article dict | reports listlengths 1 3.97k |
|---|---|
{
"abstract": "Paclitaxel is frequently used for the treatment of patients with nonsmall cell lung cancer. Hypersensitivity reactions (HSRs) have been one of the toxicities observed with administration of paclitaxel. Here, we presented a case of a 49-year-old man with a history of right lung mass proven by biopsy to be a nonsmall cell lung cancer (squamous cell carcinoma) who developed HSR during therapy. In addition to the hypermetabolic primary malignancy, a positron emission tomography/computed tomography (PET/CT) scan showed multiple hypermetabolic skin lesions at several parts of the body. These cutaneous lesions were resolved in the restaging PET/CT scan performed after completion of the six cycles of chemotherapy. This is the first documented case of comparative PET/CT findings of a paclitaxel-induced hypersensitivity.",
"affiliations": "Department of Nuclear Medicine, Ataturk Chest Diseases and Thoracic Surgery Training and Research Hospital, Ankara, Turkey.;Department of Nuclear Medicine, Ataturk Chest Diseases and Thoracic Surgery Training and Research Hospital, Ankara, Turkey.;Department of Chest Diseases, Ataturk Chest Diseases and Thoracic Surgery Training and Research Hospital, Ankara, Turkey.;Department of Nuclear Medicine, Ataturk Chest Diseases and Thoracic Surgery Training and Research Hospital, Ankara, Turkey.",
"authors": "Biner|Inci Uslu|IU|;Tatci|Ebru|E|;Ozyurek|Berna Akinci|BA|;Ozmen|Ozlem|O|",
"chemical_list": null,
"country": "India",
"delete": false,
"doi": "10.4103/lungindia.lungindia_189_17",
"fulltext": "\n==== Front\nLung IndiaLung IndiaLILung India : Official Organ of Indian Chest Society0970-21130974-598XMedknow Publications & Media Pvt Ltd India 29487253LI-35-15710.4103/lungindia.lungindia_189_17Case ReportPaclitaxel-induced dermal hypersensitivity lesions: 2-deoxy-2-[18F]fluoro-D-glucose positron emission tomography/computed tomography Biner Inci Uslu Tatci Ebru Ozyurek Berna Akinci 1Ozmen Ozlem Department of Nuclear Medicine, Ataturk Chest Diseases and Thoracic Surgery Training and Research Hospital, Ankara, Turkey1 Department of Chest Diseases, Ataturk Chest Diseases and Thoracic Surgery Training and Research Hospital, Ankara, TurkeyAddress for correspondence: Dr. Inci Uslu Biner, Department of Nuclear Medicine, Ataturk Chest Diseases and Thoracic Surgery Training and Research Hospital, Sanatoryum Caddesi, Kecioren, 06280 Ankara, Turkey. E-mail: inciuslu@yahoo.comMar-Apr 2018 35 2 157 159 Copyright: © 2018 Indian Chest Society2018This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.Paclitaxel is frequently used for the treatment of patients with nonsmall cell lung cancer. Hypersensitivity reactions (HSRs) have been one of the toxicities observed with administration of paclitaxel. Here, we presented a case of a 49-year-old man with a history of right lung mass proven by biopsy to be a nonsmall cell lung cancer (squamous cell carcinoma) who developed HSR during therapy. In addition to the hypermetabolic primary malignancy, a positron emission tomography/computed tomography (PET/CT) scan showed multiple hypermetabolic skin lesions at several parts of the body. These cutaneous lesions were resolved in the restaging PET/CT scan performed after completion of the six cycles of chemotherapy. This is the first documented case of comparative PET/CT findings of a paclitaxel-induced hypersensitivity.\n\nKEY WORDS\n2-deoxy-2-[18F]fluoro-D-glucose positron emission tomography/computed tomographyhypersensitivity reactionlung cancerpaclitaxel\n==== Body\nINTRODUCTION\nPaclitaxel is a cytotoxic antitumor agent that is widely used for the treatment of various malignancies including lung cancer. Hypersensitivity reactions (HSRs) are one of the adverse events in paclitaxel usage. They most commonly occur after the first or second administration of the drug. Various clinical symptoms from mild rash to severe anaphylaxis can be seen.[1]\n\nThe exact etiology of HSR to paclitaxel and docetaxel is not clearly known. Glucocorticoids with or without H1–H2 receptor antagonist are routinely used to prevent these adverse effects. Desensitization protocols are used to continue the administration of the drug. Skin testing can be helpful.[234]\n\nWe describe the hypermetabolic skin lesions on interim (after two cycles) 2-deoxy-2-[18F] fluoro-D-glucose positron emission tomography/computed tomography (18F-FDG PET/CT) scan of a man with lung cancer who developed severe cutaneous hypersensitivity to paclitaxel.\n\nCASE REPORT\nHere, we present a case of a 49-year-old man with a history of right lung mass proven by biopsy to be a nonsmall cell lung cancer (squamous cell carcinoma). The first and second dose of paclitaxel (200 mg m2) combined with cisplatin was infused within 1 h with standard premedications. An 18F-FDG PET/CT scan performed 3 weeks after the second cycle of chemotherapy revealed multiple hypermetabolic skin lesions at several parts of the body including scalp, neck, chest, abdomen, and back, right inguinal region with maximum standardized uptake value of 4.31 [Figure 1, arrows] mimicking probable skin metastases in addition to hypermetabolic mass in the right lower lobe and hypermetabolic mediastinal lymph nodes. On physical examination, severe painful and pruritic rashes on his scalp, neck, chest, abdomen, and back were inspected. It was retrospectively learned that he developed a widespread paclitaxel-induced drug eruption during the therapy within 2 days after the administration of the second cycle. Radiologic and clinical examination by a dermatologist indicated first the drug HSR as the underlying cause of these hypermetabolic skin lesions. Biologic tests revealed no autoimmunity. He reported not to have any skin lesions after the prior cycle of chemotherapy, and there were not any skin lesions at the first 18F-FDG PET/CT performed for staging, as well. Based on the clinical course and physical examination, skin biopsy did not need to be performed. Successful symptomatic management with oral (dexamethasone 4 mg/day) and topical treatment produced prominent regression of the lesions. The patient was re-exposed to taxanes through desensitization protocol, and these allowed him to complete the six courses of therapy that includes paclitaxel. Subsequently, 18F-FDG PET/CT performed after 3 weeks after completion of six cycles of chemotherapy showed resolution of the skin lesions in addition to the regression in primary malignancy [Figure 2, arrows], which correlated with clinical resolution of the skin lesions without any scarring.\n\nFigure 1 Maximum intensity projection image of attenuation-corrected 2-deoxy-2-[18F] fluoro-D-glucose positron emission tomography/computed tomography taken 3 weeks after he had received second cycle of chemotherapy shows multiple focal hypermetabolic skin lesions located at scalp, neck, chest, abdomen, back (black arrow). (a) Axial computed tomography and axial positron emission tomography/computed tomography images of the thoracal skin lesions are seen, respectively. (b and c) (White and black arrows) In the light of clinical course of the lesion and drug exposure history, paclitaxel-induced hypersensitivity is diagnosed\n\nFigure 2 Prominent regression of these hypermetabolic skin lesions on the maximum intensity projection and axial positron emission tomography/computed tomography images (a and c) (black arrows) and the resolution of the skin lesions on axial computed tomography images of the thoracic region (b) (white arrow) which are taken when the six courses of chemotherapy with docetaxel and cisplatin and thoracal radiotherapy had finished\n\nDISCUSSION\nIn view of the extensive use of paclitaxel in lung cancers, it is important to be aware of the possibility of drug hypersensitivity in these patients. The patients can have the reaction after the first or second course of therapy.[1] HSR was developed within 2 days after the second paclitaxel infusion in our patient.\n\n18F-FDG PET has been shown to be useful in the evaluation of many tumors including lung cancers. However, abnormal FDG uptake is not specific to malignancy, and inflammatory or infectious processes must be considered as well. Inflammatory cells (neutrophils and activated macrophages) at the sites of inflammation or infection will show increased FDG accumulation.[56]\n\nCutaneous 18F-FDG uptakes may be an incidental finding at PET/CT scans. Some benign skin lesions that show high 18F-FDG accumulations may mimic malignancies and lead to false positive interpretations.[678]\n\nAbnormal skin uptake can be easily misinterpreted as skin metastases such as our case. As demonstrated in this case, benign skin lesions showing FDG uptake such as drug eruptions must be ruled out in patients with carcinoma.[69]\n\nCorrelation with clinical findings can avoid false positive interpretation. In our patient, the additional finding of abnormal multiple skin uptakes of FDG in association with clinically evident rashes resulted in the correct diagnosis of drug hypersensitivity. He also had a dramatic response to the symptomatic therapy with oral and topical corticosteroids. Restaging 18F-FDG PET/CT scan performed after completion of six cycles of chemotherapy showed resolution of these lesions.\n\nClinical and imaging findings together may aid the distinction of benign from malignant lesions, which is highly relevant to prognosis.\n\nAdverse skin reactions associated with the use of paclitaxel have been reported in the literature.[10] To our knowledge, comparative 18F-FDG PET/CT findings of paclitaxel-induced cutaneous hypersensitivity lesions have not previously been described.\n\nCONCLUSIONS\nThe possibility of false positive inflammatory processes must be considered when abnormal skin FDG uptake is examined in 18F-FDG PET/CT scans. The presence of these hypersensitivity lesions should be taken into account during paclitaxel treatment. We would like to highlight the importance of correlation with clinical findings that can avoid false positive interpretation of these lesions.\n\nDeclaration of patient consent\nThe authors certify that they have obtained all appropriate patient consent forms. In the form the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.\n\nFinancial support and sponsorship\nNil.\n\nConflicts of interest\nThere are no conflicts of interest.\n==== Refs\nREFERENCES\n1 Boulanger J Boursiquot JN Cournoyer G Lemieux J Masse MS Almanric K Management of hypersensitivity to platinum- and taxane-based chemotherapy: Cepo review and clinical recommendations Curr Oncol 2014 21 e630 41 25089112 \n2 Picard M Castells MC Re-visiting hypersensitivity reactions to Taxanes: A comprehensive review Clin Rev Allergy Immunol 2015 49 177 91 24740483 \n3 Morita M Suyama H Igishi T Shigeoka Y Kodani M Hashimoto K Dexamethasone inhibits paclitaxel-induced cytotoxic activity through retinoblastoma protein dephosphorylation in non-small cell lung cancer cells Int J Oncol 2007 30 187 92 17143528 \n4 Peereboom DM Donehower RC Eisenhauer EA McGuire WP Onetto N Hubbard JL Successful re-treatment with taxol after major hypersensitivity reactions J Clin Oncol 1993 11 885 90 8098057 \n5 El-Haddad G Zhuang H Gupta N Alavi A Evolving role of positron emission tomography in the management of patients with inflammatory and other benign disorders Semin Nucl Med 2004 34 313 29 15493008 \n6 Blumer SL Scalcione LR Ring BN Johnson R Motroni B Katz DS Cutaneous and subcutaneous imaging on FDG-PET: Benign and malignant findings Clin Nucl Med 2009 34 675 83 19893399 \n7 Bruna-Muraille C Pochart JM Papathanassiou D Guedec-Ghelfi R Cuif-Job A Liehn JC Incidental finding of F-18 FDG skin uptake in a patient with psoriasis during the evaluation of a recurrent papillary thyroid carcinoma Clin Nucl Med 2011 36 34 5 21157205 \n8 Wadih A Rehm PK Deng C Douvas M Active herpes zoster infection with cutaneous manifestation and adenopathy on FDG PET/CT Radiol Case Rep 2015 10 27 9 26649113 \n9 Dhambri S Zendah I Ayadi-Kaddour A Adouni O El Mezni F Cutaneous metastasis of lung carcinoma: A retrospective study of 12 cases J Eur Acad Dermatol Venereol 2011 25 722 6 20735519 \n10 Beri R Rosen FR Pacini MJ Desai SR Severe dermatologic reactions at multiple sites after paclitaxel administration Ann Pharmacother 2004 38 238 41 14742758\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "0970-2113",
"issue": "35(2)",
"journal": "Lung India : official organ of Indian Chest Society",
"keywords": "2-deoxy-2-[18F]fluoro-D-glucose positron emission tomography/computed tomography; hypersensitivity reaction; lung cancer; paclitaxel",
"medline_ta": "Lung India",
"mesh_terms": null,
"nlm_unique_id": "8405380",
"other_id": null,
"pages": "157-159",
"pmc": null,
"pmid": "29487253",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "24740483;26649113;21157205;19893399;17143528;25089112;20735519;8098057;14742758;15493008",
"title": "Paclitaxel-induced dermal hypersensitivity lesions: 2-deoxy-2-[18F]fluoro-D-glucose positron emission tomography/computed tomography.",
"title_normalized": "paclitaxel induced dermal hypersensitivity lesions 2 deoxy 2 18f fluoro d glucose positron emission tomography computed tomography"
} | [
{
"companynumb": "TR-TEVA-2018-TR-879469",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CISPLATIN"
},
"drugadditional": null,
... |
{
"abstract": "Decompression sickness (DCS) is a well-recognized complication of diving but rarely results in shock or respiratory failure. We report a case of severe DCS in a diver associated with shock and respiratory failure requiring mechanical ventilation. A healthy 50-year-old male diver dove to a depth of 218 feet for 43 minutes while breathing air but omitted 6.5 hours of air decompression due to diver error. The clinical presentation was remarkable for loss of consciousness, hypotension, cutis marmorata, peripheral edema, and severe hypoxia requiring mechanical ventilation with diffuse lung opacities on chest radiograph. Laboratories were significant for polycythemia and hypoalbuminemia. A single hyperbaric oxygen treatment was provided on the day of admission during which shock worsened requiring aggressive volume resuscitation and three vasopressors. In the first 37 hours of hospitalization, 22 liters of crystalloid and multiple albumin boluses were administered for refractory hypotension by which time all vasopressors had been discontinued and blood pressure had normalized. He required 10 days of mechanical ventilation and was discharged on day 21 with mild DCS-related neurologic deficits. This clinical course is characteristic of DCS-related shock wherein bubble-endothelial interactions cause a transient capillary leak syndrome associated with plasma extravasation, hemoconcentration, and hypovolemia. The pathophysiology and typical clinical course of DCS-related shock suggest the need for aggressive but time-limited administration of crystalloid and albumin. Because hyperbaric oxygen is the primary treatment for DCS, treatment with hyperbaric oxygen should be strongly considered even in the face of extreme critical illness.",
"affiliations": "Sections of Graduate Medical Education, Virginia Mason Medical Center, Seattle, WA, USA.;Undersea and Hyperbaric Medicine, Virginia Mason Medical Center, Seattle, WA, USA.;Undersea and Hyperbaric Medicine, Virginia Mason Medical Center, Seattle, WA, USA.",
"authors": "Arjomand|Abdullah|A|;Holm|James R|JR|;Gerbino|Anthony J|AJ|https://orcid.org/0000-0001-8521-0143",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2020/8855060",
"fulltext": "\n==== Front\nCase Rep Crit Care\nCase Rep Crit Care\nCRICC\nCase Reports in Critical Care\n2090-6420 2090-6439 Hindawi \n\n10.1155/2020/8855060\nCase Report\nSevere Decompression Sickness Associated with Shock and Acute Respiratory Failure\nArjomand Abdullah \n1\n Holm James R. \n2\n https://orcid.org/0000-0001-8521-0143Gerbino Anthony J. tgerbino@comcast.net\n2\n\n3\n\n4\n \n1Sections of Graduate Medical Education, Virginia Mason Medical Center, Seattle, WA, USA\n\n2Undersea and Hyperbaric Medicine, Virginia Mason Medical Center, Seattle, WA, USA\n\n3Pulmonary Medicine, Virginia Mason Medical Center, Seattle, WA, USA\n\n4Critical Care Medicine, Virginia Mason Medical Center, Seattle, WA, USA\nAcademic Editor: Zsolt Molnár\n\n\n2020 \n3 11 2020 \n2020 885506023 4 2020 15 9 2020 22 10 2020 Copyright © 2020 Abdullah Arjomand et al.2020This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Decompression sickness (DCS) is a well-recognized complication of diving but rarely results in shock or respiratory failure. We report a case of severe DCS in a diver associated with shock and respiratory failure requiring mechanical ventilation. A healthy 50-year-old male diver dove to a depth of 218 feet for 43 minutes while breathing air but omitted 6.5 hours of air decompression due to diver error. The clinical presentation was remarkable for loss of consciousness, hypotension, cutis marmorata, peripheral edema, and severe hypoxia requiring mechanical ventilation with diffuse lung opacities on chest radiograph. Laboratories were significant for polycythemia and hypoalbuminemia. A single hyperbaric oxygen treatment was provided on the day of admission during which shock worsened requiring aggressive volume resuscitation and three vasopressors. In the first 37 hours of hospitalization, 22 liters of crystalloid and multiple albumin boluses were administered for refractory hypotension by which time all vasopressors had been discontinued and blood pressure had normalized. He required 10 days of mechanical ventilation and was discharged on day 21 with mild DCS-related neurologic deficits. This clinical course is characteristic of DCS-related shock wherein bubble-endothelial interactions cause a transient capillary leak syndrome associated with plasma extravasation, hemoconcentration, and hypovolemia. The pathophysiology and typical clinical course of DCS-related shock suggest the need for aggressive but time-limited administration of crystalloid and albumin. Because hyperbaric oxygen is the primary treatment for DCS, treatment with hyperbaric oxygen should be strongly considered even in the face of extreme critical illness.\n==== Body\n1. Introduction\nDecompression sickness (DCS) is a well-recognized complication of diving that occurs when inert gas breathed at depth leaves solution and forms injurious bubbles. Symptoms are most often musculoskeletal and neurologic and are effectively treated with hyperbaric oxygen using a standard protocol administered over roughly five to eight hours.\n\nShock is a rare manifestation of DCS that is typically associated with a large, omitted decompression obligation. These patients often present with severe illness, challenging the clinical team to provide aggressive critical care that transitions from the emergency department, to the hyperbaric chamber, and then to the intensive care unit. We report a case of DCS causing severe shock associated with plasma extravasation, hemoconcentration, and respiratory failure requiring mechanical ventilation.\n\n2. Case\nA healthy 50-year-old experienced SCUBA diver dove to a maximum depth of 218 feet for 43 minutes while breathing air. He became confused due to nitrogen narcosis leading to a longer, deeper dive than originally planned. He ascended from depth slowly according to the staged decompression suggested by his dive computer but ultimately exhausted his supply of breathing gas and was forced to surface having omitted 6.5 hours of required air decompression. Upon surfacing, he was conscious and aware that he had a massive unfulfilled decompression obligation, hailed a nearby boat, and requested that emergency medical services be summoned. Shortly thereafter, he lost consciousness but remained at the surface due to his buoyancy control device. He was rescued from the water, intubated, and mechanically ventilated.\n\nUpon arrival in the emergency room, he was hypotensive requiring norepinephrine infusion. Peripheral edema was present. He developed cutis marmorata (Figure 1) [1], a rash typically associated with severe DCS. The initial chest radiograph (after 2 L intravenous crystalloid) demonstrated diffuse opacities. Initial labs showed hypoalbuminemia (1.1 g/dL), polycythemia (hematocrit 58), lactic acidosis, and impaired gas exchange (pH 7.18, PaO2 120 mm Hg, PaCO2 50 mm Hg on 100% oxygen).\n\nHe was transported to a hospital-based multiplace hyperbaric chamber with critical care capabilities. The standard hyperbaric treatment protocol for decompression sickness, a United States Navy Treatment Table 6, was begun. Shock worsened during hyperbaric treatment prompting repeated boluses of intravenous crystalloid and albumin and addition of vasopressin and epinephrine infusions to norepinephrine. Similarly, progressive hypoxia, acidemia, and ventilator dyssynchrony during hyperbaric treatment prompted increases in positive end-expiratory pressure and initiation of bicarbonate and cisatracurium infusions. Despite this management, shock and hypoxia worsened and the decision was made to terminate the hyperbaric treatment after 230 minutes of a planned 260-minute treatment. Subsequent hyperbaric treatments were not provided due to cardiopulmonary instability.\n\nDuring the initial 37 hours of hospitalization, 22 liters of crystalloid and multiple albumin boluses were administered for refractory hypotension at which time blood pressure normalized and all vasopressors had been discontinued (Figure 2). Despite aggressive diuresis over the next few days until euvolemic, he required low tidal volume mechanical ventilation for 10 days. He was discharged on day 21 without need for supplemental oxygen. Neurologic deficits included mild ischemic optic neuropathy and cognitive dysfunction with brain MRI demonstrating small, multifocal infarcts consistent with severe DCS.\n\n3. Discussion\nWe present a case of severe DCS due to a massive omitted decompression requirement associated with shock, acute respiratory failure, and neurologic injury. This case highlights two rare manifestations of DCS—shock and respiratory failure—treated with hyperbaric oxygen therapy in the setting of cardiopulmonary collapse.\n\nOnly three cases of shock due to DCS have been reported in the last 45 years [2–4] but case series of DCS reported prior to that time in divers, aviators, and animal models reveal a characteristic clinical course. These accounts [5–8] describe hypovolemic shock with plasma extravasation associated with hemoconcentration and hypoalbuminemia, typically resolving within 48-72 hours if the subject survived. The rarity of these clinical reports and their publication outside of the critical care literature may make recognition of DCS-related shock challenging for the intensivist, especially when not associated with an exceptional dive profile.\n\nThe pathophysiology of shock due to DCS involves the interaction of undissolved inert gas with vascular endothelium. Inert gas breathed at high ambient pressure (i.e., at depth) forms bubbles in tissue and vascular spaces if, upon diver ascent, the pressure decreases too quickly relative to the amount of dissolved gas. In the present case, the omitted decompression was massive, resulting in an uncommonly large burden of bubbles. Bubble-endothelial interactions lead to endothelial dysfunction and an inflammatory response [9–12] that increases vascular permeability, resulting in plasma extravasation and subsequent intravascular volume depletion [7]. Whether there is a component of distributive shock related to endothelial dysfunction that compounds hypovolemic shock is unclear. This pathophysiology and characteristic clinical course suggest the need for aggressive, early but time-limited administration of crystalloid and albumin to correct intravascular hypovolemia and oncotic pressure defects.\n\nWe advocate for a trial of hyperbaric oxygen even in the most unstable of patients with DCS or arterial gas embolism because hyperbaric oxygen is the primary treatment for these diseases and rapid improvement in typical DCS-related symptoms is common [13]. Although shock did not improve during hyperbaric treatment in the present case, we speculate that clinical outcome would have been worse without such treatment.\n\nThere are several caveats to the aggressive use of hyperbaric oxygen in the critically ill DCS patient. The patient should be first transported to the closest emergency department for evaluation and stabilization, even if that center does not have hyperbaric capabilities. Second, the ability to comfortably manage severely ill patients is variable, even among hyperbaric centers with critical care capabilities [14, 15]. Finally, the decision to treat severely ill patients with hyperbaric oxygen requires close collaboration between the intensivist and hyperbaricist throughout the clinical course to repeatedly weigh the risks and benefits of treatment [14].\n\nThis patient's respiratory failure likely was multifactorial including water aspiration, lung DCS, extravascular fluid overload, and possibly DCS-related fat emboli. Water aspiration is likely because the patient lost consciousness at the surface prior to rescue. While hypotension predominates in DCS-related shock, varying degrees of lung injury are often reported [3, 5, 6] and interactions between pulmonary endothelium and bubbles result in vascular leak [10, 11]. DCS-related pulmonary edema is suggested in the present case by dense, homogeneous lung opacities on the admission chest radiograph (rather than patchy infiltrates anticipated from aspiration at the water's surface) and the massive systemic capillary leak that suggests similar injury to the pulmonary endothelium. Aggressive volume resuscitation undoubtedly contributed to respiratory failure, with effects likely amplified by increased permeability of the alveolar-capillary membrane. Although there is no evidence of fat emboli in the present case, fat emboli have been found in the lung and other organs in fatal cases of DCS [6, 8, 16], presumably due to bubble-mediated infarction of long bones, and thus may also play a role in DCS-related lung injury.\n\nWe have presented a case of DCS-related shock with acute respiratory failure requiring prolonged mechanical ventilation. This case illustrates the characteristic clinical course of time-limited shock with plasma extravasation caused by severe DCS. We recommend aggressive, early resuscitation with crystalloid and albumin to correct intravascular volume deficits and strong consideration of hyperbaric oxygen treatment even in extreme critical illness.\n\nData Availability\nData are not applicable (all data related to the presented case is available in the medical record).\n\nConsent\nThe patient has provided signed informed consent for publication of his clinical case.\n\nConflicts of Interest\nThe authors have no conflicts of interest to disclose.\n\nFigure 1 Cutis marmorata, a rash typically associated with severe decompression sickness, was present on arrival to the hyperbaric chamber.\n\nFigure 2 Time course of crystalloid administered upon arrival at the medical center with hyperbaric capabilities. Solid bars show timing of hyperbaric oxygen treatment (HBO) and norepinephrine (Norepi), vasopressin (Vaso), and epinephrine (Epi) infusions. The darkest color intensity indicates maximum vasopressor dose (Norepi, 30 mcg/min; Vaso, 0.04 units/min; Epi, 10 mcg/min), faded intensity indicates taper of dose, and absence of bar indicates discontinuation of vasopressor. Mean arterial pressure (not shown) was 55-65 mm Hg throughout this period.\n==== Refs\n1 Mutluoglu M. Ay H. Uzun G. Cutaneous manifestations of decompression sickness: cutis marmorata The New Zealand Medical Journal 2011 124 1340 87 88 \n2 Trytko B. Mitchell S. Extreme survival: a serious technical diving accident South Pacific Underwater Medicine Society (SPUMS) Journal 2005 35 23 27 \n3 Gempp E. Lacroix G. Cournac J. M. Louge P. Severe capillary leak syndrome after inner ear decompression sickness in a recreational scuba diver The Journal of Emergency Medicine 2013 45 1 70 73 10.1016/j.jemermed.2012.11.101 2-s2.0-84897354134 23602149 \n4 Klapa S. Meyne J. Kähler W. Decompression illness with hypovolemic shock and neurological failure symptoms after two risky dives: a case report Physiological Reports 2017 5 6, article e13094 10.14814/phy2.13094 2-s2.0-85016328816 28325788 \n5 Malette W. G. Fitzgerald J. Cockett A. Dysbarism. A review of thirty-five cases with suggestion for therapy Aerospace Medicine 1962 33 1132 1139 14468878 \n6 Haymaker W. Johnston A. D. Downey V. M. Fatal decompression sickness during jet aircraft flight: a clinicopathological study of two cases The Journal of Aviation Medicine 1956 27 1 2 17 13286215 \n7 Brunner F. P. Frick P. G. Bühlmann A. A. Post-decompression shock due to extravasation of plasma The Lancet 1964 283 7342 1071 1073 10.1016/s0140-6736(64)91270-x 2-s2.0-0000541277 14132608 \n8 Cockett A. T. K. Pathophysiology of shock secondary to underwater decompression sickness Bulletin de la Société Internationale de Chirurgie 1973 32 2 229 237 4198527 \n9 Zhang K. Wang D. Jiang Z. Ning X. Buzzacott P. Xu W. Endothelial dysfunction correlates with decompression bubbles in rats Scientific Reports 2016 6 1, article 33390 10.1038/srep33390 2-s2.0-84987600868 \n10 Nossum V. Hjelde A. Brubakk A. O. Small amounts of venous gas embolism cause delayed impairment of endothelial function and increase polymorphonuclear neutrophil infiltration European Journal of Applied Physiology 2002 86 3 209 214 10.1007/s00421-001-0531-y 2-s2.0-0036939236 11990728 \n11 Barak M. Katz Y. Microbubbles: pathophysiology and clinical implications Chest 2005 128 4 2918 2932 10.1378/chest.128.4.2918 2-s2.0-27144506167 16236969 \n12 Martin J. D. Thom S. R. Vascular leukocyte sequestration in decompression sickness and prophylactic hyperbaric oxygen therapy in rats Aviation, Space, and Environmental Medicine 2002 73 6 565 569 \n13 Vann R. D. Butler F. K. Mitchell S. J. Moon R. E. Decompression illness Lancet 2011 377 9760 153 164 10.1016/s0140-6736(10)61085-9 2-s2.0-79251527221 21215883 \n14 Mathieu D. Ratzenhofer-Komenda B. Kot J. Hyperbaric oxygen therapy for intensive care patients: position statement by the European Committee for Hyperbaric Medicine Diving and Hyperbaric Medicine 2015 45 1 42 46 25964038 \n15 Kot J. Staffing and training issues in critical care hyperbaric medicine Diving and Hyperbaric Medicine 2015 45 1 47 50 25964039 \n16 Rait W. The etiology of postdecompression shock in aircrewmen United States Armed Forces Medical Journal 1959 10 7 790 805 13669167\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-6420",
"issue": "2020()",
"journal": "Case reports in critical care",
"keywords": null,
"medline_ta": "Case Rep Crit Care",
"mesh_terms": null,
"nlm_unique_id": "101598416",
"other_id": null,
"pages": "8855060",
"pmc": null,
"pmid": "33204543",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "14132608;16236969;11990728;4198527;27615160;25964038;13669167;23602149;12056672;25964039;28325788;13286215;21215883;21952389;14468878",
"title": "Severe Decompression Sickness Associated with Shock and Acute Respiratory Failure.",
"title_normalized": "severe decompression sickness associated with shock and acute respiratory failure"
} | [
{
"companynumb": "US-TEVA-2021-US-1914973",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "EPINEPHRINE"
},
"drugadditional": "1",
... |
{
"abstract": "OBJECTIVE\nTo study serious harms associated with selective serotonin and serotonin-norepinephrine reuptake inhibitors.Design Systematic review and meta-analysis.\n\n\nMETHODS\nMortality and suicidality. Secondary outcomes were aggressive behaviour and akathisia.\n\n\nMETHODS\nClinical study reports for duloxetine, fluoxetine, paroxetine, sertraline, and venlafaxine obtained from the European and UK drug regulators, and summary trial reports for duloxetine and fluoxetine from Eli Lilly's website.\nDouble blind placebo controlled trials that contained any patient narratives or individual patient listings of harms.\n\n\nMETHODS\nTwo researchers extracted data independently; the outcomes were meta-analysed by Peto's exact method (fixed effect model).\n\n\nRESULTS\nWe included 70 trials (64,381 pages of clinical study reports) with 18,526 patients. These trials had limitations in the study design and discrepancies in reporting, which may have led to serious under-reporting of harms. For example, some outcomes appeared only in individual patient listings in appendices, which we had for only 32 trials, and we did not have case report forms for any of the trials. Differences in mortality (all deaths were in adults, odds ratio 1.28, 95% confidence interval 0.40 to 4.06), suicidality (1.21, 0.84 to 1.74), and akathisia (2.04, 0.93 to 4.48) were not significant, whereas patients taking antidepressants displayed more aggressive behaviour (1.93, 1.26 to 2.95). For adults, the odds ratios were 0.81 (0.51 to 1.28) for suicidality, 1.09 (0.55 to 2.14) for aggression, and 2.00 (0.79 to 5.04) for akathisia. The corresponding values for children and adolescents were 2.39 (1.31 to 4.33), 2.79 (1.62 to 4.81), and 2.15 (0.48 to 9.65). In the summary trial reports on Eli Lilly's website, almost all deaths were noted, but all suicidal ideation events were missing, and the information on the remaining outcomes was incomplete.\n\n\nCONCLUSIONS\nBecause of the shortcomings identified and having only partial access to appendices with no access to case report forms, the harms could not be estimated accurately. In adults there was no significant increase in all four outcomes, but in children and adolescents the risk of suicidality and aggression doubled. To elucidate the harms reliably, access to anonymised individual patient data is needed.",
"affiliations": "Nordic Cochrane Centre, Rigshospitalet, Copenhagen, Denmark University of Copenhagen, Faculty of Health and Medical Sciences, Denmark ts@cochrane.dk.;Nordic Cochrane Centre, Rigshospitalet, Copenhagen, Denmark University of Copenhagen, Faculty of Health and Medical Sciences, Denmark.;Nordic Cochrane Centre, Rigshospitalet, Copenhagen, Denmark University of Copenhagen, Faculty of Health and Medical Sciences, Denmark.;Nordic Cochrane Centre, Rigshospitalet, Copenhagen, Denmark University of Copenhagen, Faculty of Health and Medical Sciences, Denmark.",
"authors": "Sharma|Tarang|T|;Guski|Louise Schow|LS|;Freund|Nanna|N|;Gøtzsche|Peter C|PC|",
"chemical_list": "D000928:Antidepressive Agents; D017367:Serotonin Uptake Inhibitors",
"country": "England",
"delete": false,
"doi": "10.1136/bmj.i65",
"fulltext": "\n==== Front\nBMJBMJbmjThe BMJ0959-81381756-1833BMJ Publishing Group Ltd. 26819231shar02795110.1136/bmj.i65ResearchSuicidality and aggression during antidepressant treatment: systematic review and meta-analyses based on clinical study reports Sharma Tarang student1 2Guski Louise Schow student1 2Freund Nanna medical student1 2Gøtzsche Peter C professor1 21 Nordic Cochrane Centre, Rigshospitalet, Copenhagen, Denmark2 University of Copenhagen, Faculty of Health and Medical Sciences, DenmarkCorrespondence to: T Sharma Nordic Cochrane Centre, Rigshospitalet, Blegdamsvej 9, Department 7811, 2100 Ø Copenhagen, Denmark ts@cochrane.dk2016 27 1 2016 352 i6503 12 2015 Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions2016BMJThis is an Open Access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 3.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/3.0/.Objective To study serious harms associated with selective serotonin and serotonin-norepinephrine reuptake inhibitors.\n\nDesign Systematic review and meta-analysis.\n\nMain outcome measures Mortality and suicidality. Secondary outcomes were aggressive behaviour and akathisia.\n\nData sources Clinical study reports for duloxetine, fluoxetine, paroxetine, sertraline, and venlafaxine obtained from the European and UK drug regulators, and summary trial reports for duloxetine and fluoxetine from Eli Lilly’s website.\n\nEligibility criteria for study selection Double blind placebo controlled trials that contained any patient narratives or individual patient listings of harms.\n\nData extraction and analysis Two researchers extracted data independently; the outcomes were meta-analysed by Peto’s exact method (fixed effect model).\n\nResults We included 70 trials (64 381 pages of clinical study reports) with 18 526 patients. These trials had limitations in the study design and discrepancies in reporting, which may have led to serious under-reporting of harms. For example, some outcomes appeared only in individual patient listings in appendices, which we had for only 32 trials, and we did not have case report forms for any of the trials. Differences in mortality (all deaths were in adults, odds ratio 1.28, 95% confidence interval 0.40 to 4.06), suicidality (1.21, 0.84 to 1.74), and akathisia (2.04, 0.93 to 4.48) were not significant, whereas patients taking antidepressants displayed more aggressive behaviour (1.93, 1.26 to 2.95). For adults, the odds ratios were 0.81 (0.51 to 1.28) for suicidality, 1.09 (0.55 to 2.14) for aggression, and 2.00 (0.79 to 5.04) for akathisia. The corresponding values for children and adolescents were 2.39 (1.31 to 4.33), 2.79 (1.62 to 4.81), and 2.15 (0.48 to 9.65). In the summary trial reports on Eli Lilly’s website, almost all deaths were noted, but all suicidal ideation events were missing, and the information on the remaining outcomes was incomplete.\n\nConclusions Because of the shortcomings identified and having only partial access to appendices with no access to case report forms, the harms could not be estimated accurately. In adults there was no significant increase in all four outcomes, but in children and adolescents the risk of suicidality and aggression doubled. To elucidate the harms reliably, access to anonymised individual patient data is needed.\n==== Body\nIntroduction\nSelective serotonin reuptake inhibitors (SSRIs) and serotonin-norepinephrine reuptake inhibitors (SNRIs) are some of the most commonly prescribed drugs.1\n2 SSRI induced suicidality was first reported in 19903 but only became generally recognised after a BBC Panorama programme focused on it in 2002.4\n\nA 2004 UK review showed a noticeable discrepancy between published and unpublished trials and increased suicidal behaviour in children and adolescents (aged <18 years),5 which resulted in serious warnings against these drugs being used in this age group.6 It is widely believed that the risk of suicide is not increased in adults, and support for this was provided by a Food and Drug Administration meta-analysis of about 100 000 patients.7 However, a large systematic review of published trials found an increase in suicide attempts with SSRI treatment,1 and another review using data submitted to the UK’s Medicines and Healthcare products Regulatory Agency (MHRA) could not rule out an increased risk of suicidal behaviour during early treatment with these drugs.8\n\nFor aggressive behaviour (for example, hostility, assault) in general, reports are conflicting.9\n10\n11\n12\n13\n14\n15 A UK review using MHRA data found an increase in hostility in children and adolescents,16 and an analysis of adverse events reported to the FDA showed that antidepressants were disproportionately involved in cases of violence, including murder.17 Many cases of aggressive behaviour have been reported,2\n4 but, unlike with suicidality, little systematic research has been undertaken. Perpetrators of school shootings and similar events have often been reported to be users of antidepressants18 and the courts have in many cases found them not guilty as a result of drug induced insanity.4\n\nAkathisia is an extreme form of restlessness, which some patients describe as wanting to “jump out of their skin,” that may increase the risk of suicide and violence.2\n4\n11\n19\n20\n21\n22\n23\n24\n25 The Diagnostic and Statistical Manual of Mental Disorders describes akathisia or similar activation symptoms as “medication-induced movement disorder not otherwise specified.”26\n\nClinical study reports are detailed summaries of trial results prepared by the drug industry for submission to regulatory authorities to obtain authorisation for marketing. A recent review of clinical study reports showed that essential information on patient relevant outcomes was often missing in the published articles.27 Research undertaken by our centre using nine clinical study reports on duloxetine found that data on major harms was missing from journal articles and in summary trial reports.28 We did not have access to any case report forms (paper or electronic questionnaires that contain the collected data on each participant in the trial), although they would have been the ideal information source.28\n\nWe report here our results for mortality, suicidality, aggression, and akathisia based on clinical study reports for five different antidepressants.\n\nMethods\nIn 2011, we requested clinical study reports on SSRIs and SNRIs from the European Medicines Agency and the UK’s MHRA. We did not get access to clinical study reports for all trials or for all the commonly prescribed drugs, and we did not receive case report forms for any of the trials. One researcher (TS) selected those clinical study reports that described double blind placebo controlled trials and which contained patient narratives (brief summaries of deaths, serious adverse events, or other events of clinical importance) or listings of adverse events in individual patients (with details such as patient identifier, the adverse event (preferred term and verbatim term), duration, severity, and outcome).28\n\nWe were able to include five drugs: duloxetine, fluoxetine, paroxetine, sertraline, and venlafaxine (or venlafaxine extended release). We converted the clinical study reports to readable portable document format, and one researcher (TS) copied all relevant pages—with study information, protocols, all adverse event summaries and tables, relevant appendices (where available), patient narratives, and individual patient listings—for use in data extraction.\n\nAs a pilot, we randomly chose one report for each drug and read it in its entirety to help understand the different formats of the clinical study reports and to refine the data extraction form. We had planned that the second observer would extract the data blindly, with the treatment groups masked, but the pilot showed that the format and language used made blinding impossible. The primary researcher (TS) and a second observer (LSJ or NF) extracted data from the selected pages of all the clinical study reports independently; disagreements were resolved by discussion and documented using κ statistics (see supplementary data A).\n\nOutcomes\nThe primary outcomes were mortality and suicidality (suicide, suicide attempt or preparatory behaviour, intentional self harm, and suicidal ideation); secondary outcomes were aggressive behaviour and akathisia. To identify the primary outcomes, we used the same terms and phrases as those of the FDA7\n29 and added additional terms from our pilot. We searched the clinical study reports both electronically and manually. For people with more than one suicidality event, we counted only the most severe one, whereas this was not possible for the secondary outcomes, which only allowed us to count events. Terms for aggressive behaviour were informed by the pilot, and akathisia was identified by searching for “akathisia” in the text (see supplementary data A). All relevant events were classified using the Medical Dictionary for Regulatory Activities (MedDRA) coding dictionary. For duloxetine and fluoxetine, we compared the data with the summary trial reports from Eli Lilly’s website.30\n\nFor meta-analysis of rare events, we reported odds ratios using Peto’s exact method and calculated 95% confidence intervals with a fixed effect model using RevMan 5.3.31\n32 All post-randomisation events were included, so when data from the lead-out and post-treatment phases were available, we combined them with the data from the randomised phase. In trials with multiple intervention arms, we added the data on arms arithmetically to get a combined drug arm. We planned and conducted subgroup analyses for adults for all outcomes and for suicides and suicide attempts combined, and did post-hoc analyses for suicides and children and adolescents and a sensitivity analysis removing data from fraudulent centres, as suggested by peer reviewers.\n\nPatient involvement\nNo patients were involved in setting the research question or the outcome measures, nor were they involved in the design and implementation of the study. We plan to involve patient organisations in the dissemination of our results.\n\nResults\nWe excluded 125 of the 198 clinical study reports: 96 were not double blind placebo controlled trials, 28 were studies in healthy volunteers, and one was a crossover trial (fig 1). Of the remaining 73 clinical study reports, we excluded five that had no patient narratives or individual patient listings of adverse events. The 68 included clinical study reports amounted to 64 381 pages and corresponded to 70 trials.\n\nFig 1 Flowchart showing selection of relevant studies for inclusion\n\nTrial characteristics and study design\nThe experimental drugs were duloxetine (23 trials), fluoxetine (n=3), paroxetine (n=8), sertraline (n=28), and venlafaxine (n=8). In total, 10 258 patients received a drug and 6832 a placebo. Fifteen trials had an additional (SSRI or SNRI) comparator in 669 patients (228 receiving fluoxetine and 441 receiving paroxetine) and a tricyclic or tetracyclic comparator in 767 patients. Eleven of the trials (12% of the patients) concerned children and adolescents. Table 1 shows the indications for treatment; 34 trials included 7882 patients with major depressive disorder. Patients at risk of suicide were excluded in 44 trials (63%); in 16 trials, suicide risk was not an exclusion criterion (23%), whereas it was unknown in 10 trials (14%). The randomised phase of the trials lasted from one to 54 weeks (median nine weeks).\n\nTable 1 Overview of indications in 70 trials\n\nIndication\tDrugs (No of trials)\t\nMajor depressive disorder\tDuloxetine (12), fluoxetine (2), paroxetine (3), sertraline (9), venlafaxine or venlafaxine extended release (8)\t\nObsessive compulsive disorder\tFluoxetine (1), paroxetine (1), sertraline (7)\t\nPost-traumatic stress disorder\tParoxetine (3), sertraline (4)\t\nStress urinary incontinence\tDuloxetine (8)\t\nPanic disorder\tSertraline (5)\t\nGeneralised social phobia or social anxiety disorder or social phobia\tSertraline (2), paroxetine (1)\t\nIrritative symptoms of benign prostatic hyperplasia\tDuloxetine (1)\t\nDiabetic peripheral neuropathic pain\tDuloxetine (1)\t\nFibromyalgia\tDuloxetine (1)\t\nNon-insulin-dependent diabetes mellitus\tSertraline (1)\t\nSixty trials (86%) had a placebo lead-in period (4 to 14 days, median 7 days) and all of them excluded from randomisation those who improved while receiving placebo, as judged by their Hamilton scores or similar. Rarely was there any information about the numbers excluded.\n\nIt was unclear to what extent sedatives were allowed or used. Four duloxetine trials and four sertraline trials allowed benzodiazepines or similar psychoactive drugs. However, in at least 50 trials (71%, we did not have access to the full protocol for all the trials), sedatives such as choral hydrate or zolpidem were allowed if the patients had difficulty sleeping.\n\nThe quality of the clinical study reports varied. For 32 trials we had individual patient listings of adverse events for all patients (in appendices, apart from the venlafaxine trials where the listings were part of the main report). We had access to the protocol for 44 trials; for the remaining trials, only a summary of the study design was available. It seemed that all other appendices were either only “available on request” to the authorities or came under “the system of exceptions set out in the Regulation (EC) No 1049/2001,” and so could not be released to us. This is in line with the guidance for clinical study reports, where certain appendices are not required to be submitted to the EMA.33 For 27 trials, we only had abbreviated or summary clinical study reports; some of these were titled accordingly whereas others were called clinical study reports, although they were only short summaries of about 100 pages. For four trials of sertraline, we only had summary reports combining two trials each (trials 51 and 52, and trials 53 and 54) for which the protocols were the same. We analysed the results accordingly. Key characteristics of the included trials are available in the supplementary data B.\n\nThe drug companies had concerns about the validity of the data or fraudulent behaviour in three trials. The data from one centre in trial 28 was not included in the efficacy analyses “due to concerns over the validity of the data,” and in trial 34, one centre was shut down “following an internal audit that detected significant compliance violations.” Four centres in trial 70 exhibited potentially fraudulent behaviour: three centres had their study records “impounded by the Swiss police for fraud”; and for the fourth centre, “Many of the enrolled patients . . . had identical evaluations for consecutive visits, and . . . all 35 patients from this site had very similar evaluation patterns.”\n\nThe interobserver agreement for our assessments was high (κ=0.94). Most disagreements resulted from errors in data extraction; discussion and consensus was needed for only two events.\n\nMortality\nSixteen deaths occurred, all in adults: one in the placebo lead-in phase and one in a 12 week lead-in phase during treatment with duloxetine 60 mg/day. Post-randomisation, nine deaths occurred during treatment with an SSRI or SNRI and four with placebo (odds ratio 1.28, 95% confidence interval 0.40 to 4.06) plus one with imipramine (table 2, fig 2, and supplementary data C). As none of the deaths occurred in fraudulent centres, no sensitivity analysis was needed.\n\nTable 2 Number of all cause mortality events in 70 included trials\n\nPhase of trial\tNo of deaths\t\nBefore randomisation\tDrug arm\tThird arm (imipramine)\tPlacebo arm\t\nBefore randomisation\t2\t0\t0\t0\t\nRandomised phase\t0\t8\t1\t3\t\nLead-out and post-treatment\t0\t1\t0\t1\t\nTotal No of deaths\t2\t9\t1\t4\t\nDrugs: duloxetine, fluoxetine, paroxetine, sertraline, venlafaxine.\n\nFig 2 Meta-analysis of all cause mortality for SSRIs or SNRIs compared with placebo post-randomisation\n\nFour deaths were misreported by the company, in all cases favouring the active drug. One death in a participant receiving paroxetine (trial 31) was called a post-study event, taking place 21 days after the patient had admitted to taking the last dose, but this was on day 63 out of the 84 days of randomised treatment. Moreover, the patient had detectable paroxetine in the blood at the time of death. A patient receiving venlafaxine (trial 69) attempted suicide by strangulation without forewarning and died five days later in hospital. Although the suicide attempt occurred on day 21 out of the 56 days of randomised treatment, the death was called a post-study event as it occurred in hospital and treatment had been discontinued because of the suicide attempt. Conversely, a patient receiving placebo (trial 62) died on day 404, 26 days after the randomised phase ended, but the death was not listed as a post-study event as the patient had allegedly taken treatment until the previous day. Finally, a death in a participant receiving venlafaxine (trial 70) that occurred three months after treatment was only noted in the patient narratives and nowhere else in the clinical study report.\n\nSuicidality\nOverall, 155 suicidality events took place, 13 before randomisation. The odds ratio post-randomisation for suicidality in patients was 1.21 (95% confidence interval 0.84 to 1.74) and was similar for number of suicidality events (1.14, 0.80 to 1.64). The odds ratio for suicidality in adults was 0.81 (0.51 to 1.28) and 0.77 (0.49 to 1.21 for events) and for children and adolescents was 2.39 (1.31 to 4.33) and 2.24 (1.24 to 4.04 for events). None of the suicidality events occurred in patients from fraudulent centres. See table 3, fig 3 and supplementary data C and D.\n\nTable 3 Overall suicidality events in 70 included trials, before and post-randomisation\n\nSuicidality events\tDuloxetine\tFluoxetine\tParoxetine\tSertraline\tVenlafaxine\tAll drugs\tPlacebo\tImipramine\t\nBefore randomisation\t\nDrug event:\t\t\t\t\t\t\t\t\t\n Suicides\t1\t—*\t—*\t—*\t—*\t1\t0\t—*\t\n Suicide attempts\t4\t—*\t—*\t—*\t—*\t4\t2\t—*\t\n Suicidal ideation\t4\t—*\t—*\t—*\t—*\t4\t2\t—*\t\n Suicidality\t9\t\t\t\t\t9\t4\t\t\nPost-randomisation\t\n Drug (any arm) event:\t\t\t\t\t\t\t\t\t\n Suicides\t1\t0\t0\t0\t1\t2\t2\t1\t\n Suicide attempts\t8\t5\t18\t9\t3\t43\t22\t2\t\n Suicidal ideation\t8\t1\t18\t11\t3\t41\t25\t4\t\n Suicidality\t17\t6\t36\t20\t7\t86 in 85 patients\t49 in 46 patients\t7 in 7 patients\t\nTotal population\t4277\t456\t1766\t3165\t1263\t10 927\t6832\t767\t\n*No patients received these drugs pre-randomisation.\n\nFig 3 Meta-analysis of suicidality in participants receiving selective serotonin reuptake inhibitors (SSRIs) or serotonin-norepinephrine reuptake inhibitors (SNRIs) compared with placebo post-randomisation\n\nSuicides\nSix suicides were reported, one in the duloxetine lead-in phase. Post-randomisation five suicides were reported: two in the study drug group, two in the placebo group (odds ratio 0.58, 95% confidence interval 0.07 to 4.48), and one in the imipramine group (see supplementary data C and D).\n\nSuicide attempts\nWe counted all attempted suicides, including intentional self harm (for example, slitting of wrists), intentional overdoses, and obvious preparatory events (for example, putting a knife to the wrist or neck, but being stopped before any harm). Six of the 73 events (n=70 patients) took place before randomisation (four in participants taking duloxetine and two in participants taking placebo).\n\nOne of the events, in a participant taking placebo before randomisation, occurred on day 29, although the lead-in phase was supposed to last only 14 days. Also, one of the four suicide attempts in participants taking duloxetine before randomisation was only identified by going over the appendices containing individual patient listings. This “possible suicide attempt” was listed as “mild” and was not documented elsewhere in the clinical study report and there was no patient narrative.\n\nFive of the 67 post-randomisation events occurred during the lead-out or post-treatment phase of the trials (in three patients receiving study drugs and in two receiving placebo).\n\nOf the remaining 62 suicide attempts (in 59 patients), 40 occurred in 39 patients receiving the study drug, 20 in 18 patients receiving placebo, and two in two patients receiving imipramine. Four of these events were only listed in the individual patient listings and three others only noted in adverse events tables (no further information was available as there was no narrative). Twenty seven events were coded as emotional lability or worsening depression, although in patient narratives or individual patient listings they were clearly suicide attempts. Conversely, several cases of suicidal ideation were called suicide attempts in the adverse events tables. One suicide attempt (intentional overdose with paracetamol (acetaminophen)) in a patient receiving fluoxetine was described as “elevated liver enzymes” in the adverse events tables, in contrast with the narrative (see supplementary data C). There was no difference between suicides and suicide attempts (odds ratio 1.05, 95% confidence interval 0.63 to 1.75). The odds ratio for adults was 0.60 (0.29 to 1.24) and for children and adolescents was 1.85 (0.90 to 3.83, see supplementary data D).\n\nSuicidal ideation\nSeventy five participants experienced 76 suicidal ideation events, of which six events were in the lead-in phase (four were taking duloxetine and two placebo). Two of the four events in the duloxetine users were severe and had patient narratives. A third event was mild and was only recorded in treatment emergent adverse events tables. The fourth event, mild suicidal thoughts, appeared only in the appendix containing individual patient listings. Of the 70 post-randomisation events, 41 occurred in participants receiving study drugs, 25 in those receiving placebo, and four in those receiving imipramine.\n\nSixty two patients experienced 63 events during the randomised phase of the trials (34 events in those receiving drugs, 25 in 24 participants receiving placebo, and four in participants receiving imipramine). Thirty two of these events were coded as emotional lability or worsening of depression in the treatment emergent adverse events tables, but it was clear from the patient narratives or individual patient listings that they were in fact ideation events.\n\nSeven events occurred in the lead-out or post-treatment phases of the trials, and all in participants receiving the study drug (see supplementary data C).\n\nAggressive behaviour\nThree events of aggressive behaviour in participants receiving duloxetine and two in participants receiving placebo took place before randomisation. Post-randomisation there were 62 events in participants receiving the study drugs, 28 in participants receiving placebo, and four in participants receiving imipramine, of which three in the paroxetine group and two in the placebo group occurred in the lead-out or post-treatment phase (table 4). Aggressive behaviour occurred more often in the drug group compared with placebo group (odds ratio 1.93, 95% confidence interval 1.26 to 2.95). The odds ratio for adults was 1.09 (0.55 to 2.14) and for children and adolescents was 2.79 (1.62 to 4.81, figure 4). If data were removed from trials 28 and 34 (paediatric trials in which each centre had fraudulent data), the increase in aggression remained: all ages 1.58 (1.00 to 2.51) and children and adolescents only 2.19 (1.17 to 4.11, see supplementary data D).\n\nTable 4 Aggressive behaviour events in 70 included trials, before and post-randomisation\n\nEvents\tDuloxetine\tFluoxetine\tParoxetine\tSertraline\tVenlafaxine\tAll drugs\tPlacebo\tImipramine\t\nBefore randomisation\t3\t0\t0\t0\t0\t3\t2\t0\t\nPost-randomisation (any arm)\t7\t6\t31\t14\t4\t62\t26\t4\t\nTotal population\t4277\t456\t1766\t3165\t1263\t10 927\t6832\t767\t\nFig 4 Meta-analysis of aggressive behaviour in patients receiving selective serotonin reuptake inhibitors (SSRIs) or serotonin-norepinephrine reuptake inhibitors (SNRIs) compared with placebo post-randomisation\n\nOnly patient narratives were available for serious events and they included homicidal threat, homicidal ideation, assault, sexual molestation, and a threat to take a gun to school (all five participants receiving sertraline), damage to property, punching household items, aggressive assault, verbally abusive and aggressive threats (all five participants receiving paroxetine), and belligerence (fluoxetine). Details were unavailable for non-serious events, as they were either listed in adverse events tables or given in the appendix of individual patient listings without any narratives. These events were increased hostility, aggressiveness, rage, or anger.\n\nAkathisia\nThirty akathisia events occurred, all post-randomisation (22 in participants receiving study drugs, six in participants receiving placebo, and two in participants receiving clomipramine); two of the events, both in participants receiving duloxetine, took place in the lead-out phase (table 5). Akathisia occurred more often in participants receiving the study drug than in those receiving placebo (2.04, 0.93 to 4.48), but this difference was not statistically significant: for adults 2.00 (0.79 to 5.04) and for children and adolescents (2.15, 0.48 to 9.65, fig 5). If data were removed from trial 70 (adults), where some centres had fraudulent data, the odds ratio becomes 1.99 (0.90 to 4.44) and for adults becomes 1.94 (0.75 to 4.99, see supplementary data D).\n\nTable 5 Akathisia events in 70 included trials, post-randomisation (no events noted previously)\n\nDrug (any arm)\tDuloxetine\tFluoxetine\tSertraline\tVenlafaxine\tAll drugs\tPlacebo\tClomipramine\t\nAkathisia events\t12\t7\t2\t1\t22\t6\t2\t\nTotal population\t4277\t456\t3165\t1263\t10 927\t6832\t767\t\nFig 5 Meta-analysis of akathisia in participants receiving selective serotonin reuptake inhibitors (SSRIs) or serotonin-norepinephrine reuptake inhibitors (SNRIs) compared with placebo post-randomisation\n\nSome events were not listed as akathisia in the adverse events tables because of the coding dictionaries used. For example, in the three sertraline trials where we had access to both the verbatim and the coded preferred terms, akathisia seemed to have been coded as “hyperkinesia” according to the World Health Organisation Adverse Drug Reaction Terminology dictionary. We could only identify akathisia if we had access to the verbatim terms, which were sometimes available from individual patient listings or patient narratives. For most duloxetine and fluoxetine trials, akathisia was also noted in the regular adverse events tables, and therefore the trials appeared to have more events than those for other drugs for which akathisia was miscoded—for example, no cases of akathisia were reported in the paroxetine trials. These events would be missed in trials where such detailed information was not available. Therefore our number of akathisia events is likely to be an underestimate, as the event appeared to be have been coded under many other activation terms, such as irritability, agitation, or nervousness.\n\nComparison of our data with the summary trial reports on Eli Lilly’s website\nInformation was limited on adverse events in these summary reports and it was not reliable. The number of serious events was always mentioned but the cases were not always explained and the reports focused on the most common adverse events. All reports contained tables of treatment emergent adverse events, but not for all patients (with the exception of trials 23 and 26 where complete data were tabulated), and in most cases the events were only shown if they occurred in, for example, at least 5% of patients. We were unable to find the online summary reports for four trials (trials 19-22, all on duloxetine). All the eight deaths (six in participants receiving duloxetine and two in participants receiving placebo) post-randomisation were noted in the online summaries, although information on one suicide in a participant receiving duloxetine in the open label phase before randomisation in trial 7 was missing, as no data from that phase were available online. Only two (both participants receiving fluoxetine) of the 20 suicide attempts (14 participants receiving duloxetine, three fluoxetine, and three placebo) were documented in the summaries, and none of the 14 suicidal ideation events (eight in participants receiving duloxetine, two paroxetine, one fluoxetine, and three placebo) were mentioned. Only 10 (three participants receiving fluoxetine and seven placebo) of the 25 aggressive behaviour events (five participants receiving duloxetine, six fluoxetine, and 14 placebo) were found online. Only three akathisia events (all participants receiving fluoxetine) of the 17 (10 receiving duloxetine, five fluoxetine, and two placebo) were in the summaries. However, the case of the “elevated liver enzymes” in a patient receiving fluoxetine in trial 26 was clarified as an intentional overdose.\n\nDiscussion\nSystematic reviews of harms are needed for a balanced view of medical interventions, particularly to elucidate the occurrence of rare but serious events.34 Clinical study reports are far more reliable than published trial reports,2\n4\n28 but even using these we were unable to unravel the true number of serious harms. The trials had many shortcomings, in both the design and the reporting of the trials in the clinical study reports, and therefore our numbers are likely to be underestimates. The summary reports on Eli Lilly’s website were even more unreliable than we previously suspected.28 Only mortality had (almost) complete information.\n\nComparison with other studies\nWe found no significant differences in mortality or suicidality overall, but our data confirmed the increased risk of suicide in children and adolescents.5\n16 We wanted to clarify these risks in adults and found no significant increase in association with drugs, similar to previous analyses.7\n8 Our results however, cannot be compared easily with the results of the 2006 FDA meta-analysis7 as we had data from 18 526 patients, whereas the FDA included about 100 000 patients. The FDA did not consider the limitations of the trials that we identified and introduced some of their own—for example, by only counting events within 24 hours after the randomised phase was over. We counted all post-randomisation events in our study, although they were not always available. Interestingly, an FDA employee published a paper in 2001 using FDA data that showed 22 suicides in 22 062 patients randomised to antidepressants,35 which equates to 10 per 10 000 population, but in the large FDA meta-analysis five years later, five suicides were reported in 52 960 patients, or 1 per 10 000 population.7\n\nA review with over 40 000 patients using data submitted to the UK’s Medicines and Healthcare products Regulatory Agency (MHRA) also found no increased risk for suicidality in adults using serotonin reuptake inhibitors (SSRIs), but noted that the relative frequency of reported self harm and suicidal thoughts in the trials compared with suicide indicated that non-fatal endpoints were under-recorded.8 Another review, with 87 650 patients (all ages), reported a doubling in the odds of suicide attempts, which was statistically significant,1 in contrast with our findings in adults. As with our study, both reviews found serious limitations in the trials and evidence of under-reporting of serious harms.\n\nThis under-reporting was also confirmed in the recent republication by independent investigators of study 329 of paroxetine in children and adolescents.36 We did not get access to the appendices of this trial, which contained the individual patient listings. Many suicidal events were only documented there, and even more suicidal events were only identified in the case report forms, which the investigators got access to after protracted negotiations with GlaxoSmithKline and then only through a single screen remote desktop interface, which made it impossible for the researchers to review all 77 000 pages.36\n\nWe found that the risk of aggressive behaviour was doubled with use of antidepressants (all ages), which was a statistically significant result, but when we restricted our analysis to adults, there was no such effect. However, we did find a doubling of risk for children and adolescents, which is consistent with the increased incidence in hostility noted by the MHRA.16 We found that akathisia was much under-reported. Akathisia occurred more often in participants receiving drugs than receiving placebo, both in children and adolescents and in adults, but the difference was not significant (all ages, odds ratio 2.04, 95% confidence interval 0.93 to 4.48). We also found similar results in a systematic review of trials in healthy adult volunteers that included data from 10 published trials and two unpublished trials (clinical study reports obtained from EMA). Compared with placebo (n=226), antidepressants (n=318) were associated with an increased rate of activation or other precursor events for aggression and suicidality (odds ratio 1.81, 95% confidence interval 1.05 to 3.12).37\n\nLimitations in the trials and clinical study reports\nIn most trials (86%), patients were only randomised if they failed to improve in the placebo lead-in period. One large trial had a 12 week open label period where 533 patients received duloxetine and only 278 patients (52%) who tolerated the drug were randomised. This gives rise to response based selection bias, which has an impact on the subsequent randomised phase. During that open label period for duloxetine, there was one suicide (by hanging), four suicide attempts, and four suicidal ideation events.\n\nAnother problem was insufficient lead-in periods.4\n24 At least 36 trials had insufficient wash-out periods, lasting for only a few days or a week. An additional nine trials had no lead-in period. Even when a placebo lead-in period was specified it was not always adhered to—for example, in a venlafaxine trial (trial 70), the wash-out period was inadequate in 30 patients who received drugs before the study, and in a sertraline trial (trial 50) it was stated that “some patients proceeded to double-blind treatment without a prior placebo run-in.” As patients are often receiving treatment with similar drugs already, some may develop withdrawal effects when they are switched to a placebo,2\n4\n12\n14\n23\n24 which can be wrongly counted as adverse events. These iatrogenic harms can be substantial. In a large study supported by Eli Lilly, withdrawal symptoms were registered in patients during a 5-8 day period; 4-24 months after their depression had remitted. Placebo was substituted for active drug, unknown to the patients, and when the patients were switched to placebo, about one third receiving sertraline or paroxetine became agitated, irritable, reported worsened mood, and their Hamilton depression score increased by at least 8.38\n\nMost trials did not report on post-treatment events. As previously noted, the FDA included events occurring within the first 24 hours after the randomised phase ended.7 For sertraline trials in adults (the report’s table 30; we reanalysed this summary data), there was no increased risk of suicide or suicide attempts (risk ratio 0.87, 95% confidence interval 0.31 to 2.48).7 When Pfizer analysed its trial data, the results looked much better for sertraline (we reanalysed their data for suicide or suicide attempts); risk ratio 0.52 (0.17 to 1.59).39 However, Pfizer published an additional analysis where the patients were followed up for 30 days after the randomised phase ended and then sertraline did not seem to protect against suicides or suicide attempts in adults but rather seemed to cause them (we reanalysed their data, risk ratio 1.47, 0.77 to 2.83), even though these findings were not significant.39 The investigators who used MHRA data8 found that when events after 24 hours were included, the risk of suicide or self harm was doubled with sertraline: we reanalysed the data (risk ratio 2.14, 0.96 to 4.75), although the finding was not statistically significant (see supplementary data D).7\n\nAnother limitation was the use of different coding dictionaries; 32 trials (46%) did not state which one they used. Sixteen of the sertraline trials used the World Health Organisation Adverse Drug Reaction Terminology, and as it does not allow for coding of akathisia or suicidal ideation, such events are most likely to be underestimated in our review. Furthermore, we found that many suicidal ideation events were coded as “worsening depression” or “emotional lability” in treatment emergent adverse events tables in the paroxetine trials, which used their own dictionary (the Adverse Drug Experience Coding System, ADECS), as has been noted by other studies.36\n40 Only one trial (trial 27) mentioned this problem in the clinical study report, which stated that “emotional lability captures events such as suicidal ideation/gestures as well as overdoses.” We could not find any akathisia events in the paroxetine trials, as we did not have access to the verbatim terms and the events were coded as other activation terms despite akathisia being the preferred term in the Coding Symbols for a Thesaurus of Adverse Reaction Terms dictionary, on which ADECS is based.41\n\nMinor tranquillisers and sleeping aids were used in many of the studies, which tend to obscure aggression and akathisia events. Additionally, two thirds of all trials excluded patients at risk of suicide.\n\nStrengths and limitations of this review\nWe believe ours is the first comprehensive review of randomised controlled trial data using clinical study reports for aggressive behaviour and akathisia, and our finding of the doubling of aggression in children and adolescents is novel. Our review has highlighted limitations in the trials, not only in their design but also in their reporting in the clinical study reports, which may have led to serious under-estimation of the harms.\n\nA main limitation of our review was that the quality of the clinical study reports differed vastly and ranged from summary reports to full reports with appendices, which limited our ability to detect the harms. Our study also showed that the standard risk of bias assessment tool was insufficient when harms from antidepressants were being assessed in clinical study reports. Most of the trials excluded patients with suicidal risk and so our numbers of suicidality might be underestimates compared with what we would expect in clinical practice. We also did not have access to case report forms and because of coding problems we deliberately took a conservative approach and used only one term for identifying akathisia.\n\nConclusions and implications for research and practice\nWe believe our study shows that, despite using clinical study reports, the true risk for serious harms is still uncertain. The low incidence of these rare events and the poor design and reporting of the trials makes it difficult to get accurate effect estimates.\n\nThe FDA has advised that antidepressants may also cause suicide in young adults (18 to 24 years) and recommends that “patients of all ages” treated with antidepressants should be monitored for “clinical worsening, suicidality, and unusual changes in behaviour.”42 GlaxoSmithKline also issued letters to doctors, informing them about the increased harm in young adults6 and admitted that for adults with depression “(all ages), the frequency of suicidal behaviour was higher in patients treated with paroxetine compared with placebo: 11/3455 (0.32%) versus 1/1978 (0.05%).”43 A cohort study from Sweden recently showed an increase in violent crime in young adults taking antidepressants (hazard ratio 1.43, 95% confidence interval 1.19 to 1.73).44\n\nTherefore we suggest minimal use of antidepressants in children, adolescents, and young adults, as the serious harms seem to be greater, and as their effect seems to be below what is clinically relevant.4\n45\n46\n47 Alternative treatments such as exercise48\n49 or psychotherapy4\n50 may have some benefit and could be considered, although psychotherapy trials also suffer from publication bias.51\n\nThe need for identifying hidden information in clinical study reports to form a more accurate view of the benefits and harms of drugs has been highlighted by the Restoring Invisible and Abandoned Trials (RIAT) initiative,52 and the recent revised version of trial 329.36 More data from clinical study reports are expected to become available in the coming years, with the EMA’s new policy to make all newly submitted reports publicly available.53 As it can be quite labour intensive to perform systematic reviews using clinical study reports, more reliable automated methods for text mining are needed, such that all data, including that from individual patient listings and case report forms, can be routinely considered.36\n54\n\nWhat is already known on this topic\nImportant information on harms is often missing in published trial reports\n\nClinical study reports should therefore be the preferred source for systematic reviews of drugs\n\nAntidepressants can increase the risk of suicide in children and adolescents\n\nWhat this study adds\nDespite all the limitations we identified in the trials and in the clinical study reports, we found an increase in events of aggression with antidepressants (lost in adults alone), with a doubling of both suicidality and aggression in children and adolescents\n\nSelective reporting of relevant harms across the different sections of the clinical study reports meant that patient narratives, tables with individual patient listings (often found in appendices), and case report forms are needed for complete information\n\nOnline summary reports of trials available from Eli Lilly’s website are inadequate as source documents for identifying harms data\n\nWeb extra Web extra material supplied by the author\n\nSupplementary data A: additional details on methods\n\nClick here for additional data file.\n\n Supplementary data B: trial characteristics of included 70 randomised controlled trials\n\nClick here for additional data file.\n\n Supplementary data C: case notes for primary outcomes\n\nClick here for additional data file.\n\n Supplementary data D: additional analyses\n\nClick here for additional data file.\n\n We thank the European Medicines Agency and Medicines and Healthcare products Regulatory Agency for providing the clinical study reports used for this review. Some results of this study were presented at the Research waste/EQUATOR conference in Edinburgh, Scotland (September 2015).\n\nContributors: All authors had complete access to the data in the study. LSG was known by her maiden name Jensen at the time of the study. TS and PCG contributed to the study concept and design, wrote the protocol, and obtained funding. TS, LSG, and NF acquired the data for the study; all authors contributed to the analysis and/or interpretation of data. TS developed the first draft of the manuscript and all authors critically revised the manuscript and approved the final version. PCG is the study supervisor and guarantor.\n\nFunding: This study is part of a PhD (TS) thesis, funded by the Laura and John Arnold Foundation. The funding source had no role in the design and conduct of the study; data collection, management, analysis, and interpretation; preparation, review, and approval of the manuscript; or the decision to submit the paper for publication.\n\nCompeting interests: All authors have completed the ICMJE uniform disclosure form at http://www.icmje.org/coi_disclosure.pdf (available on request from the corresponding author) and declare: this study is part of a PhD funded by the Laura and John Arnold Foundation for lead author (TS); no financial relationships with any organisations that might have an interest in the submitted work in the previous three years; no other relationships or activities that could appear to have influenced the submitted work.\n\nEthical approval: Not required.\n\nTransparency: The lead author (TS) and study guarantor (PCG) affirm that the manuscript is an honest, accurate, and transparent account of the study being reported. No important aspect of the study has been omitted. No discrepancies are withheld.\n\nData sharing: Additional data and the clinical study reports can be obtained from the corresponding author on request.\n==== Refs\n1 Fergusson D, Doucette S, Glass KC, et al. Association between suicide attempts and selective serotonin reuptake inhibitors: systematic review of randomised controlled trials. BMJ 2005 ;330 : 396. 10.1136/bmj.330.7488.396 . 15718539.\n2 Healy D. Let them eat Prozac. New York University Press, 2004 .\n3 Teicher MH, Glod C, Cole JO. Emergence of intense suicidal preoccupation during fluoxetine treatment. Am J Psychiatry 1990 ;147 : 207-10 . 10.1176/ajp.147.2.207 . 2301661.\n4 Gøtzsche PC. Deadly psychiatry and organised denial. People’s Press, 2015 .\n5 Whittington CJ, Kendall T, Fonagy P, et al. Selective serotonin reuptake inhibitors in childhood depression: systematic review of published versus unpublished data. Lancet 2004 ;363 : 1341-5 .\n6 Healy D. Did regulators fail over selective serotonin reuptake inhibitors?BMJ 2006 ;333 : 92-5 . 10.1136/bmj.333.7558.92 . 16825234.\n7 Laughren TP. Overview for December 13 meeting of Psychopharmacologic Drugs Advisory Committee (PDAC). 2006. www.fda.gov/ohrms/dockets/ac/06/briefing/2006-4272b1-01-fda.pdf.\n8 Gunnell D, Saperia J, Ashby D. Selective serotonin reuptake inhibitors (SSRIs) and suicide in adults: meta-analysis of drug company data from placebo controlled, randomised controlled trials submitted to the MHRA’s safety review. BMJ 2005 ;330 : 385. 10.1136/bmj.330.7488.385 . 15718537.\n9 Bond AJ. Antidepressant treatments and human aggression. Eur J Pharmacol 2005 ;526 : 218-25 . 10.1016/j.ejphar.2005.09.033 . 16253231.\n10 Bouvy PF, Liem M. Antidepressants and lethal violence in the Netherlands 1994-2008. Psychopharmacology (Berl) 2012 ;222 : 499-506 . 10.1007/s00213-012-2668-2 . 22395429.\n11 Breggin PR. Fluvoxamine as a cause of stimulation, mania, and aggression: a critical analysis of the FDA-approved label. Ethical Hum Sci Serv 2002 ;4 : 211-27 .\n12 Breggin PR. Suicidality, violence and mania caused by selective serotonin reuptake inhibitors (SSRIs): a review and analysis. Int J Risk Saf Med 2003 ;16 : 31-49 .\n13 Krakowski M. Violence and serotonin: influence of impulse control, affect regulation, and social functioning. J Neuropsychiatry Clin Neurosci 2003 ;15 : 294-305 . 10.1176/jnp.15.3.294 . 12928505.\n14 Lucire Y, Crotty C. Antidepressant-induced akathisia-related homicides associated with diminishing mutations in metabolizing genes of the CYP450 family. Pharmgenomics Pers Med 2011 ;4 : 65-81 . 10.2147/PGPM.S17445 . 23226054.\n15 Walsh MT, Dinan TG. Selective serotonin reuptake inhibitors and violence: a review of the available evidence. Acta Psychiatr Scand 2001 ;104 : 84-91 . 10.1034/j.1600-0447.2001.00357.x . 11473500.\n16 United Kingdom Committee on Safety of Medicines, CSM. report of the CSM Expert Working Group on the safety of selective serotonin reuptake inhibitor antidepressants. Medicines and Healthcare products Regulatory Agency; 2004.\n17 Moore TJ, Glenmullen J, Furberg CD. Prescription drugs associated with reports of violence towards others. PLoS One 2010 ;5 : e15337. 10.1371/journal.pone.0015337 . 21179515.\n18 SSRI stories. SSRI stories: antidepressant nightmares. 2013. http://ssristories.org/.\n19 Adler LA, Angrist BM. Paroxetine and akathisia. Biol Psychiatry 1995 ;37 : 336-7 . 10.1016/0006-3223(94)00158-Y . 7748986.\n20 Baldassano CF, Truman CJ, Nierenberg A, Ghaemi SN, Sachs GS. Akathisia: a review and case report following paroxetine treatment. Compr Psychiatry 1996 ;37 : 122-4 . 10.1016/S0010-440X(96)90572-6 . 8654061.\n21 Bass A. Side effects: a prosecutor, a whistleblower, and a bestselling antidepressant on trial. Algonquin Books, 2008 .\n22 Breggin P, Breggin GR. Talking back to Prozac: what doctors aren’t telling you about today’s most controversial drug. E-reads, 1994 .\n23 Breggin P. Medication madness: the role of psychiatric drugs in cases of violence, suicide, and crime. St Martin’s Griffin, 2008 .\n24 Healy D, Herxheimer A, Menkes DB. Antidepressants and violence: problems at the interface of medicine and law. PLoS Med 2006 ;3 : e372. 10.1371/journal.pmed.0030372 . 16968128.\n25 Miller M, Swanson SA, Azrael D, Pate V, Stürmer T. Antidepressant dose, age, and the risk of deliberate self-harm. JAMA Intern Med 2014 ;174 : 899-909 . 10.1001/jamainternmed.2014.1053 . 24782035.\n26 Koliscak LP, Makela EH. Selective serotonin reuptake inhibitor-induced akathisia. J Am Pharm Assoc (2003) 2009 ;49 : e28-36, quiz e37-8 . 10.1331/JAPhA.2009.08083 . 19289334.\n27 Wieseler B, Wolfram N, McGauran N, et al. Completeness of reporting of patient-relevant clinical trial outcomes: comparison of unpublished clinical study reports with publicly available data. PLoS Med 2013;10:e1001526.\n28 Maund E, Tendal B, Hróbjartsson A, et al. Benefits and harms in clinical trials of duloxetine for treatment of major depressive disorder: comparison of clinical study reports, trial registries, and publications. BMJ 2014 ;348 : g3510. 10.1136/bmj.g3510 . 24899650.\n29 Stone M, Laughren T, Jones ML, et al. Risk of suicidality in clinical trials of antidepressants in adults: analysis of proprietary data submitted to US Food and Drug Administration. BMJ 2009 ;339 : b2880. 10.1136/bmj.b2880 . 19671933.\n30 Lilly E. Clinical Trial Report (CTR) summaries. 2014. www.lillytrials.com/results/ctr_toc.pdf.\n31 Higgins JPT, Green S, eds. Cochrane handbook for systematic reviews of interventions version 5.1.0. Cochrane Collaboration, 2011. www.cochrane-handbook.org.\n32 Sweeting MJ, Sutton AJ, Lambert PC. What to add to nothing? Use and avoidance of continuity corrections in meta-analysis of sparse data. Stat Med 2004 ;23 : 1351-75 . 10.1002/sim.1761 . 15116347.\n33 Structure and content of clinical study reports: E3. International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use, 1995. www.ich.org/fileadmin/Public_Web_Site/ICH_Products/Guidelines/Efficacy/E3/E3_Guideline.pdf.\n34 Chou R, Helfand M. Challenges in systematic reviews that assess treatment harms. Ann Intern Med 2005;142(12_Part_2):1090-9.\n35 Laughren TP. The scientific and ethical basis for placebo-controlled trials in depression and schizophrenia: an FDA perspective. Eur Psychiatry 2001 ;16 : 418-23 . 10.1016/S0924-9338(01)00600-9 . 11728855.\n36 Le Noury J, Nardo JM, Healy D, et al. Restoring Study 329: efficacy and harms of paroxetine and imipramine in treatment of major depression in adolescence. BMJ 2015 ;351 : h4320. 10.1136/bmj.h4320 . 26376805.\n37 Bielefeldt AØ, Danborg PB, Gøtzsche PC. Systematic review of adverse effects of antidepressants in healthy volunteer studies. Proceedings of the 23rd Cochrane colloquium. Vienna, Austria; Cochrane 2015.\n38 Rosenbaum JF, Fava M, Hoog SL, Ascroft RC, Krebs WB. Selective serotonin reuptake inhibitor discontinuation syndrome: a randomized clinical trial. Biol Psychiatry 1998 ;44 : 77-87 . 10.1016/S0006-3223(98)00126-7 . 9646889.\n39 Vanderburg DG, Batzar E, Fogel I, Kremer CM. A pooled analysis of suicidality in double-blind, placebo-controlled studies of sertraline in adults. J Clin Psychiatry 2009 ;70 : 674-83 . 10.4088/JCP.07m04004 . 19552866.\n40 Furukawa TA. All clinical trials must be reported in detail and made publicly available. BMJ 2004 ;329 : 626. 10.1136/bmj.329.7466.626-a . 15361464.\n41 Breggin PR. How GlaxoSmithKline suppressed data on Paxil-induced akathisia: implications for suicidality and violence. Ethical Hum Psychol Psychiatry 2006 ;8 : 91-100.10.1891/ehpp.8.2.91 . .\n42 FDA. Antidepressant use in children, adolescents, and adults. 2014. www.fda.gov/downloads/Drugs/DrugSafety/InformationbyDrugClass/UCM173233.pdf.\n43 GlaxoSmithKline. Important prescribing information. Letter to healthcare professionals, May 2006. www.gsk.com/media/388699/adult_hcp_letter.pdf.\n44 Molero Y, Lichtenstein P, Zetterqvist J, Gumpert CH, Fazel S. Selective serotonin reuptake inhibitors and violent crime: a cohort study. PLoS Med 2015 ;12 : e1001875. 10.1371/journal.pmed.1001875 . 26372359.\n45 Gøtzsche PC, Young AH, Crace J. Does long term use of psychiatric drugs cause more harm than good?BMJ 2015 ;350 : h2435. 10.1136/bmj.h2435 . 25985333.\n46 Leucht S, Fennema H, Engel R, Kaspers-Janssen M, Lepping P, Szegedi A. What does the HAMD mean?J Affect Disord 2013 ;148 : 243-8 . 10.1016/j.jad.2012.12.001 . 23357658.\n47 Moncrieff J, Wessely S, Hardy R. Active placebos versus antidepressants for depression. Cochrane Database Syst Rev 2004 ;1 : CD003012.14974002.\n48 Larun L, Nordheim LV, Ekeland E, Hagen KB, Heian F. Exercise in prevention and treatment of anxiety and depression among children and young people. Cochrane Database Syst Rev 2006 ;3 : CD004691.16856055.\n49 Cooney GM, Dwan K, Greig CA, et al. Exercise for depression. Cochrane Database Syst Rev 2013 ;9 : CD004366.24026850.\n50 Cox GR, Callahan P, Churchill R, et al. Psychological therapies versus antidepressant medication, alone and in combination for depression in children and adolescents. Cochrane Database Syst Rev 2012 ;11 : CD008324.23152255.\n51 Driessen E, Hollon SD, Bockting CL, Cuijpers P, Turner EH. Does Publication bias inflate the apparent Efficacy of psychological treatment for major depressive disorder? A systematic review and meta-analysis of US National Institutes of Health-funded trials. PLoS One 2015 ;10 : e0137864. 10.1371/journal.pone.0137864 . 26422604.\n52 Doshi P, Dickersin K, Healy D, Vedula SS, Jefferson T. Restoring invisible and abandoned trials: a call for people to publish the findings. BMJ 2013 ;346 : f2865. 10.1136/bmj.f2865 . 23766480.\n53 European Medicines Agency. Publication and access to clinical-trial data. 2014. www.ema.europa.eu/docs/en_GB/document_library/Other/2013/06/WC500144730.pdf.\n54 Cohen D. Rosiglitazone: what went wrong?BMJ 2010 ;341 : c4848. 10.1136/bmj.c4848 . 20819889.\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "0959-8138",
"issue": "352()",
"journal": "BMJ (Clinical research ed.)",
"keywords": null,
"medline_ta": "BMJ",
"mesh_terms": "D000928:Antidepressive Agents; D003866:Depressive Disorder; D004311:Double-Blind Method; D006801:Humans; D011595:Psychomotor Agitation; D017367:Serotonin Uptake Inhibitors; D059020:Suicidal Ideation; D013405:Suicide",
"nlm_unique_id": "8900488",
"other_id": null,
"pages": "i65",
"pmc": null,
"pmid": "26819231",
"pubdate": "2016-01-27",
"publication_types": "D016428:Journal Article; D017418:Meta-Analysis; D013485:Research Support, Non-U.S. Gov't; D016454:Review; D000078182:Systematic Review",
"references": "15116347;25985333;20819889;22395429;16968128;15718539;23152255;24115912;15718537;23357658;16825234;11473500;9646889;16253231;12928505;14974002;26422604;26376805;26372359;24899650;23766480;8654061;11728855;24782035;19289334;21179515;7748986;15968034;24026850;19671933;23226054;15110490;2301661;16856055;19552866;15361464",
"title": "Suicidality and aggression during antidepressant treatment: systematic review and meta-analyses based on clinical study reports.",
"title_normalized": "suicidality and aggression during antidepressant treatment systematic review and meta analyses based on clinical study reports"
} | [
{
"companynumb": "DK-CIPLA LTD.-2016DK01007",
"fulfillexpeditecriteria": "1",
"occurcountry": "DK",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SERTRALINE HYDROCHLORIDE"
},
"drugadditional"... |
{
"abstract": "The impact of the reconstitution of IgG subclasses after allogeneic hematopoietic cell transplantation (allo-HCT) on the outcomes is unclear.\n\n\n\nWe investigated the effects of stem cell source on the levels of serum IgG subclasses and their influence on the infection risk and prognosis. The levels of serum IgG, IgG2 and IgG4 were measured chronologically in 100 patients who underwent allo-HCT at our institute.\n\n\n\nThe median levels of serum IgG, IgA and IgM and the number of total B-cells were determined up to one year after allo-HCT. The serum IgG2 levels decreased within one year. A multiple linear regression analysis identified lymphoid malignancy, cord blood, and days after allo-HCT as significant risk factors for low serum IgG2 levels. There were no significant differences in the level of IgG or IgG2 at 90 days after allo-HCT between the late bacterial infection group (≥90 days following allo-HCT) and the control group (P = 0.34 and 0.45, respectively). There was no significant impact of the IgG, IgG2 or IgG4 levels on the survival or non-relapse mortality.\n\n\n\nThe results suggest that cord blood transplantation might affect humoral immune reconstitution, including the IgG2 level, after allo-HCT.",
"affiliations": "Hematology, Graduate School of Medicine, Osaka City University, Osaka, Japan.;Hematology, Graduate School of Medicine, Osaka City University, Osaka, Japan.;Hematology, Graduate School of Medicine, Osaka City University, Osaka, Japan.;Hematology, Graduate School of Medicine, Osaka City University, Osaka, Japan.;Hematology, Graduate School of Medicine, Osaka City University, Osaka, Japan.;Hematology, Graduate School of Medicine, Osaka City University, Osaka, Japan.;Hematology, Graduate School of Medicine, Osaka City University, Osaka, Japan.;Hematology, Graduate School of Medicine, Osaka City University, Osaka, Japan.;Hematology, Graduate School of Medicine, Osaka City University, Osaka, Japan. Electronic address: hirohisa@msic.med.osaka-cu.ac.jp.",
"authors": "Koh|Shiro|S|;Koh|Hideo|H|;Nanno|Satoru|S|;Okamura|Hiroshi|H|;Nakashima|Yasuhiro|Y|;Nakamae|Mika|M|;Hirose|Asao|A|;Hino|Masayuki|M|;Nakamae|Hirohisa|H|",
"chemical_list": null,
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.trim.2021.101413",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0966-3274",
"issue": "67()",
"journal": "Transplant immunology",
"keywords": "Cord blood transplantation; IgG subclass; Immune reconstitution",
"medline_ta": "Transpl Immunol",
"mesh_terms": null,
"nlm_unique_id": "9309923",
"other_id": null,
"pages": "101413",
"pmc": null,
"pmid": "34022326",
"pubdate": "2021-08",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Kinetics of IgG subclasses and their effects on the incidence of infection after allogeneic hematopoietic stem cell transplantation.",
"title_normalized": "kinetics of igg subclasses and their effects on the incidence of infection after allogeneic hematopoietic stem cell transplantation"
} | [
{
"companynumb": "JP-ROCHE-2955539",
"fulfillexpeditecriteria": "1",
"occurcountry": null,
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "MYCOPHENOLATE MOFETIL"
},
"drugadditional": "3",
... |
{
"abstract": "An 86-year-old woman was diagnosed with hospital-acquired pneumonia with Pseudomonas aeruginosa and treated with cefepime adjusted to her renal clearance. After 4 days, she developed acute-onset negative myoclonus without signs of altered mental status. After ruling out an acute intracranial haemorrhagic or ischaemic stroke as well as other metabolic and endocrine causes of negative myoclonus, the antibiotic was switched to piperacillin/tazobactam due to a suspicion of cefepime neurotoxicity. The patient improved within 24 hours and her symptoms fully resolved within 4 days. These observations suggest a link of the negative myoclonus to acute cefepime neurotoxicity, which may occur without or with minimal alteration of mental status, thus extending its spectrum of clinical presentation.",
"affiliations": "Internal Medicine, Kantonsspital Baden, Baden, Switzerland.;Internal Medicine, Kantonsspital Baden, Baden, Switzerland.;Internal Medicine, Kantonsspital Baden, Baden, Switzerland.;Neurology, Kantonsspital Baden, Baden, Switzerland atarnutzer@gmail.com.",
"authors": "Zimmermann|Philipp|P|;Camenzind|Dominik|D|;Beer|Jürg Hans|JH|;Tarnutzer|Alexander Andrea|AA|http://orcid.org/0000-0002-6984-6958",
"chemical_list": "D000900:Anti-Bacterial Agents; D002511:Cephalosporins; D000077725:Piperacillin, Tazobactam Drug Combination; D000077723:Cefepime",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2020-239744",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "14(4)",
"journal": "BMJ case reports",
"keywords": "movement disorders (other than Parkinsons); neurology (drugs and medicines)",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000369:Aged, 80 and over; D000900:Anti-Bacterial Agents; D002545:Brain Ischemia; D000077723:Cefepime; D002511:Cephalosporins; D005260:Female; D006801:Humans; D009207:Myoclonus; D000077725:Piperacillin, Tazobactam Drug Combination; D020521:Stroke",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33832932",
"pubdate": "2021-04-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Negative myoclonus as the leading symptom in acute cefepime neurotoxicity.",
"title_normalized": "negative myoclonus as the leading symptom in acute cefepime neurotoxicity"
} | [
{
"companynumb": "CH-PFIZER INC-2021681859",
"fulfillexpeditecriteria": "1",
"occurcountry": "CH",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "INSULIN ASPART"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nTo describe the successful use of high-dose enoxaparin therapy (1.5 mg/kg subcutaneously twice daily) to attain a therapeutic anti-factor Xa (anti-Xa) level in a cancer patient with heparin resistance.\n\n\nMETHODS\nA proven heparin-resistant patient with venous thromboembolism (VTE) and lung cancer who required approximately 66 000 units of unfractionated heparin daily was successfully transitioned to an off-label high-dose enoxaparin (OLHDE) 1.5 mg/kg subcutaneously twice daily. The patient was maintained on this same dose, and therapeutic levels were confirmed via use of the anti-Xa monitoring test. The patient was able to be discharged from the medical floor on this same dose with no further complications of VTE noted. No adverse events from this dosing were observed during the duration of therapy.\n\n\nCONCLUSIONS\nOptions for overcoming heparin resistance are limited to case reports and small studies. The best course of treatment in the cancer patient is unclear. OLHDE allowed for the transition from intravenous to subcutaneous medication and transition off the medical floor. This case supports the use of OLHDE as a therapeutic option in heparin-resistant patients with cancer. Further study is needed to confirm the efficacy of OLHDE in this patient population.\n\n\nCONCLUSIONS\nHigh-dose enoxaparin may be an option to treat cancer patients with confirmed heparin resistance and venous thromboembolism.",
"affiliations": "Veteran's Affairs Western New York Healthcare System, Buffalo, NY, USA kristin.krajewski@va.gov.;Veteran's Affairs Western New York Healthcare System, Buffalo, NY, USA.;Veteran's Affairs Western New York Healthcare System, Buffalo, NY, USA.;State University of New York at Buffalo, School of Pharmacy and Pharmaceutical Sciences\"",
"authors": "Krajewski|Kristin C|KC|;Smith|Kelly|K|;Conwall|Katherine|K|;Krajewski|Michael P|MP|",
"chemical_list": "D017984:Enoxaparin; D065427:Factor Xa Inhibitors; D006493:Heparin",
"country": "United States",
"delete": false,
"doi": "10.1177/1060028014554649",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1060-0280",
"issue": "49(1)",
"journal": "The Annals of pharmacotherapy",
"keywords": "heparin; heparin resistance; low-molecular-weight heparin",
"medline_ta": "Ann Pharmacother",
"mesh_terms": "D019008:Drug Resistance, Neoplasm; D017984:Enoxaparin; D065427:Factor Xa Inhibitors; D006493:Heparin; D006801:Humans; D008175:Lung Neoplasms; D008297:Male; D008875:Middle Aged; D054556:Venous Thromboembolism",
"nlm_unique_id": "9203131",
"other_id": null,
"pages": "130-4",
"pmc": null,
"pmid": "25288822",
"pubdate": "2015-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't; D013486:Research Support, U.S. Gov't, Non-P.H.S.",
"references": null,
"title": "Achievement of therapeutic anti-Xa levels in a proven heparin-resistant patient through the use of nontraditional high-dose enoxaparin.",
"title_normalized": "achievement of therapeutic anti xa levels in a proven heparin resistant patient through the use of nontraditional high dose enoxaparin"
} | [
{
"companynumb": "US-SA-2015SA002562",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ENOXAPARIN SODIUM"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nAll-trans retinoic acid (ATRA) is an acid derivative of vitamin A which is discussed as a promising candidate to ameliorate the disease course of multiple sclerosis (MS) by immunomodulation or even by promoting regeneration in progressive MS. Here we report a patient who significantly improved for MS related disability following administration of chemotherapy including ATRA for mitoxantrone-related acute promyelocytic leukemia and assess the effect of high-dose ATRA in three additional patients with progressive MS.\n\n\nMETHODS\nPatients with progressive MS who had failed previous therapies were treated with high-dose ATRA. Patients underwent clinical and routine laboratory monitoring. Additionally, PBMCs were analyzed by flow cytometry for lymphocyte subsets.\n\n\nRESULTS\nATRA was well tolerated and no pathological laboratory abnormalities were observed. After initial mild (not statistically significant) improvement of EDSS and mean MSFC z-score, ongoing disease progression was observed. One patient subacutely experienced severe cognitive and motor worsening. Cerebral MRI revealed persistent gadolinium-enhancing lesions. Flow cytometric alterations of peripheral blood naïve, central memory and effector memory CD4 and CD8 T cells, B lymphocytes, plasma cells, memory B cells, plasmablasts and natural killer (NK) cells did not reach statistical significance.\n\n\nCONCLUSIONS\nStand-alone therapy with ATRA did not ameliorate progressive MS in our limited cohort and we did not observe consistent alterations of T and B cell subsets. Intriguingly, application of ATRA may have caused marked disease exacerbation in one patient.",
"affiliations": "Department of Neurology & Stroke, Eberhard-Karls University, Tübingen, Germany. Christoph.ruschil@uni-tuebingen.de.;Department of Neurology & Stroke, Eberhard-Karls University, Tübingen, Germany.;Department of Neurology & Stroke, Eberhard-Karls University, Tübingen, Germany.;Department of Neurology & Stroke, Eberhard-Karls University, Tübingen, Germany.;Department of Neurology & Stroke, Eberhard-Karls University, Tübingen, Germany.;Department of Hematology, Oncology, Clinical Immunology and Rheumatology, Eberhard-Karls University, Tübingen, Germany.;Department of Neurology & Stroke, Eberhard-Karls University, Tübingen, Germany.;Hertie Institute for Clinical Brain Research, Eberhard-Karls University, Tübingen, Germany.",
"authors": "Ruschil|Christoph|C|http://orcid.org/0000-0001-9900-4295;Dubois|Evelyn|E|;Stefanou|Maria-Ioanna|MI|;Kowarik|Markus Christian|MC|;Ziemann|Ulf|U|;Schittenhelm|Marcus|M|;Krumbholz|Markus|M|;Bischof|Felix|F|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s42466-021-00121-4",
"fulltext": "\n==== Front\nNeurol Res Pract\nNeurol Res Pract\nNeurological Research and Practice\n2524-3489\nBioMed Central London\n\n121\n10.1186/s42466-021-00121-4\nResearch Article\nTreatment of progressive multiple sclerosis with high-dose all-trans retinoic acid – no clear evidence of positive disease modifying effects\nhttp://orcid.org/0000-0001-9900-4295\nRuschil Christoph Christoph.ruschil@uni-tuebingen.de\n\n12\nDubois Evelyn 12\nStefanou Maria-Ioanna 12\nKowarik Markus Christian 12\nZiemann Ulf 12\nSchittenhelm Marcus 34\nKrumbholz Markus 12\nBischof Felix 25\n1 grid.10392.39 0000 0001 2190 1447 Department of Neurology & Stroke, Eberhard-Karls University, Tübingen, Germany\n2 grid.10392.39 0000 0001 2190 1447 Hertie Institute for Clinical Brain Research, Eberhard-Karls University, Tübingen, Germany\n3 grid.10392.39 0000 0001 2190 1447 Department of Hematology, Oncology, Clinical Immunology and Rheumatology, Eberhard-Karls University, Tübingen, Germany\n4 grid.413349.8 0000 0001 2294 4705 Department of Oncology/Hematology, Kantonsspital St Gallen, St Gallen, Switzerland\n5 Nervenärztliche Gemeinschaftspraxis, Konrad-Zuse-Str. 14, Böblingen, Germany\n10 5 2021\n10 5 2021\n2021\n3 2516 2 2021\n23 3 2021\n© The Author(s) 2021\nhttps://creativecommons.org/licenses/by/4.0/ Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.\nBackground\n\nAll-trans retinoic acid (ATRA) is an acid derivative of vitamin A which is discussed as a promising candidate to ameliorate the disease course of multiple sclerosis (MS) by immunomodulation or even by promoting regeneration in progressive MS. Here we report a patient who significantly improved for MS related disability following administration of chemotherapy including ATRA for mitoxantrone-related acute promyelocytic leukemia and assess the effect of high-dose ATRA in three additional patients with progressive MS.\n\nMethods\n\nPatients with progressive MS who had failed previous therapies were treated with high-dose ATRA. Patients underwent clinical and routine laboratory monitoring. Additionally, PBMCs were analyzed by flow cytometry for lymphocyte subsets.\n\nResults\n\nATRA was well tolerated and no pathological laboratory abnormalities were observed. After initial mild (not statistically significant) improvement of EDSS and mean MSFC z-score, ongoing disease progression was observed. One patient subacutely experienced severe cognitive and motor worsening. Cerebral MRI revealed persistent gadolinium-enhancing lesions. Flow cytometric alterations of peripheral blood naïve, central memory and effector memory CD4 and CD8 T cells, B lymphocytes, plasma cells, memory B cells, plasmablasts and natural killer (NK) cells did not reach statistical significance.\n\nConclusions\n\nStand-alone therapy with ATRA did not ameliorate progressive MS in our limited cohort and we did not observe consistent alterations of T and B cell subsets. Intriguingly, application of ATRA may have caused marked disease exacerbation in one patient.\n\nSupplementary Information\n\nThe online version contains supplementary material available at 10.1186/s42466-021-00121-4.\n\nKeywords\n\nProgressive multiple sclerosis\nAll-trans retinoic acid\nVitamin A\nLymphocyte subsets\nissue-copyright-statement© The Author(s) 2021\n==== Body\nIntroduction\n\nWhile treatment options for patients with relapsing-remitting multiple sclerosis (RRMS) have improved tremendously during the last years, evidence of effective therapies for progressive disease is still scarce. Mitoxantrone reduces disease progression in secondary progressive multiple sclerosis (SPMS), but its use is limited by side effects, including the high risk for cardiotoxicity [1] and occasional therapy-related acute leukemia. In particular, therapy-related acute promyeloic leukemia (tAPL) has been linked to the inhibition of topoisomerase II with subsequent DNA double strand breaks [2]. Recently, ocrelizumab has been approved as the first drug to modestly delay disease progression in primary progressive multiple sclerosis (PPMS), while siponimod may delay disease progression in SPMS with superimposed relapses [3, 4]. Further compounds are still in the experimental phase or clinical testing, and hitherto unavailable.\n\nAll-trans retinoic acid (ATRA) is an acid derivative of vitamin A (retinol), which regulates a broad range of biological processes. ATRA is an essential part of the AIDA (all-trans retinoic acid and idarubicin) protocol [5] for treatment of tAPL, consisting of an anthracycline (idarubicin) chemotherapy in addition to simultaneous ATRA for remission induction, followed by 3 cycles of consolidation and maintenance therapy. ATRA seems to exert positive effects also in autoimmune diseases, including MS. In RRMS, results from a previous study showed improvement of MSFC but not EDSS in RRMS patients treated with vitamin A (initially with 25.000 IU/d for 6 months, followed by 10.000 IU/d foranother 6 months) [6]. An earlier study had already pointed towards beneficial effects of ATRA in combination with interferon-beta treatment by promoting suppressor cell function [7]. Moreover, in an animal model of MS, ATRA appeared to exhibit synergistic effects with atorvastatin and led to reduced secretion of the pro-inflammatory cytokine interleukin-17 and increased production of the anti-inflammatory interleukin-10 [8]. These findings are in line with earlier observations showing that oral Vitamin A ameliorates the course of experimental autoimmune encephalomyelitis (EAE) [9–11].\n\nVia retinoic acid receptors (RARs) [12], ATRA has been suggested to induce a shift in T cell subsets from a Th1 to a Th2 type profile [11]. Moreover, proliferation and differentiation of Th17 cells [13, 14] is decreased by ATRA, e. g., by modulation of chemokines and chemokine receptors, including IL-1 receptor (IL-1R) up-regulation, IL-6R down-regulation [15] and an increase in IL-2 secretion, which is at least partly mediated by RARs [16]. In addition, alteration of other components of the immune system, including B cells and immunoglobulin production has been observed [17, 18]. Beside these immunomodulatory effects, there is evidencefrom animal models that ATRA might generate neurite outgrowth [19, 20], probably by interaction via nerve growth factor [21]. Taking these findings together, ATRA was considered a candidate for immunomodulation and regeneration in MS.\n\nHere, we report an index patient with progressive MS, who improved clinically after therapy with ATRA plus an anthracycline-based chemotherapy regimen (AIDA protocol) for the treatment of tAPL, as well as the clinical outcome and flow cytometry results of three subsequent patients with progressive MS who received off-label high-dose ATRA treatment.\n\nMethods\n\nStandard protocol approvals, registrations, and patient consents\n\nAll patients were treated at the Center of Neurology, University of Tübingen, Germany (index patient 2002–2020, other patients 2015–2019). All patients consented to off-label treatment with ATRA after previous treatment had failed and provided written informed consent for the provision of blood samples for research purposes. The protocol for processing and analyzing peripheral blood samples was approved by the Ethics Committee of the University of Tübingen, Germany (029/2014BO2). Ethics approval of individualized treatment with ATRA with a defined protocol (including ≤4 treated patients) was not necessary under German ethics legislation (“Individueller Heilversuch”). The reasons for implementing the off-label use of ATRA for progressive MS were: (i) continued clinically relevant disease progression and failure of previous treatments with no alternative treatment options currently available, (ii) limited evidence of ATRA as a promising drug for autoimmune diseases from the index patient and literature as described above, (iii) good evidence from the AIDA protocol in support of good tolerability and safety profile of ATRA.\n\nFor control purpose, we used an internal cohort of progressive MS patients (n = 52) who presented in our outpatient clinic between 2014 and 2019 (retrospective analysis, control cohort from ethics approval 329/2019B01), further details are described in Supplementary S4.\n\nPatient characteristics and plan of treatment\n\nAll 3 patients had been diagnosed with progressive multiple sclerosis (2xPPMS, 1xSPMS) and fulfilled the McDonald criteria for MS [22] and Lublin revised criteria for progressive MS [23]. They had failed previous treatments and had a documented progressive course of disease, including progressive worsening of walking ability for at least 2 years before initiation of treatment with ATRA. None of the patients had any signs of acute relapse or acute exacerbation within the previous year (Table 1, patient characteristics and diagnostic data). They did not show significant alterations compared with retrospectively analyzed control patients concerning EDSS at baseline, age, age at disease onset and disease duration. Table 1 Clinical characteristics of patients\n\nPatient No\t0 (Index)\t1\t2\t3\tControl cohort\t\nSex\t female\tfemale\t male\tmale\tfemale n = 31,\n\nmale n = 19\n\n\t\nAge\t56\t59\t60\t39\tMean = 53,9 ± 3.1\n\n[range 28–82]\n\n\t\nCourse of MS\tSPMS\tPPMS\tPPMS\tSPMS\tPPMS n = 26\n\nSPMS n = 24\n\n\t\nAge of disease onset\t15 (RRMS) / 23 (SPMS)\t52\t58\t29 (RRMS) / 35 (SPMS)\tMean = 40.6 ± 3.8\n\n[range 18–71]\n\n\t\nEDSS baseline\t6.5\t5.0\t5.5\t4.0\t4.92 ± 0.23\n\n[range 1.5–7.5]\n\n\t\nPrevious treatment\tAzathioprine, betaferon, e MP q3m, mitoxantrone\tMitoxantrone, MP q3m\tMP q3m\tGlatiramer acetat, fingolimod, teriflunomide, MP q3m\tvarious\t\nConcomitant treatment\tBotolinum toxin q3m\tFampridin,\n\nL-Thyroxin\n\n\tPramipexol\tTHC/CBD-spray\tvarious\t\nPPMS primary progressive multiple sclerosis, SPMS secondary progressive multiple sclerosis, EDSS extended disease severity score, MP q3m high dose intra-venous methyprednisolone (1000 mg/day for 3–5 days) every 3 months\n\nSimilar to the ATRA administration in the AIDA-protocol, a 30-day induction phase with daily oral administration of ATRA (45 mg/m2) was followed by 3 cycles of consolidation (daily medication during the first 15 days of a 30-day cycle) and multiple cycles of sustainment (3-month cycles with treatment during the first 15 days, planned for 6 cycles or until sustained disease progression) (Fig. 1a). One patient (patient 1) received 4 cycles of sustainment, patient 2 and 3 discontinued treatment after the 2nd cycle of sustainment (= day 300) due to disease progression. During treatment with ATRA, symptomatic therapies (e. g. anti-spastic) were continued, but no additional immunomodulatory drugs (except for intravenous corticosteroids in patient 2 for acute disease exacerbation) were administered. Fig. 1 Schematic overview of treatment plan and clinical outcome. a Schematic overview of the planned treatment, consisting of 30 days of induction therapy followed by 3 cycles of consolidation therapy and 6 cycles of sustainment therapy. Due to lack of evidence and potential aggravation of disease activity, treatment was stopped after the 2nd cycle of sustainment / day 300. b Clinical course of EDSS and c clinical course of walking ability. Slight non-significant improvement was observed on day 210 that was not statistically significant and could not be proven on day 300. d MSFC z score did not show significant changes. All tests showed no significance (p < 0,05) in Friedman-test with Dunn’s post-hoc test\n\nClinical assessment\n\nFor maximal patient safety during off-label treatment, patients were assessed regularly (monthly during induction/consolidation phase and every 3 months at the beginning of each cycle of the sustainment phase). Routine laboratory investigations (including blood count, serum electrolyte, liver enzymes, infection parameters) were drawn at each visit and adverse events were documented. Clinical course was documented by EDSS (not blinded, performed by certified EDSS raters), measured maximal walking distance, and multiple sclerosis functional composite (MSFC) test, consisting of 9-hole-peg-test (9HPT), 25-ft walking time (25FWT) and paced 3″ auditory serial addition test (PASAT 3″).\n\nFlow cytometry staining\n\nPeripheral blood mononuclear cells (PBMCs) were isolated from EDTA blood using a Ficoll gradient and frozen (− 80 °C) until further analysis. For flow cytometry, the following antibodies were used: anti-human CD3-APC (1/100) clone UCHT1, anti-human CD4-FITC (1/100) clone SK3, anti-human CD8-PerCP (1/100) clone SK1, anti-human CD19-FITC (1/100) clone HIB19, anti-human CD27-PE (1/50) clone L128, anti-human CD38-APC (1/50) clone HIT2, anti-human CD56-PE (1/50) clone B159, anti-human CD197(CCR7)-PE (1/50) clone 3D12 (all BD Biosciences), anti-human CD45RA-APC (1/50) clone HI100 (BioLegend). As a reference, analyses were additionally performed in 10 healthy controls. Gating strategy for CD4/CD8-T cell subsets, NK cells and B cell-subsets is displayed in Supplementary Fig. S1.\n\nStatistical analysis\n\nFor graphical and statistical representation, GraphPadPrism, Version 5.0 and customized R scripts [24] were used. For comparison of clinical parameters and lymphocyte subpopulations at different timepoints, the non-parametric Friedman-test with Dunn’s post-hoc analysis was applied, p-values were adjusted for multiple testing using the Bonferroni correction. Wilcoxon rank sum test was applied for comparisons between ATRA treated patients and the control cohort. Adjusted values for p < 0.05 were considered statistically significant. All values are displayed as mean ± sd [95% confidence interval (CI) lower; 95% CI upper] unless stated differently.\n\nResults\n\nIndex patient\n\nOur hypothesis that ATRA may exert positive effects on the course of progressive multiple sclerosis emerged from the clinical observation of a woman with SPMS who improved significantly in walking ability and EDSS after receiving the AIDA protocol for the treatment of tAPL, which includes high doses of ATRA.\n\nRRMS was first diagnosed in 1978, when she presented with hemianopsia that responded well to glucocorticoid treatment. CSF analysis revealed pleocytosis and positive oligoclonal bands (OCB) and evoked potentials were prolonged. MRI showed spinal, infratentorial, juxtacortical and periventricular lesions, typical for MS. In the following years, she experienced two more clinical relapses, but from 1986 onwards a secondary progression with reduction of her walking ability and left dominant tetraparesis was documented. The patient had been initially treated with azathioprine (1978–1980), followed by glucocorticoids (in the first years irregularly after relapses, in the next several years 3-4x/year as treatment for progressive disease) until 1998. Despite treatment, the patient essentially lost her walking ability (documented EDSS 6.5) in 1999. Subsequently, mitoxantrone was administered from 2000 to 2002 (initial dose 12 mg/m2 i.v./every 3 months, cumulative dose 72 mg/m2) until acute promyeloic leukemia was diagnosed in 04/2002. The length of exposure to mitoxantrone was compatible with the diagnosis of mitoxantrone therapy-related leukemia (tAPL). Following the AIDA protocol for tAPL, induction therapy with Idarubicin (12 mg/m2 on day 2, 4, 6, 8) and cytarabin (Ara-C 100 mg/m2/24h on day 1) accompanied by ATRA (45 mg/m2 until complete remission) was initiated. Three cycles of consolidation (anthracycline-based and cytarabine, each combined with ATRA for 15 days in 30-day-cycles) were administered subsequently, followed by 6 cycles of maintenance therapy (6-mercaptopurine daily, methotrexate weekly plus ATRA during the first 15 days of 3-month-cycles). Treatment was successful, with a stable complete molecular remission ever since (up to date 2020).\n\nAlthough no further immunomodulatory/immunosuppressive therapy was administered since 2004, MS symptoms continuously improved after the end of the tAPL therapy. The patient regained her walking ability and was later able to walk 120 m with bilateral assistance. Motor function of the arms increased and the EDSS improved slightly to 6.0. The patient underwent botulinum toxin injections (facial spasms) since 2004 and regular physiotherapy without further symptomatic drug therapies.\n\nBased on this favorable outcome of the index patient and given the above-mentioned research data on immunomodulatory effects of ATRA, we hypothesized that administration of high-dose ATRA as in the tAPL protocol may have positively modified the course of disease of progressive multiple sclerosis.\n\nATRA is well tolerated and causes no abnormalities in routine laboratory parameters\n\nAll three subsequent patients complained about light headache during the first days of each cycle. Two out of three patients had mild flu-like symptoms after the first 30 days of induction, which resolved without treatment. One patient complained about mild worsening of a psoriatic exanthema and reported mild flushes. No serious treatment-related adverse events were observed during treatment with ATRA. Routine safety testing showed no relevant changes in WBC, serum electrolytes, infection parameters, and liver or kidney function.\n\nNo changes in clinical outcome\n\nClinical outcome was assessed by EDSS rating, testing of walking ability and MSFC. For two out of three patients (not including the previous index case), initial improvement in EDSS after 120 days was observed (Fig. 1b) (Baseline: 4.83 ± 0.44 [CI 3.99; 5.69]; d120 4.5 ± 0 [CI not applicable]). However, this (non-significant) improvement could not be sustained. Instead, asubsequent clinical worsening was observed and at day 300 (after 2 cycles of sustainment therapy) EDSS returned to baseline values (d300: 5.0 ± 0.29 [CI 4,43; 5.56]). Compared with the control cohort (baseline EDSS 4.92 ± 0.23 [CI 4.49; 5.34]), the annual worsening (ΔEDSS) of 0.17 ± 0.1 [CI -0.02; 0.36] was within the expected range without significant improvement after treatment (control ΔEDSS 0.23 ± 0.09 [CI 0.05; 0.40],: p = 0.983; effect size W = 74.5).\n\nMaximal walking ability (Fig. 1c) at baseline was 328 m ± 103 m [CI 209.9, 444.1] and initially improved at day 120 to 382 m ± 55 m [CI 235.7, 529.6] (mean delta change 71 m ± 72 m). Nonetheless, this change was not statistically significant. Yet, at the end of treatment/day 300, walking ability reached again a level below baseline with maximal walking ability of 298 ± 49 m [CI 212.2, 383.2]. Thus, no overall clinical effects on walking ability could be observed.\n\nMSFC Test (containing 25FWT, 9HPT, 3”PASAT, Fig. 1d) showed similar tendencies with minimal, not statistically significant or clinically relevant improvement at day 30 and day 120 that were not sustained at day 210 and day 300 (baseline z-score: 15.1 ± 0.38 [ci 14.3; 15,8], d300: 12.5 ± 5.05 [ci 2.6; 22.4]). Analysis of the single components (see Supplementary Fig. S2) showed improvement of 9HPT at days 30, 120 and 300 against baseline (moderate effect size, Kendall W = 0.424), most likely due to training effects. For 25 ft walk test or 3”PASAT no significant changes were observed.\n\nLymphocyte subsets\n\nAt baseline and during treatment with ATRA, peripheral blood samples were obtained from all patients and cells were analyzed by flow cytometry. After induction therapy with ATRA, we observed a proportional increase of naive CD4+ and naive CD8 T+ cells in one patient (patient 1), whereas another patient (patient 2) presented a proportional increase of CD4+ and CD8+ effector memory T cells (Fig. 2). However, compared to normal population or healthy controls (i.e., not treated with ATRA), we did not observe any significant differences. Fig. 2 High heterogeneity in CD4 / CD8 T cell subsets with no obvious alteration by ATRA. Central memory CD4+ T cells (CD4+ Tcm), naïve CD4+ T cells and effector memory CD4+ T cells (CD4+ Tem) as well as central memory CD8 T cells (CD8+ Tcm), naive CD8+ T cells and effector memory CD8+ T cells (CD8+ Tem) were tested before (green dots), during (black dots) and in the follow-up period after (blue dots) treatment with ATRA, red dots indicate end of treatment. High heterogeneity was observed with no evidence of direct alteration by induction of treatment. Grey lines indicate range of normal values (mean +/− 2*SD) obtained as reference from 10 healthy controls. All tests showed no significance (p < 0,05) in Friedman-test with Dunn’s post-hoc test\n\nThe frequencies of central memory CD4+ or CD8+ T cells (Fig. 2), CD19+ B lymphocytes, CD19 + CD38+ plasma cells, CD19 + CD27+ memory B cells and CD56+ NK cells (Fig. 3) were not affected by ATRA. Fig. 3 Frequency of B lymphocytes, plasma cells and NK cells. Frequency of CD19+ B lymphocytes, CD19 + CD38+ plasma cells, CD19 + CD27+ memory B cells and CD56+ NK cells did not significantly differ during treatment of ATRA (Friedman test with Dunn’s post-hoc test p<0.05)\n\nDisease exacerbation in one patient\n\nOne patient (patient 2) experienced severe cognitive and motor worsening after the first cycle of sustainment therapy (day 210). Cerebral MRI revealed gadolinium enhancing lesions. The patient received high-dose glucocorticoid treatment and the 2nd cycle of sustainment therapy with ATRA was continued. However, symptoms progressed. Repeated MRI 3 months later, showed persisting and new gadolinium enhancing lesions (Fig. 4). ATRA therapy was halted and the patient received another cycle of high-dose glucocorticoid treatment followed by rituximab (1 g every 6 months), which stabilized the disease course. No new T2 or persistent Gd + MRI lesions were observed in the following 2 years. This disease exacerbation was unexpected as none of the 50 patients in the control cohort showed similar disease activity on repeated MRI scans. Fig. 4 MRI imaging of patient 2 displaying disease activity. a FLAIR and b T1 weighted MRI with application of gadolinium at day 300 after start of ATRA revealed multiple gadolinium-enhancing lesions\n\nClinical outcome\n\nWhile a slight, non-significant clinical improvement was noted at initial stages during induction therapy, all patients experienced clinical worsening in subsequent cycles, with an overall reduced walking ability noted at day 300. Therefore, treatment with ATRA was discontinued in all patients. MRI (FLAIR, Gd-enhanced T1) of patient 1 and 3 remained stable during and after treatment.\n\nDiscussion\n\nAll-trans retinoic acid (ATRA) is known to interact via multiple ways with the immune system and previous studies have suggested that ATRA could shift the imbalance in multiple sclerosis from a Th1/Th17 to Th2/Treg T cell phenotype [25], potentially facilitating clinical improvement in MS or even inducing neuroregeneration. Here we report a single index patient who improved significantly after treatment with a high-dose ATRA-containing regimen (AIDA protocol for tAPL). This observation is in line with reports of beneficial effects after ATRA treatment in other autoimmune disorders, including inflammatory bowel disease [26] and systemic lupus erythematosus [27], where ATRA has been shown to reduce proteinuria in lupus nephritis. The positive effects noted in our index patient are also in line with evidence of efficacy of ATRA in dampening inflammatory processes in animal models. In particular, ATRA has been associated with attenuation of disease activity in EAE models [9, 10] along with attenuation of neuroinflammation following global ischemia and rescue of neurons in a gerbil model [28].\n\nDespite the suggested clinical improvement associated with ATRA therapy in the index patient, we could not observe any significant amelioration of clinical symptoms in three further patients treated with high-dose stand-alone ATRA. In this small cohort, we were not able to demonstrate any consistent shift in T and B cell subsets. Yet, as the flow cytometry results exhibited high variability already at baseline, treatment induced changes may have remained undetected. Some further methodological limitations should be considered for an accurate interpretation of our results:a) The population treated with ATRA was small, heterogenous and had failed previous treatment attempts. The small population size per se may account for type II errors. However, in this small cohort, no striking ATRA effects in these exemplary MS patients were noted. The small cohort was heterogenous and included patients with primary and secondary progressive MS. Although genetic and histopathological features as well as the natural course of disease indicate a common “progressive stage” of MS [23, 29], it cannot be ruled out that PPMS and SPMS are two different entities. Moreover, it has been suggested to categorize MS in three different stages: early/initial stage driven by systemic inflammation, a second stage of compartmentalized inflammation in the CNS and a third stage with prominent neurodegeneration [30]. Taking the promising experience from the index patient, we hypothesized that ATRA might hold potential for attenuating neurodegeneration. With a range of disease duration between 2 and 10 years, our patients were most likely in the second to third stage of MS. However, the patient with the shortest disease duration (2 years) experienced disease exacerbation with new Gd-enhanced lesions on MRI. Thus, we cannot exclude that differential ATRA effects could be expected in patients with different MS types or at different MS stages. Also, regarding the previous failed treatment attempts, we consider it unlikely that relevant carry-over effects persisted when treatment with ATRA was initiated. More importantly, the repeated failures of treatment attempts and the severe disability (EDSS 4.0–6.0) of our patients indicate a severe MS course. Thus, we cannot exclude that a “floor-effect” may have confounded our results. As seen in previous studies, rigorous selection of inclusion criteria, including young age, short disease duration and MRI activity might unmask treatment effects. Nonetheless, we considered ATRA as off-label treatment to be ethically justified only in selected patients with aggressive disease course, persistent clinical worsening and after all other available treatment options had been exhausted, even at the cost of introducing bias in patient selection.\n\nb) While the index patient had received ATRA and additional idarubicin during induction, cytarabin during consolidation and 6-mercaptopurin during maintenance stages of the AIDA protocol, the prospectively treated three patients received only ATRA monotherapy. Idarubicin has not been previously studied in multiple sclerosis. Cytarabin is part of high-dose immunosuppressive treatment in combination with autologous hematopoietic stem cell transplantation in multiple sclerosis [31], but monotherapy has failed to improve neurological outcome [32]. Certainly, 6-mercaptopurin (or its prodrug azathioprine) has well proven effects on the course of disease in multiple sclerosis [33] but it seems very unlikely that a limited treatment period during 6 cycles of maintenance could have induced the observed amelioration of the index patient.\n\nc) Effects like neuronal outgrowth or neuroregeneration promoted by ATRA evolve slowly and the duration of treatment or the subsequent follow-up might not have been sufficient to detect slight but steady improvements as the ones observed in the index patient for nearly 20 years. Therefore, the observational period may have been too short. However, the clinical worsening and acute exacerbation in at least one patient prompted us to withdraw ATRA treatment.\n\nOn the other hand, we contemplated whether ATRA might induce detrimental effects in MS. Patient 2 in our cohort experienced disease exacerbation with clinical worsening and acute gadolinium enhancing lesions during the treatment period. Although this finding was unexpected and a causative role of ATRA cannot be formally proven, detrimental effects of ATRA in experimental settings have been previously reported. In a spinal cord injury model, application of ATRA increased the Treg population and reduced activation of Teff cells, which was paradoxically associated with decreased neuronal survival [34]. Additionally, in an experimental mouse model of lupus-like disease, ATRA promoted neuroinflammation with clinical disease exacerbation and increased circulating plasma cells, autoantibodies and total IgG [35, 36]. A potential explanation for this paradoxical cerebral inflammatory process might be that in vivo, retinoic acid interacts via multiple pathways with immunological cascades, besides the Th1/Th2-pathways. For example, retinoic acid has been shown to increase B cell proliferation and plasmocytic cell differentiation [37]. Considering the crucial involvement of antibody and B cell mediated-processes especially at early disease stages of MS [38], an ATRA-mediated propagation of B cell proliferation may explain clinical worsening. Of note, patient 2, who experienced relapse symptoms, displayed higher relative plasmablasts (percentage of total B cells) than the other subjects.\n\nConclusions\n\nATRA may promote or inhibit inflammation dependend on the stage of disease [39] or the overall susceptibility of the inflammatory environment. In combination with other immunomodulatory substances such as atorvastatin [8], interferone-beta [40] or Vitamin D [41], − or even in combination with other immunusuppressive drugs like cytarabin or 6-mercaptopurin - high-dose ATRA might indeed regulate inflammatory processes. Eventually, this could be the case with our index patient, who received ATRA not as stand-alone therapy but in combination with chemotherapy. As a monotherapy, at least in our limited cohort, and possibly depending on the stage of disease, high-dose ATRA failed to promote clinical improvement.\n\nSupplementary Information\n\nAdditional file 1: Supplementary Figure S1. Schematic overview for flow cytometry. Supplementary Figure S2. Subanalysis of single components of the MSFC test. Supplementary Figure S3. Additional analysis of flow cytometry results. Supplementary S4. Control cohort for progressive multiple sclerosis.\n\nAbbreviations\n\nAIDA All-trans retinoic acid and idarubicin (protocol)\n\nAra-C Cytarabine\n\nATRA All-trans retinoic acid\n\nCSF Cerebro-spinal fluid\n\nEDSS Expanded disability status scale\n\nGd Gadolinium\n\nIL-1R Interleukin-1 receptor\n\nMRI Magnetic resonance imaging\n\nMS Multiple sclerosis\n\nMSFC Multiple sclerosis functional compound\n\nNK cells Natural killer cells\n\nOCB Oligoclonal bands\n\nPMBC Peripheral blood mononuclear cells\n\nPASAT 3″ Paced 3″ auditory serial addition test\n\nPPMS Primary-progressive multiple sclerosis\n\nRARs Retinoic acid receptors\n\nRRMS Relapsing-remitting multiple sclerosis\n\nSPMS Secondary-progressive multiple sclerosis\n\ntAPL Therapy-related acute promyeloic leukemia\n\n25FWT 25-ft walking time\n\n9HPT 9-hole-peg-test\n\nAcknowledgements\n\nNot applicable.\n\nAuthors’ contributions\n\nCR treated the patients, collected and analyzed the data, did statistical analysis, did literature research, wrote the manuscript, critically reviewed and revised the manuscript; ED performed flow cytometry, analyzed the data and critical revised the manuscript; MIS treated the patients and critically reviewed the manuscript for important intellectual content; MCK critically reviewed the manuscript for important intellectual content; UZ critically reviewed the manuscript for important intellectual content; MS treated the index patient, advised the treatment for hematological features and critically reviewed the manuscript for important intellectual content; MK supervised treatment of the patients and data collection and critically reviewed the manuscript for important intellectual content; FB designed and supervised the treatment of all patients, treated the patients, collected and analyzed the data, wrote the manuscript and critically revised the manuscript. The author(s) read and approved the final manuscript.\n\nFunding\n\nThe authors received no financial support for the research, authorship, and/or publication of this article.\n\nAvailability of data and materials\n\nNot applicable.\n\nDeclarations\n\nEthics approval and consent to participate\n\nAll patients consented to off-label treatment with ATRA after previous treatment had failed and provided written informed consent for the provision of blood samples for research purposes. The protocol for processing and analyzing peripheral blood samples was approved by the Ethics Committee of the University of Tübingen, Germany (029/2014BO2). Ethics approval of individualized treatment with ATRA with a defined protocol (including ≤4 patients treated) was not necessary under German ethics legislation (“Individueller Heilversuch”). For control purpose, we used an internal cohort of progressive MS patients (n = 52) who presented in our outpatient clinic between 2014 and 2019 (ethics approval for retrospective analysis 329/2019B01 by Ethics Committee of the University of Tübingen).\n\nConsent for publication\n\nAll patients provided written consent for publication.\n\nCompeting interests\n\nChristoph Ruschil is supported by fortüne/PATE (grant no 2536-0-0) from the medical faculty, Eberhard-Karls University of Tübingen; not related to this project. Evelyn Dubois reports no disclosures. Maria-Ioanna Stefanou reports no disclosures. Ulf Ziemann has received grants from European Research Council (ERC), German Research Foundation (DFG), German Federal Ministry of Education and Research (BMBF), Bristol Myers Squibb, Janssen Pharmaceutica NV, Servier, Biogen Idec GmbH, and personal fees from Bayer Vital GmbH, Pfizer GmbH, CorTec GmbH, all not related to this work. Markus C Kowarik receives financial support from Merck, Sanofi-Genzyme, Novartis, Biogen, Celgene and Roche, not related to this project. Marcus Schittenhelm receives financial support from Pfizer and Astellas, not related to this project. M S was supported by the IZKF Program of the medical faculty, Eberhard-Karls University of Tübingen. M. Krumbholz received travel funding and speaker honoraria from Merck, Novartis and Roche, and research support from Merck. F. Bischof served on the scientific advisory board for Genzyme, Novartis, and Roche, received speaker honoraria and travel funding from Biogen Idec, Genzyme, and Novartis, and received research support from Novartis, all unrelated to this work.\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Martinelli Boneschi, F., Vacchi, L., Rovaris, M., Capra, R., & Comi, G. (2013). Mitoxantrone for multiple sclerosis. Cochrane Database of Systematic Reviews, (5), CD002127.\n2. Mistry, A. R., Felix, C. A., Whitmarsh, R. J., Mason, A., Reiter, A., Cassinat, B., … Grimwade, D. (2005). DNA topoisomerase II in therapy-related acute promyelocytic leukemia. The New England Journal of Medicine, 352(15), 1529–1538. 10.1056/NEJMoa042715.\n3. Kappos, L., Bar-Or, A., Cree, B. A. C., Fox, R. J., Giovannoni, G., Gold, R., … Ziemssen, T. (2018). Siponimod versus placebo in secondary progressive multiple sclerosis (EXPAND): A double-blind, randomised, phase 3 study. Lancet, 391(10127), 1263–1273. 10.1016/S0140-6736(18)30475-6.\n4. Montalban, X., Hauser, S. L., Kappos, L., Arnold, D. L., Bar-Or, A., Comi, G., … Wolinsky, J. S. (2017). Ocrelizumab versus placebo in primary progressive multiple sclerosis. The New England Journal of Medicine, 376(3), 209–220. 10.1056/NEJMoa1606468.\n5. Avvisati, G., Lo Coco, F., Diverio, D., Falda, M., Ferrara, F., Lazzarino, M., … Mandelli, F. (1996). AIDA (all-trans retinoic acid + idarubicin) in newly diagnosed acute promyelocytic leukemia: a Gruppo Italiano Malattie Ematologiche Maligne dell'Adulto (GIMEMA) pilot study. Blood, 88(4), 1390–1398. 10.1182/blood.V88.4.1390.bloodjournal8841390.\n6. Bitarafan, S., Saboor-Yaraghi, A., Sahraian, M. A., Nafissi, S., Togha, M., Beladi Moghadam, N., … Harirchian, M. H. (2015). Impact of vitamin a supplementation on disease progression in patients with multiple sclerosis. Archives of Iranian Medicine, 18(7), 435–440.\n7. Qu ZX Dayal A Jensen MA Arnason BG All-trans retinoic acid potentiates the ability of interferon beta-1b to augment suppressor cell function in multiple sclerosis Archives of Neurology 1998 55 3 315 321 10.1001/archneur.55.3.315 9520005\n8. Abtahi Froushani SM Delirezh N Hobbenaghi R Mosayebi G Synergistic effects of atorvastatin and all-trans retinoic acid in ameliorating animal model of multiple sclerosis Immunological Investigations 2014 43 1 54 68 10.3109/08820139.2013.825269 24063549\n9. Racke, M. K., Burnett, D., Pak, S. H., Albert, P. S., Cannella, B., Raine, C. S., … Scott, D. E. (1995). Retinoid treatment of experimental allergic encephalomyelitis. IL-4 production correlates with improved disease course. Journal of Immunology, 154(1), 450–458.\n10. Massacesi L Castigli E Vergelli M Olivotto J Abbamondi AL Sarlo F Amaducci L Immunosuppressive activity of 13-cis-retinoic acid and prevention of experimental autoimmune encephalomyelitis in rats The Journal of Clinical Investigation 1991 88 4 1331 1337 10.1172/JCI115438 1918383\n11. Lovett-Racke AE Racke MK Retinoic acid promotes the development of Th2-like human myelin basic protein-reactive T cells Cellular Immunology 2002 215 1 54 60 10.1016/S0008-8749(02)00013-8 12142036\n12. Iwata M Eshima Y Kagechika H Retinoic acids exert direct effects on T cells to suppress Th1 development and enhance Th2 development via retinoic acid receptors International Immunology 2003 15 8 1017 1025 10.1093/intimm/dxg101 12882839\n13. Ikeda U Wakita D Ohkuri T Chamoto K Kitamura H Iwakura Y Nishimura T 1alpha,25-Dihydroxyvitamin D3 and all-trans retinoic acid synergistically inhibit the differentiation and expansion of Th17 cells Immunology Letters 2010 134 1 7 16 10.1016/j.imlet.2010.07.002 20655952\n14. Mohammadzadeh Honarvar, N., Harirchian, M. H., Koohdani, F., Siassi, F., Abdolahi, M., Bitarafan, S., … Saboor-Yarghi, A. A. (2013). The effect of vitamin A supplementation on retinoic acid-related orphan receptor gammat (RORgammat) and interleukin-17 (IL-17) gene expression in Avonex-treated multiple sclerotic patients. Journal of Molecular Neuroscience, 51(3), 749–753. 10.1007/s12031-013-0058-9.\n15. Lu, L., Lan, Q., Li, Z., Zhou, X., Gu, J., Li, Q., … Zheng, S. G. (2014). Critical role of all-trans retinoic acid in stabilizing human natural regulatory T cells under inflammatory conditions. Proceedings of the National Academy of Sciences of the United States of America, 111(33), E3432–E3440. 10.1073/pnas.1408780111.\n16. Ertesvag A Engedal N Naderi S Blomhoff HK Retinoic acid stimulates the cell cycle machinery in normal T cells: Involvement of retinoic acid receptor-mediated IL-2 secretion Journal of Immunology 2002 169 10 5555 5563 10.4049/jimmunol.169.10.5555\n17. Aukrust P Muller F Ueland T Svardal AM Berge RK Froland SS Decreased vitamin a levels in common variable immunodeficiency: Vitamin a supplementation in vivo enhances immunoglobulin production and downregulates inflammatory responses European Journal of Clinical Investigation 2000 30 3 252 259 10.1046/j.1365-2362.2000.00619.x 10692003\n18. Jin, C. J., Hong, C. Y., Takei, M., Chung, S. Y., Park, J. S., Pham, T. N., et al. (2010). All-trans retinoic acid inhibits the differentiation, maturation, and function of human monocyte-derived dendritic cells. Leukemia Research, 34(4), 513–520. 10.1016/j.leukres.2009.10.006.\n19. Palencia, G., Hernandez-Pedro, N., Saavedra-Perez, D., Pena-Curiel, O., Ortiz-Plata, A., Ordonez, G., … Arrieta, O. (2014). Retinoic acid reduces solvent-induced neuropathy and promotes neural regeneration in mice. Journal of Neuroscience Research, 92(8), 1062–1070. 10.1002/jnr.23376.\n20. Zhelyaznik N Schrage K McCaffery P Mey J Activation of retinoic acid signalling after sciatic nerve injury: Up-regulation of cellular retinoid binding proteins The European Journal of Neuroscience 2003 18 5 1033 1040 10.1046/j.1460-9568.2003.02834.x 12956703\n21. Corcoran J Maden M Nerve growth factor acts via retinoic acid synthesis to stimulate neurite outgrowth Nature Neuroscience 1999 2 4 307 308 10.1038/7214 10204534\n22. Polman, C. H., Reingold, S. C., Banwell, B., Clanet, M., Cohen, J. A., Filippi, M., … Wolinsky, J. S. (2011). Diagnostic criteria for multiple sclerosis: 2010 revisions to the McDonald criteria. Annals of Neurology, 69(2), 292–302. 10.1002/ana.22366.\n23. Lublin, F. D., Reingold, S. C., Cohen, J. A., Cutter, G. R., Sorensen, P. S., Thompson, A. J., … Polman, C. H. (2014). Defining the clinical course of multiple sclerosis: The 2013 revisions. Neurology, 83(3), 278–286. 10.1212/WNL.0000000000000560.\n24. Team RC R: A language and environment for statistical computing 2013\n25. Abdolahi M Yavari P Honarvar NM Bitarafan S Mahmoudi M Saboor-Yaraghi AA Molecular mechanisms of the action of vitamin a in Th17/Treg Axis in multiple sclerosis Journal of Molecular Neuroscience 2015 57 4 605 613 10.1007/s12031-015-0643-1 26319266\n26. Hong, K., Zhang, Y., Guo, Y., Xie, J., Wang, J., He, X., … Bai, A. (2014). All-trans retinoic acid attenuates experimental colitis through inhibition of NF-kappaB signaling. Immunology Letters, 162(1 Pt A), 34–40.\n27. Kinoshita K Kishimoto K Shimazu H Nozaki Y Sugiyama M Ikoma S Funauchi M Successful treatment with retinoids in patients with lupus nephritis American Journal of Kidney Diseases 2010 55 2 344 347 10.1053/j.ajkd.2009.06.012 19628316\n28. Kim, J. H., Yu, K. S., Jeong, J. H., Lee, N. S., Lee, J. H., Jeong, Y. G., … Han, S. Y. (2013). All-trans-retinoic acid rescues neurons after global ischemia by attenuating neuroinflammatory reactions. Neurochemical Research, 38(12), 2604–2615. 10.1007/s11064-013-1178-x.\n29. Lassmann H Bruck W Lucchinetti CF The immunopathology of multiple sclerosis: An overview Brain Pathology 2007 17 2 210 218 10.1111/j.1750-3639.2007.00064.x 17388952\n30. Lassmann H Targets of therapy in progressive MS Multiple Sclerosis 2017 23 12 1593 1599 10.1177/1352458517729455 29041864\n31. Nash, R. A., Hutton, G. J., Racke, M. K., Popat, U., Devine, S. M., Griffith, L. M., et al. (2015). High-dose immunosuppressive therapy and autologous hematopoietic cell transplantation for relapsing-remitting multiple sclerosis (HALT-MS): A 3-year interim report. JAMA Neurology, 72(2), 159–169. 10.1001/jamaneurol.2014.3780.\n32. Tourtellotte WW Potvin AR Mendez M Baumhefner RW Potvin JH Ma BI Syndulko K Failure of intravenous and intrathecal cytarabine to modify central nervous system IgG synthesis in multiple sclerosis Annals of Neurology 1980 8 4 402 408 10.1002/ana.410080411 6893646\n33. Casetta, I., Iuliano, G., & Filippini, G. (2007). Azathioprine for multiple sclerosis. The Cochrane database of systematic reviews, 2007(4), CD003982. 10.1002/14651858.CD003982.pub2\n34. Walsh JT Zheng J Smirnov I Lorenz U Tung K Kipnis J Regulatory T cells in central nervous system injury: A double-edged sword Journal of Immunology 2014 193 10 5013 5022 10.4049/jimmunol.1302401\n35. Liao, X., Ren, J., Wei, C. H., Ross, A. C., Cecere, T. E., Jortner, B. S., … Luo, X. M. (2015). Paradoxical effects of all-trans-retinoic acid on lupus-like disease in the MRL/lpr mouse model. PLoS One, 10(3), e0118176. 10.1371/journal.pone.0118176.\n36. Theus MH Sparks JB Liao X Ren J Luo XM All- trans-retinoic acid augments the Histopathological outcome of Neuroinflammation and Neurodegeneration in lupus-prone MRL/lpr mice The Journal of Histochemistry and Cytochemistry 2017 65 2 69 81 10.1369/0022155416679638 27856824\n37. Chen Q Mosovsky KL Ross AC Retinoic acid and alpha-galactosylceramide differentially regulate B cell activation in vitro and augment antibody production in vivo Clinical and Vaccine Immunology 2011 18 6 1015 1020 10.1128/CVI.00004-11 21471300\n38. Weber MS Hemmer B Cepok S The role of antibodies in multiple sclerosis Biochimica et Biophysica Acta 2011 1812 2 239 245 10.1016/j.bbadis.2010.06.009 20600871\n39. Abdelhamid, L., Cabana-Puig, X., Swartwout, B., Lee, J., Li, S., Sun, S., … Luo, X. M. (2020). Retinoic acid exerts disease stage-dependent effects on Pristane-induced lupus. Frontiers in Immunology, 11, 408. 10.3389/fimmu.2020.00408.\n40. Mousavi Nasl-Khameneh, A., Mirshafiey, A., Naser Moghadasi, A., Chahardoli, R., Mahmoudi, M., Parastouei, K., … Saboor-Yaraghi, A. A. (2018). Combination treatment of docosahexaenoic acid (DHA) and all-trans-retinoic acid (ATRA) inhibit IL-17 and RORgammat gene expression in PBMCs of patients with relapsing-remitting multiple sclerosis. Neurological Research, 40(1), 11–17. 10.1080/01616412.2017.1382800.\n41. Fragoso YD Stoney PN McCaffery PJ The evidence for a beneficial role of vitamin a in multiple sclerosis CNS Drugs 2014 28 4 291 299 10.1007/s40263-014-0148-4 24557746\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2524-3489",
"issue": "3(1)",
"journal": "Neurological research and practice",
"keywords": "All-trans retinoic acid; Lymphocyte subsets; Progressive multiple sclerosis; Vitamin A",
"medline_ta": "Neurol Res Pract",
"mesh_terms": null,
"nlm_unique_id": "101767802",
"other_id": null,
"pages": "25",
"pmc": null,
"pmid": "33966627",
"pubdate": "2021-05-10",
"publication_types": "D016428:Journal Article",
"references": "29041864;10692003;6893646;25099355;7527821;23868508;26319266;17943809;25004394;17388952;20655952;15829534;26161708;12421932;25775135;23728638;1918383;19883939;10204534;24158695;21471300;29576505;25546364;25320276;9520005;21387374;24063549;12882839;27856824;19628316;29155646;8695858;12142036;24647975;12956703;28002688;24557746;20600871;32265909",
"title": "Treatment of progressive multiple sclerosis with high-dose all-trans retinoic acid - no clear evidence of positive disease modifying effects.",
"title_normalized": "treatment of progressive multiple sclerosis with high dose all trans retinoic acid no clear evidence of positive disease modifying effects"
} | [
{
"companynumb": "DE-MYLANLABS-2021M1067223",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "MITOXANTRONE HYDROCHLORIDE"
},
"drugadditiona... |
{
"abstract": "OBJECTIVE\nLittle data exist regarding infliximab use in surgical decision making and postoperative complications in ulcerative colitis. Our goals were to determine the rate of postoperative complications in infliximab-treated ulcerative colitis patients undergoing restorative proctocolectomy and to determine whether three-stage procedures are more often necessary.\n\n\nMETHODS\nWe studied a group of infliximab-treated patients and matched control subjects who underwent two-stage restorative proctocolectomy between 2000 and 2006. Postoperative complications were compared. In addition, the rate of three-stage procedures was compared between all infliximab- and noninfliximab-treated patients.\n\n\nRESULTS\nA total of 523 restorative proctocolectomies were performed. In the infliximab group, there were 46 two-stage and 39 three-stage procedures. Covariate-adjusted odds of early complication for the infliximab group was 3.54 times that of controls (P = 0.004; 95 percent confidence interval (CI), 1.51-8.31). The odds of sepsis were 13.8 times greater (P = 0.011; 95 percent CI, 1.82-105) and the odds of late complication were 2.19 times greater (P = 0.08; 95 percent CI, 0.91-5.28) for infliximab. The odds of requirement for three-stage procedures was 2.07 times greater in the infliximab group (P = 0.011; 95 percent CI, 1.18-3.63).\n\n\nCONCLUSIONS\nInfliximab increases the risk of postoperative complications after restorative proctocolectomy and has altered the surgical approach to ulcerative colitis. Potential benefits of infliximab should be balanced against these risks.",
"affiliations": "Digestive Diseases Institute, A30, Cleveland Clinic, 9500 Euclid Avenue, Cleveland, Ohio 44195, USA.",
"authors": "Mor|I J|IJ|;Vogel|J D|JD|;da Luz Moreira|A|A|;Shen|B|B|;Hammel|J|J|;Remzi|F H|FH|",
"chemical_list": "D000911:Antibodies, Monoclonal; D005765:Gastrointestinal Agents; D000069285:Infliximab",
"country": "United States",
"delete": false,
"doi": "10.1007/s10350-008-9364-7",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0012-3706",
"issue": "51(8)",
"journal": "Diseases of the colon and rectum",
"keywords": null,
"medline_ta": "Dis Colon Rectum",
"mesh_terms": "D000328:Adult; D000911:Antibodies, Monoclonal; D016022:Case-Control Studies; D016009:Chi-Square Distribution; D003093:Colitis, Ulcerative; D003131:Combined Modality Therapy; D005260:Female; D005765:Gastrointestinal Agents; D006801:Humans; D000069285:Infliximab; D016015:Logistic Models; D008297:Male; D011183:Postoperative Complications; D016737:Proctocolectomy, Restorative; D012189:Retrospective Studies; D012306:Risk; D018709:Statistics, Nonparametric; D016896:Treatment Outcome",
"nlm_unique_id": "0372764",
"other_id": null,
"pages": "1202-7; discussion 1207-10",
"pmc": null,
"pmid": "18536964",
"pubdate": "2008-08",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Infliximab in ulcerative colitis is associated with an increased risk of postoperative complications after restorative proctocolectomy.",
"title_normalized": "infliximab in ulcerative colitis is associated with an increased risk of postoperative complications after restorative proctocolectomy"
} | [
{
"companynumb": "US-JNJFOC-20200341922",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "INFLIXIMAB"
},
"drugadditional": "3",
"... |
{
"abstract": "To study the clinical features of children diagnosed with anti-NMDAR encephalitis in southern China.\n\n\n\nClinical data of children diagnosed with anti-NMDAR encephalitis from October 2014 to June 2020 from one national regional medical center were analyzed. Neurological disability was assessed by modified Rankin Scale (mRS) throughout the course of disease.\n\n\n\n111 children (M/F = 49/62; mean onset age = 6.8 y) with anti-NMDAR encephalitis were involved. Prodromal events occurred in 34.2% of patients with infectious events being the most common. Seizure was the most common initial symptom, though movement disorder served as the most common event throughout the course of disease. 9.9% of patients had overlapped with other neuronal autoantibodies. Electroencephalogram showed abnormalities with slow wave (100.0%), epileptic discharge (31.5%) and delta brush (8.1%) respectively. 41.4% of patients had abnormal brain MRI, with focal lesions being the most common. None patients had tumor. 80.9% of patients had good response to first line therapy (steroid plus immunoglobulin), while 14 patients accepted second-line therapy (Rituximab) and all had a good response. Boys were significantly more likely to need more course of steroid. 13.8% of patients relapsed. 2 male patients died. mRS score was significantly improved after treatment. 51.4% of patients had a full recovery and 81.7% had mRS score ≤ 2. The median mRS score of boys after treatment was higher than that of girls. Non-infectious prodromal event, past medical history, perivascular lesions in brain MRI, hospital stay, initial mRS score higher than 3, and RTX treatment were independent risk factors associated with poor prognosis, defined as mRS score > 2.\n\n\n\nOf pediatric anti-NMDAR encephalitis in southern China: median onset age around 7 years; girls more common; boys might have poor outcome than girls; seizure or movement disorder respectively being most common onset or course symptom; a few overlapped with other neuronal autoantibodies; rare combined with tumor; most had a good response to immunotherapy and a good prognosis; relapse rate relatively high; fatality rate relatively low; some risk factors associated with poor prognosis.",
"affiliations": "Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China.;Department of Neurology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 9# Jin Sui Road, 510623 Guangzhou, Guangdong Province, PR China. Electronic address: chenwenxiong@gwcmc.org.",
"authors": "Li|Xiaojing|X|;Hou|Chi|C|;Wu|Wen-Lin|WL|;Liang|Huici|H|;Zheng|Kelu|K|;Zhang|Yani|Y|;Zeng|Yiru|Y|;Chen|Lianfeng|L|;Zhu|Haixia|H|;Tian|Yang|Y|;Gao|Yuanyuan|Y|;Peng|Bingwei|B|;Yang|Sida|S|;Wang|Xiuying|X|;Ning|Shuyao|S|;Liao|Yinting|Y|;Lin|Haisheng|H|;Chen|Wen-Xiong|WX|",
"chemical_list": null,
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.jneuroim.2021.577479",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0165-5728",
"issue": "352()",
"journal": "Journal of neuroimmunology",
"keywords": "Anti-NMDAR encephalitis; Children; Clinical features; Prognosis; Risk factor",
"medline_ta": "J Neuroimmunol",
"mesh_terms": "D060426:Anti-N-Methyl-D-Aspartate Receptor Encephalitis; D002648:Child; D002681:China; D005260:Female; D006801:Humans; D008297:Male",
"nlm_unique_id": "8109498",
"other_id": null,
"pages": "577479",
"pmc": null,
"pmid": "33486307",
"pubdate": "2021-03-15",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Pediatric anti-N-methyl-d-aspartate receptor encephalitis in southern China: Analysis of 111 cases.",
"title_normalized": "pediatric anti n methyl d aspartate receptor encephalitis in southern china analysis of 111 cases"
} | [
{
"companynumb": "CN-PFIZER INC-2021136783",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE SODIUM SUCCINATE"
},
"druga... |
{
"abstract": "Bullous pemphigoid is an autoimmune skin disease that results in formation of pruritic blisters. Most cases are treated with a combination of systemic and topical corticosteroids as well as other immunomodulatory drugs. Dupilumab is a fully human monoclonal antibody that acts as an antagonist against IL4Ra traditionally used in the treatment of atopic dermatitis. We present an 80-year-old man with moderate to severe bullous pemphigoid successfully treated with dupilumab.",
"affiliations": "Northeast Ohio Medical University, Rootstown, OH Trillium Creek Dermatology and Surgery Center, Medina, OH. mattsreedy@gmail.com.",
"authors": "Saleh|Maleck|M|;Reedy|Matthew|M|;Torok|Helen|H|;Weaver|Joshua|J|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D005938:Glucocorticoids; D053662:Interleukin-4 Receptor alpha Subunit; C582203:dupilumab; D011241:Prednisone",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1087-2108",
"issue": "27(4)",
"journal": "Dermatology online journal",
"keywords": null,
"medline_ta": "Dermatol Online J",
"mesh_terms": "D000369:Aged, 80 and over; D061067:Antibodies, Monoclonal, Humanized; D004351:Drug Resistance; D005938:Glucocorticoids; D006801:Humans; D053662:Interleukin-4 Receptor alpha Subunit; D008297:Male; D010391:Pemphigoid, Bullous; D011241:Prednisone",
"nlm_unique_id": "9610776",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33999579",
"pubdate": "2021-04-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Successful treatment of bullous pemphigoid with dupilumab: a case and brief review of the literature.",
"title_normalized": "successful treatment of bullous pemphigoid with dupilumab a case and brief review of the literature"
} | [
{
"companynumb": "US-TEVA-2021-US-1986971",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "3",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": null,
... |
{
"abstract": "We firstly report a postoperative hemodialysis patient who was co-administered with amiodarone and dexmedetomidine and developed severe bradycardia followed by cardiac arrest. A 79-year-old male patient underwent an amputation of the right lower extremity. The electrocardiogram of the patient showed a complete right bundle branch block with left anterior fascicular block before the anesthesia, and paroxysmal atrial tachycardia over 200 beats/min lasting 15 min was observed during surgery. After admission to the intensive care unit, the intensivist and the consultant cardiologist decided to treat tachycardia using amiodarone. The initial dosing of amiodarone and the maintenance infusion succeeded to decrease the heart rate. Approximately 2 h and a half after the start of dexmedetomidine infusion for sedation, the heart rate gradually declined and severe bradycardia suddenly followed by cardiac arrest was observed. Resuscitation was promptly initiated and the patient regained sinus rhythm without delay. In retrospective analysis, the monitoring record of the electrocardiogram revealed the marked atrioventricular conduction abnormalities. This is the first case report concerning a cardiac arrest induced by amiodarone and dexmedetomidine.",
"affiliations": "Department of Intensive Care Medicine, Tokyo Medical and Dental University Medical Hospital, M&D Tower 15th floor, 1-5-45 Yushima, Bunkyo-ku, 1138519 Tokyo Japan.;Department of Intensive Care Medicine, Tokyo Medical and Dental University Medical Hospital, M&D Tower 15th floor, 1-5-45 Yushima, Bunkyo-ku, 1138519 Tokyo Japan.;Department of Intensive Care Medicine, Tokyo Medical and Dental University Medical Hospital, M&D Tower 15th floor, 1-5-45 Yushima, Bunkyo-ku, 1138519 Tokyo Japan.;Department of Intensive Care Medicine, Tokyo Medical and Dental University Medical Hospital, M&D Tower 15th floor, 1-5-45 Yushima, Bunkyo-ku, 1138519 Tokyo Japan.;Department of Intensive Care Medicine, Tokyo Medical and Dental University Medical Hospital, M&D Tower 15th floor, 1-5-45 Yushima, Bunkyo-ku, 1138519 Tokyo Japan.;Department of Intensive Care Medicine, Tokyo Medical and Dental University Medical Hospital, M&D Tower 15th floor, 1-5-45 Yushima, Bunkyo-ku, 1138519 Tokyo Japan.;Department of Intensive Care Medicine, Tokyo Medical and Dental University Medical Hospital, M&D Tower 15th floor, 1-5-45 Yushima, Bunkyo-ku, 1138519 Tokyo Japan.;Department of Intensive Care Medicine, Tokyo Medical and Dental University Medical Hospital, M&D Tower 15th floor, 1-5-45 Yushima, Bunkyo-ku, 1138519 Tokyo Japan.",
"authors": "Ohmori|Takafumi|T|;Shiota|Nobuhiro|N|;Haramo|Akihiro|A|;Masuda|Takahiro|T|;Maruyama|Fumi|F|;Wakabayashi|Kenji|K|;Adachi|Yushi U|YU|;Nakazawa|Koichi|K|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s40560-015-0109-0",
"fulltext": "\n==== Front\nJ Intensive CareJ Intensive CareJournal of Intensive Care2052-0492BioMed Central London 10910.1186/s40560-015-0109-0Case ReportPost-operative cardiac arrest induced by co-administration of amiodarone and dexmedetomidine: a case report Ohmori Takafumi Shiota Nobuhiro Haramo Akihiro Masuda Takahiro Maruyama Fumi Wakabayashi Kenji Adachi Yushi U. +81358035959adachi.yushi@i.nagoya-u.jp Nakazawa Koichi Department of Intensive Care Medicine, Tokyo Medical and Dental University Medical Hospital, M&D Tower 15th floor, 1-5-45 Yushima, Bunkyo-ku, 1138519 Tokyo Japan 21 10 2015 21 10 2015 2015 3 4317 8 2015 13 10 2015 © Ohmori et al. 2015\nOpen AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.We firstly report a postoperative hemodialysis patient who was co-administered with amiodarone and dexmedetomidine and developed severe bradycardia followed by cardiac arrest. A 79-year-old male patient underwent an amputation of the right lower extremity. The electrocardiogram of the patient showed a complete right bundle branch block with left anterior fascicular block before the anesthesia, and paroxysmal atrial tachycardia over 200 beats/min lasting 15 min was observed during surgery. After admission to the intensive care unit, the intensivist and the consultant cardiologist decided to treat tachycardia using amiodarone. The initial dosing of amiodarone and the maintenance infusion succeeded to decrease the heart rate. Approximately 2 h and a half after the start of dexmedetomidine infusion for sedation, the heart rate gradually declined and severe bradycardia suddenly followed by cardiac arrest was observed. Resuscitation was promptly initiated and the patient regained sinus rhythm without delay. In retrospective analysis, the monitoring record of the electrocardiogram revealed the marked atrioventricular conduction abnormalities. This is the first case report concerning a cardiac arrest induced by amiodarone and dexmedetomidine.\n\nKeywords\nAmiodaroneDexmedetomidineCardiac arrestissue-copyright-statement© The Author(s) 2015\n==== Body\nBackground\nDexmedetomidine is one of well-known sedatives, and administration of dexmedetomidine has become a popular regimen in intensive care unit [1–3]. Dexmedetomidine has been considered as a preferable drug among intensivists because of it showing less respiratory and cardiovascular depression [4]. Recently, the application of dexmedetomidine in clinical settings is expanding in Japan and in western countries [1]. However, we previously reported that dexmedetomidine showed a fatal cardiovascular complication including cardiac arrest and reviewed the literature [5]. Now, we firstly present another patient who developed severe bradycardia followed by cardiac arrest induced by the co-administration of amiodarone and dexmedetomidine.\n\nCase presentation\nA 79-year-old male patient was transferred to our hospital for a scheduled amputation surgery of the right lower extremity. He had suffered diabetes and subsequent chronic renal insufficiency. The hemodialysis was introduced 9 years ago in other hospital. The chronic heart failure was pointed out, and the echocardiography demonstrated that the ejection fraction of the left ventricle was only 14 % at the preoperative visit. The history of coronary artery diseases was strongly suspected; however, the detailed information could not be obtained. His electrocardiogram showed sinus rhythm and a sign of complete right bundle branch block with left anterior fascicular block (Fig. 1) [6]. The heart rate was about 130 beats/min, and the QTc interval was 482 ms. The hemodialysis had continued three times a week, and other laboratory data was within normal limits. The patient had been admitted to another hospital, and the sign of arteriosclerosis obliterans was worsening with ischemic change. He was transferred to our hospital for the operation.Fig. 1 The preoperative electrocardiogram of the patient at admission to the hospital. Complete right bundle branch block with left anterior fascicular block was observed\n\n\n\nThe use of local anesthetics on the popliteal sciatic nerve block was planned. Using an ultrasound device, the nerve was identified, and the sufficient amount of analgesia was confirmed after the injection of 20 ml of 0.75 % ropivacaine and 20 ml of 2 % mepivacaine without any complications including paresthesia. Immediately after the beginning of surgery, the anesthesiologist administered propofol at a rate of 2 mg/kg/h; however, the blood pressure of the patient (94/60 mmHg) lowered to 62/42 mmHg, and the infusion was discontinued. During the anesthesia, sudden paroxysmal atrial tachycardia over 200 beats/min was observed. The tachycardia lasted approximately 15 min. The anesthesiologist started to prepare to administer an antiarrhythmic agent (detail was unknown), but the heart rate decreased before the intervention.\n\nThe patient was admitted to the intensive care unit after the anesthesia for observation. Approximately 2 h later, the heart rate of patient increased to 130–140 beats/min with atrial fibrillation. The intensivist and the consultant cardiologist decided to treat tachycardia with atrial fibrillation using amiodarone. The initial dosing of amiodarone (125 mg/30 min) was followed by fast maintenance dosing (50 mg/h). The heart rate decreased to approximately 100/min during the 2 h after the start of infusion. The infusion rate of amiodarone was reduced to 25 mg/h. After 5 h from the admission to the intensive care unit, infusion of dexmedetomidine was initiated for sedation at a rate of 0.3 μg/kg/h. The heart rate of the patient gradually decreased to 90 beats/min (Fig. 2, upper row). The QTc interval was prolonged to 526 ms. The monitoring electrocardiogram showed sinus rhythm with atrioventricular block.Fig. 2 \nUpper: The monitoring record of the electrocardiogram after the administration of amiodarone. Progressive atrioventricular block was observed. Lower: The record of the electrocardiogram immediately before the sinus arrest. The complete atrioventricular block with ectopic beat was observed\n\n\n\nThe dexmedetomidine infusion was continued for 2 h and a half. Then, the heart rate suddenly decreased to 40 beats/min. The complete atrioventricular block along with ectopic rhythm was followed by sinus arrest without escaped beat was occurred (Fig. 2, lower row). Cardiopulmonary resuscitation was promptly initiated. One milligram of epinephrine was administered three times during chest compression and emergency orotracheal intubation. Recovery of spontaneous circulation was observed within 8 min, and the patient regained sinus rhythm and appropriate blood pressure. Mechanical ventilation was started, and spontaneous respiration was observed. Continuous hemodiafiltration was applied for correcting volume abnormalities caused by resuscitation. Immediately after the resuscitation, blood gas analysis showed acidemia (pH 7.05) and hyperlactatemia (13.3 mmol/l); however, both abnormalities disappeared quickly. The infusion of dexmedetomidine was aborted.\n\nNext morning, the patient’s trachea was extubated without any neurological complications. At post-operative day 3, slight liver dysfunction was revealed by laboratory examinations; however, the general condition was improved. The patient was moved to the general ward at post-operative day 6 and discharged to the former hospital at day 10 in good course.\n\nThis is the first case report describing a patient presenting cardiac arrest induced by amiodarone and dexmedetomidine. Both drugs are considered as negative chronotropic agents and would suppress the cardiac conduction system. The additive or synergistic interaction on the impulse conduction was strongly suspected for the etiology of cardiac arrest. The preoperative electrocardiogram of the patient showed conduction abnormality, e.g., complete right bundle branch block with left anterior fascicle block, and the conduction dysfunction might be a risk factor for administration of the drugs [5]. We should pay more attention to the possibility of bradycardia; however, the heart rate of the patient showed a consistent tendency of tachycardia before the event.\n\nAmiodarone is one of the most popular antiarrhythmic drugs and widely used [7]. The applicable arrhythmia of amiodarone includes ventricular arrhythmia, e.g., ventricular premature beat, ventricular tachycardia, and supraventricular arrhythmia, e.g., tachycardia with atrial fibrillation. Although amiodarone showed a wide spectrum of antiarrhythmic effect, a variety of complications has been reported on the organs, including the heart, thyroid, liver, eyes, and lungs [8, 9]. The most common complication is bradycardia or conduction disturbance and sympathetic β blocking effect [10]. Kim et al. [10] reviewed that amiodarone-induced bradycardia and atrioventricular block were common adverse effects of amiodarone owing to the calcium channel blocking activity. Amiodarone also significantly prolongs ventricular repolarization, i.e., QTc interval [11], and the effect was consistent with the change in the electrocardiogram of the current patient.\n\nA fatal arrhythmia, ventricular tachycardia, is one of the most recommended conditions to administer amiodarone. We could not find any report describing that amiodarone itself induces cardiac arrest. Tsimogianni et al. [12] reported that administration of itraconazole provoked cardiac arrest in a patient administered with amiodarone. The patient received amiodarone for a treatment of ischemic stroke associated with atrial fibrillation. The administration of itraconazole induced hypotension and subsequent cardiac arrest. The same episode was observed 2 months later, and the antifungal treatment was changed to caspofungin.\n\nDexmedetomidine decreases heart rate. An incidence of severe bradycardia might be rare [13, 14]; however, we suspect that some of the cases with atrioventricular block induced by the administration of dexmedetomidine were overlooked [5, 15]. Moderate bradycardia with atrioventricular block would be misdiagnosed as a slow sinus rhythm in bipolar electrocardiography monitoring [16]. Usually, intensivists might pay attention to the value of the heart rate, not the pattern of the electrocardiogram. Dexmedetomidine reduces heart rate without a prolongation of the QT interval; thus, QTc interval is shortened [17, 18]. Although the apparent antiarrhythmic effect of dexmedetomidine in human is not known, a possibility of preventing the effect against ventricular tachycardia was demonstrated in animal experiment [19]. Recently, Narisawa et al. [20] demonstrated that dexmedetomidine sedation reduced the incidence of postoperative atrial fibrillation in cardiovascular surgery patients.\n\nConclusion\nAdministration of dexmedetomidine to a patient receiving negative chronotropic drugs should be re-considered, and further attention and intensive monitoring are absolutely required.\n\nConsent\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nCompeting interests\n\nThe authors declare that they have no competing interests.\n\nAuthors’ contributions\n\nTO, NS, AH, TM, FM, KW: provided medicine for the patient and wrote the draft of the manuscript. YUA: provided medicine for the patient and wrote the manuscript as a corresponding author. KN: provided medicine for the patient and wrote the manuscript. All authors read and approved the final manuscript.\n\nAuthors’ information\n\nTakafumi Ohmori: Assistant professor of Intensive Care Unit\n\nNobuhiro Shiota: Assistant professor of Intensive Care Unit\n\nAkihiro Haramo: Assistant professor of Intensive Care Unit\n\nTakahiro Masuda: Assistant professor of Intensive Care Unit\n\nFumi Maruyama: Assistant professor of Intensive Care Unit\n\nKenji Wakabayashi: Assistant professor, Department of Intensive Care Medicine\n\nYushi U. Adachi: Associate professor, Department of Intensive Care Medicine\n\nKoichi Nakazawa: Associate professor, Department of Intensive Care Medicine, Director of Intensive Care Unit\n==== Refs\nReferences\n1. Ozaki M Takeda J Tanaka K Shiokawa Y Nishi S Matsuda K Doi M Kakihana Y Fujino Y Takinami M Kawai M Safety and efficacy of dexmedetomidine for long-term sedation in critically ill patients J Anesth 2014 28 38 50 10.1007/s00540-013-1678-5 23912755 \n2. Adams R Brown GT Davidson M Fisher E Mathisen J Thomson G Webster NR Efficacy of dexmedetomidine compared with midazolam for sedation in adult intensive care patients: a systematic review Br J Anaesth 2013 111 703 10 10.1093/bja/aet194 23748199 \n3. Pandharipande PP Sanders RD Girard TD McGrane S Thompson JL Shintani AK Herr DL Maze M Ely EW MENDS investigators. Effect of dexmedetomidine versus lorazepam on outcome in patients with sepsis: an a priori-designed analysis of the MENDS randomized controlled trial Cirt Care 2010 14 R38 10.1186/cc8916 \n4. Keating GM Dexmedetomidine: a review of its use for sedation in the intensive care setting Drugs 2015 75 1119 30 10.1007/s40265-015-0419-5 26063213 \n5. Takata K Adachi YU Suzuki K Obata Y Sato S Nishiwaki K Dexmedetomidine-induced atrioventricular block followed by cardiac arrest during atrial pacing: a case report and review of the literature J Anesth 2014 28 116 20 10.1007/s00540-013-1676-7 23948748 \n6. Surawicz B Childers R Deal BJ Gettes LS Bailey JJ Gorgels A Hancock EW Josephson M Kligfield P Kors JA Macfarlane P Mason JW Mirvis DM Okin P Pahlm O Rautaharju PM van Herpen G Wagner GS Wellens H American Heart Association Electrocardiography and Arrhythmias Committee, Council on Clinical Cardiology American College of Cardiology Foundation Heart Rhythm Society AHA/ACCF/HRS recommendations for the standardization and interpretation of the electrocardiogram: part III: intraventricular conduction disturbances: a scientific statement from the American Heart Association Electrocardiography and Arrhythmias Committee, Council on Clinical Cardiology; the American College of Cardiology Foundation; and the Heart Rhythm Society: endorsed by the International Society for Computerized Electrocardiology Circulation 2009 119 e235 40 10.1161/CIRCULATIONAHA.108.191095 19228822 \n7. Kudenchuk PJ Brown SP Daya M Morrison LJ Grunau BE Rea T Aufderheide T Powell J Leroux B Vaillancourt C Larsen J Wittwer L Colella MR Stephens SW Gamber M Egan D Dorian P Resuscitation Outcomes Consortium Investigators Resuscitation Outcomes Consortium-Amiodarone, Lidocaine or Placebo Study (ROC-ALPS): rationale and methodology behind an out-of-hospital cardiac arrest antiarrhythmic drug trial Am Heart J 2014 167 653 9 10.1016/j.ahj.2014.02.010 24766974 \n8. Haffajee CI Love JC Alpert JS Asdourian GK Sloan KC Efficacy and safety of long-term amiodarone in treatment of cardiac arrhythmias: dosage experience Am Heart J 1983 106 935 43 10.1016/0002-8703(83)90019-4 6613840 \n9. Nademanee K Singh BN Hendrickson J Intarachot V Lopez B Feld G Cannom DS Weiss JL Amiodarone in refractory life-threatening ventricular arrhythmias Ann Intern Med 1983 98 577 84 10.7326/0003-4819-98-5-577 6846970 \n10. Kim HL Seo JB Chung WY Kim SH Kim MA Zo JH The incidence and predictors of overall adverse effects caused by low dose amiodarone in real-world clinical practice Korean J Intern Med 2014 29 586 96 \n11. Kotake Y, Kurita T, Akaiwa Y, Yasuoka R, Motoki K, Kobuke K, et al. Intravenous amiodarone homogeneously prolongs ventricular repolarization in patients with life-threatening ventricular tachyarrhythmia. J Cardiol. 2015;161–7.\n12. Tsimogianni AM, Andrianakis I, Betrosian A, Douzinas E. Cardiac arrest provoked by itraconazole and amiodarone interaction: a case report. J Med Case Rep. 2011;5:33.\n13. Shah AN Koneru J Nicoara A Goldfeder LB Thomas K Ehlert FA Dexmedetomidine related cardiac arrest in a patient with permanent pacemaker; a cautionary tale Pacing Clin Electrophysiol 2007 30 1158 60 10.1111/j.1540-8159.2007.00829.x 17725762 \n14. Bharati S Pal A Biswas C Biswas R Incidence of cardiac arrest increases with the indiscriminate use of dexmedetomidine: a case series and review of published case reports Acta Anaesthesiol Taiwan 2011 49 165 7 10.1016/j.aat.2011.11.010 22221692 \n15. Nagasaka Y Machino A Fujikake K Kawamoto E Wakamatsu M Cardiac arrest induced by dexmedetomidine Masui 2009 58 987 9 19702214 \n16. Aoyama Y Nakahara K Yoshida T Shioya Y Adachi Y Matsuda N Dexmedetomidine-induced atrioventricular block in a patient staying in intensive care unit Jpn J Clin Anesth 2015 39 653 4 \n17. Kato H, Krishna SG, Sebastian R, Smith K. Effect of dexmedetomidine on the QT interval in pediatric patients undergoing general anesthesia. J Anesth [Epub ahead of print].\n18. Kim HL Seo JB Chung WY Kim SH Kim MA Zo JH Effect of dexmedetomidine on the corrected QT and Tp-e intervals during spinal anesthesia Yonsei Med J 2014 55 517 22 10.3349/ymj.2014.55.2.517 24532526 \n19. Tsutsui K Hayami N Kunishima T Sugiura A Mikamo T Kanamori K Yamagishi N Yamagishi S Watanabe H Ajiki K Murakawa Y Dexmedetomidine and clonidine inhibit ventricular tachyarrhythmias in a rabbit model of acquired long QT syndrome Cir J 2012 76 2343 7 10.1253/circj.CJ-12-0171 \n20. Narisawa A Nakane M Kano T Momose N Onodera Y Akimoto R Kobayashi T Iwabuchi M Okada M Miura Y Kawamae K Dexmedetomidine sedation during the nighttime reduced the incidence of postoperative atrial fibrillation in cardiovascular surgery patients after tracheal extubation J Intensive Care 2015 3 26 10.1186/s40560-015-0092-5 26060574\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2052-0492",
"issue": "3()",
"journal": "Journal of intensive care",
"keywords": "Amiodarone; Cardiac arrest; Dexmedetomidine",
"medline_ta": "J Intensive Care",
"mesh_terms": null,
"nlm_unique_id": "101627304",
"other_id": null,
"pages": "43",
"pmc": null,
"pmid": "26500779",
"pubdate": "2015",
"publication_types": "D002363:Case Reports",
"references": "25228834;26063213;6846970;24532526;23912755;23748199;26060574;25468767;20233428;6613840;17725762;22786471;26238761;21801420;23948748;19702214;24766974;22221692;19228822",
"title": "Post-operative cardiac arrest induced by co-administration of amiodarone and dexmedetomidine: a case report.",
"title_normalized": "post operative cardiac arrest induced by co administration of amiodarone and dexmedetomidine a case report"
} | [
{
"companynumb": "JP-MYLANLABS-2016M1056587",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "AMIODARONE"
},
"drugadditional": "3",
... |
{
"abstract": "Adverse drug reactions (ADRs) are an important cause of hospital admissions. Insufficient data are available about the frequency and characteristics of ADR-related emergency readmissions in Switzerland. The aim of this retrospective study was to characterise ADRs related to short-term emergency readmissions in a large Swiss University Hospital and to assess their reporting frequency.\n\n\n\nElectronic records of all patients discharged from the University Hospital Bern within a 12-month period (1 January to 31 December 2012) and emergency readmission within 30 calendar days were reviewed. Case inclusion required a known ADR. Cases with intentional overdosing, lack of compliance or insufficient documentation were excluded. Identified ADR-related readmission cases were searched in the Swiss ADR reporting system to assess reporting rate.\n\n\n\nThere were 1294 emergency readmissions among the 4792 readmissions (14% of all admissions) within 30 days after discharge. We identified 270 cases of ADR-related readmissions, corresponding to 21% of emergency readmissions and 6% of all readmissions within 30 days. The most frequent ADRs were gastrointestinal disorders (26%), infections and infestations (19%), and nervous system disorders (10%). The most frequent drug classes leading to ADRs were antineoplastic/immunomodulating (35%) and antithrombotic agents (25%). Only 8 (3%) of the 270 cases were reported to the Swiss ADR reporting system.\n\n\n\nADR-related readmissions constituted a considerable part of short-term emergency readmissions. Despite being a relevant cause for rehospitalisation, only a minority of the ADRs were reported to the regulatory authorities. Strategies to prevent ADR-related readmissions and to improve reporting rates are needed.",
"affiliations": "Clinical Pharmacology and Toxicology, Department of General Internal Medicine, Inselspital, Bern University Hospital, University of Bern, Switzerland; Institute of Pharmacology, University of Bern, Switzerland.;Department of General Internal Medicine, Inselspital, Bern University Hospital, University of Bern, Switzerland.;Clinical Pharmacology and Toxicology, Department of General Internal Medicine, Inselspital, Bern University Hospital, University of Bern, Switzerland / Institute of Pharmacology, University of Bern, Switzerland.;Internal Medicine, Lindenhofspital, Bern, Switzerland.;Department of Emergency Medicine, Inselspital, University Hospital Bern, University of Bern, Switzerland.;Clinical Pharmacology and Toxicology, University Hospital Basel, Switzerland.;Clinical Pharmacology and Toxicology, Department of General Internal Medicine, Inselspital, Bern University Hospital, University of Bern, Switzerland / Institute of Pharmacology, University of Bern, Switzerland.",
"authors": "Banholzer|Sarah|S|;Dunkelmann|Lea|L|;Haschke|Manuel|M|;Derungs|Adrian|A|;Exadaktylos|Aristomenis|A|;Krähenbühl|Stephan|S|;Liakoni|Evangelia|E|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0036-7672",
"issue": "151()",
"journal": "Swiss medical weekly",
"keywords": null,
"medline_ta": "Swiss Med Wkly",
"mesh_terms": "D016907:Adverse Drug Reaction Reporting Systems; D064420:Drug-Related Side Effects and Adverse Reactions; D004636:Emergency Service, Hospital; D006760:Hospitalization; D006801:Humans; D010359:Patient Readmission; D012189:Retrospective Studies",
"nlm_unique_id": "100970884",
"other_id": null,
"pages": "w20400",
"pmc": null,
"pmid": "33516159",
"pubdate": "2021-01-18",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Retrospective analysis of adverse drug reactions leading to short-term emergency hospital readmission.",
"title_normalized": "retrospective analysis of adverse drug reactions leading to short term emergency hospital readmission"
} | [
{
"companynumb": "CH-ALLERGAN-2124446US",
"fulfillexpeditecriteria": "1",
"occurcountry": "CH",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "AZATHIOPRINE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nRisperidone long-acting injection (RLAI) is increasingly being switched to paliperidone palmitate (PP) because of several benefits. However, this switching is not always successful.\n\n\nMETHODS\nWe examined patient profiles following discontinuation of PP after switching from RLAI. We collected the electronic records of 24 patients with schizophrenia who had switched from RLAI to PP treatment at our hospital between November 2013 and March 2014. Twelve patients continued PP injection for over 1 year (PP-continuers), the other 12 patients discontinued within 1 year (PP-discontinuers), and both groups were followed up until December 31, 2014.\n\n\nRESULTS\nPP-discontinuers had significantly shorter RLAI-administration period (mean 73.1 ± 59.0 weeks versus 148.5 ± 75.0 weeks), and lower chlorpromazine (CP) equivalent mean doses (mean 553.5 ± 251.0 mg versus 1002.5 ± 529.3 mg) compared with PP-continuers. The CP equivalent mean dose of PP-discontinuers had increased at the time of discontinuation and their social status became significantly worse. Six PP-discontinuers (50%) re-switched to RLAI, and their social status was not significantly worse at the end of the observation period.\n\n\nCONCLUSIONS\nOn switching from RLAI to PP, we need to consider that some patients have had a shorter RLAI-administration period and may require lower amounts of antipsychotics.",
"affiliations": "Dr. Watanabe, MD, Psychiatrist, Department of Psychiatry, Gifu Hospital. 3-13-6 Hinohigashi, Gifu City, Gifu, Japan. Dr. Atsurou Yamada, MD, Psychiatrist, Department of Psychiatry, Gifu Hospital. 3-13-6 Hinohigashi, Gifu City, Gifu, and Department of Psychiatry, Nagoya City University Graduate School of Medical Sciences, Kawasumi 1, Mizuho-Chou-Aza, Mizuho-Ku, Nagoya City, Aichi, Japan.;Dr. Watanabe, MD, Psychiatrist, Department of Psychiatry, Gifu Hospital. 3-13-6 Hinohigashi, Gifu City, Gifu, Japan. Dr. Atsurou Yamada, MD, Psychiatrist, Department of Psychiatry, Gifu Hospital. 3-13-6 Hinohigashi, Gifu City, Gifu, and Department of Psychiatry, Nagoya City University Graduate School of Medical Sciences, Kawasumi 1, Mizuho-Chou-Aza, Mizuho-Ku, Nagoya City, Aichi, Japan.",
"authors": "Watanabe|Takafumi|T|;Yamada|Atsurou|A|",
"chemical_list": "D014150:Antipsychotic Agents; D003692:Delayed-Action Preparations; D018967:Risperidone; D000068882:Paliperidone Palmitate",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0048-5764",
"issue": "46(2)",
"journal": "Psychopharmacology bulletin",
"keywords": "antipsychotics; discontinuation; long-acting injectable; paliperidone palmitate; risperidone; successful switching",
"medline_ta": "Psychopharmacol Bull",
"mesh_terms": "D014150:Antipsychotic Agents; D003692:Delayed-Action Preparations; D006801:Humans; D000068882:Paliperidone Palmitate; D012189:Retrospective Studies; D018967:Risperidone; D012559:Schizophrenia",
"nlm_unique_id": "0101123",
"other_id": null,
"pages": "42-52",
"pmc": null,
"pmid": "27738379",
"pubdate": "2016-08-15",
"publication_types": "D016428:Journal Article",
"references": "24117209;24419004;25882381;24113628;22311537;21777507;21092748;25470090;25730525;23446197",
"title": "Effects of Discontinuation of Paliperidone Long-Acting Injectable After Switching from Risperidone Long-Acting Injectable Switching.",
"title_normalized": "effects of discontinuation of paliperidone long acting injectable after switching from risperidone long acting injectable switching"
} | [
{
"companynumb": "JP-JNJFOC-20161025087",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PALIPERIDONE PALMITATE"
},
"drugadditional": null... |
{
"abstract": "The authors report an interesting coincidental unearthing by 18F-fluorodeoxyglucose positron emission tomography/computed tomography (18F-FDG PET/CT) of a potentially serious medical condition of emphysematous pyelonephritis in a case of nasopharyngeal carcinoma. The management by conservative ureteric stenting and antibiotics was done with gratifying clinical outcome.",
"affiliations": "Department of Radio Diagnosis and Nuclear Medicine, Omega Hospitals, Banjara Hills, Hyderabad, India.;Department of Radio Diagnosis and Nuclear Medicine, Omega Hospitals, Banjara Hills, Hyderabad, India.;Department of Radio Diagnosis and Nuclear Medicine, Omega Hospitals, Banjara Hills, Hyderabad, India.;Department of Radio Diagnosis and Nuclear Medicine, Omega Hospitals, Banjara Hills, Hyderabad, India.;Department of Medical Oncology, Omega Hospitals, Banjara Hills, Hyderabad, India.;Department of Radiation Oncology, Omega Hospitals, Banjara Hills, Hyderabad, India.;Department of Surgical Oncology, Omega Hospitals, Banjara Hills, Hyderabad, India.;Department of Radio Diagnosis and Nuclear Medicine, Omega Hospitals, Banjara Hills, Hyderabad, India.",
"authors": "Pathapati|Deepti|D|;Shinkar|Pawan Gulabrao|PG|;Kumar|Satya Awadhesh|SA|;Jha|||;Dattatreya|Palanki Satya|PS|;Chigurupati|Namrata|N|;Chigurupati|Mohana Vamsy|MV|;Rao|Vatturi Venkata Satya Prabhakar|VV|",
"chemical_list": null,
"country": "India",
"delete": false,
"doi": "10.4103/0972-3919.198477",
"fulltext": "\n==== Front\nIndian J Nucl MedIndian J Nucl MedIJNMIndian Journal of Nuclear Medicine : IJNM : The Official Journal of the Society of Nuclear Medicine, India0972-39190974-0244Medknow Publications & Media Pvt Ltd India IJNM-32-4210.4103/0972-3919.198477Case ReportAsymptomatic Emphysematous Pyelonephritis - Positron Emission Tomography Computerized Tomography Aided Diagnostic and Therapeutic Elucidation Pathapati Deepti Shinkar Pawan Gulabrao kumar Satya Awadhesh Jha Dattatreya Palanki Satya Dr1Chigurupati Namrata 2Chigurupati Mohana Vamsy 3Rao Vatturi Venkata Satya Prabhakar Department of Radio Diagnosis and Nuclear Medicine, Omega Hospitals, Banjara Hills, Hyderabad, India1 Department of Medical Oncology, Omega Hospitals, Banjara Hills, Hyderabad, India2 Department of Radiation Oncology, Omega Hospitals, Banjara Hills, Hyderabad, India3 Department of Surgical Oncology, Omega Hospitals, Banjara Hills, Hyderabad, IndiaAddress for corresponding: Dr. V. V. S. Prabhakar Rao, Department of Nuclear Medicine and PET CT, OMEGA Hospitals, MLA Colony, Road No 12, Banjara Hills, Hyderabad, Andhra Pradesh, India E-mail: vvs_prabhakar@yahoo.co.ukJan-Mar 2017 32 1 42 45 Copyright: © 2017 Indian Journal of Nuclear Medicine2017This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.The authors report an interesting coincidental unearthing by 18F-fluorodeoxyglucose positron emission tomography/computed tomography (18F-FDG PET/CT) of a potentially serious medical condition of emphysematous pyelonephritis in a case of nasopharyngeal carcinoma. The management by conservative ureteric stenting and antibiotics was done with gratifying clinical outcome.\n\nEmphysematous pyelonephritisDouble J Stent Neprectomy\n==== Body\nIntroduction\nEmphysematous pyelonephritis, a less frequently noticed acute clinical condition, is invariably associated with uncontrolled diabetes or immune suppression. Infective renal mass with gas lucencies is the hall mark with associated pyrexial and septic state. Asymptomatic incidental detection of the condition during follow up (18F-FDG PET/CT) study in a treated case of nasopharyngeal carcinoma, and its further management by nonradical noninvasive treatment modality based on 18F-FDG PET/CT findings, is the unique hall mark in the present case.\n\nCase Report\nA 65-year old female of histopathologically proven primary nasopharyngeal carcinoma was treated with concurrent chemo radiation of 60 Gy radiotherapy in 30 fractions of 2 Gy each, along with weekly Cisplatin. Except for well controlled type 2 diabetes on oral hypoglycemic drugs, the patient had no other co morbid conditions, and was symptom free after completion of the radical treatment. The clinical examination revealed no evidence of disease at the local site and no loco regional lymphadenopathy. Hematological, biochemical and metabolic parameters were within normal limits. F18 FDG PET/ CT was performed for the end of treatment evaluation and compared with the pretreatment 18F-FDG PET/CT. Present study revealed no abnormal morphologic or metabolic focus at the primary site of nasopharynx and no loco regional adenopathy either morphologic or metabolic. Interestingly, in the abdominal sections, a large heterogeneous peripherally enhancing hypodense 85x83x80 mm mass with peripheral FDG avidity and central void lesion containing multiple pockets of air lucencies within, was seen in the postero inferior aspect of right kidney [Figure 1a] within feromedial infiltration into the adjoining right psoas muscle [Figure 1b]. The free gas lucency was also noted in non dependent part of the urinary bladder and hypodense debris amidst the contrast filled bladder at the right vescico ureteric junction [Figure 2]. The findings were characteristic of emphysematous pyelonephritis. Ultrasonography (USG) revealed classical echogenic scattered echoes typical of free gas in a mixed echoic mass corresponding to the PET CT outlined lesion in the right kidney [Figure 3]. The initial PET CT done prior to initiation of treatment was reviewed to see the renal morphology, which showed both kidneys of normal morphology and excretion [Figure 4]. In view of the potentially serious nature of the condition and the patient being absolutely symptom free and afebrile, a detailed retrospective history was taken, which revealed an episode of febrile neutropenia during the fourth cycle of chemotherapy. It was managed conservatively and the patient was afebrile since then. Despite the present symptom free state, since the condition can flare up any time, a curative treatment was planned whenever immune status was compromised. The conventional options were nephrectomy and percutaneous drainage, the former radical surgery and the latter invasive. In view of the evidence of free gas in the bladder and the debris seen at the vescicoureteric junction, there was an ample objective proof of the abscess communicating with collecting system. Hence, a Double J (DJ) stent placement to facilitate better drainage of infective material into the bladder alongwith broad spectrum antibiotics was endeavored before embarking on more invasive and radical measures. The patient was followed up after three weeks with an ultrasonogarphy, which showed gratifying near complete disappearance of the abscess, and return of the renal contour to normal and disappearance of all the gas in the kidney and bladder as well [Figure 5]. Plain CT and topogram of abdomen subsequently revealed disappearance of free gas lucencies in the right renal region with DJ stent in situ [Figure 6a] with resolution of the emphysematous abscess, urinary bladder gas and debris [Figure 6b]. The patient on follow up was disease free from both the primary nasopharyngeal carcinoma and emphysematous pyelonephritis.\n\nFigure 1 (a) Axial PET/ CT images of abdomen demonstratinghypodense abscess cavity in the postero inferior part ofright kidney with multiple pockets of air lucencies within (arrow) and FDG avid uptake in the peripheral enhancingpart(dotted arrow).\n\nFigure 1 (b) Coronal PET/CT sections showing extension and infiltration inferomedially into adjacent right psoas muscle (arrow)\n\nFigure 2 Axial contrast CT section ofurinary bladder showing a hypodense filling defect at the right vesico ureteric junction(solid arrow) and freegas lucencies in the anterior aspectof urinary bladder(dotted arrow)\n\nFigure 3 Ultrasound abdomen outlining enlarged right kidney with ill defined heterogeneous mass in postero inferior portion (arrow) containing dirty echogenic foci of air (dotted arrow).\n\nFigure 4 Pre treatment staging coronal PET/CT images showing normal morphology of both kidneys.\n\nFigure 5 Follow up ultrasonography showing complete disappearance of the abscess and return of the renal contour to normal.\n\nFigure 6 (a) Post stenting CT topogram showing disappearance of free gas lucencies in the right renal region with DJ stent in situ.\n\nFigure 6 (b) Plain CT abdomen showing resolution of the emphysematous abscess and the urinary bladder gas and debris.\n\nDiscussion\nEmphysematous pyelonephritis is a rare life threatening severe infective condition of the renal parenchyma causing accumulation of free gas in the renal soft tissues.[1] The patients are typically very ill with sepsis and circulatory failure. The factors that predispose persons with diabetes include uncontrolled diabetic state, high levels of glycosylated hemoglobin, and impaired host immune mechanisms.[2] Diabetic microangiopathy may also contribute to the slow transport of catabolic products and may lead to accumulation of gas. Transplanted kidney is also susceptible to this condition because of associated high-risk factors in the recipient, such as diabetes and immunosuppressant. Literature is replete with emphysematous pyelonephritis reported with various forms of presentation. Nevertheless, there has been no subjective or objective revelation of such serious condition and the condition of patient being symptom less, all through the illness.[3]\n\nThe management, traditionally being aggressive and surgery in the form of nephrectomy, is considered mandatory. A conservative alternative to radical surgery is the combination of antibiotics and drainage.[45] The drainage procedure has traditionally been percutaneous drainage, which is invasive.[6] The highlight of the case is the management with non invasive endoureteric DJ stenting and antibiotics with effective outcome confirmed on follow up USG and CT.[67] The decision for DJ stenting was impelled by the PET CT evidence of free gas in the urinary bladder and debris seen in the bladder. DJ stent ensures a constantly open vesicoureteric junction. The drainage of the infected debris is facilitated not only through the DJ stent lumen, but also through the space between the stent and the ureteric wall.[8] Another highlight of the case is the incidental nature of detection of such a serious condition, which was clinically unnoticeable due to clinical symptoms conspicuous by their absence or any evidence of systemic manifestations of fulminant infection such as fever, chills rigors, urinary complaints or uncontrolled diabetes. The incriminating causative factor unearthed is the possible transient chemotherapy induced immune suppression as evidenced by an episode of febrile neutropaenia during fourth cycle of chemotherapy. The patient having contracted the infection remained asymptomatic till its detection during follow up PET\n\nCT study.\n\nConclusion\nA potentially serious clinical entity of emphysematous pyelonephritis has serendipitously been discovered and treated in a case of nasopharyngeal carcinoma. Non invasive treatment modality with DJ stenting and antibiotics was suggested based on PET CT findings of free gas not only in the kidney but also in the urinary bladder. The favorable clinical outcome and salvaging the kidney has been achieved with out recourse to radical nephrectomy or invasive nephrostomy.\n\n\nFinancial support and sponsorship\nNil\n\nConflicts of interest\nThere are no conflicts of interest.\n==== Refs\n1 Ho KMT Sole GM Pneumaturia due to gas producing E.coli and urinary stasis Br J Urol 1994 73 588 9 8012788 \n2 Pontin AR Barnes RD Joffe J Kahn D Emphysematous pyelonephritis in diabetic patients Br J Urol 1995 75 71 4 7850302 \n3 Kumar VS Lakshmi AY Emphysematous pyelonephritis Indian J Nephrol 2004 14 192 94 \n4 Aswathaman K Gopalakrishnan G Gnanaraj L Chacko NK Kekre NS Devasia A Emphysematous pyelonephritis: Outcome of conservative management Urology 2008 71 1007 9 18372018 \n5 Bhat RA Khan I Palla N Mir T Emphysematous pyelonephritis: Outcome with conservative management Indian J Nephrol 2013 23 444 7 24339524 \n6 Chen MT Huang CN Chou YH Huang CH Chiang CP Liu GC Percutaneous drainage in the treatment of Emphysematous pyelonephritis: 10 year experience J Urol 1997 157 1569 73 9112478 \n7 Dutta D Shivaprasad KS Kumar M Biswas D Ghosh S Mukhopadhyay P Conservative management of severe bilateral emphysematous pyelonephritis: Case series and review of literature Indian J Endocrinol Metab 2013 17 S329 32 24251204 \n8 Khaira A Gupta A Rana DS Gupta A Bhalla A Khullar D Retrospective analysisof clinical profile prognostic factors and outcomes of 19 patients of emphysematous pyelonephritis Int Urol Nephrol 2009 41 959 66 19404766\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "0974-0244",
"issue": "32(1)",
"journal": "Indian journal of nuclear medicine : IJNM : the official journal of the Society of Nuclear Medicine, India",
"keywords": "Double J Stent Neprectomy; Emphysematous pyelonephritis",
"medline_ta": "Indian J Nucl Med",
"mesh_terms": null,
"nlm_unique_id": "8901274",
"other_id": null,
"pages": "42-45",
"pmc": null,
"pmid": "28242985",
"pubdate": "2017",
"publication_types": "D002363:Case Reports",
"references": "19404766;18372018;8012788;9112478;7850302;24339524;24251204",
"title": "Asymptomatic Emphysematous Pyelonephritis - Positron Emission Tomography Computerized Tomography Aided Diagnostic and Therapeutic Elucidation.",
"title_normalized": "asymptomatic emphysematous pyelonephritis positron emission tomography computerized tomography aided diagnostic and therapeutic elucidation"
} | [
{
"companynumb": "IN-ACCORD-049183",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CISPLATIN"
},
"drugadditional": "3",
"drugad... |
{
"abstract": "Pediatric exposure to prazosin is unusual because it is most commonly indicated for the treatment of hypertension. Prazosin's increase in popularity as a treatment for posttraumatic stress disorder makes it important for emergency physicians to be aware of how to manage potential toxic ingestion because of prazosin overdose.\n\n\n\nA 16-year-old, 76-kg female presented after ingesting 110 mg of prazosin, 209.3 g of acetaminophen, and 55 g of naproxen. She was admitted to the pediatric intensive care unit for rapidly deteriorating hypotension (lowest blood pressure 47/19 mm Hg) refractory to aggressive fluid resuscitation and infusions of epinephrine and norepinephrine each at 0.5 mcg/kg/min. Stabilization of blood pressure was eventually achieved, and associated with use of a vasopressin infusion of 0.004 units/kg/min. WHY SHOULD AN EMERGENCY PHYSICIAN BE AWARE OF THIS?: Because of the increasing exposure of children to prazosin, clinicians should be aware of the pharmacology behind alpha-1 antagonist overdose and consider treatment options, such as vasopressin, when hypotension is resistant to standard fluid and catecholamine therapy.",
"affiliations": "Department of Pediatrics at Schulich School of Medicine, University of Western Ontario, and the Children's Health Research Institute, Children's Hospital at London Health Sciences Centre, London, Ontario, Canada.;Department of Pediatrics at Schulich School of Medicine, University of Western Ontario, and the Children's Health Research Institute, Children's Hospital at London Health Sciences Centre, London, Ontario, Canada.;Department of Pediatrics, McMaster University, Hamilton, Ontario, Canada.;Department of Pediatrics at Schulich School of Medicine, University of Western Ontario, and the Children's Health Research Institute, Children's Hospital at London Health Sciences Centre, London, Ontario, Canada.",
"authors": "Anderson|Cory|C|;Lynch|Timothy|T|;Gupta|Ronish|R|;Lim|Rodrick K|RK|",
"chemical_list": "D018712:Analgesics, Non-Narcotic; D000894:Anti-Inflammatory Agents, Non-Steroidal; D000959:Antihypertensive Agents; D000082:Acetaminophen; D009288:Naproxen; D011224:Prazosin",
"country": "United States",
"delete": false,
"doi": "10.1016/j.jemermed.2018.09.015",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0736-4679",
"issue": "55(6)",
"journal": "The Journal of emergency medicine",
"keywords": "alpha-1 antagonist; alpha-1 blockade; hypotension; overdose; prazosin; refractory hypotension; vasopressin",
"medline_ta": "J Emerg Med",
"mesh_terms": "D000082:Acetaminophen; D000293:Adolescent; D018712:Analgesics, Non-Narcotic; D000894:Anti-Inflammatory Agents, Non-Steroidal; D000959:Antihypertensive Agents; D062787:Drug Overdose; D005260:Female; D006801:Humans; D007022:Hypotension; D009288:Naproxen; D011224:Prazosin; D013406:Suicide, Attempted",
"nlm_unique_id": "8412174",
"other_id": null,
"pages": "e141-e145",
"pmc": null,
"pmid": "30287134",
"pubdate": "2018-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Refractory Hypotension Caused by Prazosin Overdose Combined With Acetaminophen and Naproxen Toxicity: A Case Report and Review of the Literature.",
"title_normalized": "refractory hypotension caused by prazosin overdose combined with acetaminophen and naproxen toxicity a case report and review of the literature"
} | [
{
"companynumb": "CA-MYLANLABS-2018M1079659",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "EPINEPHRINE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nHyperkalemia secondary to beta-adrenergic receptor blockade occurs in 1-5% of patients and is likely to develop with non-cardio-selective beta-blockers.\n\n\nMETHODS\nWe have described hyperkalemia in a patient with angina pectoris receiving propranolol, clinically manifested as weakness, tightness behind the sternum and numbness in the limbs. Laboratory tests showed hyperkalemia (6.6 mmol/L), peaked T wave and a corrected QT interval of 510 ms. After discontinuation of propranolol, decline in potassium level, normalisation of electrocardiographic changes and clinical improvement were achieved. Causal relationship of drug related hyperkalemia has been confirmed as probable/likely according to Naranjo Adverse Drug Reaction Probability Score of 7 and the World Health Organization Uppsala Monitoring Centre Probability Scale.\n\n\nCONCLUSIONS\nHyperkalemia can be unpredictable and life-threatening complication of propranolol or a non-selective adrenergic beta blocker treatment, and requires timely identification of cause and implementation of therapeutic measures.",
"affiliations": null,
"authors": "Mandić|Danijela|D|;Nezić|Lana|L|;Skrbić|Ranko|R|",
"chemical_list": "D000319:Adrenergic beta-Antagonists; D011433:Propranolol",
"country": "Serbia",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0025-8105",
"issue": "67(5-6)",
"journal": "Medicinski pregled",
"keywords": null,
"medline_ta": "Med Pregl",
"mesh_terms": "D000319:Adrenergic beta-Antagonists; D000787:Angina Pectoris; D005260:Female; D006801:Humans; D006947:Hyperkalemia; D008875:Middle Aged; D011433:Propranolol",
"nlm_unique_id": "2985249R",
"other_id": null,
"pages": "181-4",
"pmc": null,
"pmid": "25033579",
"pubdate": "2014",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Severe hyperkalemia induced by propranolol.",
"title_normalized": "severe hyperkalemia induced by propranolol"
} | [
{
"companynumb": "BA-IMPAX LABORATORIES, INC-2017-IPXL-00308",
"fulfillexpeditecriteria": "1",
"occurcountry": "BA",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CALCIUM"
},
"drugadditional... |
{
"abstract": "Roux-en-Y gastric bypass (RYGB) is thought to reduce calcium absorption from the gut. Here, we report the case of a patient with a RYGB, who developed primary hypoparathyroidism after a total thyroidectomy, leading to recalcitrant hypocalcaemia. Despite aggressive oral calcium and calcitriol supplementation, she remained hypocalcaemic and required intravenous (IV) calcium supplementation to control her symptoms, and to keep calcium serum levels within an acceptable range. Teriparatide treatment improved calcium levels marginally. This treatment, however, was poorly tolerated and ultimately stopped by the patient. As a last resort, reversal of RYGB was performed to improve calcium absorption from the gut. Unfortunately, IV calcium supplementation remained necessary. This case illustrates that the reversal of RYGB is not always a guarantee for success in managing recalcitrant hypocalcaemia.",
"affiliations": "Department of Chronic diseases, Metabolism & Ageing (CHROMETA), Clinical and Experimental Endocrinology, KU Leuven, O&N1 Herestraat 49 - box 902, 3000, Leuven, Belgium. katrien.corbeels@kuleuven.be.;Department of Chronic diseases, Metabolism & Ageing (CHROMETA), Clinical and Experimental Endocrinology, KU Leuven, O&N1 Herestraat 49 - box 902, 3000, Leuven, Belgium.;Department of Chronic diseases, Metabolism & Ageing (CHROMETA), Clinical and Experimental Endocrinology, KU Leuven, O&N1 Herestraat 49 - box 902, 3000, Leuven, Belgium.;Department of Chronic diseases, Metabolism & Ageing (CHROMETA), Clinical and Experimental Endocrinology, KU Leuven, O&N1 Herestraat 49 - box 902, 3000, Leuven, Belgium.;Department of Chronic diseases, Metabolism & Ageing (CHROMETA), Clinical and Experimental Endocrinology, KU Leuven, O&N1 Herestraat 49 - box 902, 3000, Leuven, Belgium.;Department of Endocrinology, Coimbra Hospital and University Centre (CHUC), Coimbra, Portugal.;Department of Translational Research in Gastrointestinal Disorders (TARGID), KU Leuven, Leuven, Belgium.;Department of Chronic diseases, Metabolism & Ageing (CHROMETA), Clinical and Experimental Endocrinology, KU Leuven, O&N1 Herestraat 49 - box 902, 3000, Leuven, Belgium.;Department of Chronic diseases, Metabolism & Ageing (CHROMETA), Clinical and Experimental Endocrinology, KU Leuven, O&N1 Herestraat 49 - box 902, 3000, Leuven, Belgium.;Department of Chronic diseases, Metabolism & Ageing (CHROMETA), Clinical and Experimental Endocrinology, KU Leuven, O&N1 Herestraat 49 - box 902, 3000, Leuven, Belgium.;Department of Chronic diseases, Metabolism & Ageing (CHROMETA), Clinical and Experimental Endocrinology, KU Leuven, O&N1 Herestraat 49 - box 902, 3000, Leuven, Belgium.",
"authors": "Corbeels|Katrien|K|http://orcid.org/0000-0001-9494-1650;Steenackers|Nele|N|;Lannoo|Matthias|M|;Mertens|Ann|A|;Deleus|Ellen|E|;Cunha|Nelson|N|;Sinonquel|Pieter|P|;Matthys|Christophe|C|;Meulemans|Ann|A|;Vangoitsenhoven|Roman|R|;Van der Schueren|Bart|B|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1007/s11695-020-04903-8",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0960-8923",
"issue": "30(12)",
"journal": "Obesity surgery",
"keywords": "Bariatric surgery; Calcium; Parathyroid hormone; Roux-en-Y gastric bypass; Thyroidectomy",
"medline_ta": "Obes Surg",
"mesh_terms": "D005260:Female; D015390:Gastric Bypass; D006801:Humans; D006996:Hypocalcemia; D007011:Hypoparathyroidism; D009767:Obesity, Morbid; D013965:Thyroidectomy",
"nlm_unique_id": "9106714",
"other_id": null,
"pages": "5150-5152",
"pmc": null,
"pmid": "32770385",
"pubdate": "2020-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Reversal of Roux-en-Y Gastric Bypass Fails to Facilitate the Management of Recalcitrant Hypocalcaemia Caused by Primary Hypoparathyroidism.",
"title_normalized": "reversal of roux en y gastric bypass fails to facilitate the management of recalcitrant hypocalcaemia caused by primary hypoparathyroidism"
} | [
{
"companynumb": "BE-SUN PHARMACEUTICAL INDUSTRIES LTD-2021RR-298712",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CALCIUM GLUCONATE"
},
... |
{
"abstract": "A 50-year-old woman was referred to the clinic reporting oral discomfort during the previous month and plaques of a white removable slough. Diagnosis of pseudomembranous oral candidiasis was clinically confirmed. When the tongue and palatal mucosa were wiped with gauze, the soft yellowish-white slough detached revealing the erythematous surface beneath. The patient also presented paranoid schizophrenia and severe depression, pulmonary emphysema, and two vertebral hernias. She was a smoker (10 cigarettes per day) with xerostomia that was being treated with: bupropion, reboxetine, quetiapine, trazadone clotiapine, pregabalin, fentanyl (patches), and alprazolam. To minimize the risk of potential drug interactions, a mouthwash containing 0.05% chlorhexidine + 0.05% cetylpyridinium chloride was prescribed three times a day for two weeks. At the end of the two weeks, the candidiasis had abated.",
"affiliations": "Department of Medically Compromised Patients in Dentistry, School of Dentistry, University of Granada, Granada, Spain. ggomez@ugr.es.",
"authors": "Gómez-Moreno|G|G|;Valerón-Rodríguez|F|F|",
"chemical_list": null,
"country": "Italy",
"delete": false,
"doi": "10.26355/eurrev_202109_26790",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1128-3602",
"issue": "25(18)",
"journal": "European review for medical and pharmacological sciences",
"keywords": null,
"medline_ta": "Eur Rev Med Pharmacol Sci",
"mesh_terms": null,
"nlm_unique_id": "9717360",
"other_id": null,
"pages": "5725-5728",
"pmc": null,
"pmid": "34604963",
"pubdate": "2021-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Pseudomembranous oral candidiasis resolved with a mouthwash containing 0.05% chlorhexidine + 0.05% cetylpyridinium chloride.",
"title_normalized": "pseudomembranous oral candidiasis resolved with a mouthwash containing 0 05 chlorhexidine 0 05 cetylpyridinium chloride"
} | [
{
"companynumb": "ES-STADA-235537",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ALPRAZOLAM"
},
"drugadditional": "3",
"drugad... |
{
"abstract": "We describe an 18-year-old male patient with myoclonic astatic epilepsy (MAE), moderate to severe intellectual disability, behavioural problems, several dysmorphisms and a 1.2-Mb de novo deletion on chromosome 16p11.2. This deletion results in haploinsufficiency of STX1B and other genes. Recently, variants in the STX1B gene have been associated with a wide spectrum of fever-related epilepsies ranging from single febrile seizures to severe epileptic encephalopathies. Two previously reported patients with a STX1B missense variant or deletion were diagnosed with MAE. Our observation of a STX1B deletion in a third patient with MAE therefore supports that STX1B gene variants or deletions can be involved in the aetiology of MAE. Furthermore, STX1B encodes for syntaxin-1B, of which interaction with the protein encoded by the STXBP1 gene is essential for the regulation of the synaptic transmission of neurotransmitters. STXBP1 gene variants have been identified in patients with many different types of epilepsy, including Dravet syndrome and epileptic encephalopathies, suggesting STX1B plays a similar role. We recommend that analysis of STX1B should be considered in the diagnostic work-up of individuals with MAE.",
"affiliations": "University of Groningen, University Medical Centre Groningen, Department of Neurology, Groningen, The Netherlands; University of Groningen, University Medical Centre Groningen, Department of Genetics, Groningen, The Netherlands. Electronic address: d.r.m.vlaskamp@umcg.nl.;University of Groningen, University Medical Centre Groningen, Department of Genetics, Groningen, The Netherlands.;University of Groningen, University Medical Centre Groningen, Department of Neurology, Groningen, The Netherlands.;University of Groningen, University Medical Centre Groningen, Department of Genetics, Groningen, The Netherlands.;University of Groningen, University Medical Centre Groningen, Department of Genetics, Groningen, The Netherlands.;University of Groningen, University Medical Centre Groningen, Department of Genetics, Groningen, The Netherlands.;University of Groningen, University Medical Centre Groningen, Department of Neurology, Groningen, The Netherlands.",
"authors": "Vlaskamp|Danique R M|DR|;Rump|Patrick|P|;Callenbach|Petra M C|PM|;Vos|Yvonne J|YJ|;Sikkema-Raddatz|Birgit|B|;van Ravenswaaij-Arts|Conny M A|CM|;Brouwer|Oebele F|OF|",
"chemical_list": "C000610189:STX1B protein, human; D050827:Syntaxin 1",
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1090-3798",
"issue": "20(3)",
"journal": "European journal of paediatric neurology : EJPN : official journal of the European Paediatric Neurology Society",
"keywords": "Aetiology; Doose syndrome; Genetics; Myoclonic astatic epilepsy; STX1B",
"medline_ta": "Eur J Paediatr Neurol",
"mesh_terms": "D000293:Adolescent; D004831:Epilepsies, Myoclonic; D057895:Haploinsufficiency; D006801:Humans; D008297:Male; D017384:Sequence Deletion; D050827:Syntaxin 1",
"nlm_unique_id": "9715169",
"other_id": null,
"pages": "489-92",
"pmc": null,
"pmid": "26818399",
"pubdate": "2016-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Haploinsufficiency of the STX1B gene is associated with myoclonic astatic epilepsy.",
"title_normalized": "haploinsufficiency of the stx1b gene is associated with myoclonic astatic epilepsy"
} | [
{
"companynumb": "NL-ALEMBIC PHARMACUETICALS LIMITED-2016SCAL000391",
"fulfillexpeditecriteria": "1",
"occurcountry": "NL",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "VALPROIC ACID"
},
"dr... |
{
"abstract": "Vomiting, abdominal distension, and feeding intolerance are common findings following brain injury in children, and are usually attributed to the brain injury or to delayed gastric emptying: a specific cause is usually not sought. We report six children who developed mild to moderate pancreatitis at least 7 days following apparently isolated brain injury, a previously unreported association. Five of the six patients received drugs that are known or suspected pancreatotoxins; all recovered without changes in the medications. When children develop feeding intolerance or upper gastrointestinal symptoms following traumatic brain injury pancreatitis should be suspected.",
"affiliations": "Department of Physical Medicine and Rehabilitation, Medical College of Wisconsin, Milwaukee 53226.",
"authors": "Urban|M|M|;Splaingard|M|M|;Werlin|S L|SL|",
"chemical_list": "D000900:Anti-Bacterial Agents; D000927:Anticonvulsants; D002317:Cardiovascular Agents; D011619:Psychotropic Drugs",
"country": "Germany",
"delete": false,
"doi": "10.1007/BF00335128",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0256-7040",
"issue": "10(6)",
"journal": "Child's nervous system : ChNS : official journal of the International Society for Pediatric Neurosurgery",
"keywords": null,
"medline_ta": "Childs Nerv Syst",
"mesh_terms": "D000208:Acute Disease; D000293:Adolescent; D000900:Anti-Bacterial Agents; D000927:Anticonvulsants; D001930:Brain Injuries; D002317:Cardiovascular Agents; D002648:Child; D002675:Child, Preschool; D005260:Female; D016489:Head Injuries, Closed; D006408:Hematoma, Subdural; D006801:Humans; D008297:Male; D010195:Pancreatitis; D011619:Psychotropic Drugs; D012307:Risk Factors; D014948:Wounds, Gunshot",
"nlm_unique_id": "8503227",
"other_id": null,
"pages": "388-91",
"pmc": null,
"pmid": "7842426",
"pubdate": "1994-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "6205162;2742474;2408820;6192510;6986321;2442498",
"title": "Pancreatitis associated with remote traumatic brain injury in children.",
"title_normalized": "pancreatitis associated with remote traumatic brain injury in children"
} | [
{
"companynumb": "US-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2017-BI-007089",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "FENTANYL"
},
"d... |
{
"abstract": "17q12 deletion syndrome encompasses a broad constellation of clinical phenotypes, including renal magnesium wasting, maturity-onset diabetes of the young (MODY), renal cysts, genitourinary malformations, and neuropsychiatric illness. Manifestations outside of the renal, endocrine, and nervous systems have not been well described.\n\n\n\nWe report a 62-year-old male referred to the Undiagnosed Diseases Program (UDP) at the National Institutes of Health (NIH) who presented with persistent hypermagnesiuric hypomagnesemia and was found to have a 17q12 deletion. The patient exhibited several known manifestations of the syndrome, including severe hypomagnesemia, renal cysts, diabetes and cognitive deficits. Coronary CT revealed extensive coronary calcifications, with a coronary artery calcification score of 12,427. Vascular calcifications have not been previously reported in this condition. We describe several physiologic mechanisms and a review of literature to support the expansion of the 17q12 deletion syndrome to include vascular calcification.\n\n\n\nExtensive coronary and vascular calcifications may be an extension of the 17q12 deletion phenotype, particularly if hypomagnesemia and hyperparathyroidism are prevalent. In patients with 17q12 deletions involving HNF1B, hyperparathyroidism and hypomagnesemia may contribute to significant cardiovascular risk.",
"affiliations": "Harvard Medical School, Boston, MA, 02115, USA.;Undiagnosed Diseases Program, Office of the Clinical Director and National Human Genome Research Institute, NIH, Bethesda, MD, 20892, USA.;Harvard Medical School, Boston, MA, 02115, USA.;Renal-Electrolyte Division, Department of Medicine, University of Pittsburgh, Pittsburgh, PA, 15261, USA.;Medical Genetics Branch, National Human Genome Research Institute, NIH, Bethesda, MD, USA.;Undiagnosed Diseases Program, Office of the Clinical Director and National Human Genome Research Institute, NIH, Bethesda, MD, 20892, USA.;Undiagnosed Diseases Program, Office of the Clinical Director and National Human Genome Research Institute, NIH, Bethesda, MD, 20892, USA. donna.novacic@nih.gov.",
"authors": "Li|Howard J|HJ|;Groden|Catherine|C|;Hoenig|Melanie P|MP|;Ray|Evan C|EC|;Ferreira|Carlos R|CR|;Gahl|Willam|W|;Novacic|Danica|D|0000-0001-7755-4042",
"chemical_list": "C496495:HNF1B protein, human; D051539:Hepatocyte Nuclear Factor 1-beta",
"country": "England",
"delete": false,
"doi": "10.1186/s12882-019-1533-5",
"fulltext": "\n==== Front\nBMC NephrolBMC NephrolBMC Nephrology1471-2369BioMed Central London 153310.1186/s12882-019-1533-5Case ReportCase report: extreme coronary calcifications and hypomagnesemia in a patient with a 17q12 deletion involving HNF1B Li Howard J. howard_li@hms.harvard.edu 12Groden Catherine cgroden@mail.nih.gov 3Hoenig Melanie P. mhoenig@bidmc.harvard.edu 14Ray Evan C. rayec@upmc.edu 5Ferreira Carlos R. carlos.ferreira@nih.gov 6Gahl Willam gahlw@mail.nih.gov 36http://orcid.org/0000-0001-7755-4042Novacic Danica donna.novacic@nih.gov 31 000000041936754Xgrid.38142.3cHarvard Medical School, Boston, MA 02115 USA 2 0000 0004 0464 0574grid.416868.5National Institute of Mental Health, NIH, Bethesda, MD 20892 USA 3 0000 0001 2237 2479grid.420086.8Undiagnosed Diseases Program, Office of the Clinical Director and National Human Genome Research Institute, NIH, Bethesda, MD 20892 USA 4 0000 0000 9011 8547grid.239395.7Division of Nephrology, Beth Israel Deaconess Medical Center, Boston, MA 02215 USA 5 0000 0004 1936 9000grid.21925.3dRenal-Electrolyte Division, Department of Medicine, University of Pittsburgh, Pittsburgh, PA 15261 USA 6 Medical Genetics Branch, National Human Genome Research Institute, NIH, Bethesda, MD USA 9 9 2019 9 9 2019 2019 20 3533 2 2019 23 8 2019 © The Author(s). 2019Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\n17q12 deletion syndrome encompasses a broad constellation of clinical phenotypes, including renal magnesium wasting, maturity-onset diabetes of the young (MODY), renal cysts, genitourinary malformations, and neuropsychiatric illness. Manifestations outside of the renal, endocrine, and nervous systems have not been well described.\n\nCase presentation\nWe report a 62-year-old male referred to the Undiagnosed Diseases Program (UDP) at the National Institutes of Health (NIH) who presented with persistent hypermagnesiuric hypomagnesemia and was found to have a 17q12 deletion. The patient exhibited several known manifestations of the syndrome, including severe hypomagnesemia, renal cysts, diabetes and cognitive deficits. Coronary CT revealed extensive coronary calcifications, with a coronary artery calcification score of 12,427. Vascular calcifications have not been previously reported in this condition. We describe several physiologic mechanisms and a review of literature to support the expansion of the 17q12 deletion syndrome to include vascular calcification.\n\nConclusion\nExtensive coronary and vascular calcifications may be an extension of the 17q12 deletion phenotype, particularly if hypomagnesemia and hyperparathyroidism are prevalent. In patients with 17q12 deletions involving HNF1B, hyperparathyroidism and hypomagnesemia may contribute to significant cardiovascular risk.\n\nKeywords\n17q12 deletion syndromeHNF1BHypomagnesemiaHyperparathyroidismVascular calcificationCase reportIntramural Research Program of the National Human Genome Research Institute1ZIDHG200352-11issue-copyright-statement© The Author(s) 2019\n==== Body\nBackground\n17q12 deletions involving HNF1B are associated with maturity-onset diabetes of the young type 5 (MODY5) and abnormalities in renal structure and function, including congenital malformations of the kidney and ureter, renal cysts, electrolyte abnormalities, and renal failure. Many of the renal and endocrine abnormalities, including hypomagnesemia, have been attributed to the involvement of HNF1B, a major transcription factor encoded within the 17q12 region. Further reports showed that 17q12 deletion is associated with neuropsychiatric manifestations such as developmental delay, autism spectrum disorder, and schizophrenia. Cardiovascular manifestations have not been described.\n\nCase presentation\nA 62-year-old Caucasian male was referred to the NIH Undiagnosed Diseases Program (UDP) by his nephrologist in January 2018 and enrolled in protocol 15-HG-0130, “Clinical and Genetic Evaluation of Individuals With Undiagnosed Disorders Through the Undiagnosed Diseases Network” [1].\n\nThe patient’s hypomagnesemia came to clinical attention at age 45. One week after starting triamterene-hydrochlorothiazide for hypertension, he complained of profound malaise, myalgia, and arthralgia and was found to have severe electrolyte abnormalities: hypomagnesemia, hypocalcemia, and hypokalemia (Table 1). Aside from his 1 week trial of triamterene-hydrochlorothiazide, the patient had not taken any other diuretics. The patient was hospitalized for electrolyte repletion and evaluation. Since then, he required aggressive oral and intravenous magnesium supplementation daily (magnesium lactate, 504 mg p.o., magnesium sulfate, 5 g i.v.), along with amiloride 10 mg tid for magnesium sparing. Laboratory monitoring has been consistently notable for renal magnesium wasting and hyperparathyroidism, but otherwise normal renal function.\nTable 1 Representative laboratory values (August 2000 – January 2018)\n\n\tAug. 2000a\tAug. 2000b\tJun. 2009\tMay 2017\tJan. 2018c\t\nNa (136–145 mEq/L)\t\n133\n\t140\t140\t139\t143\t\nK (3.5–5.0 mEq/L)\t\n2.8\n\t4.1\t4.3\t4.3\t4.2\t\nCl (98–106 mEq/L)\t102\t101\t102\t101\t101\t\nCO2 (23–28 mEq/L)\t28\t29\t28\t26\t23\t\nBUN (8–20 mg/dL)\t12\t17\t17\t16\t20\t\nCr (0.7–1.5 mg/dL)\t1.0\t1.0\t0.9\t0.7\t0.9\t\neGFR (CKD-EPI) (> 90 mL/min/1.73m2)\t90\t90\t96\t102\t91\t\nUric acid (3.7–8.6 mg/dL)\t\t\t\t\t7.0\t\nHbA1c (4.0–5.6%)\t\t5.6\t6.4\t5.8\t5.6\t\nPTH (10–65 pg/mL)\t\t\n80\n\t\t\n184.4\n\t\n148.6\n\t\nCa (8.6–10.2 mg/dL)\t\n7.7\n\t9.2\t9\t9.1\t9.3\t\nPhos (3.0–4.5 mg/dL)\t\t4.4\t2.9\t3.9\t3.0\t\n25-OH Vit D (20–60 ng/mL)\t\t\t25\t22.7\t25\t\nMg (1.6–2.6 mEq/L)\t\n1.0\n\t\n1.1\n\t\n1.5\n\t\n1.4\n\t1.6\t\n24 h Urine Mg (14–290 mg/24 h)\t\t\n595\n\t\n322\n\t\n537\n\t\n553\n\t\n24 h Urine Ca (50–300 mg/24 h)\t\t\n326\n\t\t294\t\n354\n\t\n24 h Urine Cr (1.00–2.00 g/24 h)\t\t1.60\t\t1.27\t1.13\t\nRelevant values in bold\n\naInitial ED Presentation\n\nbClinically stable, on discharge\n\ncNIH evaluation\n\n\n\nAt age 61 he developed unstable angina and was treated with a coronary artery bypass graft in 2016. At that time, diabetes mellitus type 2 and hyperlipidemia were also noted and well-controlled with medication. In addition to magnesium supplementation, the patient’s medications were aspirin (81 mg qd), amiloride (10 mg tid), furosemide (40 mg qd), amlodipine (10 mg qd), carvedilol (6.25 mg bid), metformin (500 mg bid), glimepiride (4 mg qam), ezetimibe (10 mg qd), and simvastatin (40 mg qd). He did not take any proton-pump inhibitors.\n\nFamily history was significant for sudden cardiac death (maternal grandfather, deceased, age 40), ruptured aortic aneurysm (father, deceased, age 79), pancreatic cancer (mother, deceased, age 77), and mild intellectual disability with speech delay (son, age 28). There was no family history of hypomagnesemia. There was no cosangunity.\n\nThe patient appeared well but obese (BMI 35.2). Mental status was suspicious for subtle cognitive and social deficits. The remainder of the physical exam, including vital signs, cardiopulmonary exam, and reflexes, were normal.\n\nLaboratory evaluation at the NIH in January 2018 was significant for hyperparathyroidism and increased urinary magnesium excretion with an inappropriately high fractional excretion of magnesium of 23% based on 24-h urine collection (normal < 4%), and slightly increased urinary calcium excretion. Serum electrolytes were normal while receiving oral and intravenous magnesium repletion at the time of NIH evaluation. Aside from magnesium, urine electrolytes were normal (Table 1). A comprehensive metabolic panel including liver and lipid studies was unremarkable.\n\nRenal ultrasound showed multiple cortical cysts, bilaterally. Bone density scan showed osteopenia at the left forearm (T = − 2.0) and lumbar spine (T = − 1.9). CT scan showed vascular calcifications of the anterior and posterior cerebral arteries, bilateral carotid arteries, and calcific spots along the descending aorta and iliac arteries. Notably, there was extensive calcification of the coronary arteries (Fig. 1), with a coronary artery calcium (CAC) score of 12,427 by the Agatston scoring method [2]. Echocardiogram was normal. Neuropsychiatric testing revealed significant abnormalities in short term memory despite adequate attention, language and reasoning skills. The patient also had a deficit in fine motor speed but not in processing speed. Prior to referral to the NIH, the patient received genetic testing and was found to have a 17q12 deletion of 1.5 megabases via chromosomal microarray. Whole genome sequencing confirmed a 17q21 deletion (ch17:34,815,551-36,223,325) involving 15 genes including HNF1B, and did not reveal any variants known to be associated with vascular calcification. Genetic counseling was offered, and family members did not elect for genetic testing at the time of evaluation.\nFig. 1 Axial CT images depicting extensive calcifation of the left anterior descending (left), left circumflex (middle), and distal right and posterior descending (right) coronary arteries\n\n\n\nDiscussion and conclusion\nPhenotypic features of 17q12 deletion involving HNF1B\n17q12 deletion syndrome encompasses a broad range of phenotypes, including diabetes mellitus, renal malformations, impaired renal function, and neuropsychiatric disorders [3]. Hepatocyte Nuclear Factor 1B (HNF1B) is a critical transcription factor gene within the 17q12 deletion region. While HNF1B polymorphisms have been known to cause hereditary Maturity-Onset Diabetes of the Young (MODY), HNF1B deletion now appears to be responsible for many other manifestations of 17q12 deletion syndrome [4]. HNF1B is critical to pancreatic development and beta cell function, a mechanism linking HNF1B polymorphisms to MODY and neonatal diabetes [4, 5]. Recent studies also documented hyperparathyroidism in patients carrying HNF1B mutations and identified it as a regulator of PTH expression, suggesting that HNF1B deficiency causes hyperparathyroidism independent of associated renal failure [6]. Renal cysts (most common), renal hypoplasia or agenesis, and genital malformations have also been noted, consistent with HNF1B’s involvement in kidney and urinary tract morphogenesis [7]. Neuropsychiatric manifestations of 17q12 deletion syndrome may be independent from HNF1B deletion [8], although this is controversial [9]. Hypomagnesemia is a common manifestation of HNF1B mutations [10]. HNF1B is essential for expression of FXYD2, a subunit of the sodium-potassium ATPase critical for driving transcellular magnesium transport in the kidney’s distal convoluted tubule (DCT). Mutations in both HNF1B and FXYD2 are associated with renal magnesium wasting [6, 10]. While the inheritance of these renal syndromes have been described as autosomal dominant traits, deleterious HNF1B polymorphisms frequently arise from de novo mutations. Gitelman syndrome (GS) is often initially considered in patients with HNF1B-related renal disease who present with hypomagnesemia; this was the case with our patient before GS was excluded by the absence of hypocalciuria and by genetic testing.\n\nFindings in this patient consistent with known manifestations of 17q12 deletion involving HNF1B include multiple renal cysts, diabetes mellitus, hypomagnesemia, hyperparathyroidism, and cognitive deficits. This is the first description of extreme coronary calcifications in a patient carrying a 17q12 deletion.\n\nHypomagnesemia\nHypomagnesemia may be attributed to three etiologic categories: redistribution, decreased gastrointestinal absorption, and increased renal excretion. Redistribution occurs when magnesium is sequestered in specific tissues or compartments, such as in refeeding syndrome and fat saponification in acute pancreatitis. Causes of decreased gastrointestinal uptake include malnutrition, malabsorption, and diarrhea. Proton pump inhibitors commonly cause hypomagnesemia by altering the pH of gastric secretions and limiting magnesium absorption by enterocytes. Increased renal excretion can be due to excessive diuresis, medications (particularly loop and thiazide diuretics), acquired tubular dysfunction, and more rarely, genetic causes such as Gitelman and Bartter syndromes and defects of tubular components such as CaSR, claudins 19 and 14, among others. Quantifying renal magnesium excretion via a 24-h urine collection for fractional excretion calculation is the most definitive test when renal magnesium loss is suspected.\n\nThis patient presented in late adulthood within 1 week of initiating a thiazide diuretic. The potential side effects of thiazide diuretics are well-characterized and include hypomagnesemia. Specifically, the DCT is a target site for both therapeutic action (thiazide-sensitive Na/Cl symporter antagonism) and toxic effects (apoptosis of DCT epithelial cells, decreased expression of DCT-specific magnesium transporters) [11]. The DCT is also a key tubular segment for regulated, transcellular magnesium transport, and a segment where HNF1B haploinsufficiency contributes to hypomagnesemia [10, 12], though the potential effect of HNF1B deletion on other nephron segments and extra-renal determinants of magnesium balance cannot be excluded. This patient likely had longstanding but subclinical HNF1B-related renal magnesium wasting with a heightened genetic vulnerability to thiazide diuretics, which may explain his initial presentation shortly after initiating a thiazide diuretic.\n\nDecades after discontinuing the causal agent, however, this patient was unable to reduce his supplementation regimen without developing symptomatic hypomagnesemia. One explanation is that acute nephrotoxic episodes result in permanent but subclinical loss of tubular function. In the setting of preexisting HNF1B haploinsufficiency and impaired magnesium transport at the DCT, this may result in permanent, clinically significant magnesium wasting. A comparison can be made with cisplatin, an agent known to also cause irreversible tubular dysfunction and renal magnesium wasting due to specific nephrotoxic effects on the DCT [13]. Additionally, manifestations of HNF1B haploinsufficiency may worsen with age, as both childhood and late-adulthood presentations of HNF1B-related disease have been described [14]. Variability in HNF1B-related hypomagnesemia may be influenced by the extent of 17q12 deletion (1.5 megabases involving 15 genes in this patient), the effect of metabolic and cardiovascular comorbidities (obesity, hypertension, and diabetes), and the presence of structural renal disease (renal cysts).\n\nCoronary calcification as a possible physiologic sequela of HNF1B deletion\nWith a coronary arterial calcium (CAC) score of 12,427, the extent of this patient’s coronary calcification is unprecedented. While this patient has several cardiovascular risk factors (history of unstable angina, obesity, diabetes, hypertension, and hyperlipidemia), one study found that among individuals in the United States with five or more risk factors for coronary artery disease (obesity, diabetes, hypercholesterolemia, hypertension, smoking, sedentary lifestyle, or family history), the mean CAC score was 271.5 [15]. In another study, the mean CAC score among 92 patients with a history of myocardial infarction was 427.0 ± 516.2 [16]. Despite the considerable variability in CAC scores across studies and populations, this patient’s CAC score is 1–2 orders of magnitude outside the typical CAC score distribution for both low and high CAD-risk groups. We review three overlapping mechanisms that may link this patient’s HNF1B deletion to his extensive vascular calcifications:\nBone-vascular axis dysregulation. The relationship between skeletal and vascular mineralization is known as the bone-vascular axis [17]. A major mechanistic underpinning of the bone-vascular axis is the fact that calcification of bone and vasculature share common regulators, most notably parathyroid hormone (PTH). HNF1B is required for repression of PTH transcription, and HNF1B haploinsufficiency leads to primary hyperparathyroidism [6]. Also, while severe hypomagnesemia potently blocks PTH secretion, moderate hypomagnesemia is a stimulator of PTH [18]. With the exception of his initial presentation of severe magnesium deficiency and subsequent hypocalcemia, this patient’s parathyroid physiology while on magnesium supplementation may be best described as primary hyperparathyroidism due to HNF1B deletion, exacerbated by moderate hypomagnesemia. This patient’s hyperparathyroidism, osteopenia, and vascular calcifications constitute a clinical triad similar to chronic kidney disease–mineral bone disorder (CKD-MBD) [19]. CKD-MBD entails a complex pathophysiological model, in which hyperphosphatemia, secondary hyperparathyroidism, inflammatory cytokines, and oxidized lipids all contribute to vascular calcification. Although renal insufficiency is essential to CKD-MBD, the independent contribution of hyperparathyroidism to bone-vascular axis dysregulation is relevant to this case. In animal models, PTH induces bone turnover and arterial calcification, even in the absence of hypercalcemia, hyperphosphatemia, or renal insufficiency [20]. Finally, epidemiologic studies confirm that bone density is inversely correlated with vascular calcification, independent of age, in patients both with and without chronic kidney disease [21, 22].\n\nHypomagnesemia and increased calcium crystal precipitation. The association between hypomagnesemia and vascular calcification is well-studied. Magnesium directly inhibits calcium-phosphate crystal formation in vitro [23], while magnesium supplementation in an animal model for a heritable disorder of vascular calcification prevented mineralization [24]. Large population studies show that magnesium intake in people free of cardiovascular disease was inversely associated with coronary artery calcification [25], whereas serum magnesium concentrations are inversely associated with CAC both in a general healthy population [26–28], as well as in patients with chronic kidney disease [29]. Low magnesium levels may decrease expression of endogenous inhibitors of calcification, notably matrix Gla-protein (MGP) and fetuin-A, which sequester calcium and phosphate ions, act as chaperones for calcium-phosphate complexes, and inhibit crystal nucleation at the extracellular matrix [23, 30, 31].\n\nCell-mediated osteogenic activity. Hypomagnesemia and hyperparathyroidism modulate osteogenic activity in endothelial and vascular smooth muscle cells (VSMC), a major mechanism of arterial calcification, especially in atherosclerosis. In endothelial cells, low magnesium levels increase atherosclerotic signaling: ROS production, NF-kB activation, and cytokine release [32, 33]. Magnesium deficiency also promotes endothelial permeability allowing for invasion of LDL particles, macrophages, and VSMCs, a key initiating step in atherosclerosis and vascular calcification [32]. In VSMCs, magnesium suppresses transcription of potent osteogenic genes, including BMP2, RUNX2, and osteocalcin [23]. Similarly, elevated PTH levels stimulate osteogenic signaling in endothelial cells, including NF-kB-dependent upregulation of BMP2 [34]. In VSMCs, hyperparathyroidism ultimately promotes calcification, even though the direct effect of PTH and PTH-related peptide (PTHrP) on VSMCs appears to be one of inhibited calcification [17]. It is thought that longstanding hyperparathyroidism causes receptor internalization and antagonism via excess PTH fragments, paradoxically reducing the protective effects of PTH signaling at VSMCs [35]. Furthermore, fetuin-A and MGP, in addition to directly inhibiting calcium crystal formation as discussed above, regulate VSMCs; both hypomagnesemia and hyperparathyroidism decrease fetuin-A and MGP levels, which in turn promote the osteogenic phenotype of VSMCs [30, 31]. Finally, HNF1B may be a transcription factor for SPP1, also known as osteopontin [36]. Osteopontin is a secreted protein with multiple functions, including regulating soft tissue mineralization. Particularly in VSMCs, osteopontin inhibits hydroxyapatite crystal deposition and calcification. Decreased expression of osteopontin due to haploinsufficiency of HNF1B may be another mechanism promoting vascular calcification [37].\n\n\n\nIn conclusion, vascular calcifications have not been previously described in 17q12 deletion syndrome. Based on our discussion of this patient’s findings, review of literature, and pertinent physiologic mechanisms, vascular calcifications are a plausible extension of the 17q12 deletion phenotype and may contribute significantly to the cardiovascular risk of affected patients, particularly in the setting of hypomagnesemia and hyperparathyroidism. Evaluation, surveillance, and aggressive management of cardiovascular risk factors should be considered for individuals with 17q12 deletion syndrome.\n\nAbbreviations\nCACCoronary Artery Calcium [Score]\n\nCKD-MBDChronic kidney disease–mineral bone disorder\n\nDCTDistal convoluted tubule\n\nESRDEnd Stage Renal Disease\n\nHNF1BHepatocyte Nuclear Factor 1B\n\nLDLLow Density Lipoprotein\n\nMGPMatrix Gla protein\n\nMODYMaturity-onset diabetes of the young\n\nPTHParathyroid hormone\n\nPTHrPParathyroid Hormone Related Peptide\n\nROSReactive Oxygen Species\n\nVSMCVascular smooth muscle cell\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAcknowledgements\nThe authors thank:\n\nDr. Jeffrey Kopp, MD, National Institute of Diabetes and Digestive and Kidney Diseases, NIH, Bethesda MD 20892.\n\nDr. Joel Krier, MD, Department of Medicine, Medical Genetics, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115.\n\nDr. David Cassiman, MD, PhD, UZ Leuven, Belgium.\n\nAuthors’ contributions\nHJL wrote the manuscript and conducted the literature review. HJL, CG, and DN participated in the clinical care of the patient. DN supervised patient evaluation and clinical care at the NIH clinical center. DN, MPH, ECR, CRF, and WG contributed to and oversaw the writing of the manuscript. All authors read and approved the final manuscript.\n\nFunding\nHJL was supported by the Harvard Medical School Scholars in Medicine Office. This work was supported in part by the Intramural Research Program of the National Human Genome Research Institute. ECR is supported by NIDDK K08 DK110332. The funders had no role in study design, data collection, analysis, interpretation, writing of the manuscript or final submission.\n\nAvailability of data and materials\nThe datasets used and/or analysed during the current study available from the corresponding author on reasonable request. Clinical phenotyping deposited into the PhenomeCentral database via PhenoTips.\n\nEthics approval and consent to participate\nProtocol 15-HG-0130 was approved by the National Human Genome Research Institute (NHGRI) Institutional Review Board (IRB). The patient gave written informed consent.\n\nConsent for publication\nThe patient provided written informed consent to this case’s publication.\n\nCompeting interests\nThe authors declare that they have no competing.\n==== Refs\nReferences\n1. Gahl WA Wise AL Ashley EA The undiagnosed diseases network of the National Institutes of Health: a National Extension JAMA 2015 314 1797 1798 10.1001/jama.2015.12249 26375289 \n2. Agatston AS Janowitz WR Kaplan G Gasso J Hildner F Viamonte M Ultrafast computed tomography-detected coronary calcium reflects the angiographic extent of coronary arterial atherosclerosis Am J Cardiol 1994 74 1272 1274 10.1016/0002-9149(94)90563-0 7977105 \n3. Mefford HC Clauin S Sharp AJ Moller RS Ullmann R Kapur R Recurrent reciprocal genomic rearrangements of 17q12 are associated with renal disease, diabetes, and epilepsy Am J Hum Genet 2007 81 1057 1069 10.1086/522591 17924346 \n4. El-Khairi R Vallier L The role of hepatocyte nuclear factor 1β in disease and development Diabetes Obes Metab 2016 18 Suppl 1 23 32 10.1111/dom.12715 27615128 \n5. Frayling TM Bulamn MP Ellard S Appleton M Dronsfield MJ Mackie AD Mutations in the hepatocyte nuclear factor-1alpha gene are a common cause of maturity-onset diabetes of the young in the U.K Diabetes 1997 46 720 725 10.2337/diab.46.4.720 9075818 \n6. Ferrè S Bongers EMHF Sonneveld R Cornelissen EAM van der Vlag J van Boekel GAJ Early development of hyperparathyroidism due to loss of PTH transcriptional repression in patients with HNF1β mutations? J Clin Endocrinol Metab 2013 98 4089 4096 10.1210/jc.2012-3453 23979948 \n7. Igarashi P Shao X McNally BT Hiesberger T Roles of HNF-1beta in kidney development and congenital cystic diseases Kidney Int 2005 68 1944 1947 10.1111/j.1523-1755.2005.00625.x 16221171 \n8. Clissold RL Shaw-Smith C Turnpenny P Bunce B Bockenhauer D Kerecuk L Chromosome 17q12 microdeletions but not intragenic HNF1B mutations link developmental kidney disease and psychiatric disorder Kidney Int 2016 90 203 211 10.1016/j.kint.2016.03.027 27234567 \n9. Laffargue F Bourthoumieu S Llanas B Baudouin V Lahoche A Morin D Towards a new point of view on the phenotype of patients with a 17q12 microdeletion syndrome Arch Dis Child 2015 100 259 264 10.1136/archdischild-2014-306810 25324567 \n10. Adalat S Woolf AS Johnstone KA Wirsing A Harries LW Long DA HNF1B mutations associate with hypomagnesemia and renal magnesium wasting J Am Soc Nephrol JASN 2009 20 1123 1131 10.1681/ASN.2008060633 19389850 \n11. Ellison DH Loffing J Thiazide effects and side effects: insights from molecular genetics Hypertension 2009 54 196 202 10.1161/HYPERTENSIONAHA.109.129171 19564550 \n12. Ferrè S Veenstra GJC Bouwmeester R Hoenderop JGJ Bindels RJM HNF-1B specifically regulates the transcription of the γa-subunit of the Na+/K+-ATPase Biochem Biophys Res Commun 2011 404 284 290 10.1016/j.bbrc.2010.11.108 21130072 \n13. Panichpisal K Angulo-Pernett F Selhi S Nugent KM Gitelman-like syndrome after cisplatin therapy: a case report and literature review BMC Nephrol 2006 7 10 10.1186/1471-2369-7-10 16723030 \n14. Heidet L Decramer S Pawtowski A Morinière V Bandin F Knebelmann B Spectrum of HNF1B mutations in a large cohort of patients who harbor renal diseases Clin J Am Soc Nephrol CJASN 2010 5 1079 1090 10.2215/CJN.06810909 20378641 \n15. Mamudu HM Paul TK Wang L Veeranki SP Panchal HB Alamian A The effects of multiple coronary artery disease risk factors on subclinical atherosclerosis in a rural population in the United States Prev Med 2016 88 140 146 10.1016/j.ypmed.2016.04.003 27090918 \n16. Schmermund A Baumgart D Görge G Seibel R Grönemeyer D Ge J Coronary artery calcium in acute coronary syndromes: a comparative study of electron-beam computed tomography, coronary angiography, and intracoronary ultrasound in survivors of acute myocardial infarction and unstable angina Circulation 1997 96 1461 1469 10.1161/01.CIR.96.5.1461 9315532 \n17. Towler DA Skeletal anabolism, PTH, & the bone-vascular Axis J Bone Miner Res 2011 26 2579 2582 10.1002/jbmr.523 22021135 \n18. Vetter T Lohse MJ Magnesium and the parathyroid Curr Opin Nephrol Hypertens 2002 11 403 410 10.1097/00041552-200207000-00006 12105390 \n19. Moe S Drüeke T Cunningham J Goodman W Martin K Olgaard K Definition, evaluation, and classification of renal osteodystrophy: a position statement from kidney disease: improving global outcomes (KDIGO) Kidney Int 2006 69 1945 1953 10.1038/sj.ki.5000414 16641930 \n20. Neves KR Graciolli FG dos Reis LM Graciolli RG Neves CL Magalhães AO Vascular calcification: contribution of parathyroid hormone in renal failure Kidney Int 2007 71 1262 1270 10.1038/sj.ki.5002241 17410101 \n21. Schulz E Arfai K Liu X Sayre J Gilsanz V Aortic calcification and the risk of osteoporosis and fractures J Clin Endocrinol Metab 2004 89 4246 4253 10.1210/jc.2003-030964 15356016 \n22. Naves M Rodríguez-García M Díaz-López JB Gómez-Alonso C Cannata-Andía JB Progression of vascular calcifications is associated with greater bone loss and increased bone fractures Osteoporos Int 2008 19 1161 1166 10.1007/s00198-007-0539-1 18180973 \n23. ter Braake AD Shanahan CM de Baaij JHF Magnesium counteracts vascular calcification: passive interference or active modulation? Arterioscler Thromb Vasc Biol 2017 37 1431 1445 10.1161/ATVBAHA.117.309182 28663256 \n24. LaRusso J Li Q Jiang Q Uitto J Elevated dietary magnesium prevents connective tissue mineralization in a mouse model of pseudoxanthoma elasticum (Abcc6(−/−)) J Invest Dermatol 2009 129 1388 1394 10.1038/jid.2008.391 19122649 \n25. Hruby A O’Donnell CJ Jacques PF Meigs JB Hoffmann U McKeown NM Magnesium intake is inversely associated with coronary artery calcification: the Framingham heart study JACC Cardiovasc Imaging 2014 7 59 69 10.1016/j.jcmg.2013.10.006 24290571 \n26. Posadas-Sánchez R Posadas-Romero C Cardoso-Saldaña G Vargas-Alarcón G Villarreal-Molina MT Pérez-Hernández N Serum magnesium is inversely associated with coronary artery calcification in the genetics of atherosclerotic disease (GEA) study Nutr J 2016 15 22 10.1186/s12937-016-0143-3 26931571 \n27. Ma J Folsom AR Melnick SL Eckfeldt JH Sharrett AR Nabulsi AA Associations of serum and dietary magnesium with cardiovascular disease, hypertension, diabetes, insulin, and carotid arterial wall thickness: the ARIC study. Atherosclerosis risk in communities study J Clin Epidemiol 1995 48 927 40 10.1016/0895-4356(94)00200-A 7782801 \n28. Han H Fang X Wei X Liu Y Jin Z Chen Q Dose-response relationship between dietary magnesium intake, serum magnesium concentration and risk of hypertension: a systematic review and meta-analysis of prospective cohort studies Nutr J. 2017 16 26 10.1186/s12937-017-0247-4 28476161 \n29. Massy ZA Drüeke TB Magnesium and outcomes in patients with chronic kidney disease: focus on vascular calcification, atherosclerosis and survival Clin Kidney J 2012 5 Suppl 1 i52 i61 10.1093/ndtplus/sfr167 26069821 \n30. Proudfoot D Shanahan CM Molecular mechanisms mediating vascular calcification: role of matrix Gla protein Nephrol Carlton Vic 2006 11 455 461 10.1111/j.1440-1797.2006.00660.x \n31. Heiss A Eckert T Aretz A Richtering W van Dorp W Schäfer C Hierarchical role of fetuin-a and acidic serum proteins in the formation and stabilization of calcium phosphate particles J Biol Chem 2008 283 14815 14825 10.1074/jbc.M709938200 18364352 \n32. Maier JAM Endothelial cells and magnesium: implications in atherosclerosis Clin Sci (Lond) 2012 122 397 407 10.1042/CS20110506 22248353 \n33. Kolte D Vijayaraghavan K Khera S Sica DA Frishman WH Role of magnesium in cardiovascular diseases Cardiol Rev 2014 22 182 192 10.1097/CRD.0000000000000003 24896250 \n34. Cheng Z-Y Ye T Ling Q-Y Wu T Wu G-Y Zong G-J Parathyroid hormone promotes osteoblastic differentiation of endothelial cells via the extracellular signal-regulated protein kinase 1/2 and nuclear factor-κB signaling pathways Exp Ther Med 2018 15 1754 1760 29434762 \n35. Usatii M Rousseau L Demers C Petit J-L Brossard J-H Gascon-Barré M Parathyroid hormone fragments inhibit active hormone and hypocalcemia-induced 1,25(OH)2D synthesis Kidney Int 2007 72 1330 1335 10.1038/sj.ki.5002532 17805236 \n36. Senkel S Lucas B Klein-Hitpass L Ryffel GU Identification of target genes of the transcription factor HNF1beta and HNF1alpha in a human embryonic kidney cell line Biochim Biophys Acta 2005 1731 179 190 10.1016/j.bbaexp.2005.10.003 16297991 \n37. Paloian NJ Leaf EM Giachelli CM Osteopontin protects against high phosphate-induced nephrocalcinosis and vascular calcification Kidney Int 2016 89 1027 1036 10.1016/j.kint.2015.12.046 27083280\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2369",
"issue": "20(1)",
"journal": "BMC nephrology",
"keywords": "17q12 deletion syndrome; Case report; HNF1B; Hyperparathyroidism; Hypomagnesemia; Vascular calcification",
"medline_ta": "BMC Nephrol",
"mesh_terms": "D002872:Chromosome Deletion; D002886:Chromosomes, Human, Pair 17; D003327:Coronary Disease; D051539:Hepatocyte Nuclear Factor 1-beta; D006801:Humans; D008297:Male; D008875:Middle Aged; D015499:Renal Tubular Transport, Inborn Errors; D058496:Smith-Magenis Syndrome",
"nlm_unique_id": "100967793",
"other_id": null,
"pages": "353",
"pmc": null,
"pmid": "31500578",
"pubdate": "2019-09-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D052060:Research Support, N.I.H., Intramural; D013485:Research Support, Non-U.S. Gov't",
"references": "12105390;15356016;16221171;16297991;16641930;16723030;17014561;17410101;17805236;17924346;18180973;18364352;19122649;19389850;19564550;20378641;21130072;22021135;22248353;23979948;24290571;24896250;25324567;26069821;26375289;26931571;27083280;27090918;27234567;27615128;28476161;28663256;29434762;7782801;7977105;9075818;9315532",
"title": "Case report: extreme coronary calcifications and hypomagnesemia in a patient with a 17q12 deletion involving HNF1B.",
"title_normalized": "case report extreme coronary calcifications and hypomagnesemia in a patient with a 17q12 deletion involving hnf1b"
} | [
{
"companynumb": "US-TEVA-2019-US-1132075",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SIMVASTATIN"
},
"drugadditional": "3",
... |
{
"abstract": "A 46-year-old woman with a history of Graves' disease presented with the chief complaints of appetite loss, weight loss, fatigue, nausea, and sweating. She was diagnosed with diabetic ketoacidosis (DKA), thyroid storm, and influenza A. She was treated with an intravenous insulin drip, intravenous fluid therapy, intravenous hydrocortisone, oral potassium iodine, and oral methimazole. As methimazole-induced neutropenia was suspected, the patient underwent thyroidectomy. It is important to maintain awareness that thyroid storm and DKA can coexist. Furthermore, even patients who have relatively preserved insulin secretion can develop DKA if thyroid storm and infection develop simultaneously.",
"affiliations": "Department of Endocrinology and Metabolism, National Hospital Organization Nagasaki Medical Center, Japan.",
"authors": "Ikeoka|Toshiyuki|T|;Otsuka|Hiroaki|H|;Fujita|Naruhiro|N|;Masuda|Yukiko|Y|;Maeda|Shigeto|S|;Horie|Ichiro|I|;Ando|Takao|T|;Abiru|Norio|N|;Kawakami|Atsushi|A|",
"chemical_list": "D013956:Antithyroid Agents; D007328:Insulin; D008713:Methimazole",
"country": "Japan",
"delete": false,
"doi": "10.2169/internalmedicine.56.7593",
"fulltext": "\n==== Front\nIntern MedIntern. Med10.2169/internalmedicine.56.7593Internal Medicine0918-29181349-7235The Japanese Society of Internal Medicine 28090049Case ReportThyroid Storm Precipitated by Diabetic Ketoacidosis and Influenza A: A Case Report and Literature Review Ikeoka Toshiyuki 1Otsuka Hiroaki 1Fujita Naruhiro 1Masuda Yukiko 2Maeda Shigeto 3Horie Ichiro 4Ando Takao 4Abiru Norio 4Kawakami Atsushi 41 Department of Endocrinology and Metabolism, National Hospital Organization Nagasaki Medical Center, Japan2 Department of Emergency and Critical Care Center, National Hospital Organization Nagasaki Medical Center, Japan3 Department of Surgery, National Hospital Organization Nagasaki Medical Center, Japan4 Department of Endocrinology and Metabolism, Nagasaki University Graduate School of Biomedical Sciences, JapanCorrespondence to Dr. Toshiyuki Ikeoka, toshiyukiikeoka@hotmail.co.jp\n\n15 1 2017 56 2 181 185 15 4 2016 26 5 2016 The Internal Medicine is an Open Access article distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).A 46-year-old woman with a history of Graves' disease presented with the chief complaints of appetite loss, weight loss, fatigue, nausea, and sweating. She was diagnosed with diabetic ketoacidosis (DKA), thyroid storm, and influenza A. She was treated with an intravenous insulin drip, intravenous fluid therapy, intravenous hydrocortisone, oral potassium iodine, and oral methimazole. As methimazole-induced neutropenia was suspected, the patient underwent thyroidectomy. It is important to maintain awareness that thyroid storm and DKA can coexist. Furthermore, even patients who have relatively preserved insulin secretion can develop DKA if thyroid storm and infection develop simultaneously. \n\ndiabetic ketoacidosisthyroid storminfluenzaslowly progressive type 1 diabetesautoimmune polyglandular syndrome\n==== Body\nIntroduction\nThyroid storm is a life-threatening situation with severe clinical manifestations of thyrotoxicosis, which leads to irreversible cardiovascular collapse due to a fever, tachycardia, and congestive heart failure (1). Diabetic ketoacidosis (DKA) is also a life-threatening condition in which severe insulin deficiency leads to hyperglycemia, metabolic acidosis, dehydration, and electrolyte imbalances (2). The association between type 1 diabetes (T1D) and autoimmune thyroid diseases is well described and is a variant of autoimmune polyglandular syndrome type 3 variant (APS3v) (3). The simultaneous development of thyroid storm and DKA is relatively uncommon and a fulminant medical emergency that can result in a fatal outcome unless recognized and managed promptly.\n\nCase Report\nA 46-year-old woman with a history of Graves' disease (GD) was transferred to our emergency department on suspicion of DKA. She had noticed polydipsia, polyuria, and fatigue approximately four months prior to admission. She had also been suffering from a 1-month complaint of appetite loss, approximately 7 kg weight loss, fatigue, nausea, and sweating. Her medical history included GD, diagnosed at 42 years of age and managed with methimazole. However, she had poor compliance with anti-thyroid drugs. She denied a family history of thyroid diseases or diabetes. Three days before admission, she was also diagnosed with influenza A at a nearby hospital, and oseltamivir phosphate was prescribed.\n\nAt the emergency department, she presented with drowsiness and a body temperature of 37.0℃, blood pressure of 90/60 mmHg, heart rate of 200 bpm, respiratory rate of 32 breaths/min, oxygen saturation of 99% in 5 L nasal air, and a Glasgow coma scale (GCS) score of 14. Her clinical examination revealed a diffuse goiter with bilateral exophthalmoses. Her lungs were clear when auscultated. Her abdomen was soft and non-tender. Her skin was warm and wet. She had no lower extremity edema. The electrocardiogram showed marked tachycardia with atrial fibrillation, and a chest radiograph was normal. The laboratory data are shown in Table 1. Her initial laboratory data demonstrated marked metabolic acidosis, an increased plasma glucose level of 472 mg/dL, an increased HbA1c level of 13.7%, an increased free triiodothyronine level of 6.440 pg/mL, and a free thyroxine level of 2.830 ng/dL, with a suppressed thyrotropin (TSH) level of 0.005 μIU/mL. She scored 55 on the diagnostic criteria of Burch & Wartofsky for thyroid storm, and the diagnostic criteria of the Japan Thyroid Association for thyroid storm were also satisfied, since she had thyrotoxicosis, symptoms involving the central nervous system, tachycardia, and gastrointestinal symptoms (4). Accordingly, she was diagnosed with DKA and thyroid storm and admitted to the medical intensive care unit for further monitoring and treatment.\n\nTable 1. Laboratory Findings on Admission.\n\n\t\tReference\t\t\tReference\t\nDiabetes\t\t\tBlood Count\t\t\t\nGlucose (mg/dL)\t472\t80-112\tWhite blood cell (/μL)\t21,300\t3,500-9,100\t\nHemoglobin A1c (%)\t13.7\t4.6-6.2\tRed blood cell (×104/μL)\t574\t380-480\t\nUrinary C-peptide (μg/day)\t23.9\t18.3-124.4\tHemoglobin (g/dL)\t16.2\t11.3-15.2\t\nGAD antibody (U/mL)\t896\t<1.5\tPlatelet (×104/μL)\t17.2\t13.0-36.9\t\nIA-2 antibody (U/mL)\t18\t<0.4\t\t\t\t\nInsulin autoantibody (nU/mL)\t191\t<125\tBlood Chemistry\t\t\t\nUrinary ketone bodies\t4+\t(-)\tAspartate aminotransferase (IU/L)\t16\t13-33\t\n\t\t\tAlanine aminotransferase (IU/L)\t21\t6-27\t\nThyroid\t\t\tLactate dehydrogenase (IU/L)\t143\t119-229\t\nFree triiodothyronine (pg/mL)\t6.440\t2.300-4.000\tAlkaline phosphatase (IU/L)\t438\t115-359\t\nFree thyroxine (ng/dL)\t2.830\t0.900-1.700\tγ-Glutamyl transferase (IU/L)\t25\t10-47\t\nThyroid stimulating hormone (μIU/mL)\t0.005\t0.500-5.000\tCreatinine kinase (IU/L)\t25\t45-163\t\nThyrotropin receptor antibodies (IU/L)\t10.3\t<2\tBlood urea nitrogen (mg/dL)\t31.3\t8.0-22.0\t\nThyroglobulin antibodies (IU/mL)\t13\t<28\tCreatinine (mg/dL)\t0.8\t0.4-0.7\t\nThyroid peroxidase antibodies (IU/mL)\t166\t<16\tSodium (mEq/L)\t128\t138-146\t\n\t\t\tPotassium (mEq/L)\t4.7\t3.6-4.9\t\n\t\t\tChloride (mEq/L)\t93\t99-109\t\n\t\t\tC-reactive protein (mg/dL)\t<0.3\t<0.3\t\n\t\t\tArterial Blood Gas Analysis\t\t\t\n\t\t\tpH\t7.030\t7.350-7.450\t\n\t\t\tPartial pressure of carbon dioxide (mmHg)\t13.4\t35.0-45.0\t\n\t\t\tPartial pressure of oxygen (mmHg)\t160.0\t>75\t\n\t\t\tBicarbonate (mmol/L)\t3.4\t23.0-28.0\t\n\t\t\tBase excess (mmol/L)\t-28.3\t-2.2-1.2\t\nGAD: anti-glutamic acid decarboxylase, IA-2: anti-insulinoma antigen 2\n\nThe clinical course is shown in Figure. She was treated with an intravenous insulin drip and aggressive intravenous fluid therapy. The thyroid storm with GD was treated with intravenous hydrocortisone 100 mg every 8 hours, oral potassium iodine 50 mg every 6 hours, and oral methimazole 20 mg every 6 hours. Since she had a history of asthma, landiolol hydrochloride, a short-acting beta-adrenoceptor blocker, was used at 4-12 μg/kg/min to control her heart rate. By Day 3, her tachycardia had resolved, and landiolol hydrochloride was discontinued. On Day 6, the white blood cell count had decreased to 2,800 cells/mm3 [neutrophils, 44.2% (1,238 cells/mm3)]. Methimazole was discontinued because methimazole-induced neutropenia was suspected. The patient was referred to an endocrine surgeon, and thyroidectomy was performed on Day 32. She was discharged from the hospital on Day 37 and maintained on multiple daily insulin infusion and levothyroxine sodium hydrate.\n\nFigure. The clinical course of the present case. FT3: free triiodothyronine\n\nFurther immunological investigation revealed elevated levels of anti-glutamic acid decarboxylase (GAD) antibody, anti-insulinoma antigen 2 (IA-2) antibody, and insulin autoantibody, consistent with T1D. The intravenous glucagon stimulation test was performed with blood samples for glucose and C-peptide taken at baseline and 6 minutes. Her plasma glucose levels were 139 and 152 mg/dL at baseline and 6 minutes, respectively. The corresponding serum C-peptide levels were 0.8 and 1.3 ng/mL at baseline and 6 minutes, respectively.\n\nDiscussion\nThe incidence of thyroid storm in hospitalized patients in Japan is estimated to be 0.20 per 100,000 per year, with a mortality rate of more than 10.7% (4). The association between autoimmune thyroid diseases and T1D is well known. Thyroid storm is precipitated by many factors, such as the irregular use or discontinuation of anti-thyroid drugs, infection, DKA, surgery, radioiodine therapy, adrenocortical insufficiency, and administration of iodinated contrast medium (5). The discontinuation of anti-thyroid drugs, infection, and DKA, three of the most common triggering factors of thyroid storm in Japan, were suspected as the triggering factors in the current case.\n\nWe performed a PubMed search of the English-language literature using a combination of “thyroid storm AND diabetic ketoacidosis”. Applying the diagnostic criteria of Burch & Wartofsky, a score of 45 or greater was considered to indicate thyroid storm. Eighteen English-language cases, including the present case, were considered to be cases of thyroid storm with DKA (Table 2) (6-20). The mean age of these cases was 37.4 years (male 2; female 16). Five cases (27.8%) were simultaneously diagnosed with GD and diabetes. Four cases (22.2%) had already been diagnosed with diabetes before the onset of GD. Seven cases (38.9%) had already been diagnosed with GD before the onset of diabetes, which was the same chronological order of the onset as the present case. One case (5.6%) had already been diagnosed with GD before the onset of impaired glucose tolerance (IGT). The chronological order of the onset was not mentioned in one case (5.6%).\n\nTable 2. Case Reports of Simultaneous Development of Diabetic Ketoacidosis and Thyroid Storm.\n\nReference\tAge\tSex\tPast history\tDM\tAITD\tAnti-thyroid drug compliance\t\n(6)\t32\tF\tGD\tIGT\tGD\tPoor\t\n(7)\t18\tF\t-\tT1D\tGD\t-\t\n(7)\t31\tF\t-\tT1D\tGD\t-\t\n(8)\t16\tM\tT1D\tT1D\tGD\t-\t\n(9)\t18\tF\tT1D → GD\tT1D\tGD\tPoor\t\n(10)\t48\tM\tT2D, GD\tT2D\tGD\tPoor\t\n(11)\t25\tF\tGD\tT2D\tGD\tNot mentioned\t\n(12)\t27\tF\tGD → T1D\tT1D\tGD\tPoor\t\n(13)\t47\tF\t-\tT1D\tGD\t-\t\n(14)\t29\tF\tGD\tT1D\tGD\tPoor\t\n(15)\t22\tF\tGD → T1D\tT1D\tGD\tPoor\t\n(15)\t18\tF\tGD\tT1D\tGD\tPoor\t\n(16)\t79\tF\tT2D → GD\tT2D\tGD\tPoor\t\n(17)\t56\tF\t-\tT1D\tGD\t-\t\n(18)\t32\tF\tGD\tT1D\tGD\tPoor\t\n(19)\t59\tF\t-\tT2D\tGD\t-\t\n(20)\t71\tF\tT2D\tT2D\tGD\t-\t\nPresent case\t46\tF\tGD\tT1D\tGD\tPoor\t\nM: male, F: female, GD: Graves’ disease, AITD: autoimmune thyroid disease, T1D: type 1 diabetes mellitus, T2D: type 2 diabetes mellitus, IGT: impaired glucose tolerance\n\nT1D → GD; The onset of type 1 diabetes mellitus preceded that of Graves’ disease.\n\nT2D, GD; The chronological order of the onset of type 2 diabetes mellitus and Graves’ disease was not mentioned.\n\nGD → T1D; The onset of Graves’ disease preceded that of type 1 diabetes mellitus.\n\nT2D → GD; The onset of type 2 diabetes mellitus preceded that of Graves’ disease.\n\nThe mean age at onset in the previous five cases in which GD was diagnosed before the onset of T1D was 25.6 years. Therefore, the age of onset in the present case of 46 years seems relatively old. Three of twelve cases with T1D in this literature review showed an age of onset of thyroid storm and DKA over 40 years; this lower number of cases is likely because the age of onset for T1D is generally young. However, the patient in the present study had noticed polydipsia, polyuria, and fatigue approximately four months before admission, when the onset of T1D was suspected.\n\nThe Japan Diabetes Society has proposed the following diagnostic criteria for slowly progressive insulin-dependent (type 1) diabetes mellitus (SPIDDM): the presence of GAD antibodies and/or islet cell autoantibodies at some time during the patient's clinical course and the absence of ketosis or ketoacidosis at the onset (or diagnosis) of diabetes mellitus without the need for insulin treatment to correct hyperglycemia immediately after diagnosis (21). The present case meets the diagnostic criteria of SPIDDM.\n\nWe previously reported the clinical characteristics of APS3v in the Japanese population. Among 30 patients with T1D and GD, 60% developed GD before the onset of T1D, 30% developed GD after the onset of T1D, and 10% developed T1D and GD simultaneously. A remarkable female dominance, a slower onset and older age onset of T1D, and higher prevalence of GAD were observed in APS3v patients compared to patients with T1D without autoimmune thyroid disease (22). Given that the duration from the onset of hyperglycemic symptoms to the initiation of insulin therapy was more than 4 months and that the absolute deficiency of insulin secretion was not suggested by urinary C-peptide and fasting serum C-peptide levels, the T1D in the present case seems to be SPIDDM rather than acute-onset T1D. Thyroid storm and infection might precipitate beta-cell destruction, leading to the need for insulin therapy to manage hyperglycemia starting at the time of diagnosis in patients with SPIDDM.\n\nWhile new-onset T1D or the discontinuation of insulin in cases of established T1D commonly leads to the development of DKA, five cases in the literature review involved type 2 diabetes (T2D), and one case even involved IGT. It is interesting to note that not only T1D but also T2D and IGT, which are insulin-independent, can develop DKA and be the precipitating factor of thyroid storm. Thyroid hormone increases hepatic glucose output, decreases peripheral glucose disposal, increases pancreatic inactive insulin secretion, and increases renal insulin clearance (16). These mechanisms suggest that thyroid storm may affect glucose metabolism and lead to an insulin-dependent situation.\n\nBaharoon et al. also reported H1N1 infection-induced thyroid storm, but the mechanism is not well understood (23). Since infection is one of the most widely-known precipitating factors for DKA, the infection of influenza A might have precipitated both thyroid storm and DKA in the present case. In all but 1 of 11 cases with a known history of GD, including the present case, anti-thyroid drug compliance was reported to be poor; therefore, drug compliance should be checked for patients with a history of GD.\n\nThe neutrophil count in the present case gradually decreased after admission. Methimazole was discontinued because methimazole-induced neutropenia was suspected, and thyroidectomy was performed. However, the administration of granulocyte colony-stimulating factor (G-CSF) may be the treatment of choice before considering thyroidectomy. This is supported by the findings of Dai et al., who reported that G-CSF was effective in the treatment of antithyroid drug-induced agranulocytosis, based on a retrospective analysis of 18 cases (24). Nonetheless, infection due to agranulocytosis should be avoided, because infection complicated with DKA and thyroid storm can be fatal.\n\nIn conclusion, the simultaneous development of thyroid storm and DKA is a relatively uncommon and life-threatening situation. The clinical features of thyroid storm may be masked by DKA and infection, which makes diagnosis a clinical challenge. Nonetheless, it is important to be aware of the possibility of simultaneous development of DKA and thyroid storm in patients with a history of GD, since APS3v may be present. In addition, patients who have relatively preserved insulin secretion can develop DKA if thyroid storm and infection develop simultaneously.\n\nThe authors state that they have no Conflict of Interest (COI).\n==== Refs\n1. \nRoth RN , McAuliffe MJ \nHyperthyroidism and thyroid storm . Emerg Med Clin North Am \n7 : 873 -883 , 1989 .2680469 \n2. \nKitabchi AE , Umpierrez GE , Miles JM , Fisher JN \nHyperglycemic crises in adult patients with diabetes . Diabetes Care \n32 : 1335 -1343 , 2009 .19564476 \n3. \nHuber A , Menconi F , Corathers S , Jacobson EM , Tomer Y \nJoint genetic susceptibility to type 1 diabetes and autoimmune thyroiditis: from epidemiology to mechanisms . Endocr Rev \n29 : 697 -725 , 2008 .18776148 \n4. \nAkamizu T , Satoh T , Isozaki O , et al \nDiagnostic criteria, clinical features, and incidence of thyroid storm based on nationwide surveys . Thyroid \n22 : 661 -679 , 2012 .22690898 \n5. \nBurch HB , Wartofsky L \nLife-threatening thyrotoxicosis. Thyroid storm . Endocrinol Metab Clin North Am \n22 : 263 -277 , 1993 .8325286 \n6. \nHanscom DH , Ryan RJ \nThyrotoxic crisis and diabetic ketoacidosis; report of a case . N Engl J Med \n257 : 697 -701 , 1957 .13477373 \n7. \nBridgman JF , Pett S \nSimultaneous presentation of thyrotoxic crisis and diabetic ketoacidosis . Postgrad Med J \n56 : 354 -355 , 1980 .6777765 \n8. \nMayfield RK , Sagel J , Colwell JA \nThyrotoxicosis without elevated serum triiodothyronine levels during diabetic ketoacidosis . Arch Intern Med \n140 : 408 -410 , 1980 .6767458 \n9. \nAhmad N , Cohen MP \nThyroid storm with normal serum triiodothyronine level during diabetic ketoacidosis . JAMA \n245 : 2516 -2517 , 1981 .6785464 \n10. \nKunishige M , Sekimoto E , Komatsu M , Bando Y , Uehara H , Izumi K \nThyrotoxicosis masked by diabetic ketoacidosis: a fatal complication . Diabetes Care \n24 : 171 , 2001 .\n11. \nLee HL , Yu E , Guo HR \nSimultaneous presentation of thyroid storm and diabetic ketoacidosis . Am J Emerg Med \n19 : 603 -604 , 2001 .11699014 \n12. \nSola E , Morillas C , Garzon S , Gomez-Balaguer M , Hernandez-Mijares A \nAssociation between diabetic ketoacidosis and thyrotoxicosis . Acta Diabetol \n39 : 235 -237 , 2002 .12486499 \n13. \nLim D , Lunt H , Ojala R , Turner J \nSimultaneous presentation of Type 1 diabetes and thyrotoxicosis as a medical emergency . N Z Med J \n117 : U775 , 2004 .15014564 \n14. \nLin CH , Chen SC , Lee CC , Ko PC , Chen WJ \nThyroid storm concealing diabetic ketoacidosis leading to cardiac arrest . Resuscitation \n63 : 345 -347 , 2004 .\n15. \nYeo KF , Yang YS , Chen KS , Peng CH , Huang CN \nSimultaneous presentation of thyrotoxicosis and diabetic ketoacidosis resulted in sudden cardiac arrest . Endocr J \n54 : 991 -993 , 2007 .18048992 \n16. \nPotenza M , Via MA , Yanagisawa RT \nExcess thyroid hormone and carbohydrate metabolism . Endocr Pract \n15 : 254 -262 , 2009 .19364696 \n17. \nAhmad FA , Mukhopadhyay B \nSimultaneous presentation of type 1 diabetes and Graves' disease . Scott Med J \n56 : 59 , 2011 .\n18. \nGupta S , Kandpal SB \nCase report: storm and acid, together.. . ! Am J Med Sci \n342 : 533 -534 , 2011 .21817875 \n19. \nOsada E , Hiroi N , Sue M , et al \nThyroid storm associated with Graves' disease covered by diabetic ketoacidosis: a case report . Thyroid Res \n4 : 8 , 2011 .21492449 \n20. \nEliades M , El-Maouche D , Choudhary C , Zinsmeister B , Burman KD \nTakotsubo cardiomyopathy associated with thyrotoxicosis: a case report and review of the literature . Thyroid \n24 : 383 -389 , 2014 .23560557 \n21. \nTanaka S , Ohmori M , Awata T , et al \nDiagnostic criteria for slowly progressive insulin-dependent (type 1) diabetes mellitus (SPIDDM) (2012): report by the Committee on Slowly Progressive Insulin-Dependent (Type 1) Diabetes Mellitus of the Japan Diabetes Society . Diabetol Int \n6 : 1 -7 , 2015 .\n22. \nHorie I , Kawasaki E , Ando T , et al \nClinical and genetic characteristics of autoimmune polyglandular syndrome type 3 variant in the Japanese population . J Clin Endocrinol Metab \n97 : E1043 -E1050 , 2012 .22466347 \n23. \nBaharoon SA \nH1N1 infection-induced thyroid storm . Ann Thorac Med \n5 : 110 -112 , 2010 .20582177 \n24. \nDai WX , Zhang JD , Zhan SW , et al \nRetrospective analysis of 18 cases of antithyroid drug (ATD)-induced agranulocytosis . Endocr J \n49 : 29 -33 , 2002 .12008747\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0918-2918",
"issue": "56(2)",
"journal": "Internal medicine (Tokyo, Japan)",
"keywords": null,
"medline_ta": "Intern Med",
"mesh_terms": "D000284:Administration, Oral; D013956:Antithyroid Agents; D016883:Diabetic Ketoacidosis; D003937:Diagnosis, Differential; D005260:Female; D005440:Fluid Therapy; D006111:Graves Disease; D006801:Humans; D007251:Influenza, Human; D007262:Infusions, Intravenous; D007328:Insulin; D008713:Methimazole; D008875:Middle Aged; D013958:Thyroid Crisis; D013965:Thyroidectomy",
"nlm_unique_id": "9204241",
"other_id": null,
"pages": "181-185",
"pmc": null,
"pmid": "28090049",
"pubdate": "2017",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "8325286;12486499;15582771;19564476;23560557;13477373;22690898;11699014;20582177;19364696;2680469;6785464;6777765;11194224;15014564;21492449;12008747;21817875;18776148;22466347;6767458;18048992;21515537",
"title": "Thyroid Storm Precipitated by Diabetic Ketoacidosis and Influenza A: A Case Report and Literature Review.",
"title_normalized": "thyroid storm precipitated by diabetic ketoacidosis and influenza a a case report and literature review"
} | [
{
"companynumb": "JP-SUN PHARMACEUTICAL INDUSTRIES LTD-2017R1-133989",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": null,
"drugadditional": null,
"drugadministrationroute": ... |
{
"abstract": "BACKGROUND\nData on combination-biologic treatment in (IBD) are still scant.\n\n\nOBJECTIVE\nTo explore outcomes of patients co-exposed to anti-TNF and vedolizumab.\n\n\nMETHODS\nPatients starting vedolizumab having measurable anti-TNF levels after recently stopping adalimumab/infliximab ('VDZ-aTNF' group), were compared with control vedolizumab patients in a retrospective 1:2 matched case-control study.\n\n\nRESULTS\nSeventy-five patients were included (25 VDZ-aTNF, 50 VDZ). Adverse events were experienced by 9/25 VDZ-aTNF compared to 13/50 VDZ patients (P = 0.4, follow-up 14 weeks in all). Week 14 clinical remission was attained in 10/25 (40%) of VDZ-aTNF patients versus 23/50 (46%) of VDZ patients (OR = 0.8, 95% CI 0.3-2.1, P = 0.6) and clinical response in 19/25 (76%) versus 39/50 (78%) respectively (OR = 0.9, 95% CI 0.3-2.7, P = 0.8). Corticosteroid-free remission and corticosteroid-free response were experienced by 30% and 54%, respectively, of the entire cohort, and were similar between the two groups. Vedolizumab drug concentrations at week 2, 6 and 14 were similar among VDZ-aTNF and VDZ patients (P > 0.5). Multi-variable analysis showed independent association of some vedolizumab drug-levels time-points with baseline albumin and weight, but not with anti-TNF co-exposure. In a prospective study of a separate cohort of patients starting infliximab (n = 12), the percentage of α4β7+ memory T cells, slightly but nonsignificantly increased throughout weeks 0, 2 to 14 (26 ± 2.3%, 27.8 ± 2.9%, 29.5 ± 2.6% respectively, P = 0.06).\n\n\nCONCLUSIONS\nVedolizumab/anti-TNF co-exposure did not generate new safety signals during 14-weeks induction, nor did it reduce efficacy or alter vedolizumab pharmacokinetics. These observations may aid the design of future co-biologics trials and also suggest that a deliberate waiting-interval between anti-TNF cessation and subsequent vedolizumab initiation may not be warranted.",
"affiliations": "Department of Gastroenterology, Sackler School of Medicine, Sheba Medical Center Tel Hashomer, Tel-Aviv University, Tel Aviv, Israel.;Department of Gastroenterology, Sackler School of Medicine, Sheba Medical Center Tel Hashomer, Tel-Aviv University, Tel Aviv, Israel.;Department of Gastroenterology, Sackler School of Medicine, Sheba Medical Center Tel Hashomer, Tel-Aviv University, Tel Aviv, Israel.;Department of Gastroenterology, Sackler School of Medicine, Sheba Medical Center Tel Hashomer, Tel-Aviv University, Tel Aviv, Israel.;Department of Gastroenterology, Sackler School of Medicine, Sheba Medical Center Tel Hashomer, Tel-Aviv University, Tel Aviv, Israel.;Department of Gastroenterology, Sackler School of Medicine, Sheba Medical Center Tel Hashomer, Tel-Aviv University, Tel Aviv, Israel.;Department of Gastroenterology, Sackler School of Medicine, Sheba Medical Center Tel Hashomer, Tel-Aviv University, Tel Aviv, Israel.;Cardiology Department, Sheba Medical Center & Tel-Aviv University, Israel.;Department of Gastroenterology, Sackler School of Medicine, Sheba Medical Center Tel Hashomer, Tel-Aviv University, Tel Aviv, Israel.;Department of Gastroenterology, University Hospital of Saint Etienne, Saint Etienne, France.;Department of Gastroenterology, University Hospital of Saint Etienne, Saint Etienne, France.;Department of Gastroenterology, University Hospital of Saint Etienne, Saint Etienne, France.",
"authors": "Ben-Horin|S|S|0000-0002-3984-4580;Ungar|B|B|0000-0002-6078-2249;Kopylov|U|U|0000-0002-7156-0588;Lahat|A|A|0000-0003-1513-7280;Yavzori|M|M|;Fudim|E|E|;Picard|O|O|;Peled|Y|Y|;Eliakim|R|R|;Del Tedesco|E|E|;Paul|S|S|0000-0002-8830-4273;Roblin|X|X|0000-0002-7929-4878",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D005765:Gastrointestinal Agents; D014409:Tumor Necrosis Factor-alpha; C543529:vedolizumab; D000069285:Infliximab; D000068879:Adalimumab",
"country": "England",
"delete": false,
"doi": "10.1111/apt.14567",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0269-2813",
"issue": "47(8)",
"journal": "Alimentary pharmacology & therapeutics",
"keywords": null,
"medline_ta": "Aliment Pharmacol Ther",
"mesh_terms": "D000068879:Adalimumab; D000328:Adult; D061067:Antibodies, Monoclonal, Humanized; D016022:Case-Control Studies; D005260:Female; D005765:Gastrointestinal Agents; D006801:Humans; D015212:Inflammatory Bowel Diseases; D000069285:Infliximab; D008297:Male; D008875:Middle Aged; D014409:Tumor Necrosis Factor-alpha",
"nlm_unique_id": "8707234",
"other_id": null,
"pages": "1117-1125",
"pmc": null,
"pmid": "29446098",
"pubdate": "2018-04",
"publication_types": "D018848:Controlled Clinical Trial; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Safety, efficacy and pharmacokinetics of vedolizumab in patients with simultaneous exposure to an anti-tumour necrosis factor.",
"title_normalized": "safety efficacy and pharmacokinetics of vedolizumab in patients with simultaneous exposure to an anti tumour necrosis factor"
} | [
{
"companynumb": "IL-TAKEDA-2018TUS014709",
"fulfillexpeditecriteria": "1",
"occurcountry": "IL",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": null,
... |
{
"abstract": "Delayed neurological deterioration after hypoxia is uncommon. Here we report a case of reversible delayed leukoencephalopathy following intravenous heroin intoxication with hypoxia. A 42-year-old man presented disturbed consciousness and unstable hemodynamic status after intravenous heroin injection. He made a good initial recovery after infection control and hemodynamic support. But his neurological condition deteriorated later on and gradually progressed into akinetic mutism and generalized hypertonia within 3 weeks. Prominent leukoencephalopathy was disclosed by magnetic resonance imaging (MRI) of the brain. His general condition improved again in a few months and follow-up MRI revealed regression of the white matter lesion. Early diagnosis of delayed leukoencephalopathy with appropriate supportive treatment may be worthwhile as illustrated by the reported case.",
"affiliations": "Division of Neurology, Department of Internal Medicine, Chi Mei Medical Center, Liouying, Taiwan.",
"authors": "Chang|Wei-Lun|WL|;Chang|Yu-Kang|YK|;Hsu|Sen-Yen|SY|;Lin|Gua-Jang|GJ|;Chen|Shih-Cheng|SC|",
"chemical_list": null,
"country": "China (Republic : 1949- )",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1028-768X",
"issue": "18(3)",
"journal": "Acta neurologica Taiwanica",
"keywords": null,
"medline_ta": "Acta Neurol Taiwan",
"mesh_terms": "D000328:Adult; D001921:Brain; D006556:Heroin Dependence; D006801:Humans; D000860:Hypoxia; D056784:Leukoencephalopathies; D008279:Magnetic Resonance Imaging; D008297:Male",
"nlm_unique_id": "9815355",
"other_id": null,
"pages": "198-202",
"pmc": null,
"pmid": "19960964",
"pubdate": "2009-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Reversible delayed leukoencephalopathy after heroin intoxication with hypoxia: a case report.",
"title_normalized": "reversible delayed leukoencephalopathy after heroin intoxication with hypoxia a case report"
} | [
{
"companynumb": "TW-SPECGX-T202201391",
"fulfillexpeditecriteria": "1",
"occurcountry": "TW",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHADONE HYDROCHLORIDE"
},
"drugadditional": "3",... |
{
"abstract": "Medication-related osteonecrosis of the jaws (MRONJ) is a well-known complication that, in the majority of cases, is related to antiresorptive agents. Numerous articles have described cases of MRONJ in bisphosphonate-naïve patients treated with anti-angiogenic agents administered via various routes. A single case of MRONJ after intravitreal injection of bevacizumab has been reported. We report a case of MRONJ after intravitreal injection of a different anti-angiogenic agent - ranibizumab - for the treatment of neovascular age-related macular degeneration, in a bisphosphonate-naïve patient. Although it may be a rare complication, patients treated with multiple doses of anti-angiogenic agents should be monitored for the possible early diagnosis of MRONJ.",
"affiliations": "Department of Otolaryngology, Head and Neck Surgery and Maxillofacial Surgery, Tel Aviv Sourasky Medical Center, Tel Aviv, Israel.;Department of Otolaryngology, Head and Neck Surgery and Maxillofacial Surgery, Tel Aviv Sourasky Medical Center, Tel Aviv, Israel; Institute of Pathology, Tel Aviv Sourasky Medical Center, Tel Aviv, Israel; Sackler School of Medicine, Tel Aviv University, Tel Aviv, Israel.;Department of Otolaryngology, Head and Neck Surgery and Maxillofacial Surgery, Tel Aviv Sourasky Medical Center, Tel Aviv, Israel.;Department of Otolaryngology, Head and Neck Surgery and Maxillofacial Surgery, Tel Aviv Sourasky Medical Center, Tel Aviv, Israel.;Department of Otolaryngology, Head and Neck Surgery and Maxillofacial Surgery, Tel Aviv Sourasky Medical Center, Tel Aviv, Israel; Department of Oral and Maxillofacial Surgery, Goldschleger School of Dental Medicine, Tel Aviv University, Tel Aviv, Israel. Electronic address: amirshu@tlvmc.gov.il.",
"authors": "Oz|I|I|;Kaplan|I|I|;Kleinman|S|S|;Arbel|S|S|;Shuster|A|A|",
"chemical_list": "D020533:Angiogenesis Inhibitors; D050071:Bone Density Conservation Agents; D000068258:Bevacizumab; D000069579:Ranibizumab",
"country": "Denmark",
"delete": false,
"doi": "10.1016/j.ijom.2020.05.017",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0901-5027",
"issue": "49(12)",
"journal": "International journal of oral and maxillofacial surgery",
"keywords": "Anti-angiogenic agent; MRONJ; Ranibizumab",
"medline_ta": "Int J Oral Maxillofac Surg",
"mesh_terms": "D020533:Angiogenesis Inhibitors; D000068258:Bevacizumab; D059266:Bisphosphonate-Associated Osteonecrosis of the Jaw; D050071:Bone Density Conservation Agents; D006801:Humans; D058449:Intravitreal Injections; D010020:Osteonecrosis; D000069579:Ranibizumab",
"nlm_unique_id": "8605826",
"other_id": null,
"pages": "1589-1591",
"pmc": null,
"pmid": "32616306",
"pubdate": "2020-12",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Medication-related osteonecrosis of the jaws associated with intravitreal administration of ranibizumab.",
"title_normalized": "medication related osteonecrosis of the jaws associated with intravitreal administration of ranibizumab"
} | [
{
"companynumb": "IL-ROCHE-2637151",
"fulfillexpeditecriteria": "1",
"occurcountry": "IL",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BEVACIZUMAB"
},
"drugadditional": "3",
"drug... |
{
"abstract": "Angiotensin II type 1 receptor (AT1R) antibody, a non-HLA antibody, has been found to have a detrimental effect on kidney allografts. Similarly to HLA antibodies, recipients who have AT1R antibodies are at risk for allograft rejection and poor long-term graft outcome. Besides mediating allograft rejections via direct effects on endothelial and vascular smooth muscle without complement activation, AT1R antibodies may lead to accelerated hypertension via the renin-angiotensin pathway. There has been no definite level of AT1R antibody that predicts allograft rejection. Because of a low incidence of AT1R antibody-associated rejection, there are few reports on specific treatment. The results of conventional treatment, which aims to remove these pathologic antibodies similarly to the treatment of HLA antibody-associated rejection, have been unsatisfactory. Some studies recommend using angiotensin receptor blocker to attenuate the adverse effects of AT1R antibody on kidney allograft. Herein we present a kidney transplant recipient with AT1R antibody-associated refractory allograft rejection who was successfully treated with the use of steroid, plasmapheresis, intravenous immunoglobulin, and rituximab.",
"affiliations": "Division of Nephrology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University Bangkok, Thailand. Electronic address: punlop.wiw@mahidol.ac.th.;Section for Clinical Epidemiology and Biostatistics, Faculty of Medicine, Ramathibodi Hospital, Mahidol University, Bangkok, Thailand.;Histocompatibility and Immunogenetics Laboratory, Department of Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University, Bangkok, Thailand.;Immunopathology Laboratory, Department of Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University, Bangkok, Thailand.",
"authors": "Wiwattanathum|P|P|;Ingsathit|A|A|;Thammanichanond|D|D|;Worawichawong|S|S|",
"chemical_list": "D001323:Autoantibodies; D016756:Immunoglobulins, Intravenous; D044140:Receptor, Angiotensin, Type 1; D013256:Steroids",
"country": "United States",
"delete": false,
"doi": "10.1016/j.transproceed.2017.11.027",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-1345",
"issue": "50(3)",
"journal": "Transplantation proceedings",
"keywords": null,
"medline_ta": "Transplant Proc",
"mesh_terms": "D001323:Autoantibodies; D006084:Graft Rejection; D006801:Humans; D016756:Immunoglobulins, Intravenous; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D010956:Plasmapheresis; D044140:Receptor, Angiotensin, Type 1; D013256:Steroids",
"nlm_unique_id": "0243532",
"other_id": null,
"pages": "877-880",
"pmc": null,
"pmid": "29331505",
"pubdate": "2018-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Successful Treatment of Anti-angiotensin II Type 1 Receptor Antibody-Associated Rejection in Kidney Transplantation: A Case Report.",
"title_normalized": "successful treatment of anti angiotensin ii type 1 receptor antibody associated rejection in kidney transplantation a case report"
} | [
{
"companynumb": "TH-ALKEM LABORATORIES LIMITED-TH-ALKEM-2018-03475",
"fulfillexpeditecriteria": "1",
"occurcountry": "TH",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "MYCOPHENOLATE MOFETIL"
},
... |
{
"abstract": "The first-line treatment of glioblastoma typically consists of a maximal surgical resection, followed by a combination of radio-chemotherapy with temozolomide. There is however no consensus regarding optimal therapeutic approaches at relapse. The following phase II study explored the therapeutic gain obtained when exposing these patients to a combination of intra-arterially administered carboplatin and melphalan at first or second relapse as a salvage treatment in recurrent glioblastoma. Fifty-one consecutive patients diagnosed with glioblastoma were accrued and offered this treatment at first or second relapse. A Karnofsky score of ≥ 60 was required, and when appropriate, patients were first reoperated prior to accrual. Patients enrolled were treated every 4 weeks (1 cycle) for up to 12 cycles. Progression was evaluated by Macdonald criteria. Primary end point surrogates were overall survival from diagnosis and study entry. Median survival from diagnosis and study entry was 23 and 11 months, respectively. The median time to progression was 5.2 months. All patients enrolled were treated for a minimum of 2 cycles. Hematologic toxicity was manageable, with an 8 % of grade II neutropenia, 12 % of grade II thrombocytopenia and 7 % of grade III thrombocytopenia. This therapeutic strategy represents an adequate option in the second-line treatment of recurrent glioblastoma. The adjunction of an osmotic permeabilization could be considered to further expand delivery, and hopefully improve survival in these patients.",
"affiliations": "Division of Neurosurgery and Neuro-Oncology, Faculté de médecine et des sciences de la santé, Université de Sherbrooke, 3001, 12th Avenue North, Sherbrooke, QC, J1H 5N4, Canada, david.fortin@usherbrooke.ca.",
"authors": "Fortin|David|D|;Morin|Pierre-Aurèle|PA|;Belzile|Francois|F|;Mathieu|David|D|;Paré|Francois-Michel|FM|",
"chemical_list": "D000970:Antineoplastic Agents; D016190:Carboplatin",
"country": "United States",
"delete": false,
"doi": "10.1007/s11060-014-1504-4",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0167-594X",
"issue": "119(2)",
"journal": "Journal of neuro-oncology",
"keywords": null,
"medline_ta": "J Neurooncol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000970:Antineoplastic Agents; D001921:Brain; D001932:Brain Neoplasms; D016190:Carboplatin; D018572:Disease-Free Survival; D005260:Female; D005909:Glioblastoma; D006801:Humans; D007261:Infusions, Intra-Arterial; D053208:Kaplan-Meier Estimate; D017567:Karnofsky Performance Status; D008279:Magnetic Resonance Imaging; D008297:Male; D008875:Middle Aged; D011446:Prospective Studies; D016879:Salvage Therapy; D013997:Time Factors; D016896:Treatment Outcome",
"nlm_unique_id": "8309335",
"other_id": null,
"pages": "397-403",
"pmc": null,
"pmid": "24947313",
"pubdate": "2014-09",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "17211866;17198973;22284691;12587794;21086192;16710748;9588554;8301375;14612899;7641197;15880378;22407251;10649259;5046750;15758009;17465237;1823343;24355810;18756530;10885607;21400119;16193381;19846986;10820358;20541421;9870058;18446517;15582786;22440873;2541513;21997879;16371949;22259689;22229251;21163583;9304534;17803026;21791942;10360481;11870182;19937839;17363519;16525182",
"title": "Intra-arterial carboplatin as a salvage strategy in the treatment of recurrent glioblastoma multiforme.",
"title_normalized": "intra arterial carboplatin as a salvage strategy in the treatment of recurrent glioblastoma multiforme"
} | [
{
"companynumb": "CA-CIPLA LTD.-2014CA01312",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugadditional": null,
... |
{
"abstract": "Bevacizumab, a humanized monoclonal antibody against vascular endothelial growth factor (VEGF), is an angiogenesis inhibitor used to treat a variety of cancers, including lung, colon, cervical, ovarian, and renal cancers as well as glioblastoma. A significant adverse effect associated with its use is one of thromboembolic events. We report a case of a 74-year-old male with diagnosis of glioblastoma multiforme treated with partial resection, radiation, temozolomide, and bevacizumab. He presented to a plastic surgeon with a several week history of asymptomatic crusted hemorrhagic ulcers and purpuric patches on the lower legs shortly following the initiation of bevacizumab. A biopsy showed an occlusive pauci-inflammatory thrombogenic vasculopathy associated with ischemic epidermal and dermal changes and accompanied by extensive vascular C5b-9 (complement C5b-9 membrane attack complex) deposition. Bevacizumab has been associated with thrombotic complications including atypical hemolytic uremic syndrome and arterial and venous thrombosis. C5b-9 may be the factor most important in the mechanism of vascular thrombosis given the extent of deposition in our index case. Thrombotic events in the skin associated with bevacizumab therapy are without precedent and dermatologists should be aware of this potential complication.",
"affiliations": "Weill Cornell Medical College; Memorial Sloan-Kettering Cancer Center.",
"authors": "Kiuru|Maija|M|;Schwartz|Mark|M|;Magro|Cynthia|C|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D042461:Vascular Endothelial Growth Factor A; D000068258:Bevacizumab",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1087-2108",
"issue": "20(6)",
"journal": "Dermatology online journal",
"keywords": null,
"medline_ta": "Dermatol Online J",
"mesh_terms": "D000368:Aged; D061067:Antibodies, Monoclonal, Humanized; D000068258:Bevacizumab; D003875:Drug Eruptions; D005909:Glioblastoma; D006801:Humans; D008297:Male; D012883:Skin Ulcer; D013927:Thrombosis; D042461:Vascular Endothelial Growth Factor A",
"nlm_unique_id": "9610776",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "24945646",
"pubdate": "2014-06-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Cutaneous thrombogenic vasculopathy associated with bevacizumab therapy.",
"title_normalized": "cutaneous thrombogenic vasculopathy associated with bevacizumab therapy"
} | [
{
"companynumb": "US-ROCHE-1513588",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BEVACIZUMAB"
},
"drugadditional": "3",
"drug... |
{
"abstract": "The role of epidermal growth factor receptor (EGFR) inhibition in chemoradiation strategies in the nonoperative treatment of patients with esophageal cancer remains uncertain.\nTo evaluate the benefit of cetuximab added to concurrent chemoradiation therapy for patients undergoing nonoperative treatment of esophageal carcinoma.\nA National Cancer Institute (NCI) sponsored, multicenter, phase 3, randomized clinical trial open to patients with biopsy-proven carcinoma of the esophagus. The study accrued 344 patients from 2008 to 2013.\nPatients were randomized to weekly concurrent cisplatin (50 mg/m2), paclitaxel (25 mg/m2), and daily radiation of 50.4 Gy/1.8 Gy fractions with or without weekly cetuximab (400 mg/m2 on day 1 then 250 mg/m2 weekly).\nOverall survival (OS) was the primary endpoint, with a study designed to detect an increase in 2-year OS from 41% to 53%; 80% power and 1-sided α = .025.\nBetween June 30, 2008, and February 8, 2013, 344 patients were enrolled. This analysis used all data received at NRG Oncology through April 12, 2015. Sixteen patients were ineligible, resulting in 328 evaluable patients, 159 in the experimental arm and 169 in the control arm. Patients were well matched between the treatment arms for patient and tumor characteristics: 263 (80%) with T3 or T4 disease, 215 (66%) N1, and 62 (19%) with celiac nodal involvement. Incidence of grade 3, 4, or 5 treatment-related adverse events at any time was 71 (46%), 35 (23%), or 6 (4%) in the experimental arm and 83 (50%), 28 (17%), or 2 (1%) in the control arm, respectively. A clinical complete response (cCR) rate of 81 (56%) was observed in the experimental arm vs 92 (58%) in the control arm (Fisher exact test, P = .66). No differences were seen in cCR between treatment arms for either histology (adenocarcinoma or squamous cell). Median follow-up for all patients was 18.6 months. The 24- and 36-month local failure for the experimental arm was 47% (95% CI, 38%-57%) and 49% (95% CI, 40%-59%) vs 49% (95% CI, 41%-58%) and 49% (95% CI, 41%-58%) for the control arm (HR, 0.92; 95% CI, 0.66-1.28; P = .65). The 24- and 36-month OS rates for the experimental arm were 45% (95% CI, 37%-53%) and 34% (95% CI, 26%-41%) vs 44% (95% CI, 36%-51%) and 28% (95% CI, 21%-35%) for the control arm (HR, 0.90; 95% CI, 0.70-1.16; P = .47).\nThe addition of cetuximab to concurrent chemoradiation did not improve OS. These phase 3 trial results point to little benefit to current EGFR-targeted agents in an unselected patient population, and highlight the need for predictive biomarkers in the treatment of esophageal cancer.\nclinicaltrials.gov Identifier: NCT00655876.",
"affiliations": "University of Maryland Medical System, Baltimore.;NRG Oncology Statistics and Data Management Center, Philadelphia, Pennsylvania.;Memorial Sloan-Kettering Cancer Center, New York City, New York.;Thomas Jefferson University Hospital, Philadelphia, Pennsylvania.;Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, Tennessee.;The Chester County Hospital, West Chester, Pennsylvania.;Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, Tennessee.;Huntsman Cancer Hospital, University of Utah, Salt Lake City.;MBCCOP, John H. Stroger Jr Hospital of Cook County, Chicago, Illinois.;University of Maryland Medical System, Baltimore.;Department of Oncology, USON-Texas, Bedford, Texas.;Shadyside Hospital, University of Pittsburgh Medical Center, Pittsburgh, Pennsylvania.;Christiana Care Health Services Inc, CCOP, Newark, Delaware.;Greenville South Carolina, CCOP, Greenville.;Southeast Cancer Control Consortium Inc, CCOP, Winston Salem, North Carolina.;Cleveland Clinic, Cleveland, Ohio.;The Schiffler Cancer Center, Wheeling, West Virginia.;Brown University Oncology Group, Providence, Rhode Island.;Memorial Sloan-Kettering Cancer Center, New York City, New York.",
"authors": "Suntharalingam|Mohan|M|;Winter|Kathryn|K|;Ilson|David|D|;Dicker|Adam P|AP|;Kachnic|Lisa|L|;Konski|André|A|;Chakravarthy|A Bapsi|AB|;Anker|Christopher J|CJ|;Thakrar|Harish|H|;Horiba|Naomi|N|;Dubey|Ajay|A|;Greenberger|Joel S|JS|;Raben|Adam|A|;Giguere|Jeffrey|J|;Roof|Kevin|K|;Videtic|Gregory|G|;Pollock|Jondavid|J|;Safran|Howard|H|;Crane|Christopher H|CH|",
"chemical_list": "C512478:EGFR protein, human; D066246:ErbB Receptors; D017239:Paclitaxel; D000068818:Cetuximab; D002945:Cisplatin",
"country": "United States",
"delete": false,
"doi": "10.1001/jamaoncol.2017.1598",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2374-2437",
"issue": "3(11)",
"journal": "JAMA oncology",
"keywords": null,
"medline_ta": "JAMA Oncol",
"mesh_terms": "D000230:Adenocarcinoma; D000368:Aged; D000369:Aged, 80 and over; D000971:Antineoplastic Combined Chemotherapy Protocols; D002294:Carcinoma, Squamous Cell; D000068818:Cetuximab; D059248:Chemoradiotherapy; D002945:Cisplatin; D019583:Dose Fractionation, Radiation; D004334:Drug Administration Schedule; D066246:ErbB Receptors; D004938:Esophageal Neoplasms; D000077277:Esophageal Squamous Cell Carcinoma; D005260:Female; D006801:Humans; D053208:Kaplan-Meier Estimate; D008297:Male; D008875:Middle Aged; D009367:Neoplasm Staging; D017239:Paclitaxel; D016016:Proportional Hazards Models; D013997:Time Factors; D016896:Treatment Outcome",
"nlm_unique_id": "101652861",
"other_id": null,
"pages": "1520-1528",
"pmc": null,
"pmid": "28687830",
"pubdate": "2017-11-01",
"publication_types": "D017428:Clinical Trial, Phase III; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial",
"references": "23623280;17704421;24243140;11432164;10078631;10213503;7082756;19052812;4612056;16618717;23594787;10235156;1584260;12174341;19897418;5910392;22646630;25154822;24399786;24492674;18202412;17980508",
"title": "Effect of the Addition of Cetuximab to Paclitaxel, Cisplatin, and Radiation Therapy for Patients With Esophageal Cancer: The NRG Oncology RTOG 0436 Phase 3 Randomized Clinical Trial.",
"title_normalized": "effect of the addition of cetuximab to paclitaxel cisplatin and radiation therapy for patients with esophageal cancer the nrg oncology rtog 0436 phase 3 randomized clinical trial"
} | [
{
"companynumb": "US-PFIZER INC-2017305098",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CETUXIMAB"
},
"drugadditional": null,
... |
{
"abstract": "Thirteen leukemic patients with disease refractory to conventional chemotherapy were treated with 1.0 to 7.5 g/m2 of Cytosine Arabinoside (Ara-C) over 29 drug cycles. Drug infusions were spaced at 12-hour intervals; a maximum of four doses was administered over 36 hours. After single dose tolerance had been established, three or four dose cycles were given at 2- to 30-day intervals. There were three partial remissions (PR) and one complete remission (CR) in a treatment group of four patients with AML, five with ALL, two with lymphoma converted to leukemic phase, one CML in blast crisis, and one promyelocytic leukemia. Five of the patients were septic and considered terminally ill at the time of treatment. All other patients had evidence of drug responsiveness. The nadir of the white count occurred from 3 to 12 days after treatment, with subsequent recovery of the peripheral granulocyte count between days 12 and 28. Toxicity included nausea and vomiting (GI symptoms) in twelve patients, central nervous system (CNS) disturbances in eight patients, one episode of inappropriate antidiuretic hormone syndromes (SIADH), one of hyperuricemia, and fever in eleven patients. There was no evidence of hepatic or renal dysfunction. These high doses of Ara-C appear useful for treatment of patients with refractory leukemia. Hospitalization is brief and toxicity acceptable.",
"affiliations": null,
"authors": "Rudnick|S A|SA|;Cadman|E C|EC|;Capizzi|R L|RL|;Skeel|R T|RT|;Bertino|J R|JR|;McIntosh|S|S|",
"chemical_list": "D000970:Antineoplastic Agents; D003561:Cytarabine",
"country": "United States",
"delete": false,
"doi": "10.1002/1097-0142(197910)44:4<1189::aid-cncr2820440404>3.0.co;2-o",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0008-543X",
"issue": "44(4)",
"journal": "Cancer",
"keywords": null,
"medline_ta": "Cancer",
"mesh_terms": "D000208:Acute Disease; D000293:Adolescent; D000328:Adult; D000970:Antineoplastic Agents; D002490:Central Nervous System; D002648:Child; D002675:Child, Preschool; D003561:Cytarabine; D004064:Digestive System; D004351:Drug Resistance; D005260:Female; D006801:Humans; D007263:Infusions, Parenteral; D007938:Leukemia; D008297:Male; D008875:Middle Aged; D012075:Remission, Spontaneous; D013997:Time Factors",
"nlm_unique_id": "0374236",
"other_id": null,
"pages": "1189-93",
"pmc": null,
"pmid": "498009",
"pubdate": "1979-10",
"publication_types": "D016428:Journal Article; D013487:Research Support, U.S. Gov't, P.H.S.",
"references": null,
"title": "High dose cytosine arabinoside (HDARAC) in refractory acute leukemia.",
"title_normalized": "high dose cytosine arabinoside hdarac in refractory acute leukemia"
} | [
{
"companynumb": "US-MYLANLABS-2014M1013209",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "CYTARABINE"
},
"drugadditional": null,
... |
{
"abstract": "Thirteen patients who were treated with cephem antibiotics developed blood coagulation disorders due to vitamin K deficiency. At the time of detection of prolongation of the prothrombin time, cefazolin was being administered in four cases, cefmetazole and latamoxef (moxalactam) in three cases each, and cefoperazone, cefpiramide and ceftazidime in one case each. Bleeding occurred in ten patients, but administration of vitamin K rapidly eliminated the prothrombin time prolongation and the haemorrhagic tendency. To date, we have not detected prothrombin time prolongation or a haemorrhagic tendency with cefotaxime, ceftizoxime, cefotiam, cefoxitin or cefsulodin. Thus, different cephem antibiotics show different effects on the prothrombin time.",
"affiliations": null,
"authors": "Shimada|K|K|;Matsuda|T|T|;Inamatsu|T|T|;Urayama|K|K|",
"chemical_list": "D001779:Blood Coagulation Factors; D002511:Cephalosporins; D002513:Cephamycins; D014812:Vitamin K; D015311:Cefmetazole; D002438:Cefoperazone; D002442:Ceftazidime; D002437:Cefazolin; C036666:cefpiramide; D009070:Moxalactam",
"country": "England",
"delete": false,
"doi": "10.1093/jac/14.suppl_b.325",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0305-7453",
"issue": "14 Suppl B()",
"journal": "The Journal of antimicrobial chemotherapy",
"keywords": null,
"medline_ta": "J Antimicrob Chemother",
"mesh_terms": "D000368:Aged; D001419:Bacteria; D001779:Blood Coagulation Factors; D002437:Cefazolin; D015311:Cefmetazole; D002438:Cefoperazone; D002442:Ceftazidime; D002511:Cephalosporins; D002513:Cephamycins; D005260:Female; D006470:Hemorrhage; D006801:Humans; D007275:Injections, Intravenous; D007422:Intestines; D008297:Male; D009070:Moxalactam; D014812:Vitamin K; D014813:Vitamin K Deficiency",
"nlm_unique_id": "7513617",
"other_id": null,
"pages": "325-30",
"pmc": null,
"pmid": "6389475",
"pubdate": "1984-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Bleeding secondary to vitamin K deficiency in patients receiving parenteral cephem antibiotics.",
"title_normalized": "bleeding secondary to vitamin k deficiency in patients receiving parenteral cephem antibiotics"
} | [
{
"companynumb": "JP-PFIZER INC-2016203653",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CEFOPERAZONE SODIUM"
},
"drugadditional": null... |
{
"abstract": "A case history of a thirty-one year old schizophrenic female who was treated with olanzapine is described. Olanzapine is a relatively new atypical antipsychotic drug with a dopamine antagonistic as well as a potent serotonine antagonistic effect. Olanzapine was prescribed effectively after haloperidol, flupentixol chloride, and clozapine had not lead to (lasting) improvements of the psychiatric condition of the patient. Considering the efficacy and the limited risks of this relatively new antipsychotic medication the question arises as to whether olanzapine should be considered as the drug of first choice for patients who do not benefit from treatment with a typical neuroleptic drug.",
"affiliations": "*Psychiatric Hospital Welterhof,Heerlen,The Netherlands.;*Psychiatric Hospital Welterhof,Heerlen,The Netherlands.;**Department of Psychology,Maastricht University,Maastricht,The Netherlands.",
"authors": "À Campo|J|J|;Nijman|H|H|;Merckelbach|H|H|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1017/S0924270800036620",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0924-2708",
"issue": "10(3)",
"journal": "Acta neuropsychiatrica",
"keywords": null,
"medline_ta": "Acta Neuropsychiatr",
"mesh_terms": null,
"nlm_unique_id": "9612501",
"other_id": null,
"pages": "78-82",
"pmc": null,
"pmid": "26971742",
"pubdate": "1998-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Olanzapine as medication of first choice in therapy-resistant schizophrenia?",
"title_normalized": "olanzapine as medication of first choice in therapy resistant schizophrenia"
} | [
{
"companynumb": "NL-MYLANLABS-2017M1008535",
"fulfillexpeditecriteria": "1",
"occurcountry": "NL",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "FLUPENTIXOL"
},
"drugadditional": null,
... |
{
"abstract": "(1) Background: Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) excretion in stools is well documented by RT-PCR, but evidences that stools contain infectious particles are scarce. (2) Methods: After observing a Corona Virus 2019 Disease (COVID-19) epidemic cluster associated with a ruptured sewage pipe, we search for such a viable SARS-CoV-2 particle in stool by inoculating 106 samples from 46 patients. (3) Results: We successfully obtained two isolates from a unique patient with kidney transplantation under immunosuppressive therapy who was admitted for severe diarrhea. (4) Conclusions: This report emphasizes that SARS-CoV-2 is an enteric virus, and infectious virus particles can be isolated from the stool of immune-compromised patients like, in our case, kidney transplant recipient. Immune-compromised patients are likely to have massive multiplication of the virus in the gastrointestinal tract and this report suggests possible fecal transmission of SARS-CoV-2.",
"affiliations": "IHU-Méditerranée Infection, 13005 Marseille, France.;IHU-Méditerranée Infection, 13005 Marseille, France.;IHU-Méditerranée Infection, 13005 Marseille, France.;IHU-Méditerranée Infection, 13005 Marseille, France.;Institut de Recherche pour le Développement (IRD), Assistance Publique Hôpitaux de Marseille, Microbes Evolution Phylogeny and Infections (MEPHI), Aix Marseille Université, 13005 Marseille, France.",
"authors": "Dergham|Julie|J|;Delerce|Jeremy|J|;Bedotto|Marielle|M|;La Scola|Bernard|B|0000-0001-8006-7704;Moal|Valérie|V|0000-0003-4068-2715",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3390/jcm10122696",
"fulltext": "\n==== Front\nJ Clin Med\nJ Clin Med\njcm\nJournal of Clinical Medicine\n2077-0383\nMDPI\n\n10.3390/jcm10122696\njcm-10-02696\nArticle\nIsolation of Viable SARS-CoV-2 Virus from Feces of an Immunocompromised Patient Suggesting a Possible Fecal Mode of Transmission\nDergham Julie 12\nDelerce Jeremy 12\nBedotto Marielle 12\nhttps://orcid.org/0000-0001-8006-7704\nLa Scola Bernard 12*\nhttps://orcid.org/0000-0003-4068-2715\nMoal Valérie 23*\nPopescu Corneliu Petru Academic Editor\n1 IHU-Méditerranée Infection, 13005 Marseille, France; julie.dergham.96@gmail.com (J.D.); jeremy.delerce@univ-amu.fr (J.D.); marielle.bedotto@gmail.com (M.B.)\n2 Institut de Recherche pour le Développement (IRD), Assistance Publique Hôpitaux de Marseille, Microbes Evolution Phylogeny and Infections (MEPHI), Aix Marseille Université, 13005 Marseille, France\n3 Assistance Publique Hôpitaux de Marseille, Hôpital Conception, Centre de Néphrologie et Transplantation Rénale, 13005 Marseille, France\n* Correspondence: bernard.la-scola@univ-amu.fr (B.L.S.); Valerie.MOAL@ap-hm.fr (V.M.)\n18 6 2021\n6 2021\n10 12 269624 5 2021\n15 6 2021\n© 2021 by the authors.\n2021\nhttps://creativecommons.org/licenses/by/4.0/ Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).\n(1) Background: Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) excretion in stools is well documented by RT-PCR, but evidences that stools contain infectious particles are scarce. (2) Methods: After observing a Corona Virus 2019 Disease (COVID-19) epidemic cluster associated with a ruptured sewage pipe, we search for such a viable SARS-CoV-2 particle in stool by inoculating 106 samples from 46 patients. (3) Results: We successfully obtained two isolates from a unique patient with kidney transplantation under immunosuppressive therapy who was admitted for severe diarrhea. (4) Conclusions: This report emphasizes that SARS-CoV-2 is an enteric virus, and infectious virus particles can be isolated from the stool of immune-compromised patients like, in our case, kidney transplant recipient. Immune-compromised patients are likely to have massive multiplication of the virus in the gastrointestinal tract and this report suggests possible fecal transmission of SARS-CoV-2.\n\nSARS-CoV-2\nstools\ncell culture\nCovid-19\norgan transplantation\n==== Body\n1. Introduction\n\nIn Wuhan, China, a new viral disease emerged in December 2019. The pathogen responsible for this disease was identified as a new strain of coronavirus, called Severe Acute Respiratory Syndrome Corona Virus 2 (SARS-CoV-2), and the associated disease was named “Corona Virus 2019 Disease” (COVID-19) [1]. SARS-CoV-2 was responsible for more than 3.39 million deaths worldwide as of 19 May 2021 (https://covid19.who.int/ (accessed on 19 May 2021)). SARS-CoV-2 is highly contagious and considered as acquired through the respiratory tract after inhalation of particles or contact of face mucosa with contaminated hands [2]. For this reason, the main recommendations to avoid infection are the wearing of masks and frequent hand washing. However, mounting evidence suggests that this virus may also be an enteric virus. First, gastrointestinal symptoms have been described in patients with COVID-19 since the onset of the pandemic and a recent meta-analysis of >6600 patients with COVID-19 described that up to 15% had gastrointestinal symptoms, with the three most common symptoms being nausea or vomiting, diarrhea, and loss of appetite [3]. Second, the pooled estimate of SARS-CoV-2 viral RNA positivity in fecal samples was 54%, with positivity persisting for up to 47 days after symptom onset [3]. Apart from SARS-CoV-2 RNA detection, intracellular staining of viral nucleocapsid protein in gastric, duodenal, and rectal epithelia has been shown and demonstrated that SARS-CoV-2 infects these gastrointestinal epithelial cells [4]. Finally, we were able to observe that SARS-CoV-2 can grow in Caco-2 cells and polarized cells derivate from colorectal cancer [5]. In a recent work carried out in our institute, we identified a cluster of cases associated with a specific clone called genotype Marseille 1 [6]. The index case was imported from Tunisia, and the first cases subsequently diagnosed were associated with ships connecting North Africa to Marseilles, in travelers, but also in several crew members exposed to a ruptured sewage pipe. Travelers and crewmembers were infected with the same virus without direct contact with each other. We therefore raised the possibility of fecal-oral or fecal-respiratory transmission of SARS-CoV-2. Despite several attempts, viable SARS-CoV-2 was reported in stool of only six different patients [7,8,9,10]. In the present work, all SARS-CoV-2 PCR-positive samples from stools obtained in our laboratory were inoculated in order to evaluate the presence of a viable virus.\n\n2. Materials and Methods\n\nIn this study, we attempted to isolate by cell culture SARS-CoV-2 from stool samples received in our laboratory at the IHU Méditerranée Infection for patients suffering from COVID-19. All samples were collected as part of the diagnosis and follow-up of patients for COVID-19, and the study was approved by the ethical committee of the University Hospital Institute Méditerranée Infection (N°: 2020-021). From 4 March 2020 to 29 April 2020, 128 stool samples (0.2 g in 1 mL of buffer, Sigma Virocult®, Elitech, Puteaux, France) from 54 patients were tested positive for SARS-CoV-2 by PCR targeting E gene [11]. Of these, 106 frozen samples from 46 patients and stored at −80 °C were available for viral isolation. This period of time was the starting month of the epidemic in Provence-Alpes-Côte d’Azur area, southeast of France. Stool samples were part of our initial protocol of sampling for all patients admitted at our center and hospitalized. After thawing, a 500 μL diluted sample was mixed with 150 μL of HBSS buffer and then filtered using a 0.22-μm pore-sized centrifugal filter (Merck Millipore, Darmstadt, Germany). Four wells of Vero E6 cells were each inoculated with 50 µL of the filtrate, as previously described [12]. The only change from the original protocol is that after the first week of subculture, instead of two blind subcultures each week, we performed five. It was abandoned due to its low yield and a massive influx of patients, which then limited our cultivation capacity. Once a cytopathic effect was detected in the well, the content of the well was collected. Six-hundred microliters were frozen to conserve the virus, and 200 μL was used to perform the SARS-CoV-2 qPCR for confirmation of presumptive identification, then whole genome sequencing [13]. The E gene of SARS-CoV-2 was amplified through RT-PCR (upstream primer: ACAGGTACGTTAATAGTTAATAGCGT; downstream primer: ATATTGCAGCAGTACGCACACA; probe: FAM-ACACTAGCCATCCTTACTGCGCTTCG-TAMRA). Sequencing was performed on Miseq Instrument with the Illumina Nextera XT Paired-end strategy. Genome consensus sequences were obtained by mapping reads with CLC Genomics workbench v7 against the genome Wuhan-Hu-1 (MN908947) with length fraction at 0.8 and similarity fraction at 0.9. The consensus sequence was analyzed with Nextclade web interface (https://clades.nextstrain.org/ (accessed on 24 May 2021) (version 0.7.5)).\n\n3. Results\n\nFour weeks after inoculation, i.e., at the third subculture, two samples showed cytopathic effects that appeared as a group of rounded cells forming aggregates comparing with the negative control, as shown in Figure 1. All other inoculations remained negative after the fifth sub-culture. RT-PCR performed on the two supernatants confirmed that the cytopathic effect was due to active SARS-CoV-2 proliferation, with cycle threshold (Ct) values of 17.29 and 16.22. Whole genome sequencing and analysis of isolate showed that the two strains had slightly different sequences of type 20A/8371T and 20B/19818T-28845T, respectively [14] (Figure 2). These two stool samples at a PCR Ct of 33.2 (2.585 copies/mL) and 33.4 (2.250 copies/mL), respectively with viable SARS-CoV-2, were collected on 14 and 15 April 2020 from the same patient. This patient was a 62-year-old man who had undergone a kidney transplant 21 years ago. He also had diabetes, hypertension, and was overweight. He consulted in the emergency department on 13 April because for the past 10 days he had been experiencing asthenia, loss of appetite, diarrhea, and weight loss, without respiratory symptoms (Figure 3). COVID-19 pneumonia was diagnosed on chest CT. SARS-CoV-2 PCR performed on nasopharyngeal swab two times per day on 13 and 14 April was negative. It was positive once on nasopharyngeal swab on 15 April at a Ct of 33.5 (2.099 copies/mL). The culture was negative for this swab, but direct amplification and sequencing on the sample allowed us to determine it was a 20A/8371T sequence type as in the first stool sample. Laboratory results on the day of admission revealed acute kidney injury and mild inflammation. Maintenance immunosuppressive treatment consisted of tacrolimus 6.5 mg/day and prednisone 5 mg/day. Treatment with azithromycin was administered for 5 days, hydroxychloroquine for 10 days and ceftriaxone for 7 days from 14 April. The dose of tacrolimus was temporarily halved. Acute kidney injury was due to dehydration following severe diarrhea and was corrected by intravascular fluids expansion and discontinuation of diuretics and ACE inhibitors. C reactive protein normalized on 18 April. Nasopharyngeal SARS-CoV-2 PCR was positive only once on 15 April and was negative on 21, 22 and 28 April. We did not test stool samples using SARS-CoV-2 PCR until 28 April, and the result was negative.\n\n4. Discussion\n\nIn this work, we sought to determine whether the SARS-CoV-2 RNA positive stool contained infectious virus and then whether the stool could be a source of transmission. We succeeded in isolating viable SARS-CoV-2 only in 2/106 (1.9%) stool samples from 1/46 (2.2%) patients with COVID-19. To date, viable cases of SARS-CoV-2 have been reported in the feces of only six different patients, despite the common detection of viral RNA [7,8,9,10]. All of these patients were Chinese and contracted COVID-19 during the first trimester of 2020. One patient developed diarrhea [10], while two others did not [7]. No information about gastrointestinal symptoms was available for the last three patients. The viral load was considered high in two patients, but copy number was not provided [7]; to be at Ct between 20 and 24 in two patients [8]; and at 33.6 in 1 patient [10], as in our case. It was not indicated for the sixth patient [9].\n\nDespite relatively high Ct, we succeeded in isolating viable SARS-CoV-2 in two different stools sampled 1 day apart from the same patient. COVID-19 presented in this patient as enteric infection, evolving for 10 days at the time of diagnosis and severe enough to cause acute kidney injury. Although pneumonia was detected by CT scan, respiratory symptoms were absent throughout the illness. This observation suggests that gastrointestinal infections can occur before respiratory symptoms [15,16], but also without them. Interestingly, our patient also had low viral excretion in the upper respiratory sample. The fact that two culture-positive stool samples have a viral load comparable to that of culture-negative nasopharyngeal sample suggests that there was continued viral multiplication in the digestive tract of this patient. Several studies suggested that SARS-CoV-2 may be actively replicating in the gastrointestinal tract [10], even after viral clearance in the respiratory tract [17]. The viral excretion from the digestive tract may last longer than that from the respiratory tract, since fecal samples may remain positive for SARS-CoV-2 RNA for approximately 5 weeks after respiratory tract samples become negative for SARS-CoV-2 RNA [17].\n\nWe cannot exclude the possibility that viral load in the stool could be high but appear low due to PCR inhibitors present in stools. However, as isolation occurred at the third subculture, the viral load was likely low. We identified two different SARS-CoV-2 strains in two stools sampled 1 day apart from the same patient. Genome sequence differences were probably not related to subcultures as the comparison of more than 50 SARS-CoV-2 full-length genomes sequenced in our laboratory showed no significant differences between the sequences from isolates or samples. Genome sequences of the two strains were sufficiently different to hypothesize a dual SARS-CoV-2 infection as it has already been reported [18,19], rather than genome variants related to ongoing evolution of SARS-CoV-2 in the human body [20].\n\nWe believe that isolation of viable SARS-CoV-2 only in stools of an immunocompromised kidney transplant recipient in this work is not by chance. In a large French nationwide cohort of 279 kidney transplant recipients with COVID-19, diarrhea was the third most frequent symptom on admission (43.5%) after fever (80%) and cough (63.6%) [21]. Gastrointestinal symptoms were significantly more frequent than those reported in the general population [3]. It remains uncertain whether the immunosuppression state contributes to the high proportion of gastrointestinal signs in the kidney transplant recipients, but immunosuppressants might favor high viral load and more active replication in gastrointestinal tract leading to more gastrointestinal symptoms. Higher COVID-19-related mortality compared to non-transplant hospitalized patients was reported despite a similar occurrence of severe disease [22]. SARS-CoV-2 plasma load was reported to be associated with COVID-19 severity and mortality, and respiratory shedding to be prolonged [22]. Moreover, patients receiving profound immunosuppression following hematopoietic stem-cell transplantation or receiving cellular therapies may excrete viable SARS-CoV-2 for at least 2 months in respiratory samples [23]. As in other viral infections in kidney transplant recipients, SARS-CoV-2 will probably more fully display its potential dangerousness than immunocompetence [24].\n\nThe number of times SARS-CoV-2 may have developed in the stool is very low. Performing cell culture with cytotoxic fecal specimens is technically challenging. In a study from Germany, virus isolation from stool samples was never successful, irrespective of viral RNA concentrations, in 13 samples from four patients [25]. We believe that our procedure using filtered diluted specimens without the addition of any potentially toxic antibacterial agents and cell culture medium changing after centrifugation is responsible for high virus recovery [12,26]. As this virus was totally new for us and we had no idea if it was easy or difficult to isolate, we did five subcultures, a technique traditionally used to improve culture yield. We indeed observed that two subcultures improved their percentage of isolated viruses [26]. The yield obtained by three additional subcultures, even if it was not zero, was not continued beyond the first 2 months of the epidemic at our center and is now reserved in case we try to isolate at all costs the viral strain despite relatively high Ct (low viral loads); typically at this time some people are infected despite a complete vaccination protocol. The present work and others have shown that the virus can survive in the digestive tract [7,8,9,10]. Jeong et al., although they failed to directly demonstrate the presence of viable virus in stools using cell culture isolation, were able to isolate SARS-CoV-2 from ferrets that were inoculated with a stool sample from a COVID-19 patient [27].\n\nIn conclusion, infectious SARS-CoV-2 particles can be shed in stools of COVID-19 patients. SARS-CoV-2 is an enteric virus, and SARS-CoV and Middle Eastern Respiratory Syndrome (MERS-CoV) can be transmitted through fecal-oral route. Immune-compromised patients are more likely to have high viral replication in the gastrointestinal tract, leading to more gastrointestinal symptoms, and are more likely to shed infectious virus in the stool than immune-competent patients. We suggest adding SARS-CoV-2 to the list of viruses to systematically look for in stool in immunocompromised patients in the case of diarrhea.\n\nAuthor Contributions\n\nConceptualization and methodology, V.M. and B.L.S.; investigation, J.D. (Julie Dergham); validation, J.D. (Julie Dergham), V.M. and B.L.S.; formal analysis, J.D. (Jeremy Delerce) and M.B.; writing—original draft preparation, J.D. (Julie Dergham); writing—review and editing, V.M. and B.L.S.; supervision, V.M. and B.L.S. All authors have read and agreed to the published version of the manuscript.\n\nFunding\n\nParts of this work was funded by a grant from the French State managed by the National Research Agency under the “Investissements d’avenir” (Investments for the Future) program with the ANR-10-IAHU-03 (Méditerranée Infection) reference.\n\nInstitutional Review Board Statement\n\nThe study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the ethical committee of the University Hospital Institute Méditerranée Infection (N°: 2020-021).\n\nInformed Consent Statement\n\nAll samples were collected as part of the diagnosis and follow-up of patients for COVID-19, therefore obtained with the informed consent of all subjects involved in the study.\n\nData Availability Statement\n\nGenomic sequences of stool isolates 1 and 2 are available on GISAID under accession numbers EPI_ISL_860093 and EPI_ISL_860094, respectively.\n\nConflicts of Interest\n\nThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\n\nFigure 1 Cytopathic effect of Severe Acute Respiratory Syndrome Corona Virus 2 (SARS-CoV-2) on Vero E6 cells: (a) uninfected cells as negative control and (b) infected cells with the stool samples. The images were captured simultaneously at 4 days post-infection at sub-culture 3 using ZEISS Zen Microsoft software with ×10 magnification scale.\n\nFigure 2 Phylogenetic tree showing the positions of the two SARS-CoV-2 strains isolated from stools relative to other phylogenetically close neighbors. Stool isolate 1 and 2 represent the two isolated strains from clinical samples of a kidney transplant patient. Nomenclature was based on Nextstrain. Genomic sequences of isolates 1 and 2 are available on GISAID under accession numbers EPI_ISL_860093 and EPI_ISL_860094, respectively.\n\nFigure 3 Clinical, biological, virological, and treatment timeline during the course of Corona Virus 2019 Disease (COVID-19). Gastroenteritis began 10 days before hospitalization. Diarrhea ceased on 15 April. SARS-CoV-2 PCR was positive first in the stool and then in the pharynx. Typical COVID-19 pneumonia existed on the CT-scan, while the patient presented no respiratory symptom. Acute kidney injury was due to dehydration following severe diarrhea and was corrected by intravascular fluids expansion and discontinuation of diuretics and ACE inhibitors. The dose of tacrolimus was temporarily halved. Treatment with azithromycin was administered for 5 days, hydroxychloroquine for 10 days, and ceftriaxone for 7 days. C reactive protein normalized on 18 April. The two consecutive fecal samples were positive for SARS-CoV-2 by RT-PCR and culture. IV: intravenous.\n\nPublisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Coronavirus Disease (COVID-19)—World Health Organization Available online: https://www.who.int/emergencies/diseases/novel-coronavirus-2019 (accessed on 12 June 2021)\n2. Modes of Transmission of Virus Causing COVID-19: Implications for IPC Precaution Recommendations Available online: https://www.who.int/news-room/commentaries/detail/modes-of-transmission-of-virus-causing-covid-19-implications-for-ipc-precaution-recommendations (accessed on 12 June 2021)\n3. Mao R. Qiu Y. He J.S. Tan J.Y. Li X.H. Liang J. Shen J. Zhu L.R. Chen Y. Iacucci M. Manifestations and prognosis of gastrointestinal and liver involvement in patients with COVID-19: A systematic review and meta-analysis Lancet Gastroenterol. Hepatol. 2020 5 667 678 10.1016/S2468-1253(20)30126-6 32405603\n4. Xiao F. Tang M. Zheng X. Liu Y. Li X. Shan H. Evidence for Gastrointestinal Infection of SARS-CoV-2 Gastroenterology 2020 158 1831 1833.e3 10.1053/j.gastro.2020.02.055 32142773\n5. Wurtz N. Penant G. Jardot P. Duclos N. La Scola B. Culture of SARS-CoV-2 in a panel of laboratory cell lines, permissivity, and differences in growth profile Eur. J. Clin. Microbiol. Infect. Dis. 2021 40 477 484 10.1007/s10096-020-04106-0 33389257\n6. Colson P. Levasseur A. Gautret P. Fenollar F. Delerce J. Bitam I. Saile R. Maaloum M. Padane A. Bedotto M. Introduction into the Marseille geographical area of a mild SARS-CoV-2 variant originating from sub-Saharan Africa: An investigational study Travel Med. Infect. Dis. 2021 40 101980 10.1016/j.tmaid.2021.101980 33535105\n7. Wang W. Xu Y. Gao R. Lu R. Han K. Wu G. Tan W. Detection of SARS-CoV-2 in Different Types of Clinical Specimens JAMA 2020 323 1843 1844 10.1001/jama.2020.3786 32159775\n8. Zhang Y. Chen C. Zhu S. Shu C. Wang D. Song J. Song Y. Zhen W. Feng Z. Wu G. Isolation of 2019-nCoV from a Stool Specimen of a Laboratory-Confirmed Case of the Coronavirus Disease 2019 (COVID-19) China CDC Wkly. 2020 2 123 124 10.46234/ccdcw2020.033\n9. Xiao F. Sun J. Xu Y. Li F. Huang X. Li H. Zhao J. Huang J. Zhao J. Infectious SARS-CoV-2 in Feces of Patient with Severe COVID-19 Emerg. Infect. Dis. 2020 26 1920 1922 10.3201/eid2608.200681 32421494\n10. Zhou J. Li C. Liu X. Chiu M.C. Zhao X. Wang D. Wei Y. Lee A. Zhang A.J. Chu H. Infection of bat and human intestinal organoids by SARS-CoV-2 Nat. Med. 2020 26 1077 1083 10.1038/s41591-020-0912-6 32405028\n11. Amrane S. Tissot-Dupont H. Doudier B. Eldin C. Hocquart M. Mailhe M. Dudouet P. Ormières E. Ailhaud L. Parola P. Rapid viral diagnosis and ambulatory management of suspected COVID-19 cases presenting at the infectious diseases referral hospital in Marseille, France, January 31st to March 1st, 2020: A respiratory virus snapshot Travel Med. Infect. Dis. 2020 36 101632 10.1016/j.tmaid.2020.101632 32205269\n12. La Scola B. Le Bideau M. Andreani J. Grimaldier C. Colson P. Gautret P. Raoult D. Viral RNA load as determined by cell culture as a management tool for discharge of SARS-CoV-2 patients from infectious disease wards Eur. J. Clin. Microbiol. Infect. Dis. 2020 39 1059 1061 10.1007/s10096-020-03913-9 32342252\n13. Colson P. Lagier J.-C. Baudoin J.-P. Bou Khalil J. La Scola B. Raoult D. Ultrarapid diagnosis, microscope imaging, genome sequencing, and culture isolation of SARS-CoV-2 Eur. J. Clin. Microbiol. Infect. Dis. 2020 39 1601 1603 10.1007/s10096-020-03869-w 32270412\n14. Levasseur A. Delerce J. Caputo A. Brechard L. Colson P. Lagier J.C. Fournier P.E. Raoult D. Genomic diversity and evolution of coronavirus (SARS-CoV-2) in France from 309 COVID-19-infected patients Genomics 2020 10.1101/2020.09.04.282616\n15. Amoah I.D. Kumari S. Bux F. Coronaviruses in wastewater processes: Source, fate and potential risks Environ. Int. 2020 143 105962 10.1016/j.envint.2020.105962 32711332\n16. Wang D. Hu B. Hu C. Zhu F. Liu X. Zhang J. Wang B. Xiang H. Cheng Z. Xiong Y. Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus–Infected Pneumonia in Wuhan, China JAMA 2020 323 1061 10.1001/jama.2020.1585 32031570\n17. Wu Y. Guo C. Tang L. Hong Z. Zhou J. Dong X. Yin H. Xiao Q. Tang Y. Qu X. Prolonged presence of SARS-CoV-2 viral RNA in faecal samples Lancet Gastroenterol. Hepatol. 2020 5 434 435 10.1016/S2468-1253(20)30083-2 32199469\n18. Samoilov A.E. Kaptelova V.V. Bukharina A.Y. Shipulina O.Y. Korneenko E.V. Lukyanov A.V. Grishaeva A.A. Ploskireva A.A. Speranskaya A.S. Akimkin V.G. Change of dominant strain during dual SARS-CoV-2 infection Infect. Dis. 2020 10.1101/2020.11.29.20238402\n19. Hashim H.O. Mohammed M.K. Mousa M.J. Abdulameer H.H. Alhassnawi A.T. Hassan S.A. Al-Shuhaib M.B. Infection with different strains of SARS-COV-2 in patients with COVID-19 Arch. Biol. Sci. 2020 72 575 585 10.2298/ABS201024051H\n20. Xu Y. Kang L. Shen Z. Li X. Wu W. Ma W. Fang C. Yang F. Jiang X. Gong S. Dynamics of severe acute respiratory syndrome coronavirus 2 genome variants in the feces during convalescence J. Genet. Genom. 2020 10.1016/j.jgg.2020.10.002\n21. Caillard S. Anglicheau D. Matignon M. Durrbach A. Greze C. Frimat L. Thaunat O. Legris T. Moal V. Westeel P.F. An initial report from the French SOT COVID Registry suggests high mortality due to COVID-19 in recipients of kidney transplants Kidney Int. 2020 98 1549 1558 10.1016/j.kint.2020.08.005 32853631\n22. Caillard S. Chavarot N. Francois H. Matignon M. Greze C. Kamar N. Gatault P. Thaunat O. Legris T. Frimat L. Is COVID-19 infection more severe in kidney transplant recipients? Am. J. Transplant. 2021 21 1295 1303 10.1111/ajt.16424 33259686\n23. Aydillo T. Gonzalez-Reiche A.S. Aslam S. van de Guchte A. Khan Z. Obla A. Dutta J. van Bakel H. Aberg J. García-Sastre A. Shedding of Viable SARS-CoV-2 after Immunosuppressive Therapy for Cancer N. Engl. J. Med. 2020 383 2586 2588 10.1056/NEJMc2031670 33259154\n24. Moal V. Zandotti C. Colson P. Emerging viral diseases in kidney transplant recipients: Emerging viral diseases in renal transplantation Rev. Med. Virol. 2013 23 50 69 10.1002/rmv.1732 23132728\n25. Wölfel R. Corman V.M. Guggemos W. Seilmaier M. Zange S. Müller M.A. Niemeyer D. Jones T.C. Vollmar P. Rothe C. Virological assessment of hospitalized patients with COVID-2019 Nature 2020 581 465 469 10.1038/s41586-020-2196-x 32235945\n26. Jaafar R. Aherfi S. Wurtz N. Grimaldier C. Van Hoang T. Colson P. Raoult D. La Scola B. Correlation between 3790 Quantitative Polymerase Chain Reaction-Positives Samples and Positive Cell Cultures, Including 1941 Severe Acute Respiratory Syndrome Coronavirus 2 Isolates Clin. Infect. Dis. 2021 72 e921 10.1093/cid/ciaa1491 32986798\n27. Jeong H.W. Kim S.M. Kim H.S. Kim Y.I. Kim J.H. Cho J.Y. Kim S.H. Kang H. Kim S.G. Park S.J. Viable SARS-CoV-2 in various specimens from COVID-19 patients Clin. Microbiol. Infect. 2020 26 1520 1524 10.1016/j.cmi.2020.07.020 32711057\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2077-0383",
"issue": "10(12)",
"journal": "Journal of clinical medicine",
"keywords": "Covid-19; SARS-CoV-2; cell culture; organ transplantation; stools",
"medline_ta": "J Clin Med",
"mesh_terms": null,
"nlm_unique_id": "101606588",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34207314",
"pubdate": "2021-06-18",
"publication_types": "D016428:Journal Article",
"references": "32205269;33259154;32711332;32031570;33388272;32235945;32405028;32421494;32405603;32711057;32986798;32342252;32142773;33259686;32199469;33535105;32270412;32853631;23132728;32159775;33389257",
"title": "Isolation of Viable SARS-CoV-2 Virus from Feces of an Immunocompromised Patient Suggesting a Possible Fecal Mode of Transmission.",
"title_normalized": "isolation of viable sars cov 2 virus from feces of an immunocompromised patient suggesting a possible fecal mode of transmission"
} | [
{
"companynumb": "FR-MYLANLABS-2022M1006720",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "3",
... |
{
"abstract": "Salivary duct carcinoma of the parotid gland is a highly aggressive epithelial malignancy morphologically resembling high-grade, invasive, and in situ breast carcinoma. It can occasionally present with variable morphology making it diagnostically challenging in cases with unusual morphological components. Ancillary testing, particularly androgen receptor (AR) positivity on immunohistochemistry, can be very helpful in cases that demonstrate extensive squamous morphology, since AR positivity is uncommon in both the primary salivary gland and metastatic squamous cell carcinomas to the parotid. In this report, we describe a case of salivary duct carcinoma that showed only a squamous cell carcinoma component on the initial primary tumor site biopsy, as well as in subsequent contralateral neck lymph node and skin metastases. Apart from the variable morphology, the typical salivary duct and squamous cell carcinoma tumor components also showed significant immunohistochemical differences, including differential staining of human epidermal growth factor receptor 2/neu. The associated diagnostic pitfalls, distinct immunoprofiles of the tumor components, helpful adjuncts for making the correct diagnosis, and associated therapeutic implications are discussed.",
"affiliations": "12264University of Maryland School of Medicine, Baltimore, MD, USA.;Otorhinolaryngology-Head & Neck Surgery, Baltimore, MD, USA.;UM Greenebaum Comprehensive Cancer Center, Baltimore, MD, USA.;12264University of Maryland School of Medicine, Baltimore, MD, USA.;Otorhinolaryngology-Head & Neck Surgery, Baltimore, MD, USA.;12264University of Maryland School of Medicine, Baltimore, MD, USA.",
"authors": "Hardy|Naomi|N|https://orcid.org/0000-0003-0137-7451;Thompson|Joshua|J|;Mehra|Ranee|R|;Drachenberg|Cinthia B|CB|;Hatten|Kyle|K|;Papadimitriou|John C|JC|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/10668969211001952",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1066-8969",
"issue": "29(7)",
"journal": "International journal of surgical pathology",
"keywords": "HER-2/neu; hybrid carcinoma; parotid malignancy; salivary duct carcinoma; squamous cell carcinoma",
"medline_ta": "Int J Surg Pathol",
"mesh_terms": null,
"nlm_unique_id": "9314927",
"other_id": null,
"pages": "726-730",
"pmc": null,
"pmid": "33683973",
"pubdate": "2021-10",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Parotid Salivary Duct Carcinoma With a Prominent Squamous Component: Immunohistochemical Profile, Diagnostic Pitfalls, and Therapeutic Implications.",
"title_normalized": "parotid salivary duct carcinoma with a prominent squamous component immunohistochemical profile diagnostic pitfalls and therapeutic implications"
} | [
{
"companynumb": "US-AMGEN-USASP2021208219",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "TRASTUZUMAB"
},
"drugadditional": "4",
... |
{
"abstract": "BACKGROUND\nOur aim was to investigate the prognostic and predictive value of the oncogenic MAPKK-like protein T-cell-originated protein kinase (TOPK) stratified by KRAS and BRAF mutations in patients with sporadic, hereditary and metastatic colorectal cancer (CRC) treated with anti-EGFR therapy.\n\n\nMETHODS\nImmunohistochemistry (IHC) for TOPK was performed on four study groups. Group 1 included two subgroups of 543 and 501 sporadic CRC patients used to test the reliability of TOPK expression by IHC. In Group 2, representing an additional 222 sporadic CRCs, the prognostic effect of TOPK stratified by KRAS and BRAF was assessed. The prognostic effect of TOPK was further analysed in Group 3, representing 71 hereditary Lynch syndrome-associated CRC patients. In Group 4, the predictive and prognostic value of TOPK was analysed on 45 metastatic patients treated with cetuximab or panitumumab stratified by KRAS and BRAF gene status.\n\n\nRESULTS\nIn both sporadic CRC subgroups (Group 1), associations of diffuse TOPK expression with clinicopathological features were reproducible. Molecular analysis of sporadic CRCs in Group 2 showed that diffuse TOPK expression was associated with KRAS and BRAF mutations (p<0.001) and with poor outcome in patients with either mutation in univariate and multivariate analysis (P=0.017). In hereditary patients (Group 3), diffuse TOPK was linked to advanced pT stage. In metastatic patients treated with anti-EGFR therapy (Group 4), diffuse TOPK expression was linked to dismal outcome despite objective response to treatment (P=0.01).\n\n\nCONCLUSIONS\nTOPK expression is an unfavourable prognostic indicator in sporadic patients with KRAS or BRAF mutations and also in patients with metastatic disease experiencing a response to anti-EGFR therapies. The inhibition of TOPK, which could benefit 30-40% of CRC patients, may represent a new avenue of investigation for targeted therapy.",
"affiliations": "Institute for Pathology, University Hospital of Basel, 4031 Basel, Switzerland. izlobec@uhbs.ch",
"authors": "Zlobec|I|I|;Molinari|F|F|;Kovac|M|M|;Bihl|M P|MP|;Altermatt|H J|HJ|;Diebold|J|J|;Frick|H|H|;Germer|M|M|;Horcic|M|M|;Montani|M|M|;Singer|G|G|;Yurtsever|H|H|;Zettl|A|A|;Terracciano|L|L|;Mazzucchelli|L|L|;Saletti|P|P|;Frattini|M|M|;Heinimann|K|K|;Lugli|A|A|",
"chemical_list": "D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; D000970:Antineoplastic Agents; D047428:Protein Kinase Inhibitors; D000077544:Panitumumab; C512478:EGFR protein, human; D066246:ErbB Receptors; C482119:BRAF protein, human; D017346:Protein Serine-Threonine Kinases; D048493:Proto-Oncogene Proteins B-raf; D020929:Mitogen-Activated Protein Kinase Kinases; C409022:PDZ-binding kinase; D000068818:Cetuximab",
"country": "England",
"delete": false,
"doi": "10.1038/sj.bjc.6605452",
"fulltext": "\n==== Front\nBr J Cancer\nBr J Cancer\nBritish Journal of Cancer\n0007-0920\n1532-1827\nNature Publishing Group\n\n6605452\n10.1038/sj.bjc.6605452\n19935791\nTranslational Therapeutics\nPrognostic and predictive value of TOPK stratified by KRAS and BRAF gene alterations in sporadic, hereditary and metastatic colorectal cancer patients\nPrognostic and predictive value of TOPK in colorectal cancer\nZlobec I 1*\nMolinari F 2\nKovac M 3\nBihl M P 1\nAltermatt H J 4\nDiebold J 5\nFrick H 6\nGermer M 7\nHorcic M 8\nMontani M 9\nSinger G 10\nYurtsever H 11\nZettl A 12\nTerracciano L 1\nMazzucchelli L 2\nSaletti P 13\nFrattini M 2\nHeinimann K 3\nLugli A 1\n1 Institute for Pathology, University Hospital of Basel, Basel, Switzerland\n2 Institute of Pathology, Locarno, Switzerland\n3 Research Group Human Genetics, Department of Biomedicine, University of Basel, Basel, Switzerland\n4 Pathologie Länggasse, Bern, Switzerland\n5 Institute for Pathology, Cantonal Hospital of Lucerne, Lucerne, Switzerland\n6 Institute for Pathology, Cantonal Hospital of Chur, Chur, Switzerland\n7 Institute for Pathology, Cantonal Hospital of Winterthur, Winterthur, Switzerland\n8 Institute for Histological and Cytological Diagnostics, Aarau, Switzerland\n9 Department of Pathology, University Hospital Zurich, Zurich, Switzerland\n10 Institute for Pathology, Cantonal Hospital of Baden, Baden, Switzerland\n11 Institute for Pathology, Cantonal Hospital of Aarau, Aarau, Switzerland\n12 Institute of Clinical Pathology, Basel, Switzerland\n13 Oncology Institute of Southern Switzerland, Ospedale San Giovanni, Bellinzona, Switzerland\n* Institute of Pathology, University of Basel, Schönbeinstrasse 40, Basel, 4031, Switzerland. E-mail: izlobec@uhbs.ch\n05 01 2010\n24 11 2009\n102 1 151161\n14 10 2009\n22 10 2009\nCopyright © 2010 Cancer Research UK\n2010\nCancer Research UK\nhttps://creativecommons.org/licenses/by/4.0/ This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material.If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit https://creativecommons.org/licenses/by/4.0/.\nBackground:\n\nOur aim was to investigate the prognostic and predictive value of the oncogenic MAPKK-like protein T-cell-originated protein kinase (TOPK) stratified by KRAS and BRAF mutations in patients with sporadic, hereditary and metastatic colorectal cancer (CRC) treated with anti-EGFR therapy.\n\nMethods:\n\nImmunohistochemistry (IHC) for TOPK was performed on four study groups. Group 1 included two subgroups of 543 and 501 sporadic CRC patients used to test the reliability of TOPK expression by IHC. In Group 2, representing an additional 222 sporadic CRCs, the prognostic effect of TOPK stratified by KRAS and BRAF was assessed. The prognostic effect of TOPK was further analysed in Group 3, representing 71 hereditary Lynch syndrome-associated CRC patients. In Group 4, the predictive and prognostic value of TOPK was analysed on 45 metastatic patients treated with cetuximab or panitumumab stratified by KRAS and BRAF gene status.\n\nResults:\n\nIn both sporadic CRC subgroups (Group 1), associations of diffuse TOPK expression with clinicopathological features were reproducible. Molecular analysis of sporadic CRCs in Group 2 showed that diffuse TOPK expression was associated with KRAS and BRAF mutations (p<0.001) and with poor outcome in patients with either mutation in univariate and multivariate analysis (P=0.017). In hereditary patients (Group 3), diffuse TOPK was linked to advanced pT stage. In metastatic patients treated with anti-EGFR therapy (Group 4), diffuse TOPK expression was linked to dismal outcome despite objective response to treatment (P=0.01).\n\nConclusions:\n\nTOPK expression is an unfavourable prognostic indicator in sporadic patients with KRAS or BRAF mutations and also in patients with metastatic disease experiencing a response to anti-EGFR therapies. The inhibition of TOPK, which could benefit 30–40% of CRC patients, may represent a new avenue of investigation for targeted therapy.\n\ncolorectal cancer\nTOPK\nKRAS\nBRAF\nanti-EGFR therapy\n==== Body\npmcThe pathogenesis, progression and oncogenic behaviour of colorectal cancer (CRC) are to a large extent regulated by the ERK/MAPK signalling cascade, which activates transcription factors critical for angiogenesis, proliferation, apoptosis, differentiation and metastasis (Fang and Richardson, 2005). In CRC, 30–40% of cases have mutations in the KRAS proto-oncogene (Bos et al, 1987). Often linked to tumours arising from the chromosomal instability pathway, representing 80–85% of CRC cases, KRAS mutations have been associated with increased activity of ERK signalling, thereby promoting transcription of Elk-1 and c-Myc (Bos et al, 1987; Jass, 2007). Although evidence with regard to the effect of KRAS gene status on prognosis is heavily debated, the majority of published studies suggest a poorer outcome in patients with KRAS mutations (Siena et al, 2009). Interestingly, patients with Lynch syndrome-associated CRC, representing only 2–3% of all CRC patients, are also found to have a higher frequency of KRAS mutation, yet they generally show a favourable clinical outcome (Oliveira et al, 2007; Green et al, 2009). Downstream of KRAS in ERK/MAPK signalling lies BRAF, a gene that in sporadic disease is mutated in ∼10% of CRC and is more highly associated with tumours showing microsatellite instability (MSI) (Bos et al, 1987; Jass, 2007). Few reports have investigated the prognostic effect of BRAF in CRC; however, evidence points to a worse prognosis in patients with mutations in this gene (Samowitz et al, 2005; French et al, 2008; Ogino et al, 2009).\n\nCurrent regimens for patients with metastatic CRC include anti-EGFR monoclonal antibodies such as cetuximab and panitumumab, both functioning to block the binding of ligands to EGFR, thereby downregulating ERK/MAPK and PI3K/PTEN/AKT pathway signalling (Amado et al, 2008; Giusti et al, 2008; Segal and Saltz, 2009). New evidence suggests that patients with KRAS, BRAF or PTEN mutations experience fewer clinical responses to these drugs, compared with patients with wild-type tumours; moreover, molecular analysis, particularly of KRAS, is routinely being performed in standard molecular pathology laboratories (Lievre et al, 2006; Amado et al, 2008; Di Nicolantonio et al, 2008; Karapetis et al, 2008; Au et al, 2009; Jimeno et al, 2009; Sartore-Bianchi et al, 2009). As 30–40% of patients with CRC exhibit mutations in one of these genes in a mutually exclusive manner, their potential for receiving such targeted agents is substantially decreased (Jass, 2007; Di Nicolantonio et al, 2008).\n\nTaken together, the identification of novel prognostic and predictive factors, which consider the heterogeneous molecular background of CRC, particularly with regard to KRAS and BRAF gene status, is warranted. In 2000, a new member of the ERK/MAPK pathway, T-cell-originated protein kinase (TOPK), also known as PDZ-binding kinase, was identified (Abe et al, 2000; Gaudet et al, 2000). T-cell-originated protein kinase was described as a MAPKK-like protein involved in p38MAPK and JNK signalling, possibly in a cell-type-dependent manner, and was more recently found to be involved in the ERK/MAPK pathway (Matsumoto et al, 2004; Nandi et al, 2004; Ayllon and O’Connor, 2007; Oh et al, 2007). T-cell-originated protein kinase is overexpressed in highly proliferating normal tissues, foetal tissues and in a wide variety of tumours in vitro, whereas the inhibition of TOPK is shown to lead to apoptosis in breast and melanoma cell lines (Simons-Evelyn et al, 2001; Zhao et al, 2001; Matsumoto et al, 2004; Nandi et al, 2004; Dougherty et al, 2005; Park et al, 2006; Zykova et al, 2006). Most recently, Herrero-Martin et al (2009) evaluated TOPK expression in Ewing sarcoma cell lines and found that the inhibition of TOPK led to a decrease in the proliferation rate and an important change in cell growth, indicating that TOPK could have a significant role in Ewing sarcoma biology. Zhu et al (2007) systematically assessed this novel molecule in CRC and confirmed its oncogenic potential in vitro and in vivo. Importantly, they found that, unlike other MEKs that undergo negative phosphorylation loops between themselves and ERK, TOPK could promote malignant transformation by exerting a positive feedback loop on ERK2 activity. However, the prognostic and predictive effect of TOPK in patients with CRC has to date not been explored.\n\nGiven its central involvement in ERK/MAPK signalling, we hypothesised that TOPK overexpression is significantly related to KRAS and BRAF mutations, thereby implicating this gene in the poorer outcome of patients, both in terms of prognosis and response to anti-EGFR therapies. The aim of our study was, first, to determine using two randomised subgroups (n=543 and n=501) whether TOPK expression leads to reproducible associations with clinicopathological features by immunohistochemistry (IHC) and, second, to determine according to KRAS and BRAF gene status the prognostic effect of TOPK on 222 sporadic and 71 Lynch syndrome-associated CRC patients, as well as the prognostic and predictive value of TOPK in 45 metastatic CRC patients treated with anti-EGFR agents, cetuximab and panitumumab.\n\nMethods\n\nPatients\n\nSporadic CRC patients (Groups 1 and 2)\n\nA total of 1420 primary pre-operatively untreated, unselected sporadic CRC patients treated at the University Hospital of Basel between 1987 and 1996 were included in this study. Haematoxylin and eosin-stained slides were retrospectively collected from the Institute of Pathology, University Hospital of Basel, the Institute of Clinical Pathology, Basel, Switzerland and from the Institute of Pathology, Stadtspital Triemli, Zürich, Switzerland. Histopathological criteria were reviewed by an experienced gastrointestinal pathologist (LT) and included tumour diameter, pT and pN classification, grade of differentiation, histological subtype, presence of vessel invasion, tumour border configuration (pushing/expanding or infiltrating) and presence of peritumoural lymphocytic inflammation at the invasive tumour front (Jass et al, 1986). Clinical data including patient age at diagnosis, tumour location and follow-up, local recurrence, distant metastasis and post-operative therapy were retrieved from the patient records, where available. Censored observations included patients who were alive at the last follow-up, those who died for reasons other than CRC or were lost to follow-up. Median survival time was 76 (95% CI 47–137) months; median follow-up was 60.3 months.\n\nLynch syndrome-associated CRC patients (Group 3)\n\nIn all, 94 patients with genetically confirmed Lynch syndrome-associated CRC identified from the Swiss Cancer Registry were included in this study. Histopathological criteria were reviewed and included pT, pN, pM classifications and grade of differentiation. Clinical data including patient age at diagnosis, tumour location and follow-up were retrieved from patient records. Censored observations included patients who were alive at last follow-up, those who died for reasons other than CRC or were lost to follow-up. Follow-up period ranged from 0 to 74 years and median follow-up time was 7.1 years (95% CI 5.4–8.7).\n\nMetastatic CRC patients (Group 4)\n\nA total of 46 consecutive patients with histologically confirmed metastatic CRC treated at the Oncology Institute of Southern Switzerland, Bellinzona, Switzerland with cetuximab or panitumumab-based regimens were entered into this study. Cetuximab was administered at a standard loading dose of 400 mg m−2 over 2 h, followed by weekly dose of 250 mg m−2 over 1 h. Panitumumab (6 mg kg−1) was administered intravenously every 2 weeks until progression was allocated in two patients who were refractory to oxaliplatin-based and irinotecan-based regimens. With the exception of two patients who received cetuximab as frontline therapy, the others had failed at least one previous chemotherapy regimen. For those patients who progressed on irinotecan-based regimens, cetuximab was administered in combination with these regimens given at the same dose and schedule. Treatment was continued until progressive disease (PD) or toxicity occurred, according to standard criteria. Clinical response was assessed every 6–8 weeks with radiological examination (computerised tomodensitometry or magnetic resonance imaging). The Response Evaluation Criteria in Solid Tumours (RECIST) were adopted for evaluation, and objective tumour response was classified into complete response, partial response (PR), stable disease (SD) and PD. Follow-up time ranged from 0 to 8 years, with a median of 2.0 years and a median survival time of 2.4 (95% CI 2.0–3.4) years.\n\nSpecimen characteristics\n\nFor sporadic CRC patients (Groups 1 and 2), a previously described single-punch tissue microarray was constructed including all 1420 tumours and 57 normal mucosa samples as control (Sauter et al, 2003; Zlobec et al, 2008). Of the 1420 tumours, paraffin-embedded surgical resection specimens were available for 245 cases, which were retrospectively collected from the archives of the Institute of Pathology, University Hospital Basel, Switzerland for subsequent molecular analysis. Second, a multiple-punch tissue microarray including all 94 patients with Lynch syndrome-associated CRCs was constructed. Briefly, tissue blocks were retrieved from the Research Group Human Genetics, Department of Biomedicine, University of Basel. Haematoxylin and eosin slides were re-evaluated and representative areas from the tumour centre, tumour invasive front and adjacent normal mucosa (if available) were identified using a felt-tip pen. Tissue punches 0.6 mm in diameter were taken from these areas and brought into one recipient paraffin block (3 × 2.5 cm) using a homemade semi-automated tissue arrayer. The final tissue microarray contained 297 tissues, taken from 101 different tissue blocks, and included 135 punches from the tumour centre, 78 from the tumour front and 84 samples of normal tissue. Third, for patients with metastatic disease, the corresponding paraffin-embedded tissue blocks were retrospectively collected and whole-tissue sections were cut at 4 μm.\n\nAssay methods\n\nImmunohistochemistry\n\nImmunohistochemistry was carried out for all tumour specimens from Groups 1 to 4 and for normal mucosa samples using anti-TOPK antibody. Tissue microarrays and whole-tissue sections were dewaxed and rehydrated in dH2O. After pressure cooker-mediated antigen retrieval in 0.001 M EDTA (pH 8.0), endogenous peroxidase activity was blocked using 0.5% H2O2. Sections were incubated with 10% normal goat serum for 20 min. After incubation with primary antibody (PBK/TOPK, rabbit polyclonal, dilution 1 : 50, Cell Signalling, Danvers, MA, USA), sections were incubated with HRP-conjugated secondary antibody (DakoCytomation, Glostrup, Denmark) for 30 min at room temperature, immersed in 3-amino-9-ethylcarbazole plus substrate–chromogen (DakoCytomation) for 30 min and counterstained with haematoxylin. Negative control tissues underwent the same protocol with the primary antibody omitted. Tumour cell immunoreactivity was evaluated by an experienced gastrointestinal pathologist (AL) blinded to clinical end points. Tumour cell staining for TOPK was predominantly observed in the cytoplasm, rather than in the nucleus or membrane. The percentage of positive tumour cells per case was scored. Staining intensity was not considered. The inter-observer variability of TOPK scores was assessed on one tissue microarray slide containing 456 cases by a second independent pathologist (MH) from an external institution and blinded to clinicopathological features.\n\nMolecular analyses\n\nFor groups 2, 3 and 4, MSI analysis along with KRAS (exon 2, codons 12 and 13) and BRAF (exon 15, codon 600) mutational investigations was performed as detailed previously (Frattini et al, 2007; Lugli et al, 2009). Microsatellite stable and MSI-low status were defined as instability at 0 and 1 markers, respectively. Microsatellite instability-high was characterised by the presence of instability in ⩾2 markers (Umar et al, 2004).\n\nStudy design\n\nThe study design is outlined in Figure 1. For study groups 1–3, excluded cases were those resulting from tissue microarray failure, that is, insufficient tissue for evaluation or <50% tumour/punch.\n\nThe 1420 sporadic CRCs mounted onto the tissue microarray underwent IHC for TOPK and staining was evaluated semi-quantitatively. These cases were subdivided into two groups on the basis of the availability of corresponding paraffin-embedded material for subsequent DNA extraction (Figure 1A). Group 1 included cases without available tumour blocks (n=1198), whereas Group 2 represented cases with available archival paraffin-embedded material (n=245).\n\nAfter exclusion of 154 cases, Group 1 was further randomised into two matched subgroups containing 543 and 501 patients each. The appropriate IHC cutoff score for TOPK for all study groups was determined using subgroup A. Second, the reliability of TOPK expression and its association with clinicopathological features could be determined by analysing both subgroups independently.\n\nAfter exclusion of 23 cases from Group 2, 222 cases underwent molecular investigations for MSI, KRAS and BRAF. The aim of this study group was to determine the prognostic value of TOPK in CRCs, with subgroup analysis by KRAS and BRAF mutation. Multivariable cancer-specific survival time models were evaluated by including candidate variables such as age, sex, pT and pN classification, vascular invasion and MSI status.\n\nA total of 23 cases were excluded from Group 3 (Figure 1B). The remaining 71 Lynch syndrome-associated CRCs underwent molecular analysis for KRAS and BRAF. The association of TOPK expression with mutational status of KRAS and BRAF, clinicopathological features and cancer-specific survival time, was assessed.\n\nOne case of metastatic CRC was excluded from Group 4 because of insufficient material for adequate assessment of TOPK expression (Figure 1C). Immunohistochemistry for PTEN and molecular investigations of MSI, KRAS and BRAF were previously performed (Frattini et al, 2007). The prognostic and predictive value of TOPK in this group of patients was analysed, with specific end points of interest being cancer-specific survival time and objective tumour response to anti-EGFR agents.\n\nThe use of all patient material was approved by local Ethics Committees.\n\nStatistical analysis methods\n\nAssociations of TOPK with categorical features were investigated by Chi-Square and Fisher's Exact tests where appropriate, and by Student's t-test for age. Survival analysis was performed using the Kaplan–Meier method, log-rank test and by multiple Cox regression analysis after verification of the proportional hazards assumption. The appropriate number of variables to be included in regression models was dependent on the frequency of patient deaths in each analysis. We included 1 variable per 10 deaths, to prevent overfitting. Differences in TOPK expression between normal colonic mucosa and tumour were determined using Wilcoxon's rank-sum test for medians. The most clinically relevant cutoff score for TOPK was determined on subgroup A by receiver operating characteristic (ROC) curve analysis for end point survival/death. To prevent overfitting, re-sampling of data was performed by bootstrapping 200 times. The inter-observer variability of TOPK staining was assessed using the intra-class correlation coefficient (ICC), with values of ⩾0.8 indicating excellent agreement. Missing clinicopathological data were assumed to be at random. No imputation was performed; rather, only patients with complete data for all features were included in multivariable analyses. P-values <0.05 were considered to be statistically significant.\n\nResults\n\nTOPK expression in normal colon versus sporadic CRC\n\nT-cell-originated protein kinase expression in 57 normal colonic mucosa samples was compared with sporadic CRCs from Group 1 (n=1044). T-cell-originated protein kinase was highly overexpressed in tumours with a median of 90% positive cell staining compared with 5% positive cell staining in normal tissue (P<0.001).\n\nInter-observer agreement of TOPK scoring and determination of the cutoff score in CRC\n\nRe-evaluation of one tissue microarray slide (n=456 CRCs) by a second independent pathologist from an external institution using the same semi-quantitative scoring method resulted in ICC=0.92, indicating excellent agreement. Having established that the evaluation of TOPK staining was reproducible between observers, next, the most appropriate cutoff score to describe tumours as overexpressed for TOPK was evaluated. Using ROC curve analysis, the protein expression value with the highest sensitivity and specificity for patient survival was obtained for subgroup A (Group 1) and was found to be 90% positive for cell staining. This value also coincided with the median expression value of TOPK in sporadic CRCs in Group 1, hence tumours with >90% positive cell staining for TOPK were considered ‘diffuse’, whereas cases with ⩽90% were defined as ‘patchy’ (Figure 2). This definition was subsequently applied to all tumours in this study.\n\nGroup 1: TOPK in sporadic CRC and clinicopathological information\n\nIn subgroups A and B, 141 and 111 patients had a diffuse TOPK expression (26 and 28% of cases, respectively). In both randomised subgroups, diffuse TOPK expression was associated with tumour location (more right sided; P=0.008 and P=0.027) and with high tumour grade (P=0.04 and P=0.025) (Table 1).\n\nGroup 2: TOPK in sporadic CRC, molecular features and survival time\n\nIn Group 2, TOPK was evaluable in 222 cases. Diffuse expression, observed in 63 patients (corresponding to 28% of cases), was linked to tumour location (more right-sided tumours; P=0.05), mucinuous histological subtype (P=0.027) and poor tumour grade (P=0.012) (Table 2).\n\nMutational investigations gave analysable sequences in 198 cases for BRAF and 210 cases for KRAS mutations. BRAF mutations were observed in 30 cases (15%), whereas KRAS mutations occurred in 57 cases (27%). Mutations in BRAF (P=0.002) and KRAS (P=0.054) occurred more frequently in patients with diffuse TOPK staining compared with patients with wild-type tumours. As KRAS and BRAF mutations were mutually exclusive, the relationship of TOPK with either KRAS or BRAF mutation was evaluated. The diffuse expression found in 36 of 63 (57.1%) patients was significantly associated with mutation in either KRAS or BRAF, compared with 32.1% of patients with a patchy expression (P<0.001).\n\nAmong patients with KRAS or BRAF mutations, those with diffuse TOPK expression had a significantly worse prognosis compared with patients with a patchy expression (P=0.015) (Figure 3A). The relative risk of death for patients with KRAS or BRAF mutations was 2.22 (95% CI 1.1–4.4) compared with those showing no mutation in either gene. In multivariate survival analysis with age, pT classification and pN classification, TOPK expression maintained a significant adverse effect on outcome (P=0.017; HR=2.42 (95% CI 1.2–5.0)), as well as after adjusting for the prognostic effects of pT classification, pN classification and MSI status (P=0.018; HR=2.39 (95% CI 1.2–4.9)) (Table 3).\n\nGroup 3: TOPK in hereditary Lynch syndrome-associated CRC\n\nT-cell-originated protein kinase expression could be assessed in 71 patients with Lynch syndrome-associated CRC. Of the 30 patients with a diffuse TOPK expression (41% of cases), 27 (93.1%) had pT3 or pT4 tumours compared with 68.2% of patients with a patchy expression (P=0.014). KRAS mutations were found in 22 (31%) patients, whereas mutation in BRAF was noted in only one case of genetically confirmed Lynch syndrome. No association of TOPK was observed with either prognosis or KRAS mutation status (Table 4).\n\nGroup 4: TOPK in metastatic CRC patients treated with anti-EGFR therapy\n\nOf the 45 metastatic patients treated with cetuximab or panitumumab with evaluable TOPK staining, a wild-type KRAS and BRAF gene status was detected in 32 (71.1%) and 41 (91%) cases, respectively. Diffuse TOPK expression was observed in 19 (82.6%) KRAS wild-type and 21 (91.3%) BRAF wild-type tumours. A highly unfavourable outcome in patients with KRAS and BRAF wild-type tumours with overexpression of TOPK was noted (P=0.018) (Figure 3B). No difference in TOPK staining was found between PTEN loss and overexpression, and the prognostic effect of diffuse TOPK staining in KRAS and BRAF wild-type patients was maintained after adjusting for PTEN status (P=0.041). In total, 23 patients (51.1%) had PD, 11 (24.4%) had PR and 11 (24.4%) had SD, with diffuse expression of TOPK occurring in 10 (43.5%), 7 (30.4%) and 6 (26.1%) patients, respectively. Patients having SD or PR to anti-EGFR therapy but with diffuse TOPK expression suffered from poor outcome; in contrast, those with no overexpression of TOPK were alive or censored at 5-year follow-up (P=0.01) (Figure 3C). T-cell-originated protein kinase expression was not of predictive value for response to anti-EGFR therapy, either in the entire cohort of patients or when stratified by KRAS and BRAF mutation status (Table 5).\n\nDiscussion\n\nWe report the association of diffuse TOPK expression with specific sporadic CRC features, namely, with right-sided tumour location and higher tumour grade in two large multicentric cohorts of patients and excellent inter-observer reproducibility of TOPK scores. Second, our findings point to the diffuse expression of TOPK as an adverse prognostic factor in patients with sporadic CRC with a KRAS or BRAF mutation and in metastatic patients with SD or PR after treatment with anti-EGFR-based regimens.\n\nIn sporadic CRC, diffuse TOPK expression was associated with the presence of KRAS or BRAF mutation, underlining the involvement of TOPK in ERK/MAPK signalling. In patients with either KRAS or BRAF mutations, diffuse expression of TOPK had an adverse effect on 5-year survival. In addition, this unfavourable effect of TOPK expression on outcome was maintained in multivariate analysis, suggesting that TOPK could represent an important prognostic factor in patients with KRAS-mutated or BRAF-mutated tumours (Andreyev et al, 1998; Samowitz et al, 2005; French et al, 2008; Ogino et al, 2009). Although KRAS mutations are frequently found in patients with Lynch syndrome-associated CRC despite their favourable prognosis, in this study, no association between TOPK expression and KRAS mutation was observed (Oliveira et al, 2007). The propensity for more right-sided, poorly differentiated cancers and poorer outcome in patients with KRAS or BRAF mutation was not found here, despite an association with a more advanced pT stage with diffuse TOPK staining. These results seem to indicate that involvement of TOPK in CRC may be limited to tumours of sporadic origin.\n\nWe report that in 45 metastatic CRC patients treated with anti-EGFR agents and with wild-type KRAS and BRAF gene status, those expressing diffuse TOPK staining suffer from a significant adverse prognosis. In addition, TOPK expression seemed to be unmodified by PTEN status and maintained its adverse effect on outcome in KRAS or BRAF wild-type patients independently of the expression of this molecule. Furthermore, among patients with SD or those with objective response, a diffuse expression of TOPK may act as a highly unfavourable prognostic factor. Together, these results indicate that the activation of MAPK signalling is still possible at the level of TOPK, even in the context of wild-type KRAS and BRAF, and is unlikely because of loss of PTEN. Therefore, TOPK may act as a prognostic, rather than as a predictive, factor, suggesting that it may be important to consider its expression in metastatic CRC patients with a proficient molecular profile for positive response to anti-EGFR drugs.\n\nOur results suggest that inhibition of TOPK could be beneficial for at least two groups of CRC patients together representing 30–40% of all cases, namely, those with a KRAS or BRAF mutation and those with metastatic disease supported by several factors. T-cell-originated protein kinase is barely detectable in most normal adult tissues including normal colonic mucosa, whereas it is highly overexpressed in CRC (Zhu et al, 2007). Its detection by IHC leads to reproducible associations with clinicopathological features and its evaluation leads to excellent inter-observer agreement. As a MAPKK-like protein, it is a downstream molecule of KRAS and BRAF, both of which are associated with diffuse expression of TOPK (Roberts and Der, 2007). T-cell-originated protein kinase may itself be an effector of BRAF, as phosphorylation of TOPK by RAF has previously been shown (Yuryev and Wennogle, 2003). Therefore, inhibition of TOPK at this level of signalling may have a more significant impact on downregulating deregulated ERK/MAPK signalling. Current MEK inhibitors have led to moderate results (Roberts and Der, 2007). Although blocking MEK1 should lead to a decrease in the phosphorylation of ERK1/2, this process is hindered by a negative feedback loop of ERK1/2 onto MEK1, making inhibition of this molecule to some extent counter productive (Ramos, 2008). T-cell-originated protein kinase, in contrast, has been described as an oncogenic MEK involved in a positive phosphorylation loop with ERK2 (Zhu et al, 2007). Therefore, inhibition of TOPK should be expected to successfully decrease the activation of ERK2 and thus its downstream transcription factors. Moreover, TOPK expression in this study seems to be independent of PTEN status. Considering recent evidence suggesting that PTEN mutation results in resistance to EGFR-targeted therapies (Sartore-Bianchi et al, 2009), the inhibition of TOPK in KRAS and BRAF wild-type patients could represent an approach to improve clinical outcome in patients with either PTEN wild-type or mutated cancers.\n\nA limitation of this study is that information on cancer treatment was limited. Subgroup analysis produced results using relatively small sample sizes; therefore, these findings necessitate validation on larger patient cohorts. Nonetheless, our study gives valuable results for several reasons. Four groups of patients were included, representing sporadic, hereditary and metastatic CRC. Patients were treated in different centres and considerable corresponding clinicopathological data and follow-up could be obtained. Whole-tissue sections and two tissue microarrays were evaluated, the largest containing more than 1000 tumours, the second with multiple tissue punches taken from the same patient representing different tumour areas. Finally, the cohort of metastatic CRC was well characterised with respect to both clinicopathological treatment and molecular features.\n\nAlthough several study groups have investigated the functional role of TOPK in different tumour types, this seems to be the first assessment of the prognostic and predictive value of this protein in CRC. In conclusion, TOPK seems to be a valuable prognostic factor in patients with sporadic CRC with KRAS or BRAF gene mutations, as well as in patients with metastatic disease who respond to anti-EGFR therapies. If confirmed prospectively, the inhibition of TOPK may represent a novel avenue of investigation for targeted treatment in patients with CRC, especially for the early identification of patients with a worse prognosis, although experiencing disease control after anti-EGFR drug administration.\n\nThis study was funded by the Krebsliga Beider Basel (LT, KH, AL), Oncosuisse (MF, KH), the Fondazione Ticinese per la Ricerca sul Cancro (MF) and the Krebsliga Zentralschweiz (MK, KH). The sponsors were not involved in study design, collection, analysis and interpretation of data.\n\nFigure 1 Study design. (A) 1420 sporadic colorectal cancers (CRCs) mounted onto tissue microarrays (TMA) underwent immunohistochemistry (IHC) for TOPK and were then subdivided into Group 1 (n=1198) and Group 2 (n=245) on the basis of the availability of paraffin-embedded material. Excluding 154 cases, Group 1 was randomised into two matched subgroups (n=543 and 501), then used to define ‘diffuse’ and ‘patchy’ TOPK expression and to test associations of TOPK with cliniopathological features. In Group 2, 23 cases were excluded. A total of 222 cases with evaluable TOPK IHC were analysed for microsatellite instability (MSI), KRAS and BRAF. The prognostic value of TOPK stratified by KRAS and BRAF gene status was determined. (B) TOPK IHC staining was assessable in 71 of 94 Lynch syndrome-associated CRC patients in Group 3. T-cell-originated protein kinase expression was related to KRAS and BRAF mutation, clinicopathological features and cancer-specific survival time. (C) TOPK IHC was assessable in 45 of 46 metastatic CRC patients, whereas investigations of MSI, KRAS, BRAF and PTEN were performed. The prognostic and predictive value of TOPK in metastatic CRC patients treated with anti-EGFR agents was evaluated.\n\nFigure 2 Representative photomicrographs ( × 40) after immunohistochemistry staining with anti-TOPK antibody. (A) Colorectal cancer used as a negative control with the primary antibody omitted; (B) normal colonic mucosa with negligible cytoplasmic TOPK staining; (C) diffuse cytoplasmic TOPK staining in >90% of colorectal tumour cells; and (D) patchy cytoplasmic staining of TOPK in ⩽90% of colorectal tumour cells.\n\nFigure 3 Kaplan–Meier survival curves (A) illustrating survival time differences among patients in Group 2 with KRAS or BRAF mutations stratified by TOPK expression, (B) of metastatic colorectal cancer patients illustrating the negative effect of diffuse TOPK expression on prognosis in patients with KRAS and BRAF wild-type tumours and (C) of patients with stable disease or response to anti-EGFR therapy. Tables describe the number of patients at risk of death (alive) at each time point, beginning at the initial time of diagnosis when all patients are alive.\n\nTable 1 Group 1: immunohistochemical expression of TOPK (patchy or diffuse) and association with clinicopathological features in both randomized subgroups A and B\n\n \tSubgroup A\t \tSubgroup B\t \t\nClinicopathological features\tPatchy N (%)\tDiffuse N (%)\tP-value\tPatchy N (%)\tDiffuse N (%)\tP-value\t\nGender\t\n Female\t211 (52.5)\t75 (53.2)\t0.886\t200 (51.3)\t62 (55.9)\t0.395\t\n Male\t191 (47.5)\t66 (46.8)\t \t190 (48.7)\t49 (44.1)\t \t\n \t \t \t \t \t \t \t\nTumour location\t\n Left sided\t136 (34.2)\t36 (25.7)\t0.008\t132 (34.3)\t33 (30.2)\t0.027\t\n Right sided\t131 (32.9)\t64 (45.7)\t \t119 (30.9)\t46 (42.2)\t \t\n Rectum\t131 (32.9)\t40 (28.6)\t \t134 (34.8)\t30 (27.5)\t \t\n \t \t \t \t \t \t \t\nHistological subtype\t\n Mucinous\t30 (7.5)\t16 (11.4)\t0.154\t26 (6.7)\t11 (9.9)\t0.249\t\n Non-mucinous\t372 (92.5)\t125 (88.7)\t \t364 (93.3)\t100 (90.1)\t \t\n \t \t \t \t \t \t \t\npT stage\t\n pT1–2\t77 (19.4)\t23 (16.7)\t0.471\t67 (17.5)\t18 (16.4)\t0.782\t\n pT3–4\t319 (80.6)\t115 (83.3)\t \t316 (82.5)\t92 (83.6)\t \t\n \t \t \t \t \t \t \t\npN stage\t\n pN0\t194 (49.6)\t71 (52.2)\t0.603\t198 (52.4)\t55 (51.9)\t0.928\t\n pN1–2\t197 (50.4)\t65 (47.8)\t \t180 (47.6)\t51 (48.1)\t \t\n \t \t \t \t \t \t \t\npM stage\t\n pM0\t116 (81.7)\t53 (80.3)\t0.812\t124 (81.1)\t42 (82.4)\t0.836\t\n pM1\t26 (18.3)\t13 (19.7)\t \t29 (18.9)\t9 (17.7)\t \t\n \t \t \t \t \t \t \t\nTumour grade\t\n G1–2\t346 (87.4)\t112 (80.6)\t0.04\t341 (89.5)\t88 (81.5)\t0.025\t\n G3\t50 (12.6)\t27 (19.4)\t \t40 (10.5)\t20 (18.5)\t \t\n \t \t \t \t \t \t \t\nVascular invasion\t\n Absence\t274 (69.4)\t110 (79.1)\t0.028\t285 (74.8)\t79 (72.5)\t0.624\t\n Presence\t121 (30.6)\t29 (20.9)\t \t96 (25.2)\t30 (27.5)\t \t\n \t \t \t \t \t \t \t\nLocal recurrence\t\n Absence\t73 (52.9)\t43 (66.2)\t0.075\t90 (59.6)\t30 (58.8)\t0.922\t\n Presence\t65 (47.1)\t22 (33.9)\t \t61 (40.4)\t21 (41.2)\t \t\n \t \t \t \t \t \t \t\nPost-operative therapy\t\n No\t104 (7.3)\t53 (80.3)\t0.344\t129 (84.9)\t37 (72.6)\t0.048\t\n Yes\t36 (25.7)\t13 (19.7)\t \t23 (15.1)\t14 (27.5)\t \t\n \t \t \t \t \t \t \t\n \tMean (min, max)\t \tMean (min, max)\t \t\nAge (years)\t69.9, 36–96\t70.1, 39–93\t0.795\t70.1, 30–96\t70.7, 46–96\t0.654\t\n \t \t \t \t \t \t \t\n \tRate (95% CI)\t \tRate (95% CI)\t \t\nSurvival time\t\n 5-year\t55.7 (50–61)\t62.9 (53–71)\t0.337\t58.6 (53–64)\t54.9 (44–65)\t0.843\t\nAbbreviations: CI=confidence interval; N=frequency; TOPK=T-cell-originated protein kinase.\n\nTable 2 Group 2: immunohistochemical expression of TOPK (patchy or diffuse) and association with clinicopathological and molecular features in sporadic colorectal cancer\n\n \tGroup 2 (N (%))\t\nClinicopathological features\tPatchy\tDiffuse\tP-value\t\nGender\t\n Female\t87 (54.7)\t28 (44.4)\t0.167\t\n Male\t72 (45.3)\t35 (55.6)\t \t\n \t \t \t \t\nTumour location\t\n Left sided\t42 (26.4)\t18 (28.6)\t0.05\t\n Right sided\t47 (29.6)\t27 (42.9)\t \t\n Rectum\t70 (44.0)\t18 (28.6)\t \t\n \t \t \t \t\nHistological subtype\t\n Mucinous\t6 (3.8)\t8 (12.7)\t0.027\t\n Non-mucinous\t153 (96.2)\t55 (87.3)\t \t\n \t \t \t \t\npT stage\t\n pT1–2\t36 (22.8)\t13 (21.3)\t0.815\t\n pT3–4\t122 (77.2)\t48 (78.7)\t \t\n \t \t \t \t\npN stage\t\n pN0\t84 (54.6)\t36 (59.0)\t0.552\t\n pN1–2\t70 (45.5)\t25 (41.0)\t \t\n \t \t \t \t\nTumour grade\t\n G1–2\t154 (97.5)\t54 (88.5)\t0.012\t\n G3\t4 (2.5)\t7 (11.5)\t \t\n \t \t \t \t\nVascular invasion\t\n Absence\t112 (70.9)\t43 (70.5)\t0.954\t\n Presence\t46 (29.1)\t18 (29.5)\t \t\n \t \t \t \t\nKRAS\t \t \t \t\n Wild type\t117 (76.5)\t36 (63.2)\t0.054\t\n Mutation\t36 (23.5)\t21 (36.8)\t \t\n \t \t \t \t\nBRAF\t \t \t \t\n Wild type\t129 (89.6)\t39 (72.2)\t0.002\t\n Mutation\t15 (10.4)\t15 (27.8)\t \t\n \t \t \t \t\nKRAS/BRAF\t \t \t \t\n Both wild type\t108 (67.9)\t27 (42.9)\t< 0.001\t\n KRAS or BRAF mutation\t51 (32.1)\t36 (57.1)\t \t\n \t \t \t \t\nMicrosatellite status\t\n Stable/low\t126 (79.3)\t48 (76.2)\t0.618\t\n High\t33 (20.8)\t15 (23.8)\t \t\n \t \t \t \t\n \tMean (min, max)\t \t\nAge (years)\t\n Mean, range\t67.6, 43–95\t69.7, 44–89\t0.156\t\n \t \t \t \t\n \tRate (95% CI)\t \t\n5-year survival time\t\n All patients\t54.6 (47–63)\t52.3 (39–64)\t0.719\t\nAbbreviations: CI=confidence interval; N=frequency; TOPK=T-cell-originated protein kinase.\n\nTable 3 Two multivariable analyses of TOPK expression in sporadic KRAS-mutated or BRAF-mutated colorectal cancer patients\n\n \tAnalysis 1\t \t \tAnalysis 2\t \t\nVariable\tHazard ratio (95% CI)\tP-value\tVariable\tHazard ratio (95% CI)\tP-value\t\nTOPK expression\tTOPK expression\t\n Patchy\t1.0\t0.017\t Patchy\t1.0\t0.018\t\n Diffuse\t2.42 (1.2–5.0)\t \t Diffuse\t2.39 (1.2–4.9)\t \t\n \t \t \t \t \t \t\nAge\tpT stage\t\n Baseline year\t1.0\t0.004\t pT1–2\t1.0\t0.826\t\n \t1.06 (1.1–1.1)\t \t pT3–4\t1.13 (0.4–3.3)\t \t\n \t \t \t \t \t \t\npT stage\tpN stage\t\n PT1–2\t1.0\t0.542\t pN0\t1.0\t0.177\t\n PT3–4\t0.71 (0.3–2.1)\t \t pN1–2\t1.63 (0.8–3.3)\t \t\n \t \t \t \t \t \t\npN stage\tMSI status\t\n pN0\t1.0\t0.352\t MSS/MSI-L\t1.0\t0.112\t\n pN1–2\t1.38 (0.7–2.7)\t \t MSI-H\t1.9 (0.9–4.2)\t \t\nAbbreviations: CI=confidence interval; MSI=microsatellite instability; MSI-L=MSI low; MSI-H=MSI high; MSS=microsatellite stable; TOPK=T-cell-originated protein kinase.\n\nTable 4 Group 3: immunohistochemical expression of TOPK (patchy or diffuse) and association with clinicopathological and molecular features in hereditary Lynch syndrome-associated colorectal cancers\n\n \tGroup 3 (N (%))\t\nClinicopathological features\tPatchy\tDiffuse\tP-value\t\nGender\t\n Female\t22 (53.7)\t18 (60.0)\t0.635\t\n Male\t19 (46.3)\t12 (40.0)\t \t\n \t \t \t \t\nTumour location\t\n Left sided\t18 (46.2)\t11 (39.3)\t0.21\t\n Right sided\t12 (30.7)\t14 (50.0)\t \t\n Rectum\t9 (23.1)\t3 (10.7)\t \t\n \t \t \t \t\npT stage\t\n pT1–2\t12 (31.6)\t2 (6.9)\t0.014\t\n pT3–4\t26 (68.4)\t27 (93.1)\t \t\n \t \t \t \t\npN stage\t\n pN0\t23 (65.7)\t14 (51.9)\t0.27\t\n pN1–2\t12 (34.3)\t13 (48.2)\t \t\n \t \t \t \t\npM stage\t\n pM0\t14 (70.0)\t5 (55.6)\t0.675\t\n pM1\t6 (30.0)\t4 (44.4)\t \t\n \t \t \t \t\nTumour grade\t\n G1–2\t24 (72.7)\t18 (64.3)\t0.478\t\n G3\t9 (27.3)\t10 (35.7)\t \t\n \t \t \t \t\nKRAS\t\n Wild type\t28 (68.3)\t20 (61.0)\t1.0\t\n Mutation\t13 (31.7)\t9 (31.0)\t \t\n \t \t \t \t\nBRAF\t\n Wild type\t38 (100.0)\t28 (96.6)\t0.433\t\n Mutation\t0 (0.0)\t1 (3.5)\t \t\n \t \t \t \t\nKRAS/BRAF\t\n Both wild type\t28 (68.3)\t19 (65.5)\t1.0\t\n KRAS or BRAF mutation\t13 (31.7)\t10 (34.5)\t \t\n \t \t \t \t\nMicrosatellite status\t\n Stable/low\t \t \t \t\n High\t41 (57.3)\t30 (42.3)\t0.192\t\n \t \t \t \t\n \tMean (min, max)\t \t\nAge (years)\t\n Mean, range\t45.3, 24–73\t47.4, 27–83\t0.492\t\n \t \t \t \t\n \tRate (95% CI)\t \t\n5-year survival time\t\n All patients\t87.5 (73–95)\t88.7 (69–96)\t0.66\t\nAbbreviations: CI=confidence interval; EGFR=epidermal growth factor receptor; N=frequency; TOPK=T-cell-originated protein kinase.\n\nTable 5 Group 4: Immunohistochemical expression of TOPK (patchy or diffuse) and clinicopathological and molecular features in metastatic colorectal cancer patients treated with anti-EGFR therapy\n\n \tN (%)\t\nClinicopathological features\tPatchy\tDiffuse\tP-value\t\nAge (years)\t\n Mean, range\t65.7, 48–82\t60.7, 26–79\t0.113\t\n \t \t \t \t\nGender\t\n Female\t8 (36.4)\t9 (39.1)\t0.848\t\n Male\t14 (63.6)\t14 (60.9)\t \t\n \t \t \t \t\nClinical response\t\n Progressive disease\t13 (59.1)\t10 (43.5)\t0.528\t\n Partial response\t4 (18.2)\t7 (30.4)\t \t\n Stable disease\t5 (22.7)\t6 (26.1)\t \t\n \t \t \t \t\nKRAS codon 12 and 13\t\n Wild type\t13 (59.1)\t19 (82.6)\t0.082\t\n Mutation\t9 (40.9)\t4 (17.4)\t \t\n \t \t \t \t\nBRAF codon 600\t\n Wild type\t20 (90.9)\t21 (91.3)\t1.0\t\n Mutation\t2 (9.1)\t2 (8.7)\t \t\n \t \t \t \t\nKRAS/BRAF\t\n Both wild type\t11 (50.0)\t17 (73.9)\t0.098\t\n KRAS or BRAF mutation\t11 (50.0)\t6 (26.1)\t \t\n \t \t \t \t\nMicrosatellite status\t\n Stable/low\t22 (100.0)\t22 (100.0)\t \t\n High\t \t \t \t\n \t \t \t \t\nEGFR amplification\t\n No copy number gain\t4 (19.1)\t3 (13.0)\t0.693\t\n Copy number gain\t17 (81.0)\t20 (87.0)\t \t\n \t \t \t \t\nPI3KCA\t\n Loss\t19 (86.4)\t20 (87.0)\t1.0\t\n Overexpression\t3 (13.6)\t3 (13.0)\t \t\n \t \t \t \t\nPTEN\t\n Loss\t11 (50.0)\t6 (26.1)\t0.09\t\n Overexpression\t11 (50.0)\t17 (73.9)\t \t\n \t \t \t \t\n \tRate (95% CI)\t \t\n5-year survival time\t\n All patients\t34.5 (11–60)\t13.5 (1–40)\t0.473\t\n Either KRAS or BRAF mutation\t18.2 (3–44)\t16.7 (0–51)\t0.887\t\n Both wild type KRAS and BRAF\t66.7 (5–95)\t15.3 (1–45)\t0.018\t\n Stable disease or response\t100\t31.3 (8–59)\t0.01\t\nAbbreviations: CI=confidence interval; EGFR=epidermal growth factor receptor; N=frequency; TOPK=T-cell-originated protein kinase.\n==== Refs\nAbe Y, Matsumoto S, Kito K, Ueda N (2000) Cloning and expression of a novel MAPKK-like protein kinase, lymphokine-activated killer T-cell-originated protein kinase, specifically expressed in the testis and activated lymphoid cells. J Biol Chem 275 : 21525–2153110781613\nAmado RG, Wolf M, Peeters M, Van Cutsem E, Siena S, Freeman DJ, Juan T, Sikorski R, Suggs S, Radinsky R, Patterson SD, Chang DD (2008) Wild-type KRAS is required for panitumumab efficacy in patients with metastatic colorectal cancer. J Clin Oncol 26 : 1626–163418316791\nAndreyev HJ, Norman AR, Cunningham D, Oates JR, Clarke PA (1998) Kirsten ras mutations in patients with colorectal cancer: the multicenter ‘RASCAL’ study. J Natl Cancer Inst 90 : 675–6849586664\nAu HJ, Karapetis CS, O’Callaghan CJ, Tu D, Moore MJ, Zalcberg JR, Kennecke H, Shapiro JD, Koski S, Pavlakis N, Charpentier D, Wyld D, Jefford M, Knight GJ, Magoski NM, Brundage MD, Jonker DJ (2009) Health-related quality of life in patients with advanced colorectal cancer treated with cetuximab: overall and KRAS-specific results of the NCIC CTG and AGITG CO.17 trial. J Clin Oncol 27 : 1822–182819273701\nAyllon V, O’Connor R (2007) PBK/TOPK promotes tumour cell proliferation through p38 MAPK activity and regulation of the DNA damage response. Oncogene 26 : 3451–346117160018\nBos JL, Fearon ER, Hamilton SR, Verlaan-de Vries M, van Boom JH, van der Eb AJ, Vogelstein B (1987) Prevalence of ras gene mutations in human colorectal cancers. Nature 327 : 293–2973587348\nDi Nicolantonio F, Martini M, Molinari F, Sartore-Bianchi A, Arena S, Saletti P, De Dosso S, Mazzucchelli L, Frattini M, Siena S, Bardelli A (2008) Wild-type BRAF is required for response to panitumumab or cetuximab in metastatic colorectal cancer. J Clin Oncol 26 : 5705–571219001320\nDougherty JD, Garcia AD, Nakano I, Livingstone M, Norris B, Polakiewicz R, Wexler EM, Sofroniew MV, Kornblum HI, Geschwind DH (2005) PBK/TOPK, a proliferating neural progenitor-specific mitogen-activated protein kinase kinase. J Neurosci 25 : 10773–1078516291951\nFang JY, Richardson BC (2005) The MAPK signalling pathways and colorectal cancer. Lancet Oncol 6 : 322–32715863380\nFrattini M, Saletti P, Romagnani E, Martin V, Molinari F, Ghisletta M, Camponovo A, Etienne LL, Cavalli F, Mazzucchelli L (2007) PTEN loss of expression predicts cetuximab efficacy in metastatic colorectal cancer patients. Br J Cancer 97 : 1139–114517940504\nFrench AJ, Sargent DJ, Burgart LJ, Foster NR, Kabat BF, Goldberg R, Shepherd L, Windschitl HE, Thibodeau SN (2008) Prognostic significance of defective mismatch repair and BRAF V600E in patients with colon cancer. Clin Cancer Res 14 : 3408–341518519771\nGaudet S, Branton D, Lue RA (2000) Characterization of PDZ-binding kinase, a mitotic kinase. Proc Natl Acad Sci USA 97 : 5167–517210779557\nGiusti RM, Shastri K, Pilaro AM, Fuchs C, Cordoba-Rodriguez R, Koti K, Rothmann M, Men AY, Zhao H, Hughes M, Keegan P, Weiss KD, Pazdur R (2008) US Food and Drug Administration approval: panitumumab for epidermal growth factor receptor-expressing metastatic colorectal carcinoma with progression following fluoropyrimidine-, oxaliplatin-, and irinotecan-containing chemotherapy regimens. Clin Cancer Res 14 : 1296–130218316547\nGreen RC, Parfrey PS, Woods MO, Younghusband HB (2009) Prediction of Lynch syndrome in consecutive patients with colorectal cancer. J Natl Cancer Inst 101 : 331–34019244167\nHerrero-Martin D, Osuna D, Ordonez JL, Sevillano V, Martins AS, Mackintosh C, Campos M, Madoz-Gurpide J, Otero-Motta AP, Caballero G, Amaral AT, Wai DH, Braun Y, Eisenacher M, Schaefer KL, Poremba C, de Alava E (2009) Stable interference of EWS-FLI1 in an Ewing sarcoma cell line impairs IGF-1/IGF-1R signalling and reveals TOPK as a new target. Br J Cancer 101 : 80–9019491900\nJass JR (2007) Classification of colorectal cancer based on correlation of clinical, morphological and molecular features. Histopathology 50 : 113–13017204026\nJass JR, Atkin WS, Cuzick J, Bussey HJ, Morson BC, Northover JM, Todd IP (1986) The grading of rectal cancer: historical perspectives and a multivariate analysis of 447 cases. Histopathology 10 : 437–4593721406\nJimeno A, Messersmith WA, Hirsch FR, Franklin WA, Eckhardt SG (2009) KRAS mutations and sensitivity to epidermal growth factor receptor inhibitors in colorectal cancer: practical application of patient selection. J Clin Oncol 27 : 1130–113619124802\nKarapetis CS, Khambata-Ford S, Jonker DJ, O’Callaghan CJ, Tu D, Tebbutt NC, Simes RJ, Chalchal H, Shapiro JD, Robitaille S, Price TJ, Shepherd L, Au HJ, Langer C, Moore MJ, Zalcberg JR (2008) K-ras mutations and benefit from cetuximab in advanced colorectal cancer. N Engl J Med 359 : 1757–176518946061\nLievre A, Bachet JB, Le Corre D, Boige V, Landi B, Emile JF, Cote JF, Tomasic G, Penna C, Ducreux M, Rougier P, Penault-Llorca F, Laurent-Puig P (2006) KRAS mutation status is predictive of response to cetuximab therapy in colorectal cancer. Cancer Res 66 : 3992–399516618717\nLugli A, Karamitopoulou E, Panayiotides I, Karakitsos P, Rallis G, Peros G, Iezzi G, Spagnoli G, Bihl M, Terracciano L, Zlobec I (2009) CD8+ lymphocytes/ tumour-budding index: an independent prognostic factor representing a ‘pro-/anti-tumour’ approach to tumour host interaction in colorectal cancer. Br J Cancer 101 (8): 1382–139219755986\nMatsumoto S, Abe Y, Fujibuchi T, Takeuchi T, Kito K, Ueda N, Shigemoto K, Gyo K (2004) Characterization of a MAPKK-like protein kinase TOPK. Biochem Biophys Res Commun 325 : 997–100415541388\nNandi A, Tidwell M, Karp J, Rapoport AP (2004) Protein expression of PDZ-binding kinase is up-regulated in hematologic malignancies and strongly down-regulated during terminal differentiation of HL-60 leukemic cells. Blood Cells Mol Dis 32 : 240–24514757441\nOgino S, Nosho K, Kirkner GJ, Kawasaki T, Meyerhardt JA, Loda M, Giovannucci EL, Fuchs CS (2009) CpG island methylator phenotype, microsatellite instability, BRAF mutation and clinical outcome in colon cancer. Gut 58 : 90–9618832519\nOh SM, Zhu F, Cho YY, Lee KW, Kang BS, Kim HG, Zykova T, Bode AM, Dong Z (2007) T-lymphokine-activated killer cell-originated protein kinase functions as a positive regulator of c-Jun-NH2-kinase 1 signaling and H-Ras-induced cell transformation. Cancer Res 67 : 5186–519417545598\nOliveira C, Velho S, Moutinho C, Ferreira A, Preto A, Domingo E, Capelinha AF, Duval A, Hamelin R, Machado JC, Schwartz Jr S, Carneiro F, Seruca R (2007) KRAS and BRAF oncogenic mutations in MSS colorectal carcinoma progression. Oncogene 26 : 158–16316953233\nPark JH, Lin ML, Nishidate T, Nakamura Y, Katagiri T (2006) PDZ-binding kinase/T-LAK cell-originated protein kinase, a putative cancer/testis antigen with an oncogenic activity in breast cancer. Cancer Res 66 : 9186–919516982762\nRamos JW (2008) The regulation of extracellular signal-regulated kinase (ERK) in mammalian cells. Int J Biochem Cell Biol 40 : 2707–271918562239\nRoberts PJ, Der CJ (2007) Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene 26 : 3291–331017496923\nSamowitz WS, Sweeney C, Herrick J, Albertsen H, Levin TR, Murtaugh MA, Wolff RK, Slattery ML (2005) Poor survival associated with the BRAF V600E mutation in microsatellite-stable colon cancers. Cancer Res 65 : 6063–606916024606\nSartore-Bianchi A, Martini M, Molinari F, Veronese S, Nichelatti M, Artale S, Di Nicolantonio F, Saletti P, De Dosso S, Mazzucchelli L, Frattini M, Siena S, Bardelli A (2009) PIK3CA mutations in colorectal cancer are associated with clinical resistance to EGFR-targeted monoclonal antibodies. Cancer Res 69 : 1851–185719223544\nSauter G, Simon R, Hillan K (2003) Tissue microarrays in drug discovery. Nat Rev Drug Discov 2 : 962–97214654795\nSegal NH, Saltz LB (2009) Evolving treatment of advanced colon cancer. Annu Rev Med 60 : 207–21919630571\nSiena S, Sartore-Bianchi A, Di Nicolantonio F, Balfour J, Bardelli A (2009) Biomarkers predicting clinical outcome of epidermal growth factor receptor-targeted therapy in metastatic colorectal cancer. J Natl Cancer Inst 101 (19): 1308–132419738166\nSimons-Evelyn M, Bailey-Dell K, Toretsky JA, Ross DD, Fenton R, Kalvakolanu D, Rapoport AP (2001) PBK/TOPK is a novel mitotic kinase which is upregulated in Burkitt′s lymphoma and other highly proliferative malignant cells. Blood Cells Mol Dis 27 : 825–82911783945\nUmar A, Boland CR, Terdiman JP, Syngal S, de la Chapelle A, Ruschoff J, Fishel R, Lindor NM, Burgart LJ, Hamelin R, Hamilton SR, Hiatt RA, Jass J, Lindblom A, Lynch HT, Peltomaki P, Ramsey SD, Rodriguez-Bigas MA, Vasen HF, Hawk ET, Barrett JC, Freedman AN, Srivastava S (2004) Revised Bethesda Guidelines for hereditary nonpolyposis colorectal cancer (Lynch syndrome) and microsatellite instability. J Natl Cancer Inst 96 : 261–26814970275\nYuryev A, Wennogle LP (2003) Novel raf kinase protein–protein interactions found by an exhaustive yeast two-hybrid analysis. Genomics 81 : 112–12512620389\nZhao S, Dai J, Zhao W, Xia F, Zhou Z, Wang W, Gu S, Ying K, Xie Y, Mao Y (2001) PDZ-binding kinase participates in spermatogenesis. Int J Biochem Cell Biol 33 : 631–63611378444\nZhu F, Zykova TA, Kang BS, Wang Z, Ebeling MC, Abe Y, Ma WY, Bode AM, Dong Z (2007) Bidirectional signals transduced by TOPK-ERK interaction increase tumorigenesis of HCT116 colorectal cancer cells. Gastroenterology 133 : 219–23117631144\nZlobec I, Terracciano L, Tornillo L, Gunthert U, Vuong T, Jass JR, Lugli A (2008) Role of RHAMM within the hierarchy of well-established prognostic factors in colorectal cancer. Gut 57 : 1413–141918436576\nZykova TA, Zhu F, Lu C, Higgins L, Tatsumi Y, Abe Y, Bode AM, Dong Z (2006) Lymphokine-activated killer T-cell-originated protein kinase phosphorylation of histone H2AX prevents arsenite-induced apoptosis in RPMI7951 melanoma cells. Clin Cancer Res 12 : 6884–689317145805\n\n",
"fulltext_license": "CC BY",
"issn_linking": "0007-0920",
"issue": "102(1)",
"journal": "British journal of cancer",
"keywords": null,
"medline_ta": "Br J Cancer",
"mesh_terms": "D000230:Adenocarcinoma; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; D000970:Antineoplastic Agents; D000068818:Cetuximab; D015179:Colorectal Neoplasms; D003123:Colorectal Neoplasms, Hereditary Nonpolyposis; D066246:ErbB Receptors; D005260:Female; D005500:Follow-Up Studies; D015972:Gene Expression Regulation, Neoplastic; D011905:Genes, ras; D006801:Humans; D008297:Male; D008875:Middle Aged; D020929:Mitogen-Activated Protein Kinase Kinases; D015588:Observer Variation; D000077544:Panitumumab; D011237:Predictive Value of Tests; D011379:Prognosis; D047428:Protein Kinase Inhibitors; D017346:Protein Serine-Threonine Kinases; D048493:Proto-Oncogene Proteins B-raf; D011897:Random Allocation; D015203:Reproducibility of Results; D015398:Signal Transduction",
"nlm_unique_id": "0370635",
"other_id": null,
"pages": "151-61",
"pmc": null,
"pmid": "19935791",
"pubdate": "2010-01-05",
"publication_types": "D003160:Comparative Study; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "18519771;16982762;12620389;18316791;18562239;17496923;10781613;10779557;9586664;19491900;3721406;18316547;14654795;17940504;15541388;19001320;17160018;19755986;3587348;16291951;19124802;19273701;16024606;18946061;19244167;19630571;17545598;16953233;19738166;19223544;18832519;17145805;17204026;16618717;14970275;18436576;15863380;11783945;17631144;14757441;11378444",
"title": "Prognostic and predictive value of TOPK stratified by KRAS and BRAF gene alterations in sporadic, hereditary and metastatic colorectal cancer patients.",
"title_normalized": "prognostic and predictive value of topk stratified by kras and braf gene alterations in sporadic hereditary and metastatic colorectal cancer patients"
} | [
{
"companynumb": "CH-AMGEN-CHESP2021170399",
"fulfillexpeditecriteria": "2",
"occurcountry": "CH",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PANITUMUMAB"
},
"drugadditional": "3",
... |
{
"abstract": "Procedural sedation and analgesia (PSA) should be a priority in the emergency care of injured children. This humanistic approach is particularly important in paediatric victims of disaster, because these patients are prone to psychological distress secondary to the traumatic event. Following the Nepal earthquake, an Israeli field hospital (IFH) was deployed in Kathmandu. We report our experience with PSA in the emergency room (ER) of the IFH. 22 children underwent surgery in the operating room and 10 underwent PSA in the ER by paediatric emergency physicians: 6 had wound debridement, 2 had fracture reduction and 2 had laceration repair. All the procedures were successfully completed in the ER and no patient required intubation or admission to the intensive care unit due to an adverse event. The present study is the first report of the practice of paediatric PSA by non-anaesthesiologists in a field hospital.",
"affiliations": "Israel Defense Forces, Medical Corps, Tel Hashomer, Israel Pediatric Emergency Department, Shaare Zedek Medical Center, Jerusalem, Israel.;Israel Defense Forces, Medical Corps, Tel Hashomer, Israel Pediatric Department, Hadassah Medical Center, Ein Kerem, Jerusalem, Israel.;Israel Defense Forces, Medical Corps, Tel Hashomer, Israel Pediatric Emergency Department, Shaare Zedek Medical Center, Jerusalem, Israel.;Israel Defense Forces, Medical Corps, Tel Hashomer, Israel Department of Military Medicine, Hebrew University, Jerusalem, Israel.;Pediatric Emergency Department, Rambam Health Care Campus, Haifa, Israel.",
"authors": "Weiser|Giora|G|;Ilan|Uri|U|;Mendlovic|Joseph|J|;Bader|Tarif|T|;Shavit|Itai|I|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1136/emermed-2015-205297",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1472-0205",
"issue": "33(10)",
"journal": "Emergency medicine journal : EMJ",
"keywords": "disaster planning and response; paediatric injury; pain management",
"medline_ta": "Emerg Med J",
"mesh_terms": "D000293:Adolescent; D000698:Analgesia; D002648:Child; D002675:Child, Preschool; D016292:Conscious Sedation; D055866:Earthquakes; D005260:Female; D006801:Humans; D007223:Infant; D008297:Male; D008952:Mobile Health Units; D009390:Nepal; D012189:Retrospective Studies; D014947:Wounds and Injuries",
"nlm_unique_id": "100963089",
"other_id": null,
"pages": "745-7",
"pmc": null,
"pmid": "27044950",
"pubdate": "2016-10",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Procedural sedation and analgesia in the emergency room of a field hospital after the Nepal earthquake.",
"title_normalized": "procedural sedation and analgesia in the emergency room of a field hospital after the nepal earthquake"
} | [
{
"companynumb": "IL-MYLANLABS-2018M1058384",
"fulfillexpeditecriteria": "1",
"occurcountry": "NP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PROPOFOL"
},
"drugadditional": "3",
... |
{
"abstract": "A prospective, randomized, multicenter study of patients with oropharyngeal and pharyngolaryngeal tumors compared locoregional treatment alone with neoadjuvant chemotherapy with carboplatin/5-fluorouracil (5-FU) followed by locoregional treatment. The aim of the study was to evaluate the role of chemotherapy on survival and on the need for mutilating surgery. Since 1988, 219 patients (105 with oropharyngeal and 114 with pharyngolaryngeal tumors) have entered the study. All patients randomized to neoadjuvant chemotherapy received three cycles of carboplatin 400 mg/m2 day 1 and 5-FU 1 g/m2/d as a continuous infusion days 1 through 5 every 3 weeks. Neoadjuvant chemotherapy was given to 108 patients. The 268 evaluable courses induced a low rate of grade 3 or 4 toxicity. Four patients (3.6%) died of major complications. The complete response (CR) rate was 31%, which represented a decrease in mutilating surgery of 30%. (Patients with CRs had radiotherapy alone instead of radiosurgical treatment as originally planned.) The objective response rate was 61%. Survival curves for the chemotherapy and chemotherapy-naive groups were not significantly different. The rate of nodal recurrence was significantly higher in the chemotherapy group, however, and chemotherapy did not decrease the rate of second primary tumors or distant metastases. Thus, the justification for neoadjuvant chemotherapy may be a decreased rate of mutilating surgery. These preliminary results are encouraging, but follow-up is as yet too short to allow definite conclusions.",
"affiliations": "Head and Neck Surgery Department, Bichat-Claude Bernard Hospital, Paris, France.",
"authors": "Gehanno|P|P|;Depondt|J|J|;Peynegre|R|R|;Peytral|C|C|;Martin|M|M|;Baillet|F|F|;Guerrier|B|B|;Dubreuil|C|C|;Pellae Cosset|B|B|",
"chemical_list": "D016190:Carboplatin; D005472:Fluorouracil",
"country": "England",
"delete": false,
"doi": "10.1093/annonc/3.suppl_3.s43",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0923-7534",
"issue": "3 Suppl 3()",
"journal": "Annals of oncology : official journal of the European Society for Medical Oncology",
"keywords": null,
"medline_ta": "Ann Oncol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D016190:Carboplatin; D017024:Chemotherapy, Adjuvant; D005472:Fluorouracil; D005500:Follow-Up Studies; D006258:Head and Neck Neoplasms; D006801:Humans; D008875:Middle Aged; D015996:Survival Rate",
"nlm_unique_id": "9007735",
"other_id": null,
"pages": "43-6",
"pmc": null,
"pmid": "1390316",
"pubdate": "1992-08",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial",
"references": null,
"title": "Neoadjuvant combination of carboplatin and 5-FU in head and neck cancer: a randomized study.",
"title_normalized": "neoadjuvant combination of carboplatin and 5 fu in head and neck cancer a randomized study"
} | [
{
"companynumb": "FR-PFIZER INC-2021009427",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nChronic Epstein Barr virus (EBV) infection in an immunocompetent host has been described however it is not a common entity. It has been linked to many lymphoproliferative disorders and achieves such via many molecular mechanisms, some of which are poorly understood. In addition to infectious mononucleosis, the EBV is linked to various other hematological pathologies and autoimmune disorders.\n\n\nMETHODS\nWe describe the case of an elderly immunocompetent female who presented with non-specific symptomatology, lymphadenopathy, cytopenias, elevated autoantibody titers and a crescent EBV viral load that were suggestive of a multisystemic inflammatory disease related to EBV. Extensive work up including multiple bone marrow biopsy and lymphoid tissue procedures ultimately led to the diagnosis of Hodgkin lymphoma.\n\n\nCONCLUSIONS\nEBV-related lymphomagenesis is complex and through the utilization of its nuclear antigens and latent membrane proteins the virus is able to shape the microenvironment to promote the various pathologies seen. Moreover, the diagnosis of EBV-associated lymphoproliferative disorders might be challenging when they present in immunocompetent individuals. Our case also represents an emphatic reminder for clinicians that spontaneous regression of lymphadenopathy is not exclusive of low-grade lymphoid malignancies.",
"affiliations": "Department of Internal Medicine, University of Texas, Houston Health Sciences Center, Houston, TX USA.;Department of Hematopathology, University of Texas MD Anderson Cancer Center, Houston, TX USA.;Section of Benign Hematology, University of Texas MD Anderson Cancer Center, Houston, TX USA.",
"authors": "Sarwari|Nawid M|NM|;Khoury|Joseph D|JD|;Hernandez|Cristhiam M Rojas|CM|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s12878-016-0059-3",
"fulltext": "\n==== Front\nBMC HematolBMC HematolBMC Hematology2052-1839BioMed Central London 5910.1186/s12878-016-0059-3Case ReportChronic Epstein Barr virus infection leading to classical Hodgkin lymphoma Sarwari Nawid M. Nawid.m.Sarwari@uth.tmc.edu Khoury Joseph D. JKhoury@mdanderson.org Hernandez Cristhiam M. Rojas CMRojas@mdanderson.org Department of Internal Medicine, University of Texas, Houston Health Sciences Center, Houston, TX USA Department of Hematopathology, University of Texas MD Anderson Cancer Center, Houston, TX USA Section of Benign Hematology, University of Texas MD Anderson Cancer Center, Houston, TX USA 19 7 2016 19 7 2016 2016 16 1911 11 2015 30 6 2016 © The Author(s). 2016\nOpen AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nChronic Epstein Barr virus (EBV) infection in an immunocompetent host has been described however it is not a common entity. It has been linked to many lymphoproliferative disorders and achieves such via many molecular mechanisms, some of which are poorly understood. In addition to infectious mononucleosis, the EBV is linked to various other hematological pathologies and autoimmune disorders.\n\nCase presentation\nWe describe the case of an elderly immunocompetent female who presented with non-specific symptomatology, lymphadenopathy, cytopenias, elevated autoantibody titers and a crescent EBV viral load that were suggestive of a multisystemic inflammatory disease related to EBV. Extensive work up including multiple bone marrow biopsy and lymphoid tissue procedures ultimately led to the diagnosis of Hodgkin lymphoma.\n\nConclusion\nEBV-related lymphomagenesis is complex and through the utilization of its nuclear antigens and latent membrane proteins the virus is able to shape the microenvironment to promote the various pathologies seen. Moreover, the diagnosis of EBV-associated lymphoproliferative disorders might be challenging when they present in immunocompetent individuals. Our case also represents an emphatic reminder for clinicians that spontaneous regression of lymphadenopathy is not exclusive of low-grade lymphoid malignancies.\n\nKeywords\nEpstein Barr VirusLymphomaLymphadenopathyCytopeniasissue-copyright-statement© The Author(s) 2016\n==== Body\nBackground\nInfectious mononucleosis is considered a common worldwide infection, with a lifetime prevalence of 90 %. EBV is the major cause of infectious mononucleosis 90 % of the time. It is a double stranded DNA virus that belongs to the family Herpesviridae and subfamily Gamma herpesviridae [1]. Clinically many entities may mimic infectious mononucleosis thus careful examination and history taking must ensue to ensure proper diagnosis and management. It is defined as the classical triad of fever, pharyngitis, and cervical lymphadenopathy along with lymphocytosis. The challenge herein lies in the nonspecific prodromal symptoms such as fevers, chills, and malaise which may mimic various other bacterial, viral, or fungal infections. The lymphadenopathy may be prominent in the anterior as well as the posterior triangles of the neck. Furthermore, certain patients may exhibit palatal petechiae, splenomegaly, hepatomegaly, and jaundice.\n\nThe acute viral infection generally resolves within 2–4 weeks. Most cases can be treated with conservative measures such as rest, hydration, analgesics, and antipyretics. In most cases of infectious mononucleosis, splenomegaly resolves by 4–6 weeks.\n\nLess commonly, EBV infection may cause further neurological and hematological complications such as immune mediated cytopenias. EBV has been implicated in several autoimmune diseases, most notably systemic lupus erythematosus, rheumatoid arthritis and multiple sclerosis. It is postulated that EBV may be an early environmental trigger of such autoimmune diseases [2].\n\nThe virus can remain in a latent status with genome persisting in the nucleus of infected cells in the form of non-integrated circular episomes that have a nucleosomal pattern similar to the host chromatin. Through histone modification and DNA methylation, viral promoters are regulated for the lytic cell cycle reactivation. The EBV latent episomes have also the capacity to influence the epigenetic state of the host DNA and result into modulation of tumor suppressor gene expression and carcinogenesis, including lymphomas [3].\n\nThe lymphoproliferative disorders associated with EBV include Burkitt lymphoma, and Hodgkin lymphoma. Other described types of malignant neoplasms associated to EBV include plasmablastic lymphoma, EBV-positive diffuse large B-cell lymphoma, primary effusion lymphoma, classical Hodgkin lymphoma, T/NK lymphoproliferative disorders and lymphomatoid granulomatosis [4, 5].\n\nCase presentation\nA 69 year old Hispanic female with a past medical history significant for hypertension, diabetes mellitus, coronary artery disease status post revascularization, ischemic cardiomyopathy and chronic kidney disease had presented to our hospital for further evaluation and care. For the past few months the patient had suffered weight loss (approximately 30–35 lb), generalized malaise, low grade fevers (99.9 F), non-productive cough, myalgias and arthralgias. She did not endorse any night sweats or recent travel history, and there were no sick contacts at home. Prior to admission to our institution the patient was at an outside hospital and was being treated for sepsis with combinations of antibiotics including intravenous vancomycin, meropenem, echinocandin, metronidazole, and piperacillin tazobactam for 2 to 3 weeks duration as she was developing fevers and productive cough.\n\nThe physical exam yielded a thin and chronically ill appearing female patient.\n\nVital signs at the time of admission were notable for hypertension (186/79 mmHg). Her eyes did not show any conjunctival hemorrhaging or icterus, however there was conjunctival pallor. Oropharynx did not show any active exudates or ulcerative lesions. Her cardiac exam did not reveal any murmurs and her airways were clear to auscultation. Abdominal exam revealed palpable splenomegaly. Examination of the extremities did not show nail deformities including splinter hemorrhages or nail pitting. Her skin had no evidence of skin nodularities or other lesions. There was a 1 cm non tender, movable left axillary lymph node. The rest of the physical examination was unremarkable.\n\nInitial laboratory work revealed that the patient had pancytopenia. White blood cell count (WBC) was stated at 2.4 K/uL, absolute neutrophil count (ANC) 1.92 K/uL, hemoglobin (Hgb) of 11.6, and platelet count of 39,000/uL. B2-microglobulin was seen elevated at 9.2 mg/L. Basic metabolic panel obtained showed sodium 134 mEq/L, Potassium 3.5 mEq/L, Chloride 103 mEq/L, Bicarbonate 26 mEq/L, Blood urea nitrogen 30 mg/dl, Creatinine 0.90 mg/dl, glucose 220 mg/dl. Liver function panel showed Albumin 2.2 g/dl, normal transaminases, total bilirubin 0.8 mg/dl, direct bilirubin 0.4 mg/dl. Urine analysis showed 200 mg/dl of protein and occasional amorphous crystals.\n\nInitial computed tomography (CT) scan of the abdomen and pelvis during hospital admission showed a 15 cm spleen which was heterogenous and micronodular, as well as scattered abdominal and pelvic lymphadenopathy (Fig. 1a). No imaging signs of portal hypertension were noted.Fig. 1 Imaging findings at disease presentation and progression. a CT abdomen and pelvis with contrast showing an enlarged spleen with micronodular pattern. b PET-CT imaging showing interval resolution of splenomegaly and documenting no evidence of hypermetabolic adenopathy. c Repeat CT chest with contrast evidencing development of a right axillary node measuring 2.9 × 2.4 cm and a left axillary node measuring 3 × 1.5 cm (white arrows). d Repeat CT abdomen and pelvis evidencing again an enlarged spleen with numerous small subtle hypodense nodules\n\n\n\nDuring the hospitalization our patient was noted to become more confused and agitated, and there was concern that the patient was having seizures as she was seen numerous times to lose consciousness and awaken, with occasional loss of bladder function. A brain magnetic resonance imaging (MRI) showed subcortical non enhancing FLAIR hyper intense foci in the bilateral posterior occipital lobes.\n\nLumbar puncture and cerebral spinal fluid (CSF) studies were further performed for further analysis, and showed: WBC 1; no red blood cells; protein 62 mg/dL; glucose 35 mg/dL; and, lactate dehydrogenase 234 mIU/mL. Most notable negative findings in the CSF included no detectable viral cultures for cytomegalovirus, adenovirus, herpes virus, and varicella zoster virus, negative cryptococcal antigen serology and negative bacterial and fungal cultures.\n\nElectroencephalogram studies showed triphasic morphology waves with and without sharp negative component at 2–3 hertz. These were seen in continuum mostly with subtle waxing and waning features. To 0.5 mg intravenous alprazolam, above discharges had slowly resolved, replaced by organized background that consists of 6 hertz rhythms. Importantly, there was a clinical improvement after alprazolam; suggesting a nonconvulsive seizures responding to benzodiazepine.\n\nTwo weeks later after the initial CT imaging and after the patient was more stable from the neurological perspective in order to attempt a lymph node excisional biopsy, a PET-CT imaging was performed and showed complete resolution of the previously detected lymphadenopathy and splenomegaly. (Fig. 1b).\n\nAdditional serologies for viral hepatitis and autoimmune etiology work up were performed. A bone marrow biopsy was performed and additional serum erythropoietin level, iron profile; cobalamin and folate level were determined.\n\nThe patient returned to the benign hematology clinic after discharged from the hospital. During her follow up appointment she appeared in better spirits and recovering well. Physical examination was notable for an absence of lymphadenopathy particularly in the cervical and axillary region, as well as no palpable organomegaly in the abdomen. It was further revealed that her antinuclear antibody (ANA) titer was highly positive (1:640), ESR 108 mm/hr with a CRP 6.74 mg/L. Negative viral hepatitis B, C and Human Immunodeficiency virus serologies.\n\nSerum quantitative immunoglobulin showed a mildly elevated Ig A and Ig G level, without other abnormalities. Serum and urine protein electrophoresis did not reveal a monoclonal gammopathy. Serum free light chain levels showed kappa 96.3 mg/L and lambda 60.06 mg/dL with a normal ratio 1.6 in a patient with chronic kidney disease.\n\nComplement C3 level was normal with a slightly elevated C4 at 46 mg/dL.\n\nBone marrow aspirate yielded a predominance of CD3 positive polytypical small T cells and a population of polyclonal B-cells by flow cytometry and negative for lymphoma or other malignant process. A focal lymphohistiocytic aggregate with granuloma formation was noted; occasional larger cells with prominent nucleolus identified; eosinophils were increased mildly in the vicinity of this aggregate. Acid fast bacilli and fungal stains were attempted; however the focal granuloma could not be appreciated at subsequent sections.\n\nThe patient’s pancytopenia was thought to be likely secondary to systemic lupus erythematosus and she was thus referred to rheumatology for further work up, and further testing included anti-double-stranded DNA, anti-RNP, anti-CCP antibody, ANCA vasculitis panel, direct antiglobulin test, lupus anticoagulant, anticardiolipin antibody, anti-double-stranded DNA antibody, and anti-SSA and anti-SSB. All these tests were negative, thus ruling out systemic erythematous lupus, rheumatoid arthritis, and other connective tissue disorders.\n\nThe interval improvement and self-limited clinical course in our case led us to believe that her elevated ANA titers, her bone marrow granuloma were secondary to an EBV infection-related syndrome. Monospot test was not performed and at that point we evaluated for EBV PCR and EBER staining in the bone marrow. Initial EBV PCR results were positive (960 copies/mL), while Epstein–Barr virus-encoded small RNAs staining in the bone marrow was negative. Our in situ hybridization stain is validated to work on decalcified bone marrow trephine biopsies and all stains include an on-slide positive control. As such, the likelihood of a false negative result is low. A possible explanation includes a sampling factor with lack of infected B-cells in the bone marrow despite the presence of viremia.\n\nHer follow up labs during subsequent clinic visits showed WBC 5.3 K/uL, ANC 3.15 K/uL, Hgb 7.4 g/dL, calculated reticulocyte index of 1.1 and platelets 172 K/uL. Iron was 68 ug/dL, transferrin 124.1 mg/dL, ferritin 2952 ng/mL and serum erythropoietin levels were 31.7 mIU/mL. Serum cobalamin was 394 pg/mL and serum folate 12.3 ng/mL. Since there was spontaneous interval resolution of her neutropenia and her thrombocytopenia our diagnosis at that point was cytopenias secondary to infectious mononucleosis and anemia of chronic kidney disease related to diabetes.\n\nOur patient presented 7 weeks later at the emergency room with a recurrent febrile syndrome with diffuse cervical and axillary lymphadenopathy and splenomegaly (Fig. 1c-d) and worsening cytopenias: WBC 1800/uL, ANC 1480/uL, Hgb 8.3 gr/dL, platelet count 20,000/uL; a repeat EBV titer revealed 6580 copies/mL. CT imaging with contrast found bilateral axillary, mediastinal and hilar lymphadenopathy. Low volume retroperitoneal and pelvic lymphadenopathy, hepatosplenomegaly with numerous small ill-defined hypodense lesions was in the spleen and probably also within the liver (Fig. 1d). At this time a repeat bone marrow biopsy and an excisional lymph node biopsy were performed and reviewed. The bone marrow specimen showed a solitary large cell positive for CD30 identified in the clot. No atypical cells are identified in core biopsy as assessed by IHC for CD30 and Pax-5. EBER was positive in few and scattered cells. The lymph node sections demonstrated near-total effacement of the lymph node architecture by a neoplasm comprised of neoplastic cells with Hodgkin-Reed-Sternberg morphology. The neoplastic cells were positive for CD15, CD30, PAX5 (weak), and MUM1. They were negative for CD3, CD20, CD45, ALK, and EMA. The findings were diagnostic of classical Hodgkin lymphoma, best subtyped as lymphocyte-depleted. (Fig. 2a-c). The expression of PAX5 with weak intensity coupled with MUM1 expression by the neoplastic cells is diagnostic of classical Hodgkin lymphoma. The expression of PAX5, a gene encoding a B-cell-specific transcription factor, excluded T-cell lymphoma as a diagnostic consideration. It is worth noting also that flow cytometry done on a bone marrow sample with involvement by lymphoma showed no evidence of T-cell or B-cell immunophenotypic aberrancies.Fig. 2 Bone marrow histopathologic findings confirming diagnosis of Hodgkin lymphoma. a Bone marrow biopsy demonstrated involvement by classical Hodgkin lymphoma. Neoplastic large lymphoid cells with Hodgkin-Reed-Sternberg morphology were present in a background rich in histiocytes, small lymphocytes, and plasma cells. b The neoplastic cells were positive for CD30. The neoplastic cells were also positive for the B-cell marker PAX5 by immunohistochemistry (not shown). c Colorimetric in situ hybridization was positive for Epstein-Barr virus-encoded RNA within the neoplastic cells (blue signal)\n\n\n\nThe patient was started on ABVD chemotherapy regime, bleomycin was held secondary to patient’s history of cardiomyopathy. She received three cycles of chemotherapy with complete clinical remission. Additional cycles of chemotherapy were not completed given prolonged and severe chemotherapy-induced cytopenias that eventually recovered over the following months. A bone marrow biopsy at completion of treatment revealed no morphologic evidence of residual Hodgkin lymphoma. Her most recent surveillance PET-CT imaging, nine months from completion of treatment, showed no hypermetabolic lymphoma and continuing complete metabolic response to therapy.\n\nDiscussion\nHereby we have presented a challenging case of EBV infection leading to Hodgkin lymphoma, which initially manifested as a syndrome consisting of fever of unknown origin, lymphadenopathy, elevated ANA titer and cytopenias with spontaneous interval resolution suggesting infectious mononucleosis versus an autoimmune disorder. In an adult patient complaining of chronic fever with no true identifiable source, autoimmune disorders and etiologies including infectious endocarditis, intra-abdominal abscess and viral pathogens such as HIV are within the differential diagnoses. Occult malignancies are also etiologies of such a clinical presentation, especially in elderly population [6–8].\n\nRoughly one-third of healthy patients have a positive ANA titer of 1:40, and healthy woman are said to have a more likelihood of positive titers relative to men. Other non-rheumatological diseases such as thyroiditis, hepatitis, malignancies, infections, environmental exposures, and prescription drugs may show the presence of ANA [9]. Acute EBV infection or reactivation is correlated with the presence of high ANA antibodies which gives way to the notion that the virus causes the dysregulation of the immune response towards self-antigens. There is a certain level of molecular mimicry in inducing auto-antibodies and the immune response towards EBV [9].\n\nThe next diagnostic challenge in our case was the interpretation of the presence of granulomata in the bone marrow. A variety of disorders have been implicated in the pathogenesis of bone marrow granuloma. They include malignant lesions; viral, bacterial, and fungal infections; autoimmune diseases; drugs; and sarcoidosis [10]. The presence of non-caseating granulomata has been described and associated with Hodgkin lymphoma and non-hodgkin lymphoma [11–14]. In Hodgkin lymphoma, the frequency of involvement by granulomata in the bone marrow is not clearly determined, and some series have described it in up to 10 % of cases [14]. It seems that the presence of granulomata does not translate into a major difference on survival outcomes [12].\n\nThe EBV is associated with lymphoproliferative disorders (PTLD) that comprise a vast array of lymphoid proliferations after the organ transplant period. The patients affected comprise mainly those who have received either solid organ or bone marrow transplantation. The clinical spectrum ranges from that which mimics an inflammatory reaction to more aggressive and lethal B cell proliferations that often resemble non-Hodgkin lymphoma. The pathogenesis described involves the donor derived B cells which have been previously infected by EBV. With the organ recipient having insufficient T cell function, there is uninhibited growth of EBV infected cells. Multiple genetic mutations ensue which ultimately leads to virus-independent cell growth, which often exhibit more aggressive forms of disease. These tumors typically involve the transplanted organ or other regions of the gastrointestinal tract, and the incidence shows a direct relationship to the severity and duration of the immunosuppressive therapy [4]. Our case is unique in several aspects. The patient did not have a history of solid organ or hematologic transplant and she was not on pharmacologic immunosuppression. Her only risk factor for immune compromise was her history of diabetes. Her syndrome initially resembled the more benign subtypes of the PTLD which are characterized as more inflammatory and reactive with the regression and spontaneous resolution of lymphadenopathy and splenomegaly, however with time the aggressive malignancy was seen on biopsy as a rare entity: lymphocyte depleted Hodgkin lymphoma (HL).\n\nOf the various subtypes of HL, the lymphocyte depleted classical Hodgkin Lymphoma (LDCHL) type is the rarest and so consequentially little information is known about its clinical characteristics, course, and treatment outcomes. Less than 1 % of all patients with HL are diagnosed with LDHL. The diagnoses requires immunohistochemical staining which can show one of two subtypes of LDCHL; Reed-Sternberg (RS) cells in a hypocellular background with disordered fibrosis, and rich in histiocytes, or the reticular variant showing numerous RS cells with bizarre cytologic features [5].\n\nUnfortunately patients with the LDCHL tumor often have more unfavorable characteristics such as more advanced stage, B symptoms, mediastinal mass, extranodal disease, high ESR, and more lymph node involvement. Furthermore patients tend to have more bone marrow and liver involvement. Patients also have lower rates of complete remission, progression free survival (PFS), and overall survival (OS) relative to other patients with other HL subtypes. Clinically those with the LD subtype have poorer prognostic factors and poor overall outcomes [5]. Our case demonstrates the broad spectrum of EBV-related lymphoproliferative neoplasms and the occurrence in a patient without the classic immunosuppression risk factors.\n\nFinally, the prevalence and prognostic significance of EBV infection in classical Hodgkin lymphoma has been described in a recently published meta-analysis. It found that the prevalence of EBV is more common in males and typically seen in pediatric population, predominantly found in the mixed cellularity subtype and in patients with advanced clinical stage. However, the presence of EBV had little effect on patient’s overall and event-free survival [15].\n\nConclusion\nOur case illustrates one of the different clinical features in the spectrum of EBV infection. Age-related EBV-associated lymphoproliferative disorders represent a well described complication of EBV infection, typically seen in immunosuppressed individuals [16]. Our case describes an EBV-related syndrome in an immunocompetent host that mimicked features of a transient viral illness and a systemic inflammatory disorder. Ultimately, it declared itself with a pattern of chronicity that led to the diagnostic presumption and histopathologic confirmation of a rare subtype of classical Hodgkin lymphoma. Moreover, this case exemplifies a scenario where the classic “waxing and waning” clinical tendency is not pathognomonic of low grade lymphoproliferative disorders and can evidently be present in high grade lymphomas.\n\nAbbreviations\nANA, antinuclear antibodies; ANC, absolute neutrophil count; CT, computed tomography; CSF, cerebral spinal fluid; EBV, Epstein Barr virus; EBER, Epstein–Barr virus-encoded small RNAs; WBC, white blood cells; Hgb, hemoglobin; HL, Hodgkin lymphoma; LDCHL, lymphocyte depleted classical Hodgkin lymphoma; MRI, magnetic resonance imaging.\n\nAcknowledgements\nNo acknowledgements applicable.\n\nFunding\nNot applicable.\n\nAvailability of data and materials\nNot applicable.\n\nAuthors’ contributions\nNS & CMR: Writing of the manuscript, editing and final approval of the version to be published. JDK: Edition of the manuscript and final approval of the version to be published. All authors read and approved the final manuscript.\n\nAuthors’ information\nDr. Rojas Hernandez is an assistant professor in the department of benign hematology at The University of Texas MD Anderson Cancer Center. He specializes in blood disorders and actively sees patients and performs research. Dr. Joseph Khoury is an associate professor in the department of hematopathology at the University of Texas MD Anderson Cancer center. Dr. Nawid Sarwari is a medical resident at the University of Texas, Houston Health Sciences Center.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nConsent for publication\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nEthics approval and consent to participate\nNot applicable.\n==== Refs\nReferences\n1. Ok CY Li L Young KH EBV-driven B-cell lymphoproliferative disorders: from biology, classification and differential diagnosis to clinical management Exp Mol Med 2015 47 e132 10.1038/emm.2014.82 25613729 \n2. Lossius A Johansen JN Torkildsen O Vartdal F Holmoy T Epstein-Barr virus in systemic lupus erythematosus, rheumatoid arthritis and multiple sclerosis-association and causation Viruses 2012 4 12 3701 3730 10.3390/v4123701 23342374 \n3. Tempera I Lieberman PM Epigenetic regulation of EBV persistence and oncogenesis Semin Cancer Biol 2014 26 22 29 10.1016/j.semcancer.2014.01.003 24468737 \n4. Ng SB Khoury JD Epstein-Barr virus in lymphoproliferative processes: an update for the diagnostic pathologist Adv Anat Pathol 2009 16 1 40 55 10.1097/PAP.0b013e3181916029 19098466 \n5. Loghavi S Alayed K Aladily TN Zuo Z Ng SB Tang G Stage, age, and EBV status impact outcomes of plasmablastic lymphoma patients: a clinicopathologic analysis of 61 patients J Hematol Oncol 2015 8 65 10.1186/s13045-015-0163-z 26055271 \n6. Mourad O Palda V Detsky AS A comprehensive evidence-based approach to fever of unknown origin Arch Intern Med 2003 163 5 545 551 10.1001/archinte.163.5.545 12622601 \n7. Hayakawa K Ramasamy B Chandrasekar PH Fever of unknown origin: an evidence-based review Am J Med Sci 2012 344 4 307 316 10.1097/MAJ.0b013e31824ae504 22475734 \n8. Motyckova G Steensma DP Why does my patient have lymphadenopathy or splenomegaly? Hematol/Oncol Clin North Am 2012 26 2 395 408 10.1016/j.hoc.2012.02.005 \n9. Cuomo L Cirone M Di Gregorio AO Vitillo M Cattivelli M Magliocca V Elevated antinuclear antibodies and altered anti-Epstein-Barr virus immune responses Virus Res 2015 195 95 99 10.1016/j.virusres.2014.09.014 25300805 \n10. Eid A Carion W Nystrom JS Differential diagnoses of bone marrow granuloma Western J Med 1996 164 6 510 515 \n11. Sacks EL Donaldson SS Gordon J Dorfman RF Epithelioid granulomas associated with Hodgkin’s disease: clinical correlations in 55 previously untreated patients Cancer 1978 41 2 562 567 10.1002/1097-0142(197802)41:2<562::AID-CNCR2820410224>3.0.CO;2-X 630538 \n12. Abrams J Pearl P Moody M Schimpff SC Epithelioid granulomas revisited: long-term follow-up in Hodgkin’s disease Am J Clin Oncol 1988 11 4 456 460 10.1097/00000421-198808000-00009 3407625 \n13. Choe JK Hyun BH Salazar GH Ashton JK Sung CY Epithelioid granulomas of the bone marrow in non-Hodgkin’s lymphoproliferative malignancies Am J Clin Pathol 1984 81 1 19 24 10.1093/ajcp/81.1.19 6581718 \n14. O’Carroll DI McKenna RW Brunning RD Bone marrow manifestations of Hodgkin’s disease Cancer 1976 38 4 1717 1728 10.1002/1097-0142(197610)38:4<1717::AID-CNCR2820380445>3.0.CO;2-9 991090 \n15. Lee JH Kim Y Choi JW Kim YS Prevalence and prognostic significance of Epstein-Barr virus infection in classical Hodgkin’s lymphoma: a meta-analysis Arch Med Res 2014 45 5 417 431 10.1016/j.arcmed.2014.06.001 24937173 \n16. Dojcinov SD Venkataraman G Pittaluga S Wlodarska I Schrager JA Raffeld M Age-related EBV-associated lymphoproliferative disorders in the Western population: a spectrum of reactive lymphoid hyperplasia and lymphoma Blood 2011 117 18 4726 4735 10.1182/blood-2010-12-323238 21385849\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2052-1839",
"issue": "16()",
"journal": "BMC hematology",
"keywords": "Cytopenias; Epstein Barr Virus; Lymphadenopathy; Lymphoma",
"medline_ta": "BMC Hematol",
"mesh_terms": null,
"nlm_unique_id": "101609487",
"other_id": null,
"pages": "19",
"pmc": null,
"pmid": "27437106",
"pubdate": "2016",
"publication_types": "D002363:Case Reports",
"references": "25613729;24937173;23342374;12622601;26055271;6581718;21385849;8764626;19098466;24468737;3407625;630538;25300805;22463834;991090;22475734",
"title": "Chronic Epstein Barr virus infection leading to classical Hodgkin lymphoma.",
"title_normalized": "chronic epstein barr virus infection leading to classical hodgkin lymphoma"
} | [
{
"companynumb": "US-TEVA-812766USA",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "VINBLASTINE"
},
"drugadditional": "1",
"dru... |
{
"abstract": "Osteosarcoma is the most common primary malignant tumor of the bone. The most common sites of osteosarcoma in children are the metaphysis of long bones, especially the distal femur, proximal tibia, and proximal humerus. It occurs very rarely in flat bones. Here we report a 14-year-old adolescent boy with primary osteosarcoma of the fifth rib and a review of literature.",
"affiliations": "Departments of Pediatrics, Division of Pediatric Oncology.;Departments of Pediatrics, Division of Pediatric Oncology.;Radiology.;Division of Pediatric Pathology.;Departments of Pediatrics, Division of Pediatric Oncology.;Department of Pediatrics, Hacettepe University, Ankara, Turkey.;Departments of Pediatrics, Division of Pediatric Oncology.",
"authors": "Yaman Bajin|İnci|İ|;Kurucu|Nilgün|N|;Oğuz|Berna|B|;Akçören|Zuhal|Z|;Varan|Ali|A|;Şatirer|Özlem|Ö|;Akyüz|Canan|C|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1097/MPH.0000000000000896",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1077-4114",
"issue": "40(1)",
"journal": "Journal of pediatric hematology/oncology",
"keywords": null,
"medline_ta": "J Pediatr Hematol Oncol",
"mesh_terms": "D000293:Adolescent; D000971:Antineoplastic Combined Chemotherapy Protocols; D001859:Bone Neoplasms; D017809:Fatal Outcome; D006801:Humans; D008297:Male; D012516:Osteosarcoma; D012272:Ribs; D017211:Treatment Failure",
"nlm_unique_id": "9505928",
"other_id": null,
"pages": "48-50",
"pmc": null,
"pmid": "28787395",
"pubdate": "2018-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Primary Osteosarcoma of the Rib: A Case Report and Review of the Literature.",
"title_normalized": "primary osteosarcoma of the rib a case report and review of the literature"
} | [
{
"companynumb": "TR-RECORDATI RARE DISEASES INC.-TR-R13005-18-00078",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CYCLOPHOSPHAMIDE"
},
... |
{
"abstract": "Acute macroglossia and laryngeal edema are rare adverse side effects that can cause life-threatening airway obstruction. We report a case of acute macroglossia that began after initiation of ethosuximide in a 15-year-old female with severe medically refractory epilepsy. Macroglossia worsened over the next two weeks of ethosuximide administration, preventing extubation. Macroglossia and laryngeal edema improved upon ethosuximide wean, and completely resolved after discontinuation. The patient was extubated successfully, with precautionary nasal trumpet placement and dexamethasone administration prior to extubation. In medically complex patients on multiple pharmacologic agents, anti-epileptic drugs should be suspected as a possible cause of acute macroglossia.",
"affiliations": "Baylor College of Medicine, United States. Electronic address: hshang@bcm.edu.;Baylor College of Medicine, Department of Otolaryngology - Head and Neck Surgery, United States. Electronic address: mica.glaun@bcm.edu.;Baylor College of Medicine, Department of Otolaryngology - Head and Neck Surgery, United States; Texas Children's Hospital, Pediatric Otolaryngology, United States. Electronic address: julinao@bcm.edu.",
"authors": "Shang|Hanqing|H|;Glaun|Mica|M|;Ongkasuwan|Julina|J|",
"chemical_list": "D005013:Ethosuximide",
"country": "Ireland",
"delete": false,
"doi": "10.1016/j.ijporl.2020.110498",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0165-5876",
"issue": "140()",
"journal": "International journal of pediatric otorhinolaryngology",
"keywords": "Antiepileptic drugs; Drug-induced macroglossia; Ethosuximide; Macroglossia",
"medline_ta": "Int J Pediatr Otorhinolaryngol",
"mesh_terms": "D000293:Adolescent; D060666:Airway Extubation; D000402:Airway Obstruction; D004487:Edema; D005013:Ethosuximide; D005260:Female; D006801:Humans; D008260:Macroglossia",
"nlm_unique_id": "8003603",
"other_id": null,
"pages": "110498",
"pmc": null,
"pmid": "33218689",
"pubdate": "2021-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Ethosuximide induced macroglossia and oropharyngeal edema.",
"title_normalized": "ethosuximide induced macroglossia and oropharyngeal edema"
} | [
{
"companynumb": "US-UCBSA-2021019801",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEVETIRACETAM"
},
"drugadditional": "3",
... |
{
"abstract": "The presence of an anion gap in a diabetic patient, especially if associated with evidence of compromised renal function, should prompt clinicians to consider metformin as a contributing factor. This consideration is especially important in patients with severe anion gaps associated with lactic acidosis out of proportion to the patient's clinical presentation.",
"affiliations": "Department of Internal Medicine, Baylor University Medical Center at Dallas.;Department of Internal Medicine, Baylor University Medical Center at Dallas.;Department of Internal Medicine, Baylor University Medical Center at Dallas.",
"authors": "Blough|Britton|B|;Moreland|Amber|A|;Mora|Adan|A|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1080/08998280.2015.11929178",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0899-8280",
"issue": "28(1)",
"journal": "Proceedings (Baylor University. Medical Center)",
"keywords": null,
"medline_ta": "Proc (Bayl Univ Med Cent)",
"mesh_terms": null,
"nlm_unique_id": "9302033",
"other_id": null,
"pages": "31-3",
"pmc": null,
"pmid": "25552792",
"pubdate": "2015-01",
"publication_types": "D002363:Case Reports",
"references": "23034133;22365024;20091535;6766289;1444694;8686704;8569826;401925;10372243;10230584;23233435;14705855;7555503;19036140",
"title": "Metformin-induced lactic acidosis with emphasis on the anion gap.",
"title_normalized": "metformin induced lactic acidosis with emphasis on the anion gap"
} | [
{
"companynumb": "US-INDICUS PHARMA-000290",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "INSULIN HUMAN"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nTo evaluate the impact of sarcopenia in muscle invasive bladder cancer (MIBC) elderly patients submitted to curative radiotherapy.\n\n\nMETHODS\nPatients received radiotherapy between 2013 and 2018, and the skeletal muscle index was calculated to classify them as sarcopenic or non-sarcopenic. Primary endpoints were overall survival (OS), cancer specific survival (CSS), 90-day mortality and toxicity.\n\n\nRESULTS\nA total of 28 patients with a median age of 85 years met our inclusion criteria and 8 of them were sarcopenic. With a median prescribed dose of 61 Gy and a median follow-up of 24.5 months, OS rates in the sarcopenic and non-sarcopenic groups were 100% and 84.4% at 3 months, 57.1% and 56.6% at 12 months, 38.1% and 50.3% at 24 months and 38.1% and 33.5% at 48 months, respectively; the CSS rates were 100% and 94.1% at 3 months and 68.6% and 88.2% at 12, 24 and 48 months, respectively. The actuarial 90-day mortality rate was 17.9% for the whole cohort, and 20% and 12.5% for the non-sarcopenic and sarcopenic groups, respectively. The radio-induced toxicity was similar in both groups.\n\n\nCONCLUSIONS\nSarcopenia cannot be considered a negative prognostic factor for MIBC elderly patients treated with external beam radiotherapy. Irradiation is therefore a feasible and effective choice for these patients, especially if unfit for surgery.",
"affiliations": "REM Radioterapia srl, Catania, Italy.;Radiation Oncology Unit - Department of Biomedical, Dental Science and Morphological and Functional Images, University of Messina, Messina, Italy.;Fondazione Istituto Oncologico del Mediterraneo, Catania, Italy.;Radiation Oncology Unit - Department of Biomedical, Dental Science and Morphological and Functional Images, University of Messina, Messina, Italy; saralillo93@hotmail.it.;Radiation Oncology Unit - Department of Biomedical, Dental Science and Morphological and Functional Images, University of Messina, Messina, Italy.;Radiation Oncology Unit - Department of Biomedical, Dental Science and Morphological and Functional Images, University of Messina, Messina, Italy.;Radiation Oncology Unit - Department of Biomedical, Dental Science and Morphological and Functional Images, University of Messina, Messina, Italy.;Radiation Oncology Unit - Department of Biomedical, Dental Science and Morphological and Functional Images, University of Messina, Messina, Italy.;Radiation Oncology Unit - Papardo Hospital, Messina, Italy.;Radiation Oncology Unit - Papardo Hospital, Messina, Italy.;Radiation Oncology Unit, A.O.U. \"G. Martino\", Messina, Italy.;Radiation Oncology Unit, A.O.U. \"G. Martino\", Messina, Italy.;Radiation Oncology Unit - Department of Biomedical, Dental Science and Morphological and Functional Images, University of Messina, Messina, Italy.;Radiation Oncology Unit - Papardo Hospital, Messina, Italy.",
"authors": "Ferini|Gianluca|G|;Cacciola|Alberto|A|;Parisi|Silvana|S|;Lillo|Sara|S|;Molino|Laura|L|;Tamburella|Consuelo|C|;Davi|Valerio|V|;Napoli|Ilenia|I|;Platania|Angelo|A|;Settineri|Nicola|N|;Iati|Giuseppe|G|;Pontoriero|Antonio|A|;Pergolizzi|Stefano|S|;Santacaterina|Anna|A|",
"chemical_list": null,
"country": "Greece",
"delete": false,
"doi": "10.21873/invivo.12293",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0258-851X",
"issue": "35(1)",
"journal": "In vivo (Athens, Greece)",
"keywords": "Radiotherapy; bladder cancer; elderly; sarcopenia",
"medline_ta": "In Vivo",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D006801:Humans; D018482:Muscle, Skeletal; D011379:Prognosis; D012189:Retrospective Studies; D055948:Sarcopenia; D015996:Survival Rate; D001749:Urinary Bladder Neoplasms",
"nlm_unique_id": "8806809",
"other_id": null,
"pages": "571-578",
"pmc": null,
"pmid": "33402511",
"pubdate": "2021",
"publication_types": "D016428:Journal Article",
"references": "28923108;32336255;21296615;22666367;23313198;28421264;30578161;25983093;23906282;24423437;23315797;24189893;28149936;22903527;21822551;31818689;29479839;24840856;26484630;20392703;26337653;23530101;20510798;32368191;21074802;24139235;29564168;32194349;17121885",
"title": "Curative Radiotherapy in Elderly Patients With Muscle Invasive Bladder Cancer: The Prognostic Role of Sarcopenia.",
"title_normalized": "curative radiotherapy in elderly patients with muscle invasive bladder cancer the prognostic role of sarcopenia"
} | [
{
"companynumb": "IT-TEVA-2021-IT-1935868",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugadditional": "3",
... |
{
"abstract": "Drug hypersensitivity syndrome or Drug Rash with Eosinophilia and Systemic Symptoms or DRESS syndrome is a severe and potentially life-threatening toxidermia. It should be suspected in patients developing cutaneous reaction following drug intake. We report the case of a 45-year old patient treated for pulmonary tuberculosis (TPM+) who developed DRESS syndrom induced by antibacillaries.",
"affiliations": "Service de Pneumologie, Laboratoire PCIM, UCAM, Hôpital Arrazi, CHU Mohamed VI, Marrakech, Maroc.;Service de Pneumologie, Hôpital Moulay Youssef, CHU, Rabat, Maroc.;Service de Pneumologie, Hôpital Moulay Youssef, CHU, Rabat, Maroc.",
"authors": "Jridi|Siham|S|;Azzeddine|Rajae|R|;Bourkadi|Jamal Eddine|JE|",
"chemical_list": "D000995:Antitubercular Agents",
"country": "Uganda",
"delete": false,
"doi": "10.11604/pamj.2017.27.37.11663",
"fulltext": "\n==== Front\nPan Afr Med JPan Afr Med JPAMJThe Pan African Medical Journal1937-8688The African Field Epidemiology Network PAMJ-27-3710.11604/pamj.2017.27.37.11663Case ReportLe DRESS syndrome secondaire aux antituberculeux: à propos d’un cas DRESS syndrome secondary to antituberculosis drugs: about a case Jridi Siham 1&Azzeddine Rajae 2Bourkadi Jamal Eddine 2\n1 Service de Pneumologie, Laboratoire PCIM, UCAM, Hôpital Arrazi, CHU Mohamed VI, Marrakech, Maroc\n2 Service de Pneumologie, Hôpital Moulay Youssef, CHU, Rabat, Maroc& Corresponding author: Siham Jridi, Service de Pneumologie, Laboratoire PCIM, UCAM, Hôpital Arrazi, CHU Mohamed VI, Marrakech, Maroc11 5 2017 2017 27 3715 1 2017 17 4 2017 © Siham Jridi et al.2017The Pan African Medical Journal - ISSN 1937-8688. This is an Open Access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Le syndrome d'hypersensibilité médicamenteuse ou Drug Rash with Eosinophilia and Systemic Symptoms ou DRESS syndrome est une toxidermie grave qui peut mettre en jeu le pronostic vital. Il faut y penser devant toute réaction cutanée après la prise des médicaments. Nous rapportons un cas clinique d'un patient âgé de 45 ans traité pour tuberculose pulmonaire TPM+ présentant un DRESS syndrome induit par les anti-bacillaires.\n\nDrug hypersensitivity syndrome or Drug Rash with Eosinophilia and Systemic Symptoms or DRESS syndrome is a severe and potentially life-threatening toxidermia. It should be suspected in patients developing cutaneous reaction following drug intake. We report the case of a 45-year old patient treated for pulmonary tuberculosis (TPM+) who developed DRESS syndrom induced by antibacillaries.\n\nSyndrome d´hypersensibilitéantituberculeuxtoxidermieHypersensitivity syndromeantituberculosis drugstoxidermia\n==== Body\nIntroduction\nLe DRESS est une réaction médicamenteuse aiguë associant une éruption cutanée, une hyperthermie, des adénopathies diffuses, une éosinophilie sanguine et des atteintes viscérales variées. Il est potentiellement grave, avec une mortalité estimée à 10%. Nous rapportons un cas de DRESS syndrome aux antibacillaires, et nous insistons à travers cette observation sur la difficulté d'établir la relation cause effet lorsque plusieurs médicaments sont administrés de manière concomitante comme le cas du régime antituberculeux.\n\nPatient et observation\nC'est l'observation d'un patient âgé de 45 ans, tabagique chronique à 30 PA, sans autres ATCDS pathologiques particuliers, traité pour tuberculose pulmonaire confirmée à l'examen direct le 04/03/16 par la forme combinée de l'association rifampicine, Ethambutol, isoniazide et pyrazinamide (ERIP K4). Le patient a présenté depuis les 10 derniers jours de la phase d'attaque (à J50 du traitement) une fièvre, des œdèmes des deux membres inférieurs, avec apparition de lésions cutanées squameuses prurigineuses qui se sont généralisées à tous le corps (Figure 1, Figure 2). Ce qui a indiqué son hospitalisation. A l'admission dans notre service, le patient présente à l'examen clinique une fièvre à 38°, des œdèmes des membres inférieurs, des adénopathies jugulo-carotidiennes gauches, axillaires gauches et inguinales droites lenticulaires, l'examen pleuro-pulmonaire était sans particularité. Le traitement anti-bacillaire fut arrêté le 16/05/16. Le bilan biologique a objectivé une protéinurie positive à 1,02g/24h, une hyper-éosinophilie à 1430/UL, les sérologies HIV et hépatite virale B et C négatives. La recherche de BK dans les expectorations était négative. L'ionogramme sanguin et bilan hépatique étaient sans particularité La radiographie thoracique a montré des infiltrats hilo-apicale gauches (Figure 3), l'échographie abdomino-pelvienne n'a pas objectivé d'anomalie. Le diagnostic de DRESS a été retenu. La réintroduction du traitement anti-bacillaire a débuté le 08/06/16 après disparition des lésions cutanées, par la Rifampicine faite sur 3 jours (150mg, 300mg, 600mg) sans incidents. Après la réintroduction progressive de l'Isoniazide sur 3 jours (75mg, 150mg, 300mg), le patient a présenté le 2ème Jour à 150mg de l'isoniazide des œdèmes des membres inférieurs avec prurit généralisé, une substitution de l'isoniazide par l'Ethambutol a été faite avec apparition d'un prurit généralisé important dès son introduction, la conduite à tenir a consisté en l'arrêt du traitement (Rifampicine+ Ethambutol) jusqu´à disparition des lésions avec mise du patient sous traitement symptomatique. Le patient a été remis le 10/06/16 sous Rifampicine à dose complète 600 mg + Lévofloxacine 750 mg, l'évolution a été marqué le 04/07/16 par la réapparition du prurit et des œdèmes des membres inférieurs d'où l'arrêt du traitement et la mise sous Isoniazide + Lévofloxacine le 10/07/16. Le 20/07/16 et après une bonne tolérance du traitement prescrit, le patient est réadmis pour réintroduction de l'Ethambutol, prévu sur 3 jours (400mg, 800mg, 1200mg), à 800 mg le patient a présenté des œdèmes des membres inférieurs avec un prurit généralisé, l'Ethambutol fut arrêté et le patient a été remis après disparition des lésions sous isoniazide et lévofloxacine sans incident avec prolongation de la durée du traitement de 6 mois. La responsabilité de Rifampicine et de l'Ethambutol est fortement suspectée.\n\nFigure 1 Lésions squameuses prurigineuses au niveau des bras et avant bras\n\nFigure 2 Lésions squameuses prurigineuses avec des lésions de grattage au niveau des jambs\n\nFigure 3 Radiographie thoracique du patient objectivant des infiltrats hilo-apicale gauche\n\nDiscussion\nLe DRESS syndrome est un syndrome d'hypersensibilité médicamenteuse [1]. Le terme « DRESS syndrome » a été utilisé pour la première fois en 1996 par Bocquet et al. [1]. Les symptômes surviennent après 2 à 6 semaines du début du traitement, dominés le plus souvent par les lésions cutanées et hépatiques. Sur 172 cas de DRESS syndrome, 44 médicaments sont répertoriés avec un seul cas lié à la streptomycine [2]. En 2012, un cas du DRESS syndrome à l'éthambutol et à la rifampicine a été notifié [3] comme c'est le cas de notre observation, un autre cas de DRESS syndrome aux anti-bacillaires notamment à l'ethambutol et l'isoniazide avec un doute sur la rifampicine a été rapporté par Bouyad et al [4] et un autre cas a été noté par Iraqi et al [5] à l'éthambutol, à l'isoniazide et à la pyrazinamide. La majorité des patients présentant le DRESS syndrome ne sont initialement pas correctement diagnostiqués [6]. Il existe néanmoins plusieurs consensus sur les critères diagnostiques de DRESS syndrome proposés par certains auteurs [7, 8]. En tenant compte de critères de Kardaun (Tableau 1), notre patient présente 4 critères positifs; l'hyper-éosinophilie, fièvre à 38.5°, des adénopathies dans 3 territoires et le rash aigu. Selon les critères du groupe japonais (Tableau 2), notre patient présente 5 critères, l'exanthème maculopapuleux > 3 semaines, les manifestations cliniques persistantes plus de 2 semaines, les poly-adénopathies, l'hyper-éosinophilie et la fièvre. La prise en charge du DRESS, en dehors de l'arrêt du médicament incriminé, n'est pas bien codifiée. Elle dépendra des éléments clinico-biologiques et évolutifs. Ainsi dans certains cas, aucun traitement n'est nécessaire, alors que dans d'autres cas un traitement par corticothérapie générale et/ou immunoglobulines intraveineuses et/ou les antiviraux (ganciclovir) peut être nécessaire [9]. S'il est absolument nécessaire d'utiliser un médicament potentiellement responsable, il devrait être administré avec prudence en commençant par une petite dose [3]. La survenue de poussées évolutives à distance n'est pas rare même en absence de toute nouvelle prise médicamenteuse justifiant une surveillance biologique prolongée [9].\n\nTableau 1 Critères RegiSCAR d’inclusion de DRESS syndrome\n\nHospitalisation\t\t\nSuspicion de lien entre la réaction et un médicament\tAdénopathie dans au moins 2 sites distincts*\t\nRash aigu*\tAnomalies de la formule sanguine (lymphopénie ou lymphocytose*, éosinophilie*, thrombocytopénie*)\t\nFièvre > 38 _C*\tTrois critères sur les quatre marqués d’une étoile sont nécessaires pour poser le diagnostic\t\nTableau 2 Critères du groupe japonais de consensus du Drug-induced Hypersensitivity Syndrome (DiHS) ou DRESS syndrome\n\nRash maculopapuleux apparaissant plus de 3 semaines après le début du traitement\t\nmédicamenteux incriminé\t\nPersistance des symptômes 2 semaines après l’arrêt du traitement médicamenteux incriminé\t\nFièvre > 38 _C\t\nTroubles de la fonction hépatique (ALAT > 100 U/L)\t\nAnomalies leucocytaires :\t\nHyperleucocytose (> 11×109/L)\t\nLymphocytes atypiques (> 5 %)\t\nHyperéosinophilie (> 1,5× 109/L)\t\nLymphadénopathie\t\nRéactivation HHV-6\t\nSept critères présents = DiHS typique. Cinq premiers critères présents = DiHS atypique\t\nConclusion\nle DRESS syndrome du aux anti-bacillaires est rare, il ne doit pas être méconnu. La conduite à tenir n'est pas codifiée. Il faut rapporter plus de cas dans le but d'instaurer et codifier une meilleure prise en charge de ces patients.\n\nConflits d’intérêts\nLes auteurs ne déclarent aucun conflits d'intérêts.\n\nContributions des auteurs\nTous les auteurs ont contribué à la réalisation de ce travail et à la rédaction du manuscrit. Tous les auteurs ont lu et approuvé la version finale du manuscrit.\n==== Refs\nRéférences\n1 Bocquet H Bagot M Roujeau JC Drug-induced pseudolymphoma and drug hypersensitivity syndrome (Drug Rash with Eosinophilia and Systemic Symptoms: DRESS) Semin Cutan Med Surg. 1996 15 4 250 7 9069593 \n2 Cacoub P Musette P Descamps V Meyer O Speirs C Finzi L Roujeau JC The DRESS syndrome: a literature review Am J Med. 2011 124 7 588 97 21592453 \n3 Jung ES Choi B Drug reaction with eosinophilia and systemic symptoms (DRESS) syndrome induced by ethambutol and rifampin Infect Chemother. 2012 44 3 197 200 \n4 Bopaka RG El Khattabi W Afif H Aichane A Bouayad Z The “DRESS” syndrome in antituberculosis drugs Rev Pneumol Clin. 2014 70 3 185 8 24646784 \n5 Moubachir H Idahmed I El Ataouna K Bourkadi JD Iraqi G DRESS syndrome aux antituberculeux Revue française d'allergologie. 2013 53 7 605 7 \n6 Pichler WJ Wendland T Hausmann O Schnyder B Fricker M Pichler C Helbling A Syndrome DRESS (drug rash with eosinophiliaand systemic symptoms): une allergie médicamenteuse grave souvent méconnue Forum Med Suisse. 2011 11 48 879 84 \n7 Kardaun SH Sidoroff A Valeyrie-Allanore L Halevy S Davi-dovici BB Mockenhaupt M Roujeau JC Variability in the clinical pattern of cutaneous side-effects of drugs with systemic symptoms: does a DRESS syndrome really exist? Br J Dermatol. 2007 156 3 609 11 17300272 \n8 Shiohara T Iijima M Ikezawa Z Hashimoto K The diagnosis of DRESS syndrome has been sufficiently established on thebasis of typical clinical features and viral reactivations Br J Dermatol. 2007 156 5 1045 92 17313490 \n9 Descamps V Ben Saïd B Sassolas B Truchetet F Avenel-Audran M Girardin P Guinnepain MT Mathelier-Fusade P Assier H Milpied B Modiano P Lebrun-Vignes B Barbaud A Prise en charge du drug reaction with eosinophilia and systemic symptoms (DRESS) Ann Dermatol Venereol. 2010 137 11 703 8 21074653\n\n",
"fulltext_license": "CC BY",
"issn_linking": null,
"issue": "27()",
"journal": "The Pan African medical journal",
"keywords": "Hypersensitivity syndrome; antituberculosis drugs; toxidermia",
"medline_ta": "Pan Afr Med J",
"mesh_terms": "D000995:Antitubercular Agents; D063926:Drug Hypersensitivity Syndrome; D006801:Humans; D008297:Male; D008875:Middle Aged; D014397:Tuberculosis, Pulmonary",
"nlm_unique_id": "101517926",
"other_id": null,
"pages": "37",
"pmc": null,
"pmid": "28761613",
"pubdate": "2017",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "17300272;21074653;21592453;17381452;24646784;9069593",
"title": "DRESS syndrome secondary to antituberculosis drugs: about a case.",
"title_normalized": "dress syndrome secondary to antituberculosis drugs about a case"
} | [
{
"companynumb": "MA-MYLANLABS-2017M1064596",
"fulfillexpeditecriteria": "1",
"occurcountry": "MA",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ETHAMBUTOL HYDROCHLORIDE"
},
"drugadditional"... |
{
"abstract": "Background Ferumoxytol is approved for use in the treatment of iron deficiency anemia, but it can serve as an alternative to gadolinium-based contrast agents. On the basis of postmarketing surveillance data, the Food and Drug Administration issued a black box warning regarding the risks of rare but serious acute hypersensitivity reactions during fast high-dose injection (510 mg iron in 17 seconds) for therapeutic use. Whereas single-center safety data for diagnostic use have been positive, multicenter data are lacking. Purpose To report multicenter safety data for off-label diagnostic ferumoxytol use. Materials and Methods The multicenter ferumoxytol MRI registry was established as an open-label nonrandomized surveillance databank without industry involvement. Each center monitored all ferumoxytol administrations, classified adverse events (AEs) using the National Cancer Institute Common Terminology Criteria for Adverse Events (grade 1-5), and assessed the relationship of AEs to ferumoxytol administration. AEs related to or possibly related to ferumoxytol injection were considered adverse reactions. The core laboratory adjudicated the AEs and classified them with the American College of Radiology (ACR) classification. Analysis of variance was used to compare vital signs. Results Between January 2003 and October 2018, 3215 patients (median age, 58 years; range, 1 day to 96 years; 1897 male patients) received 4240 ferumoxytol injections for MRI. Ferumoxytol dose ranged from 1 to 11 mg per kilogram of body weight (≤510 mg iron; rate ≤45 mg iron/sec). There were no systematic changes in vital signs after ferumoxytol administration (P > .05). No severe, life-threatening, or fatal AEs occurred. Eighty-three (1.9%) of 4240 AEs were related or possibly related to ferumoxytol infusions (75 mild [1.8%], eight moderate [0.2%]). Thirty-one AEs were classified as allergiclike reactions using ACR criteria but were consistent with minor infusion reactions observed with parenteral iron. Conclusion Diagnostic ferumoxytol use was well tolerated, associated with no serious adverse events, and implicated in few adverse reactions. Registry results indicate a positive safety profile for ferumoxytol use in MRI. © RSNA, 2019 Online supplemental material is available for this article.",
"affiliations": "From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).;From the Diagnostic Cardiovascular Imaging Research Laboratory, Department of Radiological Sciences, David Geffen School of Medicine at UCLA, 300 Medical Plaza, Suite B119, Los Angeles, CA 90095 (K.L.N., T.Y., P.H., J.P.F.); Division of Cardiology, David Geffen School of Medicine at UCLA and VA Greater Los Angeles Healthcare System, Los Angeles, Calif (K.L.N., N.K.); Department of Radiology (I.H.Z., M.R.B.), Center for Advanced Magnetic Resonance Development (I.H.Z., M.R.B.), and Division of Gastroenterology, Department of Medicine (M.R.B.), Duke University Medical Center, Durham, NC; Department of Diagnostic Radiology and Neurology, Oregon Health Sciences University, Portland, Ore (C.G.V.); British Heart Foundation Centre for Cardiovascular Science, University of Edinburgh, Edinburgh, Scotland (S.I.S., D.E.N.); Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, Calif (R.S.); Department of Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Ill (C.K.R., L.M.G.); Department of Radiology, Northwestern University Feinberg School of Medicine, Chicago, Ill (C.K.R., L.M.G.); Institute of Cardiovascular and Medical Sciences, University of Glasgow, Scotland (S.S., A.R.); Division of Cardiology, Department of Pediatrics and Radiology, Children's Hospital of Philadelphia, Philadelphia, Pa (K.K.W., M.A.F.); Department of Radiology, University of Wisconsin, Madison, Wis (L.M.G., M.L.S.); Department of Radiology, University of California, San Francisco and VA San Francisco Healthcare System, San Francisco, Calif (D.S., M.D.H.); Department of Radiology, Weill Medical College of Cornell University, New York, NY (M.R.P.); Department of Radiology, NHS Greater Glasgow and Clyde, and Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, Scotland (G.H.R.); and Department of Neurology and Neurosurgery, Oregon Health Sciences University and VA Portland Healthcare System, Portland, Ore (E.A.N.).",
"authors": "Nguyen|Kim-Lien|KL|0000-0002-8854-2976;Yoshida|Takegawa|T|;Kathuria-Prakash|Nikhita|N|;Zaki|Islam H|IH|0000-0001-7026-5686;Varallyay|Csanad G|CG|;Semple|Scott I|SI|0000-0002-4008-7564;Saouaf|Rola|R|0000-0003-0464-3786;Rigsby|Cynthia K|CK|;Stoumpos|Sokratis|S|;Whitehead|Kevin K|KK|;Griffin|Lindsay M|LM|;Saloner|David|D|0000-0002-6989-8547;Hope|Michael D|MD|;Prince|Martin R|MR|0000-0002-9883-0584;Fogel|Mark A|MA|;Schiebler|Mark L|ML|0000-0002-9120-5428;Roditi|Giles H|GH|;Radjenovic|Aleksandra|A|0000-0002-1742-6863;Newby|David E|DE|;Neuwelt|Edward A|EA|;Bashir|Mustafa R|MR|0000-0001-8800-5057;Hu|Peng|P|;Finn|J Paul|JP|",
"chemical_list": "D003287:Contrast Media; D052203:Ferrosoferric Oxide",
"country": "United States",
"delete": false,
"doi": "10.1148/radiol.2019190477",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0033-8419",
"issue": "293(3)",
"journal": "Radiology",
"keywords": null,
"medline_ta": "Radiology",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D002648:Child; D002675:Child, Preschool; D003287:Contrast Media; D064420:Drug-Related Side Effects and Adverse Reactions; D005260:Female; D052203:Ferrosoferric Oxide; D006801:Humans; D007223:Infant; D007231:Infant, Newborn; D008279:Magnetic Resonance Imaging; D008297:Male; D008875:Middle Aged; D056687:Off-Label Use; D012042:Registries",
"nlm_unique_id": "0401260",
"other_id": null,
"pages": "554-564",
"pmc": null,
"pmid": "31638489",
"pubdate": "2019-12",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't; D013486:Research Support, U.S. Gov't, Non-P.H.S.",
"references": "18929686;19397688;27480885;21439379;24974785;10936475;30350585;29284494;30204075;8840942;29040038;26656202;25949425;9039617;29417614;29848399;26759045;27529745;28160356;25269682;28495944;22875883;28101605;25017687;24582176;15627176;25946282;26575062;29356629;22610021;26518061",
"title": "Multicenter Safety and Practice for Off-Label Diagnostic Use of Ferumoxytol in MRI.",
"title_normalized": "multicenter safety and practice for off label diagnostic use of ferumoxytol in mri"
} | [
{
"companynumb": "US-AMAG PHARMACEUTICALS, INC.-AMAG202002463",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "FERUMOXYTOL NON-STOICHIOMETRIC MAGNETITE"
... |
{
"abstract": "One of the drugs that are widely used in the treatment of atrial fibrillation is amiodarone. Despite considerable prolongation of the corrected QT interval and a substantial degree of bradycardia, amiodarone exhibits a remarkably low frequency of pro-arrhythmic events and <1.0% incidence of torsades de pointes, mostly after long-term usage. We present a case of an 80-year-old female with paroxysmal atrial fibrillation accompanied by acute heart failure treated by short-term parenteral amiodarone therapy and development of torsades de pointes.",
"affiliations": "1Department of Cardiology, Krapinske Toplice Hospital for Medical Rehabilitation, Faculty of Medicine and Faculty of Dental Medicine and Health, Josip Juraj Strossmayer University of Osijek, Krapinske Toplice, Croatia; 2Department of Internal Medicine, Krapinske Toplice Hospital for Medical Rehabilitation, Krapinske Toplice, Croatia; 3Intensive Care Unit, Krapinske Toplice Hospital for Medical Rehabilitation, Krapinske Toplice, Croatia.;1Department of Cardiology, Krapinske Toplice Hospital for Medical Rehabilitation, Faculty of Medicine and Faculty of Dental Medicine and Health, Josip Juraj Strossmayer University of Osijek, Krapinske Toplice, Croatia; 2Department of Internal Medicine, Krapinske Toplice Hospital for Medical Rehabilitation, Krapinske Toplice, Croatia; 3Intensive Care Unit, Krapinske Toplice Hospital for Medical Rehabilitation, Krapinske Toplice, Croatia.;1Department of Cardiology, Krapinske Toplice Hospital for Medical Rehabilitation, Faculty of Medicine and Faculty of Dental Medicine and Health, Josip Juraj Strossmayer University of Osijek, Krapinske Toplice, Croatia; 2Department of Internal Medicine, Krapinske Toplice Hospital for Medical Rehabilitation, Krapinske Toplice, Croatia; 3Intensive Care Unit, Krapinske Toplice Hospital for Medical Rehabilitation, Krapinske Toplice, Croatia.;1Department of Cardiology, Krapinske Toplice Hospital for Medical Rehabilitation, Faculty of Medicine and Faculty of Dental Medicine and Health, Josip Juraj Strossmayer University of Osijek, Krapinske Toplice, Croatia; 2Department of Internal Medicine, Krapinske Toplice Hospital for Medical Rehabilitation, Krapinske Toplice, Croatia; 3Intensive Care Unit, Krapinske Toplice Hospital for Medical Rehabilitation, Krapinske Toplice, Croatia.",
"authors": "Lakušić|Nenad|N|;Slivnjak|Valentina|V|;Ciglenečki|Nedeljko|N|;Cerovec|Duško|D|",
"chemical_list": "D000889:Anti-Arrhythmia Agents; D000638:Amiodarone",
"country": "Croatia",
"delete": false,
"doi": "10.20471/acc.2019.58.04.23",
"fulltext": "\n==== Front\nActa Clin Croat\nActa Clin Croat\nACC\nActa Clinica Croatica\n0353-9466 1333-9451 Sestre Milosrdnice University Hospital and Institute of Clinical Medical Research, Vinogradska cesta c. 29 Zagreb \n\nacc-58-751\n10.20471/acc.2019.58.04.23\nCase Reports\nTORSADES DE POINTES IN ELDERLY PATIENT WITH PAROXYSMAL ATRIAL FIBRILLATION TREATED BY SHORT-TERM PARENTERAL AMIODARONE THERAPY\nLakušić Nenad 1 Slivnjak Valentina 2 Ciglenečki Nedeljko 3 Cerovec Duško 1 1Department of Cardiology, Krapinske Toplice Hospital for Medical Rehabilitation, Faculty of Medicine and Faculty of Dental Medicine and Health, Josip Juraj Strossmayer University of Osijek, Krapinske Toplice, Croatia; 2Department of Internal Medicine, Krapinske Toplice Hospital for Medical Rehabilitation, Krapinske Toplice, Croatia; 3Intensive Care Unit, Krapinske Toplice Hospital for Medical Rehabilitation, Krapinske Toplice, Croatia\nCorrespondence to: Prof. Nenad Lakušić, MD, PhD, Department of Cardiology, Krapinske Toplice Hospital for Medical Rehabilitation, Gajeva 2, HR-49217 Krapinske Toplice, Croatia, E-mail: nenad.lakusic@sbkt.hr\n12 2019 \n12 2019 \n58 4 751 756\n15 11 2016 11 9 2017 2019Sestre Milosrdnice University HospitalThis is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial No Derivatives (CC BY-NC-ND) 4.0 License.SUMMARY\nOne of the drugs that are widely used in the treatment of atrial fibrillation is amiodarone. Despite considerable prolongation of the corrected QT interval and a substantial degree of bradycardia, amiodarone exhibits a remarkably low frequency of pro-arrhythmic events and <1.0% incidence of torsades de pointes, mostly after long-term usage. We present a case of an 80-year-old female with paroxysmal atrial fibrillation accompanied by acute heart failure treated by short-term parenteral amiodarone therapy and development of torsades de pointes.\n\nKey words: \nTorsades de pointesAmiodaroneAtrial fibrillationBradycardiaCase reports\n==== Body\nIntroduction\nAtrial fibrillation is one of the most common arrhythmias in daily clinical practice, associated with a significant risk of stroke, congestive heart failure, and higher mortality rate (1). One of the drugs that are widely used in treating atrial fibrillation is amiodarone. Amiodarone is a unique antiarrhythmic agent of a ‘wide-spectrum’, primarily of class III activity (prolongs phase 3 of the cardiac action potential, the repolarization phase where there is normally decreased calcium permeability and increased potassium permeability) (2). Besides efficacy in the treatment of patients with atrial fibrillation and ventricular arrhythmias, treatment with amiodarone is associated with numerous possible side effects. Despite considerable prolongation of the corrected QT interval (QTc) and a substantial degree of bradycardia, amiodarone exhibits a remarkably low frequency of pro-arrhythmic events and <1.0% incidence of torsades de pointes, mostly after long-term usage (3, 4). Torsades de pointes is a life-threatening arrhythmia associated with prolongation of the QTc interval on electrocardiogram (ECG). The treatment of hemodynamically stable torsades de pointes involves discontinuation of the offending drug(s), correction of electrolyte abnormalities and administration of intravenous magnesium sulfate (5).\n\nWe present a case of an 80-year-old female with paroxysmal atrial fibrillation accompanied by acute heart failure treated by short-term parenteral amiodarone therapy and development of torsades de pointes.\n\nCase Report\nAn 80-year-old female was admitted to the Intensive Care Unit (ICU) of our hospital due to paroxysmal atrial fibrillation with rapid ventricular response (Fig. 1) accompanied by acute heart failure. Arterial hypertension had been present for one year but the patient failed to take the recommended antihypertension therapy on regular basis (lacidipine 4 mg). In the last two weeks prior to admission to the hospital, the patient started noticing progressive effort intolerance accompanied by dyspnea. Upon her admission to the hospital, the signs of acute heart failure were found clinically and radiologically, along with newly diagnosed atrial fibrillation with ventricular tachyarrhythmia up to 200/min.\n\nFig. 1 Paroxysmal atrial fibrillation at admission.\n\nLaboratory results showed mild macrocytic anemia (hemoglobin (Hb) 115 g/L; mean corpuscular volume (MCV) 108), chronic renal insufficiency (urea 11.1 mmol/L; creatinine 171 µmol/L; creatinine clearance (Cockcroft-Gault equation) 30.2 mL/min) and mild hypokalemia (3.7 mmol/L). ECG did not show significant ST-T changes (high-sensitivity troponin I (hs-troponin I) 56.1 ng/L. Treatment with enoxaparin 60 mg s.c., furosemide 40 mg i.v., potassium substitution and amiodarone infusion was initiated at Emergency Room (ER), then the patient was transferred to the ICU where amiodarone infusion was continued.\n\nShortly after therapy had been initiated, ventricular frequency slowed down significantly to <100 /min, with regression of the patient’s subjective symptoms. Approximately six hours after initiating the administration of amiodarone, the patient experienced torsades de pointes paroxysms lasting for up to 10 seconds (Fig. 2). Both paroxysms were noted at night while the patient was asleep. The paroxysms ceased spontaneously, hence there was no need for resuscitation or electrical cardioversion. After that, the i.v. amiodarone infusion was terminated, the magnesium and potassium concentrations were measured and proved to be lowered (Mg 0.49 mmol/L, K 3.5 mmol/L), and significant QTc prolongation up to 569 ms was found on the new ECG recording (Fig. 3) with wide, biphasic to negative T waves in inferior and V3-V6 leads and unstable sinus rhythm with supraventricular and ventricular ectopic beats. Shortly after that, the patient experienced another torsades de pointes paroxysm with repeated spontaneous conversion into sinus rhythm without losing her consciousness. Magnesium sulfate was immediately introduced into therapy at a dosage of 9 mmol (2.25 g) i.v. bolus, which was followed by continuous magnesium infusion alongside potassium substitution and bisoprolol at a dosage of 1.25 mg. Clinically, the patient no longer experienced significant dyspnea or chest pain and laboratory results showed no dynamics that would indicate acute coronary syndrome (follow up hs-troponin I 50.3, 36.6 ng/L). The ECHO-cardiogram showed mild to moderate mitral regurgitation, left atrium of borderline diameter (4.0 cm), angio 2+ tricuspid regurgitation with estimated pressure in the right ventricle up to 40 mm Hg, non-dilated (LVIDd 4.5 cm) and non-hypertrophic left ventricle with left ventricular ejection fraction (EFLV) 45%-50%, without clear segmental kinetic abnormalities (2D). After amiodarone therapy had been discontinued and electrolyte imbalance corrected (Mg 1.29, 0.97 mmol/L), there were no torsades de pointes attacks. Within the next few days, the patient’s condition gradually stabilized, there were no signs of acute heart failure, and sinus rhythm stabilized with rare short-term paroxysms of atrial fibrillation. Medical therapy was optimized, warfarin was introduced. The QTc interval gradually decreased to 447 ms and T wave positivity (Fig. 4) was followed by serial ECG recording two weeks after admission to the hospital and amiodarone introduction. The patient was discharged in a stable condition with the following therapy: warfarin 1.5 mg, ramipril/amlodipine 5/5 mg, furosemide 40 mg, eplerenone 50 mg and bisoprolol 1.25 mg.\n\nFig. 2 Torsades de pointes during short-term amiodarone treatment.\n\nFig. 3 Significant QTc prolongation (569 ms).\n\nFig. 4 ECG at discharge (QTc 447 ms).\n\nDiscussion\nAlthough it is well known that different drugs can lead to significant prolongation of the QTc interval and subsequent torsades de pointes phenomena, the case presented is relatively rare since it occurred after a very short amiodarone administration, i.e. already 6 hours after the medication had been administered. There are literature data on QTc prolongation and the incidence of torsades de pointes after long-term (6, 7), as well as short-term drug administration, 4-5 days from treatment initiation (3).\n\nThe known risk factors for torsades de pointes include QTc interval >500 ms, QTc interval increase by ≥60 ms from the pretreatment value, advanced age, female sex, acute myocardial infarction, heart failure with reduced ejection fraction, hypokalemia, hypomagnesemia, hypocalcemia, bradycardia, treatment with diuretics and elevated plasma concentrations of QTc interval-prolonging drugs due to drug interactions, inappropriate dose adjustment of kidney eliminated drugs in patients with kidney disease and rapid intravenous administration (8, 9).\n\nBesides amiodarone therapy, there were several predisposing factors for the occurrence of torsades de pointes in our patient, including age, gender, moderate renal failure, hypomagnesemia and hypokalemia in the acute phase and QTc interval at the upper limit of the normal value.\n\nDrug-induced excessive QT prolongation most commonly occurs in patients with subclinical mutations in one of the genes responsible for the congenital long QT syndrome (10). These patients are susceptible to developing torsades de pointes if administered a drug that blocks potassium channels. The percentage of carriers of genetic defects in the acquired long QT syndromes is still unknown (3).\n\nConsidering the occurrence of torsades de pointes after short-term amiodarone administration with significant QTc prolongation and the fact that QTc interval was at the upper limit of the normal value at discharge from the hospital, our patient probably belongs to the susceptible group of patients who have silent mutations in the function of potassium ion channels.\n\nUsing amiodarone as first-line therapy in the acute phase of disease was another important problem in the treatment of the patient presented. Taking into consideration current guidelines for the treatment of patients with atrial fibrillation (1), amiodarone should not have been the first-line treatment at admission in the case described because there were no records of arrhythmia duration, size of the left atrium or possible thrombus presence in the left atrial auricle. In accordance with the guidelines, the first-line treatment in this patient should have been administration of digitalis for rate control. Considering a relatively large number of similar patients admitted to ERs due to acute heart failure accompanied by paroxysmal atrial fibrillation and/or ventricular arrhythmias and wide amiodarone administration (often without a clear stronghold in the guidelines), the aim of this presentation is to warn clinicians of the possible rare side effects of such a treatment even after short-term amiodarone administration, the necessity of immediate discontinuation of the drug from therapy and specific treatment in case of the occurrence of torsades de pointes, which involves administration of magnesium sulfate, correction of hypokalemia, lidocaine administration (11), temporary pacing, and in the most severe cases, electrical cardioversion and resuscitation.\n\nIn conclusion, we would like to emphasize the importance of careful patient monitoring during amiodarone therapy, even at short-term usage, and using the drug in accordance with current guidelines (1).\n==== Refs\nReferences\n1 Kirchhof P Benussi S Kotecha D Ahlsson A Atar D Casadei B \n2016 ESC Guidelines for the management of atrial fibrillation developed in collaboration with EACTS.\n\nEur Heart J . 2016 ;37 :2893 –962\n. 10.1093/eurheartj/ehw210 27567408 \n2 Opie LH, Gersh BJ. Drugs for the heart. 7th edn. Philadephia, USA: Saunders Elsevier, 2009; p. 252-9.\n3 Lim HE Pak HN Ahn JC Song WH Kim YH \nTorsades de pointes induced by short-term oral amiodarone therapy.\n\nEuropace . 2006 ;8 :1051 –3\n. 10.1093/europace/eul118 17148550 \n4 Hohnloser SH Klingenheben T Singh BN \nAmiodarone-associated proarrhythmic effects. A review with special reference to torsades de pointes tachycardia.\n\nAnn Intern Med . 1994 ;121 :529 –35\n. 10.7326/0003-4819-121-7-199410010-00009 8067651 \n5 Tisdale JE \nDrug-induced QT interval prolongation and torsades de pointes: role of the pharmacist in risk assessment, prevention and management.\n\nCan Pharm J (Ott) . 2016 ;149 :139 –52\n. 10.1177/1715163516641136 27212965 \n6 Franchi C Ardoino I Rossio R Nobili A Biganzoli EM Marengoni A \nREPOSI Investigators. Prevalence and risk factors associated with use of QT-prolonging drugs in hospitalized older people.\n\nDrugs Aging . 2016 ;33 :53 –61\n. 10.1007/s40266-015-0337-y 26693921 \n7 Keller GA Alvarez PA Ponte ML Belloso WH Bagnes C Sparanochia C \nDrug-induced QTc interval prolongation: a multicenter study to detect drugs and clinical factors involved in every day practice.\n\nCurr Drug Saf . 2016 ;11 :86 –98\n. 10.2174/1574886311207040262 26537523 \n8 Trinkley KE Page RL 2ndLien H Yamanouye K Tisdale JE \nQT interval prolongation and the risk of torsades de pointes: essentials for clinicians.\n\nCurr Med Res Opin . 2013 ;29 :1719 –26\n. 10.1185/03007995.2013.840568 24020938 \n9 Drew BJ Ackerman MJ Funk M Gibler WB Kligfield P Menon V American Heart Association Acute Cardiac Care Committee of the Council on Clinical Cardiology, the Council on Cardiovascular Nursing and the American College of Cardiology Foundation \nPrevention of torsades de pointes in hospital settings: a scientific statement from the American Heart Association and the American College of Cardiology Foundation.\n\nCirculation . 2010 ;121 :1047 –60\n. 10.1161/CIRCULATIONAHA.109.192704 20142454 \n10 Priori SG Napolitano C Schwartz PJ \nLow penetrance in the long QT syndrome: clinical impact.\n\nCirculation . 1999 ;99 :529 –33\n. 10.1161/01.CIR.99.4.529 9927399 \n11 Yelgeç NS Alper AT Tekkeşin AI Türkkan C Gürkan K \nRecurrent torsades de pointes due to amiodarone toxicity treated successfully with lidocaine.\n\nWest Indian Med J . 2015 ;65 :421 –2\n. 10.7727/wimj.2014.211 26907985\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0353-9466",
"issue": "58(4)",
"journal": "Acta clinica Croatica",
"keywords": "Amiodarone; Atrial fibrillation; Bradycardia; Case reports; Torsades de pointes",
"medline_ta": "Acta Clin Croat",
"mesh_terms": "D000208:Acute Disease; D000368:Aged; D000369:Aged, 80 and over; D000638:Amiodarone; D000889:Anti-Arrhythmia Agents; D001281:Atrial Fibrillation; D004562:Electrocardiography; D005260:Female; D006333:Heart Failure; D006801:Humans; D007263:Infusions, Parenteral; D016171:Torsades de Pointes",
"nlm_unique_id": "9425483",
"other_id": null,
"pages": "751-756",
"pmc": null,
"pmid": "32665746",
"pubdate": "2019-12",
"publication_types": "D002363:Case Reports",
"references": "27212965;26693921;26537523;27567408;26907985;24020938;17148550;9927399;20142454;8067651",
"title": "TORSADES DE POINTES IN ELDERLY PATIENT WITH PAROXYSMAL ATRIAL FIBRILLATION TREATED BY SHORT-TERM PARENTERAL AMIODARONE THERAPY.",
"title_normalized": "torsades de pointes in elderly patient with paroxysmal atrial fibrillation treated by short term parenteral amiodarone therapy"
} | [
{
"companynumb": "HR-FRESENIUS KABI-FK202008314",
"fulfillexpeditecriteria": "1",
"occurcountry": "HR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "AMIODARONE HYDROCHLORIDE"
},
"drugadditio... |
{
"abstract": "OBJECTIVE\nInfantile spasms are seizures associated with a severe epileptic encephalopathy presenting in the first 2 years of life, and optimal treatment continues to be debated. This study evaluates early and sustained response to initial treatments and addresses both clinical remission and electrographic resolution of hypsarrhythmia. Secondarily, it assesses whether response to treatment differs by etiology or developmental status.\n\n\nMETHODS\nThe National Infantile Spasms Consortium established a multicenter, prospective database enrolling infants with new diagnosis of infantile spasms. Children were considered responders if there was clinical remission and resolution of hypsarrhythmia that was sustained at 3 months after first treatment initiation. Standard treatments of adrenocorticotropic hormone (ACTH), oral corticosteroids, and vigabatrin were considered individually, and all other nonstandard therapies were analyzed collectively. Developmental status and etiology were assessed. We compared response rates by treatment group using chi-square tests and multivariate logistic regression models.\n\n\nRESULTS\nTwo hundred thirty infants were enrolled from 22 centers. Overall, 46% of children receiving standard therapy responded, compared to only 9% who responded to nonstandard therapy (p < 0.001). Fifty-five percent of infants receiving ACTH as initial treatment responded, compared to 39% for oral corticosteroids, 36% for vigabatrin, and 9% for other (p < 0.001). Neither etiology nor development significantly modified the response pattern by treatment group.\n\n\nCONCLUSIONS\nResponse rate varies by treatment choice. Standard therapies should be considered as initial treatment for infantile spasms, including those with impaired development or known structural or genetic/metabolic etiology. ACTH appeared to be more effective than other standard therapies.",
"affiliations": "Departments of Pediatrics and Neurology, School of Medicine, University of Colorado Anschutz Medical Campus, Aurora, CO.;Departments of Pediatrics and Neurology, School of Medicine, Oregon Health & Sciences University, Portland, OR.;Departments of Neurology and Pediatrics, Mayo Clinic, Rochester, MN.;Division of Neurology, Children's Hospital of Philadelphia and Perelman School of Medicine at the University of Pennsylvania, Philadelphia, PA.;Colorado School of Public Health, Department of Biostatistics and Informatics, University of Colorado Anschutz Medical Campus, Aurora, CO.;Division of Epilepsy and Clinical Neurophysiology, Department of Neurology, Boston Children's Hospital, Boston, MA.;Weill Cornell Medical Center, New York, NY.;Departments of Neurology and Pediatrics, Johns Hopkins Hospital, Baltimore, MD.;Departments of Neurology and Pediatrics, Johns Hopkins Hospital, Baltimore, MD.;Center for Neuroscience, Children's National Health System, Dallas, TX.;Department of Pediatrics, Division of Pediatric Neurology, Ohio State University, Nationwide Children's Hospital, Columbus, OH.;Department of Pediatrics & Communicable Diseases (Division of Pediatric Neurology), University of Michigan, Ann Arbor, MI.;Department of Pediatrics & Communicable Diseases (Division of Pediatric Neurology), University of Michigan, Ann Arbor, MI.;Departments of Pediatrics and Neurology, University of San Francisco, San Francisco, CA.;Division of Neurology, Children's Hospital of Philadelphia and Perelman School of Medicine at the University of Pennsylvania, Philadelphia, PA.;Department of Neurology, University of Washington, Seattle, WA.;Ann & Robert H. Lurie Children's Hospital of Chicago and Departments of Pediatrics and Neurology, Northwestern University Feinberg School of Medicine, Chicago, IL.;Ann & Robert H. Lurie Children's Hospital of Chicago and Departments of Pediatrics and Neurology, Northwestern University Feinberg School of Medicine, Chicago, IL.;Ann & Robert H. Lurie Children's Hospital of Chicago and Departments of Pediatrics and Neurology, Northwestern University Feinberg School of Medicine, Chicago, IL.;Departments of Neurology and Pediatrics, Mayo Clinic, Rochester, MN.",
"authors": "Knupp|Kelly G|KG|;Coryell|Jason|J|;Nickels|Katherine C|KC|;Ryan|Nicole|N|;Leister|Erin|E|;Loddenkemper|Tobias|T|;Grinspan|Zachary|Z|;Hartman|Adam L|AL|;Kossoff|Eric H|EH|;Gaillard|William D|WD|;Mytinger|John R|JR|;Joshi|Sucheta|S|;Shellhaas|Renée A|RA|;Sullivan|Joseph|J|;Dlugos|Dennis|D|;Hamikawa|Lorie|L|;Berg|Anne T|AT|;Millichap|John|J|;Nordli|Douglas R|DR|;Wirrell|Elaine|E|;|||",
"chemical_list": "D000305:Adrenal Cortex Hormones; D000927:Anticonvulsants; D000324:Adrenocorticotropic Hormone; D020888:Vigabatrin",
"country": "United States",
"delete": false,
"doi": "10.1002/ana.24594",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0364-5134",
"issue": "79(3)",
"journal": "Annals of neurology",
"keywords": null,
"medline_ta": "Ann Neurol",
"mesh_terms": "D000284:Administration, Oral; D000305:Adrenal Cortex Hormones; D000324:Adrenocorticotropic Hormone; D000927:Anticonvulsants; D002675:Child, Preschool; D015331:Cohort Studies; D005260:Female; D006801:Humans; D007223:Infant; D008297:Male; D015995:Prevalence; D011446:Prospective Studies; D012307:Risk Factors; D013036:Spasms, Infantile; D014481:United States; D020888:Vigabatrin",
"nlm_unique_id": "7707449",
"other_id": null,
"pages": "475-84",
"pmc": null,
"pmid": "26704170",
"pubdate": "2016-03",
"publication_types": "D018848:Controlled Clinical Trial; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "6299719;11673582;7555969;22914371;8082625;9578521;24938136;650346;6312008;22689735;1940138;25535057;15541450;25546560;8604274;19435579;13613851;15509243;467816;16061586;18793213;10522523;20196795;8176573;2548119;16615562;13532578;19348622;6254755;24446954",
"title": "Response to treatment in a prospective national infantile spasms cohort.",
"title_normalized": "response to treatment in a prospective national infantile spasms cohort"
} | [
{
"companynumb": "US-UCBSA-2016042351",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEVETIRACETAM"
},
"drugadditional": "3",
... |
{
"abstract": "OBJECTIVE\nTo evaluate the outcome of prolonged ozurdex-macular contact following vitrectomy for macular hole.\n\n\nMETHODS\nA 63-year-old woman with subtle vitreomacular traction and macula edema in the left eye underwent femto laser-assisted cataract surgery with lens implant and ozurdex injection. Postoperatively, patient developed macular hole for which she underwent vitrectomy.\n\n\nRESULTS\nThe steroid implant that remained in contact with the fovea for 16 weeks disappeared on its own without causing any retinal toxicity, and the best-corrected visual acuity improved to 6/9.\n\n\nCONCLUSIONS\nVitreomacular traction with edema may worsen after cataract surgery and ozurdex injection. Ophthalmologists should keep in mind this rare possible complication and make patients aware of the same.",
"affiliations": "Department of Ophthalmology, National Institute of Ophthalmology, Pune, India.",
"authors": "Kelkar|Aditya S|AS|;Kelkar|Jai A|JA|;Agarwal|Aanchal A|AA|;Mehta|Hetal M|HM|;Kelkar|Shreekant B|SB|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1097/ICB.0000000000000951",
"fulltext": "\n==== Front\nRetin Cases Brief Rep\nRetin Cases Brief Rep\ncabr\nRetinal Cases & Brief Reports\n1935-1089\n1937-1578\nRetinal Cases & Brief Reports\n\n31842045\nCABR-219-0047\n10.1097/ICB.0000000000000951\n00010\nCase Report\nPROLONGED OZURDEX-MACULAR CONTACT FOLLOWING VITRECTOMY FOR MACULAR HOLE\nKelkar Aditya S. FRCS\nKelkar Jai A. FRCS\nAgarwal Aanchal A. MBBS\nMehta Hetal M. MS, DNB, FVRS\nKelkar Shreekant B. MS\nDepartment of Ophthalmology, National Institute of Ophthalmology, Pune, India.\nReprint requests: Aditya S. Kelkar, FRCS, National Institute of Ophthalmology, 1187/30, Off Ghole Road, Near, Mahatma Phule Museum, Shivajinagar, Pune, Maharashtra 411005, India; e-mail: adityapune4@gmail.com\n05 12 2019\n3 2022\n16 2 168169\nCopyright © 2019 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the Opthalmic Communications Society, Inc.\n2019\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.\n\nSteroid implant that is for intravitreal use causes no harm to retina even if it is in contact with it for months.\n\nPurpose:\n\nTo evaluate the outcome of prolonged ozurdex-macular contact following vitrectomy for macular hole.\n\nMethods and Patients:\n\nA 63-year-old woman with subtle vitreomacular traction and macula edema in the left eye underwent femto laser-assisted cataract surgery with lens implant and ozurdex injection. Postoperatively, patient developed macular hole for which she underwent vitrectomy.\n\nResults:\n\nThe steroid implant that remained in contact with the fovea for 16 weeks disappeared on its own without causing any retinal toxicity, and the best-corrected visual acuity improved to 6/9.\n\nConclusion:\n\nVitreomacular traction with edema may worsen after cataract surgery and ozurdex injection. Ophthalmologists should keep in mind this rare possible complication and make patients aware of the same.\n\nKey words:\n\ncystoid macular edema\nintravitreal steroid implant\nmacular hole\nOzurdex\nvitreomacular traction\nOPEN-ACCESSTRUE\n==== Body\npmcA macular hole formation, secondary to cataract surgery and intravitreal injection of a steroid implant, is rare. Following vitrectomy for the same, the macular hole closed; however, the steroid implant (Ozurdex; Allergan Inc, Irvine, CA) was noted lying in contact with the macula for nearly 16 weeks. The prolonged contact with fovea did not result in any adverse outcome in our case.\n\nCase Report\n\nA 63-year-old, hypertensive woman, presented with decrease in vision in the left eye. Best-corrected visual acuity was 6/24 in the left eye and 6/9 in the right eye. On slit-lamp examination, both eyes had immature cataract. Intraocular pressure was 16 mmHg and 18 mmHg in the right eye and left eye respectively, by applanation tonometry. Biomicroscopic fundus examination was normal in right eye, but a branched retinal venular occlusion with macular edema was noted in the left. Optical coherence tomography (OCT) confirmed the presence of macular edema associated with subtle vitreomacular traction (Figure 1A). Patient underwent uneventful femto laser-assisted cataract surgery with lens implant and Ozurdex injection under topical anesthesia after obtaining an informed written consent.\n\nFig. 1. A. Shows presence of macular edema with subtle vitreomacular traction before Ozurdex injection. B. Shows presence of macular hole after Ozurdex injection.\n\nPostoperatively, the best-corrected visual acuity improved to 6/12 by the end of first week. However, three weeks later, she presented with decrease in vision and metamorphopsia. On examination visual acuity in left eye was 6/24. On slit-lamp examination, there was good psuedophakia, Ozurdex implant was seen floating in the vitreous cavity, and on fundus examination, a full-thickness macular hole was noted and confirmed on OCT (Figure 1B). Patient underwent pars plana vitrectomy, internal limiting membrane peeling with forceps performed after staining with Brilliant Blue G dye and fluid–gas exchange (20% SF6) after obtaining an informed written consent for the same. The surgery was uneventful. At the end of fluid–air exchange, the steroid implant was seen lying in contact with the retina between the optic disk and the fovea.\n\nDay 1, postoperatively, the best-corrected visual acuity was counting finger 1 m, gas bubble present, retina attached, and the steroid implant was on the fovea. One week later, the gas bubble reduced but the implant remained in contact with the retina at the same site (Figure 2A and B). On subsequent follow-ups, implant was seen to be reducing in size (Figure 3A and B), and by the end of 16 weeks postoperatively, it had completely disappeared. Fundus and OCT imaging showed no traces of the implant, and macular hole was closed (Figure 4A and B). Best-corrected visual acuity improved to 6/9, and multifocal erg was normal.\n\nFig. 2. A. Fundus image and (B) OCT 2 weeks postvitrectomy showing Ozurdex implant at the macula.\n\nFig. 3. A. Fundus image and (B) OCT of the macular area 8 weeks postvitrectomy showing Ozurdex implant at the macula with sealed macular hole.\n\nFig. 4. A. Fundus image and (B) OCT of the macular area 16 weeks postvitrectomy showing complete dissolution of the Ozurdex implant and sealed macular hole.\n\nDiscussion\n\nCombined cataract surgery with intravitreal Ozurdex implant is safe and effective in cases with coexisting cataract and retinal pathologies such as diabetic macular edema and vascular occlusions.1\n\nThe macular hole formation after cataract surgery or Ozurdex implant is rare.2,3\n\nAlthough exact mechanism is not known, in our case, the pre-existing subtle vitreomacular traction seems to be the predisposing factor for the development of macular hole after uneventful combined cataract surgery and injection of intravitreal Ozurdex implant.\n\nInterestingly, in our case, even after the disappearance of gas bubble following vitrectomy for macular hole, the Ozurdex implant remained firmly attached to the macula for 16 weeks till complete dissolution without any retinal toxicity or damage.\n\nPreviously, Esenulku and Gunay4 reported no adverse outcomes following the direct contact of ozurdex implant with macula in silicone oil–filled eye.\n\nConclusion\n\nMacular hole formation after cataract surgery or intravitreal steroid implant is rare.2,3 Ophthalmologists should keep in mind this rare possible complication and at the same time make patients aware of it. Patients should be reassured that the steroid implant that is for intravitreal use causes no toxicity or damage to the retina even if it is in contact with it for months and will dissolve on its own.\n\nNone of the authors has any financial/conflicting interests to disclose.\n==== Refs\nReferences\n\n1. Furino C Boscia F Niro A . Combined phacoemulsification and intravitreal dexamethasone implant (Ozurdex®) in diabetic patients with coexisting cataract and diabetic macular edema. J Ophthalmol 2017;2017 :4896036.28884024\n2. Bakri S Omar A . Evolution of vitreomacular traction following the use of the dexamethasone intravitreal implant (Ozurdex) in the treatment of macular edema secondary to central retinal vein occlusion. J Ocul Pharmacol Ther 2012;28 :547–549.22537269\n3. Patterson JA Ezra E Gregor ZJ . Acute full-thickness macular hole after uncomplicated phacoemulsification cataract surgery. Am J Ophthalmol 2001;131 :799–800.11384582\n4. Esenulku CM Gunay M . Location of a dexamethasone implant at the macula after intravitreal injection in a silicone oil-filled eye. Case Rep Ophthalmol Med 2016;2016 :5107652.27999699\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "1935-1089",
"issue": null,
"journal": "Retinal cases & brief reports",
"keywords": null,
"medline_ta": "Retin Cases Brief Rep",
"mesh_terms": null,
"nlm_unique_id": "101298744",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "31842045",
"pubdate": "2019-12-05",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "PROLONGED OZURDEX-MACULAR CONTACT FOLLOWING VITRECTOMY FOR MACULAR HOLE.",
"title_normalized": "prolonged ozurdex macular contact following vitrectomy for macular hole"
} | [
{
"companynumb": "IN-ALLERGAN-2001044US",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": null,
... |
{
"abstract": "Varicella-zoster virus (VZV) typically causes herpes zoster in the elderly due to reactivation, but immunocompromised individuals may develop organ damage such as pneumonia with a poor prognosis. We herein report a case of pneumonia and central nervous system (CNS) infection caused by reactivation of VZV in a 50-year-old man who had received a living-donor kidney transplant. We also conducted a literature review of adult cases with pneumonia or CNS infection caused by VZV after kidney transplantation. It showed that there are cases in which eruptions appeared upto 21 days after the onset of the disease and others in which eruptions did not appear at any time during the clinical course. Furthermore, there may be a wide variety of intervals from kidney transplantation to VZV infection (including both primary infection and reactivation of VZV), ranging from 2 weeks to 11 years. Therefore, it should be kept in mind that kidney transplant patients are always at high risk of VZV infection, as early recognition and treatment of the disease improves its prognosis. Although the diagnosis of varicella pneumonia is generally made by PCR test of bronchoalveolar lavage fluid, our case experience suggests that the less invasive PCR test of sputum may be useful for rapid and accurate diagnosis. The efficacy of inactivated recombinant zoster vaccine in immunocompromised individuals at high risk of reactivation of VZV also needs to be examined in the future.",
"affiliations": "Department of Rheumatology, Graduate School of Medical Science, Kanazawa University, Kanazawa, Japan. yoppi.ms.to.dr@gmail.com.;Department of Rheumatology, Graduate School of Medical Science, Kanazawa University, Kanazawa, Japan.;Department of Rheumatology, Graduate School of Medical Science, Kanazawa University, Kanazawa, Japan.;Department of Rheumatology, Graduate School of Medical Science, Kanazawa University, Kanazawa, Japan.;Department of Rheumatology, Graduate School of Medical Science, Kanazawa University, Kanazawa, Japan.;Department of Rheumatology, Graduate School of Medical Science, Kanazawa University, Kanazawa, Japan.;Department of Rheumatology, Graduate School of Medical Science, Kanazawa University, Kanazawa, Japan.;Department of Radiology, Kanazawa University School of Medical Sciences, Kanazawa, Japan.;Department of Rheumatology, Graduate School of Medical Science, Kanazawa University, Kanazawa, Japan.;Department of Rheumatology, Graduate School of Medical Science, Kanazawa University, Kanazawa, Japan.;Department of Rheumatology, Graduate School of Medical Science, Kanazawa University, Kanazawa, Japan.",
"authors": "Takahashi|Yoshinori|Y|0000-0001-8976-9614;Hara|Satoshi|S|;Hoshiba|Ryohei|R|;Hibino|Shinya|S|;Ito|Kiyoaki|K|;Zoshima|Takeshi|T|;Suzuki|Yasunori|Y|;Inoue|Dai|D|;Mizushima|Ichiro|I|;Fujii|Hiroshi|H|;Kawano|Mitsuhiro|M|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": "10.1007/s13730-021-00576-z",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2192-4449",
"issue": "10(3)",
"journal": "CEN case reports",
"keywords": "Kidney transplantation; VZV meningitis; Varicella pneumonia; Varicella-zoster virus",
"medline_ta": "CEN Case Rep",
"mesh_terms": "D002494:Central Nervous System Infections; D014645:Herpesvirus 3, Human; D006801:Humans; D016030:Kidney Transplantation; D019520:Living Donors; D008297:Male; D008875:Middle Aged; D011014:Pneumonia",
"nlm_unique_id": "101636244",
"other_id": null,
"pages": "370-377",
"pmc": null,
"pmid": "33502715",
"pubdate": "2021-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": "25838952",
"title": "Pneumonia and central nervous system infection caused by reactivation of varicella-zoster virus in a living-donor kidney transplantation patient: case report and review of the literature.",
"title_normalized": "pneumonia and central nervous system infection caused by reactivation of varicella zoster virus in a living donor kidney transplantation patient case report and review of the literature"
} | [
{
"companynumb": "JP-MYLANLABS-2022M1028069",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": "3",
... |
{
"abstract": "Watery diarrhoea coupled with weight loss is a serious condition with many potential causes. We present a possibly underappreciated cause which usually responds well to treatment; left untreated it may have a severe course.\n\n\n\nA man in his fifties with known coronary and cerebrovascular disease was admitted for watery diarrhoea. Prerenal kidney failure occurred on the same day as the initial colonoscopy. The next day he suffered a stroke. He was anticoagulated and recovered within days. In the following months his state of malabsorption continued, with ultimately 50 % weight loss (BMI 14.7) and severe electrolyte disturbances. Intravenous electrolyte solutions and nutrition were administered. Oedema and aphthous duodenal lesions were the only endoscopic findings. Microscopic findings of total villus atrophy in all sampled sites in the small intestine, including the ileum, were striking. There were inflammatory cells in lamina propria, apoptotic cells and disappearance of goblet cells. Coeliac disease was ruled out by serology and HLA typing.\n\n\n\nA final diagnosis of autoimmune enteropathy was made, based on exclusion of other intestinal and systemic diseases. Treatment with infliximab intravenously and budesonide in an open capsule regime was successful.",
"affiliations": null,
"authors": "Sarna|Vikas Kumar|VK|;Lunding|Johan|J|;Løberg|Else Marit|EM|;Solberg|Inger Camilla|IC|",
"chemical_list": null,
"country": "Norway",
"delete": false,
"doi": "10.4045/tidsskr.19.0812",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0029-2001",
"issue": "140(11)",
"journal": "Tidsskrift for den Norske laegeforening : tidsskrift for praktisk medicin, ny raekke",
"keywords": null,
"medline_ta": "Tidsskr Nor Laegeforen",
"mesh_terms": "D002446:Celiac Disease; D003967:Diarrhea; D006801:Humans; D007421:Intestine, Small; D008297:Male; D016884:Polyendocrinopathies, Autoimmune; D015431:Weight Loss",
"nlm_unique_id": "0413423",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "32815334",
"pubdate": "2020-08-18",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "A man in his fifties with chronic diarrhoea and weight loss.",
"title_normalized": "a man in his fifties with chronic diarrhoea and weight loss"
} | [
{
"companynumb": "NO-MYLANLABS-2021M1056317",
"fulfillexpeditecriteria": "1",
"occurcountry": "NO",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE"
},
"drugadditional": null... |
{
"abstract": "Umbilical vessel catheterization is a common procedure in Neonatal Intensive Care Units, especially in very low birthweight infants. Rarely, umbilical artery catheters break, and the retained fragments can cause thrombosis, infection, distal embolization, and even death. Herein, we describe a neonate with clinically significant bilateral limb ischemia developing after removal of a broken umbilical artery catheter. He was under vasodilator treatment in addition to fibrinolytic and anticoagulants. The evolution was favourable.",
"affiliations": "Departamento de Neonatología, Hospital Universitario y de Investigación Materno Infantil Dr. Sami Ulus.;Departamento de Neonatología, Hospital Universitario y de Investigación Materno Infantil Dr. Sami Ulus.;Departamento de Neonatología, Hospital Universitario y de Investigación Materno Infantil Dr. Sami Ulus.;Departamento de Cardiología Pediátrica, Hospital Universitario y de Investigación Materno Infantil Dr. Sami Ulus.;Departamento de Radiología, Hospital Universitario y de Investigación Materno Infantil Dr. Sami Ulus.;Departamento de Neonatología, Hospital Universitario y de Investigación Materno Infantil Dr. Sami Ulus.;Departamento de Neonatología, Hospital Universitario y de Investigación Materno Infantil Dr. Sami Ulus.;Departamento de Neonatología, Facultad de Medicina, Universidad Kirikkale.",
"authors": "Dilli|Dilek|D|;Özyazici|Elif|E|;Fettah|Nurdan|N|;Kaya|Özkan|Ö|;Pala Akdogan|Melek|M|;Zenciro Lu|Aysegül|A|;Okumus|Nurullah|N|;Güzoglu|Nilüfer|N|",
"chemical_list": null,
"country": "Argentina",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0325-0075",
"issue": "113(5)",
"journal": "Archivos argentinos de pediatria",
"keywords": null,
"medline_ta": "Arch Argent Pediatr",
"mesh_terms": "D001157:Arterial Occlusive Diseases; D002408:Catheters, Indwelling; D004868:Equipment Failure; D006801:Humans; D007231:Infant, Newborn; D019102:Infant, Very Low Birth Weight; D008297:Male; D014469:Umbilical Arteries",
"nlm_unique_id": "0372460",
"other_id": null,
"pages": "e283-5",
"pmc": null,
"pmid": "26294163",
"pubdate": "2015-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Rupture and displacement of umbilical arterial catheter: Bilateral arterial occlusion in a very low birth weight preterm.",
"title_normalized": "rupture and displacement of umbilical arterial catheter bilateral arterial occlusion in a very low birth weight preterm"
} | [
{
"companynumb": "TR-EVUS PHARMACEUTICALS, LLC-EPL202107-000061",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "HEPARIN SODIUM"
},
"drug... |
{
"abstract": "A description of a case is presented of an isolated hypofibrinogenaemia acquired in relation to taking topiramate used as concomitant treatment of a drug resistant epilepsy. The hypofibrinogenaemia developed in the course of a month after the introduction of the drug, and was diagnosed in the perioperative period.",
"affiliations": "Anestesiología, Reanimación y Terapia del Dolor, Hospital de Cruces, Baracaldo, Vizcaya, España. Electronic address: carlaiglesias86@hotmail.com.;Anestesiología, Reanimación y Terapia del Dolor, Hospital de Cruces, Baracaldo, Vizcaya, España.;Anestesiología, Reanimación y Terapia del Dolor, Hospital de Cruces, Baracaldo, Vizcaya, España.;Anestesiología, Reanimación y Terapia del Dolor, Hospital de Cruces, Baracaldo, Vizcaya, España.;Anestesiología, Reanimación y Terapia del Dolor, Hospital de Cruces, Baracaldo, Vizcaya, España.;Anestesiología, Reanimación y Terapia del Dolor, Hospital de Cruces, Baracaldo, Vizcaya, España.",
"authors": "Iglesias Morales|C|C|;Duca Rezzulini|F|F|;Latre Saso|C|C|;Gonzalez Paniagua|C|C|;Iturri Clavero|F|F|;Martinez Ruiz|A|A|",
"chemical_list": "D000927:Anticonvulsants",
"country": "Spain",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0034-9356",
"issue": "63(4)",
"journal": "Revista espanola de anestesiologia y reanimacion",
"keywords": "Adverse effects; Antiepileptic drugs; Efectos secundarios; Fármacos anticomiciales; Hipofibrinogenemia; Hypofibrinogenaemia; Topiramate; Topiramato",
"medline_ta": "Rev Esp Anestesiol Reanim",
"mesh_terms": "D000927:Anticonvulsants; D004827:Epilepsy; D006801:Humans",
"nlm_unique_id": "0134516",
"other_id": null,
"pages": "240-2",
"pmc": null,
"pmid": "26386515",
"pubdate": "2016-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Topiramate as concomitant antiepileptic treatment; an isolated perioperative hypofibrinogenaemia.",
"title_normalized": "topiramate as concomitant antiepileptic treatment an isolated perioperative hypofibrinogenaemia"
} | [
{
"companynumb": "PHHY2017ES031953",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TOPIRAMATE"
},
"drugadditional": "3",
"druga... |
{
"abstract": "Toxic epidermal necrolysis (TEN) is a rare complication after allogeneic hematopoietic stem-cell transplantation and carries high mortality rates. Graft-vs-host disease (GVHD) is also a life-threatening complication, and potentially indistinguishable from TEN because of similar clinical symptoms. However, current therapeutic recommendations differ between these two conditions, thereby posing a diagnostic dilemma. The authors, herein, present a complicated postoperative course after bone marrow transplantation with concurrent gastrointestinal and hepatic GVHD, and extensive epidermolytic disease compatible with both severe cutaneous GVHD and TEN. An early consult to a specialized burn service, and prompt transfer to a burn intensive care unit with extensive supportive care and nursing are of paramount importance in the management of immunosuppressed patients with TEN. Better understanding of the pathogenesis of TEN and GVHD after hematopoietic stem-cell transplantation, further treatment strategies, and more advanced diagnostic techniques are still needed to achieve acceptable mortality rates.",
"affiliations": "From the *Department of Surgery, Providence Hospital and Medical Centers, Southfield, Michigan, †Department of Surgery, ‡Department of Oncology and Barbara Ann Karmanos Cancer Institute, §Department of Immunology and Microbiology, and ║Department of Pathology, Wayne State University School of Medicine, Detroit Medical Center, Michigan.",
"authors": "Macedo|Francisco Igor B|FI|;Faris|Janie|J|;Lum|Lawrence G|LG|;Gabali|Ali|A|;Uberti|Joseph P|JP|;Ratanatharathorn|Voravit|V|;White|Michael T|MT|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1097/BCR.0000000000000040",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1559-047X",
"issue": "35(6)",
"journal": "Journal of burn care & research : official publication of the American Burn Association",
"keywords": null,
"medline_ta": "J Burn Care Res",
"mesh_terms": "D003937:Diagnosis, Differential; D017809:Fatal Outcome; D005260:Female; D006086:Graft vs Host Disease; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D008228:Lymphoma, Non-Hodgkin; D013262:Stevens-Johnson Syndrome; D014184:Transplantation, Homologous; D055815:Young Adult",
"nlm_unique_id": "101262774",
"other_id": null,
"pages": "e431-5",
"pmc": null,
"pmid": "24476990",
"pubdate": "2014",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Extensive toxic epidermal necrolysis versus acute graft versus host disease after allogenic hematopoietic stem-cell transplantation: challenges in diagnosis and management.",
"title_normalized": "extensive toxic epidermal necrolysis versus acute graft versus host disease after allogenic hematopoietic stem cell transplantation challenges in diagnosis and management"
} | [
{
"companynumb": "PHHY2015US060751",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "VANCOMYCIN"
},
"drugadditional": null,
"dru... |
{
"abstract": "BACKGROUND\nPost-infarct left ventricular free wall rupture (LVFWR) is not always an immediately catastrophic complication. The rupture can be subacute, allowing time for diagnosis and intervention. Accordingly, early recognition of the entity may be lifesaving.\n\n\nMETHODS\nWe present an electrocardiogram (ECG) change pattern in two cases, which was erroneously attributed to ischemia. Two women in their 80s were admitted to our institute after experiencing the sudden onset of chest pain. They were managed as anterior ST-segment elevation myocardial infarction without reperfusion treatment. Unfortunately, they experienced a recurrence of severe chest pain with cardiogenic shock during hospitalisation. The ECG recorded at that time showed a ST-segment re-elevation in infract-related leads.\n\n\nRESULTS\nThe two cases were regrettably received a misjudgement of reinfarction at first, and one of the patients even was administrated with tirofiban. Afterwards the diagnosis of subacute LVFWR was made through antemortem echocardiography.\n\n\nCONCLUSIONS\nNew ST-segment elevation (STE) in infarct-associated leads, coupled with recurrence of chest pain and new-onset hypotension, may constitute the premonitory signs of a subacute LVFWR.",
"affiliations": "Shanghai Institute of Cardiovascular Diseases; Department of Cardiology, Zhongshan Hospital, Fudan University, Shanghai 200032, China.;Shanghai Institute of Cardiovascular Diseases; Department of Cardiology, Zhongshan Hospital, Fudan University, Shanghai 200032, China.;Shanghai Institute of Cardiovascular Diseases; Department of Cardiology, Zhongshan Hospital, Fudan University, Shanghai 200032, China.;Shanghai Institute of Cardiovascular Diseases; Department of Cardiology, Zhongshan Hospital, Fudan University, Shanghai 200032, China.",
"authors": "Wu|Hong-Yi|HY|;Qian|Ju-Ying|JY|;Wang|Qi-Bing|QB|;Ge|Jun-Bo|JB|",
"chemical_list": null,
"country": "China",
"delete": false,
"doi": "10.5847/wjem.j.1920-8642.2020.02.009",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1920-8642",
"issue": "11(2)",
"journal": "World journal of emergency medicine",
"keywords": "Diagnosis; Electrocardiogram; Myocardial infarction; Myocardial rupture",
"medline_ta": "World J Emerg Med",
"mesh_terms": null,
"nlm_unique_id": "101549691",
"other_id": null,
"pages": "117-119",
"pmc": null,
"pmid": "32076478",
"pubdate": "2020",
"publication_types": "D016428:Journal Article",
"references": "12907544;19064683;8353916;8198310;8626938;28977576;17118207;9285648;31534595;8508857;25862248;25073887;28967573;9669261;20974994;18312750;8354804;19564703",
"title": "An unexpected electrocardiogram sign of subacute left ventricular free wall rupture: Its early awareness may be lifesaving.",
"title_normalized": "an unexpected electrocardiogram sign of subacute left ventricular free wall rupture its early awareness may be lifesaving"
} | [
{
"companynumb": "CN-AGG-02-2020-2198",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": null,
"drugadditional": null,
"drugadministrationroute": null,
"drugauthorizat... |
{
"abstract": "OBJECTIVE\nBevacizumab is the only therapeutic target approved for patients with persistent, recurrent or advanced cervical cancer from a phase III study that combined with chemotherapy; it proves a significant increase in overall survival. To retrospectively assess the efficacy and safety of bevacizumab as the first-line treatment in patients from usual clinical practice with recurrent/persistent or advanced cervical cancer.\n\n\nMETHODS\nTreatment consisted of cisplatin 50 mg/m2 or carboplatin AUC 5 plus paclitaxel 175 mg/m2 for 6-8 cycles and bevacizumab 15 mg/kg every 3 weeks up to progression or unacceptable toxicity. The endpoints were progression-free survival (PFS), overall survival (OS), response rates (RR) and toxicity.\n\n\nRESULTS\nTwenty-seven patients were included from January 2014 to June 2017, with a median follow-up 10, 1 months. Eleven percent had recurrent/persistent disease and 89% had metastatic disease at diagnosis. The prior exposition to platinum was 70%. The median PFS and OS were 9, 6 and 21, 5 months, respectively. There was an increase of fistula formation (22%). All of them had pelvic and peritoneal disease at the beginning of treatment and previous treatment with chemoradiotherapy; non-incidence differences were found according to the type of platinum agent used. There were two treatment-related deaths, one from intestinal perforation and another from severe sepsis.\n\n\nCONCLUSIONS\nFinally, although our study does have certain limitations, we believe that it can provide useful information and encouraging evidence that the routine use of bevacizumab as part of first-line treatment of patients with advanced cervical cancer may be associated with outcomes comparable with those obtained in GOG240 study.",
"affiliations": "Medical Oncology Service, Hospitales Universitarios Regional y Virgen de la Victoria, Av. Carlos Haya s/n, 29010, Málaga, Spain. anagodort@gmail.com.;Department of Oncology, Complejo Hospitalario de Jaén, Jaén, Spain.;Medical Oncology Service, Hospital Costa del Sol, Málaga, Marbella, Spain.;Medical Oncology Service, Hospitales Universitarios Regional y Virgen de la Victoria, Av. Carlos Haya s/n, 29010, Málaga, Spain.;Medical Oncology Service, Hospitales Universitarios Regional y Virgen de la Victoria, Av. Carlos Haya s/n, 29010, Málaga, Spain.;Medical Oncology Service, Hospitales Universitarios Regional y Virgen de la Victoria, Av. Carlos Haya s/n, 29010, Málaga, Spain.;Medical Oncology Service, Hospitales Universitarios Regional y Virgen de la Victoria, Av. Carlos Haya s/n, 29010, Málaga, Spain.;Medical Oncology Service, Hospitales Universitarios Regional y Virgen de la Victoria, Av. Carlos Haya s/n, 29010, Málaga, Spain.",
"authors": "Godoy-Ortiz|A|A|http://orcid.org/0000-0002-5503-6946;Plata|Y|Y|;Alcaide|J|J|;Galeote|A|A|;Pajares|B|B|;Saez|E|E|;Alba|E|E|;Sánchez-Muñoz|A|A|",
"chemical_list": "D000068258:Bevacizumab; D016190:Carboplatin; D017239:Paclitaxel; D002945:Cisplatin",
"country": "Italy",
"delete": false,
"doi": "10.1007/s12094-017-1808-x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1699-048X",
"issue": "20(7)",
"journal": "Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico",
"keywords": "Advanced disease; Angiogenesis; Bevacizumab; Cervical cancer; Fistula; Recurrent disease",
"medline_ta": "Clin Transl Oncol",
"mesh_terms": "D000230:Adenocarcinoma; D000328:Adult; D000971:Antineoplastic Combined Chemotherapy Protocols; D000068258:Bevacizumab; D016190:Carboplatin; D002294:Carcinoma, Squamous Cell; D002945:Cisplatin; D017326:Clinical Trials, Phase III as Topic; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D008297:Male; D008875:Middle Aged; D009364:Neoplasm Recurrence, Local; D017239:Paclitaxel; D011379:Prognosis; D012189:Retrospective Studies; D015996:Survival Rate; D002583:Uterine Cervical Neoplasms",
"nlm_unique_id": "101247119",
"other_id": null,
"pages": "922-927",
"pmc": null,
"pmid": "29222647",
"pubdate": "2018-07",
"publication_types": "D016428:Journal Article",
"references": "19139430;15911865;25766118;24552320;16871331;23591400;15639683;26672085;498154;19853287;19720909;16647106;27207252;27064283;28756902;17888097;15284262",
"title": "Bevacizumab for recurrent, persistent or advanced cervical cancer: reproducibility of GOG 240 study results in \"real world\" patients.",
"title_normalized": "bevacizumab for recurrent persistent or advanced cervical cancer reproducibility of gog 240 study results in real world patients"
} | [
{
"companynumb": "ES-ROCHE-2046058",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PACLITAXEL"
},
"drugadditional": "3",
"druga... |
{
"abstract": "Recent studies have found that transcarotid artery revascularization (TCAR) is associated with lower risk of stroke or death compared with transfemoral carotid artery stenting but higher risk of bleeding complications, presumably associated with the need for an incision. Heparin anticoagulation is universally used during TCAR, so protamine use may reduce bleeding complications. However, the safety and effectiveness of protamine use in TCAR are unknown. We therefore evaluated the impact of protamine use on perioperative outcomes after TCAR in the Vascular Quality Initiative TCAR Surveillance Project.\n\n\n\nWe performed a retrospective review of patients undergoing TCAR in the Vascular Quality Initiative TCAR Surveillance Project from September 2016 to April 2019. We assessed in-hospital outcomes using propensity score-matched cohorts of patients who did and did not receive protamine. The primary efficacy end point was access site bleeding complications, and the primary safety end point was in-hospital stroke or death. Secondary end points included the individual end points of stroke, death, transient ischemic attack, myocardial infarction, congestive heart failure exacerbation, and hemodynamic instability.\n\n\n\nOf the 5144 patients undergoing TCAR, all patients received heparin and 4072 (79%) patients received protamine. We identified 944 matched pairs of patients who did and did not receive protamine. Protamine use was associated with a significantly lower risk of bleeding complications (2.8% vs 8.3%; relative risk [RR], 0.33; 95% confidence interval [CI], 0.21-0.52; P < .001), including bleeding that resulted in interventional treatment (1.0% vs 3.6%; RR, 0.26; 95% CI, 0.13-0.54; P < .001) and in blood transfusion (1.2% vs 3.9%; RR, 0.30; 95% CI, 0.15-0.58; P <.001). There were no statistically significant differences in in-hospital stroke or death for patients who received protamine and those who did not (1.6% vs 2.2%; RR, 0.71; 95% CI, 0.37-1.39; P = .32); however, there was a trend toward lower risk of stroke for patients who received protamine (1.1% vs 2.0%; RR, 0.53; 95% CI, 0.24-1.13; P = .09). There were also no statistically significant differences in the rates of transient ischemic attack (0.4% vs 1.1%; RR, 0.40; 95% CI, 0.13-1.28; P = .11), myocardial infarction (0.4% vs 0.8%; RR, 0.50; 95% CI, 0.15-1.66; P = .25), heart failure exacerbation (0.4% vs 0.3%; RR, 1.33; 95% CI, 0.30-5.96; P = .71), or postoperative hypotensive hemodynamic instability (16% vs 15%; RR, 1.06; 95% CI, 0.83-1.35; P = .50) with protamine use.\n\n\n\nProtamine can be safely used in TCAR to reduce the risk of perioperative bleeding complications without increasing the risk of thrombotic events.",
"affiliations": "Division of Vascular and Endovascular Surgery, Department of Surgery, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Mass.;Division of Vascular Surgery, Department of Surgery, Indiana University School of Medicine, Indianapolis, Ind.;Division of Vascular and Endovascular Surgery, Department of Surgery, University of California San Diego Health System, San Diego, Calif.;Division of Vascular Surgery and Endovascular Therapy, Department of Surgery, Hospital of the University of Pennsylvania, Philadelphia, Pa.;Division of Vascular and Endovascular Therapy, Department of Surgery, Maine Medical Center, Portland, Me.;Section of Vascular Surgery and The Dartmouth Institute, Dartmouth-Hitchcock Medical Center, Lebanon, NH.;Division of Vascular and Endovascular Therapy, Department of Surgery, Maine Medical Center, Portland, Me.;Division of Vascular Surgery and Endovascular Therapy, Department of Surgery, University Hospitals Cleveland Medical Center, Cleveland, Ohio.;Division of Vascular and Endovascular Surgery, Department of Surgery, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Mass. Electronic address: mscherm@bidmc.harvard.edu.",
"authors": "Liang|Patric|P|;Motaganahalli|Raghu L|RL|;Malas|Mahmoud B|MB|;Wang|Grace J|GJ|;Eldrup-Jorgensen|Jens|J|;Cronenwett|Jack L|JL|;Nolan|Brian W|BW|;Kashyap|Vikram S|VS|;Schermerhorn|Marc L|ML|",
"chemical_list": "D006494:Heparin Antagonists; D011479:Protamines",
"country": "United States",
"delete": false,
"doi": "10.1016/j.jvs.2020.02.019",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0741-5214",
"issue": "72(6)",
"journal": "Journal of vascular surgery",
"keywords": "Carotid artery stenting; Protamine; Stroke; Transcarotid artery revascularization",
"medline_ta": "J Vasc Surg",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D016063:Blood Loss, Surgical; D002340:Carotid Artery Diseases; D057510:Endovascular Procedures; D005260:Female; D006494:Heparin Antagonists; D006801:Humans; D008297:Male; D008875:Middle Aged; D019106:Postoperative Hemorrhage; D011479:Protamines; D012189:Retrospective Studies; D018570:Risk Assessment; D012307:Risk Factors; D015607:Stents; D013923:Thromboembolism; D013997:Time Factors; D016896:Treatment Outcome; D014481:United States",
"nlm_unique_id": "8407742",
"other_id": null,
"pages": "2079-2087",
"pmc": null,
"pmid": "32273225",
"pubdate": "2020-12",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study",
"references": null,
"title": "Protamine use in transcarotid artery revascularization is associated with lower risk of bleeding complications without higher risk of thromboembolic events.",
"title_normalized": "protamine use in transcarotid artery revascularization is associated with lower risk of bleeding complications without higher risk of thromboembolic events"
} | [
{
"companynumb": "US-TECHDOW-2021TECHDOW000549",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "HEPARIN SODIUM"
},
"drugadditional": null... |
{
"abstract": "Acquired hemophilia A (AHA) is a blood clotting disorder caused by the presence of autoantibodies (inhibitors) against factor VIII. The typical symptom of this disorder is bleeding under the skin and soft tissue (rarely in the joints), with no family or personal previous history of bleeding. This case reports is tended to build up awareness for better diagnosis and therapy. Woman, 39 years old, bruises on both forearms are intermittent for 2 months with a history of long term drug consumption for headache treatment. Hemostatic test showed the elongation of activated partial thromboplastin test (APTT) to 87.1 (normal 24.4-44.4 seconds) and the decreament of factor VIII (FVIII) activity to 5% (normal 60-150%). Provision of recombinant factor VIII lowered factor VIII activity to 2%. Factor VIII inhibitor titer was 21.12 BU and diagnosis AHA was made. Inhibitor eradication by methylprednisolone tablet 3x16mg which was given for 2 months, improved the APPT to 46.7 seconds and factor VIII activity to 36%. Acquired Hemophilia A should be suspected in an adult bleeding patient with history of taking a long time non-steroidal anti-inflammatory drugs (NSAIDs). This case is a rare case in Indonesia and therefore the procedure for diagnosis needs to be improved in order to avoid errors in delivering a therapy which can cause the decreament of factor VIII activity.",
"affiliations": "Department of Clinical Pathology, Faculty of Medicine Universitas Airlangga - Dr. Soetomo Teaching Hospital, Surabaya, Indonesia.. diane.lukito.dr@gmail.com.",
"authors": "Setiawan|Diane Lukito|DL|;Hernaningsih|Yetti|Y|",
"chemical_list": "D000894:Anti-Inflammatory Agents, Non-Steroidal; C078147:F8 protein, human; D005169:Factor VIII; D008775:Methylprednisolone",
"country": "Indonesia",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0125-9326",
"issue": "51(3)",
"journal": "Acta medica Indonesiana",
"keywords": "Acquired Haemophilia; NSAID; factor VIII; inhibitor",
"medline_ta": "Acta Med Indones",
"mesh_terms": "D000328:Adult; D000894:Anti-Inflammatory Agents, Non-Steroidal; D005169:Factor VIII; D005260:Female; D006261:Headache; D006467:Hemophilia A; D006470:Hemorrhage; D006801:Humans; D007214:Indonesia; D008775:Methylprednisolone; D010314:Partial Thromboplastin Time",
"nlm_unique_id": "7901042",
"other_id": null,
"pages": "258-262",
"pmc": null,
"pmid": "31699950",
"pubdate": "2019-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Acquired Hemophilia A Associated with NSAID: A Case Report.",
"title_normalized": "acquired hemophilia a associated with nsaid a case report"
} | [
{
"companynumb": "ID-SA-2019SA324499",
"fulfillexpeditecriteria": "1",
"occurcountry": "ID",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN\\ASPIRIN\\CAFFEINE"
},
"drugadditional... |
{
"abstract": "Iron-induced hypophosphataemic osteomalacia remains under-recognized as a potential complication of parenteral iron therapy. We here report two cases of symptomatic hypophosphataemic osteomalacia with multiple insufficiency fractures in the context of chronic gastrointestinal blood loss, necessitating monthly iron polymaltose infusions over prolonged periods of time. Respective blood tests revealed severe hypophosphataemia [0.29 and 0.43; normal range (NR) 0.8-1.5 mmol/l] in the presence of normal serum calcium and 25-hydroxy vitamin D levels. Urinary fractional phosphate excretion was elevated (16% and 24%; NR < 5%) and the tubular maximum phosphate reabsorption was reduced, consistent with renal phosphate wasting. Serum fibroblast growth factor 23 (FGF23) obtained in one patient was significantly elevated at 285 pg/ml (NR < 54 pg/ml). Bone mineral density was significantly reduced and whole-body bone scans revealed metabolic bone disease and multiple insufficiency fractures consistent with osteomalacia. Cessation of iron infusions resulted in clinical and biochemical improvement within 2 months in one patient whereas the second patient required phosphate and calcitriol supplementation to improve symptomatically. Iron-induced hypophosphataemic osteomalacia is thought to be due to reduced degradation of FGF23, resulting in phosphaturia and reduced synthesis of 1,25-dihydroxy vitamin D. Monitoring of patients on long-term parenteral iron is recommended to avoid clinically serious adverse effects.",
"affiliations": "Department of Endocrinology and Metabolism, Concord Hospital Medical Centre, Concord, NSW 2139, Australia.;Department of Endocrinology and Metabolism, Concord Repatriation General Hospital, Concord, NSW, Australia.;Department of Endocrinology and Metabolism, Concord Repatriation General Hospital, Concord, NSW, Australia.",
"authors": "Bishay|Ramy H|RH|;Ganda|Kirtan|K|;Seibel|Markus J|MJ|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/2042018816678363",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2042-0188",
"issue": "8(1-2)",
"journal": "Therapeutic advances in endocrinology and metabolism",
"keywords": "fracture; hypophosphataemia; iron infusion; osteomalacia",
"medline_ta": "Ther Adv Endocrinol Metab",
"mesh_terms": null,
"nlm_unique_id": "101532143",
"other_id": null,
"pages": "14-19",
"pmc": null,
"pmid": "28203361",
"pubdate": "2017-01",
"publication_types": "D016428:Journal Article; D016454:Review",
"references": "24457442;23505057;7166673;7646591;24751822;17224271;21490240;9547891;19555782;24069536;15040831;18293139;19366850;24688754;24569537;19682342;26000018",
"title": "Long-term iron polymaltose infusions associated with hypophosphataemic osteomalacia: a report of two cases and review of the literature.",
"title_normalized": "long term iron polymaltose infusions associated with hypophosphataemic osteomalacia a report of two cases and review of the literature"
} | [
{
"companynumb": "AU-STRIDES ARCOLAB LIMITED-2017SP005079",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "EPROSARTAN"
},
"drugadditional... |
{
"abstract": "Early trials of tacrolimus in renal transplant recipients have not revealed hearing loss as an adverse effect. Here, we present a case report and a review of the literature of deafness after tacrolimus use. The review of the literature and our experience suggested that the possible reason for hearing loss could be due to an initiation of a sudden spike in the tacrolimus serum level, which was later worsened by its cumulative toxic effect.",
"affiliations": "From the Department of Nephrology, Sri Venkateswar Institute of Medical Sciences, Tirupati, India.",
"authors": "Lakshmi|Boju Sangeetha|BS|;Vidya|Bhukya|B|;Reddy|Mogili Hari Krishna|MHK|;Kumar|Anil Cheni Venkata|ACV|;Ram|Rapur|R|;Kumar|Vishnubotla Siva|VS|",
"chemical_list": "D065095:Calcineurin Inhibitors; D007166:Immunosuppressive Agents; D016559:Tacrolimus",
"country": "Turkey",
"delete": false,
"doi": "10.6002/ect.2017.0114",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1304-0855",
"issue": "18(1)",
"journal": "Experimental and clinical transplantation : official journal of the Middle East Society for Organ Transplantation",
"keywords": null,
"medline_ta": "Exp Clin Transplant",
"mesh_terms": "D065095:Calcineurin Inhibitors; D006309:Hearing; D006319:Hearing Loss, Sensorineural; D006801:Humans; D007166:Immunosuppressive Agents; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D000081015:Ototoxicity; D016559:Tacrolimus; D016896:Treatment Outcome",
"nlm_unique_id": "101207333",
"other_id": null,
"pages": "110-111",
"pmc": null,
"pmid": "29969081",
"pubdate": "2020-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Sensorineural Deafness Following Tacrolimus Use.",
"title_normalized": "sensorineural deafness following tacrolimus use"
} | [
{
"companynumb": "IN-GLENMARK PHARMACEUTICALS-2018GMK036914",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditi... |
{
"abstract": "Chemotherapy is a common type of preoperative neoadjuvant treatment and postoperative adjuvant or palliative therapy for many different types of malignancies. Certain chemotherapeutic agents can induce bizarre epithelial atypia that mimics malignancy. Unfamiliarity with these changes could potentially cause confusion with a neoplastic or infectious process. The endometrium is one of the few sites where chemotherapy-induced epithelial atypia has not been appreciated. We identified four patients with marked cytologic atypia of the endometrial glandular epithelium from the surgical pathology files of Severance Hospital. The histopathologic features, immunostaining results and medical records of these patients were reviewed. All patients underwent hysteroscopic examination with endometrial curettage for investigation of vaginal bleeding. They had previously undergone chemotherapy for uterine cervical cancer (n=1), rectal cancer (n=2) and myelodysplastic syndrome (n=1). The chemotherapy regimens included alkylating agents (busulfan, cyclophosphamide, ifosfamide, cisplatin, and oxaliplatin), pyrimidine antagonists (capecitabine, decitabine, and 5-fluorouracil), taxanes (paclitaxel), and topoisomerase inhibitors (irinotecan and etoposide). On histopathological examination, the atypical epithelial changes included marked nuclear enlargement and pleomorphism, a degenerative-looking chromatin pattern, abundant microvacuolated cytoplasm, and preservation of the nuclear/cytoplasmic ratio. This study demonstrates that certain chemotherapeutic agents may cause bizarre, reactive atypia of the endometrial glandular epithelium. These changes should not be interpreted as neoplastic or infectious in nature. An awareness of prior exposure to cytotoxic agents and a familiarity with the nature and distribution of these bizarre alterations is essential to avoid misinterpretation of the morphologic features and prevent unnecessary treatment.",
"affiliations": "Department of Pathology, Severance Hospital, Yonsei University College of Medicine Seoul, Republic of Korea.;Department of Obstetrics and Gynecology, Pusan National University Yangsan Hospital, Pusan National University School of Medicine Yangsan-si, Gyeongsangnam-do, Republic of Korea.;Department of Pathology, Severance Hospital, Yonsei University College of Medicine Seoul, Republic of Korea.",
"authors": "Kim|Eun Kyung|EK|;Yoon|Gun|G|;Kim|Hyun-Soo|HS|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1943-8141",
"issue": "8(5)",
"journal": "American journal of translational research",
"keywords": "Endometrium; chemotherapy; cytomegalovirus; epithelial atypia; malignancy",
"medline_ta": "Am J Transl Res",
"mesh_terms": null,
"nlm_unique_id": "101493030",
"other_id": null,
"pages": "2459-67",
"pmc": null,
"pmid": "27347355",
"pubdate": "2016",
"publication_types": "D016428:Journal Article",
"references": "8494702;11342778;18300801;2962731;8434422;12421451;2155174;10872660;709532;1183993;5214802;14192755;8181808;6211226;5281244;15338497;11353047;12453294;2256423;21501891",
"title": "Chemotherapy-induced endometrial pathology: mimicry of malignancy and viral endometritis.",
"title_normalized": "chemotherapy induced endometrial pathology mimicry of malignancy and viral endometritis"
} | [
{
"companynumb": "KR-BAXTER-2016BAX036290",
"fulfillexpeditecriteria": "1",
"occurcountry": "KR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "IFOSFAMIDE"
},
"drugadditional": "3",
... |
{
"abstract": "Although a bifid cardiac apex is common in certain marine animals, it is an uncommon finding in humans. When present, bifid cardiac apex is usually associated with other congenital heart anomalies. We present a case of bifid cardiac apex that was an incidental finding in a 25-year-old male with sudden cardiac death from combined drug toxicity. On gross examination, there was a bifid cardiac apex with a 2-cm long cleft. There were no other significant gross or microscopic abnormalities. This case represents the very rare occurrence of a bifid cardiac apex as an isolated cardiac anomaly.",
"affiliations": "Division of Anatomic Pathology, Department of Pathology and Laboratory Medicine, UCLA Center for the Health Sciences 13-145, Los Angeles, CA 90095-1732, USA. Electronic address: anniewu@mednet.ucla.edu.",
"authors": "Wu|Annie|A|;Kay|Deborah|D|;Fishbein|Michael C|MC|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1054-8807",
"issue": "23(1)",
"journal": "Cardiovascular pathology : the official journal of the Society for Cardiovascular Pathology",
"keywords": "Bifid cardiac apex; Sudden cardiac death",
"medline_ta": "Cardiovasc Pathol",
"mesh_terms": "D000328:Adult; D001344:Autopsy; D016757:Death, Sudden, Cardiac; D062787:Drug Overdose; D017809:Fatal Outcome; D006330:Heart Defects, Congenital; D006801:Humans; D033162:Incidental Findings; D008297:Male",
"nlm_unique_id": "9212060",
"other_id": null,
"pages": "59-60",
"pmc": null,
"pmid": "23928367",
"pubdate": "2014",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Bifid cardiac apex in a 25-year-old male with sudden cardiac death.",
"title_normalized": "bifid cardiac apex in a 25 year old male with sudden cardiac death"
} | [
{
"companynumb": "PHHY2015US029528",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "METHADONE HYDROCHLORIDE"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nWe report an unusual case of masticator space foreign body in a patient presenting with otorrhea and granulation tissue within the external auditory canal (EAC).\n\n\nMETHODS\nCase report.\n\n\nRESULTS\nA 16-month-old male presented with fever, unilateral otorrhea, facial swelling, leukocytosis, and granulation tissue within the EAC that failed to respond to conventional medical treatment. Computed tomography scan showed EAC and middle ear opacification and soft tissue swelling involving the masticator space. Given concerns for malignancy, biopsies of tissue within the EAC and of a newly detected right buccal mass were performed, revealing granulation tissue. Concern persisted for neoplasm, however, and magnetic resonance imaging was obtained, showing a masticator space foreign body and possible osteomyelitis of the mandible and pterygoid plates. The patient underwent urgent operative removal of a 3 cm crayon fragment from the masticator space and debridement of granulation tissue arising from a small defect at the inferior medial cartilaginous EAC. He likely sustained foreign body injury several weeks earlier upon falling from standing height while biting a crayon. Postoperatively, he was observed in hospital on intravenous antibiotics and improved significantly. He has since fully recovered.\n\n\nCONCLUSIONS\nMasticator space foreign bodies may present with erosion and granulation tissue of the EAC.",
"affiliations": "Department of Otolaryngology-Head & Neck Surgery, University of Cincinnati College of Medicine, Cincinnati, Ohio, USA Division of Pediatric Otolaryngology-Head & Neck Surgery, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio, USA Kareem.tawfik@uc.edu.;Department of Otolaryngology-Head & Neck Surgery, University of Cincinnati College of Medicine, Cincinnati, Ohio, USA Division of Pediatric Otolaryngology-Head & Neck Surgery, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio, USA.;Department of Radiology and Medical Imaging, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio, USA.;Department of Otolaryngology-Head & Neck Surgery, University of Cincinnati College of Medicine, Cincinnati, Ohio, USA Division of Pediatric Otolaryngology-Head & Neck Surgery, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio, USA.",
"authors": "Tawfik|Kareem O|KO|;Edwards|Colin R|CR|;Jones|Blaise V|BV|;Myer|Charles M|CM|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/0003489416656204",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0003-4894",
"issue": "125(10)",
"journal": "The Annals of otology, rhinology, and laryngology",
"keywords": "and airway; ear canal; foreign bodies in the ear; granulation tissue; masticator space; nose; otorrhea",
"medline_ta": "Ann Otol Rhinol Laryngol",
"mesh_terms": "D002610:Cheek; D003646:Debridement; D004424:Ear Canal; D004427:Ear Diseases; D004487:Edema; D005547:Foreign Bodies; D006097:Granulation Tissue; D006801:Humans; D007223:Infant; D008279:Magnetic Resonance Imaging; D008297:Male; D008410:Masticatory Muscles",
"nlm_unique_id": "0407300",
"other_id": null,
"pages": "854-7",
"pmc": null,
"pmid": "27357972",
"pubdate": "2016-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Masticator Space Foreign Body in a Child Presenting With Otorrhea and Granulation Tissue of the External Auditory Canal.",
"title_normalized": "masticator space foreign body in a child presenting with otorrhea and granulation tissue of the external auditory canal"
} | [
{
"companynumb": "US-BAYER-2016-192315",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CLINDAMYCIN"
},
"drugadditional": null,
... |
{
"abstract": "Exposure to quinolones is known to be an independent risk factor for aortic dissection; however, the association with vertebral artery dissection remains unclear. We report two cases of vertebral artery dissection that occurred 4 and 8 days after exposure to levofloxacin, respectively. Both patients had risk factors for vertebral artery dissection, and quinolone use could have been avoided. These two cases indicate that quinolone exposure can be a risk factor for vertebral artery dissection. Considering the possible mechanism, it is better to avoid the prescription of quinolones to patients who have insufficient connective tissues to avoid vertebral artery dissection.",
"affiliations": "Division of General Medicine, Showa Medical University Hospital, Japan.;Department of Diagnostic and Generalist Medicine, Dokkyo Medical University Hospital, Japan.;Department of Diagnostic and Generalist Medicine, Dokkyo Medical University Hospital, Japan.",
"authors": "Harada|Taku|T|;Harada|Yukinori|Y|;Shimizu|Taro|T|",
"chemical_list": "D064704:Levofloxacin",
"country": "Japan",
"delete": false,
"doi": "10.2169/internalmedicine.6736-20",
"fulltext": "\n==== Front\nIntern Med\nIntern Med\nInternal Medicine\n0918-2918\n1349-7235\nThe Japanese Society of Internal Medicine\n\n33746163\n10.2169/internalmedicine.6736-20\nCase Report\nVertebral Artery Dissection after Exposure to Levofloxacin: A Report of Two Cases\nHarada Taku 12\nHarada Yukinori 2\nShimizu Taro 2\n1 Division of General Medicine, Showa Medical University Hospital, Japan\n2 Department of Diagnostic and Generalist Medicine, Dokkyo Medical University Hospital, Japan\nCorrespondence to Dr. Taku Harada, hrdtaku@gmail.com\n\n22 3 2021\n1 9 2021\n60 17 28632865\n15 11 2020\n1 2 2021\nCopyright © 2021 by The Japanese Society of Internal Medicine\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ The Internal Medicine is an Open Access journal distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).\nExposure to quinolones is known to be an independent risk factor for aortic dissection; however, the association with vertebral artery dissection remains unclear. We report two cases of vertebral artery dissection that occurred 4 and 8 days after exposure to levofloxacin, respectively. Both patients had risk factors for vertebral artery dissection, and quinolone use could have been avoided. These two cases indicate that quinolone exposure can be a risk factor for vertebral artery dissection. Considering the possible mechanism, it is better to avoid the prescription of quinolones to patients who have insufficient connective tissues to avoid vertebral artery dissection.\n\nvertebral artery dissection\nquinolone\ndrug adverse effect\n==== Body\npmcIntroduction\n\nExposure to quinolones is an independent risk factor for aortic dissection (1). In addition, a recent study has reported that the use of quinolones can also be a risk factor for carotid artery dissection (2). In the same study, vertebral artery dissection, a form of cervical artery dissection, was not reported to be associated with the use of quinolones (2). However, the relationship between the use of levofloxacin and vertebral artery dissection is unclear. This suggests that the study was underpowered to definitively prove the relationship between quinolone exposure and vertebral artery dissection. Therefore, physicians should be alert to the use of quinolones in patients who are at high risk of vertebral artery dissection. We herein report two cases of vertebral artery dissection at 4 and 8 days after exposure to quinolones, respectively.\n\nCase Reports\n\nCase 1\n\nA 45-year-old man presented to the emergency department with sudden-onset left posterior neck pain and left hemiparesis. His medical history included hypertension, dyslipidemia, and diabetes mellitus, and he had taken levofloxacin orally for a sore throat and cough for 8 days. He had no history of connective tissue disease or head and neck trauma. His vital signs were normal, except for high blood pressure (152/95 mmHg). A neurological examination revealed nystagmus, left hemifacial hypoalgesia, left-sided deficit of cranial nerves VII, IX, and X and paralysis of the left upper limb. Magnetic resonance imaging (MRI)/magnetic resonance angiography (MRA) of the brain revealed left vertebral artery dissection and infarction of the left medulla (Fig. 1, 2). A diagnosis of Wallenberg syndrome associated with vertebral artery dissection was made. He received conservative therapy and was subsequently transferred to a rehabilitation hospital on day 30. He had a Modified Rankin Scale score of 3.\n\nFigure 1. On diffusion-weighted magnetic resonance imaging, the left lateral medulla showed a high signal intensity.\n\nFigure 2. Magnetic resonance angiography showed dilation of the left vertebral artery with irregularity.\n\nCase 2\n\nA 66-year-old man was transferred to the hospital for the treatment of pancreatitis with pancreatic abscess. His medical history included hypertension, diabetes mellitus, and chronic obstructive pulmonary disease. The patient developed duodenal stenosis caused by the pancreatic abscess and was treated with laparoscopic bypass surgery. On postoperative day 5, he developed pneumonia and was initially treated with tazobactam/piperacillin. His antibiotic treatment was switched to intravenous levofloxacin on postoperative day 9. He developed sudden-onset left occipital pain on postoperative day 13. MRI/MRA performed on postoperative day 17 revealed left vertebral artery dissection (Fig. 3). His vital signs were normal, with no neurologic abnormalities, and MRI showed no complications of ischemic stroke. The administration of levofloxacin was continued until postoperative day 30. The patient was discharged on postoperative day 35 with no neurological complications.\n\nFigure 3. Magnetic resonance angiography showed dilatation of the left vertebral artery with focal stenosis.\n\nDiscussion\n\nWe report two cases of vertebral artery dissection that developed soon after the use of levofloxacin. Although it is unclear whether there is a causal relationship between the use of levofloxacin and vertebral artery dissection, these two cases suggest that the use of levofloxacin may be associated with the risk of vertebral artery dissection and that caution should be exercised.\n\nAn association between large artery dissection and the use of quinolones has been reported (1,2). In a previous study, the use of fluoroquinolone was associated with a two- to three-fold higher risk of aortic dissection, with the risk increasing 10 days after fluoroquinolone exposure (1). Recent studies have reported data that support that it is not fluoroquinolone exposure, but other factors that are associated with aortic dissection in patients who receive fluoroquinolone to treat infections (3,4), however, even those studies could not fully rule out a causal relationship between fluoroquinolones and aortic dissection in certain patients (3,4).\n\nThere are several possible mechanisms through which quinolones may cause arterial dissection. Quinolones have properties, such as chelation of several metal ions (e.g., calcium, magnesium, and aluminum), which are essential for type 1 collagen synthesis (1), the decreased expression and activity of lysyl oxidase, and the increased expression and activity of matrix metalloproteinases (1,5). Type 1 collagen is a major component of the vessel wall (6), and a decrease of type 1 collagen may lead to vessel wall vulnerability. The lysyl oxidases are extracellular copper enzymes that initiate the crosslinking of collagens and elastin. These crosslinks provide the tensile strength and elastic properties of vascular walls. Some reports indicated that decreased expression of lysyl oxidase can be associated with vulnerability of arteries (7), which can result in aortic dissection and aneurysm (8). Matrix metalloproteinases are a family of proteolytic enzymes that degrade several components of the extracellular matrix and which mediate vascular remodeling, which may cause vascular dissection. In fact, increase serum levels of matrix metalloproteinase-9 have been reported to be associated with vertebral artery dissection (9). Thus, through these mechanisms, quinolones seem to have the potential to cause arterial dissection.\n\nIn addition, carotid artery dissection was recently reported to occur more frequently in patients who were exposed to quinolones (2). To date, there is no clear evidence that the use of quinolones is a risk factor for dissection in the intracranial artery or vertebral artery (2,10); however, these results cannot be validated due to the small sample sizes of the studies. Moreover, these results should be validated outside of Europe because although internal carotid artery dissection is more common in Europe than in Asia, vertebral artery dissection may be more common in Asia than in Europe (11). Therefore, it may be possible that the use of quinolones increases the risk of vertebral artery dissection, as observed in our two cases.\n\nQuinolone is an overused antimicrobial drug. The defined daily dose per 1,000 inhabitants in Japan was 2.379 in 2018 (12). If quinolones can cause vertebral artery dissection, efforts to revisit the appropriate use of quinolones may reduce the incidence of vertebral artery dissection. The FDA recommends that quinolones not be used by individuals who are at risk for aortic dissection or aortic aneurysm (13). Similarly, since vertebral artery dissection can cause serious ischemic stroke, physicians should reconsider the need for quinolones in patients who have additional risk factors for vertebral artery dissection.\n\nThe authors state that they have no Conflict of Interest (COI).\n==== Refs\n1. Lee CC , Lee MG , Hsieh R , et al . Oral fluoroquinolone and the risk of aortic dissection. J Am Coll Cardiol 72 : 1369-1378, 2018.30213330\n2. Del Zotto E , Pezzini A . Use of fluoroquinolones and the risk of spontaneous cervical artery dissection. Eur J Neurol 26 : 1028-1031, 2019.30697908\n3. Gopalakrishnan C , Bykov K , Fischer MA , Connolly JG , Gagne JJ , Fralick M . Association of fluoroquinolones with the risk of aortic aneurysm or aortic dissection. JAMA Intern Med 180 : 1596-1605, 2020.32897307\n4. Dong YH , Chang CH , Wang JL , Wu LC , Lin JW , Toh S . Association of infections and use of fluoroquinolones with the risk of aortic aneurysm or aortic dissection. JAMA Intern Med 180 : 1587-1595, 2020.32897358\n5. LeMaire SA , Zhang L , Luo W , et al . Effect of ciprofloxacin on susceptibility to aortic dissection and rupture in mice. JAMA Surg 153 : e181804, 2018.30046809\n6. Ponticos M , Partridge T , Black CM , Abraham DJ , Bou-Gharios G . Regulation of collagen type I in vascular smooth muscle cells by competition between Nkx2.5 and deltaEF1/ZEB1. Mol Cell Biol 24 : 6151-6161, 2004.15226419\n7. Mäki JM , Räsänen J , Tikkanen H , et al . Inactivation of the lysyl oxidase gene Lox leads to aortic aneurysms, cardiovascular dysfunction, and perinatal death in mice. Circulation 106 : 2503-2509, 2002.12417550\n8. Guo DC , Regalado ES , Gong L , et al . LOX mutations predispose to thoracic aortic aneurysms and dissections. Circ Res 118 : 928-934, 2016.26838787\n9. Chen CY , Chang FC , Lee IH , Chung CP . Involvement of matrix metalloproteinase 9 in vertebral arterial dissection with posterior circulation ischemic stroke. J Am Heart Assoc 9 : e016743, 2020.32921202\n10. Maumus-Robert S , Debette S , Bérard X , Mansiaux Y , Tubert-Bitter P , Pariente A . Risk of intracranial aneurysm and dissection and fluoroquinolone use: a case-time-control study. Stroke 51 : 994-997, 2020.31964291\n11. Debette S . Pathophysiology and risk factors of cervical artery dissection: what have we learnt from large hospital-based cohorts? Curr Opin Neurol 27 : 20-28, 2014.24300790\n12. Japan Antimicrobial Resistance Clinical Reference Center. National Antimicrobial Sales Volume Surveillance [Internet]. [cited 2020 Dec 12]. Available from: http://amrcrc.ncgm.go.jp/surveillance/020/20181128172618.html (in Japanese)\n13. FDA warns about increased risk of ruptures or tears in the aorta blood vessel with fluoroquinolone antibiotics in certain patients [Internet]. [cited 2020 Dec 12]. Available from: https://www.fda.gov/drugs/drug-safety-and-availability/fda-warns-about-increased-risk-ruptures-or-tears-aorta-blood-vessel-fluoroquinolone-antibiotics\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0918-2918",
"issue": "60(17)",
"journal": "Internal medicine (Tokyo, Japan)",
"keywords": "drug adverse effect; quinolone; vertebral artery dissection",
"medline_ta": "Intern Med",
"mesh_terms": "D006801:Humans; D064704:Levofloxacin; D012307:Risk Factors; D014711:Vertebral Artery; D020217:Vertebral Artery Dissection",
"nlm_unique_id": "9204241",
"other_id": null,
"pages": "2863-2865",
"pmc": null,
"pmid": "33746163",
"pubdate": "2021-09-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "15226419;12417550;24300790;32921202;30213330;31964291;30697908;26838787;32897358;30046809;32897307",
"title": "Vertebral Artery Dissection after Exposure to Levofloxacin: A Report of Two Cases.",
"title_normalized": "vertebral artery dissection after exposure to levofloxacin a report of two cases"
} | [
{
"companynumb": "JP-MYLANLABS-2021M1023704",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "LEVOFLOXACIN"
},
"drugadditional": null,
... |
{
"abstract": "Iron deficiency anemia (IDA) is commonly associated with reactive thrombocytosis, but thrombocytopenia is relatively uncommon and generally associated with more severe IDA. Even more rarely described has been thrombocytopenia following iron replacement therapy to treat IDA, and the underlying mechanism remains unclear. The authors present the case of a patient with severe IDA, who developed thrombocytopenia after the initiation of iron therapy. An analysis is made of all the previous reports of similar cases, to compare and start on the path of understanding this rare entity.",
"affiliations": "Internal Medicine Department, Hospital Garcia de Orta, Av Torrado da Silva, 2805-267 Almada, Portugal.",
"authors": "Cunha|Vitória|V|;Ferreira|Melanie|M|;Barosa|Rita|R|;Fonseca|Ana Glória|AG|;Delerue|Francisca|F|;Carvalho|Carla|C|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1586/17474086.2015.1010504",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1747-4094",
"issue": "8(2)",
"journal": "Expert review of hematology",
"keywords": "blood platelets; iron; iron-deficiency anemia; stem cells; thrombocytopenia",
"medline_ta": "Expert Rev Hematol",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D018798:Anemia, Iron-Deficiency; D005260:Female; D006801:Humans; D008297:Male; D013921:Thrombocytopenia; D055815:Young Adult",
"nlm_unique_id": "101485942",
"other_id": null,
"pages": "247-51",
"pmc": null,
"pmid": "25673365",
"pubdate": "2015-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Iron-induced thrombocytopenia in severe iron-deficiency anemia.",
"title_normalized": "iron induced thrombocytopenia in severe iron deficiency anemia"
} | [
{
"companynumb": "PT-SUN PHARMACEUTICAL INDUSTRIES LTD-2015R1-95755",
"fulfillexpeditecriteria": "1",
"occurcountry": "PT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "IRON SUCROSE"
},
"dru... |
{
"abstract": "BACKGROUND\nBeneficial response to first-line immunosuppressive azathioprine in patients with inflammatory bowel disease (IBD) is low due to high rates of adverse events. Co-administrating allopurinol has been shown to improve tolerability. However, data on this co-therapy as first-line treatment are scarce.\n\n\nOBJECTIVE\nRetrospective comparison of long-term effectiveness and safety of first-line low-dose azathioprine-allopurinol co-therapy (LDAA) with first-line azathioprine monotherapy (AZAm) in patients with IBD without metabolite monitoring.\n\n\nMETHODS\nClinical benefit was defined as ongoing therapy without initiation of steroids, biologics or surgery. Secondary outcomes included CRP, HBI/SCCAI, steroid withdrawal and adverse events.\n\n\nRESULTS\nIn total, 166 LDAA and 118 AZAm patients (median follow-up 25 and 27 months) were evaluated. Clinical benefit was more frequently observed in LDAA patients at 6 months (74% vs. 53%, p = 0.0003), 12 months (54% vs. 37%, p = 0.01) and in the long-term (median 36 months; 37% vs. 24%, p = 0.04). Throughout follow-up, AZAm patients were 60% more likely to fail therapy, due to a higher intolerance rate (45% vs. 26%, p = 0.001). Only 73% of the effective AZA dose was tolerated in AZAm patients, while LDAA could be initiated and maintained at its target dose. Incidence of myelotoxicity and elevated liver enzymes was similar in both cohorts, and both conditions led to LDAA withdrawal in only 2%. Increasing allopurinol from 100 to 200-300 mg/day significantly lowered liver enzymes in 5/6 LDAA patients with hepatotoxicity.\n\n\nCONCLUSIONS\nOur poor AZAm outcomes emphasize that optimization of azathioprine is needed. We demonstrated a long-term safe and more effective profile of first-line LDAA. This co-therapy may therefore be considered standard first-line immunosuppressive.",
"affiliations": "Faculty of Medicine, Amsterdam UMC, VU University Medical Centre, De Boelelaan 1118, 1081 HZ, Amsterdam, The Netherlands. elsa.vanliere@amsterdamumc.nl.;Faculty of Medicine, Amsterdam UMC, VU University Medical Centre, De Boelelaan 1118, 1081 HZ, Amsterdam, The Netherlands.;Department of Gastroenterology and Hepatology, AGEM Research Institute, Amsterdam UMC, VU University Medical Centre, 1081 HZ, Amsterdam, The Netherlands.;Department of Gastroenterology and Hepatology, Guy's and St Thomas' NHS Foundation Trust, London, SE1 7EH, UK.;IBD Service, King's College Hospital NHS Foundation Trust, London, SE5 9RS, UK.;IBD Service, King's College Hospital NHS Foundation Trust, London, SE5 9RS, UK.;Department of Gastroenterology and Hepatology, Surrey and Sussex NHS, Easy Surrey Hospital, Redhill, RH1 5RH, UK.;Department of Gastroenterology and Hepatology, AGEM Research Institute, Amsterdam UMC, VU University Medical Centre, 1081 HZ, Amsterdam, The Netherlands.;Department of Gastroenterology and Hepatology, Guy's and St Thomas' NHS Foundation Trust, London, SE1 7EH, UK.;Department of Gastroenterology and Hepatology, Surrey and Sussex NHS, Easy Surrey Hospital, Redhill, RH1 5RH, UK.",
"authors": "van Liere|Elsa L S A|ELSA|http://orcid.org/0000-0003-4826-3443;Bayoumy|Ahmed B|AB|;Mulder|Chris J J|CJJ|;Warner|Ben|B|;Hayee|Bu|B|;Mateen|Bilal A|BA|;Nolan|Jonathan D|JD|;de Boer|Nanne K H|NKH|;Anderson|Simon H C|SHC|;Ansari|Azhar R|AR|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1007/s10620-021-07273-y",
"fulltext": "\n==== Front\nDig Dis Sci\nDig Dis Sci\nDigestive Diseases and Sciences\n0163-2116\n1573-2568\nSpringer US New York\n\n34729677\n7273\n10.1007/s10620-021-07273-y\nOriginal Article\nAzathioprine with Allopurinol Is a Promising First-Line Therapy for Inflammatory Bowel Diseases\nhttp://orcid.org/0000-0003-4826-3443\nvan Liere Elsa L. S. A. elsa.vanliere@amsterdamumc.nl\n\n12\nBayoumy Ahmed B. a.b.bayoumy@amsterdamumc.nl\n\n1\nMulder Chris J. J. cjmulder@amsterdamumc.nl\n\n3\nWarner Ben b.warner@nhs.net\n\n4\nHayee Bu b.hayee@nhs.net\n\n5\nMateen Bilal A. bilal.mateen@nhs.net\n\n5\nNolan Jonathan D. jonathan.nolan2@nhs.net\n\n2\nde Boer Nanne K. H. khn.deboer@amsterdamumc.nl\n\n3\nAnderson Simon H. C. Simon.Anderson@gstt.nhs.uk\n\n4\nAnsari Azhar R. azharansari@nhs.net\n\n2\n1 grid.16872.3a 0000 0004 0435 165X Faculty of Medicine, Amsterdam UMC, VU University Medical Centre, De Boelelaan 1118, 1081 HZ Amsterdam, The Netherlands\n2 Department of Gastroenterology and Hepatology, Surrey and Sussex NHS, Easy Surrey Hospital, Redhill, RH1 5RH UK\n3 grid.16872.3a 0000 0004 0435 165X Department of Gastroenterology and Hepatology, AGEM Research Institute, Amsterdam UMC, VU University Medical Centre, 1081 HZ Amsterdam, The Netherlands\n4 grid.420545.2 0000 0004 0489 3985 Department of Gastroenterology and Hepatology, Guy’s and St Thomas’ NHS Foundation Trust, London, SE1 7EH UK\n5 grid.429705.d 0000 0004 0489 4320 IBD Service, King’s College Hospital NHS Foundation Trust, London, SE5 9RS UK\n2 11 2021\n2 11 2021\n2022\n67 8 40084019\n29 1 2021\n1 10 2021\n© The Author(s) 2021\nhttps://creativecommons.org/licenses/by-nc/4.0/ Open AccessThis article is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License, which permits any non-commercial use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc/4.0/.\nBackground\n\nBeneficial response to first-line immunosuppressive azathioprine in patients with inflammatory bowel disease (IBD) is low due to high rates of adverse events. Co-administrating allopurinol has been shown to improve tolerability. However, data on this co-therapy as first-line treatment are scarce.\n\nAim\n\nRetrospective comparison of long-term effectiveness and safety of first-line low-dose azathioprine-allopurinol co-therapy (LDAA) with first-line azathioprine monotherapy (AZAm) in patients with IBD without metabolite monitoring.\n\nMethods\n\nClinical benefit was defined as ongoing therapy without initiation of steroids, biologics or surgery. Secondary outcomes included CRP, HBI/SCCAI, steroid withdrawal and adverse events.\n\nResults\n\nIn total, 166 LDAA and 118 AZAm patients (median follow-up 25 and 27 months) were evaluated. Clinical benefit was more frequently observed in LDAA patients at 6 months (74% vs. 53%, p = 0.0003), 12 months (54% vs. 37%, p = 0.01) and in the long-term (median 36 months; 37% vs. 24%, p = 0.04). Throughout follow-up, AZAm patients were 60% more likely to fail therapy, due to a higher intolerance rate (45% vs. 26%, p = 0.001). Only 73% of the effective AZA dose was tolerated in AZAm patients, while LDAA could be initiated and maintained at its target dose. Incidence of myelotoxicity and elevated liver enzymes was similar in both cohorts, and both conditions led to LDAA withdrawal in only 2%. Increasing allopurinol from 100 to 200–300 mg/day significantly lowered liver enzymes in 5/6 LDAA patients with hepatotoxicity.\n\nConclusions\n\nOur poor AZAm outcomes emphasize that optimization of azathioprine is needed. We demonstrated a long-term safe and more effective profile of first-line LDAA. This co-therapy may therefore be considered standard first-line immunosuppressive.\n\nSupplementary Information\n\nThe online version contains supplementary material available at 10.1007/s10620-021-07273-y.\n\nKeywords\n\nAzathioprine\nAllopurinol\nThiopurines\nInflammatory bowel disease\nDrug repositioning\nissue-copyright-statement© Springer Science+Business Media, LLC, part of Springer Nature 2022\n==== Body\npmcIntroduction\n\nAzathioprine (AZA) is a cornerstone immunosuppressive therapy for patients with inflammatory bowel disease (IBD) [1, 2]. It improves important outcomes such as hospitalization, surgery, steroid use and colorectal cancer risk [3–7]. Moreover, AZA has been used for over 50 years in millions of patients worldwide and hence common as well as rare adverse events are well documented. As IBD most commonly affects patients during their reproductive years, the well-established safety of AZA during pregnancy and breastfeeding is an important advantage, as compared to newer biologics and small-molecule drugs [8–10].\n\nUnfortunately, AZA is limited by adverse events with the tolerated dose often being well below the effective dose [11, 12], resulting in 55% of patients discontinuing therapy within 5 years due to intolerance or ineffectiveness [13]. Consequently, a shift towards early therapy with biologics has occurred in those in more affluent countries. Whilst biologics can be transformative, they do have limitations: poor long-term effectiveness (related to antibody formation) [14]; parenteral administration, which affects quality of life [15]; infusion reactions (occasionally life-threatening) [16]; and high costs [17]. To address some of these concerns, new small-molecule drugs are being developed. However, the potential to optimize established small-molecule drugs like the thiopurines, and subsequently reduce the number of patients escalated to treatments like biologics, is often overlooked. Since thiopurines are affordable this strategy also reduces healthcare costs, which is particularly pertinent for developing countries and uninsured patients in higher-income countries [18].\n\nOne such optimization strategy for patients with IBD is to combine low-dose thiopurine with allopurinol, which was first described in 2005 [19]. Despite the fact that switching AZA monotherapy (AZAm) to low-dose AZA with allopurinol co-therapy (LDAA) improves tolerability and efficacy [19–26], LDAA remains underreported in current literature [27], not mentioned in most IBD guidelines [1, 2] and hence underutilized. Moreover, most studies restricted LDAA to patients both failing AZA (due to intolerance or inefficacy) and showing aberrant metabolism i.e. hypermethylation (production of toxic 6-MMPs at the expense of therapeutic 6-TGNs). Conversely, several studies have demonstrated a poor predictive value of metabolites with regard to clinical outcomes. For instance, 52% of the patients resistant [28] and up to 50% of the patients intolerant to AZAm [26, 29] were non-hypermethylators. Of those with high 6-MMP levels, nearly 90% did not show hepatotoxicity [29, 30]. Only using LDAA in patients showing hypermethylation thus excludes a large number of patients who could benefit from LDAA. Furthermore, this approach hinders LDAA use in less affluent institutions/countries without access to metabolite measurements.\n\nApart from being a valuable option for all patients with IBD who have failed AZAm, LDAA might be beneficial as first-line immunosuppressive therapy [24]. Using LDAA as first-line therapy in daily practice (rather than AZAm) could reduce delay in reaching an effective treatment, and could eliminate complex drug dosing and extra monitoring typically needed with AZAm (LDAA can be initiated and maintained at the target/effective dose in most patients). This would improve both patient and clinician experience.\n\nHence, we sought to evaluate the long-term effectiveness and safety of first-line LDAA therapy in a large IBD cohort undirected by 6-TGNs/6-MMPs, and to compare outcomes with a similar AZAm cohort.\n\nMethods\n\nStudy Design\n\nMedical records of a single centre (East Surrey Hospital, UK) were retrospectively reviewed. Subjects were identified by cross-referencing hospital pharmacy dispensing records from 01/2014 to 05/2019 with a prospective patient registry. Patients with Crohn’s disease, ulcerative colitis or IBD-unclassified and treated with either LDAA or AZAm as first thiopurine therapy, were included. Patients below 18 years, without complete follow-up or with commencement of therapy before 2014 (to avoid overlap with previously published data [24]) were excluded. Patients were followed until thiopurine discontinuation or therapy escalation, or May 2019.\n\nThroughout the study period, patients were allocated to either LDAA or AZAm based on patient’s preference and/or clinician’s experience/preference with regard to these treatments. AZAm patients were initiated on 50 mg/day, slowly increased to a target dose of 2.5 mg/kg/day or 1.25 mg/kg/day in case of wild-type or heterozygous TPMT activity, respectively. LDAA patients received a target dose from the beginning, i.e. 25% of the equivalent AZAm dose. Allopurinol was commenced at 100 mg/day.\n\nHematological, biochemical and inflammatory parameters were monitored every 2 weeks for the first 12 weeks and then every 3 months. 6-TGNs and 6-MMPs were not routinely measured.\n\nThis study was considered an audit of routine clinical practice, hence was qualified as being exempt from Research Ethical Committee review. The study was conducted in accordance with the Declaration of Helsinki.\n\nEffectiveness\n\nPrimary outcome was clinical benefit, which was defined as ongoing therapy without initiation of corticosteroids, biologics or bowel resection, and thus incorporated both efficacy and tolerability. Clinical benefit was assessed at 6 and 12 months. Moreover, sustained clinical benefit was assigned when the criterion was met during at least 12 months and maintained until final follow-up. Secondary outcomes included IBD activity scores, CRP and withdrawal of concomitant IBD medication.\n\nSafety\n\nAdverse events and reasons for withdrawal were recorded. Liver abnormalities were categorized into hepatotoxicity (ALT > twofold the upper limit of normal; > 82 U/L) and elevated liver enzymes without hepatotoxicity (ALT 41-82 U/L). Leukopenia was defined as leukocytes < 3.5 × 109/L and thrombocytopenia as platelets < 150 × 109/L.\n\nStatistics\n\nEffectiveness analyses were performed according to the per-protocol principle. Patients requiring steroids/biologics during the first three months were excluded from the effectiveness analysis, considering that AZA requires three months to become fully effective [31].\n\nChi-square and Mann–Whitney U tests were used to compare outcomes between groups. A Kaplan–Meier plot visualized survival characteristics (event: non-clinical benefit); the curves were compared using Mantel-Cox test and a Cox-regression yielded the hazard ratio.\n\nPatient characteristics associated with clinical benefit in the LDAA cohort based on a univariable Cox-regression (p < 0.20) were included in a multivariable model to identify independent associated factors. A univariate logistic regression examined possible correlations between intolerance to LDAA and gender, age, IBD-type, TPMT activity.\n\nStatistical analyses were performed using IBM SPSS Statistics version 25. A p-value < 0.05 was considered statistically significant.\n\nResults\n\nPatient and Therapy Characteristics\n\nIn total, 166 LDAA and 118 AZAm patients were included (Fig. 1), with a median follow-up of 25 and 27 months, respectively. Collected baseline characteristics were very similar in both cohorts (Table 1). Primary indication for thiopurines was ‘active disease’ (LDAA n = 149 [90%]; AZAm n = 109 [92%]). All patients were thiopurine-naïve and most patients were immunosuppressant-naïve (150 LDAA [90%] and 113 AZAm [97%]).Fig. 1 Flowchart showing the selection of the study population\n\nTable 1 Patient and disease characteristics, n (%) or median (IQR)\n\n\tLDAA patients (n = 166)\tAZAm patients (n = 118)\t\nFemale\t95 (57%)\t65 (55%)\t\nSmoking\t\nYes\t20 (12%)\t17 (14%)\t\nNo\t65 (39%)\t50 (42%)\t\nUnknown\t81 (49%)\t51 (43%)\t\nAge at initiation, y\t41 (29–55)\t35 (27–51)\t\nIBD duration at initiation, y\t1 (1–6)\t1 (0–3)\t\nCrohn’s disease\t93 (56%)\t63 (53%)\t\nAge at diagnosis, y\t\n< 17\t3 (3%)\t2 (3%)\t\n17–40\t53 (57%)\t42 (67%)\t\n> 40\t34 (37%)\t15 (23%)\t\nUnknown\t3 (3%)\t4 (6%)\t\nBehaviour\t\nInflammatory\t47 (50%)\t39 (62%)\t\nStricturing\t26 (28%)\t20 (32%)\t\nPenetrating\t10 (11%)\t2 (3%)\t\nUnknown\t10 (11%)\t2 (3%)\t\nPerianal disease\t12 (13%)\t8 (13%)\t\nLocation\t\nIleal\t33 (35%)\t30 (48%)\t\nColonic\t26 (28%)\t18 (29%)\t\nIleocolonic\t29 (31%)\t14 (22%)\t\nUnknown\t5 (5%)\t1 (2%)\t\nUlcerative colitis\t72 (43%)\t52 (44%)\t\nExtent\t\nProctitis\t9 (13%)\t4 (8%)\t\nLeft-sided\t30 (42%)\t25 (48%)\t\nPancolitis\t27 (38%)\t19 (37%)\t\nUnknown\t6 (8%)\t4 (8%)\t\nIBD unclassified\t1 (1%)\t3 (3%)\t\nBowel resection history\t15 (9%)\t10 (9%)\t\nPrior drug failure\t\nNone\t40 (24%)\t24 (21%)\t\nAminosalicylates\t119 (72%)\t93 (79%)\t\nMethotrexate\t2 (1%)\t0\t\nCalcineurin inhibitor\t9 (5%)\t4 (3%)\t\nAnti-tumour necrosis factor\t5 (3%)\t1 (1%)\t\nTPMT activity\t\nWild type rangea\t137 (87%)\t100 (90%)\t\nHeterozygous rangeb\t21 (13%)\t11 (9%)\t\nUnknown\t8 (5%)\t7 (6%)\t\nIndication for thiopurine therapy\t\nActive diseasec\t149 (90%)\t109 (92%)\t\nIntolerance to prior therapy\t3 (2%)\t3 (3%)\t\nOptimisation of biologics\t2 (1%)\t1 (1%)\t\nHigh risk profilec\t4 (2%)\t1 (1%)\t\nUnknown\t8 (5%)\t4 (3%)\t\nIBD activity scores at initiationd\t\nSCCAI\t6 (3–7)\t5 (3–6)\t\nHBI\t5 (3–8)\t7 (5–10)\t\nAzathioprine dose at final follow-up in mg/kg/day\t\nEntire cohort\t0.52 (0.43–0.58)\t1.75 (1.17–2.11)\t\nTPMT wild typea patients\t0.54 (0.47–0.59)\t1.83 (1.54–2.18)\t\nTPMT heterozygousb patients\t0.35 (0.30–0.43)\t0.93 (0.80–1.14)\t\nConcomitant IBD medication\t\nNone\t41 (25%)\t34 (29%)\t\nAminosalicylates\t83 (50%)\t61 (52%)\t\nCalcineurin inhibitor\t7 (4%)\t2 (2%)\t\nAnti-tumour necrosis factor\t14 (8%)\t3 (3%)\t\nSteroids ≥ 10 mg/day\t53 (32%)\t44 (37%)\t\nFollow-up time, m\t25 (13–43)\t27 (14–42)\t\nLDAA low-dose azathioprine with allopurinol, AZAm azathioprine monotherapy, IBD inflammatory bowel disease, SCCAI Simple Clinical Colitis Activity Index, HBI Harvey-Bradshaw Index, TPMT thiopurine s-methyltransferase\n\na68–150 mU/L\n\nb20–67 mU/L\n\ncIn accordance with international IBD guidelines[10]\n\ndDisease activity scores (SCCAI for ulcerative colitis or HBI for Crohn’s disease) at initiation were documented in the patients’ medical records in 85/166 (51%) LDAA and 63/118 (53%) AZAm patients\n\nOnly 14 (8%) LDAA and 3 (3%) AZAm patients used concurrent biologic. In most cases (11/14 LDAA and 2/3 AZAm patients) thiopurine and biologic therapy were commenced simultaneously because of a top-down therapeutic approach. In those with normal TPMT activity (~90%), median AZA dose was 0.54 mg/kg/day (LDAA) and 1.83 mg/kg/day (AZAm).\n\nEffectiveness\n\nClinical benefit rates are summarized in Figs. 2 and 3, and Table 2. Clinical benefit was more frequently observed in LDAA than AZAm patients at 6 months (116/156 [74%] vs. 59/111 [53%], p = 0.0003) and 12 months (74/138 [54%] vs. 38/103 [37%], p = 0.01). Furthermore, 51/138 (37%) LDAA compared to 25/103 (24%) AZAm subjects demonstrated sustained clinical benefit during a median of 36 (IQR 20–44) and 33 (IQR 22–44) months, respectively (p = 0.04).Fig. 2 Clinical benefit (CB) in patients receiving low-dose azathioprine with allopurinol (LDAA)\n\nFig. 3 Clinical benefit (CB) in patients receiving azathioprine monotherapy (AZAm)\n\nTable 2 Primary outcome: clinical benefit, n (%)\n\n\tLDAA patients\tAZAm patients\tp-value\t\nClinical benefit at 6 months\t116/156 (74%)\t59/111 (53%)\t0.0003\t\nClinical benefit at 12 months\t74/138 (54%)\t38/103 (37%)\t0.01\t\nClinical benefit in the long-term (≥ 12 months)\t51/138 (37%)\t25/103 (24%)\t0.04\t\n\nA Kaplan–Meier curve (Fig. 4) demonstrates that more LDAA than AZAm patients were having clinical benefit during the entire study period (p = 0.003). Throughout follow-up, AZAm individuals were 60% more likely to fail therapy (95%-CI 1.16–2.14). Moreover, median duration of beneficial response from commencement of therapy was 17 months in the LDAA cohort (95%-CI 9–25) compared to 6 months in the AZAm cohort (95%-CI 1–11).Fig. 4 Kaplan Meier survival curve of clinical benefit (CB) in patients treated with azathioprine monotherapy (AZAm) and low-dose azathioprine with allopurinol (LDAA). A statistical difference between the curves was found (p = 0.003)\n\nA multivariable analysis on the association between patient characteristics and clinical benefit in LDAA-treated patients (Table S1, Supplementary Material) demonstrated that stricturing Crohn’s disease was inversely correlated with clinical benefit (hazard ratio 2.09, 95%-CI 1.02–4.28). No difference in response to LDAA was found between Crohn’s disease and ulcerative colitis patients, nor between patients with and without concurrent biologic therapy.\n\nSecondary Outcomes\n\nSecondary outcomes are summarized in Table 3. Steroid withdrawal within 6 months occurred in approximately 90% of both cohorts. In the LDAA cohort, 65% (69/106) demonstrated clinical remission (SCCAI ≤ 2 or HBI ≤ 4) at last review, compared to 58% (45/78) in the AZAm (p = 0.31). Biochemical remission (CRP ≤ 10 mg/L) was observed in 93/158 (59%) and 59/94 (63%) of LDAA and AZAm patients, respectively (p = 0.54).Table 3 Secondary outcomes, n (%)\n\n\tLDAA patients\tAZAm patients\tp-value\t\nSteroid withdrawal within 6 months\t44/47 (94%)\t27/31 (87%)\t0.33\t\nCalcineurin inhibitor withdrawal\t4/6 (67%)\t0/2 (0%)\t0.10\t\nAnti-tumour necrosis factor withdrawala\t4/13 (31%)\t0/3 (0%)\t0.27\t\nSCCAI ≤ 2 at last review\t37/53 (70%)\t24/38 (63%)\t0.51\t\nHBI ≤ 4 at last review\t32/53 (60%)\t21/40 (53%)\t0.45\t\nCRP entire treatment duration:\t\n ≤ 10 mg/L\t93/158 (59%)\t59/94 (63%)\t0.54\t\n ≤ 5 mg/L\t65/158 (41%)\t40/94 (43%)\t0.83\t\nLDAA low-dose azathioprine with allopurinol, AZAm azathioprine monotherapy, SCCAI Simple Clinical Colitis Activity Index, HBI Harvey-Bradshaw Index, CRP C-reactive protein\n\nDisease activity scores (SCCAI for ulcerative colitis or HBI for Crohn’s disease) were documented in the patients’ medical records during follow-up in 106/166 (64%) LDAA and 78/118 (66%) AZAm patients; CRP values were available in 158 (95%) and 94 (80%) patients, respectively\n\nEight LDAA patients and 13 AZAm patients could not be assessed for rate of steroid, calcineurin inhibitor or anti-tumour necrosis factor withdrawal, due to insufficient documentation or cessation of thiopurine therapy within 6 months (only applicable for steroid withdrawal)\n\naBiologic therapy could be tapered off in 2/3 LDAA patients (but not in the single AZAm patient) using biologics prior to thiopurine initiation. Of the patients who commenced thiopurine and biologic therapy simultaneously because of a top-down therapeutic approach, 2/10 LDAA and 0/2 AZAm patients could discontinue biologic during follow-up\n\nAdverse Events\n\nSixty-eight of the 116 AZAm (58%) and 80/166 (48%) LDAA patients experienced adverse events during a median follow-up of 27 and 25 months, respectively (p = 0.12, Table 4). Adverse events were the main reason for discontinuing either LDAA or AZAm. However, a greater proportion of AZAm patients discontinued due to adverse events (AZAm: 53/118 [45%]; LDAA: 43/166 [26%]; p = 0.001). LDAA withdrawal due to intolerance did not depend on gender, age, IBD-type or TPMT level.Table 4 Adverse events, n (% of entire cohort)\n\n\tLDAA patients (n = 166)\tAZAm patients (n = 118)\tp-value\t\nPatients discontinuing treatment due to adverse events\t43 (26%)\t53 (45%)\t0.001\t\nHepatotoxicity\t2 (1%)\t3 (3%)\t0.40\t\nElevated LFTs without hepatotoxicity\t1 (0.6%)\t2 (2%)\t0.37\t\nMyelotoxicity\t3 (2%)\t5 (4%)\t0.22\t\n Leukopenia\t2 (1%)\t3 (3%)\t–\t\n Thrombocytopenia\t1 (0.6%)\t1 (0.8%)\t–\t\n Leukopenia and thrombocytopenia\t0\t1 (0.8%)\t–\t\nGastro-intestinal complaints\t22 (13%)\t22 (19%)\t0.22\t\nFatigue\t8 (5%)\t6 (5%)\t0.92\t\nDizziness\t6 (4%)\t5 (4%)\t0.79\t\nArthralgia\t5 (3%)\t3 (3%)\t0.81\t\nAlopecia\t3 (2%)\t0\t0.14\t\nPancreatitis\t3 (2%)\t4 (3%)\t0.40\t\nMalaise\t2 (1%)\t4 (3%)\t0.21\t\nHeadache\t2 (1%)\t6 (5%)\t0.05\t\nRash\t0\t4 (3%)\t0.02\t\nSerious infection\t1 (0.6%)\t1 (0.8%)\t0.81\t\nMalignancy\t0\t0\t–\t\nUnknown\t2 (1%)\t2 (2%)\t–\t\nOther\t5 (3%)\t11 (9%)\t–\t\nPatients experiencing adverse events\t80 (48%)\t68 (58%)\t0.12\t\nHepatotoxicity\t11 (7%)\t8 (7%)\t0.96\t\nElevated LFTs without hepatotoxicity\t13 (8%)\t10 (8%)\t0.84\t\nMyelotoxicity\t18 (11%)\t11 (9%)\t0.17\t\n Leukopenia\t9 (5%)\t7 (6%)\t–\t\n Thrombocytopenia\t6 (4%)\t1 (0.9%)\t–\t\n Leukopenia and thrombocytopenia\t3 (2%)\t3 (3%)\t–\t\nGastro-intestinal complaints\t24 (15%)\t24 (20%)\t0.19\t\nFatigue\t12 (7%)\t7 (6%)\t0.67\t\nDizziness\t6 (4%)\t6 (5%)\t0.54\t\nArthralgia\t5 (3%)\t4 (3%)\t0.86\t\nAlopecia\t3 (2%)\t0\t0.14\t\nPancreatitis\t3 (2%)\t4 (3%)\t0.40\t\nMalaise\t3 (2%)\t5 (4%)\t0.22\t\nHeadache\t5 (3%)\t6 (5%)\t0.37\t\nRash\t0\t4 (3%)\t0.02\t\nSerious infection\t1 (0.6%)a\t1 (0.9%)b\t0.81\t\nMalignancy\t0\t0\t–\t\nUnknown\t3 (2%)\t2 (2%)\t–\t\nOther\t7 (4%)\t12 (10%)\t–\t\nLDAA low-dose azathioprine with allopurinol, AZAm azathioprine monotherapy, LFTs liver function tests\n\naRespiratory tract infection\n\nbCMV reactivation\n\nNo malignancies were reported in either cohort and the incidence of pancreatitis was low.\n\nLiver Enzyme Abnormalities\n\nLiver enzyme abnormalities occurred equally in both cohorts: 11 (7%) patients reported hepatotoxicity and 13 (8%) elevated liver function tests (LFTs) without hepatotoxicity in the LDAA cohort, compared to 8 (7%) and 10 (8%) AZAm patients, respectively. Upon more detailed review of LDAA patients, 4/11 reporting hepatotoxicity and 5/13 reporting elevated LFTs without hepatotoxicity had liver disease prior to LDAA initiation (fatty liver n = 7; focal nodular hyperplasia n = 1; primary sclerosing cholangitis n = 1). In contrast, 1/18 AZAm patients with liver enzyme abnormalities had prior liver disease (fatty liver).\n\nHepatotoxicity led to LDAA discontinuation in two (1%) patients as did elevated LFTs without hepatotoxicity in one patient (0.6%). In six other patients with hepatotoxicity, allopurinol dose was increased to 200–300 mg/day. Consequently, the abnormal LFTs resolved in 4/6, improved in 1/6 and persisted in the remaining patient (who had primary sclerosing cholangitis). All six patients continued LDAA until final follow-up and did not experience further side effects on the escalated allopurinol dose.\n\nAZAm was discontinued due to hepatotoxicity and elevated LFTs without hepatotoxicity in three (3%) and two (2%) patients, respectively.\n\nMyelotoxicity\n\nIncidence of myelotoxicity was similar in both cohorts (LDAA: 18/166 [11%]; AZAm: 11/118 [9%], p = 0.17). One patient in each cohort required hospital admission related to myelotoxicity (LDAA: respiratory tract infection, AZAm: CMV reactivation).\n\nRegarding the LDAA cohort, 2/21 (10%) with heterozygous TPMT activity developed myelotoxicity, whereas 16/137 (12%) patients with wild-type TPMT (p = 0.77). Additionally, myelotoxicity was not related to gender, age or IBD-type.\n\nUpon minor AZA dose reduction in 5/12 LDAA patients with leukopenia, leukocyte count normalized in three patients. All three were able to continue therapy until final follow-up, without loss of response. Myelotoxicity resulted in permanent LDAA withdrawal in 3/166 (2%) patients.\n\nNone of the AZAm patients had a dose reduction after myelotoxicity was detected and 5/118 (4%) permanently discontinued AZAm due to myelotoxicity.\n\nDiscussion\n\nThis is the largest study with the longest follow-up evaluating first-line LDAA for IBD to date, and the first study comparing safety and effectiveness of LDAA (n = 166) with AZAm (n = 118) in two very similar cohorts. Ongoing therapy without need for steroids, biologics or surgery was more frequently observed in LDAA compared to AZAm patients at 6 months (74% vs. 53%), 12 months (54% vs. 37%) and in the long-term (median 36 months, 37% vs. 24%). Throughout follow-up, AZAm patients were 60% more likely to fail therapy, due to a higher intolerance rate (45% vs. 26%).\n\nDirect comparison of our results with others is challenging since most studies have evaluated either effectiveness or tolerability of thiopurines, whereas our primary outcome assessed both elements. Nevertheless, high success rates have been reported for low-dose thiopurine with allopurinol therapy, but not for AZAm (see next paragraphs).\n\nTwo well-known randomized, double-blind trials evaluated the efficacy of 2.5 mg/kg/day AZAm: steroid-free remission was seen in 30% (51/170) of Crohn’s patients at 6 months [32] and 24% (18/76) of ulcerative colitis patients at 4 months [33]. The lower response rates compared to our study are likely due to the fact that endpoints of a randomized trial are more difficult to achieve, and that intention-to-treat analysis was used (while we used per-protocol analysis). Recently, long-term effective thiopurine monotherapy was observed in 4995/11928 (42%) subjects, but analysis did not include initiation of steroids [6].\n\nThe high incidence of intolerance to AZAm in our study is in keeping with other studies, in which 30–40% of patients withdrew AZAm due to adverse events [11, 12, 34, 35]. Additionally, it is worth noting in these studies that tolerability came at the expense of a sub-therapeutic AZA dose. In our study inability to tolerate an effective AZAm dose (i.e. 2.5 mg/kg/day for patients with normal TPMT activity [36]) was also observed: only a median dose of 1.83 mg/kg/day was achieved, which is 73% of the effective dose. Conversely, LDAA could be initiated and maintained at the target dose in most patients, with a better response rate. Hence, using LDAA as first-line therapy in clinical practice (instead of AZAm) would likely reduce periods of active disease, improve patient experience and eliminate the time and costs associated with managing poor treatment effectiveness and intolerance.\n\nIn a previous study, positive response to low-dose thiopurine with allopurinol (AZA in > 50% of patients, mercaptopurine in the rest) at 12 months was seen in 62% of patients failing thiopurine monotherapy and/or showing hypermethylation [25]. Another study showed thiopurine-allopurinol continuation in 78% (n = 145) and 66% (n = 83) of patients at 12 months and 2 years, respectively [37]. The possible explanation for the greater effectiveness in their study might be a twofold lower incidence of patients with active disease at initiation, and that initiation of steroids, biologics or surgery was not considered treatment failure. In a recent randomized trial, 73% of patients on thiopurine and allopurinol (AZA in 50%) were in steroid-free remission at 6 months according to per-protocol analysis [20]. Lastly, another study showed clinical benefit during at least 12 months in 38% of the optimized thiopurine cohort (co-administration of allopurinol in 40%) [23]. The results of these studies are in line with our outcomes.\n\nTo date, effectiveness of thiopurine-allopurinol co-therapy in thiopurine-naive patients has only been assessed by our study group [24]. An improvement in IBD activity scores in the absence of steroid use was observed in 79/110 (72%) patients after a median treatment duration of 12 months [24].\n\nOur study has limitations which need to be acknowledged. First, allocation to LDAA or AZAm was not randomized. However, collected baseline characteristics in both cohorts were very similar. Another limitation is the retrospective design, which could have led to information bias. The influence of this was minimized by comparing two treatment groups, with a single researcher collecting all of the data. A further limitation concerns sampling bias, as the cohorts were restricted to patients in a single centre. Finally, we were not able to comment on mucosal response or draw firm conclusions regarding CRP level and IBD activity scores due to incomplete data.\n\nAlthough myelotoxicity is a common concern during LDAA therapy, only 12 (7%) LDAA patients developed leukopenia during a median follow-up of 25 months. This incidence is comparable to our AZAm cohort, to other thiopurine monotherapy studies [12, 38], and also to two large studies using low doses of AZA during co-therapy [26, 37]. The lack of correlation between myelotoxicity and heterozygous TPMT activity in our study can be explained by dose adjustment for weight and TPMT activity.\n\nElevated LFTs occurred in 14% (24/166) of LDAA and 15% (18/118) of AZAm patients during our study, of which 7% of both cohorts had hepatotoxicity. Nine of twenty-four patients with elevated LFTs in the LDAA cohort had a pre-existing liver disorder, which is the likely explanation in these patients. In contrast, the liver injury in the AZAm patients was more likely to be drug-induced as only one patient had a pre-existing liver condition. Previous studies described hepatotoxicity in 5% of LDAA patients [24] and de-novo elevated LFTs in 14% [37], which is in line with our results. Interestingly, we showed that increasing the allopurinol dose can be a beneficial strategy to treat hepatotoxicity. On increasing allopurinol to 200–300 mg/day, LFTs fell significantly in 5/6 patients and stabilized in a patient with primary sclerosing cholangitis. These findings are in concordance with our previous study, in which an escalated allopurinol dose of 300 mg/day led to normalization of LFTs in 8/11 patients, with the remaining three patients having primary sclerosing cholangitis [24]. The biochemical mechanism for this phenomenon may be that allopurinol reduces methylated metabolites and reactive oxidative free radicals, both of which are thought to be hepatotoxic [19, 29, 39].\n\nAlthough myelotoxicity and elevated LFTs were relatively common in our study, they only resulted in LDAA withdrawal in 2% for either abnormality. Recently, Kreijne et al. reported the same phenomenon in a cohort of 221 patients: myelotoxicity and elevated LFTs led to LDAA cessation in only 4% and 1%, respectively [37].\n\nIn conclusion, this large study demonstrates that optimization of AZA is needed, as poor outcomes were observed in our AZAm cohort. We have shown that first-line co-administration of allopurinol is a long-term effective and safe optimization strategy, even without metabolite monitoring. Although patients may still experience mild laboratory abnormality, we confirmed that myelotoxicity and elevated liver enzymes rarely necessitate LDAA withdrawal if closely monitored and adequately treated. Using LDAA as first-line therapy for IBD (rather than AZAm) would likely reduce periods of active disease, improve patient experience and reduce the number of patients escalated to more expensive treatments like biologics. Hence, LDAA may be considered as standard first-line immunosuppressive.\n\nSupplementary Information\n\nBelow is the link to the electronic supplementary material.Supplementary file1 (DOCX 19 KB)\n\nFunding\n\nThis study was not funded.\n\nDeclarations\n\nConflict of interest\n\nELSA van Liere and AB Bayoumy received unrestricted travel grants from Thimotheus Consult. CJJ Mulder has served as consultant for HLW Pharma BV, Douglas Pharma, Arega and TEVA Pharma BV. NKH de Boer has served as consultant and principal investigator for TEVA Pharma BV and Takeda. He has served as a speaker for AbbVie and MSD and has received unrestricted research grants from Dr. Falk, TEVA Pharma BV and Takeda. AR Ansari has served as consultant and speaker for Dr. Falk. He has received unrestricted research grants from Janssen Cilag and MSD. SHC Anderson, B Warner, B Hayee, BA Mateen and JD Nolan declare that they have no conflict of interest.\n\nPublisher's Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Harbord M Third European evidence-based consensus on diagnosis and management of ulcerative colitis: Part 2: current management J Crohn's Colitis. 2017 11 769 784 10.1093/ecco-jcc/jjx009 28513805\n2. Torres J ECCO guidelines on therapeutics in Crohn's disease: Medical treatment J Crohns Colitis. 2020 14 4 22 10.1093/ecco-jcc/jjz180 31711158\n3. Camus M Long-term outcome of patients with Crohn's disease who respond to azathioprine Clin Gastroenterol Hepatol. 2013 11 389 394 10.1016/j.cgh.2012.10.038 23142207\n4. Chatu S The role of thiopurines in reducing the need for surgical resection in Crohn's disease: a systematic review and meta-analysis Am J Gastroenterol. 2014 109 23 34 10.1038/ajg.2013.402 24322839\n5. Ramadas AV Natural history of Crohn's disease in a population-based cohort from Cardiff (1986–2003): a study of changes in medical treatment and surgical resection rates Gut. 2010 59 1200 1206 10.1136/gut.2009.202101 20650924\n6. Stournaras E Thiopurine monotherapy is effective in ulcerative colitis but significantly less so in Crohn's disease: long-term outcomes for 11 928 patients in the UK inflammatory bowel disease bioresource Gut. 2021 70 677 686 10.1136/gutjnl-2019-320185 33004550\n7. Zhu Z Reduced risk of inflammatory bowel disease-associated colorectal neoplasia with use of thiopurines: a systematic review and meta-analysis J Crohns Colitis. 2018 12 546 558 10.1093/ecco-jcc/jjy006 29370346\n8. Christensen LA Azathioprine treatment during lactation Aliment Pharmacol Ther. 2008 28 1209 1213 10.1111/j.1365-2036.2008.03843.x 18761704\n9. Coelho J Pregnancy outcome in patients with inflammatory bowel disease treated with thiopurines: cohort from the CESAME Study Gut. 2011 60 198 203 10.1136/gut.2010.222893 21115547\n10. Lamb CA British Society of Gastroenterology consensus guidelines on the management of inflammatory bowel disease in adults Gut. 2019 68 s1 s106 10.1136/gutjnl-2019-318484 31562236\n11. Ansari A Prospective evaluation of the pharmacogenetics of azathioprine in the treatment of inflammatory bowel disease Aliment Pharmacol Ther. 2008 28 973 983 10.1111/j.1365-2036.2008.03788.x 18616518\n12. Sood R Long-term efficacy and safety of azathioprine in ulcerative colitis J Crohns Colitis. 2015 9 191 197 10.1093/ecco-jcc/jju010 25518053\n13. Jharap B Thiopurine therapy in inflammatory bowel disease patients: analyses of two 8-year intercept cohorts Inflamm Bowel Dis. 2010 16 1541 1549 10.1002/ibd.21221 20155846\n14. Mazor Y Adalimumab drug and antibody levels as predictors of clinical and laboratory response in patients with Crohn's disease Aliment Pharmacol Ther. 2014 40 620 628 10.1111/apt.12869 25039584\n15. Buisson A The extra burden of infliximab infusions in inflammatory bowel disease Inflamm Bowel Dis. 2013 19 2464 2467 10.1097/MIB.0b013e3182a19268 23942563\n16. Lichtenstein L Infliximab-related infusion reactions: systematic review J Crohns Colitis. 2015 9 806 815 10.1093/ecco-jcc/jjv096 26092578\n17. van der Valk ME Healthcare costs of inflammatory bowel disease have shifted from hospitalisation and surgery towards anti-TNFalpha therapy: results from the COIN study Gut. 2014 63 72 79 10.1136/gutjnl-2012-303376 23135759\n18. Bayoumy AB de Boer NKH Mulder CJJ Management of Crohn disease JAMA. 2021 325 1793 1794 10.1001/jama.2021.2918\n19. Sparrow MP Allopurinol safely and effectively optimizes tioguanine metabolites in inflammatory bowel disease patients not responding to azathioprine and mercaptopurine Aliment Pharmacol Ther. 2005 22 441 446 10.1111/j.1365-2036.2005.02583.x 16128682\n20. Friedman AB Randomised clinical trial: efficacy, safety and dosage of adjunctive allopurinol in azathioprine/mercaptopurine nonresponders (AAA Study) Aliment Pharmacol Ther. 2018 47 1092 1102 10.1111/apt.14571 29468701\n21. Hoentjen F Safety and effectiveness of long-term allopurinol-thiopurine maintenance treatment in inflammatory bowel disease Inflamm Bowel Dis. 2013 19 363 369 10.1002/ibd.23021 22605661\n22. Leung Y Long term efficacy and safety of allopurinol and azathioprine or 6-mercaptopurine in patients with inflammatory bowel disease J Crohns Colitis. 2009 3 162 167 10.1016/j.crohns.2009.02.003 21172265\n23. Meijer B Optimizing thiopurine therapy in inflammatory bowel disease among 2 real-life intercept cohorts: Effect of allopurinol comedication? Inflamm Bowel Dis. 2017 23 2011 2017 10.1097/MIB.0000000000001168 28617756\n24. Pavlidis P Long-term safety and efficacy of low-dose azathioprine and allopurinol cotherapy in inflammatory bowel disease: a large observational study Inflamm Bowel Dis. 2016 22 1639 1646 10.1097/MIB.0000000000000827 27271488\n25. Smith MA Optimising outcome on thiopurines in inflammatory bowel disease by co-prescription of allopurinol J Crohns Colitis. 2012 6 905 912 10.1016/j.crohns.2012.02.007 22386736\n26. Vasudevan A Low-dose thiopurine with allopurinol co-therapy overcomes thiopurine intolerance and allows thiopurine continuation in inflammatory bowel disease Dig Liver Dis. 2018 50 682 688 10.1016/j.dld.2018.02.001 29525182\n27. Cushing K Higgins PDR Management of Crohn disease: a review JAMA. 2021 325 69 80 10.1001/jama.2020.18936 33399844\n28. Haines ML Clinical usefulness of therapeutic drug monitoring of thiopurines in patients with inadequately controlled inflammatory bowel disease Inflamm Bowel Dis. 2011 17 1301 1307 10.1002/ibd.21458 20812329\n29. Shaye OA Hepatotoxicity of 6-mercaptopurine (6-MP) and Azathioprine (AZA) in adult IBD patients Am J Gastroenterol. 2007 102 2488 2494 10.1111/j.1572-0241.2007.01515.x 17764490\n30. Reinshagen M 6-Thioguanine nucleotide-adapted azathioprine therapy does not lead to higher remission rates than standard therapy in chronic active crohn disease: results from a randomized, controlled, open trial Clin Chem. 2007 53 1306 1314 10.1373/clinchem.2007.086215 17495015\n31. Chande N Azathioprine or 6-mercaptopurine for induction of remission in Crohn's disease Cochrane Database Syst Rev. 2016 10 CD000545 27783843\n32. Colombel JF Infliximab, azathioprine, or combination therapy for Crohn's disease N Engl J Med. 2010 362 1383 1395 10.1056/NEJMoa0904492 20393175\n33. Panaccione R Combination therapy with infliximab and azathioprine is superior to monotherapy with either agent in ulcerative colitis Gastroenterology. 2014 146 392 400 e3 10.1053/j.gastro.2013.10.052 24512909\n34. Hindorf U Adverse events leading to modification of therapy in a large cohort of patients with inflammatory bowel disease Aliment Pharmacol Ther. 2006 24 331 342 10.1111/j.1365-2036.2006.02977.x 16842460\n35. Verstockt B Thiopurine monotherapy has a limited place in treatment of patients with mild-to-moderate Crohn's disease Gut. 2020 70 1416 1418 10.1136/gutjnl-2020-322646 32928916\n36. Prefontaine E Azathioprine or 6-mercaptopurine for maintenance of remission in Crohn's disease Cochrane Database Syst Rev. 2009 1 CD000067\n37. Kreijne JE Real-life study of safety of thiopurine-allopurinol combination therapy in inflammatory bowel disease: myelotoxicity and hepatotoxicity rarely affect maintenance treatment Aliment Pharmacol Ther. 2019 50 407 415 10.1111/apt.15402 31359480\n38. Teml A Thiopurine treatment in inflammatory bowel disease: clinical pharmacology and implication of pharmacogenetically guided dosing Clin Pharmacokinet. 2007 46 187 208 10.2165/00003088-200746030-00001 17328579\n39. Duley JA Florin TH Thiopurine therapies: problems, complexities, and progress with monitoring thioguanine nucleotides Ther Drug Monit. 2005 27 647 654 10.1097/01.ftd.0000169061.52715.3e 16175140\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "0163-2116",
"issue": null,
"journal": "Digestive diseases and sciences",
"keywords": "Allopurinol; Azathioprine; Drug repositioning; Inflammatory bowel disease; Thiopurines",
"medline_ta": "Dig Dis Sci",
"mesh_terms": null,
"nlm_unique_id": "7902782",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34729677",
"pubdate": "2021-11-02",
"publication_types": "D016428:Journal Article",
"references": "27783843",
"title": "Azathioprine with Allopurinol Is a Promising First-Line Therapy for Inflammatory Bowel Diseases.",
"title_normalized": "azathioprine with allopurinol is a promising first line therapy for inflammatory bowel diseases"
} | [
{
"companynumb": "NL-NOVARTISPH-NVSC2021NL253395",
"fulfillexpeditecriteria": "1",
"occurcountry": "NL",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ALLOPURINOL"
},
"drugadditional": "3",
... |
{
"abstract": "OBJECTIVE\nTo evaluate 2-year follow-up results of patients with macular oedema (ME) caused by central (CRVO) and branch (BRVO) retinal vein occlusion treated with intravitreal ranibizumab at the Department of Ophthalmology, First Faculty of Medicine, Charles University and General University Hospital in Prague, Czech Republic.\n\n\nMETHODS\nRetrospective study.\n\n\nRESULTS\nThe 2-year follow-up was completed by 18 patients with ME caused by CRVO and 16 patients with ME caused by BRVO. In CRVO group mean age at diagnosis was 63 years, mean interval from diagnosis to the beginning of treatment was 3,6 months. During the first year of treatment the mean improvement of best corrected visual acuity (BCVA) was 17,4 letters of Early Treatment Diabetic Retinopathy Study (ETDRS) optotype, during the second year +2,4 letters. Mean number of injections was 6,8 in the first and 3,6 in the second year of treatment, mean total of 10,2 injections. In BRVO group the mean age at diagnosis was 68 years, mean interval from diagnosis to the beginning of treatment 6 month, mean gain in BCVA was +18,7 letters in the first and +1 letters in the second year of treatment, mean number of injections was 7 and 3,2 respectively, mean total of 9,6 injections. In both groups neither ocular nor systemic serious adverse effects were noted.\n\n\nCONCLUSIONS\nAccording to our results intravitreal ranibizumab is a safe and effective treatment for ME caused by retinal vein occlusion. Our results in BRVO group were in accordance with published international studies - BRAVO (BRVO) +18,3 letters, HORIZON -0,7 and even slightly better in CRVO group - CRUISE (CRVO) +13,9 letters, HORIZON study -4,1 lettersKey words: macular oedema, ranibizumab, retinal vein occlusion, central retinal vein occlusion, branch retinal vein occlusion, 2-year follow-up.",
"affiliations": null,
"authors": "Hladíková|Z|Z|;Klofáčová|E|E|;Kalvodová|B|B|",
"chemical_list": "D020533:Angiogenesis Inhibitors; D042461:Vascular Endothelial Growth Factor A; D000069579:Ranibizumab",
"country": "Czech Republic",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1211-9059",
"issue": "73(2)",
"journal": "Ceska a slovenska oftalmologie : casopis Ceske oftalmologicke spolecnosti a Slovenske oftalmologicke spolecnosti",
"keywords": null,
"medline_ta": "Cesk Slov Oftalmol",
"mesh_terms": "D000368:Aged; D020533:Angiogenesis Inhibitors; D005500:Follow-Up Studies; D006801:Humans; D058449:Intravitreal Injections; D008269:Macular Edema; D008875:Middle Aged; D000069579:Ranibizumab; D012170:Retinal Vein Occlusion; D012189:Retrospective Studies; D041623:Tomography, Optical Coherence; D016896:Treatment Outcome; D042461:Vascular Endothelial Growth Factor A; D014792:Visual Acuity",
"nlm_unique_id": "9600515",
"other_id": null,
"pages": "43-51",
"pmc": null,
"pmid": "28931295",
"pubdate": "2017",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Two-Year Follow-up Results of Patients with Macular Oedema Due to Retinal Vein Occlusion Treated with Ranibizumab.",
"title_normalized": "two year follow up results of patients with macular oedema due to retinal vein occlusion treated with ranibizumab"
} | [
{
"companynumb": "CZ-ROCHE-1989701",
"fulfillexpeditecriteria": "1",
"occurcountry": "CZ",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RANIBIZUMAB"
},
"drugadditional": "3",
"drug... |
{
"abstract": "BACKGROUND\nCytomegalovirus (CMV) infection causes morbidity and mortality in solid-organ transplant recipients. Drug-resistant CMV is an emerging problem with poor survival outcomes and limited therapeutic options. In this study we comprehensively address the issue of drug resistance in CMV when compared with standard therapies, such as ganciclovir (GCV) and foscarnet.\n\n\nMETHODS\nWe conducted a retrospective review of adult patients diagnosed with CMV after solid-organ transplant at our center between 2013 and 2017, and identified 7 resistant CMV cases. To study risk factors in the published literature, we performed an extensive database search.\n\n\nRESULTS\nAll patients had documented UL97 mutations, and 3 patients harbored both UL97 and UL54 mutations. For cases with increasing viral load or failure to achieve clinical improvement despite optimal therapy, genetic resistance testing was carried out. Patients received GCV and foscarnet combination therapy. As an adjunct, CMV immunoglobulin, cidofovir, and leflunomide were added. Risk factors, including donor+/recipient- serostatus, persistent high viral replication, prolonged therapeutic GCV exposure (>2.5 months), and allograft rejection, were assessed.\n\n\nCONCLUSIONS\nPatients at risk, especially those with D+/R- serostatus, should be judiciously monitored for resistance. Prolonged intravenous GCV exposure increases the risk for development of drug resistance. Therefore, precise guidelines are required for prevention of long-term GCV/VGCV exposure. Investigation regarding interferon-gamma release assay and adoptive transfer of T cells in diagnosed CMV patients is warranted to improve future prophylactic and management strategies against CMV, with a potential to reduce the requirement for available toxic antiviral drugs.",
"affiliations": "Division of Infectious Diseases, Department of Medicine, University of Arizona, Tucson, Arizona. Electronic address: amajeed@deptofmed.arizona.edu.;Department of Medicine, University of Arizona, Tucson, Arizona.;Department of Medicine, University of Arizona, Tucson, Arizona.;Department of Medicine, University of Arizona, Tucson, Arizona.;Division of Infectious Diseases, Department of Medicine, University of Arizona, Tucson, Arizona.;Division of Infectious Diseases, Department of Medicine, University of Arizona, Tucson, Arizona.;Division of Infectious Diseases, Department of Medicine, University of Arizona, Tucson, Arizona.",
"authors": "Majeed|A|A|;Latif|A|A|;Kapoor|V|V|;Sohail|A|A|;Florita|C|C|;Georgescu|A|A|;Zangeneh|T|T|",
"chemical_list": "D000998:Antiviral Agents; D017245:Foscarnet; D000077339:Leflunomide; D000077404:Cidofovir; D015774:Ganciclovir",
"country": "United States",
"delete": false,
"doi": "10.1016/j.transproceed.2018.02.091",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-1345",
"issue": "50(10)",
"journal": "Transplantation proceedings",
"keywords": null,
"medline_ta": "Transplant Proc",
"mesh_terms": "D000328:Adult; D000368:Aged; D000998:Antiviral Agents; D000077404:Cidofovir; D003587:Cytomegalovirus; D003586:Cytomegalovirus Infections; D024882:Drug Resistance, Viral; D004359:Drug Therapy, Combination; D005260:Female; D017245:Foscarnet; D015774:Ganciclovir; D006801:Humans; D000077339:Leflunomide; D008297:Male; D008875:Middle Aged; D009154:Mutation; D016377:Organ Transplantation; D011183:Postoperative Complications; D012189:Retrospective Studies; D012307:Risk Factors; D019562:Viral Load; D014779:Virus Replication",
"nlm_unique_id": "0243532",
"other_id": null,
"pages": "3756-3762",
"pmc": null,
"pmid": "30586840",
"pubdate": "2018-12",
"publication_types": "D016428:Journal Article; D016454:Review",
"references": null,
"title": "Resistant Cytomegalovirus Infection in Solid-organ Transplantation: Single-center Experience, Literature Review of Risk Factors, and Proposed Preventive Strategies.",
"title_normalized": "resistant cytomegalovirus infection in solid organ transplantation single center experience literature review of risk factors and proposed preventive strategies"
} | [
{
"companynumb": "US-TEVA-2019-US-1007600",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "3",
... |
{
"abstract": "Ocular adnexal lymphoma and intraocular lymphoma, whether occurring simultaneously or sequentially, are often similar to associated systemic lymphoma. We describe 4 cases of ocular adnexal lymphoma or intraocular lymphoma with a dissimilar systemic lymphoma. Two of the cases represent Richter transformation of chronic lymphocytic leukemia/small-cell lymphoma into diffuse large B-cell lymphoma. In the third patient, conjunctival extranodal marginal zone lymphoma developed following treatment for Hodgkin lymphoma. The fourth patient had a remote history of systemic diffuse large B-cell lymphoma with a subsequent diagnosis of orbital extranodal marginal zone lymphoma. Clinical-pathological correlation is reported for all cases in addition to pertinent review of the literature.",
"affiliations": "Allure Facial Laser Center and Medispa, Kirkland, Washington, USA; Department of Ophthalmology, University of Washington, Seattle, Washington, USA.;Department of Ophthalmology, Cole Eye Institute, Cleveland Clinic, Cleveland, Ohio, USA.;Department of Ophthalmology, Cole Eye Institute, Cleveland Clinic, Cleveland, Ohio, USA.;Allure Facial Laser Center and Medispa, Kirkland, Washington, USA; Department of Ophthalmology, University of Washington, Seattle, Washington, USA.;Department of Pathology, Overlake Medical Center, Bellevue, Washington, USA.;Pathology and Laboratory Medicine, Cleveland Clinic, Cleveland, Ohio, USA.;Pathology and Laboratory Medicine, Cleveland Clinic, Cleveland, Ohio, USA.;Department of Ophthalmology, Cole Eye Institute, Cleveland Clinic, Cleveland, Ohio, USA. Electronic address: singha@ccf.org.",
"authors": "Rubinstein|Tal J|TJ|;Aziz|Hassan A|HA|;Bellerive|Claudine|C|;Sires|Bryan S|BS|;Hing|Andrew W|AW|;Habermehl|Gabriel|G|;Hsi|Eric|E|;Singh|Arun D|AD|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.survophthal.2017.08.005",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0039-6257",
"issue": "63(3)",
"journal": "Survey of ophthalmology",
"keywords": "chronic lymphocytic leukemia; diffuse large B-cell lymphoma; extranodal marginal zone lymphoma; intraocular lymphoma; non-Hodgkin's lymphoma; ocular adnexal lymphoma; small cell lymphoma",
"medline_ta": "Surv Ophthalmol",
"mesh_terms": "D000368:Aged; D003230:Conjunctival Neoplasms; D005134:Eye Neoplasms; D005260:Female; D006801:Humans; D015448:Leukemia, B-Cell; D015451:Leukemia, Lymphocytic, Chronic, B-Cell; D018442:Lymphoma, B-Cell, Marginal Zone; D016403:Lymphoma, Large B-Cell, Diffuse; D008297:Male; D008875:Middle Aged; D009918:Orbital Neoplasms",
"nlm_unique_id": "0404551",
"other_id": null,
"pages": "381-388",
"pmc": null,
"pmid": "28837797",
"pubdate": "2018",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Ocular/adnexal lymphoma: dissimilar to systemic lymphoma.",
"title_normalized": "ocular adnexal lymphoma dissimilar to systemic lymphoma"
} | [
{
"companynumb": "US-BAYER-2018-104439",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DACARBAZINE"
},
"drugadditional": null,
... |
{
"abstract": "•We report a case of PRES in conjunction with high grade serous ovarian carcinoma•There is a documented association between chemotherapy agents and PRES•Paraneoplastic panel was positive for voltage-gated potassium channel antibodies•Paraneoplastic workup may be justified in cases with high suspicion of PRES.",
"affiliations": "Department of Obstetrics and Gynecology, Division of Gynecology Oncology, University of Cincinnati, 231 Albert Sabin Way, Academic Health Center, PO Box 670526, Cincinnati, OH, 45267-0526, United States.;Department of Obstetrics and Gynecology, Division of Gynecology Oncology, University of Cincinnati, 231 Albert Sabin Way, Academic Health Center, PO Box 670526, Cincinnati, OH, 45267-0526, United States.",
"authors": "Hadad|Laura K|LK|;Billingsley|Caroline C|CC|",
"chemical_list": null,
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.gore.2017.02.010",
"fulltext": "\n==== Front\nGynecol Oncol RepGynecol Oncol RepGynecologic Oncology Reports2352-5789Elsevier S2352-5789(17)30021-810.1016/j.gore.2017.02.010Case ReportPosterior reversible encephalopathy syndrome (PRES) associated with ovarian cancer and voltage-gated potassium channel antibodies: A case report Hadad Laura K. hadadlk@mail.uc.edu⁎Billingsley Caroline C. Department of Obstetrics and Gynecology, Division of Gynecology Oncology, University of Cincinnati, 231 Albert Sabin Way, Academic Health Center, PO Box 670526, Cincinnati, OH, 45267-0526, United States⁎ Corresponding author. hadadlk@mail.uc.edu08 3 2017 5 2017 08 3 2017 20 67 69 28 11 2016 25 2 2017 27 2 2017 © 2017 The Authors2017This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Highlights\n• We report a case of PRES in conjunction with high grade serous ovarian carcinoma\n\n• There is a documented association between chemotherapy agents and PRES\n\n• Paraneoplastic panel was positive for voltage-gated potassium channel antibodies\n\n• Paraneoplastic workup may be justified in cases with high suspicion of PRES\n\n\n\nKeywords\nPosterior reversible encephalopathy syndrome (PRES)GemcitabineOvarian cancerParaneoplastic syndromeVoltage-gated potassium channel antibodies\n==== Body\n1 Introduction\nPosterior reversible encephalopathy syndrome (PRES) is an encephalopathic condition associated with reversible vasogenic edema. PRES is an increasingly recognized condition of cancer patients undergoing adjuvant therapy. Clinical manifestations include altered mental status, seizures, visual disturbances, and headache. CT and MRI findings include vasogenic edema, typically in the bilateral parieto-occipital regions.1 MRI shows abnormal T2 signaling, particularly fluid-attenuated inversion recovery (FLAIR) in parieto-occipital regions. The recognized etiologies of PRES include hypertension, cytotoxic drugs, and renal failure.2 There has been a causative effect noted between chemotherapy drugs such as gemcitabine3 and cisplatin4 and the development of PRES. Although PRES is usually reversible, permanent effects on mentation with significant morbidity and mortality can result if the condition is not properly identified and treated.5\n\nThe mechanism of PRES has not been definitively established but is thought to involve both failure of cerebral autoregulation and endothelial dysfunction.1 The combination of these factors is hypothesized to lead to disruption of the blood-brain barrier and vasogenic edema. PRES is not typically characterized as a paraneoplastic syndrome, although in a large review malignancies were found in 32% of patients with PRES.1 Paraneoplastic syndromes are conditions with undetermined causes that are associated with neoplasms and anti-neuronal antibodies.6 One such anti-neuronal antibody is the voltage-gated potassium channel (VGKC) antibody. In the following case we discuss the etiology of PRES in a patient with ovarian cancer.\n\n2 Case report\nA 64-year-old postmenopausal woman presented with a fixed pelvic mass and a normal CA 125 level (12 U/mL, normal 5.5–35 U/mL). She underwent a biopsy of the mass at an outside facility that was reported as a transitional cell ovarian carcinoma. She was treated with neoadjuvant chemotherapy with three cycles of intravenous carboplatin/paclitaxel with stable disease. This was followed by one cycle of carboplatin/gemcitabine with disease progression noted. She then underwent three cycles of cisplatin/gemcitabine with a documented partial response on imaging and reported improvement in her pelvic exam. There was no evidence of tumor lysis syndrome.\n\nShe was planned to undergo an interval cytoreduction but experienced a fall due to altered mental status at home leading to a vertebral fracture. She was admitted to the neurology service and diagnosed with PRES based on an MRI of the head which noted no masses, but multiple bilateral, symmetric areas of T2 and FLAIR signal abnormality involving the cerebellar hemispheres, pons, temporal, frontal and parieto-occipital lobes with predominant involvement of the cortical and subcortical zones (Fig. 1). Her symptoms were severe with selective mutism, delirium, confusion and refusal of oral intake. A paraneoplastic panel was negative with the exception of voltage-gated potassium channel antibodies.Fig. 1 63 year old female with high grade serous ovarian carcinoma who developed predominantly subcortical and cortical T2 hyperintense foci in the frontal, parietal, temporal, and occipital lobes as well as cerebellar hemispheres, as demonstrated on these T2 FLAIR images (a, b, c). T2 hyperintense foci were also noted in the pons (not pictured). Findings were consistent with posterior reversible encephalopathy syndrome (PRES).\n\nFig. 1\n\nThe gynecology oncology service was consulted due to a drop in hemoglobin and an enlarging pelvic mass. Surgery was initially deferred given her poor performance status and overall stability of the mass. But, ultimately, her pain increased and her mental status continued to severely decline, and she underwent a radical interval optimal cytoreduction including bilateral salpingo-oophorectomy, tumor debulking with mass excision and rectal resection en bloc, left ureteral repair, end sigmoid colostomy. At the end of the procedure the patient was optimally debulked with minimal (< 1 mm diffuse) residual disease in the cul de sac and on the posterior aspect of the bladder. Her pathology revealed a high-grade serous carcinoma, at least stage IIB. Her neurological symptoms resolved a few days after surgery and she became interactive, appropriate and neurologically intact. She had no memory of the preceding hospitalization. A paraneoplastic panel was not repeated at this time.\n\nHer postoperative course was prolonged and complicated. She experienced a large retroperitoneal hematoma requiring an ICU admission, wound separation and pelvic fluid collections. She was discharged after several weeks to a nursing facility and continued to suffer from deconditioning and malnutrition. Neurologically she was intact aside from intermittent aphasia. She underwent repeat imaging eight weeks after her cytoreduction and was noted to have extensive recurrent tumor in the pelvis with multiple peritoneal nodules, bladder involvement, increased right ureteral obstruction and several new pulmonary nodules. She was offered chemotherapy versus hospice. She elected hospice and quickly declined from a neurological standpoint, succumbing to her disease within two weeks.\n\n3 Discussion\nThe present case may provide evidence for a paraneoplastic, autoimmune etiology of PRES associated with neuronal voltage-gated potassium channel (VGKC) antibodies. Evidence for a paraneoplastic etiology of PRES includes the patient's positive laboratory value for neuronal VGKC antibodies, her return to near-baseline mentation after the resection of her ovarian tumor and reduction in pelvic hematoma, and her decline in mental status on recurrence and metastasis of the ovarian cancer.\n\nNeuronal VGKC antibodies are measured on paraneoplastic panels and are associated with various neurological conditions, including limbic encephalitis, Morvan's disease, and epilepsies.7 These conditions have variable manifestations on MRI, with many cases having normal-appearing MRIs.7 The neurologic effects of VGKC antibodies are broad and include cognitive impairment, seizures, dysautonomia, myoclonus, among other symptoms.8 It should be noted that the significance of a positive screen for VGKC antibodies is unclear. VGKC antibodies are associated with malignancies, particularly small-cell lung cancer and thymomas.9 Paraneoplastic encephalopathies tend to have a poor prognosis. Treatment depends on removal of the tumor and aggressive immunotherapy.10\n\nOn literature review, a case of PRES was found that was proposed to have a primary immune etiology, described in an abstract by Seby and colleagues.11 In the described case none of the usual precipitants for PRES were present. The patient's encephalopathy, seizures, and brain imaging findings resolved after discovery and treatment of squamous cell carcinoma in the lung. A paraneoplastic panel was negative. This reported case may parallel the current case in that both patients' mental statuses appear to vary based on tumor status. In the previously described case, the patient's cognition returned to baseline after resection and treatment of the cancer. In the present case, the patient's mental status returned to baseline after the resection of her ovarian tumor and reduction in pelvic hematoma. In addition, her mentation declined on recurrence and metastasis of the ovarian cancer. It should be recognized that the patient's worsened mental status late in the course of her disease could have been an effect of the dying process. The authors proposed a primary immune etiology of PRES that may have been paraneoplastic in origin.\n\nThe present case has multiple complicating factors, including the patient's history of hypertension and fluctuating blood pressures throughout her hospitalization. Hypertension is a known precipitant of PRES that may have contributed to her presentation. In addition, the patient's significant drop in hemoglobin (from 8.0 g/dL to 5.5 g/dL) could have led to decreased cerebral perfusion, contributing to her delirium. Another possible contributing factor is the patient's history of sepsis early in her hospitalization. Upon treatment, she experienced some improvement in her confusion but ultimately declined again.\n\nParticularly relevant is the patient's history of gemcitabine chemotherapy. Gemcitabine is known to be a precipitating factor for PRES. This association has been noted in a variety of cancers. In a literature review3 gemcitabine was found to be associated with PRES in non-small cell lung cancer, immunoglobulin A multiple myeloma, ovarian cancer, pancreatic cancer, gallbladder cancer, and small cell lung cancer.\n\nThe onset of PRES following chemotherapy has been reported in cases of ovarian cancer. In a retrospective study of 69 patients with cancer who developed PRES, two patients had primary ovarian cancers, one of whom was treated with chemotherapy.12 On literature review, a case of PRES in ovarian carcinoma after treatment with bevacizumab was found.13 Although our patient did not receive bevacizumab, this case provides evidence for drug-precipitated PRES in ovarian cancer. In another case, PRES was reported in a patient with metastatic high-grade serous ovarian cancer who received bevacizumab in combination with gemcitabine.14 The authors concluded that bevacizumab was the most likely causative agent, but they acknowledge that gemcitabine may have played a role. Gemcitabine-associated neurotoxicity has been noted in a patient with epithelial ovarian carcinoma.15 In summary, there is evidence of chemotherapy-induced PRES in ovarian cancer.\n\nThe majority of previous cases of gemcitabine-associated PRES occurred within two weeks of the most recent cycle of gemcitabine chemotherapy.3 In the current case, the patient's PRES did not present until six weeks after her last cycle of cisplatin/gemcitabine. It is possible that this is a later presentation of gemcitabine-associated PRES. The timing of events and association with tumor status may provide evidence for a paraneoplastic rather than drug-related etiology. It should be noted, however, that gemcitabine could be an alternate explanation for the patient's PRES.\n\nIn summary, in cases of PRES with an associated malignancy, it may be beneficial to do a paraneoplastic workup. It is important to identify PRES early so that it can be treated and its effects reversed. This possible paraneoplastic etiology of PRES is infrequently reported in the literature and may represent a new variation of the disease. Treatment of PRES involves removal of the causative agent, which may differ based on the cause of the PRES. Therefore, recognition of any new etiology of PRES is relevant for management of the condition.\n\nConflict of interest statement\nNeither of the authors has any conflicts of interest to report.\n\nAcknowledgments\nWe wish to thank Dr. Shaun Wahab of University of Cincinnati Radiology department for providing MRI images and captions for Fig. 1.\n==== Refs\nReferences\n1 Granata G. Greco A. Iannella G. Posterior reversible encephalopathy syndrome--insight into pathogenesis, clinical variants and treatment approaches Autoimmune Rev. 14 9 2015 830 836 \n2 Porcello marrone LC, Marrone BF, Gadonski G, Huf marrone AC, Da costa JC. Posterior reversible encephalopathy syndrome. Clin Adv Hematol Oncol. 2012; 10(9):614–5.\n3 Truong Q.V. Abraham J. Nagaiah G. Newton M. Veltri L. Gemcitabine associated with posterior reversible encephalopathy syndrome (PRES): a case report and review of the literature Clin Adv Hematol Oncol. 10 9 2012 611 613 23073128 \n4 Ito Y. Arahata Y. Goto Y. Cisplatin neurotoxicity presenting as reversible posterior leukoencephalopathy syndrome AJNR Am. J. Neuroradiol. 19 3 1998 415 417 9541291 \n5 Fugate J.E. Rabinstein A.A. Posterior reversible encephalopathy syndrome: clinical and radiological manifestations, pathophysiology, and outstanding questions Lancet Neurol. 14 9 2015 914 925 26184985 \n6 Dalmau J. Rosenfeld M.R. Paraneoplastic syndromes of the CNS The Lancet Neurology. 7 4 2008 327 340 18339348 \n7 Irani S.R. Vincent A. Voltage-gated potassium channel-complex autoimmunity and associated clinical syndromes Handb. Clin. Neurol. 133 2016 185 197 27112678 \n8 Tan K.M. Lennon V.A. Klein C.J. Boeve B.F. Pittock S.J. Clinical spectrum of voltage-gated potassium channel autoimmunity Neurology 70 20 2008 1883 1890 18474843 \n9 Graus F. Saiz A. Dalmau J. Antibodies and neuronal autoimmune disorders of the CNS J. Neurol. 257 4 2010 509 517 20035430 \n10 Flanagan E.P. Caselli R.J. Autoimmune encephalopathy Semin. Neurol. 31 2 2011 144 157 21590620 \n11 Seby J, Tavee J, Jehi L. Paraneoplastic Posterior Reversible Encephalopathy Syndrome (PRES) as a Harbinger of Lung Cancer. Neurology. 2013; 80(7).\n12 Kamiya-matsuoka C. Paker A.M. Chi L. Youssef A. Tummala S. Loghin M.E. Posterior reversible encephalopathy syndrome in cancer patients: a single institution retrospective study J. Neuro-Oncol. 128 1 2016 75 84 \n13 Abbas O. Shamseddin A. Temraz S. Haydar A. Posterior reversible encephalopathy syndrome after bevacizumab therapy in a normotensive patient BMJ Case Rep. 2013 2013 \n14 Elmalik H.H. Elazzazy S. Salem K.S. Bujassoum S. A grave outcome of posterior reversible encephalopathy syndrome in a patient receiving Avastin (bevacizumab) for metastatic high-grade serous ovarian cancer Case Rep Oncol. 8 2 2015 290 294 26351436 \n15 Larsen F.O. Hansen S.W. Severe neurotoxicity caused by gemcitabine treatment Acta Oncol. 43 6 2004 590 591 15370618\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2352-5789",
"issue": "20()",
"journal": "Gynecologic oncology reports",
"keywords": "Gemcitabine; Ovarian cancer; Paraneoplastic syndrome; Posterior reversible encephalopathy syndrome (PRES); Voltage-gated potassium channel antibodies",
"medline_ta": "Gynecol Oncol Rep",
"mesh_terms": null,
"nlm_unique_id": "101652231",
"other_id": null,
"pages": "67-69",
"pmc": null,
"pmid": "28349115",
"pubdate": "2017-05",
"publication_types": "D002363:Case Reports",
"references": "18474843;20035430;15370618;23073128;25999210;9541291;18339348;23436889;26351436;27112678;26184985;21590620;23073129;26900076",
"title": "Posterior reversible encephalopathy syndrome (PRES) associated with ovarian cancer and voltage-gated potassium channel antibodies: A case report.",
"title_normalized": "posterior reversible encephalopathy syndrome pres associated with ovarian cancer and voltage gated potassium channel antibodies a case report"
} | [
{
"companynumb": "US-PFIZER INC-2017144525",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "GEMCITABINE HYDROCHLORIDE"
},
"drugadditional"... |
{
"abstract": "BACKGROUND\nThere has been little effective treatment in patients with cerebral infarction at >24 hours after onset. We assessed the effects of high-dose argatroban therapy in delayed administration, and investigated the mechanism based on our clinical findings.\n\n\nMETHODS\nArgatroban 30 mg was first administered for 15 minutes intravenously, and then 90 mg for 60 minutes followed by 60 mg for 60 minutes were infused continuously. The change of vascular obstruction caused by the treatment was assessed with magnetic resonance angiography.\n\n\nRESULTS\nIn 4 patients studied, high-dose argatroban resulted in 100% recanalization of occluded vessels (5/5), even though argatroban was administrated >24 hours after onset. On the other hand, when an inadequate dose of argatroban was administered, a hemorrhage was identified. This supports our hypothesis that high-dose argatroban promotes recanalization by deactivating thrombin and exerting an anticoagulant effect on the vascular endothelium.\n\n\nCONCLUSIONS\nHigh-dose argatroban is an effective treatment for cerebral infarction and offers a novel therapeutic approach for delayed hospitalized patients at >24 hours after onset. Additional studies are necessary to identify the cellular and molecular mechanisms and determine the adequate dose in order to reduce risks of complication.",
"affiliations": "Department of Neurology, Iwate Prefectural Chubu Hospital, Iwate, Japan. i-hiroaki@hb.tp1.jp",
"authors": "Ishibashi|Hiroaki|H|;Koide|Mizuho|M|;Obara|Satoko|S|;Kumasaka|Yukiko|Y|;Tamura|Kenichi|K|",
"chemical_list": "D000991:Antithrombins; D010875:Pipecolic Acids; D013449:Sulfonamides; D001120:Arginine; C031942:argatroban",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1052-3057",
"issue": "22(5)",
"journal": "Journal of stroke and cerebrovascular diseases : the official journal of National Stroke Association",
"keywords": null,
"medline_ta": "J Stroke Cerebrovasc Dis",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D000991:Antithrombins; D001120:Arginine; D001777:Blood Coagulation; D003251:Constriction, Pathologic; D004334:Drug Administration Schedule; D005260:Female; D006801:Humans; D020244:Infarction, Middle Cerebral Artery; D007262:Infusions, Intravenous; D018810:Magnetic Resonance Angiography; D008297:Male; D020768:Middle Cerebral Artery; D010875:Pipecolic Acids; D013449:Sulfonamides; D013997:Time Factors; D061665:Time-to-Treatment; D016896:Treatment Outcome",
"nlm_unique_id": "9111633",
"other_id": null,
"pages": "656-60",
"pmc": null,
"pmid": "22576008",
"pubdate": "2013-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "High-dose argatroban therapy for stroke: novel treatment for delayed treatment and the recanalization mechanism.",
"title_normalized": "high dose argatroban therapy for stroke novel treatment for delayed treatment and the recanalization mechanism"
} | [
{
"companynumb": "JP-MYLANLABS-2015M1027804",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "UROKINASE"
},
"drugadditional": null,
... |
{
"abstract": "To report a multi-institutional case series of patients with advanced microsatellite instability high (MSI-H) prostate adenocarcinoma identified with clinical cell-free DNA (cfDNA) next-generation sequencing (NGS) testing and treated with immune checkpoint inhibitors. Retrospective analysis of patients with metastatic castration-resistant prostate cancer (mCRPC) and MSI-H tumor detected by a commercially available cfDNA NGS assay Guardant360 (G360, Guardant Health) at eight different Academic Institutions in the USA, from September 2018 to April 2020. From a total of 14 MSI-H metastatic prostate cancer patients at participating centers, nine patients with mCRPC with 56% bone, 33% nodal, 11% liver and 11% soft-tissue metastases and a median PSA of 29.3 ng/dL, were treated with pembrolizumab after 2 lines of therapy for CRPC. The estimated median time on pembrolizumab was 9.9 (95% CI 1.0 to 18.8) months. Four patients (44%) achieved PSA50 after a median of 4 (3-12) weeks after treatment initiation including three patients with >99% PSA decline. Among the patients evaluable for radiographic response (n=5), the response rate was 60% with one complete response and two partial responses. Best response was observed after a median of 3.3 (1.4-7.6) months. At time of cut-off, four patients were still on pembrolizumab while four patients discontinued therapy due to progressive disease and one due to COVID-19 infection. Half of the patients with PSA50 had both MSI-H and pathogenic alterations in BRCA1 and BRCA2 in their G360 assays. The use of liquid biopsy to identify metastatic prostate cancer patients with MSI-H is feasible in clinical practice and may overcome some of the obstacles associated with prostate cancer tumor tissue testing. The robust activity of pembrolizumab in selected patients supports the generalized testing for MSI-H.",
"affiliations": "Deming Department of Medicine, Tulane University, New Orleans, Louisiana, USA pedrobaratamd@gmail.com.;Department of Medical Oncology, University of Utah, Salt Lake City, Utah, USA.;Department of Medical Oncology, University of Utah, Salt Lake City, Utah, USA.;Department of Medical Oncology and Experimental Therapeutics, City of Hope Comprehensive Cancer Center, Duarte, California, USA.;Deming Department of Medicine, Tulane University, New Orleans, Louisiana, USA.;Deming Department of Medicine, Tulane University, New Orleans, Louisiana, USA.;Deming Department of Medicine, Tulane University, New Orleans, Louisiana, USA.;Deming Department of Medicine, Tulane University, New Orleans, Louisiana, USA.;Deming Department of Medicine, Tulane University, New Orleans, Louisiana, USA.;Department of Medicine, University of Arizona Arizona Cancer Center, Tucson, Arizona, USA.;Department of Oncology, Mayo Clinic, Scottsdale, Arizona, USA.;Division of Hematology, Oncology, and Blood and Marrow Transplant, University of Iowa, Iowa City, Iowa, USA.;Department of Medical Oncology and Experimental Therapeutics, City of Hope Comprehensive Cancer Center, Duarte, California, USA.;Guardant Health Inc, Redwood City, California, USA.;Department of Oncology, Massachusetts General Hospital, Boston, Massachusetts, USA.;Deming Department of Medicine, Tulane University, New Orleans, Louisiana, USA.",
"authors": "Barata|Pedro|P|0000-0002-8890-2951;Agarwal|Neeraj|N|0000-0003-1076-0428;Nussenzveig|Roberto|R|;Gerendash|Benjamin|B|;Jaeger|Ellen|E|;Hatton|Whitley|W|;Ledet|Elisa|E|;Lewis|Brian|B|;Layton|Jodi|J|;Babiker|Hani|H|;Bryce|Alan|A|;Garje|Rohan|R|0000-0002-7244-5602;Stein|Cy|C|;Kiedrowski|Lesli|L|;Saylor|Philip|P|;Sartor|Oliver|O|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D000074322:Antineoplastic Agents, Immunological; D019313:BRCA1 Protein; C492913:BRCA1 protein, human; D024682:BRCA2 Protein; C551750:BRCA2 protein, human; D014408:Biomarkers, Tumor; D000074141:Circulating Tumor DNA; C582435:pembrolizumab",
"country": "England",
"delete": false,
"doi": "10.1136/jitc-2020-001065",
"fulltext": "\n==== Front\nJ Immunother Cancer\nJ Immunother Cancer\njitc\njitc\nJournal for Immunotherapy of Cancer\n2051-1426 BMJ Publishing Group BMA House, Tavistock Square, London, WC1H 9JR \n\njitc-2020-001065\n10.1136/jitc-2020-001065\nClinical/Translational Cancer Immunotherapy\n1506\nShort reportClinical activity of pembrolizumab in metastatic prostate cancer with microsatellite instability high (MSI-H) detected by circulating tumor DNA\nhttp://orcid.org/0000-0002-8890-2951Barata Pedro 1 http://orcid.org/0000-0003-1076-0428Agarwal Neeraj 2 Nussenzveig Roberto 2 Gerendash Benjamin 3 Jaeger Ellen 1 Hatton Whitley 1 Ledet Elisa 1 Lewis Brian 1 Layton Jodi 1 Babiker Hani 4 Bryce Alan 5 http://orcid.org/0000-0002-7244-5602Garje Rohan 67 Stein Cy 3 Kiedrowski Lesli 8 Saylor Philip 9 Sartor Oliver 1 \n1 \nDeming Department of Medicine, Tulane University, New Orleans, Louisiana, USA\n\n\n2 \nDepartment of Medical Oncology, University of Utah, Salt Lake City, Utah, USA\n\n\n3 \nDepartment of Medical Oncology and Experimental Therapeutics, City of Hope Comprehensive Cancer Center, Duarte, California, USA\n\n\n4 \nDepartment of Medicine, University of Arizona Arizona Cancer Center, Tucson, Arizona, USA\n\n\n5 \nDepartment of Oncology, Mayo Clinic, Scottsdale, Arizona, USA\n\n\n6 \nDivision of Hematology, Oncology, and Blood and Marrow Transplant, University of Iowa, Iowa City, Iowa, USA\n\n\n7 \nGenitourinary Oncology Program, Division of Hematology, Oncology and Blood and Marrow Transplantation, The University of Iowa, Iowa City, Iowa, USA\n\n\n8 \nGuardant Health Inc, Redwood City, California, USA\n\n\n9 \nDepartment of Oncology, Massachusetts General Hospital, Boston, Massachusetts, USA\n\nCorrespondence to Dr Pedro Barata; pedrobaratamd@gmail.com\n2020 \n11 8 2020 \n8 2 e00106519 7 2020 © Author(s) (or their employer(s)) 2020. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.2020http://creativecommons.org/licenses/by-nc/4.0/This is an open access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited, appropriate credit is given, any changes made indicated, and the use is non-commercial. See http://creativecommons.org/licenses/by-nc/4.0/.To report a multi-institutional case series of patients with advanced microsatellite instability high (MSI-H) prostate adenocarcinoma identified with clinical cell-free DNA (cfDNA) next-generation sequencing (NGS) testing and treated with immune checkpoint inhibitors. Retrospective analysis of patients with metastatic castration-resistant prostate cancer (mCRPC) and MSI-H tumor detected by a commercially available cfDNA NGS assay Guardant360 (G360, Guardant Health) at eight different Academic Institutions in the USA, from September 2018 to April 2020. From a total of 14 MSI-H metastatic prostate cancer patients at participating centers, nine patients with mCRPC with 56% bone, 33% nodal, 11% liver and 11% soft-tissue metastases and a median PSA of 29.3 ng/dL, were treated with pembrolizumab after 2 lines of therapy for CRPC. The estimated median time on pembrolizumab was 9.9 (95% CI 1.0 to 18.8) months. Four patients (44%) achieved PSA50 after a median of 4 (3–12) weeks after treatment initiation including three patients with >99% PSA decline. Among the patients evaluable for radiographic response (n=5), the response rate was 60% with one complete response and two partial responses. Best response was observed after a median of 3.3 (1.4–7.6) months. At time of cut-off, four patients were still on pembrolizumab while four patients discontinued therapy due to progressive disease and one due to COVID-19 infection. Half of the patients with PSA50 had both MSI-H and pathogenic alterations in BRCA1 and BRCA2 in their G360 assays. The use of liquid biopsy to identify metastatic prostate cancer patients with MSI-H is feasible in clinical practice and may overcome some of the obstacles associated with prostate cancer tumor tissue testing. The robust activity of pembrolizumab in selected patients supports the generalized testing for MSI-H.\n\nbiomarkerstumorimmunotherapyprogrammed cell death 1 receptorprostatic neoplasmsspecial-featureunlocked\n==== Body\nIntroduction\nImmune-checkpoint blockade has shown promising therapeutic outcomes and several monoclonal antibodies that target cytotoxic T-lymphocyte-associated protein 4, programmed death 1 receptor (PD-1) and programmed death ligand 1 (PD-L1) have been approved for certain cancer treatments while others are under clinical investigation.1 2 Still, the activity of immunotherapy for unselected advanced prostate cancer, is in general, limited based on prospective phase II study.3 4\n\n\nMismatch repair (MMR) is a mechanism by which postreplicative mismatches in daughter DNA strands are repaired and replaced with the correct DNA sequence. Microsatellites, also known as short tandem repeats, consist of repeated sequences of 1–6 nucleotides.5 The mechanism of microsatellite generation is generally believed to be DNA slippage in the process of replication, or mismatch of the basic group of slippage strand and complementary strand in the process of DNA replication and repair, resulting in one or more of the repeating units missing or insert.5 MLH1, MSH2, MSH6 and PMS2 are all MMR enzymes that, when deficient, are associated with microsatellite instability (MSI) in cancer.6\n\n\nHistorically, methods for MSI testing use tissue biopsies and include PCR-based amplification followed by capillary electrophoresis, and more recently next generation sequencing (NGS)-based approaches.7–9 Different assays using tumor tissue or plasma cell-free DNA (cfDNA) (liquid biopsies) are able to assess the MSI status in patients with cancers.10 11 In prostate cancer, the prevalence of MSI-high (H)/deficient MMR (dMMR) has been observed in approximately 2%–3% of cases, based on different studies that used tumor tissue.11–13\n\n\nMSI-H/dMMR tumors are often associated with greater and more durable responses after administration of immune checkpoint inhibitors. The humanized, anti-PD-1 monoclonal antibody pembrolizumab was the first tumor-agnostic approval in oncology by the US Food and Drug Administration, for tumors expressing dMMR or MSI-H, regardless of primary tumor and regardless of the underlying assay.12 14–16\n\n\nWe report a multi-institutional case series of advanced prostate cancer with MSI-H status identified with a commercially available cfDNA NGS assay and treated with immune checkpoint inhibitors. No prior experience has been reported using MSI-H circulating tumor DNA (ctDNA) as a predictive biomarker in prostate cancer for PD-1 inhibition.\n\nMethods\nPatients and samples\nA total of 14 patients with advanced prostate cancer treated at eight different Academic Institutions in the USA, had MSI-H status detected by a commercially available cfDNA NGS assay, Guardant360 (G360). All patients had G360 testing for advanced disease. Medical record review was conducted for patient clinical characteristics and outcomes, with follow-up through April 20 2020.\n\nSequencing and analysis\nG360 (Guardant Health, Redwood City, California, USA) is a 74-gene panel validated for detection of single nucleotide variants (SNVs), indels, copy number amplifications, fusions and MSI-H status in cfDNA from plasma of patients with advanced solid tumors.11 17 This panel started reporting MSI-H status on September 27 2018. G360 sequences 90 pan-cancer informative microsatellite loci from plasma cfDNA and reports MSI-H status based on the number of detected unstable sites exceeding a predetermined threshold, as previously described.11\n\n\nCastration-resistant prostate cancer (CRPC) was defined by progression of disease (by PSA or radiographs) despite a castrate level of testosterone. PSA50 was defined as PSA decline of ≥50% from baseline PSA level prior to pembrolizumab initiation. PSA progression was defined as 25% increase from nadir PSA (confirmed by a second rising PSA at least 3 weeks later) per Prostate Cancer Working Group 3. Overall response rate was defined by RECIST 1.1. Patients were censored at the time of last follow-up. The cut-off date for analysis was April 20 2020.\n\nResults\nDuring the study period, clinical G360 testing was performed for 460 patients with advanced prostate cancer by participating center collaborators; 405 of these patients had at least one ctDNA alteration identified. Of these, MSI-high status was identified in 15 patients (3.7%). Additional clinical information was not available for one patient. The final analysis included a total of 14 metastatic prostate cancer patients, 12 (86%) of whom were Caucasian with median age 69 (55–88). The median follow-up was 2.6 years since metastatic disease was diagnosed and 12/14 patients developed CRPC. From the total MSI-H cohort (n=14), five patients did not receive immune checkpoint inhibitors due to death (n=2), metastatic castration-naïve disease (n=2) or insurance denial (n=1). A total of nine patients with metastatic CRPC (mCRPC) with 56% bone, 33% nodal, 11% liver and 11% soft-tissue metastases and a median PSA of 29.3 ng/dL were treated with pembrolizumab after a median of 16.0 (0.7–20.6) months after diagnosis of mCRPC and a median of 2 (0–4) prior lines of therapy for CRPC (table 1).\n\nTable 1 Baseline characteristics of metastatic CRPC patients treated with pembrolizumab\n\nCharacteristic\tn=9 patients\t\nAge, median (range), years\t68 (57–88)\t\nRace, n (%)\t\t\n African-American\t1 (11)\t\n Asian\t1 (11)\t\n White\t7 (78)\t\nGleason grade group, n (%)\t\t\n 2\t1 (11)\t\n 4\t2 (22)\t\n 5\t6 (67)\t\nLocation of metastases, n (%)\t\t\n Bones\t5 (56)\t\n Soft-tissue\t1 (11)\t\n Liver\t1 (11)\t\n Lymph nodes\t3 (33)\t\nInitial PSA, ng/dL, median (range)\t29.3 (3.4–266)\t\nPrior lines of therapy for mCRPC, n (%)\t\n 0\t1 (11)\t\n 1\t3 (33)\t\n 2\t3 (33)\t\n 3\t1 (11)\t\n 4\t1 (11)\t\nType of prior oncological therapies, n (%)\t\t\n Abiraterone\t6 (67)\t\n Enzalutamide\t3 (33)\t\n Ketoconazole\t1 (11)\t\n Apalutamide\t1 (11)\t\n Docetaxel\t2 (22)\t\n Cabazitaxel\t1 (11)\t\n Lutetium-177-PSMA-617\t1 (11)\t\nCRPC, castration-resistant prostate cancer; mCRPC, metastatic CRPC.\n\nOf the nine patients that received pembrolizumab, drug was administered for an estimated median of 9.9 (95% CI 1.0 to 18.8) months. Four patients (44%) achieved PSA50 after a median of 4 (3–12) weeks after treatment initiation including three patients with >99% PSA decline (figure 1).\n\nFigure 1 Best PSA change from baseline in mCRPC patients treated with pembrolizumab (N=9). *partial response, **complete response\n\nAmong the patients evaluable for radiographic response (n=5), the overall response rate was 60% with one complete response (CR) and two partial responses (PR). One patient had a CR in lymph nodes while two patients had PR in lymph nodes. All responding patients had a PSA50. Two patients progressed on therapy. Best response was observed after a median of 3.3 (1.4–7.6) months and the responses were observed in lymph nodes (n=3) and liver (n=1).\n\nAt time of cut-off, all patients who had received pembrolizumab were alive; four patients were still on pembrolizumab, while four patients discontinued therapy due to progressive disease and one due to COVID-19 infection. All four progressors had evidence of both PSA and radiographic progression. Enzalutamide, docetaxel and radium223 were the systemic therapies of choice for patients who progressed on pembrolizumab.\n\nClinically significant adverse events considered related to pembrolizumab by the treating physician were reported in one patient that required systemic corticosteroids (total dose daily of 20 mg prednisone) for grade 2 arthralgias and grade 1 rash, and no treatment interruption or hospitalization was required.\n\nAll patients treated with pembrolizumab had cfDNA NGS testing done while having mCRPC. Testing was initially done a median of 13.7 (0.9–23.3) months after developing mCRPC and 0.6 (0.3–6.8) months prior to starting pembrolizumab.\n\nConsidering the full MSI-H cohort (n=14), characterized genomic alterations were also found in the following (selected) genes: TP53 (64%), AR (57%), ARID1A (36%), PTEN (36%), BRCA1 (29%), BRCA2 (21%), PIK3CA (21%), FGFR1/2 (21%), ATM (14%) and CDK12 (7%). The median maximum mutant allele fraction on G360 in the cohort was 15.6% (range 3.34%–74%). The median number of (SNVs; inclusive of both non-synonymous and synonymous alterations) identified by G360 in this cohort was 14.5 (5–48) and the median number of deletion mutation (indels) identified was 3.5 (0–8).\n\nHalf of the patients with PSA50 had both MSI-H and pathogenic alterations in BRCA1 and BRCA2 detected by their G360 assays. One patient with PR had BRCA1, BRCA2 and ATM mutations. There were no CDK12 alterations among responders.\n\nMSI-H was detected in all three patients with available tumor tissue NGS. No germline genomic alterations were found in the two patients who underwent separate germline testing.\n\nDiscussion\nTo our knowledge, this is the first case series reporting the clinical activity of pembrolizumab for MSI-H mCRPC identified by a cfDNA assay. This dataset consists of patients with predominately bone and nodal metastases and previously exposed to novel hormonal therapies.\n\nWhile the efficacy of PD-1 inhibitors for unselected mCRPC is modest,3 durable and profound responses (PSA and radiographic) were observed in nearly half of the MSI-H tumors, consistent with prior reports in prostate and other tumor types.15 18 Despite the inclusion of MSI-H/dMMR testing and pembrolizumab treatment for mCRPC with MSI-H/dMMR in the second line and beyond in the national guidelines,19 one patient could not be treated with pembrolizumab due to insurance limitations.\n\nAlthough in small numbers, DNA repair defects in combination with MSI-H were associated with the responses to pembrolizumab, which supports their potential role as predictive biomarkers.20 Whether there is a synergy between anti-PD-1/PD-L1 agents and poly ADP ribose polymerase (PARP) inhibitors is being further explored.21 22\n\n\nThis case series might reflect a generalized practice of ordering a liquid biopsy after progression to mCRPC and after exposure to novel hormonal therapies, where the benefit of the remaining therapies is more limited. In most cases, the use of pembrolizumab was favored prior to the use of chemotherapy, which is frequently considered in routine practice.\n\nLimited tumor tissue, insufficient quality/quantity and inability to assess current genomic landscape using archival tumor samples are known limitations in prostate cancer genomic assessment. Importantly, there is clear evidence of acquired MSI-H phenotype developing as prostate cancer advances and liquid biopsies can be of significant importance to overcome all of these limitations.18 Not all MMR mutations are truncal, and in some cases the root cause of MSI-H status remains unclear. This dataset provides evidence that the use of cfDNA NGS assays in clinical practice is feasible, has direct clinical implications and yields therapeutic response which is supported by the short period of time observed between testing and initiation of pembrolizumab therapy and subsequent responses. It is reassuring that the cfDNA assay used in this study has been validated with very high concordance, sensitivity and specificity and with a limit of detection of 0.1% tumor content for MSI-H status as well as additional genomic alterations with potential therapeutic implications.11 17 This dataset is concordant with other tumor datasets supporting the cfDNA testing as an appropriate surrogate marker for MSI status in men with mCRPC.\n\nThe prevalence of cfDNA MSI-H was 3.7%, slightly higher than the previously reported prevalence of 2.3% (55/2358) of prostate cancer samples from the large pan-cancer validation study of this assay’s MSI-H detection in plasma cfDNA11 and similarly consistent with reported prevalence of 3.1% and 3.8% in two other studies of MSI status in metastatic prostate cancer.12 23 By contrast, a lower prevalence of MSI-H (0.6%) was noted in primary prostate carcinomas, based on The Cancer Genome Atlas (TCGA) dataset that included 497 patients.24\n\n\nThe relatively short follow-up and small size of this cohort is due to the limited period of time in which plasma MSI-H testing has been clinically available. However, the clinical implications of confirmed treatment outcomes even in heavily pretreated patients, based on this cfDNA biomarker, warrant quick report of this early cohort.\n\nOther PD-1/PD-L1 inhibitors are being tested in combination with different therapies to expand the use of these agents beyond MSI-H/dMMR. Examples include the combination of nivolumab with ipilimumab (CheckMate 650) or atezolizumab plus cabozantinib (COSMIC-021) where promising efficacy signals were observed in specific subgroups of patients.25 26 In addition, other immune interventions such as genetic vaccination (NCT04041310) or adaptive cell therapies (NCT03935893) are currently under investigation for patients with MSI-H tumors.\n\nAt this time, several questions related to the optimal setting for PD-1 inhibitors in the advanced disease state, the role of intermittent therapy for those who achieve durable and profound responses, the emergence of additional biomarkers (such as tumor mutational burden or TMB, as well as individual positive and negative predictive genomic biomarkers) and the potential synergic activity when combined with other effective anticancer therapies, are being explored.\n\nThe limitations of this study include the retrospective nature of this analysis, the small number of patients treated with pembrolizumab and the selection bias associated with limited access to novel therapies under current development. The G360 data does not report TMB, thus, the association of detected MSI-H status with this potentially important biomarker is not assessed. However, in MSI-H assay validation studies, the median number of SNVs and indels detected in MSI-H samples were significantly higher than in microsatellite stable samples.11 The median number of those alteration types in the cohort presented here were even higher than that seen in the MSI-H plasma validation cohort (14.5 SNVs and 3.5 indels), suggesting that these cases might also be consistent with increased mutational burden.\n\nConclusions\nIn conclusion, the use of a well-validated cfDNA NGS liquid biopsy to identify metastatic prostate cancer patients with MSI-H is feasible in clinical practice and may overcome the obstacles associated with prostate cancer tumor tissue for timely genomic assessment. The robust activity of pembrolizumab in selected patients supports the generalized testing for MSI-H.\n\nTwitter: @PBarataMD, @AlanBryce9\n\nContributors: Concept: PB and OS. Data collection: PB, RN, BG, HB, AB, RG, CS and PS. Data analysis and interpretation: all authors.\n\nFunding: The authors have not declared a specific grant for this research from any funding agency in the public, commercial or not-for-profit sectors.\n\nCompeting interests: PB has a consulting/advisory role (Institution) with Exelixis, Caris, Bayer, Janssen, EMD/Serono, Pfizer, Astellas, Dendreon, Clovis and Sanofi. Contracted Research (Institution) from Seattle Genetics, BlueEarth Diagnostics, Nektar, AstraZeneca and Seattle Genetics. NA has a consulting/advisory role with Astellas, Astra Zeneca, Bayer, Bristol Myers Squibb, Clovis, Eisai, Eli Lilly, EMD Serono, Exelixis, Foundation Medicine, Genentech, Janssen, Merck, Nektar, Novartis, Pfizer, Pharmacyclics and Seattle Genetics. Contracted Research (Instituion) from Astra Zeneca, Bavarian Nordic, Bayer, BN immunotherapeutics, Bristol Myers Squibb, Calithera, Celldex, Clovis, Eisai, Eli Lilly, EMD Serono, Exelixis, Genentech, Glaxo Smith Kline, Immunomedics, Janssen, Medivation, Merck, Nektar, New Link Genetics, Novartis, Pfizer, Prometheus, Rexahn, Roche, Sanofi, Seattle Genetics, Takeda and Tracon. HB has a consulting/advisory role with Endocyte, Celgene, Guardant360, Tracon. Honoraria: SirTex, Bayer. Speaker Bureau: Guardant360. LK is employee of Guardant Health. OS has a consulting/advisory role with AAA, Astellas, Astrazeneca, Bayer, Blue Earth Diagnostics, EMD Serono, Endocyte, Pfizer, Progenics, Sanofi, Invitae, Merck, Novartis, Janseen, Constellation, Dendreon, BMS, Bravarin Nordic, Clovis, Myriad, Noria Therapeutics, Noxopharm, Point Biopharma and Tenebio. Contracted Research from Innocrin, Sotio. He also serves as consultant on NCI Scientific Board Counselors and is a cochairman of GU Committee at NRG.\n\nPatient consent for publication: Not required.\n\nEthics approval: This retrospective study was approved by an institutional review board with a waiver of consent for the analysis of deidentified data.\n\nProvenance and peer review: Not commissioned; externally peer reviewed.\n\nData availability statement: All data relevant to the study are included in the article or uploaded as online supplementary information. All data generated or analyzed during this study are included in this published article.\n==== Refs\nReferences\n1 \nDarvin P , Toor SM , Sasidharan Nair V , et al \nImmune checkpoint inhibitors: recent progress and potential biomarkers\n. Exp Mol Med \n2018 ;50 :1 –11\n. 10.1038/s12276-018-0191-1 \n\n2 \nHargadon KM , Johnson CE , Williams CJ \nImmune checkpoint blockade therapy for cancer: an overview of FDA-approved immune checkpoint inhibitors\n. Int Immunopharmacol \n2018 ;62 :29 –39\n. 10.1016/j.intimp.2018.06.001 \n29990692 \n3 \nAntonarakis ES , Piulats JM , Gross-Goupil M , et al \nPembrolizumab for treatment-refractory metastatic castration-resistant prostate cancer: Multicohort, open-label phase II KEYNOTE-199 study\n. J Clin Oncol \n2020 ;38 :395 –405\n. 10.1200/JCO.19.01638 \n31774688 \n4 \nCook N , Hansen AR , Siu LL , et al \nEarly phase clinical trials to identify optimal dosing and safety\n. Mol Oncol \n2015 ;9 :997 –1007\n. 10.1016/j.molonc.2014.07.025 \n25160636 \n5 \nLi K , Luo H , Huang L , et al \nMicrosatellite instability: a review of what the oncologist should know\n. Cancer Cell Int \n2020 ;20 :16 \n10.1186/s12935-019-1091-8 \n31956294 \n6 \nShia J , Stadler Z , Weiser MR , et al \nImmunohistochemical staining for DNA mismatch repair proteins in intestinal tract carcinoma: how reliable are biopsy samples?\n\nAm J Surg Pathol \n2011 ;35 :447 –54\n. 10.1097/PAS.0b013e31820a091d \n21297438 \n7 \nMurphy KM , Zhang S , Geiger T , et al \nComparison of the microsatellite instability analysis system and the Bethesda panel for the determination of microsatellite instability in colorectal cancers\n. J Mol Diagn \n2006 ;8 :305 –11\n. 10.2353/jmoldx.2006.050092 \n16825502 \n8 \nNiu B , Ye K , Zhang Q , et al \nMSIsensor: microsatellite instability detection using paired tumor-normal sequence data\n. Bioinformatics \n2014 ;30 :1015 –6\n. 10.1093/bioinformatics/btt755 \n24371154 \n9 \nSalipante SJ , Scroggins SM , Hampel HL , et al \nMicrosatellite instability detection by next generation sequencing\n. Clin Chem \n2014 ;60 :1192 –9\n. 10.1373/clinchem.2014.223677 \n24987110 \n10 \nGeorgiadis A , Durham JN , Keefer LA , et al \nNoninvasive detection of microsatellite instability and high tumor mutation burden in cancer patients treated with PD-1 blockade\n. Clin Cancer Res \n2019 ;25 :7024 –34\n. 10.1158/1078-0432.CCR-19-1372 \n31506389 \n11 \nWillis J , Lefterova MI , Artyomenko A , et al \nValidation of microsatellite instability detection using a comprehensive plasma-based genotyping panel\n. Clin Cancer Res \n2019 ;25 :7035 –45\n. 10.1158/1078-0432.CCR-19-1324 \n31383735 \n12 \nAbida W , Cheng ML , Armenia J , et al \nAnalysis of the prevalence of microsatellite instability in prostate cancer and response to immune checkpoint blockade\n. JAMA Oncol \n2019 ;5 :471-478 . 10.1001/jamaoncol.2018.5801 \n30589920 \n13 \nRobinson D , Van Allen EM , Wu Y-M , et al \nIntegrative clinical genomics of advanced prostate cancer\n. Cell \n2015 ;162 :454. 10.1016/j.cell.2015.06.053 \n28843286 \n14 \nReichert ZR , Urrutia J , Alumkal JJ \nMicrosatellite instability as an emerging biomarker for checkpoint inhibitor response in advanced prostate cancer\n. JAMA Oncol \n2019 ;5 :478 –9\n. 10.1001/jamaoncol.2018.5789 \n30589921 \n15 \nLe DT , Uram JN , Wang H , et al \nPd-1 blockade in tumors with mismatch-repair deficiency\n. N Engl J Med \n2015 ;372 :2509 –20\n. 10.1056/NEJMoa1500596 \n26028255 \n16 \nMarcus L , Lemery SJ , Keegan P , et al \nFda approval summary: pembrolizumab for the treatment of microsatellite instability-high solid tumors\n. Clin Cancer Res \n2019 ;25 :3753 –8\n. 10.1158/1078-0432.CCR-18-4070 \n30787022 \n17 \nOdegaard JI , Vincent JJ , Mortimer S , et al \nValidation of a plasma-based comprehensive cancer genotyping assay utilizing orthogonal tissue- and plasma-based methodologies\n. Clin Cancer Res \n2018 ;24 :3539 –49\n. 10.1158/1078-0432.CCR-17-3831 \n29691297 \n18 \nAbida W , Cheng ML , Armenia J , et al \nAnalysis of the prevalence of microsatellite instability in prostate cancer and response to immune checkpoint blockade\n. JAMA Oncol \n2019 ;5 :471 –8\n. 10.1001/jamaoncol.2018.5801 \n30589920 \n19 \nNational comprehensive cancer network: prostate cancer. version 1\n, 2020 Available: https://www.nccn.org/professionals/physician_gls/pdf/prostate.pdf\n\n20 \nMouw KW , Goldberg MS , Konstantinopoulos PA , et al \nDna damage and repair biomarkers of immunotherapy response\n. Cancer Discov \n2017 ;7 :675 –93\n. 10.1158/2159-8290.CD-17-0226 \n28630051 \n21 \nVinayak S , Tolaney SM , Schwartzberg L , et al \nOpen-Label clinical trial of Niraparib combined with pembrolizumab for treatment of advanced or metastatic triple-negative breast cancer\n. JAMA Oncology \n2019 ;5 :1132 –40\n. 10.1001/jamaoncol.2019.1029 \n\n22 \nFriedlander M , Meniawy T , Markman B , et al \nPamiparib in combination with tislelizumab in patients with advanced solid tumours: results from the dose-escalation stage of a multicentre, open-label, phase 1a/b trial\n. Lancet Oncol \n2019 ;20 :1306 –15\n. 10.1016/S1470-2045(19)30396-1 \n31378459 \n23 \nMayrhofer M , De Laere B , Whitington T , et al \nCell-Free DNA profiling of metastatic prostate cancer reveals microsatellite instability, structural rearrangements and clonal hematopoiesis\n. Genome Med \n2018 ;10 :85. 10.1186/s13073-018-0595-5 \n30458854 \n24 \nCortes-Ciriano I , Lee S , Park W-Y , et al \nA molecular portrait of microsatellite instability across multiple cancers\n. Nat Commun \n2017 ;8 :15180. 10.1038/ncomms15180 \n28585546 \n25 \nSharma P , Pachynski RK , Narayan V , et al \nInitial results from a phase II study of nivolumab (NIVO) plus ipilimumab (IPI) for the treatment of metastatic castration-resistant prostate cancer (mCRPC; CheckMate 650 . 37 \nAmerican Society of Clinical Oncology , 2019 : 142 \n10.1200/JCO.2019.37.7_suppl.142 \n\n26 \nAgarwal N , Loriot Y , McGregor BA \nCabozantinib (C) in combination with atezolizumab (a) in patients (PTS) with metastatic castration-resistant prostate cancer (mCRPC): results of cohort 6 of the COSMIC-021 study . American Society of Clinical Oncology , 2020 .\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2051-1426",
"issue": "8(2)",
"journal": "Journal for immunotherapy of cancer",
"keywords": "biomarkers; immunotherapy; programmed cell death 1 receptor; prostatic neoplasms; tumor",
"medline_ta": "J Immunother Cancer",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D061067:Antibodies, Monoclonal, Humanized; D000074322:Antineoplastic Agents, Immunological; D019313:BRCA1 Protein; D024682:BRCA2 Protein; D014408:Biomarkers, Tumor; D000086382:COVID-19; D000074141:Circulating Tumor DNA; D018352:Coronavirus Infections; D006801:Humans; D000073890:Liquid Biopsy; D008297:Male; D053842:Microsatellite Instability; D008875:Middle Aged; D009154:Mutation; D058873:Pandemics; D011024:Pneumonia, Viral; D011471:Prostatic Neoplasms",
"nlm_unique_id": "101620585",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "32788235",
"pubdate": "2020-08",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study",
"references": "16825502;31774688;30458854;28630051;21297438;24987110;30589921;29990692;28585546;28843286;24371154;31378459;31383735;30546008;26028255;29691297;31956294;31194225;31506389;25160636;30787022;30589920",
"title": "Clinical activity of pembrolizumab in metastatic prostate cancer with microsatellite instability high (MSI-H) detected by circulating tumor DNA.",
"title_normalized": "clinical activity of pembrolizumab in metastatic prostate cancer with microsatellite instability high msi h detected by circulating tumor dna"
} | [
{
"companynumb": "US-009507513-2008USA013478",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "PEMBROLIZUMAB"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nChronic hepatitis C virus (HCV) infection is a major cause of morbidity and mortality among HIV-infected patients. Sofosbuvir is a first-in-class HCV NS5B inhibitor with potent pan-genotypic antiviral activity. We report a 2-part study that assessed the efficacy and safety of sofosbuvir in HCV/HIV-coinfected patients. Part A examined potential drug interactions between sofosbuvir and antiretrovirals (efavirenz, emtricitabine, tenofovir, zidovudine, lamivudine, atazanavir, ritonavir, darunavir, and raltegravir). Part B was a pilot study of sofosbuvir plus peginterferon-ribavirin administered for 12 weeks.\n\n\nMETHODS\nWe enrolled noncirrhotic patients with chronic HCV infection (genotype, 1-6) and stable HIV. Part A followed a 5-cohort, open-label, multiple-dose, single-sequence design; part B followed an open-label, single-arm design. The primary end point of part B was sustained virologic response (defined as undetectable HCV RNA) 12 weeks after end of treatment (SVR12). This study is registered with ClinicalTrials.gov, number NCT01565889.\n\n\nRESULTS\nThirty-eight patients were enrolled in part A and 23 in part B. In part A, no clinically significant drug interactions were observed between sofosbuvir and any of the antiretrovirals evaluated. In part B, 21 (91.3%) patients achieved SVR12. Two patients relapsed but none experienced on-treatment HCV virologic failure. Two patients discontinued study treatment because of adverse events (altered mood and anemia). No serious adverse events, HIV viral breakthrough, or decreases in CD4 percentage were reported in either part A or part B.\n\n\nCONCLUSIONS\nSofosbuvir may be coadministered safely with many commonly used antiretrovirals. The addition of sofosbuvir to peginterferon-ribavirin was highly effective as assessed by SVR in HCV/HIV-coinfected patients.",
"affiliations": "*Fundacion de Investigacion, Santurce, Puerto Rico; †Gilead Sciences, Inc, Foster City, CA; and ‡University of Puerto Rico, San Juan, Puerto Rico.",
"authors": "Rodriguez-Torres|Maribel|M|;Gaggar|Anuj|A|;Shen|Gong|G|;Kirby|Brian|B|;Svarovskaia|Evguenia|E|;Brainard|Diana|D|;Symonds|William T|WT|;McHutchison|John G|JG|;Gonzalez|Milagros|M|;Rodriguez-Orengo|Jose|J|",
"chemical_list": "D044966:Anti-Retroviral Agents; D000998:Antiviral Agents; D016898:Interferon-alpha; D012254:Ribavirin; D014542:Uridine Monophosphate; D000069474:Sofosbuvir",
"country": "United States",
"delete": false,
"doi": "10.1097/QAI.0000000000000516",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1525-4135",
"issue": "68(5)",
"journal": "Journal of acquired immune deficiency syndromes (1999)",
"keywords": null,
"medline_ta": "J Acquir Immune Defic Syndr",
"mesh_terms": "D000328:Adult; D000368:Aged; D000818:Animals; D044966:Anti-Retroviral Agents; D000998:Antiviral Agents; D015331:Cohort Studies; D004347:Drug Interactions; D005260:Female; D005838:Genotype; D015658:HIV Infections; D016174:Hepacivirus; D019698:Hepatitis C, Chronic; D006801:Humans; D016898:Interferon-alpha; D008297:Male; D008875:Middle Aged; D012254:Ribavirin; D000069474:Sofosbuvir; D016896:Treatment Outcome; D014542:Uridine Monophosphate; D019562:Viral Load",
"nlm_unique_id": "100892005",
"other_id": null,
"pages": "543-9",
"pmc": null,
"pmid": "25622055",
"pubdate": "2015-04-15",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Sofosbuvir for chronic hepatitis C virus infection genotype 1-4 in patients coinfected with HIV.",
"title_normalized": "sofosbuvir for chronic hepatitis c virus infection genotype 1 4 in patients coinfected with hiv"
} | [
{
"companynumb": "PR-CIPLA LTD.-2015PR03349",
"fulfillexpeditecriteria": "1",
"occurcountry": "PR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SOFOSBUVIR"
},
"drugadditional": null,
... |
{
"abstract": "The main clinical manifestations of anti-N-methyl-D-aspartate receptor (anti-NMDAR) encephalitis are acute or subacute seizures, cognition impairment, and psychiatric symptoms. Nowadays, the scheme of antipsychotic therapy for this disease has not been established. This study reports three cases of anti-NMDAR encephalitis with psychiatric symptoms. The anti-NMDAR antibodies in cerebrospinal fluid (CSF) and serum were positive. The psychiatric symptoms still existed after intravenous immunoglobulin (IVIG) treatment; thus, clozapine was used for antipsychotic therapy. Case 1 was a 37-year-old man who suffered from bad mood and suicide behaviors for 1 month. Hallucination and delusion still existed after IVIG treatment and hormone therapy, and the symptoms were relieved when given clozapine for 12 months. Case 2 was a 28-year-old man who was admitted to our hospital due to injuring other people and destructive behaviors for 2 days. He showed irritability, bad temper, declined cognition, and severe delusion of persecution after IVIG treatment and hormone therapy, but the psychiatric symptoms disappeared when given clozapine for 3 months. Case 3 was a 23-year-old man who suffered from headache and babbing for 7 days. Symptoms such as irritability, bad temper, babbing, and injuring other people still existed after IVIG treatment and hormone therapy, but they disappeared when given clozapine for 2 months. Therefore, we suggest that during the treatment of anti-NMDAR encephalitis with psychiatric symptoms, if the anti-NMDAR antibodies in CSF and serum were positive, and psychiatric symptoms could not be controlled after IVIG and hormone therapy, clozapine may work.",
"affiliations": "Department of Psychiatry, Hunan Brain Hospital, Clinical Medical School, Hunan University of Chinese Medicine, Changsha, China.;Provincial Key Laboratory of TCM Diagnostics, Hunan University of Chinese Medicine, Changsha, China.;Provincial Key Laboratory of TCM Diagnostics, Hunan University of Chinese Medicine, Changsha, China.;Department of Psychiatry, Hunan Brain Hospital, Clinical Medical School, Hunan University of Chinese Medicine, Changsha, China.;Department of Psychiatry, Hunan Brain Hospital, Clinical Medical School, Hunan University of Chinese Medicine, Changsha, China.;Department of Psychiatry, Hunan Brain Hospital, Clinical Medical School, Hunan University of Chinese Medicine, Changsha, China.;Department of Psychiatry, Hunan Brain Hospital, Clinical Medical School, Hunan University of Chinese Medicine, Changsha, China.;Shanghai Institute of Measurement and Testing Technology, Shanghai, China.;Provincial Key Laboratory of TCM Diagnostics, Hunan University of Chinese Medicine, Changsha, China.;Provincial Key Laboratory of TCM Diagnostics, Hunan University of Chinese Medicine, Changsha, China.",
"authors": "Yang|Ping|P|;Li|Liang|L|;Xia|Shuaishuai|S|;Zhou|Bin|B|;Zhu|Yong|Y|;Zhou|Gaoya|G|;Tu|Erwen|E|;Huang|Tianhao|T|;Huang|Huiyong|H|;Li|Feng|F|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3389/fnins.2019.00315",
"fulltext": "\n==== Front\nFront NeurosciFront NeurosciFront. Neurosci.Frontiers in Neuroscience1662-45481662-453XFrontiers Media S.A. 10.3389/fnins.2019.00315NeuroscienceCase ReportEffect of Clozapine on Anti-N-Methyl-D-Aspartate Receptor Encephalitis With Psychiatric Symptoms: A Series of Three Cases Yang Ping 1†Li Liang 2†Xia Shuaishuai 2Zhou Bin 1Zhu Yong 1Zhou Gaoya 1Tu Erwen 1Huang Tianhao 3Huang Huiyong 2*‡Li Feng 24*‡1Department of Psychiatry, Hunan Brain Hospital, Clinical Medical School, Hunan University of Chinese Medicine, Changsha, China2Provincial Key Laboratory of TCM Diagnostics, Hunan University of Chinese Medicine, Changsha, China3Shanghai Institute of Measurement and Testing Technology, Shanghai, China4School of Dentistry, University of California, Los Angeles, Los Angeles, CA, United StatesEdited by: Pei Jiang, Jining Medical University, China\n\nReviewed by: Chen Zhang, Shanghai Mental Health Center (SMHC), China; Outi Mantere, McGill University, Canada\n\n*Correspondence: Huiyong Huang, huanghy68@126.com Feng Li, fengli787@qq.com†These authors have contributed equally to this work\n\n‡These authors have contributed equally to this work and share senior authorship\n\nThis article was submitted to Neuropharmacology, a section of the journal Frontiers in Neuroscience\n\n09 4 2019 2019 13 31530 11 2018 19 3 2019 Copyright © 2019 Yang, Li, Xia, Zhou, Zhu, Zhou, Tu, Huang, Huang and Li.2019Yang, Li, Xia, Zhou, Zhu, Zhou, Tu, Huang, Huang and LiThis is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.The main clinical manifestations of anti-N-methyl-D-aspartate receptor (anti-NMDAR) encephalitis are acute or subacute seizures, cognition impairment, and psychiatric symptoms. Nowadays, the scheme of antipsychotic therapy for this disease has not been established. This study reports three cases of anti-NMDAR encephalitis with psychiatric symptoms. The anti-NMDAR antibodies in cerebrospinal fluid (CSF) and serum were positive. The psychiatric symptoms still existed after intravenous immunoglobulin (IVIG) treatment; thus, clozapine was used for antipsychotic therapy. Case 1 was a 37-year-old man who suffered from bad mood and suicide behaviors for 1 month. Hallucination and delusion still existed after IVIG treatment and hormone therapy, and the symptoms were relieved when given clozapine for 12 months. Case 2 was a 28-year-old man who was admitted to our hospital due to injuring other people and destructive behaviors for 2 days. He showed irritability, bad temper, declined cognition, and severe delusion of persecution after IVIG treatment and hormone therapy, but the psychiatric symptoms disappeared when given clozapine for 3 months. Case 3 was a 23-year-old man who suffered from headache and babbing for 7 days. Symptoms such as irritability, bad temper, babbing, and injuring other people still existed after IVIG treatment and hormone therapy, but they disappeared when given clozapine for 2 months. Therefore, we suggest that during the treatment of anti-NMDAR encephalitis with psychiatric symptoms, if the anti-NMDAR antibodies in CSF and serum were positive, and psychiatric symptoms could not be controlled after IVIG and hormone therapy, clozapine may work.\n\nclozapineanti-NMDA receptor encephalitispsychiatric symptomsantipsychotic therapyintravenous immunoglobulinhormoneNational Natural Science Foundation of China10.13039/5011000018098160351281874429\n==== Body\nIntroduction\nAnti-N-methyl-D-aspartate receptor (anti-NMDAR) encephalitis is an autoimmune encephalitis induced by anti-NMDAR (Jiang et al., 2018). Dalmau et al. (2007) reported anti-NMDAR as the pathogenic antibody and diagnostic marker of this disease in 2007. Since then, the number of newly diagnosed cases has increased year by year (Beecher et al., 2018). At present, anti-NMDAR encephalitis has become a representative in the disease spectrum of autoimmune encephalitis. The number of newly diagnosed cases of anti-NMDAR encephalitis has exceeded that of enterovirus encephalitis and herpes simplex encephalitis (Gable et al., 2012). It often combined with psychiatric symptoms, such as severe hallucination, delusion, and aggressive behaviors (Warren et al., 2018). However, there is no standard treatment for encephalitis with psychiatric symptoms, which brings serious risks and burdens to society and families. This study reported three cases of anti-NMDAR encephalitis with psychiatric symptoms. The anti-NMDAR antibodies were positive in their cerebrospinal fluid (CSF) and blood. All of them were treated with clozapine in our hospital.\n\nCase Report\nCase 1\nA 37-year-old male peasant presented with a 4-week history of low spirit, bad mood, suicide behaviors, and suspicion prior to hospitalization. He was diagnosed with severe depression and received sertraline (50–100 mg) and olanzapine (10 mg), but the situation became worse with declined cognition function and epileptic seizures after 7 days of treatment. The CSF pressure was 240 cmH2O and leukocyte count was 10 × 106/L. The anti-NMDAR antibodies in CSF and serum were 1:32 (Figure 1A,B). Initial electroencephalography (EEG) showed epileptic activity with sharp-slow waves in the right anterior frontotemporal region (Figure 2). The chest and abdomen were detected with B-ultrasound and CT to exclude tumor. He received intravenous immunoglobulin (IVIG; 25 g/day, 5 days), methylprednisolone (1,000 mg, 3 days + 500 mg, 3 days), and prednisolone (0–60 mg, 12 weeks) for two courses; levetiracetam (1,500 mg, bid) and valproic acid (500 mg, bid) were used to control epilepsy. The patient showed severe heart failure and respiratory failure, with persistent psychiatric symptoms, such as visual hallucination, auditory hallucination, and delusion. When given olanzapine (10–20 mg/day, 3 days) and aripiprazole (2.5–10 mg/day, 7 days), these psychiatric symptoms could not be alleviated. Aggressive behaviors occurred when given olanzapine; muscle stiffness and slurred speech occurred when given aripiprazole. After cessation of olanzapine and aripiprazole, the use of clonazepam (2 mg, bid) led to clinical improvement. Thus, he was sedated with midazolam (2–4 mg/h, 45 days) during the period he was in the intensive care unit (ICU). The patient received quetiapine (50 mg/day to 0.4 g/day, 30 days) and clonazepam (2–6 mg/day, 35 days) from the ICU, but he still had severe visual hallucination and auditory hallucination after 6 months of treatment. Positive and Negative Syndrome Scale (PANSS) total score (Kay et al., 1987) was 112. The anti-NMDAR antibodies in CSF and serum were 1:10 and 1:320, respectively (Figure 1C,D), and the antibodies against AMPA1, AMPA2, LGI1, CASPR2, and GABAb were negative (Suh-Lailam et al., 2013). Head-enhanced magnetic resonance imaging (MRI) showed encephalatrophy (Figure 3A,B), and no epileptic waves were found in EEG. Then, he was given clozapine (50–300 mg/day), with 218.8 ng/ml plasma concentration (Figure 4A; Zhou et al., 2004). Meanwhile, he was still treated with valproic acid (500 mg, bid) for epilepsy control. Eighteen months later, the anti-NMDAR antibodies in CSF and serum were 1:10 and 1:32 (Figure 1E,F), respectively. Up to now, the patient was able to live and work normally, with stable situation and no psychiatric symptoms. PANSS total score was 26.\n\nFIGURE 1 The anti-NMDA receptor (anti-NMDAR) antibodies in CSF (A,C,E,G,I) and serum (B,D,F,H,J). (A,B) Initial day in case 1. (C,D) Before treatment of clozapine in case 1. (E,F) After 18-month treatment of clozapine in case 1. (G,H) Before treatment of clozapine in case 2. (I,J) Before treatment of clozapine in case 3.\n\nFIGURE 2 Initial electroencephalography (EEG) in case 1. EEG showed moderate slow-wave discharge, with medium-wave amplitude, appearing as a single emission or continuous occurrence in right sphenoidal electrode, frontal pole, frontal, and pretemporal regions.\n\nFIGURE 3 Results of head MRI. (A,B) Head MRI showed encephalatrophy in case 1. (C,D) Head MRI showed long T1 and long T2 signal intensities in the left temporal lobe, and enhanced MRI stated irregular light enhancement in case 2. (A,C) T2WI; (B,D) T1-weighted sequence after gadolinium enhancement.\n\nFIGURE 4 Clozapine plasma concentration. (A) Plasma concentration was 218.8 ng/ml in case 1. (B) Plasma concentration was 90.6 ng/ml in case 2. (C) Plasma concentration was 65.3 ng/ml in case 3. Asterisks (∗) represent the chromatogram peak of clozapine.\n\nCase 2\nA 28-year-old male painter suffered from behavioral changes for 1 week after flu prior to hospitalization to the ICU of the local hospital. Head MRI showed long T1 and long T2 signal intensities in the left temporal lobe, and enhanced MRI showed irregular light enhancement (Figure 3C,D). The anti-NMDAR antibodies in CSF and serum were negative. With the diagnosis of viral encephalitis, the patient received antiviral therapy for 35 days, together with methylprednisolone (1,000 mg, 3 days + 500 mg, 3 days) and prednisolone (35–60 mg, 30 days). Then, he left the hospital. Unfortunately, he was admitted to our hospital 2 days after his discharge due to aggressive behaviors, injuring other people, irritability, and severe delusion of persecution. He was given acyclovir and olanzapine (10–20 mg/day), but the symptoms deteriorated with severe violent behavior and declined cognition function after 7 days of treatment. The CSF pressure was 200 cmH2O. Total cell count was 58 × 106/L, and leukocyte count was 38 × 106/L. The anti-NMDAR antibodies in CSF and serum were both 1:10 (Figure 1G,H), and the antibodies against AMPA1, AMPA2, LGI1, CASPR2, and GABAb were negative (Suh-Lailam et al., 2013). The chest and abdomen were detected with B-ultrasound and CT to exclude tumor. After treatment with IVIG (30 g/day, 5 days), methylprednisolone (1,000 mg, 3 days + 500 mg, 3 days), and prednisolone (0–60 mg, 12 weeks), the psychiatric symptoms became worse; even olanzapine (10–20 mg/day, 15 days), quetiapine (25–400 mg/day, 15 days), diazepam (5–10 mg/day, 15 days), and clonazepam (2–6 mg/day, 15 days) did not work. PANSS total score (Kay et al., 1987) was 103. Finally, the patient was given clozapine (25–300 mg/day), with 90.6 ng/ml plasma concentration (Figure 4B; Zhou et al., 2004), and all the psychiatric symptoms disappeared completely 3 months later. The patient was discharged. Followed up for 6 months, all the clinical symptoms disappeared. The anti-NMDAR antibodies in CSF and serum were negative, but no obvious changes could be observed in enhanced head MRI. PANSS total score was 21.\n\nCase 3\nA 23-year-old male student was admitted to the local hospital due to headache, babbing, and aggressive behaviors for 1 week. After 7 days of treatment with penicillin and acyclovir, the symptoms were not relieved and then he was transferred to our hospital. No abnormality was found in enhanced head MRI. The CSF pressure was 100 cmH2O. Total cell count and leukocyte count were normal. The protein concentration was 0.46 g/L. The anti-NMDAR antibodies in CSF and serum were 1:1 and 1:10, respectively (Figure 1I,J), and the antibodies against AMPA1, AMPA2, LGI1, CASPR2, and GABAb were negative (Suh-Lailam et al., 2013). The chest and abdomen were detected with B-ultrasound and CT to exclude tumor. PANSS total score (Kay et al., 1987) was 97. After treatment with IVIG (25 g/day, 5 days), methylprednisolone (1,000 mg, 3 days + 500 mg, 3 days), and prednisolone (0–60 mg, 12 weeks), followed by antipsychotic therapy with olanzapine (10–20 mg/day, 15 days), quetiapine (25–400 mg/day, 15 days), and clonazepam (2–4 mg/day, 30 days), the patient still showed visual hallucination and aggressive behaviors. Then, he was given clozapine (50–100 mg/day), with 65.3 ng/ml plasma concentration (Figure 4C; Zhou et al., 2004). The psychiatric symptoms disappeared after 2 months of treatment. Followed up for 6 months, he was able to live and work normally. The anti-NMDAR antibodies in CSF and serum were negative. PANSS total score was 18.\n\nDiscussion\nThe incidence of anti-NMDAR encephalitis is second only to acute disseminated encephalomyelitis in autoimmune encephalitis (Granerod et al., 2010). Anti-NMDAR encephalitis may initially present with multiple psychiatric symptoms, which results in being misdiagnosed as primary psychiatric disease (Dalmau et al., 2008).\n\nA study showed that among 111 anti-NMDAR encephalitis patients, 65 (58.6%) presented various psychiatric features, 43 (38.7%) were admitted initially to a psychiatric unit, and 2 (1.8%) were transferred from other inpatient units to a psychiatric unit before being finally correctly diagnosed (Lejuste et al., 2016). It was reported that catatonia was highly suggestive of NMDAR encephalitis, helping to diagnose anti-NMDAR encephalitis (Mythri and Mathew, 2016). The three patients in this study presented depression and aggressive behaviors, without catatonic syndrome. They were diagnosed with viral encephalitis and primary psychiatric disorder in the early stage, which delayed treatment. Gurrera believed that without appropriate treatment, patients are likely to suffer a protracted course with significant residual disability or death (Gurrera, 2018). At present, there is no formal antipsychotic treatment program for anti-NMDAR encephalitis with psychiatric symptoms. There are only few case reports about this; thus, treatment of such patients becomes more difficult. No specific medicine was found to improve the patient’s psychiatric symptoms. For example, in the two cases reported by Kuppuswamy, olanzapine only worked in one patient, while aggravating the other patient’s mental symptoms (Kuppuswamy et al., 2014). The side effects of some drugs, such as aripiprazole and haloperidol, even worsen the difficulties experienced during treatment (Chapman and Vause, 2011). In case 1, before the use of clozapine, the severe side effects caused by antipsychotics resulted in many extrapyramidal symptoms and serious aggressive behaviors. The dose of the medicine could not be increased gradually as usual, and the treatment had to be interrupted.\n\nIt was reported that NMDAR hypofunction was a potential mechanism resulting in schizophrenia, which complemented the most widespread explanatory mechanism of “dopamine hypothesis” for schizophrenia (Ramanathan et al., 2014). Some scholars declared that NMDAR dysfunction was the “final common pathway” underlying the pathogenesis of schizophrenia, and it was associated with both positive and negative symptoms (Wang et al., 2017). Anti-NMDAR antibodies were also found in schizophrenia patients (Koshiyama et al., 2018; Xie and Huang, 2018). Thus, some researchers believed that schizophrenia and anti-NMDAR encephalitis may have the same underlying mechanism and could be on the same spectrum (Maneta and Garcia, 2014). However, there is not enough proof to date to verify whether they are diseases on the same spectrum or under two different conditions.\n\nThe NMDAR, an ionotropic glutamate receptor, is related to synaptic plasticity, neuronal maturation, study, and memory (Hanson et al., 2015). NMDARs are heteromers of NMDAR1 and NMDAR2 subunits, which bind with glycine and glutamate, respectively (Tachibana et al., 2013). NMDAR hyperfunction is proposed to result in psychosis (Liu et al., 2015). Anti-NMDAR encephalitis represents a state of NMDAR hypofunction caused by autoantibodies against NMDAR (Warikoo et al., 2018). Thus, antipsychotic drugs affecting glutamate should be chosen during the treatment. Studies have shown that clozapine was the first atypical antipsychotic drug created successfully in the late 1960’s. It is a diphenyldiazepine antipsychotic drug, with strong sedative and hypnotic effects, which can directly inhibit the ascending reticular activating system in the brainstem. It can selectively act on the mesencephalic limbic dopamine and the 5-serotonin (5-HT) systems, as well as the muscarinic and α1-noradrenergic receptor systems. Clozapine blocks the dopamine receptors reversibly and increases dopamine retroconversion. It has strong anticholinergic, antisympathetic, and antihistamine effects (Shi et al., 2007). At present, the pharmacological research based on the glutamatergic hypothesis of schizophrenia can go further among all the most promising mechanisms. It was reported that clozapine can affect 5-HT2A and D4 receptors, increase the release of dopamine, and selectively increase the concentration of Glu in the prefrontal cortex ( Lopez-Munoz and Alamo, 2011). Incrocci et al. (2018) stated that the atypical antipsychotic clozapine potently blocked the disruption of the sensorimotor gating induced by NMDA antagonists. Rebollo et al. (2018) found that decreasing hypersynchronization in the local circuit may be one of the mechanisms of clozapine in preventing schizophrenia symptoms derived from NMDA hypofunction.\n\nIn this study, three patients of anti-NMDAR encephalitis with psychiatric symptoms were included. They had aggressive behaviors, even injured other people and destroyed objects. After IVIG treatment and hormone therapy, the use of various antipsychotics, such as midazolam, olanzapine, quetiapine, and aripiprazole, could not alleviate psychiatric symptoms. Olanzapine even aggravated their aggressive behaviors. Some researchers suggested that modern electroconvulsive therapy (MECT) should be used appropriately (Mann et al., 2012; Jones et al., 2015). However, anti-NMDAR encephalitis mainly showed epileptic seizures, status epilepticus, ventilation and air exchange dysfunction, autonomic nervous dysfunction, and multisystem complications. The situation was so serious that the patients had to be treated with intubation and auxiliary ventilation in the ICU. Therefore, MECT was not suitable for them. Furthermore, severe psychiatric symptoms prevented the patients from completing intensive care. In case 1 of this study, intensive care was interrupted due to severe visual and auditory hallucinations. With the improvement of seizure control, ventilation, and air exchange dysfunction, clozapine (300 mg) was used, and the psychiatric symptoms completely disappeared after 1 year of treatment. The patients in cases 2 and 3 showed violence and serious injuring tendency. The aggressive behaviors occurred after treatment of olanzapine, and other antipsychotics such as quetiapine and aripiprazole could not control psychiatric symptoms. In the end, they were given clozapine 300 and 100 mg, respectively, which controlled the symptoms well.\n\nTo sum up, clozapine can be used in the treatment of anti-NMDAR encephalitis with psychiatric symptoms. The disease should be under the control of epilepsy and good ventilation function; otherwise, clozapine may induce epilepsy (Bolu et al., 2017). It may be the reason why many doctors are reluctant to select clozapine. Therefore, when clozapine is used, it is important to monitor the EEG regularly to assess the risk of epilepsy. These three patients received EEG monitoring every month after taking clozapine, and the results were normal. Furthermore, antiepileptics, such as sodium valproate and levetiracetam, should not be ignored if necessary. Clozapine must be used on the basis of the ineffectiveness of three antipsychotics to anti-NMDAR encephalitis, just like the treatment of refractory schizophrenia. In this study, quetiapine and aripiprazole were ineffective to all the patients, and the psychiatric symptoms worsened after olanzapine. It is speculated that the affinity of receptor subtypes is different, and the exact mechanism needs further study.\n\nConclusion\nWe report three cases of anti-NMDAR encephalitis with psychiatric symptoms. During the treatment of the disease, if the psychiatric symptoms could not be controlled after IVIG and hormone therapy, clozapine may work.\n\nEthics Statement\nThis study was approved by the Ethics Committee of the Hunan Brain Hospital. A written informed consent was obtained from the patients for the publication of this case report.\n\nAUTHOR CONTRIBUTIONS\nPY and LL conceived the idea, revised all the literature, and wrote the manuscript. SX, YZ, and GZ collected the clinical data. BZ and TH analyzed and interpreted the head MRI. ET performed and analyzed the EEG. HH and FL contributed to the revision of the manuscript and read and approved the submitted version.\n\nConflict of Interest Statement\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n\nFunding. This work was supported by grants from the National Natural Science Foundation of China (Grant Nos. 81603512 and 81874429), the Hunan Chinese Medicine Science and Research Project (Grant No. 201818), and the Science and Technology Innovation Project of Hunan Province (Grant Nos. 2017SK50317 and 2017SK50313).\n\nThe authors would like to thank the patients and their family members for their cooperation.\n==== Refs\nReferences\nBeecher G. Wagner A. N. Abele J. Smyth P. (2018 ). Teaching neuroimages: prosopagnosia heralding anti-NMDA receptor encephalitis. \nNeurology \n90 \ne2012 –e2013 . 10.1212/WNL.0000000000005611 \n29807927 \nBolu A. Akarsu S. Pan E. Aydemir E. Oznur T. (2017 ). Low-dose clozapine-induced seizure: a case report. \nClin. Psychopharmacol. Neurosci. \n15 \n190 –193 . 10.9758/cpn.2017.15.2.190 \n28449570 \nChapman M. R. Vause H. E. (2011 ). Anti-NMDA receptor encephalitis: diagnosis, psychiatric presentation, and treatment. \nAm. J. Psychiatry \n168 \n245 –251 . 10.1176/appi.ajp.2010.10020181 \n21368306 \nDalmau J. Gleichman A. J. Hughes E. G. Rossi J. E. Peng X. Lai M. (2008 ). Anti-NMDA-receptor encephalitis: case series and analysis of the effects of antibodies. \nLancet Neurol. \n7 \n1091 –1098 . 10.1016/S1474-4422(08)70224-2 18851928 \nDalmau J. Tuzun E. Wu H. Y. Masjuan J. Rossi J. E. Voloschin A. (2007 ). Paraneoplastic anti-N-methyl-D-aspartate receptor encephalitis associated with ovarian teratoma. \nAnn. Neurol. \n61 \n25 –36 . 10.1002/ana.21050 \n17262855 \nGable M. S. Sheriff H. Dalmau J. Tilley D. H. Glaser C. A. (2012 ). The frequency of autoimmune N-methyl-D-aspartate receptor encephalitis surpasses that of individual viral etiologies in young individuals enrolled in the California encephalitis project. \nClin. Infect. Dis. \n54 \n899 –904 . 10.1093/cid/cir1038 \n22281844 \nGranerod J. Ambrose H. E. Davies N. W. Clewley J. P. Walsh A. L. Morgan D. (2010 ). Causes of encephalitis and differences in their clinical presentations in England: a multicentre, population-based prospective study. \nLancet Infect. Dis. \n10 \n835 –844 . 10.1016/S1473-3099(10)70222-X \n20952256 \nGurrera R. J. (2018 ). Frequency and temporal sequence of clinical features in adults with anti-NMDA receptor encephalitis presenting with psychiatric symptoms. \nPsychol. Med. \n10.1017/S0033291718003665 [Epub ahead of print]. 30560745 \nHanson E. Armbruster M. Cantu D. Andresen L. Taylor A. Danbolt N. C. (2015 ). Astrocytic glutamate uptake is slow and does not limit neuronal NMDA receptor activation in the neonatal neocortex. \nGlia \n63 \n1784 –1796 . 10.1002/glia.22844 \n25914127 \nIncrocci R. M. Paliarin F. Nobre M. J. (2018 ). Prelimbic NMDA receptors stimulation mimics the attenuating effects of clozapine on the auditory electrophysiological rebound induced by ketamine withdrawal. \nNeurotoxicology \n69 \n1 –10 . 10.1016/j.neuro.2018.08.013 \n30170016 \nJiang N. Guan H. Lu Q. Ren H. Peng B. (2018 ). Features and prognostic value of quantitative electroencephalogram changes in critically ill and non-critically ill anti-NMDAR encephalitis patients: a pilot study. \nFront. Neurol. \n9 :833 . 10.3389/fneur.2018.00833 \n30344506 \nJones K. C. Schwartz A. C. Hermida A. P. (2015 ). Kahn DA. A case of anti-NMDA receptor encephalitis treated with ECT. \nJ. Psychiatr. Pract. \n21 \n374 –380 . 10.1097/PRA.0000000000000100 \n26348805 \nKay S. R. Fiszbein A. Opler L. A. (1987 ). The positive and negative syndrome scale (PANSS) for schizophrenia. \nSchizophr. Bull. \n13 \n261 –276 . 10.1093/schbul/13.2.261 3616518 \nKoshiyama D. Kirihara K. Tada M. Nagai T. Fujioka M. Ichikawa E. (2018 ). Electrophysiological evidence for abnormal glutamate-GABA association following psychosis onset. \nTransl. Psychiatry \n8 :211 . 10.1038/s41398-018-0261-0 \n30297786 \nKuppuswamy P. S. Takala C. R. Sola C. L. (2014 ). Management of psychiatric symptoms in anti-NMDAR encephalitis: a case series, literature review and future directions. \nGen. Hosp. Psychiatry \n36 \n388 –391 . 10.1016/j.genhosppsych.2014.02.010 \n24731834 \nLejuste F. Thomas L. Picard G. Desestret V. Ducray F. Rogemond V. (2016 ). Neuroleptic intolerance in patients with anti-NMDAR encephalitis. \nNeurol. Neuroimmunol. Neuroinflamm. \n3 :e280 . 10.1212/NXI.0000000000000280 \n27606355 \nLiu H. Jian M. Liang F. Yue H. Han R. (2015 ). Anti-N-methyl-D-aspartate receptor encephalitis associated with an ovarian teratoma: two cases report and anesthesia considerations. \nBMC Anesthesiol. \n15 :150 . 10.1186/s12871-015-0134-5 \n26475263 \nLopez-Munoz F. Alamo C. (2011 ). Neurobiological background for the development of new drugs in schizophrenia. \nClin. Neuropharmacol. \n34 \n111 –126 . 10.1097/WNF.0b013e318215c2f7 \n21586917 \nManeta E. Garcia G. (2014 ). Psychiatric manifestations of anti-NMDA receptor encephalitis: neurobiological underpinnings and differential diagnostic implications. \nPsychosomatics \n55 \n37 –44 . 10.1016/j.psym.2013.06.002 \n23932531 \nMann A. Machado N. M. Liu N. Mazin A. H. Silver K. Afzal K. I. (2012 ). A multidisciplinary approach to the treatment of anti-NMDA-receptor antibody encephalitis: a case and review of the literature. \nJ. Neuropsychiatry Clin. Neurosci. \n24 \n247 –254 . 10.1176/appi.neuropsych.11070151 \n22772674 \nMythri S. V. Mathew V. (2016 ). Catatonic syndrome in anti-NMDA receptor encephalitis. \nIndian J. Psychol. Med. \n38 \n152 –154 . 10.4103/0253-7176.178812 \n27114630 \nRamanathan S. Mohammad S. S. Brilot F. Dale R. C. (2014 ). Autoimmune encephalitis: recent updates and emerging challenges. \nJ. Clin. Neurosci. \n21 \n722 –730 . 10.1016/j.jocn.2013.07.017 \n24246947 \nRebollo B. Perez-Zabalza M. Ruiz-Mejias M. Perez-Mendez L. Sanchez-Vives M. V. (2018 ). Beta and gamma oscillations in prefrontal cortex during NMDA hypofunction: an in vitro model of schizophrenia features. \nNeuroscience \n383 \n138 –149 . 10.1016/j.neuroscience.2018.04.035 \n29723576 \nShi W. X. Zhang X. Y. Pun C. L. Bunney B. S. (2007 ). Clozapine blocks D-amphetamine-induced excitation of dopamine neurons in the ventral tegmental area. \nNeuropsychopharmacology \n32 \n1922 –1928 . 10.1038/sj.npp.1301334 \n17299514 \nSuh-Lailam B. B. Haven T. R. Copple S. S. Knapp D. Jaskowski T. D. Tebo A. E. (2013 ). Anti-NMDA-receptor antibody encephalitis: performance evaluation and laboratory experience with the anti-NMDA-receptor IgG assay. \nClin. Chim. Acta \n421 \n1 –6 . 10.1016/j.cca.2013.02.010 \n23454475 \nTachibana N. Kinoshita M. Saito Y. Ikeda S. (2013 ). Identification of the N-methyl-D-aspartate receptor (NMDAR)-related epitope, NR2B, in the normal human ovary: implication for the pathogenesis of anti-NMDAR encephalitis. \nTohoku J. Exp. Med. \n230 \n13 –16 . 10.1620/tjem/230.13 \n23648631 \nWang J. Zhang B. Zhang M. Chen J. Deng H. Wang Q. (2017 ). Comparisons between psychiatric symptoms of patients with anti-NMDAR encephalitis and new-onset psychiatric patients. \nNeuropsychobiology \n75 \n72 –80 . 10.1159/000480514 \n29065417 \nWarikoo N. Brunwasser S. J. Benz A. Shu H. J. Paul S. M. Lewis M. (2018 ). Positive allosteric modulation as a potential therapeutic strategy in anti-NMDA receptor encephalitis. \nJ. Neurosci. \n38 \n3218 –3229 . 10.1523/JNEUROSCI.3377-17.2018 \n29476014 \nWarren N. Siskind D. O’Gorman C. (2018 ). Refining the psychiatric syndrome of anti-N-methyl-d-aspartate receptor encephalitis. \nActa Psychiatr. Scand. \n138 \n401 –408 . 10.1111/acps.12941 \n29992532 \nXie Y. Huang X. F. (2018 ). Commentary: GLYX-13 ameliorates schizophrenia-like phenotype induced by MK-801 in mice: role of hippocampal NR2B and DISC1. \nFront. Mol. Neurosci. \n11 :315 . 10.3389/fnmol.2018.00315 \n30233316 \nZhou Z. Li X. Li K. Xie Z. Cheng Z. Peng W. (2004 ). Simultaneous determination of clozapine, olanzapine, risperidone and quetiapine in plasma by high-performance liquid chromatography-electrospray ionization mass spectrometry. \nJ. Chromatogr. B Analyt. Technol. Biomed. Life Sci. \n802 \n257 –262 . 10.1016/j.jchromb.2003.11.037 \n15018785\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1662-453X",
"issue": "13()",
"journal": "Frontiers in neuroscience",
"keywords": "anti-NMDA receptor encephalitis; antipsychotic therapy; clozapine; hormone; intravenous immunoglobulin; psychiatric symptoms",
"medline_ta": "Front Neurosci",
"mesh_terms": null,
"nlm_unique_id": "101478481",
"other_id": null,
"pages": "315",
"pmc": null,
"pmid": "31024238",
"pubdate": "2019",
"publication_types": "D016428:Journal Article",
"references": "15018785;17262855;17299514;18851928;20952256;21368306;21586917;22281844;22772674;23454475;23648631;23932531;24246947;24731834;25914127;26348805;26475263;27114630;27606355;28449570;29065417;29476014;29723576;29807927;29992532;30170016;30233316;30297786;30344506;30560745;3616518",
"title": "Effect of Clozapine on Anti-N-Methyl-D-Aspartate Receptor Encephalitis With Psychiatric Symptoms: A Series of Three Cases.",
"title_normalized": "effect of clozapine on anti n methyl d aspartate receptor encephalitis with psychiatric symptoms a series of three cases"
} | [
{
"companynumb": "CN-DRREDDYS-USA/CHN/19/0112921",
"fulfillexpeditecriteria": "2",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ARIPIPRAZOLE"
},
"drugadditional": "3",
... |
{
"abstract": "Pulmonary hypertension is the commonest condition leading to dilated pulmonary artery. We describe three different types of compression of adjacent anatomical structures by dilated pulmonary arteries. We included involvement of the left main coronary artery, left recurrent laryngeal nerve and tracheobronchial tree. Compression of these structures can cause major complications such as myocardial ischemia, hoarseness and major airway stenosis. We present a case for each scenario and review the literature for each of these complications, focusing on patients' characteristics and contemporary management.",
"affiliations": "a Department of Pulmonary, Allergy and Critical Care Medicine, Respiratory Institute , Cleveland Clinic , Cleveland , OH , USA.;a Department of Pulmonary, Allergy and Critical Care Medicine, Respiratory Institute , Cleveland Clinic , Cleveland , OH , USA.",
"authors": "Dakkak|Wael|W|;Tonelli|Adriano R|AR|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1080/00325481.2016.1157442",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0032-5481",
"issue": "128(5)",
"journal": "Postgraduate medicine",
"keywords": "Dilated pulmonary artery; left main coronary artery; left recurrent laryngeal nerve; pulmonary hypertension; tracheobronchial tree",
"medline_ta": "Postgrad Med",
"mesh_terms": "D000328:Adult; D000368:Aged; D001982:Bronchial Diseases; D003251:Constriction, Pathologic; D017023:Coronary Angiography; D023921:Coronary Stenosis; D004108:Dilatation, Pathologic; D005260:Female; D006801:Humans; D008279:Magnetic Resonance Imaging; D008875:Middle Aged; D009408:Nerve Compression Syndromes; D011651:Pulmonary Artery; D012009:Recurrent Laryngeal Nerve; D014057:Tomography, X-Ray Computed",
"nlm_unique_id": "0401147",
"other_id": null,
"pages": "451-9",
"pmc": null,
"pmid": "26898826",
"pubdate": "2016-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": "5933796;1184052;20200637;22030961;12860221;14896447;11290495;22748904;7438411;2408809;8481580;14880023;11790711;23600433;18206638;23424588;13819416;23831302;126321;8417525;10190427;12656557;6824533;15740965;3605900;11855158;19497900;22858290;20506194;3579390;18669791;23271814;23286969;8498323;22565536;16176077;18180532;22797193;24973850;15426692;25406836;22483622;19022030;15657218;17384825;16495602;11146522;15893189;11591592;15006585;7644299;17200448;9315824;1495309;7875705;9377941;20552652;17311829;3973279;9659503;12948042;26153448;4238844;22782942;19174601;19416787;15274855;5078011",
"title": "Compression of adjacent anatomical structures by pulmonary artery dilation.",
"title_normalized": "compression of adjacent anatomical structures by pulmonary artery dilation"
} | [
{
"companynumb": "US-UNITED THERAPEUTICS-UNT-2016-003557",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TREPROSTINIL"
},
"drugadditional... |
{
"abstract": "Based upon the clinical behavior of three patients, we suggest that the combination of low-dose Ara-C and all-trans retinoic acid may potentially be effective in some elderly patients, unfit for intensive chemotherapy, affected with NPM1-mutated acute myeloid leukemia without FLT3 mutations, warranting perspective clinical studies in these selected patients.",
"affiliations": "Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.;Department of Hematology University Tor Vergata Rome Italy.;Institute of Hematology CREO (Centro di Ricerca Emato-Oncologico) Ospedale S. Maria della Misericordia, S. Andrea delle Fratte University of Perugia Perugia Italy.;Institute of Hematology CREO (Centro di Ricerca Emato-Oncologico) Ospedale S. Maria della Misericordia, S. Andrea delle Fratte University of Perugia Perugia Italy.;Department of Biomedicine and Prevention University Tor Vergata Rome Italy.;Department of Hematology University Tor Vergata Rome Italy.;Department Medical and Surgical Sciences Section of Hematology Azienda Ospedaliero-Universitaria Policlinico University of Modena and Reggio Emilia Modena Italy.",
"authors": "Forghieri|Fabio|F|;Bigliardi|Sara|S|;Quadrelli|Chiara|C|;Morselli|Monica|M|;Potenza|Leonardo|L|;Paolini|Ambra|A|;Colaci|Elisabetta|E|;Barozzi|Patrizia|P|;Zucchini|Patrizia|P|;Riva|Giovanni|G|;Vallerini|Daniela|D|;Lagreca|Ivana|I|;Marasca|Roberto|R|;Narni|Franco|F|;Venditti|Adriano|A|;Martelli|Maria Paola|MP|;Falini|Brunangelo|B|;Lo Coco|Francesco|F|;Amadori|Sergio|S|;Luppi|Mario|M|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1002/ccr3.723",
"fulltext": "\n==== Front\nClin Case RepClin Case Rep10.1002/(ISSN)2050-0904CCR3Clinical Case Reports2050-0904John Wiley and Sons Inc. Hoboken 10.1002/ccr3.723CCR3723Case ReportCase ReportsAll‐trans retinoic acid (ATRA) in non‐promyelocytic acute myeloid leukemia (AML): results of combination of ATRA with low‐dose Ara‐C in three elderly patients with NPM1‐mutated AML unfit for intensive chemotherapy and review of the literature F. Forghieri et al.Forghieri Fabio fabio.forghieri@unimore.it \n1\nBigliardi Sara \n1\nQuadrelli Chiara \n1\nMorselli Monica \n1\nPotenza Leonardo \n1\nPaolini Ambra \n1\nColaci Elisabetta \n1\nBarozzi Patrizia \n1\nZucchini Patrizia \n1\nRiva Giovanni \n1\nVallerini Daniela \n1\nLagreca Ivana \n1\nMarasca Roberto \n1\nNarni Franco \n1\nVenditti Adriano \n2\nMartelli Maria Paola \n3\nFalini Brunangelo \n3\nLo Coco Francesco \n4\nAmadori Sergio \n2\nLuppi Mario mario.luppi@unimore.it \n1\n1 Department Medical and Surgical SciencesSection of HematologyAzienda Ospedaliero‐Universitaria PoliclinicoUniversity of Modena and Reggio EmiliaModenaItaly2 Department of HematologyUniversity Tor VergataRomeItaly3 Institute of HematologyCREO (Centro di Ricerca Emato‐Oncologico)Ospedale S. Maria della Misericordia, S. Andrea delle FratteUniversity of PerugiaPerugiaItaly4 Department of Biomedicine and PreventionUniversity Tor VergataRomeItaly* Correspondence\n\nFabio Forghieri and Mario Luppi\n\nDepartment of Medical and Surgical Sciences, Azienda Ospedaliero‐Universitaria Policlinico di Modena, University of Modena and Reggio Emilia, Via del Pozzo 71, 41124 Modena, Italy. Tel: 39 059 4222447 (FF); 39 059 4225570 (ML); Fax: 39 059 4222386; E‐mails: fabio.forghieri@unimore.it and mario.luppi@unimore.it\n24 10 2016 12 2016 4 12 10.1002/ccr3.2016.4.issue-121138 1146 05 7 2016 25 9 2016 30 9 2016 © 2016 The Authors. Clinical Case Reports published by John Wiley & Sons Ltd.This is an open access article under the terms of the Creative Commons Attribution‐NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.Key Clinical Message\nBased upon the clinical behavior of three patients, we suggest that the combination of low‐dose Ara‐C and all‐trans retinoic acid may potentially be effective in some elderly patients, unfit for intensive chemotherapy, affected with NPM1‐mutated acute myeloid leukemia without FLT3 mutations, warranting perspective clinical studies in these selected patients.\n\nAll‐trans retinoic acidelderly patientslow‐dose Ara‐CNPM1‐mutated acute myeloid leukemiaunfitness for intensive chemotherapy source-schema-version-number2.0component-idccr3723cover-dateDecember 2016details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_NLMPMC version:4.9.8 mode:remove_FC converted:01.12.2016FF, SB, and CQ contributed equally to this work.\n==== Body\nIntroduction\nThe addition of pharmacological doses of all‐trans retinoic acid (ATRA) to chemotherapy has clearly revolutionized the clinical outcome of acute promyelocytic leukemia (APL) 1. In vitro observations have also suggested that exposure to ATRA may sensitize both non‐APL acute myeloid leukemia (AML) cell lines and primary cells to cytotoxic agents, such as Ara‐C and anthracyclines, thereby increasing either differentiation or apoptosis, by down‐regulation of Bcl2 and related proteins 1, 2. Based upon these preclinical data demonstrating a synergistic effect of ATRA combined with chemotherapy, several clinical studies, including large randomized trials (Table S1), have investigated the impact of adding ATRA to either remission induction chemotherapy or lower intensity regimens in patients with non‐APL AML, but these studies have overall yielded inconsistent and conflicting results 1. However, making direct comparisons between studies reporting discrepant clinical outcomes is difficult because of different patient age, leukemia characteristics, chemotherapy regimens and schedule of ATRA administration 1, 3, 4, 5.\n\nLow‐dose Ara‐C (LDAC) has been widely used with different schedules within phase II trials for elderly patients with AML considered unfit for intensive chemotherapy, obtaining complete remission (CR) in about 20% of cases, but with unsatisfactory two‐year overall survival (OS) rates of approximately 10% 2. LDAC has become the prototype for low‐intensity chemotherapy after the randomized trial by Burnett et al. in which LDAC produced higher CR rate (18% vs. 1%) and better OS, when compared to palliative hydroxyurea 2. However, median OS (5 months) was still poor for the LDAC cohort and survival advantage was not recorded for patients with adverse cytogenetics, in whom CR was never achieved. Moreover, in this study, the addition of ATRA to either of the treatment arms had no beneficial effect on OS 2. Conversely, some previous studies had shown positive effects of combining ATRA with LDAC, also in poor risk patients with AML unsuitable for aggressive chemotherapy 6, 7. Venditti et al. reported a high CR rate (48%) in 33 patients with poor prognosis AML, either at disease onset or relapsed/refractory 6. Moreover, in the retrospective study on 28 patients by Di Febo et al., a significant improvement in OS was observed, compared with LDAC alone, although the combination treatment did not increase the CR rate 7. Unfortunately, none of these studies focused on the presence of NPM1 gene mutations in leukemic cells 2, 6, 7. Of note, retrospective molecular examinations on archival samples would potentially be of interest in order to precisely evaluate the clinical impact of ATRA combined with LDAC in specific molecular subgroups of unfit patients with AML 2, 6, 7.\n\nCase Reports\nWe report on three elderly patients affected with cytogenetically normal NPM1‐mutated AML, without FLT3 and IDH1‐R132 mutations, considered unfit for intensive chemotherapy, because of advanced age and/or comorbidities (Table 1), who received moderate intensity treatment consisting of LDAC combined with ATRA. Patients have been hospitalized at AML diagnosis and received the first treatment course as inpatients. In details, LDAC 20 mg was administered subcutaneously twice daily on days 1–10, while ATRA 45 mg/m2/day was given orally for 60 days (from day +3 to +62). Patients 1, 2, and 3 have spent 24, 22, and 20 days in the hospital, respectively, thereafter they were discharged and safely managed in an outpatient setting. Subsequent LDAC cycles have been administered, after intervals of 4 weeks, while each subsequent ATRA course has been started after 1 month interval (e.g., second ATRA course starting from day +3 of the fourth LDAC cycle). After two LDAC cycles combined with one ATRA course, morphologic CR was documented on bone marrow (BM) aspirate in patients 1 and 3, whereas in patient 2, BM aspirate was unfortunately not performed. However, in this latter patient, normal WBC and platelet counts, without circulating blasts, were obtained, with a concurrent reduction of RBC transfusion requirement. Unfortunately, on day +6 of the fourth LDAC cycle, disease progression was observed with WBC count 64.8 × 109/L and 70% circulating blasts, Hb 8.1 g/dL, Plt count 12 × 109/L. The patient died a few days later, 5 months since AML diagnosis. Patient 1 underwent nine LDAC cycles combined with three ATRA courses without experiencing any complication; then, treatment was withdrawn, while persisting morphologic CR. However, 9 months after therapy interruption, leukemia relapsed with circulating and BM blast counts 2% and 15%, respectively. Retreatment with the same previously administered cytotoxic regimen was attempted. The patient then received LDAC (four cycles) and ATRA (two courses) and 2 months after initiation of therapy, full hematologic recovery was documented, concurrently with a reduction in BM blast count (5–10%). However, the patient subsequently suffered from pneumonia, sinusitis and hematuria secondary to bladder mucosal lesions, with successive occurrence of pancytopenia, and died 8 and 26 months after relapse and first AML diagnosis, respectively. Patient 3 showed transient grade 2 gastrointestinal toxicity during first LDAC cycle, without any further relevant toxicity, until leukemia relapse was documented while receiving the tenth LDAC and third ATRA courses, respectively. He died a few weeks later, 11 months since initial diagnosis. Unfortunately, we have not measured quality of life (QoL) with validated instruments in these three patients.\n\nTable 1 Clinical characteristics of three elderly patients with NPM1‐mutated AML not eligible for intensive chemotherapy\n\nPt\tAge (years)/Sex\tComorbidities\tPS (ECOG score)\tCBC at diagnosis (WBC/Plt counts x 109/L/Hb g/dL)\tLDH level at diagnosis (IU/L)\tPB/BM blasts at diagnosis (%)\tImmunophenotype of myeloid blasts\tCytogenetics\t\nNPM1/FLT3/IDH1‐R132 mutational status on molecular examinations\tPrognostic scores, according to Wheatley et al. 23/Rollig et al. 20\n\tNo. of cycles LDAC/ATRA\tCR/DFS (months)/OS (months)\t\n1\t77/M\tProstatic carcinoma, peripheral neuropathy\t1\t1.5/121/11.4\t293\t2/40\tCD34−, CD117−/+, CD33+, CD15+, CD13+, CD14−, CD64+, CD38+, DR−/+, CD11b+/−, CD66b+/−\tNormal karyotype\tMutated/WT/WT\tScore 8, standard risk/Score 1, good intermediate risk\tNine cycles of LDAC, combined with three ATRA courses, then withdrawal. Subsequently, at relapse, four cycles of LDAC, combined with two ATRA courses..\tYes/16/26\t\n2\t72/F\tArterial hypertension, hypothyroidism, depression, dementia\t3\t6.2/60/10.6\t455\t27/40\tCD34−, CD33+, CD13+, CD38+, DR−, CD11b−\tNormal karyotype\t\nMutated\n\n(type A)/WT/WT\n\tScore 9, poor risk/Score 1, good intermediate risk\tThree cycles of LDAC, combined with one ATRA course\tNA (HI)/NA/5\t\n3\t79/M\tArterial hypertension, benign prostatic hyperplasia\t1\t46.9/255/10.7\t373\t34/60\tCD34−, CD33+, CD13+, CD15+, CD14+, CD64+, CD11a+, cMPO+, DR+, CD56+/−, CD11b+\tNormal karyotype\t\nMutated\n\n(type A)/WT/WT\n\tScore 9, poor risk/Score 3, good intermediate risk\tTen cycles of LDAC, combined with three ATRA courses\tYes/7/11\t\n\nNPM1, nucleophosmin; AML, acute myeloid leukemia; Pt, patient; ys, years; PS, performance status; ECOG, Eastern Cooperative Oncology Group; CBC, complete blood count; WBC, white blood cell; Plt, platelet; Hb, hemoglobin; LDH, lactate dehydrogenase; PB, peripheral blood; BM, bone marrow; FLT3, FMS‐like tyrosine kinase 3; IDH1, isocitrate dehydrogenase 1; WT, wild type; LDAC, low‐dose Ara‐C; ATRA, all‐trans retinoic acid; CR, complete remission; DFS, disease‐free survival; OS, overall survival; HI, hematologic improvement; NA, not applicable.\n\nUnfitness for intensive chemotherapy was defined according to Ferrara et al., Leukemia 2013 25.\n\nJohn Wiley & Sons, LtdOther AML patients, in particular with NPM1 wild type, unfit for intensive chemotherapy, have not been treated with the same therapeutic strategy (LDAC + ATRA) at our Institution.\n\nDiscussion\nSeveral experimental evidence supports the modulation of the retinoic acid‐signaling pathway as a potential target for therapy in NPM1‐mutated AML 8, 9, 10, 11, 12. Earlier in vitro studies by Martelli et al. showed that pharmacological doses of ATRA induced cell cycle arrest and apoptosis in both NPM1‐mutated cell line OCI‐AML3 and primary leukemic cells propagated in NOD‐SCID mice, by selectively down‐regulating the NPM1 mutant protein at post‐transcriptional level 8. Moreover, Kutny et al. demonstrated that NPM1‐mutated AML cells may also be susceptible, in vitro, to the pro‐differentiating properties of ATRA 9. Further in vitro findings also suggested that targeted depletion of NPM1 protein may selectively sensitize NPM1‐mutated AML cells to Ara‐C and ATRA 10. Of note, it has recently been reported that exposure of NPM1‐mutated AML cells to ATRA and arsenic trioxide (ATO) induces selective proteasome‐mediated degradation of NPM1 mutant protein accompanied by nucleolar redistribution of wild‐type NPM1, reversal of the characteristic disorganization of PML bodies and pronounced apoptosis and/or differentiation 11, 12. Strikingly, NPM1 mutant protein down‐regulation by ATRA/ATO was shown to potentiate response to daunorubicin 11.\n\nAvailable information on the clinical use of ATRA in adjunct to other antileukemic treatments in NPM1‐mutated patients with AML is summarized in Table 2\n3, 4, 5, 12, 13, 14, 15, 16, 17, 18. Interestingly, in a retrospective biomarker analysis within the randomized HD98B trial, Schlenk et al. showed that the addition of ATRA to conventional chemotherapy, including etoposide, significantly improved event‐free survival and OS only in the subgroup of elderly patients with NPM1‐mutated AML without FLT3‐ITD mutation 3. Furthermore, preliminary data from the prospective randomized treatment trial AMLSG 07‐04 for younger patients with AML seem to confirm the results obtained in elderly patients 18. In details, the beneficial effect of ATRA on OS in the whole cohort could be attributed to patients with favorable risk AML, including NPM1‐mutated AML in the absence of FLT3‐ITD 18. Intriguingly, biological observations from these series suggested that repressor activity on retinoic acid signaling induced by high‐PRAME levels may be overcome by the addition of ATRA 19. Conversely, the randomized MRC AML12 trial for patients AML <60 years of age did not identify any molecular subgroup, defined by mutations in NPM1, FLT3, CEBPA genes, likely to derive a significant survival benefit from the addition of ATRA to aggressive chemotherapy 4. Consistently, in an analysis stratified by etoposide addition and NPM1/FLT3 mutational status, there was no significant improvement in clinical outcomes by the addition of ATRA to intensive chemotherapy for any subgroup of older patients enrolled in NCRI AML16 trial 15. Moreover, Nazha et al. observed that the addition of ATRA to chemotherapy did not affect overall outcome of patients with AML regardless of NPM1 mutational status 5. However, it should be noted that limitations of this study include the small sample size (20 NPM1‐mutated patients with AML) and that other gene mutations, such as FLT3‐ITD, have not been investigated in this retrospective analysis 5. Overall, there is currently no consensus as to whether the addition of ATRA to chemotherapy improves the clinical outcome of NPM1‐mutated patients with AML (Table 2) 1, 3, 4, 5, 15, 18. Of note, dosing schedule and timing of ATRA administration, namely before, simultaneously or after exposure to conventional chemotherapy, may be relevant to explain discrepancies observed in different series 3, 4, 5, 15, 18. Of interest, in vitro experiments indicated that synergistic effects on cell viability were only observed when ATRA was given after exposure to cytotoxic drugs 3. Indeed, in our three patients, such as in Austrian‐German trials, ATRA administration has been started a few days after chemotherapy, a timepoint when leukemic cells have already been exposed to a significant cytotoxic effect 3, 18. However, in addition to the potential efficacy of LDAC in association with ATRA, we acknowledge that the relatively favorable clinical outcome observed in two of our three elderly patients with AML, may also have been attributed to the less aggressive molecular features, namely NPM1 gene mutation without FLT3 gene mutations, documented in leukemic cells 20, 21, 22, 23.\n\nTable 2 Clinical use of ATRA in patient with NPM1‐mutated AML: review of the literature\n\nReference\tNumber of patients/clinical characteristics\tTreatment schedule\tOutcome\tComments\t\nHutter et al., 2008 13\n\tA total of 171 elderly patients with NPM1‐mutated AML enrolled in two consecutive AMLSG protocols and included in a retrospective analysis.\t\nSeventy‐eight patients (median age 67.8 years) from trial A, AML HD98B.\n\nNinety‐three patients (median age 67.9 years) from trial B, AMLSG 06‐04, in which idarubicin was intensified in induction therapy and etoposide was omitted.\n\n37% and 94% of patients received ATRA in trials A and B, respectively.\n\tCR 68% and 71% in trials A and B, respectively. No significant difference in OS between the two cohorts. Restricting the analysis to patients who received ATRA, better EFS and DFS for NPM1‐mutated/FLT3‐ITD negative patients in trial A compared to trial B.\tEtoposide in combination with ATRA may exert a beneficial synergistic effect in elderly patients with AML having NPM1 mutation without concurrent FLT3‐ITD.\t\nSchlenk et al., 2009 3\n\tA total of 377 patients with de novo or secondary AML, enrolled into the randomized AMLSG HD98B treatment trial. Median age 67 years (range 61–84). NPM1 mutations present in 60 of the 254 analyzed samples (24%).\tTwo induction cycles with idarubicin, standard‐dose cytarabine and etoposide with or without ATRA (45 mg/m2 on days 3–5 and then 15 mg/m2 on days 6–28), followed by one consolidation cycle of intermediate‐dose cytarabine and mitoxantrone with or without ATRA (15 mg/m2 on days 6–28). For second consolidation, patients were randomized to either intensive therapy with idarubicin and etoposide or oral maintenance therapy.\tPatients randomized to ATRA had significantly better RFS and OS, with 4‐years RFS and OS rates 20.9% and 10.8%, respectively, as compared to 4.8% and 5%, respectively, in the standard treatment arm.\tA significant interaction between NPM1‐mutated AML without FLT3‐ITD and treatment with ATRA was identified, in that the beneficial effect of ATRA on RFS and OS was restricted to this subgroup of patients.\t\nBurnett et al., 2010 4\n\tA total of 1075 adult patients with AML, enrolled in MRC AML12 randomized protocol. Median age 48 years (range 14–68). FLT3‐ITD mutations were present in 137 (23%) and NPM1 mutations in 207 (35%) of the 592 patients with available molecular data. Patients with NPM1 and FLT3 mutations were equally distributed between treatment groups.\tRandomization in induction to two courses of daunorubicin 50 mg/m2 on days 1,3,5, thioguanine 100 mg/m2 every 12 h on day 10 in course 1 and on day 8 in course 2, cytarabine at a dose of either 100 mg/m2 (standard DAT) or 200 mg/m2 (high DAT) every 12 h on days 1–10 in course 1 and days 1–8 in course 2, each with or without ATRA 45 mg/m2/day on days 1–60. Subsequently, patients received consolidation with course 3 (amsacrine, cytarabine, etoposide) and were randomized between one or two further courses, and to chemotherapy versus transplant.\tOverall, there was no effect from the addition of ATRA (CR + CRi 83% with vs. 84% without ATRA; 8‐year OS 33% with vs. 30% without ATRA).\tThe effect of ATRA was not significantly different in any of the four subgroups defined by the combination of FLT3 and NPM1 status. In NPM1‐mutated AML without FLT3‐ITD patients eight‐year OS was 56% with ATRA and 40% without ATRA, but the difference was not statistically significant. There was a suggestion that ATRA reduced relapse in patients with lower MN1 levels, but no significant effect on OS was observed. This study did not identify any subgroup of patients likely to derive a significant survival benefit from the addition of ATRA.\t\nFredly et al., 2013 14\n\tThirty‐six patients with either previously untreated (de novo or secondary) or relapsed AML, unfit for conventional intensive chemotherapy. Median age 77 years (range 48–90). NPM1 and FLT3‐ITD mutations documented in 35% (13) and 40% (14) of the cases, respectively.\tOn day 1, initial intravenous loading dose of VPA, then oral therapy 300 mg twice daily, continued indefinitely to maintain therapeutic concentrations. ATRA 21.5 mg/m2 twice daily on days 8–22 and repeated every 12th week. LDAC 10 mg/m2/day on days 15–24 and then repeated every 12th week.\tOverall, 11 of 36 patients showed response to treatment (2 CR, 9 HI). The most common response was increased and stabilized platelet counts. Median survival 171 days and 33 days in responders and nonresponders, respectively. Detailed clinical outcome of NPM1‐mutated patients with AML is not reported.\tDisease stabilization was seen in a subset of patients with AML. No significant differences with regard to age, gender, PB counts, de novo versus secondary AML, cytogenetic or molecular (FLT3, NPM1) abnormalities between responders and nonresponders.\t\nNazha et al., 2013 5\n\t\nSeventy patients with NK‐AML who were enrolled in a previous phase II randomized clinical trial and had stored BM samples for NPM1 mutation analysis.\n\nTwenty (29%) patients had NPM1 mutation. Among them, seven patients received ATRA + chemotherapy.\n\t\nPatients were randomly assigned to receive, as remission induction treatment: (a) FAI regimen (fludarabine 30 mg/m2 on days 1–4, Ara‐C 2 g/m2 on days 1–4, idarubicin 12 mg/m2 on days 2–4); (b) FAI + G‐CSF; (c) FAI + ATRA (45 mg/m2/day); (d) FAI + ATRA + G‐CSF.\n\nIf WBC count was <10 × 109/L, ATRA was begun 2 days before chemotherapy. If WBC count was ≥ 10 × 109/L, ATRA was begun on day 1. ATRA administration was continued for 3 days after completion of chemotherapy.\n\tCR rate in patients with NPM1 mutation was 71% and 69%, with or without ATRA, respectively. Median OS, EFS, RFS for the entire group were 11.5, 7, and 11.5 months, respectively.\tThe addition of ATRA to induction chemotherapy did not affect CR rate, OS, EFS, and RFS of patients with NK and NPM1 mutation.\t\nBurnett et al., 2013 15\n\tA total of 616 older patients with either de novo or secondary AML or high‐risk MDS, enrolled in the NCRI AML16 trial. Median age 67 years (range 53–82). FLT3‐ITD and NPM1 data available for 422 and 404 patients, with mutation rates of 19% and 24%, respectively.\tRandomization to DA versus ADE and ATRA versus no ATRA in a 2 × 2 factorial design. Daunorubicin 50 mg/m2 on days 1–3 and cytarabine 100 mg/m2 every 12 h on days 1–10 (course 1) or days 1–8 (course 2). Patients allocated to ATRA arms, received ATRA 45 mg/m2/day for 60 days. Etoposide in ADE arm was given at 100 mg/m2 on days 1–5 of courses 1 and 2.\tORR 69% and two‐year survival 35%. ORR not different between DA and ADE, although CR rates were nonsignificantly lower in patients given ATRA. At two‐years, neither OR nor RFS differed between arms (OS: ADE 33% vs. DA 36%; ATRA vs. not 35% vs. 35%).\tIn an analysis stratified by etoposide and by NPM1/FLT3 risk group, there was no significant heterogeneity of the effect of ATRA. No beneficial effect of ATRA in NPM1‐mutated AML without FLT3‐ITD appeared for patients receiving ADE.\t\nTassara et al., 2014 16\n\t\nA total of 195 elderly (range 61–83 years) patients with either de novo or secondary AML.\n\nNPM1 mutations were found in 22 and 18 of the available samples from patients in standard group (26%) and VPA group (22.5%), respectively\n\tRandomization to receive induction either with (VPA group) or without (standard group) VPA. Induction therapy consisted of two cycles of idarubicin 12 mg/m2 on days 1–3, cytarabine 100 mg/m2 on days 1–5, ATRA 45 mg/m2 on days 3–5 and 15 mg/m2 day 6–28 (AIC) or by the same chemotherapy plus VPA 400 mg twice daily (V‐AIC). After interim analyses, idarubicin was reduced to days 1 and 3, and VPA was given only during the first cycle. A second amendment stopped randomization because of toxicity and inferior CR rates in V‐AIC arm. All patients in CR received two consolidation cycles with chemotherapy and ATRA.\tCR rates after induction tended to be lower in VPA group (40%) compared with standard group (52%), as a result of the higher early death rate. After a median follow‐up of 84 months, five‐year EFS (2.3% in standard and 7.6% in VPA) and OS (11.7% in standard and 11.4% in VPA) were not different between the two groups. However, five‐year RFS was significantly superior in VPA group (24.4%) compared with standard (6.4%).\tThe addition of VPA to intensive induction chemotherapy and ATRA did not result in an improvement of CR rates, EFS and OS, mainly as a result of increased VPA‐related hematologic toxicity and higher death rates during second induction cycle. Explorative subset analyses revealed that NPM1‐mutated AML may particularly benefit from VPA.\t\nGuenounou et, 2014 17\n\tThree patients, aged 16, 21 and 51 years, respectively, affected with relapsed/refractory NPM1‐mutated with concurrent FLT3‐ITD positivity.\tSorafenib (400 mg twice a day) and ATRA (45 mg/m2/day on days 1–14). Each cycle was repeated every 28 days until progression or toxicity. Two patients received etoposide 150 mg/m2 for 2 days for debulking.\tPatient 1 obtained fourth CR; sorafenib was stopped after 2 years for toxicity and relapse occurred. Patient 2 was still in CR after 18 months of treatment (ATRA was stopped after 11 months for liver toxicity). Patient 3 received therapy bridge to transplant, without obtaining remission.\tPatients with FLT3‐ITD+ and NPM1‐mutated AML could obtain unexpected responses upon treatment with the combination of sorafenib and ATRA, which could not have been achieved with conventional therapies (patients 1 and 2 were previously allografted).\t\nSchlenk et al., 2014 18\n\tA total of 1100 adult (age 18–60 years) with AML, entered in prospective randomized treatment trial AMLSG 07‐04. NPM1 mutation was documented in 29% of patients.\tInduction therapy consisted of two cycles ICE (idarubicin 12 mg/m2 on days 1,3,5 or on days 1,3 in cycle 2; cytarabine 100 mg/m2 on days 1–7; etoposide 100 mg/m2 on days 1–3). For consolidation therapy, high‐risk patients received allo‐HSCT, while all other patients were assigned to high‐dose cytarabine (18 g/m2 per cycle). Patients were randomized to receive ATRA (during induction 45 mg/m2 on days 6–8, 15 mg/m2 on days 9–21; during consolidation 15 mg/m2 on days 6–28).\t\nA PP analysis revealed higher probability for NPM1‐mutated AML patients treated with ATRA to achieve a CR, with longer EFS. Explorative analysis in all patients on OS revealed a benefit for patients treated with ATRA compared to those who have not received ATRA\n\n(ITT, P = 0.09; PP, P = 0.01).\n\tThe beneficial effect of ATRA on OS in the whole cohort of younger patients could be attributed to patients with ELN‐favorable risk including core‐binding factor AML, AML with CEBPAdm and NPM1‐mutated AML in the absence of FLT3‐ITD.\t\nEl Hajj et al., 2015 12\n\tFive elderly patients with previously untreated or relapsed NPM1‐mutated AML, unfit for chemotherapy.\tCompassionate use of ATRA 45 mg/m2/day combined with ATO 0.1 mg/kg/day.\tBM blasts significantly decreased in three patients and then re‐increased upon treatment discontinuation. One patient died from IA at day +21 with no evidence of response. Another patient rapidly died from bilateral pneumonia at day +10.\tAlthough CRs were not observed, ATRA + ATO exerted a transient in vivo antileukemic effect, with leukemia regression in some patients. The combination is unlikely to be curative alone, but may be part of a broader therapeutic strategy.\t\nATRA, all‐trans retinoic acid; AML, acute myeloid leukemia; CR, complete remission; BM, bone marrow; G‐CSF, granulocyte‐colony stimulating factor; WBC, white blood cell; EFS, event‐free survival; OS, overall survival; DFS, disease‐free survival; MDS; myelodysplastic syndrome; VPA, valproic acid; CRi, complete remission with incomplete blood count recovery; ORR, overall response rate; ORR, overall response rate; PB, peripheral blood; RFS, relapse‐free survival; NK, normal karyotype; HSCT, hematopoietic stem cell transplant; PP, per protocol; ITT, intention to treat; ELN, European LeukemiaNet; ATO, arsenic trioxide; IA, invasive aspergillosis.\n\nJohn Wiley & Sons, LtdDespite the huge amount of data, although conflicting, regarding NPM1‐mutated patients with AML treated with ATRA combined with intensive chemotherapy, scanty information is so far available on the association of ATRA and LDAC in this molecular subgroup of patients, when elderly and fragile 14. Based upon our clinical observations, we suggest that the combination of LDAC and ATRA may potentially be effective in some elderly patients, unfit for intensive chemotherapy, affected with NPM1‐mutated AML without FLT3 mutations, a relatively good prognosis AML. Although IDH1‐R132 mutation has not been documented in our patients, it should be noted that ATRA at clinically achievable doses has recently been shown to markedly enhance terminal granulocytic differentiation in vitro, in either AML cell lines or primary patient samples carrying mutant IDH1\n24. Moreover, a potent antileukemic effect of ATRA was observed in the presence of IDH1‐R132H mutation in a xenograft mouse model, suggesting that IDH1‐R132 mutation could be a valuable biomarker to select patients with AML for ATRA treatment 24.\n\nPerspective randomized clinical trials are warranted to compare LDAC alone versus LDAC combined with ATRA and/or ATO, in order to clarify the exact role of such treatments in these selected genetic subsets of fragile patients 25. In addition to the assessment of the efficacy in terms of response rates and survival, further endpoints, such as transfusion requirements, achievement of transfusion independence, number and duration of hospitalizations per patient year, are actually recognized as extremely relevant, especially in clinical trials investigating moderate intensity treatments 26. Moreover, QoL parameters and other patient‐reported outcomes, assessed with validated instruments, should increasingly be incorporated as secondary endpoints in clinical studies for patients with AML 27.\n\nConflict of Interest\nBF applied for a patent on the clinical use of NPM1 mutants. The other authors report no potential conflicts of interest.\n\nSupporting information\n\nTable S1. Clinical use of ATRA in non‐APL AML patients: review of the literature.\n\nClick here for additional data file.\n\n Acknowledgments\nThe authors would like to thank the Associazione Italiana Lotta alle Leucemie, Linfoma e Mieloma (AIL) – Sezione “Luciano Pavarotti” Modena‐ONLUS for grants to FF and LP, and the Associazione Italiana per la Ricerca sul Cancro (AIRC, IG14797‐2013) for grants to ML.\n==== Refs\nReferences\n1 \n\nJohnson , D. E. \n, and \nR. L. \nRedner \n. 2015 \nAn ATRActive future for differentiation therapy in AML . Blood Rev. \n29 :263 –268 .25631637 \n2 \n\nBurnett , A. K. \n, \nD. \nMilligan \n, \nA. G. \nPrentice \n, \nA. H. \nGoldstone \n, \nM. F. \nMcMullin \n, \nR. K. \nHills \n, et al. 2007 \nA comparison of low‐dose cytarabine and hydroxyurea with or without all‐trans retinoic acid for acute myeloid leukemia and high‐risk myelodysplastic syndrome in patients not considered fit for intensive treatment . Cancer \n109 :1114 –1124 .17315155 \n3 \n\nSchlenk , R. F. \n, \nK. \nDohner \n, \nM. \nKneba \n, \nK. \nGotze \n, \nF. \nHartmann \n, \nF. \nDel Valle \n, et al. 2009 \nGene mutations and response to treatment with all‐trans retinoic acid in elderly patients with acute myeloid leukemia. Results from the AMLSG Trial AML HD98B . Haematologica \n94 :54 –60 .19059939 \n4 \n\nBurnett , A. K. \n, \nR. K. \nHills \n, \nC. \nGreen \n, \nS. \nJenkinson \n, \nK. \nKoo \n, \nY. \nPatel \n, et al. 2010 \nThe impact on outcome of the addition of all‐trans retinoic acid to intensive chemotherapy in younger patients with nonacute promyelocytic acute myeloid leukemia: overall results and results in genotypic subgroups defined by mutations in NPM1, FLT3, and CEBPA . Blood \n115 :948 –956 .19965647 \n5 \n\nNazha , A. \n, \nC. \nBueso‐Ramos \n, \nE. \nEstey \n, \nS. \nFaderl \n, \nS. \nO'Brien \n, \nM. H. \nFernandez \n, et al. 2013 \nThe addition of all‐trans retinoic acid to chemotherapy may not improve the outcome of patient with NPM1 mutated acute myeloid leukemia . Front. Oncol. \n3 :218 .24032106 \n6 \n\nVenditti , A. \n, \nR. \nStasi \n, \nG. \nDel Poeta \n, \nF. \nBuccisano \n, \nG. \nAronica \n, \nA. \nBruno \n, et al. 1995 \nAll‐trans retinoic acid and low‐dose cytosine arabinoside for the treatment of ‘poor prognosis’ acute myeloid leukemia . Leukemia \n9 :1121 –1125 .7630182 \n7 \n\nDi Febo , A. \n, \nL. \nLaurenti \n, \nP. \nFalcucci \n, \nM. E. \nTosti \n, \nL. \nFianchi \n, \nL. \nPagano \n, et al. 2007 \nAll‐trans retinoic acid in association with low dose cytosine arabinoside in the treatment of acute myeoid leukemia in elderly patients . Am. J. Ther. \n14 :351 –355 .17667210 \n8 \n\nMartelli , M. P. \n, \nV. \nPettirossi \n, \nN. \nManes \n, et al. 2007 \nSelective silencing of the NPM1 mutant protein and apoptosis induction upon ATRA in vitro treatment of AML cells carrying NPM1 mutations . Blood \n110 (Suppl. ): 868.\n9 \n\nKutny , M. A. \n, \nS. J. \nCollins \n, \nK. \nLoeb \n, \nR. B. \nWalter \n, and \nS. \nMeshinchi \n. 2010 \nAll‐trans retinoic acid (ATRA) causes extensive differentiation in the NPM mutant, non‐APL leukemic cell line OCI‐AML3 . Blood \n116 (Suppl. ): 3305.\n10 \n\nBalusu , R. \n, \nW. \nFiskus \n, \nR. \nRao \n, \nD. G. \nChong \n, \nS. \nNalluri \n, \nU. \nMudunuru \n, et al. 2011 \nTargeting levels or oligomerization of nucleophosmin 1 induces differentiation and loss of survival of human AML cells with mutant NPM1 . Blood \n118 :3096 –3106 .21719597 \n11 \n\nMartelli , M. P. \n, \nI. \nGionfriddo \n, \nF. \nMezzasoma \n, \nF. \nMilano \n, \nS. \nPierangeli \n, \nF. \nMulas \n, et al. 2015 \nArsenic trioxide and all‐trans retinoic acid target NPM1 mutant oncoprotein levels and induce apoptosis in NPM1‐mutated AML cells . Blood \n125 :3455 –3465 .25795919 \n12 \n\nEl Hajj , H. \n, \nZ. \nDassouki \n, \nC. \nBerthier \n, \nE. \nRaffoux \n, \nL. \nAdes \n, \nO. \nLegrand \n, et al. 2015 \nRetinoic acid and arsenic trioxide trigger degradation of mutated NPM‐1 resulting in apoptosis of AML cells . Blood \n125 :3447 –3454 .25800051 \n13 \n\nHutter , M. L. \n, \nK. \nDohner \n, \nI. G. H. \nSchmidt‐Wolf \n, \nF. \nDel Valle \n, \nB. \nHeydrich \n, \nW. \nHeit \n, et al. 2008 \nRole of etoposide in combination with All‐Trans Retinoic Acid in the treatment of elderly patients with acute myeloid leukemia and NPM1 mutation . Blood \n112 (Suppl. ):559 .\n14 \n\nFredly , H. \n, \nE. \nErsvaer \n, \nA. O. \nKittang \n, \nG. \nTsykunova \n, \nB. T. \nGjertsen \n, and \nO. \nBruserud \n. 2013 \nThe combination of valproic acid, all‐trans retinoic acid and low‐dose cytarabine as disease‐stabilizing treatment in acute myeloid leukemia . Clin. Epigenetics \n5 :13 .23915396 \n15 \n\nBurnett , A. K. \n, \nR. K. \nHills \n, \nL. S. \nFriis \n, \nL. \nKjeldsen \n, \nD. \nMilligan \n, \nA. E. \nHunter \n, et al. 2013 \nThe ATRA question in AML: lack of benefit overall or in any molecular subgroup in the NCRI AML16 trial . Blood \n122 (Suppl. ):493 .\n16 \n\nTassara , M. \n, \nK. \nDohner \n, \nP. \nBrossart \n, \nG. \nHeld \n, \nK. \nGotze \n, \nH. A. \nHorst \n, et al. 2014 \nValproic acid in combination with all‐trans retinoic acid and intensive therapy for acute myeloid leukemia in older patients . Blood \n123 :4027 –4036 .24797300 \n17 \n\nGuenounou , S. \n, \nE. \nDelabesse \n, and \nC. \nRecher \n. 2014 \nSorafenib plus all‐trans retinoic acid for AML patients with FLT3‐ITD and NPM1 mutations . Eur. J. Haematol. \n93 :533 –536 .24689895 \n18 \n\nSchlenk , R. \n, \nK. \nDohner \n, \nJ. \nKrauter \n, \nV. I. \nGaidzik \n, \nP. \nPaschka \n, \nM. \nHeuser \n, et al. 2014 \nAll‐trans retinoic acid as adjunct to intensive treatment in younger adult patients with acute myeloid leukemia. Final results of the AMLSG 07‐04 randomized treatment trial . Haematologica \n99 (Suppl n. 1 ):S646 .\n19 \n\nBullinger , L. \n, \nR. F. \nSchlenk \n, \nM. \nGotz \n, \nU. \nBotzenhardt \n, \nS. \nHofmann \n, \nA. C. \nRuss \n, et al. 2013 \nPRAME‐induced inhibition of retinoic acid receptor signaling‐mediated differentiation. A possible target for ATRA response in AML without t(15;17) . Clin. Cancer Res. \n19 :1 –10 .\n20 \n\nRollig , C. \n, \nC. \nThiede \n, \nM. \nGramatzki \n, \nW. \nAulitzky \n, \nH. \nBodenstein \n, \nM. \nBornhauser \n, et al. 2010 \nA novel prognostic model in elderly patients with acute myeloid leukemia: results of 909 patients entered into the prospective AML96 trial . Blood \n116 :971 –978 .20442365 \n21 \n\nBecker , H. \n, \nG. \nMarcucci \n, \nK. \nMaharry \n, \nM. D. \nRadmacher \n, \nK. \nMrozek \n, \nD. \nMargeson \n, et al. 2009 \nFavorable prognostic impact of NPM1 mutations in older patients with cytogenetically normal de novo acute myeloid leukemia and associated gene‐ and microRNA‐expression signatures: a Cancer and Leukemia Group B Study . J. Clin. Oncol. \n28 :596 –604 .20026798 \n22 \n\nFalini , B. \n, \nM. P. \nMartelli \n, \nN. \nBolli \n, \nP. \nSportoletti \n, \nA. \nLiso \n, \nE. \nTiacci \n, et al. 2011 \nAcute myeloid leukemia with mutated nucleophosmin (NPM1): is it a distinct entity? \nBlood \n117 :1109 –1120 .21030560 \n23 \n\nWheatley , K. \n, \nC. L. \nBrookes \n, \nA. J. \nHowman \n, \nA. H. \nGoldstone \n, \nD. W. \nMilligan \n, \nA. G. \nPrentice \n, et al. 2009 \nPrognostic factor analysis of the survival of elderly patients with AML in the MRC AML11 and LRF AML14 trials . Br. J. Haematol. \n145 :598 –605 .19344426 \n24 \n\nBoutzen , H. \n, \nE. \nSaland \n, \nC. \nLarrue \n, \nF. \nde Toni \n, \nL. \nGales \n, \nF. A. \nCastelli \n, et al. 2016 \nIsocitrate dehydrogenase 1 mutations prime the all‐trans retinoic acid myeloid differentiation pathway in acute myeloid leukemia . J. Exp. Med. \n213 :483 –497 .26951332 \n25 \n\nFerrara , F. \n, \nG. \nBarosi \n, \nA. \nVenditti \n, \nE. \nAngelucci \n, \nM. \nGobbi \n, \nF. \nPane \n, et al. 2013 \nConsensus‐based definition of unfitness to intensive and non‐intensive chemotherapy in acute myeloid leukemia: a project of SIE, SIES and GITMO group on a new tool for therapy decision making . Leukemia \n27 :997 –999 .23653072 \n26 \n\nFenaux , P. \n, \nG. J. \nMufti \n, \nE. \nHellstrom‐Lindberg \n, \nV. \nSantini \n, \nN. \nGattermann \n, \nU. \nGermig \n, et al. 2010 \nAzacitidine prolongs overall survival compared with conventional care regimens in elderly patients with low bone marrow blast count acute myeloid leukemia . J. Clin. Oncol. \n28 :562 –569 .20026804 \n27 \n\nBuckley , S. A. \n, \nS. J. \nLee \n, and \nR. B. \nWalter \n. 2016 \nMeasuring quality of life in acute myeloid leukemia: limitations and future directions . Expert Rev. Hematol. \n9 :821 –823 .27389467\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2050-0904",
"issue": "4(12)",
"journal": "Clinical case reports",
"keywords": "All‐trans retinoic acid; NPM1‐mutated acute myeloid leukemia; elderly patients; low‐dose Ara‐C; unfitness for intensive chemotherapy",
"medline_ta": "Clin Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101620385",
"other_id": null,
"pages": "1138-1146",
"pmc": null,
"pmid": "27980750",
"pubdate": "2016-12",
"publication_types": "D002363:Case Reports",
"references": "23915396;7630182;24032106;21719597;19059939;24689895;19344426;20442365;25631637;25795919;17315155;25800051;24797300;20026804;26951332;20026798;27389467;21030560;17667210;23653072;23444226;19965647",
"title": "All-trans retinoic acid (ATRA) in non-promyelocytic acute myeloid leukemia (AML): results of combination of ATRA with low-dose Ara-C in three elderly patients with NPM1-mutated AML unfit for intensive chemotherapy and review of the literature.",
"title_normalized": "all trans retinoic acid atra in non promyelocytic acute myeloid leukemia aml results of combination of atra with low dose ara c in three elderly patients with npm1 mutated aml unfit for intensive chemotherapy and review of the literature"
} | [
{
"companynumb": "IT-PFIZER INC-2016602187",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CYTARABINE"
},
"drugadditional": "3",
... |
{
"abstract": "OBJECTIVE\nIntraperitoneal (i.p.) chemotherapy improves survival in optimally debulked ovarian cancer patients. However, the need for inpatient administration and the perceived higher toxicity rates compared with standard intravenous chemotherapy have limited its widespread application. Several modified outpatient schemes, such as the Spanish Ovarian Cancer Research Group (GEICO) regimen, have been tested and have reported overall better tolerance with an improvement in completion treatment rates. The aim of our study was to assess the toxicity of the GEICO regimen in patients treated at our institution.\n\n\nMETHODS\nWe reviewed clinical records of stage III ovarian cancer patients with optimally debulked primary cytoreduction surgery that were treated from June 2009 to April 2013 with the GEICO regimen. Patients received intravenous paclitaxel (175 mg/m2) for 3 hours on day 1, i.p. cisplatin (100 mg/m2) on day 2, and i.p. paclitaxel (60 mg/m2) on day 8 every 21 days for a maximum of 6 cycles.\n\n\nRESULTS\nTwenty-one patients were identified. In 67% of the patients, i.p. port placement was performed at the primary surgery. The most common grade 3-to-4 toxicities seen were abdominal pain (14.3%) and neurotoxicity (9.5%). Eighteen patients (85.7%) completed the 6 cycles. Three patients stopped chemotherapy because of treatment-related toxicity. There were no serious port-related complications. With a median follow-up of 46 months, median progression-free survival was 23 months (95% confidence interval [11.8-34.6]). Nine patients (42.9%) have relapsed; most relapses were multifocal and extraperitoneal.\n\n\nCONCLUSIONS\nThe administration of the GEICO outpatient modified regimen was feasible with a good safety profile. It seems to show less toxicity than previously reported IP chemotherapy regimens. In our institution, port-related complications were infrequent and easily managed. However, further studies are warranted to establish the optimal i.p. regimen in a prospective manner and to validate it in a larger phase 3 trial.",
"affiliations": "Departments of *Medical Oncology and †Obstetrics and Gynaecology, La Fe University and Polytechnic Hospital, Valencia, Spain.",
"authors": "Bruixola|Gema|G|;Domingo|Santiago|S|;Díaz|Roberto|R|;Caballero|Javier|J|;Palomar|Laura|L|;De La Cueva|Helena|H|;Santaballa|Ana|A|",
"chemical_list": "D017239:Paclitaxel; D002945:Cisplatin",
"country": "England",
"delete": false,
"doi": "10.1097/IGC.0000000000000330",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1048-891X",
"issue": "25(2)",
"journal": "International journal of gynecological cancer : official journal of the International Gynecological Cancer Society",
"keywords": null,
"medline_ta": "Int J Gynecol Cancer",
"mesh_terms": "D000328:Adult; D000368:Aged; D000553:Ambulatory Care; D000971:Antineoplastic Combined Chemotherapy Protocols; D000077216:Carcinoma, Ovarian Epithelial; D002945:Cisplatin; D003131:Combined Modality Therapy; D065426:Cytoreduction Surgical Procedures; D005240:Feasibility Studies; D005260:Female; D006801:Humans; D007262:Infusions, Intravenous; D007263:Infusions, Parenteral; D008875:Middle Aged; D009367:Neoplasm Staging; D009375:Neoplasms, Glandular and Epithelial; D010051:Ovarian Neoplasms; D017239:Paclitaxel; D012189:Retrospective Studies; D016896:Treatment Outcome",
"nlm_unique_id": "9111626",
"other_id": null,
"pages": "214-21",
"pmc": null,
"pmid": "25415075",
"pubdate": "2015-02",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Feasibility and safety of a modified outpatient regimen with intravenous/intraperitoneal chemotherapy for optimally debulked stage III ovarian cancer.",
"title_normalized": "feasibility and safety of a modified outpatient regimen with intravenous intraperitoneal chemotherapy for optimally debulked stage iii ovarian cancer"
} | [
{
"companynumb": "ES-HQ SPECIALTY-ES-2015INT000650",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PACLITAXEL"
},
"drugadditional": null,... |
{
"abstract": "OBJECTIVE\nPure erythroid leukemia (PEL) is an extremely rare entity that may, even more rarely, evolve from a preexisting chronic myeloid neoplasm (CMN); there is minimal literature regarding this latter phenomenon.\n\n\nMETHODS\nWe describe 14 patients with PEL that represented progression from a preexisting myelodysplastic syndrome (MDS, n = 8) or myeloproliferative neoplasm (MPN, n = 6), three of which manifested as erythroblastic sarcoma (EBS), a rare entity. These patients had a highly complex karyotype with prominent clonal evolution and a very aggressive clinical course.\n\n\nRESULTS\nPatients with PEL from MDS showed a more rapid progression time to PEL and had lower platelet counts compared with PEL from MPN. No other significant differences were found between the two groups.\n\n\nCONCLUSIONS\nThese data represent the largest cohort of patients with PEL and an antecedent CMN, as well as the largest series of EBS reported to date, and underscore the unique morphologic, cytogenetic, immunophenotypic, and clinical features of this uncommon entity.",
"affiliations": "From the Department of Pathology, Medical College of Wisconsin, Milwaukee.;Department of Pathology, Massachusetts General Hospital, Boston.;From the Department of Pathology, Medical College of Wisconsin, Milwaukee.;From the Department of Pathology, Medical College of Wisconsin, Milwaukee.;Department of Pathology, Allina Health, Minneapolis, MN.;Department of Pathology, Texas Health Presbyterian Hospital, Dallas.;Department of Pathology, Stanford University, Stanford, CA.;Department of Pathology, Stanford University, Stanford, CA.;From the Department of Pathology, Medical College of Wisconsin, Milwaukee.;From the Department of Pathology, Medical College of Wisconsin, Milwaukee holteanu@mcw.edu.",
"authors": "Li|Hongmei|H|;Hasserjian|Robert P|RP|;Kroft|Steven H|SH|;Harrington|Alexandra M|AM|;Wheaton|Susan E|SE|;Pildain|Alex|A|;Ewalt|Mark D|MD|;Gratzinger|Dita|D|;Hosking|Paul|P|;Olteanu|Horatiu|H|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1093/ajcp/aqw033",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0002-9173",
"issue": "145(4)",
"journal": "American journal of clinical pathology",
"keywords": "Erythroblastic sarcoma; Myelodysplastic syndrome; Myeloproliferative neoplasm; Pure erythroid leukemia",
"medline_ta": "Am J Clin Pathol",
"mesh_terms": "D000328:Adult; D000368:Aged; D018450:Disease Progression; D005260:Female; D005434:Flow Cytometry; D006801:Humans; D007150:Immunohistochemistry; D004915:Leukemia, Erythroblastic, Acute; D008297:Male; D008875:Middle Aged; D009196:Myeloproliferative Disorders",
"nlm_unique_id": "0370470",
"other_id": null,
"pages": "538-51",
"pmc": null,
"pmid": "27124944",
"pubdate": "2016-04",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Pure Erythroid Leukemia and Erythroblastic Sarcoma Evolving From Chronic Myeloid Neoplasms.",
"title_normalized": "pure erythroid leukemia and erythroblastic sarcoma evolving from chronic myeloid neoplasms"
} | [
{
"companynumb": "US-ROCHE-1826147",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "3",
"druga... |
{
"abstract": "This case report describes the delay in diagnosis and treatment of a diffuse large B-cell lymphoma in pregnancy of a 27-year-old woman. Chemotherapy was initiated in week 21 of pregnancy - the tumour regressed and the foetus had linear growth. The patient had caesarean section in week 34, and after delivery she received high doses of methotrexate and obtained complete remission. The two-year-old infant had a normal development.",
"affiliations": "Obstetrisk Klinik, Juliane Marie Centret, Rigshospitalet, Blegdamsvej 9, 2100 København Ø. berit.woetmann.pedersen@regionh.dk.",
"authors": "Pedersen|Berit Woetmann|BW|;Clausen|Mette Borg|MB|;Gørløv|Jette Sønderskov|JS|;Langhoff-Roos|Jens|J|;Storgaard|Lone|L|",
"chemical_list": "D000970:Antineoplastic Agents",
"country": "Denmark",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-5782",
"issue": "177(23)",
"journal": "Ugeskrift for laeger",
"keywords": null,
"medline_ta": "Ugeskr Laeger",
"mesh_terms": "D000008:Abdominal Neoplasms; D000328:Adult; D000970:Antineoplastic Agents; D005260:Female; D006801:Humans; D016403:Lymphoma, Large B-Cell, Diffuse; D011247:Pregnancy; D011252:Pregnancy Complications, Neoplastic; D011256:Pregnancy Outcome; D011262:Pregnancy Trimester, Second; D011263:Pregnancy Trimester, Third",
"nlm_unique_id": "0141730",
"other_id": null,
"pages": "V12140713",
"pmc": null,
"pmid": "26058439",
"pubdate": "2015-06-01",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Chemotherapy in the second and third trimester of pregnancy is compatible with the delivery of a healthy infant.",
"title_normalized": "chemotherapy in the second and third trimester of pregnancy is compatible with the delivery of a healthy infant"
} | [
{
"companynumb": "PHHY2018DK053338",
"fulfillexpeditecriteria": "1",
"occurcountry": "DK",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DOXORUBICIN"
},
"drugadditional": null,
"dru... |
{
"abstract": "Post-transplant lymphoproliferative disorders (PTLD) exclusively affecting the central nervous system-primary CNS-PTLD (pCNS-PTLD)-are rare. There is no standard therapy, and previous case series have included heterogeneous treatment approaches. We performed a retrospective, multi-centre analysis of 14 patients with pCNS-PTLD after solid organ transplantation (SOT) treated in the prospective German PTLD registry with reduction of immunosuppression (RI), whole-brain radiotherapy (WBRT), and concurrent systemic rituximab between 2001 and 2018. Twelve of fourteen patients were kidney transplant recipients and median age at diagnosis was 65 years. Thirteen of fourteen cases (93%) were monomorphic PTLD of the diffuse large B-cell lymphoma type, and 12/13 were EBV-associated. The median dose of WBRT administered was 40 Gy with a median fraction of 2 Gy. The median number of administered doses of rituximab (375 mg/m2) IV was four. All ten patients evaluated responded to treatment (100%). Median OS was 2.5 years with a 2-year Kaplan-Meier estimate of 63% (95% confidence interval 30-83%) without any recorded relapses after a median follow-up of 2.6 years. Seven of fourteen patients (50%) suffered grade III/IV infections under therapy (fatal in two cases, 14%). During follow-up, imaging demonstrated grey matter changes interpreted as radiation toxicity in 7/10 evaluated patients (70%). The combination of RI, WBRT, and rituximab was an effective yet toxic treatment of pCNS-PTLD in this series of 14 patients. Future treatment approaches in pCNS-PTLD should take into account the significant risk of infections as well as radiation-induced neurotoxicity.",
"affiliations": "Department of Haematology and Oncology, DIAKO Ev. Diakonie-Krankenhaus Bremen, Gröpelinger Heerstr. 406-408, 28239, Bremen, Germany.;Center of Radiotherapy, Bremen, Germany.;Department of Internal Medicine II: Haematology and Oncology, University Medical Centre Schleswig-Holstein, Campus Kiel, Kiel, Germany.;Department of Nephrology and Intensive Care, Campus Virchow-Klinikum, Charité - Universitätsmedizin Berlin, Berlin, Germany.;Center for Translational Medicine and Department of Internal Medicine I, Marien Hospital Herne, Ruhr-University Bochum University Hospital, Herne, Germany.;Center of Radiotherapy, Bremen, Germany.;Department of Nephrology, UKF, Goethe University Frankfurt, Frankfurt/Main, Germany.;Department of Haematology, Oncology and Palliative Care, Katharinen hospital, Stuttgart, Germany.;Department of Internal Medicine II: Haematology and Oncology, University Medical Centre Schleswig-Holstein, Campus Kiel, Kiel, Germany.;Radiologie Bremen, Bremen, Germany.;Department of Haematopathology, University Medical Centre Schleswig-Holstein, Campus Kiel, Kiel, Germany.;Department of Pathology, University of Würzburg, Würzburg, Germany.;Department of Haematology and Oncology, DIAKO Ev. Diakonie-Krankenhaus Bremen, Gröpelinger Heerstr. 406-408, 28239, Bremen, Germany. rtrappe@gwdg.de.",
"authors": "Zimmermann|Heiner|H|http://orcid.org/0000-0002-4242-275X;Nitsche|Mirko|M|;Pott|Christiane|C|;Reinke|Petra|P|;Babel|Nina|N|;Hermann|Robert M|RM|;Hauser|Ingeborg A|IA|;Hahn|Dennis|D|;Ritgen|Matthias|M|;Pietschmann|Claudia|C|;Klapper|Wolfram|W|;Anagnostopoulos|Ioannis|I|;Trappe|Ralf U|RU|;|||",
"chemical_list": "D000074322:Antineoplastic Agents, Immunological; D007166:Immunosuppressive Agents; D000069283:Rituximab",
"country": "Germany",
"delete": false,
"doi": "10.1007/s00277-021-04548-2",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0939-5555",
"issue": "100(8)",
"journal": "Annals of hematology",
"keywords": "CNS; EBV; Lymphoma; PTLD; Whole-brain radiotherapy",
"medline_ta": "Ann Hematol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000074322:Antineoplastic Agents, Immunological; D001921:Brain; D002493:Central Nervous System Diseases; D005260:Female; D005858:Germany; D006801:Humans; D007166:Immunosuppressive Agents; D008232:Lymphoproliferative Disorders; D008297:Male; D008875:Middle Aged; D016377:Organ Transplantation; D012042:Registries; D012189:Retrospective Studies; D000069283:Rituximab",
"nlm_unique_id": "9107334",
"other_id": null,
"pages": "2043-2050",
"pmc": null,
"pmid": "33973053",
"pubdate": "2021-08",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study",
"references": "23721553;26460822;29632007;27189056;22173060;27992268;20052713;25130212;27132696;29054815;30467845;26149884;24319169;26384356;22476860;20872273;30728897;21584931;22873830;20408848;15955902;22823002;17008697;28434043",
"title": "Reduction of immunosuppression combined with whole-brain radiotherapy and concurrent systemic rituximab is an effective yet toxic treatment of primary central nervous system post-transplant lymphoproliferative disorder (pCNS-PTLD): 14 cases from the prospective German PTLD registry.",
"title_normalized": "reduction of immunosuppression combined with whole brain radiotherapy and concurrent systemic rituximab is an effective yet toxic treatment of primary central nervous system post transplant lymphoproliferative disorder pcns ptld 14 cases from the prospective german ptld registry"
} | [
{
"companynumb": "DE-CELLTRION INC.-2021DE006962",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RITUXIMAB"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nVertical transmission of covid-19 is possible; its risk factors are worth researching. The placental changes found in pregnant women have a definite impact on the foetus.\n\n\nMETHODS\nWe report a case of a 25-year-old woman, gravida 3, para 2 (2 alive children), with a history of two caesarean deliveries, who was infected by the SARS-CoV-2 during the last term of her pregnancy. She gave birth by caesarean at 34 weeks of gestation to a newborn baby also infected with SARS-CoV-2. The peri-operative observations noted several eruptive lesions in the pelvis, bleeding on contact. Microscopic examination of the foetal appendages revealed thrombotic vasculopathy in the placenta and in the umbilical cord vessels.\n\n\nCONCLUSIONS\nThis case is one of the first documented cases of COVID-19 in pregnancy in sub-Saharan Africa. We strongly suggest obstetricians to carefully examine the aspect of the peritoneum, viscera and foetal appendages in affected pregnant women.",
"affiliations": "Departement of Gynecology and Obstetrics, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo. kajibwamie@gmail.com.;Departement of Gynecology and Obstetrics, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo.;Departement of Gynecology and Obstetrics, Panzi General Referral Hospital, Bukavu, Democratic Republic of the Congo.;Departement of Internal Medicine, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo.;Departement of Paediatrics, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo.;Departement of Gynecology and Obstetrics, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo.;Faculty of Medicine, Université Catholique de Bukavu (UCB), Bukavu, Democratic Republic of the Congo.;Departement of Gynecology and Obstetrics, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo.;Departement of Gynecology and Obstetrics, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo.;Departement of Gynecology and Obstetrics, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo.;Departement of Gynecology and Obstetrics, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo.;Department of Anesthesiology and Intensive Care, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo.;Faculty of Medicine, Université Catholique de Bukavu (UCB), Bukavu, Democratic Republic of the Congo.;Departement of Pathology, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo.;Faculty of Medicine, Université Catholique de Bukavu (UCB), Bukavu, Democratic Republic of the Congo.;Faculty of Medicine, Université Catholique de Bukavu (UCB), Bukavu, Democratic Republic of the Congo.",
"authors": "Birindwa|Etienne Kajibwami|EK|http://orcid.org/0000-0001-5537-0840;Mulumeoderhwa|Guy Mulinganya|GM|;Nyakio|Olivier|O|;Mbale|Guy-Quesney Mateso|GM|;Mushamuka|Serge Zigabe|SZ|;Materanya|Jeanne Maningo|JM|;Kahasha|Pierrot Mulumeoderhwa|PM|;Bisimwa|Yvette Kujirakwinja|YK|;Kampara|Freddy Mirindi|FM|;Irenge|Jules Mongane|JM|;Kibalama|Isaac Barhishindi|IB|;Luzadi|Pierre Kabuya|PK|;Malembaka|Espoir Bwenge|EB|;Mayeri|Daniel Garhalangwa-Na-Muntu|DG|;Baguma|Marius|M|;Balaluka|Ghislain Bisimwa|GB|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s40748-021-00127-5",
"fulltext": "\n==== Front\nMatern Health Neonatol Perinatol\nMatern Health Neonatol Perinatol\nMaternal Health, Neonatology and Perinatology\n2054-958X BioMed Central London \n\n127\n10.1186/s40748-021-00127-5\nCase Report\nA case study of the first pregnant woman with COVID-19 in Bukavu, eastern Democratic Republic of the Congo\nhttp://orcid.org/0000-0001-5537-0840Birindwa Etienne Kajibwami kajibwamie@gmail.cometienne.kajibwami@ucbukavu.ac.cd 12 Mulumeoderhwa Guy Mulinganya 12 Nyakio Olivier 3 Mbale Guy-Quesney Mateso 4 Mushamuka Serge Zigabe 5 Materanya Jeanne Maningo 1 Kahasha Pierrot Mulumeoderhwa 26 Bisimwa Yvette Kujirakwinja 12 Kampara Freddy Mirindi 12 Irenge Jules Mongane 12 Kibalama Isaac Barhishindi 12 Luzadi Pierre Kabuya 7 Malembaka Espoir Bwenge 28 Mayeri Daniel Garhalangwa-Na-Muntu 6 Baguma Marius 24 Balaluka Ghislain Bisimwa 28 1 Departement of Gynecology and Obstetrics, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo \n2 grid.442834.d0000 0004 6011 4325Faculty of Medicine, Université Catholique de Bukavu (UCB), Bukavu, Democratic Republic of the Congo \n3 Departement of Gynecology and Obstetrics, Panzi General Referral Hospital, Bukavu, Democratic Republic of the Congo \n4 Departement of Internal Medicine, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo \n5 Departement of Paediatrics, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo \n6 Departement of Pathology, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo \n7 Department of Anesthesiology and Intensive Care, Hôpital Provincial Général de Référence de Bukavu (HPGRB), Bukavu, Democratic Republic of the Congo \n8 grid.442834.d0000 0004 6011 4325Ecole régionale de santé publique (ERSP), Université Catholique de Bukavu (UCB), Bukavu, Democratic Republic of the Congo \n20 1 2021 \n20 1 2021 \n2021 \n7 629 10 2020 12 1 2021 © The Author(s) 2021Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.Introduction\nVertical transmission of covid-19 is possible; its risk factors are worth researching. The placental changes found in pregnant women have a definite impact on the foetus.\n\nCase presentation\nWe report a case of a 25-year-old woman, gravida 3, para 2 (2 alive children), with a history of two caesarean deliveries, who was infected by the SARS-CoV-2 during the last term of her pregnancy. She gave birth by caesarean at 34 weeks of gestation to a newborn baby also infected with SARS-CoV-2. The peri-operative observations noted several eruptive lesions in the pelvis, bleeding on contact. Microscopic examination of the foetal appendages revealed thrombotic vasculopathy in the placenta and in the umbilical cord vessels.\n\nConclusion\nThis case is one of the first documented cases of COVID-19 in pregnancy in sub-Saharan Africa. We strongly suggest obstetricians to carefully examine the aspect of the peritoneum, viscera and foetal appendages in affected pregnant women.\n\nKeywords\nCovid-19InflammationPeritoneumVertical transmissionissue-copyright-statement© The Author(s) 2021\n==== Body\nBackground\nIn December 2019, first cases of severe acute respiratory syndrome (SARS) due to a new coronavirus (SARS-CoV-2) were reported from Wuhan in China. Soon after, the disease, subsequently named “the 2019 novel coronavirus disease” (COVID-19) and declared a pandemic by the World Health Organisation (WHO) [1], has resulted in over 18.9 million confirmed cases and more than 709,000 deaths worldwide [2].\n\nThe pregnant woman can be considered to be more at risk of severe form than the non pregnant woman [3]. Their fragile immunity and frequent comorbidities such as obesity, diabetes mellitus, arterial hypertension, or cardiovascular diseases may expose them at higher risks of developing severe forms of the disease [4] and to adverse pregnancy outcomes, especially during the third trimester [5]. COVID-19 causes pneumonia with acute respiratory distress syndrome (ARDS), which can compromise natural delivery, increase maternal morbidity, or even lead to maternal death [6]. Knowledge about coronavirus disease during pregnancy is still limited [4], and vertical transmission in utero is not yet well established [4, 5].\n\nThe risk of mother-to-child transmission of COVID-19 seems to be low [7–9]. Cases of perinatal transmission of COVID-19 have been described, but it is still unclear if this occurred via the transplacental or other routes during delivery [10]. Furthermore, COVID-19 may constitute a threat of premature delivery, intrauterine growth retardation, premature rupture of the membranes, in-utero foetal death or even a premature neonatal death during delivery or soon after [8]. Among pregnant women with SARS-CoV-2, preterm birth is reported 12.9% [11].\n\nThere are no established guidelines about the best timing nor the best mode of delivery in COVID-19 infected pregnant women to optimize foetal and maternal well-being [12]. A study on the association between mode of delivery and maternal and neonatal outcomes in COVID-19 patients in Spain has shown that caesarean section was associated with an increased risk for maternal clinical deterioration which remained significant after adjustment for confounders [13]. However, a few case-reports have shown a benefit of a caesarean section on the improvement of respiratory distress in severely affected patients [5, 12]. There have been only a few studies that have investigated the intraoperative findings in women undergoing caesarean delivery [14], or changes in the foetal appendages that may explain the risk of maternal-foetal transmission [15].\n\nWe report the first documented case of COVID-19 in a pregnant woman recorded in the province of South Kivu, in eastern Democratic Republic of the Congo (DRC) who gave birth by cesarean section to a premature newborn also infected by SARS-CoV-2. Her pelvic organs exhibited a particular inflammatory appearance, and fetal appendages revealed thrombotic vasculopathy in the placenta and in the umbilical cord vessels.\n\nCase presentation\nA 25-year-old woman, gravida 3 para 2, at 34 weeks of gestation, with no medical history of cardiovascular nor other chronic diseases, was admitted to the labour and delivery unit of the “Hôpital Provincial Général de Référence de Bukavu” (HPGRB), in South-Kivu, for preterm labour contractions in a context of COVID-19. She had an history of 2 previous caesarean sections (the first one due to a cervical dystocia and the second indicated because of the prior caesarean), her last born wasaged 16 months. Her husband, tested negative for SARS-CoV-2, was a contact person of a COVID-19 confirmed case.\n\nThree weeks before admission, she complained of fever, not responding to acetaminophen. Her obstetrician prescribed her antibiotics, anti-malaria, and anti-spasmodic drugs. Two weeks later, as fever persisted despite all these medications, a reverse transcriptase-polymerase chain reaction (RT-PCR) nasopharyngeal swabs was performed and confirmed she was infected by SARS-CoV-2.\n\nShe was then admitted to the provincial COVID-19 treatment center for isolation and health care. Upon arrival to the center, her body temperature was 38.7 °C. Gynecologic examination was unremarkable. All bacteriological tests, including hemocultures and cultures of urines were negative. She received antipyretics (acetaminophen), antispasmodics trimethylphloroglucinol and antibiotics (oral azithromycin for 5 days and intravenous ceftriaxone). Two days later, she complained of hypogastric pain, like uterine contractions of low intensity. Obstetricians of the HPGRB were contacted and recommended the administration of antispasmodics intravenously in perfusion. Despite this treatments, fever and uterine contractions persisted, so intravenous dexamethasone 12 mg daily was administered for fetal pulmonary maturation, associated with a tocolysis using nifedipine for 48 h. As the frequency, intensity and duration of contractions increased, accompanied by cervical changes (dilation, effacement, softening, and movement to a more anterior position), the patient was transferred to the labour and delivery unit of the HPGRB for an optimal care. A rapid SARS-Cov-2 antigen test was performed and found to be negative.\n\nOn admission at the HPGRB, the patient had a good general condition. Her temperature (36.5 °C) and blood pressure (120/60 mmHg) were normal. The uterine height was 29 cm, the fœtus was in cephalic presentation. On vaginal examination, the uterine cervix was softened, median, 5 mm long and had a 5 cm dilatation. Membranes were intact and the fœtal head was mobile. An obstetrical ultrasound confirmed the cephalic presentation and estimated the foetal weight at 1600 g. Foetal monitoring confirmed a foetal well-being, with a stable foetal cardiac rhythm around 140 beats per minute. Tocography showed two to three contractions per minute and an intensity of 50 to 60 mmHg. A diagnosis of intractable preterm labor in a COVID-19 patient with a history of iterative caesarean deliveries was made.\n\nA classic Caesarean section with a Pfannestiel incision was performed. The peritoneal cavity and uterus were found to be very inflamed. Fetal appendages as well as the bladder were strewn with eruptive, vesicular lesions bleeding on contact (Figs. 1 and 2). The amniotic fluid was opalescent. The placenta weighed 500 g and had a clot on the maternal side on less than 20% of the surface. Anatomopathological examination subsequently revealed thrombotic vasculopathy in the placenta and in the umbilical cord vessels (Figs. 3 and 4), and a diffuse hyalinization with marked angiogenesis of the villous stroma.\nFig. 1 Peri-operative appearance showing several bleeding eruptive lesions on contact ( ) with the posterior surface of the uterus, on the ovaries, the left fallopian tube up to Douglas’ pouch\n\nFig. 2 Same lesions in the right appendages of the uterus ( )\n\nFig. 3 Section of the placenta; in the Hematoxylin-eosin (HE) staining we noted on sections of the placenta at 100X magnification, highly vascularized villi, with vascular lesions ( ) in the form of congestion and thrombosis visualized in certain fields and large areas of stromal hyalinization\n\nFig. 4 Cross section of the umbilical cord (Magnification: 40X, Hematoxylline-eosin staining). There is the presence of thrombus ( ) in the lumen of the umbilical vessel, Wharton’s jelly is without distinction, no inflammatory reaction\n\n\n\nAbout five minutes after skin incision, a female newborn weighing 1760 g was delivered with 1 and 5 min APGAR scores of 9–10. The newborn was immediately transferred to the neonatal ward for specialized neonatal treatment for an optimal care and to minimise the potential risk of infection. Gestational age was estimated at 33 weeks according to the Finnstrom score. The newborn received the usual care (drying, stimulation, vitamin K1,\n\nFluorescein and care of the umbilical cord). A gastric liquid was collected by gastric tube, and different swabs (especially nasopharyngeal, ear and umbilical cord), as well as blood cultures were immediately performed for bacteriological investigations and for SARS-CoV-2 RT-PCR test.\n\nThe newborn was breathing autonomously, had a good control of body temperature and blood sugar. She received a 10% glucose infusion for 48 h, and on the second day an enteral feeding by nasogastric tube was progressively introduced, using artificial milk formulas adapted to preterm babies. Prophylactic antibiotherapy (penicillin G and amikacin) was initiated, considering the risk of neonatal infections in prematurity.\n\nOn postnatal day 3, the newborn baby presented jaundice, respiratory distress and a clinical picture of ulcerative enterocolitis. Hemocultures were found negative, but SARS-CoV-2 RT-PCR was positive in oropharyngeal swab and cultures of gastric liquid isolated multiresistant Citrobacter sp. and Enterobacter cloacae. A phototherapy was prescribed for 3 days and previous antibiotics were replaced by meropenem and vancomycin based on the antibiogram. Despite this treatment, the newborn died on Day 5 in a picture of severe neonatal sepsis.\n\nThe postoperative follow-up of the mother was marked by a persistence of fever for 3 days, varying between 39 and 40 °C. Although haemocultures and urine cultures were sterile, antibiotic therapy was readjusted on postoperative Day 3 as for the newborn, with ceftriaxone replaced by meropenem. C-reactive protein (CRP) varied from 106.53 mg/l on admission to 186 mg/l on postoperative Day 1, falling to 21.93 mg/l on Day 5 and below 3 mg/l on Day 7. After 7 days of hospitalization, the patient’s condition was stable, with no fever nor respiratory symptoms. She was discharged from the hospital and sent back to the COVID-19 isolation Center. A control of the SARS-CoV-2 RT-PCR was negative on Day 13, she returned back home. The late postpartum up to 6 weeks was unremarkable, with no complication.\n\nNo medical staff involved in this case was subsequently found to be infected with SARS-CoV-2.\n\nDiscussion\nOne year after the first cases of COVID-19, the disease continues spreading at striking speed in many countries worldwide. People get contaminated mainly through direct means (including respiratory droplets and physical contacts with carriers) or by indirect contacts with contaminated objects [16]. Vertical transmission of SARS-CoV-2 during pregnancy is another possible route of transmission [9], although further investigations are still needed to confirm this eventuality.\n\nIn previously published case reports of neonatal SARS-CoV-2 infections, it was not well established if the contamination occurred during pregnancy or after birth, especially during the delivery process [17].\n\nPeritoneal lesions associated with SARS CoV-2 were previously suspected in patients [18–20]. Recently, the transplacental transmission of SARS-CoV-2 was reported [21, 22] and a classification of the COVID-19 infection in pregnant women, foetuses and newborns was suggested [23].\n\nThis case-report highlights a number of facts which suggest a possible intrauterine transmission of SARS-CoV-2 infection. We recognize, however, the limitations of our means of exploration which would confirm the case. Furthermore, none of the medical staff involved was subsequently found to be infected by SARS-CoV-2.\n\nThe intense inflammatory reaction of the uterus and foetal appendages suggest a direct effect of SARS-CoV-2 on placenta.\n\nConclusion\nThis case is one of the first documented cases of COVID-19 in pregnancy in sub-Saharan Africa. The intense inflammatory reaction of the uterus and foetal appendages suggest a direct effect of SARS-CoV-2 on placenta.\n\nWe strongly suggest obstetricians to carefully examine the aspect of the peritoneum, viscera and foetal appendages in affected pregnant women.\n\nAbbreviations\nCOVID-19Coronavirus disease 2019\n\nDRCDemocratic Republic of the Congo\n\nHPGRBHôpital Provincial Général de Référence de Bukavu,\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAcknowledgements\nWe are very grateful to all those persons who contributed to this work, especially Dr. BULAMBO ASOKA Blandine.\n\nAuthors sincerely thank all the staff of Provincial referral Hospital of Bukavu for their collaboration for this case study.\n\nAuthors’ contributions\nEKB: drafted the manuscript, reviewed the literature, followed up the patient and edited the final manuscript. GMM, SZM, PMK, EBM, DGM, MB and GBB edited and revised the manuscript. All the authors approved the final version of the manuscript.\n\nFunding\nThis case report received no funding.\n\nAvailability of data and materials\nMaterials and data provided in this case study are available from the corresponding author on reasonable request.\n\nEthics approval and consent to participate\nThe publication of this case was approved by the Ethics committee of the Catholic University of Bukavu, DRC.\n\nConsent for publication\nConsent for publication of the clinical details and/or laboratory results was obtained from the patient.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n==== Refs\nReferences\n1. OMS COVID-19 – Chronologie de l’action de l’OMS [Internet]. OMS 2020 \n2. World Health Organization (WHO) Coronavirus disease (COVID-2019) situation report 200 2020 \n3. Zambrano LD Ellington S Strid P Galang RR Update: characteristics of symptomatic women of reproductive age with laboratory-confirmed SARS-CoV-2 infection by pregnancy status — United States, January 22–October 3, 2020 MMWR Morb Mortal Wkly Rep 2020 69 44 1641 1647 10.15585/mmwr.mm6944e3 33151921 \n4. Ellington S Strid P Tong VT Woodworth K Galang RR Zambrano LD Characteristics of women of reproductive age with laboratory-confirmed SARS-CoV-2 infection by pregnancy status - United States, January 22-June 7, 2020 MMWR Morb Mortal Wkly Rep 2020 69 25 769 775 10.15585/mmwr.mm6925a1 32584795 \n5. Kolkova Z Bjurström MF Länsberg J Svedas E Andrada M Hansson SR Obstetric and intensive-care strategies in a high-risk pregnancy with critical respiratory failure due to COVID-19 : A case report Case Reports Womens Health 2020 27 0 4 \n6. Goodnight WH Soper DE Pneumonia in pregnancy. Vol. 33, Critical Care Medicine 2005 \n7. Schwartz DA. An analysis of 38 pregnant women with COVID-19, their newborn infants, and maternal-fetal transmission of SARS-CoV-2: maternal coronavirus infections and pregnancy outcomes. Arch Pathol Lab Med. 2020.\n8. Schwartz DA Graham AL Potential maternal and infant outcomes from coronavirus 2019-NCOV (SARS-CoV-2) infecting pregnant women: lessons from SARS, MERS, and other human coronavirus infections Viruses. 2020 12 2 1 16 10.3390/v12020194 \n9. Karimi-Zarchi M Neamatzadeh H Dastgheib SA Abbasi H Mirjalili SR Behforouz A Vertical transmission of coronavirus disease 19 (COVID-19) from infected pregnant mothers to neonates: a review Fetal Pediatr Pathol [internet] 2020 0 0 1 5 \n10. Richtmann R Torloni MR Oyamada Otani AR Levi JE Crema Tobara M de Almeida SC Fetal deaths in pregnancies with SARS-CoV-2 infection in Brazil: a case series Case Reports Womens Health 2020 27 e00243 10.1016/j.crwh.2020.e00243 \n11. Woodworth KR Olsen EO Neelam V Lewis EL Birth and infant outcomes following laboratory-confirmed SARS-CoV-2 infection in pregnancy — SET-NET, 16 jurisdictions, march 29–October 14, 2020 MMWR Morb Mortal Wkly Rep 2020 69 44 1635 1640 10.15585/mmwr.mm6944e2 33151917 \n12. Oliva M Hsu K Alsamarai S De Chavez V Ferrara L Clinical improvement of severe COVID-19 pneumonia in a pregnant patient after caesarean delivery 2020 \n13. Martínez-Perez O Vouga M Cruz Melguizo S Forcen Acebal L Panchaud A Muñoz-Chápuli M Association between Mode of Delivery among Pregnant Women with COVID-19 and Maternal and Neonatal Outcomes in Spain JAMA. 2020 324 296 299 10.1001/jama.2020.10125 32511673 \n14. Ngaserin SHN Koh FH Ong BC Chew MH COVID-19 not detected in peritoneal fluid: a case of laparoscopic appendicectomy for acute appendicitis in a COVID-19-infected patient Langenbeck's Arch Surg 2020 9 1 3 \n15. Ng WF Wong SF Lam A Mak YF Yao H Lee KC The placentas of patients with severe acute respiratory syndrome: a pathophysiological evaluation Pathology. 2006 38 3 210 218 10.1080/00313020600696280 16753741 \n16. Lot M Hamblin MR Rezaei N COVID-19: Transmission, prevention, and potential therapeutic opportunities 2020 \n17. Lu Q Shi Y Coronavirus disease (COVID-19) and neonate: What neonatologist need to know J Med Virol 2020 92 564 567 10.1002/jmv.25740 32115733 \n18. Ahmed AOE Mohamed SFH Saleh AO Al-Shokri SD Ahmed K Mohamed MFH Acute abdomen -like-presentation associated with SARS-CoV-2 infection IDCases [internet] 2020 21 e00895 10.1016/j.idcr.2020.e00895 \n19. Blanco-Colino R Vilallonga R Martı’n R AM PC Suspected acute abdomen as an Extrapulmonary manifestation of Covid-19 infection Cir Esp 2020 98 5 295 305 10.1016/j.ciresp.2020.03.006 32252978 \n20. Cabrero-Hernández M García-Salido A Leoz-Gordillo I Alonso-Cadenas JA Gochi-Valdovinos A González Brabin A Severe SARS-CoV-2 infection in children with suspected acute abdomen: a case series from a tertiary hospital in Spain Pediatr Infect Dis J 2020 39 8 E195 E198 10.1097/INF.0000000000002777 32467457 \n21. Vivanti AJ Vauloup-Fellous C Prevot S Zupan V Suffee C Do Cao J Transplacental transmission of SARS-CoV-2 infection Nat Commun [Internet] 2020 11 1 1 7 10.1038/s41467-019-13993-7 \n22. Sisman J Jaleel MA Intrauterine transmission of SARS-COV-2 infection in a preterm infant PIDJ. 2020 39 9 265 267 \n23. Shah PS Diambomba Y Acharya G Morris SK Bitnun A Classification system and case definition for SARS-CoV-2 infection in pregnant women, fetuses, and neonates Acta Obstet Gynecol Scand 2020 99 5 565 568 10.1111/aogs.13870 32277845\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2054-958X",
"issue": "7(1)",
"journal": "Maternal health, neonatology and perinatology",
"keywords": "Covid-19; Inflammation; Peritoneum; Vertical transmission",
"medline_ta": "Matern Health Neonatol Perinatol",
"mesh_terms": null,
"nlm_unique_id": "101655194",
"other_id": null,
"pages": "6",
"pmc": null,
"pmid": "33472696",
"pubdate": "2021-01-20",
"publication_types": "D016428:Journal Article",
"references": "33151921;32238084;32277845;32691004;32511673;32704477;32467457;16215363;32658097;32675129;32714844;32385569;32050635;16753741;32665677;33151917;32115733;32252978;32180426;32584795",
"title": "A case study of the first pregnant woman with COVID-19 in Bukavu, eastern Democratic Republic of the Congo.",
"title_normalized": "a case study of the first pregnant woman with covid 19 in bukavu eastern democratic republic of the congo"
} | [
{
"companynumb": "CG-SUN PHARMACEUTICAL INDUSTRIES LTD-2021RR-293358",
"fulfillexpeditecriteria": "1",
"occurcountry": "CG",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN"
},
"d... |
{
"abstract": "BACKGROUND\nImmune checkpoint inhibitor therapy has changed the standard drug therapy for relapsed or advanced non-small cell lung cancer; its efficacy is well-recognized by pulmonary physicians, oncologists, and thoracic surgeons. Nivolumab, one of the anti-programmed cell death 1 antibodies, was the first immune checkpoint inhibitor to be approved and is used as a standard second-line regimen for patients with non-small cell lung cancer irrespective of the expression of programmed cell death ligand 1. Programmed cell death 1 antibodies have been generally confirmed to be less toxic than conventional cytotoxic chemotherapy, although unusual immune-related adverse events such as type I diabetes mellitus, adrenal failure, and myasthenia gravis may occur with a very low incidence. A case of severe grade V immune-related thrombocytopenia after two courses of nivolumab as second-line therapy for relapsed non-small cell lung cancer is reported.\n\n\nMETHODS\nAn 82-year-old Japanese woman with relapsed lung adenocarcinoma was treated with nivolumab as second-line systemic therapy at our institute. Her laboratory data indicated thrombocytopenia suspected to be an immune-related adverse event following two courses of nivolumab. Subsequently, she developed a massive pulmonary hemorrhage and left cerebral infarction despite intensive treatment including systemic steroid therapy. Although there have been a few reports of thrombocytopenia caused by nivolumab, this is the first report of grade V thrombocytopenia following administration of nivolumab for relapsed non-small cell lung cancer.\n\n\nCONCLUSIONS\nA very difficult case of grade V immune-related thrombocytopenia after the administration of nivolumab as second-line therapy for relapsed lung adenocarcinoma was described. Immune-related thrombocytopenia is a rare adverse event, but it must be considered a possible complication because it may become critical once it has occurred.",
"affiliations": "Department of Chest Surgery, Fukushima Medical University School of Medicine, 1 Hikarigaoka, Fukushima, 960-1295, Japan.;Department of Chest Surgery, Fukushima Medical University School of Medicine, 1 Hikarigaoka, Fukushima, 960-1295, Japan.;Department of Chest Surgery, Fukushima Medical University School of Medicine, 1 Hikarigaoka, Fukushima, 960-1295, Japan.;Department of Chest Surgery, Fukushima Medical University School of Medicine, 1 Hikarigaoka, Fukushima, 960-1295, Japan.;Department of Chest Surgery, Fukushima Medical University School of Medicine, 1 Hikarigaoka, Fukushima, 960-1295, Japan.;Department of Chest Surgery, Fukushima Medical University School of Medicine, 1 Hikarigaoka, Fukushima, 960-1295, Japan.;Department of Chest Surgery, Fukushima Medical University School of Medicine, 1 Hikarigaoka, Fukushima, 960-1295, Japan.;Department of Chest Surgery, Fukushima Medical University School of Medicine, 1 Hikarigaoka, Fukushima, 960-1295, Japan.;Department of Chest Surgery, Fukushima Medical University Aizu Medical Center, Fukushima, Japan.;Department of Chest Surgery, Fukushima Medical University School of Medicine, 1 Hikarigaoka, Fukushima, 960-1295, Japan.;Department of Chest Surgery, Fukushima Medical University School of Medicine, 1 Hikarigaoka, Fukushima, 960-1295, Japan. hiro@fmu.ac.jp.",
"authors": "Hasegawa|Takeo|T|;Ozaki|Yuki|Y|;Inoue|Takuya|T|;Watanabe|Yuzuru|Y|;Fukuhara|Mitsuro|M|;Yamaura|Takumi|T|;Muto|Satoshi|S|;Okabe|Naoyuki|N|;Higuchi|Mitsunori|M|;Shio|Yutaka|Y|;Suzuki|Hiroyuki|H|",
"chemical_list": "D000074322:Antineoplastic Agents, Immunological; D000077594:Nivolumab",
"country": "England",
"delete": false,
"doi": "10.1186/s13256-019-2245-y",
"fulltext": "\n==== Front\nJ Med Case RepJ Med Case RepJournal of Medical Case Reports1752-1947BioMed Central London 224510.1186/s13256-019-2245-yCase ReportNivolumab-related severe thrombocytopenia in a patient with relapsed lung adenocarcinoma: a case report and review of the literature Hasegawa Takeo tahase@fmu.ac.jp 1Ozaki Yuki y-owada@fmu.ac.jp 1Inoue Takuya inoue6116@gmail.com 1Watanabe Yuzuru watanabeyuzuru133@fmu.ac.jp 1Fukuhara Mitsuro m.fuku0225@gmail.com 1Yamaura Takumi lionheart.tkm@gmail.com 1Muto Satoshi smutoo@fmu.ac.jp 1Okabe Naoyuki okaben@fmu.ac.jp 1Higuchi Mitsunori mitchhiguchi@gmail.com 2Shio Yutaka salt@fmu.ac.jp 1Suzuki Hiroyuki +81-24-547-1252hiro@fmu.ac.jp 11 0000 0001 1017 9540grid.411582.bDepartment of Chest Surgery, Fukushima Medical University School of Medicine, 1 Hikarigaoka, Fukushima, 960-1295 Japan 2 0000 0001 1017 9540grid.411582.bDepartment of Chest Surgery, Fukushima Medical University Aizu Medical Center, Fukushima, Japan 24 10 2019 24 10 2019 2019 13 31615 2 2019 27 8 2019 © The Author(s). 2019Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nImmune checkpoint inhibitor therapy has changed the standard drug therapy for relapsed or advanced non-small cell lung cancer; its efficacy is well-recognized by pulmonary physicians, oncologists, and thoracic surgeons. Nivolumab, one of the anti-programmed cell death 1 antibodies, was the first immune checkpoint inhibitor to be approved and is used as a standard second-line regimen for patients with non-small cell lung cancer irrespective of the expression of programmed cell death ligand 1. Programmed cell death 1 antibodies have been generally confirmed to be less toxic than conventional cytotoxic chemotherapy, although unusual immune-related adverse events such as type I diabetes mellitus, adrenal failure, and myasthenia gravis may occur with a very low incidence. A case of severe grade V immune-related thrombocytopenia after two courses of nivolumab as second-line therapy for relapsed non-small cell lung cancer is reported.\n\nCase presentation\nAn 82-year-old Japanese woman with relapsed lung adenocarcinoma was treated with nivolumab as second-line systemic therapy at our institute. Her laboratory data indicated thrombocytopenia suspected to be an immune-related adverse event following two courses of nivolumab. Subsequently, she developed a massive pulmonary hemorrhage and left cerebral infarction despite intensive treatment including systemic steroid therapy. Although there have been a few reports of thrombocytopenia caused by nivolumab, this is the first report of grade V thrombocytopenia following administration of nivolumab for relapsed non-small cell lung cancer.\n\nConclusion\nA very difficult case of grade V immune-related thrombocytopenia after the administration of nivolumab as second-line therapy for relapsed lung adenocarcinoma was described. Immune-related thrombocytopenia is a rare adverse event, but it must be considered a possible complication because it may become critical once it has occurred.\n\nKeywords\nNivolumabImmune checkpoint inhibitorNon-small cell lung cancerImmune-related thrombocytopeniaissue-copyright-statement© The Author(s) 2019\n==== Body\nBackground\nLung cancer is the leading cause of cancer death in the world. Platinum-based combination cytotoxic chemotherapy was the only standard treatment regimen for advanced or relapsed non-small cell lung cancer (NSCLC) for over a decade. In 2015, the programmed cell death 1 (PD-1) antibody nivolumab was confirmed to be effective and was first approved by the US Food and Drug Administration. Today, immune checkpoint inhibitors (ICIs), such as the anti-PD-1 antibodies nivolumab [1, 2] and pembrolizumab [3] or the anti-programmed cell death ligand 1 (PD-L1) antibodies atezolizumab [4] and durvalumab [5], are recognized as standard second-line therapies for advanced or relapsed NSCLC, and use of ICIs is expanding to many other malignancies. ICIs are generally recognized to be less toxic than cytotoxic chemotherapy, but they may cause unusual immune-related adverse events (ir-AEs), such as thyroiditis, type I diabetes mellitus, adrenal failure, or myasthenia gravis, while thrombocytopenia has been reported in only a few cases of advanced NSCLC [6–9]. The first case of grade V thrombocytopenia caused by nivolumab in a patient with relapsed NSCLC is presented, and the purpose of this report is to act as a warning that ICI-induced fatal thrombocytopenia could occur, although it is very rare.\n\nCase presentation\nAn 82-year-old Japanese woman, who had never smoked tobacco, with a past medical history of hypertension, glaucoma, and slight renal dysfunction underwent left upper lobectomy with upper mediastinal lymph node dissection for lung cancer. She had been an office worker with telephone-related duties, and she was taking antihypertensives, proton pump inhibitors, acetaminophen, expectorants, and eye drops for glaucoma. The pathological diagnosis was T3N0M0 stage IIB adenocarcinoma with parietal pleural invasion (Fig. 1a). She had a point mutation of L858R in exon 21 of the epidermal growth factor receptor (EGFR) gene, and immunohistochemistry was weakly positive for PD-L1 (Fig. 1b).\nFig. 1 Pathological findings of the resected specimen. a Hematoxylin and eosin staining shows invasive adenocarcinoma of papillary predominant type. b Immunohistochemistry was weakly positive for programmed cell death ligand 1 (PD-L1) (SP-142 antibody)\n\n\n\nSeven months after surgery, she was diagnosed as having contralateral pulmonary metastasis and started the first-line tyrosine kinase inhibitor gefitinib. However, gefitinib was discontinued because of the development of interstitial lung disease (ILD). After cessation of gefitinib, disease progression was seen on positron emission tomography, but her Eastern Cooperative Oncology Group (ECOG) performance status was 0. Because she had left-sided back pain due to metastasis to the left pleura with chest wall invasion around the third thoracic spine, palliative irradiation to her chest wall was performed. After 30 Gy of palliative irradiation, she was given nivolumab 3 mg/kg every 2 weeks as a second-line therapy (Fig. 2). During the first two cycles of nivolumab treatment, no adverse events (AEs) were observed, and her platelet count was almost 180 × 103/μL before and after administration of nivolumab. However, laboratory data before the third cycle of nivolumab showed that her platelets were extremely low (2000/μL), although her hemoglobin and white blood cell count (10.6 g/dL and 4500/μL, respectively) remained unchanged compared to the previous examination. Based on this result, she was admitted to our hospital urgently that same day.\nFig. 2 Treatment timeline after relapse of cancer. Relapse of lung cancer was detected 7 months after surgery. First-line gefitinib was discontinued due to interstitial lung disease. Three months after gefitinib was stopped, nivolumab was begun as second-line therapy\n\n\n\nOn arrival, she was hemodynamically stable (blood pressure 128/79 mmHg, pulse rate 56 beats/minute, temperature 36.2 °C). There was no abnormal finding on her respiratory sounds. Her cardiac, abdominal, and neurological examinations were also without focal findings. Over time, symptoms such as nasal bleeding and bilateral purpura of her lower limbs developed. Her human leukocyte antigen (HLA) subtype was checked after emergency admission, and it was discovered that she had HLA-DRB1*0405 and DRB0901. Although she underwent a platelet transfusion every day, her platelet count remained low (Fig. 3), and platelet-associated immunoglobulin G (PA-IgG) antibody was relatively high (223 ng/107 cells). She gradually developed hemoptysis and dyspnea because of alveolar hemorrhage. Four days after admission, she required mechanical ventilation, and she developed upper gastrointestinal bleeding, macroscopic hematuria, renal dysfunction, and liver dysfunction. Intravenous immunoglobulin (IVIG) for 7 days, methylprednisolone pulse with maintenance therapy, and romiplostim (recombinant thrombopoietin receptor agonist; TRA) every week were then added to her treatment. Fifteen days after admission, her platelet counts recovered slightly; however, paradoxical cerebral infarction occurred at the left claustrum. Her general condition did not improve despite intensive therapy (Figs. 3, 4); she died 29 days after admission. There was fatal diffuse microscopic bleeding in the lungs, kidneys, pancreas, and ovaries on autopsy. On the other hand, analysis of the lung tumor showed necrotic change, probably induced by nivolumab, because immunohistochemistry showed CD8-positive tumor-infiltrating lymphocytes that were focally positive around the carcinoma (Fig. 4d). Bacterial pneumonia with Gram-positive cocci was also found, but there was no interstitial pneumonia. Based on the above findings, immune thrombocytopenia induced by nivolumab was determined to be the cause of death.\nFig. 3 Clinical course of the present case. The platelet count recovers temporarily with intensive treatment, such as platelet transfusions, intravenous immunoglobulin, steroid pulse therapy, and romiplostim, but the patient’s general condition does not improve. IVIG intravenous immunoglobulin, P/F ratio partial pressure of oxygen in arterial blood/fraction of inspired oxygen ratio, TRA thrombopoietin receptor agonist\n\n\nFig. 4 Chest X-ray, computed tomography findings, and immunohistochemistry at autopsy after thrombocytopenia. a Chest X-ray on admission for thrombocytopenia shows no noteworthy findings. b, c Chest X-ray and computed tomography scan at 24 days after admission show reduced bilateral permeability. d Immunohistochemistry at autopsy. CD8-positive tumor-infiltrating lymphocytes are focally positive, probably induced by nivolumab\n\n\n\nDiscussion and conclusions\nA case of severe grade V thrombocytopenia caused by nivolumab in a patient with relapsed NSCLC was reported because this is an educational case and a warning for all physicians and surgeons prescribing ICIs, regardless of the carcinoma. While the pathogenesis of nivolumab-related thrombocytopenia remains uncertain, it is postulated to mimic idiopathic thrombocytopenic purpura (ITP). In the present case, the mechanism of immune thrombocytopenia was likely to have been caused mainly by PA-IgG antibodies produced by activated lymphocytes. The approved treatments for thrombocytopenia most frequently recommended and used are steroids, IVIG, TRAs, platelet transfusion, splenectomy, and other immunosuppressive agents such as azathioprine and rituximab [10]. Only a few cases of nivolumab-induced thrombocytopenia in patients with NSCLC have been reported to date (Table 1) [6–9], although none of these cases was fatal.\nTable 1 Reported cases of immune-related thrombocytopenia induced by nivolumab in patients with non-small cell lung cancer\n\nAuthor (reference)\tYear\tAge (years)/sex\tCycle\tPLT lowest count\tPA-IgG (ng/107 cells)\tTreatment\tOther ir-AE\tOutcome\t\nBagley et al. [6]\t2016\t34/M\t8\t33,000/μL\tNR\tTRA\tNone\tRecovered\t\nKarakas et al. [7]\t2017\t78/M\t6\t5000/μL\tNR\tS\tNone\tDied of cancer\t\nJotatsu et al. [8]\t2018\t62/M\t2\t1600/μL\t473\tS\tHashimoto’s disease\tRecovered\t\nTokumo et al. [9]\t2018\t56/F\t3\t19,000/μL\tNR\tS, I\tPancytopenia\tDied of cancer\t\nPresent case\t2018\t82/F\t2\t2000/μL\t223\tS, I, TRA\tNone\tDied of AE\t\nAE adverse event, F female, I immunoglobulin, ir-AE immune-related adverse event, M male, NR not reported, PA-IgG platelet-associated immunoglobulin G, PLT platelets, S steroid therapy, TRA thrombopoietin receptor agonist\n\n\n\nThe present patient had severe systemic symptoms followed by bleeding from multiple organs and paradoxical cerebral infarction. She did not recover despite intensive therapy including steroid pulse therapy, a TRA, platelet transfusion, IVIG, mechanical ventilation, and so on. Nomura et al. reported that patients with ITP who had the HLA-DRB1*0410 allele were extremely resistant to steroid therapy [11]. The present patient did not have the HLA-DRB1*0410 allele, but she had HLA-DRB1*0405, which is the second most frequent allele in patients with ITP who are resistant to steroid therapy. This may explain why she had a weak response to steroid therapy. On the other hand, cerebral infarction in the present case might have been related to the IVIG she received. The pathogenesis of the subsequent brain infarction is thought to involve alteration of blood consistency after many doses of IVIG [12]. For other ICIs, there are also a limited number of reports of immune thrombocytopenia induced by pembrolizumab. Le Roy et al. reported two cases of thrombocytopenia in patients with melanoma related to pembrolizumab [13], and there are no reports of thrombocytopenia induced by atezolizumab in the English-language literature. In patients with malignant melanoma, there are also several reports of ICI-induced thrombocytopenia related to nivolumab [14–16].\n\nPillai et al. reported a large-scale systematic comparison of the toxicity profile of PD-1 or PD-L1 inhibitors in patients with NSCLC [17]. In that report, thrombocytopenia was not described as a major AE, and we also recognized ICI-induced thrombocytopenia as a rare AE. Recently, Delanoy et al. reported hematological ir-AEs induced by anti-PD-1 or anti-PD-L1 immunotherapy [18]. They reported grade 2 or worse hematological ir-AEs in 35 patients (3.7%), and immune thrombocytopenia was seen in 9 patients (0.9%). Two patients had hemorrhagic symptoms, although grade V thrombocytopenia was not seen. Two patients did not response to steroids or IVIG and were treated with TRAs or rituximab. They concluded that immunological cytopenia is a rare but potentially serious complication of anti-PD-1 or anti-PD-L1 immunotherapies. Another ICI, ipilimumab, which is a cytotoxic T lymphocyte antigen-4 antibody, has been reported to induce immune thrombocytopenia [19]. In most cases treated by ICIs, relatively frequent AEs such as fatigue and diarrhea, or ir-AEs such as hypothyroidism or pneumonitis, could be managed by multidisciplinary treatment, although life-threatening AEs such as immune thrombocytopenia could occur. We have to consider that ICIs are not only long-lasting and effective drugs in patients with NSCLC, but they also have the possibility of causing severe ir-AEs, including thrombocytopenia.\n\nA very difficult case of grade V immune-related thrombocytopenia after the administration of nivolumab as second-line therapy in a patient with relapsed lung adenocarcinoma was described. We should always consider that ICI treatment can lead to AEs that are difficult to predict, and a systematic support framework for ir-AEs and their predictive biomarkers should be established.\n\nAbbreviations\nAEAdverse event\n\nECOGEastern Cooperative Oncology Group\n\nEGFREpidermal growth factor receptor\n\nHLAHuman leukocyte antigen\n\nICIImmune checkpoint inhibitor\n\nILDInterstitial lung disease\n\nir-AEImmune-related adverse event\n\nITPIdiopathic thrombocytopenic purpura\n\nIVIGIntravenous immunoglobulin\n\nNSCLCNon-small cell lung cancer\n\nPA-IgGPlatelet-associated IgG\n\nPD-1Programmed cell death 1\n\nPD-L1Programmed cell death ligand 1\n\nTRAThrombopoietin receptor agonist\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAcknowledgements\nThe authors would like to thank Forte Science Communications (Tokyo, Japan) for English language editing.\n\nAuthors’ contributions\nTH prepared the main manuscript and abstract. MH and HS played a major role in editing, reviewing, and adding to the manuscript. YO, TI, YW, MF, TY, SM, NO, and YS all helped treat the patient together. All authors read and approved the final manuscript.\n\nFunding\nNo funding was provided or necessary in the preparation of this manuscript.\n\nAvailability of data and materials\nAll references may be accessed via hyperlink. No datasets were used in the preparation of this manuscript.\n\nEthics approval and consent to participate\nThe Ethics Committee of Fukushima Medical University approved the study.\n\nConsent for publication\nWritten, informed consent was obtained from the family of the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n==== Refs\nReferences\n1. Brahmer J Reckamp KL Baas P Crino L Eberhardt WE Poddubskaya E Antonia S Pluzanski A Vokes EE Holgado E Nivolumab versus Docetaxel in Advanced Squamous-Cell Non-Small-Cell Lung Cancer N Engl J Med 2015 373 123 135 10.1056/NEJMoa1504627 26028407 \n2. Borghaei H Paz-Ares L Horn L Spigel DR Steins M Ready NE Chow LQ Vokes EE Felip E Holgado E Nivolumab versus Docetaxel in Advanced Nonsquamous Non-Small-Cell Lung Cancer N Engl J Med 2015 373 1627 1639 10.1056/NEJMoa1507643 26412456 \n3. Reck M Rodriguez-Abreu D Robinson AG Hui R Csoszi T Fulop A Gottfried M Peled N Tafreshi A Cuffe S Pembrolizumab versus Chemotherapy for PD-L1-Positive Non-Small-Cell Lung Cancer N Engl J Med 2016 375 1823 1833 10.1056/NEJMoa1606774 27718847 \n4. Rittmeyer A Barlesi F Waterkamp D Park K Ciardiello F von Pawel J Gadgeel SM Hida T Kowalski DM Dols MC Atezolizumab versus docetaxel in patients with previously treated non-small-cell lung cancer (OAK): a phase 3, open-label, multicentre randomised controlled trial Lancet 2017 389 255 265 10.1016/S0140-6736(16)32517-X 27979383 \n5. Antonia SJ Villegas A Daniel D Vicente D Murakami S Hui R Yokoi T Chiappori A Lee KH de Wit M Durvalumab after Chemoradiotherapy in Stage III Non-Small-Cell Lung Cancer N Engl J Med 2017 377 1919 1929 10.1056/NEJMoa1709937 28885881 \n6. Bagley SJ Kosteva JA Evans TL Langer CJ Immune thrombocytopenia exacerbated by nivolumab in a patient with non-small-cell lung cancer Cancer Treat Commun 2016 6 20 23 10.1016/j.ctrc.2016.02.009 \n7. Karakas Y Yuce D Kilickap S Immune Thrombocytopenia Induced by Nivolumab in a Metastatic Non-Small Cell Lung Cancer Patient Oncol Res Treat 2017 40 621 622 10.1159/000477968 28950270 \n8. Jotatsu T Oda K Yamaguchi Y Noguchi S Kawanami T Kido T Satoh M Yatera K Immune-mediated thrombocytopenia and hypothyroidism in a lung cancer patient treated with nivolumab Immunotherapy 2018 10 85 91 10.2217/imt-2017-0100 29260625 \n9. Tokumo K Masuda T Miyama T Miura S Yamaguchi K Sakamoto S Horimasu Y Nakashima T Miyamoto S Yoshida T Nivolumab-induced severe pancytopenia in a patient with lung adenocarcinoma Lung Cancer 2018 119 21 24 10.1016/j.lungcan.2018.02.018 29656748 \n10. Weide R Feiten S Friesenhahn V Heymanns J Kleboth K Thomalla J van Roye C Koppler H Outpatient Management of Patients with Immune Thrombocytopenia (ITP) by Hematologists 1995-2014 Oncol Res Treat 2016 39 41 44 10.1159/000442769 26891217 \n11. Nomura S Matsuzaki T Ozaki Y Yamaoka M Yoshimura C Katsura K Xie GL Kagawa H Ishida T Fukuhara S Clinical significance of HLA-DRB1*0410 in Japanese patients with idiopathic thrombocytopenic purpura Blood 1998 91 3616 3622 10.1182/blood.V91.10.3616 9572996 \n12. Al-Riyami AZ Lee J Connolly M Shereck E Cerebral sinus thrombosis following IV immunoglobulin therapy of immune thrombocytopenia purpura Pediatr Blood Cancer 2011 57 157 159 10.1002/pbc.22968 21445949 \n13. Le Roy A Kempf E Ackermann F Routier E Robert C Turpin A Marabelle A Mateus C Michot JM Lambotte O Two cases of immune thrombocytopenia associated with pembrolizumab Eur J Cancer 2016 54 172 174 10.1016/j.ejca.2015.10.073 26687374 \n14. Pfohler C Eichler H Burgard B Krecke N Muller CSL Vogt T A Case of Immune Thrombocytopenia as a Rare Side Effect of an Immunotherapy with PD1-Blocking Agents for Metastatic Melanoma Transfus Med Hemother 2017 44 426 428 10.1159/000479237 29344020 \n15. Kanameishi S Otsuka A Nonomura Y Fujisawa A Endo Y Kabashima K Idiopathic thrombocytopenic purpura induced by nivolumab in a metastatic melanoma patient with elevated PD-1 expression on B cells Ann Oncol 2016 27 546 547 10.1093/annonc/mdv580 26602778 \n16. Inadomi K Kumagai H Arita S Tsuruta N Takayoshi K Mishima K Ota S Tanaka M Okumura Y Sagara K Bi-cytopenia possibly induced by anti-PD-1 antibody for primary malignant melanoma of the esophagus: A case report Medicine (Baltimore) 2016 95 e4283 10.1097/MD.0000000000004283 27442668 \n17. Pillai RN Behera M Owonikoko TK Kamphorst AO Pakkala S Belani CP Khuri FR Ahmed R Ramalingam SS Comparison of the toxicity profile of PD-1 versus PD-L1 inhibitors in non-small cell lung cancer: A systematic analysis of the literature Cancer 2018 124 271 277 10.1002/cncr.31043 28960263 \n18. Delanoy N Michot JM Comont T Kramkimel N Lazarovici J Dupont R Champiat S Chahine C Robert C Herbaux C Haematological immune-related adverse events induced by anti-PD-1 or anti-PD-L1 immunotherapy: a descriptive observational study Lancet Haematol 2019 6 e48 e57 10.1016/S2352-3026(18)30175-3 30528137 \n19. Kopecky J Trojanova P Kubecek O Kopecky O Treatment possibilities of ipilimumab-induced thrombocytopenia--case study and literature review Jpn J Clin Oncol 2015 45 381 384 10.1093/jjco/hyu222 25583422\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1752-1947",
"issue": "13(1)",
"journal": "Journal of medical case reports",
"keywords": "Immune checkpoint inhibitor; Immune-related thrombocytopenia; Nivolumab; Non-small cell lung cancer",
"medline_ta": "J Med Case Rep",
"mesh_terms": "D000077192:Adenocarcinoma of Lung; D000369:Aged, 80 and over; D000074322:Antineoplastic Agents, Immunological; D020520:Brain Infarction; D017809:Fatal Outcome; D005260:Female; D006470:Hemorrhage; D006801:Humans; D008175:Lung Neoplasms; D009364:Neoplasm Recurrence, Local; D000077594:Nivolumab; D012720:Severity of Illness Index; D013921:Thrombocytopenia",
"nlm_unique_id": "101293382",
"other_id": null,
"pages": "316",
"pmc": null,
"pmid": "31647029",
"pubdate": "2019-10-24",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": "28885881;25583422;29344020;27718847;9572996;27979383;26891217;26687374;26412456;26602778;28960263;21445949;26028407;28950270;29260625;29656748;30528137;27442668",
"title": "Nivolumab-related severe thrombocytopenia in a patient with relapsed lung adenocarcinoma: a case report and review of the literature.",
"title_normalized": "nivolumab related severe thrombocytopenia in a patient with relapsed lung adenocarcinoma a case report and review of the literature"
} | [
{
"companynumb": "JP-BEH-2019110135",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE"
},
"drugadditional": null,
... |
{
"abstract": "The management of major bleeding in patients treated with direct oral anticoagulants (DOACs) is still not well established. START-Events, a branch of the START registry (Survey on anTicoagulated pAtients RegisTer) (NCT02219984), aims to describe the actual management of bleeding or recurrent thrombotic events in routine clinical practice. We here present the results of the management of bleeding patients. The START-Event registry is a prospective, observational, multicenter, international study. Baseline characteristics (demographic, clinical, risk factors) of patients, laboratory data at admission and during follow-up, site of bleeding, therapeutic strategies, and outcomes at the time of hospital discharge and after 6 months were recorded on a web-based case report form. Between January 2015 and December 2016, 117 patients with major bleeding events were enrolled. Non-valvular atrial fibrillation (NVAF) was the indication for treatment in 84% (62% males); 53 patients had intracranial bleeding (13 fatal), 42 had gastrointestinal bleeding (1 fatal), and 22 had bleeding in other sites. Therapeutic interventions for the management of bleeding were performed in 71% of patients. Therapeutic strategies with/without surgery or invasive procedures included: fluid replacement or red blood cells transfusion, prothrombin complex concentrates (3 or 4 factors), antifibrinolytic drugs, and the administration of idarucizumab. Creatinine, blood cell count, and PT/aPTT were the most frequent tests requested, while specific DOAC measurements were performed in 23% of patients. Mortality during hospitalization was 11.9%, at 6-month follow-up 15.5%. Our data confirm a high heterogeneity in the management of bleeding complications in patients treated with DOACs.",
"affiliations": "Haemostasis and Thrombosis Center, Ospedale di Cremona, Viale Concordia 1, 26100, Cremona, Italy. s.testa@asst-cremona.it.;Department of Medicine and Surgery, University of Insubria, Varese, Italy.;Arianna Anticoagulazione Foundation, Bologna, Italy.;Haemostasis and Thrombosis Center, Ospedale di Cremona, Viale Concordia 1, 26100, Cremona, Italy.;Dresden University Clinic, Dresden, Germany.;Stroke Unit, Università di Perugia, Perugia, Italy.;Division of Angiology and Hemostasis, Geneva University Hospital, Geneva, Switzerland.;Ospedale Mauriziano Torino, Turin, Italy.;UZ Gasdthuisberg, Louvain, Belgium.;Department of Cardiac, Thoracic and Vascular Sciences, University of Padua, Padua, Italy.;Thrombosis Centre, AOU Careggi, Florence, Italy.;Arianna Anticoagulazione Foundation, Bologna, Italy.",
"authors": "Testa|Sophie|S|;Ageno|Walter|W|;Antonucci|Emilia|E|;Morandini|Rossella|R|;Beyer-Westendorf|Jan|J|;Paciaroni|Maurizio|M|;Righini|Marc|M|;Sivera|Piera|P|;Verhamme|Peter|P|;Pengo|Vittorio|V|;Poli|Daniela|D|;Palareti|Gualtiero|G|",
"chemical_list": "D000925:Anticoagulants; D001779:Blood Coagulation Factors; D011720:Pyrazoles; D011728:Pyridones; C025667:prothrombin complex concentrates; C522181:apixaban; D000069552:Rivaroxaban; D000069604:Dabigatran",
"country": "Italy",
"delete": false,
"doi": "10.1007/s11739-018-1877-z",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1828-0447",
"issue": "13(7)",
"journal": "Internal and emergency medicine",
"keywords": "Bleeding; Direct oral anticoagulant; Idarucizumab",
"medline_ta": "Intern Emerg Med",
"mesh_terms": "D000284:Administration, Oral; D000368:Aged; D000369:Aged, 80 and over; D000925:Anticoagulants; D001281:Atrial Fibrillation; D001779:Blood Coagulation Factors; D000069604:Dabigatran; D005260:Female; D006470:Hemorrhage; D006801:Humans; D008297:Male; D011446:Prospective Studies; D011720:Pyrazoles; D011728:Pyridones; D012042:Registries; D000069552:Rivaroxaban; D016896:Treatment Outcome; D014693:Ventricular Fibrillation",
"nlm_unique_id": "101263418",
"other_id": null,
"pages": "1051-1058",
"pmc": null,
"pmid": "29790125",
"pubdate": "2018-10",
"publication_types": "D016428:Journal Article; D064888:Observational Study",
"references": "27566988;24114010;26090400;24251359;26095746;27843050;26095632;19071881;28381513;26911798;24859362;24880102;21946939;14258950;29500618;29700696;26519420;19717844;26672898;28191610;15842354;25371966;26001109;24315724;23809116;22315269;28219635;21870978;27573206;27436877;26324838;21830957;18703803;24930477",
"title": "Management of major bleeding and outcomes in patients treated with direct oral anticoagulants: results from the START-Event registry.",
"title_normalized": "management of major bleeding and outcomes in patients treated with direct oral anticoagulants results from the start event registry"
} | [
{
"companynumb": "IT-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2018-BI-027878",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DABIGATRAN ETEXILATE MESYLATE"
... |
{
"abstract": "Notable sessions at the American Academy of Dermatology meeting focused on pediatric eczema, infantile hemangiomas, and vaccines. The 2015 Aging in America Conference featured discussions on managing medication use in elderly patients.",
"affiliations": null,
"authors": "Sonnenreich|Peter|P|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1052-1372",
"issue": "40(6)",
"journal": "P & T : a peer-reviewed journal for formulary management",
"keywords": null,
"medline_ta": "P T",
"mesh_terms": null,
"nlm_unique_id": "9015516",
"other_id": null,
"pages": "398-400",
"pmc": null,
"pmid": "26045649",
"pubdate": "2015-06",
"publication_types": "D016428:Journal Article",
"references": "18550886;22454089;24311479;24813298",
"title": "American academy of dermatology.",
"title_normalized": "american academy of dermatology"
} | [
{
"companynumb": "US-CELGENEUS-USA-20210808088",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "DAPSONE"
},
"drugadditional": null,
... |
{
"abstract": "Scleredema is a deposition disorder which presents as diffuse, symmetric, non-pitting skin induration from dermal deposits of glycosaminoglycans (\"mucins\"). It classically affects the upper back and posterior neck, often causing skin tightness and decreased range of motion. In most patients the clinical course is chronic and treatment options are limited. We report a case of a patient diagnosed with scleredema associated with longstanding insulin dependent diabetes who was treated successfully with IVIg. Additionally, we have reviewed the literature reporting other patients with scleredema treated with IVIg.",
"affiliations": "School of Medicine, The University of Alabama at Birmingham, Birmingham, Alabama.;Department of Dermatology, The University of Alabama at Birmingham, Birmingham, Alabama.;Department of Medicine, University of Central Florida, Orlando, Florida.",
"authors": "Kennemer|Caroline|C|;Pavlidakey|Peter|P|;Sami|Naveed|N|http://orcid.org/0000-0003-4141-9468",
"chemical_list": "D003879:Dermatologic Agents; D016756:Immunoglobulins, Intravenous",
"country": "United States",
"delete": false,
"doi": "10.1111/dth.12504",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1396-0296",
"issue": "30(4)",
"journal": "Dermatologic therapy",
"keywords": "IVIg; intravenous immunoglobulin; scleredema; therapy; treatment",
"medline_ta": "Dermatol Ther",
"mesh_terms": "D000328:Adult; D003879:Dermatologic Agents; D048909:Diabetes Complications; D003922:Diabetes Mellitus, Type 1; D018450:Disease Progression; D005260:Female; D006801:Humans; D016756:Immunoglobulins, Intravenous; D012592:Scleredema Adultorum",
"nlm_unique_id": "9700070",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "28573670",
"pubdate": "2017-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Successful treatment with IVIg therapy of diabetes-associated scleredema severe progressive case and review of the literature.",
"title_normalized": "successful treatment with ivig therapy of diabetes associated scleredema severe progressive case and review of the literature"
} | [
{
"companynumb": "US-IGSA-SR10005384",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "HUMAN IMMUNOGLOBULIN G"
},
"drugadditional": null,
... |
{
"abstract": "Heart failure in pregnancy is rare, but usually ascribed to peripartum cardiomyopathy in the absence of other possible diagnoses. However, heart failure can develop solely due to a tachycardia, so-called 'tachycardia-induced cardiomyopathy'. The incidence of tachycardia-induced cardiomyopathy in pregnancy is unknown, but it is a treatable and potentially reversible cause of heart failure. Clinically, tachycardia-induced cardiomyopathy during pregnancy might present in a similar manner, but its management has to be individualized according to the arrhythmic substrate and usually involve multidisciplinary input from specialists in obstetrics, cardiac electrophysiology and heart failure.",
"affiliations": "Department of Cardiology, Castle Hill Hospital, Hull York Medical School (at University of Hull), Kingston upon Hull, UK.",
"authors": "Joseph|Anil C|AC|;Prapa|Matina|M|;Pellicori|Pierpaolo|P|;Mabote|Thato|T|;Nasir|Mansoor|M|;Clark|Andrew L|AL|",
"chemical_list": "D010446:Peptide Fragments; C109794:pro-brain natriuretic peptide (1-76); D020097:Natriuretic Peptide, Brain",
"country": "United States",
"delete": false,
"doi": "10.2459/JCM.0000000000000209",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1558-2027",
"issue": "17(10)",
"journal": "Journal of cardiovascular medicine (Hagerstown, Md.)",
"keywords": null,
"medline_ta": "J Cardiovasc Med (Hagerstown)",
"mesh_terms": "D000328:Adult; D009202:Cardiomyopathies; D004452:Echocardiography; D004562:Electrocardiography; D005260:Female; D006333:Heart Failure; D006801:Humans; D020097:Natriuretic Peptide, Brain; D010446:Peptide Fragments; D011247:Pregnancy; D011249:Pregnancy Complications, Cardiovascular; D013610:Tachycardia; D016277:Ventricular Function, Left",
"nlm_unique_id": "101259752",
"other_id": null,
"pages": "762-6",
"pmc": null,
"pmid": "25486585",
"pubdate": "2016-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Tachycardia-induced cardiomyopathy in pregnancy.",
"title_normalized": "tachycardia induced cardiomyopathy in pregnancy"
} | [
{
"companynumb": "GB-MYLANLABS-2016M1045645",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "IVABRADINE"
},
"drugadditional": null,
... |
{
"abstract": "A few prospective trials in HIV-positive patients with Burkitt lymphoma (BL) or high-grade B-cell lymphoma (HGBL) have been reported. Investigated therapies have shown good efficacy but relevant safety problems, with high rates of interruptions, severe mucositis, septic complications, and fungal infections. Here, we report the results of a multicentre phase II trial addressing a new dose-dense, short-term therapy aimed at maintaining efficacy and improving tolerability. The experimental programme included a 36-day polychemotherapy induction followed by high-dose cytarabine-based consolidation and response-tailored BEAM (carmustine, etoposide, cyatarabine, and melphalan)- conditioned autologous stem cell transplantation (ASCT). This therapy would be considered active if ≥11 complete remissions (CR) after induction (primary endpoint) were recorded among 20 assessable patients. HIV-positive adults (median age 42, range 26-58; 16 males) with untreated BL (n = 16), HGBL (n = 3) or double-hit lymphoma (n = 1) were enrolled. All patients had high-risk features, with meningeal and bone marrow infiltration in five and nine patients respectively. The experimental programme was safe and active in a multicentre setting, with only two episodes of grade 4 non-haematological toxicity (hepatotoxicity and mucositis), and no cases of systemic fungal infections; two patients died of toxicity (bacterial infections). Response after induction (median duration: 47 days; interquartile range 41-54), was complete in 13 patients and partial in five [overall response rate = 90%; 95% confidence interval (CI) = 77-100]. All responders received consolidation, and five required autologous stem cell transplant. At a median follow-up of 55 (41-89) months, 14 patients are relapse-free and 15 are alive, with a five-year progression-free survival and an overall survival of 70% (95% CI = 60-80%) and 75% (95% CI = 66-84) respectively. No patient with cerebrospinal fluid (CSF)/meningeal lymphoma experienced central nervous system recurrence. With respect to previously reported regimens, this programme was delivered in a shorter period, and achieved the main goal of maintaining efficacy and improving tolerability.",
"affiliations": "Lymphoma Unit, Department of Onco-Hematology, IRCCS San Raffaele Scientific Institute, Milan, Italy.;Division of Hematology, Ospedali Civili di Brescia, Brescia, Italy.;Division of Medical Oncology and Immune-related tumors, IRCCS Centro di Riferimento Oncologico (CRO), Aviano (PN), Italy.;Division of Hematology, Azienda Ospedaliera San Gerardo, Monza, Italy.;A.O. Città della Salute e della Scienza - Le Molinette, Turin, Italy.;Pathology Unit, Ospedali Civili di Brescia, Brescia, Italy.;Pathology Unit, IRCCS San Raffaele Scientific Institute, Milan, Italy.;Lymphoma Unit, Department of Onco-Hematology, IRCCS San Raffaele Scientific Institute, Milan, Italy.;Division of Medical Oncology, Azienda Ospedaliera San Paolo, Milan, Italy.;Division of Hematology, Ospedale Careggi, Florence, Italy.;Pathology Unit, IRCCS San Raffaele Scientific Institute, Milan, Italy.;Lymphoma Unit, Department of Onco-Hematology, IRCCS San Raffaele Scientific Institute, Milan, Italy.;Infectious Diseases Unit, IRCCS San Raffaele Scientific Institute, Milan, Italy.;Lymphoma Unit, Department of Onco-Hematology, IRCCS San Raffaele Scientific Institute, Milan, Italy.;Lymphoma Unit, Department of Onco-Hematology, IRCCS San Raffaele Scientific Institute, Milan, Italy.;Division of Hematology, Ospedali Civili di Brescia, Brescia, Italy.;Division of Medical Oncology and Immune-related tumors, IRCCS Centro di Riferimento Oncologico (CRO), Aviano (PN), Italy.;Division of Hematology, Ospedali Civili di Brescia, Brescia, Italy.",
"authors": "Ferreri|Andrés J M|AJM|0000-0001-9606-6124;Cattaneo|Chiara|C|;Lleshi|Arben|A|;Verga|Luisa|L|;Allione|Bernardino|B|;Facchetti|Fabio|F|;Ponzoni|Maurilio|M|;Foppoli|Marco|M|;Ferrari|Daris|D|;Rigacci|Luigi|L|;Pecciarini|Lorenza|L|;Donadoni|Giovanni|G|;Fumagalli|Luca|L|;Sassone|Marianna|M|;Calimeri|Teresa|T|;Rossi|Giuseppe|G|;Spina|Michele|M|;Re|Alessandro|A|",
"chemical_list": "D000964:Antimetabolites, Antineoplastic; D000998:Antiviral Agents; D003561:Cytarabine; D005047:Etoposide; D008558:Melphalan; D002330:Carmustine",
"country": "England",
"delete": false,
"doi": "10.1111/bjh.17188",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0007-1048",
"issue": "192(1)",
"journal": "British journal of haematology",
"keywords": "\nMYC\n; Burkitt lymphoma; Human Immunodeficiency Virus; central nervous system prophylaxis; double-hit lymphoma; high-grade B-cell lymphoma",
"medline_ta": "Br J Haematol",
"mesh_terms": "D000163:Acquired Immunodeficiency Syndrome; D000328:Adult; D000964:Antimetabolites, Antineoplastic; D000971:Antineoplastic Combined Chemotherapy Protocols; D000998:Antiviral Agents; D002051:Burkitt Lymphoma; D002330:Carmustine; D003561:Cytarabine; D005047:Etoposide; D005260:Female; D015658:HIV Infections; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D016393:Lymphoma, B-Cell; D008297:Male; D008558:Melphalan; D008875:Middle Aged; D014182:Transplantation, Autologous",
"nlm_unique_id": "0372544",
"other_id": null,
"pages": "119-128",
"pmc": null,
"pmid": "33085777",
"pubdate": "2021-01",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "A dose-dense short-term therapy for human immunodeficiency virus/acquired immunodeficiency syndrome patients with high-risk Burkitt lymphoma or high-grade B-cell lymphoma: safety and efficacy results of the \"CARMEN\" phase II trial.",
"title_normalized": "a dose dense short term therapy for human immunodeficiency virus acquired immunodeficiency syndrome patients with high risk burkitt lymphoma or high grade b cell lymphoma safety and efficacy results of the carmen phase ii trial"
} | [
{
"companynumb": "IT-PFIZER INC-2020419567",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VINCRISTINE SULFATE"
},
"drugadditional": "3",... |
{
"abstract": "Long-term steroid use has a well-documented risk of myopathy that imposes functional limitations for patients and challenges for health care providers. Proximal weakness from steroid myopathy affects support structures around the pelvic girdle and likely predisposes patients to somatic dysfunction. To the authors' knowledge, there are no prior reports in the literature that describe an osteopathic manipulative medicine (OMM) approach for patients with steroid myopathy. In the present case report, a 59-year-old woman with acute myeloid leukemia received a blood stem cell transplantation and developed gastrointestinal graft-versus-host disease. High-dose steroids were prescribed, and she developed proximal weakness from steroid myopathy. The patient's acute inpatient rehabilitation was impacted by new onset left sacroiliac dysfunction. A patient-focused OMM approach was used to assist the patient in maximizing her sacroiliac function. The proximal weakness seen with steroid myopathy necessitates special considerations for an OMM approach to address somatic dysfunction associated with this disease.",
"affiliations": "From the Department of Physical Medicine and Rehabilitation at the University of Michigan in Ann Arbor dkohns@med.umich.edu.;From the Department of Physical Medicine and Rehabilitation at the University of Michigan in Ann Arbor.",
"authors": "Kohns|David J|DJ|;Fitch|David S|DS|",
"chemical_list": "D013256:Steroids",
"country": "United States",
"delete": false,
"doi": "10.7556/jaoa.2014.100",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0098-6151",
"issue": "114(6)",
"journal": "The Journal of the American Osteopathic Association",
"keywords": null,
"medline_ta": "J Am Osteopath Assoc",
"mesh_terms": "D005260:Female; D006801:Humans; D026301:Manipulation, Osteopathic; D008875:Middle Aged; D009135:Muscular Diseases; D012445:Sacrococcygeal Region; D013256:Steroids",
"nlm_unique_id": "7503065",
"other_id": null,
"pages": "498-504",
"pmc": null,
"pmid": "24917637",
"pubdate": "2014-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Osteopathic approach to sacroiliac dysfunction in a patient with steroid myopathy: case report and literature review.",
"title_normalized": "osteopathic approach to sacroiliac dysfunction in a patient with steroid myopathy case report and literature review"
} | [
{
"companynumb": "US-TEVA-642249USA",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEVOTHYROXINE SODIUM"
},
"drugadditional": null,
... |
{
"abstract": "There are no widely accepted dose alterations for inhaled tobramycin in the setting of renal dysfunction, and serum concentrations are not typically monitored. Herein we describe a case report of a 16-year-old female with a history of 2 hematopoietic cell transplants and a kidney transplant who received inhaled tobramycin for chronic Pseudomonas aeruginosa management. The patient developed chronic kidney disease, and tobramycin concentrations were monitored. Initially she received a reduced dose of inhaled tobramycin, with repeated doses based on serum concentrations. The dose was increased, but serum concentrations obtained the following day remained higher than desired, leading to a suspicion of delayed systemic absorption. Tobramycin administration was changed from immediately prior to dialysis to the evening prior to the next day's dialysis session, and serum concentrations were consistently <1 mg/L postdialysis. In conclusion, systemic absorption of inhaled tobramycin in non-cystic fibrosis (CF) patients may differ compared to that observed in CF patients. Renal dysfunction may lead to systemic accumulation of inhaled tobramycin, and the timing of inhaled tobramycin administration with respect to dialysis has a potentially significant influence on drug clearance. Thus, monitoring may be required. Further cases are required to verify these observations.",
"affiliations": null,
"authors": "Trone|Deni J|DJ|;Hall|Elizabeth A|EA|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.5863/1551-6776-25.5.451",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1551-6776",
"issue": "25(5)",
"journal": "The journal of pediatric pharmacology and therapeutics : JPPT : the official journal of PPAG",
"keywords": "administration, bronchiolitis obliterans; inhalation; renal dialysis; therapeutic drug monitoring; tobramycin",
"medline_ta": "J Pediatr Pharmacol Ther",
"mesh_terms": null,
"nlm_unique_id": "101089851",
"other_id": null,
"pages": "451-454",
"pmc": null,
"pmid": "32641916",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "18518833;15357042;12112774;25006239;12114362;18576909;12680485;21785021;20030477;27507832;11598606;16511399;15982625;25549030",
"title": "Therapeutic Drug Monitoring of Inhaled Tobramycin in a Post-Hematopoietic Cell Transplant Patient With Bronchiolitis Obliterans and End-Stage Renal Disease.",
"title_normalized": "therapeutic drug monitoring of inhaled tobramycin in a post hematopoietic cell transplant patient with bronchiolitis obliterans and end stage renal disease"
} | [
{
"companynumb": "US-009507513-2008USA002277",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "POSACONAZOLE"
},
"drugadditional": null,
... |
{
"abstract": "Laparoscopic-assisted ileostomy (LAI) represents a cornerstone for the staged approach to ulcerative colitis (UC). The aim is to determine stoma morbidity in a series of pediatric patients and possibly identify specific risk factors.\n\n\n\nAll of the patients who underwent LAI for UC between January 2008 and December 2014 were included. The following data were collected: patient demographics, preoperative medical treatment, body mass index (BMI) at surgery, Pediatric UC Index (PUCAI), and stoma-related complications. In this series of patients, a staged approach has been adopted (subtotal colectomy + ileostomy; restorative proctocolectomy with J-pouch ileo-rectal anastomosis + ileostomy; ileostomy closure).\n\n\n\nSeventy-two LAIs were fashioned in 37 pediatric patients with UC. Median age at surgery was 12 years (range 5-14.8 years). Boy to girl ratio was 0.85:1. Mortality was zero. Complications occurred after 8 procedures after a median of 31 days postoperatively (range 8-60 days). Those were significantly more frequent in the case of BMI-z score >-0.51 (deleted in revised manuscript, ie, relatively overweight patients) and in the case of preoperative azathioprine administration. Pediatric UC Index score, sex, number of preoperative medications, and other preoperative parameters did not correlate with the incidence of complications.\n\n\n\nOur study suggests to keep a prudent behavior in the case of patients with a BMI-z score >-0.51 and received preoperative azathioprine administration. Parents should be adequately acknowledged on this regard.",
"affiliations": "*Department of Surgery, Istituto Giannina Gaslini †Department of Neuroscience, Rehabilitation, Ophthalmology, Genetics, Maternal and Child Health (DINOGMI), University of Genoa ‡Epidemiology and Biostatistics Unit, Istituto Giannina Gaslini §Gastroenterology and Endoscopy Unit, Istituto Giannina Gaslini, Genoa, Italy.",
"authors": "Pini Prato|Alessio|A|;Pio|Luca|L|;Leonelli|Lorenzo|L|;Pistorio|Angela|A|;Crocco|Marco|M|;Arrigo|Serena|S|;Gandullia|Paolo|P|;Mazzola|Cinzia|C|;Sanfilippo|Fabio|F|;Barabino|Arrigo|A|;Mattioli|Girolamo|G|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1097/MPG.0000000000001025",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0277-2116",
"issue": "62(6)",
"journal": "Journal of pediatric gastroenterology and nutrition",
"keywords": null,
"medline_ta": "J Pediatr Gastroenterol Nutr",
"mesh_terms": "D000293:Adolescent; D002648:Child; D002675:Child, Preschool; D003093:Colitis, Ulcerative; D005260:Female; D006801:Humans; D007081:Ileostomy; D010535:Laparoscopy; D008297:Male; D009017:Morbidity; D011183:Postoperative Complications; D012307:Risk Factors",
"nlm_unique_id": "8211545",
"other_id": null,
"pages": "858-62",
"pmc": null,
"pmid": "26529347",
"pubdate": "2016-06",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Morbidity and Risk Factors of Laparoscopic-Assisted Ileostomies in Children With Ulcerative Colitis.",
"title_normalized": "morbidity and risk factors of laparoscopic assisted ileostomies in children with ulcerative colitis"
} | [
{
"companynumb": "IT-CELGENEUS-ITA-2016065259",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "THALIDOMIDE"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nTo record the efficacy and toxicity of combining bevacizumab with cisplatin in treating malignant pleural effusion and ascites through intrapleural and intraperitoneal infusion.\n\n\nMETHODS\nForty-three patients were admitted to the Oncology Department of Yantai Yuhuangding Hospital with confirmed malignant effusion since January, 2011. Twenty of them received intrapleural and intraperitoneal perfusion of 200 mg bevacizumab plus 60 mg cisplatin every three weeks, and 23 patients received 60 mg cisplatin alone after draining effusion as much as possible. Reduction of effusion was determined by type-B ultrasonography.\n\n\nRESULTS\nThe complete remission rate and effective rate of bevacizumab group was superior to that of the cisplatin group. The quality of life recovery rate of bevacizumab group was superior to that of the cisplatin group. The anhelation and abdominal distention of bevacizumab group was significantly improved. There was no significant difference in level III/IV toxicities and adverse effects between two groups.\n\n\nCONCLUSIONS\nBevacizumab significantly improved the objective response rate and quality of life of patients with malignant pleural effusion and ascites, while not causing notable adverse events.",
"affiliations": "Departments of Gastrointestinal Surgery, Yantai Yuhuangding Hospital, Affiliated Hospital of Medical College Qingdao University, Yantai, Shandong, P.R. China.;Departments of Oncology, Yantai Yuhuangding Hospital, Affiliated Hospital of Medical College Qingdao University, Yantai, Shandong, P.R. China.;Departments of Oncology, Yantai Yuhuangding Hospital, Affiliated Hospital of Medical College Qingdao University, Yantai, Shandong, P.R. China.;Departments of Oncology, Yantai Yuhuangding Hospital, Affiliated Hospital of Medical College Qingdao University, Yantai, Shandong, P.R. China.;Departments of Oncology, Yantai Yuhuangding Hospital, Affiliated Hospital of Medical College Qingdao University, Yantai, Shandong, P.R. China.;Central Laboratory, Yantai Yuhuangding Hospital, Affiliated Hospital of Medical College Qingdao University, Yantai, Shandong, P.R. China.;Central Laboratory, Yantai Yuhuangding Hospital, Affiliated Hospital of Medical College Qingdao University, Yantai, Shandong, P.R. China.;Departments of Oncology, Yantai Yuhuangding Hospital, Affiliated Hospital of Medical College Qingdao University, Yantai, Shandong, P.R. China.;Departments of Oncology, Yantai Yuhuangding Hospital, Affiliated Hospital of Medical College Qingdao University, Yantai, Shandong, P.R. China sunping20039@hotmail.com chenjianyt@163.com.;Departments of Oncology, Yantai Yuhuangding Hospital, Affiliated Hospital of Medical College Qingdao University, Yantai, Shandong, P.R. China Central Laboratory, Yantai Yuhuangding Hospital, Affiliated Hospital of Medical College Qingdao University, Yantai, Shandong, P.R. China sunping20039@hotmail.com chenjianyt@163.com.",
"authors": "Jiang|Lixin|L|;Li|Peng|P|;Gong|Zhaohua|Z|;Hu|Baohong|B|;Ma|Jing|J|;Wang|Jiahui|J|;Chu|Hongjin|H|;Zhang|Liangming|L|;Sun|Ping|P|;Chen|Jian|J|",
"chemical_list": "D000068258:Bevacizumab; D002945:Cisplatin",
"country": "Greece",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0250-7005",
"issue": "36(3)",
"journal": "Anticancer research",
"keywords": "Bevacizumab; ascites; cisplatin; intrapleural and intraperitoneal chemotherapy; malignant pleural effusion",
"medline_ta": "Anticancer Res",
"mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D001201:Ascites; D000068258:Bevacizumab; D002945:Cisplatin; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D016066:Pleural Effusion, Malignant; D011788:Quality of Life; D012074:Remission Induction; D016896:Treatment Outcome",
"nlm_unique_id": "8102988",
"other_id": null,
"pages": "1313-8",
"pmc": null,
"pmid": "26977031",
"pubdate": "2016-03",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Effective Treatment for Malignant Pleural Effusion and Ascites with Combined Therapy of Bevacizumab and Cisplatin.",
"title_normalized": "effective treatment for malignant pleural effusion and ascites with combined therapy of bevacizumab and cisplatin"
} | [
{
"companynumb": "CN-ROCHE-1850281",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BEVACIZUMAB"
},
"drugadditional": "3",
"drug... |
{
"abstract": "Vitamin D is a pro-hormone that plays an important role in body calcium regulation. Vitamin D toxicity occurs rarely due to its wide therapeutic index. A 38-year-old Iranian man was admitted to our hospital with a diagnosis of vitamin D toxicity. Laboratory test revealed hypercalcemia and elevated 25-hydroxyvitamin D (25(OH)D) level. Despite the cessation of vitamin D intake and diuretic treatment, he presented four months later with high 25(OH)D level and similar clinical features. Due to the potential release of vitamin D from adipose tissue, serial monitoring of 25(OH)D level is recommended.",
"affiliations": "Nephrology Research Center, Rasool Akram Hospital, Iran University of Medical Sciences, Tehran, Iran.;Neuroscience Department, Carleton University, Ottawa, Canada.;Nephrology Research Center, Rasool Akram Hospital, Iran University of Medical Sciences, Tehran, Iran.;Assistant Professor of Nephrology. Nephrology Research Center, Rasool Akram Hospital, Iran University of Medical Sciences, Tehran, Iran.",
"authors": "Ziaie|Hossein|H|;Razmjou|Sara|S|;Jomhouri|Rohollah|R|;Jenabi|Arya|A|",
"chemical_list": "D014807:Vitamin D; C104450:25-hydroxyvitamin D; D002118:Calcium",
"country": "Iran",
"delete": false,
"doi": "0161908/AIM.0013",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1029-2977",
"issue": "19(8)",
"journal": "Archives of Iranian medicine",
"keywords": null,
"medline_ta": "Arch Iran Med",
"mesh_terms": "D000273:Adipose Tissue; D000328:Adult; D002118:Calcium; D004562:Electrocardiography; D006801:Humans; D006934:Hypercalcemia; D007492:Iran; D008297:Male; D014807:Vitamin D",
"nlm_unique_id": "100889644",
"other_id": null,
"pages": "597-600",
"pmc": null,
"pmid": "27544370",
"pubdate": "2016-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Vitamin D Toxicity; Stored and Released from Adipose Tissue?",
"title_normalized": "vitamin d toxicity stored and released from adipose tissue"
} | [
{
"companynumb": "CA-VALIDUS PHARMACEUTICALS LLC-CA-2016VAL002517",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CHOLECALCIFEROL"
},
"dr... |
{
"abstract": "Sixty pregnant \"maturity-onset\" (insulin-independent), established and gestational, diabetics were treated with Metformin in the second and third trimester after dietary treatment had failed. The incidence of Metformin failure was 53.8% in the established diabetics and 28.6% in the \"gestational\" diabetics. The 27 Metformin failures were transferred to other therapy, leaving for further analysis 33 patients who received Metformin up till delivery. Two neonatal deaths occurred in this group (1 congenital abnormality and 1 preterm infant) giving a perinatal mortality of 61/1000. This compares with a perinatal mortality of 103/1000 in the Metformin failure group and 105/1000 in a group of insulin-dependent diabetics treated during the same period. Apart from a high incidence of neonatal jaundice requiring phototherapy the infant morbidity in the Metformin group was low. The mothers of 3 infants with congenital abnormalities had received Metformin only during the last trimester of their pregnancy.",
"affiliations": null,
"authors": "Coetzee|E J|EJ|;Jackson|W P|WP|",
"chemical_list": "D008687:Metformin",
"country": "Germany",
"delete": false,
"doi": "10.1007/BF01221950",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0012-186X",
"issue": "16(4)",
"journal": "Diabetologia",
"keywords": null,
"medline_ta": "Diabetologia",
"mesh_terms": "D001034:Apgar Score; D004341:Drug Evaluation; D005260:Female; D006801:Humans; D007226:Infant Mortality; D007231:Infant, Newborn; D008687:Metformin; D011247:Pregnancy; D011254:Pregnancy in Diabetics",
"nlm_unique_id": "0006777",
"other_id": null,
"pages": "241-5",
"pmc": null,
"pmid": "428695",
"pubdate": "1979-04",
"publication_types": "D016428:Journal Article",
"references": "4993314;5069893;581622;14953128;630347;5095432;5430794;14078559;607804;655129;12978289;4927547",
"title": "Metformin in management of pregnant insulin-independent diabetics.",
"title_normalized": "metformin in management of pregnant insulin independent diabetics"
} | [
{
"companynumb": "ZA-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2016-BI-54455BI",
"fulfillexpeditecriteria": "1",
"occurcountry": "ZA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CLONIDINE HYDROCHLORIDE"
... |
{
"abstract": "Epilepsy is a common neurological disorder that may complicate reproductive health. Our aim in this study was to provide prospective ascertainment of obstetric and neonatal outcomes in women with epilepsy and investigate whether the risk of pregnancy, delivery, and neonatal complications differed between women with epilepsy and women without epilepsy.\n\n\n\nPregnant women with epilepsy and women without epilepsy (control group) were prospectively evaluated during the years 2013-2018. They were regularly followed by a neurologist and obstetrician until the end of pregnancy.\n\n\n\nDelivery and perinatal outcomes were compared between 112 women diagnosed with epilepsy and 277 women without epilepsy. Epilepsy was a significant risk factor for preterm delivery, cesarean section, fetal hypoxia, and Apgar score ≤ 7 at 5 min in offspring (odds ratio (OR) = 2.83, 95% confidence interval (CI) 1.03-7.76; OR = 5.61, 95% CI 3.44-9.14; OR = 1.81, 95% CI 1.08-3.04; OR = 8.12, 95% CI 4.04-16.35, respectively). Seizures during pregnancy had influence on the preference of cesarean section as a mode of delivery (ОR = 3.39; 95% CI 1.40-8.17). The rate of perinatal hypoxia was significantly higher in children born by cesarean section (ОR = 2.84; 95% CI 1.04-7.76). There was no significant difference between women with epilepsy and controls in malformation rate.\n\n\n\nWomen with epilepsy had an increased risk of pregnancy and delivery complications. Cesarean section was associated with an increased risk of complications in offspring.",
"affiliations": "Department of Neurology, Azerbaijan Medical University, Mardanov Qardashlari, 100, AZ 1078, Baku, Azerbaijan. melikova.shahla@mail.ru.;Department of Obstetrics and Gynecology II, Azerbaijan Medical University, Mirgasimov, 1004, Baku, Azerbaijan.;Department of Neurology, Azerbaijan Medical University, Mardanov Qardashlari, 100, AZ 1078, Baku, Azerbaijan.",
"authors": "Melikova|Shahla|S|0000-0002-5173-6988;Bagirova|Hijran|H|;Magalov|Sharif|S|",
"chemical_list": null,
"country": "Germany",
"delete": false,
"doi": "10.1007/s00381-019-04435-2",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0256-7040",
"issue": "36(4)",
"journal": "Child's nervous system : ChNS : official journal of the International Society for Pediatric Neurosurgery",
"keywords": "Cesarean section; Neonatal outcome; Offspring; Pregnancy; Seizures; Women with epilepsy",
"medline_ta": "Childs Nerv Syst",
"mesh_terms": "D001034:Apgar Score; D002585:Cesarean Section; D002648:Child; D004827:Epilepsy; D005260:Female; D006801:Humans; D007231:Infant, Newborn; D011247:Pregnancy; D011256:Pregnancy Outcome; D011446:Prospective Studies; D012640:Seizures",
"nlm_unique_id": "8503227",
"other_id": null,
"pages": "775-782",
"pmc": null,
"pmid": "31786631",
"pubdate": "2020-04",
"publication_types": "D016428:Journal Article",
"references": "19461417;28038386;26359281;16752253;29587185;19781049;10901562;25777785;12683703;23848605;19561658;16492586;19490036;27784632;11001359;23303847;12712077;28666184;19087117;18929083;22429269;20716254;22955634;4014343;16417548;29898689;24339574;29179105;19021093;27942498;26187231;26527567;19667219;26147878;28641176;28176327;25837494;14981376;21557799;25843764;18805707;28672292;25746572;26318519;29981006",
"title": "The impact of maternal epilepsy on delivery and neonatal outcomes.",
"title_normalized": "the impact of maternal epilepsy on delivery and neonatal outcomes"
} | [
{
"companynumb": "AZ-SUN PHARMACEUTICAL INDUSTRIES LTD-2021R1-289504",
"fulfillexpeditecriteria": "1",
"occurcountry": "AZ",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "LEVETIRACETAM"
},
"d... |
{
"abstract": "Thrombocytopenia with absent radii (TAR) syndrome is a rare congenital disorder characterized by low platelet counts of various severity, bilateral absent radii but thumbs are usually present. TAR syndrome is not generally associated with bone marrow failure or malignancy. Janus kinase-2, myeloproliferative leukemia protein, and calreticulin are not mutated in TAR patients. Only four cases of leukemia were reported in TAR patients in the literature: three acute myeloid leukemia (AML) and one acute lymphoblastic leukemia. Of the three cases of AML found in TAR patient, only one was reported in an adult. We report a case of myelodysplastic syndrome progressing to AML with calreticulin driver mutation in an adult male with TAR syndrome who was successfully treated with hematopoietic allogeneic stem cell transplantation.",
"affiliations": "Weill Cornell Medical College, New York, NY, USA.;Weill Cornell Medical College, New York, NY, USA.;Weill Cornell Medical College, New York, NY, USA.;Weill Cornell Medical College, New York, NY, USA.;New York Presbyterian Hospital, USA.;Weill Cornell Medical College, New York, NY, USA. Electronic address: usg2001@med.cornell.edu.",
"authors": "Jameson-Lee|Maximilian|M|;Chen|Katherine|K|;Ritchie|Ellen|E|;Shore|Tsiporah|T|;Al-Khattab|Omar|O|;Gergis|Usama|U|",
"chemical_list": "C576483:CALR protein, human; D037282:Calreticulin; D009363:Neoplasm Proteins",
"country": "England",
"delete": false,
"doi": "10.1016/j.hemonc.2017.02.001",
"fulltext": null,
"fulltext_license": null,
"issn_linking": null,
"issue": "11(4)",
"journal": "Hematology/oncology and stem cell therapy",
"keywords": null,
"medline_ta": "Hematol Oncol Stem Cell Ther",
"mesh_terms": "D064591:Allografts; D037282:Calreticulin; D000080984:Congenital Bone Marrow Failure Syndromes; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D015470:Leukemia, Myeloid, Acute; D008297:Male; D008875:Middle Aged; D009154:Mutation; D009190:Myelodysplastic Syndromes; D009363:Neoplasm Proteins; D011884:Radius; D013921:Thrombocytopenia; D038062:Upper Extremity Deformities, Congenital",
"nlm_unique_id": "101468532",
"other_id": null,
"pages": "245-247",
"pmc": null,
"pmid": "28259746",
"pubdate": "2018-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Acute myeloid leukemia in a patient with thrombocytopenia with absent radii: A case report and review of the literature.",
"title_normalized": "acute myeloid leukemia in a patient with thrombocytopenia with absent radii a case report and review of the literature"
} | [
{
"companynumb": "US-GLENMARK PHARMACEUTICALS-2018GMK038714",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "OXCARBAZEPINE"
},
"drugadditi... |
{
"abstract": "First line therapy of patients with marginal zone lymphomas (MZL) is not well established and various regimens with chemo-immunotherapy can be used. Rituximab plus bendamustine (BR) is an effective and manageable treatment option for patients affected by indolent non-Hodgkin lymphoma. The aim of this monocentric retrospective study was to analyze the effectiveness and safety of the use of BR regimen in MZL patients in first line in daily clinical practice. The treatment schedule was rituximab at the dose of 375 mg/m2 on day 1 of each cycle and bendamustine at the dose of 90 mg/m2 on day 2 and 3, every 28 days for a maximum of 6 cycles. We analyzed 65 MZL patients (28 extranodal [EMZL], 23 splenic [SMZL], and 14 nodal [NMZL]) who underwent BR regimen as first line treatment. The median time from diagnosis to therapy was 2.5 months. Final responses were: 38 complete response (CR, 58.5%), 20 partial response and 7 progressive disease, leading to an overall response rate (ORR) of 89.2%. With respect to the histology, the ORR was 89.3% for EMZL, 82.6% for SMZL and 100% for NMZL, respectively (difference not statistically significant). With a median follow-up time of 44.6 months (range, 3.3-175.0 months), 2 (one EMZL after 42 months and one SMZL after 10 months) of 38 (5.2%) CR patients had disease relapse, yielding an estimated disease free survival of 89.2% at 61.1 months. The estimated 6-year progression free survival was 71.8% with 15 relapsed/progressed patients showing lymphoma recurrence within 48 months from end of treatment. The most frequently reported adverse events (any grade) were neutropenia (N = 35, 53.8%), fatigue (N = 15, 23.0%), and nausea (N = 12, 18.4%). All toxicities quickly resolved and no treatment-related death occurred. The BR regimen is effective and feasible in MZL patients inducing prolonged disease control with manageable toxicities.",
"affiliations": "Institute of Hematology \"L. e A. Seràgnoli\", University of Bologna, Bologna, Italy.;Institute of Hematology \"L. e A. Seràgnoli\", University of Bologna, Bologna, Italy.;Institute of Hematology \"L. e A. Seràgnoli\", University of Bologna, Bologna, Italy.;Institute of Hematology \"L. e A. Seràgnoli\", University of Bologna, Bologna, Italy.;Institute of Hematology \"L. e A. Seràgnoli\", University of Bologna, Bologna, Italy.;Institute of Hematology \"L. e A. Seràgnoli\", University of Bologna, Bologna, Italy.;Institute of Hematology \"L. e A. Seràgnoli\", University of Bologna, Bologna, Italy.;Institute of Hematology \"L. e A. Seràgnoli\", University of Bologna, Bologna, Italy.;Institute of Hematology \"L. e A. Seràgnoli\", University of Bologna, Bologna, Italy.;Institute of Hematology \"L. e A. Seràgnoli\", University of Bologna, Bologna, Italy.;Hematopathology Unit, Sant'Orsola-Malpighi Hospital, Bologna, Italy.;Institute of Hematology \"L. e A. Seràgnoli\", University of Bologna, Bologna, Italy.;Institute of Hematology \"L. e A. Seràgnoli\", University of Bologna, Bologna, Italy.",
"authors": "Morigi|Alice|A|;Argnani|Lisa|L|;Lolli|Ginevra|G|;Broccoli|Alessandro|A|https://orcid.org/0000-0001-5633-7313;Pellegrini|Cinzia|C|;Nanni|Laura|L|;Stefoni|Vittorio|V|;Coppola|Paolo Elia|PE|;Carella|Matteo|M|;Casadei|Beatrice|B|;Sabattini|Elena|E|;Cavo|Michele|M|;Zinzani|Pier Luigi|PL|https://orcid.org/0000-0002-2112-2651",
"chemical_list": "D000069283:Rituximab; D000069461:Bendamustine Hydrochloride",
"country": "England",
"delete": false,
"doi": "10.1002/hon.2773",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0278-0232",
"issue": "38(4)",
"journal": "Hematological oncology",
"keywords": "bendamustine; marginal zone lymphoma; rituximab; untreated",
"medline_ta": "Hematol Oncol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000971:Antineoplastic Combined Chemotherapy Protocols; D000069461:Bendamustine Hydrochloride; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D018442:Lymphoma, B-Cell, Marginal Zone; D008297:Male; D008875:Middle Aged; D011379:Prognosis; D012074:Remission Induction; D012189:Retrospective Studies; D000069283:Rituximab; D015996:Survival Rate",
"nlm_unique_id": "8307268",
"other_id": null,
"pages": "487-492",
"pmc": null,
"pmid": "32594531",
"pubdate": "2020-10",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article; D064888:Observational Study",
"references": null,
"title": "Bendamustine-rituximab regimen in untreated indolent marginal zone lymphoma: experience on 65 patients.",
"title_normalized": "bendamustine rituximab regimen in untreated indolent marginal zone lymphoma experience on 65 patients"
} | [
{
"companynumb": "IT-ACCORD-190854",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RITUXIMAB"
},
"drugadditional": "3",
"drugad... |
{
"abstract": "In the era of immunotherapy for cancer, solid organ transplant patients who go on to develop metastatic or locally advanced melanoma offer particularly difficult challenges. New approaches are needed for these patients. We present a case of in-transit metastatic melanoma in a renal transplant patient. The patient was initially managed with talimogene laherparepvec (T-VEC) injections alone with continued local progression. Addition of topical imiquimod 5% cream to intralesional T-VEC resulted in a rapid and dramatic response, with complete clearance of the cutaneous in-transit metastases and without any sign of organ rejection. In solid organ transplant patients who lack surgical options and are not eligible for treatment with a BRAF inhibitor, and for whom treatment with checkpoint inhibitors present risk of organ rejection, T-VEC either alone or in combination with topical imiquimod should be considered for patients with locally advanced disease. This combination should be a consideration, with close observation, in patients with a history of organ transplantation and immunosuppression.",
"affiliations": "Department of Dermatology, Division of Oncodermatology.;Department of Medicine, Division of Hematology and Oncology.;Department of Medicine, Division of Nephrology, Northwestern University Feinberg School of Medicine, Chicago, IL.;Department of Dermatology, Division of Oncodermatology.",
"authors": "Sunshine|Joel C|JC|;Sosman|Jeffrey|J|;Shetty|Aneesha|A|;Choi|Jennifer N|JN|",
"chemical_list": "D001688:Biological Products; D000082082:Immune Checkpoint Inhibitors; C000629782:talimogene laherparepvec; D000077271:Imiquimod",
"country": "United States",
"delete": false,
"doi": "10.1097/CJI.0000000000000319",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1524-9557",
"issue": "43(4)",
"journal": "Journal of immunotherapy (Hagerstown, Md. : 1997)",
"keywords": null,
"medline_ta": "J Immunother",
"mesh_terms": "D001688:Biological Products; D001706:Biopsy; D003131:Combined Modality Therapy; D019468:Disease Management; D018259:Herpesvirus 1, Human; D006801:Humans; D000077271:Imiquimod; D000082082:Immune Checkpoint Inhibitors; D016030:Kidney Transplantation; D008297:Male; D008545:Melanoma; D008875:Middle Aged; D050130:Oncolytic Virotherapy; D016896:Treatment Outcome",
"nlm_unique_id": "9706083",
"other_id": null,
"pages": "149-152",
"pmc": null,
"pmid": "32235165",
"pubdate": "2020-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Successful Treatment of In-Transit Metastatic Melanoma in a Renal Transplant Patient With Combination T-VEC/Imiquimod Immunotherapy.",
"title_normalized": "successful treatment of in transit metastatic melanoma in a renal transplant patient with combination t vec imiquimod immunotherapy"
} | [
{
"companynumb": "US-TOLMAR, INC.-20US021368",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TALIMOGENE LAHERPAREPVEC"
},
"drugadditional... |
{
"abstract": "BACKGROUND\nMethicillin-resistant Staphylococcus aureus (MRSA) has been established as an important cause of severe community-acquired pneumonia (CAP) with very high mortality. Panton-Valentine leukocidin (PVL) producing MRSA has been reported to be associated with necrotizing pneumonia and worse outcome. The incidence of community-acquired MRSA (CA-MRSA) pneumonia is very low, as only a few CA-MRSA pneumonia cases were reported in the last few years. We present a case of severe CAP caused by PVL-positive MRSA with ensuing septic shock.\nA 68-year-old male with no concerning medical history had developed a fever that reached 39.0°C, a productive cough that was sustained for 5 days, and hypodynamia. He was treated with azithromycin and alexipyretic in a nearby clinic for 2 days in which the symptoms were alleviated. However, 1 day later, the symptoms worsened, and he was taken to a local Chinese medicine hospital for traditional medicine treatment. However, his clinical condition deteriorated rapidly, and he then developed dyspnea and hemoptysis.\n\n\nMETHODS\nCA-MRSA pneumonia and septic shock. The sputum culture showed MRSA. Polymerase chain reaction of MRSA isolates was positive for PVL genes.\n\n\nMETHODS\nMechanical ventilation, fluid resuscitation, and antibiotic therapy were performed. Antibiotic therapy included mezlocillin sodium/sulbactam sodium, linezolid, and oseltamivir.\n\n\nRESULTS\nHe died after 12 hours of treatment.\n\n\nCONCLUSIONS\nThis is a report of severe pneumonia due to PVL-positive CA-MRSA in a healthy adult. CA-MRSA should be considered a pathogen of severe CAP, especially when combined with septic shock in previously healthy individuals.",
"affiliations": "Department of Respiratory Medicine.;Department of Respiratory Medicine.;Department of Intensive Care Unit Group One, The First Hospital of Jilin University, Changchun, Jilin, China.;Department of Respiratory Medicine.",
"authors": "Xia|Huan|H|;Gao|Jinying|J|;Xiu|Ming|M|;Li|Dan|D|",
"chemical_list": "D000900:Anti-Bacterial Agents; D053139:Oseltamivir; D000069349:Linezolid; D008802:Mezlocillin",
"country": "United States",
"delete": false,
"doi": "10.1097/MD.0000000000020914",
"fulltext": "\n==== Front\nMedicine (Baltimore)\nMedicine (Baltimore)\nMEDI\nMedicine\n0025-7974 1536-5964 Wolters Kluwer Health \n\n32590802\nMD-D-19-07098\n10.1097/MD.0000000000020914\n20914\n6700\nResearch Article\nClinical Case Report\nCommunity-acquired pneumonia caused by methicillin-resistant Staphylococcus aureus in a Chinese adult\nA case reportXia Huan MD, PhDa Gao Jinying MMa Xiu Ming MD, PhDb Li Dan MD, PhDa∗ Saranathan. Maya a Department of Respiratory Medicine\nb Department of Intensive Care Unit Group One, The First Hospital of Jilin University, Changchun, Jilin, China.\n∗ Correspondence: Dan Li, Department of Respiratory Medicine, The First Hospital of Jilin University, No. 1 Xinmin Street, Chaoyang District, Changchun, Jilin 130021, China (e-mail: lisa05@yeah.net).\n26 6 2020 \n26 6 2020 \n99 26 e2091423 9 2019 7 5 2020 26 5 2020 Copyright © 2020 the Author(s). Published by Wolters Kluwer Health, Inc.2020This is an open access article distributed under the Creative Commons Attribution License 4.0 (CCBY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. http://creativecommons.org/licenses/by/4.0Abstract\nRationale:\nMethicillin-resistant Staphylococcus aureus (MRSA) has been established as an important cause of severe community-acquired pneumonia (CAP) with very high mortality. Panton–Valentine leukocidin (PVL) producing MRSA has been reported to be associated with necrotizing pneumonia and worse outcome. The incidence of community-acquired MRSA (CA-MRSA) pneumonia is very low, as only a few CA-MRSA pneumonia cases were reported in the last few years. We present a case of severe CAP caused by PVL-positive MRSA with ensuing septic shock.\n\nPatient concerns:\nA 68-year-old male with no concerning medical history had developed a fever that reached 39.0°C, a productive cough that was sustained for 5 days, and hypodynamia. He was treated with azithromycin and alexipyretic in a nearby clinic for 2 days in which the symptoms were alleviated. However, 1 day later, the symptoms worsened, and he was taken to a local Chinese medicine hospital for traditional medicine treatment. However, his clinical condition deteriorated rapidly, and he then developed dyspnea and hemoptysis.\n\nDiagnosis:\nCA-MRSA pneumonia and septic shock. The sputum culture showed MRSA. Polymerase chain reaction of MRSA isolates was positive for PVL genes.\n\nInterventions:\nMechanical ventilation, fluid resuscitation, and antibiotic therapy were performed. Antibiotic therapy included mezlocillin sodium/sulbactam sodium, linezolid, and oseltamivir.\n\nOutcomes:\nHe died after 12 hours of treatment.\n\nLessons:\nThis is a report of severe pneumonia due to PVL-positive CA-MRSA in a healthy adult. CA-MRSA should be considered a pathogen of severe CAP, especially when combined with septic shock in previously healthy individuals.\n\nKeywords\ncommunity-acquired pneumoniamethicillin-resistant Staphylococcus aureusPanton–Valentine leukocidinOPEN-ACCESSTRUE\n==== Body\n1 Introduction\nAlthough methicillin-resistant Staphylococcus aureus (MRSA) has been known to be associated with nosocomial pneumonia, several reports have also described cases of community-acquired pneumonia (CAP) that was caused by MRSA. The estimated incidence of community-acquired MRSA (CA-MRSA) pneumonia is 0.51 to 0.64 cases per 100,000.[1] An international multicenter study indicated that the overall prevalence of confirmed MRSA CAP was 3% among 3193 CAP patients with microbiology testing, ranging from 2.4% in Europe to 5.4% in South America.[2] MRSA can cause severe CAP, which leads to critical illness and sometimes death. Self and colleagues observed that chronic hemodialysis use was more common among patients with MRSA than pneumococcal and all-cause non-S aureus CAP, whereas other clinical features at admission were similar.[3] Patients with CA-MRSA pneumonia had more severe clinical outcomes than those with pneumococcal CAP, including intensive care unit admission and in-patient mortality.[3] Some research reported the mortality of CA-MRSA pneumonia is as high as 56% to 63%.[4,5] Postinfluenza bacterial pneumonia is a leading cause of influenza-associated death and CA-MRSA pneumonia has been reported to occur following influenza infection, posing a therapeutic challenge because of the high risk of inappropriate empiric antimicrobial therapy and poor clinical outcomes.[6,7] The Panton-Valentine leukocidin (PVL) virulence is typically associated with CA-MRSA strains.[8] CAP due to MRSA carrying the PVL gene can perform as extensive lung necrosis, multilobular infiltrates, leucopenia, hemoptysis, and sepsis, leading to a higher lethality rate.[9,10]\n\nHerein, we present a case of severe CAP caused by MRSA with septic shock in a 68-year-old previously healthy male. We also review the literature related to CA-MRSA pneumonia.\n\n2 Case presentation\nA 68-year-old male with no concerning medical history had developed a fever that reached 39.0°C, a productive cough that was sustained for 5 days and hypodynamia. He went to a nearby clinic and he was treated with azithromycin and alexipyretic for 2 days, in which the symptoms alleviated. However, 1 day later, the symptoms worsened, and he was taken to local Chinese medicine hospital for traditional medicine treatment. However, his clinical condition deteriorated rapidly, and he then developed dyspnea and hemoptysis. He was then taken to another hospital for a chest computed tomography (CT) scan, which showed consolidations with interspersed small lucent areas in both lungs (Figs. 1–3). Following this, he came to our emergency department and was intubated for mechanical ventilation. He was then admitted to our respiratory intensive care unit (RICU).\n\nFigure 1 A computed tomography scan of the chest performed on January 9, 2018.\n\nFigure 2 A computed tomography scan of the chest performed on January 9, 2018.\n\nFigure 3 A computed tomography scan of the chest performed on January 9, 2018.\n\nHe had an appendectomy 10 years ago, but apart from that he had no other significant medical history. He also had a 15-pack-year smoking history and a long-term history of alcohol intake with an average of 100 g/day.\n\nHis vital signs on admission to our RICU revealed a heart rate of 106 beats/min and a blood pressure reading of 70/52 mmHg with a shock manifestation. The oxygen saturation was 83% under ambu bag operation through a trachea cannula. Auscultation revealed lower respiratory sounds and a few moist rales in the base areas of both lungs. There were no wounds on his body, arms, or legs.\n\nInitial blood investigations showed a white blood cell count (WBC) of 1.2 × 109 cells/L made up of 75% neutrophils, a lymphocyte count of 0.21 × 109 cells/L and platelet count of 94 × 109 cells/L. Arterial blood gas analysis showed a pH of 7.19, a partial pressure of carbon dioxide (PaCO2) at 39 mmHg, a partial pressure of oxygen (PO2) at 57 mmHg, and a lactate level at 5.6 mmol/L. C-reactive protein and procalcitonin were markedly elevated at 61.24 mg/L and >400 ng/mL, respectively. He appeared to have hypoproteinemia as the total protein level was 42.2 g/L and the albumin level was 22.8 g/L. Renal function was also poor as the blood urea nitrogen level was 12.62 mmol/L and the creatinine level was 231.2 mmol/L. Blood coagulation function showed activated partial thromboplastin time at 41.5 seconds, plasma prothrombin time at 14.9 seconds, the international normalized ratio was 1.27, and prothrombin activity was at 65%. The level of blood calcium was as low as 1.67 mmol/L. The plasma concentration of 1,3 beta-d-glucan was 10 ng/mL. The erythrocyte sedimentation rate was normal. Plasma d-dimer and fibrinogen degradation product was 2708 μg/L and 15.6 μg/ml, respectively. B-type natriuretic peptide was 5690 pg/mL. Myohemoglobin was 6633 ng/mL and CK-MB was 7.72 ng/mL. The routine urine test showed bilirubin 1+, ketone 1+, nitrite +, and WBC 30.1 cells/μL.\n\nHe had received mechanical ventilation immediately with FiO2 at 1.0 and positive-expiratory pressure at 10 cmH2O. He was then sedated, and a neuromuscular blockade was given to him. Noradrenaline was intravenously injected and fluid resuscitation was conducted. Antibiotic therapy was also conducted and included mezlocillin sodium/sulbactam sodium, linezolid, and oseltamivir. Hydrocortisone was administrated due to septic shock. His airway had then started to fill with bloody secretion. Although he was given immediate therapy, the condition of his hypoxemia did not improve and extracorporeal membrane oxygenation (ECMO) was advised. The patient's family members refused ECMO treatment for financial reasons. During his second day of hospitalization, the patient died.\n\nOn day 4, a culture of sputum showed MRSA that was resistant to oxacillin, benzylpenicillin, erythromycin, and clindamycin, but susceptible to ciprofloxacin, vancomycin, levofloxacin, quinupristin/dalfopri, oxacillin, moxifloxcin, rifampicin, trimethoprim/sulfamet, tigecyclin, tetracycline, and gentamicin.\n\nPolymerase chain reaction (PCR) of MRSA isolates obtained from the patient's sputum was conducted as described in previous reports.[11] The results were positive for PVL genes.\n\nInformed written consent was obtained from the son of the patient for publication of this case report and accompanying images.\n\n3 Discussion\nMRSA has been recognized as a cause of severe CAP though not common.[12] CA-MRSA pneumonia usually occurs in young otherwise healthy individuals and can progress rapidly with various complications leading to a high mortality rate.[13] Some studies have defined infections with CA-MRSA as follows: an MRSA infection identified within 48 hours of admission to a hospital; no history of hospitalization, surgery, dialysis, or residence in a long-term care facility within 1 year of the MRSA culture date; without a permanent indwelling catheter or percutaneous medical device present at the time of culture; and without a known previous MRSA infection or colonization before the study period.[14–16] Our patient was previously healthy but then developed a fever, productive cough, dyspnea, and leucopenia. His chest CT scans showed multilobular infiltrates and consolidations in both lungs. His sputum yielded strains of MRSA. Therefore, we defined the patient as having CA-MRSA pneumonia.\n\nThe PVL is a pore-forming toxin secreted by MRSA and it has been proven to induce rapid activation and cell death in human neutrophils, thus playing an important role in the development and outcome of CAP.[17] A report by Bhatta et al showed that 90.4% CA-MRSA were PVL-positive, whereas only 7.1% hospital-associated MRSA were PVL-positive, suggesting that PVL may be a marker of CA-MRSA.[8] It has also been reported that CAP caused by MRSA carrying the PVL gene can also lead to extensive lung necrosis, multilobular infiltrates, leucopenia, hemoptysis, and sepsis.[9] The presentation of the patient we described was consistent with the production of PVL, which was later confirmed by PCR.[11] The patient we described showed leucopenia, hemoptysis, and sepsis shock which were typical of PVL-positive MRSA pneumonia. Necrotizing pneumonia may the following features multiple pulmonary consolidations and necrosis of the lung tissue, which can result in cavitations and collection of pus in the pleural cavity.[18] However, not all cases are characterized by pulmonary cavitation. The radiological findings of our patient included multilobular infiltrates and pulmonary consolidations; however, there were no typical cavities on his chest CT scans.\n\nIn recent years, some cases of severe CA-MRSA pneumonia have been reported to be associated with previously having influenza,[5,6,13,19] raising concerns about PVL-MRSA pneumonia during influenza epidemics. Viral and other types of infection may damage epithelial cells in the airway, leading to the migration of PVL-positive MRSA to the basement membrane.[20] PVL could then cause pulmonary necrosis through tissue destruction via infiltration by neutrophils and macrophages. Our patient presented with a fever, a productive cough, and fatigue, but did not present with a sore throat, nasal congestion, running nose, or headache. Onset of symptoms from this patient was within the influenza season; thus, we prescribed oseltamivir. Unfortunately, the patient died the next morning; therefore, a test of the influenza virus nucleic acid PCR was not conducted.\n\nIt has been reported that CA-MRSA is typically susceptible to most non-β-lactam antibiotics and HA-MRSA exhibits resistance to numerous agents. However, increasing non-β-lactam resistance of MRSA has been found in recent years varying between countries and clones.[21] The MRSA grown from the patient's sputum was resistant to erythromycin and clindamycin, with exceptions being to oxacillin and benzylpenicillin.\n\nAlthough the prevalence of CA-MRSA pneumonia was low, 29.8% of hospitalized CAP patients still received empirical anti-MRSA antibiotics and only 0.7% of cases were CA-MRSA pneumonia.[3] It is vital to understand that CA-MRSA can cause lethal pneumonia, even in previously healthy persons. Therefore, early recognition of this infection and timely antimicrobial therapy are important to improve the prognosis. Empirical therapy for MRSA is only recommended for hospitalized patients with severe CAP defined by any one of the following: ①a requirement for intensive care unit admission, ②necrotizing or cavitary infiltrates, or ③emphysema, pending sputum and/or blood culture results.[22] Vancomycin and linezolid were recommended as first-line agents for CA-MRSA infection.[23] Our patient was initially given linezolid. However, this critically ill patient died after 12 hours.\n\nIn conclusion, we reported a severe CA-MRSA pneumonia along with septic shock in a patient without any concerning medical history. We should consider the possibility of a CA-MRSA infection in cases with severe CAP and necrotizing pneumonia, especially with the possibility of developing septic shock.\n\nAuthor contributions\nFormal analysis: Huan Xia, Jinying Gao, Ming Xiu\n\nInvestigation: Jinying Gao and Ming Xiu\n\nWriting – original draft: Huan Xia\n\nWriting – review & editing: Dan Li\n\nAbbreviations: CA-MRSA = community-acquired MRSA, CAP = community-acquired pneumonia, CT = chest computed tomography, ECMO = extracorporeal membrane oxygenation, MRSA = methicillin-resistant Staphylococcus aureus, PCR = polymerase chain reaction, PVL = Panton–Valentine leukocidin, RICU = respiratory intensive care unit.\n\nHow to cite this article: Xia H, Gao J, Xiu M, Li D. Community-acquired pneumonia caused by methicillin-resistant Staphylococcus aureus in a Chinese adult: a case report. Medicine. 2020;99:26(e20914).\n\nThe authors report no conflicts of interest.\n\nAll data generated or analyzed during this study are included in this published article [and its supplementary information files].\n==== Refs\nReferences\n[1] Vardakas KZ Matthaiou DK Falagas ME \nIncidence, characteristics and outcomes of patients with severe community acquired-MRSA pneumonia\n. Eur Respir J \n2009 ;34 :1148 –58\n.19541719 \n[2] Aliberti S Reyes LF Faverio P \nGlobal initiative for meticillin-resistant Staphylococcus aureus pneumonia (GLIMP): an international, observational cohort study\n. Lancet Infect Dis \n2016 ;16 :1364 –76\n.27593581 \n[3] Self WH Wunderink RG Williams DJ \nStaphylococcus aureus community-acquired pneumonia: prevalence, clinical characteristics, and outcomes\n. Clin Infect Dis \n2016 ;63 :300 –9\n.27161775 \n[4] David MZ Daum RS \nCommunity-associated methicillin-resistant Staphylococcus aureus: epidemiology and clinical consequences of an emerging epidemic\n. Clin Microbiol Rev \n2010 ;23 :616 –87\n.20610826 \n[5] Mandell LA Wunderink R \nMethicillin-resistant staphylococcus aureus and community-acquired pneumonia: an evolving relationship\n. Clin Infect Dis \n2012 ;54 :1134 –6\n.22438344 \n[6] Roberts JC Gulino SP Peak KK \nFatal necrotizing pneumonia due to a Panton-Valentine leukocidin positive community-associated methicillin-sensitive Staphylococcus aureus and Influenza co-infection: a case report\n. Ann Clin Microbiol Antimicrob \n2008 ;7 :5 .18284686 \n[7] Chung DR Huh K \nNovel pandemic influenza A (H1N1) and community-associated methicillin-resistant Staphylococcus aureus pneumonia\n. Expert Rev Anti Infect Ther \n2015 ;13 :197 –207\n.25578884 \n[8] Bhatta DR Cavaco LM Nath G \nAssociation of Panton Valentine Leukocidin (PVL) genes with methicillin resistant Staphylococcus aureus (MRSA) in Western Nepal: a matter of concern for community infections (a hospital based prospective study)\n. BMC Infect Dis \n2016 ;16 :199 .27179682 \n[9] Francis JS Doherty MC Lopatin U \nSevere community-onset pneumonia in healthy adults caused by methicillin-resistant Staphylococcus aureus carrying the Panton-Valentine leukocidin genes\n. Clin Infect Dis \n2005 ;40 :100 –7\n.15614698 \n[10] Gillet Y Issartel B Vanhems P \nAssociation between Staphylococcus aureus strains carrying gene for Panton-Valentine leukocidin and highly lethal necrotising pneumonia in young immunocompetent patients\n. Lancet (London, England) \n2002 ;359 :753 –9\n.\n[11] Lina G Piemont Y Godail-Gamot F \nInvolvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia\n. Clin Infect Dis \n1999 ;29 :1128 –32\n.10524952 \n[12] Lobo LJ Reed KD Wunderink RG \nExpanded clinical presentation of community-acquired methicillin-resistant Staphylococcus aureus pneumonia\n. Chest \n2010 ;138 :130 –6\n.20173050 \n[13] Hidron AI Low CE Honig EG \nEmergence of community-acquired meticillin-resistant Staphylococcus aureus strain USA300 as a cause of necrotising community-onset pneumonia\n. Lancet Infect Dis \n2009 ;9 :384 –92\n.19467478 \n[14] Naimi TS LeDell KH Como-Sabetti K \nComparison of community- and health care-associated methicillin-resistant Staphylococcus aureus infection\n. JAMA \n2003 ;290 :2976 –84\n.14665659 \n[15] Buck JM Como-Sabetti K Harriman KH \nCommunity-associated methicillin-resistant Staphylococcus aureus, Minnesota, 2000-2003\n. Emerg Infect Dis \n2005 ;11 :1532 –8\n.16318692 \n[16] Gould FK Brindle R Chadwick PR \nGuidelines (2008) for the prophylaxis and treatment of methicillin-resistant Staphylococcus aureus (MRSA) infections in the United Kingdom\n. J Antimicrob Chemother \n2009 ;63 :849 –61\n.19282331 \n[17] Loffler B Hussain M Grundmeier M \nStaphylococcus aureus panton-valentine leukocidin is a very potent cytotoxic factor for human neutrophils\n. PLoS Pathog \n2010 ;6 :e1000715 .20072612 \n[18] Tsai YF Ku YH \nNecrotizing pneumonia: a rare complication of pneumonia requiring special consideration\n. Curr Opin Pulmon Med \n2012 ;18 :246 –52\n.\n[19] Hageman JC Uyeki TM Francis JS \nSevere community-acquired pneumonia due to Staphylococcus aureus, 2003-04 influenza season\n. Emerg Infect Dis \n2006 ;12 :894 –9\n.16707043 \n[20] Labandeira-Rey M Couzon F Boisset S \nStaphylococcus aureus Panton-Valentine leukocidin causes necrotizing pneumonia\n. Science \n2007 ;315 :1130 –3\n.17234914 \n[21] Chua K Laurent F Coombs G \nAntimicrobial resistance: Not community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA)! A clinician's guide to community MRSA—its evolving antimicrobial resistance and implications for therapy\n. Clin Infect Dis \n2011 ;52 :99 –114\n.21148528 \n[22] Liu C Bayer A Cosgrove SE \nClinical practice guidelines by the infectious diseases society of america for the treatment of methicillin-resistant Staphylococcus aureus infections in adults and children\n. Clin Infect Dis \n2011 ;52 :e18 –55\n.21208910 \n[23] Blot S Koulenti D Akova M \nDoes contemporary vancomycin dosing achieve therapeutic targets in a heterogeneous clinical cohort of critically ill patients? Data from the multinational DALI study\n. Crit Care \n2014 ;18 :R99 .24887569\n\n",
"fulltext_license": "CC BY",
"issn_linking": "0025-7974",
"issue": "99(26)",
"journal": "Medicine",
"keywords": null,
"medline_ta": "Medicine (Baltimore)",
"mesh_terms": "D000368:Aged; D000900:Anti-Bacterial Agents; D003371:Cough; D000077299:Healthcare-Associated Pneumonia; D006801:Humans; D018476:Hypokinesia; D000069349:Linezolid; D008297:Male; D055624:Methicillin-Resistant Staphylococcus aureus; D008802:Mezlocillin; D053139:Oseltamivir; D012772:Shock, Septic; D013203:Staphylococcal Infections",
"nlm_unique_id": "2985248R",
"other_id": null,
"pages": "e20914",
"pmc": null,
"pmid": "32590802",
"pubdate": "2020-06-26",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Community-acquired pneumonia caused by methicillin-resistant Staphylococcus aureus in a Chinese adult: A case report.",
"title_normalized": "community acquired pneumonia caused by methicillin resistant staphylococcus aureus in a chinese adult a case report"
} | [
{
"companynumb": "CN-PFIZER INC-2020266045",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LINEZOLID"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nFungal infections have been commonly diagnosed in individuals with advanced HIV disease. Cryptococcosis, pneumocystosis, and histoplasmosis are the most frequent systemic mycoses in people suffering from HIV/AIDS.\n\n\nMETHODS\nWe report a case of multiple fungal infections in an advanced AIDS-patient. A 33-year-old HIV-positive man from Brazil was hospitalized due to diarrhea, dyspnea, emaciation, hypoxemia, extensive oral thrush, and a CD4+ T lymphocyte count of 20cells/mm(3). Honeycombed-structures consistent with Pneumocystis jirovecii were observed by direct immunofluorescence in induced sputum. Cryptococcus neoformans was recovered from respiratory secretion and cerebrospinal fluid cultures. Histopathology of the bone marrow also revealed the presence of Histoplasma capsulatum. Molecular assays were performed in a sputum sample. Nested-PCR confirmed the presence of P. jirovecii and H. capsulatum; qPCR multiplex was positive for C. neoformans and H. capsulatum. With the treatment of antifungal drugs the patient progressed satisfactorily.\n\n\nCONCLUSIONS\nThe diagnosis of several systemic mycoses demonstrates the vulnerability of advanced AIDS-patients. Thus, the detection of AIDS cases in the early stages of infection is necessary for a prompt and adequate introduction of HAART therapy, and the use of prophylaxis to control opportunistic infections.",
"affiliations": "Laboratório de Micologia, Instituto Nacional de Infectologia Evandro Chagas (INI), Fundação Oswaldo Cruz (Fiocruz), Rio de Janeiro, Brazil.;Laboratório de Micologia, Instituto Nacional de Infectologia Evandro Chagas (INI), Fundação Oswaldo Cruz (Fiocruz), Rio de Janeiro, Brazil.;Servicio de Micología, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Majadahonda, Madrid, Spain.;Servicio de Micología, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Majadahonda, Madrid, Spain.;Serviço de Anatomia, Instituto Nacional de Infectologia Evandro Chagas (INI), Fundação Oswaldo Cruz (Fiocruz), Rio de Janeiro, Brazil.;Laboratório de Micologia, Instituto Nacional de Infectologia Evandro Chagas (INI), Fundação Oswaldo Cruz (Fiocruz), Rio de Janeiro, Brazil.;Laboratório de Micologia, Instituto Nacional de Infectologia Evandro Chagas (INI), Fundação Oswaldo Cruz (Fiocruz), Rio de Janeiro, Brazil.;Laboratório de Micologia, Instituto Nacional de Infectologia Evandro Chagas (INI), Fundação Oswaldo Cruz (Fiocruz), Rio de Janeiro, Brazil. Electronic address: rosely.zancope@ini.fiocruz.br.",
"authors": "Almeida-Silva|Fernando|F|;Damasceno|Lisandra Serra|LS|;Serna|Maria Jose Buitrago|MJ|;Valero|Clara|C|;Quintella|Leonardo Pereira|LP|;Almeida-Paes|Rodrigo|R|;Muniz|Mauro de Medeiros|Mde M|;Zancope-Oliveira|Rosely Maria|RM|",
"chemical_list": "D000935:Antifungal Agents",
"country": "Spain",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1130-1406",
"issue": "33(2)",
"journal": "Revista iberoamericana de micologia",
"keywords": "AIDS; Criptococosis; Cryptococcosis; Histoplasmosis; Immune response inflammatory syndrome; Neumocistosis; Pneumocystosis; Sida; Síndrome inflamatorio de reconstitución inmune",
"medline_ta": "Rev Iberoam Micol",
"mesh_terms": "D017088:AIDS-Related Opportunistic Infections; D000163:Acquired Immunodeficiency Syndrome; D000328:Adult; D000935:Antifungal Agents; D023241:Antiretroviral Therapy, Highly Active; D060085:Coinfection; D003455:Cryptococcus neoformans; D057210:Delayed Diagnosis; D006658:Histoplasma; D006660:Histoplasmosis; D006801:Humans; D008297:Male; D016919:Meningitis, Cryptococcal; D045363:Pneumocystis carinii; D011020:Pneumonia, Pneumocystis; D014397:Tuberculosis, Pulmonary",
"nlm_unique_id": "9425531",
"other_id": null,
"pages": "118-21",
"pmc": null,
"pmid": "26896884",
"pubdate": "2016",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Multiple opportunistic fungal infections in an individual with severe HIV disease: A case report.",
"title_normalized": "multiple opportunistic fungal infections in an individual with severe hiv disease a case report"
} | [
{
"companynumb": "BR-MYLANLABS-2016M1055294",
"fulfillexpeditecriteria": "1",
"occurcountry": "BR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LOPINAVIR"
},
"drugadditional": "3",
... |
{
"abstract": "Vasomotor symptoms (VMS), such as hot flashes and night sweats, are intense and rapid sensations of internal heat, peripheral vasodilation, and profuse sweating that can be debilitating. They occur as a result of central norepinephrine discharge and narrowing of the core body thermoneutral zone with dropping brain estrogen levels in women and men. Therapy options for the treatment of VMS in postmenopausal women have been widely studied. However, we address treatment strategies for VMS that occur in some transgender men who have undergone oophorectomy. A 35-year-old female-to-male transgender man presented with symptoms of severe and frequent VMS that began shortly after total hysterectomy and oophorectomy. The patient was treated with a stable dose of testosterone for gender affirmation, and previous attempts to increase his testosterone dose did not relieve the VMS. In addition to his testosterone therapy, 0.025 to 0.0375 mg, twice per week, of transdermal estradiol was added to his hormonal regimen. Addition of estradiol completely relieved the VMS, and masculinization was not affected. Discontinuation of estradiol led to the recurrence of VMS at the same severity as previously experienced, which was associated with a low level of serum estrogen. VMS in a transgender man taking testosterone were successfully treated with the addition of transdermal estradiol.",
"affiliations": "Section of Adult and Pediatric Endocrinology, Diabetes & Metabolism, University of Chicago Medicine, Chicago, Illinois.;Section of Adult and Pediatric Endocrinology, Diabetes & Metabolism, University of Chicago Medicine, Chicago, Illinois.",
"authors": "Casimiro|Isabel|I|0000-0003-2833-1744;Cohen|Ronald N|RN|0000-0001-5030-8335",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1210/js.2018-00367",
"fulltext": "\n==== Front\nJ Endocr SocJ Endocr SocjesJournal of the Endocrine Society2472-1972Endocrine Society Washington, DC js_20180036710.1210/js.2018-00367Case ReportReproductive Biology and Sex-Based MedicineSevere Vasomotor Symptoms Post-Oophorectomy Despite Testosterone Therapy in a Transgender Man: A Unique Case Study http://orcid.org/0000-0003-2833-1744Casimiro Isabel icasimiro@medicine.bsd.uchicago.eduhttp://orcid.org/0000-0001-5030-8335Cohen Ronald N Section of Adult and Pediatric Endocrinology, Diabetes & Metabolism, University of Chicago Medicine, Chicago, IllinoisCorrespondence: Isabel Casimiro, MD, PhD, University of Chicago Medical Center, 5841 S. Maryland Avenue, MC 1027, Chicago, Illinois 60660. E-mail: icasimiro@medicine.bsd.uchicago.edu.01 4 2019 13 2 2019 3 4 734 736 06 11 2018 07 2 2019 Copyright © 2019 Endocrine Society2019This article has been published under the terms of the Creative Commons Attribution Non-Commercial, No-Derivatives License (CC BY-NC-ND; https://creativecommons.org/licenses/by-nc-nd/4.0/).Abstract\nVasomotor symptoms (VMS), such as hot flashes and night sweats, are intense and rapid sensations of internal heat, peripheral vasodilation, and profuse sweating that can be debilitating. They occur as a result of central norepinephrine discharge and narrowing of the core body thermoneutral zone with dropping brain estrogen levels in women and men. Therapy options for the treatment of VMS in postmenopausal women have been widely studied. However, we address treatment strategies for VMS that occur in some transgender men who have undergone oophorectomy. A 35-year-old female-to-male transgender man presented with symptoms of severe and frequent VMS that began shortly after total hysterectomy and oophorectomy. The patient was treated with a stable dose of testosterone for gender affirmation, and previous attempts to increase his testosterone dose did not relieve the VMS. In addition to his testosterone therapy, 0.025 to 0.0375 mg, twice per week, of transdermal estradiol was added to his hormonal regimen. Addition of estradiol completely relieved the VMS, and masculinization was not affected. Discontinuation of estradiol led to the recurrence of VMS at the same severity as previously experienced, which was associated with a low level of serum estrogen. VMS in a transgender man taking testosterone were successfully treated with the addition of transdermal estradiol.\n\ntransgenderhot flashes/hot flushesvasomotor symptomsestrogentestosteroneNational Institutes of Health10.13039/100000002T32DK007011\n==== Body\n1. Case Report\nA 35-year-old transgender man (natal female with a male gender identity) presented for continuation of testosterone therapy and severe and frequent vasomotor symptoms (VMS) that began after hysterectomy and oophorectomy. The patient measured 162.6 cm in height and weighed 77.3 kg (body mass index 26.59). He reported the severity of the hot flashes was significantly interfering with his daily quality of life. He reported having a hot flash at least once an hour, >10 times a day, and sometimes during the night (>50 VMS/week). He reported no extraordinary social or economic stressors. The patient is a plumber and lives with his wife and son. A previous provider had increased testosterone therapy from 100 mg IM every 2 weeks to 150 mg IM testosterone cypionate every 2 weeks with no improvement in symptoms, as well as worsening of his acne. The patient’s testosterone level was 853 ng/mL (male testosterone reference range: 240 to 950 ng/dL) at that time (not a trough level). His testosterone dose was subsequently reduced back to his prior regimen. Next, his testosterone regimen was split into weekly doses (50 mg IM testosterone weekly) to avoid peaks and troughs. Nonetheless, his symptoms of hot flashes persisted on a regular basis. A nonhormonal treatment option was pursued with a serotonin-norepinephrine reuptake inhibitor (venlafaxine 75 mg daily). However, he discontinued venlafaxine after a few days as a result of intolerable side effects of drowsiness and jitteriness. The efficacy of nonhormonal and hormonal therapies in natal (cis) postmenopausal women was discussed with the patient, and he asked to try estrogen despite the lack of evidence for its use for VMS in transmen. An estradiol transdermal patch of 0.025 mg/week was started with substantial improvement in symptoms, but the effects only lasted ∼3 days. The patch frequency was increased to 0.025 mg, twice a week, with continued improvement of symptoms throughout the week. The increase of the dose to 0.0375 mg, twice a week, led to the complete resolution of hot flashes. Testosterone dosing was continued at 50 mg IM testosterone cypionate every week. Laboratories performed while the patient was on testosterone and estradiol showed trough levels of testosterone between 388 and 851 ng/dL over the subsequent 6 months (reference range for testosterone in females: <60 ng/dL; males: 240 to 950 ng/dL). Estradiol levels were checked at one time point during this period of symptom remission on dual therapy and were 4.3 ng/dL (reference range for estradiol in females: 30 to 40 ng/dL; males 1 to 6 ng/dL). A period of estrogen therapy interruption as a result of insurance coverage issues led to the recurrence of hot flashes that were of the same intensity as before estrogen initiation within 48 hours of therapy interruption. Laboratories drawn during this window confirmed a low level of circulating estradiol (0.9 ng/dL).\n\n2. Discussion\nTreatment of hot flashes in a transgender man who has undergone oophorectomy is reported here with a case of the successful use of hormonal therapy in a transgender man taking testosterone. Treatment strategies involving an increased dose of testosterone, the splitting of the testosterone dose, or the use of a serotonin-norepinephrine reuptake inhibitor were not successful. In contrast, the addition of transdermal estradiol was extremely effective at stopping his symptoms of debilitating hot flashes.\n\nThis case highlights the effects of dual estrogen and testosterone therapy in a transgender man. In natal men, elevated levels of estrogen have been found in the setting of obesity as a result of increased aromatization of testosterone to estradiol [1]. Furthermore, data from Low T Centers across the United States have shown high levels of estradiol in men who use injectable testosterone therapy [2]. However, in our patient, treatment with testosterone alone did not relieve VMS. There is some evidence that in natal men exogenous estrogen does not cause harm [3]. Treatment of cis males with estrogen has been in practice for the goal of chemical castration in prostate cancer. These doses typically are given as 30 mg of estradiol every 1 to 2 weeks. Side effects associated with this treatment include gynecomastia and dermatological problems (pruritis, eczema, and urticaria) [4, 5]. Increased cardiovascular events and venous thromboembolism events that were previously reported with estrogen use have decreased with a change of the route of estrogen administration from oral to parenteral or transdermal [6]. In androgen-suppressed men, antiandrogen hormone therapy, such as estrogens and progestins, has shown therapeutic efficacy for the treatment of hot flashes [7, 8]. In women, estrogen remains the gold standard for elimination of VMS [9]. However, not all patients are candidates for therapy. A randomized double-blind trial that compared medroxyprogesterone with oral estrogen for treatment of VMS found that they were equally effective at treating VMS in women immediately postoophorectomy [10]. Furthermore, unlike estrogen, oral micronized progesterone does not cause a withdrawal increase in VMS [11, 12]. Therefore, medroxyprogesterone appears to be an effective alternative to treat VMS and would have been another potential option in our patient. We chose to continue to treat our patient with estradiol, given his very low circulating estradiol levels, even for the male reference range. Testosterone was dosed with the goal of the maintenance of testosterone levels within the range for his affirmed sex. In our patient, the addition of estradiol presented a particularly unique challenge, because treatment with his gonadal/genetic sex hormone appears to contradict the goal of providing gender-affirming hormone therapy. In this clinical case, the provision of a small dose of estradiol eliminated his VMS but also resulted in levels of estrogen within the normal range for males, his affirmed sex. Since initiation of estradiol over 1 year ago, he has not experienced gynecomastia or other reported undesirable side effects.\n\nHere, we report a case of treatment of VMS in a transgender man without ovaries with his genetic/gonadal sex hormones to alleviate severe and frequent VMS associated with surgical menopause. We agree with the recent clinical practice guidelines put forth by the Endocrine Society for the treatment of those with gender dysphoria, which recommends a thorough discussion with the patient in determining the medical necessity of including both an oophorectomy with a total hysterectomy as part of gender-affirming surgery [13]. As part of this discussion, we recommend that potential adverse effects of complete depletion of gonadal hormones, including symptoms of hot flashes, also be discussed with patients who are contemplating oophorectomy as part of gender-reaffirming surgery.\n\nAcknowledgments\n\nFinancial Support: Support for this work was provided by the National Institutes of Health (T32DK007011; to I.C.).\n\n\nDisclosure Summary: The authors have nothing to disclose.\n\nAbbreviation:\nVMSvasomotor symptoms\n==== Refs\nReferences and Notes\n1. \nSchneider G , Kirschner MA , Berkowitz R , Ertel NH \nIncreased estrogen production in obese men . J Clin Endocrinol Metab . 1979 ;48 (4 ):633 –638 .429508 \n2. \nTan RS , Cook KR , Reilly WG \nHigh estrogen in men after injectable testosterone therapy: the low T experience . Am J Men Health . 2015 ;9 (3 ):229 –234 .\n3. \nKacker R , Traish AM , Morgentaler A \nEstrogens in men: clinical implications for sexual function and the treatment of testosterone deficiency . J Sex Med . 2012 ;9 (6 ):1681 –1696 .22512993 \n4. \nDobbs RW , Malhotra NR , Greenwald DT , Wang AY , Prins GS , Abern MR \nEstrogens and prostate cancer . Prostate Cancer Prostatic Dis (in press).\n5. \nLangley RE , Cafferty FH , Alhasso AA , Rosen SD , Sundaram SK , Freeman SC , Pollock P , Jinks RC , Godsland IF , Kockelbergh R , Clarke NW , Kynaston HG , Parmar MK , Abel PD \nCardiovascular outcomes in patients with locally advanced and metastatic prostate cancer treated with luteinising-hormone-releasing-hormone agonists or transdermal oestrogen: the randomised, phase 2 MRC PATCH trial (PR09) . Lancet Oncol . 2013 ;14 (4 ):306 –316 .23465742 \n6. \nvon Schoultz B , Carlström K , Collste L , Eriksson A , Henriksson P , Pousette A , Stege R \nEstrogen therapy and liver function--metabolic effects of oral and parenteral administration . Prostate . 1989 ;14 (4 ):389 –395 .2664738 \n7. \nKouriefs C , Georgiou M , Ravi R \nHot flushes and prostate cancer: pathogenesis and treatment . BJU Int . 2002 ;89 (4 ):379 –383 .11872028 \n8. \nIrani J , Salomon L , Oba R , Bouchard P , Mottet N \nEfficacy of venlafaxine, medroxyprogesterone acetate, and cyproterone acetate for the treatment of vasomotor hot flushes in men taking gonadotropin-releasing hormone analogues for prostate cancer: a double-blind, randomised trial . Lancet Oncol . 2010 ;11 (2 ):147 –154 .19963436 \n9. \nMaclennan AH , Broadbent JL , Lester S , Moore V \nOral oestrogen and combined oestrogen/progestogen therapy versus placebo for hot flushes . Cochrane Database Syst Rev . 2004 ; (4 ):CD002978 .15495039 \n10. \nPrior JC , Nielsen JD , Hitchcock CL , Williams LA , Vigna YM , Dean CB \nMedroxyprogesterone and conjugated oestrogen are equivalent for hot flushes: a 1-year randomized double-blind trial following premenopausal ovariectomy . Clin Sci (Lond) . 2007 ;112 (10 ):517 –525 .17419685 \n11. \nHitchcock CL , Prior JC \nOral micronized progesterone for vasomotor symptoms--a placebo-controlled randomized trial in healthy postmenopausal women . Menopause . 2012 ;19 (8 ):886 –893 .22453200 \n12. \nPrior JC , Hitchcock CL \nProgesterone for hot flush and night sweat treatment--effectiveness for severe vasomotor symptoms and lack of withdrawal rebound . Gynecol Endocrinol . 2012 ;28 (Suppl 2 ):7 –11 .\n13. \nHembree WC , Cohen-Kettenis PT , Gooren L , Hannema SE , Meyer WJ , Murad MH , Rosenthal SM , Safer JD , Tangpricha V , T’Sjoen GG \nEndocrine treatment of gender-dysphoric/gender-incongruent persons: an Endocrine Society Clinical Practice Guideline . Endocr Pract . 2017 ;23 (12 ):1437 .29320642\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2472-1972",
"issue": "3(4)",
"journal": "Journal of the Endocrine Society",
"keywords": "estrogen; hot flashes/hot flushes; testosterone; transgender; vasomotor symptoms",
"medline_ta": "J Endocr Soc",
"mesh_terms": null,
"nlm_unique_id": "101697997",
"other_id": null,
"pages": "734-736",
"pmc": null,
"pmid": "30931422",
"pubdate": "2019-04-01",
"publication_types": "D002363:Case Reports",
"references": "11872028;15495039;17419685;19963436;22453200;22512993;22849758;23465742;24928451;2664738;29320642;30131606;429508",
"title": "Severe Vasomotor Symptoms Post-Oophorectomy Despite Testosterone Therapy in a Transgender Man: A Unique Case Study.",
"title_normalized": "severe vasomotor symptoms post oophorectomy despite testosterone therapy in a transgender man a unique case study"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/19/0114859",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "TESTOSTERONE"
},
"drugadditional": null... |
{
"abstract": "Autoimmune manifestations are known to occur in patients with chronic lymphocytic leukemia (CLL) and of these hemolytic anemia and immune thrombocytopenia are the most well recognized. Autoimmunity may also be triggered by some of the therapeutic agents used like purine analoges and these events may sometimes be severe and even fatal. Non-hematological autoimmune stigmata occur far less frequently and are rarely encountered. Here we report a 59 year-old-woman, with CLL, who complained of recurrent headache starting 1 month after completing 6 cycles of fludarabine, cyclophosphamide, and rituximab combination therapy. Computed tomography scan of the brain showed a contrast enhancing lesion of 1 cm in diameter, with surrounding edema in the right frontal lobe. Brain MRI revealed ring enhancing lesions in the right frontal lobe and some additional small lesions in the left parietal lobe. Brain biopsy showed an inflammatory demyelinating lesion, not associated with JC virus. The patient subsequently improved after steroid therapy. Currently, after 2 years of follow-up, she remains in complete hematologic remission, has no neurological deficits, and is carefully followed by a team of neurologists and hematologists. Treating physicians should be aware of this rare autoimmune inflammatory demyelinating lesion which can occur in patients with CLL during the course of treatment and that may be linked to treatment with purine analogues like fludarabine.",
"affiliations": "Haematology Unit, Bnai-Zion Medical Centre, Haifa, Israel.;Neurology Department, Bnai-Zion Medical Centre, Haifa, Israel.;Pathology Department, Bnai Zion Medical Centre, Haifa, Israel.;Haematology Department, Hadassah University Hospital and Hebrew University Medical School, Jerusalem, Israel.;Haematology Unit, Bnai-Zion Medical Centre, Haifa, Israel.",
"authors": "Kreiniz|Natalia|N|https://orcid.org/0000-0002-1960-9591;Garty-Ofir|Maya|M|;Bejar|Jacob|J|;Polliack|Aaron|A|;Tadmor|Tamar|T|https://orcid.org/0000-0002-3435-8612",
"chemical_list": "D013256:Steroids; D000069283:Rituximab; D003520:Cyclophosphamide; D014740:Vidarabine; C024352:fludarabine",
"country": "England",
"delete": false,
"doi": "10.1002/hon.2815",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0278-0232",
"issue": "39(1)",
"journal": "Hematological oncology",
"keywords": "CLL; autoimmune disorders; brain lesions; chronic lymphocytic leukemia; demyelination; fludarabine; therapy",
"medline_ta": "Hematol Oncol",
"mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D001921:Brain; D001929:Brain Edema; D003520:Cyclophosphamide; D003711:Demyelinating Diseases; D005260:Female; D006801:Humans; D015451:Leukemia, Lymphocytic, Chronic, B-Cell; D008875:Middle Aged; D000069283:Rituximab; D013256:Steroids; D014740:Vidarabine",
"nlm_unique_id": "8307268",
"other_id": null,
"pages": "129-133",
"pmc": null,
"pmid": "33038272",
"pubdate": "2021-02",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Demyelinating brain lesions developing in a patient with chronic lymphocytic leukemia shortly after treatment with a fludarabine containing regimen.",
"title_normalized": "demyelinating brain lesions developing in a patient with chronic lymphocytic leukemia shortly after treatment with a fludarabine containing regimen"
} | [
{
"companynumb": "IL-B.BRAUN MEDICAL INC.-2109638",
"fulfillexpeditecriteria": "1",
"occurcountry": "IL",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN"
},
"drugadditional": nu... |
{
"abstract": "Patients receiving complement inhibitor, eculizumab, are at high risk for infections with encapsulated organisms such as Neisseria due to impaired opsonophagocytic activity. Impaired complement immunity may increase the risk for dissemination of asymptomatic Neisseria gonorrhoeae. Disseminated Gonococcal Infection (DGI) is a rare but potentially life-threatening complication associated with eculizumab. Physicians should obtain adequate sexual histories from the patients and educate them on safe sexual practices. Here, we describe a case of DGI in a 32-year-old African American female patient with acetylcholine receptor antibody-positive (AChR+) generalized myasthenia gravis (gMG), receiving eculizumab.",
"affiliations": "Department of Neurology, University of Missouri, Columbia, MO, USA.;Guru Gobind Singh Medical College and Hospital, Faridkot, Punjab, India.;Department of Pulmonology and Critical Care Medicine, Staten Island University Hospital, New York, NY, USA.;Department of Neurology, University of Missouri, Columbia, MO, USA.",
"authors": "Katyal|Nakul|N|https://orcid.org/0000-0003-0249-1707;Nirola|Latika|L|;Narula|Naureen|N|;Govindarajan|Raghav|R|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2021/9713413",
"fulltext": "\n==== Front\nCase Rep Neurol Med\nCase Rep Neurol Med\nCRINM\nCase Reports in Neurological Medicine\n2090-6668\n2090-6676\nHindawi\n\n10.1155/2021/9713413\nCase Report\nDiffuse Gonococcal Infection (DGI) in a Patient with Treatment-Refractory Acetylcholine Receptor Antibody-Positive (AChR+) Generalized Myasthenia Gravis (gMG) Treated with Eculizumab\nhttps://orcid.org/0000-0003-0249-1707\nKatyal Nakul katyal.nakul@gmail.com\n1\nNirola Latika 2\nNarula Naureen 3\nGovindarajan Raghav 1\n1Department of Neurology, University of Missouri, Columbia, MO, USA\n2Guru Gobind Singh Medical College and Hospital, Faridkot, Punjab, India\n3Department of Pulmonology and Critical Care Medicine, Staten Island University Hospital, New York, NY, USA\nAcademic Editor: Dominic B. Fee\n\n2021\n14 6 2021\n2021 971341314 4 2021\n7 6 2021\nCopyright © 2021 Nakul Katyal et al.\n2021\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.\nPatients receiving complement inhibitor, eculizumab, are at high risk for infections with encapsulated organisms such as Neisseria due to impaired opsonophagocytic activity. Impaired complement immunity may increase the risk for dissemination of asymptomatic Neisseria gonorrhoeae. Disseminated Gonococcal Infection (DGI) is a rare but potentially life-threatening complication associated with eculizumab. Physicians should obtain adequate sexual histories from the patients and educate them on safe sexual practices. Here, we describe a case of DGI in a 32-year-old African American female patient with acetylcholine receptor antibody-positive (AChR+) generalized myasthenia gravis (gMG), receiving eculizumab.\n==== Body\n1. Introduction\n\nEculizumab is a recombinant humanized monoclonal antibody that binds to complement component C5 and prevents conversion to the proinflammatory C5a and eventually membrane attack complex (MAC) formation [1]. Eculizumab has been approved for management of patients with paroxysmal nocturnal hemoglobinuria (PNH) and atypical haemolytic uremic syndrome (HUS) [2]. In a phase 3, randomized, double-blind, placebo-controlled study (REGAIN) and its open-label extension, eculizumab was shown to be effective in patients with treatment-refractory acetylcholine receptor antibody-positive (AChR+) generalized myasthenia gravis (gMG) [3]. In 2017, eculizumab was approved by the Food and Drug Administration (FDA) for the treatment of AChR+ gMG [4]. Patients receiving eculizumab are at high risk for infections with encapsulated organisms such as Neisseria due to impaired opsonophagocytic activity [5]. Administration of meningococcal vaccines, therefore, is recommended before beginning treatment [6]. Despite vaccination, meningococcal disease has been reported in recipients of eculizumab [7, 8]. In vitro data have shown that eculizumab impairs meningococcal killing in whole blood even in subjects vaccinated against the relevant meningococcal serogroup [5, 7, 8]. Similarly, impaired complement immunity with eculizumab may increase the risk for dissemination of Neisseria gonorrhoeae. Here, we describe a case of Disseminated Gonococcal Infection (DGI) in a 32-year-old African American female patient with AChR+ gMG receiving eculizumab.\n\n2. Case Report\n\nA 32-year-old African American female with a past medical history of deep vein thrombosis (DVT) and AChR+ gMG status after thymectomy, on pyridostigmine (60 mg three times a day) and eculizumab, presented to the Emergency Room (ER), a week after sustaining a mechanical fall while walking carrying her child on an ice-covered pavement. During the fall, her child landed on her left knee. The patient was first started on eculizumab 2 years ago (June 2018) after receiving both the monovalent and quadrivalent meningococcal vaccines as per Advisory Committee on Immunization Practices (ACIP) guidelines. She was on eculizumab for a year but then stopped it (June 2019) due to significant improvement in her MG symptoms. She was off all MG treatments for a year and half but was restarted on eculizumab (Nov 2020) due to worsening fatigue, axial weakness, and dysphagia. Her last dose was 8 days before presentation to the ER.\n\nAt the time of presentation to the ER, she complained of 8/10, sharp pain, localized to the left knee, worse with movement, and better with rest. Her vital signs were unremarkable. Examination was remarkable for left knee tenderness to palpation and limited active and passive range of motion. Laboratory workup showed elevated White Blood Cell (WBC) count to 12,000/L with 72% neutrophils, elevated Erythrocyte Sedimentation Rate (ESR) to 111 mm/hour, elevated alkaline phosphatase to 162 Units/L, and C reactive protein (CRP) to 17.19 mg/dl. Urinary N. gonorrhoeae testing with a Nucleic Acid Amplification Technique (NAAT) showed a positive result. She denied any change in her sexual contacts or history of Sexually Transmitted Diseases (STDs). We suspect she acquired the infection from her husband who was later tested positive. X-ray of the left knee showed moderate effusion without evidence of fracture. Arthrocentesis of the left knee showed a cloudy, yellow-colored fluid with a WBC of 50,000/mcL, with 95% neutrophils, Red Blood Cell (RBC) count of 3000/mcL, and no crystals. She was diagnosed with septic arthritis of the left knee and underwent irrigation and debridement of the left knee that drained 5 cc of purulent fluid. Postoperatively, the patient was started on vancomycin (1250 mg Intravenous (IV) every 8 hours) and cefepime (2 gram IV every 8 hours). The left knee aspirate and left knee operative cultures remained negative.\n\nOn day 2 of hospitalization, blood culture from day 0 grew Gram-Positive Cocci (GPC) in the cluster, later confirmed as N. gonorrhoeae. She was then diagnosed with Disseminated Gonococcal Infection (DGI) likely related to recent eculizumab use (8 days before presentation). After obtaining antibiotic sensitivity testing results, on day 3 of hospitalization, vancomycin and cefepime were deescalated to ceftriaxone. She developed facial swelling after receiving the first dose of ceftriaxone that was treated with IV diphenhydramine. The patient was then switched to ertapenem 1 gram IV every 24 hours which she tolerated without any side effects. Further testing for STDs including Human Immunodeficiency Virus (HIV), syphilis, trichomonas, and chlamydia was negative. A repeat blood culture from day 2 was negative, and the patient was discharged home to complete four weeks of ertapenem therapy which she has since completed. The repeat ESR after 4 weeks trended down to 62.\n\n3. Discussion\n\nOur study described the complication of DGI in a patient with gMG on eculizumab. Previous studies have described similar complications of DGI in patients with PNH and HUS on eculizumab [9]. To our best knowledge, our case is the first one to describe this complication in a patient with AChR+ gMG, treated with eculizumab.\n\nGonorrhea is the second most commonly reported notifiable disease in the United States [9, 10]. In 2018, a total of 583,405 cases of gonorrhea were reported in the United States [10]. Persons aged 15–44 years accounted for 91.6% of the reported gonorrhea cases [10]. Although urethral gonorrhea can cause profuse discharge and pain, gonococcal infections of the cervix, pharynx, and rectum are often asymptomatic [9–11]. In approximately 0.5–3% of gonorrhea cases, the bacterium can enter the bloodstream and cause DGI [9, 12]. Patients receiving eculizumab are at high risk for infections with encapsulated organisms such as N. gonorrhoeae due to impaired opsonophagocytic activity [5].\n\nA case study by Crew et al. reviewed the FDA pre- and postmarketing safety reports of gonococcal infections among patients receiving eculizumab [9]. The study described 9 cases of gonococcal infections in patients receiving eculizumab for either PNH or HUS [9]. Eight out of nine patients were females, and seven out of nine were <30 years of age [9]. Eight of the nine patients were classified as having DGI and were hospitalized [9]. A diagnostic workup of cerebrospinal fluid sampling was conducted on three patients for meningitis, but none was diagnosed, one patient had a trans-thoracic echocardiogram which was negative for valvular vegetation, and two patients required vasopressor support for the concern of septic shock [9]. Seven patients continued the therapy after the infection while one discontinued [9]. All gonococcal infections resolved except in one case where the patient had developed endocarditis and thrombotic complications and died [9].\n\nVaccines containing group B N. meningitidis outer-membrane vesicles (OMV) may provide protection against a significant proportion of N. gonorrhoeae, but the mechanisms for the same have not yet been elucidated and the vaccination has not been approved for use in gonococcal infection [13]. Therefore, despite vaccination against N. meningitidis, these patients are still at a potential risk for developing gonococcal disease. CDC recommends annual screening for gonorrhea in all young sexually active women <25 years of age and older women who are at an increased risk [9, 11]. As of now, the screening recommendations for gonorrhea in patients receiving eculizumab do not differ from those for the general population [9]. In our case, the patient acquired the infection from her significant other who was later educated and treated of N. gonorrhoeae. Physicians are encouraged to obtain adequate sexual histories of patients and educate them on safe sexual practices, regular use of condoms, and avoiding unprotected sexual contact [9]. In addition, patients should be educated about the increased risk of gonococcal infection and DGI with eculizumab. Healthcare professionals should keep DGI in their differential diagnosis, especially in a patient with skin or joint involvement [9].\n\n4. Conclusions\n\nDGI is a rare but potentially life-threatening complication associated with use of complement inhibitor, eculizumab. Physicians should obtain adequate sexual histories from the patients and educate the patients and, if possible, their partners on safe sexual practices.\n\nAbbreviations\n\nAChR+: Acetylcholine receptor antibody-positive\n\ngMG: Generalized myasthenia gravis\n\nDGI: Disseminated gonococcal infection\n\nPNH: Paroxysmal nocturnal hemoglobinuria\n\nHUS: Atypical haemolytic uremic syndrome\n\nMAC: Membrane attack complex\n\nFDA: Food and Drug Administration\n\nDVT: Deep vein thrombosis\n\nER: Emergency room\n\nSTD: Sexually transmitted disease\n\nCRP: C-reactive protein\n\nESR: Erythrocyte sedimentation rate\n\nNAAT: Nucleic acid amplification technique\n\nWBC: White blood cell\n\nRBC: Red blood cell.\n\nData Availability\n\nThe data used to support the findings of this study are included within the article.\n\nEthical Approval\n\nThe authors confirm that they have read the journal's position on issues involved in ethical publication and affirm that this report is consistent with those guidelines.\n\nConflicts of Interest\n\nThe authors declare that they have no conflicts of interest.\n==== Refs\n1 Thomas T. C. Rollins S. A. Rother R. P. Inhibition of complement activity by humanized anti-C5 antibody and single-chain Fv Molecular Immunology 1996 33 17-18 1389 1401 10.1016/s0161-5890(96)00078-8 2-s2.0-0030441149 9171898\n2 US Food and Drug Administration Drugs@FDA: soliris (BLA 125166) 2018 https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=BasicSearch.process\n3 Howard J. F. Jr. Utsugisawa K. Benatar M. Safety and efficacy of eculizumab in anti-acetylcholine receptor antibody-positive refractory generalised myasthenia gravis (REGAIN): a phase 3, randomised, double-blind, placebo-controlled, multicentre study The Lancet Neurology 2017 16 12 976 986 10.1016/S1474-4422(17)30369-1 2-s2.0-85035019720 29066163\n4 Alexion Pharmaceuticals Soliris (Eculizumab) 2018 Cheshire, CT, USA Alexion Pharmaceuticals https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/125166s426lbl.pdf\n5 Konar M. Granoff D. M. Eculizumab treatment and impaired opsonophagocytic killing of meningococci by whole blood from immunized adults Blood 2017 130 7 891 899 10.1182/blood-2017-05-781450 2-s2.0-85026258770 28630122\n6 CDC Meningococcal ACIP Recommendations 2017 Atlanta, GA, USA US Department of Health and Human Services, CDC https://www.cdc.gov/vaccines/hcp/acip-recs/vacc-specific/mening.html\n7 Cullinan N. Gorman K. M. Riordan M. Waldron M. Goodship T. H. J. Awan A. Case report: benefits and challenges of long-term eculizumab in atypical hemolytic uremic syndrome Pediatrics 2015 135 6 e1506 e1509 10.1542/peds.2014-3503 2-s2.0-84930607950 25941307\n8 McNamara L. A. Topaz N. Wang X. Hariri S. Fox L. MacNeil J. R. High risk for invasive meningococcal disease among patients receiving eculizumab (soliris) despite receipt of meningococcal vaccine Morbidity and Mortality Weekly Report 2017 66 27 734 737 10.15585/mmwr.mm6627e1 2-s2.0-85024127998 28704351\n9 Crew P. E. Abara W. E. McCulley L. Disseminated gonococcal infections in patients receiving eculizumab: a case series Clinical Infectious Diseases 2019 69 4 596 600 10.1093/cid/ciy958 30418536\n10 Centers for Disease Control and Prevention Sexually transmitted diseases surveillance 2018 https://www.cdc.gov/std/stats18/gonorrhea.htm\n11 Workowski K. A. Bolan G. A. Centers for Disease Control and Prevention Sexually transmitted diseases treatment guidelines, 2015 Morbidity and Mortality Weekly Report. Recommendations and Reports 2015 64 1 137\n12 Hook E. W. Handsfield H. H. Holmes K. K. Starling P. F. Stamm W. E. Gonococcal infections in the adult Sexually Transmitted Diseases 2008 4th New York, NY, USA McGraw-Hill Medical 627 645\n13 Petousis-Harris H. Radcliff F. J. Exploitation of Neisseria meningitidis group B OMV vaccines against N. gonorrhoeae to inform the development and deployment of effective gonorrhea vaccines Frontiers in Immunology 2019 10 p. 683 10.3389/fimmu.2019.00683 2-s2.0-85065394275\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-6676",
"issue": "2021()",
"journal": "Case reports in neurological medicine",
"keywords": null,
"medline_ta": "Case Rep Neurol Med",
"mesh_terms": null,
"nlm_unique_id": "101576451",
"other_id": null,
"pages": "9713413",
"pmc": null,
"pmid": "34234969",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "9171898;25941307;30418536;31024540;29066163;26042815;28704351;28630122",
"title": "Diffuse Gonococcal Infection (DGI) in a Patient with Treatment-Refractory Acetylcholine Receptor Antibody-Positive (AChR+) Generalized Myasthenia Gravis (gMG) Treated with Eculizumab.",
"title_normalized": "diffuse gonococcal infection dgi in a patient with treatment refractory acetylcholine receptor antibody positive achr generalized myasthenia gravis gmg treated with eculizumab"
} | [
{
"companynumb": "US-ALXN-A202107928",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ECULIZUMAB"
},
"drugadditional": "3",
"dru... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.