29295842;20019066;33264547;18405143;27009539;27876626;26584195;28914368;33388903;24782338;28614216;22560573;19877067;8636829;29976044;20693540;25044674;29946706;27688774;28871523;20517154;28827301;22189397;26461152;28483541", "title": "Macrophage Activation Syndrome in Adults: A Retrospective Case Series.", "title_normalized": "macrophage activation syndrome in adults a retrospective case series" }
[ { "companynumb": "US-ROCHE-2906938", "fulfillexpeditecriteria": "1", "occurcountry": null, "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "RITUXIMAB" }, "drugadditional": "3", "drugad...
{ "abstract": "A healthy young woman is described in whom the left chest was unable to be inflated after intubation. The differential diagnosis and management are discussed. Severe unilateral bronchospasm was probably caused by topical lidocaine injected at the vocal cords and, inadvertently, into the left main bronchus with a Laryngojet device.", "affiliations": "Nuffield Department of Anaesthetics, University of Oxford, Radcliffe Infirmary, UK.", "authors": "Farmery|A D|AD|", "chemical_list": "D000779:Anesthetics, Local; D008012:Lidocaine", "country": "England", "delete": false, "doi": "10.1093/bja/85.6.917", "fulltext": null, "fulltext_license": null, "issn_linking": "0007-0912", "issue": "85(6)", "journal": "British journal of anaesthesia", "keywords": null, "medline_ta": "Br J Anaesth", "mesh_terms": "D000328:Adult; D000779:Anesthetics, Local; D001980:Bronchi; D001986:Bronchial Spasm; D003937:Diagnosis, Differential; D005260:Female; D005547:Foreign Bodies; D006801:Humans; D007442:Intubation, Intratracheal; D008012:Lidocaine; D013594:Syringes", "nlm_unique_id": "0372541", "other_id": null, "pages": "917-9", "pmc": null, "pmid": "11732533", "pubdate": "2000-12", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Severe unilateral bronchospasm mimicking inadvertent endobronchial intubation: a complication of the use of a topical lidocaine Laryngojet injector.", "title_normalized": "severe unilateral bronchospasm mimicking inadvertent endobronchial intubation a complication of the use of a topical lidocaine laryngojet injector" }
[ { "companynumb": "GB-B. BRAUN MEDICAL INC.-2042056", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "DEXTROSE\\LIDOCAINE HYDROCHLORIDE" }, ...
{ "abstract": "Acute eosinophilic pneumonia (AEP) is a rare but important complication of daptomycin therapy. We describe 2 cases of daptomycin-associated AEP, compile available data from another 22 published cases, and propose a revised set of diagnostic criteria.", "affiliations": "From the Department of Medicine, University of Texas Health Science Center at San Antonio , San Antonio, Texas.", "authors": "Phillips|Jason|J|;Cardile|Anthony P|AP|;Patterson|Thomas F|TF|;Lewis|James S|JS|", "chemical_list": "D000900:Anti-Bacterial Agents; D017576:Daptomycin", "country": "England", "delete": false, "doi": "10.3109/00365548.2013.805427", "fulltext": null, "fulltext_license": null, "issn_linking": "0036-5548", "issue": "45(10)", "journal": "Scandinavian journal of infectious diseases", "keywords": null, "medline_ta": "Scand J Infect Dis", "mesh_terms": "D000328:Adult; D000900:Anti-Bacterial Agents; D015510:Clinical Medicine; D017576:Daptomycin; D003955:Diagnostic Tests, Routine; D006801:Humans; D008297:Male; D008875:Middle Aged; D011657:Pulmonary Eosinophilia", "nlm_unique_id": "0215333", "other_id": null, "pages": "804-8", "pmc": null, "pmid": "23826793", "pubdate": "2013-10", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Daptomycin-induced acute eosinophilic pneumonia: analysis of the current data and illustrative case reports.", "title_normalized": "daptomycin induced acute eosinophilic pneumonia analysis of the current data and illustrative case reports" }
[ { "companynumb": "US-PFIZER INC-2018049712", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "DAPTOMYCIN" }, "drugadditional": "1", ...
{ "abstract": "We report three patients with acute promyelocytic leukaemia (APL) occurring after treatment for other malignant disorders. One patient had had razoxane (a drug affecting DNA topoisomerase II) for cancer of the colon, and the other two had had treatment for cancer of the breast. Two out of the three patients went into complete remission. We review the published literature on therapy-related acute promyelocytic leukaemia (t-APL) and suggest that it is a genuine clinical entity which may be caused by drugs affecting DNA topoisomerase II, and has a prognosis similar to de novo APL.", "affiliations": "Department of Haematology, Wigan Infirmary.", "authors": "Bhavnani|M|M|;Azzawi|S A|SA|;Yin|J A|JA|;Lucas|G S|GS|", "chemical_list": "D000970:Antineoplastic Agents; D004250:DNA Topoisomerases, Type II", "country": "England", "delete": false, "doi": "10.1111/j.1365-2141.1994.tb03288.x", "fulltext": null, "fulltext_license": null, "issn_linking": "0007-1048", "issue": "86(1)", "journal": "British journal of haematology", "keywords": null, "medline_ta": "Br J Haematol", "mesh_terms": "D000328:Adult; D000368:Aged; D000970:Antineoplastic Agents; D001943:Breast Neoplasms; D003110:Colonic Neoplasms; D004250:DNA Topoisomerases, Type II; D005260:Female; D006801:Humans; D015473:Leukemia, Promyelocytic, Acute; D008297:Male; D008875:Middle Aged; D016609:Neoplasms, Second Primary; D011379:Prognosis", "nlm_unique_id": "0372544", "other_id": null, "pages": "231-2", "pmc": null, "pmid": "8011541", "pubdate": "1994-01", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Therapy-related acute promyelocytic leukaemia.", "title_normalized": "therapy related acute promyelocytic leukaemia" }
[ { "companynumb": "GB-MYLANLABS-2018M1055188", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "FLUOROURACIL" }, "drugadditional": null, ...
{ "abstract": "Either analgosedation or central nervous system dysfunction may be a side effect of implemented pharmacological treatment, as well as a consequence of intentional or unintentional poisoning. In traumatic lesions or anoxia of the central nervous system, a question arises after a recommended follow-up period about the effects of xenobiotics on nervous system function. Although therapeutic drug monitoring is the gold standard in such cases, usually a single toxicological estimation of \"a neurodepressive compound\" is performed after treatment discontinuation in order to determine the type and amount of exogenous substances, or their metabolites, in a patient's bodily fluids, which allows for an assessment of its actual effects on central nervous system functions. The aim of this paper was to describe the aspects of diagnostic toxicology which are essential for improved determination of the type and amount of exogenous substances present in biological fluids of intensive care patients. We present examples of clinical cases in order to discuss the most common discrepancies in interpretation related to the ordering of toxicology tests.", "affiliations": "Department of Nephrology Transplantology and Internal Medicine, Szczecin, Poland. bkpn@pum.edu.pl.", "authors": "Janus|Tomasz|T|;Pabisiak|Krzysztof|K|", "chemical_list": "D015415:Biomarkers; D015262:Xenobiotics", "country": "Poland", "delete": false, "doi": "10.5603/AIT.2018.0042", "fulltext": null, "fulltext_license": null, "issn_linking": "1642-5758", "issue": "50(5)", "journal": "Anaesthesiology intensive therapy", "keywords": "ICU treatment; diagnostic toxicology; neurodepressants; therapeutic drug monitoring; xenobiotics", "medline_ta": "Anaesthesiol Intensive Ther", "mesh_terms": "D015415:Biomarkers; D003422:Critical Care; D016903:Drug Monitoring; D064420:Drug-Related Side Effects and Adverse Reactions; D006801:Humans; D007362:Intensive Care Units; D019966:Substance-Related Disorders; D014116:Toxicology; D015262:Xenobiotics", "nlm_unique_id": "101472620", "other_id": null, "pages": "378-383", "pmc": null, "pmid": "30615797", "pubdate": "2018", "publication_types": "D016428:Journal Article", "references": null, "title": "Toxicological pitfalls in ICU practice.", "title_normalized": "toxicological pitfalls in icu practice" }
[ { "companynumb": "PL-MYLANLABS-2019M1000545", "fulfillexpeditecriteria": "1", "occurcountry": "PL", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CARVEDILOL" }, "drugadditional": "3", ...
{ "abstract": "We report a 57-year-old woman with end-stage renal disease (ESRD) on maintenance peritoneal dialysis (PD), who presented to the emergency room (ER) by ambulance with complaints of confusion and altered sensorium for 48 hours. She had been reviewed in a walk-in clinic 72 hours earlier and had been prescribed the standard 1000 mg three times per day of valacyclovir for an acute attack of shingles instead of 500 mg once a day on ESRD. In the ER, she received further 500 mg of intravenous acyclovir as herpes encephalitis was clinically suspected. CT of the brain and lumbar puncture were non-contributory to the diagnosis. Valacyclovir and acyclovir were discontinued when the diagnosis of valacyclovir-associated neurotoxicity became clinically evident. As the patient's Glasgow Coma Scale declined, we intensified her PD regimen from one to six exchanges per day and 24 hours later there was a significant neurological improvement.", "affiliations": "Department of Nephrology, Regina Qu Appele Health region, Regina, Canada.;University of Saskatchewan, Regina, Canada.;Regina Qu'Appelle Health Region, Regina, Canada.", "authors": "Prasad|Bhanu|B|0000-0002-1139-4821;McIsaac|Mark|M|;Toppings|Julie|J|", "chemical_list": "D000998:Antiviral Agents; D014633:Valine; D000077483:Valacyclovir; D000212:Acyclovir", "country": "England", "delete": false, "doi": "10.1136/bcr-2017-220678", "fulltext": null, "fulltext_license": null, "issn_linking": "1757-790X", "issue": "2017()", "journal": "BMJ case reports", "keywords": "Dialysis; Renal Intervention; Therapeutic Indications; Toxicology; Unwanted Effects / Adverse Reactions", "medline_ta": "BMJ Case Rep", "mesh_terms": "D000212:Acyclovir; D061605:Administration, Intravenous; D000998:Antiviral Agents; D003221:Confusion; D003244:Consciousness Disorders; D003937:Diagnosis, Differential; D020803:Encephalitis, Herpes Simplex; D005260:Female; D006562:Herpes Zoster; D006801:Humans; D007676:Kidney Failure, Chronic; D008875:Middle Aged; D020258:Neurotoxicity Syndromes; D010530:Peritoneal Dialysis; D000077483:Valacyclovir; D014633:Valine", "nlm_unique_id": "101526291", "other_id": null, "pages": null, "pmc": null, "pmid": "28765478", "pubdate": "2017-07-31", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "19187258;23176110;23528373;24368610;25389728;25539699;7249508", "title": "Valacyclovir-associated neurotoxicity treated with intensification of peritoneal dialysis.", "title_normalized": "valacyclovir associated neurotoxicity treated with intensification of peritoneal dialysis" }
[ { "companynumb": "CA-CIPLA LTD.-2017CA13811", "fulfillexpeditecriteria": "1", "occurcountry": "CA", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "VALACYCLOVIR HYDROCHLORIDE" }, "drugadditiona...
{ "abstract": "Phenothiazines like antipsychotics have been known to cause neutropenia, but this has been reported very rarely with haloperidol. A 20-year-old male patient admitted to emergency service (emergency room) with shortness of breath, chest pain, and anger. He was diagnosed with pneumonia and prescribed moxifloxacin. After 2 days with antibiotic, he readmitted. Left lung pneumothorax was detected, and thorax computerized tomography was requested. However, he opposed and beated one of the hospital officials. The diagnosis of manic episode due to antibiotic moxifloxacin was considered. The tube thoracostomy had to be done, and antibiotic therapy was stopped. Haloperidol 10 mg/day and biperiden 4 mg/day injections were administered because he continued to resist medical interventions. After haloperidol, his leukocyte count decreased. He responded well to filgrastim (Neupogen) and blood transfusions, so a drug-related cause of neutropenia has been suspected. He was switched from haloperidol to quetiapine 300 mg twice a day. His white blood cell count returned to normal levels.", "affiliations": "Department of Psychiatry, Bezmialem Vakif University, Istanbul, Turkey.", "authors": "Şahan|Ebru|E|", "chemical_list": null, "country": "India", "delete": false, "doi": "10.4103/psychiatry.IndianJPsychiatry_152_18", "fulltext": "\n==== Front\nIndian J PsychiatryIndian J PsychiatryIJPsyIndian Journal of Psychiatry0019-55451998-3794Medknow Publications & Media Pvt Ltd India IJPsy-61-30710.4103/psychiatry.IndianJPsychiatry_152_18Case ReportHaloperidol-related neutropenia Şahan Ebru Department of Psychiatry, Bezmialem Vakif University, Istanbul, TurkeyAddress for correspondence: Dr. Ebru Şahan, Department of Psychiatry, Bezmialem Vakif University, Adnan Menderes Bulvari (Vatan Street), P. K. 34093 Fatih, Istanbul, Turkey. E-mail: ebrushaan@hotmail.comMay-Jun 2019 61 3 307 310 Copyright: © 2019 Indian Journal of Psychiatry2019This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.Phenothiazines like antipsychotics have been known to cause neutropenia, but this has been reported very rarely with haloperidol. A 20-year-old male patient admitted to emergency service (emergency room) with shortness of breath, chest pain, and anger. He was diagnosed with pneumonia and prescribed moxifloxacin. After 2 days with antibiotic, he readmitted. Left lung pneumothorax was detected, and thorax computerized tomography was requested. However, he opposed and beated one of the hospital officials. The diagnosis of manic episode due to antibiotic moxifloxacin was considered. The tube thoracostomy had to be done, and antibiotic therapy was stopped. Haloperidol 10 mg/day and biperiden 4 mg/day injections were administered because he continued to resist medical interventions. After haloperidol, his leukocyte count decreased. He responded well to filgrastim (Neupogen) and blood transfusions, so a drug-related cause of neutropenia has been suspected. He was switched from haloperidol to quetiapine 300 mg twice a day. His white blood cell count returned to normal levels.\n\nAgranulocytosisantipsychotichaloperidolneutropenia\n==== Body\nINTRODUCTION\nAntipsychotics, mood stabilizers, antidepressants, benzodiazepines, barbiturates, hypnotics, antithyroid drugs some antibiotics and nonsteroidal anti-inflammatory drugs have been reported to cause agranulocytosis and neutropenia. Phenothiazines like antipsychotics and its derivatives have been known to cause neutropenia, but this side effect has been reported very rarely with haloperidol.[12] Following is a newly diagnosed patient with bipolar affective disorder who later developed neutropenia which has thought to be related to haloperidol and afterward his continuation therapy with quetiapine.\n\nCASE REPORT\nA 20-year-old male, single, Caucasian patient admitted to an emergency room (ER) with shortness of breath, chest pain, and anger. We could not get the information about physical examination and laboratory workup done in that emergency service. He was diagnosed with pneumonia and prescribed moxifloxacin.\n\nAfter 2 days with antibiotic therapy, the patient complained of difficulty in breathing and readmitted at September 28, 2017. He had respiratory tachypnea, and his vital signs were as follows: oxygen saturation: 92%, blood pressure: 140/70 mmHg, and pulse: 130/min. On physical examination, no breathing sounds could be heard on the left lung with auscultation. He had uncontrolled fast speech and aggressive behaviors. In the first whole blood count we could reach, the white blood cell (WBC) count was 6900 and the neutrophil count was 2710.\n\nLeft lung pneumothorax was detected on chest X-ray, and thorax computerized tomography (CT) was requested for detailed evaluation. However, he opposed and beated one of the hospital officials, so the patient was referred to a mental health hospital.\n\nThe patient had never consulted to a psychiatrist before. There was no physical disease or psychiatric disorder mentioned in the patient's family history. He was a real estate agent, living with his mother and father. He was smoking but did not have any alcohol or substance abuse. In his psychiatric evaluation in the mental health hospital, the diagnosis of manic episode due to antibiotic moxifloxacin was considered and olanzapine was recommended. For the treatment of pneumothorax and psychiatric disorder together, he was transferred to our general hospital and has never used olanzapine.\n\nHe was hospitalized in thoracic surgery inpatient clinic. The tube thoracostomy had to be done, but it could not be performed because of aggressive behaviors due to mania. Although local anesthesia was preferred, he could only let this procedure with deep sedation in the operating room. Postoperative chest X-ray showed that the left lung was expansive, and there was 400-cc drainage from the chest tube with minimal air leak. The pleural fluid culture was negative. His purified protein derivative, Mycobacterium DNA, and QuantiFERON tests were negative. With consultation of infectious diseases, antibiotic therapy was stopped.\n\nHis thorax CT showed cystic air spaces in the left hemithorax and subcutaneous emphysema emerged after thoracostomy. Despite the vital values and breathing had returned to normal limits, a psychiatric consultation was requested due to continuing psychomotor agitation. In the psychiatric evaluation, the patient was agitated and hostile. At the same time, he was swearing and pointing his pain at the region of the chest tube. He was alert and fully oriented. His appearance was congruent with his chronological age. His speech was very fast with flight of ideas. His thought content had grandiose themes. His mood was dysphoric and his affect was irritable. He had decreased need to sleep.\n\nThere were visual hallucinations and unorganized delusions. A brain magnetic resonance imaging (MRI) scan was performed due to the presence of psychopathology after a medical condition with acute onset within 1 week and with an atypical course. The brain MRI was normal. He was refusing to take oral psychiatric pills, and his central venous catheter could only be placed under sedation in the operating room. He was given paracetamol and codeine for his pain. Haloperidol 10 mg/day and biperiden 4 mg/day intramuscular injection were administered to the patient who continued to resist the medical team and medical interventions. The 2nd day after haloperidol, his leukocyte count was 4100 and it continued to be low on subsequent days. The hematology consultation was requested on the fact that the patient's daily hemograms had fallen. Peripheral blood smear done on the 3rd day was neutropenic with monocytes and activated lymphocytes which raised a suspicion of Cytomegalovirus (CMV) or Epstein–Barr virus (EBV). He was ordered 30 units of filgrastim (Neupogen) with blood transfusions and he responded well, so a drug-related cause of neutropenia has been suspected. Three days after the second filgrastim (Neupogen) dose, bone marrow aspiration biopsy was done. Flow cytometry and karyotyping had been applied. WBC and neutrophil counts demonstrated in Figures 1 and 2, respectively. The peaks in the figures correlated with the dates when filgrastim (Neupogen) was given and/or transfusion has been done.\n\nFigure 1 White blood cell in chronological order\n\nFigure 2 Percentage of neutrophils in chronological order\n\nIt has been thought that neutropenia in this patient was related to peripheral destruction because bone marrow progenitors were normal. From laboratory tests, Brucella agglutination (wright), toxoplasma IgG, venereal disease research laboratory, anti-HIV, anti-HCV antibodies, and HBsAg were negative. For suspicion of CMV and EBV infections, antibodies were analyzed CMV IgM−, CMV IgG+, viral-capsid antigen (VCA) IgM−, and VCA IgG+. Acute CMV and EBV infections were excluded, and a drug-related cause has been suspected.\n\nMoxifloxacin, paracetamol–codeine combination, haloperidol, and biperiden were among the medications he had been given. Moxifloxacin has been reported to cause agranulocytosis[34] in some cases but also inversely been used widely with beta-lactam antibiotics to prevent infections in patients with leukemia and neutropenic fever. In our patient, moxifloxacin was removed from his drug therapy on the 3rd day. Leukocyte count did not change after moxifloxacin discontinuation.\n\nAgranulocytosis cases related to paracetamol have been reported in the French literature but none from Turkey.[567] Codeine which is found in a low dose in combination has not been associated with agranulocytosis widely.[8] The paracetamol and codeine combination continued as needed in the 1st week of treatment, but haloperidol and biperiden persisted to be given.\n\nBiperiden has not been associated with neutropenia. The hematology consultant has noted that haloperidol may be related to agranulocytosis (rare), anemia, decrease in red cell count, leukocytosis, leukopenia, and ordered some transfusions beside filgrastim (Neupogen) also asked for change in psychiatric treatment.\n\nThe patient was switched from haloperidol to quetiapine 300 mg twice a day. Neutropenia was corrected with filgrastim (Neupogen), his WBC count returned to normal levels by treatment with quetiapine, and the patient was discharged. One month later, he was brought to ER with agitation, overvalued ideas of grandiosity, and attempt to harm hospital officials. Emergency medicine doctor had given a haloperidol and biperiden injection again to calm down him. Attending psychiatrist learned that he quitted quetiapine. This time he was not using moxifloxacin. His neutrophil count decreased again after haloperidol injection. The diagnosis of bipolar affective disorder, manic episode was made for this patient. He was transferred to a mental health hospital for inpatient stay with a warning note for the physicians to avoid haloperidol in that patient.\n\nDISCUSSION\nThere has been some suspicion about drug-induced neutropenia to have an immunological background. Recovery and rebound leukocytosis may occur upon withdrawal of the offending drug.\n\nMoxifloxacin reported to induce psychosis and hallucinations[9] of our patient did not resolve spontaneously with discontinuation of it. Even if more than 1-month period had been passed without moxifloxacin, hypomanic symptoms continued. Lithium has beneficial effects on mania and leukopenia, but we did not add lithium to treatment of this patient because he was still in acute manic episode. However, in order for lithium to reach an effective serum concentration, time is needed. Lithium would be more effective in maintenance treatment besides and he was reluctant to use any medication. If we had prescribed lithium due to increase in the number of medications, his drug adherence would be even poorer. This was his first manic episode, and there are discrepancies in guidelines about using lithium in the first episode without knowing if another episode will occur again and when it will be.\n\nAlthough there is the greatest risk of agranulocytosis with clozapine from antipsychotics, haloperidol may be blamed for neutropenia very rarely. In the literature, it is mentioned that African, Arabian, and Jewish minority groups have a high risk of chronic low leukocyte count which is called benign ethnic neutropenia. In addition, elderly patients are more susceptible to neutropenia, but our patient does not carry these risk factors.\n\nAccording to the Naranjo Adverse Drug Reaction Probability Scale, the score is 6 which means probable.[10] In the literature, haloperidol-induced neutropenia cases are scarce and there is usually usage of additional antipsychotics too,[21112] and we could reach only one case report of neutropenia with solely haloperidol.[2]\n\nThe patients should be told to tell their doctor about the high fever and painful sore throats as soon as possible. Routine hemogram monitoring is not required as it is with clozapine in the follow-up of haloperidol treatment, but it is useful to ask for blood count during routine controls in patients who use haloperidol so that this rare side effect is not missed.\n\nDeclaration of patient consent\nThe authors certify that they have obtained all appropriate patient consent forms. In the form the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.\n\nFinancial support and sponsorship\nNil.\n\nConflicts of interest\nThere are no conflicts of interest.\n==== Refs\nREFERENCES\n1 Ayd FJ Jr Side effects of depot fluphenazines Adv Biochem Psychopharmacol 1974 9 301 9 4599435 \n2 Ikramullah M El-Hilu S Haloperidol induced neutropenia: Case report Arab J Psychiatry 2010 2 187 92 \n3 Koul AN Ahmad SJ Koul PA Moxifloxacin-associated neutropenia Scand J Infect Dis 2013 45 809 10 23826791 \n4 Berk V Demiraslan H Berk E Karaca H Inanc M Bozkurt O Moxifloxacin-associated neutropenia Scand J Infect Dis 2013 45 415 6 23151058 \n5 Jouet JP Huart JJ Bauters F Goudemand M Paracetamol, an unrecognized cause of acute, drug-induced agranulocytosis Nouv Presse Med 1980 9 1386 7 \n6 Lacotte J Perrin C Mosquet B Moulin M Bazin C Agranulocytosis caused by paracetamol. A case report Therapie 1990 45 438 9 2260044 \n7 Chichmanian RM Taillan B Fuzibet JG Vinti H Dujardin P Agranulocytosis caused by paracetamol: A case, with positive readministration Ann Med Interne (Paris) 1989 140 332 3 2782779 \n8 McIntyre PA Laleli YR Hodkinson BA Wagner HN Jr Evidence for anti-leukocyte antibodies as a mechanism for drug-induced agranulocytosis Trans Assoc Am Physicians 1971 84 217 28 5170812 \n9 Mazhar F Akram S Haider N Moxifloxacin-induced acute psychosis: A case report with literature review J Res Pharm Pract 2016 5 294 6 27843968 \n10 Naranjo CA Busto U Sellers EM Sandor P Ruiz I Roberts EA A method for estimating the probability of adverse drug reactions Clin Pharmacol Ther 1981 30 239 45 7249508 \n11 Cutler NR Heiser JF Leukopenia following treatment with thiothixene and haloperidol JAMA 1979 242 2872 3 513257 \n12 Abdullah N Voronovitch L Taylor S Lippmann S Olanzapine and haloperidol: Potential for neutropenia? Psychosomatics 2003 44 83 4 12515844\n\n", "fulltext_license": "CC BY-NC-SA", "issn_linking": "0019-5545", "issue": "61(3)", "journal": "Indian journal of psychiatry", "keywords": "Agranulocytosis; antipsychotic; haloperidol; neutropenia", "medline_ta": "Indian J Psychiatry", "mesh_terms": null, "nlm_unique_id": "0013255", "other_id": null, "pages": "307-310", "pmc": null, "pmid": "31142911", "pubdate": "2019", "publication_types": "D002363:Case Reports", "references": "12515844;2260044;23151058;23826791;2782779;27843968;4599435;513257;5170812;7249508;7383858", "title": "Haloperidol-related neutropenia.", "title_normalized": "haloperidol related neutropenia" }
[ { "companynumb": "TR-AMGEN-TURSP2019089793", "fulfillexpeditecriteria": "1", "occurcountry": "TR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "FILGRASTIM" }, "drugadditional": "3", ...
{ "abstract": "In recent years, there have been an increasing number of infections due to multidrug-resistant organisms in the neonatal intensive care unit. Carbapenem-resistant Klebsiella pneumoniae (CRKP) is a challenge in clinical anti-infection treatment. Herein, we report the case of CRKP sepsis in an extremely low-birth weight infant (ELBWI) who did not respond to meropenem and vancomycin, but was treated successfully after a 10-day antibiotic course with trimethoprim-sulfamethoxazole (TMP-SMZ). Recent research on CRKP-associated sepsis and the application of TMP-SMZ therapy in children and neonates were reviewed to offer a reference for clinical practice.", "affiliations": "Department of Neonatology, Shanghai Children's Hospital, Shanghai Jiao Tong University, Shanghai, 200062, People's Republic of China.;Department of Neonatology, Shanghai Children's Hospital, Shanghai Jiao Tong University, Shanghai, 200062, People's Republic of China.;Department of Neonatology, Shanghai Children's Hospital, Shanghai Jiao Tong University, Shanghai, 200062, People's Republic of China.;Department of Neonatology, Shanghai Children's Hospital, Shanghai Jiao Tong University, Shanghai, 200062, People's Republic of China.;Department of Neonatology, Shanghai Children's Hospital, Shanghai Jiao Tong University, Shanghai, 200062, People's Republic of China.;Department of Neonatology, Shanghai Children's Hospital, Shanghai Jiao Tong University, Shanghai, 200062, People's Republic of China.", "authors": "Weng|Bowen|B|;Zhang|Xiaoyue|X|;Hong|Wenchao|W|;Yan|Chongbing|C|;Gong|Xiaohui|X|;Cai|Cheng|C|", "chemical_list": null, "country": "New Zealand", "delete": false, "doi": "10.2147/IDR.S312183", "fulltext": "\n==== Front\nInfect Drug Resist\nInfect Drug Resist\nidr\nidr\nInfection and Drug Resistance\n1178-6973\nDove\n\n312183\n10.2147/IDR.S312183\nCase Report\nA Case of Sepsis Due to Carbapenem-Resistant Klebsiella pneumoniae in an Extremely Low-Birth Weight Infant Treated with Trimethoprim–Sulfamethoxazole\nWeng et al\nWeng et al\nWeng Bowen 1\nZhang Xiaoyue 1\nHong Wenchao 1\nYan Chongbing 1\nGong Xiaohui 1\nCai Cheng 1\n1 Department of Neonatology, Shanghai Children’s Hospital, Shanghai Jiao Tong University, Shanghai, 200062, People’s Republic of China\nCorrespondence: Cheng Cai Department of Neonatology, Shanghai Children’s Hospital, Shanghai Jiao Tong University, Shanghai, 200062, People’s Republic of ChinaTel +86 21 52976179Fax +86 21 62790494 Email caicheng2004@163.com\n22 6 2021\n2021\n14 23212325\n12 4 2021\n09 6 2021\n© 2021 Weng et al.\n2021\nWeng et al.\nhttps://creativecommons.org/licenses/by-nc/3.0/ This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php).\nAbstract\n\nIn recent years, there have been an increasing number of infections due to multidrug-resistant organisms in the neonatal intensive care unit. Carbapenem-resistant Klebsiella pneumoniae (CRKP) is a challenge in clinical anti-infection treatment. Herein, we report the case of CRKP sepsis in an extremely low-birth weight infant (ELBWI) who did not respond to meropenem and vancomycin, but was treated successfully after a 10-day antibiotic course with trimethoprim–sulfamethoxazole (TMP-SMZ). Recent research on CRKP-associated sepsis and the application of TMP-SMZ therapy in children and neonates were reviewed to offer a reference for clinical practice.\n\nKeywords\n\ncarbapenem-resistance\nextremely low birth weight infant\nKlebsiella pneumoniae\nsepsis\ntrimethoprim–sulfamethoxazole\n==== Body\nIntroduction\n\nKlebsiella pneumoniae (K. pneumoniae) was first identified by Carl Friedländer in 1882. It is a lactose-fermenting, nonmotile, facultative anaerobe and Gram-negative bacillus occurring naturally in the soil. Although generally found in normal flora, it is one of the important pathogens in nosocomial infections. It causes pneumonia and sepsis in premature and newborn infants and in immunocompromised patients.1\n\nNeonatal sepsis accounts for 30–50% of the annual neonatal deaths in developing countries.2 K. pneumoniae (17.54%) is one of the most prevalent causative bacterial pathogens in neonatal sepsis.2 Carbapenem-resistance poses a serious challenge in clinical treatment. The incidence rate of carbapenem-resistant gram-negative late-onset sepsis (LOS) was 6.5 cases per 1000 patient-days, and the most frequently isolated bacterial strain was K. pneumoniae.3 Carbapenem-resistant K. pneumoniae (CRKP) is associated with long hospitalizations and poor outcomes, and failure to recognize CRKP septicemia early and determine the optimum antibiotic therapy may have fatal consequences.4 However, because of concerns regarding the safety and efficacy of antibiotic therapy in the pediatric population, there were few appropriate antibiotics for CRKP treatment.\n\nIn this study, we report the case of CRKP sepsis in an extremely low-birth weight infant (ELBWI) who did not respond to meropenem and vancomycin, but was treated successfully after a 10-day antibiotic course with trimethoprim–sulfamethoxazole (TMP-SMZ). The parents of the patient provided informed consent for the case details to be published. Shanghai Children’s Hospital approval to publish the case details.\n\nCase Report\n\nA premature male infant of 28+1 weeks gestation was born vaginally to a mother with a triplet pregnancy and premature rupture of membranes around 89 h in People’s Hospital of Putuo District on May 14, 2020. The amniotic fluid, placenta, and umbilical cord were normal. This infant was transported to neonatal intensive care unit (NICU) of Shanghai Children’s Hospital because of tachypnea and grunting at 1 hour postnatally. The birthweight was 970 g, and the 1-, 5-, and 10-min Apgar scores were 3, 6, and 9, respectively. The vital signs were stable in conventional mechanical ventilation at admission.\n\nOn day 8 of admission, he had fever and frequent apnea; by day 15, he had fever with lung exudation on radiography and the usual infection parameters. On day 23, he developed symptoms of necrotizing enterocolitis (NEC), and the C-reactive protein (CRP) was 74 mg/L. By day 45, he deteriorated rapidly with increased liver enzymes (serum alanine aminotransferase (ALT), 145 U/L), thrombocytopenia, and anemia. Central nervous system infection was excluded by lumbar puncture. Cultures from tracheal intubation, sputum, and blood all showed the same CRKP strain growth. In vitro susceptibility test showed that this strain was only sensitive to ceftazidime avibactam (DISK 26mm), polymyxin B (DISK 16mm), TMP-SMZ (minimal inhibitory concentrations (MIC) ≤ 20ug/mL) and tigecycline (MIC 2ug/mL). After anti-infection treatment, CRP was significantly reduced on day 49, with gradual resolution of thrombocytopenia and anemia. However, serum ALT was 345 U/L on day 51 and 878 U/L on day 58. Repeat blood culture showed negative on day 69, but the sputum culture was still K. pneumoniae positive. The patient’s liver function returned to normal on day 85. Unfortunately, he developed bronchopulmonary dysplasia (BPD) and retinopathy of prematurity (ROP). The patient was eventually discharged on day 87.\n\nRegarding treatment, the patient needed mechanical ventilation for 4 days followed by 10 days of nasal continuous positive airway pressure (NCPAP). He was administered ampicillin sulbactam after admission, and ceftazidime was used for empirical therapy on day 8, which was changed to sulperazone on day 15. He underwent emergency abdominal drainage surgery and was administered meropenem after developing NEC on day 23; vancomycin (15 mg/kg, ivgtt, q12h) along with mechanical ventilation was required when he deteriorated rapidly on day 45. According to the clinical symptoms and in vitro susceptibility test, we discontinued vancomycin and switched to TMP–SMZ (20 mg/kg, twice daily) for 10 days. The patient eventually got better, and the mechanical ventilation was switched to NCPAP on day 51, and oxygen was discontinued from day 75 onward. Caffeine treatment was started from the first day after birth and was maintained for up to 63 days. The patient received partial parenteral venous nutrition before complete enteral feeding, compound glycyrrhizin and coenzyme complex injections for abnormal liver function, and oral diuretics and inhalant budesonide as treatments for BPD.\n\nDiscussion\n\nThis report describes a case of CRKP sepsis in an ELBWI who required surgery for NEC that was only sensitive to ceftazidime avibactam, polymyxin B, TMP-SMZ, and tigecycline. K. pneumoniae can cause life-threatening hospital acquired bloodstream infections (BSI), with a high risk of mortality of 54.3%.5 Unfortunately, it is difficult to choose the appropriate antibiotic to treat K. pneumoniae as there is no licensed antibiotic available to treat it in China until now.6 In this case, the infant got worse after treatment with meropenem and vancomycin, so we administered TMP-SMZ for 10 days based on the results of the antimicrobial susceptibility assay. The infant was discharged after his condition gradually improved. To our knowledge, this is the first and only case of CRKP sepsis in an ELBWI who was treated with TMP-SMZ in our NICU.\n\nIn a study of healthcare-associated BSI, K. pneumoniae comprised the largest proportion of pathogenic organisms in healthcare-associated BSI (32%, 93/292). Furthermore, in a subset of 12 neonates with K. pneumoniae bacteremia, it was observed that the median (interquartile range) gestational age at birth was 27 weeks, and the median birth weight was 1100 g.7 The 28-day mortality of K. pneumoniae BSI was 8.7%.5 In our patient, the infant had high risk factors for CRKP infection, such as mechanical ventilation, total parenteral intravenous nutrition support, long-term use of broad-spectrum antimicrobial agents, and admission to the NICU. In addition, the K. pneumoniae was only sensitive to ceftazidime avibactam, polymyxin B, TMP-SMZ, and tigecycline. It has been reported that an infant with CRKP invasive infections required ceftazidime avibactam (CAZ-AVI), phosphomycin, and meropenem as a combination treatment.8 However, this patient had not only moderate thrombocytopenia during the therapy but also recurrent CRKP sepsis after the antibiotics were discontinued for 2 days.8 In a study of colistin use in neonatal sepsis, only one of the seven patients with sepsis due to K. pneumoniae survived. Furthermore, there were no pharmacokinetic and pharmacodynamic studies performed with colistin in neonatal sepsis.9 There are many limitations of tigecycline treatment in pediatric patients, for example, the reported dosage and treatment duration were varied with small sample size, and it is often used in combination with other antimicrobial agents (Table 1).10Table 1 The Usage of Antimicrobials and Efficacy in Cases of Neonatal Sepsis\n\nAuthor (Year of Publication)\tPathogen\tUsage of Antimicrobials\tEfficacy\tSide Effects\t\nShobowale et al (2017)14\tCONS and K. Pneumoniae\tMeropenem, ciprofloxacin, and amikacin\tMost effective antimicrobials in vitro\t/\t\nEsposito et al (2019)8\tCRKP\tCAZ-AVI/ phosphomycin/ meropenem combination\tRecurrent CRKP sepsis\tModerate thrombocytopenia\t\nJasani et al (2016)9\tAcinetobacter baumannii, K. Pneumoniae and Pseudomonas aeruginosa\tIntravenous colistin\tOnly one of seven with K. Pneumoniae infection survived\tNone neurotoxicity or nephrotoxicity\t\nSu et al (2019)12\tCRKP\tTMP-SMZ /colistin combination\tEffective in Vitro\t/\t\nGokce et al (2012)13\tElizabethkingia\tTMP-SMZ for 3 weeks\tCSF examination returned to normal, but the patient developed hydrocephalus\tNo side-effects occurred\t\nAbbreviations: CONS, coagulase-negative staphylococci; K. pneumoniae, Klebsiella pneumoniae; CRKP, Carbapenem-resistant Klebsiella pneumoniae; CAZ-AVI, ceftazidime avibactam; TMP-SMZ, trimethoprim–sulfamethoxazole; CSF, Cerebrospinal fluid.\n\nNeonatal sepsis remains a major cause of death in very low birth weight infants with high risk for both short-term complications, such as BPD, NEC, intraventricular hemorrhage, and periventricular leukomalacia and long-term complications including cerebral palsy, psychomotor delay, and visual and auditory impairment.11 K. pneumoniae is one of the top three isolated pathogens in neonatal sepsis. Patients infected with K. pneumoniae have a high incidence of thrombocytopenia.6 Our patient developed thrombocytopenia, BPD, and ROP after being diagnosed with sepsis. The blood platelet count returned to normal after TMP-SMZ antibiotic therapy for 3 days, and supplemental oxygen was discontinued at postnatal 75 days. The ROP showed gradual resolution at the follow-up fundus examination.\n\nTMP-SMZ is one of the few remaining antimicrobial agents with some activity against CRKP in China.12 However, the functions of the liver and kidney in children are immature, and the acetyltransferase system in neonates has not yet developed. Therefore, the TMP-SMZ can compete with the bilirubin content in the plasma protein-binding site, which causes the blood concentration of free sulfanilamide to increase. This, in turn, increases the risks of kernicterus; hence, the use of TMP-SMZ in children and infants has its limitations. In another case report, a premature infant who developed sepsis, meningitis, and hydrocephalus was treated successfully with TMP–SMZ for 3 weeks with no side effects.13 Therefore, although the state drug administration has not approved TMP-SMZ use in infants younger than 2 months, in the absence of safe and effective alternatives, TMP-SMZ may be used as a reasonable substitute in order to reduce the mortality from CRKP sepsis in ELBWI. Our patient had elevated liver enzymes, which is a known associated side effect; nonetheless, with symptomatic treatment, the patient’s liver function returned to normal on day 85. We recommended that liver and kidney function should be followed up at least once a week in infants treated with TMP-SMZ. Moreover, we also carried out follow-up magnetic resonance imaging of the head to monitor any adverse reactions to TMP-SMZ since the discharge.\n\nIn summary, this case report describes CRKP sepsis, which is associated with high morbidity and mortality, in an ELBWI. We believe that timely and rational therapy with TMP-SMZ in these premature infants may reduce mortality and improve prognosis of CRKP sepsis.\n\nAbbreviations\n\nNICU, neonatal intensive care unit; CRKP, carbapenem-resistant Klebsiella pneumoniae; ELBWI, extremely low birth weight infant; TMP-SMZ, trimethoprim–sulfamethoxazole; K. pneumoniae, Klebsiella pneumoniae; LOS, late-onset sepsis; NRDS, neonatal respiratory distress syndrome; NEC, neonatal necrotizing enterocolitis; CSF, Cerebrospinal fluid; BPD, bronchopulmonary dysplasia; ROP, retinopathy of prematurity; NCPAP, nasal continuous positive airway pressure; BSI, bloodstream infections; CAZ-AVI, ceftazidime avibactam.\n\nData Sharing Statement\n\nNot shared as it contains confidential patient data.\n\nEthics Approval and Informed Consent\n\nThe parents of the patient provided informed consent for the case details to be published. Shanghai Children’s Hospital approval to publish the case details.\n\nConsent for Publication\n\nThe parents of this patient provided the written permission to the publication.\n\nAuthor Contributions\n\nWBW, CC, and HWC made substantial contributions to the conception and design, and the acquisition, analysis, and interpretation of data. WBW, ZXY, YCB, and CC were involved in drafting the manuscript and revising it critically for important intellectual content. CC and GXH revised the manuscript and gave the final approval for the version to be published. All authors contributed to data analysis, drafting or revising the article, have agreed on the journal to which the article will be submitted, gave final approval for the version to be published, and agree to be accountable for all aspects of the work.\n\nDisclosure\n\nAll authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest, or non-financial interest in the subject matter or materials discussed in this manuscript.\n==== Refs\nReferences\n\n1. Bengoechea JA, Sa Pessoa J. Klebsiella pneumoniae infection biology: living to counteract host defences. FEMS Microbiol Rev. 2019;43 (2 ):123–144.30452654\n2. Akbarian-Rad Z, Riahi SM, Abdollahi A, et al. Neonatal sepsis in Iran: a systematic review and meta-analysis on national prevalence and causative pathogens. PLoS One. 2020;15 (1 ):e0227570. doi:10.1371/journal.pone.0227570 31978069\n3. Nour I, Eldegla HE, Nasef N, Shouman B, Abdel-Hady H, Shabaan AE. Risk factors and clinical outcomes for carbapenem-resistant Gram-negative late-onset sepsis in a neonatal intensive care unit. J Hosp Infect. 2017;97 (1 ):52–58. doi:10.1016/j.jhin.2017.05.025 28583886\n4. Di Tella D, Tamburro M, Guerrizio G, Fanelli I, Sammarco ML, Ripabelli G. Molecular epidemiological insights into colistin-resistant and carbapenemases-producing clinical Klebsiella pneumoniae isolates. Infect Drug Resist. 2019;12 :3783–3795. doi:10.2147/IDR.S226416 31819559\n5. Zhang Y, Guo LY, Song WQ, Wang Y, Dong F, Liu G. Risk factors for carbapenem-resistant K. pneumoniae bloodstream infection and predictors of mortality in Chinese paediatric patients. BMC Infect Dis. 2018;18 (1 ):248. doi:10.1186/s12879-018-3160-3 29855274\n6. Guo J, Luo Y, Wu Y, Lai W, Mu X. Clinical characteristic and pathogen spectrum of neonatal sepsis in Guangzhou City from June 2011 to June 2017. Med Sci Monit. 2019;25 :2296–2304. doi:10.12659/MSM.912375 30924465\n7. Essel V, Tshabalala K, Ntshoe G, et al. A multisectoral investigation of a neonatal unit outbreak of Klebsiella pneumoniae bacteraemia at a regional hospital in Gauteng Province, South Africa. S Afr Med J. 2020;110 (8 ):783–790. doi:10.7196/SAMJ.2020.v110i8.14471 32880307\n8. Esposito P, Sbrana F, Di Toro A, Gombos S, Tascini C. Ceftazidine-avibactam salvage therapy in newborn with KPC-producing Klebsiella pneumoniae invasive infections. Minerva Anestesiol. 2019;85 (7 ):804–805. doi:10.23736/S0375-9393.19.13521-3 31271023\n9. Jasani B, Kannan S, Nanavati R, Gogtay NJ, Thatte U. An audit of colistin use in neonatal sepsis from a tertiary care centre of a resource-limited country. Indian J Med Res. 2016;144 (3 ):433–439. doi:10.4103/0971-5916.198682 28139542\n10. Mastrolia MV, Galli L, De Martino M, Chiappini E. Use of tigecycline in pediatric clinical practice. Expert Rev Anti Infect Ther. 2017;15 (6 ):605–612. doi:10.1080/14787210.2017.1318064 28395551\n11. Bakhuizen SE, de Haan TR, Teune MJ, et al. Meta-analysis shows that infants who have suffered neonatal sepsis face an increased risk of mortality and severe complications. Acta Paediatr. 2014;103 (12 ):1211–1218. doi:10.1111/apa.12764 25073543\n12. Su J, Li D, Guo Q, Guo Y, Zheng Y, Xu X. In vitro bactericidal activity of trimethoprim-sulfamethoxazole/colistin combination against carbapenem-resistant Klebsiella pneumoniae clinical isolates. Microb Drug Resist. 2019;25 (2 ):152–156. doi:10.1089/mdr.2018.0085 30109975\n13. Gokce IK, Oncel MY, Ozdemir R, et al. Trimethoprim-sulfamethoxazole treatment for meningitis owing to multidrug-resistant Elizabethkingia meningoseptica in an extremely low-birthweight, premature infant. Paediatr Int Child Health. 2012;32 (3 ):177–179. doi:10.1179/2046905511Y.0000000008 22824670\n14. Shobowale EO, Solarin AU, Elikwu CJ, Onyedibe KI, Akinola IJ, Faniran AA. Neonatal sepsis in a Nigerian private tertiary hospital: bacterial isolates, risk factors, and antibiotic susceptibility patterns. Ann Afr Med. 2017;16 (2 ):52–58. doi:10.4103/aam.aam_34_16 28469117\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "1178-6973", "issue": "14()", "journal": "Infection and drug resistance", "keywords": "Klebsiella pneumoniae; carbapenem-resistance; extremely low birth weight infant; sepsis; trimethoprim–sulfamethoxazole", "medline_ta": "Infect Drug Resist", "mesh_terms": null, "nlm_unique_id": "101550216", "other_id": null, "pages": "2321-2325", "pmc": null, "pmid": "34188498", "pubdate": "2021", "publication_types": "D002363:Case Reports", "references": "29855274;28583886;28395551;30924465;28469117;31271023;25073543;32880307;30109975;31978069;22824670;31819559;28139542;30452654", "title": "A Case of Sepsis Due to Carbapenem-Resistant Klebsiella pneumoniae in an Extremely Low-Birth Weight Infant Treated with Trimethoprim-Sulfamethoxazole.", "title_normalized": "a case of sepsis due to carbapenem resistant klebsiella pneumoniae in an extremely low birth weight infant treated with trimethoprim sulfamethoxazole" }
[ { "companynumb": "CN-PFIZER INC-2021847634", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "MEROPENEM" }, "drugadditional": "3", ...
{ "abstract": "BACKGROUND\nFasciotomy is a life-saving procedure to treat acute compartment syndrome, a surgical emergency. As fasciotomy dramatically improves wound pain, it should be performed as soon as possible. Moreover, delays in the use of fasciotomy can increase the rate of wound infections. Once the fasciotomy wound is infected, pain control is achieved via the long-term use of opioids or anti-inflammatory analgesics. However, the administration of high doses of opioids may cause complications, such as respiratory depression, over-sedation, and constipation. Therefore, treatment methods other than narcotic administration should be established to better manage the pain caused by fasciotomy wound infections. Virtual reality has recently been introduced in analgesic therapy as a replacement, or complement, to conventional pharmacological treatments. Its use has been extensively studied in the pain management of patients with burns. An increasing number of painful conditions are being successfully treated with virtual reality. Here, we report a case of acute compartment syndrome complicated by fasciotomy wound infection.\n\n\nMETHODS\nA 40-year-old Japanese man suffering from acute compartment syndrome of his leg due to a car accident trauma was treated with a fasciotomy to decompress intra-compartmental pressure and restore tissue perfusion, and admitted to an intensive care unit. Unfortunately, as the open fasciotomy wound was complicated by infection, he complained of hyperalgesia and severe pain during wound debridement. He was therefore given acetaminophen and high-dose intravenous patient-controlled analgesic fentanyl (35 μg/kg per day) to reduce the pain. Despite these efforts, the pain was poorly controlled and opioid-induced side effects such as respiratory depression were observed. An immersive virtual reality analgesic therapy aimed at distraction and relaxation was used and effectively alleviated the pain. Three sessions of virtual reality analgesic therapy over 2 days produced sustainable analgesic effects, which led to a 25-75% dose reduction in fentanyl administration and the concomitant alleviation of respiratory depression.\n\n\nCONCLUSIONS\nThis case suggests the feasibility of virtual reality analgesic therapy for pain management of fasciotomy wound complications in acute compartment syndromes. Virtual reality represents a treatment option that would reduce analgesic consumption and eliminate opioid-induced respiratory depression to treat fasciotomy wound infection.", "affiliations": "Department of Emergency and Disaster Medicine, Mie University Graduate School of Medicine, 2-174 Edobashi, Tsu, Mie, 514-8507, Japan.;Department of Anesthesiology and Critical Care Medicine, Mie University Graduate School of Medicine, 2-174 Edobashi, Tsu, Mie, 514-8507, Japan.;Department of Molecular Pathobiology and Cell Adhesion Biology, Mie University Graduate School of Medicine, 2-174 Edobashi, Tsu, Mie, 514-8507, Japan.;Department of Emergency and Disaster Medicine, Mie University Graduate School of Medicine, 2-174 Edobashi, Tsu, Mie, 514-8507, Japan. a_2.uk@mac.com.", "authors": "Esumi|Ryo|R|;Yokochi|Ayumu|A|;Shimaoka|Motomu|M|;Kawamoto|Eiji|E|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1186/s13256-020-02370-4", "fulltext": "\n==== Front\nJ Med Case Rep\nJ Med Case Rep\nJournal of Medical Case Reports\n1752-1947 BioMed Central London \n\n2370\n10.1186/s13256-020-02370-4\nCase Report\nVirtual reality as a non-pharmacologic analgesic for fasciotomy wound infections in acute compartment syndrome: a case report\nEsumi Ryo 1 Yokochi Ayumu 2 Shimaoka Motomu 3 Kawamoto Eiji a_2.uk@mac.com 13 1 grid.260026.00000 0004 0372 555XDepartment of Emergency and Disaster Medicine, Mie University Graduate School of Medicine, 2-174 Edobashi, Tsu, Mie 514-8507 Japan \n2 grid.260026.00000 0004 0372 555XDepartment of Anesthesiology and Critical Care Medicine, Mie University Graduate School of Medicine, 2-174 Edobashi, Tsu, Mie 514-8507 Japan \n3 grid.260026.00000 0004 0372 555XDepartment of Molecular Pathobiology and Cell Adhesion Biology, Mie University Graduate School of Medicine, 2-174 Edobashi, Tsu, Mie 514-8507 Japan \n14 4 2020 \n14 4 2020 \n2020 \n14 464 12 2019 16 3 2020 © The Author(s) 2020Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.Background\nFasciotomy is a life-saving procedure to treat acute compartment syndrome, a surgical emergency. As fasciotomy dramatically improves wound pain, it should be performed as soon as possible. Moreover, delays in the use of fasciotomy can increase the rate of wound infections. Once the fasciotomy wound is infected, pain control is achieved via the long-term use of opioids or anti-inflammatory analgesics. However, the administration of high doses of opioids may cause complications, such as respiratory depression, over-sedation, and constipation. Therefore, treatment methods other than narcotic administration should be established to better manage the pain caused by fasciotomy wound infections.\n\nVirtual reality has recently been introduced in analgesic therapy as a replacement, or complement, to conventional pharmacological treatments. Its use has been extensively studied in the pain management of patients with burns. An increasing number of painful conditions are being successfully treated with virtual reality. Here, we report a case of acute compartment syndrome complicated by fasciotomy wound infection.\n\nCase presentation\nA 40-year-old Japanese man suffering from acute compartment syndrome of his leg due to a car accident trauma was treated with a fasciotomy to decompress intra-compartmental pressure and restore tissue perfusion, and admitted to an intensive care unit. Unfortunately, as the open fasciotomy wound was complicated by infection, he complained of hyperalgesia and severe pain during wound debridement. He was therefore given acetaminophen and high-dose intravenous patient-controlled analgesic fentanyl (35 μg/kg per day) to reduce the pain. Despite these efforts, the pain was poorly controlled and opioid-induced side effects such as respiratory depression were observed. An immersive virtual reality analgesic therapy aimed at distraction and relaxation was used and effectively alleviated the pain. Three sessions of virtual reality analgesic therapy over 2 days produced sustainable analgesic effects, which led to a 25–75% dose reduction in fentanyl administration and the concomitant alleviation of respiratory depression.\n\nConclusions\nThis case suggests the feasibility of virtual reality analgesic therapy for pain management of fasciotomy wound complications in acute compartment syndromes. Virtual reality represents a treatment option that would reduce analgesic consumption and eliminate opioid-induced respiratory depression to treat fasciotomy wound infection.\n\nKeywords\nVirtual realityFasciotomy wound infectionsAcute compartment syndromeISPS KAKENHI18K1653618K0891617K11049Esumi Ryo Shimaoka Motomu Kawamoto Eiji issue-copyright-statement© The Author(s) 2020\n==== Body\nIntroduction\nAcute compartment syndrome (ACS) is a serious complication of limb trauma, in which the swelling of injured tissues and/or concomitant hematoma causes an increase in intra-compartmental pressure, thereby constraining blood perfusion of the tissues [1]. Ischemia induces neurological symptoms such as numbness and pain. If low or lack of blood perfusion persists, it can ultimately cause tissue necrosis, irreversibly damaging the limbs [1, 2].\n\nA prompt execution of fasciotomy is recommended to decompress the intra-compartmental pressure and restore tissue perfusion, once a severe rise in pressure is either confirmed by invasive monitoring or assessed from clinical symptoms [3]. Although early fasciotomy is recommended for those suffering from ACS, this invasive procedure leaves the wound open, thereby endangering patients with potential complications such as wound infections, which have been reported to occur in 10–30% of cases [4, 5].\n\nSevere pain is a hallmark of ACS and strongly suggests the presence of acutely increased intra-compartmental pressure and resulting tissue ischemia, thereby prompting the need for a decompressive fasciotomy [1, 2]. When decompression of the intra-compartmental pressure is achieved by fasciotomy, the intensity of the pain should gradually cease. A short course of opioid treatment is then suitable for pain management in patients with ACS [6]. However, pain can be recurrent and can even worsen when a fasciotomy wound is compounded by infection, thereby complicating the use of opioids for pain management [7–9].\n\nVirtual reality (VR) has recently emerged as a novel analgesic therapy that could replace or complement conventional pharmacological treatments, and has been extensively studied in the pain management of patients with burns. The list of painful conditions successfully treated with VR is growing. Here we add to the list a case of ACS complicated by fasciotomy wound infection. In this case, the patient’s pain was difficult to manage with opioids due to intolerable adverse effects such as nausea and respiratory depression.\n\nCase presentation\nA 40-year-old Japanese man, a truck driver, suffered multiple traumas during a road car crash that severely damaged the front part of his truck. While he was trapped in the driver’s seat, his lower-right limb was strongly pinched against the dashboard for 8 hours until he was saved by a rescue team. He was then transferred to an intensive care unit (ICU) at Mie University Hospital, a tertiary academic medical care center.\n\nHe was fully alert and complained of severe pain, along with numbness and weakness, in his right limb. A full-body computed tomography scan revealed multiple rib and lumbar compression fractures. His right lower leg had no fractures; however, the muscles in his lower leg were significantly swollen after the prolonged compression. After placing intramuscular catheters to monitor the intra-compartment pressures of his lower limb, the trauma team found that the pressures in the anterior, posterior, medial, and lateral side compartments had risen to ~ 50 mmHg. Based on these findings, he was diagnosed as having ACS, and quickly underwent a fasciotomy of his right lower limb. The fasciotomy wounds were left open (Fig. 1 top panels), and were cleaned daily and wrapped in a dressing containing an antibiotic ointment.\nFig. 1 Clinical images of right foot acute compartment syndrome in a 40-year-old man injured in a road car accident. (Top) Images taken immediately after the fasciotomy on day 1; (bottom) images taken on day 8, showing wound infections. (a) and (c) indicate the inside of the lower leg. (b) and (d) indicate the outside of the lower leg\n\n\n\nAfter the fasciotomy, the neurological deficits of his right limb were gradually restored and the pain intensity was reduced, made manageable by opioid treatment for at least for 4 days (Fig. 2).\nFig. 2 Clinical course of intravenous patient-controlled analgesia fentanyl using a 0–10 pain rating scale. On days 14 and 15, the patient was administered an immersive virtual reality. Debridement of infected necrotic tissues was performed beginning on day 8. The dotted line represents the appropriate continuous intravenous infusion of fentanyl (2.88–16.08 μg/kg per day). The time courses for the major clinical events and approximate intensities of the opioid-induced adverse effects are shown. ICU intensive care unit, IV-PCA intravenous patient-controlled analgesia, VR virtual reality\n\n\n\nHe exhibited rhabdomyolysis with increased levels of serum creatine phosphokinase (CPK) and acute renal failure, possibly due to the ischemia reperfusion injury associated with ACS (Fig. 3). His CPK level progressively decreased and returned to normal levels on day 10, indicating resolution of the rhabdomyolysis. Acute renal failure temporarily required hemodialysis for 5 days, and he subsequently recovered.\nFig. 3 Time course of rhabdomyolysis (creatine phosphokinase), acute renal failure (estimated glomerular filtration rate), and inflammation (C-reactive protein). Hemodialysis was performed only for the first 5 days. Creatine phosphokinase values are indicated on the left axis, the estimated glomerular filtration rate values are indicated on the right axis, and C-reactive protein values are indicated on the right axis. CPK creatine phosphokinase, CRP C-reactive protein, eGFR estimated glomerular filtration rate, ICU intensive care unit\n\n\n\nThe pain at the fasciotomy wounds on his right leg was well managed for 4 days (days 1 to 4), as shown by the score of 5 points on the Numeric Rating Scale (NRS) for pain (0–10) [10], via intravenous patient-controlled analgesia (IV-PCA) fentanyl at a dose of ~ 12 μg/kg per day (Fig. 2). On day 5, owing to the onset of nausea, IV-PCA fentanyl was discontinued and replaced with a drip infusion of acetaminophen. However, as acetaminophen could not sufficiently control the pain, IV-PCA fentanyl was resumed along with antiemetic agents on day 6. On day 8, as our patient’s pain at the wounds intensified, we observed the appearance of defective granulation and necrotic tissue at the site of the fasciotomy despite adequate infection prevention. In addition, the wounds exuded a foul odor and were strongly suggestive of infection (Fig. 1 bottom panels). To control the wound infections, debridement of the infected necrotic tissues was performed.\n\nAlthough the wound infections appeared to be under control with antibiotics and debridement, our patient continued to complain of severe pain both during and between procedures, as shown by the NRS of 6–10 points. The pain experienced was self-described as if being stabbed with a pin or a needle or, alternately, a numbness resulting in a dull sensation. The pain began abruptly, irrespective of body movement, and lasted for approximately 1 hour. A dose of IV-PCA fentanyl to manage the pain was progressively increased up to 35 μg/kg per day from day 10 to 13. He also presented hyperalgesia of his right limb beginning at day 10. In addition, nausea and poor appetite worsened as a side effect of high-dose fentanyl, and he experienced loud snoring and excessive daytime sleepiness due to opioid-induced respiratory depression; as such, he was administered oxygen to prevent hypoxia. We consulted with an in-hospital pain control team about a pain management strategy to replace/complement opioid administration. They confirmed the presence of opioid-refractory severe pain and hyperalgesic states, and proposed the use of VR analgesia.\n\nOn day 14, he was provided with an immersive VR using the Samsung Gear Oculus headset fitted with a Samsung Galaxy S7 phone loaded with the AppliedVR (AVR) healthcare platform (AppliedVR Inc., Los Angeles, CA 90067, USA), which delivers various VR analgesia program modules. Of 20+ VR programs designed to distract and/or relax, the program “Dream Beach” was selected according to our patient’s preference for the sea. The VR program simulates the experience of being at the beach beside a calm sea on a sunny day. Each session lasted for 30 minutes and three sessions were administered over 2 days. The VR analgesic proved effective, as his pain rating fell dramatically from 10 to 6 points. On day 15, the second day of VR administration, its analgesic effects proved so successful that bolus infusions of IV-PCA fentanyl were no longer required. On day 16, the pain rating scale remained 2 points under a baseline IV-PCA infusion of 8.8 μg/kg per day fentanyl, and as the wound pain became manageable, he was transferred from the ICU to a general surgery ward at a secondary care hospital. At day 28, after the fasciotomy, he was free of opioids and the wounds were closed using split-thickness skin grafting.\n\nDiscussion and conclusions\nIn this case report, we present a successful application of an immersive VR experience to alleviate severe pain from the open fasciotomy wounds of a patient with ACS who had been treated with a high-dose (that is, 35 μg/kg per day fentanyl) IV-PCA opioid, which became intolerable due to adverse effects such as nausea and respiratory depression. The analgesic effects brought about by this immersive VR experience to our patient made it possible to reduce the doses of IV-PCA fentanyl by 25~75%, which alleviated the opioid-induced respiratory depression. This case study not only confirms previous reports showing the effectiveness of VR to alleviate pain during wound care and physical therapy in patients with burns [11, 12], but also illustrates the feasibility of using a VR analgesic to manage pain in a patient with ACS.\n\nIn patients with ACS, the pain during the early phase – that is, within several days after fasciotomy – may stem from physical tissue damage and inflammation, as well as from ischemia and ischemia-reperfusion that can damage neuronal and non-neuronal cells [1, 6]. Generally speaking, pain in the early phase gradually decreases, as inflammation resolves while the wounds heals. Such pain is usually manageable in the early phase with opioids, as occurred in our case [6]. In contrast, pain in the late phase – that is, several days after the fasciotomy – may indicate the presence of complications associated with ACS and fasciotomy, such as wound infections and neuropathic pain [2, 4]. Pain in the late phase is often not well managed with opioids, as was observed in this case. This is partly due to the fact that prolonged use of opioids is accompanied by several adverse effects, from nausea, itching, and constipation to respiratory depression and the development of tolerance and dependency [13]. Of note, opioids have been shown to exhibit a wide range of immune-suppressive effects [14], thereby potentially worsening wound infections [15]. Hyperalgesia also occurred in our case. Hyperalgesia can be divided into three types: primary, secondary, and opioid-induced. Primary hyperalgesia is caused by the exacerbation of pain due to tissue damage. Secondary hyperalgesia involves the spreading to undamaged tissue. In general, pain spreads to the areas surrounding the damaged tissue. Opioid-induced hyperalgesia is thought to be induced by the administration of opioids such as morphine and fentanyl to relieve pain [16]. However, the narcotic side effects can be severe enough to warrant discontinuation of opioid treatment. In the current case, as primary or opioid-induced hyperalgesia may have occurred, it was necessary to reduce the dose of fentanyl as quickly as possible. Thus, it is of great clinical significance that a VR analgesic proved effective in alleviating the pain in the late phase of a patient with ACS treated with fasciotomy, thereby reducing the need for opioids [12].\n\nContinuous infusion of fentanyl at 2.88–16.08 μg/kg per day for several days has often been safely used without any serious side effects such as respiratory depression [17, 18]. The appearance of serious adverse effects such as respiratory depression, which can require intubation, would hamper the continuous use of high-dose fentanyl [19], as was the case in this report. Thus, a pain management approach that would replace/complement opioids, thereby mitigating the risk of opioid-induced respiratory depression, would be extremely useful in ICUs and other clinical settings. In fact, opioid-induced respiratory depression represents the major morbidity associated with opioid abuse [20]. Considering the adverse effects of opioids and the serious negative social impact of widespread opioid addiction that originates from the misuse of prescription drugs [21], alternative means of pain control that can reduce opioid usage are of great clinical importance. VR is a promising non-pharmacological means to replace and/or complement opioids [12]. It has been shown in healthy individuals that the thermal stimulation of VR confers additive analgesic effects to opioid treatment in alleviating pain [22]. Consistent with these findings, our own case of ACS showed that pain relieved by VR resulted in reduced opioid requirements, which alleviated our patient’s opioid-induced respiratory depression. Further investigations would be needed to test how well VR can replace/complement opioid analgesics in acute and chronic pain conditions in various diseases.\n\nThe major mechanism by which the VR program described in our case reduced pain was distraction, which is designed to dilute a patient’s attention to pain, supplanted by an immersive VR environment, which modulates a patient’s pain perception [12]. Relaxation, another mechanism closely related to distraction, was also employed in our VR analgesic regimen. As pain perception can be influenced by a patient’s affect (a psychological term describing the experience of positive emotion), shifting the distressing circumstances of being in a wounded state in a hospital room toward the much more enjoyable circumstances of a pleasant VR environment gives rise to a positive effect, which alleviates pain. To optimize the effects of distraction and relaxation, proper selection of the VR content is critically important. In fact, although we prescreened 20+ available VR programs based on our patient’s preference for the sea, the “Dream Beach” program proved effective, while the “Sea Hospital” program, which simulates the experience of being at a pool with seals, was not effective.\n\nAlthough not applicable to the present case, focus-shifting and skill-building represent two additional advanced mechanisms of VR analgesia [12]. As is often observed in gaming-type VR programs such as “Bear Blast”, which involves a shooting game to target bears with cannon balls, focus-shifting potently shifts one’s attention to VR objects, and requires the user’s focused interaction with a VR environment. It has been shown in patients with burns that VR analgesics based on focus-shifting mechanisms are more effective at alleviating pain than that of mere passive distraction [23]. Skill-building aims to foster a patient’s capacity to achieve a certain mental state, such as mindfulness mediation, in order to control their mental and physical responses to painful conditions [24, 25]. As skill-building would require more active engagement than simple passive distraction [12], this might prove difficult for some patients in ICU. Skill-building VR is expected to be effective for the management of chronic pain [12].\n\nHow long the analgesic effects of VR can last represents an important and unresolved question. It has been shown that the preoperative administration of immersive VR experiences made pediatric patients more resilient to postoperative pain [26]. It is possible that VR analgesia, under certain settings, may give rise to sustainable modulation of pain perception. In our case, our patient felt significantly less pain not only during, but also sometime after administration of the VR analgesic, thus suggesting that the effects could last for hours or days. A possible explanation for the long-lasting analgesic effects of VR in our case might be that a VR-induced positive shift of our patient’s affect helped modulate pain perception in a lasting manner, continuing even after the VR session had ended [12].\n\nA potential limitation of VR analgesics is the cost of introducing such a platform (including software and hardware) to clinics. Although the initial expenses might be high, one recent economic analysis using computer modeling has estimated that, overall, VR analgesic therapy would be cost saving whenever it reduced the length of hospitalization [27]. Real-world economic analyses are needed to carefully assess the economic benefits of VR analgesic therapies. In addition, potential adverse effects, if any, might limit the utility of VR analgesia in clinics. Several clinical studies have occasionally, though quite infrequently, reported minor incidences such as nausea, thereby supporting the overall safety profile of VR’s clinical applications [11]. As is sometime seen in recreational VR users, motion sickness, which can induce nausea, is a major factor potentially limiting the utility of VR analgesia [28]. Investigations into human and machine factors affecting susceptibility to nausea, as well as the development of novel technologies mitigating such side effects are currently underway.\n\nAbbreviations\nVRVirtual reality\n\nIV-PCAIntravenous patient-controlled analgesia\n\nNRSNumeric Rating Scale\n\nACS Acute compartment syndrome\n\nICUIntensive care unit\n\nCPKCreatine phosphokinase\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAcknowledgements\nWe would like to acknowledge the patient for allowing his case to be published.\n\nAuthors’ contributions\nRE, EK, and MS designed the study, and wrote the initial draft of the manuscript. EK and MS contributed to analysis and interpretation of data, and assisted in the preparation of the manuscript. AY has contributed to data collection and interpretation, and critically reviewed the manuscript. All authors approved the final version of the manuscript.\n\nFunding\nThis work was supported by ISPS KAKENHI (Grants-in-Aid for Scientific Research) grant numbers 18 K16536, 2019; grant numbers 18 K08916, 2019; and grant numbers 17 K11049, 2019.\n\nAvailability of data and materials\nNot applicable.\n\nEthics approval and consent to participate\nNot applicable for case report.\n\nConsent for publication\nWritten informed consent was obtained from the patient for publication of this manuscript and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n==== Refs\nReferences\n1. Schmidt AH Acute compartment syndrome Injury 2017 48 Suppl 1 S22 S25 10.1016/j.injury.2017.04.024 28449851 \n2. Sands AK Rammelt S Manoli A 2nd Foot compartment syndrome–a clinical review Fuß & Sprunggelenk 2015 13 11 21 10.1016/j.fuspru.2015.01.002 \n3. Walters TJ Kottke MA Hargens AR Ryan KL Noninvasive diagnostics for extremity compartment syndrome following traumatic injury: A state-of-the-art review J Trauma Acute Care Surg 2019 87 S59 S66 10.1097/TA.0000000000002284 31246908 \n4. Dover M Memon AR Marafi H Kelly G Quinlan JF Factors associated with persistent sequelae after fasciotomy for acute compartment syndrome J Orthop Surg (Hong Kong) 2012 20 312 315 10.1177/230949901202000309 23255636 \n5. Hake ME Etscheidt J Chadayammuri VP Kirsch JM Mauffrey C Age and dressing type as independent predictors of post-operative infection in patients with acute compartment syndrome of the lower leg Int Orthop 2017 41 2591 2596 10.1007/s00264-017-3576-1 28730321 \n6. Mar GJ Barrington MJ McGuirk BR Acute compartment syndrome of the lower limb and the effect of postoperative analgesia on diagnosis Br J Anaesth 2009 102 3 11 10.1093/bja/aen330 19022795 \n7. Lollo L Grabinsky A Clinical and functional outcomes of acute lower extremity compartment syndrome at a Major Trauma Hospital Int J Crit Illn Inj Sci 2016 6 133 142 10.4103/2229-5151.190648 27722115 \n8. Fitzgerald AM Gaston P Wilson Y Quaba A McQueen MM Long-term sequelae of fasciotomy wounds Br J Plast Surg 2000 53 690 693 10.1054/bjps.2000.3444 11090326 \n9. Brown A Strategies to reduce or eliminate wound pain Nurs Times 2014 110 12 15 24822380 \n10. Chanques G Viel E Constantin JM Jung B de Lattre S Carr J Cisse M Lefrant JY Jaber S The measurement of pain in intensive care unit: comparison of 5 self-report intensity scales Pain 2010 151 711 721 10.1016/j.pain.2010.08.039 20843604 \n11. Indovina P Barone D Gallo L Chirico A De Pietro G Giordano A Virtual Reality as a Distraction Intervention to Relieve Pain and Distress During Medical Procedures: A Comprehensive Literature Review Clin J Pain 2018 34 858 877 29485536 \n12. Ahmadpour N Randall H Choksi H Gao A Vaughan C Poronnik P Virtual Reality interventions for acute and chronic pain management Int J Biochem Cell Biol 2019 114 105568 10.1016/j.biocel.2019.105568 31306747 \n13. Chou R Fanciullo GJ Fine PG Adler JA Ballantyne JC Davies P Donovan MI Fishbain DA Foley KM Fudin J Clinical guidelines for the use of chronic opioid therapy in chronic noncancer pain J Pain 2009 10 113 130 10.1016/j.jpain.2008.10.008 19187889 \n14. Roy S Wang J Kelschenbach J Koodie L Martin J Modulation of immune function by morphine: implications for susceptibility to infection J NeuroImmune Pharmacol 2006 1 77 89 10.1007/s11481-005-9009-8 18040793 \n15. Schwacha MG McGwin G Hutchinson CB Cross JM Maclennan PA Rue LW The contribution of opiate analgesics to the development of infectious complications in burn patients Am J Surg 2006 192 82 86 10.1016/j.amjsurg.2006.01.001 16769281 \n16. Lee M Silverman SM Hansen H Patel VB Manchikanti L A comprehensive review of opioid-induced hyperalgesia Pain Physician 2011 14 145 161 21412369 \n17. Shin S Min KT Shin YS Joo HM Yoo YC Finding the 'ideal' regimen for fentanyl-based intravenous patient-controlled analgesia: how to give and what to mix? Yonsei Med J 2014 55 800 806 10.3349/ymj.2014.55.3.800 24719151 \n18. Song JW Park EY Lee JG Park YS Kang BC Shim YH The effect of combining dexamethasone with ondansetron for nausea and vomiting associated with fentanyl-based intravenous patient-controlled analgesia Anaesthesia 2011 66 263 267 10.1111/j.1365-2044.2011.06648.x 21401538 \n19. Pattinson KT Opioids and the control of respiration Br J Anaesth 2008 100 747 758 10.1093/bja/aen094 18456641 \n20. Dahan A Overdyk F Smith T Aarts L Niesters M Pharmacovigilance: a review of opioid-induced respiratory depression in chronic pain patients Pain Physician 2013 16 E85 E94 23511694 \n21. Volkow ND McLellan AT Opioid Abuse in Chronic Pain--Misconceptions and Mitigation Strategies N Engl J Med 2016 374 1253 1263 10.1056/NEJMra1507771 27028915 \n22. Hoffman HG Richards TL Van Oostrom T Coda BA Jensen MP Blough DK Sharar SR The analgesic effects of opioids and immersive virtual reality distraction: evidence from subjective and functional brain imaging assessments Anesth Analg 2007 105 1776 1783 10.1213/01.ane.0000270205.45146.db 18042882 \n23. Jeffs D Dorman D Brown S Files A Graves T Kirk E Meredith-Neve S Sanders J White B Swearingen CJ Effect of virtual reality on adolescent pain during burn wound care J Burn Care Res 2014 35 395 408 10.1097/BCR.0000000000000019 24823326 \n24. Hadley W Houck C Brown LK Spitalnick JS Ferrer M Barker D Moving Beyond Role-Play: Evaluating the Use of Virtual Reality to Teach Emotion Regulation for the Prevention of Adolescent Risk Behavior Within a Randomized Pilot Trial J Pediatr Psychol 2019 44 425 435 10.1093/jpepsy/jsy092 30551157 \n25. Nararro-Haro MV Hoffman HG Garcia-Palacios A Sampaio M Alhalabi W Hall K Linehan M The Use of Virtual Reality to Facilitate Mindfulness Skills Training in Dialectical Behavioral Therapy for Borderline Personality Disorder: A Case Study Front Psychol 2016 7 1573 10.3389/fpsyg.2016.01573 27853437 \n26. Eijlers R Dierckx B Staals LM Berghmans JM van der Schroeff MP Strabbing EM Wijnen RMH Hillegers MHJ Legerstee JS Utens EMWJ Virtual reality exposure before elective day care surgery to reduce anxiety and pain in children: A randomised controlled trial Eur J Anaesthesiol 2019 36 728 737 10.1097/EJA.0000000000001059 31356373 \n27. Delshad SD Almario CV Fuller G Luong D Spiegel BMR Economic analysis of implementing virtual reality therapy for pain among hospitalized patients NPJ Digit Med 2018 1 22 10.1038/s41746-018-0026-4 31304304 \n28. Fernandes AS Feiner SK Combating VR sickness through subtle dynamic field-of-view modification IEEE Symposium on 3D User Interfaces (3DUI) 2016 201 210\n\n", "fulltext_license": "CC BY", "issn_linking": "1752-1947", "issue": "14(1)", "journal": "Journal of medical case reports", "keywords": "Acute compartment syndrome; Fasciotomy wound infections; Virtual reality", "medline_ta": "J Med Case Rep", "mesh_terms": "D000328:Adult; D003161:Compartment Syndromes; D000071938:Fasciotomy; D006801:Humans; D007869:Leg Injuries; D008297:Male; D059408:Pain Management; D013530:Surgical Wound Infection; D000076142:Virtual Reality; D063367:Virtual Reality Exposure Therapy", "nlm_unique_id": "101293382", "other_id": null, "pages": "46", "pmc": null, "pmid": "32290865", "pubdate": "2020-04-14", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "23255636;28730321;24823326;21412369;31246908;31304304;11090326;19187889;18456641;27028915;28449851;30551157;19022795;21401538;27853437;29485536;23511694;18040793;31306747;31356373;20843604;27722115;18042882;16769281;24822380;24719151", "title": "Virtual reality as a non-pharmacologic analgesic for fasciotomy wound infections in acute compartment syndrome: a case report.", "title_normalized": "virtual reality as a non pharmacologic analgesic for fasciotomy wound infections in acute compartment syndrome a case report" }
[ { "companynumb": "JP-FRESENIUS KABI-FK202004541", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "ACETAMINOPHEN" }, "drugadditional": null...
{ "abstract": "Granulocytic sarcomas are rare tumors that can present in innumerous locations; thus there is very little clinical experience with these cases. Therefore there is no consensus on which is the best treatment for patients with this malignancy. The authors present a case of a female with a granulocytic sarcoma of the breast and review the literature for the role of radiotherapy in the management of this clinical entity.", "affiliations": "Radiotherapy Department, Instituto Português de Oncologia do Porto de Francisco Gentil, E.P.E, Portugal.;Radiotherapy Department, Instituto Português de Oncologia do Porto de Francisco Gentil, E.P.E, Portugal.;Radiotherapy Department, Instituto Português de Oncologia do Porto de Francisco Gentil, E.P.E, Portugal.;Radiotherapy Department, Instituto Português de Oncologia do Porto de Francisco Gentil, E.P.E, Portugal.;Radiotherapy Department, Instituto Português de Oncologia do Porto de Francisco Gentil, E.P.E, Portugal.", "authors": "Gonçalves|Joana|J|;Louro|Luís Vasco|LV|;Ribeiro|Ivone|I|;Oliveira|Angelo|A|;Castro|Carla|C|", "chemical_list": null, "country": "Poland", "delete": false, "doi": "10.1016/j.rpor.2014.02.002", "fulltext": null, "fulltext_license": null, "issn_linking": "1507-1367", "issue": "19(5)", "journal": "Reports of practical oncology and radiotherapy : journal of Greatpoland Cancer Center in Poznan and Polish Society of Radiation Oncology", "keywords": "Chloroma; Extramedullary leukemia; Granulocytic sarcoma; Radiotherapy", "medline_ta": "Rep Pract Oncol Radiother", "mesh_terms": null, "nlm_unique_id": "100885761", "other_id": null, "pages": "343-6", "pmc": null, "pmid": "25184060", "pubdate": "2014-09", "publication_types": "D016428:Journal Article", "references": "4513297;17169797;12764375;383264;15177430;21975070;6575971;7023656;8478662;3465429;16940364;17958995;15628906;22937319;16814144;17170724;8273636;9648817;21962486;20437873;11373207", "title": "Radiotherapy for granulocytic sarcoma of the breast-Case report and review of the literature.", "title_normalized": "radiotherapy for granulocytic sarcoma of the breast case report and review of the literature" }
[ { "companynumb": "PT-FRESENIUS KABI-FK201601511", "fulfillexpeditecriteria": "1", "occurcountry": "PT", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "CYTARABINE" }, "drugadditional": null, ...
{ "abstract": "Ofloxacin is a commonly used quinolone antibiotic both in adults as well as children. It is generally safe and well tolerated. Rarely, neurological and psychiatric adverse reactions are reported to occur with ofloxacin. We report a case of a child who developed delirium after ofloxacin treatment, that resolved after medication discontinuation and treatment with low dose olanzapine.", "affiliations": "Department of Psychiatry, Tata Motors Hospital, Jamshedpur, India.;Department of Pediatrics, Tata Motors Hospital, Jamshedpur, India.;Department of Psychiatry, Kasturba Medical College, Manipal, Udupi, India.", "authors": "Bhattacharya|Arnab|A|;Sharan|Rajiv|R|;Praharaj|Samir Kumar|SK|", "chemical_list": null, "country": "Korea (South)", "delete": false, "doi": "10.9758/cpn.2017.15.4.416", "fulltext": "\n==== Front\nClin Psychopharmacol NeurosciClin Psychopharmacol NeurosciClinical Psychopharmacology and Neuroscience1738-10882093-4327Korean College of Neuropsychopharmacology 2907375610.9758/cpn.2017.15.4.416cpn-15-416Case ReportHigh Dose Ofloxacin-induced Bimodal Hallucinations in a 4 Years Old Child Bhattacharya Arnab 1Sharan Rajiv 2Praharaj Samir Kumar 3\n1 Department of Psychiatry, Tata Motors Hospital, Jamshedpur, \nIndia\n2 Department of Pediatrics, Tata Motors Hospital, Jamshedpur, \nIndia\n3 Department of Psychiatry, Kasturba Medical College, Manipal, Udupi, \nIndiaAddress for correspondence: Samir Kumar Praharaj, MBBS, MD, DPM, Department of Psychiatry, Kasturba Medical College, Manipal, Udupi, Karnataka 576104, India, Tel: +91-8971026304, Fax: +91-820-2571930, E-mail: samirpsyche@yahoo.co.in11 2017 30 11 2017 15 4 416 417 18 4 2016 05 8 2016 10 10 2016 Copyright © 2017, Korean College of Neuropsychopharmacology2017This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.Ofloxacin is a commonly used quinolone antibiotic both in adults as well as children. It is generally safe and well tolerated. Rarely, neurological and psychiatric adverse reactions are reported to occur with ofloxacin. We report a case of a child who developed delirium after ofloxacin treatment, that resolved after medication discontinuation and treatment with low dose olanzapine.\n\nOfloxacinHallucinationsPsychotic disordersDelirium\n==== Body\nINTRODUCTION\nOfloxacin is a popular fluoroquinolone medication used in adults as well as children. Clinical trials with orally and intravenously administered ofloxacin have confirmed its potential for use for a wide variety of infections, where it has generally proved as effective as other standard treatments. The molecule acts by binding the top-oisomerase of the bacteria and is generally well tolerated in comparison with other available fluoroquinolones is less likely to cause clinically relevant drug interactions.1,2) We report a case of a child who developed delirium after ofloxacin treatment, that resolved after medication discontinuation and treatment with antipsychotics.\n\nCASE\nA four-year-old girl weighing 24 kg presented with fever, vomiting and bouts of loose motion. She was admitted and treated for acute gastroenteritis with intravenous fluids, injection ofloxacin 70 mg twice daily and injection ondansetron 2 mg single dose. Blood investigations including serum electrolytes were normal. She was discharged on third day after clinical improvement with oral ofloxacin 400 mg, 1/4 tablet twice daily and asked to follow up after two days.\n\nA day later her parents brought her to the emergency department reporting that she had begun to see snakes in her room and felt ants crawling up her arms which she brushed off. She commented that her father had a helicopter in his hand and was putting it in a bag. She reported that strangers were standing in the room and looking at her. On clarification during psychiatry consultation, it was found that inadvertently she had been given full tablet of ofloxacin twice daily instead of the quarter tablet (thus she received 800 mg/day instead of the prescribed 200 mg/day). There was no past or family history of any psychiatric disorder or major medical illness.\n\nMental status examination showed a well kempt girl with ill sustained eye contact who clung to her mother, poor attention, occasional muttering and looking frequently at the ceiling of the examination room with an anxious affect. A diagnosis of ofloxacin-induced delirium was considered and the medication was stopped. She was started on olanzapine 2.5 mg per day. Her psychotic features subsided completely within the next 72 hours and the antipsychotic was tapered off in two weeks. She remains well with no recurrence two months later.\n\nDISCUSSION\nOur patient developed a bimodal hallucinatory psychosis (tactile and visual hallucinations) after ofloxacin therapy. The first mention of such side effects was in two patients developing psychosis after exposure to ofloxacin.3) Both were adult females (one was elderly), and both had thyroid disorder which can predispose to psychosis. Also, the elderly patient had a past history of mood disorder and urinary stones needing antispasmodics and analgesics; thus being vulnerable to develop psychiatric symptoms. Another report cites a 5 year old child developing visual hallucinations in response to ofloxacin.4) She was suffering from organic cerebral disorder (epilepsy) and had taken ornidazole in addition to ofloxacin for diarhhoea, hence it may be difficult to ascertain as to which of the two medications had caused the psychosis. Similarly, in the report by Koul et al.,5) the patient received a combination of ofloxacin and metronidazole. In our case, there was no underlying psychiatric or neurological disorder, and the child received ofloxacin monotherapy, making it likely that ofloxacin was the agent involved in producing such an adverse reaction. However, the poor attention span along with psychotic symptoms raises the possibility of delirium associated with ofloxacin toxicity. Delirium has been reported with ofloxacin use previously6); which is clinically distinguishable from acute psychosis if ‘attention impairment’ or ‘confusion’ is present. A Naranjo algorithm score of 8 was obtained which implied a probable drug related causation of the phenomenon.7) The psychotic symptoms resolved within 3 days with low dose of olanzapine treatment.\n\nPsychosis is not only reported to occur with ofloxacin, but also with other fluoroquinolones such as ciprofloxacin, levofloxacin, norfloxacin and gatifloxacin,8,9) which suggests a class effect, i.e. fluoroquinolone-induced psychosis. Similarly, delirium is also associated with fluoroquinolones other than ofloxacin, such as levofloxacin,10,11) gatifloxacin12) and ciprofloxacin.13) Specifically, ciprofloxacin, ofloxacin and pefloxacin were the quinolones with more neurological and psychiatric adverse reactions reported in the literature.9) In a systematic review by Mostafa and Miller,14) fluoroquinolones, penicillins and trimethoprim-sulfamethoxazole were the three classes of antibiotics that were associated with acute psychosis. The mechanism of a fluoroquinolone-induced psychosis could involve the upregulation of glutamatergic transmission in the brain via NMDA receptor involvement.10) There is also speculation that inhibition of GABA binding to the GABA-A receptors may result in stimulation of the central nervous system,15) which has been found in electroencephalographic studies of volunteers taking ofloxacin. Ofloxacin has a serum/plasma ratio of 47% to 87%, and at therapeutic doses the serum levels are inadequate to produce cerebrospinal fluid (CSF) concentrations needed for the adverse effects to occur.16) In our case 800 mg of ofloxacin was supratherapeutic for a 4 year old child and it is possible that sufficiently high CSF levels were attained leading to development of delirium. In conclusion, prescribers need to be aware of the possibility of the frequently used drug, ofloxacin to produce delirium or acute psychotic symptoms, specifically at higher doses in children, and the need for appropriate psychiatric intervention.\n==== Refs\nREFERENCES\n1 Lipsky BA Baker CA Fluoroquinolone toxicity profiles: a review focusing on newer agents Clin Infect Dis 1999 28 352 364 10.1086/515104 10064255 \n2 Todd PA Faulds D Ofloxacin. A reappraisal of its antimicrobial activity, pharmacology and therapeutic use Drugs 1991 42 825 876 10.2165/00003495-199142050-00008 1723377 \n3 Zaudig M von Bose M Ofloxacin-induced psychosis Br J Psychiatry 1987 151 563 564 10.1192/bjp.151.4.563 3482162 \n4 Chauhan U Shanbag P Kashid P Ofloxacin-induced hallucinations Indian J Pharmacol 2013 45 189 190 10.4103/0253-7613.108316 23716899 \n5 Koul S Bhan-Kotwal S Jenkins HS Carmaciu CD Organic psychosis induced by ofloxacin and metronidazole Br J Hosp Med (Lond) 2009 70 236 237 10.12968/hmed.2009.70.4.41632 19357607 \n6 Fennig S Mauas L Ofloxacin-induced delirium J Clin Psychiatry 1992 53 137 138 1564051 \n7 Naranjo CA Busto U Sellers EM Sandor P Ruiz I Roberts EA A method for estimating the probability of adverse drug reactions Clin Pharmacol Ther 1981 30 239 245 10.1038/clpt.1981.154 7249508 \n8 Ranjan A Praharaj SK Ciprofloxacin-induced psychosis J Neuropsychiatry Clin Neurosci 2014 26 E36 E37 10.1176/appi.neuropsych.13020033 24515705 \n9 Tomé AM Filipe A Quinolones: review of psychiatric and neurological adverse reactions Drug Saf 2011 34 465 488 10.2165/11587280-000000000-00000 21585220 \n10 Kiangkitiwan B Doppalapudi A Fonder M Solberg K Bohner B Levofloxacin-induced delirium with psychotic features Gen Hosp Psychiatry 2008 30 381 383 10.1016/j.genhosppsych.2007.11.003 18585545 \n11 Slobodin G Elias N Zaygraikin N Sheikh-Ahmad M Sabetay S Weller B Levofloxacin-induced delirium Neurol Sci 2009 30 159 161 10.1007/s10072-009-0027-9 19189043 \n12 Jay GT Fitzgerald JM Ciprofloxacin-induced delirium Ann Pharmacother 1997 31 252 10.1177/106002809703100221 9034431 \n13 Sumner CL Elliott RL Delirium associated with gatifloxacin Psychosomatics 2003 44 85 86 10.1176/appi.psy.44.1.85 12515846 \n14 Mostafa S Miller BJ Antibiotic-associated psychosis during treatment of urinary tract infections: a systematic review J Clin Psychopharmacol 2014 34 483 490 10.1097/JCP.0000000000000150 24911441 \n15 Domagala JM Structure-activity and structure-side-effect relationships for the quinolone antibacterials J Antimicrob Chemother 1994 33 685 706 10.1093/jac/33.4.685 8056688 \n16 Unseld E Ziegler G Gemeinhardt A Janssen U Klotz U Possible interaction of fluoroquinolones with the benzodia-zepine-GABAA-receptor complex Br J Clin Pharmacol 1990 30 63 70 10.1111/j.1365-2125.1990.tb03744.x 2167717\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "1738-1088", "issue": "15(4)", "journal": "Clinical psychopharmacology and neuroscience : the official scientific journal of the Korean College of Neuropsychopharmacology", "keywords": "Delirium.; Hallucinations; Ofloxacin; Psychotic disorders", "medline_ta": "Clin Psychopharmacol Neurosci", "mesh_terms": null, "nlm_unique_id": "101207332", "other_id": null, "pages": "416-417", "pmc": null, "pmid": "29073756", "pubdate": "2017-11-30", "publication_types": "D002363:Case Reports", "references": "3482162;23716899;21585220;18585545;1564051;8056688;24911441;1723377;19189043;10064255;12515846;7249508;24515705;2167717;19357607;9034431", "title": "High Dose Ofloxacin-induced Bimodal Hallucinations in a 4 Years Old Child.", "title_normalized": "high dose ofloxacin induced bimodal hallucinations in a 4 years old child" }
[ { "companynumb": "IN-BAUSCH-BL-2017-032359", "fulfillexpeditecriteria": "1", "occurcountry": "IN", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "OFLOXACIN" }, "drugadditional": "1", ...
{ "abstract": "Hiccups can arise from idiopathic, psychogenic and organic causes. The use of therapeutic drugs forms one of the important causes of hiccups. Although the exact pathophysiological processes involved have not yet been established, the neurotransmitters dopamine, serotonin and gamma amino butyric aid (GABA) have been documented to play a significant role in the generation of hiccups. We report a patient of organic bipolar affective disorder who developed hiccups with the atypical antipsychotic aripiprazole. The possible underlying neurotransmitter mechanisms, predisposing factors and clinical implications of this rare adverse event are discussed.", "affiliations": "Central Institute of Psychiatry, Ranchi, India.", "authors": "Ray|Prasenjit|P|;Zia Ul Haq|Mohammad|M|;Nizamie|S Haque|SH|", "chemical_list": "D018692:Antimanic Agents; D014150:Antipsychotic Agents; D010879:Piperazines; D015363:Quinolones; D011954:Receptors, Dopamine; D011985:Receptors, Serotonin; D012701:Serotonin; D002220:Carbamazepine; D005680:gamma-Aminobutyric Acid; D000068180:Aripiprazole; D004298:Dopamine", "country": "United States", "delete": false, "doi": "10.1016/j.genhosppsych.2008.09.014", "fulltext": null, "fulltext_license": null, "issn_linking": "0163-8343", "issue": "31(4)", "journal": "General hospital psychiatry", "keywords": null, "medline_ta": "Gen Hosp Psychiatry", "mesh_terms": "D000328:Adult; D018692:Antimanic Agents; D014150:Antipsychotic Agents; D000068180:Aripiprazole; D001714:Bipolar Disorder; D002220:Carbamazepine; D015984:Causality; D004298:Dopamine; D004347:Drug Interactions; D006207:Half-Life; D016489:Head Injuries, Closed; D006606:Hiccup; D006801:Humans; D008297:Male; D010879:Piperazines; D015363:Quinolones; D011954:Receptors, Dopamine; D011985:Receptors, Serotonin; D012701:Serotonin; D013997:Time Factors; D005680:gamma-Aminobutyric Acid", "nlm_unique_id": "7905527", "other_id": null, "pages": "382-4", "pmc": null, "pmid": "19555801", "pubdate": "2009", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Aripiprazole-induced hiccups: a case report.", "title_normalized": "aripiprazole induced hiccups a case report" }
[ { "companynumb": "TR-TEVA-584600ISR", "fulfillexpeditecriteria": "1", "occurcountry": "TR", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "ARIPIPRAZOLE" }, "drugadditional": null, "d...
{ "abstract": "An 83-year-old woman was scheduled for a second transurethral resection of a bladder tumor. The preoperative electrocardiogram evaluation revealed atrial fibrillation with a slow ventricular response (ventricular rate: 59 /min). After intravenous injection of 1% lidocaine 40 mg and propofol 60 mg, the ventricular rate increased to 113 beats/min and then fell rapidly to 27 beats/min. Blood pressure was 70/40 mmHg. Later an atrial fibrillation rhythm, with a ventricular rate of 100-130 beats/min, was observed together with a sinus pause and sinus rhythm with a ventricular rate of 40-50 beats/min. An external pacemaker was applied and set at 60 mA, 40 counts. After the patient regained consciousness, she presented an alert mental state and had no chest symptoms. She was discharged 2 weeks later without complications after insertion of a permanent pacemaker.", "affiliations": "Department of Anesthesiology and Pain Medicine, Hanyang University Hospital, Seoul, Korea.;Department of Anesthesiology and Pain Medicine, Hanyang University Hospital, Seoul, Korea.;Department of Anesthesiology and Pain Medicine, Hanyang University Hospital, Seoul, Korea.;Department of Anesthesiology and Pain Medicine, Hanyang University Hospital, Seoul, Korea.", "authors": "Choi|Sung Hwan|SH|;Choi|Sung Lark|SL|;Lee|Bong Yeong|BY|;Jeong|Mi Ae|MA|", "chemical_list": null, "country": "Korea (South)", "delete": false, "doi": "10.4097/kjae.2015.68.4.415", "fulltext": "\n==== Front\nKorean J AnesthesiolKorean J AnesthesiolKJAEKorean Journal of Anesthesiology2005-64192005-7563The Korean Society of Anesthesiologists 10.4097/kjae.2015.68.4.415Case ReportTachycardia-bradycardia syndrome in a patient with atrial fibrillation: a case report Choi Sung Hwan Choi Sung Lark Lee Bong Yeong Jeong Mi Ae Department of Anesthesiology and Pain Medicine, Hanyang University Hospital, Seoul, Korea.Corresponding author: Mi Ae Jeong, M.D., Ph.D. Department of Anesthesiology and Pain Medicine, Hanyang University Hospital, 222, Wangsimni-ro, Seongdong-gu, Seoul 133-792, Korea. Tel: 82-2-2290-8680, Fax: 82-2-2299-0742, macheong@hanyang.ac.kr8 2015 28 7 2015 68 4 415 419 03 4 2014 12 5 2014 27 5 2014 Copyright © the Korean Society of Anesthesiologists, 20152015This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.An 83-year-old woman was scheduled for a second transurethral resection of a bladder tumor. The preoperative electrocardiogram evaluation revealed atrial fibrillation with a slow ventricular response (ventricular rate: 59 /min). After intravenous injection of 1% lidocaine 40 mg and propofol 60 mg, the ventricular rate increased to 113 beats/min and then fell rapidly to 27 beats/min. Blood pressure was 70/40 mmHg. Later an atrial fibrillation rhythm, with a ventricular rate of 100-130 beats/min, was observed together with a sinus pause and sinus rhythm with a ventricular rate of 40-50 beats/min. An external pacemaker was applied and set at 60 mA, 40 counts. After the patient regained consciousness, she presented an alert mental state and had no chest symptoms. She was discharged 2 weeks later without complications after insertion of a permanent pacemaker.\n\nArtificial cardaic pacingAtrial fibrillationSick sinus syndrome\n==== Body\nTachycardia-bradycardia syndrome is a variant of sick sinus syndrome (caused by a functional defect of the sinus node, the primary pacemaker of the heart) in which slow and fast arrhythmias alternate [1]. This can induce sinus arrest, sinus node exit block, sinus bradycardia and sinus tachycardia, and is also associated with paroxysmal supraventricular tachycardia (PSVT) and atrial fibrillation. When present in tachycardia- bradycardia syndrome, tachycardia is accompanied by long sinus pauses [2].\n\nAtrial fibrillation is one of the most common types of arrhythmias in elderly patients [3]. Prior to an operation, patients with this arrhythmia require treatment and care because of the risk of ischemic heart disease, hypertensive heart disease, cardiac failure and embolism [4]. Also, patients with slow ventricular rates not caused by rate-controlling medication are at risk of sick sinus syndrome, need careful history-taking to uncover syncopal or near-syncopal episodes, and may need a Holter monitor. We report a case of tachycardia- bradycardia syndrome that was discovered immediately after injecting intravenous lidocaine and propofol in a patient with atrial fibrillation and successfully treated with an external pacemaker.\n\nCase Report\nAn 83-year-old woman (height: 168 cm, weight: 56 kg) was admitted to the outpatient center to receive a second transurethral resection of a bladder tumor (TURBT). The patient had underlying diabetes and hypertension and was taking a calcium channel blocker (Amlodipine) and an angiotensin II receptor blocker (Candelotan) for high blood pressure. She had undergone a hysterectomy 30 years previously and TURBT 2 months previously. She had suffered a stroke 2 years earlier but did not present sequelae. Her first TURBT had been uneventful.\n\nWhen the patient visited our hospital for her second TURBT the preoperative electrocardiogram (ECG) evaluation revealed atrial fibrillation with a slow ventricular response (ventricular rate: 59 beats/min) (Fig. 1). There were no self-perceived symptoms. Ejection fraction 63%, eccentric left ventricular hypertrophy (LVH), and left atrial enlargement (LAE) findings were obtained by transthoracic echocardiography. Cardiomegaly was observed in chest X-ray, and neck CT angiography showed total occlusion of the right internal carotid artery.\n\nAfter the patient had been taken to the operating room, her vital signs were monitored using a non-invasive blood pressure measuring device, ECG and pulse oximeter. Before anesthesia, her blood pressure was 150/90 mmHg, pulse rate (ventricular rate) 90 beats/min and pulse oximetry of 100%. After use of a mask to supply 100% oxygen for 3 minutes before anesthesia, 1% lidocaine 40 mg and propofol 60 mg were injected intravenously. Thereafter, blood pressure declined to 130/72 mmHg whereas ventricular rate increased slightly to 113 beats/min and then fell rapidly to 27 beats/min with blood pressure of 70/40 mmHg. Ephedrine 5 mg was immediately injected intravenously. Ventricular rate responded with an increase to 120 beats/min but then decreased again after 8 seconds of sinus pause. Afterwards, atrial fibrillation rhythm, with a ventricular rate of 100-130 beats/min, was observed followed by a sinus pause, sinus rhythm, with a ventricular rate of 40-50 beats/min (Figs. 2A, 2B and 2C). This cycle was repeated within a few minutes. An external pacemaker (LIFEPAK 20, Medtronic Co., Minneapolis, MN, USA) was applied and set at 60 mA, 40 counts. Pacing rhythms were observed during sinus pauses (Fig. 2D). The breathing of the patient was adjusted by mask ventilation until she woke up. She then presented an alert mental status and had no chest symptoms. She was observed for 30 minutes in the operating room while the monitoring devices and use of the external pacemaker were maintained. The operation was put on hold by decision of the surgeon and the patient was transferred to the recovery room with external pacing. A 110-130 beats/min atrial fibrillation rhythm, 40-50 beats/min sinus rhythm and 40 beat/min pacing rhythm were also observed in the recovery room. There were no self-perceived symptoms. The patient was transferred for emergency coronary angiography. There were no abnormal findings for vascularity, and a temporary pacemaker was inserted into the right ventricle. The patient was transferred to the cardiology department and treated for 2 weeks after insertion of a permanent pacemaker. A 60 count pacing rhythm was observed in a follow-up ECG (Fig. 3), and follow-up transthoracic echocardiography showed ejection fraction 65%, eccentric LVH, LAE, and the pacing rhythm was maintained without complications. The patient was discharged without any complications.\n\nDiscussion\nAtrial fibrillation is the most common type of arrhythmia in the elderly [5] and it is 10-20 times more common than atrial flutter [6]. It may cause no symptoms, but is often associated with palpitations, exercise intolerance, angina, congestive heart failure (shortness of breath, edema). Furthermore, as it is associated with the inability to fulfill preload caused by tachycardia, it can result in dyspnea on exertion, paroxysmal nocturnal dyspnea, presyncope and syncope [5]. Tachycardia- bradycardia syndrome can be generated by PSVT or atrial fibrillation. The symptoms are similar to those of atrial fibrillation: dizziness, fatigue, chest pain, angina, shortness of breath and fainting [2]. In patients with atrial fibrillation, it is important to determine whether the fibrillation is associated with sick sinus syndrome or with chronic atrial fibrillation that have normal sinus function.\n\nIn our case, although atrial fibrillation was seen in the preoperative evaluation, the medical history of the patient was not sufficiently investigated. During pre-operative checking the patient was only asked about present chest symptoms or other symptoms related to the atrial fibrillation. In a detailed interview on the patient's medical history after she awoke in the operating room, it was discovered that the patient had experienced dizziness and felt her symptoms had been worsening over the last 2-3 weeks. Also she had experienced dyspnea (NYHA Class III) and palpitation, aggravated over the last 2-3 days, from one month before. She didn't say about this. If we had elicited more details of the patient's medical history in the pre-operative evaluation, we would have obtained more information on the type and progress of atrial fibrillation, and the effects of the disease on everyday life outside the hospital. As a consequence, sick sinus syndrome would have been suspected, and additional examinations such as Holter monitoring could have been carried out.\n\nAtrial fibrillation is classified into 4 types according to its characteristics: initial diagnosis (first detected), self terminating episode lasting less than 7 days (paroxysmal), episode lasting more than 7 days (persistent) and sustained symptoms (permanent) [5]. This patient was not classified in terms of type of atrial fibrillation in the pre-operative evaluation. Thus, access to the frequency of atrial fibrillation episodes and the level of the ordinary ventricular rate was inadequate. It is stipulated that 24 hour Holter monitoring is required for the patient treatment and care before operation. Our patient was classified as having persistent atrial fibrillation on her evaluation after pacemaker insertion.\n\nWhen an atrial fibrillation patient shows signs of hemodynamic instability or symptoms of cardiac failure, electrical cardioversion is the most effective treatment for enhancing cardiac output and reducing the risk of thromboembolism [5]. Atrial fibrillation can be converted to normal sinus rhythm by this treatment. Pharmacologic control can also be used to control ventricular rate [5789]. Amiodarone, diltiazem, verapamil and digoxin can be used as medications, and AV nodal conduction can be slowed to adjust the ventricular response [5789]. However, treating atrial fibrillation with cardioversion or medication can be hazardous if the sinus node is impaired [2]. As these treatments can worsen bradyarrhythmia, a pacemaker must be inserted before pharmacologic control is attempted [10]. If the bradycardia is not the result of drug therapy (ie, digitalis, beta-blockers), an abnormal sinus node physiology should be considered [2]. Atrial fibrillation associated with tachycardia-bradycardia syndrome should be treated with a permanent pacemaker in combination with drugs [210].\n\nIn our case, blood pressure and pulse oximetry were stable when the ventricular rate of the patient showed tachycardia. And the tachycardia was followed by severe bradycardia. Since we believed that our patient had tachycardia-bradycardia syndrome we started external pacing as quickly as possible without implementing cardioversion or medication. Our patient was started medication (verapamil for control rate, aspirin and warfarin for prevent thromoembolism) after insertion of pacemaker.\n\nMany anesthetic agents (such as lidocaine, propofol, fentanyl, remifentanil, vecuronium and etc) have some effects on the cardiac conduction system [1112131415]. They could have direct effect on sinus activity and incidence of bradycardia is higher if additional vagotomic agents. Choice of drug is very important in case of bradycardia and silent sick sinus syndrome. So, we should keep in mind these drugs can induce severe bradycardia. Lidocaine and propofol may have played a role in the development of bradycardia in our patient.\n\nAs shown in this case, serious complications can occur in atrial fibrillation patients. Thus, it is important to conduct a detailed, accurate interview and checkup on the patient's medical history and to evaluate the patient before operation. The existence of concealed sick sinus syndrome should be kept in mind in patients with atrial fibrillation. Furthermore, a defibrillator and external pacemaker must be available at all times in the operating room. Appropriate treatment must be initiated quickly to rectify the situation.\n\nFig. 1 Electrocardiogram shows artiral fibrillation with slow venstricular response (ventricular rate: 59 beats/min).\nFig. 2 Electrocardiogram monitored in the operation room. (A) Atrial fibrillation rhythm, with a ventricular rate of 100-130 beats/min, was observed before pacemaker insertion. (B) Sinus pause after atrial fibrillation rhythm was observed before pacemaker insertion. (C) Sinus rhythm, with a ventricular rate of 40-50 beats/min, was observed after atrial fibrillation rhythm and sinus pause before pacemaker insertion. (D) Pacing rhythms were observed during sinus pauses after pacemaker insertion.\nFig. 3 Electrocardiogram taken after insertion of a permanent pacemaker.\n==== Refs\n1 Dobrzynski H Boyett MR Anderson RH New insights into pacemaker activity: promoting understanding of sick sinus syndrome Circulation 2007 115 1921 1932 17420362 \n2 Keller KB Lemberg L The sick sinus syndrome Am J Crit Care 2006 15 226 229 16501143 \n3 Riley AB Manning WJ Atrial fibrillation: an epidemic in the elderly Expert Rev Cardiovasc Ther 2011 9 1081 1090 21878052 \n4 Cairns JA Connolly S McMurtry S Stephenson M Talajic M Canadian Cardiovascular Society atrial fibrillation guidelines 2010: prevention of stroke and systemic thromboembolism in atrial fibrillation and flutter Can J Cardiol 2011 27 74 90 21329865 \n5 Fuster V Rydén LE Cannom DS Crijns HJ Curtis AB Ellenbogen KA ACC/AHA/ESC 2006 Guidelines for the Management of Patients with Atrial Fibrillation: a report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines and the European Society of Cardiology Committee for Practice Guidelines (Writing Committee to Revise the 2001 Guidelines for the Management of Patients With Atrial Fibrillation): developed in collaboration with the European Heart Rhythm Association and the Heart Rhythm Society Circulation 2006 114 e257 e354 16908781 \n6 Go AS Hylek EM Phillips KA Chang Y Henault LE Selby JV Prevalence of diagnosed atrial fibrillation in adults: national implications for rhythm management and stroke prevention: the AntTicoagulation and Risk Factors in Atrial Fibrillation (ATRIA) Study JAMA 2001 285 2370 2375 11343485 \n7 Kawabata M Hirao K Hachiya H Higuchi K Tanaka Y Yagishita A Role of oral amiodarone in patients with atrial fibrillation and congestive heart failure J Cardiol 2011 58 108 115 21831597 \n8 Singh BN Connolly SJ Crijns HJ Roy D Kowey PR Capucci A Dronedarone for maintenance of sinus rhythm in atrial fibrillation or flutter N Engl J Med 2007 357 987 999 17804843 \n9 Siu CW Lau CP Lee WL Lam KF Tse HF Intravenous diltiazem is superior to intravenous amiodarone or digoxin for achieving ventricular rate control in patients with acute uncomplicated atrial fibrillation Crit Care Med 2009 37 2174 2179 19487941 \n10 Adan V Crown LA Diagnosis and treatment of sick sinus syndrome Am Fam Physician 2003 67 1725 1732 12725451 \n11 Ishida R Shido A Kishimoto T Sakura S Saito Y Prolonged cardiac arrest unveiled silent sick sinus syndrome during general and epidural anesthesia J Anesth 2007 21 62 65 17285416 \n12 Kim KO Chung S Lee K Cho H Profound bradycardia with lidocaine during anesthesia induction in a silent sick sinus syndrome patient J Clin Anesth 2011 23 227 230 21497496 \n13 Colson P Barlet H Roquefeuill B Eledjam JJ Mechanism of propofol bradycardia Anesth Analg 1988 67 906 907 3261953 \n14 Inoue K el-Banayosy A Stolarski L Reichelt W Vecuronium induced bradycardia following induction of anaesthesia with etomidate or thiopentone, with or without fentanyl Br J Anaesth 1988 60 10 17 2892519 \n15 Shirasaka W Ikeshita K Toriyama S Yamashita T Tani Y Intraoperative asystole in a patient with concealed sick sinus syndrome: a case report Masui 2014 63 338 341 24724447\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2005-6419", "issue": "68(4)", "journal": "Korean journal of anesthesiology", "keywords": "Artificial cardaic pacing; Atrial fibrillation; Sick sinus syndrome", "medline_ta": "Korean J Anesthesiol", "mesh_terms": null, "nlm_unique_id": "101502451", "other_id": null, "pages": "415-9", "pmc": null, "pmid": "26257858", "pubdate": "2015-08", "publication_types": "D016428:Journal Article", "references": "17420362;21878052;21329865;17285416;21831597;12725451;3261953;2892519;19487941;24724447;17804843;16501143;16908781;21497496;11343485", "title": "Tachycardia-bradycardia syndrome in a patient with atrial fibrillation: a case report.", "title_normalized": "tachycardia bradycardia syndrome in a patient with atrial fibrillation a case report" }
[ { "companynumb": "KR-FRESENIUS KABI-FK201504165", "fulfillexpeditecriteria": "1", "occurcountry": "KR", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "PROPOFOL" }, "drugadditional": null, ...
{ "abstract": "The development of antiretroviral therapy (ART) has been one of the most dramatic progressions in the history of medicine. Concomitant with this momentous therapeutic advance, the mitochondrial toxicities of ART were recognized as an important clinical entity.\n\n\nOBJECTIVE\nThe aim was to study the mitochondrial toxicities in terms of peripheral neuropathy (PN), lipodystrophy (LD), hepatic steatosis, lactic academia (LA), and pancreatitis developing in AIDS cases on nucleoside analog reverse transcriptase inhibitors (NRTIs) based ART regimens.\n\n\nMETHODS\nAn observational study, which included 90 AIDS cases, receiving first line ART regimens containing two NRTIs (zidovudine [AZT]/stavudine [d4T] with lamivudine [3TC]) and one nonNRTIs (nevirapine/efavirenz) was conducted at Skin-VD outpatient department of a tertiary care hospital attached to a Medical College. Thorough history was taken, and clinical examination was done. Cases were subjected to measurements of abdominal girth and mid-arm circumference, liver function tests, blood sugar, lipid profile, serum lactate, and amylase levels.\n\n\nRESULTS\nOf 90 cases on ART, 66% were males and 34% were females. Mitochondrial toxicities developed in 26 (30%) cases out of 90, which included 3 (7%) out of 42 cases on AZT + 3TC and 23 (48%) out of 48 cases on d4T + 3TC. Most common toxicity was PN seen in 20 (22%) cases; male cases developed PN at a lower CD4 count than female cases. LD was observed in total of 13 (14.5%) cases; deposition of fat in the abdomen in seven cases and at the nape of the neck (buffalo hump) in one case while loss of fat from extremities was seen in seven cases and loss of buccal fat in seven cases. Women presented more with fat accumulation (breast and abdomen), while men with loss of fat (limbs and buttocks). Both PN and LD were more common in d4T based regimen. LA was reported in one case on d4T. Hepatic steatosis was seen in three cases and pancreatitis in one case receiving AZT.\n\n\nCONCLUSIONS\nRegular monitoring and early diagnosis of mitochondrial toxicities with timely switch to safer alternatives is of utmost importance.", "affiliations": "Department of Skin-VD, Medical College Baroda, Vadodara, Gujarat, India.;Department of Skin-VD, Medical College Baroda, Vadodara, Gujarat, India.;Department of Skin-VD, R D Gardi Medical College, Surasa, Ujjain, Madhya Pradesh, India.;Consultant Dermatologist, SAI Skin and Laser Clinic, New Delhi, India.;Department of Skin-VD, Medical College Baroda, Vadodara, Gujarat, India.", "authors": "Marfatia|Yogesh S|YS|;Talwar|Mahima|M|;Agrawal|Meetesh|M|;Sharma|Ajay|A|;Mehta|Kajal|K|", "chemical_list": null, "country": "India", "delete": false, "doi": "10.4103/0253-7184.142395", "fulltext": "\n==== Front\nIndian J Sex Transm Dis AIDSIndian J Sex Transm Dis AIDSIJSTDIndian Journal of Sexually Transmitted Diseases and AIDS2589-05572589-0565Medknow Publications & Media Pvt Ltd India 26396441IJSTD-35-9610.4103/2589-0557.142395Original ArticleMitochondrial toxicities of nucleoside analogue reverse transcriptase inhibitors in AIDS cases Marfatia Yogesh S. Talwar Mahima Agrawal Meetesh 1Sharma Ajay 2Mehta Kajal Department of Skin-VD, Medical College Baroda, Vadodara, Gujarat, India1 Department of Skin-VD, R D Gardi Medical College, Surasa, Ujjain, Madhya Pradesh, India2 Consultant Dermatologist, SAI Skin and Laser Clinic, New Delhi, IndiaAddress for correspondence: Dr. Yogesh S. Marfatia, Department of Skin-VD, OPD-1, SSG Hospital, Medical College Baroda, Vadodara, Gujarat, India. E-mail: ym11256@gmail.comJul-Dec 2014 35 2 96 99 Copyright: © Indian Journal of Sexually Transmitted Diseases and AIDS2014This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.The development of antiretroviral therapy (ART) has been one of the most dramatic progressions in the history of medicine. Concomitant with this momentous therapeutic advance, the mitochondrial toxicities of ART were recognized as an important clinical entity.\n\nAim:\nThe aim was to study the mitochondrial toxicities in terms of peripheral neuropathy (PN), lipodystrophy (LD), hepatic steatosis, lactic academia (LA), and pancreatitis developing in AIDS cases on nucleoside analog reverse transcriptase inhibitors (NRTIs) based ART regimens.\n\nMaterials and Methods:\nAn observational study, which included 90 AIDS cases, receiving first line ART regimens containing two NRTIs (zidovudine [AZT]/stavudine [d4T] with lamivudine [3TC]) and one nonNRTIs (nevirapine/efavirenz) was conducted at Skin-VD outpatient department of a tertiary care hospital attached to a Medical College. Thorough history was taken, and clinical examination was done. Cases were subjected to measurements of abdominal girth and mid-arm circumference, liver function tests, blood sugar, lipid profile, serum lactate, and amylase levels.\n\nResults:\nOf 90 cases on ART, 66% were males and 34% were females. Mitochondrial toxicities developed in 26 (30%) cases out of 90, which included 3 (7%) out of 42 cases on AZT + 3TC and 23 (48%) out of 48 cases on d4T + 3TC. Most common toxicity was PN seen in 20 (22%) cases; male cases developed PN at a lower CD4 count than female cases. LD was observed in total of 13 (14.5%) cases; deposition of fat in the abdomen in seven cases and at the nape of the neck (buffalo hump) in one case while loss of fat from extremities was seen in seven cases and loss of buccal fat in seven cases. Women presented more with fat accumulation (breast and abdomen), while men with loss of fat (limbs and buttocks). Both PN and LD were more common in d4T based regimen. LA was reported in one case on d4T. Hepatic steatosis was seen in three cases and pancreatitis in one case receiving AZT.\n\nConclusion:\nRegular monitoring and early diagnosis of mitochondrial toxicities with timely switch to safer alternatives is of utmost importance.\n\nLipodystrophymitochondrial toxicitiesnucleoside analogue reverse transcriptase inhibitorsperipheral neuropathy\n==== Body\nINTRODUCTION\nThe development of antiretroviral therapy (ART) has been one of the most dramatic progressions in the history of medicine. With the availability of free ART through government run ART centers human immunodeficiency virus (HIV) related morbidity and mortality have declined significantly. ART includes nucleoside analog reverse transcriptase inhibitors (NRTIs), such as zidovudine (AZT), which was the first antiretroviral drug approved by the US FDA for management of HIV in 1987 has revolutionized the management of HIV in combination with other agents–by converting AIDS from being a lethal illness to a chronic, manageable disease. Nucleoside analogues that inhibit reverse transcriptase remain a cornerstone of ART for HIV infection. These agents inhibit HIV replication but can also inhibit the human DNA polymerase γ and thereby replication of mitochondrial DNA, leading to depletion of mitochondrial DNA and drug toxicity.[3] The spectrum of mitochondrial toxicities include peripheral neuropathy (PN), hepatic steatosis, lactic academia (LA), pancreatitis, myopathy, cardiomyopathy, and proximal renal tubular dysfunction.\n\nAims\nTo study the mitochondrial toxicities in terms of PN, LD, hepatic steatosis, LA, and pancreatitis developing in AIDS cases on NRTI based ART regimens (AZT/stavudine [d4T] + lamivudine [3TC]).\n\nMATERIALS AND METHODS\nAn observational study, which included 90 AIDS cases receiving first line ART regimens containing two NRTIs (AZT/d4T with 3TC) and one nonNRTIs (nevirapine [NVP]/efavirenz [EFV]) attending Skin-VD outpatient department of a tertiary care hospital attached to a Medical College, was conducted. Thorough history was taken and clinical examination was done. Cases were subjected to measurements of abdominal girth and mid-arm circumference, liver function tests, blood sugar (fasting and postprandial), serum lipid profile, serum lactate and amylase levels (when indicated) and ultrasonography abdomen.\n\nRESULTS\nOf 90 cases on ART, 66% were males and 34% were females. AZT + 3TC + NVP/EFV regimen was started in 42 (47%) cases and d4T + 3TC + NVP/EFV in 48 (53%) cases [Table 1]. Median CD4 count at initiation of ART was 111 cells/cc. Mitochondrial toxicity developed in 26 (30%) cases out of 90 which included 3 (7%) out of 42 cases on AZT + 3TC and 23 (48%) out of 48 cases on d4T + 3TC [Figure 1]. Most common ADR was PN seen in 20 (22%) cases; male cases developed PN at a lower CD4 count than female cases [Tables 2 and 3]. Lipodystrophy (LD) was observed in total of 13 (14.5%) cases; deposition of fat in the abdomen in seven cases and at the nape of the neck (buffalo hump) in one case, while loss of fat from extremities was seen in seven cases and loss of buccal fat in seven cases [Table 4]. Women presented more with fat accumulation (breast and abdomen) while men with loss of fat (limbs and buttocks). Both PN and LD were more common in d4T based regimen. LA was reported in one case on d4T. Hepatic steatosis was seen in three cases and pancreatitis in one case receiving AZT. Five cases on d4T were shifted to AZT due to toxicities; though tenofovir could have been an ideal switch, but was not available [Table 5].\n\nTable 1 Sex and regimen-wise distribution of cases\n\nFigure 1 Number of cases on zidovudine (n = 42) and stavudine (n = 48) developing mitochondrial toxicities\n\nTable 2 Various mitochondrial toxicities (n=90)\n\nTable 3 Peripheral neuropathy in relation to CD4 count\n\nTable 4 Pattern of LD (n=13)\n\nTable 5 Alternate regimen in cases with sever ADR (n=5)\n\nA few interesting cases of mitochondrial toxicities\nA 12-year-old male with baseline CD4 count 392 cells/mm3 who was started on AZT + 3TC + NVP; presented after 10 months of regular ART with complaints of severe abdominal pain and vomiting. Serum amylase was 1140 IU/L, blood urea - 37 mg, serum creatinine - 0.8, and CT abdomen was suggestive of pancreatic necrosis. This was suggestive of acute pancreatitis due to ART, that could have been due to 3TC. 3TC induced pancreatitis is rare in adults; although the incidence varied in pediatric patients from 8% to 38%.[4] Pancreatitis is one of the most serious mitochondrial toxicity and requires immediate management.\n\nA 40-year-old female with recurrent herpes zoster and pulmonary Koch's with baseline CD4 count 317 cells/mm3, was put on d4T + 3TC + NVP; presented after 1 year of regular ART with the complaints of nausea, vomiting, and breathlessness for 3-4 weeks. On examination, there was a loss of fat from the extremities and increase in abdominal fat. Her plasma lactate was 5.4 mmol/L, triglyceride - 405 mg/dl, very low-density lipoprotein - 81 mg/dl, and liver function test were normal. This was thus suggestive of d4T-induced LD syndrome.\n\nAs symptoms of LA are subtle; high index of suspicion is required for early diagnosis before progression to outcome.\n\nDISCUSSION\nIn a study by Hforett-Smith, d4T-induced PN and LD were found in 24% and 16% cases respectively[5] while Saint-Marc et al. reported LD in 63% cases on d4T, and in 18.75% patients taking AZT after a median time of 14 months; the relative risk of developing fat wasting was 1.95 in the d4T group compared to AZT group (95% confidence interval).[6] In the present study d4T-induced PN and LD were found in 40% and 23% cases and AZT induced PN and LD in 2.4% and 4.8% cases respectively. LD syndrome may be attributed to mitochondrial toxicity of NRTIs after 12-18 months of therapy.[7] Main clinical features are peripheral fat loss (buccal pad and extremities) and central fat accumulation within the abdomen (crix belly or protease paunch), breasts (gynaecomastia) and over the dorsocervical spine (buffalo hump) and other peripheral lipomatosis [Figures 2-5]. The metabolic features of the syndrome include hypertriglyceridemia, hypercholesterolemia, insulin resistance, type two diabetes mellitus/impaired glucose tolerance and LA.[1112] PN is the primary dose-limiting toxicity of Stavudine with symptoms similar to neuropathy associated with didanosine (ddI) and zalcitabine. The incidence of PN is dose related. Symptomatic patients develop tingling, burning and pain in the lower extremities, especially at night. It usually resolves within 1-9 weeks of discontinuation of stavudine therapy.[8] Ananworanich et al. have reported reversal of mitochondrial toxicities after switching from d4T/ddI to tenofovir/3TC regimen.[9] Van Griensven et al. found tenofovir/abacavir significantly superior to AZT for recovery from lipoatrophy due to d4T.[10] Saint-Marc et al. found that 5 out of 12 patients had a major or mild improvement in their LD after stavudine was discontinued.[6]\n\nFigure 2 Buffalo hump due to stavudine\n\nFigure 3 Loss of buccal pad of fat due to stavudine\n\nFigure 4 Central fat accumulation and peripheral lipoatrophy due to stavudine\n\nFigure 5 Zidovudine induced peripheral lipoatrophy\n\nCONCLUSION\nMitochondrial complications are a challenging issue because of potential of morbidity, mortality and distressing morphologic disfigurement. The most common cause culprit was stavudine, which is still used as part of free ART program in resource restricted setup. The latest WHO guidelines recommend replacing stavudine with tenofovir or AZT in first-line ART in resource-limited settings. There are many issues remaining to be clarified about the effects of NRTIs on mitochondria and the potential for clinical manifestations of these effects. Some of these issues involve the differing adverse effects among NRTIs, which may be associated with mitochondrial toxicities, different NRTIs have been reported to have varying magnitude of inhibitory effect on gamma polymerase in vitro, there may be differences among NRTIs regarding the ability of gamma polymerase to proofread and excise the NRTI once it has been incorporated into the DNA chain and finally, it is not understood why only some patients appear to have mitochondrial toxicity or clinical manifestations of such toxicities. Regular monitoring and early diagnosis of mitochondrial toxicities with timely switch to safer alternatives (nucleotide reverse transcriptase inhibitor/tenofovir based) is of utmost importance.\n\nSource of Support: Nil.\n\nConflict of Interest: None declared.\n==== Refs\nREFERENCES\n1 Arnaudo E Dalakas M Shanske S Moraes CT DiMauro S Schon EA Depletion of muscle mitochondrial DNA in AIDS patients with zidovudine-induced myopathy Lancet 1991 337 508 10 1671889 \n2 Dalakas MC Illa I Pezeshkpour GH Laukaitis JP Cohen B Griffin JL Mitochondrial myopathy caused by long-term zidovudine therapy N Engl J Med 1990 322 1098 105 2320079 \n3 Kakuda TN Pharmacology of nucleoside and nucleotide reverse transcriptase inhibitor-induced mitochondrial toxicity Clin Ther 2000 22 685 10929917 \n4 Dassopoulos T Ehrenpreis ED Acute pancreatitis in human immunodeficiency virus-infected patients: A review Am J Med 1999 107 78 84 10403356 \n5 Hforett-Smith RL 2003 Chicago 43rd Annual International Conference on Anti Micro and Chemo \n6 Saint-Marc T Partisani M Poizot-Martin I Bruno F Rouviere O Lang JM A syndrome of peripheral fat wasting (lipodystrophy) in patients receiving long-term nucleoside analogue therapy AIDS 1999 13 1659 67 10509567 \n7 Marfatia YS Smita M Adverse drug reactions due to antiretrovirals: Issue and challenges Indian J Sex Transm Dis 2005 26 2 10 \n8 Max B Sherer R Management of the adverse effects of antiretroviral therapy and medication adherence Oxford J Med Health Clin Infect Dis 2000 30 Suppl 2 S96 116 \n9 Ananworanich J Nuesch R Côté HC Kerr SJ Hill A Jupimai T Changes in metabolic toxicity after switching from stavudine/didanosine to tenofovir/lamivudine – A Staccato trial substudy J Antimicrob Chemother 2008 61 1340 3 18339636 \n10 van Griensven J Zachariah R Rasschaert F Atté EF Reid T Weight evolution in HIV-1 infected women in Rwanda after stavudine substitution due to lipoatrophy: Comparison of zidovudine with tenofovir/abacavir Trans R Soc Trop Med Hyg 2009 103 613 9 18835003 \n11 Marfatia YS Sharma A Modi M Sharma A Stavudin vs. zidovudin as antiretroviral therapy Indian J Sex Transm Dis 2007 28 26 9 \n12 Sharma A Vora R Modi M Sharma A Marfatia Y Adverse effects of antiretroviral treatment Indian J Dermatol Venereol Leprol 2008 74 234 7 18583790\n\n", "fulltext_license": "CC BY-NC-SA", "issn_linking": "2589-0557", "issue": "35(2)", "journal": "Indian journal of sexually transmitted diseases and AIDS", "keywords": "Lipodystrophy; mitochondrial toxicities; nucleoside analogue reverse transcriptase inhibitors; peripheral neuropathy", "medline_ta": "Indian J Sex Transm Dis AIDS", "mesh_terms": null, "nlm_unique_id": "101730896", "other_id": null, "pages": "96-9", "pmc": null, "pmid": "26396441", "pubdate": "2014", "publication_types": "D016428:Journal Article", "references": "10929917;10509567;1671889;18835003;10860894;18583790;18339636;2320079;10403356", "title": "Mitochondrial toxicities of nucleoside analogue reverse transcriptase inhibitors in AIDS cases.", "title_normalized": "mitochondrial toxicities of nucleoside analogue reverse transcriptase inhibitors in aids cases" }
[ { "companynumb": "IN-GLAXOSMITHKLINE-IN2014GSK025586", "fulfillexpeditecriteria": "1", "occurcountry": "IN", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "NEVIRAPINE" }, "drugadditional": nul...
{ "abstract": "The prevailing belief in cancer therapy is that retreatment with a given drug after the emergence of resistance is ineffective. Herein, we report several cases in which retreatment with drugs that had failed earlier in the disease trajectory caused renewed tumor regression. The possible biologic underpinnings that might explain this phenomenon are discussed.", "affiliations": "Department of Investigational Cancer Therapeutics (Phase I Clinical Trials Program), Division of Cancer Medicine, The University of Texas M. D. Anderson Cancer Center, Houston.", "authors": "Naing|Aung|A|;Kurzrock|Razelle|R|", "chemical_list": "D000970:Antineoplastic Agents; D002272:Carcinoembryonic Antigen", "country": "United States", "delete": false, "doi": "10.3816/CCC.2010.n.026", "fulltext": null, "fulltext_license": null, "issn_linking": "1533-0028", "issue": "9(2)", "journal": "Clinical colorectal cancer", "keywords": null, "medline_ta": "Clin Colorectal Cancer", "mesh_terms": "D000230:Adenocarcinoma; D000328:Adult; D000970:Antineoplastic Agents; D002272:Carcinoembryonic Antigen; D015179:Colorectal Neoplasms; D018450:Disease Progression; D019008:Drug Resistance, Neoplasm; D005260:Female; D006801:Humans; D008113:Liver Neoplasms; D008297:Male; D008875:Middle Aged; D017211:Treatment Failure", "nlm_unique_id": "101120693", "other_id": null, "pages": "E1-4", "pmc": null, "pmid": "20378496", "pubdate": "2010-04", "publication_types": "D002363:Case Reports; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural", "references": null, "title": "Chemotherapy resistance and retreatment: a dogma revisited.", "title_normalized": "chemotherapy resistance and retreatment a dogma revisited" }
[ { "companynumb": "PHHY2014US164633", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "FLUOROURACIL" }, "drugadditional": null, "dr...
{ "abstract": "Relapsed or refractory acute myeloid leukemia (R/R AML) in elderly (≥60 yr old) patients were eligible. Induction chemotherapy consisted fludarabine and cytarabine (ARAC) as a 24-hr CI without idarubicin (C-FLAG), which was compared with the results of C-FLAG with idarubicin (CI-FLAG2) in younger patients' trial. A total of 33 and 68 patients were enrolled in C-FLAG and CI-FLAG2, respectively. CR, CRp, and CRi were achieved in 10 (30.3%), 3 (9.1%), and 2 (6.1%), respectively. When comparing outcomes between C-FLAG and CI-FLAG2, there were no difference in terms of CR rate (P = 0.572) and objective response rate (ORR; P = 0.899). Favorable predictors on ORR in C-FLAG were PB WBC ≤ 20K/uL at salvage (P = 0.024) and early evaluation peripheral BLAST = 0% (P = 0.013) on multivariate analysis. The overall survival of patients who achieve CR/CRp/CRi showed significantly prolonged survival compared with patients who did not in C-FLAG (P < 0.001) and was a favorable predictor of longer survival by multivariate analysis (P = 0.009). Median overall survival was 3.19 (95% CI, 2.05-4.33) months and similar with that of CI-FLAG2 (P = 0.841). Attenuated salvage regimen C-FLGA in elderly patients was as effective as more intensive younger patients' regimen CI-FLAG2 in terms of response and survival although elderly patients had more unfavorable clinical characteristics.", "affiliations": "Division of Hematology and Cellular Therapy, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan, Korea.;Department of Hematology, Asan Medical Center, University of Ulsan College of Medicine, Ulsan, Korea.;Department of Hematology/Oncology, Haeundae Paik Hospital, Inje University College of Medicine, Busan, Korea.;Department of Hematology-Oncology, Daegu Catholic University Medical Center, Catholic University of Daegu School of Medicine, Daegu, Korea.;Department of Hematology, Asan Medical Center, University of Ulsan College of Medicine, Ulsan, Korea.;Department of Hematology, Asan Medical Center, University of Ulsan College of Medicine, Ulsan, Korea.;Department of Hematology/Oncology, Busan Paik Hospital, Inje University College of Medicine, Busan, Korea.;Department of Hematology-Oncology, Daegu Catholic University Medical Center, Catholic University of Daegu School of Medicine, Daegu, Korea.;Division of Hematology and Cellular Therapy, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan, Korea.;Division of Hematology and Cellular Therapy, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan, Korea.;Department of Hematology, Asan Medical Center, University of Ulsan College of Medicine, Ulsan, Korea.", "authors": "Kim|Hawk|H|;Lee|Je-Hwan|JH|;Joo|Young-Don|YD|;Bae|Sung Hwa|SH|;Lee|Jung-Hee|JH|;Kim|Dae-Young|DY|;Lee|Won-Sik|WS|;Ryoo|Hun-Mo|HM|;Jo|Jae-Cheol|JC|;Choi|Yunsuk|Y|;Lee|Kyoo-Hyung|KH|;|||", "chemical_list": "D003561:Cytarabine; D014740:Vidarabine; C024352:fludarabine; D015255:Idarubicin", "country": "England", "delete": false, "doi": "10.1111/ejh.12568", "fulltext": null, "fulltext_license": null, "issn_linking": "0902-4441", "issue": "96(2)", "journal": "European journal of haematology", "keywords": "FLAG; acute myeloid leukemia; continuous infusion; elderly; relapsed/refractory", "medline_ta": "Eur J Haematol", "mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D003561:Cytarabine; D004334:Drug Administration Schedule; D005260:Female; D006801:Humans; D015255:Idarubicin; D060828:Induction Chemotherapy; D007262:Infusions, Intravenous; D015470:Leukemia, Myeloid, Acute; D008297:Male; D008875:Middle Aged; D015999:Multivariate Analysis; D012074:Remission Induction; D016019:Survival Analysis; D016896:Treatment Outcome; D014740:Vidarabine", "nlm_unique_id": "8703985", "other_id": null, "pages": "188-97", "pmc": null, "pmid": "25891993", "pubdate": "2016-02", "publication_types": "D017427:Clinical Trial, Phase II; D003160:Comparative Study; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "A prospective, multicenter phase II study of continuous infusion of FLAG for patients older than 60 yr with resistant acute myeloid leukemia: a comparison with intensive younger patients' trial.", "title_normalized": "a prospective multicenter phase ii study of continuous infusion of flag for patients older than 60 yr with resistant acute myeloid leukemia a comparison with intensive younger patients trial" }
[ { "companynumb": "KR-SA-2015SA073192", "fulfillexpeditecriteria": "1", "occurcountry": "KR", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "CIPROFLOXACIN" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nThere is limited evidence on the safety and efficacy of denosumab for the management of immobilization-related hypercalcemia in hemodialysis patients. We report a case of successful treatment of immobilization-related hypercalcemia with a high dose of denosumab (120 mg).\n\n\nMETHODS\nA 55-year-old, bed-ridden woman was admitted to the intensive care unit with suspected catheter-related bacteremia and septic shock. 13 days following admission, the patient's corrected serum calcium levels rose from 2.52 mmol/L at baseline to 3.39 mmol/L. Cinacalcet, subcutaneous calcitonin, intravenous zoledronic acid, and subcutaneous 60-mg dose of denosumab were administered but resulted in an inadequate response. Consequently, subcutaneous 120-mg dose of denosumab was administered and resulted in a gradual decline of corrected serum calcium levels from 4.18 mmol/L to 2.45 mmol/L within 3 weeks; corrected serum calcium levels were maintained above 2.10 mmol/L and less than 2.80 mmol/L for 3 months after high-dose denosumab administration.\n\n\nCONCLUSIONS\nHigh-dose denosumab could be a viable treatment option for end-stage renal disease patients developing immobilization-related hypercalcemia.", "affiliations": null, "authors": "Zaitoun|Mohammad F|MF|;Al-Alsheikh|Khalid A|KA|;Elnazer|Weam|W|", "chemical_list": "D050071:Bone Density Conservation Agents; D000069448:Denosumab; D002118:Calcium", "country": "Germany", "delete": false, "doi": "10.5414/CN110058", "fulltext": null, "fulltext_license": null, "issn_linking": "0301-0430", "issue": "96(6)", "journal": "Clinical nephrology", "keywords": null, "medline_ta": "Clin Nephrol", "mesh_terms": "D050071:Bone Density Conservation Agents; D002118:Calcium; D000069448:Denosumab; D005260:Female; D006801:Humans; D006934:Hypercalcemia; D007676:Kidney Failure, Chronic; D008875:Middle Aged; D006435:Renal Dialysis", "nlm_unique_id": "0364441", "other_id": null, "pages": "353-356", "pmc": null, "pmid": "34605398", "pubdate": "2021-12", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Use of high-dose denosumab in the management of immobilization-related hypercalcemia in an end-stage renal disease patient on hemodialysis: A case report and review of the literature.", "title_normalized": "use of high dose denosumab in the management of immobilization related hypercalcemia in an end stage renal disease patient on hemodialysis a case report and review of the literature" }
[ { "companynumb": "SA-AMGEN-SAUSP2021002473", "fulfillexpeditecriteria": "2", "occurcountry": "SA", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CINACALCET HYDROCHLORIDE" }, "drugadditional":...
{ "abstract": "Brincidofovir (BCV) is a broad-spectrum antiviral agent active in vitro against double-stranded DNA viruses including herpesviruses, adenoviruses, polyomaviruses, and poxviruses. We report successful BCV use in management of disseminated acyclovir- and cidofovir-resistant varicella zoster virus in an immunocompromised hematopoietic stem cell transplant patient with chronic graft-versus-host disease who was intolerant to foscarnet.", "affiliations": "Medicine, University of Chicago, Chicago, Illinois, USA. kmullane@medicine.bsd.uchicago.edu.;Medicine, University of Chicago, Chicago, Illinois, USA.;Medicine, University of Chicago, Chicago, Illinois, USA.;Pediatrics, University of Alabama at Birmingham, Birmingham, Alabama, USA.;Pediatrics, University of Alabama at Birmingham, Birmingham, Alabama, USA.;Medicine, University of Chicago, Chicago, Illinois, USA.;Chimerix, Inc., Durham, North Carolina, USA.;Medicine, University of Chicago, Chicago, Illinois, USA.", "authors": "Mullane|K M|KM|;Nuss|C|C|;Ridgeway|J|J|;Prichard|M N|MN|;Hartline|C B|CB|;Theusch|J|J|;Mommeja-Marin|H|H|;Larson|R A|RA|", "chemical_list": "D000970:Antineoplastic Agents; D000998:Antiviral Agents; D015507:Drugs, Investigational; D063065:Organophosphonates; D017245:Foscarnet; C525733:brincidofovir; D003596:Cytosine; D014633:Valine; D000077483:Valacyclovir; D000212:Acyclovir", "country": "Denmark", "delete": false, "doi": "10.1111/tid.12583", "fulltext": null, "fulltext_license": null, "issn_linking": "1398-2273", "issue": "18(5)", "journal": "Transplant infectious disease : an official journal of the Transplantation Society", "keywords": "acyclovir-resistant; brincidofovir; disseminated varicella", "medline_ta": "Transpl Infect Dis", "mesh_terms": "D000212:Acyclovir; D000328:Adult; D019072:Antibiotic Prophylaxis; D000970:Antineoplastic Agents; D000998:Antiviral Agents; D003596:Cytosine; D024882:Drug Resistance, Viral; D015507:Drugs, Investigational; D005260:Female; D017245:Foscarnet; D006086:Graft vs Host Disease; D018380:Hematopoietic Stem Cell Transplantation; D006562:Herpes Zoster; D014645:Herpesvirus 3, Human; D006801:Humans; D016867:Immunocompromised Host; D017387:Investigational New Drug Application; D015464:Leukemia, Myelogenous, Chronic, BCR-ABL Positive; D063065:Organophosphonates; D014184:Transplantation, Homologous; D000077483:Valacyclovir; D014633:Valine", "nlm_unique_id": "100883688", "other_id": null, "pages": "785-790", "pmc": null, "pmid": "27481400", "pubdate": "2016-10", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Brincidofovir treatment of acyclovir-resistant disseminated varicella zoster virus infection in an immunocompromised host.", "title_normalized": "brincidofovir treatment of acyclovir resistant disseminated varicella zoster virus infection in an immunocompromised host" }
[ { "companynumb": "US-GLAXOSMITHKLINE-US2016181288", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "SULFAMETHOXAZOLE\\TRIMETHOPRIM" }, "dr...
{ "abstract": "Plasma cell leucaemia (PCL) is a rare aggressive form of multiple myeloma. It occasionally involves the pleura, causing malignant pleural effusion (MPE). MPE presents a management dilemma for physicians, given the different treatment options available with varying efficacy and side effects. We report a case of a 64-year-old man with MPE due to PCL, successfully managed with intrapleural cisplatin and a tunnelled pleural catheter. We believe this to be the first report of management of PCL-associated MPE with intrapleural cisplatin.", "affiliations": "Cooper University Hospital, Camden, New Jersey, USA.;Department of Internal Medicine, University of Arkansas for Medical Sciences, Little Rock, Arkansas, USA.;University of Arkansas for Medical Sciences, Little Rock, Arkansas, USA.;Department of Pulmonary and Critical Care Medicine, University of Arkansas for Medical Sciences, Little Rock, Arkansas, USA.", "authors": "Agarwal|Abhishek|A|;Klair|Jagpal|J|;Patolia|Setu|S|;Meena|Nikhil K|NK|", "chemical_list": "D000970:Antineoplastic Agents; D002945:Cisplatin", "country": "England", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1757-790X", "issue": "2015()", "journal": "BMJ case reports", "keywords": null, "medline_ta": "BMJ Case Rep", "mesh_terms": "D000970:Antineoplastic Agents; D057785:Catheters; D002945:Cisplatin; D006801:Humans; D007952:Leukemia, Plasma Cell; D008297:Male; D008875:Middle Aged; D010950:Plasma Cells; D010994:Pleura; D016066:Pleural Effusion, Malignant", "nlm_unique_id": "101526291", "other_id": null, "pages": null, "pmc": null, "pmid": "26123465", "pubdate": "2015-06-29", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "17979947;11986597;14973997;22042147;23288300;10894097;19877113;15539723;1988578;24920947;24918086;24123068;22039089;20068553", "title": "Intrapleural cisplatin for management of malignant pleural effusion in a patient with plasma cell leucaemia.", "title_normalized": "intrapleural cisplatin for management of malignant pleural effusion in a patient with plasma cell leucaemia" }
[ { "companynumb": "US-CELGENE-USA-2015090814", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "AZACITIDINE" }, "drugadditional": null, ...
{ "abstract": "Anaphylactoid reactions are well-documented adverse events associated with the intravenous administration of N-acetylcysteine (NAC) in patients with acetaminophen overdose. Most reactions are mild, occurring within the first 1-5 hours of initiation. This report presents the case of an adolescent with a delayed, life-threatening anaphylactoid reaction 24.5 hours after starting NAC, where discontinuing NAC could have resulted in fulminant hepatic failure (FHF) and death.\n\n\n\nA 17-year-old previously healthy female presented with nausea, vomiting, and abdominal pain 10 hours after an acute acetaminophen ingestion. Her 11-hour serum acetaminophen concentration was above the treatment line (149 μg/mL), and she had elevated transaminases (AST = 202 U/L, ALT = 284 U/L). She was treated with intravenous NAC, which was suspended for 3 hours after she developed an apparent life-threatening anaphylactoid reaction with angioedema and respiratory distress 24.5 hours after treatment initiation. Given her high risk of progression to FHF, NAC was resumed at double the previous rate along with scheduled corticosteroids and antihistamines after resolution of her symptoms. Her AST increased to 10,927 U/L, and INR peaked at 3.6, but she had no further anaphylactoid symptoms. She was discharged in her normal state of health after 6 days.\n\n\n\nDiscontinuing NAC in this case of severe, delayed anaphylactoid reaction could have resulted in FHF requiring liver transplant. The reason for her reaction is unclear but could be related to patient risk factors or medication error. Guidelines for reinitiation of NAC after development of delayed anaphylactoid reactions are not well-established.  Close observation beyond the first 1-5 hours of NAC administration is warranted.", "affiliations": "Department of Emergency Medicine, Integris Southwest Medical Center in conjunction with UT Southwestern Medical Center, Oklahoma City, OK, USA.;Department of Emergency Medicine, Division of Medical Toxicology, UT Southwestern Medical Center, Dallas, TX, USA. stweiss2@gmail.com.;Department of Emergency Medicine, Division of Medical Toxicology, UT Southwestern Medical Center, Dallas, TX, USA.", "authors": "Epperson|L Claire|LC|;Weiss|Stephanie T|ST|0000-0001-6286-3045;Cao|Dazhe James|DJ|", "chemical_list": "D000305:Adrenal Cortex Hormones; D018712:Analgesics, Non-Narcotic; D000931:Antidotes; D006633:Histamine Antagonists; D000082:Acetaminophen; D000111:Acetylcysteine", "country": "United States", "delete": false, "doi": "10.1007/s13181-020-00804-5", "fulltext": null, "fulltext_license": null, "issn_linking": "1556-9039", "issue": "17(1)", "journal": "Journal of medical toxicology : official journal of the American College of Medical Toxicology", "keywords": "Acetaminophen; Anaphylactoid reaction; N-acetylcysteine", "medline_ta": "J Med Toxicol", "mesh_terms": "D000082:Acetaminophen; D000111:Acetylcysteine; D000293:Adolescent; D000305:Adrenal Cortex Hormones; D018712:Analgesics, Non-Narcotic; D000707:Anaphylaxis; D000931:Antidotes; D004342:Drug Hypersensitivity; D062787:Drug Overdose; D005260:Female; D006633:Histamine Antagonists; D006801:Humans; D007262:Infusions, Intravenous; D012720:Severity of Illness Index; D013997:Time Factors; D016896:Treatment Outcome", "nlm_unique_id": "101284598", "other_id": null, "pages": "75-79", "pmc": null, "pmid": "32821982", "pubdate": "2021-01", "publication_types": "D002363:Case Reports", "references": "20585241;29423816;19280424;9624310;18445707;18584360;1954453;31341611;18803085;18635433;7249508;17046490", "title": "A Case Report of a Severe, Unusually Delayed Anaphylactoid Reaction to Intravenous N-Acetylcysteine During Treatment of Acute Acetaminophen Toxicity in an Adolescent.", "title_normalized": "a case report of a severe unusually delayed anaphylactoid reaction to intravenous n acetylcysteine during treatment of acute acetaminophen toxicity in an adolescent" }
[ { "companynumb": "US-PERRIGO-21US011720", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "ACETAMINOPHEN" }, "drugadditional": "1", ...
{ "abstract": "Solithromycin, a new macrolide, and the first fluoroketolide in clinical development, with activity against macrolide-resistant bacteria, was tested in 132 patients with moderate to moderately severe community-acquired bacterial pneumonia (CABP) in a multicenter, double-blind, randomized phase 2 study. Patients were enrolled and randomized (1:1) to either 800 mg solithromycin orally (PO) on day 1, followed by 400 mg PO daily on days 2 to 5, or 750 mg levofloxacin PO daily on days 1 to 5. Efficacy outcome rates of clinical success at the test-of-cure visit 4 to 11 days after the last dose of study drug were comparable in the intent-to-treat (ITT) (84.6% for solithromycin versus 86.6% for levofloxacin) and microbiological-intent-to-treat (micro-ITT) (77.8% for solithromycin versus 71.4% for levofloxacin) populations. Early response success rates at day 3, defined as improvement in at least two cardinal symptoms of pneumonia, were also comparable (72.3% for solithromycin versus 71.6% for levofloxacin). More patients treated with levofloxacin than with solithromycin experienced treatment-emergent adverse events (TEAEs) during the study (45.6% versus 29.7%). The majority of TEAEs were mild or moderate gastrointestinal symptoms and included nausea (1.6% for solithromycin; 10.3% for levofloxacin), diarrhea (7.8% for solithromycin; 5.9% for levofloxacin), and vomiting (0% for solithromycin; 4.4% for levofloxacin). Six patients, all of whom received levofloxacin, discontinued the study drug due to an adverse event. Solithromycin demonstrated comparable efficacy and favorable safety relative to levofloxacin. These findings support a phase 3 study of solithromycin for the treatment of CABP. (This study has been registered at ClinicalTrials.gov under registration no. NCT01168713.).", "affiliations": "Cempra Inc, Chapel Hill, North Carolina, USA.", "authors": "Oldach|David|D|;Clark|Kay|K|;Schranz|Jennifer|J|;Das|Anita|A|;Craft|J Carl|JC|;Scott|Drusilla|D|;Jamieson|Brian D|BD|;Fernandes|Prabhavathi|P|", "chemical_list": "D018942:Macrolides; D014230:Triazoles; D064704:Levofloxacin; C547755:solithromycin; D015242:Ofloxacin", "country": "United States", "delete": false, "doi": "10.1128/AAC.00197-13", "fulltext": null, "fulltext_license": null, "issn_linking": "0066-4804", "issue": "57(6)", "journal": "Antimicrobial agents and chemotherapy", "keywords": null, "medline_ta": "Antimicrob Agents Chemother", "mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D017714:Community-Acquired Infections; D004311:Double-Blind Method; D005260:Female; D006801:Humans; D064704:Levofloxacin; D018942:Macrolides; D008297:Male; D008875:Middle Aged; D015242:Ofloxacin; D018410:Pneumonia, Bacterial; D016896:Treatment Outcome; D014230:Triazoles; D055815:Young Adult", "nlm_unique_id": "0315061", "other_id": null, "pages": "2526-34", "pmc": null, "pmid": "23507282", "pubdate": "2013-06", "publication_types": "D017427:Clinical Trial, Phase II; D003160:Comparative Study; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't", "references": "23114374;18033831;17278083;11049784;15577930;15360096;21067350;15555824;18252127;23009730;15136404;21282444;18321237;16178500;4399413;12173129;23076092;22802254;19633515;11856810;15360097;20831882;15963272;12149046;19258276;19564365;20855733;20308374;22232285;18178388;20211548;12781017", "title": "Randomized, double-blind, multicenter phase 2 study comparing the efficacy and safety of oral solithromycin (CEM-101) to those of oral levofloxacin in the treatment of patients with community-acquired bacterial pneumonia.", "title_normalized": "randomized double blind multicenter phase 2 study comparing the efficacy and safety of oral solithromycin cem 101 to those of oral levofloxacin in the treatment of patients with community acquired bacterial pneumonia" }
[ { "companynumb": "US-JNJFOC-20130515732", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "LEVOFLOXACIN" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nWe conducted a phase II study to evaluate the efficacy of neoadjuvant chemotherapy with docetaxel and carboplatin followed by radical hysterectomy for patients with non-squamous cell carcinoma of the uterine cervix.\n\n\nMETHODS\nSixty-one patients with International Federation of Gynecology and Obstetrics stage IB2, IIA2, or IIB non-squamous cell carcinoma of the uterine cervix were enrolled. The patients were administered docetaxel at a dose of 60 mg/m2, followed by carboplatin at a dose based on an area under the curve of 6. The treatments were repeated every 21 days for one to three cycles. Fifty-two patients were eligible to evaluate the efficacy of neoadjuvant chemotherapy followed by radical hysterectomy. Adverse events were evaluated in 59 patients.\n\n\nRESULTS\nThe response rate was 69 % (95 % CI, 57-82 %), with 5 patients achieving complete response, 31 partial response, 15 stable disease, and 1 progressive disease. Median follow-up duration was 1913 days with a range of 145-2632 days. Of 52 patients, 50 underwent radical hysterectomy after neoadjuvant chemotherapy. The 2-year overall survival rate was 81.8 % for stage IB2, 85.7 % for stage IIA2, and 92.6 % for stage IIB. The most frequent grade 3 and 4 hematological toxicity was neutropenia, with 43 patients experiencing grade 4 and 11 with grade 3. The nonhematological toxicities were mainly grade 1 or 2 in severity.\n\n\nCONCLUSIONS\nNeoadjuvant chemotherapy with docetaxel and carboplatin followed by radical hysterectomy may be a useful strategy for patients with non-squamous cell carcinoma of uterine cervix.", "affiliations": "Department of Obstetrics and Gynecology, Tottori University School of Medicine, 36-1 Nishimachi, Yonago, Tottori, 683-8504, Japan. mshima12@med.tottori-u.ac.jp.;Department of Gynecology, Hyogo Cancer Center, 13-70 Kita-Oji, Akashi, Hyogo, 673-8558, Japan.;Department of Gynecologic Oncology, Saitama Medical University International Medical Center, 1397-1 Yamane, Hidaka, Saitama, 350-1298, Japan.;Department of Gynecology, Cancer Institute Hospital, Koto-ku, Tokyo, 135-8550, Japan.;Department of Gynecology, Cancer Institute Hospital, Koto-ku, Tokyo, 135-8550, Japan.;Department of Obstetrics and Gynecology, Iwate Medical University, 19-1, Uchimaru, Morioka, Iwate, 020-8505, Japan.;Department of Obstetrics and Gynecology, Iwate Medical University, 19-1, Uchimaru, Morioka, Iwate, 020-8505, Japan.;Department of Gynecology, Hyogo Cancer Center, 13-70 Kita-Oji, Akashi, Hyogo, 673-8558, Japan.;Hyogo Prefectural Hospitals Agency, 5-10-1, Shimoyamate-dori, Kobe, Hyogo, 650-8567, Japan.;Matsue City Hospital, 32-1 Noshiracho, Matsue, Shimane, 690-0045, Japan.", "authors": "Shimada|Muneaki|M|;Nagao|Shoji|S|;Fujiwara|Keiichi|K|;Takeshima|Nobuhiro|N|;Takizawa|Ken|K|;Shoji|Tadahiro|T|;Sugiyama|Toru|T|;Yamaguchi|Satoshi|S|;Nishimura|Ryuichiro|R|;Kigawa|Junzo|J|", "chemical_list": "D000970:Antineoplastic Agents; D043823:Taxoids; D000077143:Docetaxel; D016190:Carboplatin", "country": "Japan", "delete": false, "doi": "10.1007/s10147-016-1010-0", "fulltext": null, "fulltext_license": null, "issn_linking": "1341-9625", "issue": "21(6)", "journal": "International journal of clinical oncology", "keywords": "Neoadjuvant chemotherapy; Non-squamous cell carcinoma; Radical hysterectomy; Uterine cervical cancer", "medline_ta": "Int J Clin Oncol", "mesh_terms": "D000328:Adult; D000368:Aged; D000970:Antineoplastic Agents; D000971:Antineoplastic Combined Chemotherapy Protocols; D016190:Carboplatin; D002277:Carcinoma; D000077143:Docetaxel; D004305:Dose-Response Relationship, Drug; D005260:Female; D006801:Humans; D007044:Hysterectomy; D008875:Middle Aged; D020360:Neoadjuvant Therapy; D009367:Neoplasm Staging; D009503:Neutropenia; D011379:Prognosis; D015996:Survival Rate; D043823:Taxoids; D016896:Treatment Outcome; D002583:Uterine Cervical Neoplasms", "nlm_unique_id": "9616295", "other_id": null, "pages": "1128-1135", "pmc": null, "pmid": "27380169", "pubdate": "2016-12", "publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study", "references": "9740697;23235641;16300819;11016467;15228422;25152438;24552320;17161167;25078340;23084091;26660311;24993674;19401699;15196855;15262120;24037752;24649246;14602133;22266551;18937708;20542643;20531414;22065519;20709382;7557613;9284774;10926787;11063659;17493669;21370599;9402169;20444747", "title": "Neoadjuvant chemotherapy with docetaxel and carboplatin followed by radical hysterectomy for stage IB2, IIA2, and IIB patients with non-squamous cell carcinoma of the uterine cervix.", "title_normalized": "neoadjuvant chemotherapy with docetaxel and carboplatin followed by radical hysterectomy for stage ib2 iia2 and iib patients with non squamous cell carcinoma of the uterine cervix" }
[ { "companynumb": "JP-CIPLA LTD.-2016JP09714", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "DOCETAXEL" }, "drugadditional": null, ...
{ "abstract": "Background: Data are limited regarding the preferred antibiotics for treatment of acute pulmonary exacerbations (APEs) of cystic fibrosis (CF), when methicillin-resistant Staphylococcus aureus (MRSA) is suspected. Objective: To compare the rate of return to baseline lung function among individuals with APEs of CF treated with either vancomycin or linezolid. Methods: This retrospective study included individuals hospitalized for APEs of CF from May 1, 2015, to April 30, 2017 who were infected with MRSA and treated with vancomycin or linezolid. The primary outcome was the return to baseline lung function, as measured by forced expiratory volume in 1 s (FEV1). Descriptive and inferential statistics were used. All tests were 2-tailed with α set at 0.05. Results: A total of 122 encounters were included (vancomycin: n = 66; linezolid: n = 66). No difference existed in return to baseline FEV1 between vancomycin (53 [80.3%]) and linezolid (50 [75.8%]; P = 0.53); nor was there a difference in median percentage change in FEV1 from admission to follow-up between vancomycin (24.7%) and linezolid (20.7%; P = 0.61). Adverse drug events occurred more frequently in patient encounters treated with vancomycin (10 [15.2%]) compared with linezolid (2 [3%]; P = 0.002). Conclusion and Relevance: Our study observed no difference in the effectiveness of vancomycin compared with linezolid in terms of change in lung function for APEs of CF. The rate of adverse drug events was low. In individuals with CF infected with MRSA who are experiencing an APE, either vancomycin or linezolid appear to be viable treatment options.", "affiliations": "University at Buffalo School of Pharmacy and Pharmaceutical Sciences, Buffalo, NY, USA.;University at Buffalo School of Pharmacy and Pharmaceutical Sciences, Buffalo, NY, USA.;Jacobs School of Medicine and Biomedical Sciences, Buffalo, NY, USA.;University at Buffalo School of Pharmacy and Pharmaceutical Sciences, Buffalo, NY, USA.", "authors": "Fusco|Nicholas M|NM|0000-0001-6709-1937;Meaney|Calvin J|CJ|;Frederick|Carla A|CA|;Prescott|William A|WA|", "chemical_list": "D000900:Anti-Bacterial Agents; D014640:Vancomycin; D000069349:Linezolid", "country": "United States", "delete": false, "doi": "10.1177/1060028019885651", "fulltext": null, "fulltext_license": null, "issn_linking": "1060-0280", "issue": "54(3)", "journal": "The Annals of pharmacotherapy", "keywords": "cystic fibrosis; linezolid; methicillin-resistant Staphylococcus aureus; vancomycin", "medline_ta": "Ann Pharmacother", "mesh_terms": "D000328:Adult; D000900:Anti-Bacterial Agents; D015331:Cohort Studies; D003550:Cystic Fibrosis; D018450:Disease Progression; D005260:Female; D006760:Hospitalization; D006801:Humans; D000069349:Linezolid; D008297:Male; D055624:Methicillin-Resistant Staphylococcus aureus; D012129:Respiratory Function Tests; D012189:Retrospective Studies; D016896:Treatment Outcome; D014640:Vancomycin", "nlm_unique_id": "9203131", "other_id": null, "pages": "197-204", "pmc": null, "pmid": "31658825", "pubdate": "2020-03", "publication_types": "D003160:Comparative Study; D016428:Journal Article", "references": null, "title": "Comparative Effectiveness of Vancomycin Versus Linezolid for the Treatment of Acute Pulmonary Exacerbations of Cystic Fibrosis.", "title_normalized": "comparative effectiveness of vancomycin versus linezolid for the treatment of acute pulmonary exacerbations of cystic fibrosis" }
[ { "companynumb": "US-CADILA HEALTHCARE LIMITED-US-ZYDUS-049296", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "LINEZOLID" }, "drugadditio...
{ "abstract": "BACKGROUND\nSystemic chemotherapy combined with steroids used as prophylactic antiemetics have been reported to induce immunosuppression. Further, herpes simplex virus-1 (HSV-1) infection has been reported to occur in patients with small cell carcinomas after chemoradiotherapy that includes brain irradiation. Here, we report a case of HSV-1 encephalitis that occurred in a patient undergoing chemoradiotherapy for advanced esophageal cancer.\n\n\nMETHODS\nA 77-year-old woman received chemoradiotherapy (5-fluorouracil, 700 mg/m(2); cisplatin, 70 mg/m(2); and radiotherapy, 60 Gy in total) for stage III esophageal cancer. The total radiation dose was administered concurrently with the first two courses of chemotherapy, together with dexamethasone as a prophylactic antiemetic. Two days before completion of the fourth course of chemotherapy, the patient developed acute neurological symptoms of disorientation, clouding of consciousness, and fever. T2-weighted magnetic resonance imaging showed a high intensity area in the bilateral temporal lobes and insular cortex. Furthermore, DNA PCR testing of cerebrospinal fluid showed clear positivity for HSV-1 DNA, and the patient was diagnosed with herpetic encephalitis. Intravenous administration of acyclovir for 3 weeks led to gradual improvement of consciousness, and the patient was able to respond to verbal cues.\n\n\nCONCLUSIONS\nIn advanced esophageal cancer patients, standard treatment involves chemoradiotherapy and surgery. However, primary infection with or reactivation of endogenous latent HSV-1 in the brain cortex during chemoradiotherapy combined with administration of a steroid may compromise the benefits of treatment.", "affiliations": "Department of Surgery, Saitama Medical Center, Jichi Medical University, 1-847 Amanuma-cho, Omiya-ku, Saitama, 330-8503, Japan. msaito@jichi.ac.jp.;Department of Surgery, Saitama Medical Center, Jichi Medical University, 1-847 Amanuma-cho, Omiya-ku, Saitama, 330-8503, Japan.;Department of Surgery, Saitama Medical Center, Jichi Medical University, 1-847 Amanuma-cho, Omiya-ku, Saitama, 330-8503, Japan.;Department of Surgery, Saitama Medical Center, Jichi Medical University, 1-847 Amanuma-cho, Omiya-ku, Saitama, 330-8503, Japan.;Department of Surgery, Saitama Medical Center, Jichi Medical University, 1-847 Amanuma-cho, Omiya-ku, Saitama, 330-8503, Japan.;Department of Surgery, Saitama Medical Center, Jichi Medical University, 1-847 Amanuma-cho, Omiya-ku, Saitama, 330-8503, Japan.;Department of Surgery, Saitama Medical Center, Jichi Medical University, 1-847 Amanuma-cho, Omiya-ku, Saitama, 330-8503, Japan.", "authors": "Saito|Masaaki|M|;Kiyozaki|Hirokazu|H|;Obitsu|Tamotu|T|;Imoto|Hirofumi|H|;Taniyama|Yusuke|Y|;Takata|Osamu|O|;Rikiyama|Toshiki|T|", "chemical_list": "D013256:Steroids; D003907:Dexamethasone; D002945:Cisplatin; D005472:Fluorouracil; D000212:Acyclovir", "country": "England", "delete": false, "doi": "10.1186/s12885-016-2255-8", "fulltext": "\n==== Front\nBMC CancerBMC CancerBMC Cancer1471-2407BioMed Central London 225510.1186/s12885-016-2255-8Case ReportHerpes simplex virus-1 encephalitis induced by chemoradiotherapy and steroids in an esophageal cancer patient: a case report Saito Masaaki +81-48-647-2111msaito@jichi.ac.jp Kiyozaki Hirokazu hkiyo@omiya.jichi.ac.jp Obitsu Tamotu ob2tm2@jichi.ac.jp Imoto Hirofumi imotofamily@me.com Taniyama Yusuke yusuketaniyama@gmail.com Takata Osamu takata@omiya.jichi.ac.jp Rikiyama Toshiki trikiyama@jichi.ac.jp Department of Surgery, Saitama Medical Center, Jichi Medical University, 1-847 Amanuma-cho, Omiya-ku, Saitama, 330-8503 Japan 17 3 2016 17 3 2016 2016 16 23318 3 2015 8 3 2016 © Saito et al. 2016\nOpen AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nSystemic chemotherapy combined with steroids used as prophylactic antiemetics have been reported to induce immunosuppression. Further, herpes simplex virus-1 (HSV-1) infection has been reported to occur in patients with small cell carcinomas after chemoradiotherapy that includes brain irradiation. Here, we report a case of HSV-1 encephalitis that occurred in a patient undergoing chemoradiotherapy for advanced esophageal cancer.\n\nCase presentation\nA 77-year-old woman received chemoradiotherapy (5-fluorouracil, 700 mg/m2; cisplatin, 70 mg/m2; and radiotherapy, 60 Gy in total) for stage III esophageal cancer. The total radiation dose was administered concurrently with the first two courses of chemotherapy, together with dexamethasone as a prophylactic antiemetic. Two days before completion of the fourth course of chemotherapy, the patient developed acute neurological symptoms of disorientation, clouding of consciousness, and fever. T2-weighted magnetic resonance imaging showed a high intensity area in the bilateral temporal lobes and insular cortex. Furthermore, DNA PCR testing of cerebrospinal fluid showed clear positivity for HSV-1 DNA, and the patient was diagnosed with herpetic encephalitis. Intravenous administration of acyclovir for 3 weeks led to gradual improvement of consciousness, and the patient was able to respond to verbal cues.\n\nConclusion\nIn advanced esophageal cancer patients, standard treatment involves chemoradiotherapy and surgery. However, primary infection with or reactivation of endogenous latent HSV-1 in the brain cortex during chemoradiotherapy combined with administration of a steroid may compromise the benefits of treatment.\n\nKeywords\nHSV-1EncephalitisChemoradiotherapyEsophageal cancerissue-copyright-statement© The Author(s) 2016\n==== Body\nBackground\nEsophageal cancer patients are very likely to undergo chemotherapy and radiotherapy as definitive chemoradiotherapy for advanced esophageal cancer is a widely accepted standard treatment, with a combination of 5-fluorouracil (5-FU) and cisplatin with concurrent irradiation (50–60 Gy total dose) being a standard regimen [1, 2].\n\nHerpes simplex virus (HSV) is a well-characterized double-stranded DNA virus that can latently infect the spinal, trigeminal, and sacral cord ganglia. One subtype of the virus, HSV type 1 (HSV-1) commonly infects the trigeminal ganglia and may reactivate and spread from there to result in herpes labialis, stomatitis, keratitis, or encephalitis.\n\nHerpes simplex encephalitis (HSE) accounts for 10–20 % of encephalitis cases and is particularly noted in cases of sporadic encephalitis, the annual morbidity rate of which is 2–4 individuals per million [3–5]. HSV-1 is responsible for 95 % of all cases of HSE, and it is estimated that approximately 70–80 % of these occurrences are caused by reactivation of latent virus or re-infection, while the remaining cases are due to primary infection. Fatigue, trauma, and stress that weaken the host’s immune system can lead to reactivation of the latent virus. Moreover, systemic chemotherapy along with steroids used as prophylactic antiemetics may also induce immunosuppression.\n\nOnly a few case reports of HSE following chemotherapy or steroid therapy in cancer patients exist [6]. Herein, we report a case of HSV-1 encephalitis that occurred during chemoradiotherapy in a patient with advanced esophageal cancer.\n\nCase presentation\nA 77-year-old woman had been suffering from dysphagia for 2 months prior to hospitalization. She was diagnosed with stage III esophageal cancer at a local hospital and was referred to our hospital for further treatment. Esophagogastroduodenoscopy showed a type 2 tumor in the lower intrathoracic esophagus. Enhanced computed tomography showed wall thickening and ambient lymphadenopathy. She received chemoradiotherapy (5-FU, 700 mg/m2; cisplatin, 70 mg/m2; and radiotherapy, 60 Gy in total) every 28 days. The total irradiation dose to the mediastinum was administered concomitantly with two courses of chemotherapy, combined with dexamethasone as a prophylactic antiemetic. Partial remission after two courses of chemoradiotherapy was achieved and the residual esophageal tumor was minimal.\n\nHowever, 2 days before completion of the fourth course of chemotherapy, the patient developed acute neurological symptoms of disorientation, clouding of consciousness, and fever. At the onset, leukocyte count was 2020, and the lymphocyte count had decreased to 120/mm3. Serum squamous cell carcinoma antigen was 1.9 ng/mL and the remaining serological parameters were within normal ranges. Blood culture results were negative, and chest and abdominal radiography findings were unremarkable.\n\nA computed tomography (CT) scan of the brain at the onset of symptoms revealed only multiple small low-density areas dispersed around a cerebral hemisphere, which were remnants of an earlier cerebral infarction. Coronal T2-weighted magnetic resonance imaging (MRI) of the brain revealed bilateral high intensity areas in the temporal lobes. Diffusion-weighted imaging revealed enhanced high intensity areas corresponding to the bilateral temporal lobes (Fig. 1). These findings strongly suggested acute encephalitis. An electroencephalogram showed a diffuse sharp wave–slow wave composition wave (Fig. 2).Fig. 1 Magnetic resonance imaging of the brain upon onset of symptoms. a Coronal T2-weighted magnetic resonance imaging of the brain revealed high intensity areas bilaterally in the temporal lobes. b Diffusion-weighted imaging revealed enhanced high intensity areas corresponding to the bilateral temporal lobes\n\nFig. 2 Electroencephalogram upon onset of symptoms. An electroencephalogram showed a diffuse sharp wave–slow wave composition wave\n\n\n\nExamination of cerebrospinal fluid showed no occurrence of pleocytosis of mononuclear cells, with only two monocytes and eight erythrocytes being identified in 3 μL of CSF. Furthermore, CSF glucose and protein were normal. However, the DNA PCR consensus herpes test showed clear positivity for HSV-1 DNA. Based on these findings, we arrived at a diagnosis of acute HSV-1 encephalitis by endogenous viral reactivation in an immunocompromised patient.\n\nWith intravenous administration of acyclovir for 3 weeks, the patient’s state of consciousness gradually improved, as she regained the ability to understand and respond to simple instructions. She was subsequently transferred to another hospital, where she is currently being treated. To date, her cancer has not recurred and, although she is confined to a wheelchair and fed by tube, she remains capable of responding to simple verbal cues.\n\nDiscussion\nThe overall annual incidence of HSE is estimated at 2–4 individuals per million. An immunosuppressive state is thought to contribute to reactivation of latent HSV, and yet it is not expected to affect the incidence rate of HSE, although the severity of this disease is likely to be worse in the immunocompromised [7]. However, comorbidities of cancer, chemotherapy, radiotherapy, steroid therapy, and other disorders are known to elevate the incidence of HSE by decreasing cell-mediated immunity [5, 8].\n\nChemoradiotherapy for esophageal cancer is indicated for patients with resectable cancer who cannot tolerate surgery and those with unresectable stage T4 cancer or lymph node metastasis that is confined to one particular area. A phase II clinical study on the standard chemoradiotherapy regimen (FP therapy [5-FU, 1,000 mg/m2; cisplatin, 75 mg/m2] plus radiotherapy, 50.4 Gy) was conducted in patients with esophageal cancer at clinical stages II/III (excluding those with stage T4 cancer) in Japan [2]. Despite the favorable outcomes observed (complete response rate of 70 % and a 3-year survival rate of 63.8 %), acute toxicity was slightly increased. The toxicity of chemotherapy, especially cisplatin, includes nausea and vomiting in the acute phase. When such highly emetogenic drugs are administered, it is recommended that the following three-drug combination be included: oral administration of the neurokinin -1 receptor antagonist aprepitant at 125 mg, a 5-hydroxytryptamine-3 receptor antagonist, and dexamethasone at 12 mg [9–11].\n\nIn the present case, the patient received four courses of FP therapy and radiotherapy to the mediastinum. Additionally, steroids were also administered to prevent emesis. While systemic chemotherapy has been reported to induce suppression of systemic immunity, it is assumed that administration of steroids further contributed to the patient’s immunosuppression. Consistent with this, a decreased peripheral lymphocyte count was also observed.\n\nGraber et al. summarized prior reports of cancer patients subsequently diagnosed with HSE, including patients from their own academic cancer center over a 12-year period. He reported that 19 cancer patients receiving chemotherapy developed HSE in the past 12 years [6], indicating a higher than expected incidence of HSE in this population. The cohort included 11 patients with brain tumors, three with lung cancer, two with breast cancer and one patient each with malignant lymphoma, multiple myeloma and renal cancer. Patients received various chemotherapeutic agents, and brain radiation was concomitantly administered in 13 of these individuals. Of the total cohort, two patients survived and 15 died of herpes encephalitis. Follow up data were incomplete for the remaining two individuals. There have been no reports of this disease occurring during chemotherapy for esophageal cancer, and the present case is thus the first reported case. This patient received systemic chemotherapy and directed radiation to the mediastinum; however, the specific relationship between development of HSE and mediastinal radiation remains unclear.\n\nBecause HSE is generally difficult to diagnose in cancer patients, it is assumed that there are patients who remain without a definitive diagnosis and experience unfavorable outcomes. The disease is often difficult to differentiate from brain metastasis, paraneoplastic syndrome, and cerebral infarction as a manifestation of Trousseau’s syndrome [12, 13]. Although fever, recurrent syncopal attacks and disorientation were observed in the present case, a clinical diagnosis was difficult to make. When cancer patients experience progressive neurological symptoms with evidence of inflammation, it is prudent to actively suspect a comorbidity of HSE, with brain metastasis also taken into consideration.\n\nMany studies have been conducted regarding various diagnostic procedures for this disease [12, 13]. MRI depicts edematous changes due to inflammation as normal intensity areas on T1-weighted images and high intensity areas on T2-weighted images in the cortices of the bilateral temporal lobes, white matter, and insular cortex. MRI should allow for earlier diagnosis than a CT scan. In the present case, although no apparent finding was obtained by CT scan, MRI revealed mildly high intensity areas in the medial cortices of the bilateral temporal lobes and insular cortex on fluid-attenuated inversion recovery images.\n\nThe examination of cerebrospinal fluid of HSE patients generally reveals elevated cerebrospinal fluid pressure, cytosis with lymphocytic predominance, and increased protein. The glucose concentration is often normal. Erythrocytes or xanthochromia may be also detected in some cases [14].\n\nWhen HSV-DNA is detected in the cerebrospinal fluid via PCR, a definitive diagnosis can be made; however, a negative result does not rule out HSE [15–17]. In the present case, PCR was indeed positive for HSV-DNA, leading to the definitive diagnosis.\n\nElectroencephalograms show abnormalities in almost all cases of HSE. Focal abnormalities are found in many cases, whereas periodic lateralized epileptic discharges, which are considered to be relatively characteristic to HSE, are found in approximately 30 % of cases. The present case showed a diffuse sharp-and-slow-wave complex.\n\nSince the advent of the use of acyclovir for the treatment of HSE, mortality has markedly decreased from 70 to 7.1–28 % [4–6, 18]. As a general guideline, acyclovir is intravenously infused at a dose of 10 mg/kg three times a day for 14 days or more [19, 20]. For the treatment of convulsive seizures and cerebral edema, diazepam, midazolam, phenytoin, or other agents are used. In order to treat cerebral edema, glyceol, mannitol, and steroids are recommended. The mechanisms of action of corticosteroids are assumed to include the reduction of cerebral edema and the inhibition of secretion of proinflammatory cytokines. In the present case, while acyclovir was administered for 3 weeks, the patient received methylprednisolone for 3 days at a dose of 1,000 mg/day to prevent cerebral edema and phenobarbital for 4 weeks at a dose of 100 mg/day to prevent convulsions. Although the prognosis of this disease has traditionally been extremely poor, our patient recovered. She was subsequently transferred to another hospital, where she is currently being treated.\n\nConclusions\nAny esophageal cancer patient who undergoes chemoradiotherapy and has subsequent neurologic decline should be evaluated for HSE. Furthermore, patients undergoing chemotherapy should be monitored, given the possibility of latent HSV-1 reactivation. When HSE is suspected, we recommend that antiviral therapy commence immediately, as this may prove lifesaving while the diagnosis is being confirmed.\n\nConsent\nWritten informed consent was obtained from the patient’s next-of-kin for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor of this journal.\n\nAvailability of data and materials\nThe datasets supporting the conclusions of this article are included within the article.\n\nAbbreviations\nHSVHerpes simplex virus\n\nDNADeoxyribonucleic acid\n\nHSEHerpes simplex encephalitis\n\nCTComputed tomography\n\nMRIMagnetic resonance imaging\n\nPCRPolymerase chain reaction\n\nCompeting interests\n\nThe authors declare that they have no competing interests.\n\nAuthors’ contributions\n\nMS wrote the first draft of the manuscript and was involved in patient care. HK edited the draft, did literature review and was involved in patient care and intellectual input. TO was involved in patient care and reviewing the draft. HI and YT edited the draft and provided intellectual inputs. OT was directly involved in patient care, edited the draft and provided intellectual inputs. TR edited the draft significantly along with providing intellectual input. All authors read and approved the final manuscript.\n\nAcknowledgements\nThis study was not funded by any outside source.\n==== Refs\nReferences\n1. Minsky BD Pajak TF Ginsberg RJ Pisansky TM Martenson J Komaki R INT 0123 (Radiation Therapy Oncology Group 94-05) phase III trial of combined-modality therapy for esophageal cancer: high-dose versus standard-dose radiation therapy J Clin Oncol 2002 20 5 1167 74 10.1200/JCO.20.5.1167 11870157 \n2. Kato K Muro K Minashi K Ohtsu A Ishikura S Boku N Phase II study of chemoradiotherapy with 5-fluorouracil and cisplatin for Stage II-III esophageal squamous cell carcinoma: JCOG trial (JCOG 9906) Int J Radiat Oncol Biol Phys 2011 81 3 684 90 10.1016/j.ijrobp.2010.06.033 20932658 \n3. Kennedy PG Chaudhuri A Herpes simplex encephalitis J Neurol Neurosurg Psychiatry 2002 73 3 237 8 10.1136/jnnp.73.3.237 12185148 \n4. Hjalmarsson A Blomqvist P Skoldenberg B Herpes simplex encephalitis in Sweden, 1990-2001: incidence, morbidity, and mortality Clin Infect Dis 2007 45 7 875 80 10.1086/521262 17806053 \n5. Mailles A Stahl JP Steering C Investigators G Infectious encephalitis in france in 2007: a national prospective study Clin Infect Dis 2009 49 12 1838 47 10.1086/648419 19929384 \n6. Graber JJ Rosenblum MK DeAngelis LM Herpes simplex encephalitis in patients with cancer J Neurooncol 2011 105 2 415 21 10.1007/s11060-011-0609-2 21637964 \n7. Tan IL McArthur JC Venkatesan A Nath A Atypical manifestations and poor outcome of herpes simplex encephalitis in the immunocompromised Neurology 2012 79 21 2125 32 10.1212/WNL.0b013e3182752ceb 23136265 \n8. Stroop WG Schaefer DC Production of encephalitis restricted to the temporal lobes by experimental reactivation of herpes simplex virus J Infect Dis 1986 153 4 721 31 10.1093/infdis/153.4.721 3005432 \n9. Hesketh PJ Grunberg SM Gralla RJ Warr DG Roila F de Wit R The oral neurokinin-1 antagonist aprepitant for the prevention of chemotherapy-induced nausea and vomiting: a multinational, randomized, double-blind, placebo-controlled trial in patients receiving high-dose cisplatin--the Aprepitant Protocol 052 Study Group J Clin Oncol 2003 21 22 4112 9 10.1200/JCO.2003.01.095 14559886 \n10. de Wit R Herrstedt J Rapoport B Carides AD Carides G Elmer M Addition of the oral NK1 antagonist aprepitant to standard antiemetics provides protection against nausea and vomiting during multiple cycles of cisplatin-based chemotherapy J Clin Oncol 2003 21 22 4105 11 10.1200/JCO.2003.10.128 14559891 \n11. Grunberg S Chua D Maru A Dinis J DeVandry S Boice JA Single-dose fosaprepitant for the prevention of chemotherapy-induced nausea and vomiting associated with cisplatin therapy: randomized, double-blind study protocol--EASE J Clin Oncol 2011 29 11 1495 501 10.1200/JCO.2010.31.7859 21383291 \n12. Hirai R Ayabe M Shoji H Kaji M Ichiyama T Sakai K Herpes simplex encephalitis presenting with bilateral hippocampal lesions on magnetic resonance imaging, simultaneously complicated by small cell lung carcinoma Intern Med 2005 44 9 1006 8 10.2169/internalmedicine.44.1006 16258223 \n13. Fadul CE Stommel EW Dragnev KH Eskey CJ Dalmau JO Focal paraneoplastic limbic encephalitis presenting as orgasmic epilepsy J Neurooncol 2005 72 2 195 8 10.1007/s11060-004-2242-9 15926002 \n14. Price R Chernik NL Horta-Barbosa L Posner JB Herpes simplex encephalitis in an anergic patient Am J Med 1973 54 2 222 8 10.1016/0002-9343(73)90226-X 4685847 \n15. Dennett C Klapper PE Cleator GM Polymerase chain reaction in the investigation of “relapse” following herpes simplex encephalitis J Med Virol 1996 48 2 129 32 10.1002/(SICI)1096-9071(199602)48:2<129::AID-JMV2>3.0.CO;2-B 8835344 \n16. Cinque P Cleator GM Weber T Monteyne P Sindic CJ van Loon AM The role of laboratory investigation in the diagnosis and management of patients with suspected herpes simplex encephalitis: a consensus report. The EU concerted action on virus meningitis and encephalitis J Neurol Neurosurg Psychiatry 1996 61 4 339 45 10.1136/jnnp.61.4.339 8890768 \n17. Linde A Klapper PE Monteyne P Echevarria JM Cinque P Rozenberg F Specific diagnostic methods for herpesvirus infections of the central nervous system: a consensus review by the European Union Concerted Action on Virus Meningitis and Encephalitis Clin Diagn Virol 1997 8 2 83 104 10.1016/S0928-0197(97)00015-9 9316731 \n18. Stranska R Schuurman R Nienhuis E Goedegebuure IW Polman M Weel JF Survey of acyclovir-resistant herpes simplex virus in the Netherlands: prevalence and characterization J Clin Virol 2005 32 1 7 18 10.1016/j.jcv.2004.04.002 15572000 \n19. Solomon T Hart IJ Beeching NJ Viral encephalitis: a clinician’s guide Pract Neurol 2007 7 5 288 305 10.1136/jnnp.2007.129098 17885268 \n20. Tunkel AR Glaser CA Bloch KC Sejvar JJ Marra CM Roos KL The management of encephalitis: clinical practice guidelines by the Infectious Diseases Society of America Clin Infect Dis 2008 47 3 303 27 10.1086/589747 18582201\n\n", "fulltext_license": "CC BY", "issn_linking": "1471-2407", "issue": "16()", "journal": "BMC cancer", "keywords": "Chemoradiotherapy; Encephalitis; Esophageal cancer; HSV-1", "medline_ta": "BMC Cancer", "mesh_terms": "D000212:Acyclovir; D000368:Aged; D059248:Chemoradiotherapy; D002945:Cisplatin; D003907:Dexamethasone; D020803:Encephalitis, Herpes Simplex; D004938:Esophageal Neoplasms; D005260:Female; D005472:Fluorouracil; D018259:Herpesvirus 1, Human; D006801:Humans; D008279:Magnetic Resonance Imaging; D013256:Steroids", "nlm_unique_id": "100967800", "other_id": null, "pages": "233", "pmc": null, "pmid": "26988237", "pubdate": "2016-03-17", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "11870157;23136265;14559886;14559891;4685847;3005432;8835344;8890768;9316731;15572000;15926002;16258223;17806053;17885268;18582201;19929384;21383291;20932658;21637964;12185148", "title": "Herpes simplex virus-1 encephalitis induced by chemoradiotherapy and steroids in an esophageal cancer patient: a case report.", "title_normalized": "herpes simplex virus 1 encephalitis induced by chemoradiotherapy and steroids in an esophageal cancer patient a case report" }
[ { "companynumb": "JP-BAUSCH-BL-2016-017794", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "DEXAMETHASONE" }, "drugadditional": "3", ...
{ "abstract": "Objective. The introduction of protease inhibitors telaprevir and boceprevir in 2011 had extended the antiviral treatment options especially in genotype 1 infected hepatitis C relapsers and nonresponders to interferon/ribavirin therapy. The aim of this study was to analyze the long-term treatment efficiency of telaprevir-based triple therapy for patients with hepatitis C reinfection after orthotopic liver transplantation. Patients and Methods. We included 12 patients with histologically confirmed graft fibrosis due to hepatitis C reinfection. The treatment duration was scheduled as 12 weeks of telaprevir-based antiviral triple therapy followed by 36 weeks of dual therapy with pegylated interferon/ribavirin. The patients were followed up for two years after the end of triple therapy. Results. Of the 12 patients, 6 (50%) completed the full 48 weeks of antiviral treatment. An end of treatment response and a sustained virological response 52 weeks after the end of the antiviral treatment course were achieved in 8/12 (67%) and 7/12 (58%) patients, respectively. Conclusion. Telaprevir-based triple therapy was shown to be a long-term effective but complex treatment option for individual patients with hepatitis C graft. With the recent improvements in hepatitis C therapy options telaprevir may not be recommended as a standard therapy for this indication anymore.", "affiliations": "Department of General, Visceral and Transplantation Surgery, Charité Universitätsmedizin Berlin, Campus Virchow, Augustenburger Platz 1, 13353 Berlin, Germany.;Department of General, Visceral and Transplantation Surgery, Charité Universitätsmedizin Berlin, Campus Virchow, Augustenburger Platz 1, 13353 Berlin, Germany.;Department of General, Visceral and Transplantation Surgery, Charité Universitätsmedizin Berlin, Campus Virchow, Augustenburger Platz 1, 13353 Berlin, Germany.;Institute of Medical Virology, Helmut-Ruska-Haus and Labor Berlin Charité-Vivantes GmbH, Charité Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany.;Department of General, Visceral and Transplantation Surgery, Charité Universitätsmedizin Berlin, Campus Virchow, Augustenburger Platz 1, 13353 Berlin, Germany.;Department of General, Visceral and Transplantation Surgery, Charité Universitätsmedizin Berlin, Campus Virchow, Augustenburger Platz 1, 13353 Berlin, Germany.;Department of General, Visceral and Transplantation Surgery, Charité Universitätsmedizin Berlin, Campus Virchow, Augustenburger Platz 1, 13353 Berlin, Germany.", "authors": "Klein|Fritz|F|0000-0002-8940-6001;Neuhaus|Ruth|R|;Eurich|Dennis|D|;Hofmann|Jörg|J|;Bayraktar|Sandra|S|;Pratschke|Johann|J|;Bahra|Marcus|M|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1155/2016/8325467", "fulltext": "\n==== Front\nHepat Res TreatHepat Res TreatHEPRTHepatitis Research and Treatment2090-13642090-1372Hindawi Publishing Corporation 10.1155/2016/8325467Clinical StudyTwo-Year Follow-Up Analysis of Telaprevir-Based Antiviral Triple Therapy for HCV Recurrence in Genotype 1 Infected Liver Graft Recipients as a First Step towards Modern HCV Therapy http://orcid.org/0000-0002-8940-6001Klein Fritz \n1\n\n*\nNeuhaus Ruth \n1\nEurich Dennis \n1\nHofmann Jörg \n2\nBayraktar Sandra \n1\nPratschke Johann \n1\nBahra Marcus \n1\n1Department of General, Visceral and Transplantation Surgery, Charité Universitätsmedizin Berlin, Campus Virchow, Augustenburger Platz 1, 13353 Berlin, Germany2Institute of Medical Virology, Helmut-Ruska-Haus and Labor Berlin Charité-Vivantes GmbH, Charité Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany*Fritz Klein: fritz.klein@charite.deAcademic Editor: Piero Luigi Almasio\n\n2016 18 4 2016 2016 832546730 11 2015 8 3 2016 Copyright © 2016 Fritz Klein et al.2016This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.\nObjective. The introduction of protease inhibitors telaprevir and boceprevir in 2011 had extended the antiviral treatment options especially in genotype 1 infected hepatitis C relapsers and nonresponders to interferon/ribavirin therapy. The aim of this study was to analyze the long-term treatment efficiency of telaprevir-based triple therapy for patients with hepatitis C reinfection after orthotopic liver transplantation. Patients and Methods. We included 12 patients with histologically confirmed graft fibrosis due to hepatitis C reinfection. The treatment duration was scheduled as 12 weeks of telaprevir-based antiviral triple therapy followed by 36 weeks of dual therapy with pegylated interferon/ribavirin. The patients were followed up for two years after the end of triple therapy. Results. Of the 12 patients, 6 (50%) completed the full 48 weeks of antiviral treatment. An end of treatment response and a sustained virological response 52 weeks after the end of the antiviral treatment course were achieved in 8/12 (67%) and 7/12 (58%) patients, respectively. Conclusion. Telaprevir-based triple therapy was shown to be a long-term effective but complex treatment option for individual patients with hepatitis C graft. With the recent improvements in hepatitis C therapy options telaprevir may not be recommended as a standard therapy for this indication anymore.\n==== Body\n1. Introduction\nHepatitis C Virus (HCV) recurrence after orthotopic liver transplantation (OLT) is the major cause of graft failure and death in HCV recipients [1]. Graft reinfection with accelerated fibrosis deposition occurs in all patients with detectable HCV ribonucleic acid (HCV RNA) at the time of transplantation, and 30% of these patients will develop graft cirrhosis within 5 years after OLT, with a mortality risk directly related to HCV recurrence of 15% [2, 3]. In addition to high HCV RNA levels in the early post-OLT period, factors such as HCV genotypes 1 and 4 as well as an older donor age, graft steatosis, the degree of human leukocyte antigen (HLA) matching, and the IL28B genotype of the donor and recipient have been identified as negative predictive factors for HCV recurrence [4, 5]. Obtaining a sustained virological response (SVR) by successful antiviral therapy can distinctly improve the graft and overall patient survival [6, 7]. Until 2011, the standard antiviral therapy regimen consisted of a dual therapy of pegylated interferon (PegIFN) and ribavirin (RBV). In addition to a poor tolerance, especially in transplanted patients, overall SVR was only achieved in one-third of HCV-positive recipients (−30% GT1, −50% GT5) [8, 9]. Therefore, establishing more efficient therapy regimens for patients with severe HCV recurrence remains essential. The introduction of the novel NS3/4 protease inhibitors (PI) boceprevir (BOC) and telaprevir (TVR) in 2011 had fundamentally changed the treatment options for HCV patients. Several clinical studies demonstrated that the addition of BOC or TVR to standard dual therapy in immunocompetent patients led to promising SVR rates even in patients who failed to achieve an SVR during previous treatment with PegIFN/RBV [10–12]. However, this first success of triple therapy was accompanied by a distinct increase of treatment-related serious adverse effects (SAE), such as manifest anemia, thrombocytopenia, neutropenia, bacterial infections, and decompensation of liver cirrhosis with a potentially life-threatening clinical course [13]. As an additional concern, PIs are metabolized via the cytochrome P450 (CYP) enzyme system and are substrates and inhibitors of the CYP 3A4/5 enzyme, as well as of the efflux pump P-glycoprotein (P-gp), and may therefore cause severe drug-drug interactions (DDIs) with a wide range of approved medications, including calcineurin inhibitors (CNIs) [14]. Therefore, the clinical application of PIs in the treatment of HCV recurrence after OLT is extremely challenging. Pharmacokinetic studies demonstrated that TVR exposure increased cyclosporine and tacrolimus levels 4.6- and 70-fold, respectively [15]. Thus, an intensified monitoring of CNI levels during TVR therapy is required to achieve a balance between toxicity due to insufficient CNI dose reduction and rejection due to disproportionate CNI dose reduction. Several studies have demonstrated the feasibility of combining PIs together with CNIs until today with reported SVR rates of 20% to 50% even in formerly considered hard-to-treat patients [16–19]. The recent rapid improvement in HCV therapy such as the introduction of new directly acting antivirals (DAA) and the possibility of IFN-free regimes has however led to a therapeutic hold in the clinical application of first generation PIs [20]. Due to these rapid developments in HCV treatment options clinical and academic research has of course also focused on the feasibility, management guidelines, and effectiveness of the novel anti-HCV agents. Reports of long-term results of first generation PI's treatment thus remain scarce. The aim of our study therefore was to report our results of the one-year follow-up after TVR/PegIFN/RBV triple therapy in combination with cyclosporine immunosuppression in GT1-infected relapsers and previous nonresponders after OLT.\n\n2. Patients and Methods\n2.1. Study Design\nA retrospective analysis of 12 genotype 1 infected liver graft recipients with recurrent HCV who underwent TVR-based antiviral triple therapy between March 1, 2012, and July 31, 2013, at the Department of General, Visceral and Transplantation Surgery at Charité University Hospitals, Berlin, Campus Virchow, was performed. All patients included in this study had confirmed HCV recurrence with detectable HCV RNA in the PCR analysis and biopsy-proven graft fibrosis according to the Desmet and Scheuer classification (0, absent; 1, mild without septa; 2, moderate with few septa; 3, numerous septa without cirrhosis; and 4, cirrhosis) [21]. The indication to perform TVR-based antiviral therapy was based on sufficient renal function (glomerular filtration rate ≥ 60 mL/min according to the Cockcroft-Gault formula) and red blood cell count (hemoglobin levels ≥ 10 g/dL), as well as on adequate patient compliance. TVR treatment was not considered in patients with allograft cirrhosis, renal insufficiency, or general contraindications to IFN therapy. This study was performed in accordance with the Declaration of Helsinki and its amendments and approved by the institutional ethic committee. All patients were extensively educated about treatment-related side effects and the increased risk of DDIs during TVR therapy. Written consent to perform TVR/PegIFN/RBV triple therapy and consecutive PegIFN/RBV dual therapy by each patient was documented in the medical records.\n\n2.2. Treatment Algorithm\nThe overall antiviral treatment duration was scheduled as 12 weeks of TVR/PegIFN/RBV triple therapy and 36 weeks of consecutive PegIFN/RBV dual therapy. Primary immunosuppression was switched from tacrolimus (TAC, Prograf®) to cyclosporine (CyA, Sandimmun Optoral®) prior to the beginning of treatment, and a sufficient therapeutic range for the CyA dosage was defined as a total body clearance (TBC) from 80 to 120 ng/mL depending on the time that had elapsed since OLT. In addition, all patients underwent a lead-in phase of 4 weeks of RBV (Copegus©; Roche) at a daily dose of 600 mg to estimate hematological and renal tolerance. Hemoglobin and serum creatinine levels were measured once a week during the lead-in phase, and the RBV dosage was eventually adjusted. Triple therapy was then begun with TVR (Incivo©; Janssen-Cilag International NV), PegIFN (Pegasys©; Roche), and RBV (Copegus©; Roche). TVR was given at either two daily doses of 1,125 mg or three daily doses of 750 mg, respectively, to reach a daily dose of 2,250 mg. The CyA dosage was reduced by 50% for each patient on the day that TVR treatment started.\n\n2.3. Safety Assessment\nVisits to our outpatient department for clinical examinations and laboratory measurements of CyA levels, blood count, and clinical chemistry renal and liver parameters were scheduled three times per week during the first two weeks and then two times a week until two weeks after the end of TVR treatment. The CyA dosage was adjusted to maintain a TBC of 80 to 120 ng/mL, and the RBV dosage was eventually reduced to 400 mg/day or even 200 mg/day, depending on the degree of cytopenia or renal function. Clinical and laboratory examinations were continued twice per month during PegIFN/RBV dual therapy. Patients were systematically screened for DDIs, as well as for treatment-related side effects. Erythropoietin (EPO) (Neorecormon©; Roche) and/or packed red blood cells (PRBCs) were administered in patients with hemoglobin levels below 6.21 mmol/L. Clinically manifest anemia and leukopenia were defined as hemoglobin levels below 4.97 mmol/L and leukocyte levels below 1.5/nL, respectively. In the event of SAEs of any type, antiviral therapy was discontinued immediately.\n\n2.4. Treatment Efficacy and Definitions\nTo assess the treatment efficacy, HCV RNA was measured at baseline, at weeks 4, 8, 12, 24, and 48 of antiviral treatment, and then at weeks 12, 30, and 52 after the end of the treatment course (Roche Cobas AmpliPrep/Roche Cobas TaqMan, Roche Diagnostics GmbH, Mannheim, Germany; lower level of quantification (LLOQ) = 15 IU/mL). A rapid virological response (RVR) was defined as undetectable HCV RNA at week 4, and a complete RVR (cRVR) was defined as undetectable HCV RNA at weeks 4 and 12 of TVR-based antiviral therapy. An end of treatment response (ETR), an SVR 12, and SVR 52 were achieved when HCV RNA remained undetectable at the time of treatment discontinuation, 12 weeks or 52 weeks after the end of antiviral treatment, respectively. A Null Response (NR) was defined as a <2-log drop of HCV RNA at week 12, and a breakthrough (BT) was defined as the reappearance of HCV RNA at any time during treatment. A relapse was defined as undetectable HCV RNA at the end of treatment but detectable HCV RNA within 24 weeks of follow-up. Antiviral therapy was discontinued in the event of BT or if HCV RNA was not below 1000 IU/mL at week 4 of TVR therapy, in accordance with standard therapy guidelines.\n\n3. Results\n3.1. Patient Baseline Data\nA total of 12 patients underwent TVR-based antiviral triple therapy between March 1, 2012, and July 31, 2013, at our institution. The mean patient age was 51.8 years (32–67 years), and the male-to-female ratio was seven (58%) to five (42%). All patients had undergone OLT due to HCV cirrhosis at our institution at a mean time of 63.7 months (13–190 months) prior to beginning TVR/PegIFN/RBV triple therapy. Ten patients had HCV genotype 1b, and two patients had genotype 1a. Seven patients had previously been treated with PegIFN/RBV. All patients had confirmed HCV RNA by PCR analysis and biopsy-proven HCV recurrence, with a fibrosis grade of 1 in four patients, a grade of 2 in five patients, and a grade of 3 in three patients. No patient had histological evidence of fibrosing cholestatic hepatitis or liver cirrhosis. Liver biopsies were performed within a median time of 252.5 days (105–927 days) prior to beginning TVR therapy. All patients had compensated liver and renal functions (Table 1).\n\n3.2. Treatment Efficacy\nThe mean HCV viral load at baseline was 6.1 log⁡10 IU/mL. Ten of the twelve patients (83%) completed the 12 weeks of TVR/PegIFN/RBV triple therapy, and six patients (50%) completed the intended overall treatment duration of an additional 36 weeks of consecutive PegIFN/RBV dual therapy. An RVR was achieved in 11 patients (92%), and all 10 patients (83%) who regularly finished TVR achieved cRVR. Forty-eight weeks after beginning TVR treatment, 8 out of 12 patients were HCV RNA negative (ETR 67%), including three patients who had prematurely discontinued the consecutive PegIFN/RBV dual therapy after 15, 26, and 26 weeks, respectively. TVR/PegIFN/RBV triple therapy was discontinued in one patient after 4 weeks due to a persisting HCV viral load of 2,700 IU/mL. Three patients had an HCV relapse, which was detected 36 days after the discontinuation of 8 weeks of TVR therapy in one patient and 16 and 29 days after discontinuation of 4 and 26 weeks of PegIFN/RBV dual therapy in two other patients. One patient experienced an HCV relapse 21 days after the regular end of 48 weeks of complete antiviral treatment. An SVR 12 and SVR 52 were then achieved in 7 out of the 12 patients (58%). All 7 patients had maintained the SVR in the two-year follow-up after the end of triple therapy (Figure 1).\n\n3.3. Management of Immunosuppression Levels during TVR Therapy\nEleven patients were switched from TAC to CyA-based immunosuppression within a mean time of 59.3 days (42–98 days) before beginning TVR therapy. One patient already had a primarily CyA-based immunosuppression. One week before beginning TVR therapy, the mean daily dose of CyA was 168.8 mg (100–250 mg), with a mean TBC of 96.9 ng/mL. The mean daily CyA dosage was reduced to 133.3 mg (50–250 mg; 75% of initial daily CyA dosage), 65.5 mg (50–150 mg; 41%), 45.4 mg (10–100 mg; 29%), and 50.3 mg (30–125 mg; 28%) after 1 day, 7 days, 14 days, and 12 weeks, respectively, of TVR treatment. Eight weeks after the end of TVR treatment, the mean daily CyA dosage was increased fourfold, to 152.3 mg (75–200 mg), compared with the ETR CyA dosage (Figure 2).\n\n3.4. Treatment-Related Adverse Events\nOut of the 11 patients who underwent TVR therapy for >4 weeks, 10 patients (91%) suffered from treatment-related adverse effects (AEs), and one patient had to discontinue TVR therapy after 8 weeks due to severe anemia, progressive renal decompensation, and relevant reduction of the patient's general condition. In the following antiviral treatment course, four patients had to discontinue PegIFN/RBV dual therapy because of severe declines in general patient conditions combined with manifest hematological side effects (anemia and leukopenia) in each of the 4 patients and an additional renal decompensation in one patient. Two of the 6 patients who completed the full treatment duration also required an RBV dose reduction to a daily dose of 400 mg or 200 mg, respectively. During the 12 weeks of TVR/PegIFN/RBV therapy, the mean hemoglobin level dropped from 7.4 mmol/L to 5.7 mmol/L, whereas the mean WBC count dropped from 4.8/nL to 3.4/nL, respectively. Five patients (45%) developed anemia with hemoglobin levels below 6.2 mmol/L and required EPO administration during this time period. Four of these patients also received blood transfusions. Granulocyte colony-stimulating factor (GC-SF) was given to 5 patients due to a WBC below 2.5/nL. We did not observe a decrease of GFR under TVR therapy. The median GFR decreased from 72.0 mL/min/1.73 m2 to 58.6 mL/min/1.73 m2 from the beginning to the end of the TVR/PegIFN/RBV triple therapy. In addition, 3 patients (27%) developed infections: urinary tract infections in 2 patients and clostridium difficile diarrhea in 1 patient (9%). Skin changes expressed by a mild rash were observed in 2 patients (18%), and 1 patient (9%) reported a disturbing anorectal pruritus (Table 2).\n\n4. Discussion\nThe introduction of PIs has fundamentally changed the treatment options for patients with primary HCV and HCV recurrence after OLT even in GT1 patients with a prior nonresponse to antiviral therapy and may thus be considered as a first step towards modern HCV therapy [10, 22]. The promising results regarding the antiviral efficacy of this rather revolutionary treatment approach have, however, been overshadowed by an increase in directly treatment-associated AEs, especially in immunocompromised patients, in whom dual therapy has already proven particularly challenging [8, 23–25]. At the time our study began, the two PIs TVR and BOC were approved for antiviral therapy in Europe. The therapy costs were similar, but as previous authors have noted, TVR appeared to be more “streamlined” to us in comparison to BOC [26]. In addition, Benito et al. also reported that triple therapy with TVR exhibits greater early antiviral activity than that with BOC which has been demonstrated to be a principal predictive factor for consecutive SVR [27, 28]. Morisco et al. recently also reported that RVR was the only independent predictive factor of antiviral response in cirrhotic patients treated by triple therapy with TVR. An even shorter therapy may thus be considered [29].\n\nIn our study, we analyzed the antiviral efficacy and safety of TVR/PegIFN/RBV triple therapy in HCV GT1-infected liver transplant recipients, a patient cohort in whom SVR rates after former standard dual therapy were rather low in comparison with genotypes 2 and 3. In our study, we showed that despite the complexity in this setting, TVR-based triple therapy was feasible and efficient also in the long-term outcome. Eight of the 12 patients (67%) achieved an ETR, including 2 patients who had to discontinue consecutive dual therapy prematurely due to treatment-related side effects. One patient had an HCV relapse 21 days after regularly finishing the 48-week complete antiviral treatment course. An SVR 12 and SVR 52 were then obtained in 7 of these patients (56%). Our results are in accordance with Faisal et al., who analyzed TVR-based triple therapy for HCV recurrence after OLT in a multicenter trial and reported an ETR of 75% and an SVR 12 of 61.5% [19]. As an important and novel finding of our study in comparison to other reported results all patients with an SVR 12 also achieved an SVR 52. Severe PI's treatment-related AEs including death have been reported in several studies [19, 24, 30, 31]. In our study, 10 of the 11 patients who underwent TVR therapy >4 weeks suffered from treatment-related AEs. These AEs were clinically severe enough to discontinue TVR therapy in one patient and consecutive dual therapy in 4 additional patients. The treatment discontinuation rate in our study is comparable to the results of Gallegos-Orozco in nontransplanted (high-risk) cirrhotic patients (24%), thereby underlining the particularly difficult conditions for TVR therapy in immunocompromised patients [32]. In our study, hematological side effects were the most common treatment-related AEs. Five patients developed anemia, all of whom required EPO administration and 4 of whom required blood transfusions. Triple therapy is associated with a 20% increase in the incidence of treatment-related anemia compared with the former standard PegIFN/RBV therapy, and, according to a recent interim analysis of patients who underwent TVR therapy after OLT, 77% of all patients require EPO administration under TVR therapy [33–35]. Additionally, 5 patients in our cohort had leukopenia and required G-CSF administration. Both anemia and leukopenia are most likely explained by the bone marrow-suppressive and nonimmune hemolytic anemia effect of RBV, which is aggravated when RBV is given in combination with TVR [24, 36]. In our study, two patients also had to discontinue antiviral therapy due to severe renal decompensation, which may also be explained in the context of RBV therapy [37]. The RBV dosage may be adapted to hemoglobin and GFR levels under PI therapy with no negative effect on later SVR rates [38]. A complete cessation of RBV, however, requires a discontinuation of TVR therapy and therefore needs to be carefully evaluated. In our study, RBV dose reduction was necessary in two of the six patients who completed the full antiviral treatment duration; one of these patients experienced HCV relapse 21 days after the regular end of the 48-week antiviral treatment course. In an attempt to assess hematological and renal tolerance before beginning TVR therapy, all patients in our study underwent a 4-week RBV lead-in phase. It appears to be reasonable to include IFN in this lead-in phase, not only to assess general therapy tolerance but also to possibly identify interferon-insensitive patients who are at risk of developing protease-resistant HCV strains during TVR therapy [39]. Patients at high risk for SAEs or virological nonresponse may thereby be identified before beginning expensive and potentially harmful TVR therapy. Another major issue for TVR therapy in transplanted patients is the complex management of immunosuppression. Dose reductions and adjustments of CNIs are required during the entire TVR treatment course due to severe DDIs. In addition to the risk of CNI toxicity, previous studies have also reported rejection episodes in 4 to 6% of patients during antiviral therapy [40, 41]. Generally, the CyA dosage appears to be less difficult to manage because of the slighter required dose reduction compared with TAC [23]. Additionally, an additional antiviral action of CyA has been described due to the involvement of cyclophilin A in the viral replication of HCV, which is underlined by the results of a meta-analysis showing that during dual therapy more patients achieved SVR with CyA than with TAC [42, 43]. All of our patients were therefore switched to CyA before beginning TVR therapy. Despite deviations in the total CyA body clearance (TBC), especially in the first days of TVR therapy, no patient developed signs of toxicity or rejection. Of course, our study is limited by the small sample size and the lack of randomization. Additionally, our patients were all well selected with regard to their general conditions and a rather less distinct fibrosis progression in comparison with studies that included rather difficult-to-treat patient populations, including patients with cirrhosis or cholestatic hepatitis [24, 44]. However, we may still conclude that TVR therapy in general as well as the concomitant management of immunosuppression may safely be performed in HCV GT1-infected liver graft recipients with promising SVR 52 rates. In the context of the rapid developments in HCV treatment options in the last years, the clinical relevance of first generation PIs has however to be considered as rather negligible nowadays. The recent introduction of novel next-generation antiviral agents such as sofosbuvir, daclatasvir, simeprevir, ombitasvir, paritaprevir, and dasabuvir has led to a fundamental change in the treatment perspectives of modern HCV therapy [45, 46]. Several clinical studies have demonstrated that a combination of these new drug classes now allow interferon-free treatment regimens with a less harmful SAE spectrum, a superior antiviral efficacy, and no significant interference with immunosuppression [47–50]. The EASL guidelines for HCV treatment before and after liver transplantation have therefore recently been adapted [51]. However, the worldwide replacement of PIs by novel DAAs is until today amongst other factors limited by economic burdens. Long-term results of PI therapy efficacy as well as the emergence of resistance thus need to be continuously analyzed in order to allow an optimal and evidence-based HCV treatment also in health care systems with limited access to recent achievements of modern HCV therapy.\n\nCompeting Interests\nThe authors declare that they have no competing interests.\n\nAuthors' Contributions\nFritz Klein collected the data and wrote the paper. Ruth Neuhaus designed and performed the research. Dennis Eurich collected the data. Jörg Hofmann collected the data. Sandra Bayraktar collected the data. Johann Pratschke designed and performed the research. Marcus Bahra designed and performed the research. All authors have made substantial contributions to the study, including conception and design of the study, the acquisition, analysis, and interpretation of data, drafting or critical revision of the paper, and final approval of the submitted paper.\n\nFigure 1 Treatment course and efficacy of 12 weeks of TVR/PegIFN/RBV triple therapy and 36 weeks of consecutive PegIFN/RBV dual therapy.\n\nFigure 2 Course of immunosuppression dosage and levels during TVR/PegIFN/RBV therapy.\n\nTable 1 Patient characteristics at baseline.\n\n \tIncluded patient population for TVR/PegIFN/RBV triple therapy (n = 12)\t\nAge (years), mean ± SD\t51.8 ± 10.5\t\nGender (male)\t7 (58%)\t\nBody mass index (kg/m2), mean ± SD\t26.4 ± 5.3\t\nHCV genotype\t \t\n 1a\t2 (17%)\t\n 1b\t10 (83%)\t\nPrevious PegIFN/RBV therapy after OLT\t \t\n Naive\t5 (42%)\t\n Nonresponder/relapsers\t7 (58%)\t\nTime between OLT and beginning TVR/PegIFN/RBV therapy (months), mean ± SD\t63.7 ± 61.4\t\nFibrosis grade\t \t\n 1 \t4 (33%)\t\n 2 \t5 (42%)\t\n 3\t3 (25%)\t\nHCV viral load (log 10 IU/mL), mean ± SD\t6.1 ± 0.8\t\nBilirubin (μmol/L), mean ± SD\t23.9 ± 13.7\t\nALT (μkat/L), mean ± SD\t0.99 ± 0.84\t\nGlomerular filtration rate (mL/min/1.73 m2), mean ± SD\t72.0 ± 20.4\t\nHemoglobin (mmol/L), mean ± SD\t7.33 ± 1.43\t\nWhite blood cell count (/nL), mean ± SD\t4.8 ± 1.9\t\nPlatelet count (/nL), mean ± SD\t222.3 ± 105.9\t\nTable 2 Treatment-related adverse events during TVR/PegIFN/RBV triple therapy.\n\n \tTVR/PegIFN/RBV triple therapy > 4 weeks (n = 11)∗\n\t\nOverall treatment-related AEs during TVR/PegIFN/RBV\t10 (92%)\t\nDiscontinuation of TVR/PegIFN/RBV due to AEs\t1 (9%)\t\nAnemia with hemoglobin levels below 10 g/dL\t5 (45%)\t\n EPO administration\t5 (45%)\t\n Blood transfusion\t4 (36%)\t\nLeukopenia with a WBC count below 1.5/nL\t5 (45%)\t\n GCF administration\t5 (45%)\t\nRenal failure\t2 (18%)\t\nInfection\t3 (27%)\t\nSkin changes\t2 (18%)\t\nAnorectal pruritus\t1 (9%)\t\nDeath\t0\t\n\n∗TVR/PegIFN/RBV triple therapy was discontinued in 1 patient after 4 weeks due to a nonresponse.\n==== Refs\n1 Berenguer M. Prieto M. Rayón J. M. Natural history of clinically compensated hepatitis C virus-related graft cirrhosis after liver transplantation Hepatology 2000 32 4, part 1 852 858 10.1053/jhep.2000.17924 2-s2.0-0033807694 11003634 \n2 Forman L. M. Lewis J. D. Berlin J. A. Feldman H. I. Lucey M. R. The association between hepatitis C infection and survival after orthotopic liver transplantation Gastroenterology 2002 122 4 889 896 10.1053/gast.2002.32418 2-s2.0-0036207348 11910340 \n3 Gane E. J. The natural history of recurrent hepatitis C and what influences this Liver Transplantation 2008 14 supplement 2 S36 S44 10.1002/lt.21646 2-s2.0-58849128803 18825724 \n4 Charlton M. Seaberg E. Wiesner R. Predictors of patient and graft survival following liver transplantation for hepatitis C Hepatology 1998 28 3 823 830 10.1002/hep.510280333 2-s2.0-0031783001 9731579 \n5 Berenguer M. Schuppan D. Progression of liver fibrosis in post-transplant hepatitis C: mechanisms, assessment and treatment Journal of Hepatology 2013 58 5 1028 1041 10.1016/j.jhep.2012.12.014 2-s2.0-84876296995 23262248 \n6 Crespo G. Carrión J. A. Coto-Llerena M. Combinations of simple baseline variables accurately predict sustained virological response in patients with recurrent hepatitis C after liver transplantation Journal of Gastroenterology 2013 48 6 762 769 10.1007/s00535-012-0680-2 2-s2.0-84879410933 23011083 \n7 Berenguer M. Palau A. Aguilera V. Rayón J.-M. Juan F. S. Prieto M. Clinical benefits of antiviral therapy in patients with recurrent hepatitis C following liver transplantation American Journal of Transplantation 2008 8 3 679 687 10.1111/j.1600-6143.2007.02126.x 2-s2.0-39649100163 18294165 \n8 Berenguer M. Systematic review of the treatment of established recurrent hepatitis C with pegylated interferon in combination with ribavirin Journal of Hepatology 2008 49 2 274 287 10.1016/j.jhep.2008.05.002 2-s2.0-46349089961 18571272 \n9 Xirouchakis E. Triantos C. Manousou P. Pegylated-interferon and ribavirin in liver transplant candidates and recipients with HCV cirrhosis: systematic review and meta-analysis of prospective controlled studies Journal of Viral Hepatitis 2008 15 10 699 709 10.1111/j.1365-2893.2008.01019.x 2-s2.0-52149121573 18673428 \n10 Zeuzem S. Andreone P. Pol S. Telaprevir for retreatment of HCV infection The New England Journal of Medicine 2011 364 25 2417 2428 10.1056/nejmoa1013086 2-s2.0-79959381354 21696308 \n11 Poordad F. McCone J. Jr. Bacon B. R. Boceprevir for untreated chronic HCV genotype 1 infection The New England Journal of Medicine 2011 364 13 1195 1206 10.1056/nejmoa1010494 2-s2.0-79953173221 21449783 \n12 Farnik H. Zimmermann T. Herrmann E. Telaprevir drug monitoring during antiviral therapy of hepatitis C graft infection after liver transplantation Liver International 2015 35 1 176 183 10.1111/liv.12532 2-s2.0-84921029514 24649882 \n13 McHutchison J. G. Manns M. P. Muir A. J. Telaprevir for previously treated chronic HCV infection The New England Journal of Medicine 2010 362 14 1292 1303 10.1056/nejmoa0908014 2-s2.0-77950817619 20375406 \n14 Charlton M. Seaberg E. Impact of immunosuppression and acute rejection on recurrence of hepatitis C: results of the national institute of diabetes and digestive and kidney diseases liver transplantation database Liver Transplantation and Surgery 1999 5 4, supplement 1 S107 S114 10.1002/lt.500050203 2-s2.0-0033028424 10431024 \n15 Garg V. van Heeswijk R. Eun Lee J. Alves K. Nadkarni P. Luo X. Effect of telaprevir on the pharmacokinetics of cyclosporine and tacrolimus Hepatology 2011 54 1 20 27 10.1002/hep.24443 2-s2.0-79959561437 21618566 \n16 Papadopoulos-Köhn A. Achterfeld A. Paul A. Daily low-dose tacrolimus is a safe and effective immunosuppressive regimen during telaprevir-based triple therapy for hepatitis C virus recurrence after liver transplant Transplantation 2015 99 4 841 847 10.1097/TP.0000000000000399 2-s2.0-84929748444 25208324 \n17 Burton J. R. Jr. O'Leary J. G. Verna E. C. A US multicenter study of hepatitis C treatment of liver transplant recipients with protease-inhibitor triple therapy Journal of Hepatology 2014 61 3 508 514 10.1016/j.jhep.2014.04.037 2-s2.0-84906303033 24801415 \n18 Ikegami T. Yoshizumi T. Kato M. Reduced-dose telaprevir-based triple antiviral therapy for recurrent hepatitis C after living donor liver transplantation Transplantation 2014 98 9 994 999 10.1097/TP.0000000000000166 2-s2.0-84925020573 25099704 \n19 Faisal N. Yoshida E. M. Bilodeau M. Protease inhibitor-based triple therapy is highly effective for hepatitis C recurrence after liver transplant: a multicenter experience Annals of Hepatology 2014 13 5 525 532 2-s2.0-84906053376 25152985 \n20 Kwo P. Y. Mantry P. S. Coakley E. An interferon-free antiviral regimen for HCV after liver transplantation The New England Journal of Medicine 2014 371 25 2375 2382 10.1056/nejmoa1408921 2-s2.0-84919360641 25386767 \n21 Desmet V. J. Gerber M. Hoofnagle J. H. Manns M. Scheuer P. J. Classification of chronic hepatitis: diagnosis, grading and staging Hepatology 1994 19 6 1513 1520 10.1016/0270-9139(94)90250-x 2-s2.0-0028235641 8188183 \n22 Bacon B. R. Gordon S. C. Lawitz E. Boceprevir for previously treated chronic HCV genotype 1 infection The New England Journal of Medicine 2011 364 13 1207 1217 10.1056/nejmoa1009482 2-s2.0-79953176289 21449784 \n23 Werner C. R. Egetemeyr D. P. Lauer U. M. Telaprevir-based triple therapy in liver transplant patients with hepatitis C virus: a 12-week pilot study providing safety and efficacy data Liver Transplantation 2012 18 12 1464 1470 10.1002/lt.23542 2-s2.0-84870862182 22941516 \n24 Coilly A. Roche B. Dumortier J. Safety and efficacy of protease inhibitors to treat hepatitis C after liver transplantation: a multicenter experience Journal of Hepatology 2014 60 1 78 86 10.1016/j.jhep.2013.08.018 2-s2.0-84890558343 23994384 \n25 Barritt A. S. IV Fried M. W. Maximizing opportunities and avoiding mistakes in triple therapy for hepatitis C virus Gastroenterology 2012 142 6 1314 1323.e1 10.1053/j.gastro.2012.02.013 2-s2.0-84860315408 22537438 \n26 Shiffman M. L. Esteban R. Triple therapy for HCV genotype 1 infection: telaprevir or boceprevir? Liver International 2012 32 1 54 60 10.1111/j.1478-3231.2011.02718.x 2-s2.0-84855219215 22212573 \n27 Benito J. M. Sánchez-Parra C. Maida I. Triple combination therapy for hepatitis C with telaprevir exhibits greater early antiviral activity than with boceprevir Antiviral Therapy 2013 18 5 709 715 10.3851/IMP2614 2-s2.0-84883468671 23645335 \n28 Roche B. Sebagh M. Canfora M. L. Hepatitis C virus therapy in liver transplant recipients: response predictors, effect on fibrosis progression, and importance of the initial stage of fibrosis Liver Transplantation 2008 14 12 1766 1777 10.1002/lt.21635 2-s2.0-58249086156 19025933 \n29 Morisco F. Masarone M. Rosato V. Impact of telaprevir in HCV patients with cirrhosis and RVR: real-life data from Boceprevir or Telaprevir based “triple therapy” experience in southern Italy Reviews on Recent Clinical Trials In press \n30 Werner C. R. Egetemeyr D. P. Nadalin S. Treatment of recurrent genotype 1 hepatitis C post-liver transplantation: single center experience with telaprevir-based triple therapy Zeitschrift für Gastroenterologie 2014 52 1 27 34 10.1055/s-0033-1356345 2-s2.0-84892602582 24420796 \n31 Verna E. C. Saxena V. Burton J. R. Telaprevir- and boceprevir-based triple therapy for hepatitis C in liver transplant recipients with advanced recurrent disease: a multicenter study Transplantation 2015 99 8 1644 1651 10.1097/tp.0000000000000629 2-s2.0-84942474802 25715116 \n32 Gallegos-Orozco J. Chervenak A. Carey E. Aqel B. Byrne T. Hartel L. Liver transplant center focused experience with peginterferon α -2a, ribavirin and telaprevir therapy in patients with genotype 1 hepatitis C cirrhosis Hepatology 2012 2012 p. 218A \n33 Pungpapong S. Aqel B. A. Koning L. Multicenter experience using telaprevir or boceprevir with peginterferon and ribavirin to treat hepatitis C genotype 1 after liver transplantation Liver Transplantation 2013 19 7 690 700 10.1002/lt.23669 2-s2.0-84879551010 23696372 \n34 Sherman K. E. Flamm S. L. Afdhal N. H. Response-guided telaprevir combination treatment for hepatitis C virus infection New England Journal of Medicine 2011 365 11 1014 1024 10.1056/NEJMoa1014463 2-s2.0-80052826527 21916639 \n35 Jacobson I. M. McHutchison J. G. Dusheiko G. Telaprevir for previously untreated chronic hepatitis C virus infection The New England Journal of Medicine 2011 364 25 2405 2416 10.1056/nejmoa1012912 2-s2.0-79959438789 21696307 \n36 Druyts E. Thorlund K. Wu P. Efficacy and safety of pegylated interferon Alfa-2a or Alfa-2b plus ribavirin for the treatment of chronic hepatitis C in children and adolescents: a systematic review and meta-analysis Clinical Infectious Diseases 2013 56 7 961 967 10.1093/cid/cis1031 2-s2.0-84875043423 23243171 \n37 Zimner-Rapuch S. Janus N. Deray G. Launay-Vacher V. New therapies for hepatitis C: considerations in patients with renal impairment Drugs 2014 74 12 1307 1313 10.1007/s40265-014-0268-7 2-s2.0-84929665131 25060981 \n38 Poordad F. Lawitz E. Reddy K. R. Effects of ribavirin dose reduction vs erythropoietin for boceprevir-related anemia in patients with chronic hepatitis C virus genotype 1 infection—a randomized trial Gastroenterology 2013 145 5 1035 1044.e5 10.1053/j.gastro.2013.07.051 2-s2.0-84886803976 23924660 \n39 Susser S. Vermehren J. Forestier N. Analysis of long-term persistence of resistance mutations within the hepatitis C virus NS3 protease after treatment with telaprevir or boceprevir Journal of Clinical Virology 2011 52 4 321 327 10.1016/j.jcv.2011.08.015 2-s2.0-82755182674 21924672 \n40 Chalasani N. Manzarbeitia C. Ferenci P. Peginterferon alfa-2a for hepatitis C after liver transplantation: two randomized, controlled trials Hepatology 2005 41 2 289 298 10.1002/hep.20560 2-s2.0-19944430229 15660392 \n41 Samuel D. Bizollon T. Feray C. Interferon-α 2b plus ribavirin in patients with chronic hepatitis C after liver transplantation: a randomized study Gastroenterology 2003 124 3 642 650 10.1053/gast.2003.50095 2-s2.0-0037371521 12612903 \n42 Chatterji U. Bobardt M. Selvarajah S. The isomerase active site of cyclophilin A is critical for hepatitis C virus replication The Journal of Biological Chemistry 2009 284 25 16998 17005 10.1074/jbc.M109.007625 2-s2.0-67650550814 19380579 \n43 Cescon M. Grazi G. L. Cucchetti A. Predictors of sustained virological response after antiviral treatment for hepatitis C recurrence following liver transplantation Liver Transplantation 2009 15 7 782 789 10.1002/lt.21760 2-s2.0-68349146136 19562715 \n44 Hézode C. Fontaine H. Dorival C. Triple therapy in treatment-experienced patients with HCV-cirrhosis in a multicentre cohort of the French Early Access Programme (ANRS CO20-CUPIC)-NCT01514890 Journal of Hepatology 2013 59 3 434 441 10.1016/j.jhep.2013.04.035 2-s2.0-84882908504 23669289 \n45 Kwo P. Y. Badshah M. B. New hepatitis C virus therapies: drug classes and metabolism, drug interactions relevant in the transplant settings, drug options in decompensated cirrhosis, and drug options in end-stage renal disease Current Opinion in Organ Transplantation 2015 20 3 235 241 10.1097/mot.0000000000000198 25944238 \n46 Yau A. H. L. Yoshida E. M. Hepatitis C drugs: the end of the pegylated interferon era and the emergence of all-oral, interferon-free antiviral regimens: a concise review Canadian Journal of Gastroenterology and Hepatology 2014 28 8 445 451 2-s2.0-84907437241 25229466 \n47 Fontana R. J. Hughes E. A. Bifano M. Sofosbuvir and daclatasvir combination therapy in a liver transplant recipient with severe recurrent cholestatic hepatitis C American Journal of Transplantation 2013 13 6 1601 1605 10.1111/ajt.12209 2-s2.0-84878475234 23593993 \n48 Charlton M. Gane E. Manns M. P. Sofosbuvir and ribavirin for treatment of compensated recurrent hepatitis C virus infection after liver transplantation Gastroenterology 2015 148 1 108 117 10.1053/j.gastro.2014.10.001 2-s2.0-84922879130 25304641 \n49 Sulkowski M. S. Gardiner D. F. Rodriguez-Torres M. Daclatasvir plus sofosbuvir for previously treated or untreated chronic HCV infection The New England Journal of Medicine 2014 370 3 211 221 10.1056/nejmoa1306218 2-s2.0-84892619580 24428467 \n50 Curry M. P. Forns X. Chung R. T. Sofosbuvir and ribavirin prevent recurrence of hcv infection after liver transplantation: an open-label study Gastroenterology 2015 148 1 100 107.e1 10.1053/j.gastro.2014.09.023 2-s2.0-84922879093 25261839 \n51 European Association for Study of Liver EASL clinical practice guidelines: management of hepatitis C virus infection Journal of Hepatology 2014 60 2 392 420 10.1016/j.jhep.2013.11.003 24331294\n\n", "fulltext_license": "CC BY", "issn_linking": "2090-1364", "issue": "2016()", "journal": "Hepatitis research and treatment", "keywords": null, "medline_ta": "Hepat Res Treat", "mesh_terms": null, "nlm_unique_id": "101542600", "other_id": null, "pages": "8325467", "pmc": null, "pmid": "27195149", "pubdate": "2016", "publication_types": "D016428:Journal Article", "references": "25304641;11910340;12612903;24649882;23645335;18673428;25229466;24428467;25208324;23669289;23696372;19562715;25715116;22537438;10431024;19380579;23924660;23593993;25944238;25386767;24420796;21916639;24331294;24801415;21449784;15660392;18571272;23243171;18825724;23994384;21924672;25060981;21449783;21696308;21696307;11003634;23262248;26672601;9731579;25152985;8188183;19025933;20375406;22212573;21618566;25261839;25099704;22941516;18294165;23011083", "title": "Two-Year Follow-Up Analysis of Telaprevir-Based Antiviral Triple Therapy for HCV Recurrence in Genotype 1 Infected Liver Graft Recipients as a First Step towards Modern HCV Therapy.", "title_normalized": "two year follow up analysis of telaprevir based antiviral triple therapy for hcv recurrence in genotype 1 infected liver graft recipients as a first step towards modern hcv therapy" }
[ { "companynumb": "DE-ROCHE-1770274", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "RIBAVIRIN" }, "drugadditional": "3", "drugad...
{ "abstract": "Sibutramine is a weight loss agent that was withdrawn from the market in the USA and European Union because it increases adverse events in patients with cardiovascular diseases. However, non-prescription weight loss pills containing sibutramine can be still easily purchased over the Internet.\n\n\n\nA 21-year-old woman without history of cardiovascular diseases developed cardiac arrest. She was a user of a weight loss pills, containing sibutramine and hypokalemia-inducing agents, imported from Thailand over the Internet.\n\n\n\nShe was successfully resuscitated without any neurological deficits by using extracorporeal membrane oxygenation for refractory ventricular fibrillation.\n\n\n\nThis case indicates that sibutramine can cause cardiac arrest even in subjects without pre-existing cardiovascular disease when combined with agents that promote QT prolongation.", "affiliations": "Department of Emergency Medicine Sapporo Medical University Hokkaido Japan.;Department of Emergency Medicine Sapporo Medical University Hokkaido Japan.;Department of Emergency Medicine Sapporo Medical University Hokkaido Japan.;Department of Emergency Medicine Sapporo Medical University Hokkaido Japan.;Department of Emergency Medicine Sapporo Medical University Hokkaido Japan.;Department of Cardiovascular, Renal and Metabolic Medicine Sapporo Medical University Hokkaido Japan.;Department of Cardiovascular, Renal and Metabolic Medicine Sapporo Medical University Hokkaido Japan.;Department of Cardiovascular, Renal and Metabolic Medicine Sapporo Medical University Hokkaido Japan.;Department of Cardiovascular, Renal and Metabolic Medicine Sapporo Medical University Hokkaido Japan.;Department of Emergency Medicine Sapporo Medical University Hokkaido Japan.", "authors": "Bunya|Naofumi|N|0000-0003-3605-402X;Sawamoto|Keigo|K|;Uemura|Shuji|S|;Kyan|Ryoko|R|;Inoue|Hiroyuki|H|;Nishida|Junichi|J|;Kouzu|Hidemichi|H|;Kokubu|Nobuaki|N|;Miura|Tetsuji|T|;Narimatsu|Eichi|E|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1002/ams2.275", "fulltext": "\n==== Front\nAcute Med SurgAcute Med Surg10.1002/(ISSN)2052-8817AMS2Acute Medicine & Surgery2052-8817John Wiley and Sons Inc. Hoboken 10.1002/ams2.275AMS2275Case ReportCase ReportsCardiac arrest caused by sibutramine obtained over the Internet: a case of a young woman without pre‐existing cardiovascular disease successfully resuscitated using extracorporeal membrane oxygenation N. Bunya et al.Bunya Naofumi http://orcid.org/0000-0003-3605-402Xnaobun1221@gmail.com \n1\nSawamoto Keigo \n1\nUemura Shuji \n1\nKyan Ryoko \n1\nInoue Hiroyuki \n1\nNishida Junichi \n2\nKouzu Hidemichi \n2\nKokubu Nobuaki \n2\nMiura Tetsuji \n2\nNarimatsu Eichi \n1\n\n1 \nDepartment of Emergency Medicine\nSapporo Medical University\nHokkaido\nJapan\n\n2 \nDepartment of Cardiovascular, Renal and Metabolic Medicine\nSapporo Medical University\nHokkaido\nJapan\n* Corresponding: Naofumi Bunya, MD, Department Emergency Medicine, Sapporo Medical University, S1W16 Chuo‐ku Sapporo, Hokkaido, 060‐8543, Japan. E‐mail: naobun1221@gmail.com29 3 2017 7 2017 4 3 10.1002/ams2.2017.4.issue-3334 337 08 8 2016 30 1 2017 © 2017 The Authors. Acute Medicine & Surgery published by John Wiley & Sons Australia, Ltd on behalf of Japanese Association for Acute Medicine.This is an open access article under the terms of the Creative Commons Attribution‐NonCommercial‐NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non‐commercial and no modifications or adaptations are made.Case\nSibutramine is a weight loss agent that was withdrawn from the market in the USA and European Union because it increases adverse events in patients with cardiovascular diseases. However, non‐prescription weight loss pills containing sibutramine can be still easily purchased over the Internet.\n\nA 21‐year‐old woman without history of cardiovascular diseases developed cardiac arrest. She was a user of a weight loss pills, containing sibutramine and hypokalemia‐inducing agents, imported from Thailand over the Internet.\n\nOutcome\nShe was successfully resuscitated without any neurological deficits by using extracorporeal membrane oxygenation for refractory ventricular fibrillation.\n\nConclusion\nThis case indicates that sibutramine can cause cardiac arrest even in subjects without pre‐existing cardiovascular disease when combined with agents that promote QT prolongation.\n\ncardiac arrestextracorporeal membrane oxygenationhypokalemiaQT prolongationsibutramine source-schema-version-number2.0component-idams2275cover-dateJuly 2017details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_NLMPMC version:5.2.1 mode:remove_FC converted:07.11.2017\nFunding Information\n\n\nNo funding information provided.\n==== Body\nIntroduction\nIn recent years, the use of spurious/falsely labelled/falsified/counterfeit medicines sold over the Internet has increased rapidly, raising concerns over the harmful effects they may have.1 There are similar concerns regarding weight loss pills that are available to the general population over the Internet.2 The pills can be obtained easily without a prescription anonymously by use of a credit card or online money transfer.\n\nSibutramine, a serotonin and norepinephrine re‐uptake inhibitor, was used in the 1990s to treat obesity, but was frequently associated with increased cardiovascular events. The Sibutramine Cardiovascular and Diabetes Outcome Study (SCOUT) showed that treatment with sibtramine for 5 years in subjects with pre‐existing cardiovascular diseases significantly increased non‐fatal myocardial infarction and non‐fatal stroke, although the number of cardiovascular deaths or all‐cause mortality was not increased.3 Because the benefits of sibutramine do not outweigh the risk of the cardiovascular events, it has been withdrawn by the USA and European Union. Sibutramine was never approved in Japan. Here we report a female patient who developed a cardiac arrest, despite no pre‐existing cardiac disease, by sibutramine‐containing weight loss pills imported using the Internet.\n\nCase\nA 21‐YEAR‐OLD NON‐OBESE woman was found unresponsive on the sidewalk and by‐stander cardiopulmonary resuscitation (CPR) was initiated. On arrival of the emergency medical service, the patient's initial cardiac rhythm was ventricular fibrillation (VF). On the way to our hospital, return of spontaneous circulation was not achieved, although defibrillation was attempted twice concomitantly with conventional CPR. She had no past medical history or family history of any cardiac disorders.\n\nOn admission, she was still in VF arrest with agonal breathing. Due to a lack of response to four defibrillation attempts and administration of 3 mg epinephrine in total, the decision was made to resuscitate using extracorporeal membrane oxygenation (ECMO) for bringing forth certain circulation. Sixteen minutes after admission to our resuscitation bay (i.e., 36 min after the initial call for emergency medical service), ECMO was commenced. Her initial serum potassium measured during CPR was 3.8 mEq/L despite approximately 30 min of cardiac arrest (Table 1). Thirty minutes after starting ECMO, return of spontaneous circulation was achieved. After an intra‐aortic balloon pump was placed, coronary angiography was carried out, indicating that the coronary arteries were normal. Chest computed tomography scan with contrast enhancement showed no abnormalities that could have led to the cardiac arrest. The patient was admitted to the intensive care unit (ICU), and therapeutic hypothermia was initiated in an attempt to bring her body temperature to 34°C. At the time of admission to the ICU, the patient's serum potassium level was 2.3 mEq/L and the QTc interval was 538 ms (Fig. 1, Table 2).\n\nTable 1 Blood gas analysis at admission\n\npH\t6.951\t\npCO2\n\t57.3 mmHg\t\npO2\n\t75.4 mmHg\t\n\nHCO3−\n\t12 mmol/L\t\nLactate\t118 mg/dL\t\nNa+\n\t139 mmol/L\t\nK+\n\t3.8 mmol/L\t\nCl−\n\t108 mmol/L\t\nCa2+\n\t1.25 mmol/L\t\nJohn Wiley & Sons, LtdFigure 1 Electrocardiogram of a 21‐year‐old woman on admission to the intensive care unit following cardiac arrest caused by sibutramine. The electrocardiogram shows the QTc interval prolongation.\n\nTable 2 Electrocardiogram findings in a 21‐year‐old woman following cardiac arrest caused by sibutramine\n\n\tHR, b.p.m.\tQT interval, ms\tQTc interval, ms\tQRS complex, ms\t\nDay 1\t134\t360\t538\t80\t\nDay 2\t111\t400\t544\t80\t\nDay 3\t133\t360\t536\t80\t\nDay 4\t139\t280\t426\t80\t\nDay 6\t120\t320\t453\t60\t\nDay 7\t118\t320\t449\t60\t\nDay 8\t124\t280\t403\t60\t\nDay 9\t117\t280\t391\t60\t\nDay 11\t111\t280\t381\t60\t\nHR, heart rate.\n\nJohn Wiley & Sons, LtdOne day after the admission, her family brought to the hospital “weight loss pills” the patient had purchased from Thailand over the Internet. These pills contained sibutramine, hydrochlorothiazide, bisacodyl, chlorpheniramine, and a thyroid hormone (information regarding the contents was obtained from the Ministry of Health, Labor and Welfare of Japan's homepage regarding the health hazard due to unauthorized agents, http://www.mhlw.go.jp/kinkyu/diet/jirei/030902-1.html).\n\nTherapeutic hypothermia was continued for 5 days. The patient's hemodynamic status gradually improved, the intra‐aortic balloon pump and ECMO were removed on day 6 and day 7, respectively, and she was extubated on day 8. Her QTc interval gradually shortened and normalized by day 9 (391 ms; Table 2).\n\nAs a possible cause of the cardiac arrest, cardiomyopathies, coronary vasospasm, Brugada syndrome, arrhythmogenic right ventricular cardiomyopathy, and congenital long QT syndrome were investigated, but these diseases were excluded based on the clinical data. Her hypokalemia did not reappear after the serum potassium level was corrected during her stay in the ICU. An automated implantable cardioverter defibrillator was implanted on day 42, and she was discharged on day 51 with no neurological deficits. Before her discharge, the patient admitted that she took weight loss pills from Thailand only one day's dose at a time.\n\nDiscussion\nTo our knowledge, the present report is the first case of cardiac arrest by non‐prescribed sibutramine in a subject without cardiovascular disease. There are two previously published reports of sibutramine‐induced cardiac arrest, but in both cases, sibutramine was prescribed for 1–4 months to treat obesity before the cardiac arrest.4, 5 In the reported cases4, 5 and also the present patient, the QT interval was significantly prolonged at admission and was normalized after discontinuation of sibutramine. The significant impact of this agent on ventricular repolarization, that is, significant increase in QT dispersion, was shown in 65 consecutive patients.6 Increased QT dispersion was shown in several forms of heart disease and also is associated with increased risk of ventricular tachyarrhythmias.7, 8, 9 Kim et al.10 reported that sibutramine preferentially inhibits the hERG potassium channel through the residues Y652 and F656 and this hERG potassium channel is an important contributor to drug‐induced QT interval prolongation and cardiac arrhythmias.11 This mechanism may cause prolongation of the QT interval. Unfortunately, the effect of sibutramine on the QT interval was not evaluated in the SCOUT study.3 Nevertheless, the findings in the cases of cardiac arrest associated with sibutramine suggest that this agent should be avoided in patients already taking medications that potentially prolong the QT interval.\n\nIn the present case, the diet pills consisted of not only sibutramine but also a laxative (bisacodyl) and a diuretic (hydrochlorothiazide). How long and how regularly the patient had taken the pill before the cardiac arrest could not be confirmed, although she claimed that she had taken only one day's dose. We postulate that hypokalemia by hydrochlorothiazide and bisacodyl promoted QT prolongation by sibutramine and the near‐fatal arrhythmia.\n\nThere was no witness of the onset of the cardiac arrest in the present case. As the patient was suffering from VF with agonal breathing12 by the time the patient was admitted to our resuscitation bay, she was likely found shortly after collapse. However, VF was refractory to conventional treatment; we used ECMO as a recent study showed its clinical benefits.13, 14 By a multidisciplinary approach including ECMO, we could discharge the present patient with no neurological abnormalities.\n\nConclusion\nEven banned high‐risk agents are readily accessible to the general population over the Internet, and emergency physicians need to be aware of the potential toxicities of weight loss agents. Sibutramine is one such agent and potentially causes cardiac arrest even in subjects without pre‐existing cardiovascular disease, particularly when combined with drugs that lead to QT prolongation.\n\nConsent\nWritten consent for the publication of this case report and any accompanying images was obtained from the patient.\n\nConflict of interest\nNone Declared.\n==== Refs\nReferences\n1 \nWorld Health Organization (WHO) \n. Medicines: spurious/falsely‐labelled/falsified/counterfeit (SFFC) medicines . [Fact sheet No 275]. May 2012; http://www.who.int/mediacentre/factsheets/fs275/en/. [cited 1 December 2015].\n2 \n\nNazeri \nA \n, \nMassumi \nA \n, \nWilson \nJM \n\net al\nArrhythmogenicity of weight‐loss supplements marketed on the Internet . Heart Rhythm \n2009 ; 6 : 658 –62 .19328040 \n3 \n\nJames \nWP \n, \nCaterson \nID \n, \nCoutinho \nW \n\net al\nEffect of sibutramine on cardiovascular outcomes in overweight and obese subjects . N. Engl. J. Med. \n2010 ; 363 : 905 –17 .20818901 \n4 \n\nErnest \nD \n, \nGershenzon \nA \n, \nCorallo \nCE \n\net al\nSibutramine‐associated QT interval prolongation and cardiac arrest . Ann. Pharmacother. \n2008 ; 42 : 1514 –7 .18728104 \n5 \n\nHarrison‐Woolrych \nM \n, \nClark \nDW \n, \nHill \nGR \n\net al\nQT interval prolongation associated with sibutramine treatment . Br. J. Clin. Pharmacol. \n2006 ; 61 : 464 –9 .16542208 \n6 \n\nYalcin \nAA \n, \nYavuz \nB \n, \nErtugrul \nDT \n\net al\nElevation of QT dispersion after obesity drug sibutramine . J. Cardiovasc. Med. (Hagerstown) \n2010 ; 11 : 832 –5 .20671571 \n7 \n\nTrusz‐Gluza \nM \n, \nWozniak‐Skowerska \nI \n, \nGiec \nL \n\net al\nDispersion of the QT interval as a predictor of cardiac death in patients with coronary heart disease . Pacing Clin. Electrophysiol. \n1996 ; 19 : 1900 –4 .8945065 \n8 \n\nMiorelli \nM \n, \nBuja \nG \n, \nMelacini \nP \n\net al\nQT‐interval variability in hypertrophic cardiomyopathy patients with cardiac arrest . Int. J. Cardiol. \n1994 ; 45 : 121 –7 .7960250 \n9 \n\nGrimm \nW \n, \nSteder \nU \n, \nMenz \nV \n\net al\nClinical significance of increased OT dispersion in the 12‐lead standard ECG for arrhythmia risk prediction in dilated cardiomyopathy . Pacing Clin. Electrophysiol. \n1996 ; 19 : 1886 –9 .8945062 \n10 \n\nKim \nKS \n, \nKim \nEJ \n, \nLee \nHA \n\net al\nEffect of sibutramine HCl on cardiac hERGK+ channel . Mol. Cell. Biochem. \n2009 ; 320 : 125 –31 .18781376 \n11 \n\nSanguinetti \nMC \n, \nJiang \nC \n, \nCurran \nME \n\net al\nA mechanistic link between an inherited and an acquired cardiac arrhythmia: HERG encodes the LKr potassium channel . Cell \n1995 ; 81 : 299 –307 .7736582 \n12 \n\nRea \nTD \n. Agonal respirations during cardiac arrest . Curr. Opin. Crit. Care \n2005 ; 11 : 188 –91 .15928464 \n13 \n\nSakamoto \nT \n, \nMorimura \nN \n, \nNagao \nK \n\net al\nExtracorporeal cardiopulmonary resuscitation versus conventional cardiopulmonary resuscitation in adults with out‐of‐hospital cardiac arrest: a prospective observational study . Resuscitation \n2014 ; 85 : 762 –8 .24530251 \n14 \n\nStub \nD \n, \nBernard \nS \n, \nPellegrino \nV \n\net al\nRefractory cardiac arrest treated with mechanical CPR, hypothermia, ECMO and early reperfusion (the CHEER trial) . Resuscitation \n2015 ; 86 : 88 –94 .25281189\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2052-8817", "issue": "4(3)", "journal": "Acute medicine & surgery", "keywords": "QT prolongation; cardiac arrest; extracorporeal membrane oxygenation; hypokalemia; sibutramine", "medline_ta": "Acute Med Surg", "mesh_terms": null, "nlm_unique_id": "101635464", "other_id": null, "pages": "334-337", "pmc": null, "pmid": "29123885", "pubdate": "2017-07", "publication_types": "D002363:Case Reports", "references": "24530251;8945065;18728104;15928464;20818901;7736582;25281189;20671571;16542208;19328040;8945062;18781376;7960250", "title": "Cardiac arrest caused by sibutramine obtained over the Internet: a case of a young woman without pre-existing cardiovascular disease successfully resuscitated using extracorporeal membrane oxygenation.", "title_normalized": "cardiac arrest caused by sibutramine obtained over the internet a case of a young woman without pre existing cardiovascular disease successfully resuscitated using extracorporeal membrane oxygenation" }
[ { "companynumb": "JP-INTERNATIONAL MEDICATION SYSTEMS, LIMITED-2025122", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "EPINEPHRINE" }, "...
{ "abstract": "Intraocular injury by epinephrine auto-injector has been rarely reported. Toxic risk to the intraocular structures is suspected, but the evidence is inconclusive. We present the case of a 2-year-old girl who sustained an injury to her right eye by inadvertent epinephrine injection. Cataract surgery was performed to treat an increasingly opaque lens, and an intraocular lens was implanted. The visual outcome was good, with no retinal damage.", "affiliations": "Department of Ophthalmology, Boston Children's Hospital, Harvard Medical School, Boston, Massachusetts; Department of Ophthalmology, Boston Medical Center, Boston University School of Medicine, Boston, Massachusetts.;Department of Ophthalmology, Boston Children's Hospital, Harvard Medical School, Boston, Massachusetts; Department of Ophthalmology, Kasr Al-Ainy Hospitals, Cairo University, Cairo, Egypt. Electronic address: Abdelrahman.Elhusseiny@childrens.harvard.edu.;Department of Ophthalmology, Boston Children's Hospital, Harvard Medical School, Boston, Massachusetts.;Department of Ophthalmology, Boston Children's Hospital, Harvard Medical School, Boston, Massachusetts.;Department of Ophthalmology, Boston Children's Hospital, Harvard Medical School, Boston, Massachusetts.", "authors": "Collett|Geoffrey|G|;Elhusseiny|Abdelrahman M|AM|;Scelfo|Christina|C|;Whitman|Mary C|MC|;VanderVeen|Deborah K|DK|", "chemical_list": "D004837:Epinephrine", "country": "United States", "delete": false, "doi": "10.1016/j.jaapos.2020.02.008", "fulltext": null, "fulltext_license": null, "issn_linking": "1091-8531", "issue": "24(3)", "journal": "Journal of AAPOS : the official publication of the American Association for Pediatric Ophthalmology and Strabismus", "keywords": null, "medline_ta": "J AAPOS", "mesh_terms": "D002387:Cataract Extraction; D002675:Child, Preschool; D004837:Epinephrine; D005131:Eye Injuries; D005260:Female; D006801:Humans; D007908:Lens, Crystalline; D007910:Lenses, Intraocular", "nlm_unique_id": "9710011", "other_id": null, "pages": "179-181", "pmc": null, "pmid": "32502635", "pubdate": "2020-06", "publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Ocular injury via epinephrine auto-injector.", "title_normalized": "ocular injury via epinephrine auto injector" }
[ { "companynumb": "US-KALEO, INC.-2020KL000076", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "EPINEPHRINE" }, "drugadditional": null, ...
{ "abstract": "Neonatal abstinence syndrome (NAS) secondary to maternal drug use is a well-recognized clinical entity. We present a novel case of moderately severe NAS in a term infant whose mother was self-medicating with kratom tea. The baby required oral morphine for NAS. After 12 days in neonatal intensive care unit, she was discharged on oral morphine which was discontinued after 2 months. Kratom, a psychoactive herb with opioid activity, has traditionally been used as a stimulant to boost energy, cure cough, depression, pain, sickness and a substitute for opium. Although well known in South East Asia and Africa, this drug is less familiar to physicians in North America. It is undetectable by standard urine drug screening and is being sold as a legal herbal remedy. This is the first report of a newborn developing significant NAS after maternal use of kratom tea. We believe physicians should be aware of this 'new' risk to newborns.", "affiliations": "Department of Pediatrics, Rockyview General Hospital Calgary, Cumming School of Medicine, University of Calgary, Calgary, Alberta.;Department of Pediatrics, Rockyview General Hospital Calgary, Cumming School of Medicine, University of Calgary, Calgary, Alberta.", "authors": "Murthy|Prashanth|P|;Clark|Deborah|D|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1093/pch/pxy084", "fulltext": null, "fulltext_license": null, "issn_linking": "1205-7088", "issue": "24(1)", "journal": "Paediatrics & child health", "keywords": "Kratom tea; Neonatal abstinence syndrome; Newborn", "medline_ta": "Paediatr Child Health", "mesh_terms": null, "nlm_unique_id": "9815960", "other_id": null, "pages": "12-14", "pmc": null, "pmid": "30792593", "pubdate": "2019-02", "publication_types": "D002363:Case Reports", "references": "1163358;18259963;20411370;21513619;23024321;23206666;23212430;24698080;24841968;25453780;25516573;25995615", "title": "An unusual cause for neonatal abstinence syndrome.", "title_normalized": "an unusual cause for neonatal abstinence syndrome" }
[ { "companynumb": "CA-BAYER-2019-054297", "fulfillexpeditecriteria": "1", "occurcountry": "CA", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "LORATADINE" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nStevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are severe lifethreatening skin conditions. The most common cause of these manifestations is medications. Beside discontinued of the culprit drug, systemic corticosteroids were used as a primary treatment option among pediatric population. This study aimed to explore causative drugs (drug group/ latent period), treaments, complications, and treatment outcome (morbidity, mortality, length of hospital stay) of SJS and TEN in children.\n\n\nMETHODS\nA retrospective chart was reviewed during the period of 1992 to 2012 at Srinagarind Hospital, Faculty of Medicine, Khon Kaen University, Thailand. SJS and TEN were clinically diagnosed and confirmed by pediatric dermatologists. Other possible causes other than druginduced SJS and TEN were excluded.\n\n\nRESULTS\nA total of 30 patients was recorded, including 24 (80%) SJS patients and 6 (20%) TEN patients. The mean age was 6.9 years (SD 4.4). Male to female ratio was 1.5:1. Antiepileptic drug group was the most common causative drug (n=18, 60%), followed by antibiotic drug group (n=8, 26.6%), and others (n=4, 13.3%) which included nonsteroidal antiinflammtory drugs (NSAIDs) and chemotherapy drugs. Systemic corticosteroids were used in 29 patients (96.6%). Intravenous immunoglobulin was used in one TEN patient (3.3%). There was a medium correlation between time to treatment (systemic corticosteroids) and the length of hospital stay (Spearman correlation coefficient=0.63, P=0.005). Two TEN patients (6.6%) died.\n\n\nCONCLUSIONS\nCarbamazepine was the most common causative drug of SJS and TEN in our study. The severity of skin detachment is not correlated to severity of ocular findings. However, the persistent of ocular complications up to one year is suggested for promptly appropriate ocular treatment in all SJS and TEN patients. Our data suggested that early administration of systemic corticosteroid may reduce the length of hospital stay and should be considered for the treatment of pediatric druginduced SJS and TEN.", "affiliations": "Pediatric Department, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand. drleelawadee@gmail.com.;Pediatric Department, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand.;Pediatric Department, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand.;Pediatric Department, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand.", "authors": "Techasatian|Leelawadee|L|;Panombualert|Sunee|S|;Uppala|Rattapon|R|;Jetsrisuparb|Charoon|C|", "chemical_list": "D000305:Adrenal Cortex Hormones", "country": "Switzerland", "delete": false, "doi": "10.1007/s12519-016-0057-3", "fulltext": null, "fulltext_license": null, "issn_linking": null, "issue": "13(3)", "journal": "World journal of pediatrics : WJP", "keywords": "Stevens-Johnson syndrome; dermatology; drug-induced diseases; toxic epidermal necrolysis", "medline_ta": "World J Pediatr", "mesh_terms": "D000305:Adrenal Cortex Hormones; D002648:Child; D064420:Drug-Related Side Effects and Adverse Reactions; D005260:Female; D017052:Hospital Mortality; D006801:Humans; D007902:Length of Stay; D008297:Male; D012189:Retrospective Studies; D013262:Stevens-Johnson Syndrome; D062606:Tertiary Care Centers; D013785:Thailand; D016896:Treatment Outcome", "nlm_unique_id": "101278599", "other_id": null, "pages": "255-260", "pmc": null, "pmid": "27650525", "pubdate": "2017-06", "publication_types": "D016428:Journal Article", "references": "17313402;18603022;19811851;23691693;22043758;20618508;25070588;1753508;25087214;23777679;21428768;23895569;23816996;23866878;25262319;21198948;21467603;10951229;20345939;24031112;23874553;24819642;18855540;23873883", "title": "Drug-induced Stevens-Johnson syndrome and toxic epidermal necrolysis in children: 20 years study in a tertiary care hospital.", "title_normalized": "drug induced stevens johnson syndrome and toxic epidermal necrolysis in children 20 years study in a tertiary care hospital" }
[ { "companynumb": "TH-BAYER-2017-141189", "fulfillexpeditecriteria": "1", "occurcountry": "TH", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "ASPIRIN" }, "drugadditional": null, "dr...
{ "abstract": "We present a patient with topiramate-induced psychosis who developed alternative psychosis following temporal lobectomy. The number of surgical candidates for temporal lobectomy is increasing as is the frequency of psychiatric co-morbidities. Preoperative planning should take account of these psychiatric co-morbidities. In particular, precautions should be taken when antiepileptic drug-induced psychosis occurs, as this could predict the occurrence of alternative psychosis following lobectomy.", "affiliations": "Department of Psychological Medicine, University Malaya Medical Center, 59100 Lembah Pantai, Kuala Lumpur, Malaysia.;Department of Neurology, University Malaya Medical Center, 59100 Lembah Pantai, Kuala Lumpur, Malaysia.;Department of Psychological Medicine, University Malaya Medical Center, 59100 Lembah Pantai, Kuala Lumpur, Malaysia.;Department of Psychological Medicine, University Malaya Medical Center, 59100 Lembah Pantai, Kuala Lumpur, Malaysia.", "authors": "Benedict|F|F|;Lim|K S|KS|;Jambunathan|S T|ST|;Hashim|A Hb|AH|", "chemical_list": "D000927:Anticonvulsants; D014150:Antipsychotic Agents; D018696:Neuroprotective Agents; D000077236:Topiramate; D001569:Benzodiazepines; D005632:Fructose; D000077152:Olanzapine", "country": "China", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "2078-9947", "issue": "26(3)", "journal": "East Asian archives of psychiatry : official journal of the Hong Kong College of Psychiatrists = Dong Ya jing shen ke xue zhi : Xianggang jing shen ke yi xue yuan qi kan", "keywords": "Anticonvulsants; Electroencephalography; Epilepsy; Fructose; Seizures", "medline_ta": "East Asian Arch Psychiatry", "mesh_terms": "D000328:Adult; D038481:Anterior Temporal Lobectomy; D000927:Anticonvulsants; D014150:Antipsychotic Agents; D001569:Benzodiazepines; D005260:Female; D005632:Fructose; D006801:Humans; D018696:Neuroprotective Agents; D000077152:Olanzapine; D011605:Psychoses, Substance-Induced; D011618:Psychotic Disorders; D000077236:Topiramate", "nlm_unique_id": "101536416", "other_id": null, "pages": "109-11", "pmc": null, "pmid": "27703099", "pubdate": "2016-09", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Antiepileptic-induced Psychosis as a Possible Predictor of Post-temporal Lobectomy Alternative Psychosis.", "title_normalized": "antiepileptic induced psychosis as a possible predictor of post temporal lobectomy alternative psychosis" }
[ { "companynumb": "MY-SUPERNUS PHARMACEUTICALS, INC.-2016SUP00211", "fulfillexpeditecriteria": "1", "occurcountry": "MY", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "TOPIRAMATE" }, "drugaddi...
{ "abstract": "The risk of delayed autoimmunity occurring months or years after discontinuation of immunotherapy is frequently asserted in the literature. However, specific cases were rarely described until 2018, when a wave of reports surfaced. With expanding I-O indications in the adjuvant/neoadjuvant curative setting, growing numbers of patients will receive limited courses of immunotherapy before entering routine surveillance. In this context, under-recognition of DIRE could pose a growing clinical hazard.\n\n\n\nThe aim of this study was to characterize DIRE through identification of existing reports of delayed post-treatment irAE in cancer patients treated with immunotherapy. We performed a PubMed literature review from 2008 through 2018 to determine the median data safety reporting window from existing I-O clinical trials, which we then applied to define the DIRE cutoff, and collated all qualifying reports over the same time span. DIRE was defined as new immune-related adverse events (irAE) manifesting ≥90 days after discontinuation of immunotherapy.\n\n\n\nMedian duration of I-O clinical trials data safety reporting was 90 days (82% ≤ 90 days). DIRE cutoff was thus set as ≥90 days post-immunotherapy. We identified 23 qualifying cases; 21 by literature review and 2 from our institution. Median off-treatment interval to DIRE was 6 months (range: 3 to 28). Median cumulative immunotherapy exposure was 4 doses (range: 3 to 42). Involvement included endocrine, neurologic, GI, pulmonary, cardiac, rheumatologic and dermatologic irAE.\n\n\n\nAs immunotherapy indications expand into the curative setting, often with brief exposure and potentially sequenced with multimodality treatments, it will be necessary to recognize an emerging diagnostic complex, which we have termed delayed immune-related events (DIRE). Clinical vigilance has the potential to reduce morbidity from diagnostic delay, as irAE are generally manageable with prompt initiation of treatment - or from misdiagnosis - as misattribution can lead to unnecessary or harmful interventions as we describe. DIRE should therefore figure prominently in the differential diagnosis of patients presenting with illnesses of unclear etiology, irrespective of intervening treatments or interval post-immunotherapy, both of which can confound diagnosis. Increased recognition will rest on delineation of DIRE as a clinical diagnostic entity.", "affiliations": "Robert W. Franz Cancer Center, Providence Portland Medical Center, 2N35 North Pavilion, 4805 N.E. Glisan St, Portland, OR, 97213, USA.;Robert W. Franz Cancer Center, Providence Portland Medical Center, 2N35 North Pavilion, 4805 N.E. Glisan St, Portland, OR, 97213, USA.;Robert W. Franz Cancer Center, Providence Portland Medical Center, 2N35 North Pavilion, 4805 N.E. Glisan St, Portland, OR, 97213, USA.;Providence Neurological Specialties-West, Providence St. Vincent Medical Center, 9135 Southwest Barnes Road, Suite 461, Portland, OR, 97225, USA.;The Oregon Clinic, Radiation Oncology, 4805 NE Glisan St. Garden Level, Portland, OR, 97213, USA.;Robert W. Franz Cancer Center, Providence Portland Medical Center, 2N35 North Pavilion, 4805 N.E. Glisan St, Portland, OR, 97213, USA.;Robert W. Franz Cancer Center, Providence Portland Medical Center, 2N35 North Pavilion, 4805 N.E. Glisan St, Portland, OR, 97213, USA.;Robert W. Franz Cancer Center, Providence Portland Medical Center, 2N35 North Pavilion, 4805 N.E. Glisan St, Portland, OR, 97213, USA. Rom.Leidner@providence.org.", "authors": "Couey|Marcus A|MA|;Bell|R Bryan|RB|;Patel|Ashish A|AA|;Romba|Meghan C|MC|;Crittenden|Marka R|MR|;Curti|Brendan D|BD|;Urba|Walter J|WJ|;Leidner|Rom S|RS|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1186/s40425-019-0645-6", "fulltext": "\n==== Front\nJ Immunother CancerJ Immunother CancerJournal for Immunotherapy of Cancer2051-1426BioMed Central London 64510.1186/s40425-019-0645-6Research ArticleDelayed immune-related events (DIRE) after discontinuation of immunotherapy: diagnostic hazard of autoimmunity at a distance Couey Marcus A. Marcus.Couey@providence.org 1Bell R. Bryan Richard.Bell@providence.org 1Patel Ashish A. Ashish.Patel@providence.org 1Romba Meghan C. Meghan.Romba@providence.org 2Crittenden Marka R. Marka.Crittenden@providence.org 3Curti Brendan D. Brendan.Curti@providence.org 1Urba Walter J. Walter.Urba@providence.org 1Leidner Rom S. Rom.Leidner@providence.org 11 0000 0004 0456 863Xgrid.240531.1Robert W. Franz Cancer Center, Providence Portland Medical Center, 2N35 North Pavilion, 4805 N.E. Glisan St, Portland, OR 97213 USA 2 grid.415337.7Providence Neurological Specialties-West, Providence St. Vincent Medical Center, 9135 Southwest Barnes Road, Suite 461, Portland, OR 97225 USA 3 0000 0004 0455 9389grid.420050.3The Oregon Clinic, Radiation Oncology, 4805 NE Glisan St. Garden Level, Portland, OR 97213 USA 3 7 2019 3 7 2019 2019 7 16518 3 2019 19 6 2019 © The Author(s). 2019Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nThe risk of delayed autoimmunity occurring months or years after discontinuation of immunotherapy is frequently asserted in the literature. However, specific cases were rarely described until 2018, when a wave of reports surfaced. With expanding I-O indications in the adjuvant/neoadjuvant curative setting, growing numbers of patients will receive limited courses of immunotherapy before entering routine surveillance. In this context, under-recognition of DIRE could pose a growing clinical hazard.\n\nMethods\nThe aim of this study was to characterize DIRE through identification of existing reports of delayed post-treatment irAE in cancer patients treated with immunotherapy. We performed a PubMed literature review from 2008 through 2018 to determine the median data safety reporting window from existing I-O clinical trials, which we then applied to define the DIRE cutoff, and collated all qualifying reports over the same time span. DIRE was defined as new immune-related adverse events (irAE) manifesting ≥90 days after discontinuation of immunotherapy.\n\nResults\nMedian duration of I-O clinical trials data safety reporting was 90 days (82% ≤ 90 days). DIRE cutoff was thus set as ≥90 days post-immunotherapy. We identified 23 qualifying cases; 21 by literature review and 2 from our institution. Median off-treatment interval to DIRE was 6 months (range: 3 to 28). Median cumulative immunotherapy exposure was 4 doses (range: 3 to 42). Involvement included endocrine, neurologic, GI, pulmonary, cardiac, rheumatologic and dermatologic irAE.\n\nConclusions\nAs immunotherapy indications expand into the curative setting, often with brief exposure and potentially sequenced with multimodality treatments, it will be necessary to recognize an emerging diagnostic complex, which we have termed delayed immune-related events (DIRE). Clinical vigilance has the potential to reduce morbidity from diagnostic delay, as irAE are generally manageable with prompt initiation of treatment – or from misdiagnosis - as misattribution can lead to unnecessary or harmful interventions as we describe. DIRE should therefore figure prominently in the differential diagnosis of patients presenting with illnesses of unclear etiology, irrespective of intervening treatments or interval post-immunotherapy, both of which can confound diagnosis. Increased recognition will rest on delineation of DIRE as a clinical diagnostic entity.\n\nElectronic supplementary material\nThe online version of this article (10.1186/s40425-019-0645-6) contains supplementary material, which is available to authorized users.\n\nKeywords\nImmunotherapyCheckpoint inhibitorCostimulatory agonistDelayed toxicityImmune-related adverse eventsissue-copyright-statement© The Author(s) 2019\n==== Body\nBackground\nTwo recent cases of severe autoimmune illness in patients treated by our institution’s Head and Neck Oncology Department were the impetus for this study (Additional file 1: Institutional Case Series). Both cases were diagnosed months to years after brief exposure to immunotherapy in previous neoadjuvant surgical window trials. In Case No. 1, the relapsing remitting course of neurologic deficits roughly two years after a one week course of immunotherapy (anti-OX40 agonist mAb), led to diagnostic disputes among consulting specialists and resulted in the placement of an Ommaya reservoir based on an erroneous diagnosis of leptomeningeal carcinomatosis, ultimately requiring transfer through three hospital systems to arrive at a conclusive diagnosis of neurosarcoidosis. We found a prevailing assertion in the literature that new autoimmune illness, presenting months to years after discontinuation of immunotherapy, has been well-described. And yet, on tracing the citation trail from 39 review articles, we were able to identify only a single case report (cited by several reviews), describing a patient with delayed dermatologic hypersensitivity reaction (swelling and >erythema of the upper extremities with pruritus) diagnosed 76 days after the last dose of ipilimumab [1]. This prompted us to ask, to what extent are post-immunotherapy immune-related adverse events (irAE) being reported in the literature, what barriers exist to recognition, and to what extent have the hazards of misdiagnosis been described.\n\nMethods\nThe aim of this study was to characterize DIRE through identification of existing reports of delayed post-treatment irAE in cancer patients treated with immunotherapy. Literature review was conducted in two phases. In the first phase, we queried existing clinical trials to determine a temporal cutoff by which to define DIRE. In the second phase, we applied this cutoff to identify relevant case reports over the same period, and included 2 cases from our institution.\n\nDefining temporal cutoff for DIRE\nPubMed search of English language reports from Jan 1, 2008 to Dec 31, 2018 was conducted using first-pass Boolean filtering followed by automated titles keyword filtering (Additional file 2: Supplementary Methods). Entries were then divided into two groups: 1) I-O clinical trials, or 2) irAE or toxicity-related case reports. The text, supplement and on-line protocol (when available) for each confirmed I-O clinical trial was manually reviewed to identify the duration of serious adverse event (SAE) reporting. The median SAE reporting duration, thus determined, was taken as the temporal cutoff to define DIRE.\n\nLiterature search for clinical cases\nWe next performed full text keyword search of all identified entries (trials and case reports), using: “after,” “delay,” “time,” “onset,” “days,” “week,” and “month.” Articles that described irAE after immunotherapy discontinuation were manually reviewed, including recursive bibliography search for any additional reports. Identified DIRE cases were confirmed by consensus reading of at least two investigators. Cases in which an irAE had been previously diagnosed (e.g. colitis first noted on-treatment, then recurring post-treatment), were considered recrudescent and excluded.\n\nResults\nDetermining a temporal cutoff for DIRE (Fig. 1)\nPubMed Boolean filter and sequential automated titles keyword filter resulted in 3600 and 1489 entries, respectively (Fig. 1a). Of these, 194 were I-O clinical trials, of which 127 specified a discrete duration of SAE reporting in the report or via on-line protocol (Fig. 1b). The duration of SAE reporting following the last dose of immunotherapy was 90 days or less in 82% of I-O clinical trials (range 28 to 100 days). Extension of the SAE reporting window to 90 or 100 days appears to be a more recent trend, accounting for only 7% (1/15) of pre-2015 trials identified. The median I-O trials SAE reporting window (90 days), thus determined, was taken as the temporal cutoff to define DIRE cases the literature search which followed.Fig. 1 Serious adverse event (SAE) reporting. a Literature review to identify immuno-oncology clinical trials. b Clinical trials SAE reporting duration after discontinuation of immunotherapy\n\n\n\nLiterature search for DIRE cases (Fig. 2)\nLiterature search identified 367 case reports, case series and review articles in which the title suggested relevance to irAE or I-O toxicity. These were combined with the 194 I-O clinical trials identified by preceding search, for full-text keyword screening of n = 561 reports (Fig. 2a). We identified 21 cases of DIRE using a definition of autoimmune sequelae newly diagnosed ≥90 days following discontinuation of immunotherapy [2–19]. Only one case could be confirmed from an I-O trial, reflecting the lack of granularity inherent to conventional SAE reporting (eg. timing of SAE onset relative to first or last treatment dose) [15]. Notably, over half the cases came from 2018 (11 of 21). Two local cases are described in this report, bringing the total to 23 DIRE cases (Table 1). Literature search additionally identified 16 suspected DIRE cases, primarily from I-O clinical trials (14/16), which could not be confirmed or excluded due to lack of sufficient detail and are included in the online supplement (Additional file 3: Table S1).Fig. 2 DIRE cases. a Literature review to identify DIRE cases – immune-related adverse events presenting ≥90 days after discontinuation of immunotherapy\n\nTable 1 DIRE Cases\n\nCase\tDisease / age / sex\tRx Setting\tDIRE\tPost IO (months)\tDrug\tDoses (total)\tBest Response\tNotes\t\n1\tHNSCC, HPV+ / 62 / M\tNeoadjuvant\tNeurosarcoidosis\t28a\tMEDI6469 (OX40 agonist)\t3\tN/A\tCouey et al., 2019; Interim treatments: Surgical resection and adjuvant RT (2Gy × 33)\t\n2\tHNSCC, HPV+ / 62 / M\tNeoadjuvant\tAdrenal Insufficiency; Encephalopathy, acute\t4a\tNivolumab\t2\tN/A\tCouey et al., 2019; Interim treatments: Surgical resection and adjuvant RT (2Gy ×  27)\t\n3\tMelanoma / 64 / F\tAdjuvant\tPneumonitis\t8\tNivolumab or Ipilimumab (remains blinded)\t7 or 4 (blinded)\tNED at 2 y\tMandalà et al., 2018 [2]; On-treatment irAE: Colitis; Interim treatments: Infliximab, Corticosteroids\t\n4\tMelanoma / 62 / F\tAdjuvant\tPneumonitis\t6\tNivolumab\t5b\tBrain met at 4 mo\tDiamantopoulos et al., 2017 [3]; On-treatment irAE: Thyroiditis, Hepatitis; Interim treatments: Methimazole\t\n5\tMelanoma / 55 / M\tAdjuvant\tHypothyroidism\t3\tIpilimumab\t2\tNED at 4 mo\tGarcia et al., 2018 [4]; On-treatment irAE: AIDP, Adrenal insufficiency; Interim treatments: Corticosteroids\t\n6\tMelanoma / 63 / M\tMetastatic\tColitis\t23\tPembrolizumab\t33b\tNot reported\tSarofim and Winn, 2018 [5]; Underwent hemicolectomy for pseudo-obstruction, final path ICI-induced colitis\t\n7\tNSCLC / 60 / M\tMetastatic\tAdrenal Insufficiency\t15\tPembrolizumab\t24\tCR\tBoudjemaa et al., 2018 [6];\t\n8\tMelanoma / 65 / M\tMetastatic\tNeurosarcoidosis\t11\tIpilimumab + Nivolumab\t2\tSD\tTan et al., 2018 [7]; On-treatment irAE: Colitis, Transaminitis; Pulmonary sarcoidosis 1 month post-IO; interim treatments: Infliximab, Corticosteroids\t\n9\tMelanoma / 70 / M\tMetastatic\tVitiligo\t9\tPembrolizumab\t4\tPD\tHanrahan et al., 2013 [8]; Interim treatments: Corticosteroids for polymyalgia rheumatica 5 months post-IO\t\n10\tMelanoma / 77 / F\tMetastatic\tHepatitis\t8\tIpilimumab followed by Nivolumab\t4 (Ipi)b\n\n22 (Nivo)b\n\n\tPR\tParakh et al., 2018 [9]; Interim treatments: RT 6Gy × 6 (adrenal met)\t\n11\tNSCLC / 73 / M\tMetastatic\tAdrenal Insufficiency\t7\tNivolumab\t4\tSD\tShrotriya et al., 2018 [10]; Concurrent treatments: Gemcitabine/Vinorelbine\t\n12\tNSCLC / 66 / M\tMetastatic\tAdrenal Insufficiency\t6\tNivolumab\t11\tPD\tOtsubo et al., 2018 [11];\t\n13\tSCC cutaneous / 80’s / F\tMetastatic\tBullous Pemphigoid\t6\tPembrolizumab\t4\tPD\tWang et al., 2018 [12]; On-treatment irAE: Erythema multiforme\t\n14\tMelanoma / 67 / F\tMetastatic\tAlopecia\t6\tPD-1 + CTLA4\t2\tNot reported\tZarbo et al., 2017 [13]; On-treatment irAE: Colitis; Interim treatments: Infliximab, Corticosteroids\t\n15\tMelanoma / 65 / F\tMetastatic\tPericarditis\t6\tIpilimumab\t4\tCR\tDasanu et al., 2017 [14]; On-treatment irAE: Thyroiditis, Transaminitis, Rash; Inflamm. arthritis at 2mo & 8mo); Interim treatments: Corticosteroids\t\n16\t“Melanoma or solid tumor”c\tMetastatic\tUveitis\t5\tTremelimumab + PF-3512676 (TLR9 agonist)\t4 (Treme)\n\n38 (TLR9)b\n\n\tNot reported\tMillward et al., 2013 [15]; On-treatment irAE: Neutropenia (TLR9); Rectal bleeding (Treme)\t\n17\tMelanoma / 60’s / M\tMetastatic\tSarcoidosis (pulmonary, cutaneous)\t5\tPembrolizumab\t10\tCR\tWang et al., 2018 [12];\t\n18\tNSCLC / 68 / F\tRecurrent\tAdrenal Insufficiency\t4\tNivolumab\t2\tPR\tOtsubo et al., 2018 [11]; On-treatment irAE: Pneumonitis; Interim treatments: Corticosteroids\t\n19\tMelanoma / 63 / F\tMetastatic\tMyocarditis\t4\tIpilimumab\t8\tSD\tRoth et al., 2016 [16]; On-treatment irAE: Hypophysitis, Adrenal insufficiency; Interim treatments: Surgery (recurrence), Corticosteroids\t\n20\tMelanoma 65 / F\tMetastatic\tAlopecia\t3\tPD-1 + CTLA4\t4\tPR\tZarbo et al., 2017 [13]; On-treatment irAE: Transaminitis\t\n21\tMelanoma / 63 / F\tMetastatic\tEosinophilic Fasciitis; Encephalopathy, acute\t3\tPembrolizumab\t36b\tCR\tKhoja et al., 2016 [17]; Myalgia 1 month post-IO\t\n22\tMelanoma / 81 / F\tMetastatic\tGuillain–Barré Syndrome\t3\tPembrolizumab\t6\tPD\tKhoja et al., 2015 [18]; On-treatment irAE: Thyroiditis; Rash 7d after subsequent BRAF inhibitor, 1mo post-IO; Interim treatments: Corticosteroids\t\n23\tMelanoma / 59 / M\tMetastatic\tAdrenal Insufficiency; Pericarditis; Hypothyroidism\t3\tIpilimumab\t4\tNot reported\tYun et al., 2015 [19];\t\nAbbreviations: IO Immuno-oncology, HNSCC Head and neck squamous cell carcinoma, NSCLC Non-small cell lung cancer, RT Radiotherapy, ICI Immune-checkpoint inhibitor, AIDP Acute inflammatory demyelinating polyneuropathy, Nivo Nivolumab, Ipi Ipilimumab, Treme Tremelimumab, NED No evidence of disease, mo Months, y Years, CR Complete response, PR partial response, SD Stable disease, PD Progressive disease\n\na Cases from our institution\n\nb Estimate from article narrative\n\nc Tumor type was not specified, unkown age / sex\n\n\n\nCharacteristics of DIRE cases (Table 1)\nThe median interval to DIRE diagnosis was 6 months post-immunotherapy (range 3 to 28 months). Target organ system involvement (Fig. 2b) included: endocrine (7 patients), cutaneous (5), neurologic (5), pulmonary (3), cardiac (3), gastrointestinal (2), rheumatologic (1) and ophthalmologic (1). Interestingly, over half of the DIRE cases occurred following a brief immunotherapy course of ≤4 doses (Fig. 2c: median 4 doses, range 3 to 42). Immunotherapy exposure included pembrolizumab, nivolumab, ipilimumab, tremelimumab plus PF-3512676 (TLR9 agonist) and MEDI6469 (anti-OX40 mAb agonist). In 5 cases, patients received both anti-PD1 and anti-CTLA-4, sequentially or concurrently. Three patients experienced 2 or more DIRE, while a distinctly separate group of patients, roughly 50% (12/23), experienced prior on-treatment irAEs - frequently the proximal cause of immunotherapy discontinuation (9/12) - of which most were managed with corticosteroids (7/12), with the addition of infliximab for cases of colitis (3/12).\n\nMelanoma predominated (15 cases), followed by non-small cell lung cancer (NSCLC) (4), HPV-associated head and neck squamous cell carcinoma (HNSCC) (2), cutaneous squamous cell carcinoma (1) and not specified (1; likely melanoma, clinical trial) [15]. The majority of DIRE cases occurred in the recurrent/metastatic setting (18/23), but three cases were reported following adjuvant melanoma treatment; we identified two cases following neoadjuvant surgical window I-O trials in HNSCC. Subsequent treatment following immunotherapy included: BRAF inhibitor for a melanoma patient (to which Guillain-Barré syndrome was erroneously attributed), and multimodality standard of care (surgery followed by risk-adapted radiation +/− chemotherapy) for the two HNSCC patients, both of which developed protracted neurologic DIRE, with adrenal crisis included in the DIRE complex in case No. 2 (Table 1; Additional file 1: Institutional Case Series).\n\nSuspected DIRE cases – incomplete reports\nThere were 16 additional suspected DIRE cases identified by literature search, which although likely representing bona fide examples, could not be included due to insufficient reported details [20–26]. (Additional file 4: Clinical Trial AEs Suspicious for DIRE) Target organ system involvement included endocrine (6 patients), cutaneous (6), gastrointestinal (3), genitourinary (1), hematologic (1), rheumatologic (1) and ophthalmologic (1). Immunotherapy exposure included pembrolizumab, nivolumab, ipilimumab and gp100. Melanoma predominated (15 cases) of which 20% were adjuvant (3/15); the sixteenth case was metastatic NSCLC.\n\nDiscussion\nThe variable temporality of on-treatment irAE is well-characterized [27–37]. However, off-treatment autoimmune illness, manifesting months to years after discontinuation of immunotherapy, have occasionally been alluded to in the literature, but probably represent an under-recognized phenomenon [38–42]. In 2013, the first such report involving a case of vitiligo manifesting 9 months after discontinuation of pembrolizumab appeared in abstract form in Deutschen Dermatologischen Gesellschaft (case No. 9, Table 1) [8]. Through 2017, a handful of reports described cases of post-immunotherapy autoimmune illness, but focused primarily on target organ manifestations, rather than the fact of delayed onset following an extended interval off-treatment and the diagnostic challenges this most likely posed [3, 13, 16–19]. By the close of 2018, however, a wave of new reports had surfaced, some explicitly emphasizing the significance of newly manifest irAE emerging long after discontinuation of immunotherapy, a clinical diagnostic complex we have termed DIRE (delayed immune-related events).\n\nTo our knowledge, this is the first study to collate existing scattered reports of substantially delayed irAE, manifesting at prolonged intervals after discontinuation of immunotherapy. Over half of all cases occurred following short courses of immunotherapy of ≤4 doses, and the majority of cases were reported in 2018 (Table 1). There is sound mechanistic plausibility to support these observations. For instance, PD-1 receptor occupancy on T cells plateaus at approximately 80% up to 90 days after a single dose of nivolumab, despite a serum half-life of only 12–20 days. After three doses, occupancy remains at 40% for more than 8 months after the last dose [43]. Just as durable clinical responses following immunotherapy appear to be independent of dose and duration of treatment, so too, immune-mediated toxicity would be expected to display variable onset relative to treatment.\n\nObstacles to assessment of the true frequency and extent of DIRE are inherent in current I-O clinical trials reporting convention. Issues such as limited follow up periods and incompleteness of irAE reporting were previously described by Chen et al. in a systematic review of I-O clinical trials [44]. Some trial protocols explicitly excluded reporting of adverse events occurring > 30 days after last dose, or reporting of any adverse events after initiation of another cancer treatment [45–49]. Importantly, irAE are routinely reported relative to the start of treatment, without any related information regarding the end of treatment [21, 50–54]. We were only able to confirm a single case of DIRE in an I-O clinical trial, despite rather simple criteria we proposed, and a careful manual review of all published trials reports. This was a case of grade 2 uveitis occurring 157 days after end of study treatment (TLR9 + tremelimumab), which was couched in a DLT table that caught our eye on manual reading of the report (case No. 16, Table 1), and actually not within the searchable text [15].\n\nThe fact that our literature search was able to identify cases dating back to 2013 suggests that DIRE is not a new phenomenon. Indeed, we identified 39 review articles that posited the existence of delayed irAE post discontinuation of treatment [29, 31, 34, 38–42, 44, 55–84]; however, only two of these reviews provided specific citations, both to the same report describing a case of delayed dermatologic hypersensitivity reaction starting 76 days following final dose of ipilimumab [34, 66]. This particular example would not have posed a substantial diagnostic challenge, nor qualified as DIRE based on a ≥ 90 day cutoff. It may be that clinical anecdotes were in circulation as a basis for the widespread assertions we encountered in the literature, but the lack of citations to any extant reports suggest an under-reporting effect, likely deriving from clinical reluctance to recognize autoimmunity at a distance, in favor of misattribution to more proximal events or treatments.\n\nTwo recent cases of severe and substantially delayed post-treatment irAE occurring in patients treated by our institution’s Head and Neck Oncology Department are described in this report. These serve as among the first detailed examples of DIRE following neoadjuvant immunotherapy, and describe the diagnostic uncertainty posed by otherwise healthy individuals being followed for surveillance, months to years following remote (and brief) immunotherapy exposure in the neoadjuvant clinical trials context. We were unable to find analogous reports in the literature, indicating a diagnostic hazard which is predicted to increase with new I-O approvals in the curative setting (adjuvant/neoadjuvant treatment) [21, 85–92]. Current diagnostic challenges are reminiscent of early experience in allogeneic bone marrow transplantation, prior to delineation of graft versus host disease (GVHD) as a clinical diagnostic complex. Diagnostic misattribution to the effects of intercurrent chemotherapy, radiation, disease recurrence or sepsis, were reported as common confounding factors [93, 94]. Clinical awareness, therefore has the potential to avert morbidity/mortality from misdiagnosis, by preventing unnecessary and potentially harmful interventions, (as in the neurosarcoidosis case we describe of Ommaya reservoir placement on the basis of an erroneous leptomeningeal carcinomatosis diagnosis) – and from diagnostic delay, given that these conditions are generally manageable with prompt initiation of immune suppressive therapy.\n\nAs contemporary examples of diagnostic hazard, our literature search identified two reports, one of immune-related colitis manifesting 23 months after completion of pembrolizumab, in which the patient was initially treated with neostigmine based on an erroneous diagnosis of Ogilvie’s syndrome, failed to respond, and then underwent right-sided colectomy, which unfortunately revealed correct diagnosis (Case No. 6, Table 1) [5]. A case of Guillain-Barré syndrome (GBS) manifesting 3 months post-pembrolizumab, was erroneously attributed to subsequent treatment with dabrafenib (case No. 22, Table 1) [18]. Only one other case of GBS has been associated with dabrafenib, in a 2015 abstract, again post-pembrolizumab [95], whereas the association of checkpoint blockade with GBS is well-recognized [96, 97]. Clinical confounding, akin to experience prior to categorization of GVHD, attests to the need for characterization of DIRE as a clinical diagnostic entity. These cases illustrate several hazards of diagnostic misattribution, including unnecessary/invasive procedures, delay in the proper management of an autoimmune illness, and abandonment of an otherwise beneficial therapy (eg…BRAF inhibitors).\n\nWe would highlight three important limitations to this study. First, it is impossible to prove direct causality between immunotherapy and delayed autoimmunity, particularly from case reports. With rare exception, autoimmune sequelae of immunotherapy remain diagnoses-of-exclusion in clinical practice. The lack of a temporal association or dose-dependent relationship, which might otherwise enhance credulity, lends to a cautious skepticism which only further empiric observation will dispel or reinforce. Second, there is a heterogeneous level of detail regarding diagnosis and clinical management in the case reports thus far available. As clinical awareness increases, we anticipate that a growing emphasis will be placed on diagnostic algorithms, management strategies, and possibly unique DIRE associations to specific drugs. Third, we cannot accurately begin to gauge the frequency or true extent of DIRE given clinical trial reporting conventions which favor attribution of irAE to the most temporally proximal treatment/process and reporting irAE relative only to start of treatment but not end of treatment.\n\nConclusions\nWith expanding I-O indications in the curative disease setting, either as adjuvant/neoadjuvant therapy, or in combination with multimodality approaches, growing numbers of patients will be exposed to immunotherapy before transitioning to routine clinical surveillance. In this context, it will be necessary to recognize an emerging clinical diagnostic complex, which we have termed DIRE (delayed immune-related events), manifesting months to years after discontinuation of immunotherapy and representing a substantive diagnostic hazard. In our experience, diagnostic misattribution is clinically reinforced by several confounding factors: 1) a brief and remote immunotherapy exposure; 2) intervening treatments with overlapping toxicities; 3) a protracted diagnosis-by-exclusion process; 4) reduced vigilance in the post-treatment setting. DIRE syndrome should therefore figure prominently in the differential diagnosis of patients presenting with unexplained illnesses, irrespective of post-immunotherapy interval. The clinical hazards of diagnostic misattribution include inappropriate invasive procedures (unnecessary colectomy or Ommaya reservoir placement, as in cases described) and delay to start of treatment for autoimmune conditions that are often readily managed with prompt initiation of immune suppressive therapy. Changes to I-O clinical trial reporting convention could unmask the true incidence of DIRE, and include: the standardization of irAE reporting duration; collection of safety data regardless of whether a new cancer therapy is started; publication of irAE that emerge after the formal study period; and reporting of time-to-onset of irAE in relation to both treatment start and end.\n\nAdditional files\n\nAdditional file 1: Institutional Case Series. Detailed descriptions of two DIRE cases identified from our institution. (DOCX 23 kb)\n\n \nAdditional file 2: Supplementary Methods. Boolean search strategy and keywords for titles screen (DOCX 17 kb)\n\n \nAdditional file 3: Table S1. Table of suspected DIRE cases that could not be confirmed due to lack of supporting information (PDF 23 kb)\n\n \nAdditional file 4: Clinical Trial AEs Suspicious for DIRE. Descriptions of suspected DIRE cases from clinical trials that could not be confirmed due to lack of supporting information (DOCX 18 kb)\n\n \n\n\nAbbreviations\nDIREDelayed-immune related events\n\nDLTDose-limiting toxicity\n\nGBSGuillain-Barré syndrome\n\nGVHDGraft versus host disease\n\nHNSCCHead and neck squamous cell carcinoma\n\nI-OImmuno-oncology\n\nirAEImmune-related adverse event\n\nmAbMonoclonal antibody\n\nNSCLCNon-small cell lung cancer\n\nSAESerious adverse event\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAcknowledgements\nNot applicable.\n\nAuthors’ contributions\nMAC and RSL collected and interpreted the data and were major contributors to writing the manuscript. RBB, AAP, MCR, MRC, BDC, WJU contributed patient data and contributed to manuscript editing. All authors read and approved the final manuscript.\n\nFunding\nResearch support provided by Providence Portland Medical Foundation.\n\nAvailability of data and materials\nThe data and references supporting the conclusions of this article are included within the main text and additional files.\n\nEthics approval and consent to participate\nThe study was conducted under institutional review board approval at Providence Portland Medical Center, Oregon. Waiver of consent was obtained for retrospective chart review.\n\nConsent for publication\nNo personal identifying information was included in the manuscript, and therefore no consent was required.\n\nCompeting interests\nRBB receives research funding from the Oral and Maxillofacial Surgery Foundation, BMS, Abbvie, Safeway Foundation, Providence Portland Medical Center Foundation, receives institutional support from BMS, MedImmune, Prometheus, Merck, and is a member of the speakers bureaus for Merck and BMS, MRC receives institutional research support from Nanobiotix, Jounce, Celldex, Mavupharma and BMS, BDC receives institutional research support from MedImmune/AstraZeneca, BMS, Viralytics, and Gallectin Therapeutics, and serves as consultant to BMS, Eisai, Alligator, and Iovance, WJU has received renumeration from MedImmune and Leidos Biomedical Research, serves on the board of directors for Leidos, and serves on the advisory board for Bionical EMAS, RSL receives institutional research support from Bristol Myers Squibb and Medimmune/AstraZeneca, and serves as a consultant to Merck and Regeneron.\n==== Refs\nReferences\n1. Ludlow SP Kay N Delayed dermatologic hypersensitivity reaction secondary to ipilimumab J Immunother Hagerstown Md 1997 2015 38 165 166 \n2. Mandalà M Merelli B Indriolo A Tondini C Late-occurring toxicity induced by an immune checkpoint blockade in adjuvant treatment of a stage III melanoma patient Eur J Cancer Oxf Engl 1990 2018 95 130 132 \n3. Diamantopoulos PT Gaggadi M Kassi E Benopoulou O Anastasopoulou A Gogas H Late-onset nivolumab-mediated pneumonitis in a patient with melanoma and multiple immune-related adverse events Melanoma Res 2017 27 391 395 10.1097/CMR.0000000000000355 28419059 \n4. Garcia CA El-Ali A Rath TJ Contis LC Gorantla V Drappatz J Neurologic immune-related adverse events associated with adjuvant ipilimumab: report of two cases J Immunother Cancer 2018 6 83 10.1186/s40425-018-0393-z 30170622 \n5. Sarofim M, Winn R. Rare case of delayed onset colitis due to immunotherapy for malignant melanoma. ANZ J Surg. 2018;0. 10.1111/ans.14768.\n6. Boudjemaa A Rousseau-Bussac G Monnet I Late-onset adrenal insufficiency more than 1 year after stopping Pembrolizumab J Thorac Oncol Off Publ Int Assoc Study Lung Cancer 2018 13 e39 e40 \n7. Tan I, Malinzak M, Salama AKS. Delayed onset of neurosarcoidosis after concurrent ipilimumab/nivolumab therapy. J Immunother Cancer. 2018;6. 10.1186/s40425-018-0390-2.\n8. Hanrahan P Van Der Westhuizen A Collins S Owens D Hersey P Delayed autoimmune effects in patients treated with antibodies against the checkpoint inhibitor PD1 J Dtsch Dermatol Ges 2013 11 16 10.1111/ddg.12015_4 23734891 \n9. Parakh S Cebon J Klein O Delayed autoimmune toxicity occurring several months after cessation of anti-PD-1 therapy Oncologist 2018 23 849 851 10.1634/theoncologist.2017-0531 29666298 \n10. Shrotriya S, Rai MP, Alratroot A, Sarzynski E. Delayed presentation of isolated Adrenocorticotropin insufficiency after Nivolumab therapy for advanced non-small-cell lung carcinoma (NSCLC). BMJ Case Rep. 2018;2018:bcr-2018-225048.\n11. Otsubo K Nakatomi K Furukawa R Ashida K Yoneshima Y Nakanishi Y Two cases of late-onset secondary adrenal insufficiency after discontinuation of nivolumab Ann Oncol 2017 28 3106 3107 10.1093/annonc/mdx497 28945828 \n12. Wang Leo L. Patel Gopal Chiesa-Fuxench Zelma C. McGettigan Suzanne Schuchter Lynn Mitchell Tara C. Ming Michael E. Chu Emily Y. Timing of Onset of Adverse Cutaneous Reactions Associated With Programmed Cell Death Protein 1 Inhibitor Therapy JAMA Dermatology 2018 154 9 1057 10.1001/jamadermatol.2018.1912 30027278 \n13. Zarbo A Belum VR Sibaud V Oudard S Postow MA Hsieh JJ Immune-related alopecia (areata and universalis-type) in cancer patients receiving immune checkpoint inhibitors Br J Dermatol 2017 176 1649 1652 10.1111/bjd.15237 27943234 \n14. Dasanu CA Jen T Skulski R Late-onset pericardial tamponade, bilateral pleural effusions and recurrent immune monoarthritis induced by ipilimumab use for metastatic melanoma J Oncol Pharm Pract Off Publ Int Soc Oncol Pharm Pract 2017 23 231 234 10.1177/1078155216635853 \n15. Millward M Underhill C Lobb S McBurnie J Meech SJ Gomez-Navarro J Phase I study of tremelimumab (CP-675 206) plus PF-3512676 (CPG 7909) in patients with melanoma or advanced solid tumours Br J Cancer 2013 108 1998 2004 10.1038/bjc.2013.227 23652314 \n16. Roth ME Muluneh B Jensen BC Madamanchi C Lee CB Left ventricular dysfunction after treatment with Ipilimumab for metastatic melanoma Am J Ther 2016 23 e1925 e1928 10.1097/MJT.0000000000000430 26885708 \n17. Khoja L Maurice C Chappell M MacMillan L Al-Habeeb AS Al-Faraidy N Eosinophilic fasciitis and acute encephalopathy toxicity from Pembrolizumab treatment of a patient with metastatic melanoma Cancer Immunol Res 2016 4 175 178 10.1158/2326-6066.CIR-15-0186 26822024 \n18. Khoja L Butler MO Chappell MA Hogg D Joshua AM Increased treatment-related toxicity subsequent to an anti-PD-1 agent Curr Oncol Tor Ont 2015 22 e320 e322 10.3747/co.22.2418 \n19. Yun S Vincelette ND Mansour I Hariri D Motamed S Late onset Ipilimumab-induced pericarditis and pericardial effusion: a rare but life threatening complication Case Rep Oncol Med 2015 2015 794842 25918658 \n20. Luu Queenie Major Gabor Unleashing the tiger – iatrogenic autoimmunity from cancer immunotherapy drugs JRSM Open 2018 9 1 205427041774690 10.1177/2054270417746905 \n21. Weber J Mandala M Del Vecchio M Gogas HJ Arance AM Cowey CL Adjuvant Nivolumab versus Ipilimumab in resected stage III or IV melanoma N Engl J Med 2017 377 1824 1835 10.1056/NEJMoa1709030 28891423 \n22. Wolchok JD Chiarion-Sileni V Gonzalez R Rutkowski P Grob J-J Cowey CL Overall survival with combined Nivolumab and Ipilimumab in advanced melanoma N Engl J Med 2017 377 1345 1356 10.1056/NEJMoa1709684 28889792 \n23. Ricciuti B Metro G Baglivo S Colabrese D Chiari R Bennati C Long-lasting response to Nivolumab and immune-related adverse events in a nonsquamous metastatic non-small cell lung cancer patient J Thorac Oncol Off Publ Int Assoc Study Lung Cancer. 2017 12 e51 e55 \n24. Yamazaki N Kiyohara Y Uhara H Fukushima S Uchi H Shibagaki N Phase II study of ipilimumab monotherapy in Japanese patients with advanced melanoma Cancer Chemother Pharmacol 2015 76 997 1004 10.1007/s00280-015-2873-x 26410424 \n25. Robert C Thomas L Bondarenko I O’Day S Weber J Garbe C Ipilimumab plus Dacarbazine for previously untreated metastatic melanoma N Engl J Med 2011 364 2517 2526 10.1056/NEJMoa1104621 21639810 \n26. McDermott D Haanen J Chen T-T Lorigan P O’Day S For the MDX010-20 investigators Efficacy and safety of ipilimumab in metastatic melanoma patients surviving more than 2 years following treatment in a phase III trial (MDX010-20) Ann Oncol 2013 24 2694 2698 10.1093/annonc/mdt291 23942774 \n27. Abdel-Rahman O ElHalawani H Fouad M Risk of cutaneous toxicities in patients with solid tumors treated with immune checkpoint inhibitors: a meta-analysis Future Oncol Lond Engl 2015 11 2471 2484 10.2217/fon.15.118 \n28. Akturk HK Michels AW Adverse events associated with immune checkpoint blockade N Engl J Med 2018 378 1163 1164 10.1056/NEJMc1801663 29565519 \n29. Brahmer JR Lacchetti C Schneider BJ Atkins MB Brassil KJ Caterino JM Management of immune-related adverse events in patients treated with immune checkpoint inhibitor therapy: American Society of Clinical Oncology clinical practice guideline J Clin Oncol Off J Am Soc Clin Oncol 2018 36 1714 1768 10.1200/JCO.2017.77.6385 \n30. Costa R Carneiro BA Agulnik M Rademaker AW Pai SG Villaflor VM Toxicity profile of approved anti-PD-1 monoclonal antibodies in solid tumors: a systematic review and meta-analysis of randomized clinical trials Oncotarget. 2017 8 8910 8920 27852042 \n31. Michot JM Bigenwald C Champiat S Collins M Carbonnel F Postel-Vinay S Immune-related adverse events with immune checkpoint blockade: a comprehensive review Eur J Cancer Oxf Engl 1990 2016 54 139 148 \n32. Naidoo J Page DB Li BT Connell LC Schindler K Lacouture ME Toxicities of the anti-PD-1 and anti-PD-L1 immune checkpoint antibodies Ann Oncol Off J Eur Soc Med Oncol 2015 26 2375 2391 \n33. Nishino M Sholl LM Hodi FS Hatabu H Ramaiya NH Anti-PD-1-related pneumonitis during cancer immunotherapy N Engl J Med 2015 373 288 290 10.1056/NEJMc1505197 26176400 \n34. Spain L Diem S Larkin J Management of toxicities of immune checkpoint inhibitors Cancer Treat Rev 2016 44 51 60 10.1016/j.ctrv.2016.02.001 26874776 \n35. Topalian SL Sznol M McDermott DF Kluger HM Carvajal RD Sharfman WH Survival, durable tumor remission, and long-term safety in patients with advanced melanoma receiving nivolumab J Clin Oncol Off J Am Soc Clin Oncol 2014 32 1020 1030 10.1200/JCO.2013.53.0105 \n36. Wang P-F Chen Y Song S-Y Wang T-J Ji W-J Li S-W Immune-related adverse events associated with anti-PD-1/PD-L1 treatment for malignancies: a meta-analysis Front Pharmacol 2017 8 730 10.3389/fphar.2017.00730 29093678 \n37. Weber JS Hodi FS Wolchok JD Topalian SL Schadendorf D Larkin J Safety profile of Nivolumab monotherapy: a pooled analysis of patients with advanced melanoma J Clin Oncol Off J Am Soc Clin Oncol 2017 35 785 792 10.1200/JCO.2015.66.1389 \n38. Champiat S Lambotte O Barreau E Belkhir R Berdelou A Carbonnel F Management of immune checkpoint blockade dysimmune toxicities: a collaborative position paper Ann Oncol Off J Eur Soc Med Oncol. 2016 27 559 574 10.1093/annonc/mdv623 \n39. Haanen JBAG Carbonnel F Robert C Kerr KM Peters S Larkin J Management of toxicities from immunotherapy: ESMO clinical practice guidelines for diagnosis, treatment and follow-up Ann Oncol Off J Eur Soc Med Oncol 2017 28 suppl_4 iv119 iv142 10.1093/annonc/mdx225 \n40. Luke JJ Ott PA PD-1 pathway inhibitors: the next generation of immunotherapy for advanced melanoma Oncotarget. 2015 6 3479 3492 10.18632/oncotarget.2980 25682878 \n41. Puzanov I Diab A Abdallah K Bingham CO Brogdon C Dadu R Managing toxicities associated with immune checkpoint inhibitors: consensus recommendations from the Society for Immunotherapy of Cancer (SITC) toxicity management working group J Immunother Cancer. 2017 5 95 10.1186/s40425-017-0300-z 29162153 \n42. Tarhini A Immune-mediated adverse events associated with ipilimumab ctla-4 blockade therapy: the underlying mechanisms and clinical management Scientifica. 2013 2013 857519 10.1155/2013/857519 24278787 \n43. Brahmer JR Drake CG Wollner I Powderly JD Picus J Sharfman WH Phase I study of single-agent anti–programmed Death-1 (MDX-1106) in refractory solid tumors: safety, clinical activity, pharmacodynamics, and immunologic correlates J Clin Oncol 2010 28 3167 3175 10.1200/JCO.2009.26.7609 20516446 \n44. Chen TW Razak AR Bedard PL Siu LL Hansen AR A systematic review of immune-related adverse event reporting in clinical trials of immune checkpoint inhibitors Ann Oncol Off J Eur Soc Med Oncol. 2015 26 1824 1829 10.1093/annonc/mdv182 \n45. Weber JS Gibney G Sullivan RJ Sosman JA Slingluff CL Lawrence DP Sequential administration of nivolumab and ipilimumab with a planned switch in patients with advanced melanoma (CheckMate 064): an open-label, randomised, phase 2 trial Lancet Oncol. 2016 17 943 955 10.1016/S1470-2045(16)30126-7 27269740 \n46. Fang W Yang Y Ma Y Hong S Lin L He X Camrelizumab (SHR-1210) alone or in combination with gemcitabine plus cisplatin for nasopharyngeal carcinoma: results from two single-arm, phase 1 trials Lancet Oncol. 2018 19 1338 1350 10.1016/S1470-2045(18)30495-9 30213452 \n47. Kaufman HL Russell J Hamid O Bhatia S Terheyden P D’Angelo SP Avelumab in patients with chemotherapy-refractory metastatic Merkel cell carcinoma: a multicentre, single-group, open-label, phase 2 trial Lancet Oncol 2016 17 1374 1385 10.1016/S1470-2045(16)30364-3 27592805 \n48. Emens LA Cruz C Eder J Long-term clinical outcomes and biomarker analyses of atezolizumab therapy for patients with metastatic triple-negative breast cancer: a phase 1 study JAMA Oncol 2019 5 74 82 10.1001/jamaoncol.2018.4224 30242306 \n49. Lukas RV Rodon J Becker K Wong ET Shih K Touat M Clinical activity and safety of atezolizumab in patients with recurrent glioblastoma J Neuro-Oncol 2018 140 317 328 10.1007/s11060-018-2955-9 \n50. Horn L Gettinger SN Gordon MS Herbst RS Gandhi L Felip E Safety and clinical activity of atezolizumab monotherapy in metastatic non-small-cell lung cancer: final results from a phase I study Eur J Cancer Oxf Engl 1990 2018 101 201 209 \n51. Vokes EE Ready N Felip E Horn L Burgio MA Antonia SJ Nivolumab versus docetaxel in previously treated advanced non-small-cell lung cancer (CheckMate 017 and CheckMate 057): 3-year update and outcomes in patients with liver metastases Ann Oncol 2018 29 959 965 10.1093/annonc/mdy041 29408986 \n52. Hodi FS Chiarion-Sileni V Gonzalez R Grob J-J Rutkowski P Cowey CL Nivolumab plus ipilimumab or nivolumab alone versus ipilimumab alone in advanced melanoma (CheckMate 067): 4-year outcomes of a multicentre, randomised, phase 3 trial Lancet Oncol. 2018 19 1480 1492 10.1016/S1470-2045(18)30700-9 30361170 \n53. Schachter J Ribas A Long GV Arance A Grob J-J Mortier L Pembrolizumab versus ipilimumab for advanced melanoma: final overall survival results of a multicentre, randomised, open-label phase 3 study (KEYNOTE-006) Lancet Lond Engl 2017 390 1853 1862 10.1016/S0140-6736(17)31601-X \n54. Schadendorf D Wolchok JD Hodi FS Chiarion-Sileni V Gonzalez R Rutkowski P Efficacy and safety outcomes in patients with advanced melanoma who discontinued treatment with Nivolumab and Ipilimumab because of adverse events: a pooled analysis of randomized phase II and III trials J Clin Oncol Off J Am Soc Clin Oncol 2017 35 3807 3814 10.1200/JCO.2017.73.2289 \n55. Andrews S Holden R Characteristics and management of immunerelated adverse effects associated with ipilimumab, a new immunotherapy for metastatic melanoma Cancer Manag Res 2012 4 299 307 10.2147/CMAR.S31873 23049279 \n56. Astaras C de Micheli R Moura B Hundsberger T Hottinger AF Neurological adverse events associated with immune checkpoint inhibitors: diagnosis and management Curr Neurol Neurosci Rep 2018 18 3 10.1007/s11910-018-0810-1 29392441 \n57. Brahmer JR Identifying and addressing the toxicity of checkpoint inhibitors in lung cancer Clin Adv Hematol Oncol HO 2016 14 165 167 \n58. Camacho LH CTLA-4 blockade with ipilimumab: biology, safety, efficacy, and future considerations Cancer Med 2015 4 661 672 10.1002/cam4.371 25619164 \n59. Cappelli LC Shah AA Bingham CO Immune-related adverse effects of cancer immunotherapy- implications for rheumatology Rheum Dis Clin N Am 2017 43 65 78 10.1016/j.rdc.2016.09.007 \n60. Ciccarese C Iacovelli R Bria E Modena A Massari F Brunelli M The incidence and relative risk of pulmonary toxicity in patients treated with anti-PD1/PD-L1 therapy for solid tumors: a meta-analysis of current studies Immunotherapy. 2017 9 579 587 10.2217/imt-2017-0018 28595514 \n61. Economopoulou P Psyrri A Overview and management of toxicities of immune checkpoint-blocking drugs Forum Clin Oncol 2016 7 28 37 10.1515/fco-2016-0004 \n62. Fecher LA Agarwala SS Hodi FS Weber JS Ipilimumab and its toxicities: a multidisciplinary approach Oncologist 2013 18 733 743 10.1634/theoncologist.2012-0483 23774827 \n63. Feng S Coward J McCaffrey E Coucher J Kalokerinos P O’Byrne K Pembrolizumab-induced encephalopathy: a review of neurological toxicities with immune checkpoint inhibitors J Thorac Oncol Off Publ Int Assoc Study Lung Cancer. 2017 12 1626 1635 \n64. Helissey C Vicier C Champiat S The development of immunotherapy in older adults: new treatments, new toxicities? J Geriatr Oncol 2016 7 325 333 10.1016/j.jgo.2016.05.007 27318796 \n65. Hwang SJE Carlos G Chou S Wakade D Carlino MS Fernandez-Penas P Bullous pemphigoid, an autoantibody-mediated disease, is a novel immune-related adverse event in patients treated with anti-programmed cell death 1 antibodies Melanoma Res 2016 26 413 416 10.1097/CMR.0000000000000260 27031539 \n66. Hansen Eric D. Wang Xiao Case Amy A. Puzanov Igor Smith Tom Immune Checkpoint Inhibitor Toxicity Review for the Palliative Care Clinician Journal of Pain and Symptom Management 2018 56 3 460 472 10.1016/j.jpainsymman.2018.05.015 29792979 \n67. Linardou H Gogas H Toxicity management of immunotherapy for patients with metastatic melanoma Ann Transl Med 2016 4 272 10.21037/atm.2016.07.10 27563659 \n68. Lopez Adriana T. Geskin Larisa A Case of Nivolumab‐Induced Bullous Pemphigoid: Review of Dermatologic Toxicity Associated with Programmed Cell Death Protein‐1/Programmed Death Ligand‐1 Inhibitors and Recommendations for Diagnosis and Management The Oncologist 2018 23 10 1119 1126 10.1634/theoncologist.2018-0128 30018132 \n69. Mathias C Current standard in monitoring of immunotherapy-related toxicity J Thorac Oncol 2017 12 S1658 S1659 10.1016/j.jtho.2017.09.184 \n70. Messmer M Upreti S Tarabishy Y Mazumder N Chowdhury R Yarchoan M Ipilimumab-induced enteritis without colitis: a new challenge Case Rep Oncol 2016 9 705 713 10.1159/000452403 27920706 \n71. Miranda Poma Jesus Ostios Garcia Lorena Villamayor Sanchez Julia D’errico Gabriele What do we know about cancer immunotherapy? Long-term survival and immune-related adverse events Allergologia et Immunopathologia 2019 47 3 303 308 10.1016/j.aller.2018.04.005 29983240 \n72. Nagai H Muto M Optimal management of immune-related adverse events resulting from treatment with immune checkpoint inhibitors: a review and update Int J Clin Oncol 2018 23 410 420 10.1007/s10147-018-1259-6 29516216 \n73. Overman MJ, Ernstoff MS, Morse MA. Where we stand with immunotherapy in colorectal cancer: Deficient mismatch repair, proficient mismatch repair, and toxicity management. Am Soc Clin Oncol Educ Book. 2018;38:239–47.\n74. Remon J Mezquita L Corral J Vilariño N Reguart N Immune-related adverse events with immune checkpoint inhibitors in thoracic malignancies: focusing on non-small cell lung cancer patients J Thorac Dis 2018 10 Suppl 13 S1516 S1533 10.21037/jtd.2017.12.52 29951303 \n75. Rudzki JD Management of adverse events related to checkpoint inhibition therapy Memo. 2018 11 132 137 10.1007/s12254-018-0416-y 29983828 \n76. Shah Mohsin Tayar Jean H. Abdel-Wahab Noha Suarez-Almazor Maria E. Myositis as an adverse event of immune checkpoint blockade for cancer therapy Seminars in Arthritis and Rheumatism 2019 48 4 736 740 10.1016/j.semarthrit.2018.05.006 29909921 \n77. Simmons D, Lang E. The Most recent oncologic emergency: what emergency physicians need to know about the potential complications of immune checkpoint inhibitors. Cureus. 9. 10.7759/cureus.1774.\n78. Sosa Aaron Lopez Cadena Esther Simon Olive Cristina Karachaliou Niki Rosell Rafael Clinical assessment of immune-related adverse events Therapeutic Advances in Medical Oncology 2018 10 175883591876462 10.1177/1758835918764628 \n79. Sznol M Postow MA Davies MJ Pavlick AC Plimack ER Shaheen M Endocrine-related adverse events associated with immune checkpoint blockade and expert insights on their management Cancer Treat Rev 2017 58 70 76 10.1016/j.ctrv.2017.06.002 28689073 \n80. Thompson JA New NCCN guidelines: recognition and management of immunotherapy-related toxicity J Natl Compr Cancer Netw JNCCN 2018 16 594 596 10.6004/jnccn.2018.0047 \n81. Touat M Talmasov D Ricard D Psimaras D Neurological toxicities associated with immune-checkpoint inhibitors Curr Opin Neurol 2017 30 659 668 10.1097/WCO.0000000000000503 28938341 \n82. Bertrand A Kostine M Barnetche T Truchetet M-E Schaeverbeke T Immune related adverse events associated with anti-CTLA-4 antibodies: systematic review and meta-analysis BMC Med 2015 13 211 10.1186/s12916-015-0455-8 26337719 \n83. Gupta A De Felice KM Loftus EVJ Khanna S Systematic review: colitis associated with anti-CTLA-4 therapy Aliment Pharmacol Ther 2015 42 406 417 10.1111/apt.13281 26079306 \n84. June CH Warshauer JT Bluestone JA Is autoimmunity the Achilles’ heel of cancer immunotherapy? Nat Med 2017 23 540 10.1038/nm.4321 28475571 \n85. Forde PM Chaft JE Smith KN Anagnostou V Cottrell TR Hellmann MD Neoadjuvant PD-1 blockade in resectable lung cancer N Engl J Med 2018 378 1976 1986 10.1056/NEJMoa1716078 29658848 \n86. Uppaluri R Zolkind P Lin T Nussenbaum B Jackson RS Rich J Neoadjuvant pembrolizumab in surgically resectable, locally advanced HPV negative head and neck squamous cell carcinoma (HNSCC) J Clin Oncol 2017 35 15_suppl 6012 10.1200/JCO.2017.35.15_suppl.6012 \n87. Ferris RL Gonçalves A Baxi SS Martens UM Gauthier H Langenberg M LBA46An open-label, multicohort, phase 1/2 study in patients with virus-associated cancers (CheckMate 358): Safety and efficacy of neoadjuvant nivolumab in squamous cell carcinoma of the head and neck (SCCHN) Ann Oncol 2017 28 suppl_5 mdx440.041 \n88. Necchi A Briganti A Bianchi M Raggi D Giannatempo P Lucianó R Preoperative pembrolizumab (pembro) before radical cystectomy (RC) for muscle-invasive urothelial bladder carcinoma (MIUC): Interim clinical and biomarker findings from the phase 2 PURE-01 study J Clin Oncol 2018 36 15_suppl 4507 10.1200/JCO.2018.36.15_suppl.4507 \n89. Powles T Rodriguez-Vida A Duran I Crabb SJ Van Der Heijden MS Font Pous A A phase II study investigating the safety and efficacy of neoadjuvant atezolizumab in muscle invasive bladder cancer (ABACUS) J Clin Oncol 2018 36 15_suppl 4506 10.1200/JCO.2018.36.15_suppl.4506 \n90. Antonia SJ Villegas A Daniel D Vicente D Murakami S Hui R Durvalumab after Chemoradiotherapy in stage III non–small-cell lung cancer N Engl J Med 2017 377 1919 1929 10.1056/NEJMoa1709937 28885881 \n91. FDA grants regular approval to nivolumab for adjuvant treatment of melanoma. U.S. Food & Drug Administration. Updated December 21, 2017. https://www.fda.gov/drugs/informationondrugs/approveddrugs/ucm590004.htm. Accessed 19 Feb 2019.\n92. FDA Approves Merck’s KEYTRUDA® (pembrolizumab) for the Adjuvant Treatment of Patients with Melanoma with Involvement of Lymph Node(s) Following Complete Resection. Merck. Published February 19, 2019. https://bit.ly/2S89NmN. Accessed 19 Feb 2019.\n93. Krüger GR Berard CW DeLellis RA Graw RG Yankee RA Leventhal BG Graft-versus-host disease. Morphologic variation and differential diagnosis in 8 cases of HL-A matched bone marrow transplantation Am J Pathol 1971 63 179 202 4397431 \n94. Ferrara JLM Deeg HJ Graft-versus-host disease N Engl J Med 1991 324 667 674 10.1056/NEJM199103073241005 1994250 \n95. Maurice C Marcus B Mason W Guillain-barre syndrome after treatment with dabrafenib for metastatic recurrent melaloma. (P4.232) Neurology 2015 84 14 Supplement \n96. Garcia CR Cox JN Villano JL Myasthenia gravis and Guillain-barré syndrome adverse events with immune checkpoint inhibitors J Clin Oncol 2018 36 5_suppl 37 10.1200/JCO.2018.36.5_suppl.37 \n97. Hodi FS O’Day SJ McDermott DF Weber RW Sosman JA Haanen JB Improved survival with Ipilimumab in patients with metastatic melanoma N Engl J Med 2010 363 711 723 10.1056/NEJMoa1003466 20525992\n\n", "fulltext_license": "CC BY", "issn_linking": "2051-1426", "issue": "7(1)", "journal": "Journal for immunotherapy of cancer", "keywords": "Checkpoint inhibitor; Costimulatory agonist; Delayed toxicity; Immune-related adverse events; Immunotherapy", "medline_ta": "J Immunother Cancer", "mesh_terms": "D015551:Autoimmunity; D057210:Delayed Diagnosis; D006801:Humans; D007167:Immunotherapy", "nlm_unique_id": "101620585", "other_id": null, "pages": "165", "pmc": null, "pmid": "31269983", "pubdate": "2019-07-03", "publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't; D016454:Review", "references": "1994250;20516446;20525992;21639810;23049279;23652314;23774827;23942774;24278787;24590637;25619164;25682878;25839442;25888611;25918658;26079306;26176400;26274495;26300683;26337719;26371282;26410424;26715621;26765102;26822024;26874776;26885708;26946531;27031539;27058029;27269740;27318796;27563659;27592805;27852042;27890174;27920706;27943234;28068177;28419059;28434516;28475571;28595514;28689073;28822576;28841387;28843363;28881921;28885881;28889792;28891423;28938341;28945828;29093678;29162153;29250474;29344404;29392441;29408986;29442540;29472057;29516216;29559189;29565519;29623110;29658848;29666298;29784734;29792979;29909921;29951303;29983240;29983828;30018132;30027278;30064495;30073642;30077125;30093497;30136350;30170622;30213452;30231358;30242306;30361170;4397431", "title": "Delayed immune-related events (DIRE) after discontinuation of immunotherapy: diagnostic hazard of autoimmunity at a distance.", "title_normalized": "delayed immune related events dire after discontinuation of immunotherapy diagnostic hazard of autoimmunity at a distance" }
[ { "companynumb": "US-BRISTOL-MYERS SQUIBB COMPANY-BMS-2019-075197", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ACETAMINOPHEN" }, "drug...
{ "abstract": "OBJECTIVE\nCinacalcet is a calcimimetic drug that acts via calcium-sensing receptors (CaSRs) and increases the sensitivity of CaSRs on the parathyroid gland; thus, it lowers calcium and phosphorus levels as well as parathormone levels. Prolongation of the QT interval is recognized as a risk factor for the development of ventricular arrhythmias and sudden death. Patients with end-stage renal disease (ESRD) are sensitive for QT prolongation and torsade de pointes more than the normal population. In this study, we aimed to evaluate the effects of cinacalcet on the electrocardiogram (ECG), particularly changes in the QT interval, in patients with ESRD.\n\n\nMETHODS\nThirty-seven patients (21 males and 16 females) undergoing maintenance hemodialysis for at least 12 months were included in this retrospective study. Patients receiving cardioactive and antiarrhythmic drugs and those having a history of any cardiac or cerebrovascular events, active malignancy, and infections were excluded. Baseline ECG measurements of patients were performed over the newest ECG measurements that were obtained within 1 month before initiating the cinacalcet treatment, and the ECG measurements of patients after the cinacalcet treatment were performed according to the most recent ECG that was taken within the last 1 week in the clinic. We recorded the heart rate and QT values of patients before and after treatment and then calculated the corrected QT values (QTc). The Statistical Package for the Social Sciences (SPSS) ver. 21.0 was used for statistical analysis.\n\n\nRESULTS\nThe mean age of patients was 52.24±14.49 years. Prolongation of QTc was statistically significant compared with the baseline QTc value (baseline: 396.62±42.04 msec; after treatment: 404.97±43.47 msec; p=0.031). We found a positive correlation between the prolongation of QTc and treatment dose of cinacalcet (p<0.005, r=0.560).\n\n\nCONCLUSIONS\nClinicians should be very careful for life threatening cardiac side effects while increasing the dose of cinacalcet treatment in hemodialysis patients who have a borderline or prolonged QTc interval.", "affiliations": "Department of Nephrology, Faculty of Mecidine, Eskişehir Osmangazi University, Eskişehir-Turkey. gokhan_tem@hotmail.com.;Department of Nephrology, Faculty of Mecidine, Eskişehir Osmangazi University, Eskişehir-Turkey.;Department of Nephrology, Yunus Emre State Hospital, Eskişehir-Turkey.;Department of Nephrology, Faculty of Mecidine, Eskişehir Osmangazi University, Eskişehir-Turkey.;Department of Biostatistics, Faculty of Mecidine, Eskişehir Osmangazi University, Eskişehir-Turkey.", "authors": "Temiz|Gökhan|G|;Yalçın|Ahmet Uğur|AU|;Mutluay|Rüya|R|;Bozacı|İlter|İ|;Bal|Cengiz|C|", "chemical_list": null, "country": "Turkey", "delete": false, "doi": "10.5152/AnatolJCardiol.2015.6284", "fulltext": "\n==== Front\nAnatol J CardiolAnatol J CardiolAnatolian Journal of Cardiology2149-22632149-2271Kare Publishing Turkey AJC-16-52010.5152/AnatolJCardiol.2015.6284Original InvestigationEffects of cinacalcet treatment on QT interval in hemodialysis patients Temiz Gökhan Yalçın Ahmet Uğur Mutluay Rüya 1Bozacı İlter Bal Cengiz *Department of Nephrology, Faculty of Mecidine, Eskişehir Osmangazi University; Eskişehir-Turkey* Department of Biostatistics, Faculty of Mecidine, Eskişehir Osmangazi University; Eskişehir-Turkey1 Department of Nephrology, Yunus Emre State Hospital; Eskişehir-TurkeyAddress for correspondence: Dr. Gökhan Temiz, Eskişehir Osmangazi Üniversitesi Tıp Fakültesi, Nefroloji Bölümü 26140 Meselik, Eskişehir-Türkiye Phone: +90 222 239 29 79 - 2300 Mobile: +90 535 336 29 90 E-mail: gokhan_tem@hotmail.com7 2016 25 11 2015 16 7 520 523 14 10 2015 Copyright © 2016 Turkish Society of Cardiology2016This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International LicenseObjective:\nCinacalcet is a calcimimetic drug that acts via calcium-sensing receptors (CaSRs) and increases the sensitivity of CaSRs on the parathyroid gland; thus, it lowers calcium and phosphorus levels as well as parathormone levels. Prolongation of the QT interval is recognized as a risk factor for the development of ventricular arrhythmias and sudden death. Patients with end-stage renal disease (ESRD) are sensitive for QT prolongation and torsade de pointes more than the normal population. In this study, we aimed to evaluate the effects of cinacalcet on the electrocardiogram (ECG), particularly changes in the QT interval, in patients with ESRD.\n\nMethods:\nThirty-seven patients (21 males and 16 females) undergoing maintenance hemodialysis for at least 12 months were included in this retrospective study. Patients receiving cardioactive and antiarrhythmic drugs and those having a history of any cardiac or cerebrovascular events, active malignancy, and infections were excluded. Baseline ECG measurements of patients were performed over the newest ECG measurements that were obtained within 1 month before initiating the cinacalcet treatment, and the ECG measurements of patients after the cinacalcet treatment were performed according to the most recent ECG that was taken within the last 1 week in the clinic. We recorded the heart rate and QT values of patients before and after treatment and then calculated the corrected QT values (QTc). The Statistical Package for the Social Sciences (SPSS) ver. 21.0 was used for statistical analysis.\n\nResults:\nThe mean age of patients was 52.24±14.49 years. Prolongation of QTc was statistically significant compared with the baseline QTc value (baseline: 396.62±42.04 msec; after treatment: 404.97±43.47 msec; p=0.031). We found a positive correlation between the prolongation of QTc and treatment dose of cinacalcet (p<0.005, r=0.560).\n\nConclusion:\nClinicians should be very careful for life-threatening cardiac side effects while increasing the dose of cinacalcet treatment in hemodialysis patients who have a borderline or prolonged QTc interval.\n\ncalcimimeticscinacalcetQT intervalTorsade de Pointes\n==== Body\nIntroduction\nCinacalcet is a calcimimetic agent which increases the sensitivity of the calcium-sensing receptor (CaSR) to extracellular calcium (Ca), and this leads to the reduced release of parathormone (PTH) (1, 2). CaSR is a member of the subfamily C of G protein-coupled receptors (GPCRs) (3). The activation of the receptor by an increase in extracellular Ca initiates a signal transduction through pathways that had been demonstrated previously to be linked directly to a decrease in PTH release from parathyroid cells (4, 5). As a calcimimetic drug, cinacalcet is used to lower PTH, serum Ca, and serum phosphorus levels; hence, it prevents progressive bone disease and comorbid situations associated with secondary hyperparathyroidism and mineral metabolism disorders. The mechanism of action is through CaSRs. It increases the sensitivity of CaSRs on the parathyroid gland and as a result it lowers Ca and phosphorus levels as well as PTH levels (6). CaSR belongs to a member of GPCR, and it has been identified in many tissues such as the thyroid, kidney, bone, gastrointestinal tract, and heart (7–11). As allosteric modulators of these receptors, calcimimetics and therefore cinacalcet may have many effects beyond lowering of PTH levels. It is currently not well-known whether all of these effects of calcimimetics are due to lowering PTH levels or they have direct effects on target tissues such as the heart. As an essential cation, Ca regulates and maintains many cell functions, one of which is the cardiac heart cells. In both cardiac and skeletal muscles, cross bridges are activated by increasing the intracellular free Ca level that regulates the troponin-tropomyosin system; thus, changes in serum Ca levels may alter the cardiac contractility and therefore result in changes in the electrocardiogram (ECG) (12). The QT interval is a measure of the time between the start of the Q wave and the end of the T wave in the heart’s electrical cycle. The QT interval represents electrical depolarization and repolarization of the ventricles. torsade de pointes is a form of polymorphic ventricular tachycardia occurring in a setting of prolonged QT interval on the surface ECG. It has been reported that QTc interval prolongation and torsade de pointes is associated with end-stage renal disease (ESRD) and that they can be a cause of sudden death in ESRD (13, 14). Hypocalcaemia influences cardiac repolarization by inducing prolongation of the QT interval, which represents the electrical depolarization and repolarization of the ventricles. Prolongation of the QT interval is recognized as a risk factor for the development of ventricular arrhythmias and sudden death. In this study, we aimed to evaluate the effects of cinacalcet on Ca and ECG as a widely used calcimimetic agent in patients with renal failure.\n\nMethods\nPatient selection\nOur study was a retrospective study, and 37 adult uremic patients undergoing maintenance hemodialysis for at least 12 months were enrolled for this study. Patients receiving cardioactive drugs such as beta blockers, alpha blockers, or any antiarrhythmic medication; those with a history of cerebrovascular disease, coronary artery disease, left ventricular hypertrophy, cardiac valve disease, and bundle brunch block, those having cinacalcet treatment duration of less than 6 months, those receiving medications that may prolong the QT interval, those with heart failure, active infection, or malignancy, and those with dilated cardiomyopathy were excluded. Patients were eligible if they were free from any acute cardiovascular disease or arrhythmias. Hemodialysis was performed in three 4-h sessions per week, and all patients were dialyzed with a minimum of 1.25 mmoL Ca dialysate. The adequacy of dialysis was assessed by Kt/V urea, using the urea kinetic model of Gotch (15); patients with a Kt/V value higher than 1.2 were selected for the study. Data including age, gender, duration of cinacalcet treatment, dose of cinacalcet, and corrected Ca and intact parathormone (iPTH) levels before and after treatment were reviewed and recorded. The baseline ECG measurements of patients were performed over the newest ECG measurements that were obtained within 1 month before initiating the cinacalcet treatment, and the ECG measurements of patients after the cinacalcet treatment were performed according to the most recent ECG that was taken within the last 1 week in the clinic. ECG measurements were recorded with a standard resting 12-lead ECG (Nihon Kohden EXG-9022, Nihon Kohden Corporation, Tokyo, Japan) at a paper speed of 25 mm/s after more than 5 min of rest. The space between the start of the Q wave and the end of the T wave was defined as the QT interval, and the interval from the peak of one QRS complex to the peak of the next QRS complex was defined as the R-R interval (Fig. 1). We recorded the heart rate and QT values of patients before and after treatment and then calculated the corrected QT values (QTc) according to Bazett’s formula (QTc interval = QT interval/square root of R-R interval).\n\nFigure 1 Definition of the QT interval and RR interval\n\nAll analyses were performed using the Statistical Package for the Social Sciences (SPSS) for Windows version 21.0, and all the data were expressed as the mean ± standard deviation (SD). A p value of less than 0.05 was considered significant. Categorical variables were compared using the Mann–Whitney U test or Kruskal–Wallis test. Shapiro–Wilk’s test was used for the determination of normal distribution. Wilcoxon’s test was used for the comparison of parameters before and after treatment. Spearman’s correlation analysis was used for the comparison of data.\n\nResults\nThe mean age of the subjects was 52.24±14.49 years. The mean corrected serum Ca levels before and after treatment were as follows: baseline 9.22±0.85 mg/dL and after treatment 9.08±0.65 mg/dL. The mean serum iPTH levels before and after treatment were as follows: baseline 1405±590 pg/mL and after treatment 1186±564 pg/mL. The mean duration of cinacalcet treatment was 13.45±6.52 months, and the mean Kt/V value of patients was 1.47±0.20. The decrease in serum Ca levels before and after treatment was not statistically significant (p=0.182) but serum iPTH levels decreased significantly after treatment (p=0.031). Prolongation of QTc was statistically significant compared with the baseline QTc value (baseline: 396.62±42.04 msec; after treatment: 404.97±43.47 msec; p=0.031). The division of patients according to the cinacalcet dose is shown in Table 1. We found a positive correlation between the prolongation of QTc and treatment dose of cinacalcet (r=0.560, p<0.005), (Fig. 2). There was no correlation between the duration of cinacalcet treatment and changes in serum Ca levels and QTc (r=0.253, p=0.131 and r=0.188, p=0.265, respectively). There was a statistically significant correlation between the decrease in iPTH levels and the dose of cinacalcet treatment (r=0.366, p=0.02). There was also a statistically significant correlation between the decrease in iPTH levels and the prolongation of QTc (r=0.327, p=0.048). There was no arrhythmia during the period of cinacalcet treatment, and there was no statistically significant difference between male and female subjects according to the QT change before and after treatment with cinacalcet (p=0.057).\n\nTable 1 Distribution of patients according to the dose of cinacalcet\n\nDose of Cinacalcet (mg)\tNumber of patients\t\n30\t17\t\n60\t9\t\n90\t7\t\n>120\t4\t\nFigure 2 Correlation between the cinacalcet dose and changes on the QT interval. The X-axis shows the cinacalcet dose of patients, while the Y-axis shows the changes in msec according to the baseline QT interval (SPSS 21.0 for Windows)\n\nDiscussion\nIn our study, both baseline and after treatment QTc values were in the normal range. However, interestingly, with an increased dose of cinacalcet treatment, the QTc interval of patients was significantly prolonged. Furthermore, this prolongation was not related with both baseline and after treatment levels of Ca of hemodialysis patients. This was important because previous studies such as those of Borrego-Utiel et al. (16) reported a QTc prolongation related with baseline Ca levels and hypocalcaemia. Figure 3 shows an ECG sample of a prolonged QT after cinacalcet treatment. In the setting of chronic kidney disease, long-term treatment with cinacalcet has proven to be efficient in controlling PTH levels and subsequently Ca and P levels (6). CaSR was originally cloned from parathyroid chief cells in 1993; however, the existence of CaSR has also been subsequently identified in the thyroid, kidney, bone, and gastrointestinal tract tissues, which participate in the regulation of systemic Ca homeostasis (8–11, 17). In 2003, the expression of CaSR in cardiac tissues was shown and also revealed that the activation of CaSR leads to intracellular Ca release via G protein-phospholipase C-inositol, 4,5-triphosphate pathway (18). It has been shown that calcimimetics have some beneficial effects such as lowering the blood pressure and improving cardiac morphology, but it is currently unknown that all of these effects of calcimimetics on the cardiovascular system or other target tissues are a result of lowering PTH levels or that calcimimetics have some direct effects on the heart and other tissues (19, 20).\n\nFigure 3 The ECG samples of a patient before (a) and after (b) cinacalcet treatment\n\nOur study also showed that cinacalcet was really effective for reducing increased iPTH levels, particularly in higher doses as an expected effect from itself. Therefore, we found a positive correlation between the decrease in iPTH levels and prolongation of QTc. The decrease in iPTH levels without causing hypocalcemia a simultaneous prolongation of QTc in hemodialysis patients led us to hypothesize that cinacalcet, particularly in higher doses, may cause some dose-related but Ca-independent effects outside the parathyroid gland such as the heart. These results were important because hemodialysis patients were already sensitive to the prolongation of QTc and torsade de pointes. Recently, increasing the use of cinacalcet for the treatment of secondary hyperparathyroidism in dialysis patients may increase the risk for torsade de pointes and sudden cardiac death, particularly in high doses or in patients who have an already prolonged QTc interval.\n\nStudy limitations\nOur study has some limitations. First, this study was a retrospective study. It would be better to design prospective studies to evaluate the cardiac effects of cinacalcet. Second, the number of patients in our study was not sufficient to make a definitive conclusion for the cardiac effects of cinacalcet; however, the results of this study were important. Third, because this is a retrospective study, we aimed to evaluate the effects of cinacalcet in hemodialysis patients; therefore, we did not have a control group, and thus, we were unable to define a threshold dose for the development of QT prolongation that could be attributable to cinacalcet treatment. Finally, we did not evaluate the intra- and inter-observer variability of QT duration measurements.\n\nConclusion\nIn conclusion, we found that increasing the dose of cinacalcet treatment was related with the significant prolongation of the QTc interval of hemodialysis patients according to the baseline values. Clinicians should be extremely careful about life-threatening cardiac side effects while increasing the dose of cinacalcet treatment, particularly in hemodialysis patients who have a borderline or prolonged QTc interval. We thought that sufficient consideration should be given to ECG and QTc measurements in daily practice in dialysis clinics, particularly in patients receiving cinacalcet treatment.\n\nConflict of interest: None declared.\n\nPeer-review: Externally peer-reviewed.\n\nAuthor contributions: Concept- A.U.Y.; Design – A.U.Y., G.T.; Supervision – G.T.; Funding- G.T.; Materials- G.T.; Data collection and/or processing – G.T., R.M., İ.B.; Analysis and/or Interpretation – G.T.; Literature search – G.T.; Writing – G.T.; Critical review – G.T.; Others-C.B.\n==== Refs\nReferences\n1 Hammerland LG Garrett JE Hung BC Levinthal C Nemeth EF Allosteric activation of the Ca2+receptor expressed in Xenopus laevis oocytes by NPS 467 or NPS 568 Mol Pharmacol 1998 53 1083 8 9614212 \n2 Nemeth EF Steffey ME Hammerland LG Hung BC Van Wagenen BC DelMar EG Calcimimetics with potent and selective activity on the parathyroid calcium receptor Proc Natl Acad Sci U S A 1998 95 4040 5 9520489 \n3 Brown EM MacLeod RJ Extracellular calcium sensing and extracellular calcium signaling Physiol Rev 2001 81 239 97 11152759 \n4 Muff R Nemeth EF Haller-Brem S Fischer JA Regulation of hormone secretion and cytosolic Ca2+by extracellular Ca2+in parathyroid cells and C-cells: role of voltage-sensitive Ca2+channels Arch Biochem Biophys 1988 265 128 35 2458067 \n5 Nemeth EF Scarpa A Rapid mobilization of cellular Ca2+in bovine parathyroid cells evoked by extracellular divalent cations. Evidence for a cell surface calcium receptor J Biol Chem 1987 262 5188 96 3558389 \n6 Block GA Martin KJ de Francisco AL Turner SA Avram MM Suranyi MG Cinacalcet for secondary hyperparathyroidism in patients receiving hemodialysis N Engl J Med 2004 350 1516 25 15071126 \n7 Qi H Cao Y Huang W Liu Y Wang Y Li L Crucial role of calcium-sensing receptor activation in cardiac injury of diabetic rats PLoS One 2013 22 8 e65147 \n8 McGehee DS Aldersberg M Liu KP Hsuing S Heath MJ Tamir H Mechanism of extracellular Ca2+receptor-stimulated hormone release from sheep thyroid parafollicular cells J Physiol 1997 502 31 44 9234195 \n9 Kwak JO Kwak J Kim HW Oh KJ Kim YT Jung SM The extracellular calcium sensing receptor is expressed in mouse mesangial cells and modulates cell proliferation Exp Mol Med 2005 37 457 65 16264270 \n10 Jung SY Kwak JO Kim HW Kim DS Ryu SD Ko CB Calcium sensing receptor forms complex with and is up-regulated by caveolin-1 in cultured human osteosarcoma (Saos-2) cells Exp Mol Med 2005 37 91 100 15886522 \n11 Bevilacqua M Dominguez LJ Righini V Valdes V Toscano R Sangaletti O Increased gastrin and calcitonin secretion after oral calcium or peptones administration in patients with hypercalciuria: a clue to an alteration in calcium-sensing receptor activity J Clin Endocrinol Metab 2005 90 1489 94 15613438 \n12 Rüegg JC Cardiac contractility: how calcium activates the myofilaments Naturwissenschaften 1998 85 575 82 9871917 \n13 Stewart GA Gansevoort RT Mark PB Rooney E McDonagh TA Dargie HJ Electrocardiographic abnormalities and uremic cardiomyopathy Kidney Int 2005 67 217 26 15610245 \n14 Patanè S Marte F Di Bella G Currò A Coglitore S QT interval prolongation, torsade de pointes and renal disease Int J Cardiol 2008 12 130 71 3 \n15 Gotch FA Sargent JA A mechanistic analysis of the National Cooperative Dialysis Study (NCDS) Kidney Int 1985 28 526 34 3934452 \n16 Borrego-Utiel FJ Pérez-del Barrio Mdel P Biechy-Baldan Mdel M Segura-Torres P Cinacalcet may prolong the QT interval in patients on haemodialysis with secondary hyperparathyroidism Nefrologia 2013 33 272 3 23511764 \n17 Brown EM Gamba G Riccardi D Lombardi M Butters R Kifor O Cloning and characterization of an extracellular Ca(2+)-sensing receptor from bovine parathyroid Nature 1993 366 575 80 8255296 \n18 Wang R Xu C Zhao W Zhang J Cao K Yang B Calcium and polyamine regulated calcium-sensing receptors in cardiac tissues Eur J Biochem 2003 270 2680 8 12787035 \n19 Schmitt CP Odenwald T Ritz E Calcium, calcium regulatory hormones, and calcimimetics: impact on cardiovascular mortality J Am Soc Nephrol 2006 17 78 80 \n20 Odenwald T Nakagawa K Hadtstein C Roesch F Gohlke P Ritz E Acute blood pressure effects and chronic hypotensive action of calcimimetics in uremic rats J Am Soc Nephrol 2006 17 655 62 16421225\n\n", "fulltext_license": "CC BY-NC-SA", "issn_linking": "2149-2263", "issue": "16(7)", "journal": "Anatolian journal of cardiology", "keywords": null, "medline_ta": "Anatol J Cardiol", "mesh_terms": null, "nlm_unique_id": "101652981", "other_id": null, "pages": "520-523", "pmc": null, "pmid": "27004702", "pubdate": "2016-07", "publication_types": "D016428:Journal Article", "references": "15886522;15613438;9234195;18255176;9871917;23717692;12787035;15610245;15071126;2458067;23511764;3934452;3558389;16264270;16421225;9614212;16565253;8255296;11152759;9520489", "title": "Effects of cinacalcet treatment on QT interval in hemodialysis patients.", "title_normalized": "effects of cinacalcet treatment on qt interval in hemodialysis patients" }
[ { "companynumb": "TR-AMGEN-TURSP2016166965", "fulfillexpeditecriteria": "1", "occurcountry": "TR", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "CALCIUM" }, "drugadditional": null, ...
{ "abstract": "Retinopathy of prematurity (ROP) is a serious problem of preterm infants which may lead to impairment of vision and even to blindness if untreated. Routine eye examination is necessary for early diagnosis and treatment of ROP in preterm infants. Mydriatic eye drops (cyclopentolate, tropicamide and phenylephrine) are applied before the ophthalmic examination. These agents are rarely absorbed to systemic circulation and in some cases result with serious side effects like skin rash, tachycardia, feeding intolerance, discomfort, apnea, gastric dilatation and ileus, despite different treatment models and dosage reducing strategies. We report here a preterm patient who died because of severe diffuse necrotizing enterocolitis (NEC) after topical application of 0.5% cyclopentolate and 1.25% phenylephrine during ROP screening to emphasise the serious side effects of these agents.", "affiliations": "Department of Pediatrics, Division of Neonatology, Ege University, Faculty of Medicine, Izmir, Turkey.;Department of Pediatrics, Division of Neonatology, Ege University, Faculty of Medicine, Izmir, Turkey.;Department of Pediatrics, Division of Neonatology, Ege University, Faculty of Medicine, Izmir, Turkey.;Department of Pediatric Surgery, Ege University, Faculty of Medicine, Izmir, Turkey.;Department of Pathology, Ege University, Faculty of Medicine, Izmir, Turkey.;Department of Pediatrics, Division of Neonatology, Ege University, Faculty of Medicine, Izmir, Turkey.;Department of Pediatrics, Division of Neonatology, Ege University, Faculty of Medicine, Izmir, Turkey.", "authors": "Ozgun|Uygur|U|;Demet|Terek|T|;Ozge|Koroglu A|KA|;Zafer|Dokumcu|D|;Murat|Sezak|S|;Mehmet|Yalaz|Y|;Nilgun|Kultursay|K|", "chemical_list": "D009184:Mydriatics; D009883:Ophthalmic Solutions; D010656:Phenylephrine; D003519:Cyclopentolate", "country": "Pakistan", "delete": false, "doi": "05.2014/JCPSP.S147S149", "fulltext": null, "fulltext_license": null, "issn_linking": "1022-386X", "issue": "24 Suppl 2()", "journal": "Journal of the College of Physicians and Surgeons--Pakistan : JCPSP", "keywords": null, "medline_ta": "J Coll Physicians Surg Pak", "mesh_terms": "D001794:Blood Pressure; D003519:Cyclopentolate; D020345:Enterocolitis, Necrotizing; D017809:Fatal Outcome; D005865:Gestational Age; D006801:Humans; D007231:Infant, Newborn; D007235:Infant, Premature, Diseases; D009184:Mydriatics; D009883:Ophthalmic Solutions; D010656:Phenylephrine; D011680:Pupil; D012178:Retinopathy of Prematurity", "nlm_unique_id": "9606447", "other_id": null, "pages": "S147-9", "pmc": null, "pmid": "24906272", "pubdate": "2014-05", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Fatal necrotising enterocolitis due to mydriatic eye drops.", "title_normalized": "fatal necrotising enterocolitis due to mydriatic eye drops" }
[ { "companynumb": "TR-BAUSCH-BL-2014-003088", "fulfillexpeditecriteria": "1", "occurcountry": "TR", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "PHENYLEPHRINE\\PHENYLEPHRINE HYDROCHLORIDE" }, ...
{ "abstract": "The propofol levels in the blood and tissues of a 37-year-old Chinese male suspected of having fatally self-administered an intravenous dose of 1600 mg of propofol (12.3-15.4 times the dose required for the induction of anaesthesia) were determined by headspace gas chromatography. The blood (femoral), liver, kidney and brain propofol levels were 2.5 micrograms/ml, 22 micrograms/g, 3.6 micrograms/g and 11.3 micrograms/g, respectively. The blood propofol level in the present case is 11.4 times and the liver propofol level is 15.7 times that of the first propofol overdose reported in the literature.", "affiliations": "Institute of Science and Forensic Medicine, National Blood Centre, Singapore.", "authors": "Chao|T C|TC|;Lo|D S|DS|;Chui|P P|PP|;Koh|T H|TH|", "chemical_list": "D015742:Propofol", "country": "Ireland", "delete": false, "doi": "10.1016/0379-0738(94)90314-x", "fulltext": null, "fulltext_license": null, "issn_linking": "0379-0738", "issue": "66(1)", "journal": "Forensic science international", "keywords": null, "medline_ta": "Forensic Sci Int", "mesh_terms": "D000328:Adult; D001923:Brain Chemistry; D002849:Chromatography, Gas; D017809:Fatal Outcome; D006801:Humans; D007668:Kidney; D008099:Liver; D008297:Male; D015742:Propofol; D013405:Suicide", "nlm_unique_id": "7902034", "other_id": null, "pages": "1-7", "pmc": null, "pmid": "7927085", "pubdate": "1994-05-25", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "The first fatal 2,6-di-isopropylphenol (propofol) poisoning in Singapore: a case report.", "title_normalized": "the first fatal 2 6 di isopropylphenol propofol poisoning in singapore a case report" }
[ { "companynumb": "US-PFIZER INC-2017437662", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "PROPOFOL" }, "drugadditional": null, ...
{ "abstract": "Neoadjuvant chemotherapy before surgery improves survival compared with surgery alone for patients with oesophageal cancer. The OE05 trial assessed whether increasing the duration and intensity of neoadjuvant chemotherapy further improved survival compared with the current standard regimen.\n\n\n\nOE05 was an open-label, phase 3, randomised clinical trial. Patients with surgically resectable oesophageal adenocarcinoma classified as stage cT1N1, cT2N1, cT3N0/N1, or cT4N0/N1 were recruited from 72 UK hospitals. Eligibility criteria included WHO performance status 0 or 1, adequate respiratory, cardiac, and liver function, white blood cell count at least 3 × 109 cells per L, platelet count at least 100 × 109 platelets per L, and a glomerular filtration rate at least 60 mL/min. Participants were randomly allocated (1:1) using a computerised minimisation program with a random element and stratified by centre and tumour stage, to receive two cycles of cisplatin and fluorouracil (CF; two 3-weekly cycles of cisplatin [80 mg/m2 intravenously on day 1] and fluorouracil [1 g/m2 per day intravenously on days 1-4]) or four cycles of epirubicin, cisplatin, and capecitabine (ECX; four 3-weekly cycles of epirubicin [50 mg/m2] and cisplatin [60 mg/m2] intravenously on day 1, and capecitabine [1250 mg/m2] daily throughout the four cycles) before surgery, stratified according to centre and clinical disease stage. Neither patients nor study staff were masked to treatment allocation. Two-phase oesophagectomy with two-field (abdomen and thorax) lymphadenectomy was done within 4-6 weeks of completion of chemotherapy. The primary outcome measure was overall survival, and primary and safety analyses were done in the intention-to-treat population. This trial is registered with the ISRCTN registry (number 01852072) and ClinicalTrials.gov (NCT00041262), and is completed.\n\n\n\nBetween Jan 13, 2005, and Oct 31, 2011, 897 patients were recruited and 451 were assigned to the CF group and 446 to the ECX group. By Nov 14, 2016, 327 (73%) of 451 patients in the CF group and 302 (68%) of 446 in the ECX group had died. Median survival was 23·4 months (95% CI 20·6-26·3) with CF and 26·1 months (22·5-29·7) with ECX (hazard ratio 0·90 (95% CI 0·77-1·05, p=0·19). No unexpected chemotherapy toxicity was seen, and neutropenia was the most commonly reported event (grade 3 or 4 neutropenia: 74 [17%] of 446 patients in the CF group vs 101 [23%] of 441 people in the ECX group). The proportions of patients with postoperative complications (224 [56%] of 398 people for whom data were available in the CF group and 233 [62%] of 374 in the ECX group; p=0·089) were similar between the two groups. One patient in the ECX group died of suspected treatment-related neutropenic sepsis.\n\n\n\nFour cycles of neoadjuvant ECX compared with two cycles of CF did not increase survival, and cannot be considered standard of care. Our study involved a large number of centres and detailed protocol with comprehensive prospective assessment of health-related quality of life in a patient population confined to people with adenocarcinomas of the oesophagus and gastro-oesophageal junction (Siewert types 1 and 2). Alternative chemotherapy regimens and neoadjuvant chemoradiation are being investigated to improve outcomes for patients with oesophageal carcinoma.\n\n\n\nCancer Research UK and Medical Research Council Clinical Trials Unit at University College London.", "affiliations": "Queen Elizabeth Hospital, Birmingham, UK.;The Royal Marsden NHS Foundation Trust, London, UK. Electronic address: david.cunningham@rmh.nhs.uk.;Medical Research Council Clinical Trials Unit at UCL, London, UK.;Centre for Surgical Research, University of Bristol, Bristol and University Hospitals Bristol NHS Foundation Trust, Bristol, UK.;The Northern Oesophago-Gastric Cancer Unit, Royal Victoria Infirmary, Newcastle Upon Tyne, UK.;Leeds Teaching Hospital NHS Trust, Leeds, UK.;Leeds Institute of Cancer and Pathology, University of Leeds, Leeds, UK; Department of Pathology, GROW School for Oncology and Developmental Biology, Maastricht University Medical Center, Maastricht, Netherlands.;University of Bern, Bern, Germany.;University Hospital South Manchester, Manchester, UK.;The Royal Marsden NHS Foundation Trust, London, UK.;Royal United Hospital, Bath, UK.;The Northern Oesophago-Gastric Cancer Unit, Royal Victoria Infirmary, Newcastle Upon Tyne, UK.;Birmingham Heartlands Hospital, Birmingham, UK.;Bristol and University Hospitals Bristol NHS Foundation Trust, Bristol, UK.;St George's, University of London, London, UK.;Medical Research Council Clinical Trials Unit at UCL, London, UK.;Medical Research Council Clinical Trials Unit at UCL, London, UK.", "authors": "Alderson|Derek|D|;Cunningham|David|D|;Nankivell|Matthew|M|;Blazeby|Jane M|JM|;Griffin|S Michael|SM|;Crellin|Adrian|A|;Grabsch|Heike I|HI|;Langer|Rupert|R|;Pritchard|Susan|S|;Okines|Alicia|A|;Krysztopik|Richard|R|;Coxon|Fareeda|F|;Thompson|Joyce|J|;Falk|Stephen|S|;Robb|Clare|C|;Stenning|Sally|S|;Langley|Ruth E|RE|", "chemical_list": "D000970:Antineoplastic Agents; D015251:Epirubicin; D000069287:Capecitabine; D002945:Cisplatin; D005472:Fluorouracil", "country": "England", "delete": false, "doi": "10.1016/S1470-2045(17)30447-3", "fulltext": "\n==== Front\nLancet OncolLancet OncolThe Lancet. Oncology1470-20451474-5488Lancet Pub. Group S1470-2045(17)30447-310.1016/S1470-2045(17)30447-3ArticlesNeoadjuvant cisplatin and fluorouracil versus epirubicin, cisplatin, and capecitabine followed by resection in patients with oesophageal adenocarcinoma (UK MRC OE05): an open-label, randomised phase 3 trial Alderson Derek ProfMDa†Cunningham David ProfMDdavid.cunningham@rmh.nhs.ukb†*Nankivell Matthew MSccBlazeby Jane M MDdGriffin S Michael ProfMDeCrellin Adrian FRCRfGrabsch Heike I ProfPhDghLanger Rupert ProfMDiPritchard Susan MBChBjOkines Alicia MDbKrysztopik Richard MDkCoxon Fareeda MBBSeThompson Joyce FRCPlFalk Stephen MDmRobb Clare BScnStenning Sally ProfMSccLangley Ruth E ProfPhDca Queen Elizabeth Hospital, Birmingham, UKb The Royal Marsden NHS Foundation Trust, London, UKc Medical Research Council Clinical Trials Unit at UCL, London, UKd Centre for Surgical Research, University of Bristol, Bristol and University Hospitals Bristol NHS Foundation Trust, Bristol, UKe The Northern Oesophago-Gastric Cancer Unit, Royal Victoria Infirmary, Newcastle Upon Tyne, UKf Leeds Teaching Hospital NHS Trust, Leeds, UKg Leeds Institute of Cancer and Pathology, University of Leeds, Leeds, UKh Department of Pathology, GROW School for Oncology and Developmental Biology, Maastricht University Medical Center, Maastricht, Netherlandsi University of Bern, Bern, Germanyj University Hospital South Manchester, Manchester, UKk Royal United Hospital, Bath, UKl Birmingham Heartlands Hospital, Birmingham, UKm Bristol and University Hospitals Bristol NHS Foundation Trust, Bristol, UKn St George's, University of London, London, UK* Correspondence to: Prof David Cunningham, The Royal Marsden NHS Foundation Trust, Fulham Road, London SW3 6JJ, UKCorrespondence to: Prof David CunninghamThe Royal Marsden NHS Foundation TrustFulham RoadLondonSW3 6JJUK david.cunningham@rmh.nhs.uk† Joint first authors\n\n1 9 2017 9 2017 18 9 1249 1260 © 2017 The Author(s). Published by Elsevier Ltd. This is an Open Access article under the CC BY 4.0 license2017This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).Summary\nBackground\nNeoadjuvant chemotherapy before surgery improves survival compared with surgery alone for patients with oesophageal cancer. The OE05 trial assessed whether increasing the duration and intensity of neoadjuvant chemotherapy further improved survival compared with the current standard regimen.\n\nMethods\nOE05 was an open-label, phase 3, randomised clinical trial. Patients with surgically resectable oesophageal adenocarcinoma classified as stage cT1N1, cT2N1, cT3N0/N1, or cT4N0/N1 were recruited from 72 UK hospitals. Eligibility criteria included WHO performance status 0 or 1, adequate respiratory, cardiac, and liver function, white blood cell count at least 3 × 109 cells per L, platelet count at least 100 × 109 platelets per L, and a glomerular filtration rate at least 60 mL/min. Participants were randomly allocated (1:1) using a computerised minimisation program with a random element and stratified by centre and tumour stage, to receive two cycles of cisplatin and fluorouracil (CF; two 3-weekly cycles of cisplatin [80 mg/m2 intravenously on day 1] and fluorouracil [1 g/m2 per day intravenously on days 1–4]) or four cycles of epirubicin, cisplatin, and capecitabine (ECX; four 3-weekly cycles of epirubicin [50 mg/m2] and cisplatin [60 mg/m2] intravenously on day 1, and capecitabine [1250 mg/m2] daily throughout the four cycles) before surgery, stratified according to centre and clinical disease stage. Neither patients nor study staff were masked to treatment allocation. Two-phase oesophagectomy with two-field (abdomen and thorax) lymphadenectomy was done within 4–6 weeks of completion of chemotherapy. The primary outcome measure was overall survival, and primary and safety analyses were done in the intention-to-treat population. This trial is registered with the ISRCTN registry (number 01852072) and ClinicalTrials.gov (NCT00041262), and is completed.\n\nFindings\nBetween Jan 13, 2005, and Oct 31, 2011, 897 patients were recruited and 451 were assigned to the CF group and 446 to the ECX group. By Nov 14, 2016, 327 (73%) of 451 patients in the CF group and 302 (68%) of 446 in the ECX group had died. Median survival was 23·4 months (95% CI 20·6–26·3) with CF and 26·1 months (22·5–29·7) with ECX (hazard ratio 0·90 (95% CI 0·77–1·05, p=0·19). No unexpected chemotherapy toxicity was seen, and neutropenia was the most commonly reported event (grade 3 or 4 neutropenia: 74 [17%] of 446 patients in the CF group vs 101 [23%] of 441 people in the ECX group). The proportions of patients with postoperative complications (224 [56%] of 398 people for whom data were available in the CF group and 233 [62%] of 374 in the ECX group; p=0·089) were similar between the two groups. One patient in the ECX group died of suspected treatment-related neutropenic sepsis.\n\nInterpretation\nFour cycles of neoadjuvant ECX compared with two cycles of CF did not increase survival, and cannot be considered standard of care. Our study involved a large number of centres and detailed protocol with comprehensive prospective assessment of health-related quality of life in a patient population confined to people with adenocarcinomas of the oesophagus and gastro-oesophageal junction (Siewert types 1 and 2). Alternative chemotherapy regimens and neoadjuvant chemoradiation are being investigated to improve outcomes for patients with oesophageal carcinoma.\n\nFunding\nCancer Research UK and Medical Research Council Clinical Trials Unit at University College London.\n==== Body\nIntroduction\nMeta-analyses of randomised trials support the use of neoadjuvant chemotherapy or chemoradiotherapy before surgical resection of locally advanced oesophageal cancer to improve survival.1, 2 Older clinical studies were dominated by squamous cell carcinoma3, 4, 5, 6, 7, 8, 9, 10, 11, 12 but the increasing incidence of oesophageal adenocarcinoma, particularly in high-income countries in the past 30 years, indicates a changing epidemiology. Most trials recruited patients with either squamous cell carcinoma or adenocarcinoma13, 14, 15, 16, 17, 18, 19, 20 and although they were unable to show a survival difference between these two histological tumour types, none of the studies were specifically powered to detect any such difference. Few studies have been done only in patients with oesophageal adenocarcinoma.21, 22, 23, 24\n\nResearch in context\nEvidence before this study\n\nOn Jan 12 and 13, 2017, we searched PubMed and the abstracts of major conferences such as the American Society of Clinical Oncology for publications in English, with no publication date restrictions. The search terms used were “chemotherapy”, “neo-adjuvant (or neoadjuvant)”, and “oesophageal (or esophageal)”. We identified two meta-analyses comparing neoadjuvant chemotherapy with surgery alone in patients with oesophageal cancer. These meta-analyses showed a significant survival benefit after treatment with neoadjuvant chemotherapy, both overall and for the subset of patients with adenocarcinoma who were considered in this study. These meta-analyses were unable to assess the benefits of different neoadjuvant chemotherapy regimens, and we can identify no phase 3 randomised trials that have directly compared different regimens.\n\nAdded value of this study\n\nTo our knowledge, this is the largest randomised trial investigating whether an alternative neoadjuvant chemotherapy regimen might offer a survival benefit over the standard of two cycles of cisplatin and fluorouracil (CF). This trial showed that giving four cycles of epirubicin, cisplatin, and capecitabine (ECX) neoadjuvantly might increase the level of tumour regression, but does not lead to any survival benefit.\n\nImplications of all available evidence\n\nFor patients with oesophageal adenocarcinoma, two cycles of CF should remain the standard choice of neoadjuvant chemotherapy regimen. Further research is ongoing into the use of neoadjuvant chemoradiotherapy, but little evidence exists that directly compares it to neoadjuvant chemotherapy.\n\n\n\nHigh-quality data on the effect of neoadjuvant chemotherapy or chemoradiotherapy on health-related quality of life (HRQL) are scarce; more information is needed for clinical decision making, where small survival benefits might only be achieved with detrimental effects on many aspects of HRQL.\n\nThe results of the previous Medical Research Council (MRC) OE02 randomised clinical trial19 showed a survival advantage at 2 years with neoadjuvant chemotherapy and surgery over surgery alone (43% vs 34%; 9% increase [95% CI 3–14]), with a hazard ratio (HR) of 0·79 (95% CI 0·67–0·93), so two-cycle cisplatin with fluorouracil was used for the control group in this study. The randomised clinical MRC MAGIC trial25 assessed a regimen of three cycles of preoperative chemotherapy (epirubicin, cisplatin, and fluorouracil) followed by surgery and three postoperative cycles of chemotherapy in patients with gastric and oesophageal adenocarcinoma. The results showed a 5-year survival of 36% (95% CI 30–43) for perioperative chemotherapy and surgery compared with 23% (17–29) for surgery alone (overall survival HR 0·75, 95% CI 0·60–0·93).25 Because 45% of participants in the MAGIC trial (34% of people who had surgery) did not receive postoperative treatment (a similar pattern was also seen in the FFCD-FNCLCC 9703 trial22), we concluded that further assessment of perioperative chemotherapy would be challenging and it was decided that increased neoadjuvant therapy would be the best strategy. Oral capecitabine is readily available and has been shown to be equivalent to intravenous fluorouracil in colorectal cancer,26 so we decided to investigate four cycles of neoadjuvant epirubicin, cisplatin, and capecitabine (ECX) as the investigational group without postoperative chemotherapy. Given the results of the MAGIC trial, increasing the duration of neoadjuvant chemotherapy from two cycles to four cycles and adding anthracycline to the established doublet regimen was considered the most promising strategy for improving outcomes in patients with oesophageal adenocarcinoma in this study. A regimen of four cycles of ECX was selected because in studies of patients with advanced disease, up to 50% of patients develop resistant disease after 24 weeks of treatment and most responses have occurred by four cycles.27\n\nThe aims of the OE05 trial were therefore to investigate whether four cycles of preoperative ECX improves survival and HRQL compared with standard two-cycle cisplatin and fluorouracil (CF) in patients with locally advanced resectable adenocarcinoma of the oesophagus.\n\nMethods\nStudy design and participants\nThe UK MRC OE05 study is an open-label, phase 3, randomised clinical trial done in 72 hospitals across the UK. Participants were of any age with surgically resectable histologically verified adenocarcinoma of the oesophagus (including Siewert types 1 and 2 gastro-oesophageal junction tumours) stage cT1N1, cT2N1, cT3N0/N1, or cT4N0/N1 where invasion was thought to be confined to diaphragm, crura, or mediastinal pleura and surgically resectable (Union for International Cancer Control [UICC] TNM staging28). Additionally, patients had to meet the following criteria: WHO performance status 0 or 1 and adequate respiratory and cardiac function (forced expiratory volume in 1 sec of >1·5 L and cardiac ejection fraction of ≥50% on echocardiography or multigated acquisition scan) within 4 weeks of randomisation. Within 1 week of randomisation, liver function tests needed to be at most 1·5-times normal, white blood cell count at least 3 × 109 cells per L, platelet counts at least 100 × 109 platelets per L, and the calculated or measured glomerular filtration rate at least 60 mL/min.\n\nAssessment of disease stage required a contrast-enhanced multislice CT scan from neck to pelvis and endoscopic ultrasonography within 4 weeks of randomisation. Staging laparoscopy with or without peritoneal cytology and PET scanning were optional according to local practice. The final staging of patients (and Siewert classification) was done on the basis of a multidisciplinary team discussion following endoscopy, endoscopic ultrasonography, CT, and laparoscopy if appropriate.\n\nPatients were ineligible if investigations indicated blood-borne metastases (radiologically assessed), peritoneal dissemination, local invasion involving the tracheobronchial tree, aorta, pericardium or lung, or abdominal para-aortic lymphadenopathy greater than 1 cm in diameter on CT scan or more than 6 mm in diameter on endoscopic ultrasonography. Patients were also excluded if they had received any previous treatment for oesophageal cancer, had Siewert type 3 cancer, a medical condition that was likely to compromise the proposed trial treatment. Uncontrolled angina pectoris, myocardial infarction in the 6 months before entry into the trial, heart failure, clinically significant uncontrolled cardiac arrhythmias, or any patient with a clinically significant abnormal ECG, as well as patients with abnormal left ventricular ejection fraction (LVEF) diagnosed on MUGA scan or echocardiography, including areas of abnormal contractility, were excluded. Patients with positive serology for HIV or hepatitis C, active hepatitis B, or were pregnant were also excluded.\n\nParticipating centres were considered eligible if they had a multidisciplinary team structure, had experience of two-phase oesophagectomy with two-field lymphadenectomy (unproctored surgeons were recommended to have done a minimum of 12 such operations before joining the trial), access to multislice CT and endoscopic ultrasonography equipment, and had pathologists who were experienced in reporting oesophageal cancer.\n\nThe protocol was approved by the South West Multicentre Research Ethics Committee (04/6/005) and all patients gave written consent for participation in the study. Blood and tissue samples were collected for potential future translational studies (Trans-OE05). The protocol had five amendments during the course of the trial, predominantly for administrative reasons or to add clarity; amendments did not affect the eligibility or treatment of patients. The most recent version of the protocol (version 6.0) is available online.\n\nRandomisation and masking\nEligible patients were enrolled by staff at participating centres who then called the randomisation line at the MRC Clinical Trials Unit at UCL (London, UK). Patients were randomly assigned (1:1) to either two cycles of CF or four cycles of ECX. Allocation was done using a computerised minimisation program, with a random element, and stratified by centre and tumour stage. No masking to treatment allocation was done because of the difference in the number of chemotherapy cycles in the two groups.\n\nProcedures\nThe control group chemotherapy regimen was two 3-weekly cycles of cisplatin and fluorouracil. Cisplatin (80 mg/m2) was infused intravenously on day 1 and fluorouracil (1 g/m2 per day) was administered intravenously on days 1–4 (total 4 g/m2).\n\nThe investigational chemotherapy was four 3-weekly cycles of ECX. Epirubicin (50 mg/m2) and cisplatin (60 mg/m2) were given intravenously on day 1 and capecitabine (1250 mg/m2 daily) was given orally continuously over all four cycles (for a total of 12 weeks).\n\nProtocols for chemotherapy dose modifications were provided for haematological, renal, neurological, and hepatic toxicities, and for palmar–plantar erythema, stomatitis, diarrhoea, nausea, and vomiting. Toxicities were reported according to the National Cancer Institute Common Toxicity Criteria, version 3.0.29\n\nSurgery was done within 4–6 weeks of completion of chemotherapy. Surgery was a two-phase oesophagectomy with a two-field (abdomen and thorax) lymphadenectomy. Centres were allowed to use a minimal access surgery approach after providing evidence that complication rates and lymph node yields were similar to an open surgery approach from at least 20 patients who had had minimal access oesophagectomy.\n\nThe stomach was the preferred conduit for reconstruction based on the right gastric and right gastroepiploic vessels. Lymph node clearance in the abdomen was at the origin of the left gastric artery and along the hepatic and splenic arteries, the upper lesser curve, and at the right and left cardiac lymph node stations. Dissection at the diaphragm was used to minimise a positive radial or circumferential resection margin by inclusion of sufficient crural fibres and a cuff of diaphragm based on endoscopic ultrasonography and intraoperative appearances. Pyloroplasty, pyloromyotomy, the placement of a feeding jejunostomy, and drain insertions were all according to local practice.\n\nEither a right or left thoracic approach was permitted. Lymph node dissection involved para-oesophageal, subcarinal, and bronchial lymph node stations, and thoracic duct ligation just above the diaphragm was advised. The extent of proximal lymphadenectomy for the upper paraoesophageal nodes was determined by the extent of division of the oesophagus (ie, the length of oesophagus remaining after resection).\n\nReconstruction was recommended above the aortic arch for the right-sided approach and just below it for the left, and preferably within 5 cm of the thoracic inlet. The anastomotic technique and method of chest drainage was according to local practice. Trans-hiatal surgery was not permitted.\n\nPostoperative complications, described as none, present but not life threatening, or life threatening, were recorded for each patient. These complications were reviewed clinically, and assigned to categories.\n\nProcessing of the surgical resection specimens and histopathological assessment of all materials were done according to the recommendations of the Royal College of Pathologists:30 R0, no tumour cells remaining within 1 mm of any resection margin; R1, microscopically visible positive margin indicating the presence of tumour cells at or within 1 mm of a longitudinal or radial or circumferential resection margin; and R2, macroscopically visible tumour remaining. Resection specimens were classified using UICC TNM, 6th edition.28 Chemotherapy-induced changes in the primary tumour were graded according to Mandard and colleagues.31 The Mandard tumour regression grading (TRG) system was developed originally for the assessment of squamous cell carcinoma after chemoradiation, and was used in this study because UK pathologists are familiar with this system and it has been shown to be equivalent to the Becker grading system in terms of both interobserver agreement (ie, likelihood of two pathologists concluding the same grading by their independent assessments) and prognostic ability.32, 33\n\nPathology data were collected from local pathologists at each centre, and used for the primary analyses of all pathology data. A second review of the Mandard primary TRG was done to assess data quality and the differences between local and central assessments of TRG. One of three experienced pathologists (HIG, RL, and SP) independently reviewed all resection slides and provided a new Mandard TRG. If the reviewing pathologist's TRG agreed with the local pathologist assessment, this TRG was accepted as the true grade. If the reviewing pathologist disagreed, a second, and if necessary a third, pathologist reviewed the slides to reach a majority decision on the Mandard TRG. These centrally reviewed data form a secondary analysis of TRG.\n\nAll participating patients were asked to complete the validated generic cancer questionnaire (European Organisation for Research and Treatment of Cancer [EORTC] QLQ-C30)34 and the disease-specific oesophageal module (EORTC QLQ-OES18)35 at baseline, day 14 of chemotherapy cycle two, day 14 of cycle four (ECX group only), immediately before surgery, at 6 weeks, at 3, 6, 9, 12, 18, and 24 months after surgery, then annually. Patients could complete questionnaires at home and bring them to the hospital, return them by post, or complete them at their clinical follow-up visit. The HRQL protocol prespecified four domains of HRQL to be examined in the primary analyses and full details of all scales and items assessed in the questionnaires will be reported subsequently. Clinical follow-up involved the same schedule with the use of tests to establish recurrent disease at the discretion of individual centres.\n\nOutcomes\nThe primary outcome measure of the trial was overall survival. Secondary outcomes were disease-free survival, effects on the primary tumour (as assessed by Mandard TRG), HRQL, and morbidity related to chemotherapy and surgery. Exploratory outcomes were progression-free survival (where a progression-free survival event was defined as the first confirmed local or distant recurrence, or death from any cause), and an analysis of Mandard TRG using an amended responder definition.\n\nStatistical analysis\nThe sample size calculations were based on the primary outcome measure of overall survival. On the basis of the OE02 trial results,19 which showed an absolute survival difference of 8% at 3 years, we thought it unlikely that any greater difference would be seen in this study. The trial was originally designed to require 1300 patients and 860 events, with recruitment over 6 years and a minimum follow-up period of 6 months. With a 5% two-sided significance level, this sample would provide 90% power to detect an 8% difference (or 80% power to detect a 7% difference) in 3-year survival, from 30% in the CF group. In 2007, following a period of lower than expected recruitment, the sample size was reassessed to ensure that an adequately powered study would still be achieved in a given timeframe. The updated sample size calculations required 842 patients with 677 events over 6 years with a minimum follow-up of 2 years before analysis, to provide at least 82% power to detect an 8% difference (and 70% to detect a 7% difference) at 3 years with a two-sided significance level of 5%.\n\nAlthough we anticipated that the required events would be obtained 2 years after the final patient was randomly assigned, they accrued far more slowly than expected. 3 years after the final randomisation, a conditional survival analysis was done to assess the probability that continuing to wait for the full number of events would lead to a different trial conclusion. After discussion with the independent data monitoring committee and trial steering committee, a decision was reached that the current data were sufficiently robust for full analysis and dissemination, because the chance of obtaining a different conclusion with more events was less than 5%.\n\nAll safety and primary analyses were done on an intention-to-treat basis. Overall survival was calculated from the date of group assignment to the date of death. Patients either lost to follow-up or still alive at the time of analysis were censored at the date they were last known to be alive.\n\nBecause patients can only be deemed disease free after surgery, and to account for the different durations of preoperative chemotherapy, disease-free survival was analysed using a landmark analysis.36 Rather than the date of randomisation, the time 1 week after the last patient had surgery was used as the start point, up to a maximum of 6 months from group assignment. Patients who had an event before this point, who did not have surgery, or who were not macroscopically disease free at surgery, were said to have had an event on day 1. If any patients received surgery more than 6 months after randomisation, they were assumed to be disease free at the 6-month start point. Disease-free survival was calculated as the time from this modified origin until the first date of confirmed local recurrence, distant metastases, or death from any cause. Patients who had no evidence of relapse were censored on the last date they were known to be disease free.\n\nProgression-free survival was calculated from random assignment to the date of the event or, in event-free patients, the date last known to be alive and free from recurrence. Overall, disease-free, and progression-free survival were compared using the log-rank χ2 test. The proportion of patients who survived and median survival times were estimated from a flexible parametric survival model37 and presented with 95% CIs. HRs were calculated from Cox proportional hazard models, including adjustment for randomisation stratification factors. Proportional hazards assumptions were tested using the Grambsch-Therneau test. The heterogeneity of treatment effects across levels of prespecified patient characteristics (sex, age, performance status, clinical T-stage, and clinical N-stage) were explored using Cox proportional hazard models.\n\nTo analyse tumour regression, the original five-point Mandard scale was dichotomised into responders (Mandard TRG 1–3) and non-responders (Mandard TRG 4–5). A second, unplanned analysis was also done because emerging evidence suggested that a more appropriate dichotomisation was Mandard TRG 1–2 as responders and grades 3–5 as non-responders.\n\nFormal comparisons and summaries of HRQL function and symptom scales were restricted to a number of prespecified outcome measures. Global HRQL and prespecified symptoms related to the effects of chemotherapy and surgery (appetite loss, dysphagia, pain, and reflux) were compared immediately before surgery, and 3, 12, and 24 months after surgery, using an ANOVA with adjustment for baseline score. These timepoints were considered separately, rather than using a repeated measures method of analysis.\n\nComparisons between chemotherapy toxicities, surgical complications, tumour regression, and resection were done using a χ2 test or Fisher's exact test, as appropriate. A p value of less than 0·05 was used as the significance threshold. For all analyses, no attempts were made to impute values for missing data. All analyses were done using Stata, version 14.\n\nThis trial is registered with the ISRCTN registry (registration number 01852072) and ClinicalTrials.gov (NCT00041262).\n\nRole of the funding source\nCancer Research UK approved the study design, but had no role in data collection, data analysis, data interpretation, or writing of the report. Roche supplied capecitabine for use in the study, and had sight of the draft trial manuscript, but had no role in any other aspect of the study. MN had access to the raw data. The corresponding author had final responsibility for the decision to submit for publication.\n\nResults\nBetween Jan 13, 2005, and Oct 31, 2011, 897 patients were recruited from 72 UK hospitals and randomly allocated to the CF group (n=451) or the ECX group (n=446; figure 1). The median number of patients per centre was eight (range 1–73; appendix pp 1–3). After chemotherapy, following retrospective review of the baseline CT scan, one patient was found to be ineligible because of adrenal metastases so did not have surgery, but was included in all summaries and analyses. The baseline characteristics of the patients allocated to the CF or ECX groups were similar (table 1). The median age was 62 years (IQR 56–67; range 27–81), 810 (90%) of 897 patients were male, 603 (67%) had a WHO performance status of 0, and 576 (64%) had stage T3N1 cancer (table 1; appendix pp 4–5).Figure 1 Consort diagram\n\nCF=cisplatin and fluorouracil. ECX=epirubicin, cisplatin, and capecitabine. *Cause of death reported as cardiac failure. †Causes of death reported as cerebral vascular accident, multiple organ failure, pulmonary embolism, bronchopneumonia, and oesophageal cancer. ‡For patients not listed in † above, cause of death was reported as sepsis-related multiple organ failure in one patient and oesophageal cancer in the remaining two patients. Screening logs were not collected during the trial, so the number of potentially eligible patients is unknown.\n\nTable 1 Baseline characteristics\n\n\tCisplatin and fluorouracil (n=451)\tEpirubicin, cisplatin, and capecitabine (n=446)\t\nSex\t\nFemale\t39 (9%)\t48 (11%)\t\nMale\t412 (91%)\t398 (89%)\t\nAge, years\t\nMedian (IQR)\t62 (57–67)\t62 (56–67)\t\nRange\t27–81\t33–80\t\nWHO performance status\t\n0\t311 (69%)\t292 (65%)\t\n1\t140 (31%)\t154 (35%)\t\nStage of tumour*\t\nT1 N1\t3 (1%)\t5 (1%)\t\nT2 N1\t49 (11%)\t41 (9%)\t\nT3 N0\t97 (22%)\t99 (22%)\t\nT3 N1\t287 (64%)\t289 (65%)\t\nT4 N0†\t3 (1%)\t1 (<1%)\t\nT4 N1†\t12 (3%)\t11 (2%)\t\nParticipating in quality-of-life assessment\t\nYes\t435 (96%)\t424 (95%)\t\nNo\t16 (4%)\t22 (5%)\t\nData are n (%) unless otherwise specified.\n\n* Stage of tumour (based on both endoscopic ultrasonography and CT results) was used to stratify randomisation.\n\n† Specific site of T4 invasion is mediastinal pleura for eight patients (four in the cisplatin and fluorouracil group vs four in the epirubicin, cisplatin, and capecitabine group), crura for 14 patients (nine vs five), and diaphragm for five patients (two vs three).\n\n\n\nThree (4%) of 72 recruiting centres did not take part in the HRQL aspect of the trial for any of their patients, and HRQL assessment data were omitted at baseline for the patients from these centres (37 [4%] of the total 897 patients). Baseline HRQL was also well balanced between the two groups. Mean values (SD) for the five prespecified domains of interest were: global HRQL 76·0 (18·34), appetite loss 37·4 (27·98), reflux 17·3 (24·05), pain 20·3 (20·50), and dysphagia 73·9 (25·7); data per treatment group are in the appendix (pp 8–10). A higher score indicates better HRQL for the global score and dysphagia, but worse HRQL for the symptom scales.\n\nDetails of the chemotherapy received are shown in table 2. Four patients (<1%; two in the CF group and two in the ECX group) of 897 withdrew consent before starting chemotherapy and five (1%; one CF, four ECX) died during chemotherapy. The number of patients who completed their allocated treatment was greater in the CF group than in the ECX group (435 [96%] of 451 vs 363 [81%] of 446; p<0·0001), although a similar number of patients in the CF (435 [96%] of 451) and ECX (432 [97%] of 446) groups received at least two cycles. Of the 451 patients in the CF group, eight (2%) stopped chemotherapy because of toxicity and one (<1%) died, whereas in the ECX group, 46 (10%) of 446 patients stopped because of toxicity, and five (1%) died, one of which was thought to be related to chemotherapy toxicity (figure 1). The number of patients requiring dose reduction to any drug was smaller in the CF than in the ECX group (88 [20%] of 451 vs 187 [42%] of 446; p<0·0001), although the number receiving cisplatin dose reductions was similar between the groups (61 [14%] of 451 in the CF group and 53 [12%] of 446 in the ECX group).Table 2 Chemotherapy details\n\n\tCisplatin and fluorouracil: two cycles (n=451)\tEpirubicin, cisplatin, and capecitabine: four cycles (n=446)\t\nCycles started\t\nNone*\t2 (<1%)\t2 (<1%)\t\nOne\t14 (3%)\t12 (3%)\t\nTwo (completed two-cycle regimen)\t435 (96%)\t32 (7%)\t\nThree\tNA\t37 (8%)\t\nFour (completed four-cycle regimen)\tNA\t363 (81%)\t\nTotal completed chemotherapy\t435 (96%)\t363 (81%)\t\nDelays to cycles†\t\nYes\t113 (25%)\t148 (33%)\t\nNo\t336 (75%)\t296 (66%)\t\nNo chemotherapy received\t2 (<1%)\t2 (<1%)\t\nReduction in cisplatin dose‡\t\nNo\t373 (83%)\t378 (85%)\t\nYes\t61 (14%)\t53 (12%)\t\nNo cisplatin given\t1 (<1%)\t1 (<1%)\t\nLess than two cycles given\t16 (4%)\t14 (3%)\t\nReduction in any dose‡\t\nNo\t347 (77%)\t245 (55%)\t\nYes\t88 (20%)\t187 (42%)\t\nLess than two cycles given\t16 (4%)\t14 (3%)\t\nData are n (%). NA=not applicable.\n\n* All four patients who received no on-trial chemotherapy withdrew consent soon after randomisation.\n\n† A delay is defined as a cycle starting at least 25 days after the previous cycle, or at least 11 days after randomisation.\n\n‡ A reduction is defined as the dose decreasing by more than 10% compared with cycle one. A cycle was said to have started if any drug was administered.\n\n\n\nThe median time from randomisation to surgery was 71 days (IQR 66–80) in the CF group and 127 days (119–137) in the ECX group. The median time of surgery from the start of the last preoperative chemotherapy cycle was 44 days (39–52) for patients in the CF group and 57 days (52–64) for patients in the ECX group. Details of the surgical procedure are shown in table 3. Of the 897 patients who were enrolled, 99 (11%) did not have surgery. Of the 99 who did not have surgery, 41 (41%) were because of disease progression, nine (9%) died before surgery, nine (9%) decided not to have surgery, 15 (15%) developed significant comorbidities that precluded surgery, and 25 (25%) were deemed otherwise unsuitable for surgery. In total, 411 (91%) of 451 patients in the CF group and 387 (87%) of 446 patients in the ECX group proceeded to surgery (figure 1).Table 3 Surgery details\n\n\tCisplatin and fluorouracil (n=451)\tEpirubicin, cisplatin, and capecitabine (n=446)\t\nSurgery done\t\nYes\t411 (91%)\t387 (87%)\t\nNo\t40 (9%)\t59 (13%)\t\nReason for no surgery*\t\nCT evidence of disease progression\t13 (33%)\t11 (19%)\t\nClinical evidence of disease progression\t3 (8%)\t6 (10%)\t\nLaparoscopic evidence of disease progression\t4 (10%)\t4 (7%)\t\nComorbidity\t6 (15%)\t9 (15%)\t\nPatient choice\t2 (5%)\t7 (12%)\t\nPatient died\t1 (3%)\t8 (14%)\t\nPatient otherwise deemed inoperable\t11 (28%)\t14 (24%)\t\nResection done\t\nYes\t387 (86%)\t364 (82%)\t\nNo (open-close operation)\t24 (5%)\t23 (5%)\t\nSurgical approach†\t\nAbdomen and right chest open\t192 (50%)\t187 (51%)\t\nAbdomen (laparoscopic) and right chest open\t108 (28%)\t101 (28%)\t\nLeft thoracoabdominal incision\t28 (7%)\t24 (7%)\t\nTotally laparoscopic\t9 (2%)\t9 (2%)\t\nOther\t43 (11%)\t35 (10%)\t\nMissing\t7 (2%)\t8 (2%)\t\nLocation†\t\nMid-oesophagus\t72 (19%)\t56 (15%)\t\nSiewert type 1\t227 (59%)\t208 (57%)\t\nSiewert type 2\t76 (20%)\t89 (24%)\t\nMissing\t12 (3%)\t11 (3%)\t\nData are n (%). An open-close operation was deemed as one in which no resection was done, or the reason given on the case report form for not having surgery was that the patient was found to be inoperable at laparotomy or thoracotomy.\n\n* Percentages are out of patients who did not have surgery.\n\n† Percentages are out of all patients who did have resection.\n\n\n\n751 (84%) of 897 people had resection and reconstruction, whereas 47 (5%) of 897 patients were found to have progressive disease or to be inoperable during surgery (table 3). 588 (78%) of 751 resections were done via the abdomen and right chest using open surgery throughout (Ivor-Lewis resection) or as hybrid with a laparoscopic abdominal approach. Only 18 (2%) of the 751 resections (nine in each group) were done with a totally minimally invasive approach.\n\nAs of Nov 14, 2016, 629 (70%) of 897 patients were known to have died (327 [73%] of 451 in the CF group and 302 [68%] of 446 in the ECX group) and a further 12 had withdrawn consent for further follow-up. The median follow-up of the surviving patients was 6·4 years (IQR 4·8–8·2), and 250 (93%) of 268 patients had at least 3 years of follow-up assessments. The observed 3-year overall survival was 39% (95% CI 35–44) in the CF group, and 42% (37–47) in the ECX group (figure 2). Median overall survival was estimated to be 23·4 months (95% CI 20·6–26·3) in the CF group and 26·1 months (22·5–29·7) in the ECX group, with an HR of 0·90 (95% CI 0·77–1·05, p=0·19). No evidence indicated that the proportional hazards assumption was violated.Figure 2 Overall survival\n\nCF=cisplatin and fluorouracil. ECX=epirubicin, cisplatin, and capecitabine.\n\n\n\nFigure 3 shows prespecified subgroup analyses of overall survival were done, considering sex, age group (<60 years, 60–69 years, and ≥70 years), WHO performance status, clinical T-stage, and clinical N-stage (appendix p 11).Figure 3 Subgroup analysis\n\nData are number of patients who had a survival event (n) out of the total number of patients (N), or HR (95% CI). The subgroup of patients with T1 disease at randomisation is not shown because there were only three patients who had CF and five who had ECX treatment. p values for heterogeneity of treatment effect are 0·69 for sex, 0·05 for age, 0·46 for WHO performance status, 0·11 for T-stage, and 0·028 for N-stage. T-stage and N-stage refer to clinical staging collected at time of randomisation. CF=cisplatin and fluorouracil. ECX=epirubicin, cisplatin, and capecitabine.\n\n\n\nMedian disease-free survival (347 events in the CF group vs 316 events in the ECX group, based on a 6-month landmark analysis; appendix p 13) was 11·6 months (95% CI 8·9–13·3) in the CF group and 14·4 months (11·7–16·5) in the ECX group, with an HR of 0·86 (95% CI 0·74–1·00, p=0·051).\n\nChemotherapy toxicity data were not provided by three patients in each group and two in each group did not receive any chemotherapy. Grade 3 or 4 diarrhoea occurred in six (1%) of 446 people in the CF group and 36 (8%) of 441 in the ECX group (p<0·0001) and grade 3 or 4 neutropenia occurred in 74 (17%) of 446 in the CF group and 101 (23%) of 441 people in the ECX group (p=0·023); stomatitis occurred in 25 (6%) of 446 people in the CF group versus seven (2%) of 441 in the ECX group (p=0·0018; table 4 and appendix p 6).Table 4 Chemotherapy toxicity\n\n\tCisplatin and fluorouracil: two cycles (n=446*)\tEpirubicin, cisplatin, and capecitabine: four cycles (n=441*)\t\n\tGrade 1–2\tGrade 3\tGrade 4\tGrade 1–2\tGrade 3\tGrade 4\t\nNeutropenia\t102 (23%)\t57 (13%)\t17 (4%)\t119 (27%)\t79 (18%)\t22 (5%)\t\nDeep vein thrombosis or pulmonary embolism\t5 (1%)\t4 (1%)\t5 (1%)\t11 (2%)\t8 (2%)\t11 (2%)\t\nVomiting\t116 (26%)\t20 (4%)\t0\t177 (40%)\t26 (6%)\t0\t\nNausea\t245 (55%)\t16 (4%)\t0\t282 (64%)\t27 (6%)\t0\t\nDiarrhoea\t103 (23%)\t6 (1%)\t0\t132 (30%)\t33 (7%)\t3 (1%)\t\nPlantar–palmar erythrodysesthesia\t27 (6%)\t0\t0\t169 (38%)\t37 (8%)\t1 (<1%)\t\nStomatitis\t212 (48%)\t25 (6%)\t0\t199 (45%)\t7 (2%)\t0\t\nInfection or febrile neutropenia\t5 (1%)\t2 (<1%)\t1 (<1%)\t6 (1%)\t14 (3%)\t0\t\nCardiac toxicity\t13 (3%)\t1 (<1%)\t1 (<1%)\t17 (4%)\t2 (<1%)\t1 (<1%)\t\nPeripheral neuropathy\t27 (6%)\t1 (<1%)\t0\t103 (23%)\t3 (1%)\t0\t\nLoss of taste\t147 (33%)\t2 (<1%)\t0\t180 (41%)\t1 (<1%)\t0\t\nThrombocytopenia\t28 (6%)\t2 (<1%)\t0\t32 (7%)\t0\t1 (<1%)\t\nRenal toxicity\t28 (6%)\t2 (<1%)\t0\t37 (8%)\t1 (<1%)\t0\t\nTinnitus\t86 (19%)\t2 (<1%)\t0\t71 (16%)\t0\t0\t\nLiver toxicity\t20 (4%)\t0\t0\t33 (7%)\t2 (<1%)\t0\t\nAlopecia\t84 (19%)\t0\t0\t314 (71%)\t0\t0\t\nOther toxicity\t274 (61%)\t36 (8%)\t3 (1%)\t300 (68%)\t60 (14%)\t7 (2%)\t\nData are n (%).\n\n* Two patients in each group did not receive any chemotherapy, and another three patients in each group did not provide any toxicity data. If some toxicity data were provided, any missing toxicity data at that cycle are assumed to indicate that toxicity did not occur. One patient in the epirubicin, cisplatin, and capecitabine group died of cerebrovascular incident (reported as other toxicity).\n\n\n\nMore patients in the ECX group (108 [24%] of 446) reported serious adverse events over the course of the trial than in the CF group (73 [16% of 451], p=0·003; appendix p 7). Particularly, reports of diarrhoea were more common in the ECX group (14 [3%]) than in the CF group (0, p<0·0001). No significant differences were measured between the groups for any other type of event, or in any specific body systems (appendix p 7).\n\nIn patients for whom data were reported, no difference was seen in the overall prevalence of surgical complications between the two treatment groups (224 [56%] of 398 people in the CF group and 233 [62%] of 374 in the ECX group; p=0·089), although more people in the ECX group had respiratory complications (125 [33%] of 374) than in the CF group (107 [27%] of 398; p=0·048; appendix p 7). At 30 days after surgery, ten (2%) of 411 patients in the CF group and 11 (3%) of 387 people in the ECX group had died, and at 90 days, 21 (5%) people in the CF group and 23 (6%) people in the ECX group had died.\n\nIn the local pathologist review (table 5), the primary tumour was classified as Mandard TRG 1–3 in 44 (15%) of the 288 specimens with available results from the CF group and 93 (32%) of the 289 specimens from the ECX group (p<0·0001). Mandard primary tumour regression data were also available from central pathology review of 656 patients (87% of patients who had a resection) and a total of 24 625 slides were received, with a median of 34 (IQR 24–45) slides per person. Similar incidences of tumour regression were seen with 91 (29%) of 317 specimens graded as TRG 1, 2, or 3 in the ECX group and 40 (12%) of 339 in the CF group (p<0·0001).Table 5 Pathology details\n\n\tCisplatin and fluorouracil (n=387)*\tEpirubicin, cisplatin, and capecitabine (n=364)*\t\nType of tumour\t\nSquamous\t5/386 (1%)\t1/360 (<1%)\t\nAdenocarcinoma\t370/386 (96%)\t336/360 (93%)\t\nOther\t11/386 (3%)\t23/360 (6%)\t\nDifferentiation\t\nWell\t25/379 (7%)\t28/336 (8%)\t\nModerate\t167/379 (44%)\t158/336 (47%)\t\nPoor\t187/379 (49%)\t150/336 (45%)\t\nMandard tumour regression grade (local pathology assessment)\t\n1: Complete regression\t9/288 (3%)\t32/289 (11%)\t\n2: Mainly fibrosis\t9/288 (3%)\t16/289 (6%)\t\n3: Increased residual cancer cells\t26/288 (7%)\t45/289 (16%)\t\n4: Residual cancer cells outgrowing fibrosis\t104/288 (9%)\t97/289 (34%)\t\n5: Absence of regressive changes\t140/288 (49%)\t99/289 (34%)\t\nMandard tumour regression grade (central pathology review)\t\n1: Complete regression\t5/339 (1%)\t21/317 (7%)\t\n2: Mainly fibrosis\t7/339 (2%)\t16/317 (5%)\t\n3: Increased residual cancer cells\t28/339 (8%)\t54/317 (17%)\t\n4: Residual cancer cells outgrowing fibrosis\t194/339 (57%)\t164/317 (52%)\t\n5: Absence of regressive changes\t105/339 (31%)\t62/317 (20%)\t\nComplete resection at all margins\t\nNo\t143/379 (38%)\t108/357 (30%)\t\nYes\t236/379 (62%)\t249/357 (70%)\t\nStaging ypT\t\n0\t6/383 (2%)\t19/359 (5%)\t\n1\t28/383 (7%)\t49/359 (14%)\t\n2\t67/383 (17%)\t58/359 (16%)\t\n3\t270/383 (70%)\t223/359 (62%)\t\n4\t12/383 (3%)\t10/359 (3%)\t\nStaging ypN\t\n0\t115/385 (30%)\t142/361 (39%)\t\n1\t232/385 (60%)\t191/361 (53%)\t\n2\t28/385 (7%)\t19/361 (5%)\t\n3\t10/385 (3%)\t9/361 (2%)\t\nStaging ypM\t\n0\t80/378 (21%)\t90/356 (25%)\t\n1\t22/378 (6%)\t13/356 (4%)\t\nX\t276/378 (73%)\t253/356 (71%)\t\nExtent of resection\t\nR0: absolute curative\t212/357 (59%)\t223/336 (66%)\t\nR1: relative curative\t130/357 (36%)\t103/336 (31%)\t\nR2: non-curative\t15/357 (4%)\t10/336 (3%)\t\nData are n/N (%). Denominators are total specimens in which the parameter could be assessed and results were not missing. ypT=pathological T-stage. ypN=pathological N-stage. ypM=pathological M-stage. R0=no tumour cells within 1 mm of any resection margin. R1=presence of tumour cells at or within 1 mm of a longitudinal or radial or circumferential resection margin. R2=macroscopically visible tumour left behind during surgery.\n\n* Total number of patients for whom specimens were obtained.\n\n\n\nMore specimens from the ECX group were classified by the local pathologist as ypT0 or T1 (34 [9%] of 383 CF vs 68 [19%] of 359 ECX; p<0·0001) after surgery and the number of patients categorised as ypN0 was also higher after ECX (115 [30%] of 385 CF vs 142 [39%] of 361 ECX; p=0·0070). The proportions of patients who achieved R0, R1, and R2 were similar in both groups.\n\nNo statistically and clinically relevant differences were seen between the treatment groups in terms of HRQL (appendix pp 8–10) in any of the prespecified domains (global quality of life, pain, reflux, appetite loss, or dysphagia) or at nearly all timepoints (preoperatively and 3, 12, and 24 months postoperatively). Global HRQL was lower preoperatively during chemotherapy and postoperatively, and remained lower than at randomisation throughout the trial. Appetite loss improved during chemotherapy, worsened postoperatively, before returning to preoperative levels at 12 months after surgery. Dysphagia improved during the trial, and was slightly better at the preoperative assessment in the ECX group (appendix p 10) than in the CF group. Few changes were seen in pain and reflux scores throughout the study. Scores at 24 months were mostly within ten points of baseline values within the five prespecified domains of HRQL. One exception was dysphagia, in which a mean improvement of 10·5 points (SD 25·65) was seen in the ECX group at 24 months after surgery. The proportion of surviving patients who completed HRQL assessments declined over time, with 725 (84%) of 860 patients completing an assessment at randomisation, 339 (57%) of 595 at 3 months after surgery, 208 (45%) of 467 at 12 months, and 142 (44%) of 322 at 24 months.\n\nWhen the trial and analyses were planned, we felt that Mandard TRG 1, 2, or 3 was the most suitable definition of good response to treatment. Exploratory analyses (appendix p 14) in patients who had available specimens suggested that postoperative survival of patients with tumours considered to be Mandard TRG 1 or 2 was significantly different (appendix p 14) to survival in those with tumours considered to be Mandard TRG 3, 4, or 5, so Mandard TRG 1 or 2 appeared to denote significant tumour regression. Applying this definition to the locally collected histopathological data, 18 (6%) of 288 patients in the CF group and 48 (17%) of 289 patients in the ECX group achieved significant tumour regression (p<0·0001). Similarly, using the central review data, 12 (4%) of 339 patients in the CF group and 37 (12%) of 317 patients in the ECX group achieved notable tumour regression (p<0·0001).\n\nIn the exploratory analysis of progression-free survival, median progression-free survival (343 events in the CF group vs 313 in the ECX group; appendix p 13) was 18·4 months (95% CI 15·2–20·5) in the CF group and 21·4 months (19·4–24·0) in the ECX group, with an HR of 0·84 (95% CI 0·72–0·98, p=0·033). The contributing progression-free survival event was either local recurrence (60 [17%] of 343 patients in the CF group vs 46 [15%] of 313 in the ECX group), distant metastases (94 [27%] of 343 people vs 78 [25%] of 313), local recurrence and distant metastases (87 [25%] of 343 vs 59 [19%] of 313), or death without confirmed progression (102 [30%] of 343 vs 130 [42%] of 313).\n\nAn exploratory analysis highlighted that the overall survival HR did not remain constant over time, and a strong interaction with year of randomisation was seen (p=0·0004; appendix p 12). Patients randomly assigned early in the trial (2005–07) had some survival benefit in the ECX group compared with those in the CF group, whereas those assigned in later years (2008 onwards) did not. The use of PET scans increased greatly over the course of the trial, and so a further exploratory subgroup analysis was done looking at the effect of receiving a PET scan. This subgroup analysis also showed a strong interaction with treatment group (p value=0·0008). Patients who did not have a PET scan had longer overall survival in the ECX group, whereas for patients who did receive a PET scan, ECX gave no survival advantage.\n\nDiscussion\nThis study showed that more intensive neoadjuvant chemotherapy with four cycles of ECX provided no overall or disease-free survival advantage over two cycles of CF in 897 patients with oesophageal adenocarcinoma. Chemotherapy toxicity and serious adverse events were reported more often with ECX—as can be expected from four cycles of a triplet regimen compared with two cycles of a doublet regimen. These adverse events contributed to a greater number of patients completing their planned chemotherapy and undergoing surgery in the CF group than in the ECX group, although surgical resection, postoperative complications, and postoperative mortality were similar between the groups. In a post-hoc exploratory analysis, improved progression-free survival was shown with ECX treatment compared with CF treatment.\n\nMore patients in the ECX group had a good pathological response to chemotherapy (Mandard TRG 1 or 2), and consequently more were staged as ypT0 or 1 or ypN0 after surgery, than were those in the CF group. Results from the MRC gastro-oesophageal ST0338 study showed that Mandard TRG 1 or 2 after chemotherapy was associated with improved survival compared with Mandard TRG 3, 4, or 5. Similar exploratory analyses based on response to chemotherapy within this study also suggest a postoperative survival benefit for those patients with Mandard TRG 1 or 2. However, the absolute numbers of specimens assessed that were classified as Mandard TRG 1 or 2 (48 [17%] of 289 in the ECX group vs 18 [6%] of 288 in the CF group) were low, and so this difference did not translate into an overall survival benefit.\n\nThe results of this trial raise the question of the optimal number of preoperative chemotherapy cycles. In the absence of a good pathological response of the tumour, giving more than two cycles might unnecessarily delay surgery. In the current absence of a reliable biomarker that enables prediction of responses either before or midway through preoperative treatment, the extent of preoperative chemotherapy relies on the judgement of the clinician after discussion with the patient, to balance the possibility of achieving a good response against the risk of not being able to proceed to surgery. The results from our OE05 trial favour the use of two cycles of a chemotherapy doublet if preoperative chemotherapy alone is offered. However, two cycles of CF preoperatively has not been directly compared with the perioperative approach assessed in the MAGIC trial,25 which studied three cycles of ECX given preoperatively and postoperatively. The FFCD-FNCLCC 9703 trial22 also showed the superiority of perioperative chemotherapy over surgery alone, using the CF regimen in a population predominantly of patients with adenocarcinoma. Given the increased proportion of patients who achieved a response with ECX treatment in our study, a smaller number of preoperative cycles (two or three) with a triplet regimen combined with the selective use of postoperative chemotherapy for responding patients might be a better approach than either four cycles of ECX or two cycles of CF.\n\nOE05 showed an improvement in overall survival of patients in the CF group (recruited 2005–11) compared with the same regimen in OE02 (recruited 1992–98), in which the median survival was 1·4 years compared with 2·0 years in OE05.\n\nA number of potential factors could explain why the survival of patients with oesophageal cancer who were treated with CF improved with time. Changes in referral patterns, moves towards centralisation of surgical services, the introduction of endoscopic ultrasonography, and the development of multidisciplinary teams are all events that occurred towards the end of recruitment to the OE02 study, and these changes might have led to better patient selection for attempted curative treatment by the time of this OE05 study. The introduction of routine PET scanning might also be an important factor for the absence of survival difference in this study. Post-hoc analyses indicated that ECX offered a survival benefit in the early years of the study when PET scans were rarely used, but offered no benefit during the later years when PET was used for nearly all patients. ECX might be more effective in treating small-volume, disseminated disease that was often missed before the routine use of PET scans. Patients with this type of disease are now usually identified and would have been ineligible for participation in the study.\n\nNeoadjuvant chemoradiotherapy has also led to improved survival compared with surgery alone for patients with oesophageal adenocarcinoma and squamous cell cancers, with a median survival of 48·6 months (95% CI 32·1–65·1) with adjuvant therapy compared with 24·0 months (95% CI 14·2–33·7) with surgery alone in the CROSS trial.39 The HRs for comparison with surgery alone are similar with chemoradiotherapy in CROSS (0·73 [95% CI 0·55–0·88] in patients with adenocarcinoma) and with chemotherapy in MAGIC (0·75 [0·60–0·93]), suggesting that although the trials studied slightly different populations, the size of benefit might be similar. Trials comparing these two approaches directly20, 23, 24 have shown an increased response with chemoradiotherapy, but without any subsequent improvement in overall survival.\n\nThe present study has a number of advantages over other oesophageal cancer trials. This study was confined to patients with adenocarcinomas of the oesophagus and gastro-oesophageal junction (Siewert type 1 and 2), specifically excluding squamous cell cancers and Siewert type 3 (gastric cancer). The study involved a large number of centres with a detailed protocol regarding pretreatment staging, the delivery of chemotherapy and surgery, and histopathological assessment. To our knowledge, our study is the only prospective randomised trial in neoadjuvant treatment and surgery for oesophageal cancer to have included a comprehensive prospective assessment of HRQL using validated generic and specific measures. Although no differences between trial groups were observed in HRQL, the data confirm findings from much smaller cohort studies.40 Neoadjuvant chemotherapy and surgery are associated with reduced HRQL that persists for more than 6 months after surgery, and some features such as appetite loss persist for at least 12 months. These HRQL results should be accepted as the standard that can be achieved with current platinum-based or fluoropyrimidine-based neoadjuvant chemotherapy and surgery, and communicated to patients during shared decision making before surgery, along with the likely median survival data of the combined interventions. Limitations of this study include the changing use of PET scanning through the course of this trial as we have discussed and its potential effect on the prognosis of patients who entered the trial over time. Additional limitations are the fact that postoperative chemotherapy was not assessed, and the challenge of interpreting and implementing these results in the face of the evolving role of chemoradiation in the management of oesophagogastric adenocarcinomas.\n\nData published in 2017 show a survival advantage for patients treated with docetaxel, oxaliplatin, and fluorouracil compared with epirubicin, cisplatin, and fluorouracil or ECX given perioperatively for junctional and gastric tumours, with a 3-year overall survival of 57% for the docetaxel-containing regimen compared with 48% with epirubicin, cisplatin, and fluorouracil or ECX (HR 0·77, 95% CI 0·63–0·94).41 Though an improvement in overall survival for biomarker-unselected patients, these results highlight that further improvements in outcomes are still needed for these patients. Alternative neoadjuvant approaches such as chemoradiation are also being investigated.42, 43 Additional correlative science projects are planned for this trial with the aim of identifying subsets of patients who might specifically benefit from ECX neoadjuvant chemotherapy.\n\nFor the OE05 Clinical Trial Protocol Version 6.0 see http://www.ctu.mrc.ac.uk/research/documents/cancer_protocols/OE05_Protocol_Version_6_23_Dec_09.pdf\n\n\n\nSupplementary Material\nSupplementary appendix\n \n\nAcknowledgments\nThe study was supported by the MRC CTU at UCL, and funded by Cancer Research UK (CRUK; grant numbers C1495/A3005 and C26441/A16251). CRUK also provided funding for blood, tissue, and slide collection, slide scanning, and pathological review. The sponsor was the MRC, and the trial was done and analysed at the MRC CTU at UCL. We thank all patients and their families for their participation. We also thank the investigators and research staff at the trial centres and the MRC CTU at UCL, and the members of the Independent Data Monitoring Committee and the Independent Trial Steering Committee listed on page one of the appendix.\n\nContributors\nDA and DC were joint chief investigators. DA, DC, REL, and SS designed the trial and wrote the protocol. DA, DC, MN, JMB, SMG, AC, HIG, AO, CR, SS, and REL were the trial management group. DA, DC, JMB, SMG, AC, RK, FC, JT, and SF recruited and treated trial patients. CR coordinated the trial at the MRC Clinical Trials Unit (CTU) at University College London (UCL; London, UK). MN and SS were the trial statisticians. DA, DC, MN, and REL drafted the manuscript. MN had access to the raw data, analysed the data and constructed the figures. HIG, RL, and SP did the central pathology review. All authors were involved in data interpretation, manuscript review, and approval of the final manuscript.\n\nDeclaration of interests\nDC reports grants from Amgen, AstraZeneca, Bayer, Celgene, Merrimack, Medimmune, Merck Serono, Sanofi, and The National Institute of Health Biomedical Centre at the Institute of Research and Royal Marsden Hospital. MN, HIG, and REL report grants from Cancer Research UK (CRUK). SP received personal fees from CRUK. JMB receives funding from the Medical Research Council ConDuCT-II Hub for Trials Methodology Research at the University of Bristol. CR reports grants from CRUK and non-financial support from Roche. FC declares personal fees from Servier and Celgene. All other authors declare no competing interests.\n==== Refs\nReferences\n1 Sjoquist KM Burmeister BH Smithers BM for the Australasian Gastro-Intestinal Trials Group Survival after neoadjuvant chemotherapy or chemoradiotherapy for resectable oesophageal carcinoma: an updated meta-analysis Lancet Oncol 12 2011 681 692 21684205 \n2 Ronellenfitsch U Schwarzbach M Hofheinz R Preoperative chemo(radio)therapy versus primary surgery for gastroesophageal adenocarcinoma: systematic review with meta-analysis combining individual patient and aggregate data Eur J Cancer 49 2013 3149 3158 23800671 \n3 Nygaard K Hagen S Hansen HS Pre-operative radiotherapy prolongs survival in operable esophageal carcinoma: a randomized, multicenter study of pre-operative radiotherapy and chemotherapy. The second Scandinavian trial in esophageal cancer World J Surg 16 1992 1104 1110 1455880 \n4 Apinop C Puttisak P Preecha N A prospective study of combined therapy in esophageal cancer Hepatogastroenterology 41 1994 391 393 7959579 \n5 Le Prise E Etienne PL Meunier B A randomized study of chemotherapy, radiation therapy, and surgery versus surgery for localized squamous cell carcinoma of the esophagus Cancer 73 1994 1779 1784 8137201 \n6 Urba SG Orringer MB Turrisi A Iannettoni M Forastiere A Strawderman M Randomized trial of preoperative chemoradiation versus surgery alone in patients with locoregional esophageal carcinoma J Clin Oncol 19 2001 305 313 11208820 \n7 Bosset JF Gignoux M Triboulet JP Chemoradiotherapy followed by surgery compared with surgery alone in squamous-cell cancer of the esophagus N Engl J Med 337 1997 161 167 9219702 \n8 Roth JA Pass HI Flanagan MM Graeber GM Rosenberg JC Steinberg S Randomized clinical trial of preoperative and postoperative adjuvant chemotherapy with cisplatin, vindesine, and bleomycin for carcinoma of the esophagus J Thorac Cardiovasc Surg 96 1988 242 248 2456424 \n9 Schlag PM Randomized trial of preoperative chemotherapy for squamous cell cancer of the esophagus. The Chirurgische Arbeitsgemeinschaft Fuer Onkologie der Deutschen Gesellschaft Fuer Chirurgie Study Group Arch Surg 127 1992 1446 1450 1365692 \n10 Maipang T Vasinanukorn P Petpichetchian C Induction chemotherapy in the treatment of patients with carcinoma of the esophagus J Surg Oncol 56 1994 191 197 7518020 \n11 Law S Fok M Chow S Chu KM Wong J Preoperative chemotherapy versus surgical therapy alone for squamous cell carcinoma of the esophagus: a prospective randomized trial J Thorac Cardiovasc Surg 114 1997 210 217 9270638 \n12 Boonstra JJ Kok TC Wijnhoven BP Chemotherapy followed by surgery versus surgery alone in patients with resectable oesophageal squamous cell carcinoma: long-term results of a randomized controlled trial BMC Cancer 11 2011 181 21595951 \n13 Ancona E Ruol A Santi S Only pathologic complete response to neoadjuvant chemotherapy improves significantly the long term survival of patients with resectable esophageal squamous cell carcinoma: final report of a randomized, controlled trial of preoperative chemotherapy versus surgery alone Cancer 91 2001 2165 2174 11391598 \n14 Burmeister BH Smithers BM Gebski V for the Trans-Tasman Radiation Oncology Group (TROG) and the Australasian Gastro-Intestinal Trials Group (AGITG) Surgery alone versus chemoradiotherapy followed by surgery for resectable cancer of the oesophagus: a randomised controlled phase III trial Lancet Oncol 6 2005 659 668 16129366 \n15 Tepper J Krasna MJ Niedzwiecki D Phase III trial of trimodality therapy with cisplatin, fluorouracil, radiotherapy, and surgery compared with surgery alone for esophageal cancer: CALGB 9781 J Clin Oncol 26 2008 1086 1092 18309943 \n16 Mariette C Dahan L Mornex F Surgery alone versus chemoradiotherapy followed by surgery for stage I and II esophageal cancer: final analysis of randomized controlled phase III trial FFCD 9901 J Clin Oncol 32 2014 2416 2422 24982463 \n17 van Hagen P Hulshof MC van Lanschot JJ for the CROSS Group Preoperative chemoradiotherapy for esophageal or junctional cancer N Engl J Med 366 2012 2074 2084 22646630 \n18 Kelsen DP Winter KA Gunderson LL Long-term results of RTOG trial 8911 (USA Intergroup 113): a random assignment trial comparison of chemotherapy followed by surgery compared with surgery alone for esophageal cancer J Clin Oncol 25 2007 3719 3725 17704421 \n19 Medical Research Council Oesophageal Cancer Working Group Surgical resection with or without preoperative chemotherapy in oesophageal cancer: a randomised controlled trial Lancet 359 2002 1727 1733 12049861 \n20 Klevebro F Alexandersson von Döbeln G Wang N A randomized clinical trial of neoadjuvant chemotherapy versus neoadjuvant chemoradiotherapy for cancer of the oesophagus or gastro-oesophageal junction Ann Oncol 27 2016 660 667 26782957 \n21 Walsh TN Noonan N Hollywood D Kelly A Keeling N Hennessy TP A comparison of multimodal therapy and surgery for esophageal adenocarcinoma N Engl J Med 335 1996 462 467 8672151 \n22 Ychou M Boige V Pignon JP Perioperative chemotherapy compared with surgery alone for resectable gastroesophageal adenocarcinoma: an FNCLCC and FFCD multicenter phase III trial J Clin Oncol 29 2011 1715 1721 21444866 \n23 Stahl M Walz MK Stuschke M Phase III comparison of preoperative chemotherapy compared with chemoradiotherapy in patients with locally advanced adenocarcinoma of the esophagogastric junction J Clin Oncol 27 2009 851 856 19139439 \n24 Burmeister BH Thomas JM Burmeister EA Is concurrent radiation therapy required in patients receiving preoperative chemotherapy for adenocarcinoma of the oesophagus? A randomised phase II trial Eur J Cancer 47 2011 354 360 21084184 \n25 Cunningham D Allum WH Stenning SP Perioperative chemotherapy versus surgery alone for resectable gastroesophageal cancer N Engl J Med 355 2006 11 20 16822992 \n26 Twelves C on behalf of the Xeloda Colorectal Cancer Group Capecitabine as first-line treatment in colorectal cancer. Pooled data from two large, phase III trials Eur J Cancer 38 suppl 2 2002 15 20 11841931 \n27 Cunningham D Starling N Rao S for the Upper Gastrointestinal Clinical Studies Group of the National Cancer Research Institute of the United Kingdom Capecitabine and oxaliplatin for advanced esophagogastric cancer N Engl J Med 358 2008 36 46 18172173 \n28 Sobin LH Wittekind Ch TNM classification of malignant tumours 6th edn. 2002 John Wiley & Sons Hoboken, NJ \n29 National Cancer Institute Common terminology criteria for adverse events v3.0 (CTCAE) http://ctep.cancer.gov/protocolDevelopment/electronic_applications/docs/ctcaev3.pdf Aug 9, 2006 (accessed Feb 17, 2016). \n30 Mapstone N Data set for the histopathological reporting of oesophageal carcinoma 2nd edition 2007 Royal College of Pathologists London https://www.rcpath.org/resourceLibrary/g006oesophagealdatasetfinalfeb07-pdf.html (accessed Oct 28, 2015). \n31 Mandard AM Dalibard F Mandard JC Pathologic assessment of tumor regression after preoperative chemoradiotherapy of esophageal carcinoma. Clinicopathologic correlations Cancer 73 1994 2680 2686 8194005 \n32 Karamitopoulou E Thies S Zlobec I Assessment of tumor regression of esophageal adenocarcinomas after neoadjuvant chemotherapy: comparison of 2 commonly used scoring approaches Am J Surg Pathol 38 2014 1551 1556 25140894 \n33 Becker K Mueller JD Schulmacher C Histomorphology and grading of regression in gastric carcinoma treated with neoadjuvant chemotherapy Cancer 98 2003 1521 1530 14508841 \n34 Aaronson NK Ahmedzai S Bergman B The European Organization for Research and Treatment of Cancer QLQ-C30: a quality-of-life instrument for use in international clinical trials in oncology J Natl Cancer Inst 85 1993 365 376 8433390 \n35 Blazeby JM Conroy T Hammerlid E Clinical and psychometric validation of an EORTC questionnaire module, the EORTC QLQ-OES18, to assess quality of life in patients with oesophageal cancer Eur J Cancer 39 2003 1384 1394 12826041 \n36 Anderson JR Cain KC Gelber RD Analysis of survival by tumor response and other comparisons of time-to-event by outcome variables J Clin Oncol 26 2008 3913 3915 18711176 \n37 Royston P Parmar MK Flexible parametric proportional-hazards and proportional-odds models for censored survival data, with application to prognostic modelling and estimation of treatment effects Stat Med 21 2002 2175 2197 12210632 \n38 Cunningham D Smyth E Stenning S Peri-operative chemotherapy ± bevacizumab for resectable gastro-oesophageal adenocarcinoma: Results from the UK Medical Research Council randomised ST03 trial (ISRCTN 46020948) Eur J Cancer 51 suppl 3 2015 S400 (abstr 2201). \n39 Shapiro J van Lanschot JJ Hulshof MC CROSS Study Group Neoadjuvant chemoradiotherapy plus surgery versus surgery alone for oesophageal or junctional cancer (CROSS): long-term results of a randomised controlled trial Lancet Oncol 16 2015 1090 1098 26254683 \n40 Jacobs M Macefield RC Elbers RG Meta-analysis shows clinically relevant and long-lasting deterioration in health-related quality of life after esophageal cancer surgery Qual Life Res 23 2014 1155 1176 24293086 \n41 Al-Batran SE Homann N Schmalenberg H Perioperative chemotherapy with docetaxel, oxaliplatin, and fluorouracil/leucovorin (FLOT) versus epirubicin, cisplatin, and fluorouracil or capecitabine (ECF/ECX) for resectable gastric or gastroesophageal junction (GEJ) adenocarcinoma (FLOT4-AIO): A multicenter, randomized phase 3 trial Proc Am Soc Clin Oncol 35 2017 (abstr) 4004. \n42 Leong T Smithers BM Michael M TOPGEAR: a randomised phase III trial of perioperative ECF chemotherapy versus preoperative chemoradiation plus perioperative ECF chemotherapy for resectable gastric cancer (an international, intergroup trial of the AGITG/TROG/EORTC/NCIC CTG) BMC Cancer 15 2015 532 26194186 \n43 Keegan N Keane F Cuffe S ICORG 10–14: Neo-AEGIS: a randomized clinical trial of neoadjuvant and adjuvant chemotherapy (modified MAGIC regimen) versus neoadjuvant chemoradiation (CROSS protocol) in adenocarcinoma of the esophagus and esophagogastric junction Proc Am Soc Clin Oncol 32 2014 (abstr) TPS4145.\n\n", "fulltext_license": "CC BY", "issn_linking": "1470-2045", "issue": "18(9)", "journal": "The Lancet. Oncology", "keywords": null, "medline_ta": "Lancet Oncol", "mesh_terms": "D000230:Adenocarcinoma; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000970:Antineoplastic Agents; D000069287:Capecitabine; D002945:Cisplatin; D004359:Drug Therapy, Combination; D015251:Epirubicin; D004938:Esophageal Neoplasms; D016629:Esophagectomy; D005260:Female; D005472:Fluorouracil; D006801:Humans; D008297:Male; D008875:Middle Aged; D020360:Neoadjuvant Therapy; D011788:Quality of Life; D015996:Survival Rate", "nlm_unique_id": "100957246", "other_id": null, "pages": "1249-1260", "pmc": null, "pmid": "28784312", "pubdate": "2017-09", "publication_types": "D017428:Clinical Trial, Phase III; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't", "references": "7518020;18172173;16822992;19139439;14508841;1455880;18711176;17704421;26194186;1365692;21084184;12826041;25140894;16129366;2456424;8433390;24982463;7959579;9270638;21684205;21444866;8672151;8137201;24293086;12210632;18309943;26254683;11841931;26782957;23800671;21595951;12049861;8194005;11208820;22646630;11391598;9219702", "title": "Neoadjuvant cisplatin and fluorouracil versus epirubicin, cisplatin, and capecitabine followed by resection in patients with oesophageal adenocarcinoma (UK MRC OE05): an open-label, randomised phase 3 trial.", "title_normalized": "neoadjuvant cisplatin and fluorouracil versus epirubicin cisplatin and capecitabine followed by resection in patients with oesophageal adenocarcinoma uk mrc oe05 an open label randomised phase 3 trial" }
[ { "companynumb": "GB-PFIZER INC-2017355359", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "CISPLATIN" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nImmune checkpoint inhibitors (ICIs) have become the standard of care in many cancer types. As the number of patients receiving ICIs for various cancers continues to expand, patients and practitioners should be aware of potentially severe immune-related adverse events (irAEs). Despite reports of the incidence of grade 3/4 toxicities, the proportion of patients whose symptoms were clinically severe enough to warrant hospitalization for adverse event management is unknown.\n\n\nMETHODS\nThis single center, retrospective, observational study was designed to determine the impact of irAEs on patients and the hospital. Patients who started ICIs from May 2016 through May 2019 for melanoma or lung cancer were included. The primary outcome was incidence of hospitalization for irAE. Secondary outcomes included median length of hospitalization, time to onset of irAE, rates of hospitalization for irAE per each checkpoint inhibitor regimen, organ system affected, progression free survival, and overall survival.\n\n\nRESULTS\nOf 384 patients with melanoma or lung cancer, 27 (7%) were hospitalized at our institution for an irAE. The most common irAE leading to hospitalization was colitis for patients with melanoma and pneumonitis for patients with lung cancer. The median length of stay across all hospitalizations was 10 days. Twenty-five patients required the use of corticosteroids while hospitalized, while eight of these patients required second line irAE treatment. For the total patient population, 34.7% experienced a grade 1/2 irAE and 13.1% experienced a grade 3/4 irAE.\n\n\nCONCLUSIONS\nOur cohort of patients experienced similar rates irAEs as reported in clinical trials and published reports.", "affiliations": "Department of Pharmacy, University of Louisville Hospital, Louisville, KY, USA.;Department of Pharmacy, University of Louisville Hospital, Louisville, KY, USA.;Biostatistics and Bioinformatics Facility, University of Louisville James Graham Brown Cancer Center, Louisville, KY, USA.;Biostatistics and Bioinformatics Facility, University of Louisville James Graham Brown Cancer Center, Louisville, KY, USA.;Department of Pharmacy, University of Louisville Hospital, Louisville, KY, USA.;Department of Hematology and Medical Oncology, University of Louisville James Graham Brown Cancer Center, Louisville, KY, USA.;Department of Pharmacy, University of Louisville Hospital, Louisville, KY, USA.", "authors": "Nice|Laura|L|https://orcid.org/0000-0003-4443-2932;Bycroft|Ryan|R|;Wu|Xiaoyong|X|;Rai|Shesh N|SN|;Figg|Lindsay|L|;Bhandari|Shruti|S|;Burd|Megan|M|", "chemical_list": "D000082082:Immune Checkpoint Inhibitors", "country": "England", "delete": false, "doi": "10.1177/1078155220968909", "fulltext": null, "fulltext_license": null, "issn_linking": "1078-1552", "issue": "27(7)", "journal": "Journal of oncology pharmacy practice : official publication of the International Society of Oncology Pharmacy Practitioners", "keywords": "Immune-related adverse events; hospitalization; immune checkpoint inhibitors; immunotherapy; irAE", "medline_ta": "J Oncol Pharm Pract", "mesh_terms": "D015331:Cohort Studies; D006760:Hospitalization; D006801:Humans; D000082082:Immune Checkpoint Inhibitors; D008545:Melanoma; D012189:Retrospective Studies", "nlm_unique_id": "9511372", "other_id": null, "pages": "1736-1742", "pmc": null, "pmid": "33100180", "pubdate": "2021-10", "publication_types": "D016428:Journal Article; D064888:Observational Study", "references": null, "title": "Assessment of hospitalization rates for immune-related adverse events with immune checkpoint inhibitors.", "title_normalized": "assessment of hospitalization rates for immune related adverse events with immune checkpoint inhibitors" }
[ { "companynumb": "US-ROCHE-2952824", "fulfillexpeditecriteria": "1", "occurcountry": null, "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ATEZOLIZUMAB" }, "drugadditional": "3", "dru...
{ "abstract": "Patients may be referred to Acute Medical Units (AMUs) with a diagnosis of 'acopia'. This term is offensive and lazy, implying fault on the part of the patient and allowing the assessing doctor to erroneously label the patient as a 'social admission' when, in fact, such patients are likely to be frail with co-morbidities and have an acute (potentially reversible) illness. Frail older patients should be assessed using the principles of Comprehensive Geriatric Assessment, informed by an understanding of the concept of frailty and of geriatric syndromes such as falls and delirium.", "affiliations": "Pinderfields Hospital, ST4 Elderly Medicine, Aberford Road, Wakefield, WF1 4DG, UK.", "authors": "Granger|K|K|;Ninan|S|S|;Stopford|E|E|", "chemical_list": null, "country": "England", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1747-4884", "issue": "12(3)", "journal": "Acute medicine", "keywords": null, "medline_ta": "Acute Med", "mesh_terms": "D000058:Accidental Falls; D000203:Activities of Daily Living; D000223:Adaptation, Psychological; D000369:Aged, 80 and over; D003072:Cognition Disorders; D015897:Comorbidity; D003248:Constipation; D003625:Data Collection; D005260:Female; D016330:Frail Elderly; D015577:Geriatric Assessment; D006801:Humans; D010348:Patient Care Team; D014549:Urinary Incontinence", "nlm_unique_id": "101553725", "other_id": null, "pages": "173-7", "pmc": null, "pmid": "24098878", "pubdate": "2013", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "The patient presenting with 'acopia'.", "title_normalized": "the patient presenting with acopia" }
[ { "companynumb": "PHHY2013GB144912", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "RAMIPRIL" }, "drugadditional": null, "druga...
{ "abstract": "Primary osseous tumors of the spinal column account for approximately 1% of the total number of spinal tumors found in the pediatric patient population. The authors present a case of a C1 benign giant cell lesion that was incidentally found in a 15-year-old patient. A transoral biopsy was performed followed by treatment with denosumab, with definitive management in the form of transoral tumor resection with subsequent occiput-cervical three posterior instrumented fusion. The patient tolerated all of the procedures well, as there were no post-operative complications, discharged home neurologically intact and was eager to return to school when assessed during a follow-up visit in clinic. Osteolytic lesions affecting the cervical spine are rare in the pediatric population. It is of utmost importance to have sufficient background knowledge in order to formulate a differential diagnosis, as well as an understanding of principles underlying surgical techniques required to prevent occipital-cervical instability in this patient population. The information presented will guide surgical decision-making by identifying the patient population that would benefit from neurosurgical interventions to stabilize the atlantoaxial junction, in the context of rare osteolytic conditions affecting the cervical spine.", "affiliations": "Loma Linda University School of Medicine, Loma Linda, CA 92354, USA. ckheinrich@llu.edu.;Center for Perinatal Biology, Department of Basic Sciences, Loma Linda University, 11234 Anderson Street, Room 2567, Loma Linda, CA 92354, USA. vgospodarev@llu.edu.;Department of Pediatric Hematology/Oncology, Loma Linda University Medical Center, 11234 Anderson Street, Loma Linda, CA 92354, USA. AKheradp@llu.edu.;Department of Pathology, Loma Linda University Medical Center, 11234 Anderson Street, Loma Linda, CA 92354, USA. CZuppan@llu.edu.;Department of Neurosurgery, Loma Linda University Medical Center, 11234 Anderson Street, Room 2556, Loma Linda, CA 92354, USA. CCDougla@llu.edu.;Department of Neurosurgery, Loma Linda University Medical Center, 11234 Anderson Street, Room 2556, Loma Linda, CA 92354, USA. TMinasian@llu.edu.", "authors": "Heinrich|Christopher|C|;Gospodarev|Vadim|V|;Kheradpour|Albert|A|;Zuppan|Craig|C|;Douglas|Clifford C|CC|;Minasian|Tanya|T|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.3390/brainsci9050105", "fulltext": "\n==== Front\nBrain SciBrain ScibrainsciBrain Sciences2076-3425MDPI 10.3390/brainsci9050105brainsci-09-00105Case ReportBenign Giant Cell Lesion of C1 Lateral Mass: A Case Report and Literature Review Heinrich Christopher 1Gospodarev Vadim 2*Kheradpour Albert 3Zuppan Craig 4Douglas Clifford C. 5Minasian Tanya 51 Loma Linda University School of Medicine, Loma Linda, CA 92354, USA; ckheinrich@llu.edu2 Center for Perinatal Biology, Department of Basic Sciences, Loma Linda University, 11234 Anderson Street, Room 2567, Loma Linda, CA 92354, USA3 Department of Pediatric Hematology/Oncology, Loma Linda University Medical Center, 11234 Anderson Street, Loma Linda, CA 92354, USA; AKheradp@llu.edu4 Department of Pathology, Loma Linda University Medical Center, 11234 Anderson Street, Loma Linda, CA 92354, USA; CZuppan@llu.edu5 Department of Neurosurgery, Loma Linda University Medical Center, 11234 Anderson Street, Room 2556, Loma Linda, CA 92354, USA; CCDougla@llu.edu (C.C.D.); TMinasian@llu.edu (T.M.)* Correspondence: vgospodarev@llu.edu; Tel.: +1-909-558-441908 5 2019 5 2019 9 5 10524 3 2019 07 5 2019 © 2019 by the authors.2019Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).Primary osseous tumors of the spinal column account for approximately 1% of the total number of spinal tumors found in the pediatric patient population. The authors present a case of a C1 benign giant cell lesion that was incidentally found in a 15-year-old patient. A transoral biopsy was performed followed by treatment with denosumab, with definitive management in the form of transoral tumor resection with subsequent occiput-cervical three posterior instrumented fusion. The patient tolerated all of the procedures well, as there were no post-operative complications, discharged home neurologically intact and was eager to return to school when assessed during a follow-up visit in clinic. Osteolytic lesions affecting the cervical spine are rare in the pediatric population. It is of utmost importance to have sufficient background knowledge in order to formulate a differential diagnosis, as well as an understanding of principles underlying surgical techniques required to prevent occipital-cervical instability in this patient population. The information presented will guide surgical decision-making by identifying the patient population that would benefit from neurosurgical interventions to stabilize the atlantoaxial junction, in the context of rare osteolytic conditions affecting the cervical spine.\n\npainspinespinal diseasetransoralatlantoaxialsurgery\n==== Body\n1. Introduction\nSpinal tumors comprise approximately 5–10% of all pediatric central nervous system (CNS) tumors [1,2,3]. Primary osseous tumors of the spinal column only account for approximately 1% of the total number of spinal tumors [4]. The authors present a case of a C1 benign giant cell lesion, that was incidentally found in a 15-year-old patient. Despite the benign pathologic diagnosis, the unusual location and behavior of the lesion warranted an interesting surgical approach. Including a transoral biopsy first, followed by treatment with Denosumab, and finally definitive management in the form of transoral tumor resection with subsequent occiput-cervical three posterior instrumented fusion. Due to the complex anatomy of the atlantooccipital and atlantoaxial joint spaces and related structures, treatment of a mass in this region, whether benign or malignant, would necessitate non-surgical management as first-line treatment. However, if a mass is deemed to be locally destructive, resistant to medical management, or both, then a definitive surgical approach is necessary. Regardless of treatment paradigm, effective dissolution of a lytic lesion in this region can destabilize the atlantooccipital and atlantoaxial joints endangering key neurovascular structures. Because of this, stabilization of these joints using instrumented fusion is key to prevention of patient morbidity and potential mortality. \n\n2. Case Description\nA 15-year-old female with no significant past medical history presented after being struck in the face by a ball while playing water polo. The patient felt pain in her jaw, which was the chief complaint when she presented to the emergency department. Upon neurological assessment, the patient complained of midline tenderness from the skull base to midline cervical spine over C3; denied headaches, changes in vision, speech or swallowing, extremity weakness or paresthesias. A maxillofacial computed tomography (CT) scan did not show evidence of an acute facial fracture. However, the CT scan did reveal a radiolucent, ovoid-shaped lytic lesion arising in the left lateral mass of C1, between the anterior tubercle and the transverse process. Magnetic resonance imaging (MRI) studies further confirmed an enhancing osseous lesion at the left lateral mass of C1, with cortical breach and extension into the left lateral atlantodental joint space (Figure 1). Of note, three years prior, patient had a CT cervical spine which, upon retrospective review, demonstrated a similar but much smaller lesion.\n\nDifferential diagnoses underlying this vertebral cortical erosion included those of infectious etiology, as well as oncologic lesions, such as giant cell tumor of bone, aneurysmal bone cyst, osteoblastoma, osteosarcoma or even Langerhans histiocytosis (LCH). Oncology recommended that the cervical spine lesion be biopsied for tissue diagnosis. Due to the unusual location of the lesion and risk of locally aggressive pathology, or possible tumor seeding along the biopsy track, interventional radiology was unable to perform a CT guided needle biopsy. It was therefore decided that the patient would require open neurosurgical biopsy for diagnosis. \n\nDue to the anterior and lateral location of the vertebral lesion, an anterior transoral approach to the C1 lesion was performed, in order to obtain a sufficient amount of the contrast enhancing component of the mass for pathologic diagnosis. The transoral approach was performed in a multidisciplinary fashion, during which the otolaryngology team used direct visualization, as well as stereotactic navigation, to expose the C1 anterior tubercle on the left side. Once exposure was completed, neurosurgery team utilized a matchstick burr to then drill the anterior outer cortex of C1. Multiple specimens from the fibrous tumor were taken, with curettes and pituitary forceps. \n\nThe sampled tissue did not show features of osteoblastoma or osteosarcoma, nor were there features of LCH or signs of infection. In the sampled region, the lesion consisted of a proliferation of nondescript stromal cells with intermixed multinucleated giant cells, and occasional clusters of foamy histiocytes (Figure 2). Special testing for giant cell tumor of bone (G34W staining) was negative, as was fluorescence in situ hybridization (FISH) testing for Ubiquitin Specific Peptidase 6 (USP6), making a primary form of aneurysmal bone cyst unlikely. However, due to the aggressive nature of the patient’s osteolytic lesion and the significant risk for atlantoaxial instability associated with its location, it was decided to start the patient on Denosumab. Denosumab is an osteoclast inhibiting pharmaceutical agent, which was administered to the patient in order to stabilize and consolidate the lesion. Samples of the patient’s lesion were also sent out to a nationally recognized expert bone pathologist, whose findings were most consistent with benign giant cell rich lesion with histiocytes. \n\nThe patient was re-assessed three months postoperatively and MRI studies revealed that there was no interval decrease in the size of the tumor. In fact, there was a slight progression of the lesion anteriorly, despite treatment with Denosumab. After presenting the patient’s case at our institution’s multidisciplinary tumor board, it was decided to offer the patient a gross total resection of the offending lesion. This would inherently lead to significant atlantoaxial instability, therefore a posterior occiput to cervical three instrumented fusion was also warranted.\n\nThe transoral approach was performed in a multidisciplinary fashion, during which the otolaryngology team used direct visualization as well as stereotactic navigation, to expose the cervical vertebrae through the posterior pharynx. Fibrous tumor was identified and dissected until superior, inferior, and lateral margins of tumor resection were confirmed grossly, with fluoroscopy, and neuronavigation. Additional C1 anterior tubercle eccentric towards the right side was also taken, to include a normal bony margin. A small rim of tumor adherent to the vertebral artery was left behind. After the otolaryngology team closed the posterior pharynx, the patient was carefully turned prone, maintaining spinal precautions. Base of the occiput to cervical three was then exposed. C2 pedicle screws were placed. C3 lateral mass screws were placed. An occipital plate was sized. Screws into the occiput were placed. Fluoroscopy confirmed excellent position and spinal alignment. There were no post-operative complications and the patient was discharged home in good condition. Pathologic examination of the resected material at this time showed complete disappearance of the giant cells, due to Denosumab therapy, with the remaining lesional tissue resembling benign fibrous histiocytoma (Figure 2). Post-operative imaging studies revealed a stable posterior cervical spine construct, along with minimal rim-enhancement along the vertebral artery, as expected (Figure 3). At a three-week follow up visit in clinic, the patient’s incisions were healing well, she was neurologically intact, tolerating regular diet, and was eager to return to school.\n\n3. Discussion\nThe differential diagnosis for a spinal column tumor in a pediatric patient is broad, ranging from primary osseous lesions like osteochondromas and osteosarcomas, to tumors of soft tissue origin like rhabdomyosarcoma or neuroblastoma. If the patient’s age is taken into consideration, the most common primary osseous tumors in the pediatric spinal column are as follows: 0–5 years of age: eosinophilic granuloma; 5–10 years of age: aneurysmal bone cyst, eosinophilic granuloma, osteoblastoma, osteoid osteoma, osteosarcoma, and Ewing sarcoma; lastly 10–20 years of age: aneurysmal bone cyst, osteochondroma, osteoid osteoma, osteosarcoma, Ewing sarcoma [5]. \n\nThe most common primary osseous tumor in children is osteochondroma, which makes up about 4% of solitary spinal column tumors. They are benign lesions that consist of an abnormal outgrowth of bone with cartilaginous cap [4]. When these occur in the spine, they occur most often in the cervical spine and must be considered when evaluating a solitary spinal mass in a pediatric patient [6,7,8]. Of note, about 10% of these tumors will undergo malignant transformation to osteosarcoma. These tumors are usually seen in patients from ages 10–20 and make up about 5% of all spinal lesions [4,9]. \n\nThe most common malignant primary bone tumor seen in the spinal column of pediatric patients is Ewing sarcoma. Interestingly, these lesions can either arise as primary spinal lesions, or metastasize from other locations to the spine, a characteristic not usually seen in other primary osseous lesions. Ewing sarcoma has a predilection for the sacrum and are found less commonly in the lumbar, thoracic spine, and cervical spine, with decreasing frequency [10]. Osteoblastoma and osteoid osteoma are very pathologically similar primary osseous lesions. They differ mainly in size and behavior, and spinal lesions are most commonly found in the lumbar region [11]. Osteoblastomas are larger, generally greater than 2 cm, and tend to be locally aggressive whereas osteoid osteomas tend to be smaller than 1 cm and more latent, tending to “burn out” over time [12,13].\n\nAnother benign primary osseous lesion that can arise in the spine is the aneurysmal bone cyst. These lesions typically present in patients that are 20 years of age or younger and usually affect the lumbar spine [14,15]. Of note, these lesions can invade the pedicles and vertebral bodies on multiple vertebral levels [16]. Lastly, Langerhans cell histiocytosis is a common finding that can be seen in any bone, but occurs in the spine in approximately 10%–15% of cases [5]. The thoracic and cervical spinal regions tend to be the most common locations for this entity [17,18].\n\nManagement of most osseous spinal lesions involves en bloc resection with clear margins to avoid tumor recurrence and can be followed by adjuvant therapy, if indicated by pathologic analysis [19,20]. However, careful consideration must be taken to determine the best approach to a spinal column tumor, especially if it is in the cervical region. Tumors in the posterior aspect of the cervical spine usually require a posterior approach with the patient in the prone position [21]. Tumors along the anterior aspect of the spine present a more difficult management dilemma. The anatomy in this region is highly complex and involves many critical neurovascular structures that must be preserved to maintain the patient’s post-operative functional status. The transoral approach, which was originally pioneered by Kanavel in 1917, allows for midline access to a wider surgical field with access to multiple cervical vertebrae from C1 to C4 with less compromise to key neurovascular structures [22,23]. This approach has been used in the past to access the anterior cervical spine as noted by Tuite et al. in their report on 27 pediatric patients with occipitocervical junction pathology [24]. They also note that while this approach could have associated morbidity, such as temporomandibular joint dislocation, pharyngeal infection, and swallowing complications, when a standard transoral approach is completed and the hard palate is not compromised, the approach is safe and well tolerated [24,25]. Interestingly, this anatomic region has also been approached via the trans-nasal route as noted by Grammatica et al. This approach is well suited for patients with smaller oral cavities, that would limit the transoral approach and may represent decreased patient morbidity due to the lack of oral retraction during the procedure [26]. However, in cases where tumor pathology is quite lateral in its extent, trans-nasal approach would not allow for proper visualization of key neurovascular structures and would hinder the gross total resection. \n\nTo prevent occipitocervical instability, it is often necessary to reconstruct elements of the cervical vertebral column after tumor extirpation. Instability is usually due to a combination of destruction of local anatomy by the tumor and correlates to extent of bony and ligamentous removal during surgery [21]. In these cases, posterior cervical fusion is warranted. In the patient presented here, given extent of bony C1 removal, compromising the ability to place hardware into C1, an occiput to cervical three construct was required for adequate stabilization.\n\n4. Conclusions\nHere we report a case of an osteolytic lesion that was incidentally found in the cervical spine of a pediatric patient. The relevant differential diagnosis, as well as surgical techniques involved in treating this patient, have been thoroughly discussed. Anatomy of the atlantooccipital and atlantoaxial joint spaces is complex and medical management of osteolytic lesions discovered in this area should be considered as first-line treatment. However, when the offending lesion is locally aggressive and does not respond to medical management, one must consider surgical intervention for attempted gross total resection, with stabilization of the cranio-vertebral junction. Stabilization of the aforementioned junction using instrumented fusion is key to prevention of patient morbidity and mortality. It is our hope that the information presented will guide surgical decision-making. It is critical to be able to correctly identify the patient population that would most likely benefit from neurosurgical interventions, in the context of rare osteolytic conditions affecting the cervical spine.\n\nAuthor Contributions\nConceptualization, T.M., C.C.D., C.Z. and A.K.; Methodology, T.M., C.C.D., C.Z. and A.K.; Formal Analysis, T.M., C.C.D., C.Z. and A.K.; Investigation, T.M., C.C.D., C.Z. and A.K.; Resources, T.M., C.C.D., C.Z. and A.K.; Writing—original draft preparation, C.H., V.G., T.M. and C.Z.; Writing—review and editing, C.H., V.G., T.M. and C.Z.; Supervision, T.M. and C.Z.; Project administration, T.M. and C.Z.\n\nFunding\nThis research received no external funding.\n\nConflicts of Interest\nThe authors declare no conflict of interest.\n\nFigure 1 Pre-Operative Imaging Studies. CT of cervical spine, axial view, demonstrating the radiolucent, ovoid-shaped, lytic lesion (white arrow) arising in the left lateral mass of C1 between the anterior tubercle and the transverse process (A). CT of cervical spine, coronal view, demonstrating the lesion (white arrow) (B). Post-contrast MRI T1, axial view, demonstrating an enhancing osseous lesion (white arrow) at the left lateral mass of C1 with cortical breach and extension into the left lateral atlantodental joint space (C). Post-contrast MRI T1, coronal view, of the lesion (white arrow) (D).\n\nFigure 2 Histopathology. Hematoxylin and eosin (H&E) stained tissue from the initial biopsy which showed moderate prominence of histiocytic foam cells (black arrowhead), intermixed spindle cells, and scattered giant cells (A). H&E stained tissue following Denosumab therapy, showing disappearance of the giant cells, few foamy histiocytes, and predominance of short spindled cells in a collagenous stroma (black arrowhead) (B).\n\nFigure 3 Post-Operative Imaging Studies. Lateral view X-ray of the cervical spine demonstrating hardware on the occiput connected by rods to pedicle screws in C2 and lateral mass screws in C3 bilaterally (A). Open mouth odontoid view X-ray demonstrates normal symmetry of C1 and C2 articulation (B). Post-contrast MRI T1, sagittal view, demonstrates minimal rim-enhancement within the left lateral C1 representing mild residual tumor (white arrow) (C). Post-contrast MRI T1, axial view, of the residual lesion (white arrow) (D).\n==== Refs\nReferences\n1. Rosemberg S. Fujiwara D. Epidemiology of pediatric tumors of the nervous system according to the WHO 2000 classification: A report of 1,195 cases from a single institution Child’s Nerv. Syst. 2005 21 940 944 10.1007/s00381-005-1181-x 16044344 \n2. Vincent F. Fehlings M.G. Nater A. Spinal column tumors Neuro-Concology: The Essentials Bernstein M. Berger M. Thieme New York, NY, USA 2000 391 402 \n3. West R. Childhood cancer mortality: International comparisons 1955–1974 World Health Stat. Q. Rapp. Trimest. Stat. Sanit. Mond. 1984 37 98 127 \n4. Harter D. Weiner H. Spinal tumors Principles and Practice of Pediatric Neurosurgery Albright A.L. Pollack I. Adelson P. Thieme New York, NY, USA 2014 \n5. Ravindra V.M. Eli I.M. Schmidt M.H. Brockmeyer D.L. Primary osseous tumors of the pediatric spinal column: Review of pathology and surgical decision making Neurosurg. Focus 2016 41 E3 10.3171/2016.5.FOCUS16155 \n6. Albrecht S. Crutchfield J.S. SeGall G.K. On spinal osteochondromas J. Neurosurg. 1992 77 247 252 10.3171/jns.1992.77.2.0247 1625013 \n7. Sharma M.C. Arora R. Deol P.S. Mahapatra A.K. Mehta V.S. Sarkar C. Osteochondroma of the spine: An enigmatic tumor of the spinal cord. A series of 10 cases J. Neurosurg. Sci. 2002 46 66 70 66–70; discussion 70 12232551 \n8. Zaijun L. Xinhai Y. Zhipeng W. Wending H. Quan H. Zhenhua Z. Dapeng F. Jisheng Z. Wei Z. Jianru X. Outcome and prognosis of myelopathy and radiculopathy from osteochondroma in the mobile spine: A report on 14 patients J. Spinal Disord. Technol. 2013 26 194 199 10.1097/BSD.0b013e31823eb239 \n9. Ilaslan H. Sundaram M. Unni K.K. Shives T.C. Primary vertebral osteosarcoma: Imaging findings Radiology 2004 230 697 702 10.1148/radiol.2303030226 14749514 \n10. Venkateswaran L. Rodriguez-Galindo C. Merchant T.E. Poquette C.A. Rao B.N. Pappo A.S. Primary Ewing tumor of the vertebrae: Clinical characteristics, prognostic factors, and outcome Med. Pediatr. Oncol. 2001 37 30 35 10.1002/mpo.1159 11466720 \n11. Saifuddin A. White J. Sherazi Z. Shaikh M.I. Natali C. Ransford A.O. Osteoid osteoma and osteoblastoma of the spine. Factors associated with the presence of scoliosis Spine 1998 23 47 53 10.1097/00007632-199801010-00010 9460152 \n12. Dormans J.P. Moroz L. Infection and tumors of the spine in children J. Bone Joint Surg. Am. 2007 89 Suppl. 1 79 97 17272426 \n13. McLeod R.A. Dahlin D.C. Beabout J.W. The spectrum of osteoblastoma A.J.R. Am. J. Roentgenol. 1976 126 321 325 10.2214/ajr.126.2.321 \n14. Hay M.C. Paterson D. Taylor T.K. Aneurysmal bone cysts of the spine J. Bone Joint Surg. Br. 1978 60 406 411 10.1302/0301-620X.60B3.681419 681419 \n15. Lifeso R.M. Younge D. Aneurysmal bone cysts of the spine Int. Orthop. 1985 8 281 285 10.1007/BF00266873 4018962 \n16. Capanna R. Albisinni U. Picci P. Calderoni P. Campanacci M. Springfield D.S. Aneurysmal bone cyst of the spine J. Bone Joint Surg. Am. 1985 67 527 531 10.2106/00004623-198567040-00004 3980496 \n17. Greenlee J.D.W. Fenoy A.J. Donovan K.A. Menezes A.H. Eosinophilic granuloma in the pediatric spine Pediatr. Neurosurg. 2007 43 285 292 10.1159/000103308 17627144 \n18. Levine S.E. Dormans J.P. Meyer J.S. Corcoran T.A. Langerhans’ cell histiocytosis of the spine in children Clin. Orthop. 1996 288 293 10.1097/00003086-199602000-00040 \n19. Cloyd J.M. Acosta F.L. Polley M.-Y. Ames C.P. En bloc resection for primary and metastatic tumors of the spine: A systematic review of the literature Neurosurgery 2010 67 435 444 10.1227/01.NEU.0000371987.85090.FF 20644431 \n20. Boriani S. Bandiera S. Biagini R. Bacchini P. Boriani L. Cappuccio M. Chevalley F. Gasbarrini A. Picci P. Weinstein J.N. Chordoma of the mobile spine: Fifty years of experience Spine 2006 31 493 503 10.1097/01.brs.0000200038.30869.27 16481964 \n21. Jiang H. He J. Zhan X. He M. Zong S. Xiao Z. Occipito-cervical fusion following gross total resection for the treatment of spinal extramedullary tumors in craniocervical junction: A retrospective case series World J. Surg. Oncol. 2015 13 279 10.1186/s12957-015-0689-0 26384486 \n22. Ortega-Porcayo L.A. Cabrera-Aldana E.E. Arriada-Mendicoa N. Gómez-Amador J.L. Granados-García M. Barges-Coll J. Operative technique for en bloc resection of upper cervical chordomas: Extended transoral transmandibular approach and multilevel reconstruction Asian Spine J. 2014 8 820 826 25558326 \n23. Kanavel A.B. Bullet located between the atlas and the base of the skull: Technique of removal through the mouth Surg. Clin. Chic. 1917 1 361 366 \n24. Tuite G.F. Veres R. Crockard H.A. Sell D. Pediatric transoral surgery: Indications, complications, and long-term outcome J. Neurosurg. 1996 84 573 583 10.3171/jns.1996.84.4.0573 8613848 \n25. Salem K.M.I. Visser J. Quraishi N.A. Trans-oral approach for the management of a C2 neuroblastoma Eur. Spine J. 2015 24 170 176 10.1007/s00586-014-3216-z 24549386 \n26. Grammatica A. Bonali M. Ruscitti F. Marchioni D. Pinna G. Cunsolo E.M. Presutti L. Transnasal endoscopic removal of malformation of the odontoid process in a patient with type I Arnold-Chiari malformation: A case report Acta Otorhinolaryngol. Ital. 2011 31 248 252 22058600\n\n", "fulltext_license": "CC BY", "issn_linking": "2076-3425", "issue": "9(5)", "journal": "Brain sciences", "keywords": "atlantoaxial; pain; spinal disease; spine; surgery; transoral", "medline_ta": "Brain Sci", "mesh_terms": null, "nlm_unique_id": "101598646", "other_id": null, "pages": null, "pmc": null, "pmid": "31071908", "pubdate": "2019-05-08", "publication_types": "D002363:Case Reports", "references": "11466720;12232551;14749514;16044344;1625013;16481964;17272426;175701;17627144;20644431;22058600;22124421;24549386;25558326;26384486;27476845;3980496;4018962;6485370;681419;8613848;8625594;9460152", "title": "Benign Giant Cell Lesion of C1 Lateral Mass: A Case Report and Literature Review.", "title_normalized": "benign giant cell lesion of c1 lateral mass a case report and literature review" }
[ { "companynumb": "US-AMGEN-USASP2019082702", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "DENOSUMAB" }, "drugadditional": "3", ...
{ "abstract": "Implant loosening is the most common indication for revision surgery after total hip arthroplasty (THA). Although bone resorption around the implants plays a pivotal role in the pathophysiology of loosening, it is unknown whether potent early inhibition of osteoclasts could mitigate this process and thus reduce the need for revision surgery. We performed a randomized, double-blind, placebo-controlled phase 2 trial in 64 patients aged 35 to 65 years with unilateral osteoarthritis of the hip. They underwent surgery with an uncemented THA and were randomized to either two subcutaneous doses of denosumab (n = 32) or placebo (n = 32) given 1 to 3 days and 6 months after surgery. Patients were followed for 24 months. Primary outcome was periprosthetic bone mineral density (BMD) of the hip at 12 months as measured by dual-energy X-ray absorptiometry (DXA). In addition, [18 F] sodium fluoride positron emission tomography/CT (F-PET) was performed in half of the patients for analysis of periprosthetic standardized uptake value (SUV). Analyses were made according to intention-to-treat principles. The trial was registered at ClinicalTrials.gov 2011-001481-18, NCT01630941. Denosumab potently inhibited early periprosthetic bone loss. After 12 months, BMD in the denosumab group was 32% (95% confidence interval [CI] 22-44) higher in Gruen zone 7 and 11% (95% CI 8-15) higher in zones 1 to 7. After 24 months, the difference in BMD between groups had decreased to 15% (95% CI 4-27) in zone 7 and 4% (95% CI 0-8) in zones 1 to 7. In both groups, SUV increased after surgery, but the increase was less pronounced in the denosumab group. Biochemical markers of bone metabolism decreased in the denosumab group in the first 12 months, but a rebound effect with marker concentrations above baseline was observed after 24 months. Denosumab potently prevents early periprosthetic bone loss after uncemented THA; however, the effect diminishes after discontinuation of treatment. Further research is needed to determine whether this bone loss will prove to be of clinical importance and, if so, whether the positive effect observed in this study could be preserved by either prolonged treatment with denosumab or additional antiresorptive treatment. © 2019 American Society for Bone and Mineral Research. © 2019 American Society for Bone and Mineral Research.", "affiliations": "Department of Surgical Sciences, Section of Orthopedics, Uppsala University, Uppsala, Sweden.;Department of Surgical Sciences, Section of Orthopedics, Uppsala University, Uppsala, Sweden.;Department of Orthopedics, Gävle Hospital, Gävle, Sweden.;Department of Surgical Sciences, Section of Nuclear Medicine & PET, Uppsala University, Uppsala, Sweden.;Department of Surgical Sciences, Section of Radiology, Uppsala University, Uppsala, Sweden.;Department of Surgical Sciences, Section of Orthopedics, Uppsala University, Uppsala, Sweden.;Department of Surgical Sciences, Section of Orthopedics, Uppsala University, Uppsala, Sweden.;Department of Surgical Sciences, Section of Orthopedics, Uppsala University, Uppsala, Sweden.", "authors": "Nyström|Andreas|A|0000-0001-7836-1648;Kiritopoulos|Demostenis|D|;Ullmark|Gösta|G|;Sörensen|Jens|J|;Petrén-Mallmin|Marianne|M|;Milbrink|Jan|J|;Hailer|Nils P|NP|;Mallmin|Hans|H|", "chemical_list": "D000069448:Denosumab", "country": "United States", "delete": false, "doi": "10.1002/jbmr.3883", "fulltext": null, "fulltext_license": null, "issn_linking": "0884-0431", "issue": "35(2)", "journal": "Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research", "keywords": "ANTIRESORPTIVES; BIOCHEMICAL MARKERS OF BONE TURNOVER; CLINICAL TRIALS; DXA; IMPLANTS", "medline_ta": "J Bone Miner Res", "mesh_terms": "D015502:Absorptiometry, Photon; D000328:Adult; D000368:Aged; D019644:Arthroplasty, Replacement, Hip; D015519:Bone Density; D000069448:Denosumab; D005500:Follow-Up Studies; D006801:Humans; D008875:Middle Aged", "nlm_unique_id": "8610640", "other_id": null, "pages": "239-247", "pmc": null, "pmid": "31589776", "pubdate": "2020-02", "publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Denosumab Prevents Early Periprosthetic Bone Loss After Uncemented Total Hip Arthroplasty: Results from a Randomized Placebo-Controlled Clinical Trial.", "title_normalized": "denosumab prevents early periprosthetic bone loss after uncemented total hip arthroplasty results from a randomized placebo controlled clinical trial" }
[ { "companynumb": "SE-AMGEN-SWESP2019175202", "fulfillexpeditecriteria": "2", "occurcountry": "SE", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "CALCIUM" }, "drugadditional": null, ...
{ "abstract": "Serotonin syndrome and neuroleptic malignant syndrome are two drug toxidromes that have often overlapping and confusing clinical pictures. We report a case of a young man who presented with alteration of mental status, autonomic instability and neuromuscular hyperexcitability following ingestion of multiple psychiatric and antiepileptic medications. The patient satisfied criteria for serotonin syndrome and neuroleptic malignant syndrome, and based on the characteristic clinical features, laboratory findings and clinical course it was concluded that the patient had both toxidromes. The patient was managed with cyproheptadine and supportive measures, and recovered over the course of 3 weeks. A brief review of literature highlighting the diagnostic clues as well as the importance of recognising and distinguishing the often missed and confounding diagnoses follows.", "affiliations": "Department of Medicine, Medical College Baroda, Vadodara, Gujarat, India.;Department of Medicine, Medical College Baroda, Vadodara, Gujarat, India.;Department of Medicine, Medical College Baroda, Vadodara, Gujarat, India.;Department of Medicine, Medical College Baroda, Vadodara, Gujarat, India.", "authors": "Dosi|Rupal|R|;Ambaliya|Annirudh|A|;Joshi|Harshal|H|;Patell|Rushad|R|", "chemical_list": "D018692:Antimanic Agents; D014150:Antipsychotic Agents; D018757:GABA Modulators; D018020:Lithium Compounds; D001569:Benzodiazepines; D002998:Clonazepam; D014635:Valproic Acid; D018967:Risperidone; D000077152:Olanzapine", "country": "England", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1757-790X", "issue": "2014()", "journal": "BMJ case reports", "keywords": null, "medline_ta": "BMJ Case Rep", "mesh_terms": "D018692:Antimanic Agents; D014150:Antipsychotic Agents; D001569:Benzodiazepines; D002998:Clonazepam; D003937:Diagnosis, Differential; D018757:GABA Modulators; D006801:Humans; D018020:Lithium Compounds; D008297:Male; D009459:Neuroleptic Malignant Syndrome; D000077152:Olanzapine; D018967:Risperidone; D020230:Serotonin Syndrome; D014635:Valproic Acid; D055815:Young Adult", "nlm_unique_id": "101526291", "other_id": null, "pages": null, "pmc": null, "pmid": "24957740", "pubdate": "2014-06-23", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review; D059040:Video-Audio Media", "references": "23353974;22563571;16923659;12269861;20306454;20433130;23145389;17541044;24358002;15784664", "title": "Serotonin syndrome versus neuroleptic malignant syndrome: a challenging clinical quandary.", "title_normalized": "serotonin syndrome versus neuroleptic malignant syndrome a challenging clinical quandary" }
[ { "companynumb": "IN-ACCORD-028616", "fulfillexpeditecriteria": "1", "occurcountry": "IN", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "RISPERIDONE" }, "drugadditional": null, "dru...
{ "abstract": "A 55-year-old male was admitted to the hospital with pneumonia. During an intubation procedure, the patient received an application of endobronchial lidocaine (4% gel). Within 2 h of intubation, the patient developed worsening hypoxia, and investigation of arterial blood gasses revealed a pH of 7.21, carbon dioxide partial pressure (PaCO2) of 3.3 kPa, oxygen partial pressure (PaO2) of 55.1 kPa, and measured oxygen saturation of 49%. Co-oximetry of this sample returned a methemoglobin level of 53%. Intravenous methylthioninium chloride (1% solution at 1 mg/kg) was delivered, and subsequent arterial blood gasses, at 30 min and 1 h post administration, showed methemoglobin levels of 12 and 9%, respectively, with return of oxygen saturation to > 90%.", "affiliations": "Northwestern University Feinberg School of Medicine, Chicago, IL, USA. hawkins.gay@northwestern.edu.;Northwestern University Feinberg School of Medicine, Chicago, IL, USA.", "authors": "Gay|Hawkins C|HC|;Amaral|Ansel Philip|AP|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.1007/s40800-018-0081-4", "fulltext": "\n==== Front\nDrug Saf Case RepDrug Saf Case RepDrug Safety - Case Reports2199-11622198-977XSpringer International Publishing Cham 296279198110.1007/s40800-018-0081-4Case ReportAcquired Methemoglobinemia Associated with Topical Lidocaine Administration: A Case Report Gay Hawkins C. 312-926-6895hawkins.gay@northwestern.edu 12Amaral Ansel Philip 11 0000 0001 2299 3507grid.16753.36Northwestern University Feinberg School of Medicine, Chicago, IL USA 2 0000 0001 2299 3507grid.16753.36McGaw Medical Center of Northwestern University, 251 East Huron Street, Galter Suite 3-150, Chicago, IL 60611 USA 7 4 2018 7 4 2018 12 2018 5 15© The Author(s) 2018Open AccessThis article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/), which permits any noncommercial use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.A 55-year-old male was admitted to the hospital with pneumonia. During an intubation procedure, the patient received an application of endobronchial lidocaine (4% gel). Within 2 h of intubation, the patient developed worsening hypoxia, and investigation of arterial blood gasses revealed a pH of 7.21, carbon dioxide partial pressure (PaCO2) of 3.3 kPa, oxygen partial pressure (PaO2) of 55.1 kPa, and measured oxygen saturation of 49%. Co-oximetry of this sample returned a methemoglobin level of 53%. Intravenous methylthioninium chloride (1% solution at 1 mg/kg) was delivered, and subsequent arterial blood gasses, at 30 min and 1 h post administration, showed methemoglobin levels of 12 and 9%, respectively, with return of oxygen saturation to > 90%.\n\nissue-copyright-statement© The Author(s) 2018\n==== Body\nKey Points\n\nTopical lidocaine and other commonly used local anesthetics have a poorly recognized though well-associated risk of acquired methemoglobinemia.\t\nAcquired methemoglobinemia should be considered in any patient with a divergence in measured oxygen saturation and arterial oxygen partial pressure.\t\nIntravenous methylthioninium chloride (1% solution at 1 mg/kg) acts as a rapid iron-reducing agent and is the most effective therapy for acquired methemoglobinemia.\t\n\n\n\nBackground\nMethemoglobin is formed when ferrous iron (Fe2+) undergoes oxidation to produce ferric iron (Fe3+), which is unable to bind oxygen [1]. Under circumstances of oxidative stress, or when exposed to oxidizing agents, the body’s protective mechanisms may not be able to maintain hemoglobin homeostasis, and methemoglobin levels can rise above the upper reference range of 2%. The pathologic effects of this process include (1) a shift of the oxygen–hemoglobin dissociation curve to the left, resulting in decreased release of oxygen to the tissue, a phenomenon known as the Darling–Roughton effect; and (2) functional anemia due to the inability of methemoglobin to bind oxygen, ultimately resulting in the disease state known as methemoglobinemia [1]. The primary risk of methemoglobinemia is tissue hypoxia and cyanosis, which can lead to acidosis, seizures, arrhythmias, and—if prolonged—cardiovascular collapse and death. Classic features of methemoglobinemia include a characteristically brown coloration to the arterial blood, a large difference in the measured and calculated oxygen saturations (O2sat) (known as the saturation gap), and low measured O2sat in the setting of normal to elevated oxygen partial pressures (PaO2) [2]. These risks are increased in the setting of preexisting anemia, when the body’s oxygen-carrying capacity is already reduced [3].\n\nObjective\nOur objective is to alert clinicians, pharmacists and other medical care providers to methemoglobinemia, a rare but well-documented side effect of local anesthetics commonly encountered on medical wards.\n\nCase\nA 55-year-old male with a history of multiple myeloma (MM), previous stem cell transplant and recurrence of disease presented to the hospital. He had recently started treatment of relapsed MM with carfilzomib and had developed intermittent fevers 2 days before presentation. He also complained of dyspnea and a productive cough, which had been present for 3 days before the onset of fever. On admission examination, he was febrile, tachypneic, and tachycardic but alert and fully oriented with a normal blood pressure. He had decreased breath sounds in the right lung base, without rales or wheezing, and the rest of his examination was unremarkable. His initial laboratory analysis was notable for pancytopenia with a white blood cell count of 1.2 × 109/l, hemoglobin of 53 g/l and platelets of 4.0 × 109/l. He was admitted to the hospital and treated with cefepime and azithromycin for presumed pneumonia; further home medications continued during admission included acyclovir, allopurinol, fluconazole and pantoprazole. Shortly after admission, he developed new-onset hypoxia and hypotension with altered mental status. He was transferred to the medical intensive care unit, where laboratory analysis revealed a lactic acid of 6.1 mMol/l and an initial arterial blood gas (ABG) returned a pH of 7.40, carbon dioxide partial pressure (PaCO2) of 3.3 kPa, PaO2 of 11.3 kPa, and measured O2sat of 94%. During an intubation procedure, the patient was treated with topical endobronchial lidocaine (4% gel applied with tongue blade) as well as intravenous etomidate and succinylcholine. Roughly 2 h post-intubation, he became increasingly hypoxic while on 100% fraction of inspired oxygen (FiO2). A repeat ABG was notably brownish in color (Fig. 1a) and returned a pH of 7.21, PaCO2 of 3.3 kPa, PaO2 of 55.1 kPa, and measured O2sat of 49%. Co-oximetry was requested given the divergence in PaO2 and O2sat, which revealed a methemoglobin level of 53%. Intravenous methylthioninium chloride (a dose of 1% solution at 1 mg/kg) was delivered and subsequent ABGs, at 30 min and 1 h post administration, showed methemoglobin levels of 12 and 9%, respectively, with return of O2sat to > 90% and bright red coloration to the ABG sample (Fig. 1b). Figure 2 shows a detailed timeline of these events. Unfortunately, despite recovering from acute methemoglobinemia, the patient ultimately succumbed to septic shock secondary to bacteremia with Rothia mucilaginosa.Fig. 1 Arterial blood gas (ABG) sample in a patient with acquired methemoglobinemia a before and b after treatment with methylthioninium chloride. ICU intensive care unit, IV intravenous\n\n\nFig. 2 Timeline of events\n\n\n\nDiscussion\nThe most common cause of acquired methemoglobinemia in the clinical setting is medication administration. Although rare, methemoglobinemia secondary to local and topical lidocaine administration has been documented and described in the medical literature; whether endobronchial application increases this risk is unknown [4]. Reports in the literature describe a greater risk of methemoglobinemia in patients who are anemic; the mechanism is thought to be related to increased hypoxic stress and nitric oxide production [3]. Pre-existing anemia may place patients at greater risk of complications from methemoglobinemia, further necessitating prompt recognition and intervention. Treatment of methemoglobinemia includes withdrawal of the offending agent (including removal of any remaining topical applicant), supportive care with 100% O2 therapy and circulatory support, as well as reversal of methemoglobin back to hemoglobin. The final therapy is generally accomplished through the administration of methylthioninium chloride (1% solution at 1 mg/kg), which acts as a reducing agent, converting Fe3+ to Fe2+ [1]. This process normally occurs rapidly over the course of 30–60 min and can be confirmed through repeat co-oximetry. Ascorbic acid has also been used, though this therapy generally takes much longer and is not a viable option in the setting of acute, acquired methemoglobinemia [1].\n\nConclusion\nThis case highlights the clinical and laboratory features of methemoglobinemia, a well-described though rare and poorly recognized side effect of topical lidocaine administration. Early recognition of methemoglobinemia is of primary importance, as the condition is rapidly reversible with correct treatment but can be serious and even fatal if left untreated; these risks may be enhanced in the setting of preexisting anemia.\n\nFunding\nNo sources of funding were used to conduct this study or prepare this manuscript.\n\nAuthor Contributions\nAll authors contributed equally to the drafting, editing and completion of the manuscript.\n\nConflict of interest\nHawkins C. Gay and Ansel Philip Amaral have no conflicts of interest that are directly relevant to the content of this case study.\n\nConsent to participate\nInformed consent was obtained from the patient’s spouse for publication of this case report. A copy of the written consent may be requested from the corresponding author for review.\n==== Refs\nReferences\n1. Cortazzo JA Lichtman AD Methemoglobinemia: a review and recommendations for management J Cardiothorac Vasc Anesth 2014 28 4 1043 1047 10.1053/j.jvca.2013.02.005 23953868 \n2. Sharma VK Haber AD Acquired methemoglobinemia: a case report of benzocaine-induced methemoglobinemia and a review of the literature Clin Pulm Med. 2002 9 1 53 58 10.1097/00045413-200201000-00008 \n3. Hare GM Mu A Romaschin A Tsui AK Shehata N Beattie WS Plasma methemoglobin as a potential biomarker of anemic stress in humans Can J Anaesth 2012 59 4 348 356 10.1007/s12630-011-9663-7 22271507 \n4. Guay J Methemoglobinemia related to local anesthetics: a summary of 242 episodes Anesth Analg 2009 108 3 837 845 10.1213/ane.0b013e318187c4b1 19224791\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2199-1162", "issue": "5(1)", "journal": "Drug safety - case reports", "keywords": null, "medline_ta": "Drug Saf Case Rep", "mesh_terms": null, "nlm_unique_id": "101674544", "other_id": null, "pages": "15", "pmc": null, "pmid": "29627919", "pubdate": "2018-04-07", "publication_types": "D016428:Journal Article", "references": "19224791;22271507;23953868", "title": "Acquired Methemoglobinemia Associated with Topical Lidocaine Administration: A Case Report.", "title_normalized": "acquired methemoglobinemia associated with topical lidocaine administration a case report" }
[ { "companynumb": "US-GLENMARK PHARMACEUTICALS-2018GMK034680", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "FLUCONAZOLE" }, "drugadditio...
{ "abstract": "Corticosteroids are often empirically used to treat idiosyncratic hepatotoxicity with severe features. Interestingly, intravenous methylprednisolone (MP) is increasingly being recognized as being responsible for liver injury. We aimed to characterize MP-induced liver injury by analyzing demographical, clinical, laboratory and outcome data of three MP-induced hepatotoxicity cases and compared this information with that of previously published cases.\n\n\n\nThree females with multiple sclerosis (MS) were treated intravenously with MP, mean daily dose 767 mg. Liver damage occurred 2 to 6 weeks after exposure. Severity was mild to moderate. Two patients suffered positive rechallenge.\n\n\n\nWe identified 50 published cases of MP hepatotoxicity. Most of these cases were female (86%) and main treatment indications were MS (29 cases) and Graves' ophthalmopathy (13 cases). Hepatocellular damage predominated and mean time to onset was 6 weeks. Four patients died and rechallenge occurred in 19 cases.\n\n\n\nMP pulses can induce severe liver injury, often with an autoimmune phenotype, particularly in patients with MS and Graves' ophthalmopathy. Consequently, these patient groups should have liver tests monitored when treated with MP to provide safer patient care.", "affiliations": "UGC Digestivo y Farmacología Clínica, Instituto de Investigación Biomédica de Málaga (IBIMA), H U Virgen de la Victoria, Malaga, Spain.;UGC Digestivo y Farmacología Clínica, Instituto de Investigación Biomédica de Málaga (IBIMA), H U Virgen de la Victoria, Malaga, Spain.;UGC Digestivo y Farmacología Clínica, Instituto de Investigación Biomédica de Málaga (IBIMA), H U Virgen de la Victoria, Malaga, Spain.;Hospital de Clínicas, Clínica Gastroenterología, F Medicina, Montevideo, Uruguay.;Unidad de Gestión Clínica de Enfermedades Digestivas, Hospital Marqués de Valdecilla, Instituto de Investigación Biomédica Marques de Valdecilla (IDIVAL), Santander, Spain.;Departamento de Gastroenterología, National University Pedro Henríquez Ureña, Santo Domingo, Dominican Republic.;UGC Digestivo y Farmacología Clínica, Instituto de Investigación Biomédica de Málaga (IBIMA), H U Virgen de la Victoria, Malaga, Spain.;UGC Digestivo y Farmacología Clínica, Instituto de Investigación Biomédica de Málaga (IBIMA), H U Virgen de la Victoria, Malaga, Spain.;UGC Digestivo y Farmacología Clínica, Instituto de Investigación Biomédica de Málaga (IBIMA), H U Virgen de la Victoria, Malaga, Spain.;UGC Digestivo y Farmacología Clínica, Instituto de Investigación Biomédica de Málaga (IBIMA), H U Virgen de la Victoria, Malaga, Spain.;UGC Digestivo y Farmacología Clínica, Instituto de Investigación Biomédica de Málaga (IBIMA), H U Virgen de la Victoria, Malaga, Spain.;UGC Digestivo y Farmacología Clínica, Instituto de Investigación Biomédica de Málaga (IBIMA), H U Virgen de la Victoria, Malaga, Spain.;UGC Digestivo y Farmacología Clínica, Instituto de Investigación Biomédica de Málaga (IBIMA), H U Virgen de la Victoria, Malaga, Spain.;UGC Digestivo y Farmacología Clínica, Instituto de Investigación Biomédica de Málaga (IBIMA), H U Virgen de la Victoria, Malaga, Spain.", "authors": "Zoubek|Miguel Eugenio|ME|;Pinazo-Bandera|José|J|;Ortega-Alonso|Aida|A|;Hernández|Nelia|N|;Crespo|Javier|J|;Contreras|Fernando|F|;Medina-Cáliz|Inmaculada|I|;Sanabria-Cabrera|Judith|J|;Sanjuan-Jiménez|Rocío|R|;González-Jiménez|Andrés|A|0000-0002-7059-1577;García-Cortés|Miren|M|;Lucena|M Isabel|MI|0000-0001-9586-4896;Andrade|Raúl J|RJ|;Robles-Díaz|Mercedes|M|0000-0002-2365-2787", "chemical_list": "D005938:Glucocorticoids; D008775:Methylprednisolone", "country": "England", "delete": false, "doi": "10.1177/2050640619840147", "fulltext": null, "fulltext_license": null, "issn_linking": "2050-6406", "issue": "7(6)", "journal": "United European gastroenterology journal", "keywords": "AIH; Graves' ophthalmopathy; Methylprednisolone-induced liver injury; multiple sclerosis; steroid pulses", "medline_ta": "United European Gastroenterol J", "mesh_terms": "D061605:Administration, Intravenous; D000328:Adult; D056486:Chemical and Drug Induced Liver Injury; D005260:Female; D005938:Glucocorticoids; D006111:Graves Disease; D006801:Humans; D008111:Liver Function Tests; D008775:Methylprednisolone; D008875:Middle Aged; D009103:Multiple Sclerosis", "nlm_unique_id": "101606807", "other_id": null, "pages": "825-837", "pmc": null, "pmid": "31316787", "pubdate": "2019-07", "publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't; D016454:Review", "references": "28781825;21455003;17264438;30032042;19935411;29729087;16083708;24761710;30567201;24704526;16926305;19968572;23318289;23723114;19159178;24906135;26199298;28953662;10907999;29507031;15967341;26075468;18803363;8229110;27206238;27003434;17406840;28438569;15186621;15320978;26676833;15952415;22140391", "title": "Liver injury after methylprednisolone pulses: A disputable cause of hepatotoxicity. A case series and literature review.", "title_normalized": "liver injury after methylprednisolone pulses a disputable cause of hepatotoxicity a case series and literature review" }
[ { "companynumb": "ES-FRESENIUS KABI-FK201907898", "fulfillexpeditecriteria": "1", "occurcountry": "ES", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "PREDNISONE" }, "drugadditional": null, ...
{ "abstract": "Infections with the fungus Talaromyces (formerly Penicillium) marneffei are rare in patients who do not have AIDS. We report disseminated T. marneffei infection in 4 hematology patients without AIDS who received targeted therapy with monoclonal antibodies against CD20 or kinase inhibitors during the past 2 years. Clinicians should be aware of this emerging complication, especially in patients from disease-endemic regions.", "affiliations": null, "authors": "Chan|Jasper F W|JF|;Chan|Thomas S Y|TS|;Gill|Harinder|H|;Lam|Frank Y F|FY|;Trendell-Smith|Nigel J|NJ|;Sridhar|Siddharth|S|;Tse|Herman|H|;Lau|Susanna K P|SK|;Hung|Ivan F N|IF|;Yuen|Kwok-Yung|KY|;Woo|Patrick C Y|PC|", "chemical_list": "D000935:Antifungal Agents; D000970:Antineoplastic Agents; D009570:Nitriles; D047428:Protein Kinase Inhibitors; D011720:Pyrazoles; D011743:Pyrimidines; D000069283:Rituximab; C540383:ruxolitinib", "country": "United States", "delete": false, "doi": "10.3201/eid2107.150138", "fulltext": "\n==== Front\nEmerg Infect Dis\nEmerging Infect. Dis\nEID\nEmerging Infectious Diseases\n1080-6040\n1080-6059\nCenters for Disease Control and Prevention\n\n26079984\n15-0138\n10.3201/eid2107.150138\nSynopsis\nSynopsis\nDisseminated Infections with Talaromycesmarneffei in Non-AIDS Patients Given Monoclonal Antibodies against CD20 and Kinase Inhibitors\nDisseminated Infections with Talaromyces marneffei in Non-AIDS Patients Given Monoclonal Antibodies against CD20 and Kinase Inhibitors\nDisseminated Infections with Talaromyces marneffei\nChan Jasper F.W.\nChan Thomas S.Y.\nGill Harinder\nLam Frank Y.F.\nTrendell-Smith Nigel J.\nSridhar Siddharth\nTse Herman\nLau Susanna K.P.\nHung Ivan F.N.\nYuen Kwok-Yung\nWoo Patrick C.Y.\nThe University of Hong Kong, Hong Kong, China\n7 2015\n21 7 11011106\nClinicians should be aware of these infections, especially in patients from disease-endemic regions.\n\nKeywords:\n\nTalaromyces (Penicillium) marneffei\nfungi\nCD20\nmonoclonal antibodies\nkinase inhibitors\nrituximab\nobinutuzumab\nruxolitinib\nsorafenib\n==== Body\nMedscape CME Activity\n\nMedscape, LLC is pleased to provide online continuing medical education (CME) for this journal article, allowing clinicians the opportunity to earn CME credit.\n\nThis activity has been planned and implemented in accordance with the Essential Areas and policies of the Accreditation Council for Continuing Medical Education through the joint providership of Medscape, LLC and Emerging Infectious Diseases. Medscape, LLC is accredited by the ACCME to provide continuing medical education for physicians.\n\nMedscape, LLC designates this Journal-based CME activity for a maximum of 1.0 AMA PRA Category 1 Credit(s)TM. Physicians should claim only the credit commensurate with the extent of their participation in the activity.\n\nAll other clinicians completing this activity will be issued a certificate of participation. To participate in this journal CME activity: (1) review the learning objectives and author disclosures; (2) study the education content; (3) take the post-test with a 75% minimum passing score and complete the evaluation at http://www.medscape.org/journal/eid; (4) view/print certificate.\n\nRelease date: June 15, 2015; Expiration date: June 15, 2016\n\nLearning Objectives\n\nUpon completion of this activity, participants will be able to:\n\nDistinguish the clinical and epidemiologic characteristics of T. marneffei infection, based on a case series report\n\nDiscuss the recent emergence of disseminated T. marneffei infection in non-AIDS patients with hematologic malignant neoplasms treated with targeted therapies\n\nIdentify possible mechanisms of action underlying disseminated T. marneffei infection in non-AIDS patients with hematologic malignant neoplasms treated with targeted therapies\n\nCME Editor\n\nThomas J. Gryczan, MS, Technical Writer/Editor, Emerging Infectious Diseases. Disclosure: Thomas J. Gryczan, MS, has disclosed no relevant financial relationships.\n\nCME Author\n\nLaurie Barclay, MD, freelance writer and reviewer, Medscape, LLC. Disclosure: Laurie Barclay, MD, has disclosed no relevant financial relationships.\n\nAuthors\n\nDisclosures: Harinder Gill, MBBS; Frank Y.F. Lam, MBBS, MRCP(UK), FHKAM; Nigel J. Trendell-Smith, MBBS, FRCPath; Siddharth Sridhar, MBBS, MRCP(UK); Herman Tse, MBBS; Susanna K.P. Lau, MD; and Kwok-Yung Yuen, MD, have disclosed no relevant financial relationships. Jasper F.W. Chan, MBBS, FRCPath, FRCP(Edin), has disclosed the following relevant financial relationships: received travel grants from Pfizer Co. HK Ltd. and Astellas Pharma HK Co. Ltd. Thomas S.Y. Chan, MBBS(Hons), MRCP(UK), FHKAM(Med), has disclosed the following relevant financial relationships: served as a speaker or a member of a speakers bureau for Pfizer. Ivan F.N. Hung, MD, has disclosed the following relevant financial relationships: served as an advisor or consultant for Pfizer (Asia Pacific Capital Advisory Board), MSD; received conference sponsorships from AstraZeneca, Ferring. Patrick C.Y. Woo, MD, has disclosed the following relevant financial relationships: involved in Tigecycline Evaluation Surveillance Trial with Pfizer.\n\nEmerg Infect Dis\nEmerging Infect. Dis\nEID\nEmerging Infectious Diseases\n1080-6040\n1080-6059\nCenters for Disease Control and Prevention\n\nDOI: 10.3201/eid2107.150138\nArticle\nAddress for correspondence: Patrick C.Y. Woo, State Key Laboratory of Emerging Infectious Dieases, Department of Microbiology, Carol Yu Centre for Infection, The University of Hong Kong, University Pathology Bldg, Queen Mary Hospital Compound, Pokfulam Rd, Hong Kong, China; email: pcywoo@hku.hk\nInfections with the fungus Talaromyces (formerly Penicillium) marneffei are rare in patients who do not have AIDS. We report disseminated T. marneffei infection in 4 hematology patients without AIDS who received targeted therapy with monoclonal antibodies against CD20 or kinase inhibitors during the past 2 years. Clinicians should be aware of this emerging complication, especially in patients from disease-endemic regions.\n\nTalaromyces (formerly Penicillium) marneffei is a pathogenic, thermal dimorphic fungus that causes systemic mycosis in Southeast Asia. T. marneffei infection is characterized by fungal invasion of multiple organ systems, especially blood, bone marrow, skin, lungs, and reticuloendothelial tissues, and is highly fatal, especially when diagnosis and treatment are delayed (1,2). This disease is found predominantly in AIDS patients and occasionally those with cell-mediated immunodeficiencies involving the interleukin-12/interferon-γ (IFN-γ) signaling pathway, such as congenital STAT1 mutations or acquired autoantibodies against IFN-γ (1,3–6). The infection has rarely been reported among hematology patients, including those from disease-endemic regions (7,8).\n\nAt Queen Mary Hospital in Hong Kong, a 1,600-bed university teaching hospital that has a hematopoietic stem cell transplantation service, where a wide range of invasive fungal infections have been observed (9,10), only 3 cases of T. marneffei infection were encountered in >2,000 hematology patients in the past 20 years, despite the long-standing availability of mycologic culture and serologic testing (7,8,11,12). In contrast, the infection was commonly reported among AIDS patients (13).\n\nIn the past 2 years, we have been alerted by 4 unprecedented cases of disseminated T. marneffei infection among non-AIDS hematology patients given targeted therapies, including monoclonal antibodies (mAbs) against CD20 and kinase inhibitors, which are being increasingly used in recent years. We report details for these 4 hematology case-patients. The study was approved by the institutional review board of The University of Hong Kong/Hospital Authority Hong Kong West Cluster in Hong Kong.\n\nCase-Patient 1\n\nPatient 1 was a 56-year-old Filipino man with Waldenström macroglobulinemia, idiopathic thrombocytopenic purpura, and primary biliary cirrhosis. He had fever, night sweating, productive cough, and left facial pain for 1 week and bloody diarrhea for 2 days. He had previously received fludarabine, dexamethasone, and rituximab (mAb against CD20, 18 months earlier) for treatment of Waldenström macroglobulinemia (Table 1). The idiopathic thrombocytopenic purpura was controlled with intravenous immunoglobulin and maintenance prednisolone and mycophenolate sodium. A chest radiograph showed a small cavitary lesion in the right lower lobe. His symptoms and signs did not resolve after he received empirical intravenous imipenem/cilastatin and metronidazole (Table 2).\n\nTable 1 Characteristics of 4 case-patients with disseminated Talaromyces marneffei infection after targeted therapies*\n\nCharacteristic\tCase-patient 1\tCase-patient 2\tCase-patient 3\tCase-patient 4\t\nAge, y/sex\t56/M\t44/M\t63/M\t67/M\t\nConcurrent conditions\tWaldenström macroglobulinemia, idiopathic thrombocytopenic purpura, primary biliary cirrhosis\tChronic lymphocytic leukemia\tMyelofibrosis with splenectomy, diabetes mellitus\tAcute myeloid leukemia, hypertension\t\nTargeted therapy\tRituximab\tRituximab and obinutuzumab\tRuxolitinib\tSorafenib\t\nAction of therapy\tmAb against CD20\tmAb against CD20\tJAK-1/2 inhibitor\tMultikinase inhibitor\t\nTime interval, mo†\t18\t14 (rituximab) and concomitant (obinutuzumab)\tConcomitant\tConcomitant\t\nCumulative dose before T. marneffei infection\t700 mg/dose iv x 4 doses\t700 mg/dose IV x 13 doses (rituximab) and 1,000 mg IV x 3 doses (obinutuzumab)\t10–20 mg 2×/d oral x 6.5 mo\t400 mg 2×/d oral x 8 mo\t\nOther immunosuppressants (time interval, mo)†\tFludarabine and dexamethasone (39), prednisolone 10 mg/d and mycophenolate sodium 360 mg 2×/d (concomitant)\tFludarabine and cyclophosphamide (48), CHOP (36), bendamustine (13)\tNone\tMitoxantrone and etoposide (21), daunarubicin (20), clofarabine (18), azacitidine (15), decitabine (15), cytarabine (14)\t\nClinical manifestations\tTerminal ileitis, cerebral abscesses, nasopharyngitis, and multiple cavitary lung lesions\tMarrow infiltration and fungemia\tRight cervical lymphadenitis and multiple cavitary lung lesions\tFungemia\t\nSpecimens positive for T. marneffei\tFeces, and terminal ileal and nasopharyngeal biopsy specimens\tBlood and bone marrow aspirate\tRight cervical lymph node\tBlood\t\nHighest serum antibody titer against T. marneffei\t1:320\t<1:40\t1:320\t<1:40\t\nAntifungal treatment (duration, mo)\tAmphotericin B (2 weeks) and voriconazole (>21)\tAmphotericin B (2 weeks) and itraconaozle (5)\tAmphotericin B (2 weeks) and voriconazole (>6)\tAmphotericin B (2 weeks) and voriconazole (>5)\t\nOther opportunistic infections\tNone\tBacteremia (Mycobacterium chelonae, Enterococcus faecium, and MRCNS), fungemia (Candida glabrata), HSV oral mucositis, PJP\tBacteremia (Klebsiella pneumoniae)\tHerpes zoster at right occiput\t\nClinical outcome\tResponded to antifungal treatment\tClearance of T. marneffei fungemia but died of MODS and multiple infections 5 mo after T. marneffei infection\tResponded to antifungal treatment\tResponded to antifungal treatment\t\n*mAb, monoclonal antibody; JAK, Janus kinase; IV, intravenous; CHOP, cyclophosphamide, hydroxydaunorubicin, oncovin, and prednisolone; MRCNS, methicillin-resistant coagulase-negative Staphylococcus; HSV, herpes simplex virus; PJP, Pneumocystis jiroveci pneumonia; MODS, multiple organ dysfunction syndrome.\n†Time interval between end of therapy and onset of symptoms for T. marneffei infection.\n\nTable 2 Laboratory results for 4 case-patients with disseminated Talaromyces marneffei infection after targeted therapies*\n\nLaboratory parameter\tCase-patient 1\tCase-patient 2\tCase-patient 3\tCase-patient 4\t\nHematologic†\t\t\t\t\t\nLeukocytes, x 109 cells/L\t12.08\t0.91\t4.93\t33.79\t\nNeutrophils, x 109 cells/L\t11.01\t0.45\t3.11\t8.45 (with blasts)\t\nLymphocytes, x 109 cells/L\t0.83 (CD4+: 315/µL)‡\t0.45\t1.05\t9.12 (with blasts)\t\nHemoglobin, g/dL\t12.3\t10.3\t8.0\t9.2\t\nPlatelets, x 109/L\t250\t5\t539\t15\t\nBiochemical†\t\t\t\t\t\nSodium, mmol/L\t136\t135\t139\t138\t\nPotassium, mmol/L\t3.5\t4.1\t3.7\t4.4\t\nCreatinine, µmol/L\t101\t111\t78\t92\t\nAlbumin, g/L\t40\t32\t39\t37\t\nGlobulin, g/L\t34\t36\t36\t39\t\nTotal bilirubin, µmol/L\t8\t9\t13\t19\t\nALP, U/L\t234\t163\t112\t96\t\nALT, U/L\t79\t20\t32\t61\t\nAST, U/L\t38\t9\t28\t123\t\nLDH, U/L\t209\t97\t352\t2,069\t\nImmunologic\t\t\t\t\t\nCombined HIV antibody/antigen\tNegative\tNegative\tNegative\tNegative\t\nAutoantibody against IFN-γ\tNegative\tNegative\tNegative\tNegative\t\nMicrobiologic\t\t\t\t\t\nBlood culture\tNo bacteria and fungi\tT. marneffei; Mycobacterium chelonae, Enterococcus faecium, MRCNS, and Candida glabrata§\tKlebsiella pneumoniae§\tT. marneffei\t\nBone marrow aspirate\tND\tT. marrneffei\tND\tND\t\nSputum culture\tNegative for pathogenic bacteria, AFB, and fungi\tNegative for pathogenic bacteria, AFB, and fungi\tNegative for pathogenic bacteria, AFB, and fungi\tNegative for pathogenic bacteria, AFB, and fungi\t\nUrine culture\tNo bacteria and fungi\tNo bacteria and fungi\tNo bacteria and fungi\tNo bacteria and fungi\t\nStool culture\tT. marneffei; negative for pathogenic bacteria, including Clostridium difficile and AFB\tND\tND\tND\t\nSerum CMV pp65 antigen\tNegative\tNegative\tNegative\tNegative\t\nOther\tStool for C. difficile toxin (negative); serum for Entamoeba histolytica antibody (negative); multiple blood smears for Plasmodium sp. (negative)\tBAL: Pneumocystis jiroveci (smear-positive)\tCervical lymph node: T. marneffei (culture-positive)\t\t\n*ALP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartate aminotransferase; LDH, lactate dehydrogenase; IFN-γ, interferon-γ; MRCNS, methicillin-resistant coagulase-negative Staphylococcus; ND, not done; AFB, acid-fast bacilli; CMV, cytomegalovirus; BAL, bronchoalveolar lavage. Reference ranges: leukocytes; 3.89–9.93 × 109 cells/L; neutrophils, 2.01–7.42 × 109 cells/L; lymphocytes, 1.06–3.61 × 109 cells/L; hemoglobin, 13.3–17.7g/dL; platelets, 162–341 × 109/L; sodium, 136–148 mmol/L; potassium, 3.6–5.0 mmol/L; creatinine, 67–109 µmol/L; albumin, 39–50 g/L; globulin, 24–37 g/L; total bilirubin, 4–23 µmol/L; ALP, 42–110 U/L; ALT, 8–58 U/L; AST, 5–38 U/L; LDH, 118–221 U/L.\n†Results at presentation.\n‡Reference range of CD4+ lymphocyte count: 415–1,418 cells/µL.\n§Bacteremia caused by M. chelonae, E. faecium, MRCNS, and candidemia in case-patient 2, and bacteremia caused by K. pneumoniae in case-patient 3 occurred after recovery from T. marneffei infection and prolonged hospitalization.\n\nA colonoscopy showed multiple shallow ulcers at the terminal ileum (Figure 1). Histologic analysis of an ulcer biopsy specimen showed slough of an acutely inflamed ulcer but no microorganisms. However, histologic analysis of a specimen from a nasopharyngeal biopsy performed for persistent left facial pain showed abundant yeast cells engulfed by foamy macrophages (Figure 2). Culture of terminal ileal ulcer biopsy specimens, stool samples, and nasopharyngeal biopsy specimens yielded T. marneffei. A contrast-enhanced cranial computed tomography (CT) scan showed 2 lesions (3–4-mm) with rim enhancement and perifocal edema at the right occipital and left parieto-occipital lobes. A thoracic CT scan showed 2 cavitary lesions (4–8 mm) in the right upper and lower lobes.\n\nFigure 1 Multiple, shallow, oozing ulcers at the terminal ileum (arrows) detected by colonoscopy on day 4 of hospitalization for case-patient 1, who had a disseminated infection with Talaromyces marneffei.\n\nFigure 2 Nasopharyngeal biopsy specimen from case-patient 1, who had a disseminated infection with Talaromyces marneffei. A) Grocott silver staining showing abundant yeast cells (arrows) with central septa 4–5 µm in diameter. B) Hematoxylin and eosin staining showing necrotic material admixed with blood and fibrin with aggregates of foamy macrophages (arrow). Scale bars indicate 5 μm.\n\nImmunologic testing showed that the patient was negative for HIV and autoantibodies against IFN-γ. His CD3+ and CD8+ counts were within references ranges, but he had mild CD4+ lymphopenia (Table 2). His fever and symptoms resolved with after 2 weeks of treatment with intravenous liposomal amphotericin B, followed by oral voriconazole. Reassessment colonoscopy (at 2 months) and CT scan (at 6 months) showed complete resolution of all lesions.\n\nCase-Patient 2\n\nPatient 2 was a 44-year-old Chinese man who had fever for 2 days. He had previously received chemotherapy and mAbs against CD20 (rituximab, 14 months earlier; obinutuzumab, concomitant) for refractory chronic lymphocytic leukemia (CLL) involving bone marrow (Table 1). He was empirically given intravenous piperacillin/tazobactam and anidulafungin (Table 2). Histologic analysis of a trephine biopsy specimen showed persistent CLL with plasmacytic differentiation, and Grocott staining showed yeasts with central septa in small clusters. Culture of peripheral blood and bone marrow aspirate yielded T. marneffei. A change in antifungal treatment to intravenous amphotericin B led to defervescence and clearance of fungemia. He was given oral itraconazole as maintenance therapy. He remained well until 2 months later when he was hospitalized for deteriorating CLL complicated by neutropenic fever with multiorgan failure caused by other opportunistic infections (Table 1). He died 5 months after the episode of disseminated T. marneffei infection.\n\nCase-Patient 3\n\nPatient 3 was a 63-year-old Chinese man with myelofibrosis and well-controlled diabetes mellitus. He had intermittent fever, right cervical lymphadenopathy, and productive cough for 4 months. He was given ruxolitinib (kinase inhibitor) 6 months before symptom onset because of transfusion-dependent myelofibrosis despite splenectomy 4 years earlier (Table 1). A chest radiograph and thoracic CT scan showed multiple cavitary lesions and consolidation. Bronchoalveolar lavage was negative for bacteria, fungi, and mycobacteria. A serum cryptococcal antigen test result was negative. He was empirically given intravenous imipenem/cilastatin and oral doxycycline, but his symptoms persisted. A right cervical lymph node culture yielded T. marneffei. His symptoms and radiologic abnormalities resolved after treatment with intravenous amphotericin B for 2 weeks, followed by oral voriconazole for 6 months.\n\nCase-Patient 4\n\nPatient 4 was a 67-year-old Chinese man with acute myeloid leukemia and hypertension. He had fever and malaise for 2 days without localizing signs. He had been given sorafenib (kinase inhibitor) 8 months earlier for chemotherapy-refractory acute myeloid leukemia (Table 1). His fever did not respond to intravenous meropenem. Subsequently, 2 sets of blood cultures yielded T. marneffei. He was given intravenous amphotericin B for 2 weeks, followed by oral voriconazole. He remained well at follow-up 6 months after symptom onset.\n\nDiscussion\n\nT. marneffei infection is an emerging complication in hematology patients receiving targeted therapies. Historically, T. marneffei infection has rarely been seen in non-AIDS patients, even in disease-endemic regions. During 1994–2014, only 3 other cases were observed in our hematology patients (7,8,11). None of 47 patients with T. marneffei infection in another large local case series during 1994–2004 had hematologic disease (13). In the past 20 years, there has been no change in methods for laboratory diagnosis of T. marneffei infection or a marked increase in the number of hematology patients in our hospital. Therefore, these 4 cases indicate an increase in the incidence of T. marneffei infection in these patients. Although other immunosuppressants given to case-patients 1, 2, and 4 might have contributed to overall immunosuppression, none of these immunosuppressants, which have been used for years, have been associated with T. marneffei infection. Because use of targeted therapies is increasing in diverse patient groups, clinicians should be aware of this emerging complication, especially in patients from disease-endemic regions who have received these therapies with other immunosuppressants.\n\nThe exact mechanisms through which these targeted therapies lead to T. marneffei infection remain incompletely understood. Rituximab and obinutuzumab (used by case-patients cases 1 and 2) are mAbs against CD20 that predominantly target B cells. Unlike T cells, the role of B cell–mediated humoral response in T. marneffei infection is poorly defined. Although case-patient 1 had mild CD4+ lymphopenia probably related to concomitant use of prednisolone and mycophenolate sodium, T. marneffei infection is rarely seen in patients with CD4+ counts >300/µL (1). We postulate that B cell dysfunction might have impaired production of neutralizing antibodies against key virulence factors of T. marneffei or might involve impairment of cytokine-producing B cells, which are essential for T helper cell function (14).\n\nMore severe infections with fungemeia and bone marrow involvement developed in case-patients 2 and 4, who had undetectable levels of serum antibodies against T. marneffei. Correspondingly, case-patients 1 and 3, who had antibody titers >1:320, did not have positive blood culture results (Table 2). Symptoms developed in case-patient 1 more than a 1 year after he completed therapy with mAbs against CD20. This finding might be related to long-lasting B cell–depleting effects of mAbs against CD20 (15).\n\nRegarding kinase inhibitors (used by cases-patients 3 and 4), ruxolitinib is a selective Janus kinase (JAK)-1/2 inhibitor that prevents signal transduction for type I/II cytokines, including IFN-γ, by interfering with the JAK-STAT signaling pathway. Use of ruxolitinib has been associated with opportunistic infections caused by intracellular pathogens, such as Mycobacterium tuberculsosis and Cryptococcus neoformans (16,17). Similarly, patients with impaired JAK-STAT signaling, but not those with diabetes mellitus or splenectomy (case-patient 3), are predisposed to T. marneffei infection (6). Sorafenib is a multikinase inhibitor with various immunomodulatory effects, including impaired T-cell response and proliferation and reduced IFN-γ production (18). These immune defects have been associated with reactivation of latent tuberculosis and might also predispose patients to opportunistic infections caused by intracellular organisms such as T. marneffei (18).\n\nThe recognition of disseminated T. marneffei infection as an emerging complication in non-AIDS patients treated with targeted therapy has major public health implications. In regions to which T. marneffei infection is endemic, serologic surveillance for patients receiving targeted therapy might be useful in the early diagnosis of T. marneffei infection, as in the case of AIDS patients (19). In non-endemic regions, such as the United States, clinicians should be vigilant of this infrequent infection in at-risk hematology patients who have resided in or are returning from disease-endemic areas.\n\nThis study was partly supported by donations from the Hui Hoy and Chow Sin Lan Charity Fund Limited; the Health and Medical Research Fund (ref. no. 13121342) and HKM-15-M07 (commissioned study) of the Food and Health Bureau of Hong Kong Special Administrative Region Government; the Strategic Research Theme Fund, The University of Hong Kong; and a Croucher Senior Medical Research Fellowship.\n\nDr. Jasper F.W. Chan is a clinical assistant professor in the Department of Microbiology, The University of Hong Kong, Hong Kong, China. His research interests include emerging infectious diseases and opportunistic infections in immunocompromised hosts.\n\nEmerg Infect Dis\nEmerging Infect. Dis\nEID\nEmerging Infectious Diseases\n1080-6040\n1080-6059\nCenters for Disease Control and Prevention\n\nDOI: 10.3201/eid2107.150138\nArticle\nMedscape CME Quiz\n\nEarning CME Credit\n\nTo obtain credit, you should first read the journal article. After reading the article, you should be able to answer the following, related, multiple-choice questions. To complete the questions (with a minimum 75% passing score) and earn continuing medical education (CME) credit, please go to http://www.medscape.org/journal/eid. Credit cannot be obtained for tests completed on paper, although you may use the worksheet below to keep a record of your answers. You must be a registered user on Medscape.org. If you are not registered on Medscape.org, please click on the “Register” link on the right hand side of the website to register. Only one answer is correct for each question. Once you successfully answer all post-test questions you will be able to view and/or print your certificate. For questions regarding the content of this activity, contact the accredited provider, CME@medscape.net. For technical assistance, contact CME@webmd.net. American Medical Association’s Physician’s Recognition Award (AMA PRA) credits are accepted in the US as evidence of participation in CME activities. For further information on this award, please refer to http://www.ama-assn.org/ama/pub/about-ama/awards/ama-physicians-recognition-award.page. The AMA has determined that physicians not licensed in the US who participate in this CME activity are eligible for AMA PRA Category 1 Credits™. Through agreements that the AMA has made with agencies in some countries, AMA PRA credit may be acceptable as evidence of participation in CME activities. If you are not licensed in the US, please complete the questions online, print the certificate and present it to your national medical association for review.\n\nArticle Title: \nDisseminated Infections with Talaromyces marneffei in Non-AIDS Patients Given Monoclonal Antibodies against CD20 and Kinase Inhibitors\n\nCME Questions\n\n1. According to the case series report by Chan and colleagues, which of the following statements about the clinical and epidemiologic characteristics of Talaromyces marneffei infection is correct? A. T. marneffei infection is the most important pathogenic thermal dimorphic fungus causing systemic mycosis in Southeast AsiaB. T. marneffei infection is typically limited to the gastrointestinal and/or urinary tractC. T. marneffei infection is usually self-limited with a good prognosis for recoveryD. T. marneffei infection is common among non-AIDS hematology patients2. Your patient is a 57-year-old Chinese man with acute myeloid leukemia and fever. According to the case series report by Chan and colleagues, which of the following statements about the recent emergence of disseminated T. marneffei infection in non-AIDS patients with hematologic malignant neoplasms treated with targeted therapies is correct?A. The appearance of 4 cases in the past 2 years is the result of a change in the methodologies of a laboratory diagnosis of T. marneffei infectionB. The appearance of 4 cases in the past 2 years is the result of a dramatic increase in the number of hematology patients at the investigators' hospitalC. Recent emergence of disseminated T. marneffei infection is most likely because of overall immunosuppressionD. Recent emergence of disseminated T. marneffei infection is most likely because of targeted therapies, such as anti-CD20 monoclonal antibodies and kinase inhibitors3. According to the case series report by Chan and colleagues, which of the following statements about possible mechanisms of action underlying disseminated T. marneffei infection in non-AIDS patients with hematologic malignant neoplasms treated with targeted therapies would most likely be accurate? A. Rituximab and obinutuzumab used in 2 cases are anti-CD20 monoclonal antibodies that predominantly target T cellsB. T. marneffei infection is usually seen at CD4+ counts of more than 300/µLC. Patients with B-cell dysfunction may have impaired production of neutralizing antibodies against key virulence factors of T. marneffei D. The investigators do not suggest any role of cytokine-producing B-cells\n\nActivity Evaluation\n\n1 The activity supported the learning objectives.\n\nStrongly Disagree\t\t\t\tStrongly Agree\t\n1\t2\t3\t4\t5\t\n2. The material was organized clearly for learning to occur.\t\nStrongly Disagree\t\t\t\tStrongly Agree\t\n1\t2\t3\t4\t5\t\n3. The content learned from this activity will impact my practice.\t\nStrongly Disagree\t\t\t\tStrongly Agree\t\n1\t2\t3\t4\t5\t\n4. The activity was presented objectively and free of commercial bias.\t\nStrongly Disagree\t\t\t\tStrongly Agree\t\n1\t2\t3\t4\t5\t\n\nSuggested citation for this article: Chan JFW, Chan TSY, Gill H, Lam FYF, Trendell-Smith NJ, Sridhar S, et al. Disseminated Infections with Talaromyces marneffei in non-AIDS patients given monoclonal antibodies against CD20 and kinase inhibitors. Emerg Infect Dis. 2015 Jul [date cited]. http://dx.doi.org/10.3201/eid2107.150138\n\nSuggested citation for this article: Chan JFW, Chan TSY, Gill H, Lam FYF, Trendell-Smith NJ, Sridhar S, et al. Disseminated Infections with Talaromyces marneffei in non-AIDS patients given monoclonal antibodies against CD20 and kinase inhibitors. Emerg Infect Dis. 2015 Jul [date cited]. http://dx.doi.org/10.3201/eid2107.150138\n\nSuggested citation for this article: Chan JFW, Chan TSY, Gill H, Lam FYF, Trendell-Smith NJ, Sridhar S, et al. Disseminated Infections with Talaromyces marneffei in non-AIDS patients given monoclonal antibodies against CD20 and kinase inhibitors. Emerg Infect Dis. 2015 Jul [date cited]. http://dx.doi.org/10.3201/eid2107.150138\n\n", "fulltext_license": "CC BY", "issn_linking": "1080-6040", "issue": "21(7)", "journal": "Emerging infectious diseases", "keywords": "CD20; Talaromyces (Penicillium) marneffei; fungi; kinase inhibitors; monoclonal antibodies; obinutuzumab; rituximab; ruxolitinib; sorafenib", "medline_ta": "Emerg Infect Dis", "mesh_terms": "D000328:Adult; D000368:Aged; D000935:Antifungal Agents; D000970:Antineoplastic Agents; D006801:Humans; D016867:Immunocompromised Host; D008297:Male; D008875:Middle Aged; D009181:Mycoses; D009570:Nitriles; D047428:Protein Kinase Inhibitors; D011720:Pyrazoles; D011743:Pyrimidines; D000069283:Rituximab; D032901:Talaromyces; D016896:Treatment Outcome", "nlm_unique_id": "9508155", "other_id": null, "pages": "1101-6", "pmc": null, "pmid": "26079984", "pubdate": "2015-07", "publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": "20445006;11724878;23648912;23007150;22308048;23652167;17008130;22065867;24188975;19641069;24625550;7914566;15765113;11305468;24637161;9243031;18382016;16418525", "title": "Disseminated Infections with Talaromyces marneffei in Non-AIDS Patients Given Monoclonal Antibodies against CD20 and Kinase Inhibitors.", "title_normalized": "disseminated infections with talaromyces marneffei in non aids patients given monoclonal antibodies against cd20 and kinase inhibitors" }
[ { "companynumb": "CN-INCYTE CORPORATION-2015IN004637", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": null, "drugadditional": null, "drugadministrationroute": "042", ...
{ "abstract": "Capecitabine (Xeloda, Roche, Monza), a fluoropyrimidine carbamate, is an orally administered drug that delivers fluorouracil (5-FU) selectively to the tumor. The drug has demonstrated activity in metastatic breast cancer, pancreatic cancer and colorectal cancer. In this case report the authors describe an unusually and reversible cardiac side effect which occurs to 39-year-old patient treated with capecitabine 2000 mg/m2/day for advanced gastric cancer. It is important to note that the safety data from clinical trials indicate that capecitabine has a toxicity profile typical of infused fluoropyrimidines. However, none of the studies described cardiac side effects.", "affiliations": "Division of Medical Oncology, Ospedale di Sondrio, Italy. oncologia.sondrio@tiscalinet.it", "authors": "Bertolini|A|A|;Flumanò|M|M|;Fusco|O|O|;Muffatti|A|A|;Scarinci|A|A|;Pontiggia|G|G|;Scopelliti|M|M|", "chemical_list": "D000964:Antimetabolites, Antineoplastic; D003841:Deoxycytidine; D000069287:Capecitabine; D005472:Fluorouracil", "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0300-8916", "issue": "87(3)", "journal": "Tumori", "keywords": null, "medline_ta": "Tumori", "mesh_terms": "D000208:Acute Disease; D000328:Adult; D000964:Antimetabolites, Antineoplastic; D000971:Antineoplastic Combined Chemotherapy Protocols; D000069287:Capecitabine; D003841:Deoxycytidine; D004562:Electrocardiography; D005472:Fluorouracil; D006329:Heart Conduction System; D006801:Humans; D008297:Male; D013274:Stomach Neoplasms", "nlm_unique_id": "0111356", "other_id": null, "pages": "200-6", "pmc": null, "pmid": "11504378", "pubdate": "2001", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Acute cardiotoxicity during capecitabine treatment: a case report.", "title_normalized": "acute cardiotoxicity during capecitabine treatment a case report" }
[ { "companynumb": "TR-ALKEM LABORATORIES LIMITED-TR-ALKEM-2018-02065", "fulfillexpeditecriteria": "1", "occurcountry": "TR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CAPECITABINE" }, "dru...
{ "abstract": "Malakoplakia is a rare benign lesion, usually associated with deficient intralysosomal degradation of microorganisms, more commonly, Escherichia coli. Malakoplakia occurs in various organ systems, the most frequently affected site being the urinary bladder. We report a rare case of isolated extensive malakoplakia involving the prostate, diagnosed on transurethral resection performed for radiologically suspected prostatic abscesses. A 61-year-old African American male presented with symptoms of urinary obstruction for the past 2 months. His medical history was significant for immunosuppression (liver transplantation 3 months prior and diabetes mellitus). He reported four episodes of E. coli-associated urinary tract infection after his liver transplantation. Serum prostate specific antigen was 1.83 ng/cc (normal inferior to 4 ng/cc), and urine culture was positive for E. coli sensitive to ceftriaxone. Pelvic magnetic resonance imaging was suggestive of prostatitis with prostatic abscesses; cystoscopy was unremarkable. The patient was started on intravenous ceftriaxone therapy. A standard bipolar transurethral resection of the prostate was performed, and purulent-like material was encountered in the resected tissue. Histologic examination demonstrated extensive infiltration and replacement of the prostatic tissue by sheets of pink histiocytes with targetoid inclusions consistent with Michaelis-Gutmann bodies, ultimately confirming malakoplakia of the prostate. Prostatic malakoplakia is an unexpected diagnosis in patients suspected of having malignancy or prostatitis. Its exact pathogenesis is unknown, but it involves defective bacterial degradation after phagocytosis. E. coli is often cultured from the patients' urine. Immunosuppression, present in our patient, is a well-known associated factor. Prostatic malakoplakia can radiologically masquerade as prostatic adenocarcinoma, despite the use of cutting-edge imaging technology. With the growing use of multiparametric 3T prostate magnetic resonance imaging to screen for prostate cancer, it is possible that urologists, radiologists, and pathologists will encounter prostatic malakoplakia more frequently in the future.", "affiliations": "Department of Pathology, Emory University School of Medicine, Atlanta, Georgia, USA.;Department of Urology, Emory University School of Medicine, Atlanta, Georgia, USA.;Department of Radiology, Emory University School of Medicine, Atlanta, Georgia, USA.;Department of Pathology, Emory University School of Medicine, Atlanta, Georgia, USA.", "authors": "Bidot|Samuel|S|;Lay|Aaron H|AH|;Harri|Peter A|PA|;Harik|Lara R|LR|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1089/cren.2020.0050", "fulltext": null, "fulltext_license": null, "issn_linking": "2379-9889", "issue": "6(3)", "journal": "Journal of endourology case reports", "keywords": "abscess; immunosuppression; malakoplakia; prostate; transurethral resection of the prostate", "medline_ta": "J Endourol Case Rep", "mesh_terms": null, "nlm_unique_id": "101684114", "other_id": null, "pages": "231-234", "pmc": null, "pmid": "33102734", "pubdate": "2020", "publication_types": "D016428:Journal Article", "references": "24868476;27180057;2781684;28736746", "title": "Exuberant Malakoplakia of the Prostate Presenting as Prostatic Abscesses in an Immunocompromised Patient.", "title_normalized": "exuberant malakoplakia of the prostate presenting as prostatic abscesses in an immunocompromised patient" }
[ { "companynumb": "US-ASTELLAS-2020US037392", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "TACROLIMUS" }, "drugadditional": "3", ...
{ "abstract": "Survival after lung transplantation is limited by chronic lung allograft dysfunction (CLAD). Immunomodulatory therapies such as extracorporeal photopheresis (ECP) and alemtuzumab (AL) have been described for refractory CLAD, but comparative outcomes are not well defined.\n\n\n\nWe retrospectively reviewed spirometric values and clinical outcomes after therapy with ECP, AL, or no treatment (NT) in patients with CLAD who underwent transplant between January 2005 and December 2014. We used inverse probability-weighted regression adjustment (IPWRA) to adjust for potential confounders affecting treatment choice.\n\n\n\nOf 267 patients, 31 received immunomodulatory therapies for CLAD, and 78 received NT. The slope of forced expiratory volume in 1 second (FEV1) decline significantly improved after treatment with AL and with ECP compared with pre-treatment FEV1 slope; however, there was no significant change in slope of forced vital capacity (FVC). Comparison with NT was limited because of clinical differences in treatment groups. After IPWRA, we found no significant difference in mean difference of FEV1 slope (ml/month) when comparing treatment with NT, suggesting stabilization of lung function in the treatment group. We found no difference between the 2 immunomodulatory therapies 1, 3, and 6 months post-treatment (-49.9 [95% CI -581.8, +482.0], p = 0.85; +27.7 [95% CI -167.6, +223.0], p = 0.78; -9.6 [95% CI -167.5, +148.2], p = 0.91). We found no difference in mean FVC slope or differences between ECP and AL in infection rates or survival after treatment.\n\n\n\nImmunomodulatory therapy for CLAD with ECP or AL was associated with a significant change in FEV1 slope post-treatment compared with pre-treatment slope, with minimal effect on FVC. There was no difference between the 2 therapies in their effect on pulmonary function.", "affiliations": "Division of Pulmonary and Critical Care Medicine, Brigham and Women's Hospital, Boston, Massachusetts.;Lung Transplant Program, Pharmacy Department, Brigham and Women's Hospital, Boston, Massachusetts.;Division of Pulmonary and Critical Care Medicine, Massachusetts General Hospital, Boston, Massachusetts.;Division of Infectious Diseases, Brigham and Women's Hospital, Boston, Massachusetts.;Division of Infectious Diseases, Brigham and Women's Hospital, Boston, Massachusetts.;Lung Transplant Program, Division of Pulmonary and Critical Care Medicine, Brigham and Women's Hospital, Boston, Massachusetts; Harvard Medical School, Boston, Massachusetts.;Harvard Medical School, Boston, Massachusetts; Lung Transplant Program, Division of Thoracic Surgery, Brigham and Women's Hospital, Boston, Massachusetts.;Lung Transplant Program, Division of Pulmonary and Critical Care Medicine, Brigham and Women's Hospital, Boston, Massachusetts; Harvard Medical School, Boston, Massachusetts.;Lung Transplant Program, Division of Pulmonary and Critical Care Medicine, Brigham and Women's Hospital, Boston, Massachusetts; Harvard Medical School, Boston, Massachusetts.;Harvard Medical School, Boston, Massachusetts; Lung Transplant Program, Division of Thoracic Surgery, Brigham and Women's Hospital, Boston, Massachusetts.;Lung Transplant Program, Division of Pulmonary and Critical Care Medicine, Brigham and Women's Hospital, Boston, Massachusetts; Harvard Medical School, Boston, Massachusetts.;Lung Transplant Program, Division of Pulmonary and Critical Care Medicine, Brigham and Women's Hospital, Boston, Massachusetts; Harvard Medical School, Boston, Massachusetts; Division of Pulmonary and Critical Care Medicine, University of Colorado School of Medicine, Aurora, Colorado.;Division of Infectious Diseases, Brigham and Women's Hospital, Boston, Massachusetts; Harvard Medical School, Boston, Massachusetts.;Lung Transplant Program, Division of Pulmonary and Critical Care Medicine, Brigham and Women's Hospital, Boston, Massachusetts; Harvard Medical School, Boston, Massachusetts. Electronic address: hjgoldberg@partners.org.", "authors": "Moniodis|Anna|A|;Townsend|Keri|K|;Rabin|Alexander|A|;Aloum|Obadah|O|;Stempel|Jessica|J|;Burkett|Patrick|P|;Camp|Phillip|P|;Divo|Miguel|M|;El-Chemaly|Souheil|S|;Mallidi|Hari|H|;Rosas|Ivan|I|;Fuhlbrigge|Anne|A|;Koo|Sophia|S|;Goldberg|Hilary J|HJ|", "chemical_list": "D000074323:Alemtuzumab", "country": "United States", "delete": false, "doi": "10.1016/j.healun.2017.03.017", "fulltext": null, "fulltext_license": null, "issn_linking": "1053-2498", "issue": "37(3)", "journal": "The Journal of heart and lung transplantation : the official publication of the International Society for Heart Transplantation", "keywords": "alemtuzumab; chronic lung allograft dysfunction; lung transplant; photopheresis; rejection", "medline_ta": "J Heart Lung Transplant", "mesh_terms": "D000328:Adult; D000368:Aged; D000074323:Alemtuzumab; D002908:Chronic Disease; D003131:Combined Modality Therapy; D005260:Female; D006801:Humans; D056747:Immunomodulation; D008171:Lung Diseases; D016040:Lung Transplantation; D008297:Male; D008875:Middle Aged; D017893:Photopheresis; D055031:Primary Graft Dysfunction; D012189:Retrospective Studies; D016896:Treatment Outcome; D055815:Young Adult", "nlm_unique_id": "9102703", "other_id": null, "pages": "340-348", "pmc": null, "pmid": "28431983", "pubdate": "2018-03", "publication_types": "D003160:Comparative Study; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural", "references": null, "title": "Comparison of extracorporeal photopheresis and alemtuzumab for the treatment of chronic lung allograft dysfunction.", "title_normalized": "comparison of extracorporeal photopheresis and alemtuzumab for the treatment of chronic lung allograft dysfunction" }
[ { "companynumb": "US-MALLINCKRODT-T201803633", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "METHOXSALEN" }, "drugadditional": "3", ...
{ "abstract": "We describe the case of 79-year-old man admitted to our general hospital for a 6-week history of progressive dysphagia to solids and liquids associated with weight loss. To reach a diagnosis a total body CT scan with low-osmolality iodinate contrast agent was performed. Two hours later the patient developed an acute respiratory failure requiring orotracheal intubation and mechanical ventilation. The laboratory and neurological tests allow formulating the diagnosis of myasthenia gravis. In literature, other three case reports have associated myasthenic crisis with exposure to low-osmolality contrast media. This suggests being careful in administering low-osmolality contrast media in myasthenic patients.", "affiliations": "Department of Internal Medicine, \"Dell'Angelo\" General Hospital, 11 Paccagnella Street, Mestre, 30171 Venice, Italy.;Department of Internal Medicine, \"Dell'Angelo\" General Hospital, 11 Paccagnella Street, Mestre, 30171 Venice, Italy.;Department of Internal Medicine, \"Dell'Angelo\" General Hospital, 11 Paccagnella Street, Mestre, 30171 Venice, Italy.;Department of Internal Medicine, \"Dell'Angelo\" General Hospital, 11 Paccagnella Street, Mestre, 30171 Venice, Italy.", "authors": "Bonanni|Luca|L|;Dalla Vestra|Michele|M|;Zancanaro|Andrea|A|;Presotto|Fabio|F|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1155/2014/963461", "fulltext": "\n==== Front\nCase Rep RadiolCase Rep RadiolCRIRACase Reports in Radiology2090-68622090-6870Hindawi Publishing Corporation 10.1155/2014/963461Case ReportMyasthenia Gravis following Low-Osmolality Iodinated Contrast Media Bonanni Luca \n*\nDalla Vestra Michele Zancanaro Andrea Presotto Fabio Department of Internal Medicine, “Dell'Angelo” General Hospital, 11 Paccagnella Street, Mestre, 30171 Venice, Italy*Luca Bonanni: lbonanni@libero.itAcademic Editor: Salah D. Qanadli\n\n2014 3 12 2014 2014 96346114 10 2014 18 11 2014 Copyright © 2014 Luca Bonanni et al.2014This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.We describe the case of 79-year-old man admitted to our general hospital for a 6-week history of progressive dysphagia to solids and liquids associated with weight loss. To reach a diagnosis a total body CT scan with low-osmolality iodinate contrast agent was performed. Two hours later the patient developed an acute respiratory failure requiring orotracheal intubation and mechanical ventilation. The laboratory and neurological tests allow formulating the diagnosis of myasthenia gravis. In literature, other three case reports have associated myasthenic crisis with exposure to low-osmolality contrast media. This suggests being careful in administering low-osmolality contrast media in myasthenic patients.\n==== Body\n1. Introduction\nMyasthenia gravis is often underrecognised in the elderly people, partly because symptoms such as dysphagia, fatigue, and slurred speech can have a broad differential diagnosis  [1]. CT scan with iodinated contrast media is often performed to investigate symptoms connected with this disease (like weight loss).\n\n2. Case Presentation\nIn April 2013, a 79-year-old man was admitted to our general hospital for a 6-week history of progressive dysphagia to solids and liquids associated with weight loss of 3 kg. He denied any other symptoms. His past medical history included type II diabetes, hypertension, and COPD. He could walk and neurological examination showed no ocular symptoms or muscle weakness. There was a mild dehydration, but examination of the cardiovascular and abdominal systems was unremarkable. Investigations showed a mild increase of serum creatinine (1.3 mg/dL). Gastroscopy showed a mild hyperemic duodenitis: for this reason a therapy with Pantoprazole was started.\n\nDuring the stay in our ward he developed a progressive asthenia, leading to inability to walk and to lift the head to watch the examiner without using his hand. A blood sample was taken to test for acetylcholine-receptor antibodies. The same day, a total body CT scan with low-osmolality iodinate contrast agent (Iohexol, concentration 300 mgI/mL, volume 200 mL) was performed. Two hours later the patient developed an acute respiratory failure requiring orotracheal intubation and mechanical ventilation. In the Intensive Care Unit the weaning of mechanical ventilation was soon initiated and after two days the extubation was performed. After the extubation the patient showed complete dysphagia, dysarthria, hypophonia, and proximal muscle hyposthenia. While waiting for the serologic test, pyridostigmine was given: there was a marked improvement in the following 24 hours with a complete neurological recovery. The diagnosis of myasthenia gravis was confirmed by the acetylcholine-receptor antibody test, by the repetitive nerve stimulation, and by the single fibre electromyography.\n\nBefore the CT scan, the patient never experienced respiratory symptoms (dyspnea or orthopnea) and there were no signs of a reexacerbation of COPD (no productive cough; the chest examination was negative for rumors, the respiratory rate was always in the normal range, and the oxygen saturation ranged from 94 to 96 in RA). No new drug was added to the therapy with Pantoprazole (that had been administered daily for ten days before the acute respiratory event and it is still ongoing). Our diagnosis was a myasthenic crisis induced by the low-osmolality iodinate contrast agent.\n\n3. Discussion\nMany drugs can unmask or exacerbate myasthenia gravis, among them the iodinated contrast agents. There have been a few case reports and case series describing isolated examples of a myasthenic crisis after exposure to intravenous high-osmolality iodinate material, but, to our knowledge, only three other case reports have associated myasthenic crisis with exposure to low-osmolality contrast media  [2, 3].\n\nThis suggests being careful in administering low-osmolality contrast media in myasthenic patients.\n\nWe also think that myasthenic crisis induced by contrast media is underrecognised. In our opinion the diagnosis of myasthenic crisis should always be considered in the presence of respiratory symptoms after contrast media to define the real size of the problem and evaluate the opportunity to perform a noncontrast CT scan or a MRI. If no other options are possible, we suggest premedicating myasthenic patients before CT scan with iodinated contrast media.\n\nConflict of Interests\nThe authors declare that there is no conflict of interests regarding the publication of this paper.\n==== Refs\n1 Libman R. Benson R. Einberg K. Myasthenia mimicking vertebrobasilar stroke Journal of Neurology 2002 249 11 1512 1514 10.1007/s00415-002-0858-2 2-s2.0-0036460554 12420089 \n2 Anzola G. P. Capra R. Magoni M. Vignolo L. A. Myasthenic crisis during intravenous iodinated contrast medium injection Italian Journal of Neurological Sciences 1986 7 2 273 10.1007/BF02230893 2-s2.0-0022445592 3721837 \n3 Somashekar D. K. Davenport M. S. Cohan R. H. Dillman J. R. Ellis J. H. Effect of intravenous low-osmolality iodinated contrast media on patients with myasthenia gravis Radiology 2013 267 3 727 734 10.1148/radiol.12121508 2-s2.0-84878342575 23360741\n\n", "fulltext_license": "CC BY", "issn_linking": "2090-6870", "issue": "2014()", "journal": "Case reports in radiology", "keywords": null, "medline_ta": "Case Rep Radiol", "mesh_terms": null, "nlm_unique_id": "101580187", "other_id": null, "pages": "963461", "pmc": null, "pmid": "25544926", "pubdate": "2014", "publication_types": "D016428:Journal Article", "references": "12420089;23360741;3721837", "title": "Myasthenia Gravis following Low-Osmolality Iodinated Contrast Media.", "title_normalized": "myasthenia gravis following low osmolality iodinated contrast media" }
[ { "companynumb": "IT-GE HEALTHCARE MEDICAL DIAGNOSTICS-OMPQ-PR-1512L-3140", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "IOHEXOL" }, "d...
{ "abstract": "The efficacy and feasibility of proton beam therapy (PBT) for recurrent ovarian carcinoma had not been determined. Here we presented a case of recurrent ovarian carcinoma that was successfully treated with PBT. A 48-year-old woman who was diagnosed as left ovarian clear cell carcinoma underwent surgery without removal of two tumors. After achieving complete remission with postoperative chemotherapy, a recurrent tumor was found in the sigmoid colon, for which a colostomy was performed. Because second-line chemotherapy was not effective, PBT was selected; there were no complications, except for a transient low-grade fever. After 1 year of PBT, the tumor completely disappeared and the patient had been disease-free for over 8 years. PBT may be an effective and less invasive treatment modality for recurrent ovarian carcinoma.", "affiliations": "Department of Obstetrics and Gynecology, Yokohama Municipal Citizen's Hospital, Yokohama, Japan.;Department of Obstetrics and Gynecology, Yokohama Municipal Citizen's Hospital, Yokohama, Japan.;Department of Obstetrics and Gynecology, Yokohama Municipal Citizen's Hospital, Yokohama, Japan.;Department of Obstetrics and Gynecology, Yokohama Municipal Citizen's Hospital, Yokohama, Japan.", "authors": "Kino|Tamina|T|;Ando|Noriko|N|;Ogawara|Yuki|Y|;Shigeta|Hiroyuki|H|", "chemical_list": null, "country": "Australia", "delete": false, "doi": "10.1111/jog.14036", "fulltext": null, "fulltext_license": null, "issn_linking": "1341-8076", "issue": "45(9)", "journal": "The journal of obstetrics and gynaecology research", "keywords": "proton beam; radiation therapy; recurrent ovarian carcinoma", "medline_ta": "J Obstet Gynaecol Res", "mesh_terms": "D002277:Carcinoma; D005260:Female; D006801:Humans; D008875:Middle Aged; D009364:Neoplasm Recurrence, Local; D010051:Ovarian Neoplasms; D061766:Proton Therapy; D016896:Treatment Outcome", "nlm_unique_id": "9612761", "other_id": null, "pages": "1952-1956", "pmc": null, "pmid": "31332888", "pubdate": "2019-09", "publication_types": "D002363:Case Reports", "references": null, "title": "Proton beam therapy for recurrent ovarian carcinoma: A case report.", "title_normalized": "proton beam therapy for recurrent ovarian carcinoma a case report" }
[ { "companynumb": "JP-BAXTER-2019BAX022681", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "DOXORUBICIN HYDROCHLORIDE" }, "drugadditional":...
{ "abstract": "We discuss the diagnosis and management of a case of generalized granuloma annulare (GA) occurring in a 49-year-old man when being treated with pegylated interferon-alfa for hepatitis C infection. In our case, the GA lesions remained despite an undetectable hepatitis C viral load. The GA resolved only with treatment cessation.", "affiliations": "Divisions of 1Gastroenterology and 2Pathology, University of Toledo Medical Center, Toledo, OH.", "authors": "Ahmad|Usman|U|;Li|Xin|X|;Sodeman|Thomas|T|;Daboul|Isam|I|", "chemical_list": "D000998:Antiviral Agents; D004337:Drug Carriers; D016898:Interferon-alpha; D011092:Polyethylene Glycols; D012254:Ribavirin", "country": "United States", "delete": false, "doi": "10.1097/MJT.0b013e318209e049", "fulltext": null, "fulltext_license": null, "issn_linking": "1075-2765", "issue": "20(5)", "journal": "American journal of therapeutics", "keywords": null, "medline_ta": "Am J Ther", "mesh_terms": "D000998:Antiviral Agents; D004337:Drug Carriers; D004359:Drug Therapy, Combination; D016460:Granuloma Annulare; D006526:Hepatitis C; D006801:Humans; D016898:Interferon-alpha; D008297:Male; D008875:Middle Aged; D011092:Polyethylene Glycols; D012254:Ribavirin", "nlm_unique_id": "9441347", "other_id": null, "pages": "585-7", "pmc": null, "pmid": "21317616", "pubdate": "2013", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Hepatitis C virus treatment with pegylated interferon-alfa therapy leading to generalized interstitial granuloma annulare and review of the literature.", "title_normalized": "hepatitis c virus treatment with pegylated interferon alfa therapy leading to generalized interstitial granuloma annulare and review of the literature" }
[ { "companynumb": "US-ROCHE-1312058", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "4", "activesubstance": { "activesubstancename": "PEGINTERFERON ALFA-2A" }, "drugadditional": null, ...
{ "abstract": "Sarcoidosis is a multisystem granulomatous disease of unknown etiology. Tumor necrosis factor (TNF)-alpha is an important player in granuloma formation, and recent clinical trials have investigated the efficacy of TNF-alpha inhibitors in sarcoidosis. Paradoxically, there are several case reports in the medical literature describing the development of sarcoidosis in patients treated with TNF-alpha inhibitors. We describe 3 cases of TNF-alpha antagonist-induced sarcoidosis: 1 case of pulmonary, ocular and cutaneous sarcoidosis developing in a patient receiving infliximab for erosive rheumatoid arthritis, 1 case of etanercept-induced sarcoidosis in a patient with seronegative rheumatoid arthritis, and 1 case of sarcoidosis developing in a patient receiving etanercept for erosive rheumatoid arthritis. We also provide a brief discussion on the role of TNF alpha in granuloma formation and implications in the use of TNF-alpha antagonists in autoimmune disease.", "affiliations": "Ochsner Health System, Department of Rheumatology, New Orleans, LA, USA. rclementine@ochsner.org", "authors": "Clementine|Rochelle Robicheaux|RR|;Lyman|Justin|J|;Zakem|Jerald|J|;Mallepalli|Jyothi|J|;Lindsey|Stephen|S|;Quinet|Robert|R|", "chemical_list": "D000911:Antibodies, Monoclonal; D007074:Immunoglobulin G; D018124:Receptors, Tumor Necrosis Factor; D014409:Tumor Necrosis Factor-alpha; D000069285:Infliximab; D000068800:Etanercept", "country": "United States", "delete": false, "doi": "10.1097/RHU.0b013e3181efa190", "fulltext": null, "fulltext_license": null, "issn_linking": "1076-1608", "issue": "16(6)", "journal": "Journal of clinical rheumatology : practical reports on rheumatic & musculoskeletal diseases", "keywords": null, "medline_ta": "J Clin Rheumatol", "mesh_terms": "D000911:Antibodies, Monoclonal; D001172:Arthritis, Rheumatoid; D001706:Biopsy; D000068800:Etanercept; D005260:Female; D006801:Humans; D007074:Immunoglobulin G; D000069285:Infliximab; D008168:Lung; D008875:Middle Aged; D018124:Receptors, Tumor Necrosis Factor; D012507:Sarcoidosis; D017565:Sarcoidosis, Pulmonary; D012867:Skin; D016896:Treatment Outcome; D014409:Tumor Necrosis Factor-alpha", "nlm_unique_id": "9518034", "other_id": null, "pages": "274-9", "pmc": null, "pmid": "20808167", "pubdate": "2010-09", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Tumor necrosis factor-alpha antagonist-induced sarcoidosis.", "title_normalized": "tumor necrosis factor alpha antagonist induced sarcoidosis" }
[ { "companynumb": "US-AMGEN-USASP2015076108", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "ETANERCEPT" }, "drugadditional": null, ...
{ "abstract": "Stroke, or cerebrovascular accident (CVA), is a medical emergency that may lead to permanent neurological damage, complications, and death. The rapid loss of brain function due to disruption of the blood supply to the brain is caused by blockage (thrombosis, arterial embolism) or hemorrhage. The incidence of CVA during anesthesia for noncardiac nonvascular surgery is as high as 1% depending on risk factors. Comprehensive preoperative assessment and good perioperative management may prevent a CVA. However, should an ischemic event occur, appropriate and rapid management is necessary to minimize the deleterious effects caused to the patient. This case report describes a patient who had an ischemic CVA while under general anesthesia for dental alveolar surgery and discusses the anesthesia management.", "affiliations": "Assistant Professor, Department of Dental Anesthesiology, University of Pittsburgh School of Dental Medicine, Pittsburgh, Pennsylvania.", "authors": "Cooke|Mathew|M|;Cuddy|Michael A|MA|;Farr|Brad|B|;Moore|Paul A|PA|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.2344/0003-3006-61.2.73", "fulltext": null, "fulltext_license": null, "issn_linking": "0003-3006", "issue": "61(2)", "journal": "Anesthesia progress", "keywords": "Cerebrovascular event; Complication; Dentistry.; General anesthesia", "medline_ta": "Anesth Prog", "mesh_terms": "D000328:Adult; D000543:Alveoloplasty; D000766:Anesthesia, Dental; D000768:Anesthesia, General; D001146:Arrhythmia, Sinus; D001919:Bradycardia; D002545:Brain Ischemia; D016893:Carotid Stenosis; D004569:Electroencephalography; D005260:Female; D006801:Humans; D007022:Hypotension; D007431:Intraoperative Complications; D007442:Intubation, Intratracheal; D008279:Magnetic Resonance Imaging; D019647:Oral Surgical Procedures; D020521:Stroke; D014057:Tomography, X-Ray Computed; D014081:Tooth Extraction; D018879:Ventricular Premature Complexes", "nlm_unique_id": "0043533", "other_id": null, "pages": "73-7", "pmc": null, "pmid": "24932981", "pubdate": "2014", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "10841871;23370205;10477528;15939006;7974542;15494579;21890661;16247043;20549522;15301227;904659;19194149;14731377;23652265;9341723;17569877;19342825", "title": "Cerebrovascular accident under anesthesia during dental surgery.", "title_normalized": "cerebrovascular accident under anesthesia during dental surgery" }
[ { "companynumb": "US-BAXTER-2015BAX057630", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "EPINEPHRINE" }, "drugadditional": null, ...
{ "abstract": "This is a report of an 80-year-old man with a history of rosacea and rhinophyma treated for 15 years with oral minocycline who developed significant minocycline-induced hyperpigmentation. He also had a history of Fuchs' endothelial dystrophy and had undergone penetrating keratoplasty in the right eye. Best-corrected visual acuity was 20/60 in both eyes. Examination revealed slate-grey hyperpigmentation of his body, face, and sclera and black, confluent pigmentation in the central maculae of both eyes. Green wavelength fundus autofluorescence demonstrated speckled hyperautofluorescence in the right eye, and swept-source OCT and OCTA demonstrated pigmented epithelial detachments and significant signal blocking without choroidal neovascularization.", "affiliations": null, "authors": "Jung|Jesse J|JJ|;Chen|Michael H|MH|;Sorenson|Andrew L|AL|;Rofagha|Soraya|S|", "chemical_list": "D000900:Anti-Bacterial Agents; D008911:Minocycline", "country": "United States", "delete": false, "doi": "10.3928/23258160-20160324-09", "fulltext": null, "fulltext_license": null, "issn_linking": "2325-8160", "issue": "47(4)", "journal": "Ophthalmic surgery, lasers & imaging retina", "keywords": null, "medline_ta": "Ophthalmic Surg Lasers Imaging Retina", "mesh_terms": "D000284:Administration, Oral; D000369:Aged, 80 and over; D000900:Anti-Bacterial Agents; D005451:Fluorescein Angiography; D006801:Humans; D017495:Hyperpigmentation; D008297:Male; D008911:Minocycline; D064847:Multimodal Imaging; D061848:Optical Imaging; D011446:Prospective Studies; D012163:Retinal Detachment; D055213:Retinal Pigment Epithelium; D012224:Rhinophyma; D012393:Rosacea; D041623:Tomography, Optical Coherence", "nlm_unique_id": "101599215", "other_id": null, "pages": "356-61", "pmc": null, "pmid": "27065376", "pubdate": "2016-04-01", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Swept-Source Optical Coherence Tomography and OCT Angiography of Minocycline-Induced Retinal and Systemic Hyperpigmentation.", "title_normalized": "swept source optical coherence tomography and oct angiography of minocycline induced retinal and systemic hyperpigmentation" }
[ { "companynumb": "US-BAUSCH-BL-2016-022641", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "MINOCYCLINE\\MINOCYCLINE HYDROCHLORIDE" }, "dr...
{ "abstract": "OBJECTIVE\nTo evaluate 0.75 mg of dulaglutide, a once-weekly glucagon-like peptide-1 receptor agonist, compared with once-daily insulin glargine for glycaemic control in Japanese patients with type 2 diabetes (T2D).\n\n\nMETHODS\nIn this phase III, randomized, open-label, parallel-group, 26-week study, 361 patients with inadequately controlled T2D receiving sulphonylureas and/or biguanides, aged ≥20 years, with glycated haemoglobin (HbA1c) levels 7.0-10.0% (53-86 mmol/mol), inclusive, were randomized (1 : 1) to receive dulaglutide or glargine. Participants and investigators were not masked to treatment allocation. The primary measure was change from baseline in HbA1c at 26 weeks, analysed using a mixed-effects model for repeated measures, with a predefined non-inferiority margin of 0.4%.\n\n\nRESULTS\nAt week 26, least-squares (LS) mean (standard error) reductions in HbA1c were -1.44 (0.05)% [-15.74 (0.55) mmol/mol] in the dulaglutide group and -0.90 (0.05)% [-9.84 (0.55) mmol/mol] in the glargine group. The mean between-group treatment difference in HbA1c was -0.54% (95% CI -0.67, -0.41) [-5.90 mmol/mol (95% CI -7.32, -4.48)]; p < 0.001. Dulaglutide significantly reduced body weight compared with glargine at week 26 (LS mean difference -1.42 kg, 95% CI -1.89, -0.94; p < 0.001). The most frequent adverse events with dulaglutide treatment were nasopharyngitis and gastrointestinal symptoms. The incidence of hypoglycaemia was significantly lower with dulaglutide [47/181 (26%)] compared with glargine [86/180 (48%)], p < 0.001.\n\n\nCONCLUSIONS\nIn Japanese patients with T2D uncontrolled on sulphonylureas and/or biguanides, once-weekly dulaglutide was superior to once-daily glargine for reduction in HbA1c at 26 weeks. Although dulaglutide increased gastrointestinal symptoms, it was well tolerated, with an acceptable safety profile.", "affiliations": "Department of Metabolic Medicine, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan.;Department of Diabetes, Endocrinology and Nutrition, Kyoto University Graduate School of Medicine, Kyoto, Japan.;Division of Endocrinology, Metabolism, Hematological Science and Therapeutics, Yamaguchi University Graduate School of Medicine, Yamaguchi, Japan.;Eli Lilly Japan K.K., Kobe, Japan.;Eli Lilly Japan K.K., Kobe, Japan.;Eli Lilly Japan K.K., Kobe, Japan.", "authors": "Araki|E|E|;Inagaki|N|N|;Tanizawa|Y|Y|;Oura|T|T|;Takeuchi|M|M|;Imaoka|T|T|", "chemical_list": "D001645:Biguanides; D001786:Blood Glucose; D006442:Glycated Hemoglobin A; D007004:Hypoglycemic Agents; D007141:Immunoglobulin Fc Fragments; D011993:Recombinant Fusion Proteins; D013453:Sulfonylurea Compounds; C517652:hemoglobin A1c protein, human; D000069036:Insulin Glargine; D004763:Glucagon-Like Peptides; C555680:dulaglutide", "country": "England", "delete": false, "doi": "10.1111/dom.12540", "fulltext": "\n==== Front\nDiabetes Obes MetabDiabetes Obes Metab10.1111/(ISSN)1463-1326DOMDiabetes, Obesity & Metabolism1462-89021463-1326Blackwell Publishing Ltd Oxford, UK 10.1111/dom.12540DOM12540Original ArticleOriginal ArticlesEfficacy and safety of once‐weekly dulaglutide in combination with sulphonylurea and/or biguanide compared with once‐daily insulin glargine in Japanese patients with type 2 diabetes: a randomized, open‐label, phase III, non‐inferiority study Araki et alAraki E. \n1\nInagaki N. \n2\nTanizawa Y. \n3\nOura T. \n4\nTakeuchi M. \n4\nImaoka T. \n4\n1 Department of Metabolic MedicineFaculty of Life Sciences, Kumamoto UniversityKumamotoJapan2 Department of Diabetes, Endocrinology and NutritionKyoto University Graduate School of MedicineKyotoJapan3 Division of Endocrinology, Metabolism, Hematological Science and TherapeuticsYamaguchi University Graduate School of MedicineYamaguchiJapan4 Eli Lilly Japan K.K.KobeJapan* Correspondence to: Masakazu Takeuchi, Eli Lilly Japan K.K., 7‐1‐5, Isogamidori, Chuoku, Kobe 651‐0086, Japan.\n\nE‐mail: takeuchi_masakazu@yahoo.co.jp\n20 8 2015 10 2015 17 10 10.1111/dom.2015.17.issue-10994 1002 14 4 2015 23 6 2015 02 7 2015 © 2015 The Authors. Diabetes, Obesity and Metabolism published by John Wiley & Sons Ltd.This is an open access article under the terms of the Creative Commons Attribution‐NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.Aims\nTo evaluate 0.75 mg of dulaglutide, a once‐weekly glucagon‐like peptide‐1 receptor agonist, compared with once‐daily insulin glargine for glycaemic control in Japanese patients with type 2 diabetes (T2D).\n\nMethods\nIn this phase III, randomized, open‐label, parallel‐group, 26‐week study, 361 patients with inadequately controlled T2D receiving sulphonylureas and/or biguanides, aged ≥20 years, with glycated haemoglobin (HbA1c) levels 7.0–10.0% (53–86 mmol/mol), inclusive, were randomized (1 : 1) to receive dulaglutide or glargine. Participants and investigators were not masked to treatment allocation. The primary measure was change from baseline in HbA1c at 26 weeks, analysed using a mixed‐effects model for repeated measures, with a predefined non‐inferiority margin of 0.4%.\n\nResults\nAt week 26, least‐squares (LS) mean (standard error) reductions in HbA1c were −1.44 (0.05)% [−15.74 (0.55) mmol/mol] in the dulaglutide group and −0.90 (0.05)% [−9.84 (0.55) mmol/mol] in the glargine group. The mean between‐group treatment difference in HbA1c was −0.54% (95% CI −0.67, −0.41) [−5.90 mmol/mol (95% CI −7.32, −4.48)]; p < 0.001. Dulaglutide significantly reduced body weight compared with glargine at week 26 (LS mean difference −1.42 kg, 95% CI −1.89, −0.94; p < 0.001). The most frequent adverse events with dulaglutide treatment were nasopharyngitis and gastrointestinal symptoms. The incidence of hypoglycaemia was significantly lower with dulaglutide [47/181 (26%)] compared with glargine [86/180 (48%)], p < 0.001.\n\nConclusion\nIn Japanese patients with T2D uncontrolled on sulphonylureas and/or biguanides, once‐weekly dulaglutide was superior to once‐daily glargine for reduction in HbA1c at 26 weeks. Although dulaglutide increased gastrointestinal symptoms, it was well tolerated, with an acceptable safety profile.\n\ndulaglutideGLP‐1 receptor agonistinsulin glarginetype 2 diabetesEli Lilly K.K.Roche DiagnosticsShiratoriMitsubishi Tanabe PharmaceuticalMSD source-schema-version-number2.0component-iddom12540cover-dateOctober 2015details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_NLMPMC version:4.9.4 mode:remove_FC converted:29.09.2016\n==== Body\nIntroduction\nGlucagon‐like peptide‐1 (GLP‐1) is an endogenous incretin hormone that is rapidly secreted by intestinal L‐cells in response to food ingestion. GLP‐1 stimulates postprandial insulin secretion, inhibits glucagon secretion and slows gastric emptying 1. The acute administration of GLP‐1 induces satiety and reduces food intake in subjects with and without diabetes 2, 3. Several GLP‐1 receptor agonists have been developed or are in development for the treatment of type 2 diabetes (T2D) 4, 5, 6. As of February 2015, four GLP‐1 receptor agonists (liraglutide 7, exenatide twice daily and once weekly 8, 9, and lixisenatide 10) have been launched in Japan.\n\nDulaglutide is a long‐acting GLP‐1 receptor agonist that mimics some of the effects of endogenous GLP‐1; it has been approved in the USA and the European Union at once‐weekly doses of 0.75 and 1.5 mg as a subcutaneous injection to improve glycaemic control in patients with T2D 11, 12. Dulaglutide 0.75 mg has been approved in Japan for the treatment of T2D. Dulaglutide has been modified to render the molecule more stable against dipeptidyl peptidase‐4 inactivation, to increase the solubility of the peptide, to reduce immunogenic potential and to increase the duration of its pharmacological activity 13. In global clinical trials completed to date, dulaglutide 1.5 mg has shown superiority to metformin, sitagliptin, insulin glargine and exenatide twice daily and non‐inferiority to liraglutide in glycated haemoglobin (HbA1c) changes, and has been associated with reductions in body weight in patients with T2D 14, 15, 16, 17, 18. Also, in a phase II study in Japanese patients, dulaglutide showed dose‐dependent HbA1c reductions in doses up to 0.75 mg, with an acceptable safety profile 19.\n\nInjectable antihyperglycaemic medications, such as insulin and GLP‐1 receptor agonists, are used for patients whose T2D is inadequately controlled with oral antihyperglycaemics; basal insulin is a treatment option for second‐ or third‐line therapy 20, 21; therefore, this study compared once‐weekly dulaglutide and once‐daily basal insulin therapy in Japanese patients who were inadequately controlled by sulphonylureas and/or biguanides.\n\nMaterials and Methods\nStudy Design and Patients\nThis study was a 26‐week, randomized, open‐label, parallel‐group, multicentre, phase III, non‐inferiority study, comparing the efficacy and safety of once‐weekly dulaglutide 0.75 mg with once‐daily insulin glargine in Japanese patients with T2D inadequately controlled with monotherapy or dual therapy of oral antihyperglycaemic drugs (sulphonylureas and/or biguanides). The study had four periods: screening (2 weeks), lead‐in (2 weeks), randomization (at week 0), immediately followed by treatment (26 weeks), and safety follow‐up (30 days). Patients who discontinued the study before the end of the treatment period had an early termination visit. All patients were to return 30 days after the end of treatment for a final safety follow‐up visit. The study was conducted from June 2012 to July 2013 at 35 sites in Japan and was registered at ClinicalTrials.gov (NCT01584232).\n\nJapanese men and women with T2D, aged ≥20 years, with a body mass index (BMI) ≥18.5 and <35.0 kg/m2 and HbA1c at screening ≥7.0 and ≤10.0%, who were taking stable doses of sulphonylureas (2.5–5 mg of glibenclamide, 60–80 mg of gliclazide, or 2–3 mg of glimepiride) and/or biguanides (750–1500 mg of metformin or 100–150 mg of buformin) were randomized. Key exclusion criteria included: patients with type 1 diabetes; patients previously treated with any GLP‐1 receptor agonist; patients who had received therapy with an α‐glucosidase inhibitor, thiazolidinedione, glinide or dipeptidyl peptidase‐4 inhibitor, or insulin within 3 months before screening; patients undergoing chronic systemic glucocorticoid therapy; and patients who had a clinically significant gastric emptying abnormality, cardiovascular disease, liver disease, renal disease, active or untreated malignancy, poorly controlled hypertension, a history of chronic or acute pancreatitis, obvious clinical signs or symptoms of pancreatitis, or a self or family history of medullary C‐cell hyperplasia, focal hyperplasia or medullary thyroid carcinoma.\n\nA common protocol was approved at each site by an institutional review board; the study was performed in accordance with the principles of the Declaration of Helsinki and Good Clinical Practice. Before participation, all patients provided written informed consent 22.\n\nRandomization and Study Treatments\nPatients were randomized in a 1 : 1 ratio to receive subcutaneous injections of once‐weekly dulaglutide 0.75 mg or once‐daily glargine according to a computer‐generated random sequence with an interactive voice response system. Randomization was stratified by concomitant antihyperglycaemic regimen (sulphonylureas only, biguanides only, or sulphonylurea and biguanide), BMI group at baseline (<25 and ≥25 kg/m2) and screening HbA1c [≤8.5 and >8.5% (≤69 and >69 mmol/mol)]. An open‐label design was used, and patients, investigators and site staff were not masked to treatment allocation.\n\nDulaglutide was administered once weekly, and glargine was administered once daily at bedtime, both by subcutaneous injection. The dose of dulaglutide (0.75 mg/week) was selected based on a phase II study conducted in Japan 19. The guideline for initiation and titration of glargine doses was modified for Japanese patients based on the ATLAS study 23 (Table S1), with an initial dose of glargine between 4.0 and 8.0 IU and a fasting serum glucose (FSG) target of ≤6.1 mmol/l for investigator‐driven adjustments. Glargine doses were to be adjusted once a week based on the average of self‐monitored fasting blood glucose values over the previous 3 days. Dose adjustments were to be made as needed once weekly for up to 8 weeks; adjustments at later times were allowed if needed for further optimization of glycaemic control, based on the investigators' discretion. Patients continued their sulphonylureas and/or biguanides at the baseline dose throughout the study; the dose of sulphonylurea may have been reduced if daytime hypoglycaemia was observed. The use of other, additional antihyperglycaemic medications was prohibited during the study period while patients continued on study medication.\n\nIn certain instances, patients were allowed to continue in the study without study medication on an alternative antihyperglycaemic medication for collection of safety data (for example, patients who developed serious adverse events or sustained hyperglycaemia, as prespecified in the study protocol). Sustained hyperglycaemia was defined as self‐monitored fasting blood glucose >15.0 mmol/l (weeks 2–8) or >13.3 mmol/l (weeks 9–26). Patients who experienced sustained hyperglycaemia (≥3 times per week) for at least 2 weeks were to be discontinued from study treatment.\n\nStudy Endpoints and Assessments\nThe primary efficacy measure was change from baseline in HbA1c at 26 weeks. Additional measures included percentages of patients achieving HbA1c targets of <7.0% (53 mmol/mol) or ≤6.5% (48 mmol/mol) and changes in FSG (central laboratory measure), eight‐point self‐monitored blood glucose (SMBG) profiles, and body weight. The eight time points for the SMBG profiles were before and 2 h after each meal (breakfast, lunch and dinner), at bedtime and before breakfast the following morning (‘second pre‐breakfast’ value). Safety assessments included adverse events, vital signs (pulse rate and blood pressure, ECGs), laboratory variables and dulaglutide antidrug antibodies. Data on vital signs were collected at each visit using standardized equipment; triplicate measurements in the supine, sitting and standing positions were to be recorded, in that order. The data in sitting position, which are most commonly used in clinical practice, are shown in the results. ECG data were read by a central vendor for reporting purposes. Hypoglycaemia was defined as a blood glucose concentration of ≤3.9 mmol/l and/or symptoms and/or signs attributable to hypoglycaemia. Severe hypoglycaemia was defined as an episode requiring the assistance of another person to actively administer therapy 24.\n\nAn independent external committee adjudicated deaths and non‐fatal cardiovascular adverse events in a masked manner, with prespecified event criteria based on the preponderance of evidence and clinical knowledge and experience. An independent external committee also adjudicated adverse events of severe or serious abdominal pain, suspected or definite acute or chronic pancreatitis, and lipase or amylase concentrations of 3 × the upper limit of normal (ULN) or higher. Serum calcitonin was measured throughout the study.\n\nStatistical Analyses\nAssuming no difference in HbA1c between dulaglutide and glargine and an 11% drop‐out from baseline to week 26, it was estimated that a sample size of 360 randomized patients (180 per arm) would provide 90% power to show non‐inferiority (margin of 0.4%) of dulaglutide to glargine, with common standard deviation (s.d.) of 1.1% for change in baseline HbA1c and a one‐sided 0.025 significance level.\n\nThe primary objective was non‐inferiority of dulaglutide to glargine for HbA1c change from baseline at week 26. The primary efficacy analysis mixed‐model repeated measures included treatment, antihyperglycaemic regimen (sulphonylureas, biguanides or sulphonylureas and biguanides), baseline BMI group (<25 or ≥25 kg/m2), visit and treatment‐by‐visit interaction as fixed effects, baseline as a covariate and patient as a random effect. The 95% confidence interval (CI) for the treatment difference (dulaglutide − glargine) of the least‐squares (LS) means at week 26 based on this model was used to assess the primary objective. If the upper limit of the 95% CI was <0.4%, then non‐inferiority of dulaglutide to glargine was to be concluded. Superiority of dulaglutide to glargine was to be tested if and only if non‐inferiority was concluded. Type I error rate was controlled at 0.025 (one‐sided). A mixed‐model repeated measures was used for FSG and body weight. The percentage of patients achieving HbA1c targets was analysed with a repeated logistic regression model with fixed effects of treatment, antihyperglycaemic regimen, baseline BMI group, visit, treatment‐by‐visit interaction and baseline HbA1c as a covariate. Analysis of covariance with last observation carried forward (LOCF) was used for SMBG and vital signs. Hypoglycaemia rates were analysed with a generalized estimating equation model with negative binomial distribution. The percentage of patients with adverse events was analysed using Fisher's exact test. For laboratory data, an analysis of variance on ranks, with treatment as a fixed effect was conducted. The two‐sided significance level for treatment comparisons was 0.05.\n\nEfficacy analyses were conducted on the full analysis set (all randomized patients who received at least one dose of study drug). Safety analyses were conducted on the as‐treated population, according to the patients' actual treatments (safety analysis set). For the assessment of efficacy and hypoglycaemia events, only data obtained before the initiation of other antihyperglycaemic medication were used. For the assessment of safety, only data obtained while the patient was on study treatment were used.\n\nResults\nPatients\nOf 438 patients screened, 361 (dulaglutide, n = 181; glargine, n = 180) were randomized to treatment; 348 completed treatment with study medication and 13 discontinued study medication because of an adverse event (dulaglutide, n = 6; glargine, n = 2), patient decision (dulaglutide, n = 1; glargine, n = 1), investigator decision (dulaglutide, n = 1; glargine, n = 1) or protocol violation (dulaglutide, n = 1; Figure S1). Two patients who discontinued study medication later completed the study. Eleven patients discontinued the study as a result of: an adverse event (dulaglutide, n = 3; glargine, n = 1); patient decision (dulaglutide, n = 2; glargine, n = 1); loss to follow‐up (dulaglutide, n = 1); or investigator decision (dulaglutide, n = 2; glargine, n = 1).\n\nPatient characteristics were similar between the groups (Table 1). The mean (s.d.) daily glargine dose was 5.0 IU (0.07 IU/kg) at time of first injection and 12.5 IU (0.17 IU/kg) at endpoint. The most frequent pre‐existing conditions at baseline overall were hypertension (54.8%), dyslipidaemia (43.2%), and hepatic steatosis (25.2%). In the dulaglutide and glargine groups, 13/117 (11.1%) and 11/114 (9.6%) patients, respectively, decreased their concomitant sulphonylurea dose from baseline as a result of hypoglycaemia. One patient in the dulaglutide group discontinued concomitant sulphonylurea as a result of hypoglycaemia. Dosing of concomitant sulphonylureas and biguanides at baseline and week 26 was shown in Table S2.\n\nTable 1 Baseline characteristics\n\n\t\nDulaglutide 0.75 mg (N = 181)\n\t\nInsulin glargine (N = 180)\n\t\nTotal (N = 361)\n\t\nSex, n (%)\t\nMen\t125 (69)\t133 (74)\t258 (71)\t\nWomen\t56 (31)\t47 (26)\t103 (29)\t\nAge, years\t57.5 (10.5)\t56.1 (11.3)\t56.8 (10.9)\t\nAge ≥65 years, n (%)\t45 (25)\t47 (26)\t92 (26)\t\nWeight, kg\t70.9 (13.7)\t71.1 (13.8)\t71.0 (13.7)\t\nBMI, kg/m2\n\t26.1 (3.6)\t25.9 (3.9)\t26.0 (3.7)\t\nDiabetes duration, years\t8.9 (6.7)\t8.8 (6.1)\t8.8 (6.4)\t\nHbA1c\t\n%\t8.1 (0.8)\t8.0 (0.9)\t8.0 (0.9)\t\nmmol/mol\t65 (9.1)\t64 (9.4)\t64 (9.3)\t\nFasting blood glucose concentration, mmol/l\t8.8 (2.0)\t8.6 (2.0)\t8.7 (2.0)\t\nSeated vital signs\t\nSystolic blood pressure, mmHg\t129 (14)\t129 (13)\t129 (14)\t\nDiastolic blood pressure, mmHg\t81 (9)\t80 (9)\t80 (9)\t\nPulse rate, beats/min\t72 (11)\t71 (9)\t72 (10)\t\nPrevious oral antihyperglycaemic medication use, n (%)\t\nSulphonylureas only\t34 (19)\t33 (18)\t67 (19)\t\nBiguanides only\t64 (35)\t66 (37)\t130 (36)\t\nSulphonylureas and biguanides\t83 (46)\t81 (45)\t164 (45)\t\nPre‐existing conditions, n (%)\t\nHypertension\t107 (59.1)\t91 (50.6)\t198 (54.8)\t\nDyslipidaemia\t75 (41.4)\t81 (45.0)\t156 (43.2)\t\nHepatic steatosis\t51 (28.2)\t40 (22.2)\t91 (25.2)\t\nData are mean (standard deviation), unless indicated. BMI, body mass index; HbA1c, glycated haemoglobin; N, number of patients in full analysis set.\n\nEfficacy\nBoth dulaglutide and glargine significantly reduced HbA1c from baseline (Table 2). The LS mean reduction in HbA1c with dulaglutide was non‐inferior and superior to that achieved by glargine, with a between‐group difference in HbA1c reduction from baseline of −0.54% (95% CI −0.67, −0.41) or −5.90 mmol/mol (95% CI −7.32, −4.48); p < 0.001. Dulaglutide significantly reduced HbA1c from baseline compared with glargine at weeks 8, 14, 20 and 26 (all p < 0.001; Figure 1A). At week 26 (LOCF), significantly greater percentages of patients on dulaglutide achieved HbA1c targets of <7.0% (53 mmol/mol) or ≤6.5% (48 mmol/mol) compared with glargine [127/178 (71%) versus 82/179 (46%); p < 0.001 and 91/178 (51%) versus 43/179 (24%); p < 0.001, respectively].\n\nTable 2 Efficacy assessments\n\n\t\nDulaglutide 0.75 mg (N = 181)\n\t\nInsulin glargine (N = 180)\n\t\nDulaglutide 0.75 mg versus insulin glargine\n\t\n\nBaseline\n\t\nWeek 26\n\t\nChange from baseline to week 26\n\t\nBaseline\n\t\nWeek 26\n\t\nChange from baseline to week 26\n\t\nLS mean difference (95% CI)\n\t\np\n\t\nHbA1c\t\n%\t8.06 (0.82)\t6.58 (0.05)\t−1.44 (0.05)\t7.99 (0.87)\t7.12 (0.05)\t−0.90 (0.05)\t−0.54 (−0.67, −0.41)\t<0.001\t\nmmol/mol\t64.6 (9.0)\t48.4 (0.6)\t−15.7 (0.6)\t63.8 (9.5)\t54.3 (0.6)\t−9.8 (0.6)\t−5.9 (−7.3, −4.5)\t<0.001\t\nFSG concentration, mmol/l\t8.84 (2.03)\t6.84 (0.11)\t−1.90 (0.11)\t8.64 (2.01)\t6.64 (0.11)\t−2.10 (0.11)\t0.19 (−0.09, 0.48)\t0.18\t\nBody weight, kg\t71.00 (13.71)\t70.51 (0.17)\t−0.48 (0.17)\t71.08 (13.75)\t71.93 (0.17)\t0.94 (0.17)\t−1.42 (−1.89, −0.94)\t<0.001\t\nData are least‐squares mean (s.e.) or least‐squares mean difference (95% CI) unless otherwise stated. Baseline data are mean (s.d.). Within‐group changes are from MMRM. Between‐group changes and p‐values are from pairwise comparisons (dulaglutide − glargine) using MMRM. CI, confidence interval; FSG, fasting serum glucose; HbA1c, glycated haemoglobin; LS, least‐squares; MMRM, mixed‐model repeated measures; N, number of patients in full analysis set; s.d., standard deviation; s.e., standard error.\n\nFigure 1 Glycated haemoglobin (HbA1c), fasting serum glucose (FSG) and body weight. (A) Mean [standard error (s.e.)] HbA1c values. (B) Mean (s.e.) FSG (mmol/l) values. (C) Mean (s.e.) change from baseline in body weight (kg). *p < 0.001 for dulaglutide versus glargine. LS, least‐squares.\n\nDOM-12540-FIG-0001-cReductions from baseline in FSG were similar in both treatment groups at weeks 14 and 26 (Figure 1B). The LS mean [standard error (s.e.)] changes from baseline in FSG at week 26 were −1.9 (0.11) and −2.1 (0.11) mmol/l for the dulaglutide and glargine groups, respectively (Table 2). Dulaglutide significantly reduced SMBG values from baseline compared with glargine for all time points (p < 0.05) except for pre‐breakfast and pre‐breakfast the following day (second pre‐breakfast), which were significantly reduced from baseline in the glargine group compared with dulaglutide (p < 0.05; Table S3). The mean eight‐point SMBG profiles by treatment at baseline and week 26 (LOCF) are shown in Figure 2.\n\nFigure 2 Eight‐point self‐monitored blood glucose (SMBG) profiles (mmol/l) by time of day (analysis of covariance). (A) At baseline. (B) At week 26 (LOCF). *SMBG statistically significantly lower in the dulaglutide group compared with insulin glargine (p < 0.05). +SMBG statistically significantly lower in the insulin glargine group compared with dulaglutide (p < 0.05). LS, least‐squares.\n\nDOM-12540-FIG-0002-cBody weight was decreased from baseline in the dulaglutide group and increased from baseline in the glargine group (Figure 1C). The LS mean difference in body weight change from baseline at week 26 was −1.42 kg (95% CI −1.89, −0.94; p < 0.001; Table 2).\n\nSafety\nNo deaths occurred during the study (Table 3). A total of 12 (3%) patients [dulaglutide, n = 9 (5%); glargine, n = 3 (2%); p = 0.14] experienced at least one serious adverse event during the treatment period (Table S3). The four most frequently reported treatment‐emergent adverse events which occurred more frequently with dulaglutide than glargine were diarrhoea, nausea, constipation and lipase level increase (all p < 0.05; Table 3). Although 1 patient discontinued dulaglutide treatment because of an adverse event of vomiting, all gastrointestinal adverse events of diarrhoea, nausea, constipation and vomiting were mild in intensity. Besides the vomiting event mentioned previously, other adverse events resulting in discontinuation of study treatment were acute myocardial infarction, cerebral infarction, eczema, liver carcinoma ruptured and decrease in weight (in the dulaglutide group) and eczema and seventh nerve paralysis (in the glargine group).\n\nTable 3 Safety assessments\n\n\t\nDulaglutide 0.75 mg (N = 181)\n\t\nInsulin glargine (N = 180)\n\t\np\n\t\nDeaths\t0\t0\tN/A\t\nSerious adverse events*\n\t9 (5)\t3 (2)\t0.139\t\nPatients with at least one treatment‐emergent adverse event\t136 (75)\t111 (62)\t0.007\t\nTreatment‐emergent adverse events ≥5% in either treatment group\t\nNasopharyngitis\t49 (27)\t46 (26)\t0.811\t\nGastrointestinal disorders\t62 (34)\t25 (14)\t<0.001\t\nDiarrhoea\t22 (12)\t4 (2)\t<0.001\t\nNausea\t17 (9)\t2 (1)\t<0.001\t\nConstipation\t16 (9)\t6 (3)\t0.045\t\nVomiting\t9 (5)\t2 (1)\t0.061\t\nLipase increased\t9 (5)\t1 (<1)\t0.020\t\nPatients who discontinued study because of adverse events\t3 (2)\t1 (1)\t0.623\t\nSeated vital signs†   (mean change from baseline; s.e.)\t\nSystolic blood pressure, mmHg\t0.4 (0.8)\t2.7 (0.8)\t0.052\t\nDiastolic blood pressure, mmHg\t0.3 (0.5)\t0.3 (0.5)\t0.964\t\nPulse rate, beats/min\t3.0 (0.5)\t−1.0 (0.5)\t<0.001\t\nECG PR interval†   (ms; mean change from baseline; s.e.)\t3.1 (0.7)\t−0.7 (0.7)\t<0.001\t\nPancreatic enzymes‡   (median change; Q1, Q3)\t\nTotal amylase§, U/l\t7 (3, 16)\t3 (−2, 9)\t<0.001\t\nLipase§, U/l\t9 (2, 16)\t−1 (−6, 3)\t<0.001\t\nPatients with treatment‐emergent abnormal change in pancreatic enzymes¶ (>ULN)\t\nTotal amylase\t14/169 (8)\t9/168 (5)\t0.388\t\nLipase\t41/156 (26)\t6/165 (4)\t<0.001\t\nPatients with pancreatic enzyme concentration >3 × ULN\t\nTotal amylase\t0\t0\tN/A\t\nLipase**\n\t6 (3)\t1 (<1)\t0.065\t\nTreatment‐emergent dulaglutide antidrug antibodies††\n\t\nDulaglutide antidrug antibodies\t1 (<1)\t0\tN/A\t\nDulaglutide neutralizing antidrug antibodies\t1 (<1)\t0\tN/A\t\nnsGLP‐1 neutralizing antibodies\t1 (<1)\t0\tN/A\t\nData are n (%) unless otherwise specified. MedDRA version 16.1. LOCF, last observation carried forward; MedDRA, Medical Dictionary for Regulatory Activities; N, number of patients in safety analysis set; N/A, not applicable; nsGLP1, native sequence glucagon‐like peptide‐1; Q1, first quartile; Q3, third quartile; s.e., standard error; ULN, upper limit of normal.\n\n* Reported serious adverse events are listed in Table S4.\n\n† Data are least‐squares mean change (s.e.).\n\n‡ Data are LOCF.\n\n§ p‐values for within‐group change from baseline at week 26 and endpoint (LOCF) were <0.01 for both treatment groups by Wilcoxon signed‐rank test.\n\n¶ Denominator is patients with a normal baseline and a postbaseline measurement; p‐value is from Fisher's exact test.\n\n** p‐value is from Fisher's exact test.\n\n†† These values include all postbaseline observations including the safety follow‐up.\n\nHypoglycaemia occurred in 47 (26%) patients receiving dulaglutide and 86 (48%) patients receiving glargine (p < 0.001), with a mean (s.e.) event rate of 0.09 (0.02) events per patient per 30 days for dulaglutide, compared with 0.24 (0.04) for glargine (p < 0.001). Nocturnal hypoglycaemia occurred in 16 (9%) patients receiving dulaglutide and 48 (27%) patients receiving glargine (p < 0.001), with a mean (s.e.) event rate of 0.04 (0.01) events per patient per 30 days for dulaglutide, compared with 0.15 (0.04) for glargine (p = 0.002). No patient had severe hypoglycaemia during the study.\n\nNo patient received additional antidiabetes medication for sustained hyperglycaemia during the planned treatment period.\n\nSeven cardiovascular adverse events [dulaglutide group, 5 (cerebral infarction, 2; acute myocardial infarction, 1; percutaneous coronary intervention, 1; and angina pectoris, 1); glargine group, 2 (spinal cord infarction and intracranial aneurysm)] were adjudicated by an independent committee. All cases were confirmed by adjudication. Dulaglutide significantly increased mean seated pulse rate and ECG PR interval from baseline at week 26 (LOCF) compared with glargine (Table 3).\n\nAt week 26, treatment with dulaglutide significantly increased total amylase and lipase compared with glargine (p < 0.001; Table 3). A significantly greater proportion of patients in the dulaglutide group had treatment‐emergent postbaseline lipase levels above the ULN compared with the glargine group (dulaglutide, 26%; glargine, 4%; p < 0.001). A total of 7 patients [dulaglutide, n = 6 (3.4%); glargine, n = 1 (0.6%)] had post‐baseline lipase levels 3 × ULN or higher. None of these patients experienced abdominal pain typical of acute pancreatitis, and the elevated value decreased below 3 × ULN while the patients continued on study medication. No cases of pancreatitis were confirmed by adjudication.\n\nThere were no treatment‐emergent reports of thyroid neoplasm, including C‐cell hyperplasia or medullary thyroid carcinoma. All patients had calcitonin values within normal limits. No other clinically significant changes were detected for any other laboratory safety assessment.\n\nOne patient (0.6%) in the dulaglutide group experienced treatment‐emergent dulaglutide antidrug antibodies (Table 3). Few patients [dulaglutide, n = 3 (1.7%); glargine, n = 1 (0.6%)] had injection‐site reactions.\n\nDiscussion\nIn the present study, once‐weekly dulaglutide was superior to once‐daily glargine as measured by HbA1c reduction at 26 weeks in Japanese patients with T2D. This finding is consistent with those reported in previous studies that compared efficacy and safety between GLP‐1 receptor agonists and glargine: non‐inferiority to once‐daily glargine with respect to change in HbA1c was shown in global phase III studies for exenatide twice daily 25, taspoglutide 26 and albiglutide 27. Also, greater HbA1c reduction compared with glargine was observed in the phase III studies for liraglutide (global) 28 and exenatide once weekly (Japan) 29. In addition to the finding of glycaemic superiority for dulaglutide compared with glargine in this study, treatment with dulaglutide resulted in weight loss and fewer hypoglycaemic events compared with glargine.\n\nWhen evaluating the efficacy of insulin formulations, dosing algorithms are an important factor. In this study, glargine dosing was adjusted based on targeting FSG ≤6.1 mmol/l. Although the mean FSG at endpoint (week 26) in the glargine group (6.6 mmol/l) was higher than the target, this was similar to the average seen in treat‐to‐target glargine studies (6.7 mmol/l) 30. The mean HbA1c at endpoint in the glargine group (7.1%) was also similar to the average seen in treat‐to‐target glargine studies 30. The mean dose of glargine at endpoint in this study was 12.5 IU/day. This was lower than the average daily dose in Western populations, but similar to the average dose in the Japanese population (10–15 IU/day) reported in previous clinical studies and post‐marketing surveillance reports for glargine 29, 31, 32. As further evidence of active glargine titration, the incidence of hypoglycaemia (48%) in the glargine group in the present study was similar to the incidence (54%) reported in a review article for incidence of hypoglycaemia in a treat‐to‐target study of insulin glargine 33.\n\nIn patients on dulaglutide in the present study, the HbA1c reduction from baseline at 26 weeks was −1.44% (−15.74 mmol/mol), and the percentage of patients achieving the HbA1c target of <7.0% (53 mmol/mol) was 71%. These results were similar to those observed in the phase II monotherapy study in Japanese patients 19. At week 12 in that study, treatment with dulaglutide 0.75 mg resulted in an HbA1c change from baseline of −1.35% (−14.76 mmol/mol), and 77% of patients achieved the HbA1c target of <7.0% (53 mmol/mol). These consistent effects on glycaemic control were also observed in the dulaglutide global phase III AWARD programme (for dulaglutide doses of 0.75 and 1.5 mg) 14, 15, 16, 17, 18.\n\nIn terms of body weight change, reductions from baseline were observed with dulaglutide and increases were observed with glargine. The mean difference at week 26 was −1.4 kg, which was smaller than the mean differences (−2.6 to −4.1 kg) observed in other global phase III trials in which a GLP‐1 receptor agonist was directly compared with glargine 25, 26, 27, 28, 34; however, this may have been attributable to the leaner body mass (mean body weight at baseline: 71 kg) of the Japanese population in this study, and it is consistent with the mean difference (−2.0 kg) seen in the Japan phase III study for exenatide once‐ weekly 29.\n\nOverall, once‐ weekly dulaglutide was safe and well tolerated, and safety results were consistent with other studies of dulaglutide 14, 15, 16, 17, 18, 19. The incidences of nausea and diarrhoea in the dulaglutide group in combination with sulphonylurea and/or biguanides were slightly higher (nausea, 9%; diarrhoea, 12%) than those observed in the Japan phase II study investigating dulaglutide as monotherapy (nausea, 6%; diarrhoea, 3% in the 0.75‐mg group) 19; however, all gastrointestinal adverse events of diarrhoea, nausea, constipation and vomiting were mild in intensity. Several clinical trials of GLP‐1 receptor agonists have been conducted in Japan, and the incidence of adverse events can be compared between this study and those studies. The incidence of nausea with dulaglutide 0.75 mg in this study (9%) was slightly higher than that seen with liraglutide 0.9 mg (5%) 35 and was similar to that seen with exenatide 2 mg once weekly (13%) 29, but was lower than that seen with exenatide 5 or 10 µg twice daily (25–36%) 36 or with lixisenatide 20 µg (25–40%) 37, 38. Also, the incidence of injection site reactions with dulaglutide 0.75 mg (2%) was similar to that seen with liraglutide 0.9 mg (6%) 39, exenatide 10 µg twice daily (3%) 40, and lixisenatide 20 µg (1%) 37, but was lower than that seen with exenatide 2 mg once weekly (41%) 29. Consistent with previous reports in the GLP‐1 receptor agonist class 18, 41, elevations in pancreatic enzymes were noted, with no confirmed cases of pancreatitis.\n\nIn the present study, dulaglutide increased pulse rate compared with glargine. These increases were similar to those observed in phase III studies of other long‐acting GLP‐1 receptor agonists, such as liraglutide and exenatide once weekly 40, 42, 43.\n\nThe limitations of the present study include its open‐label design, which could have affected physicians' and patients' behaviours; however, it would have been difficult to use a double‐blind design because glargine requires titration throughout the study period. The length of the study was fairly short in view of the chronic nature of T2D, but the duration was sufficient for each treatment to reach steady state and the treatment effect to be represented in the primary outcome of HbA1c.\n\nIn conclusion, in Japanese patients with T2D who were no longer achieving glycaemic control on sulphonylureas and/or biguanides, once‐weekly dulaglutide 0.75 mg was an effective alternative to once‐daily insulin glargine for glycaemic control, with weight loss and lower rates of hypoglycaemia.\n\nConflict of Interest\nE. A., N. I. and Y. T. were trial investigators and participated in data collection. T. O., M. T. and T. I. prepared the first draft of the manuscript. T. O. was responsible for the statistical considerations in the analysis and trial design. M. T. and T. I. were responsible for medical oversight during the trial and trial design. All authors participated in reviewing and interpreting the data and providing comments and revisions to the manuscript. All authors approved the final version of the manuscript and take full responsibility for the content. E. A. has received a grant from Eli Lilly, lecture fees from Sanofi, Astellas, Ono, Takeda, Mitsubishi Tanabe Pharmaceutical and Novo Nordisk, and a research endowment from AstraZeneca, Astellas and Takeda. N. I. has received grants from Eli Lilly, Roche Diagnostics, and Shiratori; research endowments from Novartis, Sanofi, Sumitomo Dainippon Pharmaceutical, Astellas, Daiichi Sankyo, Japan Tobacco, Ono, Taisho Toyama, and Takeda; grants and research endowments from Mitsubishi Tanabe Pharmaceutical and MSD; and other awards from Boehringer Ingelheim, Kyowa Hakko Kirin, Japan Diabetes Foundation, and Novo Nordisk. Y. T. has received a grant and research endowments from Eli Lilly, research endowments from Boehringer Ingelheim, Kowa, Kyowa Hakko Kirin, Sanofi, and Taisho Toyama; lecture fees from AstraZeneca, NovoNordisk, and Ono; and research endowments and lecture fees from Astellas, Daiichi Sankyo, Mitsubishi Tanabe Pharmaceutical, MSD, Novartis, Sumitomo Dainippon Pharmaceutical, and Takeda. M. T., T. I., and T. O. are employees of Eli Lilly Japan K.K, and T. I. has the company stock option.\n\nSupporting information\n\nFigure S1. Disposition.\n\nClick here for additional data file.\n\n \nTable S1. Dosing adjustment schedule for once‐daily insulin glargine.\n\nClick here for additional data file.\n\n \nTable S2. Dosing of concomitant sulphonylureas and biguanides (mg) at baseline and week 26.\n\nClick here for additional data file.\n\n \nTable S3. Summary of least squares mean (standard error) changes from baseline in self‐monitored blood glucose (mmol/l) values (LOCF at week 26).\n\nClick here for additional data file.\n\n \nTable S4. Summary of serious adverse events by preferred term.\n\nClick here for additional data file.\n\n Acknowledgements\nThis trial was sponsored by Eli Lilly K.K. (Kobe, Japan). We thank the trial investigators, trial staff and trial participants for their contributions. We would also like to thank Miwa Sakaridani for clinical trial management of the study and Mary K. Re of inVentiv Health Clinical (Ann Arbor, MI, USA) for assisting with medical writing and the preparation of tables and figures.\n==== Refs\nReferences\n1 \n\nMacDonald \nPE \n, \nEl‐Kholy \nW \n, \nRiedel \nMJ \n et al. The multiple actions of GLP‐1 on the process of glucose‐stimulated insulin secretion . Diabetes \n2002 ; 51 (Suppl. 3): S434 –442 .12475787 \n2 \n\nGutzwiller \nJP \n, \nDegen \nL \n, \nHeuss \nL \n, \nBeglinger \nC \n. Glucagon‐like peptide 1 (GLP‐1) and eating . Physiol Behav \n2004 ; 82 : 17 –19 .15234584 \n3 \n\nMudaliar \nS \n, \nHenry \nRR \n. Incretin therapies: effects beyond glycemic control . Am J Med \n2009 ; 122 (Suppl. 6): S25 –36 .19464425 \n4 \n\nMadsbad \nS \n, \nKielgast \nU \n, \nAsmar \nM \n, \nDeacon \nCF \n, \nTorekov \nSS \n, \nHolst \nJJ \n. An overview of once‐weekly glucagon‐like peptide‐1 receptor agonists — available efficacy and safety data and perspectives for the future . Diabetes Obes Metab \n2011 ; 13 : 394 –407 .21208359 \n5 \n\nLorenz \nM \n, \nEvers \nA \n, \nWagner \nM \n. Recent progress and future options in the development of GLP‐1 receptor agonists for the treatment of diabesity . Bioorg Med Chem Lett \n2013 ; 23 : 4011 –4018 .23743288 \n6 \n\nLund \nA \n, \nKnop \nFK \n, \nVilsbøll \nT \n. Glucagon‐like peptide‐1 receptor agonists for the treatment of type 2 diabetes: differences and similarities . Eur J Intern Med \n2014 ; 25 : 407 –414 .24694879 \n7 \nNovo Nordisk Pharma Ltd, Tokyo \n. Victoza [Japan package insert] . 2014 Available from URL: http://www.info.pmda.go.jp/downfiles/ph/PDF/620023_2499410G1021_1_08.pdf Accessed 21 May 2015 (in Japanese).\n8 \nAstraZeneca K.K., Osaka \n. Byetta [Japan package insert] . 2015 Available from URL: http://www.info.pmda.go.jp/downfiles/ph/PDF/670227_2499411G1026_2_04.pdf Accessed 6 June 2015 (in Japanese).\n9 \nAstraZeneca K.K., Osaka \n. Bydureon [Japan package insert] . 2015 Available from URL: http://www.info.pmda.go.jp/downfiles/ph/PDF/670227_2499411G3029_1_11.pdf Accessed 6 June 2015 (in Japanese).\n10 \nSanofi K.K., Tokyo \n. Lyxumia [Japan package insert] . 2014 Available from URL: http://www.info.pmda.go.jp/downfiles/ph/PDF/780069_2499415G1024_1_04.pdf Accessed 21 May 2015 (in Japanese).\n11 \nLilly USA, LLC, Indianapolis \n. Trulicity [Prescribing information] . 2014 Available from URL: http://pi.lilly.com/us/trulicity-uspi.pdf. Accessed 23 March 2015.\n12 \nEli Lilly and Company, Houten \n. Trulicity [Summary of product characteristics] . 2014 Available from URL: http://www.ema.europa.eu/ema/index.jsp?curl=pages/medicines/human/medicines/002825/human_med_001821.jsp&mid=WC0b01ac058001d124. Accessed 23 March 2015.\n13 \n\nGlaesner \nW \n, \nVick \nAM \n, \nMillican \nR \n et al. Engineering and characterization of the long‐acting glucagon‐like peptide‐1 analogue LY2189265, an FC fusion protein . Diabetes Metab Res Rev \n2010 ; 26 : 287 –296 .20503261 \n14 \n\nUmpierrez \nGE \n, \nPovedano \nST \n, \nManghi \nFP \n, \nShurzinske \nL \n, \nPechtner \nV \n. Efficacy and safety of dulaglutide monotherapy versus metformin in type 2 diabetes in a randomized controlled trial (AWARD‐3) . Diabetes Care \n2014 ; 37 : 2168 –2176 .24842985 \n15 \n\nNauck \nM \n, \nWeinstock \nR \n, \nUmpierrez \nGE \n, \nGuerci \nB \n, \nSkrivanek \nZ \n, \nMilicevic \nZ \n. Efficacy and safety of dulaglutide versus sitagliptin after 52 weeks in type 2 diabetes in a randomized controlled trial (AWARD‐5) . Diabetes Care \n2014 ; 37 : 2149 –2158 .24742660 \n16 \n\nGiorgino \nF \n, \nBenroubi \nM \n, \nSun \nJH \n, \nZimmermann \nAG \n, \nPechtner \nV \n. Efficacy and safety of once‐weekly dulaglutide versus insulin glargine in combination with metformin and glimepiride in type 2 diabetes patients (AWARD‐2) . Diabetes \n2014 ; 63 (Suppl. 1): A87 [330‐OR].\n17 \n\nWysham \nC \n, \nBlevins \nT \n, \nArakaki \nR \n et al. Efficacy and safety of dulaglutide added onto pioglitazone and metformin versus exenatide in type 2 diabetes in a randomized controlled trial (AWARD‐1) . Diabetes Care \n2014 ; 37 : 2159 –2167 .24879836 \n18 \n\nDungan \nKM \n, \nPovedano \nST \n, \nForst \nT \n et al. Once‐weekly dulaglutide versus once‐daily liraglutide in metformin‐treated patients with type 2 diabetes (AWARD‐6): a randomised, open‐label, phase 3, non‐inferiority trial . Lancet \n2014 ; 384 : 1349 –1357 .25018121 \n19 \n\nTerauchi \nY \n, \nSatoi \nY \n, \nTakeuchi \nM \n, \nImaoka \nT \n. Monotherapy with the once weekly GLP‐1 receptor agonist dulaglutide for 12 weeks in Japanese patients with type 2 diabetes: dose‐dependent effects on glycaemic control in a randomised, double‐blind, placebo‐controlled study . Endocr J \n2014 ; 61 : 949 –959 .25029955 \n20 \n\nInzucchi \nSE \n, \nBergenstal \nRM \n, \nBuse \nJB \n et al. Management of hyperglycemia in type 2 diabetes: a patient‐centered approach: position statement of the American Diabetes Association (ADA) and the European Association for the Study of Diabetes (EASD) . Diabetes Care \n2012 ; 35 : 1364 –1379 .22517736 \n21 \nJapan Diabetes Society \n. Treatment guide for Diabetes 2012–2013 . 2013 Available from URL: http://www.jds.or.jp/common/fckeditor/editor/filemanager/connectors/php/transfer.php?file=/uid000025_54726561746D656E745F47756964655F666F725F44696162657465735F323031322D323031332E706466. Accessed 23 March 2015.\n22 \nWorld Medical Association Declaration of Helsinki \n. Recommendations guiding physicians in biomedical research involving human subjects . JAMA \n1997 ; 277 : 925 –926 .9062334 \n23 \n\nOdawara \nM \n, \nMisra \nA \n, \nShestakova \nM \n et al. Titration of insulin glargine in patients with type 2 diabetes mellitus in Asia: physician‐ versus patient‐led? Rationale of the Asian Treat to Target Lantus Study (ATLAS) . Diabetes Technol Ther \n2011 ; 13 : 67 –72 .21175274 \n24 \nWorkgroup on Hypoglycemia, American Diabetes Association \n. Defining and reporting hypoglycemia in diabetes: a report from the American Diabetes Association Workgroup on Hypoglycemia . Diabetes Care \n2005 ; 28 : 1245 –1249 .15855602 \n25 \n\nHeine \nRJ \n, \nVan Gaal \nLF \n, \nJohns \nD \n et al. Exenatide versus insulin glargine in patients with suboptimally controlled type 2 diabetes: a randomized trial . Ann Intern Med \n2005 ; 143 : 559 –569 .16230722 \n26 \n\nNauck \nM \n, \nHorton \nE \n, \nAndjelkovic \nM \n et al. Taspoglutide, a once‐weekly glucagon‐like peptide 1 analogue, vs. insulin glargine titrated to target in patients with Type 2 diabetes: an open‐label randomized trial . Diabet Med \n2013 ; 30 : 109 –113 .22937895 \n27 \n\nWeissman \nPN \n, \nCarr \nMC \n, \nYe \nJ \n et al. HARMONY 4: randomised clinical trial comparing once‐weekly albiglutide and insulin glargine in patients with type 2 diabetes inadequately controlled with metformin with or without sulfonylurea . Diabetologia \n2014 ; 57 : 2475 –2484 .25208756 \n28 \n\nRussell‐Jones \nD \n, \nVaag \nA \n, \nSchmitz \nO \n et al. Liraglutide vs insulin glargine and placebo in combination with metformin and sulfonylurea therapy in type 2 diabetes mellitus (LEAD‐5 met + SU): a randomised controlled trial . Diabetologia \n2009 ; 52 : 2046 –2055 .19688338 \n29 \n\nInagaki \nN \n, \nAtsumi \nY \n, \nOura \nT \n, \nSaito \nH \n, \nImaoka \nT \n. Efficacy and safety profile of exenatide once weekly compared with insulin once daily in Japanese patients with type 2 diabetes treated with oral antidiabetes drug(s): results from a 26‐week, randomized, open‐label, parallel‐group, multicenter, noninferiority study . Clin Ther \n2012 ; 34 : 1892 –1908 .22884767 \n30 \n\nBloomgarden \nZ \n, \nHandelsmann \nY \n. Lessons from glargine trials: what is the goal fasting glucose with basal insulin? \nJ Diabetes \n2014 ; 6 : 271 –273 .24656089 \n31 \n\nKawamori \nR \n, \nIwamoto \nY \n, \nKadowaki \nT \n, \nIwasaki \nM \n. Efficacy and safety of insulin glargine in concurrent use with oral hypoglycemic agents for the treatment of type 2 diabetic patients . J Clin Therap Med \n2003 ; 19 : 445 –464 (in Japanese).\n32 \n\nOdawara \nM \n, \nOhtani \nT \n, \nKadowaki \nT \n. Dosing of insulin glargine to achieve the treatment target in Japanese type 2 diabetes on a basal supported oral therapy regimen in real life: ALOHA study subanalysis . Diabetes Technol Ther \n2012 ; 14 : 635 –643 .22524524 \n33 \n\nRosenstock \nJ \n, \nDailey \nG \n, \nMassi‐Benedetti \nM \n, \nFritsche \nA \n, \nLin \nZ \n, \nSalzman \nA \n. Reduced hypoglycemia risk with insulin glargine: a meta‐analysis comparing insulin glargine with human NPH insulin in type 2 diabetes . Diabetes Care \n2005 ; 28 : 950 –955 .15793205 \n34 \n\nDiamant \nM \n, \nVan Gaal \nL \n, \nStranks \nS \n et al. Once weekly exenatide compared with insulin glargine titrated to target in patients with type 2 diabetes (DURATION‐3): an open‐label randomised trial . Lancet \n2010 ; 375 : 2234 –2243 .20609969 \n35 \n\nKaku \nK \n, \nRasmussen \nMF \n, \nNishida \nT \n, \nSeino \nY \n. Fifty‐two‐week, randomized, multicenter trial to compare the safety and efficacy of the novel glucagon‐like peptide‐1 analog liraglutide vs glibenclamide in patients with type 2 diabetes . J Diabetes Investig \n2011 ; 2 : 441 –447 .\n36 \n\nKadowaki \nT \n, \nNamba \nM \n, \nImaoka \nT \n et al. Improved glycemic control and reduced bodyweight with exenatide: a double‐blind, randomized, phase 3 study in Japanese patients with suboptimally controlled type 2 diabetes over 24 weeks . J Diabetes Investig \n2011 ; 2 : 210 –217 .\n37 \n\nSeino \nY \n, \nMin \nKW \n, \nNiemoeller \nE \n, \nTakami \nA \n, EFC10887 GETGOAL‐L Asia Study Investigators \n. Randomized, double‐blind, placebo‐controlled trial of the once‐daily GLP‐1 receptor agonist lixisenatide in Asian patients with type 2 diabetes insufficiently controlled on basal insulin with or without a sulfonylurea (GetGoal‐L‐Asia) . Diabetes Obes Metab \n2012 ; 14 : 910 –917 .22564709 \n38 \n\nOnishi \nY \n, \nNiemoeller \nE \n, \nIkeda \nY \n, \nTakagi \nH \n, \nYabe \nD \n, \nSeino \nY \n. Efficacy and safety of lixisenatide in Japanese patients with type 2 diabetes mellitus inadequately controlled by sulfonylurea with or without metformin: subanalysis of GetGoal‐S . J Diabetes Investig \n2015 ; 6 : 201 –209 .\n39 \nMinistry of Health, Labour and Welfare \n, Victoza review report in Japan . (pg 90) 2009 Available from URL: http://www.pmda.go.jp/files/000153180.pdf. Accessed 19 May 2015.\n40 \n\nJi \nL \n, \nOnishi \nY \n, \nAhn \nCW \n et al. Efficacy and safety of exenatide once‐weekly vs exenatide twice‐daily in Asian patients with type 2 diabetes mellitus . J Diabetes Investig \n2013 ; 4 : 53 –61 .\n41 \n\nPratley \nRE \n, \nNauck \nMA \n, \nBarnett \nAH \n et al. Once‐weekly albiglutide versus once‐daily liraglutide in patients with type 2 diabetes inadequately controlled on oral drugs (HARMONY 7): a randomised, open‐label, multicentre, non‐inferiority phase 3 study . Lancet Diabetes Endocrinol \n2014 ; 2 : 289 –297 .24703047 \n42 \n\nSeino \nY \n, \nRasmussen \nMF \n, \nNishida \nT \n, \nKaku \nK \n. Efficacy and safety of the once‐daily human GLP‐1 analogue, liraglutide, versus glibenclamide monotherapy in Japanese patients with type 2 diabetes . Curr Med Res Opin \n2010 ; 26 : 1013 –1022 .20199137 \n43 \n\nKaku \nK \n, \nRasmussen \nMF \n, \nClauson \nP \n, \nSeino \nY \n. Improved glycaemic control with minimal hypoglycaemia and no weight change with the once‐daily human glucagon‐like peptide‐1 analogue liraglutide as add‐on to sulphonylurea in Japanese patients with type 2 diabetes . Diabetes Obes Metab \n2010 ; 12 : 341 –347 .20380655\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "1462-8902", "issue": "17(10)", "journal": "Diabetes, obesity & metabolism", "keywords": "GLP-1 receptor agonist; dulaglutide; insulin glargine; type 2 diabetes", "medline_ta": "Diabetes Obes Metab", "mesh_terms": "D000368:Aged; D001645:Biguanides; D001786:Blood Glucose; D001835:Body Weight; D003924:Diabetes Mellitus, Type 2; D004334:Drug Administration Schedule; D004359:Drug Therapy, Combination; D005260:Female; D005767:Gastrointestinal Diseases; D004763:Glucagon-Like Peptides; D006442:Glycated Hemoglobin A; D006801:Humans; D007003:Hypoglycemia; D007004:Hypoglycemic Agents; D007141:Immunoglobulin Fc Fragments; D000069036:Insulin Glargine; D007564:Japan; D008297:Male; D008875:Middle Aged; D009304:Nasopharyngitis; D011993:Recombinant Fusion Proteins; D013453:Sulfonylurea Compounds", "nlm_unique_id": "100883645", "other_id": null, "pages": "994-1002", "pmc": null, "pmid": "26179754", "pubdate": "2015-10", "publication_types": "D017428:Clinical Trial, Phase III; D003160:Comparative Study; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't", "references": "19464425;9062334;21208359;24656089;20380655;24879836;22517736;23743288;22937895;21175274;12475787;16230722;15855602;24703047;22564709;19688338;22524524;24742660;24843528;22884767;20609969;24843631;15793205;25802728;24694879;25018121;20199137;20503261;25029955;25208756;24843486;24842985;15234584", "title": "Efficacy and safety of once-weekly dulaglutide in combination with sulphonylurea and/or biguanide compared with once-daily insulin glargine in Japanese patients with type 2 diabetes: a randomized, open-label, phase III, non-inferiority study.", "title_normalized": "efficacy and safety of once weekly dulaglutide in combination with sulphonylurea and or biguanide compared with once daily insulin glargine in japanese patients with type 2 diabetes a randomized open label phase iii non inferiority study" }
[ { "companynumb": "JP-SA-2015SA153713", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "INSULIN GLARGINE" }, "drugadditional": null, ...
{ "abstract": "Two patients with dermatological conditions developed retinal toxicity after treatment with hydroxychloroquine that exceeded dosing recommendations. There is no treatment for hydroxychloroquine retinal toxicity and associated visual loss, so appropriate monitoring is imperative. All members of a patient's multidisciplinary team should be aware of the ocular risks of hydroxychloroquine, the importance of dosing within recommended guidelines and appropriate monitoring in reducing the risk of visual loss.", "affiliations": "Alfred Hospital, Melbourne, Victoria, Australia.;St Vincent's Hospital, Melbourne, Victoria, Australia.;Melbourne Health, Melbourne, Victoria, Australia.", "authors": "Kowalski|Tanya|T|http://orcid.org/0000-0002-5519-9374;Baker|Christopher|C|;Mack|Heather G|HG|", "chemical_list": "D000962:Antimalarials; D006886:Hydroxychloroquine", "country": "Australia", "delete": false, "doi": "10.1111/ajd.12827", "fulltext": null, "fulltext_license": null, "issn_linking": "0004-8380", "issue": "59(4)", "journal": "The Australasian journal of dermatology", "keywords": "hydroxychloroquine; lichen planopilaris; lichen sclerosus; retina; toxicity", "medline_ta": "Australas J Dermatol", "mesh_terms": "D000368:Aged; D000962:Antimalarials; D005260:Female; D006801:Humans; D006886:Hydroxychloroquine; D008010:Lichen Planus; D018459:Lichen Sclerosus et Atrophicus; D008875:Middle Aged; D012160:Retina; D014786:Vision Disorders", "nlm_unique_id": "0135232", "other_id": null, "pages": "e266-e268", "pmc": null, "pmid": "29722012", "pubdate": "2018-11", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Hydroxychloroquine retinal toxicity in two patients with dermatological conditions.", "title_normalized": "hydroxychloroquine retinal toxicity in two patients with dermatological conditions" }
[ { "companynumb": "AU-CONCORDIA PHARMACEUTICALS INC.-GSH201805-001751", "fulfillexpeditecriteria": "1", "occurcountry": "AU", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "HYDROXYCHLOROQUINE" }, ...
{ "abstract": "Five syngeneic transplants were performed in four patients following myeloablative therapy using unmodified peripheral blood mononuclear cells (PBMCs) collected after the administration of recombinant human granulocyte colony stimulating factor (rhG-CSF) to normal donors. The only toxicity experienced by the four normal donors was bone pain. Four patients received two collections of PBMCs, and a second transplant was performed in one patient with one collection. The patients received a median of 20.53 x 10(8) total nucleated cells/kg (range 20 to 25.5), 11.3 x 10(8) total mononuclear cells/kg (range 6.52 to 17.2), 113.1 x 10(4)/kg CFU-GM (range 46.7 to 211.8) and 9.6 x 10(6) CD34+ cells/kg (range 1.6 to 12.6) Post-transplant growth factors were not administered. The median time to an absolute neutrophil count greater than 0.5 x 10(9)/L was 14 days (range 10 to 18). The median time to platelet transfusion independence was 11 days (range 10 to 13). Two patients had the number of CD3+ T lymphocytes determined in the pheresis product. An average of 3.04 x 10(10) CD3+ cells were collected per pheresis. This represents an approximate 1 log increase over the number of T lymphocytes in a typical bone marrow transplant. Rh-GCSF can be used to mobilize peripheral blood progenitor cells from normal donors with minimal toxicity. Studies of allogeneic transplants using PBMCs collected after rhG-CSF administration to determine permanent grafting ability and the incidence and severity of graft-versus-host disease are warranted.", "affiliations": "Fred Hutchinson Cancer Research Center, Seattle, WA 98104.", "authors": "Weaver|C H|CH|;Buckner|C D|CD|;Longin|K|K|;Appelbaum|F R|FR|;Rowley|S|S|;Lilleby|K|K|;Miser|J|J|;Storb|R|R|;Hansen|J A|JA|;Bensinger|W|W|", "chemical_list": "D015703:Antigens, CD; D018952:Antigens, CD34; D011994:Recombinant Proteins; D016179:Granulocyte Colony-Stimulating Factor", "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0006-4971", "issue": "82(7)", "journal": "Blood", "keywords": null, "medline_ta": "Blood", "mesh_terms": "D000328:Adult; D015703:Antigens, CD; D018952:Antigens, CD34; D001943:Breast Neoplasms; D005260:Female; D016179:Granulocyte Colony-Stimulating Factor; D006801:Humans; D007937:Leukapheresis; D015470:Leukemia, Myeloid, Acute; D008228:Lymphoma, Non-Hodgkin; D008297:Male; D008875:Middle Aged; D009000:Monocytes; D011994:Recombinant Proteins; D012512:Sarcoma, Ewing; D014185:Transplantation, Isogeneic", "nlm_unique_id": "7603509", "other_id": null, "pages": "1981-4", "pmc": null, "pmid": "7691244", "pubdate": "1993-10-01", "publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't; D013487:Research Support, U.S. Gov't, P.H.S.", "references": null, "title": "Syngeneic transplantation with peripheral blood mononuclear cells collected after the administration of recombinant human granulocyte colony-stimulating factor.", "title_normalized": "syngeneic transplantation with peripheral blood mononuclear cells collected after the administration of recombinant human granulocyte colony stimulating factor" }
[ { "companynumb": "US-AMGEN-USASP2020179649", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "4", "activesubstance": { "activesubstancename": "FILGRASTIM" }, "drugadditional": null, ...
{ "abstract": "•Two cases of large cervical mullerian adenosarcoma with sarcomatous overgrowth or heterologous elements and contrasting survival outcomes are reported.•When the diagnosis of mullerian adenosarcoma is uncertain or suspected, review of pathology by a national expert may be considered.•Rhabdomyoblastic differentiation of mullerian adenosarcoma may be a more aggressive histologic type.", "affiliations": "Department of Obstetrics, Gynecology, and Reproductive Biology, Division of Gynecologic Oncology, Western Connecticut Health Network, Danbury Hospital, 24 Hospital Avenue, Danbury, CT 06810, USA.;Department of Obstetrics, Gynecology, and Reproductive Biology, Division of Gynecologic Oncology, Western Connecticut Health Network, Danbury Hospital, 24 Hospital Avenue, Danbury, CT 06810, USA.;Gynecology Service, Department of Surgery, Memorial Sloan Kettering Cancer Center, 1275 York Avenue, New York, NY 10065, USA.;Department of Obstetrics and Gynecology and Women's Health, Division of Gynecologic Oncology, Albert Einstein College of Medicine, Montefiore Medical Center, 1300 Morris Park Avenue, Belfer Educational Center, Room 501, Bronx, NY 10461, USA.;Department of Obstetrics, Gynecology, and Reproductive Biology, Division of Gynecologic Oncology, Western Connecticut Health Network, Danbury Hospital, 24 Hospital Avenue, Danbury, CT 06810, USA.;Department of Obstetrics, Gynecology, and Reproductive Biology, Division of Gynecologic Oncology, Western Connecticut Health Network, Danbury Hospital, 24 Hospital Avenue, Danbury, CT 06810, USA.", "authors": "Seagle|Brandon-Luke L|BL|;Falter|Keith J|KJ|;Lee|Stephen J|SJ|;Frimer|Marina|M|;Samuelson|Robert|R|;Shahabi|Shohreh|S|", "chemical_list": null, "country": "Netherlands", "delete": false, "doi": "10.1016/j.gynor.2014.04.005", "fulltext": "\n==== Front\nGynecol Oncol Case RepGynecol Oncol Case RepGynecologic Oncology Case Reports2211-338XElsevier S2211-338X(14)00015-510.1016/j.gynor.2014.04.005Case ReportMullerian adenosarcoma of the cervix: Report of two large tumors with sarcomatous overgrowth or heterologous elements Seagle Brandon-Luke L. aFalter Keith J. IIaLee Stephen J. bFrimer Marina cSamuelson Robert aShahabi Shohreh shohreh.shahabi@wchn.orga⁎a Department of Obstetrics, Gynecology, and Reproductive Biology, Division of Gynecologic Oncology, Western Connecticut Health Network, Danbury Hospital, 24 Hospital Avenue, Danbury, CT 06810, USAb Gynecology Service, Department of Surgery, Memorial Sloan Kettering Cancer Center, 1275 York Avenue, New York, NY 10065, USAc Department of Obstetrics and Gynecology and Women's Health, Division of Gynecologic Oncology, Albert Einstein College of Medicine, Montefiore Medical Center, 1300 Morris Park Avenue, Belfer Educational Center, Room 501, Bronx, NY 10461, USA⁎ Corresponding author at: Department of Obstetrics, Gynecology, and Reproductive Biology, Danbury Hospital, 24 Hospital Avenue, Danbury, CT 06810, USA. Fax: + 1 203 739 8426. shohreh.shahabi@wchn.org5 5 2014 5 5 2014 8 2014 9 7 10 23 3 2014 29 4 2014 © 2014 The Authors2014This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).Highlights\n• Two cases of large cervical mullerian adenosarcoma with sarcomatous overgrowth or heterologous elements and contrasting survival outcomes are reported.\n\n• When the diagnosis of mullerian adenosarcoma is uncertain or suspected, review of pathology by a national expert may be considered.\n\n• Rhabdomyoblastic differentiation of mullerian adenosarcoma may be a more aggressive histologic type.\n\n\n\nKeywords\nMullerian adenosarcomaSarcomatous overgrowthHeterologous elementsCervical cancer\n==== Body\nIntroduction\nMullerian adenosarcomas (MAs) are malignant mixed mullerian tumors with benign epithelial and malignant stromal components that most often originate in the endometrium (71%), ovary (15%), or pelvis (12%), and less frequently develop in the cervix (2%) (Clement and Scully, 1974, 1990; Verschraegen et al., 1998). MAs behave as low-grade malignancies with a proclivity for local recurrence; distant metastases are infrequent (Clement and Scully, 1990; Verschraegen et al., 1998). Cervical MAs usually present as cervical polyps and can be confused with benign cervical polyps both clinically and pathologically; microscopic differentiation is critical for accurate diagnosis and appropriate treatment. Since cervical MAs are rare, experience with their diagnosis and treatment is limited. Due to a paucity of reports and an absence of long term follow-up data, the presentation, prognosis and management of cervical MA continue to be explored.\n\nTwo types of MA with unusual pathologic features are associated with poorer prognoses: MA with sarcomatous overgrowth and MA with heterologous elements. Sarcomatous overgrowth is diagnosed when the pure sarcomatous portion of the neoplasm constitutes more than 25% of the primary tumor. Heterologous elements are tissue types, such as skeletal muscle or cartilage, present in the neoplasm and not native to the primary site. Here, we report two cases of cervical MA, one with sarcomatous overgrowth and another with heterologous elements.\n\nCase 1 — cervical mullerian adenosarcoma with sarcomatous overgrowth\nA 54-year-old woman presented to her gynecologist with acute urinary retention. She reported irregular menses for the past four years. She was a former smoker, had a remote history of myomectomy, and had no family history of any cancer. On examination, she had a distended abdomen and suprapubic tenderness. Pelvic examination revealed a large cervical mass which appeared to originate from the endocervical canal. Tumor markers were as follows: CA 125 = 127 U/ml, CEA = 0.7 ng/ml, and CA 19-9 = 52 U/ml. Computed tomography demonstrated an 8 cm heterogeneous mass involving the cervix without extension of tumor into the bladder or rectum (Fig. 1A). No significant lymphadenopathy was noted. Exam under anesthesia found an 8 cm smooth, firm, and hemorrhagic mass with a broad base involving the cervix. The parametria were free. A prominent left ovary was palpated. Cystoscopy and proctoscopy were unremarkable. Cervical biopsies were performed and demonstrated fibrovascular tissue with severe hemorrhage.\n\nThe patient was counseled extensively, and she decided to undergo radical hysterectomy and bilateral salpingo-oophorectomy with frozen section, which was of concern for cervical sarcoma. Bilateral pelvic and para-aortic lymph node dissection was performed and all 27 identified nodes were negative for malignancy. Final pathology confirmed cervical low grade MA with sarcomatous overgrowth measuring 4 × 3 × 2 cm (Fig. 2 and Supplemental Information 1). Tumor immunohistochemistry was diffusely positive for muscle markers SMA and MSA, as well as estrogen and progesterone receptors, and focally positive for desmin, CKAE1/3, and CAM 5.2, but negative for myogenin, EMA, CD10, caldesmon, HMB-45, CD31, CD34, factor VIII, inhibin, and S100. She received adjuvant vaginal cuff brachytherapy (25 Gy of iridium-192) followed by six cycles of doxorubicin (40 mg/m2). Her postoperative recovery and adjuvant treatment courses were uncomplicated. She remains without evidence of disease now 66 months after diagnosis of her stage IB2 cervical MA with sarcomatous overgrowth.\n\nCase 2 — cervical mullerian adenosarcoma with heterologous elements\nA 47-year-old woman with no gynecologic care for many years presented with irregular vaginal bleeding. Her past medical and surgical histories included hypertension, obesity, cholecystectomy, and a unilateral oophorectomy for an unknown benign indication. Physical examination revealed a 10 cm polypoid, partially necrotic cervical mass arising from a pedicle in the endocervical canal. Assessment of the uterus and adnexa was very limited secondary to body habitus. Exam under anesthesia further revealed bilateral shortening of the parametria. Cystoscopy and proctoscopy were negative for bladder or rectal involvement. Cervical biopsies demonstrated cervical adenosarcoma with a histologically high grade stromal component having rhabdomyoblastic differentiation (Fig. 3 and Supplemental Information 1). Magnetic resonance imaging demonstrated a 9.5 cm × 9.6 cm × 8.1 cm cervical tumor with bilateral infiltration of the parametria and right parametrial lymph nodes (Fig. 1B), without evidence of abdominal or lung metastases.\n\nGiven her stage IIB disease, initial treatment was preoperative whole pelvis external beam radiation (5040 cGy) and chemotherapy consisting of three cycles of ifosfamide (2000 mg/m2) and doxorubicin (40 mg/m2). Significant toxicity of this treatment included colitis necessitating a four-day hospitalization, during which interval computed tomography showed an ill-defined cervical mass, new enlargement of the uterus, abdominal carcinomatosis and multiple pulmonary metastases. Chemotherapy was changed to gemcitabine (675 mg/m2) and docetaxel (75 mg/m2). Repeat imaging after 3 cycles demonstrated disease progression. She began palliative docetaxel (35 mg/m2) for two additional cycles before electing for comfort care only. She subsequently died due to metastatic cervical MA 12 months after diagnosis.\n\nDiscussion\nMAs are generally low grade neoplasms that may recur locally after initial surgical resection and infrequently metastasize to distal sites. Unfavorable prognostic factors for MAs are cytologic atypia, high mitotic rate, sarcomatous overgrowth, heterologous elements, deep myometrial invasion, necrosis and extrauterine spread (Jones and Lefkowitz, 1995; Kerner and Lichtig, 1993; Kaku et al., 1992). The diagnosis of MA is established by the criteria proposed by Clement and Scully (Clement and Scully, 1990) and Jones and Lefkowitz (Jones and Lefkowitz, 1995): formation of periglandular cuffs and intraglandular protrusions of cellular stroma, non-invasive glands lined by benign-appearing mullerian epithelia of various types showing mild to marked nuclear atypia, an average of ≥ 2 mitotic figures per 10 high powered fields in the stromal component, and more than mild nuclear atypia of the stromal cells. Given the rarity of this disease, we recommend a pathology review by a national expert when the diagnosis of adenosarcoma is suspected or uncertain. The clinical behavior and pathologic features of Case 2 were suggestive of carcinosarcoma. A pathology review by a leading national expert in adenosarcoma was obtained. The expert was confident in the diagnosis of a high grade adenosarcoma with rhabdomyoblastic differentiation, which was suggested to be a feature associated with relatively aggressive disease, although reported clinical experience with this entity is insufficient to provide robust prognostic information.\n\nApproximately 2% of MAs develop in the cervix. In the largest series of cervical MA (24 cases), the mean age at presentation was 31 years (range 11–65 years), with one-third of patients presenting before age 15 (Jones and Lefkowitz, 1995). Most patients presented with abnormal vaginal bleeding and a polypoid appearing lesion protruding through the external cervical os. The differential diagnosis of cervical MA includes benign (adenofibroma, atypical endocervical polyp, and adenomyoma of the cervix) and malignant (uterine adenosarcoma with secondary involvement of the cervix, carcinosarcoma, and embryonal rhabdomyosarcoma) lesions. Nine cases of cervical MA with sarcomatous overgrowth (Table S1) and eighteen cases of MA with heterologous elements (Table S2) are reported in the literature. Four cases had both sarcomatous overgrowth and heterologous elements (Table S1). The most common heterologous elements are skeletal muscle and cartilage.\n\nThe prognosis and management of cervical MA continue to be defined as the number of reported cases increases. Much of the management of cervical MA is extrapolated from experience with uterine MAs, which, while uncommon among uterine cancers, are seen much more frequently than cervical MAs. Some authors recommend hysterectomy and bilateral salpingo-oophorectomy (Clement and Scully, 1990; Gast et al., 1989; Zaloudek and Norris, 1981). Local excision has been curative in rare cases (Table S2). Fertility sparing surgery may be an alternative in patients with pedunculated cervical tumors with uninvolved stalks (Clement and Scully, 1990; Chen, 1985). However, obtaining a negative margin is necessary, and reoperation should be considered when disease extends to the surgical margins (Michener and Simon, 2001). No standard of care exists for radiation or chemotherapy of uterine or cervical MA due to lack of evidence that any particular therapy is more beneficial than other options in reported series (Krivak et al., 2001; Tanner et al., 2013; Bernard et al., 2013). Adjuvant treatment recommendations are poorly defined. Cases 1 and 2 were managed with radiation and standard sarcoma chemotherapy regimens that are among many treatment options per National Comprehensive Cancer Network guidelines (Annon, 2014). Management options for uterine sarcomas have been recently reviewed (Reichardt, 2012; Trope et al., 2012). Trials of radiation or chemotherapy for uterine sarcomas often included multiple uterine sarcoma types, such as the early GOG trial of stage I–II uterine sarcomas that randomized patients to adjuvant doxorubicin or no further treatment and showed no statistically significant benefit but did establish a precedent for use of adjuvant doxorubicin for uterine sarcomas (Omura et al., 1985). Retrospective data suggested decreased recurrence with radiation therapy, but no benefit was found in a prospective trial (Reed et al., 2008). Adenosarcomas with sarcomatous overgrowth are often treated according to guidelines for high-grade undifferentiated endometrial sarcoma (Trope et al., 2012). In Case 1, vaginal brachytherapy and single agent doxorubicin were offered due to the presence of sarcomatous overgrowth. Case 2 was stage IIB and high grade. The patient received second opinions regarding treatment options and elected whole pelvic radiation and one of the most studied combination chemotherapies for uterine sarcomas (ifosfamide/doxorubicin), with a plan for post-treatment surgery. Due to early disease progression with systemic metastases, she was switched to combination gemcitabine/docetaxel, which is preferred for advanced or recurrent leiomyosarcoma (NCCN, 2014). Her disease continued to progress and she began palliative docetaxel before electing for comfort measures only.\n\nRecurrences after 5 years are not infrequent for uterine MAs; therefore long-term clinical follow-up is recommended (Clement and Scully, 1990; Jones and Lefkowitz, 1995; Zaloudek and Norris, 1981). A local recurrence rate of 24% and a distant recurrence rate of 2% after hysterectomy and bilateral salpingo-oophorectomy were reported with recurrences occurring between 0.5 and 9.5 years; one-third of recurrences occurred after 5 years (Clement and Scully, 1990). In GOG 40, Kaku et al. (1992) reported a 30% recurrence rate of uterine MAs, with most recurrences occurring within 24 months after hysterectomy, bilateral salpingo-oophorectomy, and lymph node sampling. One series compared survival of patients diagnosed with uterine adenosarcoma with sarcomatous overgrowth (N = 11) to survival of patients with uterine carcinosarcoma (N = 33), reporting a trend toward worse prognosis of uterine MA with sarcomatous overgrowth (p = 0.052) with a median survival of 13 months (Krivak et al., 2001). A recent small (N = 5) series of uterine MA with sarcomatous overgrowth reported a 20% 2-year survival rate (Tanner et al., 2013). The prognosis of cervical MA with sarcomatous overgrowth or heterologous elements remains less characterized. Cases need to be reported as only continued accumulation of clinicopathologic data will lead to improved understanding of this disease. Here we report two cases of large cervical MA tumors with contrasting clinical outcomes: one case of stage IB2 low grade cervical MA with sarcomatous overgrowth and long-term disease free survival after surgical resection, vaginal brachytherapy, and single-agent chemotherapy and the second case being a patient with stage IIB high grade cervical MA with rhabdomyoblastic differentiation who experienced a short 12 month disease specific survival despite whole pelvic external beam radiation and multiple courses of chemotherapy. The disease progression of Case 2 was more rapid than is typical of MAs and may represent a more aggressive nature of high grade MA with rhabdomyoblastic features: more reports of clinical outcomes of patients with this rare histologic feature are needed to establish its prognostic significance.\n\nConflict of interest statement\nThe authors declare that there are no conflicts of interest.\n\nAppendix A Supplementary data\nSupplemental Information 1: Pathology reports of Cases 1 and 2.\n\n Table S1: Clinicopathologic features of cervical mullerian adenosarcomas with sarcomatous overgrowth reported in the literature in chronological order.\n\nTable S2: Clinicopathologic features of cervical mullerian adenosarcomas with heterologous elements reported in the literature in chronological order.\n\n \n\nAcknowledgments\nWe wish to thank Dr. Robert Soslow of Memorial Sloan Kettering Cancer Center for expert pathology consultation on both cases. We wish to thank Dr. Steven Sieber, Director of Anatomy Pathology, Western Connecticut Health Network, for providing histologic images and captions for Fig. 3.\n\nDisclaimer\n\nWritten informed consent was obtained from each patient or next of kin for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-In-Chief of this journal on request.\n\nFig. 1 A: Representative computed tomography sagittal image of large cervical mullerian adenosarcoma with sarcomatous overgrowth (Case 1). B: Representative magnetic resonance sagittal image, T2 weighted, of large cervical mullerian adenosarcoma with heterologous elements (Case 2).\n\nFig. 2 A: Gross pathologic specimen. B: Tumor glands within collagenous stroma. C: Low power field showing benign glands with stromal condensation. D: High power field showing benign glands with stromal condensation.\n\nFig. 3 A: Biphasic cervical malignant neoplasm with atypical glands and high-grade spindle cell sarcomatous elements (H&E stain, magnification × 100). B: Area of atypical glands with mild nuclear pleomorphism and focal squamoid features (H&E stain, magnification × 400). C: Region of undifferentiated sarcoma with round cell morphology (H&E stain, magnification × 100). D: Area of high-grade sarcoma with rhabdoid morphology, including polygonal and strap-shaped tumor cells with eccentric nuclei and abundant eosinophilic cytoplasm with vague cross-striations (H&E stain, magnification × 400).\n==== Refs\nReferences\nClement P.B. Scully R.E. Mullerian adenosarcoma of the uterus: a clinicopathologic analysis of ten cases of a distinctive type of mullerian mixed tumor Cancer 34 1974 1138 1149 4371193 \nClement P.B. Scully R.E. Mullerian adenosarcoma of the uterus: a clinicopathologic analysis of 100 cases with a review of the literature Hum. Pathol. 21 1990 363 381 2156771 \nVerschraegen C.F. Vasuratna A. Edwards C. Freedman R. Kudelka A.P. Tornos C. Clinicopathologic analysis of mullerian adenosarcoma: the MD Anderson Cancer Center experience Oncol. Rep. 5 1998 939 944 9625851 \nJones M.W. Lefkowitz M. Adenosarcoma of the uterine cervix: a clinicopathologic study of 12 cases Int. J. Gynecol. Pathol. 14 1995 223 229 8600073 \nKerner H. Lichtig C. Mullerian adenosarcoma presenting as cervical polyps: a report of seven cases and review of the literature Obstet. Gynecol. 81 1993 655 659 8385764 \nKaku T. Silverberg S.G. Major F.J. Miller A. Fetter B. Brady M.F. Adenosarcoma of the uterus: a Gynecologic Oncology Group clinicopathologic study of 31 cases Int. J. Gynecol. Pathol. 11 1992 75 88 1316323 \nGast M.J. Radkins L.V. Jacobs A.J. Gersell D. Mullerian adenosarcoma of the cervix with heterologous elements: diagnostic and therapeutic approach Gynecol. Oncol. 32 1989 381 384 2537782 \nZaloudek C.J. Norris H.J. Adenofibroma and adenosarcoma of the uterus: a clinicopathologic study of 35 cases Cancer 48 1981 354 366 6263458 \nChen K.T. Rhabdomyosarcomatous uterine adenosarcoma Int. J. Gynecol. Pathol. 4 1985 146 152 2991151 \nMichener C.M. Simon N.L. Ovarian conservation in a woman of reproductive age with mullerian adenosarcoma Gynecol. Oncol. 83 2001 424 427 11606111 \nKrivak T.C. Seidman J.D. McBroom J.W. MacKoul P.J. Aye L.M. Rose G.S. Uterine adenosarcoma with sarcomatous overgrowth versus uterine carcinosarcoma: comparison of treatment and survival Gynecol. Oncol. 83 2001 89 94 11585418 \nTanner E.J. Toussaint T. Leitao M.M. Jr. Hensley M.L. Soslow R.A. Gardner G.J. Management of uterine adenosarcomas with and without sarcomatous overgrowth Gynecol. Oncol. 129 2013 140 144 23283300 \nBernard B. Clarke B.A. Malowany J.I. McAlpine J. Lee C.H. Atenafu E.G. Uterine adenosarcomas: a dual-institution update on staging, prognosis and survival Gynecol. Oncol. 131 2013 634 639 24135678 \nNCCN clinical practice guidelines in oncology: uterine neoplasms http://www.nccn.org/professionals/physician_gls/pdf/uterine.pdf 2014 (Accessed April 12, 2014) \nReichardt P. The treatment of uterine sarcomas Ann. Oncol. 23 2012 x151 x157 22987952 \nTrope C.G. Abeler V.M. Kristensen G.B. Diagnosis and treatment of sarcoma of the uterus: a review Acta Oncol. 51 2012 694 705 22793037 \nOmura G.A. Blessing J.A. Major F. Lifshitz S. Ehrlich C.E. Mangan C. A randomized clinical trial of adjuvant adriamycin in uterine sarcomas: a Gynecologic Oncology Group study J. Clin. Oncol. 3 1985 1240 1245 3897471 \nReed N.S. Manigioni C. Malmstrom H. Scarfone G. Poveda A. Pecorelli S. Phase III randomised study to evaluate the role of adjuvant pelvic radiotherapy in the treatment of uterine sarcomas stages I and II: an European Organization for Research and Treatment of Cancer Gynaecological Cancer Group study (protocol 55874) Eur. J. Cancer 44 2008 808 818 18378136\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2211-338X", "issue": "9()", "journal": "Gynecologic oncology case reports", "keywords": "Cervical cancer; Heterologous elements; Mullerian adenosarcoma; Sarcomatous overgrowth", "medline_ta": "Gynecol Oncol Case Rep", "mesh_terms": null, "nlm_unique_id": "101599306", "other_id": null, "pages": "7-10", "pmc": null, "pmid": "25426405", "pubdate": "2014-08", "publication_types": "D016428:Journal Article", "references": "11606111;4371193;11585418;3897471;22793037;9625851;2991151;23283300;22987952;1316323;24135678;2537782;2156771;18378136;8600073;8385764;6263458", "title": "Mullerian adenosarcoma of the cervix: Report of two large tumors with sarcomatous overgrowth or heterologous elements.", "title_normalized": "mullerian adenosarcoma of the cervix report of two large tumors with sarcomatous overgrowth or heterologous elements" }
[ { "companynumb": "PHHY2014US153878", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "DOXORUBICIN" }, "drugadditional": null, "dru...
{ "abstract": "BACKGROUND\nLow-grade fibromyxoid sarcoma (LGFMS) is a rare sarcoma subtype with a generally indolent pattern of clinical behaviour, but treatments for advanced disease are limited.\n\n\nMETHODS\nA retrospective search of a prospectively maintained institutional database identified 102 patients treated from December 1994 to August 2018. We evaluated the outcome of patients and the efficacy and safety of non-surgical therapies in LGFMS.\n\n\nRESULTS\nNinety-four out of 102 (92.2%) underwent primary resection, seven (6.9%) were treated with systemic therapy and one (1.0%) is currently being treated with pre-operative radiotherapy. The RECIST 1.1 response rate to first-line chemotherapy was 0%, and median progression-free survival was 1.84 months (95% confidence intervaI=0.10-3.6 months).\n\n\nCONCLUSIONS\nConventional systemic therapy has limited efficacy in advanced LGFMS.", "affiliations": "Sarcoma Unit, The Royal Marsden NHS Foundation Trust, London, U.K.;Sarcoma Unit, The Royal Marsden NHS Foundation Trust, London, U.K.;Sarcoma Unit, The Royal Marsden NHS Foundation Trust, London, U.K.;Sarcoma Unit, The Royal Marsden NHS Foundation Trust, London, U.K.;Sarcoma Unit, The Royal Marsden NHS Foundation Trust, London, U.K.;Sarcoma Unit, The Royal Marsden NHS Foundation Trust, London, U.K.;Sarcoma Unit, The Royal Marsden NHS Foundation Trust, London, U.K.;Bank of Cyprus Oncology Center, Strovolos, Cyprus.;Sarcoma Unit, The Royal Marsden NHS Foundation Trust, London, U.K.;Sarcoma Unit, The Royal Marsden NHS Foundation Trust, London, U.K.;Sarcoma Unit, The Royal Marsden NHS Foundation Trust, London, U.K. robin.jones4@nhs.net.", "authors": "Chamberlain|Florence|F|;Engelmann|Bodil|B|;Al-Muderis|Omar|O|;Messiou|Christina|C|;Thway|Khin|K|;Miah|Aisha|A|;Zaidi|Shane|S|;Constantinidou|Anastasia|A|;Benson|Charlotte|C|;Gennatas|Spyridon|S|;Jones|Robin L|RL|", "chemical_list": null, "country": "Greece", "delete": false, "doi": "10.21873/invivo.11766", "fulltext": null, "fulltext_license": null, "issn_linking": "0258-851X", "issue": "34(1)", "journal": "In vivo (Athens, Greece)", "keywords": "LGFMS; Low-grade fibromyxoid sarcoma; chemotherapy; chromosomal translocation; radiotherapy", "medline_ta": "In Vivo", "mesh_terms": "D000328:Adult; D000971:Antineoplastic Combined Chemotherapy Protocols; D003131:Combined Modality Therapy; D005260:Female; D005350:Fibroma; D005354:Fibrosarcoma; D005500:Follow-Up Studies; D006801:Humans; D008297:Male; D008875:Middle Aged; D060787:Neoplasm Grading; D011446:Prospective Studies; D012189:Retrospective Studies; D015996:Survival Rate", "nlm_unique_id": "8806809", "other_id": null, "pages": "239-245", "pmc": null, "pmid": "31882484", "pubdate": "2020", "publication_types": "D016428:Journal Article", "references": "22749255;29299229;22130782;28648941;27073510;27217684;12103287;23075075;19097774;15640831;29988594;10199449;30889920;9440743;23818812;27737652;27185563;27249769;8888818;8622034;12733153", "title": "Low-grade Fibromyxoid Sarcoma: Treatment Outcomes and Efficacy of Chemotherapy.", "title_normalized": "low grade fibromyxoid sarcoma treatment outcomes and efficacy of chemotherapy" }
[ { "companynumb": "GB-HEALTHCARE PHARMACEUTICALS LTD.-2081149", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "DOXORUBICIN HYDROCHLORIDE" }, ...
{ "abstract": "BACKGROUND\nThe prognosis of cardiac arrest (CA) induced by propafenone intoxication was thought to be very poor. The maximal duration of cardiopulmonary resuscitation (CPR) for propafenone induced CA is unknown.\nWe describe a case that was successfully resuscitated after prolonged CPR (totaling 340 minutes during one hospital visit) for propafenone intoxication without subsequent neurological sequela.\nA previously healthy 36-year-old female who developed multiple and prolonged CAs after consuming 98 tablets of 50mg propafenone. The CPR duration of this case, to the best of our knowledge, is the longest of all existing propafenone-induced CPR events to still have full recovery. We also analyse the contributing factors to this successful CPR.\n\n\nMETHODS\nSodium bicarbonate, inotropic drugs and pacemaker application did not prevent the occurrence of CA. A full recovery was eventually achieved after prolonged CPR with a mechanical CPR device, blood purification and other aggressive supportive treatments.\n\n\nRESULTS\nFull recovery without neurological sequela.\n\n\nCONCLUSIONS\nProlonged CPR including the application of mechanical CPR devices should be considered in propafenone-related CA, especially in young patients without significant comorbidities and delayed resuscitation.", "affiliations": "Department of Emergency Medicine, Northern Jiangsu People's Hospital, Yangzhou China Division of Emergency Medicine, Department of Surgery, Saint Louis University Hospital, Saint Louis, Missouri, USA.", "authors": "Ling|Bingyu|B|;Geng|Ping|P|;Tan|Dingyu|D|;Walline|Joseph|J|", "chemical_list": "D000889:Anti-Arrhythmia Agents; D011405:Propafenone", "country": "United States", "delete": false, "doi": "10.1097/MD.0000000000010285", "fulltext": "\n==== Front\nMedicine (Baltimore)Medicine (Baltimore)MEDIMedicine0025-79741536-5964Wolters Kluwer Health 29642149MD-D-18-0010710.1097/MD.0000000000010285002853900Research ArticleClinical Case ReportFull recovery after prolonged resuscitation from cardiac arrest due to propafenone intoxication A case reportLing Bingyu MMaGeng Ping MDaTan Dingyu MDa∗Walline Joseph MDbNA. a Department of Emergency Medicine, Northern Jiangsu People's Hospital, Yangzhou Chinab Division of Emergency Medicine, Department of Surgery, Saint Louis University Hospital, Saint Louis, Missouri, USA.∗ Correspondence: Dingyu Tan, Department of Emergency Medicine, Northern Jiangsu People's Hospital, No.98, Nantong West Road, Guangling District, Yangzhou Ctiy, Jiangsu Provice, China (e-mail: webtan1981@gmail.com).4 2018 13 4 2018 97 15 e02858 1 2018 3 3 2018 12 3 2018 Copyright © 2018 the Author(s). Published by Wolters Kluwer Health, Inc.2018This is an open access article distributed under the terms of the Creative Commons Attribution-Non Commercial License 4.0 (CCBY-NC), where it is permissible to download, share, remix, transform, and buildup the work provided it is properly cited. The work cannot be used commercially without permission from the journal. http://creativecommons.org/licenses/by-nc/4.0Abstract\nRationale:\nThe prognosis of cardiac arrest (CA) induced by propafenone intoxication was thought to be very poor. The maximal duration of cardiopulmonary resuscitation (CPR) for propafenone induced CA is unknown.\n\nPatient concerns:\nWe describe a case that was successfully resuscitated after prolonged CPR (totaling 340 minutes during one hospital visit) for propafenone intoxication without subsequent neurological sequela.\n\nDiagnoses:\nA previously healthy 36-year-old female who developed multiple and prolonged CAs after consuming 98 tablets of 50mg propafenone. The CPR duration of this case, to the best of our knowledge, is the longest of all existing propafenone-induced CPR events to still have full recovery. We also analyse the contributing factors to this successful CPR.\n\nInterventions:\nSodium bicarbonate, inotropic drugs and pacemaker application did not prevent the occurrence of CA. A full recovery was eventually achieved after prolonged CPR with a mechanical CPR device, blood purification and other aggressive supportive treatments.\n\nOutcomes:\nFull recovery without neurological sequela.\n\nLessons:\nProlonged CPR including the application of mechanical CPR devices should be considered in propafenone-related CA, especially in young patients without significant comorbidities and delayed resuscitation.\n\nKeywords\ncardiopulmonary resuscitationhemodialysishemoperfusionpropafenoneOPEN-ACCESSTRUE\n==== Body\n1 Introduction\nPropafenone is a class 1C anti-dysrhythmic agent that blocks sodium channel, calcium channel, and beta-adrenergic receptors. Propafenone intoxication can lead to severe myocardial depression, ventricular arrhythmias, and refractory seizures is a rare yet life-threatening situation.[1] Cardiac arrest (CA) induced by propafenone overdose has been occasionally, reported in recent years. Like CA of other causes, the maximal duration of cardiopulmonary resuscitation (CPR) for propafenone induced CA is unknown. However, drug overdose may be one of the etiologies of CA that deserves prolonged resuscitation.[2] In this paper, we present a case that was successfully resuscitated after prolonged CPR for CA induced by propafenone intoxication without subsequent neurological sequela.\n\n2 Case presentation\nA previously healthy 36 year-old woman presented with impaired consciousness and sporadic, bilateral limb tremors to our emergency department. Her family stated that the patient had consumed 98 tablets of 50 mg propafenone 1 hour prior to arrival, and they had tried to induce vomiting without success. On arrival to our hospital, she had a Glasgow Coma Scale of 7/15, and her blood pressure (BP) was 53/31 mmHg with an irregular heart rate (HR) of 50 bpm. Her electrocardiogram (ECG) showed a ventricular escape rhythm, and an intraventricular conduction delay. She was intubated and ventilated. The patient's HR continued to slow despite intravenous sodium bicarbonate, atropine, dopamine, and adrenaline. A temporary pacemaker was then inserted and gastric lavage was performed. However, the patient showed no significant response to these treatments. CA developed 22 minutes after her admission, and CPR was started. Restoration of spontaneous circulation (ROSC) was achieved after 11 minutes of CPR with a HR of 48 bpm (ventricular escape rhythm on monitor) and a BP of 91/32 mmHg. Activated charcoal was administered via nasogastric tube, and hemoperfusion combined with continuous veno-venous hemofiltration (CVVH) were also initiated. However, the patient remained extremely unstable over the next 4 hours, even though supported with high-dose vasoactive drugs, and CPR was repeatedly, performed due to repeated asystole. 4.5 hours after her admission, the patient demonstrated persistent asystole, and mechanical CPR was performed with a Thumper device (Michigan Instruments, Grand Rapids, Michigan, USA; Device 1007 CVV), accompanied by CVVH, intravenous hydration, and inotropic agents.\n\nAfter an additional 155 minutes of persistent mechanical CPR, an autonomous ventricular rhythm was recovered with a HR of 51 bpm, and a BP of 91/75 mmHg. The patient was no longer in CA, although her hemodynamics were still unstable. The total duration of CPR was 340 recorded minutes. The patient was transferred to the emergency department's Intensive Care Unit (ICU) for ongoing care. She experienced several episodes of generalized seizures after ROSC. Laboratory tests revealed hypoglycemia (2.2 mmol/L), metabolic acidosis (PH 7.32, HCO3- 15.9 mmol/L, BE -10 mmol/L), lactic acidosis (3.78 mmol/L), and liver function impairment (lactate dehydrogenase [LDH] 1711 U/L, aspartate aminotransferase [AST] 225 U/L, alanine aminotransferase [ALT] 153 U/L). Otherwise, the patient's urea, creatinine and electrolytes were in the normal range. ECG showed a wide-complex bradycardia with a QT interval of 640 ms, ST-segment elevation, and T wave inversions in V1-V3. Support therapies included the induction of a mild hypothermia were implemented. The plasma propafenone concentration of the patient at 10 hours post-poisoning (and 2 hours post-ROSC) was 2.13 mg/L (normal therapeutic range is 0.1–1.0 mg/L).\n\nA weak corneal reflex, and pupillary light reflex (PLR) were detectable 1 hour after ROSC. Another 3 sessions of hemoperfusion were performed, and the patient's circulation gradually stabilized although her creatine kinase, and creatine kinase-MB levels began to elevate. Spontaneous respiration, and normal sinus rhythm recovered 7 hours post-ROSC. The patient regained full consciousness 15 hours post-ROSC, and CVVH and hypothermia were discontinued. Over the next 48 hours, inotropic support was gradually weaned, and she was extubated on day 4. A total of 37 mg, and 19.5 mg epinephrine were used before, and after sinus rhythm was recovered, respectively, while the amount of isoprenaline (isoproterenol) used was 2 mg, and 11 mg, respectively. Propafenone was undetectable approximately 32 hours post-poisoning in our patient. She was discharged on day 8, with a normal ECG, normal liver function tests, and full neurological recovery.\n\n3 Discussion\nThe patient gave her permission to publish this case, and written informed consent has been obtained. Hypotension, bradycardia, widened QRS, and even CA can be observed after severe propafenone overdoses. It has been reported recently, that sodium bicarbonate, glucagon, insulin + dextrose, calcium, intravenous lipid emulsion, and/or temporary cardiac pacing are helpful to reverse the cardiac effects induced by propafenone overdose.[3–8] However, all these potential remedies were from case reports, and there was not enough evidence to clearly demonstrate the efficacy of these treatments in propafenone intoxication. Sodium bicarbonate and a pacemaker were tried in our case without significant effect. We think the successful rescue of this patient was mainly, due to timely and aggressive supportive therapies. Cardiac toxicity is the main cause of death caused by propafenone.[9] Significant negative inotropic and negative dromotropic activity is common in propafenone overdose, while large doses of positive inotropic drugs, and catecholamines such as epinephrine, and isoproterenol are obligatory, and inevitable, as in our case.\n\nBoth reducing absorption, and promoting excretion are important treatment principles of drug overdoses. In this case, we administered early gastric lavage, and activated charcoal, which were also recommended to reduce propafenone absorption in other reports.[5] Hemoperfusion or hemodialysis are some of the key ways to promote toxicant excretion extracorporeally, especially, in lethal poisonings without an antidote.[10] Literature discussing hemoperfusion or hemodialysis in propafenone poisoning are rare, but they were performed in a couple of early case reports.[11,12] Hemodialysis is typically, suitable for small molecular weight toxicants which are water-soluble,[13] but propafenone is hard for hemodialysis to remove because it is a lipophilic drug with a high serum protein binding rate of more than 90% (as seen in a recent case report).[3] Hemoperfusion decreases the concentration of toxicants in the blood through absorption, and it is especially, preferred for lipophilic compounds with a limited volume of distribution (generally less than 1 L/kg).[14] We performed hemoperfusion early in our patient's course (within 3 hours of presentation), though propafenone's volume of distribution is relatively, high at 1.9 to 3L/kg, because much of the poison is probably, intravascular rather than extravascular at this early stage.[15]\n\nThe role of hemoperfusion in the treatment of the poisoned patient is thought to be limited in industrialized countries, as newer, and more efficient dialysis modalities are more preferred.[13] However, for hemodynamically unstable patients, as in our case, hemodialysis is relatively, contraindicated, while CVVH can be safely, performed to continuously, remove toxins that are unbound to proteins, and extravascular tissues. Based on the above theory, the combined use of hemoperfusion and CVVH seemed logical in our case. Additionally, CVVH was performed with the aim of correcting the patient's refractory acidosis, and facilitate targeted temperature management, and fluid balance.\n\nThe most shocking aspect of this case report is undoubtedly the total CPR duration of approximately, 340 minutes. To the best of our knowledge, the CPR duration of our case is the longest amongst all existing propafenone toxicity case reports, while still successfully, resulting in a full recovery for the patient. The maximal duration of CPR for CA of all etiologies including poisoning is unknown, and traditionally, efforts are usually, terminated after 15 to 30 minutes. For patients with CA due to propafenone overdoses, the prognosis was thought to be very poor in most early case reports, and the survival rate was reported as very low.[12] However, multiple cases of successful resuscitation with neurologically, intact survival have been reported more recently, and the CPR duration of several cases was more than 20 minutes.[3,6,7,9,16]\n\nProlonged CA is usually associated with high mortality rates, and the survival usually, has neurologic sequelae. However, for patients who are young without significant comorbidities, whose CA etiologies are reversible, and in whom CPR is started immediately, prolonged CPR may be associated with a favorable outcome.[2] Drug overdose is one of the CA etiologies which is treatable and reversible. Our experience described here as well as others suggest that prolonged CPR should be considered in the treatment of propafenone-related CA.\n\nPersistent high-quality CPR played a vital role in our patient's survival, and helped protect her brain from irreversible ischemic damage. However, maintaining effective manual chest compressions during an unusually, prolonged period of CPR is full of challenges. Mechanical chest compression devices may be a valid alternative to manual chest compressions during prolonged CA, though their efficacy has been subject to debate under normal circumstances.[17] In prolonged CA related to propafenone, mechanical CPR can serve as a last-resort “bridge” to allow time for the cardiac effects of the toxin to decrease until ROSC.\n\nIn conclusion, our case report suggests that in a patient with propafenone related CA, comprehensive, and aggressive supportive therapies are the cornerstone of treatment. CPR duration should be established on a case-by-case basis, and prolonged CPR should be considered in patients under specific conditions. Blood purification techniques such as hemoperfusion may deserve to be performed in these “nothing to lose” cases.\n\nAuthor contributions\nConceptualization: Bingyu Ling, Dingyu TAN.\n\nInvestigation: Bingyu Ling, Ping Geng, Dingyu TAN.\n\nMethodology: Joseph Walline.\n\nWriting – original draft: Bingyu Ling, Ping Geng, Dingyu TAN.\n\nWriting – review & editing: Dingyu TAN, Joseph Walline.\n\nAbbreviations: BP = blood pressure, CA = cardiac arrest, CPR = cardiopulmonary resuscitation, CVVH = continuous veno-venous hemofiltration, ECG = electrocardiogram, HR = heart rate, ROSC = restoration of spontaneous circulation.\n\nThe authors report no conflicts of interest.\n==== Refs\nReferences\n[1] Clarot F Goulle JP Horst M \nFatal propafenone overdoses: case reports and a review of the literature . J Anal Toxicol \n2003 ;27 :595 –9 .14670140 \n[2] Youness H Al Halabi T Hussein H \nReview and Outcome of Prolonged Cardiopulmonary Resuscitation . Crit Care Res Pract \n2016 ;2016 :7384649 .26885387 \n[3] Chen X Yang Z \nSuccessful treatment of propafenone-induced cardiac arrest by calcium gluconate . Am J Emerg Med \n2017 ;35 :1209.e1 –2 .\n[4] Bayram B Kose I Avci S \nSuccessful treatment of propafenone intoxication with intravenous lipid emulsion . Pharmacotherapy \n2015 ;35 :e149 –52 .26497484 \n[5] Avci A Yilmaz A Celik M \nSuccessful treatment of suicide attempt by megadose of propafenone and captopril . Cardiovasc Toxicol \n2013 ;13 :230 –3 .23397376 \n[6] Bayram B Dedeoglu E Hocaoglu N \nPropafenone-induced cardiac arrest: full recovery with insulin, is it possible? \nAm J Emerg Med \n2013 ;31 :457.e5 –7 .\n[7] Ovaska H Ludman A Spencer EP \nPropafenone poisoning–a case report with plasma propafenone concentrations . J Med Toxicol \n2010 ;6 :37 –40 .20373066 \n[8] Saz EU Ucar SK Ulger Z \nSuccessful treatment of suicidal mega dose of propafenone intoxication - a case report . Kardiol Pol \n2010 ;68 :1284 –5 .21108213 \n[9] Kerns W 2ndEnglish B Ford M \nPropafenone overdose . Ann Emerg Med \n1994 ;24 :98 –103 .8010557 \n[10] Ouellet G Bouchard J Ghannoum M \nAvailable extracorporeal treatments for poisoning: overview and limitations . Semin Dial \n2014 ;27 :342 –9 .24697909 \n[11] Burgess ED Duff HJ \nHemodialysis removal of propafenone . Pharmacotherapy \n1989 ;9 :331 –3 .2813154 \n[12] Koppel C Oberdisse U Heinemeyer G \nClinical course and outcome in class IC antiarrhythmic overdose . J Toxicol Clin Toxicol \n1990 ;28 :433 –44 .2176700 \n[13] Ghannoum M Bouchard J Nolin TD \nHemoperfusion for the treatment of poisoning: technology, determinants of poison clearance, and application in clinical practice . Semin Dial \n2014 ;27 :350 –61 .24823936 \n[14] Roberts DM Buckley NA \nPharmacokinetic considerations in clinical toxicology: clinical applications . Clin Pharmacokinet \n2007 ;46 :897 –939 .17922558 \n[15] Siddoway LA Thompson KA McAllister CB \nPolymorphism of propafenone metabolism and disposition in man: clinical and pharmacokinetic consequences . Circulation \n1987 ;75 :785 –91 .3829342 \n[16] Wozakowska-Kaplon B Stepien-Walek A \nPropafenone overdose: cardiac arrest and full recovery . Cardiol J \n2010 ;17 :619 –22 .21154266 \n[17] Lameijer H Immink RS Broekema JJ \nMechanical cardiopulmonary resuscitation in in-hospital cardiac arrest: a systematic review . Eur J Emerg Med \n2015 ;22 :379 –83 .26237664\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "0025-7974", "issue": "97(15)", "journal": "Medicine", "keywords": null, "medline_ta": "Medicine (Baltimore)", "mesh_terms": "D000328:Adult; D000889:Anti-Arrhythmia Agents; D016887:Cardiopulmonary Resuscitation; D066126:Cardiotoxicity; D005260:Female; D006323:Heart Arrest; D006464:Hemoperfusion; D006801:Humans; D010138:Pacemaker, Artificial; D011405:Propafenone; D013997:Time Factors; D016896:Treatment Outcome", "nlm_unique_id": "2985248R", "other_id": null, "pages": "e0285", "pmc": null, "pmid": "29642149", "pubdate": "2018-04", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "14670140;3829342;17922558;24697909;21108213;2176700;8010557;23397376;28390833;21154266;20373066;23083880;26237664;24823936;2813154;26885387;26497484", "title": "Full recovery after prolonged resuscitation from cardiac arrest due to propafenone intoxication: A case report.", "title_normalized": "full recovery after prolonged resuscitation from cardiac arrest due to propafenone intoxication a case report" }
[ { "companynumb": "CN-GLAXOSMITHKLINE-CN2018074809", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "PROPAFENONE" }, "drugadditional": null,...
{ "abstract": "BACKGROUND\nInflammatory bowel disease and schizophrenia spectrum disorders are complex and multifactorial conditions characterized by great variability of age at onset, clinical presentation, and longitudinal course. Several lines of evidence suggested different connections among immunological dysregulation, gastrointestinal inflammation, and psychosis, but to date many controversial issues still exist in this field.\n\n\nMETHODS\nWe present the case of a 14-year-old Caucasian boy with refractory ulcerative colitis, admitted to the Child Neuropsychiatry Unit of the Polyclinic Hospital of Bari in the course of his first-episode psychosis. He showed an acute onset of psychotic symptomatology during treatment with thalidomide, an immunomodulatory drug used in the experimental therapy of refractory inflammatory bowel disease. Thalidomide was discontinued and orally administered mesalazine was restarted. In addition, treatment with antipsychotics and mood stabilizers was introduced with gradual improvement of psychotic symptoms. According to Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition criteria, a diagnosis of partial remission of a first episode of schizoaffective disorder was formulated after a 6-month follow-up. Throughout this period, both psychopharmacological and mesalazine-based gastrointestinal treatments were maintained with partial remission of psychiatric and gastrointestinal symptoms.\n\n\nCONCLUSIONS\nWe propose that refractory ulcerative colitis and psychosis might represent different manifestations of a common pathological pathway. However, it is also conceivable that thalidomide may have played a role in promoting the manifestation of psychotic symptoms in an individual with a specific vulnerability to schizoaffective disorders. Further investigations are needed to improve our knowledge regarding the complexity of brain-gut interactions, thus improving the management of co-existing inflammatory bowel and schizophrenia spectrum disorders.", "affiliations": "Child Neuropsychiatry Unit, Department of Basic Medical Sciences, Neuroscience and Sense Organs, University of Bari \"Aldo Moro\", Policlinico Piazza, G. Cesare 11, 70124, Bari, Italy. maria.petruzzelli@uniba.it.;Child Neuropsychiatry Unit, Department of Basic Medical Sciences, Neuroscience and Sense Organs, University of Bari \"Aldo Moro\", Policlinico Piazza, G. Cesare 11, 70124, Bari, Italy.;Child Neuropsychiatry Unit, Department of Basic Medical Sciences, Neuroscience and Sense Organs, University of Bari \"Aldo Moro\", Policlinico Piazza, G. Cesare 11, 70124, Bari, Italy.;Child Neuropsychiatry Unit, Department of Basic Medical Sciences, Neuroscience and Sense Organs, University of Bari \"Aldo Moro\", Policlinico Piazza, G. Cesare 11, 70124, Bari, Italy.;Psychiatry Unit, Department of Basic Medical Sciences, Neuroscience and Sense Organs, University of Bari \"Aldo Moro\", Policlinico Piazza, G. Cesare 11, 70124, Bari, Italy.", "authors": "Petruzzelli|Maria Giuseppina|MG|;Margari|Lucia|L|;Ivagnes|Sara|S|;Palumbi|Roberto|R|;Margari|Francesco|F|", "chemical_list": "D000894:Anti-Inflammatory Agents, Non-Steroidal; D014150:Antipsychotic Agents; D007155:Immunologic Factors; D019804:Mesalamine; D013792:Thalidomide", "country": "England", "delete": false, "doi": "10.1186/s13256-019-2106-8", "fulltext": "\n==== Front\nJ Med Case RepJ Med Case RepJournal of Medical Case Reports1752-1947BioMed Central London 210610.1186/s13256-019-2106-8Case ReportEarly onset first-episode psychosis during treatment with thalidomide for refractory ulcerative colitis: a case report Petruzzelli Maria Giuseppina +390805592829maria.petruzzelli@uniba.it 1Margari Lucia lucia.margari@uniba.it 1Ivagnes Sara saraivagnes@gmail.com 1Palumbi Roberto roberto.palumbi@gmail.com 1Margari Francesco francesco.margari@uniba.it 21 0000 0001 0120 3326grid.7644.1Child Neuropsychiatry Unit, Department of Basic Medical Sciences, Neuroscience and Sense Organs, University of Bari “Aldo Moro”, Policlinico Piazza, G. Cesare 11, 70124 Bari, Italy 2 0000 0001 0120 3326grid.7644.1Psychiatry Unit, Department of Basic Medical Sciences, Neuroscience and Sense Organs, University of Bari “Aldo Moro”, Policlinico Piazza, G. Cesare 11, 70124 Bari, Italy 8 6 2019 8 6 2019 2019 13 17516 1 2019 29 4 2019 © The Author(s). 2019Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nInflammatory bowel disease and schizophrenia spectrum disorders are complex and multifactorial conditions characterized by great variability of age at onset, clinical presentation, and longitudinal course. Several lines of evidence suggested different connections among immunological dysregulation, gastrointestinal inflammation, and psychosis, but to date many controversial issues still exist in this field.\n\nCase presentation\nWe present the case of a 14-year-old Caucasian boy with refractory ulcerative colitis, admitted to the Child Neuropsychiatry Unit of the Polyclinic Hospital of Bari in the course of his first-episode psychosis. He showed an acute onset of psychotic symptomatology during treatment with thalidomide, an immunomodulatory drug used in the experimental therapy of refractory inflammatory bowel disease. Thalidomide was discontinued and orally administered mesalazine was restarted. In addition, treatment with antipsychotics and mood stabilizers was introduced with gradual improvement of psychotic symptoms. According to Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition criteria, a diagnosis of partial remission of a first episode of schizoaffective disorder was formulated after a 6-month follow-up. Throughout this period, both psychopharmacological and mesalazine-based gastrointestinal treatments were maintained with partial remission of psychiatric and gastrointestinal symptoms.\n\nConclusions\nWe propose that refractory ulcerative colitis and psychosis might represent different manifestations of a common pathological pathway. However, it is also conceivable that thalidomide may have played a role in promoting the manifestation of psychotic symptoms in an individual with a specific vulnerability to schizoaffective disorders. Further investigations are needed to improve our knowledge regarding the complexity of brain–gut interactions, thus improving the management of co-existing inflammatory bowel and schizophrenia spectrum disorders.\n\nKeywords\nSchizophrenia spectrum disordersNeuroinflammationInflammatory bowel diseaseImmunological dysregulationissue-copyright-statement© The Author(s) 2019\n==== Body\nIntroduction\nSchizophrenia spectrum disorders are considered a heterogeneous group of conditions with a multifactorial etiopathogenesis. Current evidence suggests that the neurodevelopmental model best explains the pathogenesis of schizophrenia, and that the interaction of genetic background and multiple environmental risk factor exposures might cause disease pathogenesis. While early onset (before 13 years) appears to be quite rare, the rate of onset increases during adolescence, with a peak age ranging from 18 to 30 years [1]. Although neurobiologically and phenomenologically continuous with its adult counterpart, childhood-onset schizophrenia represents a more severe disorder, with more prominent pre-psychotic developmental disorders, brain abnormalities, and genetic risk factors [2].\n\nIn the last decades, multiple lines of evidence support the association between autoimmunity/inflammation and schizophrenia spectrum disorders [3, 4]. Overlaps in clinical course, in addition to epidemiological and genetic associations, raised the possibility that autoimmune mechanisms may underlie some psychoses, potentially offering novel therapeutic approaches [5]. In more recent years, the focus of the research regarding the relationship between autoimmune diseases and schizophrenia has been narrowed to gastrointestinal (GI) disorders [6]. In the context of the intricate interaction between the gut and the brain, the normal ecological balance of gut microorganisms plays an important role. Disorders in the composition and quantity of gut microorganisms, the so-called gut microbiota, have been reported to be associated with various central nervous system diseases [7] and current evidence suggests that probiotic supplementation could improve mild and moderate depressive symptoms [8]. On the other hand, a recently published systematic review found that there is a paucity of clinical studies to support the benefits of probiotic supplementation in patients with schizophrenia [9]. At the turn of the twenty-first century, inflammatory bowel disease (IBD) has become a global disease with accelerating incidence in newly industrialized countries with a prevalence surpassing 0.3% [10]. Ulcerative colitis (UC) is a form of IBD with diffuse inflammation of the rectal and colonic mucosa, manifesting with abdominal pain, diarrhea, bleeding, and weight loss. The pathogenesis of IBD, which is only partly understood, is thought to arise from dysregulation of the innate and adaptive immune systems, leading to an abnormal inflammatory response to commensal bacteria in genetically susceptible individuals [11]. The incidence rate of UC may vary from 0.5 to 31.5 per 100,000 people each year, depending on the studied population; the majority of patients with UC are in the age group of 30–40 years at diagnosis, while pediatric IBD, so defined when the age at onset is < 19 years, covers approximately 5–25% of patients [12]. UC displays a chronic clinical course, characterized by periods of exacerbation and remission, which may occur either spontaneously or in response to treatment [12]. UC rarely exists in isolation but is rather part of a complex matrix of disorders arising in patients over time [13]. Psychiatric comorbidity in IBD is well known, but to date the nature of the relationship between these two diseases has not been fully understood and is still a matter of debate. The most common psychiatric disorders in IBD are depression and anxiety, whereas data on other conditions, such as bipolar disorders and psychoses, are limited [14, 15].\n\nIn the current paper we present the case of an adolescent patient with a severe form of early onset UC, refractory to conventional therapies, manifesting an early onset first-episode psychosis (FEP) during treatment with thalidomide.\n\nCase presentation\nIn April 2018, a 14-year-old Caucasian boy with acute onset of affective FEP was referred to the Child Neuropsychiatry Unit of the Polyclinic Hospital of Bari. Since the age of 12 he presented with debilitating intestinal symptoms as mucohemorragic diarrhea (discharge frequency, > 10/day), tenesmus, and abdominal pain, resulting in severe disability impairing his general and social well-being. He was diagnosed as having UC on the basis of clinical, laboratory, instrumental, and histologic criteria. In accordance with the “Guidelines for Management of Pediatric Ulcerative Colitis” [16], he was treated with conventional therapies (mesalazine, prednisone, metronidazole, azathioprine, and biological agents such as infliximab and adalimumab) with no clinical response. Before elective surgery, a medical treatment with thalidomide was started, as an off-label option for patients with primary refractory IBD, and a clinical response was gradually observed. Two months later, he showed an acute onset of irritable mood, decreased need for sleeping, abnormally increased activity, disorganized behavior and speech, and thought alterations including inflated self-esteem and flight of insight-lacking ideas. These symptoms prompted the discontinuation of thalidomide and a mesalazine-based treatment was restarted. After admission at our Child Neuropsychiatry Unit, he was found to have no history of obstetric complications, neurological or psychiatric diseases, or substance abuse and no psychopathological symptoms prior to this acute episode. His parents reported a normal achievement of early childhood neurodevelopmental milestones and a normal intelligence quotient (IQ) was assessed. General and neurological examination, laboratory tests, and a brain magnetic resonance imaging resulted in normal ranges. An electroencephalogram showed slow waves including isolated spikes in the right temporal and parietal regions. After a mild improvement of symptoms, he developed a grossly disorganized behavior, with conceptual disorganization, auditory and visual hallucinations, delusion and suspiciousness, hostility, social and emotional withdrawal, somatic concerns, anxiety, and tension. Psychopathological assessment was performed by the use of Positive and Negative Syndrome Scale (PANSS). His PANSS total score was 115, while PANSS subscale scores were 29 for positive, 26 for negative, and 60 for general psychopathological symptoms. After proper informed consent, a treatment with antipsychotics and mood stabilizers (risperidone 6 mg/day, levosulpiride 72 mg/day, valproic acid 1000 mg/day) was started, leading to progressive improvement of psychopathological symptoms. During this phase his GI symptomatology remained silent, with 2–3 regular bowel movements/day and no blood or mucus emissions.\n\nAfter a 6-month follow-up, a psychopharmacological maintenance with risperidone (4 mg/day) and valproic acid (1000 mg/day) ensured a partial remission of symptomatology. His PANSS total score was 71, with subscale scores of 11 for positive symptoms, 21 for negative symptoms and 39 for general psychopathological symptoms. On the other hand, only mesalazine efficiently controlled GI symptoms (2–3 regular bowel movements/day and no abdominal pain, diarrhea or rectal bleeding). Therefore, according to Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-5) criteria, a diagnosis of partial remission of a first episode of schizoaffective disorder was formulated.\n\nDiscussion\nSeveral lines of evidence suggest that a proportion of psychotic illnesses have a plausible autoimmune component [5], although its definition and role for treatment are still a matter of debate. This case report supports the idea that, although the co-existence of a schizoaffective disorder and UC may be an accidental coincidence, their co-occurrence, early onset, and high severity, are in line with growing evidence supporting the relationship between inflammation, autoimmunity, and psychosis [17]. Thus, we raise the question of whether UC is a risk factor for the schizoaffective disorders and/or whether these two different clinical conditions may be considered two distinct manifestations of a common pathway. The clinical history of our patient indicates that UC preceded the onset of psychosis by approximately 2 years, in absence of additional risk factors for schizophrenia spectrum disorders (psychotic illness in relatives, obstetric complications, abnormalities of early phases of neurodevelopment, gradual impairment in academic or psychosocial functioning). This temporal relationship, suggestive of a risk for immunologically mediated psychotic disorders, also emerges from a large Danish study [18] showing that several autoimmune diseases, including IBD, were associated with an increased risk of developing bipolar disorder or schizophrenia within 4–5 years from diagnosis. In addition, some previous data supported the hypothesis of an association between central nervous system infections in childhood and increased risk of schizophrenia related to abnormalities in immune mediators such as cytokines and chemokines or raised antibodies, triggered by a postnatal viral infection [19]. On the other hand, schizophrenia and immune disorders share some genetic factors. A polygenic risk score analysis suggested that a spectrum of genetic factors are shared by schizophrenia and different disorders characterized by immune dysregulation [20]. In fact, studies on schizophrenia revealed an intricate association of environmentally driven immune activation and genetically encoded immune dysfunctions. The intestinal mucosa is part of an intricate enteric immune system and is endowed with a large variety of immune cells [21]. As the largest immune organ in the body, the GI tract is a plausible junction to reconcile hypotheses regarding how the autoimmune response and GI-related products can become neuropathogenic. GI inflammation affects endothelial permeability and provides a means by which gut-derived products might penetrate the blood-brain barrier. These faulty barriers may be particularly important if autoantibodies generated in the inflamed gut would cross a compromised blood–brain barrier [6, 22]. Despite the growing evidence that increased intestinal permeability with subsequent immune activation has a major role in the pathophysiology of various psychiatric disorders [23], to date, the “leaky gut” hypothesis needs further demonstrations.\n\nMoreover, considering IBD across the age spectrum, some authors proposed that, especially in younger patients, genetics might play a more significant role as compared to other components, such as the immune system, environmental factors, and composition of the intestinal microbiota [24]. On the basis of these observations, we hypothesize that the increased genetic vulnerability characterizing IBD may also increase the risk of developing psychotic diseases and that the co-occurrence of UC and schizoaffective disorder may arise from a common pathological pathway deriving from brain–gut interactions.\n\nOne last consideration must be made on the relationship between pharmacological treatment of UC and psychotic onset. After a long period of resistance to conventional therapies, a good clinical response was achieved after treatment with thalidomide, an immunomodulatory drug used in the experimental treatment of refractory IBD. At the same time, after approximately 2 months of treatment with thalidomide, our patient developed an acute onset of FEP. The timing of such events might suggest that the psychotic symptoms are adverse events after thalidomide treatment. Of note, two different systematic reviews on the efficacy and safety of thalidomide in the treatment of IBD reported that among the most frequent adverse events are neurological disturbances, such as sedation and peripheral neuropathy, without any report of psychotic symptoms [25, 26]. Therefore, on the basis of current data, it is not possible to exclude that thalidomide may have played a role in promoting psychotic manifestations in an individual with a specific vulnerability to schizoaffective disorders.\n\nTo the best of our knowledge this is the first case report of an adolescent patient presenting with early onset UC and a schizoaffective disorder. Questions arise from our report regarding whether and how immunological changes correlate with the clinical course of schizophrenia spectrum disorders, potentially modifying the current dogma about disease pathogenesis and leading to novel disease prevention and treatment strategies. Finally, we suggest that particular attention must be placed on the potential effects that immunomodulatory drugs might exert on autoimmunity, inflammation, and psychosis.\n\nAbbreviations\nFEPFirst-episode psychosis\n\nGIGastrointestinal\n\nIBDInflammatory bowel disease\n\nPANSSPositive and Negative Syndrome Scale\n\nUCUlcerative colitis\n\nAcknowledgements\nWe would like to thank the patient and his parents for the collaboration.\n\nFunding\nThe authors received no funding towards the creation of this case report.\n\nAuthors’ contributions\nMGP conceived and wrote the manuscript; SI contributed to writing and collected clinical data. RP reviewed the bibliography; FM was lead physician for the patient; LM supervised the team. All authors read and approved the final manuscript.\n\nEthics approval and consent to participate\nThe case report did not require ethics approval.\n\nConsent for publication\nWritten informed consent was obtained from the patient’s legal guardian for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Driver DI Gogtay N Rapoport JL Childhood onset schizophrenia and early onset schizophrenia spectrum disorders Child Adolesc Psychiatr Clin N Am 2013 22 4 539 555 10.1016/j.chc.2013.04.001 24012072 \n2. Margari F Petruzzelli MG Lecce PA Todarello O De Giacomo A Lucarelli E Familial liability, obstetric complications and childhood development abnormalities in early onset schizophrenia: a case control study BMC Psychiatry 2011 11 60 10.1186/1471-244X-11-60 21492438 \n3. Cullen AE Holmes S Pollak TA Blackman G Joyce DW Kempton MJ Associations Between Non-neurological Autoimmune Disorders and Psychosis: A Meta-analysis Biol Psychiatry 2019 85 1 35 48 10.1016/j.biopsych.2018.06.016 30122288 \n4. Margari F Petruzzelli MG Mianulli R Campa MG Pastore A Tampoia M Circulating anti-brain autoantibodies in schizophrenia and mood disorders Psychiatry Res 2015 230 2 704 708 10.1016/j.psychres.2015.10.029 26548982 \n5. Al-Diwani AAJ Pollak TA Irani SR Lennox BR Psychosis: an autoimmune disease? Immunology. 2017 152 3 388 401 10.1111/imm.12795 28704576 \n6. Severance EG Yolken RH Eaton WW Autoimmune diseases, gastrointestinal disorders and the microbiome in schizophrenia: more than a gut feeling Schizophr Res 2016 176 1 23 35 10.1016/j.schres.2014.06.027 25034760 \n7. Zhu X Han Y Du J Liu R Jin K Yi W Microbiota-gut-brain axis and the central nervous system Oncotarget. 2017 8 32 53829 53838 28881854 \n8. Ng QX Peters C Ho CYX Lim DY Yeo WS A meta-analysis of the use of probiotics to alleviate depressive symptoms J Affect Disord 2018 228 13 19 10.1016/j.jad.2017.11.063 29197739 \n9. Ng Qin Xiang Soh Alex Yu Sen Venkatanarayanan Nandini Ho Collin Yih Xian Lim Donovan Yutong Yeo Wee-Song A Systematic Review of the Effect of Probiotic Supplementation on Schizophrenia Symptoms Neuropsychobiology 2019 78 1 1 6 10.1159/000498862 30947230 \n10. Ng SC Shi HY Hamidi N Underwood FE Tang W Benchimol EI Worldwide incidence and prevalence of inflammatory bowel disease in the 21st century: a systematic review of population-based studies Lancet. 2018 390 10114 2769 2778 10.1016/S0140-6736(17)32448-0 29050646 \n11. Gracie DJ Guthrie EA Hamlin PJ Ford AC Bi-directionality of Brain-Gut Interactions in Patients With Inflammatory Bowel Disease Gastroenterology. 2018 154 6 1635 46 e3 10.1053/j.gastro.2018.01.027 29366841 \n12. da Silva BC Lyra AC Rocha R Santana GO Epidemiology, demographic characteristics and prognostic predictors of ulcerative colitis World J Gastroenterol 2014 20 28 9458 9467 10.3748/wjg.v20.i28.9458 25071340 \n13. Cawthorpe D Davidson M Temporal comorbidity of mental disorder and ulcerative colitis Perm J 2015 19 1 52 57 10.7812/TPP/14-120 25663206 \n14. Bernstein CN Hitchon CA Walld R Bolton JM Sareen J Walker JR Increased Burden of Psychiatric Disorders in Inflammatory Bowel Disease Inflamm Bowel Dis 2019 25 360 368 10.1093/ibd/izy235 29986021 \n15. Mikocka-Walus A Knowles SR Keefer L Graff L Controversies Revisited: A Systematic Review of the Comorbidity of Depression and Anxiety with Inflammatory Bowel Diseases Inflamm Bowel Dis 2016 22 3 752 762 10.1097/MIB.0000000000000620 26841224 \n16. Turner D Levine A Escher JC Griffiths AM Russell RK Dignass A Management of pediatric ulcerative colitis: joint ECCO and ESPGHAN evidence-based consensus guidelines J Pediatr Gastroenterol Nutr 2012 55 3 340 361 10.1097/MPG.0b013e3182662233 22773060 \n17. Najjar S Steiner J Najjar A Bechter K A clinical approach to new-onset psychosis associated with immune dysregulation: the concept of autoimmune psychosis J Neuroinflammation 2018 15 1 40 10.1186/s12974-018-1067-y 29433523 \n18. Benros ME Nielsen PR Nordentoft M Eaton WW Dalton SO Mortensen PB Autoimmune diseases and severe infections as risk factors for schizophrenia: a 30-year population-based register study Am J Psychiatry 2011 168 12 1303 1310 10.1176/appi.ajp.2011.11030516 22193673 \n19. Koponen H Rantakallio P Veijola J Jones P Jokelainen J Isohanni M Childhood central nervous system infections and risk for schizophrenia Eur Arch Psychiatry Clin Neurosci 2004 254 1 9 13 10.1007/s00406-004-0485-2 14991373 \n20. Stringer S Kahn RS de Witte LD Ophoff RA Derks EM Genetic liability for schizophrenia predicts risk of immune disorders Schizophr Res 2014 159 2–3 347 352 10.1016/j.schres.2014.09.004 25266548 \n21. Ng QX Soh AYS Loke W Lim DY Yeo WS The role of inflammation in irritable bowel syndrome (IBS) J Inflamm Res 2018 11 345 349 10.2147/JIR.S174982 30288077 \n22. Severance EG Dickerson FB Yolken RH Autoimmune phenotypes in schizophrenia reveal novel treatment targets Pharmacol Ther 2018 189 184 198 10.1016/j.pharmthera.2018.05.005 29742478 \n23. Rudzki L Szulc A “Immune Gate” of Psychopathology-The Role of Gut Derived Immune Activation in Major Psychiatric Disorders Front Psychiatry 2018 9 205 10.3389/fpsyt.2018.00205 29896124 \n24. Ruel J Ruane D Mehandru S Gower-Rousseau C Colombel JF IBD across the age spectrum: is it the same disease? Nat Rev Gastroenterol Hepatol 2014 11 2 88 98 10.1038/nrgastro.2013.240 24345891 \n25. Yang C Singh P Singh H Le ML El-Matary W Systematic review: thalidomide and thalidomide analogues for treatment of inflammatory bowel disease Aliment Pharmacol Ther 2015 41 11 1079 1093 10.1111/apt.13181 25858208 \n26. Bramuzzo M Ventura A Martelossi S Lazzerini M Thalidomide for inflammatory bowel disease: Systematic review Medicine (Baltimore) 2016 95 30 e4239 10.1097/MD.0000000000004239 27472695\n\n", "fulltext_license": "CC BY", "issn_linking": "1752-1947", "issue": "13(1)", "journal": "Journal of medical case reports", "keywords": "Immunological dysregulation; Inflammatory bowel disease; Neuroinflammation; Schizophrenia spectrum disorders", "medline_ta": "J Med Case Rep", "mesh_terms": "D000293:Adolescent; D000359:Aftercare; D017668:Age of Onset; D000894:Anti-Inflammatory Agents, Non-Steroidal; D014150:Antipsychotic Agents; D003093:Colitis, Ulcerative; D039721:Diagnostic and Statistical Manual of Mental Disorders; D057915:Drug Substitution; D017050:Episode of Care; D006801:Humans; D007155:Immunologic Factors; D008297:Male; D019804:Mesalamine; D015213:Neuroimmunomodulation; D011618:Psychotic Disorders; D012074:Remission Induction; D013792:Thalidomide", "nlm_unique_id": "101293382", "other_id": null, "pages": "175", "pmc": null, "pmid": "31174605", "pubdate": "2019-06-08", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "14991373;21492438;22193673;22773060;24012072;24345891;25034760;25071340;25266548;25663206;25858208;26548982;26841224;27472695;28704576;28881854;29050646;29197739;29366841;29433523;29742478;29896124;29986021;30122288;30288077;30947230", "title": "Early onset first-episode psychosis during treatment with thalidomide for refractory ulcerative colitis: a case report.", "title_normalized": "early onset first episode psychosis during treatment with thalidomide for refractory ulcerative colitis a case report" }
[ { "companynumb": "IT-CELGENEUS-ITA-20190607338", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "THALIDOMIDE" }, "drugadditional": null, ...
{ "abstract": "OBJECTIVE\nTo describe a new entity characterized by airway-centered fibroelastosis.\n\n\nMETHODS\nWe identified cases with prominent airway-centered elastosis in lung samples, and little or no pleural involvement identified through a pathologic database at a single institution over an 8-year period.\n\n\nRESULTS\nAirway-centered fibroelastosis was characterized by (1) extensive airway-centered fibroelastosis of the upper lobes on histopathology and (2) marked bronchial abnormalities with bronchial wall thickening, bronchial wall deformation, and bronchiectasis, along with progressive parenchymal retraction and predominantly subpleural upper-lobe consolidations on high-resolution CT. Pateints were five nonsmoking women aged between 38 and 56 years old. They experienced chronic dyspnea with acute attacks of wheezing and dyspnea. Moderate to severe physiological abnormalities were observed, with an obstructive pattern in three cases and a restriction in two. Despite inhaled and oral corticosteroids, the disease was progressive in all patients and evolved to chronic respiratory failure, requiring lung transplantation in two patients. Four patients had chronic asthma.\n\n\nCONCLUSIONS\nWe consider airway-centered fibroelastosis to be a unique and distinct pathological entity in women that needs to be individualized, with a specific clinical, imaging, and pathological presentation. We hypothesize that airway-centered fibroelastosis may be idiopathic or asthma-associated.", "affiliations": "INSERM U1152, Paris, France; University Paris Diderot, Sorbonne Paris Cité, Paris, France; Service de Pneumologie A, Assistance Publique-Hôpitaux de Paris, Hôpital Bichat, Département hospitalo-universitaire FIRE, Competence Center for Rare Pulmonary Diseases, Paris, France.;INSERM U1152, Paris, France; University Paris Diderot, Sorbonne Paris Cité, Paris, France; Service de Pneumologie A, Assistance Publique-Hôpitaux de Paris, Hôpital Bichat, Département hospitalo-universitaire FIRE, Competence Center for Rare Pulmonary Diseases, Paris, France.;INSERM U1152, Paris, France; University Paris Diderot, Sorbonne Paris Cité, Paris, France; Département d'Anatomie Pathologique, Assistance Publique-Hôpitaux de Paris, Hôpital Bichat, Paris, France.;Service de Radiologie, Assistance Publique-Hôpitaux de Paris, Hôpital Bichat, Paris, France.;INSERM U1152, Paris, France; University Paris Diderot, Sorbonne Paris Cité, Paris, France; Service de Pneumologie A, Assistance Publique-Hôpitaux de Paris, Hôpital Bichat, Département hospitalo-universitaire FIRE, Competence Center for Rare Pulmonary Diseases, Paris, France.;INSERM U1152, Paris, France; University Paris Diderot, Sorbonne Paris Cité, Paris, France; Service d'explorations fonctionnelles, Assistance Publique-Hôpitaux de Paris, Hôpital Bichat, Paris, France.;INSERM U1152, Paris, France; University Paris Diderot, Sorbonne Paris Cité, Paris, France; Service de Pneumologie et Transplantation, Assistance Publique-Hôpitaux de Paris, Hôpital Bichat, Paris, France.;INSERM U1152, Paris, France; University Paris Diderot, Sorbonne Paris Cité, Paris, France; Service de Pneumologie A, Assistance Publique-Hôpitaux de Paris, Hôpital Bichat, Département hospitalo-universitaire FIRE, Competence Center for Rare Pulmonary Diseases, Paris, France.;INSERM U1152, Paris, France; University Paris Diderot, Sorbonne Paris Cité, Paris, France; Service de Pneumologie A, Assistance Publique-Hôpitaux de Paris, Hôpital Bichat, Département hospitalo-universitaire FIRE, Competence Center for Rare Pulmonary Diseases, Paris, France. Electronic address: bruno.crestani@bch.aphp.fr.;INSERM U1152, Paris, France; University Paris Diderot, Sorbonne Paris Cité, Paris, France; Service de Pneumologie A, Assistance Publique-Hôpitaux de Paris, Hôpital Bichat, Département hospitalo-universitaire FIRE, Competence Center for Rare Pulmonary Diseases, Paris, France.", "authors": "Pradere|Pauline|P|;Gauvain|Clément|C|;Danel|Claire|C|;Debray|Marie Pierre|MP|;Borie|Raphael|R|;Plantier|Laurent|L|;Mal|Hervé|H|;Aubier|Michel|M|;Crestani|Bruno|B|;Taillé|Camille|C|", "chemical_list": null, "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0012-3692", "issue": "149(3)", "journal": "Chest", "keywords": "asthma; chronic obstructive pulmonary disease; idiopathic disease; interstitial lung disease", "medline_ta": "Chest", "mesh_terms": "D000328:Adult; D001249:Asthma; D001980:Bronchi; D001982:Bronchial Diseases; D001987:Bronchiectasis; D015331:Cohort Studies; D016208:Databases, Factual; D018450:Disease Progression; D004547:Elastic Tissue; D005260:Female; D005355:Fibrosis; D006801:Humans; D008168:Lung; D008171:Lung Diseases; D016040:Lung Transplantation; D008875:Middle Aged; D012131:Respiratory Insufficiency; D012189:Retrospective Studies; D014057:Tomography, X-Ray Computed", "nlm_unique_id": "0231335", "other_id": null, "pages": "767-74", "pmc": null, "pmid": "26836939", "pubdate": "2016-03", "publication_types": "D016428:Journal Article; D064888:Observational Study", "references": null, "title": "Airway-Centered Fibroelastosis: A Distinct Entity.", "title_normalized": "airway centered fibroelastosis a distinct entity" }
[ { "companynumb": "FR-GLAXOSMITHKLINE-FR2020GSK050431", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "OMALIZUMAB" }, "drugadditional": "3"...
{ "abstract": "Previous studies have suggested that heterozygous variants p.Q1236H and p.E1143G in mitochondrial DNA polymerase gamma (POLG1) increase the risk for liver injury for patients on valproate (VPA) therapy. We assessed the prevalence of these common variants and seven other pathogenic mutations in POLG1 and determined the occurrence of VPA-induced hepatotoxicity (VHT) or pancreatic toxicity in a cohort of patients with epilepsy.\n\n\n\nPatients with epilepsy (N = 367) were retrospectively identified from medical record files and screened for mutations in POLG1. Patients who had received VPA monotherapy and carried either of the two variants, p.Q1236H or p.E1143G, without other pathogenic mutations in POLG1 (n = 33, variant group) and patients without these variants (n = 28, nonvariant group) were included in the study. Clinical data on epilepsy, characteristics of VPA treatment, risk factors for VHT, laboratory data on liver and pancreas functions, and adverse effects were collected.\n\n\n\nA total of 122 patients had either the POLG1 p.Q1236H (n = 99) or p.E1143G (n = 24) variant in the heterozygous or homozygous state. Transient liver dysfunction was identified in three (n = 33, 9.1%) variant group patients and in one (n = 28, 3.6%) nonvariant group patient (P = 0.62). Mild to moderate elevations in liver enzymes were encountered in both groups. Furthermore, two patients on VPA polytherapy developed acute pancreatitis, and two pediatric patients with heterozygous p.Q1236H variants and mutations in IQSEC2 and GLDC, respectively, had elevated levels of VPA metabolites in urine, elevated plasma glycine, and/or increased acylglycine excretion.\n\n\n\nPOLG1 p.Q1236H and p.E1143G variants could not be identified as statistically significant risk factors for VHT or pancreatic toxicity. We suggest that VPA treatment could be suitable for patients who harbor these common variants in the absence of other pathogenic mutations in POLG1.", "affiliations": "Research Unit for Pediatrics, Pediatric Neurology, Pediatric Surgery, Child Psychiatry, Dermatology, Clinical Genetics, Obstetrics and Gynecology, Otorhinolaryngology and Ophthalmology, University of Oulu, Oulu, Finland.;Research Unit for Pediatrics, Pediatric Neurology, Pediatric Surgery, Child Psychiatry, Dermatology, Clinical Genetics, Obstetrics and Gynecology, Otorhinolaryngology and Ophthalmology, University of Oulu, Oulu, Finland.;Research Unit for Pediatrics, Pediatric Neurology, Pediatric Surgery, Child Psychiatry, Dermatology, Clinical Genetics, Obstetrics and Gynecology, Otorhinolaryngology and Ophthalmology, University of Oulu, Oulu, Finland.;Nordlab Oulu, Oulu University Hospital, Oulu, Finland.;Medical Research Center, Oulu University Hospital, Oulu, Finland.;Department of Neurology, Oulu University Hospital, Oulu, Finland.;Department of Neurology, Kuopio University Hospital, Kuopio, Finland.;Institute of Clinical Medicine, School of Medicine, Faculty of Health Sciences, University of Eastern Finland, Kuopio, Finland.;Institute of Clinical Medicine, School of Medicine, Faculty of Health Sciences, University of Eastern Finland, Kuopio, Finland.;Department of Child Neurology, University of Turku and Turku University Central Hospital, Turku, Finland.;Department of Pediatric Neurology, Children's Hospital, University of Helsinki and Helsinki University Hospital, Helsinki, Finland.;Department of Child Neurology, University of Turku and Turku University Central Hospital, Turku, Finland.;Department of Neurology, Institute of Clinical Medicine, University of Turku, Turku, Finland.;Tampere Center for Child Health Research and Pediatric Neurology, Tampere University Hospital, Tampere, Finland.;Outpatient Intellectual Disabilities Clinic, Tampere University Hospital, Tampere, Finland.;Medical Research Center, Oulu University Hospital, Oulu, Finland.;Research Unit for Pediatrics, Pediatric Neurology, Pediatric Surgery, Child Psychiatry, Dermatology, Clinical Genetics, Obstetrics and Gynecology, Otorhinolaryngology and Ophthalmology, University of Oulu, Oulu, Finland.;Research Unit for Pediatrics, Pediatric Neurology, Pediatric Surgery, Child Psychiatry, Dermatology, Clinical Genetics, Obstetrics and Gynecology, Otorhinolaryngology and Ophthalmology, University of Oulu, Oulu, Finland.;Medical Research Center, Oulu University Hospital, Oulu, Finland.;Research Unit for Pediatrics, Pediatric Neurology, Pediatric Surgery, Child Psychiatry, Dermatology, Clinical Genetics, Obstetrics and Gynecology, Otorhinolaryngology and Ophthalmology, University of Oulu, Oulu, Finland.;Research Unit for Pediatrics, Pediatric Neurology, Pediatric Surgery, Child Psychiatry, Dermatology, Clinical Genetics, Obstetrics and Gynecology, Otorhinolaryngology and Ophthalmology, University of Oulu, Oulu, Finland.", "authors": "Hynynen|Johanna|J|;Pokka|Tytti|T|;Komulainen-Ebrahim|Jonna|J|;Myllynen|Päivi|P|;Kärppä|Mikko|M|;Pylvänen|Laura|L|;Kälviäinen|Reetta|R|;Sokka|Arja|A|;Jyrkilä|Aino|A|;Lähdetie|Jaana|J|;Haataja|Leena|L|;Mäkitalo|Anna|A|;Ylikotila|Pauli|P|;Eriksson|Kai|K|;Haapala|Piia|P|;Ansakorpi|Hanna|H|;Hinttala|Reetta|R|;Vieira|Päivi|P|;Majamaa|Kari|K|;Rantala|Heikki|H|;Uusimaa|Johanna|J|", "chemical_list": "D000927:Anticonvulsants; D014635:Valproic Acid; D005723:gamma-Glutamyltransferase; D001219:Aspartate Aminotransferases; D000410:Alanine Transaminase; D000074002:DNA Polymerase gamma; C413027:POLG protein, human", "country": "United States", "delete": false, "doi": "10.1111/epi.14568", "fulltext": null, "fulltext_license": null, "issn_linking": "0013-9580", "issue": "59(11)", "journal": "Epilepsia", "keywords": "drug-induced liver injury; mtDNA; mutation; pancreatitis", "medline_ta": "Epilepsia", "mesh_terms": "D000293:Adolescent; D000328:Adult; D000410:Alanine Transaminase; D000927:Anticonvulsants; D001219:Aspartate Aminotransferases; D056486:Chemical and Drug Induced Liver Injury; D002648:Child; D015331:Cohort Studies; D000074002:DNA Polymerase gamma; D004827:Epilepsy; D005260:Female; D006801:Humans; D008297:Male; D009154:Mutation; D010182:Pancreatic Diseases; D018709:Statistics, Nonparametric; D014635:Valproic Acid; D055815:Young Adult; D005723:gamma-Glutamyltransferase", "nlm_unique_id": "2983306R", "other_id": null, "pages": "2125-2136", "pmc": null, "pmid": "30255931", "pubdate": "2018-11", "publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Variants p.Q1236H and p.E1143G in mitochondrial DNA polymerase gamma POLG1 are not associated with increased risk for valproate-induced hepatotoxicity or pancreatic toxicity: A retrospective cohort study of patients with epilepsy.", "title_normalized": "variants p q1236h and p e1143g in mitochondrial dna polymerase gamma polg1 are not associated with increased risk for valproate induced hepatotoxicity or pancreatic toxicity a retrospective cohort study of patients with epilepsy" }
[ { "companynumb": "FI-PFIZER INC-2017509834", "fulfillexpeditecriteria": "1", "occurcountry": "FI", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "VALPROATE SODIUM" }, "drugadditional": null, ...
{ "abstract": "Neurologic complications occur in up to 40% of adult abdominal solid organ transplant recipients and are associated with increased mortality. Comparable pediatric data are sparse. This study describes the occurrence of neurologic and behavioral complications (neurobehavioral complications) in pediatric abdominal solid organ transplant recipients. We examine the association of these complications with length of stay, mortality, and tacrolimus levels.\n\n\n\nThe electronic health record was interrogated for inpatient readmissions of pediatric abdominal solid organ transplant recipients from 2009 to 2017. A computable composite definition of neurobehavioral complication, defined using structured electronic data for neurologic and/or behavioral phenotypes, was created.\n\n\n\nQuaternary children's hospital with an active transplant program.\n\n\n\nPediatric abdominal solid organ transplant recipients.\n\n\n\nNone.\n\n\n\nComputable phenotypes demonstrated a specificity 98.7% and sensitivity of 63.0% for identifying neurobehavioral complications. There were 1,542 readmissions among 318 patients, with 65 (20.4%) having at least one admission with a neurobehavioral complication (total 109 admissions). Median time from transplant to admission with neurobehavioral complication was 1.2 years (interquartile range, 0.52-2.28 yr). Compared to encounters without an identified neurobehavioral complication, encounters with a neurobehavioral complication were more likely to experience ICU admission (odds ratio, 3.9; 2.41-6.64; p < 0.001), have longer ICU length of stay (median 10.3 vs 2.2 d; p < 0.001) and hospital length of stay (8.9 vs 4.3 d; p < 0.001), and demonstrate higher maximum tacrolimus level (12.3 vs 9.8 ng/mL; p = 0.001). Patients with a neurobehavioral complication admission were more likely to die (odds ratio, 5.04; 1.49-17.09; p = 0.009). In a multivariable analysis, type of transplant, ICU admission, and tacrolimus levels were independently associated with the presence of a neurobehavioral complication.\n\n\n\nCommon electronic health record variables can be used to accurately identify neurobehavioral complications in the pediatric abdominal solid organ transplant population. Late neurobehavioral complications are associated with increased hospital resource utilization, mortality, and tacrolimus exposure. Additional studies are required to delineate the relationship between maximum tacrolimus level and neurobehavioral complications to guide therapeutic drug monitoring and dosing.", "affiliations": "Department of Anesthesiology and Critical Care Medicine, The Children's Hospital of Philadelphia, Philadelphia, PA.;Department of Anesthesiology and Critical Care Medicine, The Children's Hospital of Philadelphia, Philadelphia, PA.;Department of Anesthesiology and Critical Care Medicine, The Children's Hospital of Philadelphia, Philadelphia, PA.;Department of Critical Care Medicine, UPMC Children's Hospital of Pittsburgh, University of Pittsburgh School of Medicine, Pittsburgh, PA.;Department of Critical Care Medicine, UPMC Children's Hospital of Pittsburgh, University of Pittsburgh School of Medicine, Pittsburgh, PA.;Department of Critical Care Medicine, UPMC Children's Hospital of Pittsburgh, University of Pittsburgh School of Medicine, Pittsburgh, PA.;Department of Critical Care Medicine, UPMC Children's Hospital of Pittsburgh, University of Pittsburgh School of Medicine, Pittsburgh, PA.;Department of Critical Care Medicine, UPMC Children's Hospital of Pittsburgh, University of Pittsburgh School of Medicine, Pittsburgh, PA.;Department of Anesthesiology and Critical Care Medicine, The Children's Hospital of Philadelphia, Philadelphia, PA.", "authors": "Alcamo|Alicia M|AM|;Clark|Robert S B|RSB|;Au|Alicia K|AK|;Kantawala|Sajel|S|;Yablonsky|Eric J|EJ|;Sindhi|Rakesh|R|;Mazariegos|George V|GV|;Aneja|Rajesh K|RK|;Horvat|Christopher M|CM|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1097/PCC.0000000000002355", "fulltext": null, "fulltext_license": null, "issn_linking": "1529-7535", "issue": "21(9)", "journal": "Pediatric critical care medicine : a journal of the Society of Critical Care Medicine and the World Federation of Pediatric Intensive and Critical Care Societies", "keywords": null, "medline_ta": "Pediatr Crit Care Med", "mesh_terms": "D000328:Adult; D002648:Child; D006295:Health Resources; D006760:Hospitalization; D006801:Humans; D016017:Odds Ratio; D016377:Organ Transplantation; D012189:Retrospective Studies", "nlm_unique_id": "100954653", "other_id": null, "pages": "804-810", "pmc": null, "pmid": "32343104", "pubdate": "2020-09", "publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Factors Associated With Neurobehavioral Complications in Pediatric Abdominal Organ Transplant Recipients Identified Using Computable Composite Definitions.", "title_normalized": "factors associated with neurobehavioral complications in pediatric abdominal organ transplant recipients identified using computable composite definitions" }
[ { "companynumb": "US-ASTELLAS-2020US016087", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "TACROLIMUS" }, "drugadditional": null, ...
{ "abstract": "OBJECTIVE\nChemotherapy with panitumumab is expected to be well tolerated and improve survival in patients with metastatic colorectal cancer (mCRC). However, skin toxicities are its most common adverse events. The aim of this trial was to evaluate the efficacy and safety of pre-emptive antibiotic treatment with clarithromycin (CAM) to prevent panitumumab skin toxicities.\n\n\nMETHODS\nWe conducted a phase lll, multicenter, open-label, randomized clinical trial on mCRC patients treated with panitumumab. Eligible patients were randomly assigned 1:1 to pre-emptive antibiotic and control groups. In the pre-emptive group, CAM administration (200 mg twice per day) continued daily through the panitumumab treatment period. The control regimen consisted of skin care only. The primary end point was the incidence of grade ≥ 2 skin toxicities during the 6-week skin treatment period.\n\n\nRESULTS\nOf 156 enrolled patients, 78 received pre-emptive antibiotic treatment, and 78 received reactive treatment. The number and incidence of grade ≥ 2 skin toxicities during the 6-week skin treatment period were 16 (21.3%) and 41 (54.7%) for the pre-emptive and control groups, respectively (HR, 0.32; 95% CI, 0.17-0.56). There was almost no difference in the rate of other adverse events between the two groups, but the incidence of grade ≥ 3 diarrhea in the pre-emptive group was high, at 8% vs. 1.3% in the control group. There were no treatment-related deaths.\n\n\nCONCLUSIONS\nProphylactic oral CAM together with relatively simple skin care was found to be effective in suppressing the development of grade ≥ 2 skin toxicities induced by panitumumab.\n\n\nBACKGROUND\nUMIN000011485 DATE OF REGISTRATION: Sep 1st, 2013.", "affiliations": "Department of Surgery, Sakai City Medical Center, Ebaraji-cho 1-1-1, Nishi-ku, Sakai, Osaka, Japan. nakataken@msn.com.;Department of Gastroenterological Surgery, Hyogo Prefectural Nishinomiya Hospital, Rokutanji-cho 13-9, Nishinomiya, Hyogo, Japan.;Department of Surgery, Ashiya Municipal Hospital, Asahigaoka-cho 39-1, Ashiya, Hyogo, Japan.;Department of Gastroenterological Surgery, Ikeda City Hospital, Jounan 3-1-18, Ikeda, Osaka, Japan.;Department of Gastroenterological Surgery, Osaka General Medical Center, Mandaihigashi 3-1-56, Sumiyoshi-ku, Osaka, Japan.;Department of Surgery, Itami City Hospital, Koyaike 1-100, Itami, Hyogo, Japan.;Department of Surgery, Toyonaka Municipal Hospital, Shibahara-cho 4-14-1, Toyonaka, Osaka, Japan.;Department of Surgery, Kinan Hospital, Shinjo-cho 46-70, Tanabe, Wakayama, Japan.;Department of Gastroenterological Surgery, Graduate School of Medicine, Osaka University, 2-2 E2 Yamadaoka, Suita, Osaka, Japan.;Department of Surgery, Toyonaka Municipal Hospital, Shibahara-cho 4-14-1, Toyonaka, Osaka, Japan.;Department of Gastroenterological Surgery, Graduate School of Medicine, Osaka University, 2-2 E2 Yamadaoka, Suita, Osaka, Japan.;Department of Gastroenterological Surgery, Graduate School of Medicine, Osaka University, 2-2 E2 Yamadaoka, Suita, Osaka, Japan.;Department of Surgery, Itami City Hospital, Koyaike 1-100, Itami, Hyogo, Japan.;Department of Gastroenterological Surgery, Graduate School of Medicine, Osaka University, 2-2 E2 Yamadaoka, Suita, Osaka, Japan.;Department of Gastroenterological Surgery, Graduate School of Medicine, Osaka University, 2-2 E2 Yamadaoka, Suita, Osaka, Japan.", "authors": "Nakata|Ken|K|http://orcid.org/0000-0002-4086-4984;Komori|Takamichi|T|;Saso|Kazuhiro|K|;Ota|Hirofumi|H|;Kagawa|Yoshinori|Y|;Morita|Shunji|S|;Noura|Shingo|S|;Hayashi|Nobuyasu|N|;Uemura|Mamoru|M|;Matsuda|Chu|C|;Satoh|Taroh|T|;Mizushima|Tsunekazu|T|;Murata|Kohei|K|;Doki|Yuichiro|Y|;Eguchi|Hidetoshi|H|;|||", "chemical_list": "D000911:Antibodies, Monoclonal; D000077544:Panitumumab; D017291:Clarithromycin", "country": "Germany", "delete": false, "doi": "10.1007/s00384-021-04002-9", "fulltext": null, "fulltext_license": null, "issn_linking": "0179-1958", "issue": "36(12)", "journal": "International journal of colorectal disease", "keywords": "Clarithromycin; Colorectal cancer; Panitumumab; Skin toxicity", "medline_ta": "Int J Colorectal Dis", "mesh_terms": "D000911:Antibodies, Monoclonal; D000971:Antineoplastic Combined Chemotherapy Protocols; D017291:Clarithromycin; D015179:Colorectal Neoplasms; D006801:Humans; D000077544:Panitumumab", "nlm_unique_id": "8607899", "other_id": null, "pages": "2621-2627", "pmc": null, "pmid": "34345969", "pubdate": "2021-12", "publication_types": "D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial", "references": "16990857;17010747;17914080;24723942;20921462;22644776;18717603;20142600;27214209;26504047;17470858;20921465;21679791", "title": "Pre-emptive oral clarithromycin reduces the skin toxicity of panitumumab treatment for metastatic colorectal cancer.", "title_normalized": "pre emptive oral clarithromycin reduces the skin toxicity of panitumumab treatment for metastatic colorectal cancer" }
[ { "companynumb": "JP-TAKEDA-2021TJP073375", "fulfillexpeditecriteria": "2", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "PANITUMUMAB" }, "drugadditional": "3", ...
{ "abstract": "The catheter tip \"granuloma\" is a rare inflammatory mass that forms in about 3% of patients with an intradural catheter, most commonly from a morphine pump. It has also been seen with other narcotic pumps, narcotic-non-narcotic combinations, and baclofen pumps. Mass formation is associated with increased opioid dose and concentration. It typically presents with increasing pain requiring increasing doses of medication, with minimal improvement, although it may present with neurologic deficits or be asymptomatic. On MRI, it appears as a round, rim-enhancing lesion that is low intensity with a hypointense rim on both T1 and T2. In the absence of neurologic deficits, there are many treatment options, ranging from a temporary stopping of the pump to catheter replacement. When the lesion presents with neurologic deficits, surgical intervention, beyond catheter replacement or repositioning, is indicated. A laminectomy is performed, with intradural exploration and careful resection of the mass, which is likely adherent to the spinal cord. Postoperative worsening of symptoms is common due to the mass being densely adherent to the spinal cord, requiring spinal cord manipulation. This worsening is usually temporary, and many patients make excellent recoveries. We present a case of a hydromorphone pump inflammatory mass, which initially presented with increasing pain, then progressive neurologic deficits, requiring referral and mass resection. We achieved only a partial resection due to the lesion's adherent nature. This surgical video demonstrates our intradural technique for resection of this rare and technically difficult mass, with 6-mo patient follow-up. The patient has consented to this case report.", "affiliations": "Department of Neurosurgery, University of Miami, Jackson Memorial Hospital, Miami, Florida.;Department of Neurosurgery, University of Miami, Jackson Memorial Hospital, Miami, Florida.;Department of Neurosurgery, University of Miami, Jackson Memorial Hospital, Miami, Florida.", "authors": "Gernsback|Joanna Elizabeth|JE|;Kolcun|John Paul G|JPG|;Manzano|Glen|G|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1093/ons/opy372", "fulltext": null, "fulltext_license": null, "issn_linking": "2332-4252", "issue": "17(2)", "journal": "Operative neurosurgery (Hagerstown, Md.)", "keywords": "Catheter-tip granuloma; Granuloma; Inflammatory mass", "medline_ta": "Oper Neurosurg (Hagerstown)", "mesh_terms": null, "nlm_unique_id": "101635417", "other_id": null, "pages": "E52", "pmc": null, "pmid": "30551181", "pubdate": "2019-08-01", "publication_types": "D016428:Journal Article", "references": null, "title": "Just the Tip: Resection of a Narcotic Catheter-Tip Granuloma: 2-Dimensional Operative Video.", "title_normalized": "just the tip resection of a narcotic catheter tip granuloma 2 dimensional operative video" }
[ { "companynumb": "US-FRESENIUS KABI-FK201909547", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "HYDROMORPHONE HYDROCHLORIDE" }, "drugaddi...
{ "abstract": "We present a case of a 24-year-old woman with abnormal behaviour of recent onset. She had been diagnosed previously with epilepsy and had been started on antiepileptic medication. Clinical examination confirmed features of psychosis including paranoid delusions and auditory hallucination. Neurological examination showed nystagmus and dysmetria. Further evaluation revealed the underlying cause for her symptoms. She responded promptly to appropriate therapy with complete resolution of psychosis.", "affiliations": "Department of Medicine, Kasturba Medical College, Manipal, Karnataka, India.;Department of Medicine, Kasturba Medical College, Manipal, Karnataka, India.;Department of Medicine, Kasturba Medical College, Manipal, Karnataka, India.;Department of Cardiology, Kasturba Medical College, Manipal University, Manipal, Karnataka, India.", "authors": "Naha|Sowjanya|S|;Naha|Kushal|K|;Hande|H Manjunath|HM|;Vivek|Ganapathiraman|G|", "chemical_list": "D000927:Anticonvulsants; D000077287:Levetiracetam; D010672:Phenytoin; D010889:Piracetam", "country": "England", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1757-790X", "issue": "2014()", "journal": "BMJ case reports", "keywords": null, "medline_ta": "BMJ Case Rep", "mesh_terms": "D000328:Adult; D000927:Anticonvulsants; D004827:Epilepsy; D005260:Female; D006212:Hallucinations; D006801:Humans; D000077287:Levetiracetam; D009483:Neuropsychological Tests; D010672:Phenytoin; D010889:Piracetam; D011618:Psychotic Disorders; D012640:Seizures; D016896:Treatment Outcome", "nlm_unique_id": "101526291", "other_id": null, "pages": null, "pmc": null, "pmid": "25008334", "pubdate": "2014-07-09", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "17662062;23139703;22578079;21498130;16175217;10864594;23471787;11207792;10885738;22406094", "title": "A young woman with seizures and psychosis.", "title_normalized": "a young woman with seizures and psychosis" }
[ { "companynumb": "IN-PFIZER INC-2017023025", "fulfillexpeditecriteria": "1", "occurcountry": "IN", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "PHENYTOIN" }, "drugadditional": "1", ...
{ "abstract": "OBJECTIVE\nThe objective of this study was to assess clinical and biological changes during intermittent ART (I-ART) started early, with significant time spent on versus off ART, which has never before been studied in ART-naive patients with high nadir and current CD4 cell count.\n\n\nMETHODS\nART-naive HIV-1-infected patients with baseline CD4 ≥ 500/mm(3) and nadir CD4 ≥ 400/mm(3) received 2 years of I-ART (6 month periods on once-daily boosted-PI-based ART, alternating with 6 month periods without ART) in a 2 year, Phase II, non-comparative multicentre trial. The trial is registered with ClinicalTrials.gov, number NCT 00820118.\n\n\nRESULTS\nThe CD4 cell count remained ≥ 500/mm(3) at 2 years in all 44 patients included in the study. The mean 2 year count was higher than the mean count at baseline in 24 patients overall (55%; 95% CI 40%-69%) and in 20 (65%; 95% CI 48%-81%) of the 31 patients who fully adhered to the trial strategy. All but three of these latter patients had HIV-1 RNA concentrations below 50 copies/mL after each 6 month 'on' period. Only one strategy-related genotypic mutation (M184I) was detected. The HIV-1 DNA median load fluctuated, but it did not differ between month 0 and month 24 (2.8 versus 2.6 log10 copies/10(6) leucocytes, P = 0.29). Biomarkers of inflammation and endothelial activation remained stable between month 0 and month 24. Naive CD4, CD8+CCR5+ and CD8+CD38+ T cell numbers tended to decline. One patient developed Burkitt's lymphoma and 12 patients reported sexually transmitted infections.\n\n\nCONCLUSIONS\nIn patients with high nadir and current CD4 cell counts, 2 year I-ART maintained the CD4 cell count above 500/mm(3), with no increase in the viral reservoir. Immune activation seems related to HIV replication, while inflammation seems to evolve independently and require specific attention.", "affiliations": "Centre Hospitalier Universitaire Dijon, and Unité Mixte de Recherche 1347, Université de Bourgogne, Dijon, France lionel.piroth@chu-dijon.fr.;University of Bordeaux, Institut de Santé Publique, d'Epidémiologie et de Développement, Centre INSERM U897- Epidemiologie-Biostatistique, F-33000 Bordeaux, France Institut National de la Santé et de la Recherche Médicale (INSERM), Institut de Santé Publique, d'Epidémiologie et de Développement, Centre INSERM U897- Epidemiologie-Biostatistique, F-33000 Bordeaux, France.;Hôpital Bichat-Claude Bernard, Paris, France.;Assistance Publique-Hôpitaux de Paris (AP-HP) Hôpital Necker-Enfants Malades, Université Paris Descartes, Sorbonne Paris Cité EA7327, France.;Centre Hospitalier Universitaire de Montpellier, Hôpital Gui de Chauliac, Université de Montpellier, UMI233 Montpellier, France.;Hôpital Saint-Antoine, Paris, France.;Hôpital Purpan, Toulouse, France.;University of Bordeaux, Institut de Santé Publique, d'Epidémiologie et de Développement, Centre INSERM U897- Epidemiologie-Biostatistique, F-33000 Bordeaux, France Institut National de la Santé et de la Recherche Médicale (INSERM), Institut de Santé Publique, d'Epidémiologie et de Développement, Centre INSERM U897- Epidemiologie-Biostatistique, F-33000 Bordeaux, France.;Assistance Publique-Hôpitaux de Paris (AP-HP) Hôpital Necker-Enfants Malades, Université Paris Descartes, Sorbonne Paris Cité EA7327, France.;Hôpital Pitié-Salpêtrière, Paris, France.;Unité Mixte de Recherche U866, Université de Bourgogne, and Department of Biochemistry, Centre Hospitalier Universitaire, Dijon F-21000, France.;University of Bordeaux, Institut de Santé Publique, d'Epidémiologie et de Développement, Centre INSERM U897- Epidemiologie-Biostatistique, F-33000 Bordeaux, France Institut National de la Santé et de la Recherche Médicale (INSERM), Institut de Santé Publique, d'Epidémiologie et de Développement, Centre INSERM U897- Epidemiologie-Biostatistique, F-33000 Bordeaux, France.;University of Bordeaux, Institut de Santé Publique, d'Epidémiologie et de Développement, Centre INSERM U897- Epidemiologie-Biostatistique, F-33000 Bordeaux, France Institut National de la Santé et de la Recherche Médicale (INSERM), Institut de Santé Publique, d'Epidémiologie et de Développement, Centre INSERM U897- Epidemiologie-Biostatistique, F-33000 Bordeaux, France.", "authors": "Piroth|Lionel|L|;Moinot|Laetitia|L|;Yeni|Patrick|P|;Avettand-Fénoel|Véronique|V|;Reynes|Jacques|J|;Girard|Pierre-Marie|PM|;Marchou|Bruno|B|;Georget|Aurore|A|;Rouzioux|Christine|C|;Autran|Brigitte|B|;Duvillard|Laurence|L|;Chêne|Geneviève|G|;Fagard|Catherine|C|;|||", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1093/jac/dkv369", "fulltext": null, "fulltext_license": null, "issn_linking": "0305-7453", "issue": "71(2)", "journal": "The Journal of antimicrobial chemotherapy", "keywords": null, "medline_ta": "J Antimicrob Chemother", "mesh_terms": "D023241:Antiretroviral Therapy, Highly Active; D018791:CD4 Lymphocyte Count; D015658:HIV Infections; D015497:HIV-1; D007249:Inflammation; D019562:Viral Load", "nlm_unique_id": "7513617", "other_id": null, "pages": "490-6", "pmc": null, "pmid": "26568566", "pubdate": "2016-02", "publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Immunity, inflammation and reservoir in patients at an early stage of HIV infection on intermittent ART (ANRS 141 TIPI Trial).", "title_normalized": "immunity inflammation and reservoir in patients at an early stage of hiv infection on intermittent art anrs 141 tipi trial" }
[ { "companynumb": "FR-GLAXOSMITHKLINE-FR2016GSK049965", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "ATAZANAVIR\\RITONAVIR" }, "drugaddi...
{ "abstract": "BK viras is a human polyoma viras. It is acquired in early childhood and remains life-long latent in the genitourinary system. BK virus replication is more common in receiving immunosuppressive therapy receiving patients and transplant patients. BK virus could cause hemorrhagic cystitis in patients with allogeneic stem cell transplantation. Hemorrhagic cystitis is a serious complication of hematopoietic stem cell transplantation. Hemorrhagic cystitis could cause morbidity and long stay in the hospital. Diagnosis is more frequently determined by the presence of BK virus DNA detected with quantitative or real-time PCR testing in serum or plasma and less often in urine. The reduction of immunosuppression is effective in the treatment of BK virus infection. There are also several agents with anti-BK virus activity. Cidofovir is an active agent against a variety of DNA viruses including poliomyoma viruses and it is a cytosine nucleotide analogue. Intravenous immunoglobulin IgG (IVIG) also includes antibodies against BK and JC (John Cunningham) viruses. Hereby, we report three cases of hemorrhagic cystitis. Hemorrhagic cystitis developed in all these three cases of allogeneic stem cell transplantation due to acute myeloid leukemia (AML). BK virus were detected as the cause of hemorrhagic cystitis in these patients. Irrigation of the bladder was performed. Then levofloxacin 1 x750 mg intravenous and IVIG 0.5 gr/kg were started. But the hematuria did not decreased. In the first case, treatment with leflunomide was started, but patient died due to refractory AML and severe graft-versus-host disease after 4th day of leflunamide and levofloxacin treatments. Cidofovir treatment and the reduction of immunosuppressive treatment decreased the BK virus load and resulted symptomatic improvement in the second case. Initiation of cidofovir was planned in the third case. Administration of cidofovir together with the reduction of immunosuppression in the treatment of hemorrhagic cystitis associated with BK virus in allogeneic stem cell transplant recipients could be a good option.", "affiliations": "Infectious Diseases and Clinical Microbiology Clinic, Dr. Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey.;Hematology and Stem Cell Transplantation Clinic, Dr. Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey.;Hematology and Stem Cell Transplantation Clinic, Dr. Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey.;Infectious Diseases and Clinical Microbiology Clinic, Dr. Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey.;Hematology and Stem Cell Transplantation Clinic, Dr. Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey.;Hematology and Stem Cell Transplantation Clinic, Dr. Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey.;Hematology and Stem Cell Transplantation Clinic, Dr. Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey.;Infectious Diseases and Clinical Microbiology Clinic, Dr. Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey.", "authors": "Mert|Duygu|D|;Batgi|Hikmetullah|H|;Merdin|Alparslan|A|;Çeken|Sabahat|S|;Dal|Mehmet Sinan|MS|;Tekgündüz|Emre|E|;Altuntaş|Fevzi|F|;Ertek|Mustafa|M|", "chemical_list": null, "country": "Italy", "delete": false, "doi": "10.4081/hr.2017.7205", "fulltext": "\n==== Front\nHematol RepHematol RepHRHematology Reports2038-83222038-8330PAGEPress Publications, Pavia, Italy 10.4081/hr.2017.7205Case ReportBK Virus-associated Hemorrhagic Cystitis in Patients with Allogeneic Hematopoietic Cell Transplantation: Report of Three Cases Mert Duygu 1Batgi Hikmetullah 2Merdin Alparslan 2Çeken Sabahat 1Dal Mehmet Sinan 2Tekgündüz Emre 2Altuntaş Fevzi 2Ertek Mustafa 11 Infectious Diseases and Clinical Microbiology Clinic, Dr. Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey2 Hematology and Stem Cell Transplantation Clinic, Dr. Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, TurkeyDr. Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital, Mehmet Akif Ersoy Mh. 13, 06200 Ankara, Turkey. +90.5066486279. drduygumert@hotmail.comContributions: the authors contributed equally.\n\n26 6 2017 01 6 2017 9 2 720528 4 2017 07 5 2017 08 5 2017 ©Copyright D. Mert et al, 20172017Licensee PAGEPress, ItalyThis is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.BK viras is a human polyoma viras. It is acquired in early childhood and remains life-long latent in the genitourinary system. BK virus replication is more common in receiving immunosuppressive therapy receiving patients and transplant patients. BK virus could cause hemorrhagic cystitis in patients with allogeneic stem cell transplantation. Hemorrhagic cystitis is a serious complication of hematopoietic stem cell transplantation. Hemorrhagic cystitis could cause morbidity and long stay in the hospital. Diagnosis is more frequently determined by the presence of BK virus DNA detected with quantitative or real-time PCR testing in serum or plasma and less often in urine. The reduction of immunosuppression is effective in the treatment of BK virus infection. There are also several agents with anti-BK virus activity. Cidofovir is an active agent against a variety of DNA viruses including poliomyoma viruses and it is a cytosine nucleotide analogue. Intravenous immunoglobulin IgG (IVIG) also includes antibodies against BK and JC (John Cunningham) viruses. Hereby, we report three cases of hemorrhagic cystitis. Hemorrhagic cystitis developed in all these three cases of allogeneic stem cell transplantation due to acute myeloid leukemia (AML). BK virus were detected as the cause of hemorrhagic cystitis in these patients. Irrigation of the bladder was performed. Then levofloxacin 1 x750 mg intravenous and IVIG 0.5 gr/kg were started. But the hematuria did not decreased. In the first case, treatment with leflunomide was started, but patient died due to refractory AML and severe graft-versus-host disease after 4th day of leflunamide and levofloxacin treatments. Cidofovir treatment and the reduction of immunosuppressive treatment decreased the BK virus load and resulted symptomatic improvement in the second case. Initiation of cidofovir was planned in the third case. Administration of cidofovir together with the reduction of immunosuppression in the treatment of hemorrhagic cystitis associated with BK virus in allogeneic stem cell transplant recipients could be a good option.\n\nKey words\nBK virushemorrhagic cystitisleukemia\n==== Body\nCompeting interest statement\nConflict of interest: the authors declare no potential conflict of interest.\n\nIntroduction\nBK virus is a human polyoma virus that is acquired in childhood. It remains latent in the genitourinary system for whole life.1 It could cause more frequent and higher grade viraemia in immunosuppressed patients.2 The use of specific immunosuppressive agents and the intensity of immunosuppression could effect the risk of BK virus replication and the the progression of clinical disease in transplant recipients.3 BK virus could cause hemorrhagic cystitis in allogeneic stem cell transplant (ASCT) recipients.4 Hemorrhagic cystitis could cause morbidity and long term hospital stay.5 Acute hemorrhagic cystitis following engraftment in hematopoietic stem cell transplant recipients could be associated with BK virus.6 Clinical diagnosis could be put by detecting BK virus DNA by quantitative or real-time (polymerase chain reaction) PCR in plasma or serum and less frequently in urine.7 In this article, we present three allogeneic stem cell transplanted patients with hemorrhagic cystitis associated BK virus.\n\nCase Report #1\nA 43-year-old female patient with the diagnosis of acute myeloid leukemia-M6 (AML-M6) was admitted to the hematology inpatient 3 + 7 (standard dose cytosine, arabinoside and idarubicin) chemotherapy was given to the patient. She went into complete remission and after that she received 1 course of HIDAC (high dose cytarabine) chemotherapy. ASCT was done after 3 months. Graft-versus-host disease (GVHD) was developed in the patient. Methylprednisolone, cyclosporine and mycophenolate mofetil therapy were started. Macroscopic hematuria was developed in the patient after three months of the stem cell transplantation. Hemoglobin (Hb): 11.8 gr/dL, hematocrit (Htc): 33.8%, white blood cell (WBC): 1930/μL (neutrophil: 450/μL), platelet: 52,000/μL, creatinine: 1.21 mg/dL, blood urea nitrogen (BUN): 18 mg/dL, uric acid: 4.4 mg/dL and C-reactive protein (CRP): 4.7 mg/dL (0-5) in laboratory tests. Because of the febrile neutropenic attack, piperacillin-tazobactam 3x4.5 mg intravenous (IV) was started empirically. Blood and urine cultures were taken in patient with high fever. The urine culture, gram staining, tuberculosis culture, ARB (acid resistant bacteria) staining, BK virus PCR and adenovirus PCR tests were taken for differential diagnosis. BK virus PCR: 20.763.373 copies/mL was detected. Other tests were negative. The bladder irrigation and reduction of immunosuppressive treatment decreased hematuria. BK virus PCR: 3.760.719.465 copies/mL were detected in the control. Creatinine level increased to 3.34 mg/dL and nephritis was considered as secondary to BK virus. However, biopsy could not be performed due to low platelet counts. Hemodialysis was initiated to the patient. Leflunomide 3x100 mg tb, levofloxacin 1×500 mg IV and 0.5 g/kg intravenous immunoglobulin G (IVIG) were started to patient. The patient was admitted to the intensive care unit due to the clinical regression. The patient died due to refractory AML and severe GVHD after 4th day of leflunamide and levofloxacin treatments.\n\nCase Report #2\nA 64-year-old male patient with AML secondary to myelofibrosis was admitted to the Bone Marrow Transplantation Service (BMTS) for ASCT. The hematuria was developed in the patient at 33th day after transplantation. Hb: 7.6 gr/dL, Htc: 22.7%, WBC: 590/μL (neutrophil: 54/μL), platelets: 28,000/μL, creatinine: 1.13 mg/dL, BUN: 30 mg/dL, uric acid: 5.7 mg/dL, CRP: 27.65 mg/dL in laboratory tests. A 10 mm diameter cortical cyst was detected in the right kidney in the abdomen USG. Bladder irrigation was started with 12 liters isotonic per day. The hematuria decreased. BK virus PCR: 163,000,000 copies/mL were detected. Other tests were negative. Because of hemorrhagic cystitis, IVIG 0.5 g/kg and levofloxacin 1×750 mg IV were started to the patient. Clots were detected in the bladder in control abdomen USG. The patient underwent cystoscopy and the clots were evacuated. BK virus PCR: 580.800.000 copies/ml were detected. The patient’s immunosuppressive treatment was reduced. Cidofovir treatment was started at 5 mg/kg once in a week for two weeks, continued after then every two weeks. After 1 month, BK virus PCR: 46.120 copies/mL were detected and treatment continued. The hematuria decreased. One month later BK virus PCR: 17.080 copies/mL was detected again. The patient’s treatment continued. Symptoms of the patient improved. The treatment of the patient was completed after 3 months. The BK virus PCR was detected as negative for control purposes.\n\nCase Report #3\nA 20-year-old AML-M6 male patient with remission was admitted to the BMTS for ASTC. The patient was gone into ASCT. Acute GVHD developed after the transplant. Methylprednisolone, cyclosporine and mycophenolate mofetil treatment were started. Hematuria developed in the patient after the 30th day of transplantation. Hb: 5.7 gr/dL, Htc: 16%, WBC: 5.860/μL (Neutrophil: 5.370 /μL), platelets: 55.000 μL, creatinine: 1.28 mg/dL, BUN: 52 mg/dL, uric acid: 6.8 mg/dL in laboratory tests. 28 leukocytes and 328 erythrocytes were detected in the urine microscopy. The bladder irrigation was started with 12 liters of isotonic per day. Hematuria complaints of the patient increased. BK virus PCR: 905.080.070 copies/mL were detected. IVIG 0.5g/kg IV and levofloxacin 1×750 mg IV were started. But hematuria did not decrease. Cidofovir therapy is scheduled to be given at 5 mg/kg once a week for two weeks followed by once in two week period. However, the patient’s general condition went worse and the patient was admitted to the intensive care unit. The patient died because of refractory AML and severe GVHD before cidovofir treatment.\n\nDiscussion and Conclusions\nBK virus could cause hemorrhagic cystitis in allogeneic stem cell transplantation patients.4 Hemorrhagic cystitis is a serious complication of hematopoietic stem cell transplantation. It could cause to morbidity and long term hospital stay.5 In a study conducted by Arthur et al. BK virus was detected in 53 hematopoietic stem cell transplant recipients.6 ASCT were performed in three of our cases. Hemorrhagic cystitis developed after 3th month of transplantation in the first case and hemorrhagic cystitis developed after approximately 1 months after transplantation in the other 2 cases. BK virus was detected as the cause of hemorrhagic cystitis. The use of quantitative or real-time PCR to detect BK virus DNA has been shown to be useful in plasma or serum, less frequently in urine in following renal transplant recipients.7 In all of the three cases, BK virus was detected in urine by real-time PCR test.\n\nThe reduction of immunosuppression was known to be effective in the treatment of BK virus infection. The reduction of immunosuppression was found to be successful in elimination of viremia in a single-center study with 24 patients.8 Several agents with anti-BK virus activity were demonstrated.9 The cidofovir is cytosine nucleotide analogue and it is an active agent against various DNA viruses including poliomyelitis viruses.10 In a retrospective nonrandomized study, 8 of 21 patients were treated with weekly low-dose cidofovir administration and immunosuppression reduction, only 13 patients were treated with reduced immunosuppressive therapy.11 In another study, clinical response was obtained in all adult patients treated with cidofovir (16/19, 84%); but only 9 of 19 patients (47%) were detected reduction greater than 1 log in the BK virus load in urine.12 In a study conducted by Cesaro et al.,14 (81%) of 27 patients had a complete clearance of BK virus associated hemorrhagic cystitis after the introduction of cidofovir on the average 37 days.13 Cidofovir treatment and the reduction of immunosuppressive treatment was started to the patient. 1 log decreased in BK virus load after 1st month of cidofovir treatment. Hematuria was regressed in case 2.\n\nLeflunomide is a prodrug. Anti-metabolite of leflunomide is A77 1726. Both have immunosuppressive and antiviral activities.15 The mechanism of action against BK virus is unknown.16 In the case series, leflunomide improved in 23 of 26 patients with BK virus nephropathy.17 Leflunomide treatment was started in one of our cases; but the patient died because of refractory AML and severe GVHD after 4 days. IVIG contain antibodies against to BK and JC (John Cunningham) viruses. Three of the our patients received IVIG. Quinolone antibiotics have anti-BK virus activities.18 Levofloxacin was given as a treatment or as a prophylactic agent in the treatment of active BK viremia in two randomized trials.19 BK virus was detected as the cause of hemorrhagic cystitis in our cases. The cidofovir treatment and the reduction of immunosuppressive treatment caused to improve symptoms and findings. They caused to decrease in the BK virus load.\n\nIntravenous immunoglobulin G contain antibodies against JC and BK virus. These viruses are ubiquitous in the general population. But, these antibodies not be neutralizing.20,21 Other studies indicate that the anti-BK antibodies are not protective and these antibodies indicate an augmented humoral response to an inadequate cellular immune response.22 IVIG 0.5 g/kg IV was started in case 2 and case 3. But hematuria did not decrease in these cases.\n\nIn this article, it is aimed to emphasize that cidofovir treatment with reducing immunosuppressive treatment is a good alternative in the treatment of hemorrhagic cystitis associated with BK virus in the allogeneic stem cell transplant recipients.\n==== Refs\nReferences\n1. Hirsch HH \nBK virus: opportunity makes a pathogen . Clin Infect Dis \n2005 ;41 :354 -60 .16007533 \n2. Peinemann F de Villiers EM Dörries K \nClinical course and treatment of haemorrhagic cystitis associated with BK type of human polyomavirus in nine paediatric recipients of allogeneic bone marrow transplants . Eur J Pediatr \n2000 ;159 :182 -8 .10664232 \n3. Gralla J Huskey J Wiseman A. \nTrends in immune function assay (ImmuKnow, Cylex) results in the first year post-transplant and relationship to BK virus infection . Nephrol Dial Transplant \n2012 ;27 :2565 -70 .22167591 \n4. Hirsch HH \nPolyoma and papilloma virus infections after hematopoietic stem cell or solid organ transplantation \nBowden P Ljungman P Snydman DR (Eds). Transplant infections . Philadelphia : Lippincott Williams & Wilkins ; 2010 p 465 .\n5. Silva Lde P Patah PA Saliba RM \nHemorrhagic cystitis after allogeneic hematopoietic stem cell transplants is the complex result of BK virus infection, preparative regimen intensity and donor type . Haematologica \n2010 ;95 :1183 -90 .20410183 \n6. Arthur RR Shah KV Baust SJ \nAssociation of BK viruria with hemorrhagic cystitis in recipients of bone marrow transplants . N Engl J Med \n1986 ;315 :230 -34 .3014334 \n7. Randhawa P Vats A Shapiro R. \nMonitoring for polyomavirus BK and JC in urine: comparison of quantitative polymerase chain reaction with urine cytology . Transplantation \n2005 ;79 :984 -6 .15849556 \n8. Saad ER Bresnahan BA Cohen EP \nSuccessful treatment of BK viremia using reduction in immunosuppression without antiviral therapy . Transplantation \n2008 ;85 :850 -4 .18360267 \n9. Josephson MA Williams JW Chandraker A Randhawa PS \nPolyomavirus-associated nephropathy: update on antiviral strategies . Transpl Infect Dis \n2006 ;8 :95 -101 .16734632 \n10. Vandercam B Moreau M Goffin E \nCidofovir-induced end-stage renal failure . Clin Infect Dis \n1999 ;29 :948 -9 .10589927 \n11. Kuypers DR Vandooren AK Lerut E \nAdjuvant low-dose cidofovir therapy for BK polyomavirus interstitial nephritis in renal transplant recipients . Am J Transplant \n2005 ;5 :1997 -2004 .15996251 \n12. Savona MR Newton D Frame D \nLow-dose cidofovir treatment of BK virus associated hemorrhagic cystitis in recipients of hematopoietic stem cell transplant . Bone Marrow Transplant \n2007 ;39 :783 -7 .17438584 \n13. Cesaro S Hirsch HH Faraci M \nCidofovir for BK virus associated hemorrhagic cystitis: a retrospective study . Clin Infect Dis \n2009 ;49 :233 -40 .19522651 \n14. Cesaro S Pillon M Tridello G Aljurf M \nRelationship between clinical and BK virologicai response in patients with late hemorrhagic cystitis treated with cidofovir: a retrospective study from the European Group for Blood and Marrow Transplantation . Bone Marrow Transplant \n2013 ;48 :809 -13 .23222380 \n15. Chong AS Zeng H Knight DA \nConcurrent antiviral and immunosuppressive activities of leflunomide in vivo . Am J Transplant \n2006 ;6 :69 -75 .16433758 \n16. Farasati NA Shapiro R Vats A Randhawa P. \nEffect of leflunomide and cidofovir on replication of BK virus in an in vitro culture system . Transplantation \n2005 ;79 :116 -8 .15714178 \n17. Josephson MA Gillen D Javaid B \nTreatment of renal allograft polyoma BK virus infection with leflunomide . Transplantation \n2006 ;81 :704 -10 .16534472 \n18. Gabardi S Waikar SS Martin S \nEvaluation of fluoroquinolones for the prevention of BK viremia after renal transplantation . Clin J Am Soc Nephrol \n2010 ;5 :1298 -304 .20507960 \n19. Knoll GA Humar A Fergusson D \nLevofloxacin for BK virus prophylaxis following kidney transplantation: a randomized clinical trial . JAMA \n2014 ;312 :2106 -14 .25399012 \n20. Bohl DL Brennan DC Ryschkewitsch C \nBK virus antibody titers and intensity of infections after renal transplantation . J Clin Virol \n2008 ;43 :184 -9 .18676176 \n21. Randhawa P Bohl D Brennan D \nLongitudinal analysis of levels immunoglobulins against BK virus capsid proteins in kidney transplant recipients . Clin Vaccine Immunol \n2008 ;15 :1564 -71 .18753339 \n22. Bohl DL Storch GA Ryschkewitsch C \nDonor origin of BK virus in renal transplantation and role of HLA C7 in susceptibility to sustained BK viremia . Am J Transplant \n2005 ;5 :2213 -21 .16095500\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2038-8322", "issue": "9(2)", "journal": "Hematology reports", "keywords": "BK virus; hemorrhagic cystitis; leukemia", "medline_ta": "Hematol Rep", "mesh_terms": null, "nlm_unique_id": "101556723", "other_id": null, "pages": "7205", "pmc": null, "pmid": "28702160", "pubdate": "2017-06-01", "publication_types": "D002363:Case Reports", "references": "16534472;3014334;18753339;10664232;15996251;20507960;18676176;22167591;15714178;20410183;16007533;25399012;16734632;16095500;23222380;15849556;19522651;10589927;16433758;18360267;17438584", "title": "BK Virus-associated Hemorrhagic Cystitis in Patients with Allogeneic Hematopoietic Cell Transplantation: Report of Three Cases.", "title_normalized": "bk virus associated hemorrhagic cystitis in patients with allogeneic hematopoietic cell transplantation report of three cases" }
[ { "companynumb": "TR-ACCORD-070603", "fulfillexpeditecriteria": "1", "occurcountry": "TR", "patient": { "drug": [ { "actiondrug": "2", "activesubstance": { "activesubstancename": "CYCLOSPORINE" }, "drugadditional": "1", "dru...
{ "abstract": "The video article describes a laparoscopic anterior pelvic exenteration with radical vaginectomy using the 3-dimensional (3D) vision and multifunction instruments.\n\n\n\nThis is a step-by-step video presentation of the laparoscopic anterior pelvic exenteration (Canadian Task Force classification III). Although the therapeutic benefit of the PE remains controversial, it is often performed in women with centrally recurrent pelvic tumors that previously received radiation therapy or in the locally advanced cases (ie, stage IIb-IVa) resistant to radiochemotherapy. The patient was a 61-year-old woman (body mass index 31.8 kg/m) with locally advanced squamous cervical cancer involving the bladder (International Federation of Gynecology and Obstetrics stage IVa) submitted to chemoradiotherapy with no response and was admitted for surgery. The preoperative positron emission tomography/computed tomography scan was negative for metastatic localizations.The surgery was performed including radical hysterectomy, cystectomy, and colpectomy with macroscopic resection margins larger than 2 cm; a subsequent Bricker's ileal conduit was completed. An Endoeye Flex 3D Videoscope (Olympsus System) and Thunderbeat device were used to perform it.\n\n\n\nThe operation was performed successfully with no intraoperative or postoperative complications. Total duration of surgery was 330 minutes. The estimated blood loss was 100 mL. The patient was discharged on day 8. The pathology report was positive for relapse of cervical cancer (tumor diameter = 4 cm) with infiltration of the vagina and the posterior bladder's muscle.\n\n\n\nLaparoscopic anterior pelvic exenteration with radical colpectomy using 3D vision and multifunction instrument is a fast and safe procedure. However, we notice that further prospective trials are needed to compare this technique with other open surgery and minimally invasive approach (ie, robotically).", "affiliations": "Department of Women's and Children's Health, Fondazione Policlinico Universitario A. Gemelli - IRCCS, Università Cattolica del Sacro Cuore, Rome.;Department of Women's and Children's Health, Fondazione Policlinico Universitario A. Gemelli - IRCCS, Università Cattolica del Sacro Cuore, Rome.;Department of Women's and Children's Health, Fondazione Policlinico Universitario A. Gemelli - IRCCS, Università Cattolica del Sacro Cuore, Rome.;Department of Women's and Children's Health, Fondazione Policlinico Universitario A. Gemelli - IRCCS, Università Cattolica del Sacro Cuore, Rome.;Department of Obstetrics and Gynecology, Ospedale Maggiore della Carità Università degli Studi del Piemonte Orientale, Novara, Italy.", "authors": "Vizzielli|Giuseppe|G|;Perrone|Emanuele|E|;Pizzacalla|Sara|S|;Scambia|Giovanni|G|;Ercoli|Alfredo|A|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1097/IGC.0000000000001370", "fulltext": null, "fulltext_license": null, "issn_linking": "1048-891X", "issue": "28(9)", "journal": "International journal of gynecological cancer : official journal of the International Gynecological Cancer Society", "keywords": null, "medline_ta": "Int J Gynecol Cancer", "mesh_terms": "D005260:Female; D006801:Humans; D010535:Laparoscopy; D008875:Middle Aged; D010385:Pelvic Exenteration; D002583:Uterine Cervical Neoplasms; D014621:Vagina; D020535:Video-Assisted Surgery", "nlm_unique_id": "9111626", "other_id": null, "pages": "1805-1806", "pmc": null, "pmid": "30358707", "pubdate": "2018-11", "publication_types": "D002363:Case Reports; D016428:Journal Article; D059040:Video-Audio Media", "references": null, "title": "Laparoscopic Pelvic Exenteration With Radical Vaginectomy Using 3-Dimensional Vision and Multifunction Instrument.", "title_normalized": "laparoscopic pelvic exenteration with radical vaginectomy using 3 dimensional vision and multifunction instrument" }
[ { "companynumb": "IT-MYLANLABS-2018M1087833", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CISPLATIN" }, "drugadditional": "3", ...
{ "abstract": "A 71-year-old Japanese female with psoriatic arthritis (PsA) was admitted for fever and neck pain. Her medication had been switched from secukinumab, an interleukin (IL)-17A inhibitor, to adalimumab, a tumour necrosis factor (TNF)-α inhibitor, due to secondary failure for PsA. She was diagnosed with subacute thyroiditis (SAT) on the basis of thyroid hormone levels and thyroid ultrasound findings. Her SAT symptoms improved with prednisolone administration (15 mg/day). Following the administration of ixekizumab, an IL-17A inhibitor, her PsA improved without SAT relapse. SAT mechanism associated with TNF inhibitors remains unknown, but cytokine imbalance may be involved.", "affiliations": "Department of Internal Medicine, Japan Community Healthcare Organization, Isahaya General Hospital, Isahaya, Japan.;Department of Rheumatology, Japan Community Healthcare Organization, Isahaya General Hospital, Isahaya, Japan.;Department of Rheumatology, Japan Community Healthcare Organization, Isahaya General Hospital, Isahaya, Japan.;Department of Internal Medicine, Japan Community Healthcare Organization, Isahaya General Hospital, Isahaya, Japan.;Department of Internal Medicine, Japan Community Healthcare Organization, Isahaya General Hospital, Isahaya, Japan.;Department of Dermatology, Japan Community Healthcare Organization, Isahaya General Hospital, Isahaya, Japan.;Department of Dermatology, Japan Community Healthcare Organization, Isahaya General Hospital, Isahaya, Japan.;Department of Internal Medicine, Japan Community Healthcare Organization, Isahaya General Hospital, Isahaya, Japan.;Department of Immunology and Rheumatology, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki, Japan.", "authors": "Nakagawa|Jun|J|;Fujikawa|Keita|K|;Akagi|Midori|M|;Nakaji|Keita|K|;Yasui|Junichi|J|;Hanatani|Yumi|Y|;Hara|Toshihide|T|;Mizokami|Akinari|A|;Kawakami|Atsushi|A|", "chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D018501:Antirheumatic Agents; D020381:Interleukin-17; D000079424:Tumor Necrosis Factor Inhibitors; D014284:Triiodothyronine; D013972:Thyrotropin; C549079:ixekizumab; C555450:secukinumab; D000068879:Adalimumab; D013974:Thyroxine", "country": "England", "delete": false, "doi": "10.1080/24725625.2020.1741116", "fulltext": null, "fulltext_license": null, "issn_linking": "2472-5625", "issue": "5(1)", "journal": "Modern rheumatology case reports", "keywords": "Subacute thyroiditis; adalimumab; psoriatic arthritis", "medline_ta": "Mod Rheumatol Case Rep", "mesh_terms": "D000068879:Adalimumab; D000368:Aged; D061067:Antibodies, Monoclonal, Humanized; D018501:Antirheumatic Agents; D015535:Arthritis, Psoriatic; D005260:Female; D006801:Humans; D020381:Interleukin-17; D013960:Thyroid Function Tests; D013961:Thyroid Gland; D013968:Thyroiditis, Subacute; D013972:Thyrotropin; D013974:Thyroxine; D014284:Triiodothyronine; D000079424:Tumor Necrosis Factor Inhibitors", "nlm_unique_id": "101761026", "other_id": null, "pages": "36-39", "pmc": null, "pmid": "32731788", "pubdate": "2021-01", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Subacute thyroiditis in a patient with psoriatic arthritis switched from secukinumab to adalimumab: a case report and literature review.", "title_normalized": "subacute thyroiditis in a patient with psoriatic arthritis switched from secukinumab to adalimumab a case report and literature review" }
[ { "companynumb": "JP-ABBVIE-20K-087-3517043-00", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "ADALIMUMAB" }, "drugadditional": "1", ...
{ "abstract": "The introduction of ustekinumab, an interleukin [IL]12/23 p40 inhibitor, to the therapeutic armamentarium of Crohn's disease has provided a much needed treatment option for patients who have failed conventional biologics with anti-tumour necrosis factor [TNF] and anti-integrin agents. Despite targeting two major cytokine pathways, the side effect profile of ustekinumab appears to be favourable in clinical trials. In particular, the risk of tuberculosis infection was observed to be lower than in patients who have received anti-TNF agents. The risk of non-tuberculosis mycobacterium infection, however, remains unknown. Here, we report the first case of a patient with Crohn's disease who developed Mycobacterium abscessus infection while on ustekinumab treatment.", "affiliations": "Department of Gastroenterology and Hepatology, Singapore General Hospital, Singapore.;National Skin Centre, Singapore.;Department of Gastroenterology and Hepatology, Singapore General Hospital, Singapore.;Department of Infectious Diseases, Singapore General Hospital, Singapore.;National Skin Centre, Singapore.;Department of Gastroenterology and Hepatology, Singapore General Hospital, Singapore.", "authors": "Shim|Hang Hock|HH|;Cai|Sophie Carrie Shan|SCS|;Chan|Webber|W|;Low|Jenny Guek Hong|JGH|;Tan|Hiok Hee|HH|;Ling|Khoon Lin|KL|", "chemical_list": "D000900:Anti-Bacterial Agents; D061067:Antibodies, Monoclonal, Humanized; D053762:Interleukin-12 Subunit p40; D002440:Cefoxitin; D000583:Amikacin; D000069549:Ustekinumab", "country": "England", "delete": false, "doi": "10.1093/ecco-jcc/jjy126", "fulltext": null, "fulltext_license": null, "issn_linking": "1873-9946", "issue": "12(12)", "journal": "Journal of Crohn's & colitis", "keywords": null, "medline_ta": "J Crohns Colitis", "mesh_terms": "D000583:Amikacin; D000900:Anti-Bacterial Agents; D061067:Antibodies, Monoclonal, Humanized; D002440:Cefoxitin; D003424:Crohn Disease; D004334:Drug Administration Schedule; D005260:Female; D006801:Humans; D007077:Ileal Diseases; D007279:Injections, Subcutaneous; D053762:Interleukin-12 Subunit p40; D008279:Magnetic Resonance Imaging; D008875:Middle Aged; D009165:Mycobacterium Infections, Nontuberculous; D009170:Nontuberculous Mycobacteria; D013848:Thigh; D016896:Treatment Outcome; D000069549:Ustekinumab", "nlm_unique_id": "101318676", "other_id": null, "pages": "1505-1507", "pmc": null, "pmid": "30169620", "pubdate": "2018-11-28", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Mycobacterium abscessus Infection During Ustekinumab Treatment in Crohn's Disease: A Case Report and Review of the Literature.", "title_normalized": "mycobacterium abscessus infection during ustekinumab treatment in crohn s disease a case report and review of the literature" }
[ { "companynumb": "SG-JNJFOC-20190209995", "fulfillexpeditecriteria": "1", "occurcountry": "SG", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "USTEKINUMAB" }, "drugadditional": "1", ...
{ "abstract": "Insulinoma is a pancreatic neuroendocrine tumor that causes hyperinsulinemic hypoglycemia. Symptomatic hypoglycemia related to hepatic insulinoma metastases may be addressed with liver-directed therapies such as hepatic artery embolization.\nThis work aimed to determine the safety and effectiveness of bland hepatic artery embolization (HAE) for palliation of symptomatic hypoglycemia in patients with hepatic insulinoma metastases refractory to medical management.\nAn institutional review board-approved retrospective review was undertaken of all patients with a tissue (n = 18) or imaging (n = 2) diagnosis of hepatic insulinoma metastases and symptomatic hyperinsulinemic hypoglycemia refractory to medical management who underwent bland HAE at a single center between January 1, 1998 and November 1, 2020. Twenty patients (10 women, 10 men; mean age, 56 years; range, 18-84 years) were identified who individually underwent 1 (n = 7), 2 (n = 5), 3 (n = 5), 4 (n = 2), or 5 (n = 1) HAEs, for an overall total of 45 HAEs. Post-HAE hypoglycemia recurrence was defined as onset of adrenergic symptoms (eg, sweating, weakness, tremor), neuroglycopenic symptoms (eg, confusion, loss of consciousness), and/or documented serum glucose of less than 50 mg/dL, in the absence of an alternative explanation. Median time to first hypoglycemia recurrence, hypoglycemia-free survival (HFS), and overall survival (OS) were calculated using Kaplan-Meier method.\nBefore HAE, all patients experienced adrenergic or neuroglycopenic symptoms alleviated by glucose intake, and 60% (n = 12) of patients had documented serum glucose of less than 50 mg/dL within 1 week of the first treatment. Median post-HAE follow-up was 9.4 months (mean, 26 months; range, 0.1-190 months). Postprocedural hypoglycemic symptom relief after the first HAE was reported in 100% (n = 20) of patients before discharge or at follow-up. Post-HAE hypoglycemia recurrence occurred in 60% (n = 12) of patients with a median time to first hypoglycemia recurrence of 2 months (mean, 14 months; range, 0.2-60 months). After the first HAE, median HFS was 14.5 months, and median OS was 16 months. One patient experienced labile postprocedure blood glucose levels requiring intensive care unit admission for intravenous dextrose. Otherwise, no major procedure-related complications occurred.\nBland HAE is a safe, effective, and repeatable procedure for palliation of symptomatic hypoglycemia in patients with hepatic insulinoma metastases refractory to medical management.", "affiliations": "Division of Vascular and Interventional Radiology, Mayo Clinic, Rochester, Minnesota, USA.;Division of Vascular and Interventional Radiology, Mayo Clinic, Rochester, Minnesota, USA.;Division of Vascular and Interventional Radiology, Mayo Clinic, Rochester, Minnesota, USA.;Division of Endocrinology, Mayo Clinic, Rochester, Minnesota, USA.;Division of Vascular and Interventional Radiology, Mayo Clinic, Rochester, Minnesota, USA.", "authors": "Linch|Forrest|F|https://orcid.org/0000-0002-3743-2734;Thompson|Scott|S|;Fleming|Chad|C|;Vella|Adrian|A|https://orcid.org/0000-0001-6493-7837;Andrews|James|J|https://orcid.org/0000-0003-1481-2096", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1210/jendso/bvab149", "fulltext": "\n==== Front\nJ Endocr Soc\nJ Endocr Soc\njes\nJournal of the Endocrine Society\n2472-1972\nOxford University Press US\n\n10.1210/jendso/bvab149\nbvab149\nClinical Research Article\nAcademicSubjects/MED00250\nHepatic Artery Embolization for Palliation of Symptomatic Hypoglycemia in Patients With Hepatic Insulinoma Metastases\nhttps://orcid.org/0000-0002-3743-2734\nLinch Forrest 1\nThompson Scott 1\nFleming Chad 1\nhttps://orcid.org/0000-0001-6493-7837\nVella Adrian 2\nhttps://orcid.org/0000-0003-1481-2096\nAndrews James 1Andrews.James@Mayo.edu\n\n1 Division of Vascular and Interventional Radiology, Mayo Clinic, Rochester, Minnesota, USA\n2 Division of Endocrinology, Mayo Clinic, Rochester, Minnesota, USA\nCorrespondence: James Andrews, MD, Division of Vascular and Interventional Radiology, Mayo Clinic, 200 First St SW, Rochester, MN 55905, USA. Email: Andrews.James@Mayo.edu.\n01 12 2021\n07 10 2021\n07 10 2021\n5 12 bvab14928 5 2021\n19 8 2021\n04 12 2021\n© The Author(s) 2021. Published by Oxford University Press on behalf of the Endocrine Society.\n2021\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs licence (https://creativecommons.org/licenses/by-nc-nd/4.0/), which permits non-commercial reproduction and distribution of the work, in any medium, provided the original work is not altered or transformed in any way, and that the work is properly cited. For commercial re-use, please contact journals.permissions@oup.com\n\nAbstract\n\nContext\n\nInsulinoma is a pancreatic neuroendocrine tumor that causes hyperinsulinemic hypoglycemia. Symptomatic hypoglycemia related to hepatic insulinoma metastases may be addressed with liver-directed therapies such as hepatic artery embolization.\n\nObjective\n\nThis work aimed to determine the safety and effectiveness of bland hepatic artery embolization (HAE) for palliation of symptomatic hypoglycemia in patients with hepatic insulinoma metastases refractory to medical management.\n\nMethods\n\nAn institutional review board–approved retrospective review was undertaken of all patients with a tissue (n = 18) or imaging (n = 2) diagnosis of hepatic insulinoma metastases and symptomatic hyperinsulinemic hypoglycemia refractory to medical management who underwent bland HAE at a single center between January 1, 1998 and November 1, 2020. Twenty patients (10 women, 10 men; mean age, 56 years; range, 18-84 years) were identified who individually underwent 1 (n = 7), 2 (n = 5), 3 (n = 5), 4 (n = 2), or 5 (n = 1) HAEs, for an overall total of 45 HAEs. Post-HAE hypoglycemia recurrence was defined as onset of adrenergic symptoms (eg, sweating, weakness, tremor), neuroglycopenic symptoms (eg, confusion, loss of consciousness), and/or documented serum glucose of less than 50 mg/dL, in the absence of an alternative explanation. Median time to first hypoglycemia recurrence, hypoglycemia-free survival (HFS), and overall survival (OS) were calculated using Kaplan-Meier method.\n\nResults\n\nBefore HAE, all patients experienced adrenergic or neuroglycopenic symptoms alleviated by glucose intake, and 60% (n = 12) of patients had documented serum glucose of less than 50 mg/dL within 1 week of the first treatment. Median post-HAE follow-up was 9.4 months (mean, 26 months; range, 0.1-190 months). Postprocedural hypoglycemic symptom relief after the first HAE was reported in 100% (n = 20) of patients before discharge or at follow-up. Post-HAE hypoglycemia recurrence occurred in 60% (n = 12) of patients with a median time to first hypoglycemia recurrence of 2 months (mean, 14 months; range, 0.2-60 months). After the first HAE, median HFS was 14.5 months, and median OS was 16 months. One patient experienced labile postprocedure blood glucose levels requiring intensive care unit admission for intravenous dextrose. Otherwise, no major procedure-related complications occurred.\n\nConclusion\n\nBland HAE is a safe, effective, and repeatable procedure for palliation of symptomatic hypoglycemia in patients with hepatic insulinoma metastases refractory to medical management.\n\nbland hepatic artery embolization\ntreatment refractory hyperinsulinemic hypoglycemia\npolyvinyl alcohol particles\nPVA\ntransarterial chemoembolization\ntranscatheter arterial\n==== Body\npmcInsulinoma is a rare, functional, insulin-producing pancreatic neuroendocrine tumor (PNET), with a reported incidence of 1 to 4 cases per million person-years [1]. Unlike nonfunctional PNETs, insulinoma may cause symptomatic hypoglycemia. Hypoglycemia symptoms are broadly categorized as neuroglycopenic or adrenergic. Neuroglycopenic symptoms include confusion, personality changes, dizziness or ataxia, weakness, and vision changes. Adrenergic symptoms are driven by catecholamine release, and may include palpitations, diaphoresis, and tremors [2]. Whipple triad outlines a set of clinical criteria used to identify endogenous hyperinsulinemic hypoglycemia and is defined by symptoms of hypoglycemia, low circulating glucose, and prompt relief of symptoms after glucose administration [3].\n\nMalignant insulinoma are even rarer, with a reported crude annual overall incidence of 0.0 to 0.27 cases per million person-years [4]. For patients with malignant insulinoma metastatic to the liver with symptomatic hyperinsulinemic hypoglycemia, offered therapies vary widely in treatment intent and discipline, from various combinations of curative to palliative interventions as provided by surgery, medicine, nuclear medicine, and radiology [5]. Liver-directed therapies control tumor burden and address severe associated hypoglycemia symptoms, the latter of which require vigilance and careful meal timing on an outpatient basis.\n\nVascular and interventional radiology treatment options include ablation for smaller hepatic lesions and hepatic artery embolization (HAE) of one or both hepatic lobes in a staged approach. Published data regarding HAE for the palliation of hypoglycemia in patients with malignant insulinoma are limited because this group of patients is often included into a broader cohort of patients with metastatic neuroendocrine tumors responsible for an array of endocrine symptoms [6].\n\nThe aim of the present study was to determine the safety and effectiveness of bland HAE for palliation of symptomatic hypoglycemia in patients with hepatic insulinoma metastases refractory to medical management.\n\nMaterials and Methods\n\nAn institutional review board–approved, HIPAA (Health Insurance Portability and Accountability Act)-compliant retrospective review identified 20 patients with hepatic insulinoma metastases and symptomatic hyperinsulinemic hypoglycemia refractory to medical management who underwent bland HAE at a single center between January 1, 1998 and November 1, 2020. Hyperinsulinemic hypoglycemia refractory to medical management was defined as persistent or recurrent hypoglycemia symptoms and/or serum glucose of less than 50 mg/dL while using a somatostatin analogue and/or diazoxide.\n\nClinical, imaging, laboratory, procedural, and follow-up data were collected from the comprehensive electronic medical record. The clinical record was reviewed for neuroglycopenic (eg, confusion, loss of consciousness) or adrenergic (eg, sweating, weakness, tremor) hypoglycemia symptoms alleviated by glucose intake. Mesenteric angiography and cross-sectional imaging were reviewed for distribution of hepatic metastases. Bilobar hepatic metastases were defined as at least 1 tumor involving the right and left hepatic lobes.\n\nFollow-up\n\nPatients were followed using available clinical encounters and operative notes as documented in the electronic medical record in addition to laboratory values. Specifically, oncology and endocrinology notes were reviewed for hypoglycemic symptom onset and timing before and after HAE. Laboratory information, including serum glucose, insulin, proinsulin, and c-peptide levels, was collected from the institutional database.\n\nOutcome Definitions\n\nTechnical success was defined as selective transcatheter HAE facilitated by pretreatment and posttreatment mesenteric angiography. Post-HAE hypoglycemia recurrence was defined on the basis of a modified Whipple triad including documented onset of symptoms (adrenergic or neuroglycopenic), and/or serum glucose of less than 50 mg/dL in the absence of an alternative explanation, such as sepsis or extrahepatic metastases. Whipple triad additionally specifies improvement in hypoglycemia symptoms after administration of glucose, although this information was not available in all patients and therefore was not used in the definition of post-HAE hypoglycemia recurrence. Hypoglycemia-free survival (HFS) was defined to include patients without hypoglycemia recurrence before the date of death. The duration of follow-up for HFS was defined from the date of the first HAE to the date of first hypoglycemia recurrence, date of death, or date the patient was last known to be alive. Overall survival (OS) was estimated for all patients. The duration of follow-up for OS was defined from the date of the first HAE to the date of death or the date the patient was last known to be alive. Complications were categorized based on the proposed Society of Interventional Radiology classification system [7].\n\nData Analysis\n\nData were analyzed using Prism 9 (GraphPad Software Inc). Descriptive statistics were generated with continuous variables presented as mean ± SD and median (range) and categorical variables as counts (proportions). Wilcoxon matched-pairs signed rank test was used to assess the difference in median 24-hour preprocedure and postprocedure glucose levels. Median time to first hypoglycemia recurrence, HFS, OS, and OS stratified by HFS less or greater than 6 weeks were calculated using the Kaplan-Meier method. Two-sided P less than .05 was considered statistically significant.\n\nResults\n\nPatient Demographics and Clinical Information\n\nTwenty patients (10 women, 10 men; mean age, 56 years [18-84 years]) who underwent HAE with bland particles were included. Metastatic disease was present at the time of initial diagnosis in 75% (n = 15) of patients, at which time all patients had bilobar hepatic metastases. Extrahepatic sites of metastasis included bone (n = 3), regional lymph nodes (n = 2), lung (n = 1), diaphragm (n = 1), breast (n = 1), and chest wall (n = 1). Liver biopsy demonstrating metastatic neuroendocrine carcinoma was performed in 90% (n = 18) of patients. Patients without biopsy-proven liver metastases (n = 2) had primary pancreatic resection with pathology-proven neuroendocrine neoplasm and abdominal MR showing hypervascular liver metastases. Biochemical evidence of an insulinoma, including inappropriately elevated serum insulin or proinsulin in the setting of hypoglycemia, was documented in 85% (n = 17) of patients. No patient in this cohort had documented multiple endocrine neoplasia, type 1.\n\nBefore the first hepatic artery embolization, all patients experienced neuroglycopenic or adrenergic symptoms alleviated by glucose intake. The most commonly reported symptoms were diaphoresis (n = 8) and confusion (n = 8), followed by fatigue (n = 7), lightheadedness (n = 6), loss of consciousness (n = 5), tremor (n = 2), nausea (n = 2), and headache (n = 1). Within 1 week before the first treatment, 60% (n = 12) of patients had documented serum glucose of less than 50 mg/dL (median, 47 mg/dL; mean, 54 ± 28.4 mg/dL; range, 15-119 mg/dL).\n\nInsulinoma Treatment History\n\nStandard Whipple and distal pancreatectomy were performed in 1 and 8 patients, respectively, or 45% (n = 9) of patients in total. In 44% of pancreatectomy patients (n = 4), metastases were present at the time of surgery. Hepatic resection was performed in 26% (n = 5) of patients, and 80% (n = 4) of hepatic resections were performed before HAE. One patient without metastases at diagnosis who underwent partial pancreatectomy later underwent open radiofrequency ablation of liver metastases, before HAE.\n\nChemotherapy was initiated in 60% (n = 12) of patients, 33% of whom (n = 4) started chemotherapy before HAE. In the 8 patients who received chemotherapy after the first HAE, 50% (n = 4) were started after the first recurrence of hypoglycemia.\n\nMedications for hypoglycemia palliation including somatostatin analogues or diazoxide were used in 75% (n = 15) of patients before the first HAE, and in 95% (n = 19) of patients overall. In patients who received medication for hypoglycemia palliation, somatostatin analogues were used in 89% (n = 17) of patients, diazoxide was used in 26% (n = 5) of patients, and everolimus was used in 21% (n = 4) of patients (Table 1).\n\nTable 1. Demographic, surgical, and clinical history in 20 patients with malignant insulinoma, at time of first hepatic artery embolization\n\nVariable\tValue\t\nSex, n (%)\t\t\n Male\t10 (50)\t\n Female\t10 (50)\t\nAge, y, mean ± SD; median\n(range)\t55.6 ± 17.2; 56.5\n(18.4-83.8)\t\nSurgery, n (%)\t\t\n Partial pancreatectomy\t8 (40)\t\n Total pancreatectomy\t1 (5)\t\n Hepatic resection\t4 (20)\t\nChemotherapy, n (%)\t\t\n Doxorubicin and streptozocin\t2 (10)\t\n Streptozocin and 5-FU, then adriamycin\t1 (5)\t\n Sunitinib\t1 (5)\t\n None\t16 (80)\t\nMedications for hypoglycemia palliation\t\t\n Somatostatin analogue\t9 (45)\t\n Diazoxide\t3 (15)\t\n Somatostatin analogue and diazoxide\t3 (15)\t\n None\t5 (25)\t\nSigns/symptoms, n (%)\t\t\n Diaphoresis\t8 (40)\t\n Confusion\t8 (40)\t\n Fatigue\t7 (35)\t\n Lightheadedness\t6 (30)\t\n Loss of consciousness\t5 (25)\t\n Tremor\t2 (10)\t\n Nausea\t2 (10)\t\n Headache\t1 (5)\t\nAbbreviation: 5-FU, 5-fluorouracil.\n\nHepatic Artery Embolization Procedure\n\nThe night before HAE, patients were admitted for blood glucose monitoring. Dextrose infusions were initiated for 85% (n = 17) of patients. One patient’s hypoglycemia was initially managed with oral glucose, although ultimately required intravenous (IV) dextrose intraprocedurally. The remaining 2 patients were maintained on their home diazoxide and frequent small meals.\n\nHAE was performed in 45 sessions. The right hepatic lobe was treated during the first HAE in 70% (n = 14) of patients, which was at the operator’s discretion based on tumor staining at the time of angiography and/or postoperative anatomy. For each patient, a median of 2 HAEs (mean, 2.3 ± 1.2; range, 1-5) were performed. In the 11 patients without prior hepatectomy who underwent at least 2 treatments, 73% (n = 8) underwent treatment of the contralateral hepatic lobe during the second treatment. Medium (250-355 μm) polyvinyl alcohol (PVA) particles were used in 93% (n = 42) of HAEs. Small PVA, large PVA, and Bead Block (300-500 μm) were each used once (Table 2).\n\nTable 2. Hepatic artery embolization details in 20 patients with insulinoma liver metastases and hyperinsulinemic hypoglycemia\n\nVariable\tValue\t\nFirst treated liver lobe, n (%)\t\t\n Right\t14 (70)\t\n Left\t6 (30)\t\nSecond treated liver lobe, n (%)\t12 (60)\t\n Right\t2 (20)\t\n Left\t10 (80)\t\nTotal No. of HAEs per patient, n (%)\t\t\n 1\t7 (35)\t\n 2\t5 (25)\t\n 3\t5 (25)\t\n 4\t2 (10)\t\n 5\t1 (5)\t\nParticle selection per HAE, n (%)\t\t\n Small PVA\t1 (2)\t\n Medium PVA\t42 (93)\t\n Large PVA\t1 (2)\t\n Bead Block, 300-500 µm\t1 (2)\t\nAbbreviations: HAE, hepatic artery embolization; PVA, polyvinyl alcohol.\n\nHypoglycemia Control\n\nPostprocedural hypoglycemic symptom relief was reported in 100% (n = 20) of patients before discharge or at follow-up after the first HAE. The median of the difference between blood glucose levels 24 hours before and after the first HAE was +72 mg/dL (P = .005). IV fluids containing dextrose given preprocedurally in 85% (n = 17) of patients were stopped either immediately postprocedure, on resumption of oral intake, or before discharge, in all patients after the first HAE. One patient, as detailed later, was discharged home on IV dextrose after the fourth HAE.\n\nMedications for hypoglycemia and/or outpatient management routines in use before the first HAE were generally continued afterward. For example, in the 75% (n = 15) of patients on medication for hypoglycemia palliation before the first HAE, 80% (n = 12) of patients were maintained on similar medication regimens. Three patients continued to manage hypoglycemia with frequent meals after the first HAE, although one of these patients was initiated on a somatostatin analogue after the third HAE. Quality of life was documented to have improved in several patients. For example, one patient was able to return to work, one patient no longer needed to eat in the middle of the night, and one patient noted higher blood glucose levels between 60 and 80 mg/dL in the morning, improved from 40 to 60 mg/dL.\n\nHypoglycemia Recurrence and Survival\n\nMedian HFS was 14.5 months (Figs. 4 and 5), wherein survival without hypoglycemia recurrence (n = 1), date of liver transplantation (n = 1), and loss to follow-up (n = 2) were classified as censor events. Median OS after the first treatment was 16 months (Fig. 6). Hypoglycemia recurrence occurred in 60% (n = 12) of patients with a median time to first hypoglycemia recurrence of 2 months (mean, 14 months; range, 0.2-60 months). In the 4 patients who underwent at least 2 HAEs and had a second hypoglycemia recurrence, median time to second hypoglycemia recurrence was 1.1 months (mean, 13 months; range, 0.5-48 months). Individual demographic, pathology, and laboratory data, and time to first recurrence and overall survival are summarized in Table 3.\n\nFigure 1. Contrast-enhanced coronal computed tomography of the abdomen demonstrating enhancing hepatic masses (arrowhead) and a hypervascular pancreatic mass (arrow).\n\nFigure 2. Selective celiac angiogram demonstrates numerous hepatic foci of tumor staining (arrowhead) in addition to a hypervascular pancreatic mass (arrow).\n\nFigure 3. Hepatic artery embolization was carried out from the right hepatic artery to stasis with excellent angiographic result on repeat selective hepatic angiogram.\n\nFigure 4. Kaplan-Meier curve of hypoglycemia free survival (months) after the first hepatic artery embolization.\n\nFigure 5. Frequency distribution of hypoglycemia-free survival (HFS) after the first hepatic artery embolization, excluding 2 patients who were lost to follow-up.\n\nFigure 6. Kaplan-Meier curve of overall survival (OS; months) after the first hepatic artery embolization.\n\nTable 3. Individual demographic, pathology, and laboratory data, and time to first recurrence and overall survival\n\nPatient\tAge at diagnosis, y\tAge at HAE 1\tPathology, liver metastasis\tTumor grade\tYear of pathology interpretation\tTotal HAEs\tSerum glucose nadirs, mg/dL\t\t\tFollow-up, mo\tTime to first recurrence, mo\tOverall survival, mo\t\n\t\t\t\t\t\t\tWithin 1 wk before HAE 1\tWithin 24 h after HAE 1\tWithin 1-6 mo after HAE 1\t\t\t\t\n1\t54\t65\tIslet cell carcinoma\tNS\t1994\t1\t40\t70\t73\t46.3\tNA\t46.2\t\n2\t57\t78\tNone\tNA\tNA\t3\t49\t47\t61\t44.2\t38.5\t44.2\t\n3\t18\t18\tIslet cell tumor\t1-2\t1998\t4\t68\t92\t57\t10.8\t8.5\t11.0\t\n4\t84\t84\tNeuroendocrine tumor\t2\t2010\t1\t38\t43\tNA\t2.2\t0.8\t3.3\t\n5\t51\t51\tNeuroendocrine carcinoma\tLow\t2000\t2\t25\t156\t105\t10.2\tNA\t14.5\t\n6\t48\t54\tNeuroendocrine carcinoma\tLow\t2006\t2\t37\t100\t70\t190.2\tNA\t190.2\t\n7\t41\t41\tNeuroendocrine neoplasm\t1\t2001\t5\t119\t104\t96\t53.9\t49.0\t54.0\t\n8\t69\t69\tIslet cell tumor\tNS\t2000\t4\t42\t86\t25\t10.2\t3.0\t11.1\t\n9\t52\t53\tNeuroendocrine carcinoma\t2\t2001\t1\t23\t86\t43\t1.4\t1.4\t9.1\t\n10\t52\t62\tNeuroendocrine carcinoma\t1\t2002\t1\t62\t65\tNA\t1.4\t0.7\t1.5\t\n11\t59\t59\tNeuroendocrine carcinoma\t2\t2005\t1\t58\t166\tNA\t0.1\tNA\t22.9\t\n12\t41\t41\tNeuroendocrine carcinoma\t1\t2005\t1\t114\t77\tNA\t1.0\tNA\t69.0\t\n13\t30\t30\tNeuroendocrine carcinoma\t3\t2015\t1\t15\t96\t125\t65.8\t59.8\t65.8\t\n14\t65\t65\tNeuroendocrine tumor\t3\t2013\t3\t40\t80\t66\t24.0\t0.2\t24.2\t\n15\t40\t40\tNeuroendocrine neoplasm\t3\t2016\t3\t49\t81\t75\t16.6\tNA\t15.6\t\n16\t62\t76\tNeuroendocrine carcinoma\t1\t2006\t2\t61\t64\t42\t6.8\t0.6\t7.8\t\n17\t60\t60\tNeuroendocrine tumor\tNS\t2000\t3\t65\t130\t59\t2.4\t1.1\t9.3\t\n18\t44\t44\tNeuroendocrine carcinoma\tNS\t2000\t2\t96\t107\t44\t3.3\t2.7\t6.4\t\n19\t70\t78\tNone\tNA\tNA\t3\t44\t74\t46\t6.4\tNA\t45.6\t\n20\t46\t46\tNeuroendocrine tumor\t3\t2020\t2\t27\t41\t94\t2.0\tNA\t2.0\t\nAbbreviations: HAE, hepatic artery embolization; NA, data not available; NS, not specified.\n\nIn patients with recurrent hypoglycemia after the first HAE, 50% (n = 6) recurred within 6 weeks with a median time to recurrence of 0.8 months, and 50% (n = 6) recurred greater than 6 weeks post-HAE with a median time to recurrence of 23.5 months. Recurrence of hypoglycemia within 6 weeks of the first HAE was associated with a median OS of 8.5 months, and recurrence greater than 6 weeks post-HAE was associated with a median OS of 32.6 months (P = .03) (Fig. 7). Demographic and therapeutic information stratified by each group is summarized in Table 4.\n\nFigure 7. Kaplan-Meier curve of overall survival (OS; months) after the first hepatic artery embolization stratified by first hypoglycemia recurrence occurring greater or less than 6 weeks (P = .03).\n\nTable 4. Demographic, surgical, and medical history in 12 patients with recurrence of hypoglycemia symptoms fewer or greater than 6 weeks after the first hepatic artery embolization\n\nVariable\tRecurrence < 6 wk\tRecurrence > 6 wk\t\nSex, n (%)\t\t\t\n Male\t4 (67)\t4 (67)\t\n Female\t2 (33)\t2 (33)\t\nAge, y, mean ± SD; median (range)\t62 ± 11.7; 60.7 (51.6-83.7)\t47 ± 22.8; 42.4 (18.4-78)\t\nTreatment before first HAE\t\t\t\nSurgery, n (%)\t\t\t\n Partial pancreatectomy\t3 (50)\t0 (0)\t\n Total pancreatectomy\t0 (0)\t1 (17)\t\n Hepatic resection\t3 (50)\t0 (0)\t\n None\t3 (50)\t5 (83)\t\nChemotherapy, n (%)\t\t\t\n Doxorubicin and streptozocin\t0 (0)\t1 (17)\t\n Streptozocin and 5-FU, then adriamycin\t1 (17)\t0 (0)\t\n None\t5 (83)\t5 (83)\t\nMedications for hypoglycemia palliation\t\t\t\n Somatostatin analogue\t4 (67)\t2 (33)\t\n Diazoxide\t0 (0)\t1 (17)\t\n Somatostatin analogue and diazoxide\t1 (17)\t0 (0)\t\n None\t1 (17)\t3 (50)\t\nTreatment before first recurrence\t\t\t\nSurgery, n (%)\t\t\t\n Partial pancreatectomy and\t0 (0)\t1 (17)\t\n  Right hepatectomy\t–\t–\t\n None\t6 (100)\t5 (83)\t\nChemotherapy, n (%)\t\t\t\n Capecitabine and temozolomide, then\t0 (0)\t1 (17)\t\n  FOLFOX and bevacizumab, then\t–\t–\t\n  Capecitabine and bevacizumab\t–\t–\t\n None\t6 (100)\t5 (83)\t\nPRRT\t\t\t\n Lutetium Lu 177 dotatate\t0 (0)\t1 (17)\t\nMedications for hypoglycemia palliation\t\t\t\n Somatostatin analogue\t6 (100)\t2 (33)\t\n Diazoxide\t0 (0)\t2 (33)\t\n Everolimus\t0 (0)\t1 (17)\t\n None\t0 (0)\t2 (33)\t\nTreatment after first recurrence\t\t\t\nChemotherapy, n (%)\t\t\t\n Streptozocin and 5-FU\t1 (17)\t1\t\n Capecitabine and temozolomide\t1 (17)\t0 (0)\t\n VIP-16 and cisplatin, then\t0 (0)\t1 (17)\t\n  Gemcitabine and interferon\t–\t–\t\n Gefitinib\t0 (0)\t1 (17)\t\n None\t4 (67)\t3 (50)\t\nMedications for hypoglycemia palliation\t\t\t\n Somatostatin analogue\t6 (100)\t6 (100)\t\n Diazoxide\t0 (0)\t1 (17)\t\n Everolimus\t1 (17)\t1 (17)\t\n Prednisone\t1 (17)\t0 (0)\t\n None\t0 (0)\t0 (0)\t\nAbbreviations: 5-FU, 5-fluorouracil; HAE, hepatic artery embolization; PRRT, peptide receptor radionuclide therapy.\n\nFollow-up\n\nMedian post-HAE follow-up was 9.4 months (mean, 26 months; range, 0.1-190 months). One patient underwent orthotopic liver transplant after HAE without recurrence of hypoglycemia symptoms. Two patients were treated with PRRT after the first HAE, before recurrence of hypoglycemic symptoms. Of the 2 patients treated with PRRT, octreotide radiolabeled with yttrium-90 was used in 1 patient, and lutetium-177 was used in the other. The patient treated with yttrium-90–radiolabeled octreotide had an overall survival of 46.2 months without recurrence of hypoglycemia, and the patient treated with lutetium-177–radiolabeled octreotide had a first recurrence of hypoglycemia symptoms at 59.8 months. One patient with recurrent hypoglycemia underwent ablation of a flank mass with resolution of symptoms, and therefore was not categorized as having had a recurrence after the first HAE. This same patient later had a recurrence of hypoglycemia symptoms and underwent hepatic artery calcium stimulation testing, which was positive, and subsequently underwent staged bilobar HAEs.\n\nComplications\n\nOut of 45 HAE sessions, there was 1 severe adverse event (2%) wherein the patient experienced labile postprocedure blood glucose levels below 50 mg/ dL and above 275 mg/dL, prompting intensive care unit admission for IV dextrose. Of note, insulin levels were 53 mcIU/mL before the procedure, 82 mcIU/ mL just after the procedure, and 29 mcIU/mL 5 days after the procedure. This patient’s admission was further complicated by hypokalemia requiring parenteral repletion and elevated ammonia levels, which were present on admission, requiring nasogastric tube placement for lactulose in the setting of hepatic encephalopathy. The patient was initially transferred from an outside facility for 2 weeks of hypoglycemia that was difficult to control, and the HAE preceding this event was the patient’s fourth treatment. The patient had a 39-day hospital stay in total and was discharged home on IV dextrose where she died 2 days later.\n\nThere were 3 mild adverse events in total (7%). Two mild adverse events occurred related to volume overload from periprocedural IV fluids requiring diuretics, which were completed in 1 case on an outpatient basis. One mild adverse event occurred in which a patient experienced flushing after contrast injection, was promptly treated with IV diphenhydramine and methylprednisolone sodium succinate, and underwent HAE without issue.\n\nPostembolization syndrome occurring after transarterial embolization includes symptoms of pain, fever, nausea, and vomiting that begin within 72 hours of solid organ embolization [8]. Postembolization symptoms were common and most frequently included right upper abdominal pain in 80% (n = 16) and fever 40% (n = 8), which were treated with fluids, antipyretics, and/or oral and parenteral opiates, as needed. Steroids were not used in any patient for management of postembolization syndrome.\n\nDiscussion\n\nThe presented data suggest that patients with malignant insulinoma and hyperinsulinemic hypoglycemia refractory to surgical and medical therapies can derive clinical benefit from bland HAE. Relief from hypoglycemia-related symptoms was not only reported by all patients before discharge or at follow-up, but also quantitatively observed within the first 24 hours with a significant increase in median blood glucose levels.\n\nRecurrence of hypoglycemia less than 6 weeks after the first HAE was associated with a significantly shorter OS, which suggests that patients with recurrence within 6 weeks of the first HAE may derive less benefit from subsequent HAEs. Unfortunately, owing to the retrospective nature of this study and the long period of time over which these patients were treated, consistent biopsy grading, including Ki-67 index assessment, is not available to correlate response, and heterogeneous imaging modalities across patients precludes comparison of hepatic tumor burden.\n\nIn this study, the mean time to first hypoglycemia recurrence of 14 months is greater than a previously reported mean of 7.5 months in a study that more broadly evaluated the use of bland HAE for metastatic carcinoid and noncarcinoid neuroendocrine tumors [9]. This comparison highlights the significant heterogeneity in the current literature both in embolization agent selection and studied neuroendocrine tumor subtypes, although the small number of retrospective studies specific to HAE for malignant insulinoma is likely accounted for by the low incidence of this entity. Available data do suggest at least a palliative effect in the use of HAE in alleviating endocrine symptoms related to not only PNETs, but malignant insulinoma [10].\n\nHAE for the indication of hyperinsulinemic hypoglycemia is primarily performed using medium-sized PVA particles at our institution. The main advantage of PVA particles over other embolic agents for the indication of hyperinsulinemic hypoglycemia is the ability to provide repeat treatments as symptoms recur. At present, no studies have conducted a prospective comparison between the 3 forms of embolotherapy for metastatic neuroendocrine tumor, precluding direct comparisons in progression-free survival, OS, and quality of life [11], and retrospective reviews have not found a statistical difference between transarterial bland and chemoembolization [9, 12]. A recent retrospective review investigated the use of transcatheter arterial chemoembolization (TACE) and radioembolization in 7 patients with malignant insulinoma similarly reported relief of hypoglycemia symptoms in 100% of patients within 1 month of HAE, in addition to a significant increase in daytime random glucose levels [13]. Additionally, Starke et al [14] described the long-term management of 10 patients with malignant insulinoma, which required frequent chemoembolizations with treatment-free intervals between TACE lasting from several weeks to several months, and a 1 month duration of response has been described with the use of gel foam in a patient with malignant insulinoma [15].\n\nThere are limitations to this study. It is a single-center, retrospective review with a small sample size, and owing to the palliative nature of the procedure, a control group is not available for comparison. This cohort of patients was also heterogeneous in the surgical and medical management preceding and following HAE, which is supported by the description of metastatic insulinoma as having a variable natural history [16]. Given these limitations, the presented data focus on areas pertinent to the palliative context, such as subjective hypoglycemic symptom improvement.\n\nPotential additional confounding factors include therapies administered after HAE such as PRRT, variability in medical hypoglycemia palliation including specific somatostatin analogue selection, and chemotherapy. These therapies may have contributed to overestimating the median time to hypoglycemia recurrence. However, the less-stringent, modified Whipple triad criteria used to define hypoglycemia recurrence in this study would be expected to underestimate the median time to first hypoglycemia recurrence because of reliance on provided clinical documentation of subjective patient symptoms. In other words, an event categorized as hypoglycemia recurrence may not necessarily reflect hypoglycemic symptom severity experienced before HAE. This study is also limited by the long study period, although variability in HAE technique over this period was minimal. For example, 49% (n = 22) of the 45 HAEs were performed by a single operator, and 93% (n = 42) were performed using medium-sized PVA.\n\nOverall, bland HAE is a safe, effective, and repeatable treatment option for palliation of symptomatic hypoglycemia in patients with hepatic insulinoma metastases refractory to medical management, especially when considered against the generally well-tolerated nature of the procedure and low adverse event rate. The presented data also suggest that patients with earlier recurrence of hypoglycemia may not derive significant benefit from additional HAEs. Potential avenues of further investigation could include standardized symptom scoring pre-HAE and post-HAE in addition to comparing tumor grade with time to recurrence of hypoglycemia symptoms.\n\nIllustrative Case\n\nA 41-year-old man initially presented with a 6-month history of increasing appetite, episodes of confusion, diaphoresis, and amnesia that tended to respond to juice. A 72-hour fasting study was aborted because of hypoglycemia, and on 2 occasions he was found to have an inappropriately elevated insulin level in the setting of hypoglycemia, initially with an insulin level of 183 mcIU/mL and a blood glucose of 37 mg/dL. An abdominal computed tomography scan demonstrated multiple liver metastases and a large enhancing pancreatic mass (Fig. 1). The patient was initiated on diazoxide, intravenous (IV) dextrose, and transferred to our institution. Liver biopsy demonstrated a metastatic, moderately well-differentiated neuroendocrine tumor. He was deemed inoperable because of vascular involvement. The patient underwent right hepatic artery embolization (HAE) in the morning (Figs. 2 and 3), and overnight blood glucose levels were elevated at 130 to 180 mg/dL while on IV 10% dextrose, which was halved from 50 cc/h to 25 cc/h and discontinued altogether by the afternoon of the next day. The patient developed expected postembolization syndrome with symptoms of right upper quadrant pain and fever. After a negative workup was completed including evaluation for multiple endocrine neoplasia, type 1 with a brain magnetic resonance scan, he was transitioned to a long-acting somatostatin analogue and discharged 6 days after HAE. The patient underwent a second stage treatment of the left hepatic lobe 1 month later without interval recurrence of symptoms. After repeat advanced imaging demonstrated stable metastatic disease, he was initiated on capecitabine and temozolomide approximately 2 months after the first HAE. Imaging obtained approximately 5 months after the initial HAE demonstrated marked progression of left hepatic liver metastases in addition to new retroperitoneal lymphadenopathy in the setting of new abdominal pain. He underwent a third HAE for palliation of abdominal pain without incident. The patient died approximately 1 year and 4 months after the initial diagnosis was made without recurrence of hypoglycemia symptoms.\n\nAcknowledgments\n\nThe team acknowledges the late Dr F. John Service.\n\nAbbreviations\n\nHAE hepatic artery embolization\n\nHFS hypoglycemia-free survival\n\nIV intravenous\n\nOS overall survival\n\nPNET pancreatic neuroendocrine tumor\n\nPRRT peptide receptor radionuclide therapy\n\nPVA polyvinyl alcohol\n\nTACE transcatheter arterial chemoembolization\n\nAdditional Information\n\nDisclosures: The authors have nothing to disclose, and no off-label drugs or devices were used.\n\nData Availability\n\nSome or all data sets generated during and/or analyzed during the present study are not publicly available but are available from the corresponding author on reasonable request.\n==== Refs\nReferences\n\n1. Service FJ , McMahonMM, O’BrienPC, BallardDJ. Functioning insulinoma—incidence, recurrence, and long-term survival of patients: a 60-year study. Mayo Clin Proc. 1991;66 (7 ):711-719.1677058\n2. Dizon AM , KowalykS, HoogwerfBJ. Neuroglycopenic and other symptoms in patients with insulinomas. Am J Med. 1999;106 (3 ):307-310.10190379\n3. van Heerden JA , EdisAJ, ServiceFJ. The surgical aspects of insulinomas. Ann Surg. 1979;189 (6 ):677-682.222222\n4. Sada A , GlasgowAE, VellaA, ThompsonGB, McKenzieTJ, HabermannEB. Malignant insulinoma: a rare form of neuroendocrine tumor. World J Surg. 2020;44 (7 ):2288-2294.32128613\n5. Pavel M , BaudinE, CouvelardA, et al ; Barcelona Consensus Conference participants. ENETS consensus guidelines for the management of patients with liver and other distant metastases from neuroendocrine neoplasms of foregut, midgut, hindgut, and unknown primary. Neuroendocrinology. 2012;95 (2 ):157-176.22262022\n6. Moertel CG , JohnsonCM, McKusickMA, et al. The management of patients with advanced carcinoid tumors and islet cell carcinomas. Ann Intern Med. 1994;120 (4 ):302-309.8291824\n7. Khalilzadeh O , BaerlocherMO, ShynPB, et al. Proposal of a new adverse event classification by the Society of Interventional Radiology Standards of Practice Committee. J Vasc Interv Radiol. 2017;28 (10 ):1432-1437.e3.28757285\n8. Leung DA , GoinJE, SicklesC, RaskayBJ, SoulenMC. Determinants of postembolization syndrome after hepatic chemoembolization. J Vasc Interv Radiol. 2001;12 (3 ):321-326.11287509\n9. Ruutiainen AT , SoulenMC, TuiteCM, et al. Chemoembolization and bland embolization of neuroendocrine tumor metastases to the liver. J Vasc Interv Radiol. 2007;18 (7 ):847-855.17609443\n10. Grozinsky-Glasberg S , KaltsasG, KaltsatouM, et al. Hepatic intra-arterial therapies in metastatic neuroendocrine tumors: lessons from clinical practice. Endocrine. 2018;60 (3 ):499-509.29383678\n11. Kennedy A , BesterL, SalemR, SharmaRA, ParksRW, RuszniewskiP; NET-Liver-Metastases Consensus Conference. Role of hepatic intra-arterial therapies in metastatic neuroendocrine tumours (NET): guidelines from the NET-Liver-Metastases Consensus Conference. HPB (Oxford). 2015;17 (1 ):29-37.25186181\n12. Pitt SC , KnuthJ, KeilyJM, et al. Hepatic neuroendocrine metastases: chemo- or bland embolization? J Gastrointest Surg. 2008;12 (11 ):1951-1960.18709512\n13. Habibollahi P , BaiHX, SanampudiS, SoulenMC, DagliM. Effectiveness of liver-directed therapy for the management of intractable hypoglycemia in metastatic insulinoma. Pancreas. 2020;49 (6 ):763-767.32541627\n14. Starke A , SaddigC, MansfeldL, et al. Malignant metastatic insulinoma-postoperative treatment and follow-up. World J Surg. 2005;29 (6 ):789-793.15880279\n15. Eriksson BK , LarssonEG, SkogseidBM, LöfbergAM, LöreliusLE, ObergKE. Liver embolizations of patients with malignant neuroendocrine gastrointestinal tumors. Cancer. 1998;83 (11 ):2293-2301.9840528\n16. Hirshberg B , CochranC, SkarulisMC, et al. Malignant insulinoma: spectrum of unusual clinical features. Cancer. 2005;104 (2 ):264-272.15937909\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2472-1972", "issue": "5(12)", "journal": "Journal of the Endocrine Society", "keywords": "PVA; bland hepatic artery embolization; polyvinyl alcohol particles; transarterial chemoembolization; transcatheter arterial; treatment refractory hyperinsulinemic hypoglycemia", "medline_ta": "J Endocr Soc", "mesh_terms": null, "nlm_unique_id": "101697997", "other_id": null, "pages": "bvab149", "pmc": null, "pmid": "34877442", "pubdate": "2021-12-01", "publication_types": "D016428:Journal Article", "references": "8291824;9840528;32541627;15880279;29383678;25186181;11287509;222222;18709512;15937909;1677058;28757285;10190379;22262022;32128613;17609443", "title": "Hepatic Artery Embolization for Palliation of Symptomatic Hypoglycemia in Patients With Hepatic Insulinoma Metastases.", "title_normalized": "hepatic artery embolization for palliation of symptomatic hypoglycemia in patients with hepatic insulinoma metastases" }
[ { "companynumb": "US-009507513-2201USA005513", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "TEMOZOLOMIDE" }, "drugadditional": "4", ...
{ "abstract": "Cardiac amyloidosis is a manifestation of amyloidosis which is a multisystem disorder. This is difficult to diagnose, rare disease which eventually leads to the mortality. Diagnosis requires a high index of clinical suspicion along with echocardiographic clues like, diastolic dysfunction, bi-atrial enlargement and ventricular thickening. Treatment is mainly supportive with disappointing outcomes. We present a case of systemic amyloidosis with negative congo red staining, presenting with predominantly cardiac features.", "affiliations": "Junior Interventional Cardiologist, Department of Cardiology, Fortis Hospital, Bengaluru, Karnataka, India.;DNB Cardiology Resident, Department of Cardiology, Fortis Hospital, Bengaluru, Karnataka, India.;Non Invasive Cardiologist, Department of Cardiology, Fortis Hospital, Bengaluru, Karnataka, India.;DNB Cardiology Resident, Department of Cardiology, Fortis Hospital, Bengaluru, Karnataka, India.;Consultant Interventional Cardiologist, Department of Cardiology, Fortis Hospital, Bengaluru, Karnataka, India.", "authors": "Magesh|B|B|;Kadeli|Deepak|D|;Bohra|Sunil|S|;Krishnaprasath|V|V|;Keshava|R|R|", "chemical_list": null, "country": "India", "delete": false, "doi": "10.7860/JCDR/2017/24698.9661", "fulltext": null, "fulltext_license": null, "issn_linking": "0973-709X", "issue": "11(4)", "journal": "Journal of clinical and diagnostic research : JCDR", "keywords": "Bi-atrial enlargement; Congo red staining; Macroglossia; Ventricular thickening", "medline_ta": "J Clin Diagn Res", "mesh_terms": null, "nlm_unique_id": "101488993", "other_id": null, "pages": "OD14-OD15", "pmc": null, "pmid": "28571197", "pubdate": "2017-04", "publication_types": "D002363:Case Reports", "references": "21755769;12802585;22949539;23678221;8434166;16186440;18036445;25793032;21749890;20165547;18973119;27012134;21193707", "title": "Cardiac Amyloidosis, An Infiltrative Heart Disease Presenting as Arrhythmia-A Case Report.", "title_normalized": "cardiac amyloidosis an infiltrative heart disease presenting as arrhythmia a case report" }
[ { "companynumb": "IN-CELGENEUS-IND-20170500916", "fulfillexpeditecriteria": "1", "occurcountry": "IN", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "DEXAMETHASONE" }, "drugadditional": null,...
{ "abstract": "The thalamocortical network appears to play a pivotal role in ictogenesis. We herein present three cases of non-convulsive status epilepticus (SE), in adult patients without previous history of epilepsy or seizures, precipitated by acute thalamic vascular and metabolic-induced lesions. In all cases the EEG showed patterns consistent with generalized SE confirmed either by a fast and complete clinical and EEG response to anti-seizure medication or definitive subtle motor signs consistent with SE. We argue that the subcortical disruption of thalamocortical networks due to the thalamic lesion predisposed to the occurrence of non-convulsive SE. In patients with thalamic disorders and unexplained mental status changes EEG evaluation should always be considered.", "affiliations": "Department of Neurosciences and Mental Health, Hospital de Santa Maria, Centro Hospitalar Universitário Lisboa Norte, Lisboa, Portugal. Electronic address: sara.parreira@chln.min-saude.pt.;Department of Neurosciences and Mental Health, Hospital de Santa Maria, Centro Hospitalar Universitário Lisboa Norte, Lisboa, Portugal.;EEG/Sleep Laboratory, Department of Neurosciences and Mental Health, Hospital de Santa Maria, Centro Hospitalar Universitário Lisboa Norte, Lisboa, Portugal; Univ Lisboa, Fac Med, Clin Univ Neurol, Lisboa, Portugal; Centro de Referência para Epilepsias Refratárias do CHULN, Member of ERN EpiCare, Portugal.;EEG/Sleep Laboratory, Department of Neurosciences and Mental Health, Hospital de Santa Maria, Centro Hospitalar Universitário Lisboa Norte, Lisboa, Portugal; Univ Lisboa, Fac Med, Clin Univ Neurol, Lisboa, Portugal; Centro de Referência para Epilepsias Refratárias do CHULN, Member of ERN EpiCare, Portugal.;EEG/Sleep Laboratory, Department of Neurosciences and Mental Health, Hospital de Santa Maria, Centro Hospitalar Universitário Lisboa Norte, Lisboa, Portugal; Univ Lisboa, Fac Med, Clin Univ Neurol, Lisboa, Portugal; Centro de Referência para Epilepsias Refratárias do CHULN, Member of ERN EpiCare, Portugal.", "authors": "Parreira|Sara|S|;Abreu|Luís|L|;Franco|Ana|A|;Bentes|Carla|C|;Peralta|Ana Rita|AR|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1016/j.seizure.2021.02.033", "fulltext": null, "fulltext_license": null, "issn_linking": "1059-1311", "issue": "89()", "journal": "Seizure", "keywords": "Acute symptomatic seizures; Generalized seizures; Non-convulsive status epilepticus; Thalamocortical network", "medline_ta": "Seizure", "mesh_terms": "D000328:Adult; D004569:Electroencephalography; D006801:Humans; D001523:Mental Disorders; D012640:Seizures; D013226:Status Epilepticus; D013788:Thalamus", "nlm_unique_id": "9306979", "other_id": null, "pages": "1-4", "pmc": null, "pmid": "33932837", "pubdate": "2021-07", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Non-convulsive status epilepticus induced by acute thalamic lesions: A report of three cases.", "title_normalized": "non convulsive status epilepticus induced by acute thalamic lesions a report of three cases" }
[ { "companynumb": "PT-UCBSA-2021030607", "fulfillexpeditecriteria": "1", "occurcountry": "PT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "METHYLPREDNISOLONE" }, "drugadditional": "3", ...
{ "abstract": "In the course of an uncomplicated sigmoidostomy a 63-year-old male who had severe comorbidity developed a critical bleeding due to dabigatran intoxication induced by acute kidney injury. Massive blood transfusions, tranexamic acid, Octaplex and haemodialysis were not effective. Administration of idarucizumab induced immediate clinical and paraclinical improvement. Dabigatran should be carefully administrated in patients who have any degree of renal insufficiency. Idarucizumab may be effective in severe bleeding caused by dabigatran.", "affiliations": "christinagpoulsen@gmail.com.", "authors": "Poulsen|Christina Gjerlev|CG|;Bestle|Morten|M|;Boesby|Lene|L|", "chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D000931:Antidotes; D000991:Antithrombins; C000594745:idarucizumab; D000069604:Dabigatran", "country": "Denmark", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0041-5782", "issue": "179(7)", "journal": "Ugeskrift for laeger", "keywords": null, "medline_ta": "Ugeskr Laeger", "mesh_terms": "D058186:Acute Kidney Injury; D061067:Antibodies, Monoclonal, Humanized; D000931:Antidotes; D000991:Antithrombins; D000069604:Dabigatran; D062787:Drug Overdose; D006470:Hemorrhage; D006801:Humans; D008297:Male; D008875:Middle Aged; D013916:Thrombelastography", "nlm_unique_id": "0141730", "other_id": null, "pages": null, "pmc": null, "pmid": "28397672", "pubdate": "2017-02-13", "publication_types": "D002363:Case Reports", "references": null, "title": "Successful treatment of severe dabigatran intoxication with idarucizumab in a patient with acute kidney injury.", "title_normalized": "successful treatment of severe dabigatran intoxication with idarucizumab in a patient with acute kidney injury" }
[ { "companynumb": "DK-MYLANLABS-2019M1000853", "fulfillexpeditecriteria": "1", "occurcountry": "DK", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "TRANEXAMIC ACID" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nThere is a major lack of randomized controlled trials (RCTs) evaluating the effects of hydrocortisone (HC) substitution therapy in patients with secondary adrenal insufficiency. Therefore, we evaluated the effects of two different replacement doses of HC on health-related quality of life (HRQoL) in a RCT.\n\n\nMETHODS\nThis RCT with a double-blind cross-over design was performed at the University Medical Center Groningen. Forty-seven patients (29 men, age 51 ± 14 years, range 19-73 years) with secondary adrenal insufficiency participated. Patients received both a lower and a higher dose of HC (0.2-0.3 and 0.4-0.6 mg/kg body weight/day) for 10 weeks in random order. HRQoL was assessed with a daily mood and symptom checklist (Patient Health Questionnaire-15 [PHQ-15], Generalized Anxiety Disorder-7 [GAD-7], Patient Health Questionnaire-9 [PHQ-9]) and with questionnaires assessing general well-being (RAND 36-Item Health Survey [RAND-36]), mood (Hospital Anxiety and Depression Scale [HADS]) and fatigue (Multidimensional Fatigue Inventory-20 [MFI-20]). ClinicalTrials.gov identifier: NCT01546922.\n\n\nRESULTS\nPatients receiving the higher dose of HC reported significantly fewer symptoms of depression (p = 0.016 and p = 0.045 for HADS and PHQ-9, respectively), less general and mental fatigue (p = 0.004 and p = 0.003, respectively, both MFI-20), increased motivation (p = 0.021, MFI-20), better physical functioning (p = 0.041), better general health (p = 0.013) and more vitality (p = 0.025) (all RAND-36). In addition, while on the higher dose, fewer somatic symptoms (p = 0.022) and less pain (p < 0.001) (both PHQ-15) were experienced.\n\n\nCONCLUSIONS\nOn the higher dose of HC, patients reported a better HRQoL on various domains as compared to the lower dose of HC. The fact that a higher dose of HC may improve patient well-being should be taken into consideration when individualizing the HC substitution dose.", "affiliations": "Department of Endocrinology, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands.", "authors": "Werumeus Buning|Jorien|J|;Brummelman|Pauline|P|;Koerts|Janneke|J|;Dullaart|Robin P F|RP|;van den Berg|Gerrit|G|;van der Klauw|Melanie M|MM|;Sluiter|Wim J|WJ|;Tucha|Oliver|O|;Wolffenbuttel|Bruce H R|BH|;van Beek|André P|AP|", "chemical_list": "D000893:Anti-Inflammatory Agents; D006854:Hydrocortisone", "country": "Switzerland", "delete": false, "doi": "10.1159/000442985", "fulltext": null, "fulltext_license": null, "issn_linking": "0028-3835", "issue": "103(6)", "journal": "Neuroendocrinology", "keywords": null, "medline_ta": "Neuroendocrinology", "mesh_terms": "D000309:Adrenal Insufficiency; D000328:Adult; D000368:Aged; D000893:Anti-Inflammatory Agents; D018592:Cross-Over Studies; D003866:Depressive Disorder; D004311:Double-Blind Method; D005260:Female; D006801:Humans; D006854:Hydrocortisone; D008297:Male; D008875:Middle Aged; D010146:Pain; D011788:Quality of Life; D018709:Statistics, Nonparametric", "nlm_unique_id": "0035665", "other_id": null, "pages": "771-8", "pmc": null, "pmid": "26646751", "pubdate": "2016", "publication_types": "D016428:Journal Article; D016449:Randomized Controlled Trial", "references": null, "title": "Hydrocortisone Dose Influences Pain, Depressive Symptoms and Perceived Health in Adrenal Insufficiency: A Randomized Controlled Trial.", "title_normalized": "hydrocortisone dose influences pain depressive symptoms and perceived health in adrenal insufficiency a randomized controlled trial" }
[ { "companynumb": "NL-SEBELA IRELAND LIMITED-2016SEB01507", "fulfillexpeditecriteria": "1", "occurcountry": "NL", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "HYDROCORTISONE" }, "drugaddition...
{ "abstract": "BACKGROUND\nTubular dysfunction is prevalent among kidney transplant patients using calcineurin inhibitors, but our knowledge of the tubular effects of mTOR inhibitors is more limited.\n\n\nMETHODS\n60 kidney transplant outpatients using either the calcineurin inhibitor tacrolimus or the mTOR inhibitor sirolimus were investigated for renal tubular dysfunction. Proximal tubule function was assessed by quantification of albumin and β2-microglobulin, tubular reabsorption of phosphate and fractional excretion of bicarbonate. Distal tubular function was evaluated by water deprivation test and by urinary acidification test using furosemide and fludrocortisone for pH, ammonium and titratable acidity measurements.\n\n\nRESULTS\nThe prevalence of distal renal tubular acidosis (dRTA) was 17% for both treatment groups. 70% of patients treated with sirolimus and 94% using tacrolimus presented with urine concentrating defect (p=0.04).\n\n\nCONCLUSIONS\nDistal RTA and urine concentrating defect were highly prevalent after kidney transplantation both in the sirolimus and tacrolimus treated patients. Acidification test was essential for the appropriate diagnosis of dRTA while dipstick urine specific gravity test was able to detect urine concentrating defect in this population.", "affiliations": null, "authors": "Banhara|Pedro B|PB|;Gonçalves|Renato T|RT|;Rocha|Pedro T|PT|;Delgado|Alvimar G|AG|;Leite|Maurilo|M|;Gomes|Carlos P|CP|", "chemical_list": "D007166:Immunosuppressive Agents; D020123:Sirolimus; D016559:Tacrolimus", "country": "Germany", "delete": false, "doi": "10.5414/CN108541", "fulltext": null, "fulltext_license": null, "issn_linking": "0301-0430", "issue": "83(6)", "journal": "Clinical nephrology", "keywords": null, "medline_ta": "Clin Nephrol", "mesh_terms": "D000141:Acidosis, Renal Tubular; D000328:Adult; D005260:Female; D006801:Humans; D006863:Hydrogen-Ion Concentration; D007166:Immunosuppressive Agents; D016030:Kidney Transplantation; D007684:Kidney Tubules; D008297:Male; D008875:Middle Aged; D020123:Sirolimus; D016559:Tacrolimus", "nlm_unique_id": "0364441", "other_id": null, "pages": "331-7", "pmc": null, "pmid": "25943142", "pubdate": "2015-06", "publication_types": "D016428:Journal Article", "references": null, "title": "Tubular dysfunction in renal transplant patients using sirolimus or tacrolimus.", "title_normalized": "tubular dysfunction in renal transplant patients using sirolimus or tacrolimus" }
[ { "companynumb": "BR-ASTELLAS-2015US018502", "fulfillexpeditecriteria": "1", "occurcountry": "BR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "TACROLIMUS" }, "drugadditional": null, ...
{ "abstract": "The observation that several Mexican-American women were taking oral hypoglycaemic agents while pregnant led to a study to confirm reports of associations between these agents and congenital abnormalities. 20 non-insulin-dependent (NIDDM) pregnant diabetic women with exposure to oral hypoglycaemic drugs during embryogenesis and 40 pregnant NIDDM women matched for age, race, parity, weight, and glycaemic control but not exposed to oral hypoglycaemic drugs were followed up. 10 infants (50%) in the exposed group had congenital malformations, compared with only 6 (15%) in the control group (p less than 0.002). 5 (25%) infants in the exposed group had ear malformations, anomalies not commonly described in diabetic embryopathy. Hyperbilirubinemia (p less than 0.04), polycythaemia, and hyperviscosity requiring partial exchange transfusions (p less than 0.03) were commoner among babies in the exposed than in the control group. 3 babies in the exposed group but none in the comparison group had severe prolonged neonatal hypoglycaemia lasting 2, 4, and 7 days; 2 of the 3 had been exposed for 22 and 28 weeks during gestation, whereas the third had been exposed throughout the first trimester. Although exposure to oral hypoglycaemic drugs during fetal life seems to be associated with congenital malformations and neonatal hypoglycaemia, a large, prospective study is needed to exclude the confounding effect of maternal metabolic derangement secondary to diabetes.", "affiliations": "Department of Obstetrics and Gynecology, Naval Hospital, San Diego, California.", "authors": "Piacquadio|K|K|;Hollingsworth|D R|DR|;Murphy|H|H|", "chemical_list": "D007004:Hypoglycemic Agents", "country": "England", "delete": false, "doi": "10.1016/0140-6736(91)91512-s", "fulltext": null, "fulltext_license": null, "issn_linking": "0140-6736", "issue": "338(8771)", "journal": "Lancet (London, England)", "keywords": null, "medline_ta": "Lancet", "mesh_terms": "D000014:Abnormalities, Drug-Induced; D000328:Adult; D003924:Diabetes Mellitus, Type 2; D005260:Female; D006801:Humans; D006932:Hyperbilirubinemia; D007003:Hypoglycemia; D007004:Hypoglycemic Agents; D007231:Infant, Newborn; D008431:Maternal-Fetal Exchange; D011086:Polycythemia; D011247:Pregnancy; D011261:Pregnancy Trimester, First; D011254:Pregnancy in Diabetics", "nlm_unique_id": "2985213R", "other_id": null, "pages": "866-9", "pmc": null, "pmid": "1681225", "pubdate": "1991-10-05", "publication_types": "D016428:Journal Article", "references": null, "title": "Effects of in-utero exposure to oral hypoglycaemic drugs.", "title_normalized": "effects of in utero exposure to oral hypoglycaemic drugs" }
[ { "companynumb": "AU-ALKEM LABORATORIES LIMITED-AU-ALKEM-2018-04097", "fulfillexpeditecriteria": "2", "occurcountry": "AU", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "METFORMIN HYDROCHLORIDE" }, ...
{ "abstract": "OBJECTIVE\nAll women with CHD, especially those with more severe disease, should be offered preconception counseling (PCC), to discuss the risk of complications and to plan a future pregnancy. Several scoring system have been devised to estimate the risk of adverse events in pregnancies complicated by maternal heart disease (HD) and while comparisons have been made across the whole population, none have focused on the high-risk population.\n\n\nMETHODS\nRetrospective cohort study that included women classed as modified WHO (mWHO) 3 and 4 who had a pregnancy from at least 20weeks gestation between 1994 and 2015 managed within our institution. We assessed how well the quoted risk (at PCC) of an adverse event (maternal or fetal) related to the actual rate of occurrence. We calculated NYHA and CARPREG scores for all patients, and the clinician assessment of percentage risk, to predict the occurrence of an adverse outcome.\n\n\nRESULTS\nWe identified 76 mWHO 3 and 4 women who had a total of 102 pregnancies. However, only in 63 pregnancies had the woman attended PCC. Both maternal and fetal adverse events were common. NYHA did not significantly predict any adverse events, whilst a CARPREG score of >3 score predicted heart failure and mWHO4 score predicted maternal death. However, the best prediction of adverse outcomes was a composite quoted risk (percent) given at PCC.\n\n\nCONCLUSIONS\nWomen must have access to PCC as those with worse CARPREG and mWHO scores encounter greater adverse events.", "affiliations": "Academic Department of Obstetrics and Gynaecology, Imperial College London, Chelsea and Westminster Hospital, 369 Fulham Road, London SW10 9NH, UK. Electronic address: mrc100@ic.ac.uk.;Adult Congenital Heart Centre, The National Heart and Lung Institute, Imperial College London, Royal Brompton Hospital, Sydney Street, London SW3 6NP, UK.;Adult Congenital Heart Centre, The National Heart and Lung Institute, Imperial College London, Royal Brompton Hospital, Sydney Street, London SW3 6NP, UK.;Adult Congenital Heart Centre, The National Heart and Lung Institute, Imperial College London, Royal Brompton Hospital, Sydney Street, London SW3 6NP, UK.;Academic Department of Obstetrics and Gynaecology, Imperial College London, Chelsea and Westminster Hospital, 369 Fulham Road, London SW10 9NH, UK.;Adult Congenital Heart Centre, The National Heart and Lung Institute, Imperial College London, Royal Brompton Hospital, Sydney Street, London SW3 6NP, UK.;Academic Department of Obstetrics and Gynaecology, Imperial College London, Chelsea and Westminster Hospital, 369 Fulham Road, London SW10 9NH, UK. Electronic address: mark.johnson@imperial.ac.uk.", "authors": "Cauldwell|Matthew|M|;Ghonim|Sarah|S|;Uebing|Anselm|A|;Swan|Lorna|L|;Steer|Philip J|PJ|;Gatzoulis|Michael|M|;Johnson|Mark R|MR|", "chemical_list": null, "country": "Netherlands", "delete": false, "doi": "10.1016/j.ijcard.2017.02.003", "fulltext": null, "fulltext_license": null, "issn_linking": "0167-5273", "issue": "234()", "journal": "International journal of cardiology", "keywords": "Counseling; Preconception; Pregnancy; Risk prediction; mWHO3; mWHO4", "medline_ta": "Int J Cardiol", "mesh_terms": "D000328:Adult; D015331:Cohort Studies; D037001:Directive Counseling; D005260:Female; D006331:Heart Diseases; D006801:Humans; D016742:Preconception Care; D011247:Pregnancy; D011249:Pregnancy Complications, Cardiovascular; D018566:Pregnancy, High-Risk; D011379:Prognosis; D012189:Retrospective Studies; D018570:Risk Assessment; D012720:Severity of Illness Index; D006113:United Kingdom", "nlm_unique_id": "8200291", "other_id": null, "pages": "76-80", "pmc": null, "pmid": "28238509", "pubdate": "2017-05-01", "publication_types": "D016428:Journal Article", "references": null, "title": "Preconception counseling, predicting risk and outcomes in women with mWHO 3 and 4 heart disease.", "title_normalized": "preconception counseling predicting risk and outcomes in women with mwho 3 and 4 heart disease" }
[ { "companynumb": "GB-MYLANLABS-2017M1028515", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ENOXAPARIN SODIUM" }, "drugadditional": "3", ...
{ "abstract": "BACKGROUND\nAn autoimmune disease is characterized by tissue damage, caused by self-reactivity of different effector mechanisms of the immune system, namely antibodies and T cells. All autoimmune diseases, to some extent, have implications for fertility and obstetrics. Currently, due to available treatments and specialised care for pregnant women with autoimmune disease, the prognosis for both mother and child has improved significantly. However these pregnancies are always high risk. The purpose of this study is to analyse the fertility/pregnancy process of women with systemic and organ-specific autoimmune diseases and assess pathological and treatment implications.\n\n\nMETHODS\nThe authors performed an analysis of the clinical records and relevant obstetric history of five patients representing five distinct autoimmune pathological scenarios, selected from Autoimmune Disease Consultation at the Hospital of Braga, and reviewed the literature.\n\n\nRESULTS\nThe five clinical cases are the following: Case 1-28 years old with systemic lupus erythematosus, and clinical remission of the disease, under medication with hydroxychloroquine, prednisolone and acetylsalicylic acid, with incomplete miscarriage at 7 weeks of gestation without signs of thrombosis. Case 2-44 years old with history of two late miscarriages, a single preterm delivery (33 weeks) and multiple thrombotic events over the years, was diagnosed with antiphospholipid syndrome after acute myocardial infarction. Case 3-31 years old with polymyositis, treated with azathioprine for 3 years with complete remission of the disease, took the informed decision to get pregnant after medical consultation and full weaning from azathioprine, and gave birth to a healthy term new-born. Case 4-38 years old pregnant woman developed Behcet's syndrome during the final 15 weeks of gestation and with disease exacerbation after delivery. Case 5-36 years old with autoimmune thyroiditis diagnosed during her first pregnancy, with difficult control over the thyroid function over the years and first trimester miscarriage, suffered a second miscarriage despite clinical stability and antibody regression.\n\n\nCONCLUSIONS\nAs described in literature, the authors found a strong association between autoimmune disease and obstetric complications, especially with systemic lupus erythematosus, antiphospholipid syndrome and autoimmune thyroiditis.", "affiliations": "Autoimmune Disease Unit, Department of Internal Medicine, Hospital of Braga, Braga, Portugal. vaniagomes84@gmail.com.;Life and Health Sciences Research Institute, School of Health Sciences, University of Minho, Campus Gualtar, 4710-057, Braga, Portugal. amfm.mes@gmail.com.;Autoimmune Disease Unit, Department of Internal Medicine, Hospital of Braga, Braga, Portugal. carloscapela@ecsaude.uminho.pt.", "authors": "Gomes|Vânia|V|;Mesquita|Alexandra|A|;Capela|Carlos|C|", "chemical_list": "D007166:Immunosuppressive Agents", "country": "England", "delete": false, "doi": "10.1186/s13104-015-1177-x", "fulltext": "\n==== Front\nBMC Res NotesBMC Res NotesBMC Research Notes1756-0500BioMed Central London 26040452117710.1186/s13104-015-1177-xCase ReportAutoimmune diseases and pregnancy: analysis of a series of cases Gomes Vânia vaniagomes84@gmail.com Mesquita Alexandra amfm.mes@gmail.com Capela Carlos carloscapela@ecsaude.uminho.pt Autoimmune Disease Unit, Department of Internal Medicine, Hospital of Braga, Braga, Portugal Life and Health Sciences Research Institute, School of Health Sciences, University of Minho, Campus Gualtar, 4710-057 Braga, Portugal 4 6 2015 4 6 2015 2015 8 21629 3 2014 19 5 2015 © Gomes et al. 2015\nOpen AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nAn autoimmune disease is characterized by tissue damage, caused by self-reactivity of different effector mechanisms of the immune system, namely antibodies and T cells. All autoimmune diseases, to some extent, have implications for fertility and obstetrics. Currently, due to available treatments and specialised care for pregnant women with autoimmune disease, the prognosis for both mother and child has improved significantly. However these pregnancies are always high risk. The purpose of this study is to analyse the fertility/pregnancy process of women with systemic and organ-specific autoimmune diseases and assess pathological and treatment implications.\n\nMethods\nThe authors performed an analysis of the clinical records and relevant obstetric history of five patients representing five distinct autoimmune pathological scenarios, selected from Autoimmune Disease Consultation at the Hospital of Braga, and reviewed the literature.\n\nResults\nThe five clinical cases are the following: Case 1–28 years old with systemic lupus erythematosus, and clinical remission of the disease, under medication with hydroxychloroquine, prednisolone and acetylsalicylic acid, with incomplete miscarriage at 7 weeks of gestation without signs of thrombosis. Case 2–44 years old with history of two late miscarriages, a single preterm delivery (33 weeks) and multiple thrombotic events over the years, was diagnosed with antiphospholipid syndrome after acute myocardial infarction. Case 3–31 years old with polymyositis, treated with azathioprine for 3 years with complete remission of the disease, took the informed decision to get pregnant after medical consultation and full weaning from azathioprine, and gave birth to a healthy term new-born. Case 4–38 years old pregnant woman developed Behcet’s syndrome during the final 15 weeks of gestation and with disease exacerbation after delivery. Case 5–36 years old with autoimmune thyroiditis diagnosed during her first pregnancy, with difficult control over the thyroid function over the years and first trimester miscarriage, suffered a second miscarriage despite clinical stability and antibody regression.\n\nConclusions\nAs described in literature, the authors found a strong association between autoimmune disease and obstetric complications, especially with systemic lupus erythematosus, antiphospholipid syndrome and autoimmune thyroiditis.\n\nKeywords\nAutoimmune diseaseFertilityMiscarriageSystemic lupus erythematosusAntiphospholipid syndromePolymyositisAutoimmune thyroiditisBehcet’s diseaseissue-copyright-statement© The Author(s) 2015\n==== Body\nBackground\nAn autoimmune disease (AID) is characterised by tissue damage, caused by self-reactivity of different effectors mechanisms of the immune system, namely antibodies and T cells. Its occurrence may be associated with genetic and/or environmental predisposition. There is an activation of the adaptive immune response with tissue damage and inflammation in the absence of any infection, exposure to toxins or tumour growth [1]. Although, individually, each AID affects a small number of individuals, as a whole, it is estimated that its prevalence is between 7.6 and 9.4% [2]. All AIDs, to some extent, have implications for fertility and obstetrics. In the general population, about 80% of miscarriages occur in the first 12 weeks of pregnancy and the risk of miscarriage in those under the age of 35 is about 10% while it is about 45% in those over the age of 40 [3].\n\nPregnancy and AID\nMost AIDs occur frequently in women and should they appear at childbearing age, they pose a potential risk for almost all aspects of reproduction, from fertility to pregnancy itself (Table 1) [4–8]. In the past, it was suggested that women with certain AIDs [particularly systemic lupus erythematosus (SLE)/antiphospholipid syndrome (APS)] should avoid pregnancy. Currently, due to available treatments and specialised care for pregnant women with AID, the prognosis for both mother and child has improved significantly [4, 7, 9]. However, these pregnancies are always high risk, often associated with foetal loss in the first trimester, preeclampsia/eclampsia, intrauterine growth restriction, premature rupture of membranes, placental insufficiency, pre-term birth, caesarean delivery and low birth weight [4, 5, 9]. The overall principle, common to all AIDs, is planning the pregnancy for the remission phase of the disease, in addition to all the care necessary for a successful pregnancy [9].Table 1 Available information on fertility and miscarriage rates in autoimmune diseases (adapted from Carp et al. [5])\n\nDisease\tFertility\tMiscarriage\t\nAntiphospolipidic syndrome\tNew tudies suggest a role played by aAP in infertility pathogenesis\tReported recurrent foetal loss with a 10–19% frequency\t\nAutoimmune thyroiditis\tAntibodies associated with increased risk of infertility\tAntibodies associated with increased risk of miscarriages (recurrent)\t\nSystemic lupus erythematosus\tNo increased risk of infertility\taAP are the main miscarriage risk factor and are present in 34%\t\n\naAP antiphospholipid antibodies.\n\n\n\nGoal\nThe purpose of this study is to analyse the fertility/pregnancy process of women with AID and assess the pathological and treatment implications.\n\nSystemic AIDs\nSystemic lupus erythematosus\nSLE is a complex AID with varied clinical manifestations and developments. It is characterised by the presence of antinuclear autoantibodies (ANA), anti-DNA, anti-RNA, anti-Ro/SSA and anti-La/SSB autoantibodies (among others), immune complex deposition and damages to target organs, especially kidneys, skin and joints. It is associated with a significant mortality rate [10]. Immunological mechanisms involved include defects in the removal of immune complexes, apoptosis and antigen presentation. The treatment may be topical (sunscreen and corticosteroids) or systemic, with anti-inflammatory drugs (non-steroidal anti-inflammatory drugs, salicylates) or immunosuppressors (hydroxychloroquine, methotrexate, corticosteroids, cyclophosphamide, mycophenolate mofetil, azathioprine, biological therapy) [11].\n\nAntiphospholipid syndrome\nAPS is defined by the presence of at least one clinical manifestation (venous/arterial thrombosis or obstetric complications) and antiphospholipid antibodies (aAP). aAPs are part of a set of antibodies that recognise negatively charged plasma proteins and include anti-cardiolipin, anti-β-2 glycoprotein and lupus anticoagulant antibodies, among others [4]. It also causes skin and cardiac valves lesions and changes in neurological, renal and haematological functions [12]. This syndrome can be primary or occur in association with other systemic diseases, especially SLE [9]. Many individuals are aAP positive without presenting any symptoms and may develop this syndrome. The prevention of the morbidity associated with APS requires an assessment of the risk of thrombosis and the evaluation of the benefits of antithrombotic therapy, which must be performed individually, taking into account the immunological profile and background [12].\n\nPolymyositis (PM)/dermatomyositis (DM)\nPolymyositis with/without dermatomyositis is an inflammatory myopathy which begins by symmetrically affecting the proximal muscles, is characterised by an increase in the levels of muscle enzymes (creatine kinase/aldolase), electrophysiological changes and characteristic histological findings. These myopathies may involve the muscles that control breathing and swallowing, the heart (pericarditis, cardiomyopathy and heart failure) or the lungs (complications arising from aspiration, interstitial lung disease and pulmonary hypertension). DM also includes skin changes. While PM is mediated by T cells (CD8+), DM is a vascular disorder, mediated by autoantibodies. The first-line treatment of PM/DM is corticosteroid therapy, and it may call for the administration of other immunosuppressive drugs (azathioprine or methotrexate), to which DM responds better [1].\n\nVasculitis\nVasculitis, an immune-mediated disease, is potentially fatal, especially when it affects medium or large calibre vessels. On the one hand, it can cause aneurysms, ruptures and haemorrhages and on the other, it may lead to luminal stenosis with obstruction, tissue ischemia or infarction. There are three major categories of systemic vasculitis: large-, medium- and small-vessel vasculitis. Its accurate diagnosis is difficult and requires clinical, pathological and laboratory data, crucial for an appropriate diagnosis and therapy [11].\n\nBehcet’s disease (BD) is a multisystem vasculitis, characterised by orogenital ulcers, uveitis and skin lesions. It may also affect the gastrointestinal tract, joints, the central nervous system or the cardiovascular system. Venous or arterial thrombosis may occur due to endothelial dysfunction and hypercoagulability. Its diagnosis is primarily clinical, although a positive Pathergy test is a classic indicator of the disease. Its treatment differs and may be topical (corticosteroids) or systemic (corticosteroids, anti-TNF-α) [13–15].\n\nOrgan-specific AIDs\nAutoimmune thyroiditis (AIT)\n90% of non-iatrogenic hypothyroidism in countries without iodine deficiency occurs due to autoimmunity and it is a prevalent condition in women of childbearing age [1, 5, 16]. There are several types of AITs, of which the most noteworthy is Hashimoto’s thyroiditis, characterised by the presence of high levels of antithyroglobulin and anti-thyroid peroxidase antibodies in the presence of hypothyroidism. Available treatment consists of hormone replacement with exogenous thyroxin.\n\nMethods\nThe authors performed a systematic literature review and an analysis of the clinical records and relevant obstetric history of 5 patients with AID, representing five distinct AID pathological scenarios, selected from AID Consultation at the Hospital of Braga.\n\nResults and discussion\nThe following are the descriptions and analysis of a series of five clinical cases.\n\nCase 1: systemic lupus erythematosus\nA 28 years old Brazilian citizen was diagnosed with SLE in 2010 after the appearance of osteoarticular, vascular, ocular and haematological signs/symptoms. aAP were all negative and the liver was never affected. After stabilisation, she was subjected to a regular treatment with prednisolone (10 mg/day) and hydroxychloroquine (400 mg/day)—with periods of intensification of the immunosuppressive dosage due to discoid lupus lesions. The last exacerbation of skin lesions was on December 2012. She first planned pregnancy in March 2013, under medication with hydroxychloroquine 400 mg/day, prednisolone 2.5 mg/day and acetylsalicylic acid 100 mg/day but suffered incomplete miscarriage at 7 weeks gestation, requiring uterine curettage. A histopathological analysis of the abortion material revealed no signs of thrombosis. There was no clinical or laboratory exacerbation of SLE during or after pregnancy, apart from the skin lesions previously described.\n\nDiscussion\nSLE associated with pregnancy can lead to maternal, obstetric and foetal problems (related to the AID). It is agreed that the maternal and foetal prognosis is better when the disease is in remission/quiescent for at least 6 months prior to conception (Table 2) [17]. This patient was in clinical remission at least since 2011. The presence of aAP, anti-SSA/Ro or anti-SSB/La antibodies, hypertension or renal impairment, situations that comprise a greater risk of complications, were excluded. During the 7 weeks of gestation, there was no disease activity or lupus flares, although inavailable literature, a greater incidence of acute exacerbations during pregnancy is described [18], nor were there any complications commonly present in pregnant women with SLE (hypertension, preeclampsia/eclampsia, premature rupture of membranes and gestational diabetes, which usually appear at later stages [19]). The patient eventually had a miscarriage in the first trimester, a common complication in SLE [4, 5, 9]. Histopathology revealed no signs of thrombosis, which safely excludes vascular phenomena associated with APS and/or vasculitis, which could foretell a bleaker prognosis for a new pregnancy. In terms of treatment (Table 3), corticosteroids, and hydroxychloroquine were properly maintained. The abrupt discontinuation of hydroxychloroquine is one of the main causes of exacerbation of the disease during pregnancy [20].Table 2 Contraindications for pregnancy in patients with systemic lupus erythematosus (adapted from Andreoli et al. [9])\n\n1. Severe pulmonary hypertension (systolic BP >50 mmHg or symptomatic)\t\n2. Heart failure\t\n3. Severe restrictive lung disease\t\n4. Mild/severe chronic liver failure\t\n5. Treatment with high dosages of corticosteroids\t\n6. Exacerbation in the last 6 months\t\n7. Previous severe preeclampsia or HELLP syndrome, despite treatment with aspirin and heparin\t\n\nBP blood pressure, HELLP hemolysis elevated liver enzymes low platelet count.\n\nTable 3 Drugs used in the treatment of autoimmune diseases/compatibility with pregnancy (adapted from Andreoli et al. [9])\n\nDrug\tFDA category\tPermitted during pregnancy\tNotes\t\nPrednisolone\tB\tAllowed\tAssociated to medical/obstetric complications (maternal diabetes, preeclampsia, premature rupture of membranes)\t\nNSAID\tB/D\tAllowed; avoid from 3rd trimester onward\tRisk of premature closure of the arterial duct in the 3rd trimester\t\nHydroxychloroquine\tC\tAllowed\tDiscontinuation during pregnancy is associated with SLE exacerbations\t\nAzathioprine\tD\tAllowed\tIn the smallest therapeutic dosage, if benefits outweigh risks\t\nCyclosporine\tC\tAllowed\t\t\nTacrolimus\tC\tAllowed\t\t\nSulfasalazine\tB\tAllowed\t\t\nMethotrexate\tX\tDiscontinue 3–6 months before a planned pregnancy\t\t\nCyclophosphamide\tD\tDiscontinue at least 3 months before a planned pregnancy\t\t\nMycophenolatemofetil\tD\tDiscontinue at least 6 weeks before a planned pregnancy\t\t\nWarfarin\tD\tDiscontinue after positive pregnancy test\tCan be used while breastfeeding\t\nLMWH\tB\tAllowed\tUsed as primary prevention of thrombotic events during the puerperal period\t\nIVIG\tC\tAllowed\t\t\nRituximab\tC\tDiscontinue at least 6–12 months before a planned pregnancy\t\t\nBelimumab\tC\tDiscontinue at least 4 months before a planned pregnancy\t\t\nFDA-assigned pregnancy categories (The United States Food and Drug Administration): A controlled studies in humans have failed to demonstrate a risk to the foetus, B no evidence of risk for the human species, C Teratogenic—risk to humans cannot be excluded, D clear evidence of risk to the human foetus—risk is acceptable in a situation of very high risk for the pregnant woman, in lack of safer alternatives, X Drugs considered unsafe during pregnancy.\n\n\nNSAID nonsteroidal anti-inflammatory drugs, LMWH low-molecular-weight heparin, IVIG intravenous immunoglobulin, SLE systemic lupus erythematosus.\n\n\n\nCase 2: antiphospolipid syndrome\nA 44 years old, Portuguese citizen, had a first miscarriage at 6 months gestation, in 1992, and a second miscarriage at 8 months gestation, in 1993. Her first and single delivery occurred in 1994 and was a preterm of 33 weeks who required hospitalisation in Neonatology. She had also a history of deep venous thrombosis, with a first episode in 2004 and others in 2006 (including brachial region), having subsequently initiated treatment with oral anticoagulants, which was suspended in late 2012 due to methorragias. In January 2013, she was admitted to the hospital due to acute myocardial infarction with extensive thrombus in the middle right coronary artery. Tests were positive for anti-β-2-glycoprotein (IgG/IgM), anti-cardiolipin antibodies (IgG/IgM) and ANAs, which led to an APS diagnosis and resumption of oral anticoagulant medication.\n\nDiscussion\nAPS is probably the AID with the most implications for pregnancy. The reason for the referral and follow-up of this patient to an AID consultation was not related to the pregnancy, but her obstetric history helps support the diagnosis. Generally, after the diagnosis of APS and during pregnancy, anti-thrombotic therapy is based on low-molecular-weight heparin (Table 3) [9]. In this patient’s case, it should be pointed out that, after the second miscarriage, APS could have been diagnosed at the first thrombotic event.\n\nCase 3: polymyositis\nA 31 years old Portuguese citizen with a history of PM, diagnosed in 2008 based on a clinical scenario of polyarthralgia and myalgia with myositis and a biopsy which confirmed the diagnosis. She had a normal caesarean delivery in 2006 and a current pregnancy progressing uneventfully. PM was diagnosed after the first pregnancy. She was treated with high doses of prednisolone for 1 year, and was then put on azathioprine. After 3 years of complete remission and due to her (informed) decision to get pregnant, she began a full weaning from azathioprine, having stabilised with 10 mg/day prednisolone. An angiography was performed and excluded pulmonary hypertension. She then became pregnant and delivered a full term healthy new-born in August 2013.\n\nDiscussion\nGiven the low incidence (1–9 cases per million) of PM/DM, its implications for pregnancy are poorly known and existing literature consists of mere descriptions of cases or series of cases [21]. Fertility is still subject to speculation. The trend towards lower fertility may be more related to prior treatment history [22]. The severity of the autoimmune inflammatory activity affects the foetal prognosis. Complete remission of the disease translates into a better outcome of pregnancy [23]; otherwise, abortion rates are almost always above 50% [24]. This patient’s stability and remission were evident, which contributed to the good obstetric development described. Pulmonary hypertension may be one of the manifestations (although rare, ~5%) of PM/DM [25], constituting, besides an activity of the disease, a risk factor for pregnant women (10–40% mortality). A decision was made to study the presence of this manifestation, despite the absence of any cardio- or respiratory symptoms. After it was excluded, pregnancy was safely advised. Unlike SLE, pregnancy does not induce exacerbations of PM. In terms of treatment (Table 3), although azathioprine is allowed during pregnancy, it is the team who decides on whether to maintain or exclude it [26]; in this case, the decision was to replace it with an appropriate dosage of corticosteroids.\n\nCase 4: vasculitis—Behcet’s disease\nThirty-eight years old Portuguese citizen with an obstetric history of 3G 2P 1A. She had a first delivery in 2004 that occurred uneventful. In 2011, she had a miscarriage at 7 weeks gestation, with no pathological analysis of the abortion material. The third pregnancy was unplanned. During the final 15 weeks of gestation, BD was diagnosed due to erythema nodosum on limbs and genital ulcers (minor criteria) and recurrent oral thrush (major criteria), with a 2-year evolution, exacerbated during pregnancy. Throughout the entire pregnancy, she was only treated with topical betamethasone to control oral thrush. The delivery was eutocic, preterm (36 weeks), due to premature rupture of membranes. The new-born infant required hospitalisation in Neonatology and was discharged on day 7. Due to persistent oral thrush and postpartum genital ulcers, systemic corticosteroid therapy was initiated (5 mg/day).\n\nDiscussion\nThe BD diagnosis is sometimes suggested by the gynaecologist due to the presence of genital ulcers, being oral thrush usually underestimated [27, 28]. It is a widespread opinion that pregnancy does not affect the natural development of BD and vice versa [29], except in rarer conditions associated with a worse prognosis for pregnancy (vasculopathy, thrombosis and pulmonary hypertension), where it has been shown to affect the placenta at an early stage [15]. We did not find in the literature a description of the relationship between BD and preterm delivery as in this case, but we found other foetal problems [30]. Immunosuppressive therapy, as in the other cases studied, may also have implications. BD, and especially severe oral thrush, have an undetermined behaviour during pregnancy, so the treatment must be adjusted to each individual using the risk/benefit principle. This patient’s symptoms were only oral thrush, and so the treatment adopted was topical. No systemic therapy was administered postpartum, considering the absence of other manifestations (vascular/uveitis).\n\nCase 5: autoimmune thyroiditis\nThirty-six years old Portuguese citizen, with a history of AIT (Hashimoto’s disease) diagnosed in 2006 during her first pregnancy. She was medicated with levothyroxine in widely variable doses to achieve clinical/laboratory goals. Her obstetric history up to the first consultation was 2G 1P 1A. The first pregnancy had no complications but it was eutocic and preterm (34 weeks) and an miscarriage occurred during the first trimester in 2012. She was then referred to the AID consultation for pathology review and due to very high levels of antithyroglobulin and anti-thyroid peroxidase antibodies and difficult control over the thyroid function. After systemic AID was excluded and 4 months of clinical stability with antibody regression, she became pregnant. A new miscarriage occurred at 7 weeks gestation.\n\nDiscussion\nUpon the diagnosis of organ-specific AID (Hashimoto thyroiditis, type 1 diabetes, vitiligo), associated systemic diseases must be ruled out. Clinical immunology studies have shown that, during pregnancy, initially high levels of antithyroid antibodies fall abruptly due to the immune tolerance environment [31]. However, AIT is associated with higher rates of infertility and early miscarriages, due to the associated hormonal changes and instability and higher age (the average age of the study groups is above normal childbearing age, which is associated with increased obstetric risk), as is the case with this patient. The presence of antithyroid antibodies may react against the structures of the placenta or fertilized egg and cause problems in embryo implantation [32, 33]. This patient’s hormonal instability and age were possible causes for the miscarriages.\n\nConclusions\nAs described in literature, we found a strong association between AIDs and obstetric complications, especially with SLE, APS and AIT—of the 12 pregnancies studied, 50% resulted in miscarriage and 25% in preterm birth. However, it is important to point out that these cases were already particularly complicated, as they concern women who were being followed in specific AID consultations, which excludes simpler cases that do not require such specialised care.\n\nAbbreviations\nAIDAutoimmune disease\n\nSLESystemic lupus erythematosus\n\nAPSAntiphospholipid syndrome\n\nANAAntinuclear autoantibodies\n\naAPAntiphospholipid antibodies\n\nPMPolymyositis\n\nDMDermatomyositis\n\nBDBehcet’s disease\n\nAITAutoimmune thyroiditis.\n\nAuthor’s contributions\nVG and CC treated the patients. AM and VG wrote the paper. CC supervised the writing. All authors read and approved the final manuscript.\n\nAcknowledgements\nThe authors would like to thank Dr. Juan Garcia, the coordinator of the Autoimmune Disease Unit of Braga’s Hospital, for his scientific support and also the five patients who kindly participated in this study.\n\nCompliance with ethical guidelines\nCompeting interests The authors declare that they have no competing interests. and there is no source of fundings to declare.\n\nEthics The study was conducted according to the principles expressed in the declaration of Helsinki. The authors received ethical approval for this study from the Braga Hospital Ethical Committee and all five patients provided written informed consent for publication of this manuscript.\n==== Refs\nReferences\n1. Rose NR, MacKay IR (2006) The autoimmune diseases. Elsevier Academic Press\n2. Cooper G Bynum M Somers E Recent insights in the epidemiology of autoimmune diseases: improved prevalence estimates and understanding of clustering of diseases J Autoimmun 2009 33 3–4 197 207 10.1016/j.jaut.2009.09.008 19819109 \n3. Hurt KJ, Guile MW, Bienstock JL, Fox HE, Wallach EE (2011) The Johns Hopkins manual of gynecology and obstetrics. Lippincott Williams and Wilkins\n4. Perricone C Carolis C Perricone R Pregnancy and autoimmunity: a common problem Best Pract Res Clin Rheumatol 2012 26 1 47 60 10.1016/j.berh.2012.01.014 22424192 \n5. Carp HJ Selmi C Shoenfeld Y The autoimmune bases of infertility and pregnancy loss J Autoimmun 2012 38 2–3 266 274 10.1016/j.jaut.2011.11.016 \n6. Borchers AT Naguwa SM Keen CL Gershwin ME The implications of autoimmunity and pregnancy J Autoimmun 2010 34 3 287 299 10.1016/j.jaut.2009.11.015 \n7. Ostanek L Milchert M Pregnancy associated with connective tissue disease Ann Acad Med Stetin 2006 52 Suppl 2 11 16 17471833 \n8. Mecacci F Pieralli A Bianchi B Paidas MJ The impact of autoimmune disorders and adverse pregnancy outcome Semin Perinatol 2007 31 4 223 226 10.1053/j.semperi.2007.05.005 17825677 \n9. Andreoli L Fredi M Nalli C Reggia R Lojacono A Motta M Pregnancy implications for systemic lupus erythematosus and the antiphospholipid syndrome J Autoimmun 2012 38 2–3 197 208 10.1016/j.jaut.2011.11.010 \n10. Marian V Anolik J Treatment targets in systemic lupus erythematosus: biology and clinical perspective Arthritis Res Ther 2012 14 Suppl 4 S3 10.1186/ar3917 23281796 \n11. Longo DL, Fauci AS, Kasper DL, Hauser SL, Jameson JL, Loscalzo J (2012) Harrison’s Principles of Internal Medicine. McGraw-Hill Medical\n12. Tuthill JI Khamashta MA Management of antiphospholipid syndrome J Autoimmun 2009 33 2 92 98 10.1016/j.jaut.2009.05.002 19559568 \n13. Tolosa-Villela C Capela CA Monteagudo-Jiménez M Marí Alfonso B Infliximab for life-threatening pulmonary artery aneurysms in Behçet’s disease. A case report Clin Exp Rheumatol 2011 29 Suppl 67 S94 S95 21385550 \n14. Hiwarkar P Stasi R Sutherland G Shannon M Deep vein and intracardiac thrombosis during the post-partum period in Behcet’s disease Int J Hematol 2010 91 4 679 686 10.1007/s12185-010-0538-4 20217284 \n15. Hwang I Lee C Yoo B Lee I Necrotizing villitis and decidualvasculitis in the placentas of mothers with Behcet’s disease Hum Pathol 2009 40 1 135 138 10.1016/j.humpath.2008.04.021 18715615 \n16. Twig G Shina A Amital H Shoenfeld Y Pathogenesis of infertility and recurrent pregnancy loss in thyroid autoimmunity J Autoimmun 2012 38 2–3 J275 J281 10.1016/j.jaut.2011.11.014 22218218 \n17. Diniz-da-Costa T Centeno M Pinto L Marques A Mendes-Graça L Systemic lupus erythematosus and pregnancy Acta Med Port 2012 25 6 448 453 23534598 \n18. Clowse M Lupus activity in pregnancy Rheum Dis Clin North Am 2007 33 2 237 252 10.1016/j.rdc.2007.01.002 17499705 \n19. Witter FR Management of the high-risk lupus pregnant patient Rheum Dis Clin N Am 2007 33 2 253 265 10.1016/j.rdc.2007.02.002 \n20. Lockshin M, Salmon J, Erkan D (2008) Pregnancy and rheumatic diseases. In: Creasy RK, Saunders RR (eds) Maternal-fetal medicine: principles and practice, pp 1079–1088\n21. Chopra S Suri V Bagga R Thami MR Sharma A Bambery P Autoimmune inflammatory myopathy in pregnancy Medscape J Med 2008 10 1 17 18324327 \n22. Kanoh H Izumi T Seishima M Nojiri M Ichiki Y Kitajima Y A case of dermatomyositis that developed after delivery: the involvement of pregnancy in the induction of dermatomyositis Br J Dermatol 1999 141 897 900 10.1046/j.1365-2133.1999.03165.x 10583175 \n23. King CR Chow S Dermatomyositis and pregnancy Obstet Gynecol 1985 66 4 589 592 3900842 \n24. Gutiérrez G Dagnino R Mintz G Polymyositis/dermatomyositis and pregnancy Arthritis Rheum 1984 27 3 291 294 10.1002/art.1780270307 6704192 \n25. Katsuragi S Yamanaka K Neki R Kamiya C Sasaki Y Osato K Maternal outcome in pregnancy complicated with pulmonary arterial hypertension Circ J 2012 76 9 2249 2254 10.1253/circj.CJ-12-0235 22785004 \n26. Cleary BJ Källén B Early pregnancy azathioprine use and pregnancy outcomes Birth Defects Res A Clin Mol Teratol 2009 85 7 647 654 10.1002/bdra.20583 19343728 \n27. Uzun S Alpzoy E Durdu M Akman A The clinical course of Behcet’s disease in pregnancy: a retrospective analysis and review of the literature J Dermatol 2003 30 7 499 502 10.1111/j.1346-8138.2003.tb00423.x 12928538 \n28. Marsal S Falgá C Simeon CP Vilardell M Bosch JA Behcet’s disease and pregnancy relationship study Br J Rheumatol 1997 36 2 234 238 10.1093/rheumatology/36.2.234 9133937 \n29. Jadaon J Shushan A Ezra Y Sela H Ozcan C Rojansky N Behcet’s disease and pregnancy Acta Obstet Gynecol Scand 2005 84 10 939 944 16167908 \n30. Balucan FS Morshed SA Davies TF Thyroid autoantibodies in pregnancy: their role, regulation and clinical relevance J Thyroid Res 2013 23 2 139 141 10.1089/thy.2013.2302.ed2 \n31. Grassi G Balsamo A Ansaldi C Balbo A Massobrio M Benedetto C Thyroid autoimmunity and infertility Gynecol Endocrinol 2001 15 5 389 396 10.1080/gye.15.5.389.396 11727362 \n32. Negro R Formoso G Mangieri T Pezzarossa A Dazzi D Hassan H Levothyroxine treatment in euthyroid pregnant women with autoimmune thyroid disease: effects on obstetrical complications J Clin Endocrinol Metab 2006 91 7 2587 2591 10.1210/jc.2005-1603 16621910 \n33. Miyakis S Lockshin MD Atsumi T Branch DW Brey RL Cervera R International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome J Thromb Haemost 2006 4 2 295 306 10.1111/j.1538-7836.2006.01753.x 16420554\n\n", "fulltext_license": "CC BY", "issn_linking": "1756-0500", "issue": "8()", "journal": "BMC research notes", "keywords": null, "medline_ta": "BMC Res Notes", "mesh_terms": "D000022:Abortion, Spontaneous; D000328:Adult; D016736:Antiphospholipid Syndrome; D001327:Autoimmune Diseases; D015551:Autoimmunity; D018450:Disease Progression; D005260:Female; D005865:Gestational Age; D006801:Humans; D007166:Immunosuppressive Agents; D050498:Live Birth; D008180:Lupus Erythematosus, Systemic; D011174:Portugal; D011247:Pregnancy; D011248:Pregnancy Complications; D012074:Remission Induction; D012307:Risk Factors; D013967:Thyroiditis, Autoimmune; D016896:Treatment Outcome", "nlm_unique_id": "101462768", "other_id": null, "pages": "216", "pmc": null, "pmid": "26040452", "pubdate": "2015-06-04", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": "22785004;17499706;16167908;20217284;22204899;22218218;17471833;23281796;17825677;9133937;23691429;23534598;22424192;6704192;19343728;18324327;16621910;19819109;20031371;22284905;16420554;18715615;12928538;21385550;3900842;11727362;10583175;19559568;17499705", "title": "Autoimmune diseases and pregnancy: analysis of a series of cases.", "title_normalized": "autoimmune diseases and pregnancy analysis of a series of cases" }
[ { "companynumb": "PT-MYLANLABS-2016M1011250", "fulfillexpeditecriteria": "1", "occurcountry": "PT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "HYDROXYCHLOROQUINE" }, "drugadditional": null...
{ "abstract": "Fluorouracil monotherapy, instead of the FOLFOX or FOLFIRI regimen, is administered to patients intolerant to oxaliplatin or irinotecan because of their adverse effects. A prospective clinical trial was designed to evaluate the efficacy and safety of fluorouracil monotherapy combined with panitumumab administered to patients with KRAS wild-type (WT) metastatic colorectal cancer (mCRC) intolerant to oxaliplatin and irinotecan. Screening for potential serum biomarkers to predict early therapeutic responses was conducted.\n\n\n\nThis single-arm, open-label multicenter phase II trial recruited patients with KRAS WT mCRC from 16 institutes between January 2012 and October 2014. Panitumumab (6 mg/kg) was intravenously administered every 2 weeks, combined with fluorouracil monotherapy, in 2-week cycles. The primary objective was overall response rate, and secondary endpoints included disease-control rate, progression-free survival, overall survival, toxicity, and blood-test data.\n\n\n\nForty patients (male, 65.0%; median age, 74 years; colon cancer, 72.5%) met eligibility criteria and received 7 cycles (median) of fluorouracil chemotherapy combined with panitumumab. There were no treatment-related deaths. Median time to treatment failure was 3.2 months. 23 (57.5%) patients experienced at least one adverse effect ≥ grade 3. The response rate was 10.0% (95% confidence interval 2.8-23.7%). Median progression-free survival and overall survival were 4.3 and 11.3 months, respectively. Total lactase dehydrogenase (LDH) levels and those of LDH-4 and LDH-5, quickly changed with disease reduction or progression.\n\n\n\nFluorouracil monotherapy combined with panitumumab was safely administered to patients with KRAS WT mCRC intolerant to oxaliplatin and irinotecan. Serum LDH levels may predict early responses.", "affiliations": "Department of Surgery, Fukui Prefecture Saiseikai Hospital, Fukui, Japan.;Department of Gastroenterological Surgery (Surgery II), Nagoya University Graduate School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya, 466-8550, Japan. m-kanda@med.nagoya-u.ac.jp.;Department of Biostatistics, School of Public Health, Tokyo University Graduate School of Medicine, Tokyo, Japan.;Department of Surgery, Rinku General Medical Center, Osaka, Japan.;Department of Surgery, Kinki Central Hospital, Itami, Japan.;Division of Gastroenterology, Chiba Cancer Center, Chiba, Japan.;Kitakyushu General Hospital, Kitakyushu, Japan.;Tokai Central Hospital, Kakamigahara, Japan.;Department of Surgery, Hyogo Prefectural Nishinomiya Hospital, Nishinomiya, Japan.;Department of Surgery, National Hospital Organization Nagoya Medical Center, Nagoya, Japan.;Department of Surgery, Kyoto Teishin Hospital, Kyoto, Japan.;Tokai Central Hospital, Kakamigahara, Japan.;Cancer Center, Aichi Medical University, Nagakute, Japan.", "authors": "Munemoto|Yoshinori|Y|;Kanda|Mitsuro|M|;Oba|Koji|K|;Kim|Ho Min|HM|;Takemoto|Hiroyoshi|H|;Denda|Tadamichi|T|;Nagata|Naoki|N|;Takano|Nao|N|;Fukunaga|Mutsumi|M|;Kataoka|Masato|M|;Tokunaga|Yukihiko|Y|;Sakamoto|Junichi|J|;Mishima|Hideyuki|H|", "chemical_list": "D014408:Biomarkers, Tumor; D000077150:Oxaliplatin; D000077544:Panitumumab; D000077146:Irinotecan; D007770:L-Lactate Dehydrogenase; D005472:Fluorouracil", "country": "Germany", "delete": false, "doi": "10.1007/s00280-018-3556-1", "fulltext": null, "fulltext_license": null, "issn_linking": "0344-5704", "issue": "81(5)", "journal": "Cancer chemotherapy and pharmacology", "keywords": "Colorectal cancer; Early marker of therapeutic response; Fluorouracil; Panitumumab; Phase II trial", "medline_ta": "Cancer Chemother Pharmacol", "mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D000971:Antineoplastic Combined Chemotherapy Protocols; D014408:Biomarkers, Tumor; D015179:Colorectal Neoplasms; D005260:Female; D005472:Fluorouracil; D006801:Humans; D000077146:Irinotecan; D007770:L-Lactate Dehydrogenase; D008297:Male; D008875:Middle Aged; D000077150:Oxaliplatin; D000077544:Panitumumab; D000077982:Progression-Free Survival; D011446:Prospective Studies; D017211:Treatment Failure", "nlm_unique_id": "7806519", "other_id": null, "pages": "829-838", "pmc": null, "pmid": "29508026", "pubdate": "2018-05", "publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "A phase II trial to evaluate the efficacy of panitumumab combined with fluorouracil-based chemotherapy for metastatic colorectal cancer: the PF trial.", "title_normalized": "a phase ii trial to evaluate the efficacy of panitumumab combined with fluorouracil based chemotherapy for metastatic colorectal cancer the pf trial" }
[ { "companynumb": "JP-AMGEN-JPNCT2018073482", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "PANITUMUMAB" }, "drugadditional": "3", ...
{ "abstract": "Clinical deterioration during the treatment of tuberculosis remains a diagnostic challenge. We describe the case of a 46-year-old man with a history of oral cancer status after a radical operation who had pulmonary tuberculosis with pleura and neck lymph node involvement. The clinical condition improved after antituberculosis therapy. However, the patient suffered from low-grade fever, progressive dyspnea, and cough after 7 weeks of the therapy. The findings of chest plain films were relapse and progression of left lung haziness. The deterioration was caused by disseminated Penicillium marneffei infection. Disseminated P. marneffei in a non-HIV patient with tuberculosis is rarely seen, and the manifestations are similar to a paradoxical response and relapse of pulmonary tuberculosis, thereby making it difficult to establish a diagnosis.", "affiliations": "Division of Thoracic Medicine, Far Eastern Memorial Hospital, Taipei, Taiwan, ROC.;Department of Internal Medicine, National Taiwan University Hospital, Taipei, Taiwan, ROC. Electronic address: hcwang@ntumc.org.;Division of Infectious Disease, Far Eastern Memorial Hospital, Taipei, Taiwan, ROC.", "authors": "Wang|Ping-Huai|PH|;Wang|Hao-Chien|HC|;Liao|Chun-Hsing|CH|", "chemical_list": "D000666:Amphotericin B", "country": "Netherlands", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1726-4901", "issue": "78(4)", "journal": "Journal of the Chinese Medical Association : JCMA", "keywords": "Penicillium marneffei; human immunodeficiency virus; tuberculosis", "medline_ta": "J Chin Med Assoc", "mesh_terms": "D000666:Amphotericin B; D006801:Humans; D008297:Male; D008875:Middle Aged; D009181:Mycoses; D010407:Penicillium; D012008:Recurrence; D014397:Tuberculosis, Pulmonary", "nlm_unique_id": "101174817", "other_id": null, "pages": "258-60", "pmc": null, "pmid": "25823679", "pubdate": "2015-04", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Disseminated Penicillium marneffei mimicking paradoxical response and relapse in a non-HIV patient with pulmonary tuberculosis.", "title_normalized": "disseminated penicillium marneffei mimicking paradoxical response and relapse in a non hiv patient with pulmonary tuberculosis" }
[ { "companynumb": "TW-LUPIN PHARMACEUTICALS INC.-2015-03959", "fulfillexpeditecriteria": "2", "occurcountry": "TW", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "PYRAZINAMIDE" }, "drugadditio...
{ "abstract": "Cerebral hemorrhage is a known complication of infective endocarditis (IE) and is associated with a high mortality rate. We herein present a case of fatal cerebral hemorrhage occurring after successful mitral valve repair in a patient in active phase of IE. A 58-year-old male with active IE underwent an urgent mitral valve repair due to systemic embolisms and a massive mobile vegetation on the mitral valve. During the surgery, a rolled autologous pericardium was fixed onto the annulus, therefore we initiated anticoagulation therapy with warfarin. A follow-up brain MRI on the 18th postoperative day showed several cerebral micro bleedings, and on the next day, the patient suffered massive and fatal cerebral hemorrhage. As cerebral hemorrhage can be fatal especially in patients taking anticoagulants, we believe that anticoagulation therapy should be avoided after mitral valve repair in patients who have cerebral micro bleeding in active phase of IE.", "affiliations": "Department of Cardiovascular Surgery, Shin-Koga Hospital, Kurume, Japan.", "authors": "Hayashi|Nagi|N|;Yoshikai|Masaru|M|;Sato|Hisashi|H|;Kuwano|Akito|A|", "chemical_list": null, "country": "Japan", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0021-5252", "issue": "74(9)", "journal": "Kyobu geka. The Japanese journal of thoracic surgery", "keywords": null, "medline_ta": "Kyobu Geka", "mesh_terms": "D002543:Cerebral Hemorrhage; D004696:Endocarditis; D004697:Endocarditis, Bacterial; D006801:Humans; D008297:Male; D008875:Middle Aged; D008943:Mitral Valve; D008944:Mitral Valve Insufficiency; D016896:Treatment Outcome", "nlm_unique_id": "0413533", "other_id": null, "pages": "677-680", "pmc": null, "pmid": "34446621", "pubdate": "2021-09", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Fatal Cerebral Hemorrhage after Mitral Valve Repair for Active Infective Endocarditis:Report of a Case.", "title_normalized": "fatal cerebral hemorrhage after mitral valve repair for active infective endocarditis report of a case" }
[ { "companynumb": "JP-LUPIN PHARMACEUTICALS INC.-2021-19536", "fulfillexpeditecriteria": "2", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "CEFTRIAXONE" }, "drugadditiona...
{ "abstract": "BACKGROUND\nMultiple sclerosis (MS) and psoriasis vulgaris (PV) are two disorders with autoimmune pathophysiology and a supposed altered T helper (TH) cell response.\n\n\nOBJECTIVE\nTo report a case of concomitant relapsing remitting MS and PV treated with different immunomodulatory medications, particularly secukinumab and rituximab.\n\n\nMETHODS\nCase report.\n\n\nRESULTS\nIn a 68-year-old woman diagnosed with MS and PV, secukinumab alleviated the dermatological condition, but could not control neuroinflammation. Rituximab treatment halted MS activity, but led to a flare-up of dermatological inflammation.\n\n\nCONCLUSIONS\nThe presented case suggests that the pathomechanisms of MS and PV differ regarding involvement of TH and B cells with implications for therapeutic approaches.", "affiliations": "Neurological Clinic and Policlinic, University Hospital and University of Basel, Basel, Switzerland. Electronic address: martin.diebold@usb.ch.;Department of Dermatology, University Hospital and University of Basel, Basel, Switzerland.;Neurological Clinic and Policlinic, University Hospital and University of Basel, Basel, Switzerland.;Neurological Clinic and Policlinic, University Hospital and University of Basel, Basel, Switzerland.", "authors": "Diebold|Martin|M|;Müller|Simon|S|;Derfuss|Tobias|T|;Décard|Bernhard F|BF|", "chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D007155:Immunologic Factors; D000069283:Rituximab; C555450:secukinumab", "country": "Netherlands", "delete": false, "doi": "10.1016/j.msard.2019.03.009", "fulltext": null, "fulltext_license": null, "issn_linking": "2211-0348", "issue": "31()", "journal": "Multiple sclerosis and related disorders", "keywords": "Autoimmune diseases; B-lymphocytes; Helper-induced T-lymphocytes; Immunomodulation; Monoclonal antibodies; Multiple sclerosis; Psoriasis", "medline_ta": "Mult Scler Relat Disord", "mesh_terms": "D000368:Aged; D061067:Antibodies, Monoclonal, Humanized; D005260:Female; D006801:Humans; D007155:Immunologic Factors; D020529:Multiple Sclerosis, Relapsing-Remitting; D011565:Psoriasis; D000069283:Rituximab; D016896:Treatment Outcome", "nlm_unique_id": "101580247", "other_id": null, "pages": "38-40", "pmc": null, "pmid": "30901703", "pubdate": "2019-06", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "A case of concomitant psoriasis and multiple sclerosis: Secukinumab and rituximab exert dichotomous effects in two autoimmune conditions.", "title_normalized": "a case of concomitant psoriasis and multiple sclerosis secukinumab and rituximab exert dichotomous effects in two autoimmune conditions" }
[ { "companynumb": "CH-ORION CORPORATION ORION PHARMA-19_00006020", "fulfillexpeditecriteria": "1", "occurcountry": "CH", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "METHOTREXATE" }, "drugadd...
{ "abstract": "Hepatitis B virus reactivation (HBVr) in patients with gastrointestinal stromal tumors (GISTs) have not been sufficiently characterized. This study aimed to review the possible mechanism of HBVr induced by imatinib and explore appropriate measures for patient management and monitoring.\nThe clinical data of GIST patients who experienced HBVr due to treatment with imatinib at Xiangya Hospital (Changsha, Hunan, China) were retrospectively analyzed. A literature review was also conducted.\nFive cases were analyzed, including 3 cases in this study. The average age of the patients was 61.8 y, with male preponderance (4 of 5 vs. 1 of 5). These patients received imatinib as adjuvant treatment (n=4) or as neoadjuvant treatment (n=1). Primary tumors were mostly located in the stomach (n=4) or rectum (n=1). High (n=3) or intermediate (n=1) recurrence risk was categorized using the postoperative pathological results (n=4). Imatinib was then started at 400 (n=4) or 200 mg (n=1) daily. Patients first reported abnormal liver function during the 2th (n=1),6th (n=3), or 10th (n=1) month of treatment with imatinib. Some patients (n=4) discontinued imatinib following HBVr; notably, 1 month after discontinuation, 1 patient experienced HBVr. Antivirals (entecavir n=4, tenofovir n=1), artificial extracorporeal liver support (n=1), and liver transplant (n=1) were effective approaches to treating HBVr. Most patients (n=3) showed favorable progress, 1 patient underwent treatment, and 1 patient died due to severe liver failure induced by HBVr.\nAlthough HBVr is a rare complication (6.12%), HBV screening should be conducted before starting treatment with imatinib in GIST patients. Prophylactic therapy for hepatitis B surface antigen positive patients, prompt antiviral treatment and cessation of imatinib are also necessary.", "affiliations": "Department of Gastrointestinal Surgery, Xiangya Hospital, Central South University, Changsha, China.;Department of Gastrointestinal Surgery, Xiangya Hospital, Central South University, Changsha, China.;Department of Infectious Diseases, Xiangya Hospital, Central South University, Changsha, China.;Department of Gastrointestinal Surgery, Xiangya Hospital, Central South University, Changsha, China.;Department of Gastrointestinal Surgery, Xiangya Hospital, Central South University, Changsha, China.;Department of Gastrointestinal Surgery, Xiangya Hospital, Central South University, Changsha, China.", "authors": "Lei|Tianxiang|T|;Tan|Fengbo|F|;Hou|Zhouhua|Z|;Liu|Peng|P|;Zhao|Xianhui|X|;Liu|Heli|H|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.3389/fonc.2020.596500", "fulltext": "\n==== Front\nFront Oncol\nFront Oncol\nFront. Oncol.\nFrontiers in Oncology\n2234-943X Frontiers Media S.A. \n\n10.3389/fonc.2020.596500\nOncology\nOriginal Research\nHepatitis B Virus Reactivation in Gastrointestinal Stromal Tumor Patients Treated With Imatinib\nLei Tianxiang 1† Tan Fengbo 1† Hou Zhouhua 2 Liu Peng 1 Zhao Xianhui 1 Liu Heli 1* 1Department of Gastrointestinal Surgery, Xiangya Hospital, Central South University, Changsha, China\n2Department of Infectious Diseases, Xiangya Hospital, Central South University, Changsha, China\nEdited by: Domenico M. D’Ugo, Catholic University of the Sacred Heart, Italy\n\nReviewed by: Manidhar Reddy Lekkala, University of Rochester, United States; Hao Xu, Nanjing Medical University, China\n\n*Correspondence: Heli Liu, heliliu@csu.edu.cnThis article was submitted to Gastrointestinal Cancers, a section of the journal Frontiers in Oncology\n\n†These authors have contributed equally to this work\n\n\n22 1 2021 \n2020 \n10 59650019 8 2020 07 12 2020 Copyright © 2021 Lei, Tan, Hou, Liu, Zhao and Liu2021Lei, Tan, Hou, Liu, Zhao and LiuThis is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.Purpose\nHepatitis B virus reactivation (HBVr) in patients with gastrointestinal stromal tumors (GISTs) have not been sufficiently characterized. This study aimed to review the possible mechanism of HBVr induced by imatinib and explore appropriate measures for patient management and monitoring.\n\nMethods\nThe clinical data of GIST patients who experienced HBVr due to treatment with imatinib at Xiangya Hospital (Changsha, Hunan, China) were retrospectively analyzed. A literature review was also conducted.\n\nResults\nFive cases were analyzed, including 3 cases in this study. The average age of the patients was 61.8 y, with male preponderance (4 of 5 vs. 1 of 5). These patients received imatinib as adjuvant treatment (n=4) or as neoadjuvant treatment (n=1). Primary tumors were mostly located in the stomach (n=4) or rectum (n=1). High (n=3) or intermediate (n=1) recurrence risk was categorized using the postoperative pathological results (n=4). Imatinib was then started at 400 (n=4) or 200 mg (n=1) daily. Patients first reported abnormal liver function during the 2th (n=1),6th (n=3), or 10th (n=1) month of treatment with imatinib. Some patients (n=4) discontinued imatinib following HBVr; notably, 1 month after discontinuation, 1 patient experienced HBVr. Antivirals (entecavir n=4, tenofovir n=1), artificial extracorporeal liver support (n=1), and liver transplant (n=1) were effective approaches to treating HBVr. Most patients (n=3) showed favorable progress, 1 patient underwent treatment, and 1 patient died due to severe liver failure induced by HBVr.\n\nConclusions\nAlthough HBVr is a rare complication (6.12%), HBV screening should be conducted before starting treatment with imatinib in GIST patients. Prophylactic therapy for hepatitis B surface antigen positive patients, prompt antiviral treatment and cessation of imatinib are also necessary.\n\nhepatitis B virusreactivationgastrointestinal stromal tumorsimatinibmechanism\n==== Body\nIntroduction\nGastrointestinal stromal tumors (GISTs) are the most common mesenchymal neoplasms located in the digestive tract, with an estimated annual incidence of 1–2 per 100,000 globally (1, 2). Most cases of GIST have activated mutations in KIT and platelet-derived growth receptor alpha (PDGFRA). Since 2000, imatinib has been found to target KIT changes in GIST cells (3). More than 80% of GIST patients have benefited from treatment with imatinib (4). This therapy has become one of the standard treatments for GIST (5).\n\nHepatitis B virus reactivation (HBVr) is a common complication in tumor patients with chronic HBV infection and simultaneously undergoing cytotoxic chemotherapy or immunosuppressive therapy (6). HBV is a major global health problem chronically affecting more than 257 million people worldwide (7). However, HBVr in tumor patients may lead to liver function injury or fatal liver failure. This occurrence can interrupt therapy, delaying the effective treatment of tumor patients and consequently affecting prognosis.\n\nHowever, the risk for HBVr during the treatment of GISTs by using imatinib is poorly understood. To the best of our knowledge, only 2 cases have been reported worldwide (8, 9). Thus, it is urgent to clarify the mechanism and summarize such cases in order to draw attention from the medical community and provide clinical guidance for patient management.\n\nMethods and Materials\nWe retrospectively reviewed the data of 869 patients with GIST from January 2007 to June 2020 through the hospital information system of Xiangya Hospital of Central South University (Changsha, Hunan, China). A total of 440 patients received imatinib as adjuvant treatment (n=428) or neoadjuvant treatment (n=12); 49 patients tested positive for hepatitis B surface antigen (HBsAg), whereas 391 tested negative. Finally, 3 cases (6.12%) of HBVr due to imatinib for GIST were recorded. This study protocol was approved by the Medical Ethics Committee of Xiangya Hospital, Central South University (Changsha, Hunan, China).\n\nResults\nCase 1\nA 50-year-old woman with a history of HBV infection over 20 years presented with abdominal pain, hematemesis, hematochezia, and even syncope on December 29, 2018. The patient had no experience using antivirals for HBV or hepatotoxic drugs. She was diagnosed with GIST by gastroscopy and abdominal-pelvic computed tomography (CT) scan. At the time of diagnosis, the patient had a normal liver function. Serologic tests for HBV showed that the patient was positive for HBsAg, hepatitis B e-antibody (HBeAb), hepatitis B core antigen (HBcAg) but negative for hepatitis B e-antigen (HBeAg) and hepatitis B surface antibody (HBsAb). The HBV DNA level was 3.10 × 104 IU/mL (normal, <10 IU/mL). The patient underwent resection of two tumors with partial resection of the stomach on January 11, 2019. Postoperative pathology confirmed the diagnosis of two gastric GISTs [size, 10.5 cm × 7 cm × 6 cm and 4 cm × 2.5 cm × 2 cm; mitosis, both>5/50 high-power field (HPF)]. Immunohistochemistry indicated that the tumors were positive for CD34, CD117, Dog1, and Ki-67 (3%). Mutational analysis demonstrated a mutation in KIT exon 11. The patient was classified as high-risk under the modified National Institutes of Health (NIH) classification system (2008) (10). To reduce the risk of tumor recurrence, administration of imatinib 400 mg daily was started postoperatively in January 2019.\n\nOn June 25, 2019, the patient presented with nausea, vomiting, and jaundice. Liver function tests showed elevated aspartate transaminase (AST) at 434.0 U/L (normal, 13.0–35.0 U/L), alanine transaminase (ALT) at 407.0 U/L (normal, 7.0–40.0 U/L), total bilirubin at 24.5 umol/L (normal, 1.7–17.1 umol/L), and direct bilirubin at 12.4 umol/L (normal, 0.0–6.8 umol/L). No change in serum HBV serology was indicated, and the HBV DNA level increased to 3.57 × 106 IU/mL. With the exclusion of other causes of liver injury such as infection with hepatitis A, C, or E virus, cytomegalovirus, Epstein-Barr virus, and autoimmune hepatitis, a diagnosis of imatinib-related chronic HBV reactivation was established. Thus, the patient immediately received entecavir (0.5 mg/d), discontinued imatinib, and took artificial extracorporeal liver support 3 times for severe liver damage. After 1 month, the symptoms and liver function abnormalities resolved. The HBV DNA level decreased to 6.59 × 102 IU/mL. After discharge, the patient continued to take entecavir (0.5 mg/d) (up to present). In January 2020, the patient resumed taking low-dose imatinib (100 mg/d), with doses increased to 200 mg/d in February 2020 and 300 mg/d from March up to present. Patient recovery was uneventful. In April 2020, her liver function subsequently remained within normal ranges, No HBV DNA was detected, and no evidence of GIST recurrence was found in the abdominal–pelvic CT scan.\n\nCase 2\nA 59-year-old man without any symptoms was diagnosed with GIST by physical examination including gastroscopy in November 2018. He was diagnosed with HBV infection 20 years ago without undergoing antiviral therapy. After admission to the local hospital, he tested positive for HBsAg, HBeAb, and HBcAg but negative for HBsAb, HBeAg, hepatitis C virus, and normal liver function. He underwent laparoscopic complete stomach resection of the tumor with an uncomplicated postoperative course. The mass was diagnosed as a gastric GIST and categorized as high-risk in accordance with the modified NIH classification system (2008) (10). (size, 7 cm × 5 cm × 4 cm mitosis, >5/50 HPF). Immunohistochemistry showed the following: CD117(+), CD34(+), Dog-1(+), and Ki-67 (<8%). Adjuvant treatment with imatinib (400 mg/d) was started on December 23, 2018.\n\nIn January 2019, the patient manifested abdominal pain. Laboratory and imaging tests showed normal results. The abdominal pain resolved after symptomatic treatment. In February 2019, the patient presented with edema of eyelids, hands, and ankles as side effects of imatinib. On May 15, 2019, the patient was admitted to a local hospital because of increasing systemic edema. Owing to serious side effects, imatinib administration was stopped. From November 2018 to May 2019, the patient received imatinib (400 mg/d), and his liver function was normal. No other hepatotoxic medication, except for imatinib, was taken.\n\nHowever, after discontinuing imatinib, the patient reported dizziness, body weakness, and weight loss in June 2019. The patient was immediately admitted to Xiangya hospital. Laboratory findings showed the following measurements: ALT, 977.1 U/L (normal, 7.0–40.0 U/L); AST, 1382.0 U/L (normal, 13.0–35.0 U/L); total bilirubin, 20.5 umol/L (normal, 1.7–17.1 umol/L); and direct bilirubin, 11.3 umol/L (normal, 0.0–6.8 umol/L). Serology results indicated no change in serum HBV; moreover, HBV DNA was 6.11 × 107 IU/mL (normal < 10 IU/mL), and the tumor marker CA125 was 82.73U/mL (normal, 0–35.00 U/mL). However, positron emission tomography–computed tomography did not indicate recurrence or metastasis of GIST and other tumors. Thus, HBVr was identified as the potential cause of liver damage, and the patient was immediately administered entecavir (0.5 mg/d). However, the clinical condition of the patient progressively deteriorated because of severe hepatitis caused by HBVr. The patient ultimately developed severe liver failure leading to death.\n\nCase 3\nA 51-year-old man was found to have multiple hepatic masses and a gastric mass after a physical examination in September 2019. The patient subsequently underwent radical surgical resection for the gastric mass and palliative resection for the hepatic masses in a local hospital. The patient had a history of HBV infection of over 10 years but received no antiviral therapy for HBV. During hospitalization, the patient showed normal liver function, tested positive for HBsAg, HBeAb, and HBcAb, and tested negative for HBsAb, HBcAb, and hepatitis C virus. Pathological examination revealed that the gastric mass was a high-risk gastric GIST (size, 4.5 cm × 3.5 cm × 3 cm; mitotic index>10/50 HPF), which stained positive for CD117, CD34, DOG1, and ki-67 (20%). The liver mass was a metastatic GIST (the maximum tumor diameter was 1.5 cm), which stained positive for DOG1; one lymph node was metastatic (1/1). Additional molecular analysis confirmed the mutation in KIT exon 11. The liver metastases were only partly removed, requiring lifetime treatment with imatinib (400 mg/d), which the patient started to receive in January 2020.\n\nRegular laboratory examination after treatment with imatinib for 3 months showed that the patient had mildly elevated ALT, 80.0 U/L (normal, 9.0–50.0 U/L), but no symptoms and signs. Laboratory examination after treatment with imatinib for 6 months showed further increases in ALT to 282.6 U/L (normal, 9.0–50.0 U/L), AST to 154.0 U/L (normal, 15.0–40.0 U/L), total bilirubin to 19.9 umol/L (normal, 1.7–17.1 umol/L), and direct bilirubin to 10.5 umol/L (normal, 0.0–6.8 umol/L). HBV DNA was 4.99 × 108 IU/ml (normal, < 10 IU/ml). Serology testing results showed that HBsAg and HBcAb were positive, whereas HBsAb, HBeAb, and HBeAg were negative. After excluding other causes of hepatitis, we considered that hepatitis could be attributable to HBVr. Thus, entecavir (0.5 mg/d) was administered, and imatinib was discontinued immediately. The patient now was followed up under close observation.\n\nLiterature Review\nWe performed a literature search in PubMed for other reported cases by using the terms “Hepatitis B virus reactivation”, “Gastrointestinal stromal tumors,” and “imatinib” and identified only 2 case reports (8, 9). The aforementioned cases, together with the 3 cases presented in the current study, complete the 5 cases currently reported (Table 1).\n\nTable 1 Characteristics of cases with GIST who suffered HBV reactivation after receiving imatinib.\n\nAuthor, year\tGender\tAge (years)\tNeoadjuvant or adjuvant treatment\tTumor type\tRisk classificationa\tDose of imatinib before HBVr(mg/d)\tTime to onset of hepatic dysfunction from use of GIST (months)\tHBV DNA before imatinib(IU/mL)\tHBV DNA after HBVr (IU/mL)\tStatus of Imatinib following HBVr\tAntiviral agent for HBVr (Dosage)\tLiver transplant\tartificial extracorporeal liver support\tOutcome\t\nWalker et al. (9)\tM\t62\tAdjuvant treatment\tGastric GIST\tIntermediate\t400\t6\tNA\t56600\tDiscontinued\tEntecavir (NA)\tDone\tNot done\tRecovered\t\nInayat et al. (8)\tM\t87\tNeoadjuvant treatment\tRectal GIST\tNA\t200, held, 100, 400, held, 200\t10\tNA\t397168540\tDiscontinued\tTenofovir (25 mg/d)\tNot done\tNot done\tRecovered\t\nReport (Case 1)\tF\t50\tAdjuvant\ntreatment\tGastric GIST\tHigh\t400\t6\t3.10×104\t3.57×106\tDiscontinued\tEntecavir (0.5 mg/d)\tNot done\tDone\tRecovered\t\nReport (Case 2)\tM\t59\tAdjuvant\ntreatment\tGastric GIST\tHigh\t400\t6\tNA\t6.11×107\tDiscontinued before HBVr\tEntecavir (0.5 mg/d)\tNot done\tNot done\tDied\t\nReport\n(Case 3)\tM\t51\tAdjuvant\ntreatment\tGastric GIST and liver metastases\tHigh\t400\t2\tNA\t4.99 x 108\tDiscontinued\tEntecavir (0.5 mg/d)\tNot done\tNot done\tUnder treatment\t\nGIST, Gastrointestinal stromal tumor; athe risk classification is based on the modified National Institutes of Health classification system (2008).\n\nIn the 5 cases, the average age of the patients was 61.8 y (range: 50–87 y), with a male-to-female ratio of 4:1. Four patients received imatinib as adjuvant treatment for intermediate—(n=1) or high-risk (n=3) recurrence based on the modified NIH classification system (2008) (10), and 1 patient received neoadjuvant treatment. Primary tumors were located in the stomach (n=4) or rectum (n=1), and one of our patients with a gastric GIST had liver metastasis. Imatinib at 400 mg daily was started in accordance with consensus-based medication (10) in 4 patients and 200 mg daily in 1 patient suffering from chronic kidney disease (stage 3b). Abnormal liver function was reported in 3 patients during the 6th month of treatment with imatinib at 400 mg/d and in 1 patient during the 2nd month of the same treatment at the same dose. Meanwhile 1 patient was diagnosed with HBVr during the 10th month of treatment with 6 dose adjustments of imatinib, as follows: 200 mg/d for 10 d, held for 2 weeks; 100 mg/d for 3 months; and 400 mg/d for 40 d, held for 2 weeks, and restarted at 200 mg/d imatinib. We observed the change in HBV DNA (3.10 × 104 IU/mL to 3.57 × 106 IU/mL) before and after HBVr in 1 patient, which was attributed to treatment with imatinib, as well as the high level of HBV DNA following HBVr in 4 patients.\n\nTreatment with imatinib was stopped in all patients following HBVr. Four patients received entecavir as antiviral treatment, and 1 patient received tenofovir. Two patients accepted liver transplant or artificial extracorporeal liver support to reverse the deterioration of their liver function. Three patients successfully recovered, 1 patient underwent treatment, and 1 patient died due to severe liver failure.\n\nDiscussion\nImatinib has indeed changed the fate of patients with GIST and Philadelphia chromosome-positive chronic myeloid leukemia by targeting the oncogenic drivers of these diseases—BCR–ABL1 and KIT and/or PDGFRA—mutations that promote the function of tyrosine kinase activities (11). The importance of imatinib, as the mainstay of treatment for GIST, has been emphasized in various clinical guidelines (10, 12, 13). The side effects of imatinib are usually mild and generally well tolerated by most GIST patients (14). HBVr rarely occurs in patients infected with chronic HBV. However, when GIST patients with chronic HBV infection receive imatinib, the risk for HBVr is present. Without timely adequate recognition and treatment, HBVr can lead to an unfavorable prognosis or even death, such as that in Case 2, or increase the risk of tumor recurrence and progression, such as that in Case 3. GIST patients with chronic HBV infection and treated with imatinib rarely suffer from HBVr; regardless, these cases need to be consolidated to raise awareness of complications.\n\nDefinition of HBVr\nNo unified diagnostic criteria for HBVr have been established worldwide; however, a consensus has been reached for patients with HBsAg(+)/HBcAb(-) or HBsAg(-)/HBcAb(+) receiving immunosuppressive therapy or chemotherapy. HBVr is defined as the occurrence of any of the following: a hundredfold increase in the HBV DNA level, the recurrence of detectable HBV DNA or positive HBsAg, or HBV DNA > 105 IU/mL without a previously known HBV DNA level baseline (7, 15). Imatinib-induced hepatotoxicity has been reported and the incidence is less than 2.5% in patients with GIST (16); however, liver dysfunction usually resolves with either dose reduction or the discontinuation of the drug, which clearly contradicts Case 2 in the current study. Thus, the 3 cases presented meet the definition of HBVr. Notably, HBVr occurs not only in patients with overt chronic HBV infection but also in patients with resolved HBV infection (17).\n\nHBVr is usually divided into two stages: (i) immediately after immunosuppressive therapy with the induction of HBV replication, reflecting a sharp increase in serum HBV DNA, and (ii) during withdrawal or a decrease in immune suppression. In stage (ii), patients tend to develop immune reconstitution that may lead to hepatocellular injury and even liver failure (18).\n\nMechanism of Imatinib-Induced HBVr\nThe mechanism by which imatinib induces HBVr has yet to be determined. However, a review of the relevant literature suggests that imatinib is directly and/or indirectly (by immunosuppressive function) involved in HBVr (Table 2). HBV covalently closed circular DNA and low levels of HBV DNA and RNA can be detected in host hepatocytes even in patients who have recovered from HBV and produced HBsAg after complete clearance of serum HBsAg and HBV DNA from a recent infection (26). When the immunity of the body, particularly the cellular immune function, is inhibited, viral replication increases, inducing an imbalance in the mechanisms that lead to HBVr (27). The imbalance between host immune response and HBV replication seem to indirectly cause HBVr. Although imatinib was not defined as an immunosuppressant, evidence has suggested that it exhibits an immunoregulatory effect. Imatinib at 400–800 mg/d inhibits the differentiation and function of dendritic cells (DCs), reducing the efficiency of priming cytotoxic T cell lymphocytes (CTLs) (19, 20). It also reduces memory B-cell frequencies and the secondary expansion of memory CTLs, resulting in impaired protection against reinfection (21, 22). Moreover, several in vitro studies using T cells isolated from human peripheral blood have demonstrated a dose-dependent reduction in T-cell proliferation and activation in the presence of imatinib (23, 24). Imatinib also inhibits immunity to several disease, such as herpes zoster infection (28), tuberculosis (29), Epstein Barr Virus-positive lymphoproliferative disease (30), and sclerotic-type chronic graft-versus-host disease, in addition to HBVr (31). However, imatinib can stimulate anticancer responses mediated by T cells, interferon-producing killer DCs and NK cells in patients (11, 32–34). Thus, further research is needed to distinguish the difference in effect of imatinib between viral immunity regulation and tumor immunity regulation.\n\nTable 2 Mechanism of Hepatitis B virus reactivation induced by imatinib.\n\nReactivation modes of HBV\tActivation mechanisms\tReference\t\nIndirect reactivation of HBV\tInhibiting the differentiation and function of dendritic cells\t (19, 20)\t\n\tInhibiting memory cytotoxic T cell expansion\t (21)\t\n\tReducing memory B-cell and impairing humoral immune responses \t (22)\t\n\tReducing T-cell proliferation and activation\t (23, 24)\t\nDirect reactivation of HBV\tInhibiting c-Abl kinase to downregulate CRL4 activity, suppress CRL4cdt2-mediated ubiquitination of HBV polymerase, and further promote HBV reactivation\t (25)\t\nIn addition to indirect reactivation by immunosuppression, imatinib can directly activate HBV. Moreover, c-Abl kinase promotes the CRL4Cdt2 mediated ubiquitination of HBV polymerase and further suppresses HBV replication. However, inhibiting c-Abl kinase activity with imatinib can lead to the accumulation of HBV polymerase protein and release of HBV, and consequently to HBVr (25). Clinical HBV replication in patients with chronic HBV may be activated via direct and indirect pathways; however the exact mechanism of HBVr induced by imatinib is unknown and needs further study.\n\nPrevention and Treatment\nWith the introduction of imatinib, GIST patients often have a good prognosis of long-term survival and quality of life. However, some patients develop HBVr, causing acute fatal liver failure and even death. According to the guideline (35), imatinib is associated with a moderate risk (1% to 10% incidence rate of HBVr). Therefore, early prevention, diagnosis, and treatment of HBVr are extremely significant for GIST patients receiving imatinib therapy.\n\nPrompt identification of HBV-infected patients is mandatory before administering imatinib to prevent HBVr (36). HBV prophylaxis, identification of HBV patients, or reactivation monitoring can effectively prevent imatinib discontinuation. Conducting HBsAg and HBcAb tests is widely recommended before administering immunosuppressors (37, 38). If chronic HBV infection is evident, HBsAb, HBeAg, HBeAb, and HBV DNA may be tested selectively for risk stratification (39). HBsAg-positive tumor patients are suggested to undergo antiviral therapy 1 week before receiving immunosuppressors or are given antivirals and imatinib simultaneously and continue to suppress the risk for HBVr during treatment. The reason is that HBVr-induced hepatitis is more difficult to control and cure (37). Prophylactic therapy can potentially reduce the incidence of HBVr (40). ALT, AST and HBV DNA should be tested every 3 to 6 months during prophylaxis (6). Moreover, HBcAb-positive and HBsAg-negative GIST patients should be monitored every 1-3 months for their ALT, HBV DNA and HBsAg levels during treatment (6, 41). If the tests turn positive under close surveillance, antiviral treatment is started immediately (42). In principle, both therapy for HBV patients with normal immunity function and therapy for HBVr patients should reach the same therapeutic endpoint (43). GIST patients receiving antivirals during treatment with imatinib need to continue their antivirals for 6–12 months after treatment with imatinib (37, 44).\n\nWhen GIST patients experience HBVr, treatment with imatinib should be stopped, and antiviral treatment should be immediately initiated to avoid unfavorable outcomes. As soon as HBVr was evident, imatinib was instantly discontinued in 4 (except Case 2) of the 5 cases presented. Most patients had a good prognosis. Owing to its efficacy in reducing the occurrence of HBVr, lamivudine is widely used in the treatment of cancer patients undergoin g chemotherapy (45). However, long-term use of lamivudine may lead to HBV resistance mutations and drug resistance. Compared with lamivudine, some more recent drugs such as entecavir may reduce the risk of drug resistance (46). Numerous studies (47, 48) have shown that entecavir can effectively inhibit viral replication and improve liver inflammation; moreover, it has an adequate safety index. Thus, entecavir is often considered as a first-line agent. Tenofovir disoproxil fumarate and tenofovir alafenamide fumarate also provide alternatives (49, 50).\n\nOne patient had artificial extracorporeal liver support and another patient had a liver transplant, and each had a good prognosis. Although some GIST patients with HBVr underwent antiviral and supportive treatment, their liver function still deteriorated. If liver injury could not be controlled by antivirals and liver-protective drugs, prompt artificial extracorporeal liver support as treatment choice would save the patient as in Case 1. For a favorable prognosis, a liver transplant is also a therapeutic choice (the case in Walker’s study) for patients with tumors (such as GIST) and suffering acute liver failure.\n\nHowever, our study has several limitations. First, a small number of cases was included in the review, and the follow-up period was short. Second, this study is a retrospective study with possible selection bias. Third, the management and monitoring of HBVr in patients with GIST were not based on research concerning GIST patients with HBVr induced by imatinib but were merely suggested as feasible by current clinical evidence. More prospective clinical random control trials are needed to improve clinical understanding of severe complications.\n\nConclusion\nHBVr has a relatively low incidence rate (6.12%). Regardless, the occurrence of HBVr in GIST patients undergoing treatment with imatinib cannot be ignored, particularly in China, which has a high rate of HBV infection. HBVr prophylaxis and monitoring seem effective and safe for the management of these patients. Thus, serology testing for HBsAg and HBcAb in GIST patients and prophylactic therapy for patients at high risk for HBVr needs to be conducted prior to the initiation of treatment with imatinib. Meanwhile, cessation of treatment with imatinib and initiation of antiviral therapy are mandatory following HBVr.\n\nData Availability Statement\nThe original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.\n\nEthics Statement\nThe studies involving human participants were reviewed and approved by Xiangya Hospital of Central South University. The patients/participants provided their written informed consent to participate in this study. Written informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article.\n\nAuthor Contributions\nTL was the lead investigator and contributed to writing the article. HL, FT, and ZH were the chief investigator and the senior author of the article. PL and XZ assisted with setting up the project and its promotion and helped with editing of the report. All authors contributed to the article and approved the submitted version.\n\nFunding\nThis study was supported by the Hunan Provincial Clinical Medical Technology Innovation Guidance Project, China (2018SK52604).\n\nConflict of Interest\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n\nAbbreviations\nALT, alanine transaminase; AST, aspartate transaminase; CT, computed tomography; GISTs, gastrointestinal stromal tumors; HBcAg, hepatitis B core antigen; HBeAb, hepatitis B e-antibody; HBeAg, hepatitis B e-antigen; HBsAb, hepatitis B surface antibody; HBsAg, hepatitis B surface antigen; HPF, high-power field; HBVr, hepatitis B virus reactivation; NIH, National Institutes of Health; PDGFRA, platelet-derived growth receptor alpha.\n==== Refs\nReferences\n1 \nvon Mehren M Randall RL Benjamin RS Boles S Bui MM Ganjoo KN \nSoft Tissue Sarcoma, Version 2.2018, NCCN Clinical Practice Guidelines in Oncology\n. J Natl Compr Canc Netw (2018 ) 16 (5 ):536–63.  10.6004/jnccn.2018.0025 \n\n2 \nMantese G \nGastrointestinal stromal tumor: epidemiology, diagnosis, and treatment\n. Curr Opin Gastroenterol (2019 ) 35 (6 ):555–9.  10.1097/MOG.0000000000000584 \n\n3 \nJoensuu H Roberts PJ Sarlomo-Rikala M Andersson LC Tervahartiala P Tuveson D \nEffect of the tyrosine kinase inhibitor STI571 in a patient with a metastatic gastrointestinal stromal tumor\n. N Engl J Med (2001 ) 344 (14 ):1052–6.  10.1056/NEJM200104053441404 \n\n4 \nVerweij J Casali PG Zalcberg J LeCesne A Reichardt P Blay JY \nProgression-free survival in gastrointestinal stromal tumours with high-dose imatinib: randomised trial\n. Lancet (2004 ) 364 (9440 ):1127–34.  10.1016/S0140-6736(04)17098-0 \n\n5 \nChang SC Liao CH Wang SY Tsai CY Chiang KC Cheng CT \nFeasibility and Timing of Cytoreduction Surgery in Advanced (Metastatic or Recurrent) Gastrointestinal Stromal Tumors During the Era of Imatinib\n. Med (Baltimore) (2015 ) 94 (24 ):e1014.  10.1097/MD.0000000000001014 \n\n6 \nEuropean Association for the Study of the Liver \nElectronic address eee, European Association for the Study of the L. EASL 2017 Clinical Practice Guidelines on the management of hepatitis B virus infection\n. J Hepatol (2017 ) 67 (2 ):370–98.  10.1016/j.jhep.2017.03.021 \n\n7 \nChinese Society of Infectious Diseases CMA \nChinese Society of Hepatology CMA. [The guidelines of prevention and treatment for chronic hepatitis B (2019 version)]\n. Zhonghua Gan Zang Bing Za Zhi (2019 ) 27 (12 ):938–61.  10.3760/cma.j.issn.1007-3418.2019.12.007 \n\n8 \nInayat F Song F Ali NS Aslam MH Aloma A Hachem H \nHepatitis B virus reactivation following imatinib therapy: A comparative review of 9 cases\n. J Oncol Pharm Pract (2019 ) 25 (6 ):1500–8.  10.1177/1078155218790337 \n\n9 \nWalker EJ Simko JP Ko AH \nHepatitis B viral reactivation secondary to imatinib treatment in a patient with gastrointestinal stromal tumor\n. Anticancer Res (2014 ) 34 (7 ):3629–34.\n\n10 \nLi J Ye Y Wang J Zhang B Qin S Shi Y \nChinese consensus guidelines for diagnosis and management of gastrointestinal stromal tumor\n. Chin J Cancer Res (2017 ) 29 (4 ):281–93.  10.21147/j.issn.1000-9604.2017.04.01 \n\n11 \nZitvogel L Rusakiewicz S Routy B Ayyoub M Kroemer G \nImmunological off-target effects of imatinib\n. Nat Rev Clin Oncol (2016 ) 13 (7 ):431–46.  10.1038/nrclinonc.2016.41 \n\n12 \nCasali PG Abecassis N Bauer S Biagini R Bielack S Bonvalot S \nGastrointestinal stromal tumours: ESMO–EURACAN Clinical Practice Guidelines for diagnosis, treatment and follow-up\n. Ann Oncol (2018 ) 29 :iv68–78.  10.1093/annonc/mdy095 \n\n13 \nLandi B Blay JY Bonvalot S Brasseur M Coindre JM Emile JF \nGastrointestinal stromal tumours (GISTs): French Intergroup Clinical Practice Guidelines for diagnosis, treatments and follow-up (SNFGE, FFCD, GERCOR, UNICANCER, SFCD, SFED, SFRO)\n. Dig Liver Dis (2019 ) 51 (9 ):1223–31.  10.1016/j.dld.2019.07.006 \n\n14 \nWaller CF \nImatinib Mesylate\n. Recent Results Cancer Res (2018 ) 212 :1 –27\n.  10.1007/978-3-319-91439-8_1 \n30069623 \n15 \nChoi J Lim YS \nCharacteristics, Prevention, and Management of Hepatitis B Virus (HBV) Reactivation in HBV-Infected Patients Who Require Immunosuppressive Therapy\n. J Infect Dis (2017 ) 216 (suppl_8 ):S778–S84.  10.1093/infdis/jix178 \n\n16 \nSeidel C Fenner M Langer F Bantel H Ganser A Grunwald V \nImatinib-induced liver cirrhosis in a patient with advanced gastrointestinal stroma tumor (GIST)\n. BMC Cancer (2012 ) 12 :186 .  10.1186/1471-2407-12-186 \n22612794 \n17 \nMasarone M De Renzo A La Mura V Sasso FC Romano M Signoriello G \nManagement of the HBV reactivation in isolated HBcAb positive patients affected with Non Hodgkin Lymphoma\n. BMC Gastroenterol (2014 ) 14 :31 .  10.1186/1471-230X-14-31 \n24533834 \n18 \nHoofnagle JH \nReactivation of hepatitis B\n. Hepatology (2009 ) 49 (5 Suppl ):S156–65.  10.1002/hep.22945 \n\n19 \nBoissel N Rousselot P Raffoux E Cayuela JM Maarek O Charron D \nDefective blood dendritic cells in chronic myeloid leukemia correlate with high plasmatic VEGF and are not normalized by imatinib mesylate\n. Leukemia (2004 ) 18 (10 ):1656–61.  10.1038/sj.leu.2403474 \n\n20 \nAppel S Boehmler AM Grunebach F Muller MR Rupf A Weck MM \nImatinib mesylate affects the development and function of dendritic cells generated from CD34+ peripheral blood progenitor cells\n. Blood (2004 ) 103 (2 ):538–44.  10.1182/blood-2003-03-0975 \n\n21 \nMumprecht S Matter M Pavelic V Ochsenbein AF \nImatinib mesylate selectively impairs expansion of memory cytotoxic T cells without affecting the control of primary viral infections\n. Blood (2006 ) 108 (10 ):3406–13.  10.1182/blood-2006-04-018705 \n\n22 \nde Lavallade H Khoder A Hart M Sarvaria A Sekine T Alsuliman A \nTyrosine kinase inhibitors impair B-cell immune responses in CML through off-target inhibition of kinases important for cell signaling\n. Blood (2013 ) 122 (2 ):227–38.  10.1182/blood-2012-11-465039 \n\n23 \nSeggewiss R Lore K Greiner E Magnusson MK Price DA Douek DC \nImatinib inhibits T-cell receptor-mediated T-cell proliferation and activation in a dose-dependent manner\n. Blood (2005 ) 105 (6 ):2473–9.  10.1182/blood-2004-07-2527 \n\n24 \nDietz AB Souan L Knutson GJ Bulur PA Litzow MR Vuk-Pavlovic S \nImatinib mesylate inhibits T-cell proliferation in vitro and delayed-type hypersensitivity in vivo\n. Blood (2004 ) 104 (4 ):1094–9.  10.1182/blood-2003-12-4266 \n\n25 \nHou L Zhao J Gao S Ji T Song T Li Y \nRestriction of hepatitis B virus replication by c-Abl-induced proteasomal degradation of the viral polymerase\n. Sci Adv (2019 ) 5 (2 ):eaau7130.  10.1126/sciadv.aau7130 \n30775435 \n26 \nYang HC Kao JH \nPersistence of hepatitis B virus covalently closed circular DNA in hepatocytes: molecular mechanisms and clinical significance\n. Emerg Microbes Infect (2014 ) 3 (9 ):e64 .  10.1038/emi.2014.64 \n26038757 \n27 \nOh MJ Lee HJ \nA study of hepatitis B virus reactivation associated with rituximab therapy in real-world clinical practice: a single-center experience\n. Clin Mol Hepatol (2013 ) 19 (1 ):51–9.  10.3350/cmh.2013.19.1.51 \n\n28 \nMattiuzzi GN Cortes JE Talpaz M Reuben J Rios MB Shan J \nDevelopment of Varicella-Zoster virus infection in patients with chronic myelogenous leukemia treated with imatinib mesylate\n. Clin Cancer Res (2003 ) 9 (3 ):976–80.\n\n29 \nDaniels JM Vonk-Noordegraaf A Janssen JJ Postmus PE van Altena R \nTuberculosis complicating imatinib treatment for chronic myeloid leukaemia\n. Eur Respir J (2009 ) 33 (3 ):670–2.  10.1183/09031936.00025408 \n\n30 \nBekkenk MW Vermeer MH Meijer CJ Jansen PM Middeldorp JM Stevens SJ \nEBV-positive cutaneous B-cell lymphoproliferative disease after imatinib mesylate\n. Blood (2003 ) 102 (12 ):4243 .  10.1182/blood-2003-07-2436 \n14623772 \n31 \nArai S Pidala J Pusic I Chai X Jaglowski S Khera N \nA Randomized Phase II Crossover Study of Imatinib or Rituximab for Cutaneous Sclerosis after Hematopoietic Cell Transplantation\n. Clin Cancer Res (2016 ) 22 (2 ):319–27.  10.1158/1078-0432.CCR-15-1443 \n\n32 \nBalachandran VP Cavnar MJ Zeng S Bamboat ZM Ocuin LM Obaid H \nImatinib potentiates antitumor T cell responses in gastrointestinal stromal tumor through the inhibition of Ido\n. Nat Med (2011 ) 17 (9 ):1094–100.  10.1038/nm.2438 \n\n33 \nLarmonier N Janikashvili N LaCasse CJ Larmonier CB Cantrell J Situ E \nImatinib mesylate inhibits CD4+ CD25+ regulatory T cell activity and enhances active immunotherapy against BCR-ABL- tumors\n. J Immunol (2008 ) 181 (10 ):6955–63.  10.4049/jimmunol.181.10.6955 \n\n34 \nSmyth MJ \nImatinib mesylate–uncovering a fast track to adaptive immunity\n. N Engl J Med (2006 ) 354 (21 ):2282–4.  10.1056/NEJMcibr061878 \n\n35 \nPerrillo RP Gish R Falck-Ytter YT \nAmerican Gastroenterological Association Institute technical review on prevention and treatment of hepatitis B virus reactivation during immunosuppressive drug therapy\n. Gastroenterology (2015 ) 148 (1 ):221 –44.e3\n.  10.1053/j.gastro.2014.10.038 \n25447852 \n36 \nKusumoto S Tobinai K \nScreening for and management of hepatitis B virus reactivation in patients treated with anti-B-cell therapy\n. Hematol Am Soc Hematol Educ Program (2014 ) 2014 (1 ):576–83.  10.1182/asheducation-2014.1.576 \n\n37 \nTerrault NA Lok ASF McMahon BJ Chang KM Hwang JP Jonas MM \nUpdate on Prevention, Diagnosis, and Treatment of Chronic Hepatitis B: AASLD 2018 Hepatitis B Guidance\n. Clin Liver Dis (Hoboken) (2018 ) 12 (1 ):33–4.  10.1002/cld.728 \n\n38 \nJang JW Choi JY Bae SH Yoon SK Chang UI Kim CW \nA randomized controlled study of preemptive lamivudine in patients receiving transarterial chemo-lipiodolization\n. Hepatology (2006 ) 43 (2 ):233–40.  10.1002/hep.21024 \n\n39 \nHuang SC Yang HC Kao JH \nHepatitis B reactivation: diagnosis and management\n. Expert Rev Gastroenterol Hepatol (2020 ) 14 (7 ):565–78.  10.1080/17474124.2020.1774364 \n\n40 \nLiu CJ Chen PJ Chen DS Kao JH \nHepatitis B virus reactivation in patients receiving cancer chemotherapy: natural history, pathogenesis, and management\n. Hepatol Int (2013 ) 7 (2 ):316–26.  10.1007/s12072-011-9279-6 \n\n41 \nLaw MF Ho R Cheung CK Tam LH Ma K So KC \nPrevention and management of hepatitis B virus reactivation in patients with hematological malignancies treated with anticancer therapy\n. World J Gastroenterol (2016 ) 22 (28 ):6484–500.  10.3748/wjg.v22.i28.6484 \n\n42 \nLiu WP Xiao XB Xue M Wang GQ Wang XP Song YQ \nProphylactic Use of Entecavir for Lymphoma Patients With Past Hepatitis B Virus Infection: A Randomized Controlled Trial\n. Clin Lymphoma Myeloma Leuk (2019 ) 19 (2 ):103–8.  10.1016/j.clml.2018.11.008 \n\n43 \nSarri G Westby M Bermingham S Hill-Cawthorne G Thomas H Guideline Development G \nDiagnosis and management of chronic hepatitis B in children, young people, and adults: summary of NICE guidance\n. BMJ (2013 ) 346 :f3893.  10.1136/bmj.f3893 \n23804177 \n44 \nSarin SK Kumar M Lau GK Abbas Z Chan HL Chen CJ \nAsian-Pacific clinical practice guidelines on the management of hepatitis B: a 2015 update\n. Hepatol Int (2016 ) 10 (1 ):1 –98\n.  10.1007/s12072-015-9675-4 \n\n45 \nLoomba R Rowley A Wesley R Liang TJ Hoofnagle JH Pucino F \nSystematic review: the effect of preventive lamivudine on hepatitis B reactivation during chemotherapy\n. Ann Intern Med (2008 ) 148 (7 ):519–28.  10.7326/0003-4819-148-7-200804010-00008 \n\n46 \nTang LSY Covert E Wilson E Kottilil S \nChronic Hepatitis B Infection: A Review\n. JAMA (2018 ) 319 (17 ):1802–13.  10.1001/jama.2018.3795 \n\n47 \nChang TT Gish RG de Man R Gadano A Sollano J Chao YC \nA comparison of entecavir and lamivudine for HBeAg-positive chronic hepatitis B\n. N Engl J Med (2006 ) 354 (10 ):1001–10.  10.1056/NEJMoa051285 \n\n48 \nChang TT Lai CL Kew Yoon S Lee SS Coelho HS Carrilho FJ \nEntecavir treatment for up to 5 years in patients with hepatitis B e antigen-positive chronic hepatitis B\n. Hepatology (2010 ) 51 (2 ):422–30.  10.1002/hep.23327 \n\n49 \nGentile G Andreoni M Antonelli G Sarmati L \nScreening, monitoring, prevention, prophylaxis and therapy for hepatitis B virus reactivation in patients with haematologic malignancies and patients who underwent haematologic stem cell transplantation: a systematic review\n. Clin Microbiol Infect (2017 ) 23 (12 ):916–23.  10.1016/j.cmi.2017.06.024 \n\n50 \nSarmati L Andreoni M Antonelli G Arcese W Bruno R Coppola N \nRecommendations for screening, monitoring, prevention, prophylaxis and therapy of hepatitis B virus reactivation in patients with haematologic malignancies and patients who underwent haematologic stem cell transplantation-a position paper\n. Clin Microbiol Infect (2017 ) 23 (12 ):935–40.  10.1016/j.cmi.2017.06.023\n\n", "fulltext_license": "CC BY", "issn_linking": "2234-943X", "issue": "10()", "journal": "Frontiers in oncology", "keywords": "gastrointestinal stromal tumors; hepatitis B virus; imatinib; mechanism; reactivation", "medline_ta": "Front Oncol", "mesh_terms": null, "nlm_unique_id": "101568867", "other_id": null, "pages": "596500", "pmc": null, "pmid": "33552970", "pubdate": "2020", "publication_types": "D016428:Journal Article", "references": "14504105;29846513;21670970;15572591;31577561;18378948;19399803;23719297;11287975;26091448;28427875;29752328;29156044;28668465;26563120;15451219;23804177;22612794;15343347;31387778;30079802;16440357;21873989;28668466;16525137;16723621;27030078;29715359;25447852;20049753;30775435;24533834;23593610;14623772;31941257;30069623;19251803;30581161;30988907;28947860;26378033;12631595;25696914;27605883;26038757;16873671;24982379;15100154;32448008;18981115", "title": "Hepatitis B Virus Reactivation in Gastrointestinal Stromal Tumor Patients Treated With Imatinib.", "title_normalized": "hepatitis b virus reactivation in gastrointestinal stromal tumor patients treated with imatinib" }
[ { "companynumb": "CN-SUN PHARMACEUTICAL INDUSTRIES LTD-2021R1-287633", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "IMATINIB" }, "drugad...
{ "abstract": "Oxaliplatin-induced neurotoxicity can be a dose-limiting side effect to effective chemotherapy. Acute hyperexcitability causes cold-evoked sensory and motor symptoms, which resemble neuromyotonia. An accessible and non-invasive technique for early detection could help select patients for potential treatments. We assessed the use of a simple surface electromyography (sEMG) in patients directly after oxaliplatin infusion.\n\n\n\nIn patients with colorectal cancer, acute neurotoxicity was evaluated by means of a physical examination, a questionnaire, and sEMG directly after the second and fourth cycle of oxaliplatin. Questionnaires were also assessed 1 day after infusion.\n\n\n\n14 patients were measured after the second cycle and 8 patients were also measured after the fourth cycle of oxaliplatin. All patients reported to a variable degree oxaliplatin induced neurotoxicity symptoms: sensitivity to touching cold or swallowing cold items were reported as most severe. Clinical signs of hyperexcitability were observed in 55% of the measurements. Spontaneous activity compatible with neuromyotonia was observed in 82% of the sEMG recordings.\n\n\n\nPatient reported symptoms, physical examination and simple sEMG are complementary measurements to detect acute oxaliplatin induced neurotoxicity. After further validation, sEMG recording can be used as a simple objective screenings tool to detect nerve hyperexcitability directly after oxaliplatin administration.", "affiliations": "Expertise center for Pain and Palliative Medicine, Department of Anesthesiology and Pain Medicine, Radboud University Medical Center, Nijmegen, The Netherlands.;Donders Institute for Brain Cognition and Behavior, Department of Neurology, Radboud University Medical Center, Nijmegen, The Netherlands.;Expertise center for Pain and Palliative Medicine, Department of Anesthesiology and Pain Medicine, Radboud University Medical Center, Nijmegen, The Netherlands.;Department of Health Evidence, Radboud University Medical Center, Nijmegen, The Netherlands.;Department of Medical Oncology, Radboud University Medical Center, Nijmegen, The Netherlands.;Expertise center for Pain and Palliative Medicine, Department of Anesthesiology and Pain Medicine, Radboud University Medical Center, Nijmegen, The Netherlands.;Expertise center for Pain and Palliative Medicine, Department of Anesthesiology and Pain Medicine, Radboud University Medical Center, Nijmegen, The Netherlands.;Donders Institute for Brain Cognition and Behavior, Department of Neurology, Radboud University Medical Center, Nijmegen, The Netherlands.", "authors": "Heuvel|Sandra A S van den|SASVD|;Doorduin|Jonne|J|;Steegers|Monique A H|MAH|;Bronkhorst|Ewald M|EM|;Radema|Sandra A|SA|;Vissers|Kris C P|KCP|;Wal|Selina E I van der|SEIV|;Alfen|Nens van|NV|", "chemical_list": "D000970:Antineoplastic Agents; D000077150:Oxaliplatin", "country": "Ireland", "delete": false, "doi": "10.1016/j.neulet.2019.02.014", "fulltext": null, "fulltext_license": null, "issn_linking": "0304-3940", "issue": "699()", "journal": "Neuroscience letters", "keywords": "Hyperexcitability; Oxaliplatin; Screening; Surface electromyography", "medline_ta": "Neurosci Lett", "mesh_terms": "D000328:Adult; D000368:Aged; D000970:Antineoplastic Agents; D015179:Colorectal Neoplasms; D042241:Early Diagnosis; D004576:Electromyography; D005240:Feasibility Studies; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D020258:Neurotoxicity Syndromes; D000077150:Oxaliplatin; D010865:Pilot Projects", "nlm_unique_id": "7600130", "other_id": null, "pages": "184-188", "pmc": null, "pmid": "30753911", "pubdate": "2019-04-23", "publication_types": "D016430:Clinical Trial; D016428:Journal Article", "references": null, "title": "Simple surface EMG recording as a noninvasive screening method for the detection of acute oxaliplatin-induced neurotoxicity: a feasibility pilot study.", "title_normalized": "simple surface emg recording as a noninvasive screening method for the detection of acute oxaliplatin induced neurotoxicity a feasibility pilot study" }
[ { "companynumb": "NL-ROCHE-2278506", "fulfillexpeditecriteria": "1", "occurcountry": "NL", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CAPECITABINE" }, "drugadditional": "3", "dru...
{ "abstract": "BACKGROUND\nPhiladelphia (Ph) chromosome results from the reciprocal translocation t(9;22)(q34.1;q11.2) and is diagnostic for chronic myeloid leukemia (CML). However, this translocation is also found in acute lymphoid leukemia (ALL), as well as in rare cases of acute myeloid leukemias (AML). Most patients with CML harbor either the e13a2 or the e14a2 BCR-ABL fusion product, while a small subset of the cases expresses e1a2 or e19a2 transcripts. Moreover, several atypical BCR-ABL1 transcripts, beside the most common e1a2, e13a2 and e14a2, have been described, mainly in patients with CML. However, ALL and de novo AML may also carry BCR-ABL1 atypical transcripts which will confer a poor prognosis.\n\n\nMETHODS\nA 78-years old male was admitted at our hospital with clinical and laboratory features allowing to make the diagnosis of AML. No evidence of a preceding CML (splenomegaly or basophilia) was found. The karyotype on G-banded metaphases was 46,XY, t(9;22)(q34;q11). While the molecular analysis was ongoing, the patient started treatment based on hydroxyurea followed by 5-aza-2'-deoxycytidine. The molecular biology analysis revealed the simultaneous presence of the common p190 e1a2 and the rare e6a2 isoforms. Because of persistent pancytopenia and presence of blasts, according to the molecular data, he was then switched to tyrosine kinase inhibitors (TKIs) treatment. Nevertheless, after 2 months, the patient was still refractory to second line treatment dying because of a pulmonary infection.\n\n\nCONCLUSIONS\nThe atypical p190 e6a2 transcript seems to be associated in AML with aggressive disease. TKI therapy alone does not seem to control the disease. Prompt observations on these patients carrying rare BCR-ABL1 transcripts may help to establish optimal treatment approaches on these aggressive BCR-ABL1 phenotypes in different setting of patients.", "affiliations": "Department of Clinical and Molecular Medicine, Hematology Sant'Andrea University Hospital, Sapienza University of Rome, Rome, Italy.;Department of Biomedicine and Prevention, University of Tor Vergata, Rome, Italy.;Department of Biomedicine and Prevention, University of Tor Vergata, Rome, Italy.;Department of Clinical and Molecular Medicine, Hematology Sant'Andrea University Hospital, Sapienza University of Rome, Rome, Italy.;Department of Clinical and Molecular Medicine, Hematology Sant'Andrea University Hospital, Sapienza University of Rome, Rome, Italy.;Department of Biomedicine and Prevention, University of Tor Vergata, Rome, Italy.;Department of Clinical and Molecular Medicine, Hematology Sant'Andrea University Hospital, Sapienza University of Rome, Rome, Italy.;Department of Clinical and Molecular Medicine, Hematology Sant'Andrea University Hospital, Sapienza University of Rome, Rome, Italy.;Department of Clinical and Molecular Medicine, Hematology Sant'Andrea University Hospital, Sapienza University of Rome, Rome, Italy.;Department of Clinical and Molecular Medicine, Hematology Sant'Andrea University Hospital, Sapienza University of Rome, Rome, Italy.;Department of Clinical and Molecular Medicine, Hematology Sant'Andrea University Hospital, Sapienza University of Rome, Rome, Italy.;Department of Biomedicine and Prevention, University of Tor Vergata, Rome, Italy.;Department of Clinical and Molecular Medicine, Hematology Sant'Andrea University Hospital, Sapienza University of Rome, Rome, Italy.;Department of Clinical and Molecular Medicine, Hematology Sant'Andrea University Hospital, Sapienza University of Rome, Rome, Italy.;Department of Clinical and Molecular Medicine, Hematology Sant'Andrea University Hospital, Sapienza University of Rome, Rome, Italy.;Department of Biomedicine and Prevention, University of Tor Vergata, Rome, Italy.;Department of Clinical and Molecular Medicine, Hematology Sant'Andrea University Hospital, Sapienza University of Rome, Rome, Italy. agostino.tafuri@uniroma1.it.", "authors": "Piedimonte|Monica|M|;Ottone|Tiziana|T|;Alfonso|Valentina|V|;Ferrari|Antonella|A|;Conte|Esmeralda|E|;Divona|Mariadomenica|M|;Bianchi|Maria Paola|MP|;Ricciardi|Maria Rosaria|MR|;Mirabilii|Simone|S|;Licchetta|Roberto|R|;Campagna|Alessia|A|;Cicconi|Laura|L|;Galassi|Giulia|G|;Pelliccia|Sabrina|S|;Leporace|Annapaola|A|;Lo Coco|Francesco|F|;Tafuri|Agostino|A|", "chemical_list": "C581634:BCR-ABL1 fusion protein, human; D016044:Fusion Proteins, bcr-abl", "country": "England", "delete": false, "doi": "10.1186/s12885-019-5265-5", "fulltext": "\n==== Front\nBMC CancerBMC CancerBMC Cancer1471-2407BioMed Central London 526510.1186/s12885-019-5265-5Case ReportA rare BCR-ABL1 transcript in Philadelphia-positive acute myeloid leukemia: case report and literature review Piedimonte Monica 1Ottone Tiziana 2Alfonso Valentina 2Ferrari Antonella 1Conte Esmeralda 1Divona Mariadomenica 2Bianchi Maria Paola 1Ricciardi Maria Rosaria 1Mirabilii Simone 1Licchetta Roberto 1Campagna Alessia 1Cicconi Laura 2Galassi Giulia 1Pelliccia Sabrina 1Leporace Annapaola 1Lo Coco Francesco 2Tafuri Agostino agostino.tafuri@uniroma1.it 11 grid.7841.aDepartment of Clinical and Molecular Medicine, Hematology Sant’Andrea University Hospital, Sapienza University of Rome, Rome, Italy 2 0000 0001 2300 0941grid.6530.0Department of Biomedicine and Prevention, University of Tor Vergata, Rome, Italy 10 1 2019 10 1 2019 2019 19 5022 8 2018 2 1 2019 © The Author(s). 2019Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nPhiladelphia (Ph) chromosome results from the reciprocal translocation t(9;22)(q34.1;q11.2) and is diagnostic for chronic myeloid leukemia (CML). However, this translocation is also found in acute lymphoid leukemia (ALL), as well as in rare cases of acute myeloid leukemias (AML). Most patients with CML harbor either the e13a2 or the e14a2 BCR-ABL fusion product, while a small subset of the cases expresses e1a2 or e19a2 transcripts. Moreover, several atypical BCR-ABL1 transcripts, beside the most common e1a2, e13a2 and e14a2, have been described, mainly in patients with CML. However, ALL and de novo AML may also carry BCR-ABL1 atypical transcripts which will confer a poor prognosis.\n\nCase presentation\nA 78-years old male was admitted at our hospital with clinical and laboratory features allowing to make the diagnosis of AML. No evidence of a preceding CML (splenomegaly or basophilia) was found. The karyotype on G-banded metaphases was 46,XY, t(9;22)(q34;q11). While the molecular analysis was ongoing, the patient started treatment based on hydroxyurea followed by 5-aza-2′-deoxycytidine. The molecular biology analysis revealed the simultaneous presence of the common p190 e1a2 and the rare e6a2 isoforms. Because of persistent pancytopenia and presence of blasts, according to the molecular data, he was then switched to tyrosine kinase inhibitors (TKIs) treatment. Nevertheless, after 2 months, the patient was still refractory to second line treatment dying because of a pulmonary infection.\n\nConclusion\nThe atypical p190 e6a2 transcript seems to be associated in AML with aggressive disease. TKI therapy alone does not seem to control the disease. Prompt observations on these patients carrying rare BCR-ABL1 transcripts may help to establish optimal treatment approaches on these aggressive BCR-ABL1 phenotypes in different setting of patients.\n\nKeywords\nAcute myeloid leukemiaPhiladelphia chromosomeBCR-ABL1 e6a2Atypical transcriptsTKIhttp://dx.doi.org/10.13039/501100004271Sapienza Università di RomaC26A14CPRB, C26A158NJR, RM116154EC670667 RP11715C7D08BDC2, and RM11715C7D01147ATafuri Agostino Fondazione Internazionale D'AMATO OnlusFondazione Frisiani-Santiniissue-copyright-statement© The Author(s) 2019\n==== Body\nBackground\nThe t(9;22) chromosome translocation originating the BCR-ABL1 fusion oncoprotein is detected in more than 95% of patients with CML representing the hallmark of the disease [1]. However, this translocation is also found in 10 to 20% of adults and in 2 to 5% of children with ALL, as well as in rare cases (1% approximately) of AML [2].\n\nThe breakpoint on chromosome 9 is localized between exons 1a, 1b and a2. In contrast, breakpoints on chromosome 22 occur within the BCR gene, consisting of 23 exons, thus resulting in several distinct fusion genes. Generally, the breakpoints location on BCR gene occur between b1-b5 exons, within a central region called major breakpoint cluster region (M-bcr), whereas rare cases occur within two other breakpoint cluster regions: minor (m-bcr), with the breakpoint between e1-e2 exons, and micro (μ-bcr) with rupture point between e19-e20 exons. Depending on the breakpoint of the ABL1 gene, the fusion protein has different molecular weight: p190, p210 and p230 proteins for m-bcr, M-bcr and μ-bcr, respectively [3]. Moreover, atypical BCR breakpoints outside the cluster regions have been described, involving splicing between whole exons, insertion of small sequences or genomic breakpoints within exons. For example, e8a2, e15a2 and e6a2 have been also described and their clinical significance is under investigation [2, 4, 5]. The atypical e6a2 BCR-ABL1 transcript produces a rare fusion protein of 185 kDa conferring a poor prognosis in CML due to its association with aggressive phenotype and early transformation, perhaps due to the lack of an important regulatory BCR sequence within the fusion proteins [6]. Here we report a rare case of de novo AML carrying the BCR-ABL1 transcript e6a2.\n\nCase presentation\nA 78-years old male was admitted to the Hematology of the University Hospital Sant’Andrea-Sapienza, because of worsening fatigue and abdominal pain. Written informed consent was obtained from the patient and the study was approved by our institutional review board.\n\nThe peripheral blood count showed hyperleucocytosis (WBC 118 × 109/L), anemia (hemoglobin 8.6 g/dl) and mild thrombocytopenia (98 × 109/L), with no associated splenomegaly. Peripheral blood smear showed hypercellularity with 90% blast cells.\n\nThe morphological examination of bone marrow (BM) aspirate showed 90% agranular blast cells of medium and large size (Fig. 1) and the immunophenotypic analysis performed on a FACScalibur flow cytometer using standard protocol revealed that blast cells were CD34+, CD117+, CD33+, CD13+, HLA-DR+, CD2+ MPO+/−, CD7+/− [7].Fig. 1 The bone marrow cell morphology of the patient at diagnosis. Agranular blast cells of medium and large size\n\n\n\nA diagnosis of AML (M2) was established and the patient started cytoreduction with hydroxyurea obtaining after seven days of treatment a WBC count of 39 × 109/L.\n\nConventional karyotyping was performed on the BM diagnostic aspirate after short-term culture and analyzed after G-banding. The description of the karyotype was made according to the International System for Human Cytogenetic Nomenclature. The cytogenetic analysis on G-banded metaphases disclosed a 46,XY,t(9;22)(q34;q11) karyotype. Then, interphase FISH experiments were carried out using BCR-ABL1 probes (Vysis) and demonstrated the presence of BCR-ABL1 fusion gene.\n\nAt the resolution of a pulmonary aspergillus infection treated with voriconazole, while the cytogenetic and molecular analyses were ongoing, the patient started treatment with 5-aza-2′-deoxycytidine (otherwise called decitabine, 20 mg/m2 for 5 days) for a total of two cycles. Subsequently, nested RT-PCR revealed the simultaneous presence of the common p190 e1a2 and the rare e6a2 isoforms (Fig. 2). PCR products, corresponding to BCR-ABL1 p190 amplification, were purified from agarose gel (QIAquick PCR Purification Kit - Qiagen) and directly sequenced on ABI/Prism 3130 Sequencer (Thermo Fisher Scientific) using BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific). RQ-PCR for e6a2 BCR-ABL1 transcript analysis was performed using the forward primer Q-BCR_ex6_F (GATCCAACGACCAAGAACTCTCT), the reverse primer ENR561 and the ENP541 probe reported elsewhere [8]. The p190 e6a2 values were normalized on the number of ABL1 transcripts and expressed as the number of p190 e6a2 copies every 104 copies of ABL1. To assess molecular response after treatment, a real-time quantitative RT-PCR assay (RQ-PCR) for p190 e6a2 was designed by which we observed significant different kinetics through the e1a2 and e6a2 transcripts with consistent persistence of e6a2 [9].Fig. 2 Kinetics of BCR-ABL1 p190 e1a2 and e6a2 at diagnosis and during follow-up and treatment course of the AML patient\n\n\n\nAfter the first, BM aspirated showed 70% blast cells and two transcripts e1a2 and e6a2 were respectively 3.09 and 5805.47/104 ABL1, while after second cycles blast cells were 20% and e1a2 and e6a2 5.71 and 5747.52.\n\nBecause of persistent pancytopenia and presence of blasts after two cycles of decitabine and in light of molecular data, the patient was then switched to TKI treatment.\n\nThe initial therapy consisted of imatinib 600 mg/day for two weeks that was subsequently reduced to 400 mg/day due to febrile neutropenia. After one month of imatinib, bone marrow showed 60% blast cells with small improvement of thrombocytopenia. Therefore, treatment was switched to dasatinib 100 mg/day, but it was discontinued five days later because of pulmonary embolism. At 10 days of TKI discontinuation, e1a2 and e6a2 were 0.17 and 9477.16/104 ABL1, respectively. After two months of continuous therapy with TKIs, bone marrow infiltration was present and the two transcripts were e1a2 1.6 and e6a2 23727.06/104 ABL1 (Fig. 2).\n\nThe patient, still refractory to second-line treatment, died of pulmonary infection.\n\nDiscussion\nThe AML with BCR-ABL1 fusion is a rare entity and has been included in the 2016 revised World Health Organization (WHO) as a provisional entity of myeloid neoplasm and acute leukemia [10]. The 2017 European LeukemiaNet risk stratification allocated AML with BCR-ABL1 to the adverse risk group [11]. In fact, the patients with BCR-ABL1 positive AML are often refractory to chemotherapy while the responses to imatinib are of limited duration [12]. A recent paper has reported that allogenic stem cell transplantation (allo-SCT) may improve outcome of younger patients [13]; however, given the small number of cases, the optimal therapy for AML with BCR-ABL1 has not been established yet. Beside common BCR-ABL1 transcripts, unusual transcripts have been also described in CML and acute leukemias. We report a rare case of AML characterized by the co-expression of the atypical e6a2 BCR-ABL1 transcript with the common e1a2 one. The e6a2 transcript is mainly observed in CML and sporadically in acute leukemia. In particular, so far about 24 e6a2 cases, in addition to our, have been described in the literature: 17 in CML (1 developed after chronic myelomonocytic leukemia -CMML-), 1 in a case of acute basophilic leukemia, 5 in AML (3 de novo and 2 cases developed after CMML and Myelofibrosis respectively) and 1 in an ALL patient [14]. Table 1 is a summary of the clinical features of e6a2 BCRABL-positive leukemia patients described so far. Notably, co-expression of e6a2 and e1a2 transcripts was previously described in only few cases of CML [15, 16]. Here we reported the first evidence of coexpression in AML.Table 1 Cases reported in literature showing the e6a2 transcript\n\nDiagnosis\tSex/age\tCoexpression of other transcripts\tOther molecular alterations\tTreatment\tReferences\t\nCP - CML\tM/41\t\t\tBMT\tHochhaus et al. [2]\t\nCP - CML\tM/50\t\t\tIFN-Ara C-- > BMT\tDupont et al. [30]\t\nBC - CML\tM/65\t\t\tImatinib\tSchultheis et al. [6]\t\nCP - CML\tM/76\t\t\tIFN\tColla et al. [31]\t\nCML secondary to CMML\tF/64\t\tt(11;16)\tImatinib\tHayette et al. [32]\t\nCP - CML\tM/37\te1a2\t\tImatinib\tRoti et al. [16]\t\nAcute basophilic leukemia\tM/71\t\t\tImatinib-Dauno-Ara C\tGregoire et al. [33]\t\nALL\tF/29\t\t\tG MALL 7/03-Imatinib-- > BMT\tBurmeister et al. [34]\t\nCP - CML\tM/43\t\t\tImatinib\tBreccia et al. [35]\t\nAML\tF/53\t\t\tImatinib-Ida-Ara C\n-- > BMT-Dasatinib\tRitchie et al. [22]\t\nAML (M7)\tF/53\t\tdel(18)(p10)\tImatinib-Ida-Ara C\n-- > Dasatinib-BMT\tCorm et al. [23]\t\nCP - CML\tM/48\t\t\tImatinib-- > Dasatinib\tSchnittger et al. [36]\t\nCP - CML\tM/48\t\tt(7;9), ins(22;9)\tImatinib-- > BMT\tVefring et al. [17]\t\nAP - CML\tM/42\t\t\tImatinib\n-- > BMT-Dasatinib\tVefring et al. [17]\t\nCP - CML\tM/67\t\t\tImatinib\tPopovici et al. [26]\t\nCP - CML\tF/18\t\t\tImatinib\tTorres et al. [37]\t\nAP - CML\tM/57\t\ttrisomy 8\tImatinib\tBeel et al. [18]\t\nCP - CML\tM/36\te1a2\t\tImatinib-Nilotinib\n-- > BMT\tLangabeer et al. [15]\t\nAP - CML\tM/51\t\t\tImatinib-- > BMT\tRohon et al. [19]\t\nBC – CML\tM/48\t\t\tDasatinib\tZagaria et al. [14]\t\nAML (M4)\tF/55\t\t\tMitox-Ara C-Imatinib\n-- > BMT-Dasatinib-DLI\tHarada et al. [21]\t\nBC - CML\tF/48\t\ttrisomy and tetrasomy 8\tDauno-Ara c-Imatinib\n-- > BMT\tCrampe et al. [20]\t\nAML secondary to CMML\tM/58\t\tDNMT3A RUNX1 SUZ12\t3 + 7-Dasatinib-Nilotinib\tYao et al. [25]\t\nAML secondary to myelofibrosis\tM/80\t\tJAK2-V617F\tHydroxyurea-valproic acid\nDasatinib-Imatinib\tBrattas et al. [38]\t\n\n\nData reported so far indicate that the course of disease associated with e6a2a is particularly aggressive both in chronic and acute leukemias. In fact, within CML cases harboring this transcript, 6/17 developed an accelerated or blastic phase [6, 14, 17–20]. Furthermore, there was a prevalence of males on female (ratio 14:3) and the median age at diagnosis was 48 years old (range 18–76 years). Notably, the 3 de novo AML cases with e6a2 transcript were female and the age at diagnosis ranged from 53 to 55 years old [21–23]. These patients underwent allo-SCT in first CR after TKIs and chemotherapy. In these cases, dasatinib and nilotinib were effective treatments in inducing molecular remission after imatinib failure [22, 23] and against relapse after transplant maybe thanks to synergy between TKI and the graft versus-leukemia effect, reaching sustained response [21, 22]. They were alive at 24, 30 and 52 months from diagnosis [21–23]. On the contrary, the case here presented was older and not eligible to allo-SCT. The absence of prior clinical or laboratory evidences of CML (splenomegaly or basophilia) suggested a diagnosis of de novo AML with BCR-ABL1 [24]. He was resistant to decitabine and to TKIs and he died for disease shortly after the diagnosis.\n\nDespite the clinical heterogeneity, all previously reported cases and the one here reported indicate that the atypical e6a2 transcript is associated with aggressive disease and underline the potential advantage of TKIs and allo-SCT in improving prognosis of these patients [6, 14, 15, 17–20, 25]. As suggested, the poor prognosis could be attributed to the partial loss of the Guanine Exchange Factor (GEF)/dbl-like domain [26]. This GEF/dbl-like domain is able to mediate the interaction with several Ras-like G proteins involved in proliferation, signalling and cell organization. Therefore, this truncation seems to determine an increased kinase activity with a greater transforming oncogenic potential. In our patient, the significant different kinetics of e1a2 and e6a2 transcripts quantified by RQ-PCR during the treatment further supports this hypothesis.\n\nThe case here described presents a diagnostic and therapeutic challenge since it shows the importance of combining conventional karyotype/FISH and appropriate genetic assays to detect rare BCR-ABL1 fusion transcripts. Furthermore, the different clearance of the e1a2 and e6a2 transcripts underlines the importance to design specific molecular assays for the evaluation of minimal residual disease and to choose the best therapeutic options.\n\nConclusions\nIn conclusion, hematological malignancies with the atypical e6a2 show an aggressive phenotype with an higher capacity of transformation to blast crisis in CML. Ph + AML is more rare, but with the same worse prognosis [15]. Therapeutic options include TKIs and allo-SCT. In fact, these patients can benefit from use of TKI, although this treatment seems to be more effective as salvage or maintenance therapy or even as bridging to transplant after a remission [15].\n\nFor patients not eligible to transplantation, the prognosis is even more unfavourable and a different approach should be considered. There is no standard of care and treatment of patients affected by Ph + AML, especially elderly, remains an area of unmet need. Notably, Shao et al. recently reported that dasatinib single agent may be an effective and tolerable induction therapy for AML patients with BCR-ABL1 and poor physical condition [27]. Hovewer, prognosis with low-intensity therapies is still poor and novel therapeutic strategies are needed. Future approaches may investigate role of Ras-Mek inhibitors, nowadays under investigation as targeted therapies in other diseases. Additional strategies can combine also novel agent: gentuzumab ozogamicin, tipifarnib, volasertib [28]. Moreover, interesting data arise from the use of ibrutinib [29] that inhibits AML blast proliferation, enhancing cytotoxic activities of cytarabine or daunorubicin.\n\nPrompt observations of patients carrying rare BCR-ABL1 transcripts associated with unfavourable prognosis remain mandatory to include these patients in more aggressive treatment strategies. In vitro studies are necessary to clarify the transforming property and the mechanisms of resistance of e6a2 transcript and to design novel target therapeutic agents.\n\nAbbreviations\nALLAcute lymphoid leukemia\n\nAMLAcute myeloid leukemia\n\nBMBone marrow\n\nBMTBone marrow transplantation\n\nCMChronic myeloid leukemia\n\nDACDacogen\n\nDASDasatinib\n\nFUOFever of unknown origin\n\nGEFGuanine exchange factor\n\nIFIInvasive fungal disease\n\nM-bcrMajor breakpoint cluster region\n\nm-bcrMicro breakpoint cluster region\n\nm-bcrminor breakpoint cluster region\n\nMRDMinimal residual disease\n\nPhPhiladelphia\n\nRQ-PCRReal-time quantitative RT-PCR\n\nTKIsTyrosine kinase inhibitors\n\nWBCWhite blood cells\n\nAcknowledgements\nThe authors thank the team of the laboratory of the immunophenotype, molecular biology and cytogenetics of the Sant’Andrea Hospital for the diagnostic contribution and D. Calef and Dr. V. Gianfelici for editing the manuscript.\n\nFunding\nThis research was funded by Sapienza University (C26A14CPRB, C26A158NJR, RM116154EC670667 RP11715C7D08BDC2, and RM11715C7D01147A) grants, by Fondazione Internazionale D’AMATO Onlus and by Fondazione Frisiani-Santini.\n\nAvailability of data and materials\nThe raw data supporting our findings can be requested from the corresponding author.\n\nAuthors’ contributions\nMP analyzed the data and wrote the paperaccording to the revisions of MRR, AT and FLC; TO, MD, VA and LC performed the assays and reported results. TO wrote methods and drew the figure too. MP, AF, EC, MPB, AC, GG, SP, APL and AT treated the patient. AT, FLC, MRR, SM, RL, TO approved the final version. All authors read and approved the final manuscript.\n\nEthics approval and consent to participate\nNot applicable.\n\nConsent for publication\nWritten informed consent was obtained from the patient for the publication of this case report and the accompanying images.\n\nCompeting interests\nAuthors declare no competing financial interests.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Carter BZ Mak DH Cortes J Andreeff M The elusive chronic myeloid leukemia stem cell: does it matter and how do we eliminate it? SeminHematol 2010 47 4 362 370 \n2. Hochhaus A Reiter A Skladny H Melo JV Sick C Berger U Guo JQ Arlinghaus RB Hehlmann R Goldman JM Cross NC A novel BCR-ABL fusion gene (e6a2) in a patient with Philadelphia chromosome-negative chronic myelogenous leukemia Blood 1996 88 6 2236 2240 8822944 \n3. Melo JV The diversity of BCR-ABL fusion proteins and their relationship to leukemia phenotype Blood 1996 88 7 2375 2384 8839828 \n4. Branford S Rudzki Z Hughes TP A novel BCR±ABL transcript (e8a2) with the insertion of an inverted sequence of ABL intron 1b in a patient with Philadelphia-positive chronic myeloid leukaemia Br J Haematol 2000 109 3 635 637 10.1046/j.1365-2141.2000.02042.x 10886215 \n5. Moreno Mdel P Cortinas MN Bonomi R Cardeza A UriarteMdelR. A novel BCR-ABL fusion transcript (e15a2) in 2 patients with atypicalchronicmyeloproliferativesyndrome Blood 2001 97 11 3668 3669 10.1182/blood.V97.11.3668 11392325 \n6. Schultheis B Wang L Clark RE Melo JV BCR-ABL with an e6a2 fusion in aCML patient diagnosed in blast crisis Leukemia 2003 17 2054 2055 10.1038/sj.leu.2403079 14513059 \n7. Montillo M, Tedeschi A, Pagano L, Venditti A, Ferrara F, Fabris P, Martino B, Musso M, De Rosa G, Specchia G, Monaco M, Sparaventi G, Spadea A, Palmas A, Deplano W, Manna A, Melillo L, Miraglia E, Mirto S, Mandelli F. Feasibility of peripheral blood stem cell rescue as intensification in elderly patients with acute myelocytic leukaemia: a pilot study from the Gimema group. Gruppo Italiano Malattie Ematologiche Maligne Dell'Adulto. Br J Haematol 2000;111(1):334–337.\n8. Gabert J Beillard E van der Velden VH Bi W Grimwade D Pallisgaard N Barbany G Cazzaniga G Cayuela JM Cavé H Pane F Aerts JL De Micheli D Thirion X Pradel V González M Viehmann S Malec M Saglio G van Dongen JJ Standardization and quality control studies of 'real-time' quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia - a Europe against Cancer program Leukemia 2003 17 12 2318 2357 10.1038/sj.leu.2403135 14562125 \n9. Thiede C Steudel C Mohr B Schaich M Schäkel U Platzbecker U Wermke M Bornhäuser M Ritter M Neubauer A Ehninger G Illmer T Analysis of FLT3-activating mutations in 979 patients with acute myelogenous leukemia: association with FAB subtypes and identification of subgroups with poor prognosis Blood 2002 99 12 4326 4335 10.1182/blood.V99.12.4326 12036858 \n10. Arber DA Orazi A Hasserjian R Thiele J Borowitz MJ Le Beau MM Bloomfield D Cazzola M Vardiman JW The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia Blood 2016 127 20 2391 2405 10.1182/blood-2016-03-643544 27069254 \n11. Döhner H Estey E Grimwade D Amadori S Appelbaum FR Büchner T Dombret H Ebert BL Fenaux P Larson RA Levine RL Lo-Coco F Naoe T Niederwieser D Ossenkoppele GJ Sanz M Sierra J Tallman MS Tien HF Wei AH Löwenberg B Bloomfield CD Diagnosis and management of AML in adults: 2017 ELN recommendations from an international expert panel Blood 2017 129 4 424 447 10.1182/blood-2016-08-733196 27895058 \n12. Soupir CP Vergilio JA Dal Cin P Muzikansky A Kantarjian H Jones D Hasserjian RP Philadelphia chromosome-positive acute myeloid leukemia: a rare aggressive leukemia with clinicopathologic features distinct from chronic myeloid leukemia in myeloid blast crisis Am J ClinPathol 2007 127 4 642 650 \n13. Lazarevic VL Labopin M Depei W Yakoub-Agha I Huynh A Ljungman P Schaap N Cornelissen JJ Maillard N Pioltelli P Gedde-Dahl T Lenhoff S Houhou M Esteve J Mohty M Nagler A Relatively favorable outcome after allogeneic stem cell transplantation for BCR-ABL1-positive AML: a survey from the acute leukemia working party of the European society for blood and marrow transplantation (EBMT) Am J Hematol 2018 93 1 31 39 10.1002/ajh.24928 28971504 \n14. Zagaria A Anelli L Coccaro N Tota G Casieri P Cellamare A Impera L Brunetti C Minervini A Minervini CF Delia M Cumbo C Orsini P Specchia G Albano F BCR-ABL1 e6a2 transcript in chronic myeloid leukemia: biological features and molecular monitoring by droplet digital PCR Virchows Arch 2015 467 3 357 363 10.1007/s00428-015-1802-z 26149409 \n15. Langabeer SE Crampe M Kelly J Fadalla K Connaghan G Conneally E Nilotinib and allogeneic stem cell transplantation in a chronic myeloid leukemia patient with e6a2 and e1a2 BCR-ABL transcripts Leuk Res 2010 34 8 e204 e205 10.1016/j.leukres.2010.02.022 20346507 \n16. Roti G La Starza R Gorello P Gottardi E Crescenzi B Martelli MF Mecucci C. e6a2 BCR/ABL1 fusion with cryptic der(9)t(9;22) deletions in a patient with chronic myeloid leukemia Haematologica 2005 90 1139 1141 16079118 \n17. Vefring HK Gruber FX Wee L Hovland R Hjorth-Hansen H Gedde Dahl T Meyer P Chronic myelogenous leukemia with the e6a2 BCR-ABL and lacking imatinib response: presentation of two cases ActaHaematol 2009 122 11 16 \n18. Beel KA Lemmens J Vranckx H Maertens J Vandenberghe P CML with e6a2 BCR-ABL1 transcript: an aggressive entity? Ann Hematol 2011 90 1241 1243 10.1007/s00277-011-1169-4 21302112 \n19. RohonP DM Calabkova L Mojzikova R Katrincsakova B Rusinakova Z Lapcikova A Raida L Faber E Jarosova M Divoky V Indrak K Identification of e6a2 BCR-ABL fusion in a Philadelphia positive CML with marked basophilia: implications for treatment strategy Biomed Pap Med FacUnivPalacky Olomouc Czech Repub 2011 155 187 190 10.5507/bp.2011.030 \n20. Crampe M Haslam K Groarke E Kelleher E O'Shea D Conneally E Langabeer SE Chronic myeloid leukemia with an e6a2 BCR-ABL1 fusion transcript: cooperating mutations at blast crisis and molecular monitoring Case Rep Hematol 2017 2017 9071702 29123930 \n21. Harada Y Nishiwaki S Sugimoto T Onodera K Goto T Sato T Kamoshita S Kawashima N Seto A Okuno S Yamamoto S Iwasaki T Ozawa Y Miyamura K Akatsuka Y Sugiura I Successful treatment with allogeneic stem cell transplantation followed by DLI and TKIs for e6a2 BCR-ABL-positive acute myeloid leukaemia: a case report and literature review Medicine (Baltimore) 2017 96 50 e9160 10.1097/MD.0000000000009160 29390324 \n22. Ritchie DS McBean M Westerman DA Kovalenko S Seymour JF Dobrovic A Complete molecular response of e6a2 BCRABL-positive acute myeloid leukemia toimatinib then dasatinib Blood 2008 111 2896 2898 10.1182/blood-2007-08-107508 18073350 \n23. Corm S Renneville A Rad-Quesnel E Grardel N Preudhomme C Quesnel B Successful treatment of imatinib-resistant acute megakaryoblastic leukemia with e6a2 BCR/ABL: use of dasatinib and reduced-conditioning stem-cell transplantation Leukemia 2007 21 2376 2377 10.1038/sj.leu.2404792 17554376 \n24. Konoplev S Yin CC Kornblau SM Kantarjian HM Konopleva M Andreeff M Lu G Zuo Z Luthra R Medeiros LJ Bueso-Ramos CE Molecular characterization of de novo Philadelphia chromosome-positive acute myeloid leukemia Leuk Lymphoma 2013 54 1 138 144 10.3109/10428194.2012.701739 22691121 \n25. Yao J Douer D Wang L Arcila ME Nafa K Chiu A A case of acute myeloid leukemia with e6a2 BCR-ABL fusion transcript acquired after progressing from chronic myelomonocytic leukemia Leuk Res Rep 2017 7 17 19 28275539 \n26. Popovici C Cailleres S David M Lafage-Pochitaloff M Sainty D Mozziconacci MJ E6a2 BCR-ABL fusion with BCR exon 5-deleted transcript in a Philadelphia positive CML responsive to imatinib Leuk Lymphoma 2005 46 1375 1377 10.1080/10428190500138138 16109618 \n27. Shao X Chen D Xu P Peng M Guan C Xie P Yuan C Chen B Primary Philadelphia chromosome positive acute myeloid leukemia: A case report Medicine (Baltimore) 2018 97 44 e12949 10.1097/MD.0000000000012949 30383645 \n28. Erba HP Finding the optimal combination therapy for the treatment of newly diagnosed AML in older patients unfit for intensive therapy Leuk Res 2015 39 2 183 191 10.1016/j.leukres.2014.11.027 25577399 \n29. Rushworth SA Murray MY Zaitseva L Bowles KM MacEwan DJ Identification of Bruton's tyrosine kinase as a therapeutic target in acute myeloid leukemia Blood 2014 123 8 1229 1238 10.1182/blood-2013-06-511154 24307721 \n30. Dupont M Jourdan E Chiesa J Identification of E6A2 BCR-ABL fusion in a Philadelphia-positive CML Leukemia 2000 14 2011 2012 10.1038/sj.leu.2401916 11069039 \n31. Colla S Sammarelli G Voltolini S Crugnola M Sebastio P Giuliani N. e6a2 BCR-ABL transcript in chronic myeloid leukemia: is it associated with aggressive disease? Haematologica 2004 89 611 613 15136228 \n32. Hayette S Tigaud I Thomas X French M Perrin MC Nicolini F Michallet M Magaud JP Identification of a rare e6a2 BCR-ABL fusion gene during the disease progression of chronic myelomonocytic leukemia: a case report Leukemia 2004 18 1735 1736 10.1038/sj.leu.2403476 15356652 \n33. Grégoire MJ Latger-Cannard V Staal A Bologna S Leotard B Rault JP Béry-Dexheimer M Jonveaux P Identification of an acute basophilic leukaemia carrying a rare e6a2 BCR-ABL transcript ActaHaematol 2006 116 216 218 \n34. Burmeister T Schwartz S Taubald A Jost E Lipp T Schneller F Diedrich H Thomssen H Mey UJ Eucker J Rieder H Gökbuget N Hoelzer D Thiel E Atypical BCR-ABL mRNA transcripts in adult acute lymphoblastic leukemia Haematologica 2007 92 1699 1702 10.3324/haematol.11737 18055996 \n35. Breccia M Cannella L Diverio D Streponi P Nanni M Stefanizzi C Natalino F Mecarocci S Alimena G Isolated thrombocytosis as first sign of chronic myeloid leukemia with e6a2 BCR/ABL fusion transcript, JAK2 negativity and complete response to imatinib Leuk Res 2008 32 177 180 10.1016/j.leukres.2007.05.022 17688946 \n36. Schnittger S Bacher U Kern W Haferlach T Hertenstein B Haferlach C A new case with rare e6a2 BCR-ABL fusion transcript developing two new resistance mutations during imatinibmesylate, which were replaced by T315I after subsequent dasatinib treatment Leukemia 2008 22 856 858 10.1038/sj.leu.2404949 17851552 \n37. Torres F Ivanova-Dragoeva A Pereira M Veiga J Rodrigues AS Sousa AB Tavares P Fernandes AR An e6a2 BCR-ABL fusion transcript in a CML patient having an iliac chloroma at initial presentation Leuk Lymphoma 2007 48 1034 1037 10.1080/10428190701216402 17487751 \n38. Brattås MK Lilleeng K Hovland R Lægreid IJ Vorland M Leh F Bruserud Ø Gjertsen BT Reikvam H Philadelphia chromosome positive AML arising from JAK2- positive myelofibrosis Biomark Res 2018 6 33 10.1186/s40364-018-0147-6 30479769\n\n", "fulltext_license": "CC BY", "issn_linking": "1471-2407", "issue": "19(1)", "journal": "BMC cancer", "keywords": "Acute myeloid leukemia; Atypical transcripts; BCR-ABL1 e6a2; Philadelphia chromosome; TKI", "medline_ta": "BMC Cancer", "mesh_terms": "D000328:Adult; D000368:Aged; D001853:Bone Marrow; D005260:Female; D005500:Follow-Up Studies; D016044:Fusion Proteins, bcr-abl; D006801:Humans; D059785:Karyotype; D015470:Leukemia, Myeloid, Acute; D008297:Male; D008875:Middle Aged; D010677:Philadelphia Chromosome; D014178:Translocation, Genetic", "nlm_unique_id": "100967800", "other_id": null, "pages": "50", "pmc": null, "pmid": "30630459", "pubdate": "2019-01-10", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": "10886215;11069039;11091221;11392325;12036858;14513059;14562125;15136228;15356652;16079118;16109618;17016044;17369142;17487751;17554376;17688946;17851552;18055996;18073350;19641300;20346507;20875553;21302112;21804629;22691121;24307721;25577399;26149409;27069254;27895058;28275539;28971504;29123930;29390324;30383645;30479769;8822944;8839828", "title": "A rare BCR-ABL1 transcript in Philadelphia-positive acute myeloid leukemia: case report and literature review.", "title_normalized": "a rare bcr abl1 transcript in philadelphia positive acute myeloid leukemia case report and literature review" }
[ { "companynumb": "IT-MYLANLABS-2019M1066533", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "2", "activesubstance": { "activesubstancename": "IMATINIB MESYLATE" }, "drugadditional": null,...
{ "abstract": "Patients with hematologic malignancies are at increased risk of infection, with associated morbidity and mortality. Patients with acute myeloid leukemia (AML) have qualitative and quantitative deficits in granulocytes predisposing to bacterial and fungal infections. Acute lymphoblastic leukemia results in qualitative deficits in lymphocytes, resulting in hypogammaglobulinemia and reduced cell-mediated immunity predisposing to certain bacterial and viral as well as fungal infections. Chemotherapeutic regimens often compound these deficits, result in prolonged periods of severe neutropenia, and disrupt mucosal barriers, further elevating infection risk. Despite advances in antimicrobial therapies and prophylaxis, acute leukemia patients with disease- and treatment-related immunosuppression remain at risk for life-threatening infection, including with resistant organisms, antimicrobial-related adverse events, and higher treatment costs. Additionally, our knowledge of infection risk and drug-drug interactions with new immune-targeted cancer therapeutics is evolving. Here, we review 3 areas in which standard practice is evolving as challenges arise and new experience is gained, including antibiotic use in febrile neutropenia, fungal prophylaxis, and use of targeted therapies.", "affiliations": "Division of Infectious Diseases, Department of Medicine, and.;Division of Blood and Marrow Transplant, University of California, San Diego, CA; and.;Division of Infectious Diseases, Department of Medicine, City of Hope National Medical Center, Duarte, CA.", "authors": "Logan|C|C|;Koura|D|D|;Taplitz|R|R|", "chemical_list": "D000970:Antineoplastic Agents; D007166:Immunosuppressive Agents", "country": "United States", "delete": false, "doi": "10.1182/hematology.2020000098", "fulltext": null, "fulltext_license": null, "issn_linking": "1520-4383", "issue": "2020(1)", "journal": "Hematology. American Society of Hematology. Education Program", "keywords": null, "medline_ta": "Hematology Am Soc Hematol Educ Program", "mesh_terms": "D000970:Antineoplastic Agents; D064147:Febrile Neutropenia; D006801:Humans; D007166:Immunosuppressive Agents; D017053:Infection Control; D007239:Infections; D015470:Leukemia, Myeloid, Acute; D008297:Male; D008875:Middle Aged; D054198:Precursor Cell Lymphoblastic Leukemia-Lymphoma; D012307:Risk Factors", "nlm_unique_id": "100890099", "other_id": null, "pages": "135-139", "pmc": null, "pmid": "33275701", "pubdate": "2020-12-04", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": "32435969;29454849;26102575;23975584;30033822;26598096;9243041;8187783;29578073;28161120;25907298;29447988;24425445;30629902;29153975;29255727;20826719;17251531;24323983;32582924;31688198;11037850;30085172;31765470;21258094;29544767;25987632;32556455;29572070;23813455;12884163;25624327;26227319;29451055;29581116;32514626;19647995;8589161;26504183", "title": "Updates in infection risk and management in acute leukemia.", "title_normalized": "updates in infection risk and management in acute leukemia" }
[ { "companynumb": "US-HIKMA PHARMACEUTICALS USA INC.-US-H14001-21-00834", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "POSACONAZOLE" }, ...