article dict | reports listlengths 1 3.97k |
|---|---|
{
"abstract": "The case of a patient with left ventricular assist device (LVAD)-associated endocarditis involving multiple clones of Staphylococcus aureus is presented. Different clones with distinct colony morphology were identified from blood cultures collected on the same day and showed diverse antimicrobial resistance patterns. In addition, a difference in antimicrobial susceptibility was observed even within an identical clone recovered 400 days apart due to the loss of SCCmec for methicillin and modification of the 23S rRNA target site for linezolid during a long-term treatment course.",
"affiliations": "Department of Infectious Diseases, Fujita Health University School of Medicine, 1-98 Dengakugakubo, Kutsukake-cho, Toyoake, Aichi 470-1192, Japan; Department of Microbiology and Infectious Diseases, Toho University School of Medicine, 5-21-16 Omori-nishi, Ota-ku, Tokyo 143-8540, Japan. Electronic address: haradas-tky@umin.ac.jp.;Department of Microbiology and Infectious Diseases, Toho University School of Medicine, 5-21-16 Omori-nishi, Ota-ku, Tokyo 143-8540, Japan.;Department of Infectious Diseases, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan.;Department of Cardiac Surgery, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan.;Department of Cardiac Surgery, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan.;Department of Microbiology and Infectious Diseases, Toho University School of Medicine, 5-21-16 Omori-nishi, Ota-ku, Tokyo 143-8540, Japan.;Department of Microbiology and Infectious Diseases, Toho University School of Medicine, 5-21-16 Omori-nishi, Ota-ku, Tokyo 143-8540, Japan.;Department of Clinical Laboratories, Toho University Omori Medical Center, 6-11-1 Omori-nishi, Ota-ku, Tokyo 143-8541, Japan.;Central Laboratory Division, Akita University Hospital, 1-1-1 Hondo, Akita 010-8543, Japan.;Department of Infectious Diseases, Fujita Health University School of Medicine, 1-98 Dengakugakubo, Kutsukake-cho, Toyoake, Aichi 470-1192, Japan.;Department of Infectious Diseases, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan.;Department of Infectious Diseases, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan.;Department of Cardiac Surgery, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan.",
"authors": "Harada|Sohei|S|;Aoki|Kotaro|K|;Okamoto|Koh|K|;Kinoshita|Osamu|O|;Nawata|Kan|K|;Ishii|Yoshikazu|Y|;Tateda|Kazuhiro|K|;Sasaki|Masakazu|M|;Saga|Tomoo|T|;Doi|Yohei|Y|;Yotsuyanagi|Hiroshi|H|;Moriya|Kyoji|K|;Ono|Minoru|M|",
"chemical_list": "D000900:Anti-Bacterial Agents; D012338:RNA, Ribosomal, 23S; D000069349:Linezolid",
"country": "Canada",
"delete": false,
"doi": "10.1016/j.ijid.2019.05.001",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1201-9712",
"issue": "84()",
"journal": "International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases",
"keywords": "Endocarditis; Left ventricular assist device; Linezolid resistance; Staphylococcus aureus; Whole-genome sequencing",
"medline_ta": "Int J Infect Dis",
"mesh_terms": "D000900:Anti-Bacterial Agents; D004697:Endocarditis, Bacterial; D006352:Heart Ventricles; D006353:Heart-Assist Devices; D006801:Humans; D000069349:Linezolid; D008297:Male; D055624:Methicillin-Resistant Staphylococcus aureus; D008826:Microbial Sensitivity Tests; D008875:Middle Aged; D012338:RNA, Ribosomal, 23S; D013203:Staphylococcal Infections; D013211:Staphylococcus aureus",
"nlm_unique_id": "9610933",
"other_id": null,
"pages": "44-47",
"pmc": null,
"pmid": "31075509",
"pubdate": "2019-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Left ventricular assist device-associated endocarditis involving multiple clones of Staphylococcus aureus with distinct antimicrobial susceptibility patterns.",
"title_normalized": "left ventricular assist device associated endocarditis involving multiple clones of staphylococcus aureus with distinct antimicrobial susceptibility patterns"
} | [
{
"companynumb": "JP-PFIZER INC-2019246654",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "VANCOMYCIN"
},
"drugadditional": null,
... |
{
"abstract": "We present the case of a 22-year-old African American transgender women (male to female), who was admitted for fatigue, abdominal pain and lower extremity edema and was diagnosed with systemic lupus erythematosus (SLE) and lupus nephritis. Treatment with high-dose steroids and mycophenolate mofetil helped resolve her symptoms. She has remained off oestrogen therapy since admission and has not experienced any major complications. It is important to consider therapy outcomes in this specific patient population. A review of four other cases of transgender women on cross-sex hormone therapy who were diagnosed with lupus is also presented.",
"affiliations": "Department of Internal Medicine, 1745Brookwood Baptist Health Birmingham, Alabama, USA.;Department of Internal Medicine, 1745Brookwood Baptist Health Birmingham, Alabama, USA.;Department of Internal Medicine, 1745Brookwood Baptist Health Birmingham, Alabama, USA.",
"authors": "Hill|Brittany G|BG|https://orcid.org/0000-0002-1317-4590;Hodge|Bonnie|B|;Misischia|Richard|R|",
"chemical_list": "D004967:Estrogens; D007166:Immunosuppressive Agents; D013256:Steroids; D009173:Mycophenolic Acid",
"country": "England",
"delete": false,
"doi": "10.1177/0961203320946372",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0961-2033",
"issue": "29(13)",
"journal": "Lupus",
"keywords": "Systemic lupus erythematosus; estrogen; nephritis; renal lupus; transgender",
"medline_ta": "Lupus",
"mesh_terms": "D004359:Drug Therapy, Combination; D004967:Estrogens; D005260:Female; D006801:Humans; D007166:Immunosuppressive Agents; D008181:Lupus Nephritis; D008297:Male; D009173:Mycophenolic Acid; D013256:Steroids; D063106:Transgender Persons; D055815:Young Adult",
"nlm_unique_id": "9204265",
"other_id": null,
"pages": "1807-1810",
"pmc": null,
"pmid": "32731807",
"pubdate": "2020-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Lupus nephritis in a transgender woman on cross-sex hormone therapy: a case for the role of oestrogen in systemic lupus erythematosus.",
"title_normalized": "lupus nephritis in a transgender woman on cross sex hormone therapy a case for the role of oestrogen in systemic lupus erythematosus"
} | [
{
"companynumb": "US-TEVA-2020-US-1865198",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "SPIRONOLACTONE"
},
"drugadditional": "1",
... |
{
"abstract": "A 44-year-old woman with ovarian cancer and normal renal function developed gross hematuria after carboplatin therapy. Laboratory investigation revealed elevated blood urea nitrogen and serum creatinine values. Computed tomography scan of the abdomen and pelvis with or without contrast revealed bilateral hydronephrosis with high-attenuation material within the left renal pelvis and both ureters consistent with blood. Delayed images at 3 hours revealed intense nephrogram with delayed excretion of contrast bilaterally. She underwent cystoscopy and placement of ureteral stent bilaterally. She had brisk diuresis with associated progressive decrease in serum creatinine to baseline value.",
"affiliations": "Department of Medicine, Long Island Jewish Medical Center, New Hyde Park, New York 11042, USA.",
"authors": "Krishnan|Srivilliputtur G Santhana|SG|;VanderBrink|Brian|B|;Weiss|Gary|G|;Singhal|Pravin C|PC|;Shah|Hitesh H|HH|",
"chemical_list": "D000970:Antineoplastic Agents; D016190:Carboplatin",
"country": "United States",
"delete": false,
"doi": "10.1016/j.urology.2007.08.059",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0090-4295",
"issue": "70(6)",
"journal": "Urology",
"keywords": null,
"medline_ta": "Urology",
"mesh_terms": "D058186:Acute Kidney Injury; D000970:Antineoplastic Agents; D016190:Carboplatin; D005260:Female; D006417:Hematuria; D006470:Hemorrhage; D006801:Humans; D007682:Kidney Pelvis; D008875:Middle Aged; D010051:Ovarian Neoplasms",
"nlm_unique_id": "0366151",
"other_id": null,
"pages": "1222.e5-7",
"pmc": null,
"pmid": "18158057",
"pubdate": "2007-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural",
"references": "12377641;12953086;6370067;2824209;2644887;2003521;1760899;8334645;10074593;16515631",
"title": "Renal pelvic hemorrhage and acute renal failure associated with carboplatin therapy.",
"title_normalized": "renal pelvic hemorrhage and acute renal failure associated with carboplatin therapy"
} | [
{
"companynumb": "US-CIPLA LTD.-2014US02876",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugadditional": null,
... |
{
"abstract": "Mycobacterium abscessus is a rapidly growing mycobacterium. It rarely causes disseminated infection or endocarditis. A 55-year-old male with a history of hepatitis C, liver cirrhosis, intravenous drug use (last use was four years ago), and chronic back pain presented with a three-week history of a right calf nodular lesion. He did not have a fever, chills, rash, dyspnea, or cough. Laboratory data showed mild leukocytosis. Computed tomography of the chest revealed bilateral cavitating nodules. Skin biopsy, sputum, and blood cultures grew Mycobacterium abscessus. Therapy with meropenem, tigecycline, and amikacin was initiated. He was re-admitted with worsening lower back pain. A lumbar magnetic resonance imaging showed destructive changes of L4 and L5 vertebral bodies concerning for osteomyelitis. Blood culture and bone biopsy grew Mycobacterium abscessus again. An echocardiogram was performed due to persistent bacteremia, which revealed large vegetation on the tricuspid valve and small vegetation on the mitral valve. Therapy was changed to eight weeks of amikacin, with cefoxitin and imipenem for twelve months based on drug susceptibility. Treatment of disseminated Mycobacterium abscessus is challenging due to antibiotic resistance. Typically, multidrug therapy is warranted with at least three active drugs. In severe valvular endocarditis, valve replacement may be required.",
"affiliations": "Division of Pulmonary Diseases and Critical Care Medicine, Yale-New Haven Health Bridgeport Hospital, Bridgeport, CT, USA.;Department of Internal Medicine, Yale-New Haven Health Bridgeport Hospital, Bridgeport, CT, USA.;Department of Internal Medicine, Yale-New Haven Health Bridgeport Hospital, Bridgeport, CT, USA.;Division of Pulmonary Diseases and Critical Care Medicine, Yale-New Haven Health Bridgeport Hospital, Bridgeport, CT, USA.;Division of Pulmonary Diseases and Critical Care Medicine, Yale-New Haven Health Bridgeport Hospital, Bridgeport, CT, USA.;Division of Pulmonary Diseases and Critical Care Medicine, Yale-New Haven Health Bridgeport Hospital, Bridgeport, CT, USA.",
"authors": "Rahi|Mandeep Singh|MS|;Reyes|Sandra Patrucco|SP|;Parekh|Jay|J|;Gunasekaran|Kulothungan|K|;Amoah|Kwesi|K|;Rudolph|Daniel|D|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1016/j.rmcr.2020.101331",
"fulltext": "\n==== Front\nRespir Med Case Rep\nRespir Med Case Rep\nRespiratory Medicine Case Reports\n2213-0071 Elsevier \n\nS2213-0071(20)30545-1\n10.1016/j.rmcr.2020.101331\n101331\nCase Report\nDisseminated Mycobacterium abscessus infection and native valve endocarditis\nRahi Mandeep Singh rahi.mandeepsingh@yahoo.coma∗ Reyes Sandra Patrucco b Parekh Jay b Gunasekaran Kulothungan a Amoah Kwesi a Rudolph Daniel a a Division of Pulmonary Diseases and Critical Care Medicine, Yale-New Haven Health Bridgeport Hospital, Bridgeport, CT, USA\nb Department of Internal Medicine, Yale-New Haven Health Bridgeport Hospital, Bridgeport, CT, USA\n∗ Corresponding author. Division of Pulmonary Diseases and Critical Care Medicine, Yale-New Haven Health Bridgeport Hospital, 267 Grant Street, Bridgeport, CT, 06610, USA. rahi.mandeepsingh@yahoo.com\n01 1 2021 \n2021 \n01 1 2021 \n32 10133129 10 2020 17 12 2020 27 12 2020 © 2020 The Author(s)2020This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Mycobacterium abscessus is a rapidly growing mycobacterium. It rarely causes disseminated infection or endocarditis. A 55-year-old male with a history of hepatitis C, liver cirrhosis, intravenous drug use (last use was four years ago), and chronic back pain presented with a three-week history of a right calf nodular lesion. He did not have a fever, chills, rash, dyspnea, or cough. Laboratory data showed mild leukocytosis. Computed tomography of the chest revealed bilateral cavitating nodules. Skin biopsy, sputum, and blood cultures grew Mycobacterium abscessus. Therapy with meropenem, tigecycline, and amikacin was initiated. He was re-admitted with worsening lower back pain. A lumbar magnetic resonance imaging showed destructive changes of L4 and L5 vertebral bodies concerning for osteomyelitis. Blood culture and bone biopsy grew Mycobacterium abscessus again. An echocardiogram was performed due to persistent bacteremia, which revealed large vegetation on the tricuspid valve and small vegetation on the mitral valve. Therapy was changed to eight weeks of amikacin, with cefoxitin and imipenem for twelve months based on drug susceptibility. Treatment of disseminated Mycobacterium abscessus is challenging due to antibiotic resistance. Typically, multidrug therapy is warranted with at least three active drugs. In severe valvular endocarditis, valve replacement may be required.\n\nKeywords\nMycobacterium abscessusEndocarditisPulmonary cavity\n==== Body\n1 Introduction\nMycobacterium abscessus complex are rapidly growing mycobacteria, which are ubiquitous to the environment. They have a very low incidence of infection and are mostly described in the immunocompromised population with reduced CD4 count and complement levels [1]. Immunocompetent individuals with indwelling vascular catheters or disruption of normal anatomic barriers are at risk for developing disseminated infection [2].\n\n2 Case presentation\nA 55-year-old male with a history of hepatitis C, liver cirrhosis, intravenous drug use (last use was four years ago), and chronic back pain presented with a three-week history of a right calf nodular lesion. He denied fevers, chills, rash, dyspnea, or cough. He was unsuccessfully treated with a course of doxycycline as an outpatient. Of note, one month prior, he was on a prednisone taper for three weeks for back pain exacerbation. On presentation, he was afebrile with a blood pressure of 163/89 mmHg, heart rate of 92/minute, respiratory rate of 20 breaths/minute, and saturating 98% on ambient air. There was a right calf nodular lesion with peripheral induration, central ulceration with a black base, and mild serous discharge.\n\nLaboratory data showed mild leukocytosis. Computed tomography of the chest revealed bilateral cavitating nodules, the largest in the superior segment of the left lower lobe (Fig. 1A). Skin biopsy, blood, and sputum cultures were obtained. Given skin and cavitary lung lesions, there was concern about methicillin-resistant Staphylococcus aureus (MRSA) infection, and empiric vancomycin was initiated. Skin biopsy, blood, and sputum cultures grew acid-fast bacilli, but Mycobacterium tuberculosis polymerase chain reaction assay was negative. The final result showed Mycobacterium abscessus. The human immunodeficiency virus antibody screen was negative. Therapy with meropenem, tigecycline, and amikacin was initiated after infectious diseases consultation, and he was discharged to a rehabilitation facility. After three months, he was re-admitted for evaluation of worsening lower back pain. A lumbar magnetic resonance imaging revealed destructive changes of L4 and L5 vertebral bodies concerning for osteomyelitis. Bone biopsy and blood cultures grew Mycobacterium abscessus again. Due to persistent bacteremia, an echocardiogram was performed, which revealed large mobile vegetation on the tricuspid valve and small vegetation on the mitral valve consistent with endocarditis (Fig. 1B). Based on drug susceptibility, he was discharged on amikacin for eight weeks, with cefoxitin and imipenem for twelve months. During follow-up after a month, he had been clinically doing well with a near-complete resolution of skin rash.Fig. 1 (A) Is computed tomography of the chest in an axial view showing a cavitary lesion in the superior segment of the left lower lobe and (B) is an echocardiogram showing large tricuspid valve vegetation (arrow) and small mitral valve vegetation (arrowhead) in an apical 4-chamber view (RV, right ventricle; TV, tricuspid valve; RA, right atrium; LV, left ventricle; MV, mitral valve; LA, left atrium and interventricular septum denoted by a curved arrow).\n\nFig. 1\n\n3 Discussion\nMycobacterium abscessus complex includes M. chelonae, and M. abscessus. M. abscessus is the most prevalent microorganism in the rapidly-growing mycobacteria group causing pulmonary infections [3]. Disseminated M. abscessus is rare, and mycobacterial endocarditis is rarer. Prosthetic valves are commonly infected, and among native valves, aortic and mitral valves are the most frequently affected [4]. Risk factors include indwelling vascular catheters, cardiac catheterization, intravenous drug users, immunocompromised due to human immunodeficiency virus, hematological malignancies, or immunosuppressive agent use due to organ transplants. Recent corticosteroid use may have been the risk factor for our patient. Patients can present with non-specific symptoms or be asymptomatic. The most common presenting symptom is usually fever presenting as pyrexia of unknown origin, followed by chest pain or dyspnea. Blood cultures are highly sensitive, especially in cases of native valve endocarditis. Acid-fast bacilli stain of sputum, and histological sections (if available like skin biopsy, prosthetic valve) should be performed [4]. Echocardiography should be performed in patients with persistently positive blood cultures or radiological findings of pulmonary septic emboli. In a literature review of mycobacterial endocarditis, 15 out of 46 patients had a cardiac murmur at presentation, and echocardiography was used to confirm the presence of vegetations [4,5]. Treatment of Mycobacterium abscessus is challenging due to antibiotic resistance, including macrolides, aminoglycosides, rifamycins, tetracyclines, and β-lactams [3]. Evidence-based management of disseminated M. abscessus infection and endocarditis lacks due to the rarity of the condition. Usually, empiric treatment is started based on the in vitro susceptibility data, and later targeted therapy is employed when drug susceptibilities are available [6]. Drugs with in vitro activity include clarithromycin, amikacin, tigecycline, imipenem, and cefoxitin [5]. Treatment of pulmonary disease involves a multidrug regimen with at least three active drugs. Treatment duration ranges from 4 to 12 months depending on the severity of illness, and in refractory cases, surgical debridement may be required. Therefore, expert consultation is recommended [7]. Treatment of infective endocarditis requires a multidrug regimen for 6–12 months and is usually refractory, requiring early surgical intervention, especially in severe valvular endocarditis [4,8].\n\nDeclaration of competing interest\nThe authors whose names are listed immediately below certify that they have NO affiliations with or involvement in any organization or entity with any financial interest (such as honoraria; educational grants; participation in speakers’ bureaus; membership, employment, consultancies, stock ownership, or other equity interest; and expert testimony or patent-licensing arrangements), or non-financial interest (such as personal or professional relationships, affiliations, knowledge or beliefs) in the subject matter or materials discussed in this manuscript.\n==== Refs\nReferences\n1 Liebeskind D.S. Ostrzega N. Wasterlain C.G. Buttner E.A. Neurologic manifestations of disseminated infection with Mycobacterium abscessus Neurology 56 6 2001 810 813 11274327 \n2 Rodriguez-Coste M.A. Chirca I. Steed L.L. Salgado C.D. Epidemiology of rapidly growing mycobacteria bloodstream infections Am. J. Med. Sci. 351 3 2016 253 258 26992253 \n3 Johansen M.D. Herrmann J.-L. Kremer L. Non-tuberculous mycobacteria and the rise of Mycobacterium abscessus Nat. Rev. Microbiol. 18 7 2020 392 407 32086501 \n4 Yuan S.-M. Mycobacterial endocarditis: a comprehensive review Braz. J. Cardiovasc. Surg. 30 2015 93 103 \n5 Mahajan S. Mishra V. Sorabjee J. Mycobacterium abscessus: causing fatal endocarditis after cardiac catheterization J. Postgrad. Med. 61 2 2015 131 133 25766351 \n6 Kunin M. Salamon F. Weinberger M. Genkin I. Sagie A. Tur-Kaspa R. Conservative treatment of prosthetic valve endocarditis due to Mycobacterium fortuitum Eur. J. Clin. Microbiol. Infect. Dis. 21 7 2002 539 541 12172746 \n7 Daley C.L. Iaccarino J.M. Jr. Lange C. Cambau E. Wallace R.J. Andrejak C. Böttger E.C. Brozek J. Griffith D.E. Guglielmetti L. Huitt G.A. Knight S.L. Leitman P. Marras T.K. Olivier K.N. Santin M. Stout J.E. Tortoli E. van Ingen J. Wagner D. Winthrop K.L. Treatment of nontuberculous mycobacterial pulmonary disease: an official ATS/ERS/ESCMID/IDSA clinical practice guideline: executive summary Clin. Infect. Dis. 2020 \n8 Williamson J.C. Miano T.A. Morgan M.R. Palavecino E.L. Fatal Mycobacterium abscessus endocarditis misidentified as Corynebacterium spp Scand. J. Infect. Dis. 42 3 2010 222 224 19958237\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2213-0071",
"issue": "32()",
"journal": "Respiratory medicine case reports",
"keywords": "Endocarditis; Mycobacterium abscessus; Pulmonary cavity",
"medline_ta": "Respir Med Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101604463",
"other_id": null,
"pages": "101331",
"pmc": null,
"pmid": "33489744",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "26992253;32628747;12172746;25859873;11274327;19958237;25766351;32086501",
"title": "Disseminated Mycobacterium abscessus infection and native valve endocarditis.",
"title_normalized": "disseminated mycobacterium abscessus infection and native valve endocarditis"
} | [
{
"companynumb": "US-TEVA-2021-US-1920130",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nBrugada syndrome is an inherited arrhythmogenic disease that may cause sudden cardiac death due to ventricular fibrillation in young adults. Brugada syndrome caused by propafenone intoxication has been noted rarely in the literature. We report a rare case, Brugada phenocopy due to propafenone intoxication and its treatment.\n\n\nMETHODS\nA 15-year-old girl having a seizure was brought to the emergency room. She took 1.5 g propafenone (Rythmol, Abbott, Chicago, IL, USA) for suicidal intention. She had metabolic acidosis. Long QRS interval and ST elevation in leads V1 through V3 were seen on electrocardiography. After bicarbonate infusion for 4 hours, haemodynamic and neurologic findings were recovered, and all electrocardiography abnormalities disappeared. The Brugada-like electrocardiography pattern was not recognized in her surface and 24-hour Holter electrocardiography at follow-up. Ajmaline challenge test was negative 2 weeks later.\n\n\nCONCLUSIONS\nAbsence of symptoms and documented ventricular tachycardia, negative challenge test, and a negative family history demonstrated that the Brugada phenocopy was a transient finding in this case and related to propafenone intoxication.",
"affiliations": "Department of Pediatric Cardiology, Ankara Children's Hematology and Oncology Training and Research Hospital, Ankara, Turkey.;Department of Pediatric Cardiology, Ankara Children's Hematology and Oncology Training and Research Hospital, Ankara, Turkey.",
"authors": "Arı|Mehmet Emre|ME|;Ekici|Filiz|F|",
"chemical_list": "D000927:Anticonvulsants; D026941:Sodium Channel Blockers; D011405:Propafenone; D008874:Midazolam",
"country": "Turkey",
"delete": false,
"doi": "10.4274/balkanmedj.2016.1185",
"fulltext": "\n==== Front\nBalkan Med JBalkan Med JBMJBalkan Medical Journal2146-31232146-3131Galenos Publishing 2838139110.4274/balkanmedj.2016.11852084Case ReportBrugada-Phenocopy Induced by Propafenone Overdose and Successful Treatment: A Case Report Arı Mehmet Emre 1*Ekici Filiz 1\n1 \nDepartment of Pediatric Cardiology, Ankara Children’s Hematology and Oncology Training and Research Hospital, Ankara, Turkey\n* Address for Correspondence: Department of Pediatric Cardiology, Ankara Children’s Hematology and Oncology Training and Research Hospital, Ankara, Turkey GSM: +90 553 650 32 34 E-mail: memreari@yahoo.com9 2017 29 9 2017 34 5 473 475 3 8 2016 24 3 2017 © Copyright 2017, Trakya University Faculty of Medicine2017Balkan Medical JournalBackground:\nBrugada syndrome is an inherited arrhythmogenic disease that may cause sudden cardiac death due to ventricular fibrillation in young adults. Brugada syndrome caused by propafenone intoxication has been noted rarely in the literature. We report a rare case, Brugada phenocopy due to propafenone intoxication and its treatment.\n\nCase Report:\nA 15-year-old girl having a seizure was brought to the emergency room. She took 1.5 g propafenone (Rythmol, Abbott, Chicago, IL, USA) for suicidal intention. She had metabolic acidosis. Long QRS interval and ST elevation in leads V1 through V3 were seen on electrocardiography. After bicarbonate infusion for 4 hours, haemodynamic and neurologic findings were recovered, and all electrocardiography abnormalities disappeared. The Brugada-like electrocardiography pattern was not recognized in her surface and 24-hour Holter electrocardiography at follow-up. Ajmaline challenge test was negative 2 weeks later.\n\nConclusion:\nAbsence of symptoms and documented ventricular tachycardia, negative challenge test, and a negative family history demonstrated that the Brugada phenocopy was a transient finding in this case and related to propafenone intoxication.\n\nBrugada-like electrocardiography patternpropafenonechildrenBrugada phenocopy\n==== Body\nBrugada syndrome is an inherited arrhythmogenic disease that may cause sudden cardiac death due to ventricular fibrillation in young adults. Brugada syndrome is usually identified by a characteristic type 1 electrocardiography (ECG) pattern that consists of ST elevation of a coved type in the precordial leads V1 to V3. In addition, the term Brugada phenocopy is used to describe conditions that induce Brugada-like ECG manifestations in patients without true Brugada syndrome. Some drugs and conditions can cause a Brugada type 1 ECG pattern which is not true congenital Brugada syndrome (1,2).\n\nPropafenone (Rythmol, Abbott, Chicago, IL, USA) is a group 1C antiarrhythmic drug that has sodium channel-blocking effects. Excessive intake may cause severe arrhythmias such as bradycardia, sinoatrial block, atrioventricular block, intraventricular block, junctional and/or ventricular tachycardia, or chaotic ventricular rhythm (3,4,5,6,7). Intoxication with class I antiarrhythmic drugs is associated with a higher mortality rate (22.5%) than other drugs (1%) (3).\n\nWe present a case report of successful treatment of Brugada phenocopy due to propafenone intoxication.\n\nCASE PRESENTATION\nA 15-year-old girl was admitted to the emergency room with complaints of vomiting and loss of consciousness lasting 3 hours. Upon admission, her blood pressure was 70/45 mmHg, her heart rate was 60/minute, and the body temperature was 36.8 °C. The initial ECG revealed sinus rhythm, absent of the P-wave, and an extremely prolonged QRS interval (280 ms). It was reported that she had attempted suicide by taking five pills of propafenone hydrochloride (total dose 1.5 g, 30 mg per kilogram of body weight) 3 hours before admission. Generalized tonic-clonic convulsion was observed in the patient and treated with midazolam infusion. Arterial blood gas analysis revealed mild metabolic acidosis. The other laboratory tests showed that blood glucose level, electrolytes, hepatic and kidney function tests, and troponin 1 levels were normal. Bedside echocardiographic examination was normal as well. Intravenous sodium bicarbonate, saline, and positive inotropic agent infusions were started immediately. On a following ECG, Brugada phenocopy appeared in leads V1 through V3 (Figure 1). Haemodynamic and neurologic findings were recovered 4 hours after treatment. When the acidosis was treated, the ECG abnormalities returned to normal (Figure 2). After the treatment was completed, 24 hour rhythm Holter ECG recording was normal. The patient was discharged from hospital without any sequel 2 days after admission. We observed that ajmaline challenge test was negative 2 weeks after the incident. She had no medication and arrhythmic syncope in the history. Her family members had neither pathological ECG findings nor history for sudden cardiac death. We have received confirmation from the family to be published.\n\nDISCUSSION\nThe characteristic ECG irregularities of Brugada syndrome may be seen intermittently. It can be unmasked by sodium channel blockers and febrile states. In addition, some drugs and conditions can trigger a Brugada type 1 ECG pattern without true congenital Brugada syndrome. The terminology of this situation in the literature is diverse and variable such as acquired forms of Brugada syndrome, Brugada-like ECG patterns, Brugada-like ECG findings, Brugada-like ECG ST segment abnormalities, and Brugada syndrome mimicry (1,2,8). The lack of consensus on the terminology is confusing. As such, we need to use a common term for this Brugada syndrome type. Baranchuk et al. (1) suggested that Brugada phenocopy is the best descriptor for Brugada-like ECG patterns in patients without true Brugada syndrome. A type 1 ECG pattern of Brugada syndrome was observed in our patient, who did not meet any clinical or ECG criteria. Thus, it was accepted as propafenone-induced Brugada phenocopy. Similarly, Hasdemir et al. (6) presented a 16-year-old girl who took 2.4 g propafenone and had extreme QRS complex widening and prolonged PR interval on ECG. Brugada phenocopy was seen on ECG after saline infusion therapy, and she was discharged from hospital without any sequel.\n\nMetabolic conditions (hypokalaemia, hyperkalaemia, hyponatraemia, and hypercalcaemia), medicines with a sodium channel-blocking effect such as class 1 antiarrhythmic drugs, anaesthetics (especially propofol), tricyclic antidepressants, severe fever, or cocaine can cause Brugada phenocopy (1,3,4,5,6,7). Junttila et al. (7) evaluated 47 patients with a typical Brugada-type ECG due to medicines or severe fever in the emergency room. They detected malignant arrhythmias and sudden cardiac death in 51% and 37% of cases respectively.\n\nThere is no specific treatment for propafenone intoxication. Haemodialysis or haemoperfusion can be used, but are frequently unsuccessful. Atropine, inotropic drugs, or pacemaker therapy may be required. As in our case, intravenous sodium bicarbonate infusion may support rapid and full recovery of dysrhythmia related to propafenone intoxication (3,4,5,6,7). If propafenone-induced cardiotoxicity is unresponsive to the current treatment, intravenous lipid emulsion therapy or glucose-insulin infusion may be considered.\n\nIn conclusion, Brugada phenocopy is the best term to define the Brugada type 1 ECG pattern without congenital Brugada syndrome. We presented a very rare case in children, propafenone intoxication which causes Brugada phenocopy.\n\nFinancial Disclosure: No financial disclosure was declared by the authors.\n\nConflict of Interest: No conflict of interest was declared by the authors. \n\nFIG. 1. Brugada phenocopy appeared in leads V1 through V3.\nFIG. 2. All electrocardiography abnormalities returned to normal 4 hours later.\n==== Refs\nReferences\n1 Baranchuk A Nguyen T Ryu MH Femenía F Zareba W Wilde AA et al Brugada phenocopy: new terminology and proposed classification Ann Non-invasive Electrocardiol 2012 17 299 314 \n2 Riera AR Uchida AH Schapachnik E Dubner S Filho CF Ferreira C Propofol infusion syndrome and Brugada syndrome electrocardiographic phenocopy Cardiol J 2010 17 130 5 20544610 \n3 Köppel C Oberdisse U Heinemeyer G Clinical course and outcome in class IC antiarrhythmic overdose J Toxicol Clin Toxicol 1990 28 433 44 2176700 \n4 Brubacher J Bicarbonate therapy for unstable propafenone-induced wide complex tachycardia CJEM 2004 6 349 56 17381993 \n5 Avci A Yilmaz A Celik M Demir K Keles F Successful treatment of suicide attempt by megadose of propafenone and captopril Cardiovasc Toxicol 2013 13 230 3 23397376 \n6 Hasdemir C Olukman M Ulucan C Roden DM Brugada-type ECG pattern and extreme QRS complex widening with propafenone overdose J Cardiovasc Electrophysiol 2006 17 565 6 16684037 \n7 Junttila MJ Gonzalez M Lizotte E Benito B Vernooy K Sarkozy A et al Induced Brugada-type electrocardiogram, a sign for imminent malignant arrhythmias Circulation 2008 117 1890 3 18391123 \n8 Hermida JS Jandaud S Lemoine JL Rodriguez-Lafrasse C Delonca J Bertrand C et al Prevalence of drug-induced electrocardiographic pattern of the Brugada syndrome in a healthy population Am J Cardiol 2004 94 230 3 15246910\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2146-3123",
"issue": "34(5)",
"journal": "Balkan medical journal",
"keywords": "Brugada-like electrocardiography pattern; children Brugada phenocopy.; propafenone",
"medline_ta": "Balkan Med J",
"mesh_terms": "D000293:Adolescent; D000294:Adolescent Behavior; D000927:Anticonvulsants; D053840:Brugada Syndrome; D002641:Chicago; D004562:Electrocardiography; D015716:Electrocardiography, Ambulatory; D005260:Female; D006801:Humans; D008874:Midazolam; D011405:Propafenone; D012640:Seizures; D026941:Sodium Channel Blockers; D013406:Suicide, Attempted; D016896:Treatment Outcome",
"nlm_unique_id": "101571817",
"other_id": null,
"pages": "473-475",
"pmc": null,
"pmid": "28381391",
"pubdate": "2017-09-29",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "17381993;23094876;16684037;20544610;15246910;18391123;2176700;23397376",
"title": "Brugada-Phenocopy Induced by Propafenone Overdose and Successful Treatment: A Case Report.",
"title_normalized": "brugada phenocopy induced by propafenone overdose and successful treatment a case report"
} | [
{
"companynumb": "TR-MYLANLABS-2017M1024554",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "PROPAFENONE"
},
"drugadditional": null,
... |
{
"abstract": "The prognosis of leptomeningeal metastasis (LM) from solid tumors is extremely poor, especially for patients with adverse prognostic factors. In this phase II clinical trial, we evaluated the efficacy and safety of intrathecal chemotherapy (IC) combined with concomitant involved-field radiotherapy (IF-RT) for treating LM from solid tumors with adverse prognostic factors. Fifty-nine patients with LM from various solid tumors were enrolled between May 2010 and December 2014. Concurrent therapy consisted of concomitant IC (methotrexate 12.5-15 mg and dexamethasone 5 mg, weekly) and IF-RT (whole brain and/or spinal canal RT, 40 Gy/20f). For patients with low Karnofsky performance status (KPS) score and radiotherapy intolerance, induction IC (1-3 times) was given before concurrent therapy. Thirty-eight patients (64.4%) received subsequent treatments. All patients were followed up at least 6 months after LM diagnosis or until death. Primary endpoint evaluated was clinical response rate. Secondary endpoints were overall survival (OS) and safety. The pathological types included lung cancer (n = 42), breast cancer (n = 11) and others (n = 6). Median KPS score was 40 (range 20-70). Fifty-one patients (86.4%) completed concurrent therapy. The overall response rate was 86.4% (51/59). OS ranged from 0.4 to 36.7 months (median 6.5 months), and 1-year-survival rate was 21.3%. Treatment-related adverse events mainly included acute meningitis, chronic-delayed encephalopathy, radiculitis, myelosuppression and mucositis. Twelve patients (20.3%) had grade III-V toxic reactions. We concluded that IC combined with concomitant IF-RT, with significant efficacy and acceptable toxicity, may be an optimal therapeutic option for treatment of LM from solid tumors with adverse prognostic factors. LM, in which cancer cells spread to membranes enveloping the brain and spinal cord, is a devastating complication of solid cancers. Existing LM therapies center on IC. In this prospective clinical study, the authors combined intrathecal methotrexate with involved-field radiotherapy in a concomitant regimen, showing that the approach can potentially improve quality of life for patients with adverse prognostic factors. Concurrent radiotherapy-bolstered IC by contributing to prolonged remission of neurological symptoms and increasing OS. The findings suggest that the concomitant regimen could be an optimal treatment option for LM.",
"affiliations": "Department of Radiation-Oncology, The First Hospital of Jilin University, Changchun, 130021, China.;Department of Radiation-Oncology, The First Hospital of Jilin University, Changchun, 130021, China.;Cancer Center, The First Hospital of Jilin University, Changchun, 130021, China.;Department of Neuro-Oncological Surgery, The First Hospital of Jilin University, Changchun, 130021, China.;Department of Radiology, The First Hospital of Jilin University, Changchun, 130021, China.;Department of Radiation-Oncology, The First Hospital of Jilin University, Changchun, 130021, China.;Department of Radiation-Oncology, The First Hospital of Jilin University, Changchun, 130021, China.;Department of Radiation-Oncology, The First Hospital of Jilin University, Changchun, 130021, China.;Department of Radiation-Oncology, The First Hospital of Jilin University, Changchun, 130021, China.;Department of Neuro-Oncological Surgery, The First Hospital of Jilin University, Changchun, 130021, China.",
"authors": "Pan|Zhenyu|Z|;Yang|Guozi|G|;He|Hua|H|;Zhao|Gang|G|;Yuan|Tingting|T|;Li|Yu|Y|;Shi|Weiyan|W|;Gao|Pengxiang|P|;Dong|Lihua|L|;Li|Yunqian|Y|",
"chemical_list": "D003907:Dexamethasone; D008727:Methotrexate",
"country": "United States",
"delete": false,
"doi": "10.1002/ijc.30214",
"fulltext": "\n==== Front\nInt J CancerInt. J. Cancer10.1002/(ISSN)1097-0215IJCInternational Journal of Cancer0020-71361097-0215John Wiley and Sons Inc. Hoboken 10.1002/ijc.30214IJC30214Cancer Therapy and PreventionCancer Therapy and PreventionConcurrent radiotherapy and intrathecal methotrexate for treating leptomeningeal metastasis from solid tumors with adverse prognostic factors: A prospective and single‐arm study Concomitant schedule for treating leptomeningeal metastasis from solid tumors with adverse prognostic factorsPan et al.Pan Zhenyu \n1\nYang Guozi \n1\nHe Hua \n2\nZhao Gang \n3\nYuan Tingting \n4\nLi Yu \n1\nShi Weiyan \n1\nGao Pengxiang \n1\nDong Lihua \n1\nLi Yunqian \n3\n1 Department of Radiation‐OncologyThe First Hospital of Jilin UniversityChangchun130021China2 Cancer CenterThe First Hospital of Jilin UniversityChangchun130021China3 Department of Neuro‐Oncological SurgeryThe First Hospital of Jilin UniversityChangchun130021China4 Department of RadiologyThe First Hospital of Jilin UniversityChangchun130021China* Correspondence to: Lihua Dong, Department of Radiation‐Oncology, The First Hospital of Jilin University, 71 Xinmin Street, Changchun 130021, China, Tel.: +86‐431‐88786172, Fax: +86‐431‐88786172, E‐mail: dlh@jlu.edu.cn or Yunqian Li, Department of Neuro‐Oncological Surgery, The First Hospital of Jilin University, Changchun 130021, China, Tel.: +86‐431‐81875701, Fax: +86‐431‐81875701, E‐mail: yunqian@jlu.edu.cn30 6 2016 15 10 2016 139 8 10.1002/ijc.v139.81864 1872 11 3 2016 17 5 2016 20 5 2016 © 2016 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICCThis is an open access article under the terms of the Creative Commons Attribution‐NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.The prognosis of leptomeningeal metastasis (LM) from solid tumors is extremely poor, especially for patients with adverse prognostic factors. In this phase II clinical trial, we evaluated the efficacy and safety of intrathecal chemotherapy (IC) combined with concomitant involved‐field radiotherapy (IF‐RT) for treating LM from solid tumors with adverse prognostic factors. Fifty‐nine patients with LM from various solid tumors were enrolled between May 2010 and December 2014. Concurrent therapy consisted of concomitant IC (methotrexate 12.5–15 mg and dexamethasone 5 mg, weekly) and IF‐RT (whole brain and/or spinal canal RT, 40 Gy/20f). For patients with low Karnofsky performance status (KPS) score and radiotherapy intolerance, induction IC (1–3 times) was given before concurrent therapy. Thirty‐eight patients (64.4%) received subsequent treatments. All patients were followed up at least 6 months after LM diagnosis or until death. Primary endpoint evaluated was clinical response rate. Secondary endpoints were overall survival (OS) and safety. The pathological types included lung cancer (n = 42), breast cancer (n = 11) and others (n = 6). Median KPS score was 40 (range 20–70). Fifty‐one patients (86.4%) completed concurrent therapy. The overall response rate was 86.4% (51/59). OS ranged from 0.4 to 36.7 months (median 6.5 months), and 1‐year‐survival rate was 21.3%. Treatment‐related adverse events mainly included acute meningitis, chronic‐delayed encephalopathy, radiculitis, myelosuppression and mucositis. Twelve patients (20.3%) had grade III–V toxic reactions. We concluded that IC combined with concomitant IF‐RT, with significant efficacy and acceptable toxicity, may be an optimal therapeutic option for treatment of LM from solid tumors with adverse prognostic factors. LM, in which cancer cells spread to membranes enveloping the brain and spinal cord, is a devastating complication of solid cancers. Existing LM therapies center on IC. In this prospective clinical study, the authors combined intrathecal methotrexate with involved‐field radiotherapy in a concomitant regimen, showing that the approach can potentially improve quality of life for patients with adverse prognostic factors. Concurrent radiotherapy‐bolstered IC by contributing to prolonged remission of neurological symptoms and increasing OS. The findings suggest that the concomitant regimen could be an optimal treatment option for LM.\n\n\nWhat's new?\n\n\nLeptomeningeal metastasis (LM), in which cancer cells spread to membranes enveloping the brain and spinal cord, is a devastating complication of solid cancers. Existing LM therapies center on intrathecal chemotherapy (IC). In this prospective clinical study, the authors combined intrathecal methotrexate with involved‐field radiotherapy in a concomitant regimen, showing that the approach can potentially improve quality of life for patients with adverse prognostic factors. Concurrent radiotherapy bolstered IC by contributing to prolonged remission of neurological symptoms and increasing overall survival. The findings suggest that the concomitant regimen could be an optimal treatment option for LM.\n\nmetastasissolid tumorleptomeningeal metastasiscentral nervous systemintrathecal chemotherapyradiation therapy source-schema-version-number2.0component-idijc30214cover-date15 October 2016details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_NLMPMC version:4.9.6 mode:remove_FC converted:04.11.2016Z. Pan wrote the manuscript and designed the study; G. Yang did the data collection; H. He did the data analysis; T. Yuan did the imaging findings analysis; Y. Li, W. Shi, and P. Gao did the data collection and recording; G. Zhao did the imaging findings analysis and revised the manuscript; L. Dong and Y. Li revised the manuscript and approved the submission.\n==== Body\nLeptomeningeal metastasis (LM) is a lethal complication of solid tumors. Despite specific treatment, the median overall survival (OS) is limited to 2–3 months and the 1‐year‐survival rate is <15% worldwide.1 Several factors are associated with poor prognosis of LM, such as Karnofsky performance status (KPS) score of < 60, multiple and severe neurologic deficits, bulky central nervous system (CNS) disease, encephalopathy and extensive systemic disease with few treatment options.2, 3, 4, 5, 6 For these patients, LM‐specific treatment is ineffective and the prognosis is extremely poor. 3, 4, 7, 8, 9, 10 Palliative treatment is proposed by National Comprehensive Cancer Network (NCCN), however, it merely improves neurologic symptoms without extending patients' survival.11, 12 For patients with good prognostic factors such as high KPS score, no major neurologic deficit, minimal systemic disease or reasonable systemic treatment options, involved‐field radiotherapy (IF‐RT) therapy was suggested by NCCN guidelines to the bulky disease and/or symptomatic sites firstly. Subsequently, cerebrospinal fluid (CSF) flow scan was suggested, and intrathecal chemotherapy (IC) was proposed to the LM patients with normal CSF flow.\n\nThe aim of LM‐directed treatment is to maintain or stabilize the neurological status, improve quality of life and prolong survival. Up to now, IC is the mainstay for the treatment of LM from solid tumors,1, 13, 14 despite no study has confirmed the interest of intra‐CSF therapy until now. Methotrexate (MTX) and liposomal cytarabine are the most frequently used agents for IC of LM from solid tumors. Liposomal cytarabine showed a better neurological progression‐free survival and a better impact on the quality of life.15, 16, 17 Nevertheless, all of the included subjects were suffered from lymphoma in these studies except one17 including patients with breast cancer, lung cancer, melanoma, primary brain tumor and other conditions. DepoCyt is approved only for lymphomatous meningitis but is often used off label for LM from solid tumor.1\n\n\nCurrently, the most common regimen of intrathecal MTX was on a twice‐weekly schedule for 4 weeks, followed by a decrease in frequency for 3–6 months.1, 18, 19 IF‐RT to symptomatic sites, sites of CSF flow block and bulky disease observed on MRI, is also a candidate for LM‐related treatment.1 Whole brain radiotherapy has been proved to induce neurologic improvement11 and control of parenchymal brain metastasis. Besides, irradiation could eliminate the tumor mass not treatable by intra‐CSF chemotherapy.20 Furthermore, radiotherapy is also indicated to reestablish normal CSF following documentation of CSF flow block to permit improved efficacy and decreased toxicity of intra‐CSF chemotherapy,8, 21 aspects that commend the need for early LM treatment.1, 22\n\n\nComprehensive treatment is an option for LM treatment with acceptable efficiency.1 However, leukoencephalopathy is most common in patients received intrathecal MTX following cranial irradiation.23 On this occasion, concomitant therapy may be an optimal treatment modality. To our best knowledge, no prospective study has been carried out using concomitant therapy except one in 1987.24 In that study, the authors conducted a prospective randomized trial to compare the efficiency of intrathecal MTX or MTX plus cytosine arabinoside (Ara‐C). Twenty‐two (50%) patients received concomitant IC and CNS radiotherapy, which showed significantly superior clinical response rate and better OS compared with those only received IC. In addition, the majority of patients with a survival of >6 months (6/7) received concomitant therapy. These indicated that concomitant therapy might contribute to the improvement of prognosis. Unfortunately, no further study has been carried out thereafter despite seldom severe neurotoxicity reported in that study. Indeed, concomitant therapy is a recommended modality for LM by NCCN guidelines, but no published studies are available. In this study, a prospective and single‐arm clinical trial was designed to investigate the efficacy and safety of the concomitant therapeutic modality.\n\nMaterial and Methods\nPatients\nLM patients admitted to our hospital from May 2010 to December 2014 were enrolled. LM diagnosis was ascertained according to the NCCN guidelines and previous literatures1, 4, 13, 14, 18, 19 (Supporting Information 1). Patients met with any of the following criteria were sufficient to the diagnosis: positive CSF cytology; MRI scans indicating LM or based on the comprehensive analysis of CSF cytology, neuroimaging findings and other clinical features, including malignant tumor history, nervous system symptoms and conventional CSF examination.\n\nThe inclusion criteria were: (i) those aged > 18 years and confirmed diagnosis of LM; (ii) those confirmed with solid tumors excluding hematological malignancies (e.g., leukemia and lymphoma) and primary brain tumors; (iii) those with at least one poor prognostic factor, including KPS of < 60, severe and multiple neurological deficits (those with two or more groups of neurological symptoms/signs or severe neurological symptoms/signs mainly distributed in three domains including cerebral hemisphere, cranial nerve and the existing nerve roots affecting the life quality), encephalopathy, extensive systemic disease with few treatment options (the patients with active systemic disease, and showed tolerance to the systemic therapy including chemotherapy and target therapy), and bulky brain metastasis (brain parenchyma metastatic lesions with a diameter of >2 cm).\n\nThe exclusion criteria were: (i) those with severe hepatic or renal insufficiency, leucocyte count of < 2.5 × 1012, and platelet count of < 6.0 × 109; (ii) received cranial radiotherapy within 6 months; (iii) received systemic chemotherapy within 2 weeks, or molecular target therapy within 1 month and (iv) with poor tolerance of treatment. Written informed consent was obtained from each patient. All procedures were compliant with the Declaration of Helsinki. The study protocols were approved by the Ethic Committee of The First Hospital of Jilin University. This clinical trial was registered in the Chinese Clinical Trial Registry (ID: ChiCTR‐OOC‐14005403).\n\nTreatment plan\nThe study schema is provided in Figure 1. The regimen of concomitant therapy consisted of IC via lumbar punctures (MTX 12.5–15 mg, plus dexamethasone 5 mg, once per week, 4 weeks in total) and IF‐RT. Radiotherapy consisted of fractionated, conformal radiation given at a daily dose of 2 Gy. The planning volume consisted of sites of symptomatic disease, bulky disease observed on MRI, including the whole brain and basis cranii received 40 Gy in 20 fractions and/or segment of spinal canal received 40–50 Gy (the above segments of the first lumbar vertebra were given 40 Gy in 20 fractions; the first lumbar vertebra and the inferior segments were given 40/50 Gy in 20 fractions). Patients with KPS of ≤ 40 and irradiation intolerance were required to receive induction IC (MTX 12.5–15 mg, plus dexamethasone 5 mg, twice per week). Then these patients were allowed to receive concomitant therapy upon neurologic improvement and radiotherapy tolerance. Supporting therapy was given to patients with low KPS score.\n\nFigure 1 Protocol schema. IC: intrathecal chemotherapy; RT: radiation therapy; KPS: Karnofsky performance status; MTX: methotrexate; DXM: dexamethasone.\n\nSubsequent treatment was recommended after concomitant therapy. Consolidation IC (MTX 12.5–15 mg, plus dexamethasone 5 mg) was recommended once per week. The total cycles of IC including the induction therapy, concomitant therapy and consolidation therapy should be <8 times within 2 months. Maintenance IC (MTX 12.5–15 mg, plus dexamethasone 5 mg) was recommended once per month after concomitant therapy and/or consolidation therapy to patients with stable systemic disease or longer expected survival. The patients with active systemic disease were proposed to systemic therapy (chemotherapy or molecular target therapy) according to the NCCN guidelines of related tumors.\n\nClinical evaluation and follow‐up\nNowadays, it is lack of standardization with respect to response criteria.14 Neuroimaging and CSF cytology have been used for the diagnosis and even evaluation of LM, however, these techniques do have their limitations.1, 25 In this study, we established the criteria of evaluation for clinical response based on improvement of neurologic symptoms/signs and changes of KPS. The clinical response was evaluated by at least two experienced neuro‐oncologists. The evaluation consists of five layers, including complete response (CR), obvious response (OR), partial response (PR), stable disease (SD) and progressive disease (PD); Table 1. Clinical evaluation was performed once per week from the beginning of LM‐related therapy, till 4 weeks later after concomitant therapy. Clinical response was defined as continuous presence of CR, OR or PR within an interval of at least 1 week. SD and PD were defined as ineffective.\n\nTable 1 Criteria of clinical response evaluation\n\n\tNeurological symptoms and signs\tKPS score\t\nComplete response\tAlmost normal neurological examination. Mild cranial nerve symptoms including tinnitus or blurred vision may exist. GCS score of 15.\t≥90\t\nObvious response\tSignificant neurologic improvement. No severe symptoms/signs, such as severe headache, somnolence, mental status. Dizziness, confusion, mild headache, cranial nerve paralysis or radiculitis may exist. GCS ≥ 12.\t≥ 70 or elevation of ≥ 30 compared with the baseline level.\t\nPartial response\tPartial neurological improvement. Still with headache or other mild/moderate symptoms/signs. GCS ≥ 9.\t50–70 or elevation of 10–20 compared with the baseline level.\t\nStable disease\tNo visible neurological improvement.\tElevation of ≤ 10 compared with the baseline level.\t\nProgressive disease\tDeteriorative neurological symptoms and signs.\tDecrease of KPS compared to the baseline level.\t\nTwo conditions both of neurological symptoms/signs and KPS must be satisfied synchronously. KPS: Karnofsky performance status score; GCS: Glasgow coma scale.\n\nThe following parameters were determined before treatment: general health conditions, KPS score, neurological conditions, Glasgow coma scale, full blood count and multichannel biochemical profile. Imaging examination was used to evaluate systemic disease. Toxicity was evaluated by physical examination, neurological examination, CSF examination, full blood count and multichannel biochemical profile monitoring weekly. CSF cytology was performed once per week. Survival time was recorded since the date of LM diagnosis. All patients were followed up until death or July 31, 2015. Adverse events (AEs) were evaluated according to the Common Terminology Criteria for Adverse Events (CTCAE, version 3.0). Events of grade 3–5 were defined as moderate and severe adverse events.\n\nStatistical analysis\nThe primary endpoint was clinical response rate. The secondary endpoints were OS and safety. SPSS 17.0 software was used for data analysis. Survival analysis was performed using the Kaplan–Meier method. Log‐Rank test was used to compare the survival time of patients. Univariate and multivariate Cox regression analysis were carried out to determine the risk factors of OS. χ2 test and Fisher exact test were used to evaluate the difference of clinical response rate and OS between patients with various features. p < 0.05 demonstrated significant difference.\n\nResults\nPatient characteristics\nFifty‐nine patients (male: 27, female: 32, aged 31–72 years, median 55 years) were enrolled in this study. Patients' characteristics were showing in Table 2. The flow chart of the treatment was shown in Supporting Information 2.\n\nTable 2 General information of the patients\n\nCharacteristic\t\nN (%)\t\nGender\t\t\nMale\t27(46%)\t\nFemale\t32(54%)\t\nMedian age\t\t\n<55 yrs\t29 (49%)\t\n≥55 yrs\t30 (51%)\t\nPathological features of the primary disease\t\t\nNSCLC\t32 (54%)\t\nSCLC\t10 (17%)\t\nBreast cancer\t11 (19%)\t\nOthers*\t6 (10%)\t\nNeuroimaging features\t\t\nPositive\t53 (90%)\t\nNegative\t6 (10%)\t\nCSF biochemistry\t\t\nElevation of protein\t44 (75%)\t\nDecrease of glucose\t21 (36%)\t\nNegative\t13 (22%)\t\nCSF cytology\t\t\nPositive\t55 (93%)\t\nNegative\t4 (7%)\t\nOnset as LM\t\t\nYes\t10 (17%)\t\nNo\t49 (83%)\t\nGCS\t\t\n15\t32(54%)\t\n13∼14\t18(31%)\t\n9∼12\t9(15%)\t\nKPS\t\t\n≥ 60\t13 (22%)\t\n< 60\t46 (78%)\t\n≥ 40\t32 (54%)\t\n< 40\t27 (46%)\t\nSevere and multiple neurologic deficits\t\t\nYes\t39 (66%)\t\nNo\t20 (34%)\t\nBulky CNS disease\t\t\nYes\t32 (54%)\t\nNo\t27 (46%)\t\nSystemic disease\t\t\nStable/free\t32 (54%)\t\nActive\t27 (46%)\t\nExtensive systemic disease with few treatment options\t\t\nYes\t15 (25%)\t\nNo\t44 (75%)\t\nEncephalopathy\t\t\nYes\t4 (7%)\t\nNo\t55 (93%)\t\n*Including gastric adenocarcinoma(n = 3), laryngeal squamous cell carcinoma (n = 1), hepatocellular carcinoma (n = 1), and primary cranial malignant melanoma (n = 1). NSCLC: nonsmall‐cell lung cancer; SCLC: small cell lung cancer; CSF: cerebrospinal fluid; KPS: Karnofsky score; GCS: Glasgow coma scale.\n\nAdverse prognostic factors were identified in all patients, including KPS of < 60 (n = 46), severe and multiple neurological deficits (n = 39), encephalopathy (n = 4), extensive systemic disease with few treatment options (n = 15) and bulky brain metastasis (n = 32).\n\nTreatment and efficacy\nTwenty‐nine patients received radiotherapy within 3 days after the first IC. Thirty patients with KPS score of ≤ 40 received induction IC prior to radiotherapy, including 20 (66.7%) received for once, 8 (26.7%) for twice and 2 (6.7%) for thrice, respectively. Three (5.1%) critically ill patients died with no response to the induction IC. Fifty‐six patients received concomitant therapy, among whom 51 (86.4%) accomplished the concomitant therapy, including 4 with temporary cessation (3–10 days) due to severe bone marrow depression (white blood cell number of <1.5 × 1012, or platelet number of <45 × 109) and severe mucous reaction. Five patients (8.5%) quit the treatment after receiving 2–3 weeks of concomitant therapy for personal reasons. Fifty‐one patients (86%) received whole brain radiotherapy. Twenty patients (34%) received partial spinal irradiation, among whom 2 received cervical spinal irradiation and 3 received thoracic spinal irradiation, and 18 received lumbosacral spinal irradiation. Fifteen (25%) received both whole brain irradiation and partial spinal field irradiation. Forty‐two (71%) received supportive treatment.\n\nNeurological remission was generally achieved after the first week of the concomitant therapy, and the clinical response was commonly achieved 2–4 weeks later. The overall clinical response rate was 86.4%, including CR (14, 23.7%), OR (29, 49.1%) and PR (8, 13.6%). Five patients (8.5%) had SD and three (5.1%) had PD. We also evaluated the clinical response rate based on pathological types, and the response rates were 87.5% (28/32) for nonsmall cell lung cancer (NSCLC), 90% (9/10) for small cell lung cancer (SCLC), 72.7% (8/11) for breast cancer and 100% (6/6) for the other tumors. No statistical difference was observed in the response rate of the patients with diverse tumors (p = 0.568, Table 3).\n\nTable 3 Clinical response rate and overall survival of patients with various pathological features\n\n\t\nNSCLC (n = 32)\t\nSCLC (n = 10)\t\nBreast cancer (n = 11)\t\nOthers (n = 6)\t\nCR\t8\t3\t2\t1\t\nOR\t15\t5\t5\t4\t\nPR\t5\t1\t1\t1\t\nSD\t3\t1\t1\t0\t\nPD\t1\t0\t2\t0\t\nEffective\t28\t9\t8\t6\t\nNoneffective\t4\t1\t3\t0\t\nMedian OS (months)\t6.7\t4.5\t5.4\t11\t\nNo statistical difference was observed in the response of the patients with various primaries (p = 0.568). No statistical difference was observed in the survival of the patients with various primaries (p = 0.110).\n\nThirty‐eight patients (64.4%) received further subsequent treatments, including consolidation IC (n = 31; 1–4 times, median 3), maintenance IC (n = 12; 1–9 times, median 4), systemic chemotherapy [n = 15; 1–4 cycles, median 2; the regimens included docetaxel and cisplatin (n = 5), etoposide and cisplatin (n = 4), docetaxel and capecitabine (n = 1), capecitabine (n = 2), pemetrexed and cisplatin (n = 3)] and molecular target therapy using tyrosine kinase inhibitor (n = 3; 1 received Erlonat and 2 received Gefitinib).\n\nImplantation metastases of intra‐spinal canal were observed at month 2–11 in four patients following cranial radiotherapy and concomitant intrathecal MTX. Thus, spinal radiotherapy was performed subsequently. Fifteen patients presented recurrent neurologic symptoms mainly manifested as headache 2–9 months after concomitant therapy and other initial antitumor treatment. Among these patients, 9 received supportive treatment and died in a short time. For the other 6 patients, symptomatic improvement was obtained in 3 patients received further intrathecal MTX and 3 received second‐line IC (cytosine arabinoside, 50 mg, dexamethasone, 5 mg). Particularly, one patient with breast cancer accomplished 8 times of induction, concomitant and consolidation IC, as well as subsequent 8 times of maintenance IC (once per month). Afterward, the patient received IC every 2–3 months to attenuate recurrent headache. Up to now, the patient had received 30 times of IC in total with a survival of up to 36.7 months despite a mild short‐term memory loss and a KPS score of 80.\n\nFollow‐up and outcomes\nAll the patients were followed up for 0.4–36.7 months until July 31, 2015. The median OS was 6.5 months. One‐year survival rate was 21.3%, and two‐year survival rate was 6.1%. Fifty‐three patients were dead. Forty‐eight (90.6%) died from cancer progression, among whom 22 (41.5%) died wholly from LM, 10 (18.6%) wholly from systemic disease. The remaining patients died from delayed treatment‐related neurotoxicity (2, 3.8%) and noncancer diseases (3, 5.7%).\n\nAccording to the criteria of evaluation of clinical response (Table 1), fourteen patients showed CR (OS: 3.5–36.7 months, median: 8.4 months), and OR was noticed in 29 patients (OS: 1.4–17.2 months, median: 6.8 months). PR was noticed in 8 patients (OS: 2.4–13 months, median: 4.9 months). Five patients had SD (OS: 1.5–18.5 months, median: 3.2 months), and three had PD (OS: 0.4–0.6 months, median: 0.4 months). In total, response was observed in 51 patients (OS: 1.4–36.7 months, median: 6.8 months), and SD and PD was observed in 8 patients (OS: 0.4–18.5 months, median: 2.8 months, Table 4). Significant extension in OS was observed in the patients with clinical response (p = 0.009, Table 4). The status of clinical response (CR, OR, PR or noneffective) had significant correlation with the OS (p = 0.006, Table 4). The median OS for the patients with breast cancer, NSCLC, SCLC and others was 5.4 months, 6.7 months, 4.5 months and 9 months, respectively. No statistical difference was observed in the OS of patients with various pathologic types (p = 0.110, Table 3).\n\nTable 4 Clinical response rate and the patients' survival\n\n\t\nN\n\t\nOS (months)\n\t\nMedian OS (months)\n\t\nCR\t14\t3.5–36\t8.4\t\nOR\t29\t1.4–17.2\t6.8\t\nPR\t8\t2.4–13\t4.9\t\nSD\t5\t1.5–18.5\t3.2\t\nPD\t3\t0.4–0.6\t0.4\t\nEffective\t51\t1.5–36.7\t6.8\t\nNoneffective\t8\t0.4–18.5\t2.8\t\nThe clinical response (CR, OR, PR or noneffective) was correlated to the patients' survival (p = 0.006). Significant OS extension was observed in the patients with clinical response to the treatment (p = 0.009).\n\nOn univariate analysis (Supporting Information 3) OS was not influenced by gender (p = 0.331), age (p = 0.324), severe and multiple neurological deficits (p = 0.395), bulky CNS disease (p = 0.800), KPS < 40 (p = 0.997) and KPS <60 (p = 0.309), systemic disease progression (p = 0.288) and primary lung cancer (p = 0.142), and hypoglycorrhachia (p = 0.153), respectively. The cytology was turned to be negative in 15 patients (27%), which showed no protective effects against the OS (p = 0.988). Significant OS benefits were observed in patients with clinical response (p = 0.013), and accomplishing the concomitant therapy (p = 0.016). Besides, extensive systemic disease with few treatment options caused significant adverse effects on the OS (p = 0.009). Multivariate analysis revealed extensive systemic disease with few treatment options (p = 0.005) and primary lung cancer (p = 0.033) were the adverse prognostic factors. In addition, KPS of < 60 (p = 0.107) or severe and multiple neurological deficits (p = 0.110) caused no significant effects on prognosis (Supporting Information 3).\n\nSafety and toxicity\nThe major toxicities and side effects were radiotherapy‐related injuries to skin and mucosa, bone‐marrow depression, MTX‐induced mucosal injuries, lumber radiculitis, as well as acute/chronic neurotoxicity (Table 5). Mild or moderate skin reaction and hair loss occurred in all the patients undergoing brain radiotherapy. In addition, radiotherapy‐related mild and moderate otitis media was observed in 13 patients. Bone marrow depression was mainly occurred at Week 3 and 4 during concomitant therapy, which was manifested as decreased white blood cell count (n = 12) and platelet count (n = 5). Twelve patients (20.3%) showed MTX‐induced mucosal injuries. Among them, five patients received intravenous injection of leucovorin (100 mg, b. i. d.). Eleven patients showed mild or moderate mucosal injuries. Only one patient showed severe mucosal injury (grade IV) manifested as oral mucosal ulcer 2 days after the fourth intrathecal MTX. One week later, this patient showed mucosanguineous stool and mucosal swelling of the perineal region. The symptoms were attenuated after intravenous injection of leucovorin (100 mg, b. i. d.), and gargling with leucovorin (5%) as well as hip‐bath. Sixteen patients with radiculitis mainly presented regional numbness of the gluteal region and lower extremities. Among these patients, 9 with mild symptoms were alleviated spontaneously without interfering quality of life. However, several patients showed moderate (n = 5) and severe radiculitis (n = 2), which persistently affected sleeping and walking. No patient showed lumbar puncture‐induced purulent meningitis.\n\nTable 5 Mainly adverse events\n\n\nVariables\n\t\nN (%)\t\nAcute cerebral meningitis\t1 (2%)\t\nI–II degree\t0\t\nIII–IV degree\t0\t\nV degree\t1 (2%)\t\nChronic encephalopathy\t3 (5%)\t\nI–II degree\t1 (2%)\t\nIII–IV degree\t1 (2%)\t\nV degree\t1 (2%)\t\nRadiculitis\t16 (27%)\t\nI–II degree\t9 (15%)\t\nIII–IV degree\t7 (12%)\t\nV degree\t0\t\nBone marrow depression\t13 (22%)\t\nI–II degree\t5 (8%)\t\nIII–IV degree\t8 (14%)\t\nV degree\t0\t\nMucositis\t12 (20%)\t\nI–II degree\t10 (17%)\t\nIII–IV degree\t2 (3%)\t\nV degree\t0\t\nLeukodystrophy (n = 44)\t30 (68%)\t\nI degree\t15 (50%)\t\nII degree\t7 (23%)\t\nIII degree\t8 (27%)\t\nEncephalopathy\t11(19%)\t\nII–III degree\t9(15%)\t\nIV degree\t1(2%)\t\nV degree\t1(2%)\t\nModerate and severe toxicity\t12 (20%)\t\nTreatment‐related death\t2 (3%)\t\nDeath of adverse events during concurrent therapy\t0\t\nThree patients (5.1%) showed severe neurotoxicity, including 1 with acute neurotoxicity manifested as chemical arachnoiditis and 2 with delayed neurotoxicity manifested as encephalopathy. Among these patients, 2 died finally due to deterioration of neurotoxicity. For the patient with acute neurotoxicity, the symptoms were presented at 5.5 months after concomitant therapy, and were manifested as progressively severe headache accompanied by stiff neck, vomiting, seizure, ablepsia and photophobia. This patient showed remarkable increase in CSF protein (1.41 g/L, normal range 0.15–0.45 g/L). The patient had received 13 times of IC in total, and also received systemic chemotherapy (Docetaxel and cisplatin) during the consolidation and maintenance IC. Brain MRI showed no new lesions or cerebral apoplexy, but showed grade I leukoencephalopathy. For the 2 patients with delayed neurotoxicity, it happened in 6 months and 16 months following concomitant therapy, respectively. Main manifestations were progressive cognitive disorder, mental obtundation, lower motor neuron weakness and dysphagia. Leukoencephalopathy (grade III) was confirmed by neuro‐radiologic examination presenting severe cerebral atrophy, increase in subarachnoid space and other features.\n\nLeukoencephalopathy refers to a type of delayed and chronic neurotoxicity evaluated by neuroimaging examination. As regular cranial MRI was not compulsory in this study, it was hard to precisely evaluate leukoencephalopathy. A total of 44 patients received cranial MRI/CT within 1–24 months after concomitant therapy, 30 of whom showed leukoencephalopathy (Table 5). Besides 3 patients with severe neurotoxicity mentioned above, no significant CNS symptoms were noticed except for mild or moderate encephalopathy (grade II–III) mainly manifested as short‐term memory loss and depression or dullness of mind in 9 patients. Nineteen patients underwent MRI scan over 6 months after concomitant therapy, and all of them were confirmed with leukoencephalopathy.\n\nIn this study, about half the patients showed a Glasgow coma scale of less than 14 upon the diagnosis of LM. As the patients' conditions were severe, it was hard to perform the cognitive evaluation. Due to the absence of baseline, regular cognitive evaluation was not designed. Patients with typically delayed encephalopathy manifested as cognitive disturbance, confusion and other typical symptoms could be ascertained as adverse effects, and minimum mental state examination (MMSE) was performed for the evaluation. Regular MMSE was not designed as the OS of LM patients was too short.\n\nDiscussion\nIn this single‐arm and prospective clinical study, we confirmed IF‐RT combined with concomitant intrathecal MTX could improve the quality of life and neurological symptoms of LM patients from solid tumors with adverse prognostic factors. Meanwhile, the neurotoxicity was not as severe as expected. The median OS and one‐year survival rate was obviously higher than the historical reports. This treatment regimen improved the prognosis of LM patients from solid tumors with adverse prognostic factors for the first time.\n\nLM patients with poor conditions may achieve clinical improvement after IC, however, the neurologic symptoms commonly relapse within a short time.24, 26 Such situation was also proved by our clinical experiences. In this study, concomitant radiotherapy contributed to a long‐term neurologic remission and extension of OS. This regimen provides lots of advantages: (i) MTX is a type of antimetabolic antitumor drug that inhibits the metabolism of folic acid. Cancer cells at S phase and G1/S phase are sensitive to MTX, while those at G1, G2 and M phase are sensitive to irradiation. Thus, radiotherapy and MTX mediate synergistic effects for different phases of the cell cycle. (ii) MTX is also involved in radiosensitizing effect.27 (iii) Radiotherapy is indicated to relieve CSF flow block and reestablish normal CSF, which subsequently improves the diffusion of drugs in CSF and attenuates the neurotoxicity induced by CFS flow blocks and drug accumulation.8, 21, 28 (iv) The simultaneous modality of radiotherapy and IC, rather than the administration of each treatment sequentially, can also shorten the total time of LM‐related treatment. After controlling CNS involvement, systemic therapy could be administered promptly. Thus, it is appropriate for the comprehensive treatment of the patients with active systemic disease.\n\nLM patients from solid tumors showed similar outcomes (median OS is 2–3 months approximately) and clinical features.1 To our knowledge, lots of previous studies enrolled patients with various solid tumors2, 17, 24, 29, 30, 31, 32 despite the prognosis of LM from breast cancer was satisfactory.33 Therefore, patients with different primaries were enrolled in this study. After all, patients with various tumors showed no statistical difference in the clinical response and OS in this study. We concluded that the concomitant therapeutic modality could be effective for LM from various solid tumors.\n\nAlthough induction IT showed no marked impact on the OS and clinical response rate, it was applied to the critical patients to alleviating severe conditions temporarily. Upon short‐term attenuation of symptoms, the concomitant radiotherapy should be performed subsequently. In this study, 3 patients with severe conditions and lower KPS (20 score) died from LM progression even though induction IC had been given. Consequently, whether concomitant therapy could be administered in those with poor conditions is depended on the response to induction IC. In line with the previous studies,24, 34 the response to initial IC is one of the key points for the prognosis of critical LM patients. The patients with neurological remission and improved KPS ordinarily indicate better prognosis.\n\nThe one‐dimensional response evaluation criteria in solid tumors (RECIST) are not appropriate for the evaluation of LM as the neuroimaging features of LM commonly are not measurable at least as defined by current brain tumor response criteria.1 Moreover, a prior autopsy study revealed that changes in MRI findings might not accurately represent the changes in actual degree of leptomeningeal lesion burden.35 To date, CSF cytological clearance rates and symptomatic improvement have been commonly used for clinical evaluation.17, 29, 36, 37 However, the presence or absence of CSF cytology did not appear to influence survival.25 Besides, false negative testing of CSF cytology is common. Indeed, our study revealed that CSF cytological clearance showed no correlation with either clinical response rate (p = 0.423) or OS (p = 0.988). Thus, CSF cytology may not be a suitable choice for the evaluation. Previously, changes of neurologic symptoms/signs were solely used to assess the clinical response.38 The clinical evaluation based on changes of neurologic symptoms/signs was performed every 2 weeks or before each cycle of therapy in several studies.26, 29, 31 Transient neurological symptoms related with supportive treatment or AEs might be misconstrued as clinical improvement or progression. Thus, it should be necessary to define a span of time to identify the effectiveness of treatment. In one study, it was defined that clinical status persisting >4 weeks could serve as a criterion of evaluation.26 Considering the survival of LM patients with adverse prognostic factors was extremely short, continuous CR, OR or PR for two times of evaluation within an interval for at least 1 week was set as a criterion for effectiveness in this study. Data analysis revealed the clinical response (CR, OR, PR or noneffective) was correlated with the patients' survival (p = 0.006, Table 4), which indicated this method was effective for the evaluation of prognosis.\n\nRecurrence was inevitable even though presence of CSF cytological clearance, as it was difficult to eradicate the tumor cells in CSF thoroughly. According to the NCCN guidelines, maintenance IC was mostly recommended to the clinically stable patients. The patients received maintenance IC usually showed stable disease or longer expected survival that caused absence of randomness in this study. However, maintenance IC was still effective in improving neurologic symptoms of the patients with recurrent disease following the concurrent therapy. Of note, all of 3 patients with severe neurotoxicity (grade IV–V) received many times of IC (12–13 times) and concomitant systemic therapy with consolidation/maintenance IC during the subsequent treatment. Thus, for the patients with active systemic disease and needed systemic therapy, it should be deliberated to decide whether simultaneous systemic therapy should be given during the regimen of IC.\n\nTo date, the efficacy of systemic therapy for LM from solid tumors is uncertain. Blood–brain and blood–CSF barriers limit penetration of most systemically administered anticancer agents into CNS. Thus, CSF exposure to most cytotoxic agents is <5% of the plasma concentration, and it is rarely used for the primary treatment of LM.1 Furthermore, it has been reported that systemic chemotherapy provided no additional benefits over the combination of IC and radiotherapy.39 Nevertheless, most LM patients showed active systemic disease that was considered as the main cause of death.5 For these patients, systemic therapy was necessary.40, 41, 42, 43, 44 However, partial patients showed poor tolerance to systemic therapy due to low KPS and fatal CNS involvement. Thus, it is crucial to select an appropriate time for the systemic therapy. In a previous study, Park et al. 40 suggested further systemic therapy (chemotherapy or target therapy) after IC conferred survival benefits. In this study, the regimen shortened the total time of LM‐related treatment. After controlling CNS involvement, systemic chemotherapy could be given to the patients with active systemic disease promptly. Despite no obvious survival benefits in the patients received systemic therapy (p = 0.296), active systemic disease showed no influence on OS either (p = 0.288). However, extensive systemic disease with few treatment options was an adverse prognostic factor (p = 0.006). It seemed that systemic therapy improved the prognosis of the LM patients with active systemic disease. However, it was hard to confirm whether systemic therapy could cause benefits to the CNS dissemination.\n\nIn line with the previous studies,4, 5multivariate analysis revealed lung cancer was a risk factor for poor prognosis (p = 0.033), which might be attributed to the poor prognosis of SCLC patients (mean OS: 4.5 months). According to the univariate analysis, the survival of SCLC patients was inferior to NSCLC (p = 0.082). Moreover, the clinical response rate of SCLC patients was up to 90%, however, half of them (50%) died from progressive systemic disease in a short time. Above all, as a risk factor, lung cancer might be related with the progression of the systemic disease rather than invalidness for the regimen of the concurrent therapy. Based on the multivariate and univariate analysis, the prognosis is worse for those with systemic disease progression with few treatment options. Despite no benefits in the OS in these patients following concomitant therapy, significant improvement was noticed in their neurologic function and quality of life.\n\nIt was difficult to ascertain a time span for MRI examination as the survival time of LM patients with poor prognostic factors was extremely short. Therefore, regular MRI was not compulsory in this study. A total of 44 patients received cranial MRI scan after concomitant therapy, among whom a higher incidence (68%) of leukoencephalopathy was noticed. Consistent with the previous studies,23, 45, 46 most of the patients with leukoencephalopathy were asymptomatic, and mainly presented in patients aged < 60 years or received high dose chemotherapy. In this study, leukoencephalopathy was mainly observed in the patients with survival time of ≥6 months. Thus, the incidence of leukoencephalopathy was inclined to increase in patients with longer survival, but severe neurological deficit was seldom observed.\n\nIndeed, there were limitations in this study. The concurrent therapy was designed as the mainstay of this study, and classical regimen of IC (including induction IC, consolidation IC and maintenance IC) was not compulsory. Thus, patients received various cycles of IC, which might affect the outcomes slightly. Additionally, LM is a lethal complication of malignancy. The design of clinical trial and the patients' prognosis could be affected by many aspects, such as general status of patients, status of extra‐CNS disease and other anticancer treatment. The subsequent therapy, including consolidation/maintenance IC or systemic therapy, might have potential influence on the outcomes, especially the delayed neurotoxicity and patients' survival. Furthermore, LM patients usually present with pleomorphic and subtle neurological signs affecting the CNS, and sometimes it is difficult to differentiate from those caused by the adverse effects of cancer treatment.1 Thus, it was hard to evaluate the treatment related neurotoxicity (e.g., cognitive disturbance) precisely. In this study, approximately half the patients showed a Glasgow coma scale of less than 14 upon the diagnosis of LM. Due to severe conditions of these patients, it was hard to perform the cognitive evaluation before treatment. Because of the absence of baseline, regularly cognitive evaluation was not designed in this study. Despite the inevitable limitations, the patients received comprehensive treatment based on the concurrent therapy as a mainstay achieved higher clinical response rate and obvious survival benefit than histological reports.\n\nIn conclusion, this study provides important information about the regimen of the concurrent therapy with significant efficacy and acceptable toxicity that may serve as an optimal therapeutic option for treatment of LM from solid tumors with adverse prognostic factors. The evaluation criteria based on the neurologic improvement and KPS changes are appropriate for the response assessment of LM‐related treatment.\n\nSupporting information\nSupporting Information\n\nClick here for additional data file.\n==== Refs\nReferences\n1 \n\nLe Rhun \nE \n, \n\nTaillibert \nS \n, \n\nChamberlain \nMC. \n\nCarcinomatous meningitis: leptomeningeal metastases in solid tumors . Surg Neurol Int \n2013 ; 4 :S265 \n23717798 \n2 \n\nChamberlain \nMC. \n\nCombined‐modality treatment of leptomeningeal gliomatosis . Neurosurgery \n2003 ; 52 :324 –30 .\n12535360 \n3 \n\nChamberlain \nMC \n, \n\nTsao‐Wei \nD \n, \n\nGroshen \nS. \n\nNeoplastic meningitis‐related encephalopathy prognostic significance . Neurology \n2004 ; 63 :2159 –61 .\n15596770 \n4 \n\nChamberlain \nMC \n, \n\nGlantz \nM \n, \n\nGroves \nMD \n, et al. Diagnostic tools for neoplastic meningitis: detecting disease, identifying patient risk, and determining benefit of treatment . Semin Oncol \n2009 ; 36 :S35 –45 .\n19660682 \n5 \n\nTaillibert \nS \n, \n\nLaigle‐Donadey \nF \n, \n\nChodkiewicz \nC \n, et al. Leptomeningeal metastases from solid malignancy: a review . J Neurooncol \n2005 ; 75 :85 –99 .\n16215819 \n6 \n\nChamberlain \nMC \n, \n\nJohnston \nSK \n, \n\nGlantz \nMJ. \n\nNeoplastic meningitis‐related prognostic significance of the Karnofsky performance status . Arch Neurol \n2009 ; 66 :74 –8 .\n19139302 \n7 \n\nBrem \nSS \n, \n\nBierman \nPJ \n, \n\nBlack \nP \n, et al. Central nervous system cancers: clinical practice guidelines in oncology . J Natl Compr Canc Netw \n2005 ; 3 :644 –90 .\n16194456 \n8 \n\nChamberlain \nMC \n, \n\nKormanik \nPA. \n\nPrognostic significance of 111indium‐DTPA CSF flow studies in leptomeningeal metastases . Neurology \n1996 ; 46 :1674 –7 .\n8649568 \n9 \n\nChamberlain \nMC \n, \n\nKormanik \nPA. \n\nPrognostic significance of coexistent bulky metastatic central nervous system disease in patients with leptomeningeal metastases . Arch Neurol \n1997 ; 54 :1364 –8 .\n9362983 \n10 \n\nChamberlain \nM. \n\nLeptomeningeal metastases: a review of evaluation and treatment . J Neuro oncol \n1998 ; 37 :271 –84 .\n\n11 \n\nGani \nC \n, \n\nMüller \nA‐C \n, \n\nEckert \nF \n, et al. Outcome after whole brain radiotherapy alone in intracranial leptomeningeal carcinomatosis from solid tumors . Strahlenther Onkol \n2012 ; 188 :148 –53 .\n22231633 \n12 \n\nMorris \nPG \n, \n\nReiner \nAS \n, \n\nSzenberg \nOR \n, et al. Leptomeningeal metastasis from non‐small cell lung cancer: survival and the impact of whole brain radiotherapy . J Thorac Oncol \n2012 ; 7 :382 –5 .\n22089116 \n13 \n\nClarke \nJL \n, \n\nPerez \nHR \n, \n\nJacks \nLM \n, et al. Leptomeningeal metastases in the MRI era . Neurology \n2010 ; 74 :1449 –54 .\n20439847 \n14 \n\nChamberlain \nM \n, \n\nSoffietti \nR \n, \n\nRaizer \nJ \n, et al. Leptomeningeal metastasis: a response assessment in neuro‐oncology critical review of endpoints and response criteria of published randomized clinical trials . Neuro‐Oncology \n2014 ; 16 :1176 –85 .\n24867803 \n15 \n\nGlantz \nMJ \n, \n\nLaFollette \nS \n, \n\nJaeckle \nK \n, et al. Randomized trial of a slow‐ release versus a standard formulation of cytarabine for the intrathecal treatment of lymphomatous meningitis . J Clin Oncol \n1999 ; 17 :3110 –6 .\n10506606 \n16 \n\nCole \nBF1 \n, \n\nGlantz \nMJ \n, \n\nJaeckle \nKA \n, et al. Quality‐of‐life‐adjusted survival comparison of sustained‐release cytosine arabinoside versus intrathecal methotrexate for treatment of solid tumor neoplastic meningitis . Cancer \n2003 ; 97 :3053 –60 .\n12784341 \n17 \n\nGlantz \nMJ \n, \n\nJaeckle \nKA \n, \n\nChamberlain \nMC \n, et al. A randomized controlled trial comparing intrathecal sustained‐release cytarabine (DepoCyt) to intrathecal methotrexate in patients with neoplastic meningitis from solid tumors . Clin Cancer Res \n1999 ; 5 :3394 –402 .\n10589750 \n18 \n\nGroves \nMD. \n\nLeptomeningeal metastasis: still a challenge . ASCO Educational Book \n2008 \n80 –87 .\n\n19 \n\nChamberlain \nMC. \n\nNeoplastic meningitis . J Clin Oncol \n2005 ; 23 :3605 –13 .\n15908671 \n20 \n\nBlasberg \nRG \n, \n\nPatlak \nC \n, \n\nFenstermacher \nJD. \n\nIntrathecal chemotherapy: brain tissue profiles after ventriculocisternal perfusion . J Pharmacol Exp Ther \n1975 ; 195 :73 –83 .\n810575 \n21 \n\nChamberlain \nMC \n, \n\nKormanik \nP \n, \n\nJaeckle \nKA \n, et al. 111Indium‐diethylenetriamine pentaacetic acid CSF flow studies predict distribution of intrathecally administered chemotherapy and outcome in patients with leptomeningeal metastases . Neurology \n1999 ; 52 :214 .\n\n22 \n\nNovak \nLJ. \n\nRadiotherapy of the central nervous system in acute leukemia . Hematol Oncol \n1989 ; 11 :87 –104 .\n\n23 \n\nBleyer \nWA. \n\nCurrent status of intrathecal chemotherapy for human meningeal neoplasms . Natl Cancer Inst Monogr \n1977 ; 46 :171 –8 .\n580638 \n24 \n\nHitchins \nRN \n, \n\nBell \nDR \n, \n\nWoods \nRL \n, et al. A prospective randomized trial of single‐agent versus combination chemotherapy in meningeal carcinomatosis . J Clin Oncol \n1987 ; 5 :1655 –62 .\n3309199 \n25 \n\nChamberlain \nMC \n, \n\nSK \nJ. \n\nNeoplastic meningitis: survival as a function of cerebrospinal fluid cytology . Cancer \n2009 ; 115 :1941 –6 .\n19235827 \n26 \n\nVedrine \nL \n, \n\nArtru \nP \n, \n\nTournigand \nC \n, et al. Meningeal carcinomatosis in gastric cancer . Gastroenterol Clin Biol \n2001 ; 25 :422 –4 .\n11449130 \n27 \n\nKim \nA \n, \n\nLee \nJ‐E \n, \n\nJang \nW‐S \n, et al. A combination of methotrexate and irradiation promotes cell death in NK/T‐cell lymphoma cells via down‐regulation of NF‐κB signaling . Leuk Res \n2012 ; 36 :350 –57 .\n21893341 \n28 \n\nWasserstrom \nWR \n, \n\nGlass \nJP \n, \n\nPosner \nJB. \n\nDiagnosis and treatment of leptomeningeal metastases from solid tumors: experience with 90 patients . Cancer \n1982 ; 49 :759 –72 .\n6895713 \n29 \n\nGrossman \nSA \n, \n\nFinkelstein \nDM \n, \n\nRuckdeschel \nJC \n, et al. Randomized prospective comparison of intraventricular methotrexate and thiotepa in patients with previously untreated neoplastic meningitis . J Clin Oncol \n1993 ; 11 :561 –9 .\n8445432 \n30 \n\nShapiro \nWR \n, \n\nSchmid \nM \n, \n\nGlantz \nM \n, et al. A randomized phase III/IV study to determine benefit and safety of cytarabine liposome injection for treatment of neoplastic meningitis . J Clin Oncol \n2006 ; 24 :1528s \n\n31 \n\nGroves \nMD \n, \n\nGlantz \nMJ \n, \n\nChamberlain \nMC \n, et al. A multicenter phase II trial of intrathecal topotecan in patients with meningeal malignancies . Neuro‐Oncology \n2008 ; 10 :208 –15 .\n18316473 \n32 \n\nChamberlain \nMC \n, \n\nWei‐Tao \nDD \n, \n\nGroshen \nS. \n\nA phase 2 trial of intra‐CSF etoposide in the treatment of neoplastic meningitis . Cancer \n2006 ; 106 :2021 –7 .\n16583432 \n33 \n\nScott \nBJ \n, \n\nOberheim‐Bush \nNA \n, \n\nKesari \nS. \n\nLeptomeningeal metastasis in breast cancer—a systematic review . Oncotarget \n2016 ; 7 : 3740 –47 .\n26543235 \n34 \n\nSause \nWT \n, \n\nCrowley \nJ \n, \n\nEyre \nHJ \n, et al. Whole brain irradiation and intrathecal methotrexate in the treatment of solid tumor leptomeningeal metastases—a southwest oncology group study . J Neurooncol \n1988 ; 6 :107 –12 .\n3225633 \n35 \n\nBussani \nR \n, \n\nCova \nM \n, \n\nPozzi‐Mucelli \nR \n, et al. Extensive metastatic leptomeningeal melanomatosis as the first clinical sign of a cutaneous melanoma: morphological correlations between magnetic resonance imaging and autopsy findings. A case report . Hum Pathol \n2003 ; 34 :625 –8 .\n12827619 \n36 \n\nJackman \nDM \n, \n\nCioffredi \nLA \n, \n\nJacobs \nL \n, et al. A phase I trial of high dose gefitinib for patients with leptomeningeal metastases from non‐small cell lung cancer . Oncotarget \n2015 ; 6 :4527 –36 .\n25784657 \n37 \n\nScott \nBJ \n, \n\nvan Vugt \nVA \n, \n\nRush \nT \n, et al. Concurrent intrathecal methotrexate and liposomal cytarabine for leptomeningeal metastasis from solid tumors: a retrospective cohort study . J Neurooncol \n2014 ; 119 :361 –8 .\n24942463 \n38 \n\nBoogerd \nW \n, \n\nvan den Bent \nMJ \n, et al. The relevance of intraventricular chemotherapy for leptomeningeal metastasis in breast cancer: a randomized study . Eur J Cancer \n2004 ; 40 :2726 –33 .\n15571954 \n39 \n\nChamberlain \nMC \n, \n\nKormanik \nP. \n\nCarcinoma meningitis secondary to non‐small cell lung cancer: combined modality therapy . Arch Neurol \n1998 ; 55 :506 –12 .\n9561978 \n40 \n\nPark \nJH \n, \n\nKim \nYJ \n, \n\nLee \nJ‐O \n, et al. Clinical outcomes of leptomeningeal metastasis in patients with non‐small cell lung cancer in the modern chemotherapy era . Lung Cancer \n2012 ; 76 :387 –92 .\n22186628 \n41 \n\nBoogerd \nW \n, \n\nHart \nAAM \n, \n\nvan der Sande \nJJ \n, et al. Meningeal carcinomatosis in breast cancer. Prognostic factors and influence of treatment . Cancer \n1991 ; 67 :1685 –95 .\n2001559 \n42 \n\nFizazi \nK \n, \n\nAsselain \nB \n, \n\nVincent‐Salomon \nA \n, et al. Meningeal carcinomatosis in patients with breast carcinoma: clinical features, prognostic factors, and results of a high‐dose intrathecal methotrexate regimen . Cancer \n1996 ; 77 :1315 –23 .\n8608509 \n43 \n\nGrant \nR \n, \n\nNaylor \nB \n, \n\nGreenberg \nHS \n, et al. Clinical outcome in aggressively treated meningeal carcinomatosis . Arch Neurol \n1994 ; 51 :457 –61 .\n8179494 \n44 \n\nSiegal \nT \n, \n\nLossos \nA \n, \n\nPfeffer \nMR. \n\nLeptomeningeal metastases analysis of 31 patients with sustained off‐therapy response following combined‐modality therapy . Neurology \n1994 ; 44 :1463 –3 .\n8058150 \n45 \n\nKerr \nJZ \n, \n\nBerg \nS \n, \n\nBlaney \nSM. \n\nIntrathecal chemotherapy . Crit Rev Oncol Hematol \n2001 ; 37 :227 –36 .\n11248578 \n46 \n\nKim \nJY \n, \n\nKim \nST \n, \n\nNam \nD‐H \n, et al. Leukoencephalopathy and disseminated necrotizing leukoencephalopathy following intrathecal methotrexate chemotherapy and radiation therapy for central nerve system lymphoma or leukemia . J Korean Neurosurg Soc \n2011 ; 50 :304 –10 .\n22200011\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "0020-7136",
"issue": "139(8)",
"journal": "International journal of cancer",
"keywords": "central nervous system; intrathecal chemotherapy; leptomeningeal metastasis; metastasis; radiation therapy; solid tumor",
"medline_ta": "Int J Cancer",
"mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D001943:Breast Neoplasms; D059248:Chemoradiotherapy; D003907:Dexamethasone; D005260:Female; D006801:Humans; D007278:Injections, Spinal; D008175:Lung Neoplasms; D008297:Male; D008577:Meningeal Neoplasms; D008727:Methotrexate; D008875:Middle Aged; D016896:Treatment Outcome",
"nlm_unique_id": "0042124",
"other_id": null,
"pages": "1864-72",
"pmc": null,
"pmid": "27243238",
"pubdate": "2016-10-15",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article",
"references": "3225633;15571954;24867803;580638;3309199;24942463;22231633;8608509;8445432;22089116;19139302;8649568;8058150;16583432;6895713;12827619;22200011;9561978;11449130;9524085;16215819;8179494;19235827;12535360;2001559;12784341;22186628;25784657;10506606;21893341;20439847;15908671;19660682;9921888;11248578;2653079;810575;10589750;26543235;16194456;23717798;18316473;15596770;9362983",
"title": "Concurrent radiotherapy and intrathecal methotrexate for treating leptomeningeal metastasis from solid tumors with adverse prognostic factors: A prospective and single-arm study.",
"title_normalized": "concurrent radiotherapy and intrathecal methotrexate for treating leptomeningeal metastasis from solid tumors with adverse prognostic factors a prospective and single arm study"
} | [
{
"companynumb": "CN-MYLANLABS-2015M1035132",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nPlanning dental extractions for Taiwanese patients on antithrombotic therapy remains controversial. This study aimed to examine management of dental extraction in patients on warfarin and antiplatelet therapy.\n\n\nMETHODS\nSubjects comprised 1331 patients, with (1) 60 on warfarin with intentional normalized ratio (INR) below 4.0 (warfarin continued: 28 patients/33 occasions; warfarin stopped and switched to heparin under hospitalization: 32 patients/37 occasions); (2) 183 on antiplatelet therapy (aspirin: 125 patients/185 occasions; clopidogrel: 42 patients/65 occasions; dual therapy: 16 patients/24 occasions); and (3) a control group of 1088 patients/1472 occasions without any antithrombotic therapy. The patient's clinico-demographic parameters, warfarin effectiveness (dose and INR levels) and antiplatelet therapy, number and type of dental extraction and incidence of postoperative bleeding were investigated.\n\n\nRESULTS\nIncidence of postoperative bleeding in the warfarinized group (warfarin continued: 9.1%; warfarin stopped: 8.1%) was higher than in the antiplatelet group (aspirin: 1.1%; clopidogrel: 3.1%; dual antiplatelet: 4.2%), and the control group (0.7%), but these differences were not significant and unrelated to INR or number and type of dental extraction. Postoperative hemorrhage was managed successfully by repacking with Gelfoam impregnated with tranexamic acid powder in most patients.\n\n\nCONCLUSIONS\nThe study indicated that there is no need to interrupt warfarin (INR<4.0) and antiplatelet therapy before dental extractions in Taiwanese patients. A sufficient hemostasis could be obtained using local measures. This approach can save these individuals from becoming exposed to the risk of thromboembolism and the inconvenience of bridging anticoagulation with heparin.",
"affiliations": "Oral Pathology and Family Dentistry Section, Department of Dentistry, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung, Taiwan. Electronic address: jasminelu@adm.cgmh.org.tw.;Oral Pathology and Family Dentistry Section, Department of Dentistry, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung, Taiwan.;Oral Pathology and Family Dentistry Section, Department of Dentistry, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung, Taiwan.",
"authors": "Lu|Shin-Yu|SY|;Lin|Liang-Ho|LH|;Hsue|Shui-Sang|SS|",
"chemical_list": "D000925:Anticoagulants; D010975:Platelet Aggregation Inhibitors; D014859:Warfarin; D014148:Tranexamic Acid; D000077144:Clopidogrel; D001241:Aspirin",
"country": "Singapore",
"delete": false,
"doi": "10.1016/j.jfma.2018.08.019",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0929-6646",
"issue": "117(11)",
"journal": "Journal of the Formosan Medical Association = Taiwan yi zhi",
"keywords": "Aspirin; Clopidogrel; Dental extractions; Warfarin",
"medline_ta": "J Formos Med Assoc",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000925:Anticoagulants; D001241:Aspirin; D002648:Child; D000077144:Clopidogrel; D005260:Female; D006801:Humans; D015994:Incidence; D019934:International Normalized Ratio; D008297:Male; D008875:Middle Aged; D010975:Platelet Aggregation Inhibitors; D019106:Postoperative Hemorrhage; D013624:Taiwan; D014081:Tooth Extraction; D014148:Tranexamic Acid; D014859:Warfarin; D055815:Young Adult",
"nlm_unique_id": "9214933",
"other_id": null,
"pages": "979-986",
"pmc": null,
"pmid": "30195969",
"pubdate": "2018-11",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Management of dental extractions in patients on warfarin and antiplatelet therapy.",
"title_normalized": "management of dental extractions in patients on warfarin and antiplatelet therapy"
} | [
{
"companynumb": "TW-INGENUS PHARMACEUTICALS NJ, LLC-ING201809-000963",
"fulfillexpeditecriteria": "1",
"occurcountry": "TW",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ASPIRIN\\CARISOPRODOL\\CODEINE PHOSPHAT... |
{
"abstract": "Kratom is an herbal compound that has been used as a recreational drug though is not regulated by the Food and Drug Administration. We report a 19-year-old male with recurrent seizures that developed during daily Kratom abuse as a self-treatment for anxiety. Following recurrent focal impaired awareness seizures in addition to generalized tonic-clonic seizures, he was begun on anti-seizure drugs. Seizures subsided after completing rehabilitation. Brain MRI at 29 months revealed bilaterally symmetric T1-hyperintensity in globus pallidus, subthalamic nuclei, and cerebral peduncles. Our case suggests Kratom abuse may be associated with structural brain lesions on MRI and symptomatic focal epilepsy.",
"affiliations": "Department of Neurology, United States.;Department of Neurologic Surgery, Mayo Clinic, Jacksonville, Florida, United States.;Department of Neurology, United States.;Department of Neurology, United States.",
"authors": "Tatum|William O|WO|;Hasan|Tasneem F|TF|;Coonan|Erin E|EE|;Smelick|Christopher P|CP|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.ebcr.2018.04.002",
"fulltext": "\n==== Front\nEpilepsy Behav Case RepEpilepsy Behav Case RepEpilepsy & Behavior Case Reports2213-3232Elsevier S2213-3232(18)30030-610.1016/j.ebcr.2018.04.002ArticleRecurrent seizures from chronic kratom use, an atypical herbal opioid☆ Tatum William O. tatum.william@mayo.edua⁎Hasan Tasneem F. bCoonan Erin E. aSmelick Christopher P. aa Department of Neurology, United Statesb Department of Neurologic Surgery, Mayo Clinic, Jacksonville, Florida, United States⁎ Corresponding author at: FACNS, Department of Neurology, Mayo Clinic, Cannaday, 2 East. 4500 San Pablo Road, Jacksonville, Florida, 32224, United States. tatum.william@mayo.edu17 4 2018 2018 17 4 2018 10 18 20 15 3 2018 28 3 2018 4 4 2018 © 2018 The Authors2018This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Kratom is an herbal compound that has been used as a recreational drug though is not regulated by the Food and Drug Administration. We report a 19-year-old male with recurrent seizures that developed during daily Kratom abuse as a self-treatment for anxiety. Following recurrent focal impaired awareness seizures in addition to generalized tonic–clonic seizures, he was begun on anti-seizure drugs. Seizures subsided after completing rehabilitation. Brain MRI at 29 months revealed bilaterally symmetric T1-hyperintensity in globus pallidus, subthalamic nuclei, and cerebral peduncles. Our case suggests Kratom abuse may be associated with structural brain lesions on MRI and symptomatic focal epilepsy.\n\nHighlights\n• Kratom has become a popular recreational drug in the West.\n\n• Kratom works as a stimulant but at high doses it has sedative/anti-nociceptive effects.\n\n• Kratom abuse may be associated with structural brain lesions on MRI.\n\n• No standard methods exist to detect Kratom or its metabolites on drug screening.\n\n\n\nAbbreviations\nASD, anti-seizure drugsDEA, Drug and Enforcement AdministrationFDA, Food and Drug AdministrationGTC, generalized tonic–clonicKeywords\nKratomAbuseEpilepsyMRIDependencyOpioid\n==== Body\n1 Introduction\nKratom is an herbal supplement (leaves of extracts(s) of the Mitragyna speciosa tree in the coffee family) that originated in Southeast Asia where it is chewed or ingested as a tea to either give energy or curb anxiety. In small doses, Kratom works as a stimulant, but in higher-doses it has sedative and anti-nociceptive effects [1]. Oftentimes, supplements are taken to fortify or maintain health and are believed to be innocuous [2]. There is evidence that most supplements do not prevent disease or death, and their use is not justified when they have no clear benefit because they could be harmful [3]. Since the 1990s, Kratom has become a popular recreational drug in the West. This is largely due to migration of people from Asia to the U.S. and from the dissemination of information through internet marketing [4]. Its true prevalence of usage has remained unclear due to limited reports. In 2016, several million consumers were reported purchasing Kratom from greater than 10,000 retail locations in the U.S. with an estimated annual market of 207 million dollars [5]. Anecdotal reports have included side effects such as seizure, hypothyroidism, hepatotoxicity, and coma [1], [6], [7], [8]. In a case report, Kratom has shown to produce reversible injury to the posterior white matter of the brain [9]. We report a patient with chronic monotherapy Kratom use who developed focal epilepsy.\n\n2 Case report\nA 19-year-old right-handed Caucasian male with anxiety was without risks factors for epilepsy. He was evaluated after experiencing a first seizure. He was initially found down at school, in the bathroom with post-event confusion and was suspected to have experienced an unwitnessed generalized tonic–clonic (GTC) seizure. He was concurrently being treated with intermittent lisdexamfetamine dimesylate usage for attention deficit hyperactivity disorder. A brain MRI performed shortly after the first seizure was reported to reveal no focal abnormalities. A complete metabolic profile, blood count, urine drug screen, and electroencephalogram were within normal limits. He was not treated with anti-seizure drugs (ASDs).\n\nOne year later, the patent experienced a second seizure characterized by awakening from sleep in a transient “dream-like reverie state,” with generalized muscle soreness and tongue laceration. At this time, the patient admitted to excessive use of Kratom (several pills per day) for several months to self-treat anxiety. Typically, Kratom dosage can vary between 2 to 8 g, producing stimulant to sedative effects, respectively. Further, ASDs were not administered for a suspected provoked seizure.\n\nAfter a third focal seizure, he was prescribed levetiracetam (LEV), 500 mg twice daily. Despite treatment, a witnessed focal to bilateral GTC seizure occurred 21 months after the first event, despite taking LEV. The event was initially described as “blacking out” with disorientation and lip smacking prior to the GTC seizure. At this time, the patient admitted to continued use of Kratom. A urine drug screen returned negative. Lisdexamfetamine dimesylate and intermittent use of alprazolam had been discontinued, but he continued taking Kratom as an affordable and available means of alleviating anxiety and providing him with energy. After his fifth GTC seizure, he admitted to being non-compliant with LEV due to changes in mood and was switched to lamotrigine for its mood stabilizing effects.\n\nThe sixth GTC seizure resulted in a motor vehicle accident. In addition to Kratom use, he then admitted to intermittent use of marijuana (once weekly), lisdexamfetamine dimesylate use (3 times weekly), rare alprazolam use (monthly), and intermittent alcohol consumption (4 drinks weekly). He followed up with Psychiatry and due to chronic Kratom abuse was recommended to drug rehabilitation.\n\nAfter switching to lamotrigine and discontinuing Kratom the patient was seizure-free. Nonetheless, breakthrough seizures were noted when a relapse of Kratom abuse occurred. A brain MRI performed 29 months after the initial seizure revealed bilateral symmetric T1 hyperintensity in the diencephalon including the globus pallidus, subthalamic nuclei, and portions of the cerebral peduncles (Fig. 1). Repeat metabolic profiles were within normal limits. After successful completion of a substance abuse rehabilitation program, no further seizures were reported on lamotrigine. A follow-up brain MRI was sought to visualize if structural brain abnormalities had subsided since discontinuation of Kratom, but the patient was lost to follow-up when insurance changed.Fig. 1 A. Brain MRI, transverse T1-weighted demonstrating normal imaging after first seizure event; B. Brain MRI, 3-T high-resolution, 29 months after initial seizure event demonstrating increased signal in the globus pallidus bilaterally during chronic Kratom use.\n\nFig. 1\n\n3 Discussion\nHerbal supplements are used for their perceived benefits without much consideration given to harmful properties. They are used globally and the prevalence of usage continues to rise. Like patients abusing illicit drugs, our patient abusing Kratom benefited from detoxification at a supervised facility with trained medical professionals to monitor and provide medical support during the process. Kratom use in the U.S. has received limited attention yet the active ingredients are alkaloid substances called mitragynine and 7-hydroxymitragynine, and are mediated via the monoaminergic and opioid (mu- and kappa-) receptors [10]. These mechanisms of action are similar to opioids partly due to its molecular structure referred to as biased agonist [4]. Given the current worldwide opioid analgesic crisis and potential for misuse, abuse, and dependence, Kratom may be subject to recreational abuse.\n\nThere are a number of herbal supplements that are associated with seizures including Black cohosh [11], Bearberry [12], Ma Huang [13], kava-kava [12], Yohimbe [14], and Monkshood [12]. On the other hand, herbal supplements have had putative anti-seizure effects, though the lack of evidence precludes this conclusion [15]. For example, exogenous cannabinoids can mimic the endogenous system and may have a role in reducing seizure frequency or protect against neurodegeneration [16]. Devinsky et al. performed an open-label trial in patients between ages 1–30 with severe, drug-resistant childhood-onset seizures [17]. Oral cannabidiol 2–5 mg/kg/day and titrated to a maximum tolerated dose of 25 mg/kg or 50 mg/kg/day (depending on the center) reduced seizure frequency and was safe in children and young adults, though randomized controlled trials like the trial of cannabindiol in Dravet's syndrome [18] are necessary to validate these findings in adults with focal seizures.\n\nBetween 1983 and 1989, National Poisons Unit in London reported 5131 inquiries. Of these, 968 were related to herbal supplements, and of which, 245 (25%) were symptomatic [12]. Side effects arising from herbal supplements may be due to various reasons, such as, misidentifying the plant species, overlooking the toxicity of the plant, variability in the chemical constituents of the herb, adulteration, incorrect dosing, and differing potency depending on the conditions in which the plant was grown [19].\n\nCurrently, no standard methods exist to detect Kratom or its metabolites on drug screening after ingestion and this is a contributing factor to its abuse potential. Like our patient, this also complicates the clinical scenario for the treating physician and delays management [10]. Evidence also suggests high rates of dependency, development of withdrawal symptoms, and craving among chronic users [20]. In one study, more than half of regular Kratom users (> 6 months) developed severe withdrawal symptoms while 45% demonstrated moderate dependency [20]. Consequently, withdrawal symptoms tend to worsen with chronic use. In a retrospective review in Thailand, 52 Kratom cases were identified of which 76.9% resulted in Kratom poisoning and 23.1% were due to withdrawal [21]. Symptoms commonly reported were palpitations in 22.5% and seizures in 17.5%. An infant born to a chronic Kratom-abusing mother within this cohort experienced withdrawal symptoms and emphasized the role of transplacental transmission [21]. Currently, no specific treatment regimens for Kratom withdrawal or addiction exist.\n\nIncreasing Kratom abuse in the U.S. has created disputes regarding public safety. In parallel to the opioid crisis, the U.S. Drug and Enforcement Administration (DEA) listed Kratom as a “Drug of Concern” in 2008 [22]. Several states have banned the sale of Kratom [5]. In 2016, the DEA announced temporary placement of Kratom into a Schedule I category governed by the Controlled Substances Act [22]. However, public rebuttals, a bipartisan response from the U.S. congress, and arguments made by the American Kratom Association resulted in the DEA to withdraw its proposition [4]. Consequently, the DEA, with input from the Food and Drug Administration (FDA) and National Institute on Drug Abuse undertook a full abuse potential assessment of Kratom use to develop regulatory recommendations [5]. The conclusion was Kratom did not appear to be of a public health threat and emergency scheduling of this supplement or any of its specific alkaloids was considered insignificant [4]. Additionally, it was suggested that those individuals who consume Kratom for reasons other than recreational use may resort to illicit unregulated Kratom venders, thus exposing them to additional risk [4]. Since the banning of its importation by the FDA, its availability has flown under the radar and has increased. It is now being sold in powder and tablet form at tobacco stores, and marketed in shops, purchased online, or mixed into drinks.\n\n4 Conclusion\nWe associate structural brain abnormality on MRI and symptomatic focal epilepsy with chronic Kratom abuse during initial use and again during relapse. Thus far, complications from Kratom abuse have received limited attention and untoward behavioral dependence and complications have been largely anecdotal. Kratom abuse is likely to increase due to market globalization and readily available internet-driven supply chains, in addition to the relative safety of Kratom being endorsed as a “natural” herbal supplement. The accessibility and unknown safety profile of Kratom calls for urgent safety assessment to help guide appropriate regulatory control.\n\n☆ Declaration of interest: None.\n==== Refs\nReferences\n1 Boyer E.W. Babu K.M. Adkins J.E. McCurdy C.R. Halpern J.H. Self-treatment of opioid withdrawal using kratom (Mitragynia speciosa korth) Addiction 103 6 2008 1048 1050 18482427 \n2 Bailey R.L. Gahche J.J. Miller P.E. Thomas P.R. Dwyer J.T. Why US adults use dietary supplements JAMA Intern Med 173 5 2013 355 361 23381623 \n3 Guallar E. Stranges S. Mulrow C. Appel L.J. Miller E.R. III Enough is enough: stop wasting money on vitamin and mineral supplements Ann Intern Med 159 12 2013 850 851 24490268 \n4 Henningfield J.E. Fant R.V. Wang D.W. The abuse potential of kratom according the 8 factors of the controlled substances act: implications for regulation and research Psychopharmacology 235 2 2018 573 589 29273821 \n5 Economic impact of Kratom scheduling 2016 Botanical Education Alliance \n6 Kapp F.G. Maurer H.H. Auwarter V. Winkelmann M. Hermanns-Clausen M. Intrahepatic cholestasis following abuse of powdered kratom (Mitragyna speciosa ) J Med Toxicol 7 3 2011 227 231 21528385 \n7 Nelsen J.L. Lapoint J. Hodgman M.J. Aldous K.M. Seizure and coma following Kratom (Mitragynina speciosa Korth) exposure J Med Toxicol 6 4 2010 424 426 20411370 \n8 Sheleg S.V. Collins G.B. A coincidence of addiction to “Kratom” and severe primary hypothyroidism J Addict Med 5 4 2011 300 301 21817918 \n9 Castillo A. Payne J.D. Nugent K. Posterior reversible leukoencephalopathy syndrome after kratom ingestion Proc (Baylor Univ Med Cent) 30 3 2017 355 357 \n10 Warner M.L. Kaufman N.C. Grundmann O. The pharmacology and toxicology of kratom: from traditional herb to drug of abuse Int J Legal Med 130 1 2016 127 138 26511390 \n11 Shuster J. Herbal remedies and seizures Nursing 27 4 1997 75 9171674 \n12 Bateman J. Chapman R.D. Simpson D. Possible toxicity of herbal remedies Scott Med J 43 1 1998 7 15 9533252 \n13 Cupp M.J. Herbal remedies: adverse effects and drug interactions Am Fam Physician 59 5 1999 1239 1245 10088878 \n14 D'Arcy P.F. Adverse reactions and interactions with herbal medicines. Part 1. Adverse reactions Adverse Drug React Toxicol Rev 10 4 1991 189 208 1793770 \n15 Tyagi A. Delanty N. Herbal remedies, dietary supplements, and seizures Epilepsia 44 2 2003 228 235 12558579 \n16 Kolikonda M.K. Srinivasan K. Enja M. Sagi V. Lippmann S. Medical marijuana for epilepsy? Innov Clin Neurosci 13 3–4 2016 23 26 27354925 \n17 Devinsky O. Marsh E. Friedman D. Thiele E. Laux L. Sullivan J. Cannabidiol in patients with treatment-resistant epilepsy: an open-label interventional trial Lancet Neurol 15 3 2016 270 278 26724101 \n18 Devinsky O. Cross H.J. Laux L. Marsh E. Miller I. Nabbout R. Trial of cannabidiol for drug-resistant seizures in the dravet syndrome N Engl J Med 376 21 2017 2011 2020 28538134 \n19 Huxtable R.J. The harmful potential of herbal and other plant products Drug Saf 5 Suppl. 1 1990 126 136 2182056 \n20 Singh D. Muller C.P. Vicknasingam B.K. Kratom (Mitragyna speciosa ) dependence, withdrawal symptoms and craving in regular users Drug Alcohol Depend 139 2014 132 137 24698080 \n21 Trakulsrichai S. Tongpo A. Sriapha C. Wongvisawakorn S. Rittilert P. Kaojarern S. Kratom abuse in Ramathibodi Poison Center, Thailand: a five-year experience J Psychoactive Drugs 45 5 2013 404 408 24592666 \n22 Schedules of controlled substances: placement of mitragynine and 7-Hydroxymitragynine into schedule I. Federal Register: U.S. drug enforcement administration Available from: https://www.federalregister.gov/documents/2016/08/31/2016-20803/schedules-of-controlled-substances-temporary-placement-of-mitragynine-and-7-hydroxymitragynine-into 2016\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2213-3232",
"issue": "10()",
"journal": "Epilepsy & behavior case reports",
"keywords": "ASD, anti-seizure drugs; Abuse; DEA, Drug and Enforcement Administration; Dependency; Epilepsy; FDA, Food and Drug Administration; GTC, generalized tonic–clonic; Kratom; MRI; Opioid",
"medline_ta": "Epilepsy Behav Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101614202",
"other_id": null,
"pages": "18-20",
"pmc": null,
"pmid": "30062086",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "24698080;20411370;28538134;1793770;27354925;2182056;24592666;21817918;10088878;23381623;18482427;12558579;9533252;28670086;29273821;26724101;24490268;9171674;21528385;26511390",
"title": "Recurrent seizures from chronic kratom use, an atypical herbal opioid.",
"title_normalized": "recurrent seizures from chronic kratom use an atypical herbal opioid"
} | [
{
"companynumb": "US-CIPLA LTD.-2018US19360",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LAMOTRIGINE"
},
"drugadditional": "3",
... |
{
"abstract": "Objective: To evaluate the efficacy and safety of mycophenolate mofetil (MMF) in neuromyelitis optica spectrum disorder (NMOSD). Method: From September 2014 to February 2017, NMOSD patients with seropositive aquaporin4-IgG was enrolled through a multicenter, prospective study, and the annual recurrence rate (ARR), Expanded Disability Status Scale (EDSS) and MMF-related side effects before and after MMF treatment were compared. Results: Ninety patients were enrolled in the study. After being treated for a median of 12 months (1-30 months), the median ARR decreased from 1.1 pre-MMF to 0 post-MMF (P<0.001), and the median EDSS score decreased from 4.0 pre-MMF to 3.0 post-MMF (P<0.001). The EDSS score reduced significantly after 90 days' treatment (P<0.05). The main adverse events included the deranged liver enzymes (19%, 17/90), respiratory infection (11%, 10/90), urinary tract infection (6%, 5/90), varicella-zoster infection (6%, 5/90), anemia (6%, 5/90), leucopenia (6%, 5/90), diarrhea (2%, 2/90), hair loss (1%, 1/90); 11% (10/90) patients experienced severe adverse events, and 6% (5/90) patients discontinued MMF. Conclusions: MMF could significantly reduce the ARR and EDSS score of NMOSD. However, awareness on side effects should be raised.",
"affiliations": "Department of Neurology, the Third Affiliated Hospital of SUN Yat-sen University, Guangzhou 510630, China.",
"authors": "Huang|Q|Q|;Wang|Y G|YG|;Shu|Y Q|YQ|;Yang|H|H|;Wang|Z H|ZH|;Yan|Z W|ZW|;Long|Y M|YM|;Yin|J|J|;Feng|H Y|HY|;Li|C X|CX|;Lu|Z Z|ZZ|;Hu|X Q|XQ|;Qiu|W|W|",
"chemical_list": "D007166:Immunosuppressive Agents; D009173:Mycophenolic Acid",
"country": "China",
"delete": false,
"doi": "10.3760/cma.j.issn.0376-2491.2018.21.009",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0376-2491",
"issue": "98(21)",
"journal": "Zhonghua yi xue za zhi",
"keywords": "Azathioprine; Mycophenolate mofetil; Neuromyelitis optica spectrum disorders; Therapy",
"medline_ta": "Zhonghua Yi Xue Za Zhi",
"mesh_terms": "D006801:Humans; D007166:Immunosuppressive Agents; D009173:Mycophenolic Acid; D009471:Neuromyelitis Optica; D011446:Prospective Studies; D000068356:Self-Control; D016896:Treatment Outcome",
"nlm_unique_id": "7511141",
"other_id": null,
"pages": "1664-1668",
"pmc": null,
"pmid": "29925143",
"pubdate": "2018-06-05",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study",
"references": null,
"title": "Efficacy and safety of mycophenolate mofetil in treating neuromyelitis optica spectrum disorder: a multicenter, prospective, self-control study in Guangzhou City.",
"title_normalized": "efficacy and safety of mycophenolate mofetil in treating neuromyelitis optica spectrum disorder a multicenter prospective self control study in guangzhou city"
} | [
{
"companynumb": "CN-ALKEM LABORATORIES LIMITED-CN-ALKEM-2018-07484",
"fulfillexpeditecriteria": "2",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "MYCOPHENOLATE MOFETIL"
},
... |
{
"abstract": "For treatment with psychotropic drugs during pregnancy, extended therapeutic drug monitoring is recommended for individual therapy adjustment. We measured venlafaxine (VEN), O-desmethylvenlafaxine (ODV) and active moiety, AM (sum of VEN+ODV) concentrations in maternal serum, amniotic fluid and umbilical cord blood.\n\n\n\nConcentrations of VEN, ODVEN and AM were measured in nine mother-infant pairs at time of delivery; in five cases, amniotic fluid samples were available. Concentrations are reported as median values, first (Q1) and third (Q3) quartiles and ranges. Penetration ratio was calculated by dividing concentrations of VEN, ODVEN and AM in amniotic fluid and umbilical cord blood by maternal serum concentrations.\n\n\n\nMedian daily dosage of venlafaxine was 75 mg (range 37.5-225 mg). There were no significant correlations between daily dose, maternal serum, umbilical cord blood and amniotic fluid concentrations. Median penetration ratio into amniotic fluid was 2.5 (range 0.56-4.48). Median penetration ratio into fetal circulation was 1.05 (range 0.62-2.08). Median concentration of AM was 223.8 ng/mL, range 33.9-338.0 ng/mL (maternal serum), 789.0 ng/mL, range 309-1052.5 ng/mL (amniotic fluid) and 291.0 ng/mL, range 21.1-448.4 ng/mL (cord blood).\n\n\n\nVEN, ODVEN and AM concentrations in maternal serum, amniotic fluid and umbilical cord blood indicate that the fetus might have been exposed to relatively high concentrations throughout pregnancy. High concentrations in amniotic fluid indicate an increased penetration into and/or accumulation within amniotic fluid and a decreased elimination out of amniotic fluid. Findings indicate that fetal in-utero exposition to venlafaxine is higher compared to other antidepressants.",
"affiliations": "Alexianer Hospital Aachen, Germany; Department of Psychiatry, Psychotherapy and Psychosomatics, RWTH Aachen University, Aachen, Germany; JARA-Translational Brain Medicine, Aachen, Germany.;The Zucker Hillside Hospital, Psychiatry Research, Northwell Health, Glen Oaks, New York, USA; Hofstra Northwell School of Medicine, Hempstead, New York, USA; The Feinstein Institute for Medical Research, Manhasset, New York, USA.;Department of Molecular Neuroimaging, Central Institute of Mental Health, Medical Faculty Mannheim, Heidelberg University, Mannheim, Germany.;Department of Gynecology and Obstetrics, RWTH Aachen University, Aachen, Germany.;Institute of Clinical Pharmacology, University Hospital of RWTH Aachen, Aachen, Germany.;Department of Psychiatry, Psychotherapy and Psychosomatics, RWTH Aachen University, Aachen, Germany; JARA-Translational Brain Medicine, Aachen, Germany; Protestant University of Applied Sciences Bochum, Immanuel-Kant-Str. 18-20, 44803 Bochum, Germany. Electronic address: maugustin@ukaachen.de.",
"authors": "Paulzen|Michael|M|;Schoretsanitis|Georgios|G|;Gründer|Gerhard|G|;Franz|Cordula|C|;Stingl|Julia C|JC|;Augustin|Marc|M|",
"chemical_list": "D000069470:Venlafaxine Hydrochloride; D000069468:Desvenlafaxine Succinate",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.jad.2020.02.010",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0165-0327",
"issue": "266()",
"journal": "Journal of affective disorders",
"keywords": "Amniotic fluid; Antidepressants; Cord blood; Depression; Pharmacokinetics; Placental transfer; Pregnancy; Therapeutic drug monitoring; Venlafaxine",
"medline_ta": "J Affect Disord",
"mesh_terms": "D000653:Amniotic Fluid; D000069468:Desvenlafaxine Succinate; D016903:Drug Monitoring; D005260:Female; D005312:Fetal Blood; D006801:Humans; D011247:Pregnancy; D000069470:Venlafaxine Hydrochloride",
"nlm_unique_id": "7906073",
"other_id": null,
"pages": "578-584",
"pmc": null,
"pmid": "32056930",
"pubdate": "2020-04-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Pregnancy exposure to venlafaxine-Therapeutic drug monitoring in maternal blood, amniotic fluid and umbilical cord blood and obstetrical outcomes.",
"title_normalized": "pregnancy exposure to venlafaxine therapeutic drug monitoring in maternal blood amniotic fluid and umbilical cord blood and obstetrical outcomes"
} | [
{
"companynumb": "DE-MYLANLABS-2020M1033118",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "VENLAFAXINE HYDROCHLORIDE"
},
"drugadditional... |
{
"abstract": "Rivaroxaban, a selective inhibitor of active factor X, is metabolized by cytochrom P450 3A4 (CYP3A4) and is a substrate for transporter protein--P-glycoprotein (P-gp). Amiodarone, an antiarrhytmic agent, is classified as moderate CYP3A4 and P-gp inhibitor.\n\n\nMETHODS\nA 75-year-old male, who underwent lobectomy for bronchiectasis many years ago, is presented. For one year the patient was treated with rivaroxaban (20 mg/d) due to venous thromboembolism and recurrent episodes of atrial fibrillation. Two weeks after amiodarone initiation (200 mg/d) hemoptysis occurred and computed tomography revealed unilateral pulmonary infiltrates with ground-glass opacities limited to the lower lobe of the left lung. The symptoms disappeared following discontinuation of the two medications and did not recur while rivaroxaban was reintroduced in a dose of 15 mg/d; measurement of anti-Xa activity confirmed it as a therapeutic dose. Amiodarone, that had been used for a short time and well tolerated a few years before, was definitely withdrawn.\n\n\nCONCLUSIONS\nThe authors suggest, that the concomitant use of rivaroxaban and amiodarone should be very careful in patients with a history of pulmonary disease.",
"affiliations": "Department of Internal Medicine, Józef Struś Hospital, Poznań, Poland.;Department of Internal Medicine, Józef Struś Hospital, Poznań, Poland.;Wielkopolska Center of Pulmonology and Thoracic Surgery, Ludwikowo, n. Poznań, Poland.;Department of Internal Medicine, Józef Struś Hospital, Poznań, Poland.;Radiology Unit, Józef Struś Hospital, Poznań, Poland.;Hemostasis Laboratory, Diagnostic and Therapeutic Center Interlab, Poznań",
"authors": "Elikowski|Waldemar|W|;Małek|Małgorzata|M|;Skowroński|Marcin|M|;Wróblewski|Dariusz|D|;Skrzywanek|Paweł|P|;Zawilska|Krystyna|K|",
"chemical_list": "D000889:Anti-Arrhythmia Agents; D065427:Factor Xa Inhibitors; D000069552:Rivaroxaban; D000638:Amiodarone",
"country": "Poland",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1426-9686",
"issue": "39(232)",
"journal": "Polski merkuriusz lekarski : organ Polskiego Towarzystwa Lekarskiego",
"keywords": "amiodarone; hemoptysis; history of pulmonary disease; rivaroxaban",
"medline_ta": "Pol Merkur Lekarski",
"mesh_terms": "D000368:Aged; D000638:Amiodarone; D000889:Anti-Arrhythmia Agents; D001281:Atrial Fibrillation; D001987:Bronchiectasis; D004359:Drug Therapy, Combination; D065427:Factor Xa Inhibitors; D006469:Hemoptysis; D006801:Humans; D008297:Male; D011859:Radiography; D000069552:Rivaroxaban; D054556:Venous Thromboembolism",
"nlm_unique_id": "9705469",
"other_id": null,
"pages": "227-30",
"pmc": null,
"pmid": "26608490",
"pubdate": "2015-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Hemoptysis during concomitant treatment with rivaroxaban and amiodarone in a patient with a history of pulmonary disease.",
"title_normalized": "hemoptysis during concomitant treatment with rivaroxaban and amiodarone in a patient with a history of pulmonary disease"
} | [
{
"companynumb": "PHHY2015PL164367",
"fulfillexpeditecriteria": "1",
"occurcountry": "PL",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "RIVAROXABAN"
},
"drugadditional": null,
"dru... |
{
"abstract": "Toxoplasma gondii transmission via breastfeeding has been discussed; however, no cases have been confirmed to date. This article describes a case of acute toxoplasmosis diagnosed in a mother and her six-month-old breastfed infant. The study accounts for the possibility of breast milk transmission and directs both clinicians and pediatricians to the hypothesis that both patients acquired toxoplasmosis via water ingestion.",
"affiliations": "Centro de Ciências da Saúde, Universidade de Londrina, Londrina, PR, Brasil, jaquedc@uel.br.;Centro de Ciências Biológicas, Universidade de Londrina, Londrina, PR, Brasil, rbregano@gmail.com.;Universidade de Londrina, Londrina, PR, Brasil, thaismonicavet@gmail.com.;Departamento de Medicina Veterinária Preventiva, Universidade de Londrina, Londrina, PR, Brasil, nandaferreiravet@gmail.com.;Departamento de Patologia, Centro de Ciências da Saúde, Universidade de Londrina, Londrina, PR, Brasil, reiche@sercomtel.com.br.",
"authors": "Capobiango|Jaqueline Dario|JD|;Mitsuka-Breganó|Regina|R|;Monica|Thais Cabral|TC|;Ferreira|Fernanda Pinto|FP|;Reiche|Edna Maria Vissoci|EM|",
"chemical_list": "D060766:Drinking Water",
"country": "Brazil",
"delete": false,
"doi": null,
"fulltext": "\n==== Front\nRev Inst Med Trop Sao PauloRev. Inst. Med. Trop. Sao PaulorimtspRevista do Instituto de Medicina Tropical de São Paulo0036-46651678-9946Instituto de Medicina Tropical 10.1590/S0036-46652015000600012Case ReportACUTE TOXOPLASMOSIS IN A BREASTFED INFANT WITH POSSIBLE TRANSMISSION BY\nWATER Toxoplasmose aguda em um lactente durante a amamentação, com possível\ntransmissão pela água CAPOBIANGO Jaqueline Dario \n1\nMITSUKA-BREGANÓ Regina \n2\nMONICA Thais Cabral \n3\nFERREIRA Fernanda Pinto \n4\nREICHE Edna Maria Vissoci \n5\n1 Universidade de Londrina, Centro de Ciências da Saúde, Departamento de\nPediatria e Cirurgia Pediátrica, Londrina, PR, Brasil. E-mail:\njaquedc@uel.br2 Universidade de Londrina, Centro de Ciências Biológicas, Departamento de\nCiências Patológicas, Londrina, PR, Brasil. E-mail: rbregano@gmail.com3 Universidade de Londrina, Programa de Pós-Graduação de Ciências Animais,\nLondrina, PR, Brasil. E-mail: thaismonicavet@gmail.com4 Universidade de Londrina, Laboratório de Zoonoses e Saúde Pública do\nDepartamento de Medicina Veterinária Preventiva, Londrina, PR, Brasil. E-mail:\nnandaferreiravet@gmail.com5 Universidade de Londrina, Centro de Ciências da Saúde, Departamento de\nPatologia, Análises Clínicas e Toxicológicas, Londrina, PR, Brasil. E-mail:\nreiche@sercomtel.com.brCorrespondence to: Dr. Jaqueline Dario Capobiango, Professor Assistente\nde Pediatria, Universidade de Londrina, Centro de Ciências da Saúde, Departamento de\nPediatria e Cirurgia Pediátrica, Hospital Universitário (UEL), Rua Robert Koch 60,\n86038-350 Londrina, PR, Brasil. FAX: 55.43.33751000. E-mail:\njaquedc@uel.br\nAUTHOR CONTRIBUTIONS JDC conceived and designed the study; performed\ndata analysis and interpretation; and prepared the manuscript. EMVR performed data\ninterpretation and manuscript revision. RMB, TCM and FE performed the laboratory\ntests. All the authors read and approved the final manuscript.\n\n\nCONFLICTS OF INTEREST The authors declare that there are no conflicts\nof interest.\n\nNov-Dec 2015 Nov-Dec 2015 57 6 523 526 30 9 2014 01 4 2015 This is an open-access article distributed under the terms of the Creative\nCommons Attribution LicenseToxoplasma gondii transmission via breastfeeding has been discussed; however, no\ncases have been confirmed to date. This article describes a case of acute\ntoxoplasmosis diagnosed in a mother and her six-month-old breastfed infant. The study\naccounts for the possibility of breast milk transmission and directs both clinicians\nand pediatricians to the hypothesis that both patients acquired toxoplasmosis via\nwater ingestion.\n\nA transmissão do Toxoplasma gondii através do aleitamento materno tem sido discutida;\nno entanto, até o momento nenhum caso foi confirmado. Este artigo relata um caso de\ntoxoplasmose aguda diagnosticada na mãe e no seu bebê com seis meses de vida, que\nestava em amamentação exclusiva. Embora apresente a possibilidade de transmissão pelo\nleite materno, o estudo chama a atenção de clínicos e pediatras para a mais provável\nhipótese de que ambos adquiriram toxoplasmose pela ingestão de água.\n\nToxoplasmaToxoplasmosisBreastfeedingDisease transmissionInfectious\n==== Body\nINTRODUCTION\nBreastfeeding mothers with acute infections are often concerned about the continuation\nof breastfeeding and the risk of microorganism transmission via breast milk. Such an\ninfection may be caused by Toxoplasma gondii. Breast milk is a probable\nroute of transmission for other animals, and the presence of Toxoplasma\nin the milk of several animals has been confirmed using polymerase chain reaction (PCR),\ncell culture, and antigen capture enzyme immunoassays (ELISA)6. The transmission of T. gondii via breastfeeding\nmay occur due to the presence of cysts or tachyzoites in milk8\n,\n11, since the nutrients in milk may sustain\nviable cysts because of their resistance to gastric acidity10; the tachyzoites subsequently penetrate the oropharyngeal mucosa.\nHowever, oral transmission via breast milk in the setting of an acute infection is\nunlikely, as tachyzoites are extremely sensitive to proteolytic enzymes20\n,\n22. However, if gastric acidity is buffered by\nbreast milk (decreasing pepsin digestion), tachyzoite penetration may occur via\ngastro-duodenal mucosa17. Maternal antibodies\npresent in milk may exert protective effects for the infant, as previously demonstrated\nby the presence of anti-T. gondii antibodies in milk (with\nconcentrations similar to serum levels)1.\nAlthough toxoplasmosis transmission to humans has occurred via ingestion of goat\nmilk19\n,\n20, there has been only one reported case of\nprobable transmission via breast milk following an outbreak of acute toxoplasmosis among\nguests at a party that included a breastfeeding mother3. In 2005, a two-month-old exclusively breastfed infant was diagnosed with\nacquired toxoplasmosis concomitantly with his mother; the infection was most likely\ntransmitted by breastfeeding, as the mother was susceptible to T.\ngondii, and the newborn tested negative4.\n\nThe aim of this study was to describe the possible transmission of T.\ngondii via breast milk or via water ingestion in a breastfeeding infant, and\nto draw the attention of clinicians and pediatricians regarding this situation. \n\nCASE REPORT\nAn infant was referred to the Pediatric Infectious Disease Outpatient Unit of the\nUniversity Hospital, State University of Londrina, Parana State, Brazil, with a\ndiagnosis of acute toxoplasmosis. At the time, the limited epidemiological data\nregarding other transmission routes, such as the ingestion of water and food, suggested\nthat the most feasible route of transmission was via breast milk. \n\nThe mother received prenatal care; however, serological tests for toxoplasmosis were\nassayed only during the first trimester (July 2012). Anti-T. gondii IgM\nand IgG antibodies were both not reactive, as determined via a chemiluminescence (CL)\nimmunoassay. During pregnancy, the patient denied any risk of exposure to T.\ngondii, including the consumption of raw or undercooked meat, drinking\nunfiltered water, contact with cat feces, and gardening. Following childbirth, the woman\nreported consumption of raw meat; however, she drank only filtered water while in\nBrazil. In September 2013, she traveled to Mogadouro (Portugal) with her child\n(six-months-old), who was exclusively breastfed. Both mother and child stayed for 11\ndays, and the woman reported consuming colonial salami and goat cheese. During this\nperiod, she and her child drank water from a local mine and from a sink faucet, each of\nthese locations being possible sources of T. gondii oocysts. The mother\nalso reported that the only solid food that the child consumed was pear pulp and banana.\nFollowing their return to Brazil, the mother presented left cervical lymphadenopathy\nwithout fever. In November 2013, laboratory tests revealed the presence of\nanti-T. gondii IgG and IgM antibodies, and the diagnosis of acute\ntoxoplasmosis was confirmed (Table 1). The\nmother was treated with sulfadiazine, pyrimethamine, and folinic acid. During this\nperiod, the child presented fever and rash on the trunk that lasted for three days,\nsymptoms that occurred a few days before the mother's adenopathy developed. A physical\nexamination revealed the presence of multiple 1.5 cm diameter nodes in the right\noccipital chain without hepatosplenomegaly, but no serological tests were performed. In\nDecember 2013, the serological tests were repeated using maternal serum samples, and the\npresence of anti-T. gondii IgG, IgM and IgA antibodies was noted. In\nJanuary 2014, the mother finished treatment, and additional tests demonstrated no\nreactivity of antibodies against human immunodeficiency virus types 1 and 2\n(anti-HIV-1/2), decreased anti-T. gondii IgA and low avidity for\nanti-T. gondii IgG.\n\n\nTable 1 \n- Comparison of serological results of mother and infant\n\nPeriod\n\t\nMother\n\t\nInfant\n\t\n\nIFI IgG\n\t\nIFI IgM\n\t\nCL IgG\n\t\nCL IgM*\n\t\nELISA IgA\n\t\nIgG Avidity\n\t\nIFI IgG\n\t\nCL IgG\n\t\nCL IgM**\n\t\nIgG Avidity\n\t\nNovember 18, 2013\t1: 1,024\t1: 4,096\t-\t-\t-\t-\t-\t-\t-\t-\t\nDecember 20, 2013\t-\t-\t200.0\t21.4\t4.0\t-\t-\t-\t-\t-\t\nJanuary 8, 2014\t-\t-\t-\t-\t-\t-\t-\t> 200.0\t17.3\t-\t\nJanuary 17, 2014\t1: 32, 000\t-\t1,394.0\t41.2\t-\tLow (22.3%)\t1: 128,000\t1,736.0\t24.8\tLow (21.6%)\t\nMarch 28, 2014\t-\t-\t-\t-\t1.4\t-\t-\t> 200.0\t2.1\t-\t\nIndirect immunofluorescence (IFI): reference values (RV) IgG <1:16 and\nIgM = nonreactive; Anti- T. gondii IgG by chemiluminescence\n(CL) RV < 1.6 UI/mL; *Anti- T. gondii IgM by CL - RV\nindex < 0.5; **Anti- T. gondii IgM by CL - RV index <\n0.83; Anti- T. gondii IgA by enzima immunoassay (ELISA) -\nRV index < 1.0; Avidity of anti-T gondii IgG by CL- RV:\nlow < 49.9%; intermediate 50.0 - 59.9%; high > 60.0% IFI IgM and ELISA\nIgA not done in infant\n\n\n\n\nIn Brazil, the child drank only filtered water and consumed fruit pulp; the mother has\ndenied exposing the child to other risk factors for T. gondii. In\nJanuary 2014, serological tests of the child's serum samples for toxoplasmosis detected\nanti-T. gondii IgG and anti-T. gondii IgM\nantibodies (Table 1); the child was subsequently\nreferred to the Pediatric Infectious Disease Outpatient Unit of the University Hospital.\nNew serological tests for toxoplasmosis revealed low avidity for IgG anti-T.\ngondii (CL). A positive PCR test identified T. gondii DNA\nin a blood sample taken from the child (Fig. 1). The child was then treated\nwith sulfadiazine, pyrimethamine and folinic acid. Following seven days of treatment,\nthe child presented anemia (hemoglobin: 10.0 g/dL, hematocrit: 30.9%) and neutropenia\n(780 cells/mm3). The dose of folinic acid was increased, and the neutropenia\nsubsequently improved slightly (836 cells/mm3). An ophthalmologic examination\nand a brain computed tomography (CT) scan revealed no abnormalities. Treatment was\nmaintained for 28 days, and folinic acid was maintained for an additional seven days\nthereafter. One month after discontinuing the drugs, a second ophthalmological\nexamination was performed. No lesions were noted, and the ganglia sizes were reduced; a\nsecond hematologic evaluation demonstrated recovery from the anemia (hemoglobin: 11.2\ng/dL), but the neutrophil count remained decreased (871 cells/mm3). Treatment\nwith ferrous sulfate was initiated, and folinic acid was re-introduced. The neutrophil\ncount finally recovered (1,520 cells/mm3) following these treatments. \n\n\nFig. 1 \n- Electrophoretic profile of 529 bp DNA fragment of\nToxoplasma gondii (Gen-Bank no. AFI46527)\namplified from peripheral blood sample of a child diagnosed with acute\ntoxoplasmosis. Method of polymerase chain reaction (PCR), agarose gel 2%,\nstained with SYBRÒ Safe DNA Gel Stain (Invitrogen, Life Techonology,\nUSA). Line 1: molecular marker 100 pb. Line 2: peripheral blood samples of\nchildren with acute toxoplasmosis. Line 3: negative control (no DNA ). Line 4:\npositive control (529 pb of sample with DNA of Tachyzoites of the RH\nstrain)\n\n\n\nDISCUSSION\nIn the present case report, serological tests for toxoplasmosis were performed only\nduring early pregnancy, and the results were characteristic of a profile of\nsusceptibility to infection. However, the serological profile at the time of diagnosis,\nwhich was performed when the child was eight months old, was compatible with an acute\ninfection, as demonstrated by the presence of anti-T. gondii IgG\nantibodies with low avidity, which excluded the possibility of a congenital infection.\nAdditionally, the infant's symptoms began prior to the onset of maternal symptoms, and\nthe incubation period was consistent with the acquisition of the disease while traveling\nabroad. There is a small possibility that the child's infection was the result of\ncontact with its mother's hands after she handled the colonial salami and goat cheese.\nMoreover, during the clinical history, it was revealed that the water in Portugal was\nthe only likely common source of toxoplasmosis transmission for mother and child.\n\nWater is an important vehicle for the transmission of toxoplasmosis. In a study of\nseroprevalence in Brazil, where municipal water distribution was addressed, 84.0% of the\npopulation with a low socioeconomic status, and 23.0% of the population with a high\nsocioeconomic status presented toxoplasmosis seroreactivity. The most important risk\nfactor for seropositivity among the people with a low socioeconomic status was drinking\nunfiltered water, which demonstrates the importance of transmission via waterborne\noocysts in that region2. This may be due to the\ncontamination of water reservoirs, particularly wells with shallow water in which\noocysts from soil may contaminate the water during floods2. Oocysts remain viable for long periods of time in both soil and water9. In another study conducted in Poland, the\npresence of T. gondii was demonstrated in water wells, and 64.6% of the\ncountry's rural population tested positive for T. gondii. Higher\npercentages of seropositivity were observed among people who drank well water compared\nwith those who drank filtered water21. In late\n2001, there was a large toxoplasmosis outbreak resulting from the contamination of the\ncity's tank water supply in Santa Isabel do Ivai, Parana State, southern Brazil7. These studies demonstrate that water-borne\ninfections are a constant concern in public health, and there have been several recent\ncases of toxoplasmosis transmitted via water. Mogadouro is a village in northern\nPortugal, and studies conducted in the northeastern region of Portugal were\ncharacterized by seropositivity for anti-T. gondii in 72.4% of domestic\ncats, 38.0% of dogs, 7.5% of cattle, 33.6% of sheep, 18.5% of goats, and 9.8% of\npigs12\n,\n14\n,\n15. These results demonstrate the prevalence of\nenvironmental contamination with T. gondii, which was responsible for\nthese animal infections. Another seroprevalence study from this region demonstrated that\nthe majority of women in childbearing age are susceptible to primary infection with\nT. gondii; therefore, the risk of congenital toxoplasmosis remains\nhigh in this region13.\n\nIn this case report, the specific treatment for acute toxoplasmosis was continued until\nophthalmological injury, damage to the central nervous system, and possible congenital\ninfection were excluded. Acquired infections usually do not require specific treatment\nunless the symptoms are both severe and persistent, vital organs are involved, or the\ninfection has occurred in an immunosuppressed patient16\n,\n18. Treatment was maintained for four weeks due\nto the persistence of parasite DNA positivity, which was revealed by PCR during the\nthird month following infection, and because the child was less than 12 months of age.\nHowever, the risk of side effects should always be considered, even though they are\nreversible upon discontinuation of treatment5\n,\n18 (as was observed in this study). \n\nFinally, we emphasize that transmission of toxoplasmosis via breastfeeding in humans\nremains unproven, which underscores the necessity of excluding other routes of\ntransmission. The lack of data proving disease transmission via breastfeeding and the\nfavorable clinical outcomes noted are enough to recommend the maintenance of\nbreastfeeding, even when the mother presents acute toxoplasmosis. When breastfeeding\nchildren, we should exclude other possible routes of toxoplasmosis transmission, such as\ncongenital disease and intake of water and other contaminated foods. The consumption of\nwater, contaminated with oocysts, may be an important transmission route and may be\nresponsible for acute infections among pregnant women, breastfeeding mothers, and\ninfants, justifying the intensification of public health measures in several countries\nwith prophylactic guidelines for drinking only boiled or filtered water in order to\nreduce the transmission of toxoplasmosis via this route.\n\nACKNOWLEDGMENTS\nWe thank Dr. João Luis Garcia (Department of Veterinary Preventive Medicine of UE) for\nhis assistance with the laboratory procedures.\n==== Refs\nREFERENCES\n1 Azab ME Kamel AM Makled KM Khattab H el-Zayyat EA Abo-Amer EA Naturally occurring toxoplasma antibodies in serum and milk of\nlactating women J Egypt Soc Parasitol 1992 22 561 568 1500798 \n2 Bahia-Oliveira LMG Jones JL Azevedo-Silva J Alves CCF Oréfice F Addiss DG Highly endemic, waterborne toxoplasmosis in north Rio de Janeiro\nstate, Brazil Emerg Infect Dis 2003 9 55 62 12533282 \n3 Bonametti AM Passos JN Koga de Silva EM Macedo ZS Probable transmission of acute toxoplasmosis through breast\nfeeding J Trop Pediatr 1997 43 116 116 9143185 \n4 Brasil. Secretaria de Vigilância em Saúde Surto intra familiar de toxoplasmose, Santa Vitoria do Palmar-RS,\njulho de 2005 Bol Eletrôn Epidemiol 2006 6 3 1 7 www.saude.gov.br/svs \n5 Daveluy A Haramburu F Bricout H Costanzo S Fourrier A Tan HK Review of data related to side effects of drugs used in congenital\ntoxoplasmosis [Unpublished report] Bordeaux The Eurotoxo Group 2005 http://eurotoxo.isped.u-bordeaux2.fr /WW W_PUBLIC/\nDOC/Side_effects_main_drugs_v3.pdf \n6 Dehkordi FS Borujeni MR Rahimi E Abdizadeh R Detection of Toxoplasma gondii in raw caprine, ovine, buffalo, bovine,\nand camel milk using cell cultivation, cat bioassay, capture ELISA, and PCR\nmethods in Iran Foodborne Pathog Dis 2013 10 120 125 23441913 \n7 de Moura L Bahia-Oliveira LM Wada MY Jones JL Tuboi SH Carmo EH Waterborne toxoplasmosis, Brazil, from field to gene Emerg Infect Dis 2006 12 326 329 16494765 \n8 Dubey JP Persistence of encysted Toxoplasma gondii in caprine livers and public\nhealth significance of toxoplasmosis in goats J Am Vet Med Assoc 1980 177 1203 1207 7440321 \n9 Dubey JP Toxoplasmosis in sheep, goats, pigs and cattle Dubey J Beattie C Toxoplasmosis in animals and man Boca Raton CRC Press 1988 61-114 \n10 Gross U Bohne W Soête M Dubremetz JF Developmental differentiation between tachyzoites and bradyzoites of\nToxoplasma gondii Parasit Today 1996 12 30 33 \n11 Hiramoto RM Mayrbaurl-Borges M Galisteo AJ Jr Meireles LR Macre MS Andrade HF Jr Infectivity of cysts of the ME-49 Toxoplasma gondii strain in bovine\nmilk and homemade cheese Rev Saude Publica 2001 35 113 118 11359195 \n12 Lopes AP Cardoso L Rodrigues M Serological survey of Toxoplasma gondii infection in domestic cats\nfrom northestern Portugal Vet Parasitol 2008 155 184 189 18571327 \n13 Lopes AP Dubey JP Moutinho O Gargaté MJ Vilares A Rodrigues M Seroepidemiology of Toxoplasma gondii infection in women from the\nNorth of Portugal in their childbearing years Epidemiol Infect 2012 140 872 877 21878147 \n14 Lopes AP Dubey JP Neto F Rodrigues A Martins T Rodrigues M Seroprevalence of Toxoplasma gondii infection in cattle, sheep, goats\nand pigs from the North of Portugal for human consumption Vet Parasitol 2013 193 266 269 23290614 \n15 Lopes AP Santos H Neto F Rodrigues M Kwok OC Dubey JP Prevalence of antibodies to Toxoplasma gondii in dogs from\nnortheastern Portugal J Parasitol 2011 97 418 420 21506866 \n16 McAuley JB Boyer KM Remington JS McLeod RL Toxoplasmosis Feigin & Cherry's textbook of pediatric infectious diseases Philadelphia Saunders Elsevier 2009 2954-71 \n17 Pettersen EK Transmission of toxoplasmosis via milk from lactating\nmice Acta Pathol Microbiol Immunol Scand B 1984 92 175 176 6485808 \n18 Remigton JS McLeod R Wilson CB Desmonts G Toxoplasmosis Remington & Klein Infectious diseases of the fetus and newborn infant Philadelphia Elsevier 2011 918-1041 \n19 Riemann HP Meyer ME Theis JH Kelso G Behymer DE Toxoplasmosis in an infant fed unpasteurized goat milk J Pediatr 1975 87 573 576 1171952 \n20 Sacks JJ Roberto RR Brooks NF Toxoplasmosis infection associated with raw goat´s\nmilk JAMA 1982 248 1728 1732 7120593 \n21 Sroka J Wójcik-Fatia A Dutkiewicz J Ocurrence of Toxoplasma gondii in water from wells located on\nfarms Ann Agric Environ Med 2006 13 169 175 16841888 \n22 Walsh CP Hammond SE Zajac AM Lindsay DS Survival of Toxoplasma gondii tachyzoites in goat milk: potencial\nsource of human toxoplasmosis J Eukaryot Microbiol 1999 46 73S 74S 10519255\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "0036-4665",
"issue": "57(6)",
"journal": "Revista do Instituto de Medicina Tropical de Sao Paulo",
"keywords": null,
"medline_ta": "Rev Inst Med Trop Sao Paulo",
"mesh_terms": "D000915:Antibody Affinity; D001938:Brazil; D001942:Breast Feeding; D060766:Drinking Water; D005260:Female; D006801:Humans; D007223:Infant; D008895:Milk, Human; D016133:Polymerase Chain Reaction; D014122:Toxoplasma; D014123:Toxoplasmosis; D000069578:Waterborne Diseases",
"nlm_unique_id": "7507484",
"other_id": null,
"pages": "523-6",
"pmc": null,
"pmid": "27049709",
"pubdate": "2015-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "12533282;7120593;16494765;9143185;10519255;18571327;1171952;7440321;11359195;21878147;16841888;21506866;15275305;23290614;1500798;6485808;23441913",
"title": "ACUTE TOXOPLASMOSIS IN A BREASTFED INFANT WITH POSSIBLE TRANSMISSION BY WATER.",
"title_normalized": "acute toxoplasmosis in a breastfed infant with possible transmission by water"
} | [
{
"companynumb": "PHHY2016BR013161",
"fulfillexpeditecriteria": "1",
"occurcountry": "BR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEUCOVORIN"
},
"drugadditional": null,
"drug... |
{
"abstract": "No dosing regimen has been established for the initial treatment of pediatric status epilepticus with intravenous midazolam. We therefore evaluated the efficacy, safety, and pharmacokinetics of bolus and continuous midazolam infusion.\n\n\n\nThis open-label, prospective, multicenter study involved 34 Japanese children with status epilepticus unresponsive to diazepam. An initial bolus of 0.15 mg/kg midazolam was given, with additional doses of 0.1-0.3 mg/kg up to a cumulative dose of 0.6 mg/kg. A continuous infusion was initiated at 0.1 mg/kg/h (maximum 0.4 mg/kg/h) for patients at high risk of recurrence or in whom seizure reduction was achieved, and continued for 24 h after seizure cessation. Seizure cessation was assessed based on clinical observation (disappearance of motor symptoms regardless of recovery of consciousness), rather than the disappearance of electroencephalography abnormalities.\n\n\n\nThe seizure cessation rate with bolus midazolam was 88%. The cumulative dose was ≤0.3 mg/kg in 90% of patients who responded to bolus administration. Adverse events were observed in three patients; one had mild respiratory depression that required supplemental oxygen and bag-valve-mask ventilation. Elimination half-life was 0.999 ± 0.241 h in seven patients. Total body clearance ranged from 423 to 1220 mL/h/kg in older children but was notably higher in a 10-month-old infant (2010 mL/h/kg).\n\n\n\nThe efficacy and safety of midazolam were demonstrated in children with status epilepticus, suggesting that intravenous midazolam is suitable as first-line treatment.",
"affiliations": "Division of Neurology, Saitama Children's Medical Center, 1-2 Shintoshin, Chuo-ku, Saitama 330-8777, Japan. Electronic address: hamano.shinichiro@scmc.pref.saitama.jp.;Department of Child Neurology, National Center of Neurology and Psychiatry, 4-1-1 Ogawahigashi-cho, Kodaira, Tokyo 187-8551, Japan. Electronic address: sugaik@ncnp.go.jp.;Alfresa Pharma Corporation, R&D Headquarters, 2-2-9 Koku-machi, Chuo-ku, Osaka 540-8575, Japan. Electronic address: ms-miki@alfresa-pharma.co.jp.;Alfresa Pharma Corporation, R&D Headquarters, 2-2-9 Koku-machi, Chuo-ku, Osaka 540-8575, Japan. Electronic address: to-tabata@alfresa-pharma.co.jp.;Alfresa Pharma Corporation, R&D Headquarters, 2-2-9 Koku-machi, Chuo-ku, Osaka 540-8575, Japan. Electronic address: takako-fukuyama@alfresa-pharma.co.jp.;Department of Pediatrics, Tokyo Women's Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666, Japan. Electronic address: hmosawa@vesta.dti.ne.jp.",
"authors": "Hamano|Shin-Ichiro|SI|;Sugai|Kenji|K|;Miki|Masuo|M|;Tabata|Toshiyuki|T|;Fukuyama|Takako|T|;Osawa|Makiko|M|",
"chemical_list": "D018686:Anesthetics, Intravenous; D000927:Anticonvulsants; D003975:Diazepam; D008874:Midazolam",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.jns.2018.09.035",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0022-510X",
"issue": "396()",
"journal": "Journal of the neurological sciences",
"keywords": "Efficacy; Midazolam; Open-label study; Pharmacokinetics; Safety; Status epilepticus",
"medline_ta": "J Neurol Sci",
"mesh_terms": "D061605:Administration, Intravenous; D000293:Adolescent; D018686:Anesthetics, Intravenous; D000927:Anticonvulsants; D002648:Child; D002675:Child, Preschool; D003975:Diazepam; D004569:Electroencephalography; D005260:Female; D005500:Follow-Up Studies; D005865:Gestational Age; D006801:Humans; D007223:Infant; D007231:Infant, Newborn; D007564:Japan; D008297:Male; D008874:Midazolam; D011446:Prospective Studies; D013226:Status Epilepticus",
"nlm_unique_id": "0375403",
"other_id": null,
"pages": "150-158",
"pmc": null,
"pmid": "30472551",
"pubdate": "2019-01-15",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Efficacy, safety, and pharmacokinetics of intravenous midazolam in Japanese children with status epilepticus.",
"title_normalized": "efficacy safety and pharmacokinetics of intravenous midazolam in japanese children with status epilepticus"
} | [
{
"companynumb": "JP-MYLANLABS-2018M1094101",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CLONAZEPAM"
},
"drugadditional": "3",
... |
{
"abstract": "Late-onset neutropenia (LON) after anti-CD20 therapy is a poorly described side effect in inflammatory disorders of the CNS. In this prospective study, patients treated with Rituximab or Ocrelizumab for MS, neuromyelitis optica spectrum disorders or MOG antibody-associated disease (MOGAD) were asked to perform complete blood count (CBC) every two weeks for six months, with the aim of identifying LON. Out of 152 patients, two (1,32%) had an absolute neutrophil count <1,000/mm3: one patient with MOGAD had agranulocytosis and one patient with MS had grade 3 neutropenia. Both were asymptomatic. These results confirm that LON after anti-CD20 therapy in inflammatory disorders of the CNS is not exceptional. Nevertheless, this biological complication remains too infrequent to justify close systematic CBC follow-up.",
"affiliations": "Department of Neurology, University Hospital of Toulouse, 31059 Toulouse cedex 9, France.;Department of Neurology, University Hospital of Toulouse, 31059 Toulouse cedex 9, France; Centre de Ressources et de Compétences Sclérose en plaques, University Hospital of Toulouse, 31059 Toulouse cedex 9, France; Inserm UMR1291 - CNRS UMR5051, University Toulouse 3, University Hospital of Toulouse, 31024 Toulouse cedex 3, France.;Department of Neurology, University Hospital of Toulouse, 31059 Toulouse cedex 9, France.;Department of Neurology, University Hospital of Toulouse, 31059 Toulouse cedex 9, France; Centre de Ressources et de Compétences Sclérose en plaques, University Hospital of Toulouse, 31059 Toulouse cedex 9, France; Inserm UMR1291 - CNRS UMR5051, University Toulouse 3, University Hospital of Toulouse, 31024 Toulouse cedex 3, France. Electronic address: ciron.j@chu-toulouse.fr.",
"authors": "Rigal|J|J|;Biotti|D|D|;Lépine|Z|Z|;Ciron|J|J|",
"chemical_list": null,
"country": "France",
"delete": false,
"doi": "10.1016/j.neurol.2021.06.007",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0035-3787",
"issue": null,
"journal": "Revue neurologique",
"keywords": "Anti-CD20 monoclonal antibodies; Late-onset neutropenia; Multiple sclerosis; Myelin oligodendrocyte glycoprotein (MOG) antibody-associated disease; Neuromyelitis optica spectrum disorders (NMOSD)",
"medline_ta": "Rev Neurol (Paris)",
"mesh_terms": null,
"nlm_unique_id": "2984779R",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34579948",
"pubdate": "2021-09-24",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Late-onset neutropenia after anti-CD20 therapy for multiple sclerosis, neuromyelitis optica spectrum disorders and MOG antibody-associated disease: A prospective study.",
"title_normalized": "late onset neutropenia after anti cd20 therapy for multiple sclerosis neuromyelitis optica spectrum disorders and mog antibody associated disease a prospective study"
} | [
{
"companynumb": "FR-CELLTRION INC.-2022FR009560",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "RITUXIMAB"
},
"drugadditional": "4",
... |
{
"abstract": "Hereditary neuropathy with liability to pressure palsies is an autosomal dominant condition occurring in up to 16 per 100,000 people and predisposes to neural compressive injury. Given the rarity of this condition, no guidelines currently exist for the anesthetic management of hereditary neuropathy with liability to pressure palsies. We describe the management of analgesia during labor in a woman diagnosed with hereditary neuropathy with liability to pressure palsies and a history of nerve palsy after obstetric anesthesia. Our report highlights the necessity of clinician awareness of hereditary neuropathy with liability to pressure palsies and the anesthetic precautions used to successfully avoid neural injury in this case.",
"affiliations": "From the Department of Anaesthetics, Alfred Hospital, Melbourne, Victoria, Australia.;The University of Sydney, Sydney, New South Wales, Australia.",
"authors": "Bolger|Alexandra Amy|AA|;Stewart|Paul Anthony|PA|",
"chemical_list": "D000777:Anesthetics",
"country": "United States",
"delete": false,
"doi": "10.1213/XAA.0000000000001010",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2575-3126",
"issue": "13(4)",
"journal": "A&A practice",
"keywords": null,
"medline_ta": "A A Pract",
"mesh_terms": "D000328:Adult; D000773:Anesthesia, Obstetrical; D000777:Anesthetics; D001176:Arthrogryposis; D005260:Female; D015417:Hereditary Sensory and Motor Neuropathy; D006801:Humans; D011247:Pregnancy",
"nlm_unique_id": "101714112",
"other_id": null,
"pages": "126-129",
"pmc": null,
"pmid": "30985325",
"pubdate": "2019-08-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Anesthetic Considerations of Hereditary Neuropathy With Liability to Pressure Palsies in an Obstetric Patient: A Case Report.",
"title_normalized": "anesthetic considerations of hereditary neuropathy with liability to pressure palsies in an obstetric patient a case report"
} | [
{
"companynumb": "AU-MYLANLABS-2020M1040447",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "FENTANYL"
},
"drugadditional": null,
... |
{
"abstract": "With more women getting pregnant at later ages than in the past, the incidence of malignancies in pregnancy is on the rise. Common malignancies of pregnancy are melanoma, breast cancer, cervical cancer, lymphomas, and leukemias. Colorectal carcinoma is rare in pregnancy, with an estimated incidence of 1 in 13',000 cases. We describe such a case of colorectal carcinoma in pregnancy (CRC-p), in a 31-year-old patient. She presented in the 21st week of her second pregnancy with constipation of two weeks duration despite appropriate medical management. This prompted further evaluation with abdominal imaging revealing partial small bowel obstruction of unclear etiology. She was treated surgically with subtotal colectomy with ileostomy. Pathologic evaluation revealed Stage III B: pT3N2a adenocarcinoma with mucinous features of the sigmoid colon with lymph node metastases. Adjuvant FOLFOX chemotherapy was started in the third trimester and was continued postpartum for a total of 12 cycles. She is doing well, and ileostomy reversal is being planned at the time of writing this. Advancing maternal age is a significant risk factor for CRC-p. Common presenting symptoms in CRC-p include bleeding per rectum, abdominal pain, vomiting, and constipation. The frequent occurrence of many of these symptoms, as well as risks and restrictions associated with diagnostic modalities such as computed tomography scan and colonoscopy during pregnancy, makes the diagnosis challenging. Colonoscopy, followed by pathology evaluation, remains the standard diagnostic method in CRC-p. Management of CRC-p is determined by multiple variables such as the stage of the disease, gestational age, and most importantly, patient wishes. Surgical resection is performed following the diagnosis if the gestational age is less than 20 weeks and delayed until after delivery if gestational age is above 20 weeks. 5-fluorouracil based chemotherapy regimens are used in second and third trimesters, in patients with stage III CRC-p. Prognosis has been reported variably. Despite advanced stages at presentation, most of the studies indicate a similar prognosis compared to CRC in the non-pregnant population. Two-year survival was found to be 64.4% in one case series.",
"affiliations": "Internal Medicine, The Wright Center for Graduate Medical Education, Scranton, USA.;Internal Medicine, The Wright Center for Graduate Medical Education, Scranton, USA.;Student, Abington Heights High School, Scranton, USA.;Oncology, Hematology & Oncology Associates of Northeastern Pennsylvania, Scranton, USA.",
"authors": "Sravanthi|Metlapalli Venkata|MV|;Suma Kumaran|Sharmil|S|;Palle|Abhinav|A|;Bojanapally|Padmaja|P|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.7759/cureus.9491",
"fulltext": "\n==== Front\nCureus\nCureus\n2168-8184\nCureus\n2168-8184 Cureus Palo Alto (CA) \n\n10.7759/cureus.9491\nObstetrics/Gynecology\nOncology\nAdenocarcinoma of Sigmoid Colon Diagnosed in Pregnancy: A Case Report\nMuacevic Alexander Adler John R Sravanthi Metlapalli Venkata 1 Suma Kumaran Sharmil 1 Palle Abhinav 2 Bojanapally Padmaja 3 \n1 \nInternal Medicine, The Wright Center for Graduate Medical Education, Scranton, USA \n\n2 \nStudent, Abington Heights High School, Scranton, USA \n\n3 \nOncology, Hematology & Oncology Associates of Northeastern Pennsylvania, Scranton, USA \n\nSharmil Suma Kumaran sumakumarans@thewrightcenter.org\n31 7 2020 \n7 2020 \n12 7 e949113 7 2020 30 7 2020 Copyright © 2020, Sravanthi et al.2020Sravanthi et al.This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.This article is available from https://www.cureus.com/articles/37287-adenocarcinoma-of-sigmoid-colon-diagnosed-in-pregnancy-a-case-reportWith more women getting pregnant at later ages than in the past, the incidence of malignancies in pregnancy is on the rise. Common malignancies of pregnancy are melanoma, breast cancer, cervical cancer, lymphomas, and leukemias. Colorectal carcinoma is rare in pregnancy, with an estimated incidence of 1 in 13',000 cases. We describe such a case of colorectal carcinoma in pregnancy (CRC-p), in a 31-year-old patient. She presented in the 21st week of her second pregnancy with constipation of two weeks duration despite appropriate medical management. This prompted further evaluation with abdominal imaging revealing partial small bowel obstruction of unclear etiology. She was treated surgically with subtotal colectomy with ileostomy. Pathologic evaluation revealed Stage III B: pT3N2a adenocarcinoma with mucinous features of the sigmoid colon with lymph node metastases. Adjuvant FOLFOX chemotherapy was started in the third trimester and was continued postpartum for a total of 12 cycles. She is doing well, and ileostomy reversal is being planned at the time of writing this.\n\nAdvancing maternal age is a significant risk factor for CRC-p. Common presenting symptoms in CRC-p include bleeding per rectum, abdominal pain, vomiting, and constipation. The frequent occurrence of many of these symptoms, as well as risks and restrictions associated with diagnostic modalities such as computed tomography scan and colonoscopy during pregnancy, makes the diagnosis challenging. Colonoscopy, followed by pathology evaluation, remains the standard diagnostic method in CRC-p. Management of CRC-p is determined by multiple variables such as the stage of the disease, gestational age, and most importantly, patient wishes. Surgical resection is performed following the diagnosis if the gestational age is less than 20 weeks and delayed until after delivery if gestational age is above 20 weeks. 5-fluorouracil based chemotherapy regimens are used in second and third trimesters, in patients with stage III CRC-p. Prognosis has been reported variably. Despite advanced stages at presentation, most of the studies indicate a similar prognosis compared to CRC in the non-pregnant population. Two-year survival was found to be 64.4% in one case series.\n\ncolorectal carcinomapregnancycrc-pThe content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.\n==== Body\nIntroduction\nMost frequent cancers associated with pregnancy are melanoma, breast cancer, cervical cancer, lymphomas, and leukemias, in the order of decreasing frequency [1]. Although colorectal carcinoma (CRC) is the second most common cancer in women worldwide, colorectal carcinoma in pregnancy (CRC-p) is rare and is often associated with poor prognosis. We describe a case of stage III adenocarcinoma of sigmoid colon diagnosed during the second trimester of pregnancy.\n\nCase presentation\nA 31-year-old female gravida 2 para 1 (G2P1) in her 21st week of pregnancy was evaluated in the emergency room (ER) for constipation of 10-day duration. She also endorsed abdominal pain, nausea, and non-bloody vomiting. She denied any hematochezia or melena. The only risk factor for her constipation was her pregnancy. She was not on any medications that could cause constipation, including narcotics, nor did she have any recent surgery or thyroid disorders. On initial evaluation, her vital signs were within normal limits. The physical examination was consistent with her pregnancy. An abdominal sonogram demonstrated a single live intrauterine pregnancy and no other abdominal findings of note. She was prescribed stool softeners and osmotic laxatives and discharged. She returned to the ER the next day with a lack of relief despite using those medications. This time abdominal distention appeared more pronounced, and palpation of the abdomen demonstrated diffuse tenderness. No other changes in clinical or laboratory evaluation were noted. She was reassured and discharged home with the addition of metoclopramide and a stimulant laxative. She presented for a third time to the ER the day after, with worsening vomiting and ongoing constipation. Her vital signs were unremarkable. Pertinent laboratory findings were neutrophilic leukocytosis (total leukocyte count 13.3 x 109/L; reference range 4.5-10 x 109/L) and baseline anemia (hemoglobin 8 g/dL; reference range 12.5-15.5 g/dL). Abdominal radiography revealed dilated small bowel measuring up to 5.4 cm in diameter and stool throughout the colon suspicious for small bowel obstruction. A CT scan of the abdomen showed marked colonic distention with a transition point between distended and collapsed bowel in the region of the sigmoid in addition to the dilated small bowel, concerning for mechanically significant colonic obstruction (Figures 1, 2). No obvious masses were identified. There were ascites and mesenteric edema. She was admitted for further evaluation and management. After multiple attempts, a nasogastric tube was inserted. At this point, general surgery and obstetric services were consulted. After reviewing the risks and benefits of operative and nonoperative management and a possibility of fetal loss since the fetus was still pre-viable, a decision to proceed with the former was made. A subtotal colectomy with ileostomy was done the next day. She was started on intravenous fluids and broad-spectrum antibiotics perioperatively.\n\nFigure 1 Coronal reconstruction from CT scan of the abdomen and pelvis demonstrating colonic distention with abrupt transition to complete collapse in the region of the sigmoid colon (blue arrow) and gravid uterus (red arrow)\nFigure 2 Axial slice from CT scan of the abdomen demonstrating dilated small bowel loops with air-fluid levels\nPostoperatively, indomethacin suppositories were given for 24 hours as a precaution to quiesce the uterus, should uterine activity occur. Fetal viability was confirmed with fetal heart tracing and obstetric ultrasound. Analysis of peritoneal fluid demonstrated no evidence of malignancy. However, a culture of the fluid grew staphylococcal species, which was managed with antibiotics tailored per sensitivity report. Her condition improved, and she started tolerating oral feeds.\n\nPathologic evaluation of the total abdominal colectomy specimen revealed adenocarcinoma with mucinous features of the sigmoid colon measuring 3.5 cm in the largest dimension and six positive lymph nodes out of 16. Pathologic classification was assigned as stage III B: pT3N2a (pTNM, AJCC 8th Edition) [2]. The histologic grade was determined to be moderately differentiated (G2). Immunohistochemical stains for mismatch repair were negative. A positron emission tomography (PET) CT scan or CT with contrast was not done due to potential fetal adversities. An adjuvant chemotherapy with FOLFOX (folinic acid “FOL,” 5-fluorouracil “F,” and oxaliplatin “OX”) regimen was chosen to prevent recurrence and to prolong progression-free survival. The chemotherapy was deferred until the third trimester as the risk for adverse effects was thought to be minimal in the third trimester, and benefits outweighed the risks of adverse effects. She was eventually discharged home.\n\nShe was followed up regularly as an outpatient. She was started on the FOLFOX regimen in the third trimester as planned. Her pregnancy continued uneventfully, resulting in the birth of a healthy child via normal vaginal delivery in the 39th week. She received five cycles of chemotherapy before delivery. During the hospitalization for confinement, she was noted to have stable mild anemia and thrombocytopenia, possibly due to chemotherapy. The FOLFOX regimen was resumed after delivery. A CT scan of the abdomen with contrast obtained one month after childbirth revealed no evidence of metastasis, but an 11 mm para-aortic lymph node. She completed 12 cycles of FOLFOX with the development of adverse effects, including anemia, thrombocytopenia, and peripheral neuropathy. She remained healthy and maintained a functioning ileostomy. At the time of writing this, an ileostomy reversal is being planned.\n\nDiscussion\nThe most common cancers associated with pregnancy are melanoma, breast cancer, cervical cancer, lymphomas, and leukemia, most of which have a peak incidence in the reproductive age group. CRC is usually more common above the age of 50. However, CRC incidence among individuals under the age of 50 in the United States steadily increased at a rate of 2.1% per year from 1992 to 2012 [3]. It has continued the trend since then. Also, the average age of first-time mothers increased 4.9 years from 1970 to 2014, from 21.4 to 26.3 years [4]. With advancing maternal age, malignancies in pregnancy including CRC-p are becoming increasingly frequent. The estimated incidence of CRC-p is 1 in 13,000 cases [5]. Although the incidence of CRC-p is very low, it parallels the trend of the increase in the incidence of CRC in younger individuals.\n\nAge is a significant risk factor for CRC, and the incidence increases significantly with advancing age. In an extensive systematic review of 41 cases of CRC-p by Bernstein et al., the mean age at presentation was found to be 31 (range 16-41) years [5]. Another review by Pellino et al. had similar findings, with a median age at presentation of 32 (range 17-46) years [6]. Apart from the risk factors for sporadic CRC such as age, African American inheritance, high red meat consumption, obesity, etc., no specific risk factors for CRC-p has been identified. Colon cancer caused by familial adenomatous polyposis has also been reported in pregnancy [7].\n\nUpon review of previously reported cases, the involvement of colon and rectum have been seen in comparable frequencies. Common presenting symptoms include bleeding per rectum, abdominal pain, vomiting, and constipation. There were bowel obstruction and perforation in some cases [6]. Cases presenting with intussusception have also been reported [8]. The diagnosis of CRC-p is quite challenging. Since the symptoms such as abdominal pain and constipation are common in pregnancy, they can be easily overlooked. Also, diagnostic workup such as imaging and colonoscopies are not often pursued in the pregnant population due to potential risks to the fetus. Even when the workup is done, pregnancy can interfere with the sensitivity and specificity of these diagnostic tests. All these can result in a delay in diagnosis and advanced stages at presentation. The Duke stage at presentation was B or above in all the cases in one series involving 41 cases [5].\n\nThe diagnosis depends on the nature of the presentation. In our case, the patient presented with small bowel obstruction, which was managed with emergent surgical intervention. Subsequent pathological evaluation of the surgical specimen led to the diagnosis. Colonoscopies remain an invaluable tool for the determination of CRC in the pregnant population as well. Colonoscopy during pregnancy is of low risk for mother and child in all three trimesters of pregnancy [9]. A retrospective study determined that colonoscopies are relatively safe during the second trimester, without substantial fetal risks [10]. Potential complications of colonoscopy specific to pregnancy include placental abruption, fetal injury, or loss. The imaging modality of choice for the abdomen and pelvis in pregnancy is MRI. The safety of contrast is not proven in pregnancy and is better avoided [11]. CT scan of the abdomen and pelvis can also be performed when a fetal radiation threshold of 100 milligrays is maintained [12,13]. CT scan of other regions for staging purposes can be done with adequate abdominal shielding. Abdominal ultrasonography is also a safe diagnostic tool to evaluate metastatic disease, especially in the liver. Endoluminal ultrasonography can aid in confirming the staging of rectal lesions. Carcinoembryonic antigen (CEA) is elevated but within the normal range during pregnancy. Elevated CEA above normal is useful as a prognostic factor and should be periodically monitored.\n\nThere are no incidences of the fetal spread of malignancy noted in any of the reported cases of CRC-p. The fetal risk from the malignancy itself is minimal. Placental metastasis is extremely rare and has been reported only once [14]. The incidence of ovarian metastasis is said to be as high as 25% in pregnancy, compared to 5% in non-pregnant female population [15]. Management of CRC-p depends on many factors such as stage, nature of the presentation, disease progression, gestational age, and patient wishes. The mainstays of treatment are surgical resection and chemotherapy. The current consensus on the timing of surgery is immediately after the diagnosis if the gestational age is less than 20 weeks, and one to two weeks after delivery if the gestational age is more than 20 weeks [16]. Despite frequent metastasis to ovaries, routine oophorectomy is not recommended. Premature delivery and low birth weight have been reported to occur twice as numerous following surgeries compared to the general pregnant population. Chemotherapy is recommended in patients in stage III. Chemotherapy is avoided in the first trimester due to harmful effects on organogenesis. 5-fluorouracil-based chemotherapy regimens are frequently utilized due to its relative safety in the second and third trimesters, with a lower risk of abortion and fetal malformation [1,17]. However, stillbirth, intrauterine growth restriction, and fetal toxicities are found to occur more frequently in patients who received chemotherapy after the first trimester [18]. Hence the decision-making related to chemotherapy whenever appropriate, should be left primarily to the patient herself. Radiotherapy is not useful in colon cancer and is especially avoided in pregnancy [1]. In the first half of pregnancy, abortion is offered, should the patient no longer wish to proceed with the pregnancy. The mode of delivery is determined based on obstetric parameters and is not affected by the diagnosis of cancer itself. The approach to CRC-p is multimodal and involves teamwork, including the oncologist and obstetrician.\n\nThe prognosis of CRC-p has been reported variably. Many systematic reviews reported similar prognosis when compared to the general population, despite advanced stages at presentation [5,19]. One case series indicated a significantly poorer prognosis compared to the general population [20]. The median survival was 42 (range 0-120) months in one systematic review [6]. The overall two-year survival was found to be 64.4% in another series [19].\n\nConclusions\nColorectal carcinoma in pregnancy is a devastating diagnosis, adding immense physical and emotional stress to the expectant mother and family. Attention to persistent non-specific symptoms in pregnancy, early diagnosis, and therapy driven by shared decision making are vital in addressing this unfortunate situation.\n\nThe authors have declared that no competing interests exist.\n\nHuman Ethics\nConsent was obtained by all participants in this study\n==== Refs\nReferences\n1 Cancer during pregnancy: the oncologist overview World J Oncol Hepner A Negrini D Hase EA 28 34 10 2019 30834049 \n2 AJCC Cancer Staging Manual (8th edition) Amin MB Edge S Greene F 251 274 Chicago Springer International Publishing 1 2017 \n3 Cancer statistics 2016 CA Cancer J Clin Siegel RL Miller KD Jemal A 7 30 66 2016 26742998 \n4 Mean age of mothers is on the rise: United States, 2000-2014 NCHS data brief Mathews TJ Hamilton BE 1 8 232 2016 https://www.cdc.gov/nchs/data/databriefs/db232.pdf \n5 Colon and rectal cancer in pregnancy Dis Colon Rectum Bernstein MA Madoff RD Caushaj PF 172 178 36 1993 8425421 \n6 Colorectal cancer diagnosed during pregnancy: systematic review and treatment pathways Eur J Gastroenterol Hepatol Pellino G Simillis C Kontovounisios C 743 753 29 2017 28252463 \n7 Synchronous rectal and colon cancer caused by familial polyposis coli during pregnancy J Obstet Gynaecol Res Lolis ED Likoudis P Voiniadis P Hassiakos D Samanides L 199 202 33 2007 17441896 \n8 Intussusception caused by colon cancer in pregnancy Korean J Gastroenterol Kim K Ko M Sim HC Kim CL Jung YJ Kim TO 355 359 73 2019 https://www.researchgate.net/publication/334064671_Intussusception_Caused_by_Colon_Cancer_in_Pregnancy 31234626 \n9 Does lower gastrointestinal endoscopy during pregnancy pose a risk for mother and child? - a systematic review BMC Gastroenterol de Lima A Galjart B Wisse PHA Bramer WM van der Woude CJ 15 15 2015 25849032 \n10 Safety and efficacy of colonoscopy during pregnancy: an analysis of pregnancy outcome in 20 patients J Reprod Med Cappell MS Fox SR Gorrepati N 115 123 55 2010 https://europepmc.org/article/med/20506671 20506671 \n11 Pregnancy and the safety of magnetic resonance imaging Magn Reson Imaging Clin N Am Kanal E 309 317 2 1994 7489290 \n12 Difficulties with diagnosis of malignancies in pregnancy Best Pract Res Clin Obstet Gynaecol de Haan J Vandecaveye V Han SN van de Vijver KK Amant F 19 32 33 2016 26586541 \n13 Pregnancy and radiation Cancer Treat Rev Fenig E Mishaeli M Kalish Y Lishner M 1 7 27 2001 11237773 \n14 Placental and fetal involvement by maternal malignancy: a report of rectal carcinoma and review of the literature Am J Obstet Gynecol Rothman LA Cohen CJ Astarloa J 1023 1034 116 1973 4718214 \n15 Malignant ovarian tumors associated with pregnancy: report of six cases Int J Gynaecol Obstet Matsuyama T Tsukamoto N Matsukuma K Kamura T Kaku T Saito T 61 66 28 1989 2565833 \n16 Cancer of the colon, rectum, and anus during pregnancy: the surgeon’s perspective Gastroenterol Clin North Am Walsh C Fazio VW 257 267 27 1998 9546093 \n17 Gastrointestinal, urologic and lung malignancies during pregnancy Recent Results Cancer Res Pentheroudakis G Pavlidis N 137 164 178 2008 18080450 \n18 Cancer chemotherapy and pregnancy J Obstet Gynaecol Can Koren G Carey N Gagnon R Maxwell C Nulman I Senikas V 263 278 35 2013 23470115 \n19 Management and outcome of colorectal cancer during pregnancy: report of 41 cases Acta Chir Belg Kocián P de Haan J Cardonick EH 166 175 119 2019 30010511 \n20 Carcinoma of the colon during pregnancy Obstet Gynecol Surv Shushan A Stemmer SM Reubinoff BE Eid A Weinstein D 222 225 47 1992 1553155\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2168-8184",
"issue": "12(7)",
"journal": "Cureus",
"keywords": "colorectal carcinoma; crc-p; pregnancy",
"medline_ta": "Cureus",
"mesh_terms": null,
"nlm_unique_id": "101596737",
"other_id": null,
"pages": "e9491",
"pmc": null,
"pmid": "32879815",
"pubdate": "2020-07-31",
"publication_types": "D002363:Case Reports",
"references": "26828319;17441896;8425421;2565833;18080450;30834049;23470115;28252463;26742998;26586541;4718214;9546093;30010511;11237773;25849032;20506671;1553155;7489290;31234626",
"title": "Adenocarcinoma of Sigmoid Colon Diagnosed in Pregnancy: A Case Report.",
"title_normalized": "adenocarcinoma of sigmoid colon diagnosed in pregnancy a case report"
} | [
{
"companynumb": "US-ACCORD-201064",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "FLUOROURACIL"
},
"drugadditional": null,
"dr... |
{
"abstract": "Antibiotic-induced fever is a probably underestimated complication, which may be misdiagnosed as new infection. In this study, characteristics, diagnostic approach, and outcome of antibiotic-induced fever in patients treated for musculoskeletal infections are described.\n\n\n\nWe retrospectively reviewed all patients with antibiotic-induced fever after surgery treated at our institution from 2014 to 2017. Antibiotic-induced fever was diagnosed, if the following criteria were fulfilled: (i) central (ear) body temperature > 38.0 °C; (ii) intravenous antibiotics for > three days; (iii) exclusion of infectious or other non-infectious causes of fever; and (iv) defervescence after discontinuation of antibiotics.\n\n\n\nWe included 11 patients (median age 51 years) treated for infection after fracture fixation (n = 5), periprosthetic joint infections (n = 3), infection after spinal instrumentation (n = 1), and soft tissue infection (n = 2). The suspected antibiotics inducing fever were beta-lactam antibiotics (n = 9), vancomycin (n = 3), daptomycin (n = 2), clindamycin, and meropenem (n = 1 each). Additional clinical findings were reduced general condition, generalized exanthema, and rigors, whereas five patients were asymptomatic apart from a fever. Leukopenia was observed in nine patients and increase of C-reactive protein value in ten patients. Fever occurred after a median of 20 days of antibiotic treatment and resolved after a median of one day after discontinuation of the suspected antibiotic.\n\n\n\nAntibiotics should be considered as the possible cause of fever in orthopaedic patients receiving antimicrobial treament whenever clinical signs of new or persisting infection are lacking. Important hints suggestive for antibiotic-induced fever are good general condition despite high temperature and progressive leukopenia. Discontinuation or change to another substance leads to prompt defervescence, preventing unnecessary diagnostic procedures and antibiotic treatment.",
"affiliations": "Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Center for Musculoskeletal Surgery (CMSC), Charitéplatz 1, D-10117, Berlin, Germany.;Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Center for Musculoskeletal Surgery (CMSC), Charitéplatz 1, D-10117, Berlin, Germany.;Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Center for Musculoskeletal Surgery (CMSC), Charitéplatz 1, D-10117, Berlin, Germany.;Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Center for Musculoskeletal Surgery (CMSC), Charitéplatz 1, D-10117, Berlin, Germany.;Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Center for Musculoskeletal Surgery (CMSC), Charitéplatz 1, D-10117, Berlin, Germany. nora.renz@charite.de.",
"authors": "Labbus|Kirsten|K|;Junkmann|Jana Karina|JK|;Perka|Carsten|C|;Trampuz|Andrej|A|;Renz|Nora|N|http://orcid.org/0000-0001-8011-6684",
"chemical_list": "D000900:Anti-Bacterial Agents",
"country": "Germany",
"delete": false,
"doi": "10.1007/s00264-018-3909-8",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0341-2695",
"issue": "42(8)",
"journal": "International orthopaedics",
"keywords": "Adverse event; Antibiotic; Fever; Musculoskeletal infections",
"medline_ta": "Int Orthop",
"mesh_terms": "D000328:Adult; D000368:Aged; D000900:Anti-Bacterial Agents; D003937:Diagnosis, Differential; D005260:Female; D005334:Fever; D006801:Humans; D007239:Infections; D008297:Male; D008875:Middle Aged; D009140:Musculoskeletal Diseases; D019637:Orthopedic Procedures; D011183:Postoperative Complications; D012189:Retrospective Studies",
"nlm_unique_id": "7705431",
"other_id": null,
"pages": "1775-1781",
"pmc": null,
"pmid": "29600426",
"pubdate": "2018-08",
"publication_types": "D016428:Journal Article",
"references": "18416314;2815075;26579799;25346755;23490338;20409256;11949753;26984075;10090118;24176478;7463680;20030474;27810308;27440850",
"title": "Antibiotic-induced fever in orthopaedic patients-a diagnostic challenge.",
"title_normalized": "antibiotic induced fever in orthopaedic patients a diagnostic challenge"
} | [
{
"companynumb": "DE-MYLANLABS-2018M1060606",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PIPERACILLIN SODIUM\\TAZOBACTAM SODIUM"
},
"d... |
{
"abstract": "Rituximab added to chemotherapy prolongs survival among adults with B-cell cancer. Data on its efficacy and safety in children with high-grade, mature B-cell non-Hodgkin's lymphoma are limited.\n\n\n\nWe conducted an open-label, international, randomized, phase 3 trial involving patients younger than 18 years of age with high-risk, mature B-cell non-Hodgkin's lymphoma (stage III with an elevated lactate dehydrogenase level or stage IV) or acute leukemia to compare the addition of six doses of rituximab to standard lymphomes malins B (LMB) chemotherapy with standard LMB chemotherapy alone. The primary end point was event-free survival. Overall survival and toxic effects were also assessed.\n\n\n\nAnalyses were based on 328 patients who underwent randomization (164 patients per group); 85.7% of the patients had Burkitt's lymphoma. The median follow-up was 39.9 months. Events were observed in 10 patients in the rituximab-chemotherapy group and in 28 in the chemotherapy group. Event-free survival at 3 years was 93.9% (95% confidence interval [CI], 89.1 to 96.7) in the rituximab-chemotherapy group and 82.3% (95% CI, 75.7 to 87.5) in the chemotherapy group (hazard ratio for primary refractory disease or first occurrence of progression, relapse after response, death from any cause, or second cancer, 0.32; 95% CI, 0.15 to 0.66; one-sided P = 0.00096, which reached the significance level required for this analysis). Eight patients in the rituximab-chemotherapy group died (4 deaths were disease-related, 3 were treatment-related, and 1 was from a second cancer), as did 20 in the chemotherapy group (17 deaths were disease-related, and 3 were treatment-related) (hazard ratio, 0.36; 95% CI, 0.16 to 0.82). The incidence of acute adverse events of grade 4 or higher after prephase treatment was 33.3% in the rituximab-chemotherapy group and 24.2% in the chemotherapy group (P = 0.07); events were related mainly to febrile neutropenia and infection. Approximately twice as many patients in the rituximab-chemotherapy group as in the chemotherapy group had a low IgG level 1 year after trial inclusion.\n\n\n\nRituximab added to standard LMB chemotherapy markedly prolonged event-free survival and overall survival among children and adolescents with high-grade, high-risk, mature B-cell non-Hodgkin's lymphoma and was associated with a higher incidence of hypogammaglobulinemia and, potentially, more episodes of infection. (Funded by the Clinical Research Hospital Program of the French Ministry of Health and others; ClinicalTrials.gov number, NCT01516580.).",
"affiliations": "From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).;From the Departments of Pediatric and Adolescent Oncology (V.M.-C., C.P.) and Clinical Research (G.V.), INSERM Unité 1015 (V.M.-C.), and the Unit of Biostatistics and Epidemiology and INSERM Unité 1018 (A.A.), Gustave Roussy, Université Paris-Saclay, Villejuif, France; the Department of Pediatric Hematology and Oncology, University of Padua, Padua, Italy (M.P.); the Department of Paediatric Haematology, Oncology, and Palliative Care, Cambridge University Hospitals NHS Foundation Trust, Addenbrooke's Hospital, Cambridge (G.A.A.B.), Cancer Research UK Clinical Trials Unit, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham (K.W.), and the Department of Histopathology, Royal Marsden NHS Foundation Trust, London (A.W.) - all in the United Kingdom; the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (D.A.B.); the Department of Pediatric Hematology and Oncology, University of Valencia, Valencia, Spain (R.F.D.); the Division of Haematology-Oncology, Hospital for Sick Children, Toronto (S.A.); the Department of Pediatric Hematology and Oncology, University Hospitals Leuven, Leuven, Belgium (A.U.); the Center for Cancer and Immunology Research, Children's National Health System and George Washington University, Washington, DC (C.M.B.); Princess Máxima Center for Pediatric Oncology, Utrecht, the Netherlands (J.Z.); the Department of Pediatric Hematology and Oncology, Semmelweis University, Budapest, Hungary (M.C.); the Department of Pediatric Bone Marrow Transplantation, Oncology, and Hematology, Wroclaw Medical University, Wroclaw, Poland (B.K.); the Department of Pediatrics and Adolescent Medicine, Li Ka Shing Faculty of Medicine, Queen Mary Hospital, University of Hong Kong, Hong Kong (A.K.C.); the Department of Pathology, University of Utah, Salt Lake City (R.R.M.); Children's Hospital of Philadelphia, Philadelphia (P.C.A.); and the National Cancer Institute, Center for Global Health, Rockville, MD (T.G.G.).",
"authors": "Minard-Colin|Véronique|V|0000-0002-0296-5207;Aupérin|Anne|A|;Pillon|Marta|M|;Burke|G A Amos|GAA|;Barkauskas|Donald A|DA|;Wheatley|Keith|K|;Delgado|Rafael F|RF|;Alexander|Sarah|S|;Uyttebroeck|Anne|A|;Bollard|Catherine M|CM|;Zsiros|József|J|;Csoka|Monika|M|;Kazanowska|Bernarda|B|;Chiang|Alan K|AK|0000-0002-1089-5325;Miles|Rodney R|RR|;Wotherspoon|Andrew|A|;Adamson|Peter C|PC|;Vassal|Gilles|G|;Patte|Catherine|C|;Gross|Thomas G|TG|;|||;|||",
"chemical_list": "D000074322:Antineoplastic Agents, Immunological; D000069283:Rituximab",
"country": "United States",
"delete": false,
"doi": "10.1056/NEJMoa1915315",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0028-4793",
"issue": "382(23)",
"journal": "The New England journal of medicine",
"keywords": null,
"medline_ta": "N Engl J Med",
"mesh_terms": "D000293:Adolescent; D000074322:Antineoplastic Agents, Immunological; D000971:Antineoplastic Combined Chemotherapy Protocols; D002648:Child; D002675:Child, Preschool; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D007239:Infections; D007262:Infusions, Intravenous; D053208:Kaplan-Meier Estimate; D016393:Lymphoma, B-Cell; D008297:Male; D009503:Neutropenia; D000077982:Progression-Free Survival; D000069283:Rituximab",
"nlm_unique_id": "0255562",
"other_id": null,
"pages": "2207-2219",
"pmc": null,
"pmid": "32492302",
"pubdate": "2020-06-04",
"publication_types": "D017428:Clinical Trial, Phase III; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't",
"references": "28251914;31283408;20516455;28542862;30772656;17132719;27080498;15486066;23802659;7973215;30341058;22940833;26681685;26304908;26887776;31369199;17138821;30926794",
"title": "Rituximab for High-Risk, Mature B-Cell Non-Hodgkin's Lymphoma in Children.",
"title_normalized": "rituximab for high risk mature b cell non hodgkin s lymphoma in children"
} | [
{
"companynumb": "NVSC2020FR169338",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": null,
"dr... |
{
"abstract": "We documented the adjunctive bacteriophage therapy to treat a chronic relapsing periprosthetic joint infection of the knee and chronic osteomyelitis of the femur caused by multidrug-resistant Pseudomonas aeruginosa The combined antibiotic-phage treatment eradicated the infection, and no side effects to phages were observed.",
"affiliations": "Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, Berlin Institute of Health, Center for Musculoskeletal Surgery, Berlin, Germany tamta.tkhilaishvili@charite.de.;Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, Berlin Institute of Health, Center for Musculoskeletal Surgery, Berlin, Germany.;Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, Berlin Institute of Health, Center for Musculoskeletal Surgery, Berlin, Germany.;Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, Berlin Institute of Health, Center for Musculoskeletal Surgery, Berlin, Germany.;Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, Berlin Institute of Health, Center for Musculoskeletal Surgery, Berlin, Germany.",
"authors": "Tkhilaishvili|Tamta|T|;Winkler|Tobias|T|;Müller|Michael|M|;Perka|Carsten|C|;Trampuz|Andrej|A|",
"chemical_list": "D000900:Anti-Bacterial Agents",
"country": "United States",
"delete": false,
"doi": "10.1128/AAC.00924-19",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0066-4804",
"issue": "64(1)",
"journal": "Antimicrobial agents and chemotherapy",
"keywords": "MDR Pseudomonas aeruginosa; bacteriophage therapy; biofilm infections; periprosthetic joint infection",
"medline_ta": "Antimicrob Agents Chemother",
"mesh_terms": "D000369:Aged, 80 and over; D000900:Anti-Bacterial Agents; D003131:Combined Modality Therapy; D020878:Device Removal; D024901:Drug Resistance, Multiple, Bacterial; D005260:Female; D006801:Humans; D007719:Knee Joint; D007720:Knee Prosthesis; D010019:Osteomyelitis; D000071059:Phage Therapy; D016459:Prosthesis-Related Infections; D011552:Pseudomonas Infections; D011550:Pseudomonas aeruginosa; D012008:Recurrence",
"nlm_unique_id": "0315061",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "31527029",
"pubdate": "2019-12-20",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "22396736;15483283;24766536;30763536;30687285;28643099;29459853;19673983;30597868;25761060;28971508;29886257;20810181;30236955;24600439;30650088;28583189;29119440;26419763;28076361;28807909;31092596;30406049",
"title": "Bacteriophages as Adjuvant to Antibiotics for the Treatment of Periprosthetic Joint Infection Caused by Multidrug-Resistant Pseudomonas aeruginosa.",
"title_normalized": "bacteriophages as adjuvant to antibiotics for the treatment of periprosthetic joint infection caused by multidrug resistant pseudomonas aeruginosa"
} | [
{
"companynumb": "DE-PFIZER INC-2020046989",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "COLISTIN"
},
"drugadditional": null,
... |
{
"abstract": "Fourteen patients with acute myocardial infarction were given 0.3 mg sublingual nitroglycerin within the first 12 hours of their acute myocardial infarction. Five minutes after sublingual nitroglycerin mean arterial pressure fell 9 mmHg (1.2 kPa) and remained significantly reduced for 30 minutes. Pulmonary capillary wedge pressure fell from a mean control value of 17 to 12 mmHg (2.3 to 1.6 kPa) and also remained reduced for 30 minutes. Heart rate was significantly raised and stroke work index reduced at five minutes. Patients with a stroke work index of greater than 55 g m per m-2 b.s.a. responed to nitroglycerin with a fall in both pulmonary capillary wedge pressue and strokework index while in those with a stroke work index of less than 55 g m per m-2 b.s.a. stroke work index did not fall concomitantly with the fall in pulmonary capillary wedge pressure. In one patient, nitroglycerin led to a precipitious fall in arterial pressure andrecurrence of chest pain.",
"affiliations": null,
"authors": "Delgado|C E|CE|;Pitt|B|B|;Taylor|D R|DR|;Weisfeldt|M L|ML|;Kelly|D T|DT|",
"chemical_list": "D005996:Nitroglycerin",
"country": "England",
"delete": false,
"doi": "10.1136/hrt.37.4.392",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0007-0769",
"issue": "37(4)",
"journal": "British heart journal",
"keywords": null,
"medline_ta": "Br Heart J",
"mesh_terms": "D000208:Acute Disease; D001794:Blood Pressure; D002302:Cardiac Output; D003864:Depression, Chemical; D005260:Female; D006339:Heart Rate; D006801:Humans; D008297:Male; D008875:Middle Aged; D009060:Mouth Floor; D009203:Myocardial Infarction; D005996:Nitroglycerin; D010146:Pain; D013997:Time Factors; D014655:Vascular Resistance",
"nlm_unique_id": "0370634",
"other_id": null,
"pages": "392-6",
"pmc": null,
"pmid": "804910",
"pubdate": "1975-04",
"publication_types": "D016428:Journal Article; D013487:Research Support, U.S. Gov't, P.H.S.",
"references": "4125161;4631342;4628187;4551026;4781232;4726241;4696794;4954412",
"title": "Role of sublingual nitroglycerin in patients with acute myocardial infarction.",
"title_normalized": "role of sublingual nitroglycerin in patients with acute myocardial infarction"
} | [
{
"companynumb": "US-PFIZER INC-2016468218",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "LIDOCAINE HYDROCHLORIDE"
},
"drugadditional":... |
{
"abstract": "We describe a case of a 19-year-old female presenting with Mycobacterium bovis meningitis, a rarely encountered infection. We discuss the use of pyrosequencing to aid in prompt diagnosis of M. bovis infection, as well as treatment strategies and challenges given the organism's intrinsic resistance to pyrazinamide.",
"affiliations": "Department of Neurology, Stanford University School of Medicine, Stanford, California, USA.;Division of HIV, ID and Global Medicine, Department of Medicine, University of California, San Francisco, San Francisco, California, USA.",
"authors": "Clifford|Katherine M|KM|0000-0001-6969-4846;Szumowski|John D|JD|0000-0002-0287-9704",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1093/ofid/ofaa475",
"fulltext": "\n==== Front\nOpen Forum Infect Dis\nOpen Forum Infect Dis\nofid\nOpen Forum Infectious Diseases\n2328-8957 Oxford University Press US \n\n10.1093/ofid/ofaa475\nofaa475\nNovel ID Cases\nAcademicSubjects/MED00290\nDisseminated Mycobacterium bovis Infection Complicated by Meningitis and Stroke: A Case Report\nhttp://orcid.org/0000-0001-6969-4846Clifford Katherine M 1 http://orcid.org/0000-0002-0287-9704Szumowski John D 2 1 \nDepartment of Neurology, Stanford University School of Medicine, Stanford, California, USA\n2 \nDivision of HIV, ID and Global Medicine, Department of Medicine, University of California, San Francisco, San Francisco, California, USA\nCorrespondence: Katherine Clifford, MD, Department of Neurology, Stanford University School of Medicine, 300 Pasteur Drive, Palo Alto, CA 94305 (kcliffo2@stanford.edu).\n10 2020 \n07 10 2020 \n07 10 2020 \n7 10 ofaa47508 8 2020 29 9 2020 30 9 2020 26 10 2020 © The Author(s) 2020. Published by Oxford University Press on behalf of Infectious Diseases Society of America.2020This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs licence (http://creativecommons.org/licenses/by-nc-nd/4.0/), which permits non-commercial reproduction and distribution of the work, in any medium, provided the original work is not altered or transformed in any way, and that the work is properly cited. For commercial re-use, please contact journals.permissions@oup.comAbstract\nWe describe a case of a 19-year-old female presenting with Mycobacterium bovis meningitis, a rarely encountered infection. We discuss the use of pyrosequencing to aid in prompt diagnosis of M. bovis infection, as well as treatment strategies and challenges given the organism’s intrinsic resistance to pyrazinamide.\n\nbovismeningitistuberculosisUniversity of California San Francisco Open Access Publishing Fund\n==== Body\nDespite advances in antituberculous chemotherapy, tuberculous meningitis (TBM) remains associated with significant morbidity and mortality [1, 2]. Although most commonly associated with Mycobacterium tuberculosis (Mtb), other members of the Mtb complex can cause central nervous system (CNS) disease. Indeed, in the early 20th century, Mycobacterium bovis (M. bovis) caused ~25% of cases of TBM [3] and was particularly a concern for young children [4]. As M. bovis infection is largely attributed to transmission from cattle and consumption of unpasteurized milk, its incidence has dramatically decreased in developed countries following implementation of milk pasteurization and bovine tuberculosis surveillance. However, these improvements have not been universal, and substantial rates of M. bovis disease have been noted in immigrant communities [5, 6]. Rarely, cases of meningitis with M. bovis BCG have been reported complicating BCG vaccination [7].\n\nThere remain significant gaps in our understanding of M. bovis disease and its management. While M. bovis has been associated with a higher proportion of extrapulmonary manifestations than Mtb [8], rates of CNS disease might be similar [5]. Published experience in the management of CNS M. bovis, however, is limited to individual case reports and small series [5, 9–12], and there are no major treatment guidelines available.\n\nWe report a case of a young female presenting with disseminated M. bovis infection complicated by meningitis and stroke secondary to TB vasculitis, managed with the addition of corticosteroids, aspirin, and levofloxacin to her TB regimen.\n\nCASE PRESENTATION\nA 19-year-old female with a medical history of cerebral palsy, developmental delay, and prior seizures presented to an outside hospital with nausea, vomiting, abdominal distension, and fevers. She was found to have bilateral tubo-ovarian abscesses (TOAs) and was treated for presumed pelvic inflammatory disease with ampicillin-sulbactam, metronidazole, and doxycycline. Following discharge, she continued to have worsening abdominal distension, nausea, anorexia, and weight loss. She presented again to an outside hospital about 6 months later.\n\nComputed tomography (CT) imaging of the abdomen and pelvis at that time was notable for bilateral TOA, mesenteric and omental nodularity, and bilateral pulmonary nodules. Drainage from her TOA and tissue from a retroperitoneal lymph node biopsy were both smear-negative for acid fast bacilli (AFB). However, both samples were positive for M. tuberculosis complex on molecular testing (TOA fluid via real-time PCR at Quest Diagnostics, San Juan Capistrano, CA, USA, and lymph node tissue via Cepheid Xpert MTB/RIF assay). She was diagnosed with tuberculosis with peritoneal and pulmonary involvement and was transferred to our hospital for ongoing management.\n\nHer developmental history was notable for premature birth and being nonverbal at baseline. Social history was notable for prior residence on a farm in Mexico, where she lived in close proximity to cattle. She was not known to be immunocompromised, and fourth-generation HIV enzyme-linked immunosorbent assay was negative. She had no history of treatment for active or latent tuberculosis and no known tuberculosis (TB) contacts.\n\nOn presentation to our hospital, she was noted to have nuchal rigidity and ongoing nausea and vomiting. A head CT scan demonstrated multiple small ring-enhancing parenchymal lesions in the left frontal lobe and left cerebellar vermis, along with bilateral supratentorial sulcal enhancement concerning for CNS tuberculosis with tuberculomas and meningitis (Figure 1).\n\nFigure 1. Contrast-enhanced computed tomography imaging on presentation demonstrating tuberculomas (arrows) in the left frontal lobe and left cerebellar vermis.\n\nTreatment for tuberculosis was initiated—rifampin 600 mg/d (15 mg/kg; patient weight, 38 kg), isoniazid 300 mg/d, pyrazinamide 750 mg/d, and ethambutol 600 mg/d—and the patient was started on adjunctive dexamethasone 0.4 mg/kg intravenously daily, using the tapered regimen reported by Thwaites and colleagues [13]. Cerebrospinal fluid (CSF) testing showed a white blood cell count of 115 cells/mcL (56% lymphocytes), protein 98 mg/dL, and glucose 20 mg/dL. AFB smear was negative, but CSF cultures were ultimately positive for M. tuberculosis complex. Culture from her TOA fluid also grew M. tuberculosis complex, whereas culture from her retroperitoneal lymph node biopsy was negative.\n\nAfter 2 days of treatment, ethambutol was discontinued due to concern for difficulty monitoring potential ocular toxicity given her cognitive impairment, and levofloxacin 750 mg/d was started. On day 5 of hospitalization, she was noted to have new left-sided hemiplegia, and magnetic resonance imaging of the brain was consistent with acute infarct likely secondary to TB vasculitis (Figure 2). Aspirin 162 mg daily was initiated due to its potential benefit in stroke reduction in TBM [14, 15].\n\nFigure 2. Diffusion-weighted image (DWI) magnetic resonance imaging sequence demonstrating acute ischemic infarct affecting the right basal ganglia. Areas of restricted diffusion were visualized in the right corona radiata, posterior limb of the internal capsule, and putamen, as well as in the left anterior centrum semiovale.\n\nOnce a sample of pelvic abscess fluid yielded growth of acid fast bacilli, the sample was sent by clinician request to the California Department of Public Health for pyrosequencing and showed that her disease was actually due to M. bovis, based on pncA sequencing. Pyrazinamide was discontinued given the organism’s intrinsic resistance, and she was started on linezolid 600 mg/d in order to provide an additional agent with good CNS penetration pending full drug susceptibility test results. Phenotypic susceptibility testing performed via MGIT on isolates from pelvic fluid, and CSF showed that her M. bovis was resistant to pyrazinamide but susceptible to isoniazid, rifampin, ethambutol, and streptomycin. Additional susceptibility testing for her CSF isolate was performed at National Jewish Health via the indirect proportion method on 7H11 agar and showed susceptibility to all tested drugs (amikacin, capreomycin, ethionamide, levofloxacin, moxifloxacin, para-aminosalicylic acid (PAS), and rifabutin). Pyrosequencing also did not detect any resistance-associated mutations for isoniazid, rifampin, quinolones, amikacin, kanamycin, or capreomycin. Linezolid was stopped after 1 month due to induced anemia (nadir hemoglobin 9.3 g/dL from 12.7g/dL). The patient continued treatment with isoniazid, rifampin, levofloxacin, and aspirin, and dexamethasone taper was initiated. She remained stable on this regimen, with an anticipated total treatment duration of 12 months. There has been no clinical evidence of recurrent infarcts, and there were no new neurological sequelae on follow-up several months later.\n\nCONCLUSIONS\nThis case highlights some of the clinical challenges that arise in the management of M. bovis meningitis, a rarely encountered infection. There was a significant lag in diagnosis likely related to difficulties with history and exam given her developmental delay. Unfortunately, even when these communication barriers are not present, the diagnosis of TBM may not be initially considered due to nonspecific symptoms such as fever, headache, vomiting, anorexia, and failure to thrive. Delayed diagnosis in TBM remains a major concern given the poor prognosis associated with more advanced disease [1, 9, 16]. The availability of rapid molecular diagnostic tools such as the Cepheid Xpert MTB/RIF assay has the potential to allow for more timely diagnosis of TB, as in the case reported here, where initial body fluid samples were all smear-negative. However, despite the potential utility of Xpert for the diagnosis of extrapulmonary TB [17], its use on nonrespiratory specimens is considered off-label by the US Food and Drug Administration, and testing of such specimens may not be widely available due to need for laboratory validation.\n\nWhile the prompt recognition of TBM is important for clinical management, working with the clinical laboratory to speciate the mycobacterium may also be helpful, particularly before phenotypic antimicrobial susceptibility results are available. M. bovis is intrinsically resistant to pyrazinamide, so its identification allows this potentially hepatotoxic therapy to be discontinued at an earlier point. In this case, we were fortunate to have access to rapid molecular testing through the California Department of Public Health’s Microbial Diseases Laboratory [18, 19]. The lab’s pyrosequencing assay screens for and reports resistance-associated mutations in multiple bacterial genes associated with drug resistance (ie, rpoB for rifampin); M. bovis is differentiated from M. tuberculosis based on pyrosequencing of the pncA gene [20].\n\nWhat are the therapeutic implications if pyrazinamide cannot be used in the treatment of TB meningitis? Despite its potential toxicities, pyrazinamide is appealing as a part of CNS TB treatment given its good CNS penetration [21]. The impact of omitting pyrazinamide is not entirely clear in the context of 9–12 months of TB meningitis therapy, though its use has been associated with improved outcomes [22]. In our case, identification of M. bovis through pyrosequencing prompted modification of her treatment regimen to include linezolid, an alternative drug with good CNS penetration [23], albeit with limited published experience in TBM [24]. Additional TB drugs known to have good CNS penetration include isoniazid and fluoroquinolones, both of which were included in her treatment, along with the more poorly tolerated second-line drugs cycloserine and ethionamide [21]. The role for newer TB drugs such as bedaquiline and delamanid in TB meningitis remains to be defined, though CSF concentrations may be low for both [25, 26]. Despite promising initial studies, the addition of a fluoroquinolone has not been shown to confer a mortality benefit in TBM [27–29]. Whether there is a benefit to incorporating a fluoroquinolone or an alternative agent with good CNS penetration into TB treatment regimens when pyrazinamide cannot be used remains uncertain.\n\nIn addition to drug choice, drug dosing remains an important consideration in the management of TB meningitis [30]. Rifampin has garnered the most attention in this regard [31] based on animal models suggesting greater efficacy with higher rifampin dosing. Although Ruslami and colleagues found that a 2-week course of intravenous rifampin (13 mg/kg) was associated with reduced mortality compared with standard dosing of oral rifampin (10 mg/kg) [29], a similar mortality benefit was not seen with higher-dose oral rifampin (15 mg/kg) in Vietnam [27]. However, there is ongoing interest in studying even larger doses of rifampin for both pulmonary and meningeal TB [32, 33].\n\nThe optimal duration of therapy for pan-susceptible TB meningitis remains a matter of debate, with current US guidelines recommending a duration of 9–12 months [34]. This uncertainty is reflected by the variation observed in clinical practice globally; for example, nearly half of clinicians in 1 Indian study preferred to treat for 18 months [35]. It is uncertain whether treatment beyond 12 months has a role in the setting of pyrazinamide monoresistance.\n\nDespite the availability of effective antimicrobial agents, patients with TB meningitis remain at risk for paradoxical worsening on therapy (labeled immune reconstitution inflammatory syndrome [IRIS] in HIV+ patients) [36] and severe complications such as vasculitis leading to ischemic stroke, which may be driven by a pathologic immune response [37]. Consequently, there has been considerable interest in the use of adjunctive host-directed therapies in tuberculosis [38]. Corticosteroids have been shown to improve mortality [13], whereas aspirin may reduce the risk of stroke [14, 15]. The optimal dosing of aspirin remains uncertain and is an area of ongoing study [39]; we chose to treat the case patient with 162 mg/d of aspirin to approximate the 150-mg/d dosing used by Misra and colleagues [14]. It is not clear whether corticosteroids and aspirin have similar benefit in cases of CNS M. bovis infection, though it seems reasonable to consider their use, as they are generally recommended in TB meningitis.\n\nIn 1 retrospective case series conducted in Mexico, CNS M. bovis infection was associated with worse outcomes compared with M. tuberculosis, including increased frequency of tuberculomas and neurological sequelae [9]. Whether these differences in outcomes are due to differences in species virulence or immune response, or instead reflect antimicrobial regimens of differing potency, is not clear. While our patient’s disseminated M. bovis infection was complicated by meningitis, tuberculomas, and stroke, to date she has not had additional neurologic complications in the context of a treatment strategy employing drugs with good CNS penetration such as linezolid and levofloxacin, as well as adjunctive corticosteroids and aspirin. Further study is needed to clarify optimal therapy for M. bovis and pyrazinamide-resistant TBM more generally.\n\nAcknowledgments\n\nFinancial support. There were no contributing grants in the production of this article. Publication made possible in part by support from the University of California San Francisco Open Access Publishing Fund.\n\n\nPotential conflicts of interest. No author has any potential conflict of interest related to this article. All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of the manuscript have been disclosed.\n\n\nPatient consent. Our article does not include factors necessitating written patient consent. No human subjects experiments were conducted related to this case report; therefore, approval by local ethical committees was not indicated.\n\n\nAuthor contributions. K.C. and J.S. participated in the literature review and production of the manuscript. All authors reviewed the final manuscript and approved its contents.\n==== Refs\nReferences\n1. \nThwaites GE , van Toorn R , Schoeman J \nTuberculous meningitis: more questions, still too few answers\n. Lancet Neurol 2013 ; 12 :999 –1010\n.23972913 \n2. \nStadelman AM , Ellis J , Samuels THA , et al. Treatment outcomes in adult tuberculous meningitis: a systematic review and meta-analysis\n. Open Forum Infect Dis 2020 ; 7 :ofaa257 .32818138 \n3. \nGriffith AS \nBovine tuberculosis in man\n. Tuberculosis 1937 ; 18 :529 –43\n.\n4. \nNovick N \nThe incidence of bovine infection in tuberculous meningitis\n. J Med Res 1920 ; 41 :239 –46\n.19972503 \n5. \nDankner WM , Waecker NJ , Essey MA , et al. Mycobacterium bovis infections in San Diego: a clinicoepidemiologic study of 73 patients and a historical review of a forgotten pathogen\n. Medicine (Baltimore) 1993 ; 72 :11 –37\n.8426535 \n6. \nGallivan M , Shah N , Flood J \nEpidemiology of human Mycobacterium bovis disease, California, USA, 2003–2011\n. Emerg Infect Dis 2015 ; 21 :435 –43\n.25693687 \n7. \nTardieu M , Truffot-Pernot C , Carriere JP , et al. Tuberculous meningitis due to BCG in two previously healthy children\n. Lancet 1988 ; 1 :440 –1\n.2893868 \n8. \nDürr S , Müller B , Alonso S , et al. Differences in primary sites of infection between zoonotic and human tuberculosis: results from a worldwide systematic review. Phillips RO, ed\n. PLoS Negl Trop Dis 2013 ; 7 :e2399 .24009789 \n9. \nGonzàlez-Duarte A , Ponce de Leon A , Sifuentes Osornio J \nImportance of differentiating Mycobaterium bovis in tuberculous meningitis\n. Neurol Int 2011 ; 3 :e9 .\n10. \nJones PG , Joseph S \nMycobacterium bovis meningitis\n. JAMA 1982 ; 247 :2270 –1\n.7040709 \n11. \nWilkins EG , Griffiths RJ , Roberts C , Green HT \nTuberculous meningitis due to Mycobacterium bovis: a report of two cases\n. Postgrad Med J 1986 ; 62 :653 –5\n.3529067 \n12. \nAlbrecht H , Stellbrink HJ , Eggers C , et al. A case of disseminated Mycobacterium boris infection in an AIDS patient\n. Eur J Clin Microbiol Infect Dis 1995; 14:226–9 .\n13. \nThwaites GE , Nguyen DB , Nguyen HD , et al. Dexamethasone for the treatment of tuberculous meningitis in adolescents and adults\n. N Engl J Med 2004 ; 351 :1741 –51\n.15496623 \n14. \nMisra UK , Kalita J , Nair PP \nRole of aspirin in tuberculous meningitis: a randomized open label placebo controlled trial\n. J Neurol Sci 2010 ; 293 :12 –7\n.20421121 \n15. \nMai NT , Dobbs N , Phu NH , et al. A randomised double blind placebo controlled phase 2 trial of adjunctive aspirin for tuberculous meningitis in HIV-uninfected adults\n. eLife 2018 ; 7 :e33478 .29482717 \n16. \nLincoln EM , Sordillo SVR , Davies PA \nTuberculous meningitis in children: a review of 167 untreated and 74 treated patients with special reference to early diagnosis\n. J Pediatr 1960 ; 57 :807 –23\n.13762229 \n17. \nDenkinger CM , Schumacher SG , Boehme CC , et al. Xpert MTB/RIF assay for the diagnosis of extrapulmonary tuberculosis: a systematic review and meta-analysis\n. Eur Respir J 2014 ; 44 :435 –46\n.24696113 \n18. \nLin SY , Rodwell TC , Victor TC , et al. Pyrosequencing for rapid detection of extensively drug-resistant Mycobacterium tuberculosis in clinical isolates and clinical specimens\n. J Clin Microbiol 2014 ; 52 :475 –82\n.24478476 \n19. \nLowenthal P , Lin SG , Desmond E , et al. Evaluation of the impact of a sequencing assay for detection of drug resistance on the clinical management of tuberculosis\n. Clin Infect Dis 2019 ; 69 :668 –75\n.30383209 \n20. \nScorpio A , Collins D , Whipple D , et al. Rapid differentiation of bovine and human tubercle bacilli based on a characteristic mutation in the bovine pyrazinamidase gene\n. J Clin Microbiol 1997 ; 35 :106 –10\n.8968889 \n21. \nDonald PR \nCerebrospinal fluid concentrations of antituberculosis agents in adults and children\n. Tuberculosis (Edinb) 2010 ; 90 :279 –92\n.20709598 \n22. \nJacobs RF , Sunakorn P , Chotpitayasunonah T , et al. Intensive short course chemotherapy for tuberculous meningitis\n. Pediatr Infect Dis J 1992 ; 11 :194 –8\n.1565533 \n23. \nCresswell FV , Te Brake L , Atherton R , et al. Intensified antibiotic treatment of tuberculosis meningitis\n. Expert Rev Clin Pharmacol 2019 ; 12 :267 –88\n.30474434 \n24. \nSun F , Ruan Q , Wang J , et al. Linezolid manifests a rapid and dramatic therapeutic effect for patients with life-threatening tuberculous meningitis\n. Antimicrob Agents Chemother 2014 ; 58 :6297 –301\n.25092692 \n25. \nAkkerman OW , Odish OF , Bolhuis MS , et al. Pharmacokinetics of bedaquiline in cerebrospinal fluid and serum in multidrug-resistant tuberculous meningitis\n. Clin Infect Dis 2016 ; 62 :523 –4\n.26534926 \n26. \nTucker EW , Pieterse L , Zimmerman MD , et al. Delamanid central nervous system pharmacokinetics in tuberculous meningitis in rabbits and humans\n. Antimicrob Agents Chemother 2019 ; 63 :e00913-19.\n27. \nHeemskerk AD , Bang ND , Mai NT , et al. Intensified antituberculosis therapy in adults with tuberculous meningitis\n. N Engl J Med 2016 ; 374 :124 –34\n.26760084 \n28. \nThwaites GE , Bhavnani SM , Chau TT , et al. Randomized pharmacokinetic and pharmacodynamic comparison of fluoroquinolones for tuberculous meningitis\n. Antimicrob Agents Chemother 2011 ; 55 :3244 –53\n.21502621 \n29. \nRuslami R , Ganiem AR , Dian S , et al. Intensified regimen containing rifampicin and moxifloxacin for tuberculous meningitis: an open-label, randomised controlled phase 2 trial\n. Lancet Infect Dis 2013 ; 13 :27 –35\n.23103177 \n30. \nDavis A , Meintjes G , Wilkinson RJ \nTreatment of tuberculous meningitis and its complications in adults\n. Curr Treat Options Neurol 2018 ; 20 :5 .29492737 \n31. \nSvensson EM , Svensson RJ , Te Brake LHM , et al. The potential for treatment shortening with higher rifampicin doses: relating drug exposure to treatment response in patients with pulmonary tuberculosis\n. Clin Infect Dis 2018 ; 67 :34 –41\n.29917079 \n32. \nDian S , Yunivita V , Ganiem AR , et al. Double-blind, randomized, placebo-controlled phase II dose-finding study to evaluate high-dose rifampin for tuberculous meningitis\n. Antimicrob Agents Chemother 2018 ; 62 :e01014 –18\n.30224533 \n33. \nBoeree MJ , Heinrich N , Aarnoutse R , et al ; PanACEA consortium \nHigh-dose rifampicin, moxifloxacin, and SQ109 for treating tuberculosis: a multi-arm, multi-stage randomised controlled trial\n. Lancet Infect Dis 2017 ; 17 :39 –49\n.28100438 \n34. \nNahid P , Dorman SE , Alipanah N , et al. Official American Thoracic Society/Centers for Disease Control and Prevention/Infectious Diseases Society of America Clinical Practice Guidelines: treatment of drug-susceptible tuberculosis\n. Clin Infect Dis 2016 ; 63 :e147 –95\n.27516382 \n35. \nVibha D , Prasad K \nPrevailing practices in the treatment of tuberculous meningitis (TBM): a cross-sectional study\n. Postgrad Med J 2019 ; 95 :348 –9\n.31085623 \n36. \nSingh AK , Malhotra HS , Garg RK , et al. Paradoxical reaction in tuberculous meningitis: presentation, predictors and impact on prognosis\n. BMC Infect Dis 2016 ; 16 :306 .27329253 \n37. \nTobin DM , Roca FJ , Oh SF , et al. Host genotype-specific therapies can optimize the inflammatory response to mycobacterial infections\n. Cell 2012 ; 148 :434 –46\n.22304914 \n38. \nFrank DJ , Horne DJ , Dutta NK , et al. Remembering the host in tuberculosis drug development\n. J Infect Dis 2019 ; 219 :1518 –24\n.30590592 \n39. \nDonovan J , Thwaites GE , Huynh J \nTuberculous meningitis: where to from here?\n Curr Opin Infect Dis 2020 ; 33 :259 –66\n.32324614\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2328-8957",
"issue": "7(10)",
"journal": "Open forum infectious diseases",
"keywords": "bovis; meningitis; tuberculosis",
"medline_ta": "Open Forum Infect Dis",
"mesh_terms": null,
"nlm_unique_id": "101637045",
"other_id": null,
"pages": "ofaa475",
"pmc": null,
"pmid": "33134425",
"pubdate": "2020-10",
"publication_types": "D002363:Case Reports",
"references": "27329253;24478476;15496623;28100438;7040709;30224533;31383662;2893868;13762229;3529067;19972503;31085623;23103177;30474434;29917079;26534926;23972913;22304914;30383209;1565533;8426535;25693687;29492737;27516382;8968889;30590592;7614965;21502621;25092692;22368776;20709598;24696113;26760084;20421121;24009789;32818138;32324614;29482717",
"title": "Disseminated Mycobacterium bovis Infection Complicated by Meningitis and Stroke: A Case Report.",
"title_normalized": "disseminated mycobacterium bovis infection complicated by meningitis and stroke a case report"
} | [
{
"companynumb": null,
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "LINEZOLID"
},
"drugadditional": null,
"drugadministrationr... |
{
"abstract": "The patient is a 40-kg, 12-year-old Caucasian male with history of asthma who is undergoing an elective inguinal hernia repair. There is no family history of anesthesia-related complications. The surgery proceeds under general anesthesia with an IV induction with propofol, fentanyl, and succinylcholine; intubation under direct laryngoscopy; and maintenance with isoflurane. During the surgery, he develops malignant hyperthermia (MH).\nLearners are to identify the signs of MH, including tachycardia, hypercapnia, muscle rigidity, and renal failure, and provide the appropriate treatment, resuscitation, and follow-up care. Anesthesiology faculty in the room assist and offer guided instruction to aid the learners in achieving these goals.\nThe simulation was completed by 24 medical students with 2 weeks of anesthesia training and daily lectures on various anesthesia topics. Verbal feedback from the learners was positive, and many appreciated the preparation in how to prioritize the management of such a rare but life-threatening anesthesia emergency. Based on reviewers' recommendations, a learner evaluation of the session and pre- and posttest exams have been developed but have not yet been used with learners.\nThe simulation not only was received well by the students but was also crucial to understanding the benefits of simulation training in the field of anesthesiology, especially when rare diseases are difficult to encounter in real life. Future simulations will incorporate other rare but important disease processes in the simulation training environment to allow anesthesia providers to learn in a safe setting without detriment to any patient.",
"affiliations": "Anesthesiology Resident, Department of Anesthesiology, University of Toledo Medical Center.;Fourth-year Medical Student, Wayne State University School of Medicine.;Anesthesiology Resident, Department of Anesthesiology, University of Toledo Medical Center.;Anesthesiology Resident, Department of Anesthesiology, University of Toledo Medical Center.;Anesthesiology Resident, Department of Anesthesiology, University of Toledo Medical Center.;Assistant Professor, Department of Anesthesiology, University of Toledo Medical Center.",
"authors": "Quick|Johnny|J|;Murthy|Rachana|R|;Goyal|Nitin|N|;Margolis|Steven|S|;Pond|Gregory|G|;Jenkins|Kimberly|K|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.15766/mep_2374-8265.10550",
"fulltext": "\n==== Front\nMedEdPORTALMedEdPORTALMEPMedEdPORTAL : the Journal of Teaching and Learning Resources2374-8265Association of American Medical Colleges 10.15766/mep_2374-8265.10550Original PublicationMalignant Hyperthermia: An Anesthesiology Simulation Case for Early Anesthesia Providers Quick Johnny 1Murthy Rachana 2Goyal Nitin 1*Margolis Steven 1Pond Gregory 1Jenkins Kimberly 31 Anesthesiology Resident, Department of Anesthesiology, University of Toledo Medical Center2 Fourth-year Medical Student, Wayne State University School of Medicine3 Assistant Professor, Department of Anesthesiology, University of Toledo Medical Center*Corresponding author: nitin.goyal@utoledo.edu2017 07 3 2017 13 1055014 7 2016 16 2 2017 Copyright © 2017 Quick et al.2017Quick et al.This is an open-access article distributed under the terms of the Creative Commons Attribution license.Introduction\nThe patient is a 40-kg, 12-year-old Caucasian male with history of asthma who is undergoing an elective inguinal hernia repair. There is no family history of anesthesia-related complications. The surgery proceeds under general anesthesia with an IV induction with propofol, fentanyl, and succinylcholine; intubation under direct laryngoscopy; and maintenance with isoflurane. During the surgery, he develops malignant hyperthermia (MH).\n\nMethods\nLearners are to identify the signs of MH, including tachycardia, hypercapnia, muscle rigidity, and renal failure, and provide the appropriate treatment, resuscitation, and follow-up care. Anesthesiology faculty in the room assist and offer guided instruction to aid the learners in achieving these goals.\n\nResults\nThe simulation was completed by 24 medical students with 2 weeks of anesthesia training and daily lectures on various anesthesia topics. Verbal feedback from the learners was positive, and many appreciated the preparation in how to prioritize the management of such a rare but life-threatening anesthesia emergency. Based on reviewers' recommendations, a learner evaluation of the session and pre- and posttest exams have been developed but have not yet been used with learners.\n\nDiscussion\nThe simulation not only was received well by the students but was also crucial to understanding the benefits of simulation training in the field of anesthesiology, especially when rare diseases are difficult to encounter in real life. Future simulations will incorporate other rare but important disease processes in the simulation training environment to allow anesthesia providers to learn in a safe setting without detriment to any patient.\n\nKeywords\nSimulationAnesthesiologyMalignant Hyperthermia\n==== Body\nEducational Objectives\nBy the end of the module, the learner will be able to:\n1. Identify and treat malignant hyperthermia (MH) in the intraoperative setting in an organized team.\n\n2. Discuss differential diagnosis of MH.\n\n3. Identify and understand the chronological order of developing MH, including end-tidal carbon dioxide, heart rate, temperature, and muscle rigidity.\n\n4. Identify the change in blood tests, including arterial blood gas, electrolyte panel, and renal function.\n\n5. Apply the algorithm for treatment of MH, including dantrolene administration, with an emphasis on teamwork.\n\n6. Recognize the patient's response to appropriate (and inappropriate) management interventions.\n\n7. Develop individual and team skills in management of MH.\n\n8. Develop team-oriented communication.\n\n9. Develop a method to allocate tasks efficiently within a group.\n\n\n\nIntroduction\nAny patient may potentially develop malignant hyperthermia (MH) intraoperatively. We aimed this simulation curriculum to educate early anesthesia providers in the accurate identification of and appropriate treatment regimen for this disease process. The target audience includes medical students, Postgraduate Year 1 residents, Clinical Anesthesia 1 residents, and student nurse anesthetists. The simulation can be adapted for senior residents, faculty, and mid-level anesthesia providers, but such modifications are beyond the scope of this publication. The prerequisite knowledge and skills needed are a fundamental understanding of MH as a disease process and of the signs and symptoms of the disease intraoperatively, as well as the ability to reconstitute and draw a powdered form of medication for administration.\n\nWe chose a simulation setting in an intraoperative environment with an anesthetized patient to give learners the most realistic presentation of MH. The learners can identify specific signs and symptoms that are clear indicators the patient has developed MH. Then, they can immediately start the required treatment and resuscitation. At our institution, learners were asked to familiarize themselves with the Malignant Hyperthemia Association of the United States website and its various tools.\n\nMethods\nThe case is fully presented for facilitators in the simulation case file (Appendix A). A separate critical actions checklist (Appendix B) is also included for learners to reference while running the simulation. A debriefing handout (Appendix C) is included to facilitate the postassessment session. Prior to the simulation, learners are asked to read an article by Jurkat-Rott, McCarthy, and Lehmann-Horn.1\n\nEquipment/Environment\n• Setup: operating room or simulation laboratory.\n\n• Mannequin setup: Pediatric patient is intubated with a 6.0-mm cuffed endotracheal tube (ETT) under general volatile anesthesia supine with a prepared sterile field for an inguinal procedure. Patient should have a single peripheral IV access.\n\nProps\n• IV access (20 g), IV pole, 1-L normal saline bag to be used as IV fluid, noninvasive blood pressure, electrocardiogram, plethysmography, capnography, and temperature probe.\n\n• MAC3 direct laryngoscope, 6.0-mm ID single lumen cuffed ETT, 10-cc syringe, and anesthesia machine.\n\n• Labeled medication syringes for induction of anesthesia.\n\n• Advanced Cardiac Life Support code cart, MH cart, and MH treatment algorithm.\n\n• Neuromuscular stimulator and patient chart with history and physical describing no family history of MH.\n\n• Sterile Mayo tray with basic surgical equipment.\n\nPersonnel\n• Actors: nursing staff (scrub nurse/circulator; these roles may be performed by a single actor).\n\n• Surgeon.\n\n• Simulation learners: two individuals as anesthesia providers.\n\n• Instructor: may be physically present to guide learners through the simulation scenario or behind the scenes, depending on the learner levels.\n\nPrior to initiating the scenario, the multiple-choice-question pretest (Appendix D) should be administered to all learners participating. In addition to the case narrative, the patient's initial signs and symptoms of the disease process are subtle but become increasingly pronounced over the duration of the simulation to reflect MH.\n\nAfter initial briefing, the simulation is activated. The patient has stable vital signs and is adequately anesthetized with isoflurane gas. The learners have a moment to get acclimated to the scenario, the anesthesia machine, and the setup. The faculty guide the learners to the vital signs and ask them to interpret them. The surgeon, who has paused during this initial introduction, then continues with the abdominal procedure. At this point, the instructor announces that 15 minutes have passed since incision.\n\nStarting with very subtle findings, MH begins to set in on the patient. End-tidal carbon dioxide (ETCO2) has gradually risen and is now at the upper limit of normal, and heart rate increases. The muscles become rigid (but this is apparent only if the patient is physically examined). The actors in the simulation act as if everything is going normally. The instructor may promote discussion but should initially give the learners time (1–2 minutes) to recognize the new findings on their own.\n\nThe vitals change again after 5 minutes, at which time the patient has a more pronounced elevation of ETCO2. His temperature is at the upper limits of normal, and he has tachycardia greater than 110 bpm. Around this time, the surgeon comments that the patient's abdomen appears more rigid and asks for increased sedation. If the learners have not realized there is a suspicious process occurring, the instructor should ask them how they would respond to the surgeon's request and what medication they would administer. As the learners are talked through this process, the instructor then challenges them by pointing out various vital signs and continues to guide them as necessary, with the goal of their recognizing all the changes in vital signs and physical exam findings.\n\nIf the learners have not arrived at the appropriate diagnosis by this time (within a total of 10 minutes), the instructor explains that the patient is expressing signs and symptoms worrisome for MH, then asks the learners what the next appropriate step is. By this time, the patient's vital signs have progressively worsened. If the learners do not suggest an arterial blood gas, the instructor should encourage them to get one and to send off for some basic labs.\n\nThe instructor then guides the learners to alerting the OR staff of the high suspicion of MH. The learners should immediately inform the surgeon to discontinue the surgery as quickly as possible. At this point, the surgeon stops the procedure, and then the actor can transition to the other role of an auxiliary RN. The learners should call for help and also should call for and access the MH cart. The instructor tells one or both learners to be the leaders of the MH event. Learners should coordinate the OR staff in their respective roles and in order to complete certain tasks.\n\nLearners should turn off all volatile anesthetics, hyperventilate the patient with high-flow 100% O2, and instruct the OR staff to administer dantrolene as quickly as possible. The instructor provides reminders if the learners do not take appropriate steps and helps with calculations if requested by the learners. The learners should create an organized system to administer the dantrolene, delegating the tasks to mix the dantrolene and administer the mixed solution.\n\nThe simulation ends when dantrolene has been administered; supportive measures have been taken, including obtaining central venous access (or two large-bore IVs), arterial line, and cooling with cold fluids and cooling blankets; and the mannequin responds with improvement of vital signs. The learners should also direct the staff to have the patient moved to the ICU as soon as possible.\n\nDuring various points in the sequence of events, critical actions must be taken in a timely manner. These include administration of a 100% FiO2, high, fresh gas flow, hyperventilation, discontinuation of all volatile anesthetics, cooling with cold fluids and cooling blankets, requesting help and the MH cart, and organizing staff to prepare dantrolene for administration. The scenario ends when the team successfully completes the algorithm and sees an improvement in the patient's clinical condition or when time expires, whichever occurs sooner.\n\nDebriefing\nThe following questions and talking points are recommended during the debriefing with the simulation learners.\n\nMH and patient care\n• Identification of MH: The team should identify the steadily increasing ETCO2, heart rate, muscle rigidity, and temperature. They should discuss the risk factors, causes, and anesthetic agents involved in MH. The team should alos discuss what questions to ask during the preoperative evaluation that may raise a red flag to indicate possible MH susceptibility.\n\n• Management of MH: The team should alert OR staff/call for the MH cart and prepare for placement of invasive lines (large-bore IVs, arterial line, central line).\n\n• Treatment of MH: The team should discuss the pathophysiology of MH, involving ryanodine receptors. The team should organize and set up an assembly line to reconstitute and administer dantrolene at the appropriate dose. They should discuss the mechanism of action of dantrolene and its role as treatment for MH.\n\n• Emphasize the importance of recognizing the signs early and how intervening sooner leads to better outcomes. Talk about case reports of delayed-onset MH. In one review of published cases, patients had previous uneventful anesthesia in 20.9% of the cases, and positive family history was identified in only 24.1% of cases.2\n\n• Explain that there is a designated MH expert whose information should be available on the MH cognitive aid, or as part of the MH cart, whom the learners can call at any time to help advise them in a real-life situation.\n\nOrganization and communication\n• Did the team members organize and communicate well together?\n\n• Did they give adequate instructions and explicit tasks to individuals to perform duties?\n\n• Did they discuss the new changes in the case with each other?\n\nAfter completion of the discussions, the multiple-choice-question posttest (Appendix D) should be administered to all learners participating. Answers for each question should be discussed to ensure each learner understands the correct responses. A learner evaluation (Appendix E) of the session has also been developed and can be used by the facilitator.\n\nResults\nThe simulation was completed by 24 medical students with 2 weeks of anesthesia training and daily lectures on various anesthesia topics. On average, it took 8–10 minutes before the learners began to recognize the early signs of MH. The first sign recognized was an increase in temperature, followed by the ETCO2, which was generally in the high 50s before the learners recognized the possibility of MH. Most participants were hesitant to enlist the help of the OR staff in identifying the possibility of MH. No student requested the surgeon to stop the operation.\n\nOnce the signs of MH were recognized, the learners moved aggressively towards treatment options. This management by the students included the call for the MH cart and the initiation of dantrolene preparation. The last step in most of the students' management was the discontinuation of the volatile anesthetic. There were several instances where the isoflurane was maintained throughout the management of the MH. In some instances, only after prompting did the learners discover that the sustained hemodynamic collapse of the patient may have been related to the ongoing inhalation agent administration.\n\nMost of the learners attempted to establish more secure central access or at least an additional large-bore peripheral catheter. In recognizing that the patient may have been acidotic with significant electrolyte imbalance, some of the learners also established arterial line access. In general, the students seemed to understand the need for a team-based approach to crisis management in these patients and the possibility of full circulatory collapse if MH is not promptly and adequately managed.\n\nVerbal feedback from the learners was positive, and many students appreciated the preparation in how to prioritize the management of such a rare but life-threatening anesthesia emergency. Based on MedEdPORTAL reviewer recommendations, a learner evaluation of the session and pre- and posttest exams have been developed; however, they have not yet been used with our learners.\n\nDiscussion\nThe simulation curriculum was designed to educate anesthesia providers on the life-threatening disease MH. The development of the scenario we presented was created by a group of anesthesiology residents and faculty who implemented it in a simulation center at the University of Toledo Medical Center. The majority of learners were medical students rotating on the anesthesiology service over the course of several months. The results were positive, with students interacting with a simulated patient and receiving the occasional guided instruction to appropriately manage a true anesthetic emergency. Improvements to the curriculum should include properly mixing the dantrolene, which, per Harrison, Manser, Howard, and Gaba, is incorrectly mixed by up to 45% of providers in simulations.3 Since recognition is only half the battle, treatment with a new dantrolene preparation, Ryanodex, may speed the treatment phase because of its ease of mixture. Unfortunately, not all centers have the Ryanodex formulation; therefore, it is important to learn the method of preparing the generic version for administration.\n\nThe simulation not only was received well by the students but was also crucial to understanding the benefits of simulation training in the field of anesthesiology, especially when rare diseases are difficult to encounter in real life. Future simulations will incorporate other rare but important disease processes in the simulation training environment to allow anesthesia providers to learn in a safe setting without detriment to any patient.\n\nAppendices\nA. Simulation Case.docx\n\nB. Critical Actions.docx\n\nC. Debriefing Materials.docx\n\nD. Pre Post Test.docx\n\nE. Simulation Course Evaluation.docx\n\nAll appendices are peer reviewed as integral parts of the Original Publication.\n\n Disclosures\nNone to report.\n\nFunding/Support\nNone to report.\n\nEthical Approval\nReported as not applicable.\n==== Refs\nReferences\nJurkat-Rott K , McCarthy T , Lehmann-Horn F \nGenetics and pathogenesis of malignant hyperthermia . Muscle Nerve. \n2000 ;23 (1 ):4 –17 . https://doi.org/10.1002/(SICI)1097-4598(200001)23:1<4::AID-MUS3>3.0.CO;2-D10590402 \nStrazis KP , Fox AW \nMalignant hyperthermia: a review of published cases . Anesth Analg. \n1993 ;77 (2 ):297 –304 . https://doi.org/10.1213/00000539-199308000-000148346828 \nHarrison TK , Manser T , Howard SK , Gaba DM \nUse of cognitive aids in a simulated anesthetic crisis . Anesth Analg. \n2006 ;103 (3 ):551 –556 . https://doi.org/10.1213/01.ane.0000229718.02478.c416931660\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2374-8265",
"issue": "13()",
"journal": "MedEdPORTAL : the journal of teaching and learning resources",
"keywords": "Anesthesiology; Malignant Hyperthermia; Simulation",
"medline_ta": "MedEdPORTAL",
"mesh_terms": null,
"nlm_unique_id": "101714390",
"other_id": null,
"pages": "10550",
"pmc": null,
"pmid": "30800752",
"pubdate": "2017-03-07",
"publication_types": "D016428:Journal Article",
"references": "10590402;16931660;8346828",
"title": "Malignant Hyperthermia: An Anesthesiology Simulation Case for Early Anesthesia Providers.",
"title_normalized": "malignant hyperthermia an anesthesiology simulation case for early anesthesia providers"
} | [
{
"companynumb": "US-HIKMA PHARMACEUTICALS USA INC.-US-H14001-20-01523",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "FENTANYL"
},
"dru... |
{
"abstract": "Antibiotics are natural or synthetic substances that are used to control bacterial infections because antibiotics are by definition only effective against bacteria. A 30-year-old female came to our emergency clinic complaining rubor in both eyes, especially in the left eye, with swelling, rubor and pain in ears, and eruption in lips extremities. In her anamnesis, it has been determined that she did not have any medical disease that requires regular utilization of drugs. After the patient received cefuroxime axetil for acute tonsillitis, she observed eruptions in lip extremities on the 3rd day, but she did not care about it. On the 5th day, rubor in both eyes and, especially in the left eye, have been developed, and complaints such as unable to look toward light and pain have started together with swelling, rubor, and pain in both ears. She came to our clinic because she was very much worried about the situation. In this study, we aimed to discuss a drug reaction characterized by face and ear skin observations, due to uveitis after the use of antibiotics including cefuroxime axetil for acute tonsillitis.",
"affiliations": "a Department of Emergency Medicine , Kanuni Training and Research Hospital , Istanbul , Turkey and.;b Department of Emergency Medicine , Abant Izzet Baysal University Medical Faculty , Golkoy , Bolu , Turkey.;a Department of Emergency Medicine , Kanuni Training and Research Hospital , Istanbul , Turkey and.;b Department of Emergency Medicine , Abant Izzet Baysal University Medical Faculty , Golkoy , Bolu , Turkey.",
"authors": "Akman|Canan|C|;Duran|Arif|A|;Kalafat|Utku Murat|UM|;Ocak|Tarık|T|",
"chemical_list": "D000900:Anti-Bacterial Agents; D000893:Anti-Inflammatory Agents; D002444:Cefuroxime; D008775:Methylprednisolone; C040738:cefuroxime axetil",
"country": "England",
"delete": false,
"doi": "10.3109/15569527.2015.1067817",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1556-9527",
"issue": "35(3)",
"journal": "Cutaneous and ocular toxicology",
"keywords": "Cefuroxime axetil; drug reaction; uveitis",
"medline_ta": "Cutan Ocul Toxicol",
"mesh_terms": "D000328:Adult; D000900:Anti-Bacterial Agents; D000893:Anti-Inflammatory Agents; D002444:Cefuroxime; D003875:Drug Eruptions; D005260:Female; D006801:Humans; D008775:Methylprednisolone; D014069:Tonsillitis; D014605:Uveitis",
"nlm_unique_id": "101266892",
"other_id": null,
"pages": "254-6",
"pmc": null,
"pmid": "26203731",
"pubdate": "2016-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Uveitis attack and drug reaction due to cefuroxime axetil.",
"title_normalized": "uveitis attack and drug reaction due to cefuroxime axetil"
} | [
{
"companynumb": "TR-GLAXOSMITHKLINE-TR2016GSK025935",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CEFUROXIME AXETIL"
},
"drugadditiona... |
{
"abstract": "Growing teratoma syndrome (GTS) of the lung is extremely rare, and there are very few reports on this condition. This is a case report of GTS of the lung that was successfully treated by resection. A 19-year-old man, who had been diagnosed with a testicular tumor, lung metastases and left hilar lymph node metastasis, underwent surgical resection for left testicular cancer. After orchiectomy and chemotherapy, the patient was successfully treated with wedge resection of the right upper lobe and left upper lobectomy. In conclusion, the current case suggests that some patients with GTS might be successfully treated by surgical resection.",
"affiliations": "Department of Surgery and Sciences, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.;Department of Surgery and Sciences, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan gouji104kawa@gmail.com.;Department of Surgery and Sciences, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.;Department of Anatomic Pathology, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.;Department of Surgery and Sciences, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.;Department of Surgery and Sciences, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.;Department of Anatomic Pathology, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.;Department of Surgery and Sciences, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.",
"authors": "Tanaka|Kensuke|K|;Toyokawa|Gouji|G|;Tagawa|Tetsuzo|T|;Ijichi|Kayo|K|;Haratake|Naoki|N|;Hirai|Fumihiko|F|;Oda|Yoshinao|Y|;Maehara|Yoshihiko|Y|",
"chemical_list": null,
"country": "Greece",
"delete": false,
"doi": "10.21873/anticanres.12571",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0250-7005",
"issue": "38(5)",
"journal": "Anticancer research",
"keywords": "Growing teratoma syndrome; lung metastases; surgery",
"medline_ta": "Anticancer Res",
"mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D006801:Humans; D008175:Lung Neoplasms; D008297:Male; D009373:Neoplasms, Germ Cell and Embryonal; D009919:Orchiectomy; D011013:Pneumonectomy; D013577:Syndrome; D013724:Teratoma; D013736:Testicular Neoplasms; D055815:Young Adult",
"nlm_unique_id": "8102988",
"other_id": null,
"pages": "3115-3118",
"pmc": null,
"pmid": "29715149",
"pubdate": "2018-05",
"publication_types": "D016428:Journal Article; D016454:Review",
"references": null,
"title": "Successful Treatment of Growing Teratoma Syndrome of the Lung by Surgical Resection: A Case Report and Literature Review.",
"title_normalized": "successful treatment of growing teratoma syndrome of the lung by surgical resection a case report and literature review"
} | [
{
"companynumb": "JP-PFIZER INC-2018231852",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ETOPOSIDE"
},
"drugadditional": "3",
... |
{
"abstract": "There are limited real-world data comparing the effectiveness and safety of non-vitamin K antagonist oral anticoagulants (NOACs) and warfarin in Asians with nonvalvular atrial fibrillation. We aimed to compare the effectiveness and safety between NOACs and warfarin users in the Korean atrial fibrillation population, with particular focus on high-risk patients.\n\n\n\nUsing the Korean National Health Insurance Service database, we analyzed the risk of ischemic stroke, intracranial hemorrhage (ICH) events, and all-cause death in NOAC users (n=11 611 total, n=5681 taking rivaroxaban, n=3741 taking dabigatran, and n=2189 taking apixaban) compared with propensity score-matched warfarin users (n=23 222) among patients with high-risk atrial fibrillation (CHA2DS2-VASc score ≥2) between 2014 and 2015.\n\n\n\nNOAC treatment was associated with similar risk of ischemic stroke and lower risk of ICH and all-cause mortality compared with warfarin. All 3 NOACs were associated with a similar risk of ischemic stroke and a lower risk of ICH compared with warfarin. Dabigatran and apixaban were associated with a lower risk of total mortality and the composite net clinical outcome (ischemic stroke, ICH, and all-cause death) compared with warfarin, whereas this was nonsignificant for rivaroxaban. Among previously oral anticoagulant-naive patients (n=23 262), dabigatran and apixaban were superior to warfarin for ICH prevention, whereas rivaroxaban and warfarin were associated with similar risk of ICH.\n\n\n\nIn real-world practice among a high-risk Asian atrial fibrillation population, all 3 NOACs demonstrated similar risk of ischemic stroke and lower risk of ICH compared with warfarin. All-cause mortality was significantly lower only with dabigatran and apixaban.",
"affiliations": "From the Department of Internal Medicine, Seoul National University Hospital, Republic of Korea (M.-J.C., E.-K.C., S.O.); Department of Biostatistics, College of Medicine, Catholic University of Korea, Seoul, Republic of Korea (K.-D.H.); Department of Internal Medicine, Soonchunhyang University Hospital Seoul, Republic of Korea (S.-R.L.); Division of Cardiology, Department of Internal Medicine, Seoul National University Boramae Medical Center, Republic of Korea (W.-H.L.); Institute of Cardiovascular Sciences, University of Birmingham, United Kingdom (G.Y.H.L.); and Department of Clinical Medicine, Aalborg Thrombosis Research Unit, Aalborg University, Denmark (G.Y.H.L.).;From the Department of Internal Medicine, Seoul National University Hospital, Republic of Korea (M.-J.C., E.-K.C., S.O.); Department of Biostatistics, College of Medicine, Catholic University of Korea, Seoul, Republic of Korea (K.-D.H.); Department of Internal Medicine, Soonchunhyang University Hospital Seoul, Republic of Korea (S.-R.L.); Division of Cardiology, Department of Internal Medicine, Seoul National University Boramae Medical Center, Republic of Korea (W.-H.L.); Institute of Cardiovascular Sciences, University of Birmingham, United Kingdom (G.Y.H.L.); and Department of Clinical Medicine, Aalborg Thrombosis Research Unit, Aalborg University, Denmark (G.Y.H.L.). choiek17@snu.ac.kr.;From the Department of Internal Medicine, Seoul National University Hospital, Republic of Korea (M.-J.C., E.-K.C., S.O.); Department of Biostatistics, College of Medicine, Catholic University of Korea, Seoul, Republic of Korea (K.-D.H.); Department of Internal Medicine, Soonchunhyang University Hospital Seoul, Republic of Korea (S.-R.L.); Division of Cardiology, Department of Internal Medicine, Seoul National University Boramae Medical Center, Republic of Korea (W.-H.L.); Institute of Cardiovascular Sciences, University of Birmingham, United Kingdom (G.Y.H.L.); and Department of Clinical Medicine, Aalborg Thrombosis Research Unit, Aalborg University, Denmark (G.Y.H.L.).;From the Department of Internal Medicine, Seoul National University Hospital, Republic of Korea (M.-J.C., E.-K.C., S.O.); Department of Biostatistics, College of Medicine, Catholic University of Korea, Seoul, Republic of Korea (K.-D.H.); Department of Internal Medicine, Soonchunhyang University Hospital Seoul, Republic of Korea (S.-R.L.); Division of Cardiology, Department of Internal Medicine, Seoul National University Boramae Medical Center, Republic of Korea (W.-H.L.); Institute of Cardiovascular Sciences, University of Birmingham, United Kingdom (G.Y.H.L.); and Department of Clinical Medicine, Aalborg Thrombosis Research Unit, Aalborg University, Denmark (G.Y.H.L.).;From the Department of Internal Medicine, Seoul National University Hospital, Republic of Korea (M.-J.C., E.-K.C., S.O.); Department of Biostatistics, College of Medicine, Catholic University of Korea, Seoul, Republic of Korea (K.-D.H.); Department of Internal Medicine, Soonchunhyang University Hospital Seoul, Republic of Korea (S.-R.L.); Division of Cardiology, Department of Internal Medicine, Seoul National University Boramae Medical Center, Republic of Korea (W.-H.L.); Institute of Cardiovascular Sciences, University of Birmingham, United Kingdom (G.Y.H.L.); and Department of Clinical Medicine, Aalborg Thrombosis Research Unit, Aalborg University, Denmark (G.Y.H.L.).;From the Department of Internal Medicine, Seoul National University Hospital, Republic of Korea (M.-J.C., E.-K.C., S.O.); Department of Biostatistics, College of Medicine, Catholic University of Korea, Seoul, Republic of Korea (K.-D.H.); Department of Internal Medicine, Soonchunhyang University Hospital Seoul, Republic of Korea (S.-R.L.); Division of Cardiology, Department of Internal Medicine, Seoul National University Boramae Medical Center, Republic of Korea (W.-H.L.); Institute of Cardiovascular Sciences, University of Birmingham, United Kingdom (G.Y.H.L.); and Department of Clinical Medicine, Aalborg Thrombosis Research Unit, Aalborg University, Denmark (G.Y.H.L.).;From the Department of Internal Medicine, Seoul National University Hospital, Republic of Korea (M.-J.C., E.-K.C., S.O.); Department of Biostatistics, College of Medicine, Catholic University of Korea, Seoul, Republic of Korea (K.-D.H.); Department of Internal Medicine, Soonchunhyang University Hospital Seoul, Republic of Korea (S.-R.L.); Division of Cardiology, Department of Internal Medicine, Seoul National University Boramae Medical Center, Republic of Korea (W.-H.L.); Institute of Cardiovascular Sciences, University of Birmingham, United Kingdom (G.Y.H.L.); and Department of Clinical Medicine, Aalborg Thrombosis Research Unit, Aalborg University, Denmark (G.Y.H.L.).",
"authors": "Cha|Myung-Jin|MJ|;Choi|Eue-Keun|EK|;Han|Kyung-Do|KD|;Lee|So-Ryoung|SR|;Lim|Woo-Hyun|WH|;Oh|Seil|S|;Lip|Gregory Y H|GYH|",
"chemical_list": "D000925:Anticoagulants; D014812:Vitamin K",
"country": "United States",
"delete": false,
"doi": "10.1161/STROKEAHA.117.018773",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0039-2499",
"issue": "48(11)",
"journal": "Stroke",
"keywords": "Asian continental ancestry group; anticoagulants; atrial fibrillation; intracranial hemorrhages; stroke; warfarin",
"medline_ta": "Stroke",
"mesh_terms": "D000284:Administration, Oral; D000368:Aged; D000369:Aged, 80 and over; D000925:Anticoagulants; D044466:Asians; D001281:Atrial Fibrillation; D002545:Brain Ischemia; D016208:Databases, Factual; D005260:Female; D006801:Humans; D007348:Insurance, Health; D008297:Male; D056910:Republic of Korea; D012307:Risk Factors; D020521:Stroke; D014812:Vitamin K",
"nlm_unique_id": "0235266",
"other_id": null,
"pages": "3040-3048",
"pmc": null,
"pmid": "28974629",
"pubdate": "2017-11",
"publication_types": "D016430:Clinical Trial; D003160:Comparative Study; D016428:Journal Article; D016448:Multicenter Study",
"references": null,
"title": "Effectiveness and Safety of Non-Vitamin K Antagonist Oral Anticoagulants in Asian Patients With Atrial Fibrillation.",
"title_normalized": "effectiveness and safety of non vitamin k antagonist oral anticoagulants in asian patients with atrial fibrillation"
} | [
{
"companynumb": "KR-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2017-BI-060530",
"fulfillexpeditecriteria": "1",
"occurcountry": "KR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DABIGATRAN ETEXILATE MESYLATE"
... |
{
"abstract": "Azathioprine is used for immunosuppression in myasthenia gravis (MG). We report a patient with seropositive MG who developed a brainstem lymphoma 4 years after being treated with azathioprine and review the literature on the occurrence of lymphoma in this patient population. An 82-year-old man with ocular MG who had been on azathioprine for 4 years developed subacute worsening of bulbar symptoms including diplopia, dysarthria and dysphagia mimicking MG exacerbation. Neuroimaging followed by biopsy showed brainstem diffuse large B-cell lymphoma (DLBCL). To our knowledge this is the first reported patient with brainstem DLBCL after azathioprine treatment in MG. Lymphoma has been reported in MG patients treated with azathioprine, although the incidence is unknown. We suggest reduction of azathioprine dose and subsequent discontinuation, if possible, in MG patients who are in remission. Special caution should be taken with elderly patients and Epstein-Barr virus serology prior to initiation may be useful in this population, but this requires further study.",
"affiliations": "Department of Neurology and the Neurological Institute, University Hospitals Case Medical Center, Case Western Reserve University School of Medicine, 11100 Euclid Avenue, Cleveland, OH 44106, USA. Electronic address: pichetterm@gmail.com.;Department of Neurology and the Neurological Institute, University Hospitals Case Medical Center, Case Western Reserve University School of Medicine, 11100 Euclid Avenue, Cleveland, OH 44106, USA.",
"authors": "Termsarasab|Pichet|P|;Katirji|Bashar|B|",
"chemical_list": "D007166:Immunosuppressive Agents; D001379:Azathioprine",
"country": "Scotland",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0967-5868",
"issue": "22(2)",
"journal": "Journal of clinical neuroscience : official journal of the Neurosurgical Society of Australasia",
"keywords": "Azathioprine; Lymphoma; Myasthenia gravis",
"medline_ta": "J Clin Neurosci",
"mesh_terms": "D000369:Aged, 80 and over; D001379:Azathioprine; D020295:Brain Stem Neoplasms; D018450:Disease Progression; D017809:Fatal Outcome; D006801:Humans; D007166:Immunosuppressive Agents; D016403:Lymphoma, Large B-Cell, Diffuse; D008297:Male; D009157:Myasthenia Gravis",
"nlm_unique_id": "9433352",
"other_id": null,
"pages": "415-8",
"pmc": null,
"pmid": "25443086",
"pubdate": "2015-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Brainstem lymphoma in a myasthenia gravis patient on azathioprine.",
"title_normalized": "brainstem lymphoma in a myasthenia gravis patient on azathioprine"
} | [
{
"companynumb": "US-ZYDUS-011154",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "AZATHIOPRINE"
},
"drugadditional": null,
"dr... |
{
"abstract": "Seizures due to subdural hematoma (SDH) are a common finding, typically diagnosed using electroencephalography (EEG). At times, aggressive management of seizures is necessary to improve neurologic recovery and outcomes. Here, we present three patients who had undergone emergent SDH evacuation and showed postoperative focal deficits without accompanying electrographic epileptiform activity. After infarction and recurrent hemorrhage were ruled out, seizures were suspected despite a negative EEG. Patients were treated aggressively with AEDs and eventually showed clinical improvement. Long-term monitoring with EEG revealed electrographic seizures in a delayed fashion. EEG recordings are an important tool for seizure detection, but should be used as an adjunct to, rather than a replacement for, the clinical examination in the acute setting. At times, aggressive treatment of suspected postoperative seizures is warranted despite lack of corresponding electrographic activity and can improve clinical outcomes.",
"affiliations": "Department of Neurosurgery, Brigham and Women's Hospital, 75 Francis St, Boston, MA, 02115, USA.;Department of Neurosurgery, Brigham and Women's Hospital, 75 Francis St, Boston, MA, 02115, USA.;Massachusetts General Hospital Institute of Health Professions, Boston, MA, USA.;Department of Neurology, Massachusetts General Hospital and Brigham and Women's Hospital, Harvard Medical School, Boston, MA, USA.;Department of Neurosurgery, Brigham and Women's Hospital, 75 Francis St, Boston, MA, 02115, USA. wgormley@bwh.harvard.edu.",
"authors": "Driver|Joseph|J|;DiRisio|Aislyn C|AC|;Mitchell|Heidi|H|;Threlkeld|Zachary D|ZD|;Gormley|William B|WB|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1007/s12028-018-0503-2",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1541-6933",
"issue": "30(1)",
"journal": "Neurocritical care",
"keywords": "Intensive care; Seizures; Subdural hematoma",
"medline_ta": "Neurocrit Care",
"mesh_terms": "D000369:Aged, 80 and over; D004569:Electroencephalography; D006408:Hematoma, Subdural; D006801:Humans; D008297:Male; D008875:Middle Aged; D019635:Neurosurgical Procedures; D011183:Postoperative Complications; D012640:Seizures",
"nlm_unique_id": "101156086",
"other_id": null,
"pages": "16-21",
"pmc": null,
"pmid": "29476391",
"pubdate": "2019-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": "19933056;22146350;24549935;23117492;21423002;21286854;15159471;26840874;10102423;12638104;27914224;8213276;27156207;17236792;18074483;13694560;25077058;8710130;947745;14581666;25266728;19698050;15158702;12102674;27474219;27748723;9186246;12743228",
"title": "Non-electrographic Seizures Due to Subdural Hematoma: A Case Series and Review of the Literature.",
"title_normalized": "non electrographic seizures due to subdural hematoma a case series and review of the literature"
} | [
{
"companynumb": "US-BAYER-2019-028634",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ASPIRIN"
},
"drugadditional": null,
"dr... |
{
"abstract": "Oligodendrogliomas are a rare type of primary brain tumor. They are genetically defined as diffuse gliomas carrying mutation in isocitrate dehydrogenase type 1 (IDH1) or type 2 (IDH2) and codeletion of chromosomes 1p and 19q. The WHO grading system distinguishes two histopathologic grades of ODs: grade II (low-grade) and grade III (anaplastic oligodendroglioma or AO). These tumors rarely metastasize outside of central nervous system with only few cases reported in the literature. Here we present a case of an AO, which metastasized to the bone marrow and other sites within a year of diagnosis despite aggressive treatment measures. Our patient eventually succumbed to his disease, raising many questions about this rare condition, its natural course and optimal management strategy.",
"affiliations": "a James Graham Brown Cancer Center , University of Louisville , Louisville , KY , USA.;b College of Education and Human Development , University of Louisville , Louisville , KY , USA.;c Baptist Health , Louisville , KY , USA.",
"authors": "Singh|Vikas K|VK|http://orcid.org/0000-0003-4635-9580;Singh|Shipra|S|;Bhupalam|Leela|L|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1080/00207454.2018.1557165",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0020-7454",
"issue": "129(7)",
"journal": "The International journal of neuroscience",
"keywords": "Oligodendroglioma; anaplastic oligodendroglioma; bone marrow involvement; bone marrow metastasis; extracranial metastasis; extraneural metastasis; extraoccipital metastasis",
"medline_ta": "Int J Neurosci",
"mesh_terms": "D019046:Bone Marrow Neoplasms; D001921:Brain; D001932:Brain Neoplasms; D006801:Humans; D008297:Male; D008875:Middle Aged; D009837:Oligodendroglioma",
"nlm_unique_id": "0270707",
"other_id": null,
"pages": "722-728",
"pmc": null,
"pmid": "30526175",
"pubdate": "2019-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Anaplastic oligodendroglioma metastasizing to the bone marrow: a unique case report and literature review.",
"title_normalized": "anaplastic oligodendroglioma metastasizing to the bone marrow a unique case report and literature review"
} | [
{
"companynumb": "US-MYLANLABS-2019M1052234",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "SULFAMETHOXAZOLE\\TRIMETHOPRIM"
},
"drugaddit... |
{
"abstract": "A 41-year-old female patient complaining of fatigue, headache, mild confusion, and rush on her lower extremities was admitted to our emergency department. Laboratory tests revealed that he had anemia, thrombocytopenia, and increased levels of indirect bilirubin and lactic dehydrogenase (LDH) in blood tests. Direct and indirect Coombs tests were negative, and fragmented erythrocytes were observed in peripheral blood smears. The patient was diagnosed with thrombotic thrombocytopenic purpura (TTP). The best supportive care was provided. Therapeutic plasma exchange (TPE) and 1 mg/kg methylprednisolone treatments were administered. On the 10th day of treatment, LDH level and fragmented red blood cells in peripheral blood smear were decreased, but his direct and indirect bilirubin levels increased despite the fact that he was treated with 1 mg/kg methylprednisolone and TPE. The patient had severe ADAMTS-13 deficiency. After discontinued steroids treatment, his bilirubin level normalized within 4 days. On the 4th day after bilirubin level normalized, vincristine treatment was administered. TPE was also continued. There was no consensus about the optimal schedule for discontinuing plasmapheresis therapy, and also we observed total bilirubin level improvement with discontinued corticosteroid treatment. In this case, corticosteroid treatment was linked with the increase of total bilirubin level in severe ADAMTS-13-deficient TTP patient.",
"affiliations": "Department of Internal Medicine, Gaziantep University School of Medicine, Gaziantep, Turkey. zeynelasayiner@hotmail.com.;Department of Haematology, Gaziantep University School of Medicine, Gaziantep, Turkey.;Department of Haematology, Gaziantep University School of Medicine, Gaziantep, Turkey.;Department of Internal Medicine, Gaziantep University School of Medicine, Gaziantep, Turkey.;Department of Infection Diseases, Gaziantep University School of Medicine, Gaziantep, Turkey.;Department of Haematology, Dicle University School of Medicine Diyarbakir, Diyarbakir, Turkey.",
"authors": "Sayiner|Zeynel Abidin|ZA|;Acik|Didar Yanardag|DY|;Yilmaz|Mehmet|M|;Subari|Salih|S|;Mete|Ayse Ozlem|AO|;Dai|M Sinan|MS|",
"chemical_list": "D000305:Adrenal Cortex Hormones; D051722:ADAM Proteins; D000071120:ADAMTS13 Protein; C099604:ADAMTS13 protein, human; D001663:Bilirubin",
"country": "Austria",
"delete": false,
"doi": "10.1007/s00508-014-0691-5",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0043-5325",
"issue": "127(19-20)",
"journal": "Wiener klinische Wochenschrift",
"keywords": "Corticosteroid treatment; Hemolysis; Severe ADAMTS-13 deficiency; TPE; TTP",
"medline_ta": "Wien Klin Wochenschr",
"mesh_terms": "D051722:ADAM Proteins; D000071120:ADAMTS13 Protein; D000305:Adrenal Cortex Hormones; D000328:Adult; D001663:Bilirubin; D003131:Combined Modality Therapy; D005260:Female; D006801:Humans; D010956:Plasmapheresis; D011697:Purpura, Thrombotic Thrombocytopenic; D016896:Treatment Outcome; D015854:Up-Regulation",
"nlm_unique_id": "21620870R",
"other_id": null,
"pages": "795-8",
"pmc": null,
"pmid": "25576335",
"pubdate": "2015-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "18028271;24387053;10625026;3309432;20088924;11532079;2062331;2062330;12588343;12192020;24523598;12660343;16107513;21993669;23629429;20686117;22790258",
"title": "Does corticosteroid treatment cause prolonged recovery and increased total bilirubin level in severe ADAMTS-13-deficient TTP patient?",
"title_normalized": "does corticosteroid treatment cause prolonged recovery and increased total bilirubin level in severe adamts 13 deficient ttp patient"
} | [
{
"companynumb": "PHHY2015TR145498",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE"
},
"drugadditional": null,
... |
{
"abstract": "Human herpesvirus-6 (HHV-6) is a common pathogen among children, classically presenting with fever and rash that resolves without specific therapy. HHV-6 can be reactivated in the immunosuppressed patient. After bone marrow and solid organ transplantation, HHV-6 has been linked to various clinical syndromes, including undifferentiated febrile illness, encephalitis, myelitis, hepatitis, pneumonitis, and bone marrow suppression. However, HHV-6 encephalitis after pancreatic transplant has rarely been reported. Early diagnosis and treatment of HHV-6 encephalitis may be important for affected patients. We report the case of a 53-year-old pancreas-after-kidney transplant recipient who initially presented with high fever and confusion 3 weeks after operation. We managed to save the patient's life and preserve the pancreas graft function. We also review previously reported cases of HHV-6B encephalitis in solid organ transplant recipients.",
"affiliations": "Department of Transplant Surgery, Nagoya Daini Red Cross Hospital, Nagoya, Japan; Department of Transplant Immunology, Nagoya University School of Medicine, Nagoya, Japan.",
"authors": "Yamamoto|T|T|;Watarai|Y|Y|;Goto|N|N|;Horikoshi|Y|Y|;Yamada|S|S|;Yasui|K|K|;Tsujita|M|M|;Hiramitsu|T|T|;Narumi|S|S|;Katayama|A|A|;Uchida|K|K|;Kobayashi|T|T|",
"chemical_list": "D000998:Antiviral Agents",
"country": "Denmark",
"delete": false,
"doi": "10.1111/tid.12270",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1398-2273",
"issue": "16(5)",
"journal": "Transplant infectious disease : an official journal of the Transplantation Society",
"keywords": "HHV-6; encephalitis; human herpesvirus-6B; pancreas-after-kidney transplantation",
"medline_ta": "Transpl Infect Dis",
"mesh_terms": "D000998:Antiviral Agents; D004660:Encephalitis; D005260:Female; D015654:Herpesvirus 6, Human; D006801:Humans; D007165:Immunosuppression Therapy; D016030:Kidney Transplantation; D008279:Magnetic Resonance Imaging; D008875:Middle Aged; D016035:Pancreas Transplantation; D019349:Roseolovirus Infections",
"nlm_unique_id": "100883688",
"other_id": null,
"pages": "853-8",
"pmc": null,
"pmid": "25040797",
"pubdate": "2014-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Encephalitis caused by human herpesvirus-6B in pancreas-after-kidney transplantation.",
"title_normalized": "encephalitis caused by human herpesvirus 6b in pancreas after kidney transplantation"
} | [
{
"companynumb": "JP-MYLANLABS-2015M1026998",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nSystemic mastocytosis is a clonal myeloproliferative neoplasm associated with constitutional symptoms from mast cell mediated chemical and cytokine release. According to the literature, Ruxolitinib, a JAK1/JAK2 inhibitor, has been shown to reduce symptoms related to proinflammatory cytokine release in other myeloproliferative neoplasms.\n\n\nMETHODS\nHere we present a case using Ruxolitinib for disabling constitutional symptoms despite complete bone marrow response in a patient with aggressive systemic mastocytosis. Assessment tools used to monitor symptoms in previously published Ruxolitinib trials were adopted to track symptom improvement and quality of life.\n\n\nCONCLUSIONS\nRuxolitinib significantly improved symptoms and quality of life in our patient with systemic mastocytosis.",
"affiliations": "Division of Hematology and Oncology, Univerity of Kansas Medical Center, 2330 Shawnee Mission Parkway, 66205 Westwood, Kansas USA.;Division of Hematology and Oncology, Univerity of Kansas Medical Center, 2330 Shawnee Mission Parkway, 66205 Westwood, Kansas USA.",
"authors": "Yacoub|Abdulraheem|A|;Prochaska|Lindsey|L|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s40364-016-0056-5",
"fulltext": "\n==== Front\nBiomark ResBiomark ResBiomarker Research2050-7771BioMed Central London 5610.1186/s40364-016-0056-5Case ReportRuxolitinib improves symptoms and quality of life in a patient with systemic mastocytosis Yacoub Abdulraheem 913-588-6029ayacoub@kumc.edu Prochaska Lindsey lprochaska@kumc.edu Division of Hematology and Oncology, Univerity of Kansas Medical Center, 2330 Shawnee Mission Parkway, 66205 Westwood, Kansas USA 5 2 2016 5 2 2016 2016 4 23 12 2015 1 2 2016 © Yacoub and Prochaska. 2016\nOpen AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nSystemic mastocytosis is a clonal myeloproliferative neoplasm associated with constitutional symptoms from mast cell mediated chemical and cytokine release. According to the literature, Ruxolitinib, a JAK1/JAK2 inhibitor, has been shown to reduce symptoms related to proinflammatory cytokine release in other myeloproliferative neoplasms.\n\nCase presentation\nHere we present a case using Ruxolitinib for disabling constitutional symptoms despite complete bone marrow response in a patient with aggressive systemic mastocytosis. Assessment tools used to monitor symptoms in previously published Ruxolitinib trials were adopted to track symptom improvement and quality of life.\n\nConclusions\nRuxolitinib significantly improved symptoms and quality of life in our patient with systemic mastocytosis.\n\nKeywords\nSystemic mastocytosisMastocytosisRuxolitinibQuality of lifeyacoubissue-copyright-statement© The Author(s) 2016\n==== Body\nBackground\nSystemic mastocytosis (SM) is a very rare clonal myeloproliferative neoplasm (MPN) [1]. The hallmarks of disease are mast cell (MC) degranulation and organ infiltration by multifocal clusters of abnormal mast cells, including bone marrow. Aggressive systemic mastocytosis (ASM) presents with symptoms related to organ infiltration by mast cells, including dermatologic, hematologic, gastrointestinal, and skeletal manifestations [2]. Mast cell degranulation leads to various cytokine release, producing pruritus, flushing, dyspepsia, hypotension, and even shock [2]. The workup of SM includes testing for mutations that play a role in pathogenesis and treatment implications. Many of the molecular defects associated with SM involve activating mutations in the gene encoding the c-kit receptor, the most common of which is KIT mutation D816V [3, 4]. D816V, N8221 mis-sense mutation, and Val559lle juxtamembrane-type mutation are all KIT mutations that render imatinib resistance in mast cells [5]. There are some mutations not associated with the activation loop of KIT, such as K5091 mutation and Phe522Cys KIT mutation, in which imatinib can be effective [5]. Cytoreductive agents have been used in attempts to control ASM, but treatment remains challenging and mostly palliative. Clinical trials are investigating treatment with KIT D816V inhibitors in relapsed or refractory disease. Cytokine release symptoms are typically treated with histamine receptor antagonists and glucocorticoids, but can remain debilitating despite systemic disease control [6].\n\nRuxolitinib, a potent inhibitor of JAK1 and JAK2, has been shown in the literature to reduce symptoms related to proinflammatory cytokine release in hematologic diseases. The COMFORT-I and COMFORT-II trials using Ruxolitinib showed a significant decrease in disease related symptoms in patients with myelofibrosis [7, 8]. The RESPONSE trial showed similar results with significant symptom improvement in patients with polycythemia vera using Ruxolitinib [9]. Here we present a case using Ruxolitinib for disabling constitutional symptoms despite complete bone marrow response in a patient with aggressive SM. Myeloproliferative Neoplasm Symptom Assessment Forms (MPN-SAF), the European Organisation for Research and Treatment of Cancer (EORTC) Quality of Life Questionnaire–Core 30 Version 3.0 (QLQ-C30), Brief Fatigue Inventory (BFI), and Patient Global Impression of Change (PGIC) were used to assess symptom response [7–10].\n\nPermission to use the BFI was granted by The University of Texas M. D. Anderson Cancer Center. EORTC Quality of Life Group granted permission to use the EORTC QLQ. HIPPA approval was obtained and approved by KUMC IRB.\n\nCase presentation\nA 30-year-old woman was diagnosed with aggressive systemic mastocytosis at age 9 after battling with cutaneous and gastrointestinal symptoms for 4 years. At age 24, she suffered significant progression of her symptoms with disabling fatigue, flushing, and chronic bone pain requiring high doses of narcotic analgesia. Bone marrow biopsy at that time showed 50 % involvement with mast cells and her tryptase level was 101 ng/mL. KIT mutation analysis showed a rare K509I mutation that is sensitive to imatinib [11]. She was started on imatinib 100 mg daily and achieved complete bone marrow response and normalization of tryptase level. Despite disease control, patient continued to suffer from significant constitutional symptoms.\n\nSubsequent bone marrow biopsy continued to showed normocellular marrow with no abnormal mast cells. There was an increase in reticulin fibrosis that was not previously reported. Jak-2 mutation was negative and cytogenetics were normal.\n\nImatinib was continued, but Ruxolitinib was started in attempt to control symptoms. Ruxolitinib was initiated at 5 mg twice daily and titrated up every 4 weeks over a 24-week period based on symptoms response and tolerance. Patient was monitored closely for toxicity or adverse effects from the addition of Ruxolitinib. Weight, EKG, and labs including CBC, CMP, amylase, lipase, and tryptase were collected at baseline and monitored weekly.\n\nLabs and clinical data were recorded with each Ruxolitinib dose adjustment and results are depicted in Table 1. Only mild anemia was seen with increasing doses of Ruxolitinib that reversed once dose was decreased. No additional cytopenias were noted. Liver function, amylase, and lipase remained at baseline. Tryptase remained stable. No EKG changes were seen. Weight gain was witnessed over the 24-week period.Table 1 Patient characteristics\n\n\tBaseline\tWeek 4\tWeek 8\tWeek 12\tWeek 16\tWeek 20\tWeek 24\t\nHemoglobin\t12\t11.7\t11.3\t10.5\t10.9\t11.4\t11.6\t\nPlatelet count\t188\t246\t277\t297\t314\t296\t250\t\nWBC\t6.3\t6.8\t6.9\t7.3\t7.4\t8.0\t8.3\t\nCreatinine\t0.85\t0.88\t0.89\t0.92\t1.02\t1.16\t1.03\t\nALT/AST\tNormal\tNormal\tNormal\tNormal\tNormal\tNormal\tNormal\t\nAmylase/Lipase\tNormal\tNormal\tNormal\tNormal\tNormal\tNormal\tNormal\t\nEKG\tNormal\tNormal\tNormal\tNormal\tNormal\tNormal\tNormal\t\nWeight (Kg)\t77.9\t78.4\t80.5\t83.7\t85.2\t85.6\t84.6\t\nTryptase\t10.2\tNA\t10.8\t9.6\tNA\t9.5\t9.1\t\nRuxolitinib dose\t5 mg BID\t10 mg BID\t20 mg BID\t15 mg BID\t10 mg BID\t10 mg BID\t5 mg BID\t\n\n\nSymptoms and quality of life were assessed every 4 weeks by EORTC QLQ-C30 (Fig. 1a and b), BFI (Fig. 2), MPN-SAF (Fig. 3), and PGIC. Patient reported significant improvement in quality of life due to symptom reduction. Narcotic requirement was reduced from Methadone 30 mg daily to 15 mg daily. Flushing resolved and cutaneous manifestations markedly improved (Fig. 4a and b).Fig. 1 QLQ-C30 Functional scales (a) and combined symptoms score (b)\n\nFig. 2 Brief fatigue inventory\n\nFig. 3 MPN-SAF\n\nFig. 4 Skin rash prior to therapy with Ruxolitinib (a) and 24 weeks post therapy (b)\n\n\n\nConclusions\nSystemic mastocytosis is associated with constitutional symptoms from mast cell mediated cytokine release that occurs chronically and episodically. Ruxolitinib is a Jak1/Jak2 inhibitor that blocks signal transduction for many cytokine receptors, leading to its effectiveness in patients with myeloproliferative neoplasms (MPNs).\n\nIn the COMFORT-I trial, patients with myelofibrosis were treated with Ruxolitinib and had significant improvement in the total symptom score using the modified Myelofibrosis Symptom Assessment Form (MFSAF). MFSAF scores for abdominal pain, pain under the ribs on the left side, and early satiety, which were all improved. The PGIC and patient-reported outcomes also illustrated symptom improvement. The COMFORT-2 trial also evaluated the use of Ruxolitinib in myelofibrosis patients. Symptoms and quality of life in this trial were assessed by the EORTC QLQ-C30 and Functional Assessment of Cancer Therapy-Lymphoma scale (FACT-Lym). This study showed improvements in quality of life and functioning in the patients receiving Ruxolitinib. Significant reductions were seen in fatigue, weight loss, dyspnea, insomnia, and pain [7, 8]. The RESPONSE trial randomized patients with polycythemia vera who were refractory or intolerant to hydroxyurea to receive Ruxolitinib versus standard therapy. Patient-reported symptoms were assessed in this trial using the Myeloproliferative Neoplasm Symptom Assessment Form (MPN-SAF) diary, EORTC QLQ-C30, Pruritus Symptom Impact Scale, and PGIC. Fourteen disease related symptoms were evaluated by the MPN-SAF and resulted as a total symptom score. Ruxolitinib led to significant symptom improvement in the polycythemia patients, as well. [9] A single case in the literature reports on a patient with KIT-mediated systemic mastocytosis associated with myelofibrosis treated with Ruxolitinib. This patient also experienced significant improvement in symptoms and reduction in splenomegaly [12].\n\nGiven the remarkable results and quality of life improvement seen in the aforementioned trials when using Ruxolitinib in the treatment of MPNs, Ruxolitinib was trialed in our patient in attempts to alleviate the debilitating constitutional symptoms of systemic mastocytosis. EORTC QLQ-C30, BFI, MPN-SAF, and PGIC were the tools used to assess symptom improvement and improvement in quality of life in our patient [13]. As evident in the QLQ-C30 functional scales graph (Fig. 1a), our patient had improvement in all functional scales and improvement in quality of life and global health status with the use of Ruxolitinib. The QLQ-C30 combined symptoms score (Fig. 1b) decreased dramatically over the 24 weeks on Ruxolitinib, representing the decrease in symptomatology experienced by our patient. The BFI assessment was used on our patient, as fatigue was one of her most debilitating symptoms. Baseline BFI score of 5.8 was decreased to 2.5 on Ruxolitinib, denoting an improvement in fatigue (Fig. 2). The MPN-SAF was used to assess improvement in symptom burden in our patient. Symptoms evaluated by the MPN-SAF assessment include concentration, early satiety, inactivity, night sweats, itching, bone pain, abdominal discomfort, weight loss, and fever. Baseline MPN-SAF total symptom score (TSS) for our patient was near 70 (designated as severe if ≥ 70) and was reduced to 12 by week 24 on Ruxolitinib (Fig. 3). It is noteworthy to mention that higher doses of Ruxolitinib (week 8–12) caused the MPN-SAF TSS to elevate to the 30–40 range, but this was still a significant improvement from baseline. As Ruxolinitib was dose reduced due to worsening anemia in weeks 16–24, the MPN-SAF TSS did decrease proportionately. PGIC was the last assessment tool used to monitor symptoms and improvement in quality of life in our patient. Patient responses range from very much improved to very much worse on this assessment. Our patient’s response for the PGIC was “much improvement” by week 24 on Ruxolitinib therapy.\n\nIn addition to monitoring for symptom improvement, adverse events in the setting of Ruxolitinib were evaluated. Weight gain was reported in other trials using Ruxolitinib and was also seen in our patient. No significant adverse events were noted.\n\nDose escalations were slow and monitored closely since Ruxolitinib was being added to imatinib in our patient. There were no detected toxicities observed in this novel combination of active agents. The combination of imatinib and Ruxolitinib has been published in the literature [14] and no serious toxicity has been demonstrated.\n\nRuxolitinib is a promising and active agent, especially in terms of symptom improvement and improved quality of life in a variety of patient subsets. Regardless of the underlying disease process, it appears that diseases with proinflammatory and cytokine release mechanisms are obtaining benefit with the addition of Ruxolitinib. In patients’ with systemic mastocytosis with difficult to control symptoms, Ruxolitinib may be a therapeutic consideration. Controlled prospective clinical trials evaluating the role of Ruxolitinib in systemic mastocytosis, post-SM myelofibrosis, and other cytokine-dependent diseases are needed.\n\nEthics approval\nNot applicable.\n\nConsent for publication\nConsent has been obtained to publish this data and is available to the editors upon request.\n\nAvailability of data and materials\nAll data is presented in main paper.\n\nCompeting interests\n\nA. Yacoub received honoraria from Incyte for advisory and speaker roles. L. Prochaska reports no financial conflict of interest.\n\nAuthors’ contributions\n\nAY and LP both contributed to background search and drafting the manuscript. Both authors read and approved the final manuscript.\n\nAcknowledgements\nNo additional acknowledgments.\n\nFunding\nThere is no alternative funding source. The authors of the manuscript will provide funding.\n==== Refs\nReferences\n1. Horny HPAC Metcalfe DD Swerdlow SH Campo E Harris NL World Health Organization (WHO) Classification of Tumours. Mastocytosis (Mast cell disease) 2008 Lyon, France Pathology & Genetics. Tumours of Haematopoietic and Lymphoid Tissues. \n2. Pardanani A Systemic mastocytosis in adults: 2012 Update on diagnosis, risk stratification, and management Am J Hematol 2012 87 4 401 11 10.1002/ajh.23459 22410759 \n3. Garcia-Montero AC Jara-Acevedo M Teodosio C Sanchez ML Nunez R Prados A KIT mutation in mast cells and other bone marrow hematopoietic cell lineages in systemic mast cell disorders: a prospective study of the Spanish Network on Mastocytosis (REMA) in a series of 113 patients Blood 2006 108 7 2366 72 10.1182/blood-2006-04-015545 16741248 \n4. Nagata H Worobec AS Oh CK Chowdhury BA Tannenbaum S Suzuki Y Identification of a point mutation in the catalytic domain of the protooncogene c-kit in peripheral blood mononuclear cells of patients who have mastocytosis with an associated hematologic disorder Proc Natl Acad Sci U S A 1995 92 23 10560 4 10.1073/pnas.92.23.10560 7479840 \n5. Alvarez-Twose I Gonzalez P Morgado JM Jara-Acevedo M Sanchez-Munoz L Matito A Complete response after imatinib mesylate therapy in a patient with well-differentiated systemic mastocytosis J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 2012 30 12 e126 9 10.1200/JCO.2011.38.9973 \n6. Valent P Sperr WR Akin C How I treat patients with advanced systemic mastocytosis Blood 2010 116 26 5812 7 10.1182/blood-2010-08-292144 20855864 \n7. Verstovsek S Mesa RA Gotlib J Levy RS Gupta V DiPersio JF A double-blind, placebo-controlled trial of ruxolitinib for myelofibrosis N Engl J Med 2012 366 9 799 807 10.1056/NEJMoa1110557 22375971 \n8. Harrison C Kiladjian JJ Al-Ali HK Gisslinger H Waltzman R Stalbovskaya V JAK inhibition with ruxolitinib versus best available therapy for myelofibrosis N Engl J Med 2012 366 9 787 98 10.1056/NEJMoa1110556 22375970 \n9. Vannucchi AM Kiladjian JJ Griesshammer M Masszi T Durrant S Passamonti F Ruxolitinib versus standard therapy for the treatment of polycythemia vera N Engl J Med 2015 372 5 426 35 10.1056/NEJMoa1409002 25629741 \n10. Aaronson NK Ahmedzai S Bergman B Bullinger M Cull A Duez NJ The European Organization for Research and Treatment of Cancer QLQ-C30: a quality-of-life instrument for use in international clinical trials in oncology J Natl Cancer Inst 1993 85 5 365 76 10.1093/jnci/85.5.365 8433390 \n11. Zhang LY Smith ML Schultheis B Fitzgibbon J Lister TA Melo JV A novel K509I mutation of KIT identified in familial mastocytosis-in vitro and in vivo responsiveness to imatinib therapy Leuk Res 2006 30 4 373 8 10.1016/j.leukres.2005.08.015 16183119 \n12. Santos FP Helman R Pereira WO Puga RD Nakashima SS Bello IC Activity Of a JAK1/JAK2 Inhibitor In a Patient With KIT-Mutated Systemic Mastocytosis (SM) Associated With Myelofibrosis Blood 2013 122 21 5246 \n13. Fayers PMANK Bjordal K Groenvold M Curran D Bottomley A on behalf of the EORTC Quality of Life Group The EORTC QLQ-30 Scoring Manual 2001 3 Brussels European Organisation for Research and Treatment of Cancer \n14. Iurlo A Gianelli U Rapezzi D Cattaneo D Fermo E Binda F Imatinib and ruxolitinib association: first experience in two patients Haematologica 2014 99 6 e76 7 10.3324/haematol.2013.102525 24633869\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2050-7771",
"issue": "4()",
"journal": "Biomarker research",
"keywords": "Mastocytosis; Quality of life; Ruxolitinib; Systemic mastocytosis",
"medline_ta": "Biomark Res",
"mesh_terms": null,
"nlm_unique_id": "101607860",
"other_id": null,
"pages": "2",
"pmc": null,
"pmid": "26855781",
"pubdate": "2016",
"publication_types": "D002363:Case Reports",
"references": "22370312;22375970;16183119;20855864;16741248;25629741;8433390;24633869;22375971;7479840;22410759",
"title": "Ruxolitinib improves symptoms and quality of life in a patient with systemic mastocytosis.",
"title_normalized": "ruxolitinib improves symptoms and quality of life in a patient with systemic mastocytosis"
} | [
{
"companynumb": "US-INCYTE CORPORATION-2017IN000234",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "IMATINIB"
},
"drugadditional": null,... |
{
"abstract": "OBJECTIVE\nIn hepatitis C virus (HCV)-infected patients receiving pegylated interferon (PEG-IFN)/ribavirin (RBV) combination therapy, anemia is a well-known side effect. The purpose of this study was to describe the time course and extent of hemoglobin (Hb) changes and the erythropoietic response to PEG-IFN/RBV-induced anemia.\n\n\nMETHODS\nIn this multicenter, observational, 8-wk study, laboratory parameters were measured weekly for 8 wk or until early withdrawal. Primary endpoints included changes in Hb and serum erythropoietin (sEPO) from baseline to week 8; other measures were changes in reticulocytes and RBV dose. The predictive value of baseline factors for maximum Hb decline was assessed.\n\n\nRESULTS\nIn the 97 evaluable patients, mean Hb decreased from 14.4 +/- 1.4 g/dl (baseline) to 11.9 +/- 1.3 g/dl (week 8). Twenty-one percent of patients withdrew before week 8. The estimated erythropoietic response was lower than that seen in two historic control populations of iron deficiency anemia patients. Mean RBV dose decreased from 986 +/- 190 mg/day (baseline) to 913 +/- 228 mg/day (week 8). Fifty-seven out of 77 (74%) patients who completed the study maintained their initial prescribed RBV dose. Patients maintained on the initial dose of RBV who had a higher baseline Hb and viral load showed a trend toward larger Hb declines. Platelets and white blood cells (WBCs) also declined during the study.\n\n\nCONCLUSIONS\nHCV-infected patients receiving PEG-IFN/RBV therapy have reductions in Hb, platelets, and WBCs, possibly due to bone marrow suppression. They also have diminished endogenous sEPO production for their degree of anemia.",
"affiliations": "Division of Transplantation Medicine, Mayo Clinic Hospital, 5777 E. Mayo Boulevard, Phoenix, AZ 85054, USA.",
"authors": "Balan|Vijayan|V|;Schwartz|David|D|;Wu|George Y|GY|;Muir|Andrew J|AJ|;Ghalib|Reem|R|;Jackson|John|J|;Keeffe|Emmet B|EB|;Rossaro|Lorenzo|L|;Burnett|Alfreda|A|;Goon|Betty L|BL|;Bowers|Peter J|PJ|;Leitz|Gerhard J|GJ|;|||",
"chemical_list": "D000998:Antiviral Agents; D006454:Hemoglobins; D000077190:Interferon alpha-2; D016898:Interferon-alpha; D011994:Recombinant Proteins; D004921:Erythropoietin; D011092:Polyethylene Glycols; D012254:Ribavirin; C417083:peginterferon alfa-2b",
"country": "United States",
"delete": false,
"doi": "10.1111/j.1572-0241.2005.40757.x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0002-9270",
"issue": "100(2)",
"journal": "The American journal of gastroenterology",
"keywords": null,
"medline_ta": "Am J Gastroenterol",
"mesh_terms": "D000740:Anemia; D000998:Antiviral Agents; D004305:Dose-Response Relationship, Drug; D004359:Drug Therapy, Combination; D004921:Erythropoietin; D005260:Female; D006454:Hemoglobins; D019698:Hepatitis C, Chronic; D006801:Humans; D000077190:Interferon alpha-2; D016898:Interferon-alpha; D008297:Male; D008875:Middle Aged; D011092:Polyethylene Glycols; D011994:Recombinant Proteins; D012254:Ribavirin",
"nlm_unique_id": "0421030",
"other_id": null,
"pages": "299-307",
"pmc": null,
"pmid": "15667486",
"pubdate": "2005-02",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Erythropoietic response to anemia in chronic hepatitis C patients receiving combination pegylated interferon/ribavirin.",
"title_normalized": "erythropoietic response to anemia in chronic hepatitis c patients receiving combination pegylated interferon ribavirin"
} | [
{
"companynumb": "US-ROCHE-1925694",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RIBAVIRIN"
},
"drugadditional": "3",
"drugad... |
{
"abstract": "BACKGROUND\nChronic pouchitis with penetrating anal lesions often leads to pouch failure after restorative proctocolectomy. The aim of this study was to analyze those predictors and to evaluate the effects of infliximab (IFX).\n\n\nMETHODS\nWe reviewed patients’ backgrounds and performed a prospective trial of IFX treatment. Possible pre-operative factors were analyzed. Efficacy was assessed by comparing the pouchitis disease activity index (PDAI) and peri-anal DAI. Long-term efficacy was assessed via the rate of pouch failure.\n\n\nRESULTS\nA total of 41 patients with refractory pouchitis were included. Although the patients with penetrating lesions were younger than those without, neither predictive pre-operative factors nor a correlation of C-related protein levels were observed. A total of 10 patients with penetrating lesions were enrolled for IFX treatment. Although the PDAI and peri-anal DAI decreased significantly (p = 0.04 and p = 0.02, respectively), the primary non-responders during the induction of IFX were 3 patients with obvious abscesses. The 1-year cumulative pouch failure rate was 0% in patients without abscesses and 50% in patients with abscesses under IFX maintenance.\n\n\nCONCLUSIONS\nIFX treatment for refractory pouchitis with penetrating complications appears to be effective. However, once penetrating lesions develop to abscesses, these lesions are difficult to heal.",
"affiliations": null,
"authors": "Uchino|Motoi|M|;Ikeuchi|Hiroki|H|;Bando|Toshihiro|T|;Hirose|Kei|K|;Hirata|Akihiro|A|;Chohno|Teruhiro|T|;Sasaki|Hirofumi|H|;Horio|Yuki|Y|;Takahashi|Yoshiko|Y|;Takesue|Yoshio|Y|;Hida|Nobuyuki|N|;Hori|Kazutoshi|K|;Nakamura|Shiro|S|",
"chemical_list": "D005765:Gastrointestinal Agents; D000069285:Infliximab",
"country": "Switzerland",
"delete": false,
"doi": "10.1159/000438922",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0012-2823",
"issue": "92(3)",
"journal": "Digestion",
"keywords": null,
"medline_ta": "Digestion",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D002908:Chronic Disease; D003093:Colitis, Ulcerative; D005260:Female; D005765:Gastrointestinal Agents; D006801:Humans; D000069285:Infliximab; D008297:Male; D008875:Middle Aged; D011183:Postoperative Complications; D019449:Pouchitis; D016737:Proctocolectomy, Restorative; D011446:Prospective Studies; D016896:Treatment Outcome; D055815:Young Adult",
"nlm_unique_id": "0150472",
"other_id": null,
"pages": "147-55",
"pmc": null,
"pmid": "26343749",
"pubdate": "2015",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article",
"references": null,
"title": "Clinical Features of Refractory Pouchitis with Penetrating Lesions and the Efficacy of Infliximab Treatment for Patients with Ulcerative Colitis after Restorative Proctocolectomy.",
"title_normalized": "clinical features of refractory pouchitis with penetrating lesions and the efficacy of infliximab treatment for patients with ulcerative colitis after restorative proctocolectomy"
} | [
{
"companynumb": "JP-JNJFOC-20151208956",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "INFLIXIMAB"
},
"drugadditional": null,
... |
{
"abstract": "Rheumatoid nodules are a common manifestation of rheumatoid arthritis but buccal rheumatoid nodules are extremely rare. The purpose of this study was to report a rare case of a rheumatoid buccal nodule and a review of the literature.\n\n\n\nThis case is about a 79-year-old woman with rheumatoid arthritis who was taking methotrexate and hydroxychloroquine, presenting with an enlarging left buccal submucosal mass. An incisional biopsy showed features consistent with that of a rheumatoid nodule. The mass was managed expectantly and the patient was taken off methotrexate with a marked reduction in the size of the nodule.\n\n\n\nSubmucosal rheumatoid nodules of the oral cavity are an extremely rare manifestation of rheumatoid arthritis but should be considered in the differential diagnosis in patients with a history of rheumatoid arthritis presenting with submucosal masses. © 2016 Wiley Periodicals, Head Neck 39: E12-E14, 2017.",
"affiliations": "Department of Otolaryngology - Head and Neck Surgery, Oregon Health and Science University, Portland, Oregon.;Department of Pathology, Oregon Health and Science University, Portland, Oregon.;Department of Otolaryngology - Head and Neck Surgery, Oregon Health and Science University, Portland, Oregon.",
"authors": "Tay|Gerald Ci-An|GC|;Sauer|David A|DA|;Andersen|Peter E|PE|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1002/hed.24573",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1043-3074",
"issue": "39(1)",
"journal": "Head & neck",
"keywords": "autoimmune; buccal mass; methotrexate; rheumatoid arthritis; rheumatoid nodule",
"medline_ta": "Head Neck",
"mesh_terms": "D000368:Aged; D005260:Female; D006801:Humans; D009055:Mouth; D012218:Rheumatoid Nodule",
"nlm_unique_id": "8902541",
"other_id": null,
"pages": "E12-E14",
"pmc": null,
"pmid": "27618678",
"pubdate": "2017-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Rheumatoid nodule presenting as a buccal submucosal nodule: A rare presentation of a common disease.",
"title_normalized": "rheumatoid nodule presenting as a buccal submucosal nodule a rare presentation of a common disease"
} | [
{
"companynumb": "US-ANTARES PHARMA, INC.-2016-LIT-ME-0312",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditio... |
{
"abstract": "BACKGROUND\nEpothilones, a new class of cytotoxic agents, have demonstrated activity in non-small-cell lung cancer (NSCLC). This phase II study examined ixabepilone/carboplatin (cohort A) and ixabepilone/carboplatin/bevacizumab (cohort B) as first-line therapy for patients with advanced NSCLC.\n\n\nMETHODS\nPatients were enrolled to either cohort A or B at physician discretion and when eligibility met. Eligible patients had newly diagnosed stage III/IV NSCLC, ECOG PS 0-1, adequate organ function, no active CNS metastases, and, in cohort B, bevacizumab treatment criteria. Both cohorts received ixabepilone 30 mg/m2 and carboplatin AUC=6 IV day 1 every 3-weeks for a maximum of 6 cycles. Patients assigned to cohort B also received bevacizumab 15 mg/kg IV day 1 of each cycle, and could continue single-agent bevacizumab for 6 additional cycles.\n\n\nRESULTS\nEighty-two patients (median age, 63 years; majority stage IV and former smokers) were enrolled from 11/08 to 10/09 (A-42, B-40) and received medians of 4 and 6 cycles, respectively. The ORRs were 29% and 50%. After median follow up of 17.5 months (A) and 15.7 months (B), median progression free survivals were A-5.3 months (95% CI 2.8-8.6) and B-6.7 months (95% CI 5.1-8.4), with median overall survivals of 9.3 months (95% CI 6.4-16.6) 13.2 months (95% CI 8.9-upper limit not reached), respectively. Grade 3/4 toxicity included: anemia (A-10%, B-27%), neutropenia (A-31%, B-48%), thrombocytopenia (A-19%, B-20%), fatigue (A-10%, B-23%), infection (A-5%, B-20%), and hypersensitivity reaction (A-2%, B-5%). There was one treatment-related death, due to hemoptysis in a cohort B patient with squamous histology.\n\n\nCONCLUSIONS\nIxabepilone can be safely combined with carboplatin in newly diagnosed patients with advanced NSCLC. The benefits of treatment appear consistent with those achieved with other modern platinum-doublet regimens. The addition of bevacizumab increases toxicities, however, these are largely expected and reversible. The high ORR and OS observed in the bevacizumab-cohort are encouraging, but would require validation in a larger randomized trial of cohort A versus B.",
"affiliations": "Sarah Cannon Research Institute, Nashville, TN 37203, USA. dspigel@tnonc.com",
"authors": "Spigel|David R|DR|;Anthony Greco|F|F|;Waterhouse|David M|DM|;Shipley|Dianna L|DL|;Zubkus|John D|JD|;Bury|Martin J|MJ|;Webb|Charles D|CD|;Hart|Lowell L|LL|;Gian|Victor G|VG|;Infante|Jeffrey R|JR|;Burris|Howard A|HA|;Hainsworth|John D|JD|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D034261:Epothilones; D000068258:Bevacizumab; D016190:Carboplatin; C430592:ixabepilone",
"country": "Ireland",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0169-5002",
"issue": "78(1)",
"journal": "Lung cancer (Amsterdam, Netherlands)",
"keywords": null,
"medline_ta": "Lung Cancer",
"mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D061067:Antibodies, Monoclonal, Humanized; D000971:Antineoplastic Combined Chemotherapy Protocols; D000068258:Bevacizumab; D016190:Carboplatin; D002289:Carcinoma, Non-Small-Cell Lung; D034261:Epothilones; D005260:Female; D006801:Humans; D008175:Lung Neoplasms; D008297:Male; D008875:Middle Aged; D009367:Neoplasm Staging; D016896:Treatment Outcome",
"nlm_unique_id": "8800805",
"other_id": null,
"pages": "70-5",
"pmc": null,
"pmid": "22947511",
"pubdate": "2012-10",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Phase II trial of ixabepilone and carboplatin with or without bevacizumab in patients with previously untreated advanced non-small-cell lung cancer.",
"title_normalized": "phase ii trial of ixabepilone and carboplatin with or without bevacizumab in patients with previously untreated advanced non small cell lung cancer"
} | [
{
"companynumb": "US-CIPLA LTD.-2016US08908",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BEVACIZUMAB"
},
"drugadditional": "3",
... |
{
"abstract": "Pain management following pediatric tonsillectomy and adenotonsillectomy surgery is challenging and traditionally involves perioperative opioids. However, the recent national opioid shortage compelled anesthesiologists at Bellevue Surgery Center to identify an alternative perioperative analgesic regimen that minimizes opioids yet provides effective pain relief. We assembled an interdisciplinary quality improvement team to trial a series of analgesic protocols using the Plan-Do-Study-Act cycle. Initially, we replaced intraoperative morphine and acetaminophen (M/A protocol) with intraoperative dexmedetomidine and preoperative ibuprofen (D/I protocol). However, when results were not favorable, we rapidly transitioned to intraoperative ketorolac and dexmedetomidine (D/K protocol). The following measures were evaluated using statistical process control chart methodology and interpreted using Shewhart's theory of variation: maximum pain score in the postanesthesia care unit, postoperative morphine rescue rate, postanesthesia care unit length of stay, total anesthesia time, postoperative nausea and vomiting rescue rate, and reoperation rate within 30 days of surgery. There were 333 patients in the M/A protocol, 211 patients in the D/I protocol, and 196 patients in the D/K protocol. With the D/I protocol, there were small increases in maximum pain score and postanesthesia care unit length of stay, but no difference in morphine rescue rate or total anesthesia time compared to the M/A protocol. With the D/K protocol, postoperative pain control and postanesthesia care unit length of stay were similar compared to the M/A protocol. Both the D/I and D/K protocols had reduced nausea and vomiting rescue rates. Reoperation rates were similar between groups. In summary, we identified an intraoperative anesthesia protocol for pediatric tonsillectomy and adenotonsillectomy surgery utilizing dexmedetomidine and ketorolac that provides effective analgesia without increasing recovery times or reoperation rates.",
"affiliations": "Department of Anesthesiology and Pain Medicine, Seattle Children's Hospital, University of Washington, Seattle, Washington.;Department of Otolaryngology Head and Neck Surgery, Seattle Children's Hospital, University of Washington, Seattle, Washington.;Department of Anesthesiology and Pain Medicine, Seattle Children's Hospital, University of Washington, Seattle, Washington.;Department of Anesthesiology and Pain Medicine, Seattle Children's Hospital, University of Washington, Seattle, Washington.;Department of Anesthesiology and Pain Medicine, Seattle Children's Hospital, University of Washington, Seattle, Washington.;Department of Anesthesiology and Pain Medicine, Seattle Children's Hospital, University of Washington, Seattle, Washington.;Department of Anesthesiology and Pain Medicine, Seattle Children's Hospital, University of Washington, Seattle, Washington.",
"authors": "Franz|Amber M|AM|0000-0001-6334-0916;Dahl|John P|JP|;Huang|Henry|H|;Verma|Shilpa T|ST|;Martin|Lynn D|LD|0000-0001-9513-8763;Martin|Lizabeth D|LD|0000-0002-7792-5269;Low|Daniel King-Wai|DK|",
"chemical_list": "D018712:Analgesics, Non-Narcotic; D000701:Analgesics, Opioid; D020927:Dexmedetomidine",
"country": "France",
"delete": false,
"doi": "10.1111/pan.13662",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1155-5645",
"issue": "29(7)",
"journal": "Paediatric anaesthesia",
"keywords": "analgesics; anesthesia; dexmedetomidine; ketorolac; quality improvement; tonsillectomy",
"medline_ta": "Paediatr Anaesth",
"mesh_terms": "D000233:Adenoidectomy; D000293:Adolescent; D018712:Analgesics, Non-Narcotic; D000701:Analgesics, Opioid; D002648:Child; D002675:Child, Preschool; D020927:Dexmedetomidine; D005260:Female; D006801:Humans; D007223:Infant; D007231:Infant, Newborn; D008297:Male; D059408:Pain Management; D010147:Pain Measurement; D010149:Pain, Postoperative; D058996:Quality Improvement; D014068:Tonsillectomy",
"nlm_unique_id": "9206575",
"other_id": null,
"pages": "682-689",
"pmc": null,
"pmid": "31077491",
"pubdate": "2019-07",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "The development of an opioid sparing anesthesia protocol for pediatric ambulatory tonsillectomy and adenotonsillectomy surgery-A quality improvement project.",
"title_normalized": "the development of an opioid sparing anesthesia protocol for pediatric ambulatory tonsillectomy and adenotonsillectomy surgery a quality improvement project"
} | [
{
"companynumb": "US-JNJFOC-20200341949",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "DEXMEDETOMIDINE"
},
"drugadditional": null,
... |
{
"abstract": "Acyclovir (ACV) neurotoxicity is a neuropsychiatric condition induced by the anti-herpetic drugs ACV and valacyclovir (VACV). It is presumed that elevated blood levels of ACV and its metabolite 9-carboxymethoxymethylguanine are involved in the development of ACV-induced encephalopathy; age and renal dysfunction are risk factors. Here, we report a case of encephalopathy caused by the administration of VACV for herpes zoster prophylaxis in a patient with renal dysfunction owing to multiple myeloma.\nRenal dysfunction was diagnosed in a 70-year-old man visiting our hospital for a medical checkup. His creatinine clearance rate was 8 mL/min. He was diagnosed with symptomatic multiple myeloma, and bortezomib/dexamethasone (BD) therapy for multiple myeloma and VACV for herpes zoster prophylaxis were initiated. We administered 500 mg/day of VACV three times a week, a lower dosage than recommended, after adjusting for his renal impairment. His renal function was monitored twice per week during therapy. During the second course of BD therapy, 6 weeks after starting treatment, he was hospitalized owing to impaired consciousness (Glasgow Coma Scale score: E2, V4, M4), and his BD and VACV therapy were suspended. Brain magnetic resonance imaging and cerebrospinal fluid analysis showed no abnormalities. Three days after discontinuing BD and VACV therapy, his consciousness recovered completely, and impaired consciousness did not recur after resuming BD therapy. His clinical diagnosis was thus ACV-induced encephalopathy.\nVACV is often prescribed to patients with multiple myeloma receiving BD therapy to prevent herpes zoster. ACV-induced encephalopathy is commonly observed in patients with renal dysfunction; especially among patients with multiple myeloma with Bence-Jones proteinuria, renal tubules are easily damaged and plasma ACV concentrations are likely to increase and induce ACV-induced encephalopathy. Careful monitoring of the level of consciousness is necessary during preventive ACV therapy in patients with renal dysfunction.",
"affiliations": "Department of Internal Medicine, Hyogo Prefectural Tamba Medical Center, Tamba, Hyogo, Japan.;Department of Internal Medicine, Hyogo Prefectural Tamba Medical Center, Tamba, Hyogo, Japan.;Department of Internal Medicine, Hyogo Prefectural Tamba Medical Center, Tamba, Hyogo, Japan.;Division of Medical Oncology/Hematology, Kobe University Graduate School of Medicine, Kobe, Hyogo, Japan.;Department of Internal Medicine, Hyogo Prefectural Tamba Medical Center, Tamba, Hyogo, Japan.",
"authors": "Sugimoto|Kazuma|K|;Kenzaka|Tsuneaki|T|0000-0002-3120-6605;Sugimoto|Ryu|R|;Kitao|Akihito|A|;Akita|Hozuka|H|",
"chemical_list": null,
"country": "New Zealand",
"delete": false,
"doi": "10.2147/IJGM.S291320",
"fulltext": "\n==== Front\nInt J Gen Med\nInt J Gen Med\nijgm\nijgm\nInternational Journal of General Medicine\n1178-7074 Dove \n\n291320\n10.2147/IJGM.S291320\nCase Report\nEncephalopathy Induced by Preventive Administration of Acyclovir in a Man with Symptomatic Multiple Myeloma and Renal Dysfunction\nSugimoto et alSugimoto et alSugimoto Kazuma 1 http://orcid.org/0000-0002-3120-6605Kenzaka Tsuneaki 12 Sugimoto Ryu 1 Kitao Akihito 3 Akita Hozuka 1 1 Department of Internal Medicine, Hyogo Prefectural Tamba Medical Center, Tamba, Hyogo, Japan\n2 Division of Community Medicine and Career Development, Kobe University Graduate School of Medicine, Kobe, Hyogo, Japan\n3 Division of Medical Oncology/Hematology, Kobe University Graduate School of Medicine, Kobe, Hyogo, Japan\nCorrespondence: Tsuneaki Kenzaka Division of Community Medicine and Career Development, Kobe University Graduate School of Medicine, 2-1-5, Arata-cho, Hyogo-ku, Kobe, Hyogo, 652-0032, JapanTel +81 78 382 6732Fax +81 78 382 6283 Email smile.kenzaka@jichi.ac.jp\n11 2 2021 \n2021 \n14 413 417\n10 11 2020 26 1 2021 © 2021 Sugimoto et al.2021Sugimoto et al.This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php).Background\nAcyclovir (ACV) neurotoxicity is a neuropsychiatric condition induced by the anti-herpetic drugs ACV and valacyclovir (VACV). It is presumed that elevated blood levels of ACV and its metabolite 9-carboxymethoxymethylguanine are involved in the development of ACV-induced encephalopathy; age and renal dysfunction are risk factors. Here, we report a case of encephalopathy caused by the administration of VACV for herpes zoster prophylaxis in a patient with renal dysfunction owing to multiple myeloma.\n\nCase Presentation\nRenal dysfunction was diagnosed in a 70-year-old man visiting our hospital for a medical checkup. His creatinine clearance rate was 8 mL/min. He was diagnosed with symptomatic multiple myeloma, and bortezomib/dexamethasone (BD) therapy for multiple myeloma and VACV for herpes zoster prophylaxis were initiated. We administered 500 mg/day of VACV three times a week, a lower dosage than recommended, after adjusting for his renal impairment. His renal function was monitored twice per week during therapy. During the second course of BD therapy, 6 weeks after starting treatment, he was hospitalized owing to impaired consciousness (Glasgow Coma Scale score: E2, V4, M4), and his BD and VACV therapy were suspended. Brain magnetic resonance imaging and cerebrospinal fluid analysis showed no abnormalities. Three days after discontinuing BD and VACV therapy, his consciousness recovered completely, and impaired consciousness did not recur after resuming BD therapy. His clinical diagnosis was thus ACV-induced encephalopathy.\n\nConclusion\nVACV is often prescribed to patients with multiple myeloma receiving BD therapy to prevent herpes zoster. ACV-induced encephalopathy is commonly observed in patients with renal dysfunction; especially among patients with multiple myeloma with Bence–Jones proteinuria, renal tubules are easily damaged and plasma ACV concentrations are likely to increase and induce ACV-induced encephalopathy. Careful monitoring of the level of consciousness is necessary during preventive ACV therapy in patients with renal dysfunction.\n\nKeywords\nacyclovir neurotoxicityvalacyclovirherpes zosterBence–Jones proteinuriano funding to reportThere is no funding to report.\n==== Body\nIntroduction\nAcyclovir (ACV) neurotoxicity is a neuropsychiatric condition induced by the administration of the anti-herpetic drugs ACV and valacyclovir (VACV).1 VACV is the prodrug of ACV. Usually, various neuropsychiatric symptoms, such as disturbance of consciousness, tremor, and myoclonus, occur within 2 days after initiating the therapy.1–3 Hallucinations are also common.1–3 It is presumed that elevated blood levels of ACV and its metabolite, 9-carboxymethoxymethylguanine (CMMG), are involved in the development of ACV-induced encephalopathy4 and that age and renal dysfunction are risk factors.5\n\nBortezomib/dexamethasone (BD) therapy is one of the standard regimens for patients with symptomatic multiple myeloma who have severe renal impairment.6 In bortezomib-containing regimens, low-dose oral ACV is recommended for herpes zoster prophylaxis.7,8\n\nWe present a case of encephalopathy caused by the administration of VACV for herpes zoster prophylaxis in a patient with renal dysfunction due to multiple myeloma.\n\nCase Presentation\nRenal dysfunction was diagnosed in a 70-year-old man who visited our hospital for a medical checkup. His serum creatinine level and creatinine clearance rate were 8.78 mg/dL (normal range: 0.53–1.02 mg/dL) and 8 mL/min (normal range: 80–180 mL/min), respectively. He was diagnosed with Bence–Jones protein λ-type multiple myeloma based on the presence of 40% plasma cells in his bone marrow (10% or more of plasma cells is considered definitive of the disease) and Bence–Jones proteinuria (M proteinuria of 4.8 g/day). Additionally, the diagnosis of symptomatic multiple myeloma (International Staging System stage 3) was based on the presence of renal dysfunction. Renal biopsy revealed cast nephropathy known as myeloma kidney, in which large amounts of Bence–Jones proteins formed casts that blocked the tubules (Figure 1). BD therapy was initiated with concurrent VACV for herpes zoster prophylaxis. We administered a reduced dose VACV of 500 mg three times a week because of the patient’s renal impairment, based on the drug information on VACV provided in the UpToDate database.9 His renal function was monitored twice per week during therapy. Six weeks later, during his second course of BD therapy, the patient was hospitalized because of impaired consciousness. He displayed no other symptoms during hospitalization.Figure 1 Histology of kidney tissue showing myeloma cast nephropathy. (A) Hematoxylin and eosin stain (magnification ×200). (B) Periodic acid-Schiff stain (magnification ×400).\n\n\n\nOn admission, his vital signs were as follows: Glasgow Coma Scale score, E2, V4, M4; body temperature, 36.5°C; blood pressure, 145/79 mmHg; pulse rate, 73 beats/min; respiratory rate, 15 breaths/min; and SpO2, 96%. His vital signs were normal, and there were no remarkable neurological abnormalities except for disturbance of consciousness. Table 1 summarizes the results of patient’s blood test on admission. The results, including renal function, were unchanged. Brain magnetic resonance imaging and cerebrospinal fluid analysis—cell counts 1/µL, protein 40 mg/dL, glucose 98 mg/dL, reference blood glucose level 125 mg/dL—revealed no abnormalities. There was no new electrolyte, endocrine hormone abnormality, or suggestion of epilepsy. Therefore, we suspected drug-induced disturbance of consciousness and suspended the BD and VACV therapy. Three days after discontinuing the drugs, his level of consciousness returned to normal, and the BD therapy was restarted after 20 days of drug interruption. The Naranjo score10 for estimating the probability of adverse drug reactions was 7 points. In this scoring system, ≥ 9 points indicate “high probability for adverse reactions” and 5–8 points indicate “probability for adverse reactions”.10 In all Japan, the laboratories do not have facilities to measure ACV/CMMG levels. Though his blood level of ACV could not be measured, the clinical diagnosis was ACV neurotoxicity based on his response to the suspension of the therapy, the high Naranjo score, and the lack of other contributing factors. We theorized that ACV blood levels gradually increased over the long-term administration of oral VACV owing to renal dysfunction. Figure 2 illustrates his clinical course.Table 1 Results of the Patient’s Admission Blood Tests\n\nParameters\tResult\tReference Range\t\nWhite blood cell count\t15.278 × 103/µL\t4.50–7.50 × 103/µL\t\nNeutrophils\t89.2%\t\t\nLymphocytes\t5.8%\t\t\nHemoglobin\t7.2 g/dL\t11.3–15.2 g/dL\t\nHematocrit\t21.7%\t36–45%\t\nPlatelets\t173 × 103/µL\t130–350 × 103/µL\t\nC-reactive protein\t0.06 mg/dL\t≤0.60 mg/dL\t\nTotal protein\t6.7 g/dL\t6.9–8.4 g/dL\t\nAlbumin\t3.9 g/dL\t3.9–5.1 g/dL\t\nAspartate aminotransferase\t15 U/L\t11–30 U/L\t\nAlanine aminotransferase\t15 U/L\t4–30 U/L\t\nLactate dehydrogenase\t235 U/L\t109–216 U/L\t\nCreatine phosphokinase\t55 U/L\t40–150 U/L\t\nBlood nitrogen urea\t69.7 mg/dL\t8–20 mg/dL\t\nCreatinine\t7.71 mg/dL\t0.63–1.03 mg/dL\t\nCreatinine clearance\t8.8 mL/min\t>60 mL/min\t\nSodium\t136 mEq/L\t136–148 mEq/L\t\nPotassium\t4.6 mEq/L\t3.6–5.0 mEq/L\t\nGlucose\t155 mg/dL\t70–109 mg/dL\t\n\nFigure 2 Clinical course of the patient after starting bortezomib/dexamethasone therapy. BD therapy: Bortezomib was administered at a dose of 1.3 mg/m2 on Days 1, 4, 8, and 11 with dexamethasone (20 mg) administered on Days 1 and 2, 4 and 5, 8 and 9, and 11 and 12. The 21-day regimen administered in 2 cycles was defined as 1 course.\n\n\n\nThe patient underwent 9 cycles of BD therapy and achieved complete remission. We administered 250 mg of famciclovir for herpes zoster prophylaxis, three times a week, between cycles 4 to 9. One year after the end of treatment, he remained in remission. His creatinine level recovered and remained stable at 4–5 mg/dL in response to the treatment. He did not exhibit any sequelae of ACV encephalopathy.\n\nDiscussion\nWe presented a case of ACV-induced encephalopathy caused by the administration of VACV for herpes zoster during the treatment of multiple myeloma in a man with renal dysfunction. To the best of our knowledge, this is the first report of ACV neurotoxicity in a patient taking low-dose VACV for herpes zoster prophylaxis. This case illustrates that ACV or VACV should be used with caution in patients with myeloma-associated renal dysfunction, even if used in low doses for herpes zoster prophylaxis.\n\nIn all Japan, the laboratories do not have facilities to measure ACV/CMMG levels. However, we diagnosed ACV-induced encephalopathy based on his clinical course, the high Naranjo score, the lack of other contributing factors. ACV or VACV can cause renal tubular obstruction secondary to crystal-induced nephropathy, and direct action of the ACV aldehyde can cause acute kidney injury; these can lead to increased blood concentrations of ACV and CMMG and cause encephalopathy.2,11 In this case, our patient exhibited Bence–Jones proteinuria. Increased excretion of Bence–Jones proteins may have damaged the tubular epithelium or formed casts that blocked the renal tubules, leading to myeloma cast nephropathy. It is the most common cause of myeloma-associated renal injury and may cause renal dysfunction.12,13 Though the renal dysfunction in our patient was stable at a low level, we theorized that long-term preventive oral VACV therapy gradually led to increased plasma concentrations of ACV and CMMG, resulting in encephalopathy.\n\nIn this case, the VACV prophylaxis resulted in ACV-induced encephalopathy, even though we administered it at a dose lower than the recommended dose for patients with renal dysfunction. ACV-induced encephalopathy has been observed in patients administered with extremely high doses (10 mg/kg every hour) of the drug or in cases of renal failure without dose adjustment.4 It has often been reported in elderly people and patients with impaired renal function,5 but it has occurred in patients without renal dysfunction and young patients.14 In all cases, ACV-induced encephalopathy developed owing to the ACV or VACV treatment for herpes simplex or zoster virus. There were no reports that ACV-induced encephalopathy developed with prophylactic administration. Myeloma kidney with Bence–Jones proteinuria causes kidney renal tubular damage, which is disproportionate to the degree of renal impairment suggested by the creatinine level. Thus, it is presumed that it inhibits the excretion of drugs, including ACV, in renal tubules, resulting in an elevated blood concentration. It is difficult to measure ACV and CMMG blood levels. Therefore, even with the recommended level of ACV or VACV prophylaxis for renal impairment, it is not possible to predict ACV neurotoxicity, such as impaired consciousness and impaired renal function.\n\nIn conclusion, among patients with multiple myeloma with Bence–Jones proteinuria, the renal tubules are easily damaged, and the plasma concentration of ACV is likely to increase and induce ACV neurotoxicity. Careful monitoring of the level of consciousness is necessary during preventive ACV therapy in patients with renal dysfunction.\n\nAbbreviations\nACV, acyclovir; BD, bortezomib/dexamethasone; CMMG, 9-carboxymethoxymethylguanine; VACV, valacyclovir.\n\nData Sharing Statement\nData sharing is not applicable to this article as no datasets were generated or analyzed during the current study.\n\nConsent for Publication\nWritten informed consent was obtained from the patient for the publication of this case report and accompanying images.\n\nAuthor Contributions\nAll authors contributed to the conception, study design, execution, acquisition of data, analysis and interpretation, drafting and revising the article, and critically reviewing the article; provided final approval of the version to be published; and agreed to be accountable for all aspects of the work.\n\nDisclosure\nThe authors declare that they have no conflicts of interest.\n==== Refs\nReferences\n1. Rashiq \nS , Briewa \nL , Mooney \nM , Giancarlo \nT , Khatib \nR , Wilson \nFM . Distinguishing acyclovir neurotoxicity from encephalomyelitis\n. J Intern Med . 1993 ;234 :507 –511\n. doi:10.1111/j.1365-2796.1993.tb00785.x 8228796 \n2. Asahi \nT , Tsutsui \nM , Wakasugi \nM , et al. Valacyclovir neurotoxicity: clinical experience and review of the literature\n. Eur J Neurol . 2009 ;16 :457 –460\n. doi:10.1111/j.1468-1331.2008.02527.x 19187258 \n3. Adair \nJC , Gold \nM , Bond \nRE . Acyclovir neurotoxicity: clinical experience and review of the literature\n. South Med J . 1994 ;87 :1227 –1231\n. doi:10.1097/00007611-199412000-00006 7973922 \n4. Chowdhury \nMA , Derar \nN , Hasan \nS , Hinch \nB , Ratnam \nS , Assaly \nR . Acyclovir-induced neurotoxicity: a case report and review of literature\n. Am J Ther . 2016 ;23 :e941 –e943\n. doi:10.1097/MJT.0000000000000093 24942005 \n5. Das \nV , Peraldi \nMN , Legendre \nC . Adverse neuropsychiatric effects of cytomegalovirus prophylaxis with valaciclovir in renal transplant recipients\n. Nephrol Dial Transplant . 2006 ;21 :1395 –1401\n. doi:10.1093/ndt/gfk031 16401626 \n6. Harousseau \nJL , Attal \nM , Avet-Loiseau \nH , et al. Bortezomib plus dexamethasone is superior to vincristine plus doxorubicin plus dexamethasone as induction treatment prior to autologous stem-cell transplantation in newly diagnosed multiple myeloma: results of the IFM 2005-01 Phase III trial\n. J Clin Oncol . 2010 ;28 :4621 –4629\n. doi:10.1200/JCO.2009.27.9158 20823406 \n7. Chanan-Khan \nA , Sonneveld \nP , Schuster \nMW , et al. Analysis of herpes zoster events among bortezomib-treated patients in the phase III APEX study\n. J Clin Oncol . 2008 ;26 :4784 –4790\n. doi:10.1200/JCO.2007.14.9641 18711175 \n8. San Miguel \nJF , Schlag \nR , Khuageva \nNK , et al. Bortezomib plus melphalan and prednisone for initial treatment of multiple myeloma\n. N Engl J Med . 2008 ;359 :906 –917\n. doi:10.1056/NEJMoa0801479 18753647 \n9. UpToDate® . Valaciclovir: drug information\n. Available from : https://www.uptodate.com/contents/valacyclovir-drug-information?search=valacyclovir&topicRef=8337&source=see_link#F50991799. Accessed 1 17 , 2021.\n10. Naranjo \nCA , Busto \nU , Sellers \nEM , et al. A method for estimating the probability of adverse drug reactions\n. Clin Pharmacol Ther . 1981 ;30 :239 –245\n. doi:10.1038/clpt.1981.154 7249508 \n11. Sacchetti \nD , Alawadhi \nA , Albakour \nM , Rapose \nA . Herpes zoster encephalopathy or acyclovir neurotoxicity: a management dilemma\n. BMJ Case Rep . 2014 ;2014 :bcr2013201941 . doi:10.1136/bcr-2013-201941 \n12. Hutchison \nCA , Batuman \nV , Behrens \nJ , et al. The pathogenesis and diagnosis of acute kidney injury in multiple myeloma\n. Nat Rev Nephrol . 2011 ;8 :43 –51\n. doi:10.1038/nrneph.2011.168 22045243 \n13. Leung \nN , Rajkumar \nSV . Renal manifestations of plasma cell disorders\n. Am J Kidney Dis . 2007 ;50 :155 –165\n. doi:10.1053/j.ajkd.2007.05.007 17591537 \n14. Izumo \nA , Sakai \nK , Tamura \nY . Acyclovir-induced neurotoxicity in an elderly patient: report of a case\n. J Japan Soc Emerg Med . 2017 ;20 :763 –768\n.\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1178-7074",
"issue": "14()",
"journal": "International journal of general medicine",
"keywords": "Bence–Jones proteinuria; acyclovir neurotoxicity; herpes zoster; valacyclovir",
"medline_ta": "Int J Gen Med",
"mesh_terms": null,
"nlm_unique_id": "101515487",
"other_id": null,
"pages": "413-417",
"pmc": null,
"pmid": "33603447",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "8228796;7249508;18711175;18753647;7973922;16401626;19187258;24777077;17591537;20823406;24942005;22045243",
"title": "Encephalopathy Induced by Preventive Administration of Acyclovir in a Man with Symptomatic Multiple Myeloma and Renal Dysfunction.",
"title_normalized": "encephalopathy induced by preventive administration of acyclovir in a man with symptomatic multiple myeloma and renal dysfunction"
} | [
{
"companynumb": "JP-SUN PHARMACEUTICAL INDUSTRIES LTD-2021RR-287495",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VALACYCLOVIR HYDROCHLORIDE"
},... |
{
"abstract": "We describe the management of a pregnant patient with osteogenesis imperfecta with a history of numerous fractures, severe scoliosis, and anticipated difficult airway. Her pregnancy was complicated by progressive shortness of breath and a fetal diagnosis of osteogenesis imperfecta. Spine anatomy precluded neuraxial anesthesia. Cesarean delivery was performed under general anesthesia at 34 weeks. Immediately after awake fiberoptic intubation and induction of general anesthesia, capnography waveform was lost with rapid profound oxygen desaturation. A supraglottic airway device was placed, oxygenation maintained with supraglottic airway and positive pressure ventilation throughout case, and the baby was delivered with Apgars of 8 and 9.",
"affiliations": "From the Department of Anesthesiology, Perioperative, and Pain Medicine, Baylor College of Medicine, Houston, Texas.;Department of Anesthesiology, Perioperative, and Pain Medicine, Stanford University School of Medicine, Stanford, California.",
"authors": "Sutton|Caitlin Dooley|CD|;Carvalho|Brendan|B|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1213/XAA.0000000000000968",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2575-3126",
"issue": "13(1)",
"journal": "A&A practice",
"keywords": null,
"medline_ta": "A A Pract",
"mesh_terms": "D000328:Adult; D000768:Anesthesia, General; D002585:Cesarean Section; D005260:Female; D005336:Fiber Optic Technology; D006801:Humans; D007442:Intubation, Intratracheal; D010013:Osteogenesis Imperfecta; D011247:Pregnancy",
"nlm_unique_id": "101714112",
"other_id": null,
"pages": "7-9",
"pmc": null,
"pmid": "30694815",
"pubdate": "2019-07-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Supraglottic Airway Rescue After Failed Fiberoptic Intubation in a Patient With Osteogenesis Imperfecta: A Case Report.",
"title_normalized": "supraglottic airway rescue after failed fiberoptic intubation in a patient with osteogenesis imperfecta a case report"
} | [
{
"companynumb": "US-PURDUE-USA-2019-0147662",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHADONE HYDROCHLORIDE"
},
"drugadditional"... |
{
"abstract": "Immunosuppressants are widely used to treat patients with rheumatoid arthritis (RA), and their adverse effects have been known to cause other iatrogenic immunodeficiency-associated lymphoproliferative disorders (OIIA-LPDs). We report a patient with RA who had been treated with methotrexate (MTX) and tacrolimus (TAC) and who developed whole body lymphadenopathy. We simultaneously confirmed angioimmunoblastic T-cell lymphoma (AITL) through a right cervical lymph node biopsy and Epstein-Barr virus-positive B-cell lymphoproliferative disorder (EBV-positive B-LPD) through a bone marrow examination. After cessation of immunosuppressant therapy, both LPDs completely disappeared. Patients with AITL are occasionally reported to develop B-cell lymphoma through reactivation of the EBV, which leads to clonal expansion in the microenvironment. Immunohistochemistry results revealed that both LPD components were positive for EBV-encoded RNA. Moreover, in this patient, the plasma EBV DNA level was found to be high; therefore, EBV infection was a probable etiology. Synchronous coexistence of AITL and B-LPD as an OIIA-LPD has rarely been reported. This case report is the first to discuss the disappearance of both LPDs on withdrawal of immunosuppressants only. AITL occasionally accompany B-LPD; however, this composite lymphoma comprised AITL and B-LPD, and OIIA-LPDs should not be overlooked.",
"affiliations": "Department of Hematology, Yodogawa Christian Hospital, Osaka, Japan.;Division of Medical Oncology and Hematology, Kobe University Graduate School of Medicine, Kobe, Japan.;Department of Hematology, Yodogawa Christian Hospital, Osaka, Japan.;Department of Hematology, Yodogawa Christian Hospital, Osaka, Japan.;Department of Hematology, Yodogawa Christian Hospital, Osaka, Japan.;Department of Hematology, Yodogawa Christian Hospital, Osaka, Japan.;Division of Molecular Medicine & Medical Genetics, Department of Pathology, Kobe Graduate School of Medicine, Kobe, Japan.;Department of Pathology, Hyogo Cancer Center, Akashi, Japan.;Department of Hematology, Yodogawa Christian Hospital, Osaka, Japan.",
"authors": "Kakiuchi|Seiji|S|;Yakushijin|Kimikazu|K|;Takagi|Ikumi|I|;Rikitake|Junpei|J|;Akiyama|Hiroaki|H|;Matsuba|Hiroyuki|H|;Hayashi|Yoshitake|Y|;Kajimoto|Kazuyoshi|K|;Iwata|Nobuko|N|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3389/fmed.2020.625442",
"fulltext": "\n==== Front\nFront Med (Lausanne)\nFront Med (Lausanne)\nFront. Med.\nFrontiers in Medicine\n2296-858X Frontiers Media S.A. \n\n10.3389/fmed.2020.625442\nMedicine\nCase Report\nCase Report: Composite Angioimmunoblastic T-Cell Lymphoma and Epstein-Barr Virus-Positive B-Cell Lymphoproliferative Disorder as Other Iatrogenic Immunodeficiency-Associated Lymphoproliferative Disorders\nKakiuchi Seiji 12* Yakushijin Kimikazu 2 Takagi Ikumi 1 Rikitake Junpei 12 Akiyama Hiroaki 1 Matsuba Hiroyuki 1 Hayashi Yoshitake 3 Kajimoto Kazuyoshi 4 Iwata Nobuko 1 1Department of Hematology, Yodogawa Christian Hospital, Osaka, Japan\n2Division of Medical Oncology and Hematology, Kobe University Graduate School of Medicine, Kobe, Japan\n3Division of Molecular Medicine & Medical Genetics, Department of Pathology, Kobe Graduate School of Medicine, Kobe, Japan\n4Department of Pathology, Hyogo Cancer Center, Akashi, Japan\nEdited by: Paolo Fabrizio Caimi, Case Western Reserve University, United States\n\nReviewed by: Akira Satou, Aichi Medical University, Japan; Naoya Nakamura, Tokai University, Japan\n\n*Correspondence: Seiji Kakiuchi kakky_49@yahoo.co.jpThis article was submitted to Hematology, a section of the journal Frontiers in Medicine\n\n\n23 12 2020 \n2020 \n7 62544203 11 2020 07 12 2020 Copyright © 2020 Kakiuchi, Yakushijin, Takagi, Rikitake, Akiyama, Matsuba, Hayashi, Kajimoto and Iwata.2020Kakiuchi, Yakushijin, Takagi, Rikitake, Akiyama, Matsuba, Hayashi, Kajimoto and IwataThis is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.Immunosuppressants are widely used to treat patients with rheumatoid arthritis (RA), and their adverse effects have been known to cause other iatrogenic immunodeficiency-associated lymphoproliferative disorders (OIIA-LPDs). We report a patient with RA who had been treated with methotrexate (MTX) and tacrolimus (TAC) and who developed whole body lymphadenopathy. We simultaneously confirmed angioimmunoblastic T-cell lymphoma (AITL) through a right cervical lymph node biopsy and Epstein-Barr virus-positive B-cell lymphoproliferative disorder (EBV-positive B-LPD) through a bone marrow examination. After cessation of immunosuppressant therapy, both LPDs completely disappeared. Patients with AITL are occasionally reported to develop B-cell lymphoma through reactivation of the EBV, which leads to clonal expansion in the microenvironment. Immunohistochemistry results revealed that both LPD components were positive for EBV-encoded RNA. Moreover, in this patient, the plasma EBV DNA level was found to be high; therefore, EBV infection was a probable etiology. Synchronous coexistence of AITL and B-LPD as an OIIA-LPD has rarely been reported. This case report is the first to discuss the disappearance of both LPDs on withdrawal of immunosuppressants only. AITL occasionally accompany B-LPD; however, this composite lymphoma comprised AITL and B-LPD, and OIIA-LPDs should not be overlooked.\n\ncomposite lymphomaEpstein-Barr virus reactivationmethotrexateangioimmunoblastic T-cell lymphoma (AITL)clonal expansion\n==== Body\nIntroduction\nAccording to the World Health Organization classification of tumors of hemopoietic and lymphoid tissues, other iatrogenic immunodeficiency-associated lymphoproliferative disorder (OIIA-LPD) is categorized as an immunodeficiency-related lymphoproliferative disorder. It is associated with anti-rheumatoid arthritis drugs including methotrexate (MTX), tacrolimus (TAC), and biological disease-modifying anti-rheumatic medication such as anti-TNFα drugs (1). B-cell lymphoma and Hodgkin lymphoma comprise most OIIA-LPDs, whereas T-cell lymphoma or natural killer (NK)/T-cell lymphoma comprise between 4 and 8% only (1–5). To date, only 50 patients (men, n = 26; women, n = 24) with MTX-associated T-LPDs (MTX T-LPDs) have been reported, including our patient, as detailed in Table 1 (2, 4, 6–18). Of these, 49 patients were treated for rheumatoid arthritis (RA) and one patient was treated for polymyalgia rheumatica. Data concerning the duration of MTX usage was available for 38 patients, and the median duration was 5 years (range, 0.4–24 years). Treatment for 38 patients initially involved the withdrawal of MTX only and, of these, 35 patients improved post-MTX cessation [complete response (CR), n = 31; partial response (PR), n = 4]. Chemotherapy was the initial treatment for 12 patients and response data was recorded for 10 patients [CR, n = 9; progressive disease (PD), n = 1]. Finally, data of 48 patients were available comprising 35 patients with a CR, four patients with a PR, and nine patients with PD. In total, 10 of 48 patients relapsed or progressed after initial treatment.\n\nTable 1 Clinicopathological features of methotrexate-associated T-cell lymphoproliferative disorder.\n\nCase (References)\tAge/Sex\tsubtype\tDisease site\tBiopsy site\tMTX duration (year)\tEBER in tumor cell\tEBER in background\tEBV-DNA copy (/106 cells)\tFirst line Management\tSecond line Management\tSR\tResponse\tRecurrence or Progression\tOutcome (month)\t\nCase 1 (6)\t66/F\tCD30+ PC T-LPD\tSkin\tSkin\tNA\t+\tNA\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t2\t\nCase 2 (7)\t75/F\tCD8+ T-LPD\tLiver, spleen, LNs\tLN\t7\t+\tNA\t7,400\tOff MTX\tAcyclovir,\t-\tNR → CR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\tIVIG, steroid\t\t\t\t7\t\nCase 3 (8)\t71/F\tAITL-like\tLNs\tLN\t20\t–\t+\tNA\tOff MTX\t–\t+\tCR\tNo\tNA\t\nCase 4 (8)\t68/M\tAITL-like\tLNs\tLN\tNA\t–\t+\tNA\tOff MTX\t–\t+\tCR\tNo\tNA\t\nCase 5 (8)\t67/M\tAITL-like\tLNs\tLN\t16\t–\t+\tNA\tOff MTX\tCHOP\t+\tCR\tYes\tNA\t\nCase 6 (2)\t60/M\tAITL\tLNs\tLN\t0.6\t–\tNA\tNA\tOff MTX\tChemotherapy\t+\tPR\tYes\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t9\t\nCase 7 (9)\t66/F\tAITL\tLN\tLN\t0.4\t–\t+\t290\tOff MTX\tOff MTX\t+\tCR → CR\tYes (DLBCL)\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t18\t\nCase 8 (10)\t48/F\tCD8+ T-LPD\tLungs, LNs, kidney, liver, spleen\tLN\t11.1\t–\t+\tNA\tOff MTX\t–\t+\tPR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t1\t\nCase 9 (11)\t78/M\tPTCL-NOS\tLNs\tLN\t5.5\t+\tNA\tNA\tNA about MTX\t–\tNA\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\tChemotherapy\t\t\t\t\t12\t\nCase 10 (12)\t59/F\tT-LGL\tBM, LN\tNA\tNA\t–\t–\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t18\t\nCase 11 (12)\t69/F\tALK- ALCL\tLN\tLN\tNA\t–\t–\tNA\tChemotherapy\t–\tNo cessation\tNA\tNA\tDead\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t2\t\nCase 12 (12)\t61/F\tT-LGL\tBM, LN\tNA\tNA\t–\t–\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t65\t\nCase 13 (12)\t70/M\tAITL to T-ML, nos\tLN\tLN\tNA\tAITL-\t+\tNA\tOff MTX\tCHOP\t+\tCR → CR\tYes\tAlive\t\n\t\t\t\t\t\tT-ML +\t\t\t\t\t\t\t\t60\t\nCase 14 (12)\t31/M\tSPTCL\tSubcutis\tSubcutis\tNA\t–\t–\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t24\t\nCase 15 (4)\t75/M\tT-pleomorphic\tNA\tNA\t24\tNA\tNA\tNA\tOff MTX\t–\tNA\tNA → PD\tNA\tDOD\t\n\t\t\t\t\t\t\t\t\tChemotherapy\t\t\t\t\tNA\t\nCase 16 (4)\t58/M\tT-LGL\tNA\tNA\t6\tNA\tNA\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t41\t\nCase 17 (13)\t77/M\tPTCL-NOS\tLNs\tLN\t22\t-\tNA\tNA\tOff MTX\tCHOP\t-\tPD\tYes\tDied for infection\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t5\t\nCase 18 (14)\t60/M\tSPTCL\tSubcutis, abdominal cavity\tSubcutis\tNA\t+\tNA\t2,000\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t15\t\nCase 19 (15)\t44/F\tPTCL-NOS\tNasal sputum, maxillary sinus, lungs, LNs\tLN\t5\t+\t+\t420\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t12\t\nCase 20 (16)\t66/F\tCD30+ T-LPD\tLips\tLower lip\t>5\t+\tNA\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t12\t\nCase 21 (17)\t74/F\tAITL\tLNs\tLN\t8\t-\t+\tNA\tOff MTX\t–\t+\tPR\tNo\tDied for DIC\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t0\t\nCase 22 (17)\t81/M\tAITL\tLNs\tLN\tNA\t-\t+\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t16\t\nCase 23 (17)\t78/M\tAITL\tLNs\tLN\t5.5\t-\t+\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t2\t\nCase 24 (17)\t69/M\tAITL\tLNs\tLN\t1\t-\t+\tNA\tOff MTX\t–\t+\tPR\tNo\tAlive with disease\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t4\t\nCase 25 (17)\t75/F\tAITL\tLNs\tLN\t0.5\t-\t+\tNA\tOff MTX\tNA\t+\tCR → PD\tYes\tDOD\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t49\t\nCase 26 (17)\t67/M\tAITL\tLNs, PB, subcutis\tLN\t6\t-\t+\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\tCHOP\t\t\t\t\t31\t\nCase 27 (17)\t66/F\tAITL\tLNs, BM\tLN\t2.5\t-\t+\tNA\tOff MTX\tNA\t+\tCR → PD\tYes (DLBCL)\tDOD\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t93\t\nCase 28 (17)\t72/F\tAITL, EBV+ B-LPD\tLNs, skin, spleen\tLN, skin\tNA\t-\t+\tNA\tOff MTX\t–\t-\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\tR-CHOP\t\t\t\t\t6\t\nCase 29 (17)\t57/M\tAITL\tLNs\tLN\t5\t-\t-\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t45\t\nCase 30 (17)\t75/M\tAITL\tLNs\tLN\t2.4\t-\t+\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\tSobuzoxane + ETO\t\t\t\t\t45\t\nCase 31 (17)\t69/M\tAITL with EBV+HRS\tLNs\tLN\t21\t-\t+\tNA\tOff MTX\t–\t-\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\tCHOP\t\t\t\t\t37\t\nCase 32 (17)\t67/F\tAITL\tLNs, PB\tLN\t4.5\t-\t+\tNA\tOff MTX\t–\t-\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\tR-CHOP\t\t\t\t\t17\t\nCase 33 (17)\t79/M\tAITL with EBV+HRS\tLNs\tLN\t2.5\t-\t+\tNA\tOff MTX\tNA\t-\tPD\t-\tDOD\t\n\t\t\t\t\t\t\t\t\tCOP\t\t\t\t\t2\t\nCase 34 (17)\t79/M\tAITL\tLNs\tLN\t15.5\t-\t+\tNA\tTHP-COP\t–\tNo cessation\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t9\t\nCase 35 (17)\t85/M\tAITL with EBV+HRS\tLNs\tLN\t0.9\t-\t+\tNA\tOff MTX\tNA\t-\tNR → PD\t-\tDOD\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t1\t\nCase 36 (17)\t70/M\tAITL\tLNs, Extranodal >1\tLN\t18.4\t-\t+\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t68\t\nCase 37 (17)\t76/M\tAITL\tLNs\tLN\t1.8\t-\t+\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t65\t\nCase 38 (17)\t67/F\tAITL\tLNs\tLN\t0.5\t-\t-\tNA\tCHOP\t–\tNo cessation\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t14\t\nCase 39 (17)\t62/M\tAITL\tLNs, liver, spleen, adrenal gland\tLN\t3\t-\t+\tNA\tOff MTX\tNA\t+\tCR → NA\tYes\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t25\t\nCase 40 (17)\t63/F\tPTCL-NOS of Tfh\tLNs\tLN\t10\t-\t+\tNA\tOff MTX\tNA\t+\tCR → PD\tNo\tDOD\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t37\t\nCase 41 (17)\t76/F\tPTCL-NOS\tLNs\tLN\t1.3\t–\t–\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t27\t\nCase 42 (17)\t64/M\tPTCL-NOS\tLNs, ST\tST\t7.7\t–\t+\tNA\tOff MTX\tNA\t+\tCR → PD\tYes\tDOD\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t31\t\nCase 43 (17)\t80/F\tPTCL-NOS\tLN, oral mucosa\tOral mucosa\t9.3\t–\t+\tNA\tOff MTX\t-\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t12\t\nCase 44 (17)\t63/M\tPTCL-NOS with EBV+ HRS\tLNs\tLN\t2.3\t–\t+\tNA\tOff MTX\t–\t-\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\tCHOP\t\t\t\t\t21\t\nCase 45 (17)\t56/F\tCutaneous PTCL-NOS\tSkin\tSkin\t4.3\t–\t+\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t20\t\nCase 46 (17)\t72/F\tCD8+ Cytotoxic T-LPD\tLNs, pleural E, pericardial\tLN\t3\t-\t+\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t66\t\nCase 47 (17)\t57/F\tCD8+ Cytotoxic T-LPD\tLNs, BM, spleen\tBM\t0.5\t+\tNA\tNA\tOff MTX\t–\t+\tCR\tNo\tDied for ASO and RB\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t80\t\nCase 48 (17)\t65/F\tCD8+ Cytotoxic T-LPD\tLNs, liver, kidney\tLiver\t3\t-\t+\tNA\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t13\t\nCase 49 (17)\t74/F\tATL lymphoma type\tLNs\tLN\t5\t-\tNA\tNA\tOff MTX\tNo\t+\tCR → PD\tYes\tDOD\t\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t14\t\nPresent Case\t73/M\tAITL\tLNs, BM\tLN\t17.8\t-\t+\t1,700\tOff MTX\t–\t+\tCR\tNo\tAlive\t\n\t\tEBV-positive B-cell LPD\t\t\t\t\t\t\t\t\t\t\t\t20\t\nAITL, angioimmunoblastic T-cell lymphoma; ALCL, anaplastic large cell lymphoma; ASO, arteriosclerosis obliterans; ATL, adult t-cell lymphoma; BM, bone marrow; CR, complete response; DLBCL, diffuse large b-cell lymphoma; DOD, died of disease; E, effusion; EBV, Epstein-Barr virus; EBER; EBV-encoded small RNA; F, female; HRS, Hodgkin-Reed-Sternberg; LGL, large granular lymphocytic leukemia; LN, lymph node; LPD, lymphoproliferative disorder; M, male; MO, months; MTX, methotrexate; NA, not available; NOS, not otherwise specified; NR, no response; PC, primary cutaneous; PD, progressive disease; PR, partial response; PS, performance status; PTCL, peripheral T-cell lymphoma; RB, rectal bleeding; SR, spontaneous regression; ST, subcutaneous tissue; Tfh, follicular helper T cell; y, year.\n\nWe encountered a 73-year-old male with a long medication history of MTX and TAC administration for the treatment of RA, who developed composite lymphomas consisting of angioimmunoblastic T-cell lymphoma (AITL) and Epstein-Barr virus-positive B-cell lymphoproliferative disorder (EBV-positive B-LPD). Considering the possibility of OIIA-LPD, we discontinued immunosuppressant therapy and undertook careful observation. Immunohistochemical test results indicated composite lymphomas, and both tumors were EBV-encoded RNA (EBER)-positive. In addition, his plasma level of EBV DNA copies was also high. He achieved CR only after immunosuppressant withdrawal. Therefore, composite lymphomas can be considered MTX-associated LPDs with different lineages and, here, we report one such type as a first case.\n\nCase Presentation\nA 73-year-old man with a 20-year history of RA and a medication history of MTX (duration, 17.8 years), TAC (duration, 10.2 years), and prednisolone (PSL) was admitted to our hospital with a 4-day history of high fever and fatigue. On arrival, his vital signs were normal, except for his heart rate (113 beats/min) and body temperature (40.1°C). On physical examination, we observed right cervical lymphadenopathy. His blood test results are described in Table 2. His soluble IL-2 receptor (sIL-2R) level was markedly elevated (11,200 IU/mL; normal range, 145–519 IU/mL). A whole body computed tomography (CT) scan revealed bilateral cervical, subclavian, axilla, inguinal, mediastinal, portal, periaortic, and pelvic lymph node swelling. Given his medication history of immunosuppressant therapy, we assumed the possibility of an OIIA-LPD and consequently discontinued MTX and TAC. We continued PSL only and started intravenous antibiotics, and his elevated body temperature was soon resolved. On day 2, a bone marrow examination was conducted, and a cervical lymph node biopsy was performed on day 7.\n\nTable 2 Patient laboratory data on admission.\n\nComplete blood count\t\t\nWhite blood cells\t7,300 /μL\t\nRed blood cells\t450 ×104 /μL\t\nHemoglobin\t12.3 g/dL\t\nHematocrit\t41.2 %\t\nPlatelet\t16.8 /μL\t\nBiochemistry\t\t\nTotal protein\t6.0 g/dL\t\nTotal bilirubin\t0.6 mg/dL\t\nAlbumin\t2.8 g/dL\t\nAST\t36 IU/L\t\nALT\t12 IU/L\t\nγ-GTP\t21 IU/L\t\nLDH\t365 IU/L\t\nALP\t207 IU/L\t\nCPK\t49 IU/L\t\nBlood urea nitrogen\t27.7 mg/dL\t\nCreatinine\t1.0 mg/dL\t\nAmylase\t28 IU/L\t\nC-reactive protein\t13.0 mg/dL\t\nsIL-2R\t11,200 U/mL\t\nFerritin\t640 ng/mL\t\nprocalcitonin\t1.1 ng/mL\t\nImmunology\t\t\nAnti-nuclear Ab\t× <40\t\nRheumatoid factor\t48 IU/mL\t\nInfection\t\t\nT-SPOT®.TB Assay\tNegative\t\nEBV VCA-IgG\t×160\t\nEBV VCA-IgM\t× <10\t\nEBV EA-DR IgG\t× <10\t\nEBV EA-DR IgM\t× <10\t\nEBV EBNA\t×20\t\nCMV IgG\t10.0\t\nCMV IgM\t0.6\t\nβ-D gllucan\t <6 pg/mL\t\nHBs antigen\t0.00 IU/mL\t\nHCV Ab\t0.13 Log IU/mL\t\nRPR\t0.0 R.U.\t\nTPLA\t0.0 T.U.\t\nHTLV-1\tNegative\t\nAb, antibody; ALP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartate aminotransferase; CMV, cytomegalo virus; CPK, creatinine phosphokinase; EA-DR, early antigen-diffuse and restricted antibody; EBNA, Epstein-Barr virus nuclear antigen antibody; HBs, hepatitis B surface; HCV, hepatitis C virus; HTLV-1, human T-cell leukemia virus type 1; LDH, lactate dehydrogenase; RPR, rapid plasma reagin test; sIL-2R, soluble interleukin-2 receptor; TPLA, Treponema pallidum latex agglutination test; VCA, virus capsid antigen; γ-GTP, γ-glutamyl transpeptidase.\n\nHistopathological examination of the bone marrow biopsy revealed scattered infiltration of large atypical lymphocytes (Figures 1A,B). These cells were positive for CD20, CD25, and MUM1, and negative for CD3 (Figure 1C). EBER-positive lymphocytes were detected using in situ hybridization background staining (Figure 1D). However, histological examination of the lymph nodes showed an effaced structure with a marked increase in small-to-medium-sized atypical mononuclear cells with irregular nuclei and clear cytoplasm in a background of arborizing endothelial venules (Figures 2A,B). Immunostaining showed these atypical cells were positive for CD3 and CD4, and large immunoblastic lymphocytes scattered among the neoplastic cells were positive for CD20 (Figure 2C). No Reed-Sternberg-like cells were observed. In addition, the neoplastic cells were positive for BCL6 and CD10, suggestive of the follicular T-helper cell phenotype. Podoplanin immunostaining, a highly effective marker of follicular dendritic cells, showed an expanded follicular dendritic cell meshwork, although it was negative for CD21 (Figure 2D) (19, 20). PD-1-positive lymphocytes were EBER-negative, while CD20-positive background cells were EBER-positive (Figures 2E,F).\n\nFigure 1 Histopathology of bone marrow biopsy showing scattered infiltration of atypical large lymphocytes. (A) Low-power view of the bone marrow biopsy (H&E stain, ×50). (B) High-power view of the atypical lymphocytes (H&E stain, ×200). (C) Immunohistochemical staining of CD20-positive lymphoproliferative cells (×400). (D) EBER in situ hybridization indicating positive signals in the nuclei of background cells (×200).\n\nFigure 2 Photomicrography of the nodal biopsy. (A) Low-power view reveals effaced structure by marked infiltrate of small-to-medium-sized atypical lymphocytes with clear cytoplasm (H&E stain, ×100). (B) High-power view showing polymorphous lymphoid infiltrate with high endothelial venules (H&E stain, ×400). (C) Immunohistochemically, large immunoblastic lymphocytes were positive for CD20 (×400). (D) Podoplanin immunostain revealed expanded follicular dendritic cell meshwork (×400). (E) EBER in situ hybridization followed by PD-1 immunostaining showed that lymphoma cells were negative for EBER. (F) EBER in situ hybridization followed by the immunostaining of CD20 indicated positive-signal lymphocytes infiltrate indicating positive signals in the nuclei of background cells (×600).\n\nDiagnoses of AITL from cervical lymph nodes and of EBV-positive polymorphic B-LPD from bone marrow were confirmed. Thereafter, his lymph node swellings gradually regressed and his general condition improved. On day 22, he was discharged from hospital. Quantitative polymerase chain reaction for plasma EBV DNA on that day showed 1,700 copies/106 cells (normal range, <20). On day 24, a fluorodeoxyglucose-positron emission tomography/CT scan revealed CR. His sIL-2R level dropped to 622 IU/mL on day 47, then returned to a normal level (421 IU/mL) on day 68. In addition, a bone marrow examination was conducted on day 148. Flow cytometry showed no abnormal cells, the G-band showed a normal karyotype, immunoglobulin heavy chain (IgH) rearrangement was negative, and no evidence of disease was histologically evident. Thus, he achieved CR. So far, he is still in disease-free for more than 20 months.\n\nDiscussion\nWe encountered a patient with RA who had been treated with immunosuppressant therapy, who developed composite lymphomas consisting of AITL and EBV-positive B-LPD. To date, only 3 cases have been reported that have exhibited metachronous or synchronous coexistence of AITL and B-LPD as OIIA-LPDs, comprising two metachronous cases and one synchronous case (9, 17). Concerning the synchronous case, Satou et al. presented a 72-year-old woman with RA who had received MTX (17). She was diagnosed with AITL through lymph node biopsy, and was found to be EBV-positive according to cutaneous lesion biopsy results. The disease did not exhibit spontaneous regression after MTX withdrawal; therefore, she was treated with a combination of rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone and achieved CR. She remained alive 6 months after diagnosis without recurrence. Satou et al. also reported a 66-year-old woman with RA who had received MTX for 2.5 years as a metachronous case. Lymph node biopsy results were used to diagnose AITL and a CR was achieved post-MTX withdrawal. Thereafter, she relapsed and was found to have lymphadenopathy, and the lymph node biopsy results indicated diffuse large B-cell lymphoma (DLBCL). She died of the disease 93 months after initial diagnosis. Concerning a second metachronous case, Ishibuchi et al. presented a 66-year-old woman with polymyalgia rheumatica and a 4-month history of MTX therapy (9). An inguinal lymph node biopsy was performed and she was diagnosed with AITL. MTX therapy was stopped and the disease disappeared 6 months after MTX cessation. Eight months later, subcutaneous nodules appeared and a biopsy was performed, which later revealed DLBCL. With discontinuation of MTX only, the disease also regressed after 4 months. To our knowledge, no case of AITL and B-LPD simultaneously occurring and both disappearing through withdrawal of immunosuppressant therapy only has previously been reported prior to our case.\n\nComposite lymphoma, a term introduced by Custer (21), is a rare pathological condition in which two different lymphomas co-exist simultaneously in one patient. Composite lymphoma has been reported to account for 1–4% of all lymphoma cases (22). Additionally, an analysis of 9,426 lymphoma cases in Japan revealed OIIA-LPD accounted for 147 (1.56%) cases (23). As previously stated, only 50 patients with MTX T-LPD have been reported. Composite lymphoma including T-cell lineage as an OIIA-LPD appears to be extremely rare and, as such, the clinicopathological features of MTX T-LPD remain to be elucidated. Clinicopathological feature of MTX T-LPD has yet to be elucidated because of its rarity. However, concerning our case, we consider EBV has key roles in lymphomagenesis.\n\nIn terms of EBV, Feng et al. suggested that MTX may directly reactivate latent EBV, as another cause of immunodeficiency, and lead to the development of LPDs in most MTX-associated LPDs (24). However, most proliferative T- and NK-cells are negative for EBV in MTX T-LPDs. Therefore, this suggestion does not appear readily applicable. As described in Table 1, while the tumor cells were positive for EBV in 8 (17%) of 48 patients, background cells were positive in 32 (82%) of 39 patients with available data (2, 4, 6–18). In relation to patients with AITL or those with AITL-like lymphomas, background cells were EBV-positive in 24 (96%) of 25 patients with available data. Therefore, immunodeficiency may suppress EBV-specific cytotoxic T-lymphocytes activity (25), and the reactivation of EBV suggests that the patients are immunodeficient and may suppress any immune response to prevent tumor growth. Furthermore, the relationship between EBV-positive background B-cells and AITL should be noted. AITL is a neoplasm due to clonal expansion of germinal center T-cells (26). Moreover, microarray studies have shown that tumor cells originate from follicular helper T-cells (27, 28). Of note, patients with AITL are frequently found to have EBV-positive B-cells in the microenvironment, as mentioned earlier. These B-cells accumulate somatic mutations through clonal expansion, and it has been suggested that some of these mutated cells develop B-cell lymphomas (29). Approximately 10% of patients with AITL have been found to have concurrent B-cell lymphoma at diagnosis or during the course of the disease (30, 31). In our case, B-LPD cells as well as CD20-positive cells surrounding AITL cells were EBER-positive. We speculate that MTX-associated EBV reactivation may have triggered the mutation and caused clonal expansion into the B-cells surrounding the AITL cells, leading to the development of B-LPD. Moreover, immunosuppressant can certainly accelerate lymphomageneses through inhibition of cytotoxic T-cell activity.\n\nThis case is the first to report AITL and EBV-positive B-LPD co-occurring as an OIIA-LPD that disappeared after we stopped immunosuppressant therapy only. AITL is known as a lymphoma that occasionally complicates B-LPD; thus, AITL co-locating with B-cell LPD as an OIIA-LPD might be overlooked. It is important to note that AITL can accompany B-LPD simultaneously or at a later stage, regardless of whether it is an OIIA-LPD.\n\nData Availability Statement\nThe datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/supplementary material.\n\nAuthor Contributions\nSK and KY wrote the manuscript, with support from all other authors. IT, JR, HA, HM, and NI treated the patient and provided the clinical history. YH and KK performed the histological examinations. All authors have critically revised and approved the final version of the manuscript.\n\nConflict of Interest\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n==== Refs\nReferences\n1. Swerdlow SH Campo E Harris NL Jaffe ES Pileri SA Stein H \nWHO Classification of Tumours of Haematopoietic and Lymphoid Tissues\n. WHO Classification of Tumours . Revised 4th ed. Lyon: IARC Press (2017 ).\n2. Hoshida Y Xu JX Fujita S Nakamichi I Ikeda J Tomita Y . Lymphoproliferative disorders in rheumatoid arthritis: clinicopathological analysis of 76 cases in relation to methotrexate medication\n. J Rheumatol. (2007 ) 34 :322 –31\n.17117491 \n3. Ichikawa A Arakawa F Kiyasu J Sato K Miyoshi H Niino D . Methotrexate/iatrogenic lymphoproliferative disorders in rheumatoid arthritis: histology, Epstein-Barr virus, and clonality are important predictors of disease progression and regression\n. Eur J Haematol. (2013 ) 91 :20 –8\n. 10.1111/ejh.12116 23560463 \n4. Mariette X Cazals-Hatem D Warszawki J Liote F Balandraud N Sibilia J . Lymphomas in rheumatoid arthritis patients treated with methotrexate: a 3-year prospective study in France\n. Blood. (2002 ) 99 :3909 –15\n. 10.1182/blood.V99.11.3909 12010788 \n5. Yamakawa N Fujimoto M Kawabata D Terao C Nishikori M Nakashima R . A clinical, pathological, and genetic characterization of methotrexate-associated lymphoproliferative disorders\n. J Rheumatol. (2014 ) 41 :293 –9\n. 10.3899/jrheum.130270 24334644 \n6. Claudino WM Gibson B Tse W Krem M Grewal J . Methotrexate-associated primary cutaneous CD30-positive cutaneous T-cell lymphoproliferative disorder: a case illustration and a brief review\n. Am J Blood Res. (2016 ) 6 :1 –5\n.27335685 \n7. Hatachi S Kunitomi A Aozasa K Yagita M . CD8(+) T-cell lymphoproliferative disorder associated with Epstein-Barr virus in a patient with rheumatoid arthritis during methotrexate therapy\n. Mod Rheumatol. (2010 ) 20 :500 –5\n. 10.3109/s10165-010-0300-z 20437072 \n8. Hatanaka K Nakamura N Kojima M Ando K Irie S Bunno M . Methotrexate-associated lymphoproliferative disorders mimicking angioimmunoblastic T-cell lymphoma\n. Pathol Res Pract. (2010 ) 206 :9 –13\n. 10.1016/j.prp.2009.03.005 19628340 \n9. Ishibuchi H Motegi S Yamanaka M Amano H Ishikawa O . Methotrexate-associated lymphoproliferative disorder: sequential development of angioimmunoblastic T-cell lymphoma-like lymphoproliferation in the lymph nodes and diffuse large B-cell lymphoma in the skin in the same patient\n. Eur J Dermatol. (2015 ) 25 :361 –2\n. 10.1684/ejd.2015.2582 26105783 \n10. Koji H Yazawa T Nakabayashi K Fujioka Y Kamma H Yamada A . CD8-positive T-cell lymphoproliferative disorder associated with Epstein-Barr virus-infected B-cells in a rheumatoid arthritis patient under methotrexate treatment\n. Mod Rheumatol. (2016 ) 26 :271 –5\n. 10.3109/14397595.2013.850613 24386983 \n11. Kojima M Itoh H Hirabayashi K Igarashi S Tamaki Y Murayama K . Methtrexate-associated lymphoproliferative disorders. A clinicopathological study of 13 Japanese cases\n. Pathol Res Pract. (2006 ) 202 :679 –85\n. 10.1016/j.prp.2006.05.007 16859835 \n12. Kondo S Tanimoto K Yamada K Yoshimoto G Suematsu E Fujisaki T . Mature T/NK-cell lymphoproliferative disease and Epstein-Barr virus infection are more frequent in patients with rheumatoid arthritis treated with methotrexate\n. Virchows Arch. (2013 ) 462 :399 –407\n. 10.1007/s00428-013-1389-1 23494713 \n13. Miyazaki T Fujimaki K Shirasugi Y Yoshiba F Ohsaka M Miyazaki K . Remission of lymphoma after withdrawal of methotrexate in rheumatoid arthritis: relationship with type of latent Epstein-Barr virus infection\n. Am J Hematol. (2007 ) 82 :1106 –9\n. 10.1002/ajh.21003 17654684 \n14. Nemoto Y Taniguchi A Kamioka M Nakaoka Y Hiroi M Yokoyama A . Epstein-Barr virus-infected subcutaneous panniculitis-like T-cell lymphoma associated with methotrexate treatment\n. Int J Hematol. (2010 ) 92 :364 –8\n. 10.1007/s12185-010-0642-5 20665252 \n15. Sakaguchi R Fujikawa K Okamoto M Matsuo E Matsumoto K Uchida T . A case of rheumatoid arthritis complicated with nasal septum perforation due to methotrexate-associated lymphoproliferative disorder\n. Intern Med. (2019 ) 58 :3167 –71\n. 10.2169/internalmedicine.2995-19 31292392 \n16. Saleh JZ Lee LH Schieke SM Hosking PR Hwang ST . Methotrexate-induced CD30(+) T-cell lymphoproliferative disorder of the oral cavity\n. JAAD Case Rep. (2016 ) 2 :354 –6\n. 10.1016/j.jdcr.2016.02.002 27626055 \n17. Satou A Tabata T Miyoshi H Kohno K Suzuki Y Yamashita D . Methotrexate-associated lymphoproliferative disorders of T-cell phenotype: clinicopathological analysis of 28 cases\n. Mod Pathol. (2019 ) 32 :1135 –46\n. 10.1038/s41379-019-0264-2 30952973 \n18. Takajo I Umekita K Ikei Y Oshima K Okayama A . Adult T-cell leukemia/lymphoma as a methotrexate-associated lymphoproliferative disorder in a patient with rheumatoid arthritis\n. Intern Med. (2018 ) 57 :2071 –5\n. 10.2169/internalmedicine.0308-17 29491299 \n19. Marsee DK Pinkus GS Hornick JL . Podoplanin (D2-40) is a highly effective marker of follicular dendritic cells\n. Appl Immunohistochem Mol Morphol . (2009 ) 17 :102 –7\n. 10.1097/PAI.0b013e318183a8e2 18838918 \n20. Xie Q Chen L Fu K Harter J Young KH Sunkara J . Podoplanin (d2-40): a new immunohistochemical marker for reactive follicular dendritic cells and follicular dendritic cell sarcomas\n. Int J Clin Exp Pathol . (2008 )1 :276 –84\n.18784810 \n21. Custer R \nPitfalls om the diagnosis of lymphoma and leukemia from the pathologist's point of view. In: Second National Cancer Conference\n. New York, NY (1954 ).\n22. Thirumala S Esposito M Fuchs A . An unusual variant of composite lymphoma: a short case report and review of the literature\n. Arch Pathol Lab Med. (2000 ) 124:1376−8.10975943 \n23. Muto R Miyoshi H Sato K Furuta T Muta H Kawamoto K . Epidemiology and secular trends of malignant lymphoma in Japan: analysis of 9426 cases according to the World Health Organization classification\n. Cancer Med. (2018 ) 7 :5843 –58\n. 10.1002/cam4.1805 30311404 \n24. Feng WH Cohen JI Fischer S Li L Sneller M Goldbach-Mansky R . Reactivation of latent Epstein-Barr virus by methotrexate: a potential contributor to methotrexate-associated lymphomas\n. J Natl Cancer Inst. (2004 ) 96 :1691 –702\n. 10.1093/jnci/djh313 15547182 \n25. Landais E Saulquin X Houssaint E . The human T cell immune response to Epstein-Barr virus\n. Int J Dev Biol. (2005 ) 49 :285 –92\n. 10.1387/ijdb.041947el 15906243 \n26. Attygalle A Al-Jehani R Diss TC Munson P Liu H Du MQ . Neoplastic T cells in angioimmunoblastic T-cell lymphoma express CD10\n. Blood. (2002 ) 99 :627 –33\n. 10.1182/blood.V99.2.627 11781247 \n27. Piccaluga PP Agostinelli C Califano A Carbone A Fantoni L Ferrari S . Gene expression analysis of angioimmunoblastic lymphoma indicates derivation from T follicular helper cells and vascular endothelial growth factor deregulation\n. Cancer Res. (2007 ) 67 :10703 –10\n. 10.1158/0008-5472.CAN-07-1708 18006812 \n28. de Leval L Rickman DS Thielen C Reynies A Huang YL Delsol G . The gene expression profile of nodal peripheral T-cell lymphoma demonstrates a molecular link between angioimmunoblastic T-cell lymphoma (AITL) and follicular helper T (TFH) cells\n. Blood . (2007 ) 109 :4952 –63\n. 10.1182/blood-2006-10-055145 17284527 \n29. Brauninger A Spieker T Willenbrock K Gaulard P Wacker HH Rajewsky K . Survival and clonal expansion of mutating forbidden (immunoglobulin receptor-deficient) epstein-barr virus-infected b cells in angioimmunoblastic t cell lymphoma\n. J Exp Med . (2001 ) 194 :927 –40\n. 10.1084/jem.194.7.927 11581315 \n30. Suefuji N Niino D Arakawa F Karube K Kimura Y Kiyasu J . Clinicopathological analysis of a composite lymphoma containing both T- and B-cell lymphomas\n. Pathol Int. (2012 ) 62 :690 –8\n. 10.1111/j.1440-1827.2012.02858.x 23005596 \n31. Willenbrock K Brauninger A Hansmann ML . Frequent occurrence of B-cell lymphomas in angioimmunoblastic T-cell lymphoma and proliferation of Epstein-Barr virus-infected cells in early cases\n. Br J Haematol. (2007 ) 138 :733 –9\n. 10.1111/j.1365-2141.2007.06725.x 17672882\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2296-858X",
"issue": "7()",
"journal": "Frontiers in medicine",
"keywords": "Epstein-Barr virus reactivation; angioimmunoblastic T-cell lymphoma (AITL); clonal expansion; composite lymphoma; methotrexate",
"medline_ta": "Front Med (Lausanne)",
"mesh_terms": null,
"nlm_unique_id": "101648047",
"other_id": null,
"pages": "625442",
"pmc": null,
"pmid": "33425968",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "31292392;11781247;20437072;23005596;17654684;30952973;17117491;27335685;24386983;15906243;15547182;18838918;30311404;11581315;23494713;18006812;18784810;27626055;12010788;24334644;20665252;16859835;26105783;29491299;17284527;19628340;17672882;10975943;23560463",
"title": "Case Report: Composite Angioimmunoblastic T-Cell Lymphoma and Epstein-Barr Virus-Positive B-Cell Lymphoproliferative Disorder as Other Iatrogenic Immunodeficiency-Associated Lymphoproliferative Disorders.",
"title_normalized": "case report composite angioimmunoblastic t cell lymphoma and epstein barr virus positive b cell lymphoproliferative disorder as other iatrogenic immunodeficiency associated lymphoproliferative disorders"
} | [
{
"companynumb": "JP-MYLANLABS-2021M1007013",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": "1",
... |
{
"abstract": "Toxic epidermal necrolysis (TEN) is a life-threatening disease, the pathogenesis of which remains largely unknown. We describe a 23-year-old woman under treatment with clobazam who developed lesions of TEN in light-exposed areas. Patch and photopatch tests with clobazam were negative. The cellular phenotype and cytokines were studied in blister fluid. The cellular infiltrate was composed mainly of T lymphocytes with a predominant cytotoxic phenotype. There was an increase in the level of tumour necrosis factor (TNF)-alpha in blister fluid compared with the control (a patient with bullous pemphigoid).",
"affiliations": "Department of Dermatology, University Clinic of Navarra, School of Medicine, Pamplona, Spain.",
"authors": "Redondo|P|P|;Vicente|J|J|;España|A|A|;Subira|M L|ML|;De Felipe|I|I|;Quintanilla|E|E|",
"chemical_list": "D014151:Anti-Anxiety Agents; D001570:Benzodiazepinones; D014409:Tumor Necrosis Factor-alpha; D001569:Benzodiazepines; D000078306:Clobazam",
"country": "England",
"delete": false,
"doi": "10.1046/j.1365-2133.1996.d01-1111.x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0007-0963",
"issue": "135(6)",
"journal": "The British journal of dermatology",
"keywords": null,
"medline_ta": "Br J Dermatol",
"mesh_terms": "D000328:Adult; D000506:Alopecia Areata; D014151:Anti-Anxiety Agents; D001569:Benzodiazepines; D001570:Benzodiazepinones; D000078306:Clobazam; D005122:Exudates and Transudates; D005260:Female; D006801:Humans; D010787:Photosensitivity Disorders; D012867:Skin; D013262:Stevens-Johnson Syndrome; D013602:T-Lymphocytes, Cytotoxic; D014409:Tumor Necrosis Factor-alpha",
"nlm_unique_id": "0004041",
"other_id": null,
"pages": "999-1002",
"pmc": null,
"pmid": "8977728",
"pubdate": "1996-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Photo-induced toxic epidermal necrolysis caused by clobazam.",
"title_normalized": "photo induced toxic epidermal necrolysis caused by clobazam"
} | [
{
"companynumb": "TR-ALKEM LABORATORIES LIMITED-TR-ALKEM-2021-03869",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CLOBAZAM"
},
"drugadd... |
{
"abstract": "Hepatitis C virus (HCV) infection has been associated with several extrahepatic adverse clinical outcomes, including an accelerated rate of loss of kidney function in patients with chronic kidney disease (CKD) and an increased mortality in patients with CKD and kidney failure on hemodialysis. Clinical trials using direct-acting antiviral (DAA) agents have uniformly achieved sustained viral response at 12 weeks (SVR12) rates of > 90% in the general population as well as in patients with CKD/kidney failure on hemodialysis. Sofosbuvir is a DAA prodrug that is phosphorylated into the active metabolite GS-461203, with subsequent dephosphorylation into the inactive metabolite GS-331007. The kidneys clear both sofosbuvir and GS-331007, and its use has been associated with worsening kidney function in some studies. In the HCV-TARGET study, patients with an estimated glomerular filtration rate (eGFR) < 30 mL/min at the initiation of sofosbuvir-based therapy had higher rates of deterioration of kidney function compared to patients with higher eGFR [1]. However, based on recent data demonstrating safety in patients with advanced CKD, the US Food and Drug Administration (FDA) approved the use of sofosbuvir-containing regimens in patients with CKD 4/5 (eGFR of less than 30 mL/min/1.73m2) and end-stage renal disease (ESRD) in late 2019. The current report describes 8 HCV-infected patients who developed acute kidney injury (AKI) with biopsy-proven acute interstitial nephritis (AIN) temporally associated with the use of DAAs. The mean age of the group was 61.3 (± 6 years). The most common HCV genotype (GT) was 1a (n = 7). The DAA formulations were sofosbuvir/ledipasvir (n = 5), elbasvir/grazoprevir (n = 2), and sofosbuvir/simeprevir (n = 1). All patients achieved an SVR12. The mean serum creatinine at the initiation of DAA treatment was 1.5 mg/dL (± 0.6) and increased to 2.03 mg/dL (± 0.7) by the last day of DAA administration. The kidney biopsies were performed at a mean of 320 days (± 247) after achieving an SVR12, at which point the mean creatinine had increased to 2.3 mg/dL (± 1.4). All patients received a course of high-dose corticosteroids after the diagnosis of AIN was confirmed by biopsy. Serum creatinine levels at 3 and 6 months following the completion of steroid therapy were 2.8 (± 1.2) and 3.1 mg/dL (± 1.5), respectively. Three patients had worsening CKD and progressed to kidney failure requiring hemodialysis. These results are consistent with earlier studies demonstrating the efficacy of the DAAs in HCV-infected CKD patients. Of note, the demonstration of AIN in these patients may explain some of the AKI events reported with the use of DAAs in patients with CKD.",
"affiliations": null,
"authors": "Duque|Juan C|JC|;Dejman|Adriana|A|;Venkat|Vasuki|V|;Hernandez|Maria|M|;Roth|David|D|;Ladino|Marco A|MA|",
"chemical_list": "D000998:Antiviral Agents; D000069474:Sofosbuvir",
"country": "Germany",
"delete": false,
"doi": "10.5414/CN110276",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0301-0430",
"issue": "95(1)",
"journal": "Clinical nephrology",
"keywords": null,
"medline_ta": "Clin Nephrol",
"mesh_terms": "D000208:Acute Disease; D058186:Acute Kidney Injury; D000368:Aged; D000998:Antiviral Agents; D004359:Drug Therapy, Combination; D005260:Female; D006526:Hepatitis C; D006801:Humans; D008297:Male; D008875:Middle Aged; D009395:Nephritis, Interstitial; D012189:Retrospective Studies; D000069474:Sofosbuvir",
"nlm_unique_id": "0364441",
"other_id": null,
"pages": "22-27",
"pmc": null,
"pmid": "32909545",
"pubdate": "2021-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Acute interstitial nephritis following treatment with direct-acting antiviral agents in hepatitis C virus-infected patients: A case series.",
"title_normalized": "acute interstitial nephritis following treatment with direct acting antiviral agents in hepatitis c virus infected patients a case series"
} | [
{
"companynumb": "US-GILEAD-2018-0369754",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEDIPASVIR\\SOFOSBUVIR"
},
"drugadditional": "3"... |
{
"abstract": "The aim of the present study was to introduce a new modified trabeculectomy technique, stab incision mitomycin C (MMC)-assisted rapid trabeculectomy (SMART), which requires less surgical time and tissue manipulation. A total of 41 eyes with indication for trabeculectomy underwent glaucoma surgery with the SMART technique; superior subconjunctival injection of 0.005 mg MMC mixed with 0.1 ml lidocaine, followed by small, fornix base conjunctival opening. A stab incision was made to enter the anterior chamber 1.5 mm post-limbus using a 2.4 mm cataract knife. Double 0.75 mm punch and peripheral iridectomy were performed. A releasable suture was placed in the scleral opening, and matrix sutures to close conjunctiva. The preoperative mean intraocular pressure (IOP) was 23.8 mmHg, with a mean number of medications of 3.3. The mean follow-up duration was 27.6 months, with a range of 12-46 months. A year post-surgery, the mean IOP was 11 mmHg, with a mean number of medications of 0.7, corresponding to a reduction of 12.8 mmHg in IOP and 2.6 in the number of medications. During follow-up, additional 5-fluorouracil injections were administered when needed. In conclusion, SMART with wound modulation appears to be a safe and quick alternative to classic trabeculectomy. Few minor and no major complications were observed during the first 2.5 years of follow-up, with all eyes maintaining an IOP <15 mmHg.",
"affiliations": "Department of Ophthalmology, Konstantopouleio-Patission General Hospital, Athens 14233, Greece.;Department of Ophthalmology, Konstantopouleio-Patission General Hospital, Athens 14233, Greece.;Department of Ophthalmology, Konstantopouleio-Patission General Hospital, Athens 14233, Greece.",
"authors": "Terzidou|Chryssa|C|;Trivli|Alexandra|A|;Dalianis|Georgios|G|",
"chemical_list": null,
"country": "Greece",
"delete": false,
"doi": "10.3892/etm.2020.8852",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1792-0981",
"issue": "20(2)",
"journal": "Experimental and therapeutic medicine",
"keywords": "filtering surgery; glaucoma surgery; small incision; stab incision; trabeculectomy",
"medline_ta": "Exp Ther Med",
"mesh_terms": null,
"nlm_unique_id": "101531947",
"other_id": null,
"pages": "1752-1757",
"pmc": null,
"pmid": "32742404",
"pubdate": "2020-08",
"publication_types": "D016428:Journal Article",
"references": "29151685;15534469;19225352;21150025;7573314;507161;12059864;22805881;19573620;28100482;22251843;12486516;9098275;2023752;26527859;15051196;3067743;24685235;27144015;18949008;4891876;10376259;8600884;11438050;7609370;19128377;3331607;11890288",
"title": "Stab incision mitomycin C-assisted rapid trabeculectomy: A 'SMART' trabeculectomy alternative.",
"title_normalized": "stab incision mitomycin c assisted rapid trabeculectomy a smart trabeculectomy alternative"
} | [
{
"companynumb": "GR-ACCORD-196330",
"fulfillexpeditecriteria": "1",
"occurcountry": "GR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "MITOMYCIN"
},
"drugadditional": "3",
"drugad... |
{
"abstract": "OBJECTIVE\nPineal parenchymal tumors of intermediate differentiation (PPTID) are rare tumors of the pineal gland. Their treatment is often heterogeneous due to the lack of literature to compile standardized treatments. Although no single institution has large numbers of cases, our experience has been that the clinical course is more varied and complicated than reported.\n\n\nMETHODS\nWe reviewed the clinical data for all patients with pathology found to be consistent with PPTID at our institution between the years 2006 and 2019.\n\n\nRESULTS\nNine patients were identified. At initial diagnosis, all were treated with surgery and 4 of 9 patients underwent gross total resection. Adjuvant radiation therapy to the resection bed was administered in 6 of 9 patients. Mean follow-up time was 95.3 months. Mean progression-free survival was 50.5 months, with a tendency to be longer for male sex and after gross total resection. Seven patients developed a recurrence. Five of 6 known locations of first recurrences had either distant metastases or dissemination of disease. First recurrences were treated with radiation alone in 5 patients, craniospinal radiation with multiagent chemotherapy in 1 patient, and surgery with radiation therapy in 1. At last follow-up, 2 patients had died.\n\n\nCONCLUSIONS\nHerein, we report clinical patterns of disease progression and treatment patterns of PPTID. Many patients progressed during the follow-up period. Disseminated disease was the most common presentation at recurrence. Ultimately, given the risk of recurrence and dissemination at recurrence, more aggressive treatment strategies should be considered. Specifically, our series suggests a benefit of adjuvant radiation at initial diagnosis for grade II patients.",
"affiliations": "Department of Neurosurgery, The University of Colorado School of Medicine, Aurora, Colorado, USA.;Department of Pathology, The University of Colorado School of Medicine, Aurora, Colorado, USA.;Department of Neurosurgery, The University of Colorado School of Medicine, Aurora, Colorado, USA.;Department of Neurosurgery, The University of Colorado School of Medicine, Aurora, Colorado, USA.;Department of Neurosurgery, The University of Colorado School of Medicine, Aurora, Colorado, USA. Electronic address: david.ormond@cuanschutz.edu.",
"authors": "Kunigelis|Katherine E|KE|;Kleinschmidt-DeMasters|B K|BK|;Youssef|A Samy|AS|;Lillehei|Kevin O|KO|;Ormond|D Ryan|DR|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.wneu.2021.08.056",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1878-8750",
"issue": "155()",
"journal": "World neurosurgery",
"keywords": "Jouvet criteria; PPTID; Pineal; Pineal parenchymal tumors of intermediate differentiation",
"medline_ta": "World Neurosurg",
"mesh_terms": null,
"nlm_unique_id": "101528275",
"other_id": null,
"pages": "e229-e235",
"pmc": null,
"pmid": "34418607",
"pubdate": "2021-11",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Clinical Features of Pineal Parenchymal Tumors of Intermediate Differentiation (PPTID): A Single-Institution Series.",
"title_normalized": "clinical features of pineal parenchymal tumors of intermediate differentiation pptid a single institution series"
} | [
{
"companynumb": "US-MYLANLABS-2022M1036442",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nIatrogenic Kaposi's sarcoma is widely reported after transplantation. Less commonly, it occurs in patients receiving immunosuppressive therapy for ANCA associated vasculitis. We report here the rare association of Kaposi's sarcoma, prurigo nodularis and ANCA associated vasculitis in a hemodialysis patient.\n\n\nMETHODS\nWe describe a 58-year-old woman who presented granulomatosis with polyangeiitis with alveolar hemorrhage and renal failure requiring hemodialysis. She developed cutaneous Kaposi's sarcoma seven weeks after the beginning of immunosuppressive therapy. Biological tests showed negative HHV8 virus infection. Lesions of Kaposi's sarcoma responded to a discontinuation of immunosuppressive drugs and a decreasing dosage of corticosteroids.\n\n\nCONCLUSIONS\nOur case showed that the immunosuppressed state related to multiple factors such as underlying disease, immunosuppressive therapy and hemodialysis may all have contributed to the development of this neoplastic disorder in our patient.",
"affiliations": "Service de Néphrologie, de dialyse et de transplantation rénale, CHU La Rabta, Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie. Electronic address: hela.bergaoui@yahoo.fr.;Service de Néphrologie, de dialyse et de transplantation rénale, CHU La Rabta, Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie.;Service de Néphrologie, de dialyse et de transplantation rénale, CHU La Rabta, Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie.;Service de Néphrologie, de dialyse et de transplantation rénale, CHU La Rabta, Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie.;Service d'anatomie pathologique, CHU La Rabta, Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie.;Service d'anatomie pathologique, CHU La Rabta, Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie.;Service de Néphrologie, de dialyse et de transplantation rénale, CHU La Rabta, Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie.;Service de Néphrologie, de dialyse et de transplantation rénale, CHU La Rabta, Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie.;Service de Néphrologie, de dialyse et de transplantation rénale, CHU La Rabta, Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie.;Service de Néphrologie, de dialyse et de transplantation rénale, CHU La Rabta, Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie.;Service de Néphrologie, de dialyse et de transplantation rénale, CHU La Rabta, Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie.;Laboratoire de recherches des maladies rénales (LR00SP01), Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie.;Service de Néphrologie, de dialyse et de transplantation rénale, CHU La Rabta, Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie.;Service de Néphrologie, de dialyse et de transplantation rénale, CHU La Rabta, Tunis, Tunisie; Faculté de Médecine de Tunis, Université Tunis El Manar, Tunis, Tunisie.",
"authors": "Jebali|H|H|;Saihi|M|M|;Omrane|M|M|;Kheder|R|R|;Chelly|I|I|;Haouet|S|S|;Beji|S|S|;Raïs|L|L|;Mami|I|I|;Krid|M|M|;Smaoui|W|W|;Ben Hmida|F|F|;Ben Fatma|L|L|;Zouaghi|M K|MK|",
"chemical_list": "D000305:Adrenal Cortex Hormones",
"country": "France",
"delete": false,
"doi": "10.1016/j.revmed.2018.08.001",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0248-8663",
"issue": "39(12)",
"journal": "La Revue de medecine interne",
"keywords": "ANCA associated vasculitis; Hemodialysis; Hémodialyse; Kaposi's sarcoma; Sarcome de Kaposi; Vascularite à ANCA",
"medline_ta": "Rev Med Interne",
"mesh_terms": "D000305:Adrenal Cortex Hormones; D056648:Anti-Neutrophil Cytoplasmic Antibody-Associated Vasculitis; D005260:Female; D006801:Humans; D016867:Immunocompromised Host; D008875:Middle Aged; D006435:Renal Dialysis; D051437:Renal Insufficiency; D012514:Sarcoma, Kaposi; D012878:Skin Neoplasms",
"nlm_unique_id": "8101383",
"other_id": null,
"pages": "942-945",
"pmc": null,
"pmid": "30316478",
"pubdate": "2018-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Kaposi sarcoma in a patient with ANCA vasculitis requiring hemodialysis.",
"title_normalized": "kaposi sarcoma in a patient with anca vasculitis requiring hemodialysis"
} | [
{
"companynumb": "PHHY2019TN079168",
"fulfillexpeditecriteria": "1",
"occurcountry": "TN",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE"
},
"drugadditional": null,
... |
{
"abstract": "Unilateral abdominal wall clonic seizures are a rare manifestation of epilepsy. We report three cases of focal aware seizures manifesting as unilateral abdominal clonic motor movements. Standard EEG for patients with focal motor abdominal seizures is often unrevealing, which can make the diagnosis difficult. We report the first case of intracranial EEG in the diagnosis of a patients with this type of semiology during a focal seizure. In the absence of an electroclinical seizure verified by video-EEG monitoring, caution should be made with the diagnosis. A careful history should be obtained to help differentiate between unilateral abdominal clonic jerking and other abdominal complaints.",
"affiliations": "Division of Neurology, Department of Medicine, Dalhousie University, 1796 Summer Street, Halifax, Nova Scotia B3H 3A, Canada.;Division of Neurology, Department of Medicine, Dalhousie University, 1796 Summer Street, Halifax, Nova Scotia B3H 3A, Canada.;Division of Neurology, Department of Medicine, Dalhousie University, 1796 Summer Street, Halifax, Nova Scotia B3H 3A, Canada.",
"authors": "Patterson|Adam|A|;Woodroffe|Stephanie|S|;Sadler|R Mark|RM|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.ebr.2021.100480",
"fulltext": "\n==== Front\nEpilepsy Behav Rep\nEpilepsy Behav Rep\nEpilepsy & Behavior Reports\n2589-9864\nElsevier\n\nS2589-9864(21)00054-X\n10.1016/j.ebr.2021.100480\n100480\nCase Report\nUnilateral abdominal clonic jerking as an epileptic phenomenon\nPatterson Adam ad322554@dal.ca\n⁎\nWoodroffe Stephanie\nSadler R. Mark\nDivision of Neurology, Department of Medicine, Dalhousie University, 1796 Summer Street, Halifax, Nova Scotia B3H 3A, Canada\n⁎ Corresponding author. ad322554@dal.ca\n08 9 2021\n2021\n08 9 2021\n16 10048011 5 2021\n29 8 2021\n31 8 2021\n© 2021 The Author(s)\n2021\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).\nHighlights\n\n• We report three cases of focal aware seizures presenting as unilateral abdominal clonic motor movements.\n\n• One of these cases is the first seizure manifesting as unilateral abdominal clonic motor movements with simultaneous intracranial electrode recording in the literature, and demonstrates the utility of intracranial EEG in the diagnosis.\n\n• The symptomatic zone of seizures presenting as unilateral abdominal clonic motor movements is felt to be in an anatomically restricted area of the abdominal region of the motor homunculus.\n\n• A careful clinical history is important in the assessment of this seizure type, and the diagnosis is ideally established with video-EEG.\n\nUnilateral abdominal wall clonic seizures are a rare manifestation of epilepsy. We report three cases of focal aware seizures manifesting as unilateral abdominal clonic motor movements. Standard EEG for patients with focal motor abdominal seizures is often unrevealing, which can make the diagnosis difficult. We report the first case of intracranial EEG in the diagnosis of a patients with this type of semiology during a focal seizure. In the absence of an electroclinical seizure verified by video-EEG monitoring, caution should be made with the diagnosis. A careful history should be obtained to help differentiate between unilateral abdominal clonic jerking and other abdominal complaints.\n==== Body\npmcIntroduction\n\nSeizures presenting as unilateral abdominal wall clonic jerking have been reported infrequently in the literature. There are 20 cases published in the English literature, the majority of which were an expression of epilepsia partialis continua [1], [2], [3], [4], [5], [6], [7], [8], [9], [10], [11], [12], [13], [14], [15] (See Table 1).Table 1 Review of prior cases of abdominal motor seizures in the English literature.\n\nReference (Year + First author)\tAge and Sex\tSeizure Type\tSeizure Description\tNeuroimaging Lesion Location\tIctal EEG\tInterictal EEG\tEtiology\t\nMatsuo 1984\t19-year-old-female\tFocal Motor\tRight abdominal wall spasms spreading occasionally to right thigh and rarely to right arm\tLeft parietal\t–\t“Slow waves over the left posterior quadrant…reactive to eye opening and closure.” No epileptiform activity\tAspergilloma\t\nMatsuo 1984\t66-year-old-female\tFocal Motor\tLeft lower quadrant abdominal spasms with post-ictal hemiparesis\tRight parietal\t–\t“Amplitude asymmetry of the alpha rhythm, right greater than left… in light sleep…low voltage slow waves, involving primarily the right hemisphere.” No epileptiform activity.\tMeningioma\t\nMatsuo 1984\t42-year-old male\tFocal Motor\tRight abdominal wall contractions at times spreading to right shoulder and face\t–\tNo epileptiform discharges but “postictally low voltage focal slow waves…over the left parietal area”\t–\tUnknown\t\nRosenbaum 1990\t65-year-old-male\tFocal Motor Status Epilepticus\tInitially left hemiparesis followed by clonic left-sided abdominal jerking; recurrent seizures also involved left sided limbs and left face\tRight frontoparietal\t“Continuous quasiperiodic bursts of high-voltage delta- and sharp-wave complexes of 1.5 to 2.5 seconds originating from the right centroparietal area”\t–\tBrain Metastases\t\nChalk 1991\t66-year-old male\tFocal Motor Status Epilepticus\tShort episodes of brief and rhythmic contractions of the left abdominal muscles occurring at 2 to 3 Hz\tRight parasagittal\t“Right parasagittal periodic sharp wave discharges”\t–\tCryptococcal Meningitis\t\nLim 2004\t31-year-old male\tFocal Motor Status Epilepticus\tMyoclonic jerking of the left proximal lower limb and abdomen occurring at approximately 1 Hz\tRight cingulate\t“Ictal focus over the right anterior temporal region”\t–\tDevelopmental venous abnormality\t\nFernandez-Torre 2004\t77-year-old-female\tFocal Motor Status Epilepticus\tBilateral clonic jerking of the abdominal muscles (more intense on the left) occurring almost rhythmically at a rate of 0.5 Hz. Associated with left hemiparesis, hemianesthesia, hemi-asomatognosia, right sided gaze deviation and dysphagia\tRight frontal, temporal pole, left parasagittal frontal\tPeriodic lateralized epileptiform discharges (PLEDs) in the right central, mid-temporal, and parietal areas and with occasional spread to the left parieto-occipital region.\t–\tBrain Metastasis\t\nDafotakis 2006\t62-year-old-male\tFocal Motor Status Epilepticus\tClonic twitching of the left sided abdominal muscles\tRight precentral gyrus\t–\t–\tUnknown\t\nTezer 2008\t25-year-old male\tFocal Motor Status Epilepticus\tMyoclonic twitching of the right sided abdominal muscles with a frequency of approximately 1–2 Hz.\tLeft parieto-occipital\t–\tPeriodic lateralized epileptiform discharges involving the left frontocentral and parietal areas\tFocal Cortical Dysplasia\t\nOster 2011\t59-year-old-male\tFocal Motor\tClonic contractions of the right abdomen and torso with subsequent right arm and leg clonic contractions. Occasional spread to bilateral tonic-clonic\tLeft Precentral Gyrus\t“Obscured by muscle and movement artifacts “\t–\tUnknown\t\nRibeiro2015\t69-year-old-male\tFocal Motor Status Epilepticus\tMyoclonic jerks of the right abdominal wall. Associated with right hemiparesis and dysphagia\tLeft frontal\tPeriodic lateralized epileptiform discharges (PLEDs) maximum at the left occipital region and evolving into rhythmic fast activity in the same area\tSporadic left temporo-parieto-occipital spikes\tVascular\t\nRibeiro2015\t75-year-old-male\tFocal Motor Status Epilepticus\tArrhythmic myoclonic twitches of the left abdominal muscles. Associated with left hemiparesis, and left gaze deviation\tRight occipital\t“Slight asymmetry of the posterior background activity, with slower activity on the right side and some spikes over the right occipital area”\t–\tVascular\t\nBrigo 2018\t91-year-old male\tFocal Motor Status Epilepticus\tContinuous rhythmic jerking of the right sided abdominal muscles\tLeft temporal\tRhythmic epileptiform discharges and polyspikes in the left hemisphere\t–\tAcute Infarction\t\nAljaafari 2018\t26-year-old male\tFocal motor\tClonic jerking of the right side of the abdomen. Preceded by a pulling sensation of the right neck and shoulder. With or without right arm clonic jerking and head deviation to the right. Occasional spread to bilateral tonic-clonic\tLeft parietal and peri-insular region\t“Sequential sharp waves recorded over the left mid parietal area … evolving into a rhythmic theta and later alpha frequency ictal pattern recorded over the left centroparietal… region”\t“Spike and wave or sharp and slow wave discharges, recorded maximally over the left mid parietal region”\tBrain malformation (not specified)\t\nAsranna 2019\t25-year-old male\tFocal Motor Status Epilepticus\tArrhythmic myoclonic movements of the right abdominal muscles\tLeft frontal\t“No focal abnormalities”\t“No focal abnormalities”\tNeuro-cysticercosis\t\nLizarraga 2019\t77-year-old-male\tFocal motor\tSemicontinuous, right-greater-than-left, clonic-like abdominal contractions lasting for 10 to 20 seconds\tLeft parietal\t“3.5- to 4-Hz, rhythmic, and sharply contoured activity in the mesial parietal region and left posterior quadrant … propagating anteriorly to mesial central and left frontocentral regions\t“Epileptiform activity in the mesial parietal and left parieto-occipital regions… propagating to mesial central and left frontocentral regions”\tIntracerebral hemorrhage\t\nCasciatto 2019\t61-year-old-male\tFocal Motor Status Epilepticus\tIrregular contractions of the abdominal wall, predominantly on the left side\tRight parietal\t“Rhythmic epileptiform activity involving all contacts over the right hemisphere”\t“Interictal brief bursts of slow waves over the right temporal region.”\tBrain Surgery\t\nTatum 2020\t48-year-old-female\tFocal Motor\tBilateral clonic jerking of the abdomen with rare involvement of the thighs, right more than left\t–\tRhythmic myogenic artifact followed by postictal slowing in the left temporal region\tNormal\tUnknown\t\nTatum 2020\t67-year-old-male\tFocal Motor\tParesthesias in right foot spreading to the right abdomen followed by abdominal twitching. Occasional sensory symptoms in right face and arm\tLeft parietal\tStandard EEG: Normal High Density EEG:Focal subclinical seizures from the left central parietal region\tStandard EEG: Unrevealing High Density EEG:Frequent spikes in the left central parietal lobe\tEncephalomalacia from prior tumor resection\t\nTatum 2020\t55-year-old-female\tFocal Motor\tParesthesias in right toe followed by contractions in right leg spreading up to hip and abdomen, rarely spreading to back\tLeft paramedian frontoparietal lobe and left frontal lobe\t“Continuous left-hemispheric slowing, maximal in the left parietal-occipital region”\tOne of seizures with an “electrographic correlate”\tTwo tumors treated with surgical resection (with minimal residual) and radiotherapy\t\n\nThe cortical representation of the abdominal wall and trunk is small compared to the face, hand, and limbs; This was initially demonstrated in Penfield’s and Rasmussen’s electrostimulation studies [16] (See Fig. 1 for a representation of the motor homunculus). Further evidence supporting that the abdominal area of the homunculus is smaller compared to other areas is provided by a recent intraoperative study that stimulated 608 sites in the precentral gyrus in 100 patients and did not identify the abdominal area of the homunculus [17] [February 2021 E-mail from author FE Roux; unreferenced]. The small size of the abdominal area of the homunculus has been hypothesized to be a reason for the rarity of this type of seizure [1].Fig. 1 The motor homunculus. Modified from Nicholas et al (2019), with the author’s permission.\n\nSeizures involving abdominal symptoms can be difficult to diagnose, and a recent article published highlighted these diagnostic challenges [15]. Patients with subjective non-motor abdominal complaints have been diagnosed with “abdominal epilepsy” based solely on EEG abnormalities or response to anti-seizure medication, which has the potential of misdiagnosis. That publication recommends abandoning the use of the term “abdominal epilepsy” and instead using terminology recommended by the International League Against Epilepsy. Further adding to diagnostic difficulties, patients with seizures consisting of unilateral abdominal clonic jerking often do not have epileptiform abnormalities on ictal or interictal EEG, likely because of the limited cortical representation described above. Of the 20 prior cases of seizures with abdominal wall clonic jerking in the English literature, only 11 of 15 with ictal EEG results published had ictal rhythms and 5 of 10 with interictal EEG results published had spikes or sharp waves. Notably, high-density EEG has been used to help detection of epileptiform abnormalities in these patients and these authors recommend video-EEG with ictal recording for diagnosis [15].\n\nWe report three additional cases of focal aware motor seizures with abdominal clonic jerking from our institution, including the first known case with intracranial electroencephalographic (EEG) recording. These cases highlight the diagnostic process and challenges with this type of seizure.\n\nCase 1\n\nThe patient was a 41-year-old right-handed female when she was admitted to the epilepsy monitoring unit (EMU). Epilepsy onset was at 12 years of age when she presented with three bilateral tonic-clonic seizures within 24 hours. This acute presentation was immediately followed by focal motor status epilepticus with seizures involving predominantly her abdomen, proximal left arm, and neck. She was admitted to hospital for three weeks and the status epilepticus was successfully treated with phenytoin, phenobarbital, and carbamazepine. She continued to have seizures into adulthood despite changes in her antiseizure medication with all seizures occurring in sleep at a frequency of 4 per month.\n\nShe had no risk factors for epilepsy and had a normal physical examination.\n\nThe patient’s habitual seizures were captured during her EMU admission and consisted of clonic jerks of the left lower abdominal wall (below the costal margin, above the iliac crest) for thirty seconds followed by abduction movements of the left shoulder for one to two minutes. Postictally, she described left hemibody “numbness” lasting for 2 minutes. Based on a nursing language and behavior assessment during and after the seizure, it was determined her seizures had preserved awareness. Interictal EEG was normal. Ictal EEG was uninterpretable due to movement artifact with no post ictal focal slowing. MRI was normal.\n\nHer antiseizure treatment was changed from valproic acid to levetiracetam and her seizure frequency reduced significantly to one every several years.\n\nCase 2\n\nThe patient was a 32-year-old male when he was admitted for implantation of subdural electrodes at our center for presurgical evaluation of drug-resistant epilepsy. He had a history of drug-resistant epilepsy since the age of 24 years. His habitual seizures were focal aware consisting of left face sensory changes followed by left arm and leg tonic posturing lasting 10 – 15 seconds. Awareness during his seizures was established by a nursing language and behavior assessment during and after a seizure while admitted to the epilepsy monitoring unit previously. Seizure frequency was one to three per day.\n\nHe had no risk factors for epilepsy and his MRI brain was normal. Interictal scalp EEG demonstrated central (Cz, Fz) spikes. Ictal scalp EEG was contaminated by movement and muscle artifact and no clear ictal rhythms were identified.\n\nSubdural EEG recording electrodes were implanted (a 4x5 contact grid over the right central region plus 6 additional right hemisphere 4–5 contact strip electrodes over the right mesial parietal, mesial frontal, and frontal convexity). On the first day following the subdural electrode implantation the patient developed an entirely new seizure type distinct from his habitual seizures: the new seizures were isolated left abdominal wall rhythmic contractions with a frequency of 2 Hz and a duration of 80 seconds. These movements correlated with a very spatially restricted ictal intracranial EEG rhythm (see Fig. 2). These seizures did not evolve to his habitual seizure type and the new attacks ceased with the removal of the intracranial electrodes.Fig. 2 Case 2 a). Subdural EEG at onset of left abdominal wall seizure. Selected channels from 20 contact grid. Note new rhythm at contacts 20,15,14.(EEG channels: Sens = 20 microvolts/mm; LFF = 1; HLF = 100 Hz)b) Same seizure; 30 seconds after onset c) Same seizure; termination 80 sec after onset d) Axial MRI and position of subdural grid. Contacts 20, 15, 14 in red.\n\nCase 3\n\nThe patient was a 35-year-old right-handed male at the time of seizure onset. The frequency of events was initially every few months, but gradually increased in frequency to once every 1 – 2 weeks. Seizures were classified as focal aware. Awareness during the seizure was determined by the clinical history. Seizures consisted of a distortion of sensory perception and motor control of the right arm and involuntary contractions of the right side of his abdomen lasting 15–20 seconds.\n\nHe did not have any known seizure risk factors. Neurological examination was normal. MRI demonstrated a left parietal lesion consistent with a low-grade glioma (see Fig. 3). He underwent partial resection of the tumor, with some residual adjacent to the motor cortex. The tumor pathology disclosed a WHO grade II oligodendroglioma.Fig. 3 Case 3 MRI Brain on initial presenting a) T2 Axial b) T1 Axial c) T1 Axial Post-Gadolinium Lesion in left parietal lobe abutting the left post-central gyrus. T2 Hyperintensity with T1 hypointensity is demonstrated with a lack of gadolinium enhcancement, consistent with a low-grade glioma. The patient later underwent resection of this lesion and pathology disclosed a grade II oligodendroglioma.\n\nThe patient continued to have sporadic focal seizures after the resection, though these decreased in frequency to once every several weeks on a combination of levetiracetam and lamotrigine. Interictal EEG done after his resection demonstrated left central slowing and breach rhythm, but no epileptiform discharges. He did not have video-EEG monitoring.\n\nDiscussion\n\nWe provide confirmatory evidence of abdominal clonic jerking as an epileptic phenomenon by video-EEG monitoring in two cases and detail localization in one case with intracranial EEG.\n\nCase 1 highlights the importance of video-EEG in the diagnosis of seizures with abdominal clonic jerking. In this case her interictal and ictal EEG were unrevealing, and her neuroimaging was normal, but her semiology witnessed on video (unilateral clonic jerking of the abdomen following by abduction of the shoulder) was definitively epileptic. Case 1 also demonstrated the somatotopic organization of the motor cortex. Penfield found the trunk and abdomen area in the precentral gyrus medial to the shoulder region and lateral to the hip region. The proximity of the abdominal representation to the shoulder is demonstrated by our Case 1, with the patient’s seizures consisting of left abdomen clonic jerking followed by abduction of the shoulder.\n\nCase 2 is in particular notable as there have been no previous case reports of clonic abdominal seizures with simultaneous intracranial recording. Nonhabitual seizure types caused by implanted subdural electrodes, as occurred in this case, is a known phenomenon [18]. Though in this case nonhabitual seizures were captured, this demonstrates the ability of intracranial EEG to identify the epileptogenic zone in seizures with unliteral abdominal clonic jerking with high precision.\n\nOf note, case 3 has not had video-EEG or ictal recording on EEG. In this case, we do not have the same degree of confidence as case 1 or case 2 proven by video-EEG monitoring. Our diagnostic confidence is high, however, based on the clear history of unilateral abdomenal motor involvement (as opposed to subjective or bilateral complaints) and etiology with a structural lesion in the contralateral hemisphere. Depending on the clinician’s practice setting and location, it may not be possible to obtain video-EEG monitoring on a timely basis. Epilepsy is a clinical diagnosis, and in cases like this, we think it is reasonable to make the diagnosis based on a careful history including distinguishing between subjective abdominal complaints and unilateral motor phenomenon. Video-EEG monitoring could then be pursued in the future if drug-resistant epilepsy were to develop. We agree with Tatum et al., it is important to use appropriate ILAE terminology in these cases, namely “focal aware motor seizures with clonic jerking” as opposed to “abdominal epilepsy”. In case 2 the seizure was first detected in contacts next to the precentral and postcentral gyrus that correspond to the abdominal area of the homunculus. In case 3 the lesion is located in the left parietal lobe, with the lesion extending into the left abdominal sensory area of the post-central gyrus. The semiology from case 3 contrasts with case 1, in case 3 the seizure evolving from a sensory distortion of the arm to clonic abdominal jerking, in contrast to case 1 with abdominal clonic jerking evolving to abduction movements of the shoulder. This contrast highlights the variable ways seizure spread among the sensorimotor cortex can manifest. Our cases are consistent with most reports of seizures with abdominal clonic jerking in that they report the seizure onset zone, based on MRI or EEG, in the parietal or frontal lobe. There are some exceptions, including seizures with lesions or the most prominent epileptiform abnormality reported in occipital [6], parieto-occipital [11], temporo-parietal-occipital [1], and cingulate [14] lobes. In these cases, we suspect the symptomatogenic zone was likely in the abdominal motor area of the homunculus with spread to this area of seizure activity from the epileptogenic lesion.\n\nConclusion\n\nFocal aware seizures with clonic jerking of the abdomen as the main manifestation have been infrequently reported. The intracranial EEG recording and lesional location on neuroimaging in our cases adds to prior reports asserting that the symptomatogenic zone for these seizures is the abdominal area of the motor homunculus. The diagnosis can be difficult to make, as scalp EEG is often normal. Intracranial EEG is effective for diagnosis of seizures with abdominal clonic jerking. Ideally the diagnosis should be established by ictal video-EEG, though we argue a clear history of unilateral motor contractions of the abdomen can be used to make a clinical diagnosis.\n\nDeclaration of Competing Interest\n\nThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\n==== Refs\nReferences\n\n1 Brigo F. Bratti A. Tavernelli V. Nardone R. Epilepsia partialis continua of the abdominal musculature caused by acute ischemic stroke Can J Neurol Sci. 45 6 2018 703 706 30246670\n2 Aljaafari D. Nascimento F. Abraham A. Andrade D. Wennberg R. Unilateral abdominal clonic seizures of parietal lobe origin: EEG findings Epileptic Disord. 20 2 2018 158 163 29624180\n3 Asranna A. Sureshbabu S. Mittal G. Peter S. Chindripu S. Saini L. Abdominal epilepsia partialis continua in neurocysticercosis Epileptic Disord 21 3 2019 302 306 31225805\n4 Chalk C. McManis P. Cascino G. Cryptococcal meningitis manifesting as epilepsia partialis continua of the abdomen Mayo Clin Proc. 66 9 1991 926 929 1921503\n5 Fernández-Torre J.L. Calleja J. Pascual J. Galdós P. De Pablos C. Berciano J. Epilepsia partialis continua of the abdominal muscles: a detailed electrophysiological study of a case Mov Disord. 19 11 2004 1375 1378 15389985\n6 Ribeiro J. Sousa M. Teotónio R. Bento C. Sales F. Epilepsia partialis continua of the abdominal muscles due to cerebrovascular disease Epileptic Disord 17 1 2015 72 76 25786409\n7 Dafotakis M, Sparing R, Becker S, Fink G. Epilepsia partialis continua of the abdominal muscles with transient MRI abnormalities. Neurology 2006;66(7):1099.\n8 Lizarraga K.J. Serrano E.A. Tornes L. Kanner A.M. Lang A.E. Isolated abdominal motor seizures of mesial parietal origin: epileptic belly dancing? Mov Disord Clin Pract 6 5 2019 396 399 31286010\n9 Casciatto S. Mascia A. D'Aniello A. Qurato P. Grammaldo L. Scoppetta C. A case of epilepsia partialis continua of abdominal muscles after brain tumor surgery Eur Rev Med Pharmacol Sci 23 7 2019 3001 3004 31002150\n10 Rosenbaum D.H. Rowan A.J. Unilateral truncal seizures: frontal origin Epilepsia 31 1 1990 37 40 2137408\n11 Tezer F.I. Celebi O. Ozgen B. Saygi S. P041 A patient with two episodes of epilepsia partialis continua of the abdominal muscles caused by cortical dysplasia Clin Neurophysiol 119 2008 S81 10.1016/S1388-2457(08)60312-0\n12 Matsuo F. Partial epileptic seizures beginning in the truncal muscles Acta Neurol Scand 69 5 1984 264 269 6235702\n13 Oster J.M. Aljumairi F. Cosgrove G.R. Metabolic imaging correlate of truncal onset seizures Arch Neurol 68 2 2011 10.1001/archneurol.2010.370\n14 Lim E.C.H. Tan J.J.H. Ong B.K.C. Wilder-Smith E.P.V. Generalised myoclonus evolving into epilepsia partialis continua due to a cingulate gyrus lesion: case report and review of the literature Parkinsonism Relat Disord 10 7 2004 447 449 15465405\n15 Tatum K. Schuele S. Templer J. Becker T. Tatum W. True abdominal epilepsy is clonic jerking of the abdominal musculature Epileptic Disord 22 5 2020 582 591 32985987\n16 Nicholas J. Johannessen A. Van Nunen T. Tactile working memory scale a professional manual Nordic Welfare Centre 2019\n17 Roux F.-E. Niare M. Charni S. Giussani C. Durand J.-B. Functional architecture of the motor homunculus detected by electrostimulation J Physiol 598 23 2020 5487 5504 32857862\n18 Fountas K. King D. Jenkins P. Smith J. Nonhabitual seizures in patients with implanted subdural electrodes Stereotact Funct Neurosurg 82 4 2004 165 168 15528955\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2589-9864",
"issue": "16()",
"journal": "Epilepsy & behavior reports",
"keywords": null,
"medline_ta": "Epilepsy Behav Rep",
"mesh_terms": null,
"nlm_unique_id": "101750909",
"other_id": null,
"pages": "100480",
"pmc": null,
"pmid": "34647004",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "2137408;31002150;15389985;32857862;6235702;19017573;25786409;15528955;16606926;29624180;21320992;31286010;15465405;1921503;32985987;30246670;31225805",
"title": "Unilateral abdominal clonic jerking as an epileptic phenomenon.",
"title_normalized": "unilateral abdominal clonic jerking as an epileptic phenomenon"
} | [
{
"companynumb": "CA-MYLANLABS-2022M1010618",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "VALPROIC ACID"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nDalbavancin is an antibiotic administered by intravenous infusion weekly or bi-weekly and is currently FDA-approved only for treatment of skin and soft-tissue infections. It has shown promise, but is not considered the standard of care, for bacteremia and infective endocarditis (IE), which typically require outpatient parenteral antibiotic therapy (OPAT) for prolonged durations. People who inject drugs (PWID) with bacteremia or IE are often perceived as having barriers to OPAT and standard daily-administered antibiotics, prompting off-label use of dalbavancin in this population.\n\n\nMETHODS\nA retrospective review of adult patients receiving at least one dose of dalbavancin for bacteremia or IE was conducted between 1 November 2017 and 31 October 2019. Outcomes and reasons for use of dalbavancin were recorded, including specific barriers to standard therapy.\n\n\nRESULTS\nStated reasons for dalbavancin use in the 18 patients identified included active injection drug use (50%), inability to arrange standard OPAT due to patient adherence or inability to place in skilled nursing facility (SNF) (22%), risk for additional infections or other morbidity with OPAT (22%), and patient preference (6%). In 11 patients (61%) SNF placement was not attempted due to behavioral issues or patient declination. There were five patients who did not complete their intended course of treatment (28%). At 90 days, eight patients (44%) achieved a clinical or biologic cure, six (33%) failed treatment, and four (22%) were lost to follow-up.\n\n\nCONCLUSIONS\nDalbavancin may have a role as salvage therapy in the treatment of IE and bacteremia in PWID who have significant barriers to standard treatment.",
"affiliations": "Department of Medicine, University of Maryland Medical Center, Baltimore, MD 21201, USA.;Department of Pharmacy Practice and Science, University of Maryland School or Pharmacy, Baltimore, MD 21201, USA.;Department of Medicine, University of Maryland Medical Center, Baltimore, MD 21201, USA.",
"authors": "Ajaka|Leama|L|;Heil|Emily|E|0000-0002-6644-6684;Schmalzle|Sarah|S|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3390/antibiotics9100700",
"fulltext": "\n==== Front\nAntibiotics (Basel)\nAntibiotics (Basel)\nantibiotics\nAntibiotics\n2079-6382 MDPI \n\n33076275\n10.3390/antibiotics9100700\nantibiotics-09-00700\nArticle\nDalbavancin in the Treatment of Bacteremia and Endocarditis in People with Barriers to Standard Care\nAjaka Leama 1* https://orcid.org/0000-0002-6644-6684Heil Emily 2 Schmalzle Sarah 134 1 Department of Medicine, University of Maryland Medical Center, Baltimore, MD 21201, USA; sschmalzle@ihv.umaryland.edu\n2 Department of Pharmacy Practice and Science, University of Maryland School or Pharmacy, Baltimore, MD 21201, USA; eheil@rx.umaryland.edu\n3 Department of Medicine, Division of Infectious Disease, University of Maryland School of Medicine, Baltimore, MD 21201, USA\n4 Institute of Human Virology, University of Maryland School of Medicine, Baltimore, MD 21201, USA\n* Correspondence: Lajaka@som.umaryland.edu\n15 10 2020 \n10 2020 \n9 10 70031 8 2020 09 10 2020 © 2020 by the authors.2020Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).Introduction: Dalbavancin is an antibiotic administered by intravenous infusion weekly or bi-weekly and is currently FDA-approved only for treatment of skin and soft-tissue infections. It has shown promise, but is not considered the standard of care, for bacteremia and infective endocarditis (IE), which typically require outpatient parenteral antibiotic therapy (OPAT) for prolonged durations. People who inject drugs (PWID) with bacteremia or IE are often perceived as having barriers to OPAT and standard daily-administered antibiotics, prompting off-label use of dalbavancin in this population. Methods: A retrospective review of adult patients receiving at least one dose of dalbavancin for bacteremia or IE was conducted between 1 November 2017 and 31 October 2019. Outcomes and reasons for use of dalbavancin were recorded, including specific barriers to standard therapy. Results: Stated reasons for dalbavancin use in the 18 patients identified included active injection drug use (50%), inability to arrange standard OPAT due to patient adherence or inability to place in skilled nursing facility (SNF) (22%), risk for additional infections or other morbidity with OPAT (22%), and patient preference (6%). In 11 patients (61%) SNF placement was not attempted due to behavioral issues or patient declination. There were five patients who did not complete their intended course of treatment (28%). At 90 days, eight patients (44%) achieved a clinical or biologic cure, six (33%) failed treatment, and four (22%) were lost to follow-up. Conclusion: Dalbavancin may have a role as salvage therapy in the treatment of IE and bacteremia in PWID who have significant barriers to standard treatment.\n\ndalbavancininfective endocarditisinjection drug usesubstance use disorderpeople who inject drugs\n==== Body\n1. Introduction\nDalbavancin is a long-acting intravenous (IV) antibiotic active against Gram-positive bacteria, including methicillin-resistant Staphylococcus aureus (MRSA). It is a synthetic glycopeptide that has the same mechanism of action as vancomycin; it binds to the terminal d-alanyl-d-alanine of growing peptidoglycan chains and inhibits bacterial cell wall synthesis. It has more potent in vitro bactericidal activity against Gram-positive organisms than vancomycin, possibly because dalbavancin has a novel ability to anchor its lipophilic side chain in the bacterial membrane. In healthy adults with normal renal and hepatic function, it exhibits linear and dose-dependent pharmacokinetics. Dalbavancin has a half-life of 170–210 hours following administration of one IV dose [1]. Its long half-life allows for dosing every 1 or 2 weeks [2,3]. Furthermore, it is well-tolerated, with analyses of randomized controlled trials showing adverse event rate similar or lower than that of comparable agents [4]. \n\nDalbavancin is currently FDA-approved for the treatment of skin and soft-tissue infections. Treatment courses for skin and soft-tissue infections typically require antibiotics ranging from 5 to 14 days, meaning one dose of dalbavancin is sufficient [5,6]. It is likely that dalbavancin is also effective in more serious infections. Case reports and randomized clinical trials have demonstrated success in treating more deep-seated or morbid infections, such as pneumonia, osteomyelitis, and endovascular infections, which typically require extended antibiotic durations; however, dalbavancin is not FDA-approved for these indications and is not yet considered the standard of care for these sites [7,8,9,10,11]. There are also data suggesting that dalbavancin can be an effective treatment for bacteremia and infectious endocarditis (IE) [12,13,14,15,16,17]. First-line treatment for bacteremia and IE includes the use of parenteral antibiotics for 2–6 weeks, depending on pathogen and patient characteristics [18]. This requires long-term venous access, such as a peripherally inserted central catheter (PICC), and outpatient parenteral antibiotic therapy (OPAT), either in the patient’s home or a skilled nursing facility (SNF). For a subset of patients, these first-line treatments are not possible due to social and health system barriers in arranging standard antibiotic courses. This includes people who inject drugs (PWID), those with repeated hospital discharges against medical advice (AMA), and patients with behavioral issues, such as elopement from medical facilities, inpatient drug use, or threatening behavior [14]. For some of these patients in our center, dalbavancin has been used in lieu of standard therapy for treatment of bacteremia or IE. With only limited data available on the use of dalbavancin for this indication, there are no defined standard dosing or interval recommendations and there are likely variations in provider practice [19].\n\nHerein, we describe a series of patients receiving off-label dalbavancin for bacteremia or IE, the majority of which were PWID or with other substance use history.\n\n2. Methods\n2.1. Study Location, Design, and Eligibility\nThis is a retrospective observational study conducted at the University of Maryland Medical Center (UMMC), a 750 bed acute tertiary care center in Baltimore, MD. A retrospective chart review was conducted to identify cases from December 2017 to June 2019, in which adult patients received at least 1 dose of dalbavancin in the treatment of bacteremia or IE. During this study period, all dalbavancin prescriptions were made at the clinical discretion of the infectious diseases (ID) physicians evaluating the patient. \n\n2.2. Data Extraction and Definitions\nCharts were each reviewed by an internal medicine resident, ID physician, and ID pharmacist. Charts were abstracted for relevant patient demographics, including age, gender, and race. Presence of active injection drug use or other substance abuse (drug use by any route, or alcohol abuse) within 30 days was also noted. ID notes and microbiology data were examined to determine infection being treated, and cases of bacteremia or IE were included in this analysis. Organisms and likely source of infection were identified, as well as if source control was obtained (if relevant). For patients receiving treatment for IE, cases were reviewed to determine if modified Duke criteria were satisfied by either clinical or pathologic criteria [20]. Also documented were any antibiotic treatments received prior to dalbavancin for the relevant infection, as well as the date of the patient’s last negative blood cultures in relation to when dalbavancin was received. Reasons for a non-standard antibiotic course were identified through primary team, ID consultant, case manager, and social worker documentation. These reasons were categorized as active injection drug use, post-hospitalization patient placement or patient adherence issues, general infection risk or morbidity with standard therapy, and patient preference. Dalbavancin treatment courses were identified, including dates, doses, and intended and completed numbers of doses. Also abstracted were elements of the hospital stay, including suspected drug use in the hospital, length of stay, denial from SNFs, number of days of clinical stability while awaiting SNF placement, and type of discharge (i.e., regular discharge, AMA discharge, or elopement). \n\nClinical outcomes were classified as cure, failure, or loss to follow-up (LTFU). Cure was defined as lack of evidence of clinical or microbiological persistent or recurrent infection within 90 days or negative blood cultures within 90 days after completion of dalbavancin. Those categorized as failure experienced clinical or microbiologic relapse within 90 days (signs of infection, positive culture data, or infection-related death). LTFU was defined as any patient not having a subsequent encounter to evaluate their infection at either UMMC or any institution linked via the electronic medical record within 90 days. Outcomes were adjudicated and agreed upon by all three study team members.\n\n2.3. Data Analysis\nDescriptive statistics were performed for all data using Microsoft Excel software. \n\nThe study was approved with a waiver of informed consent by the University of Maryland, Baltimore Institutional Review Board.\n\n3. Results\nDalbavancin was used a total of 60 times from December 2017 to June 2019 at UMMC, but in only 18 cases (n = 18) for bacteremia or IE. Of these cases, the majority of dalbavancin use was for bacteremia (78%). In four cases (22%), dalbavancin was used for treatment of IE. Of cases in which it was used for endocarditis, two were cases of definitive IE and two were possible IE (following modified Duke criteria). There was one patient who was presumed to have bacteremia given overwhelming evidence of disseminated MRSA infection, but did not have any positive blood cultures. MRSA and methicillin-susceptible Staphylococcus aureus (MSSA) were the causative organisms in seven (39%) and three (17%) cases, respectively. In three cases (17%), dalbavancin was used in the treatment of polymicrobial Gram-positive organism and Gram-negative rod infection. In two cases (11%) dalbavancin was used in the treatment of polymicrobial infection with multiple Gram-positive organisms. One patient received dalbavancin for the treatment of group A streptococcus infection, one for Streptococcus mitis, and one for Staphylococcus lugdunensis infection.\n\nIn half (50%) of the cases, the source of bacteremia or IE was unknown. In four cases (22%), the source of bacteremia or IE was likely skin and soft-tissue infections (3 abscesses; 1 tenosynovitis). In two cases (11%), the source of infection was thought to be osteomyelitis. One patient developed bacteremia from pneumonia, which was complicated by empyema formation, and one from an indwelling catheter that was present prior to admission. Of patients with a presumed source, whether it was empyema, abscess, osteomyelitis, or an indwelling catheter, all but two had source control of their infection (including incision and drainage, amputation, or chest tube and decortication). One patient each with pelvic osteomyelitis and tenosynovitis were treated medically only, with no surgical intervention. All patients had documented negative blood cultures prior to receiving dalbavancin except for two—one patient who had left against medical advice and one patient who actually never had positive blood cultures, but instead had evidence of disseminated MRSA infection, and thus was presumed to have bacteremia. In all cases, the patient had received at least one antibiotic prior to initiating treatment with dalbavancin; in sixteen cases (89%), that antibiotic was vancomycin. Patients had received between 2 and 30 days (average 12.3 days) of other antibiotic therapy before therapy was changed to dalbavancin. \n\nThe majority of patients that received dalbavancin for bacteremia or IE were PWID (67%), while one patient (5.5%) was not classified as PWID but had other active substance abuse issues. Of the PWID, 92% also abused other substances such as cocaine or alcohol. Six of 18 patients (33%) were suspected of using illicit drugs while hospitalized. The majority were deemed to be poor candidates for or declined PICC. Stated reasons for dalbavancin use were active injection drug use (50%), issues with SNF placement or patient adherence (22%), concern for line manipulation or infection, and patient preference (6%). No patients were considered appropriate candidates for home OPAT. In 61% of cases, SNF placement was not attempted due to behavioral issues or patient declining any SNF placement. Behavioral issues identified included prior elopement from SNF; continually leaving the medical ward with PICC in place, thus raising suspicion for PICC manipulation for drug use outside of hospital; suspected drug use in the hospital; or threatening hospital staff. In three cases, the patient was denied from at least one SNF and declined the alternative placement options. One patient was denied from every possible SNF in the region. Three patients left against medical advice (AMA) or eloped prior to completion of treatment for bacteremia or IE. These patients either received dalbavancin immediately before leaving the hospital due to planned AMA discharge or elopement or during outpatient follow-up. The median hospital stay was 14 days (range: 4–33 days), with an average of 4 days of clinical stability while awaiting SNF placement (range: 0–13 days). In 3 cases, patients were clinically stable for 10 or more days while attempts at SNF placement were made. \n\nThe intended number of doses was one to three for all patients (average: 2), with patients completing one or two doses (average: 1). Five (28%) did not complete the intended course. Thirteen patients received 1.5 g as a single dose. Two patients received 1.5 g followed by another 1.5 g 7–14 days later. Two patients received 1.5 g followed by 1 g 7–14 days later. One patient received 1 g followed by 500 mg 8 days later. Eight patients achieved clinical cure (45%), six failed therapy (33%), and four were LTFU (22%). Eight patients were readmitted (related or unrelated to initial complaint) within 90 days of discharge. Three patients died within one month of receiving dalbavancin; one was thought to have died from complications of IE. One patient died of fulminant Clostridium difficile colitis and another died from presumed narcotic overdose. However, as it is unknown if the initial disease state for which they received dalbavancin or the dalbavancin treatment ultimately contributed to cause of death, all three of these outcomes have been labeled failures. \n\nOf note, two patients who received incomplete courses of dalbavancin grew a strain of MRSA with an elevated minimum inhibitory concentration (MIC) to vancomycin on a subsequent admission (MIC of <0.5 increased to 1 in both).\n\nThe patient demographics, infection details, treatment, and hospital course for each patient are included in Table 1.\n\n4. Discussion\nThis review demonstrates a potential role for dalbavancin in the treatment of bacteremia and IE in patients with substance abuse disorders and barriers to standard therapy. The current modus operandi typically does not recommend that patients with substance abuse disorder be offered home OPAT [21]. The appropriateness for home OPAT in PWID is an area of active debate. There are examples of success with home OPAT in this population, but many physicians remain uncomfortable with PICCs and home OPAT in PWID [22]. If a patient has demonstrated a pattern of non-adherence and injurious behavior, PICC and even SNF placement may be viewed as unacceptable options given the risk of treatment failure and further morbidity and mortality. In patients with ongoing drug use, new bloodstream infections are common when receiving parenteral treatment for infective endocarditis [23]. While carefully selected PWID can be considered for OPAT at home, there is still a tremendous need to identify alternative treatment strategies for PWID with endovascular infections. Even in PWID who are motivated to adhere to OPAT, there can be concomitant issues that serve as roadblocks to safe and consistent antibiotic delivery, such as housing instability and lack of transportation or support systems [24]. Although newer data indicate that oral therapy could be utilized for partial treatment of endocarditis, non-adherence to the regimens could be a potential barrier to treatment success, particularly medications dosed multiple times per day [25]. In the 2019 Partial Oral versus Intravenous Antibiotic Treatment of Endocarditis (POET) study, the oral antibiotic regimens studied were often a combination of multiple antibiotics dosed twice or even four times daily. Furthermore, only a very small number of PWID were included and history of non-adherence was an exclusion criterion [26]. There have been studies showing that adherence to antibiotic therapy after discharge is low, even in general populations, and is unsurprisingly associated with poor clinical response. Furthermore, it is common for patients to overestimate or overstate their medication adherence, which increases the challenges in identifying those at risk for treatment failure [27]. The structural vulnerabilities (such as home insecurity or lack of a support system) that make OPAT difficult to arrange with PWID also affect adherence to both short- and long-term oral antibiotic treatment. Therefore, long-acting antimicrobials such as dalbavancin still present a very appealing niche for treatment of bacteremia and IE in PWID.\n\nAdditionally, even partial treatment may be better than none; one study in PWID leaving AMA showed that receipt of sub-par oral antimicrobials for invasive infections resulted in lower readmission rates [28]. Furthermore, dalbavancin confers the probable benefit of directly observed therapy, which is generally not possible for outpatient oral microbial regimens. However, while dalbavancin is a promising new therapy option, the risks of incomplete treatment do exist. In this series, two patients have grown MRSA with increased MIC to vancomycin following incomplete treatment courses with dalbavancin. This finding of increasing MIC is not entirely unexpected, given the similar mechanism of action between the antibiotics [29]. The elevated MICs to vancomycin remained within the susceptible range, but it is foreseeable that resistance could occur with continued sub-optimal treatment courses given the prolonged half-life of the drug [16,30]. Pairing use of dalbavancin with transitions-of-care programs that provide intensive patient support could assist in preventing loss to follow-up for future dalbavancin doses and clinic visits. Transitions-of-care programs that focus on medication management and adherence, potentially utilizing ambulatory care pharmacists or pharmacy technicians, may be a sustainable and cost effective way to ensure appropriate medicine education and follow-up [31]. The lay healthcare worker model, in which a member of the community who has received training to promote or carry out healthcare services, has also been implemented to assist high-risk patients with post-discharge social needs and has been shown to significantly reduce 30 day hospital readmission rates [32]. Interdisciplinary care and communication between hospitals, pharmacists, ambulatory providers, social workers, and mental health professionals is necessary in treating patients with complex infections that have barriers to healthcare. These methods may be a way to get vulnerable patients through a complete treatment course of dalbavancin and improve outcomes. It is also possible for home infusion companies to administer dalbavancin at home or at an SNF for patients who have difficulty with follow-up in clinics. \n\nRecent evidence has shown that long-term outcomes following IE in PWID are dismal. In one study in the United Kingdom that followed PWID during and after episodes of IE, 56% of patients were dead in 10 years. The cause of death was most often another infection (mostly IE) [33]. Treating patients with dalbavancin for IE and bacteremia may be a worthwhile harm reduction effort to improve long-term outcomes. Furthermore, the use of dalbavancin in skin and soft-tissue infections has been associated with decreased number of hospitalizations and decreased hospital length of stay. One report, which analyzed clinical outcomes of administering dalbavancin 7–10 days prior to the end date of parenteral therapy, found that in 81% of cases, this approach appeared to lead to successful treatment of the infection. Furthermore, it averted approximately 7 in-hospital days per patient, as well as saved an average of $9600 per patient [34]. This was certainly a motivating factor in its use in our institution—to facilitate discharge in patients who posed a risk to hospital staff or themselves should they remain in the hospital, and especially in those who wished to be discharged against medical advice. Patients in our study were clinically stable for an average of 4 days prior to discharge (and up to 13 days), demonstrating that delays in discharge are frequent and can be quite prolonged when attempting to set up parenteral antibiotics and SNF placement. It is reasonable to assume that the use of dalbavancin in bacteremia and IE could help eliminate these delays, and thus reduce hospital stay [35]. While a cost analysis was not performed in our study, dalbavancin use has been shown to reduce the cost of hospitalization in general. Certainly, when compared to 4–6 weeks in the hospital receiving parenteral antibiotics (the only alternative for standard of care therapy for patients who do not qualify for OPAT and are unable to be placed in a SNF), treatment with dalbavancin would be expected to decrease the financial burden on hospitals [36]. \n\nThe standard of care for blood stream infections typically involves central venous access, a safe location for antibiotic administration, and prolonged courses of intravenous antibiotics; for the patients in this case series, this was found to be insurmountably difficult to facilitate. In these patients, dalbavancin could potentially be used as salvage therapy. It may also significantly decrease the length of hospital stay due to difficulties in SNF placement, as well as adverse events such as catheter-related infections [34]. However, even with a treatment course that often consisted of only 2 infusions, adherence and follow-up remained an issue in our patient population. Novel interventions in disease treatment will likely be insufficient if there is no clear plan to address barriers to care, such as addiction, in our patients. Complex infections and IVDU are often comorbid conditions and the risks of repeat infection or incomplete treatment are high if we only treat one and not the other. \n\n5. Conclusions\nWhile all healthcare providers should aim to prescribe first-line therapy for any disease state, the ideal treatment is sometimes not feasible. In vulnerable patient populations such as PWID, who are both more likely to develop bacteremia or IE as well as to have barriers to standard treatments, dalbavancin can be a logical alternative. Further study is needed to demonstrate clinical and microbiological non-inferiority of dalbavancin to standard treatments for bacteremia and IE in this group, and to determine the most effective dosing and frequency for a dalbavancin course. \n\nPublisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAuthor Contributions\nConceptualization, S.S., L.A. and E.H.; data curation, L.A., E.H. and S.S.; writing—original draft, L.A.; writing—review and editing, E.H. and S.S. All authors have read and agreed to the published version of the manuscript.\n\nFunding\nThis research received no external funding.\n\nConflicts of Interest\nThe authors declare no conflict of interest.\n\nantibiotics-09-00700-t001_Table 1Table 1 Patient Characteristics, Infection Details, Treatment, and Outcomes.\n\nAge (Years); Sex; Race\tActive IDU\tInfection Type\tOrganism (s) in Blood Culture\tSource\tSource Control Achieved\tPre-DAL Antibiotic(s); Total Days\tDalba. Dose(s)\tDAL Doses Received/Intended\tIntended DAL Course (Days)\tOutcome\t\n24; F; Cauc.\tYes\tDefinitive IE \tMRSA, α and γ hemolytic Streptococci, Bacillus cereus\n\tUnknown\tNA\tVAN; 21\t1500 mg\t1/2\t42\tLTFU\t\n24; F; Cauc.\tYes\tPossible IE\tMSSA\tUnknown\tNA\tOXA, CFZ; 21\t1500 mg\t1/2\t42\tCure \t\n27; M; AA\tYes\tBSI\t\nStaphylococcus lugdunensis\n\tUnknown\tNA\tVAN; 3\t1500 mg \t1/2\t14\tLTFU\t\n29; M; Cauc.\tYes\tBSI\tMRSA\tOM\tNo \tVAN, SAM; 4\t1500 mg \t1/2\t42\tFailure\t\n35; M; Cauc.\tNo\tBSI\tMSSA, GAS, CoNS\tSSTI\tNA\tVAN, CFZ; 4\t1500 mg\t1/1\t14\tFailure (death)\t\n36; M; Cauc.\tYes\tDefinitive IE \t\nStreptococcus mitis\n\tUnknown\tNA\tCRO, GEN; 11\t1500 mg \t1/1\t14\tLTFU\t\n36; M; Cauc.\tYes\tBSI\tMRSA\tPNA/ empyema\tYes \tVAN; 30\t1500 mg\t1/1\t42\tLTFU\t\n38; M; Cauc.\tNo\tBSI\tMRSA\tUnknown\tNA\tVAN; 2\t1500 mg; 1000 mg\t2/2\t28\tCure \t\n38; F; AA\tNo\tBSI\tGAS\tSSTI\tYes\tVAN; 6\t1500 mg\t1/1\t14\tCure \t\n44; M; Cauc.\tYes\tPossible IE \tMRSA, Klebsiella pneumonia, Candida albicans and tropicalis,\tCLABSI\tYes \tVAN, DAP; 27\t1500 mg\t1/1\t42\tFailure (death)\t\n50; M; Cauc.\tYes\tDissem. MRSA\tsterile\tSSTI\tYes \tVAN; 13\t1500 mg; 1500 mg\t2/2\t28\tFailure\t\n50; M; AA\tYes\tBSI\tMRSA\tSSTI\tNo \tVAN; 6\t1500 mg\t1/1\t14\tCure\t\n50; F; Cauc.\tYes\tBSI\tMSSA\tUnknown\tNA\tVAN, CFZ; 23\t1000 mg; 500 mg\t2/2\t42\tFailure\t\n51; F; Cauc.\tYes\tBSI\tMSSA\tUnknown\tNA\tVAN, CFZ; 11\t1500 mg\t1/1\t14\tCure \t\n51; M; Cauc.\tYes\tBSI\tMRSA\tOM\tYes \tVAN 11\t1500 mg; 1000 mg\t2/2\t28\tCure\t\n55; F; AA\tNo\tBSI\tMRSA\tCLABSI\tYes\tVAN; 8\t1500 mg; 1500 mg\t2/3\t28\tCure\t\n57; M; Cauc.\tNo\tBSI\t\nStaphylococcus epidermidis, Klebsiella pneumoniae\n\tUnknown\tNA\tVAN; 12\t1500 mg\t1/1\t14\tCure\t\n66; M; AA\tNo\tBSI\tMRSA, Enterococcus feacalis Acinetobacter baumanni, Pseudomonas aeruginosa, Candida albicans,\tUnknown \tNA\tVAN; 8\t1500 mg\t1/1\t14\tFailure (death)\t\nAA, African American; Cauc., Caucasian; CFZ, cefazolin; CLABSI, central-line associated blood stream infection; CoNS, coagulase-negative Staphylococcus; CRO, ceftriaxone; DAL, dalbavancin; DAP, daptomycin; Dissem., disseminated; F, female; GAS, group A Streptococcus; GEN, gentamycin; IDU, injection drug use; IE, infective endocarditis; LTFU, lost to follow-up; M, male; MSSA, methicillin-sensitive Staphylococcus aureus; MRSA, methicillin-resistant Staphylococcus aureus; NA, not applicable; OM, osteomyelitis; OXA, oxacillin; PNA, pneumonia; SAM, ampicillin–sulbactam; SSTI, skin and soft-tissue infections; VAN, vancomycin.\n==== Refs\nReferences\n1. Zhanel G.G. Trapp S. Gin A. DeCorby M. Lagacé-Wiens P.R.S. Rubinstein E. Hoban D. Karlowsky J.A. Dalbavancin and telavancin: Novel lipoglycopeptides for the treatment of Gram-positive infections Expert Rev. Anti-infective Ther. 2008 6 67 81 10.1586/14787210.6.1.67 18251665 \n2. Wunsch S. Krause R. Valentin T. Prattes J. Janata O. Lenger A. Bellmann-Weiler R. Weiss G. Zollner-Schwetz I. Multicenter clinical experience of real life Dalbavancin use in gram-positive infections Int. J. Infect. Dis. 2019 81 210 214 10.1016/j.ijid.2019.02.013 30794940 \n3. Boucher H.W. Wilcox M. Talbot G.H. Puttagunta S. Das A.F. Dunne M.W. Once-Weekly Dalbavancin versus Daily Conventional Therapy for Skin Infection New Engl. J. Med. 2014 370 2169 2179 10.1056/NEJMoa1310480 24897082 \n4. Dunne M.W. Talbot G.H. Boucher H.W. Wilcox M. Puttagunta S. Safety of Dalbavancin in the Treatment of Skin and Skin Structure Infections: A Pooled Analysis of Randomized, Comparative Studies Drug Saf. 2015 39 147 157 10.1007/s40264-015-0374-9 \n5. Chen A.Y. Zervos M.J. Vazquez J.A. Dalbavancin: A novel antimicrobial Int. J. Clin. Pr. 2007 61 853 863 10.1111/j.1742-1241.2007.01318.x 17362476 \n6. Seltzer E. Dorr M.B. Goldstein B.P. Perry M. Dowell J.A. Henkel T. Dalbavancin Skin and Soft-Tissue Infection Study Group Once-Weekly Dalbavancin versus Standard-of-Care Antimicrobial Regimens for Treatment of Skin and Soft-Tissue Infections Clin. Infect. Dis. 2003 37 1298 1303 10.1086/379015 14583862 \n7. Almangour T.A. Perry G.K. Alhifany A.A. Dalbavancin versus standard of care for the treatment of osteomyelitis in adults: A retrospective matched cohort study Saudi Pharm. J. 2020 28 460 464 10.1016/j.jsps.2020.02.007 32273805 \n8. Rappo U. Puttagunta S. Shevchenko V. Shevchenko A. Jandourek A. Gonzalez P.L. Suen A. Casullo V.M. Melnick D. Miceli R. Dalbavancin for the Treatment of Osteomyelitis in Adult Patients: A Randomized Clinical Trial of Efficacy and Safety Open Forum Infect. Dis. 2018 6 10.1093/ofid/ofy331 30648126 \n9. Stover K.R. Barber K.E. Tirmizi A. Finley R. Dalbavancin use for the treatment of methicillin-resistant Staphylococcus aureus pneumonia J. Pharmacol. Pharmacother. 2017 8 77 79 10.4103/jpp.JPP_2_17 28706403 \n10. Ciccullo A. Giuliano G. Segala F.V. Taddei E. Farinacci D. Pallavicini F. Dalbavancin as a second-line treatment in methicillin-resistant Staphylococcus aureus prosthetic vascular graft infection Infection 2019 48 309 310 10.1007/s15010-019-01379-2 31784895 \n11. Raad I. Darouiche R. Vazquez J. Lentnek A. Hachem R. Hanna H. Goldstein B. Henkel T. Seltzer E. Efficacy and Safety of Weekly Dalbavancin Therapy for Catheter-Related Bloodstream Infection Caused by Gram-Positive Pathogens Clin. Infect. Dis. 2005 40 374 380 10.1086/427283 15668859 \n12. Hakim A. Braun H. Thornton D. Strymish J. Successful treatment of methicillin-sensitive Staphylococcus aureus tricuspid-valve endocarditis with dalbavancin as an outpatient in a person who injects drugs: A case report Int. J. Infect. Dis. 2020 91 202 205 10.1016/j.ijid.2019.12.008 31841726 \n13. Rybak M.J. Miller M.A. Montague B.T. Barber G.R. McQueen R.B. Krsak M. On- and off-label utilization of dalbavancin and oritavancin for Gram-positive infections J. Antimicrob. Chemother. 2019 74 2405 2416 10.1093/jac/dkz162 31322694 \n14. Bork J.T. Heil E.L. Berry S. Lopes E. Davé R. Gilliam B.L. Amoroso A. Dalbavancin Use in Vulnerable Patients Receiving Outpatient Parenteral Antibiotic Therapy for Invasive Gram-Positive Infections Infect. Dis. Ther. 2019 8 171 184 10.1007/s40121-019-0247-0 31054088 \n15. Hidalgo -Tenorio C. Vinuesa D. Plata A. Dávila P.M. Iftimie S. Sequera S. Loeches B. Lopez-Cortés L.E. Fariñas M.C. Fernández-Roldan C. Dalbavancin as Treatment for Endocarditis and/or Bloodstream Infections Produced by Gram-Positive Cocci Proceedings of the 28th ECCMID Madrid, Spain 21–24 April 2018 \n16. Sader H.S. E Mendes R. Pfaller M.A. Flamm R.K. Antimicrobial activity of dalbavancin tested against Gram-positive organisms isolated from patients with infective endocarditis in US and European medical centres J. Antimicrob. Chemother. 2019 74 1306 1310 10.1093/jac/dkz006 30753485 \n17. Tobudic S. Forstner C. Burgmann H. Lagler H. Ramharter M. Steininger C. Vossen M. Winkler S. Thalhammer F. Dalbavancin as Primary and Sequential Treatment for Gram-Positive Infective Endocarditis: 2-Year Experience at the General Hospital of Vienna Clin. Infect. Dis. 2018 67 795 798 10.1093/cid/ciy279 29659732 \n18. Correction to: Infective Endocarditis in Adults: Diagnosis, Antimicrobial Therapy, and Management of Complications: A Scientific Statement for Healthcare Professionals From the American Heart Association Circulation 2016 134 e113 10.1161/CIR.0000000000000427 27550972 \n19. Morrisette T. Miller M.A. Montague B.T. Barber G.R. McQueen R.B. Krsak M. Long-Acting Lipoglycopeptides: “Lineless Antibiotics” for Serious Infections in Persons Who Use Drugs Open Forum Infect. Dis. 2019 6 ofz274 10.1093/ofid/ofz274 31281868 \n20. Li J.S. Sexton D.J. Mick N. Nettles R. Fowler J.V.G. Ryan T. Bashore T. Corey G.R. Proposed Modifications to the Duke Criteria for the Diagnosis of Infective Endocarditis Clin. Infect. Dis. 2000 30 633 638 10.1086/313753 10770721 \n21. Bryson-Cahn C. Beieler A.M. Chan J.D. Harrington R.D. Dhanireddy S. Dalbavancin as Secondary Therapy for Serious Staphylococcus aureus Infections in a Vulnerable Patient Population Open Forum Infect. Dis. 2019 6 10.1093/ofid/ofz028 \n22. Beieler A. Magaret A. Zhou Y. Schleyer A. Wald A. Dhanireddy S. Outpatient Parenteral Antimicrobial Therapy in Vulnerable Populations—People Who Inject Drugs and the Homeless J. Hosp. Med. 2019 14 105 109 10.12788/jhm.3138 30785418 \n23. Tan C. Shojaei E. Wiener J. Shah M. Koivu S. Silverman M.S. Risk of New Bloodstream Infections and Mortality Among People Who Inject Drugs With Infective Endocarditis JAMA Netw. Open 2020 3 e2012974 10.1001/jamanetworkopen.2020.12974 32785635 \n24. Ho J. Archuleta S. Sulaiman Z. Fisher D. Safe and successful treatment of intravenous drug users with a peripherally inserted central catheter in an outpatient parenteral antibiotic treatment service J. Antimicrob. Chemother. 2010 65 2641 2644 10.1093/jac/dkq355 20864497 \n25. Sadosky A. Srivastava K. Arora A. Kataria A. Cappelleri J.C. Peterson A.M. Impact of reducing dosing frequency on adherence to oral therapies: A literature review and meta-analysis Patient Prefer. Adherence 2013 7 419 434 10.2147/PPA.S44646 23737662 \n26. Iversen K. Ihlemann N. Gill S.U. Madsen T. Elming H. Jensen K.T. Bruun N.E. Høfsten D.E. Fursted K. Christensen J.J. Partial Oral versus Intravenous Antibiotic Treatment of Endocarditis N. Engl. J. Med. 2019 380 415 424 10.1056/NEJMoa1808312 30152252 \n27. Eells S.J. Nguyen M. Jung J. Macias-Gil R. May L. Miller L.G. Relationship between Adherence to Oral Antibiotics and Postdischarge Clinical Outcomes among Patients Hospitalized with Staphylococcus aureus Skin Infections Antimicrob. Agents Chemother. 2016 60 2941 2948 10.1128/AAC.02626-15 26926634 \n28. Marks L.R. Liang S.Y. Muthulingam D. Schwarz E.S. Liss D.B. Munigala S. Warren D.K. Durkin M.J. Evaluation of partial oral antibiotic treatment for persons who inject drugs and are hospitalized with invasive infections Clin. Infect. Dis. 2020 10.1093/cid/ciaa365 \n29. Steele J.M. Seabury R.W. Hale C.M. Mogle B.T. Unsuccessful treatment of methicillin-resistant Staphylococcus aureus endocarditis with dalbavancin J. Clin. Pharm. Ther. 2017 43 101 103 10.1111/jcpt.12580 28628223 \n30. Werth B. Jain R. Hahn A. Cummings L. Weaver T. Waalkes A. Sengupta D. Salipante S. Rakita R. Butler-Wu S.M. Emergence of dalbavancin non-susceptible, vancomycin-intermediate Staphylococcus aureus (VISA) after treatment of MRSA central line-associated bloodstream infection with a dalbavancin- and vancomycin-containing regimen Clin. Microbiol. Infect. 2018 24 429.e1 429.e5 10.1016/j.cmi.2017.07.028 \n31. Slazak E. Cardinal C. Will S. Clark C.M. Daly C.J. Jacobs D.M. Pharmacist-led transitions-of-care services in primary care settings: Opportunities, experiences, and challenges J. Am. Pharm. Assoc. 2020 60 443 449 10.1016/j.japh.2019.11.016 \n32. Cardarelli R. Horsley M. Ray L. Maggard N. Schilling J. Weatherford S. Feltner F. Gilliam K. Reducing 30-day readmission rates in a high-risk population using a lay-health worker model in Appalachia Kentucky Heal. Educ. Res. 2018 33 73 80 10.1093/her/cyx064 \n33. Schranz A.J. A Wake-Up Call: Outcomes Following Infective Endocarditis in Persons Who Inject Drugs Clin. Infect. Dis. 2019 71 572 573 10.1093/cid/ciz875 \n34. Deida A.A.V. Shihadeh K.C. Preslaski C.R. Young H.L. Wyles D.L. Jenkins T.C. Use of a Standardized Dalbavancin Approach to Facilitate Earlier Hospital Discharge for Vulnerable Patients Receiving Prolonged Inpatient Antibiotic Therapy Open Forum Infect. Dis. 2020 7 ofaa293 10.1093/ofid/ofaa293 32793767 \n35. Marcellusi A. Bini C. Andreoni M. Sarmati L. Espin J. Horcajada J.P. Czypionka T. Andretta D. Sciattella P. Favato G. Budget Impact Analysis of Dalbavancin in the Treatment of Acute Bacterial Skin and Skin Structure Infections in Three European Countries Clin. Drug Investig. 2020 40 305 318 10.1007/s40261-020-00891-w \n36. Streifel A.C. Sikka M.K. Bowen C.D. Lewis J.S. Dalbavancin use in an academic medical centre and associated cost savings Int. J. Antimicrob. Agents 2019 54 652 654 10.1016/j.ijantimicag.2019.08.007 31398481\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2079-6382",
"issue": "9(10)",
"journal": "Antibiotics (Basel, Switzerland)",
"keywords": "dalbavancin; infective endocarditis; injection drug use; people who inject drugs; substance use disorder",
"medline_ta": "Antibiotics (Basel)",
"mesh_terms": null,
"nlm_unique_id": "101637404",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33076275",
"pubdate": "2020-10-15",
"publication_types": "D016428:Journal Article",
"references": "29474535;29659732;26715497;30794940;31504337;20864497;32239136;17362476;28628223;31866384;31784895;32273805;24897082;15668859;31054088;31322694;18251665;28706403;10770721;27550972;31281868;30785418;28782651;31841726;14583862;30152252;31398481;26926634;30753485;30838225;32785635;30648126;32034687;32793767;23737662",
"title": "Dalbavancin in the Treatment of Bacteremia and Endocarditis in People with Barriers to Standard Care.",
"title_normalized": "dalbavancin in the treatment of bacteremia and endocarditis in people with barriers to standard care"
} | [
{
"companynumb": "US-ALLERGAN-2042310US",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DALBAVANCIN HYDROCHLORIDE"
},
"drugadditional": n... |
{
"abstract": "Rabbit antithymocyte globulin is a lymphocytedepleting agent commonly used as induction therapy in kidney transplants. Although its use is generally safe and well tolerated, serious side effects can occur. Here, we describe a case of a severe immune complex hypersensitivity reaction with disseminated intravascular coagulation in response to rabbit antithymocyte globulin infusion. Immediate treatment required return to the operating room, massive transfusion of blood products, and plasmapheresis. The patient's posttransplant course was significant for volume overload, prolonged respiratory failure, and delayed graft function that required hemodialysis, but within 10 weeks the patient had made a full recovery and kidney allograft function had returned to normal.",
"affiliations": "From the Department of Pharmacy Services and Clinical Pharmacy, Michigan Medicine, University of Michigan Health System and University of Michigan College of Pharmacy, Michigan, USA.",
"authors": "Clark|Kaylee|K|;McMurry|Katie|K|;Naik|Abhijit S|AS|;Parasuraman|Raviprasenna|R|;Court|Christopher|C|;Colquhoun|Douglas A|DA|;Farkash|Evan A|EA|;Barrett|Meredith|M|;Woodside|Kenneth J|KJ|;van der Windt|Dirk J|DJ|",
"chemical_list": null,
"country": "Turkey",
"delete": false,
"doi": "10.6002/ect.2020.0562",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1304-0855",
"issue": null,
"journal": "Experimental and clinical transplantation : official journal of the Middle East Society for Organ Transplantation",
"keywords": null,
"medline_ta": "Exp Clin Transplant",
"mesh_terms": null,
"nlm_unique_id": "101207333",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34085917",
"pubdate": "2021-06-03",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Disseminated Intravascular Coagulation During Induction Treatment With Rabbit-Derived Antithymocyte Globulin For Kidney Transplant.",
"title_normalized": "disseminated intravascular coagulation during induction treatment with rabbit derived antithymocyte globulin for kidney transplant"
} | [
{
"companynumb": "US-SA-2021SA202687",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "LAPINE T-LYMPHOCYTE IMMUNE GLOBULIN"
},
"drugadditio... |
{
"abstract": "Mercaptopurine (6MP) is used to treat acute lymphoblastic leukemia (ALL) and is metabolized by hypoxanthine guanine phosphoribosal transferase to form 6-thioguanine nucleotide (6TGN). It is also metabolized by thiopurine methyl-transferase to produce 6-methylmercaptopurine (6MMP). Elevated levels of 6MMP have been associated with toxic effects that may interfere with therapy. Allopurinol is known to inhibit thiopurine methyl-transferase which reduces red cell 6MMP and increases 6TGN. Allopurinol has been utilized successfully in adult and pediatric patients with inflammatory bowel disease who have experienced 6MMP related gastrointestinal toxicity. Between August 2015 and August 2018 we started 25 patients with ALL in maintenance on allopurinol in combination with a reduced dose of 6MP. They all had unacceptable side-effects from elevated 6MMP, including abdominal pain, nausea, vomiting, decreased appetite, hypoglycemia, fatigue, and liver toxicity. In addition many had a facial rash. All patients showed resolution of symptoms within a few weeks after starting allopurinol. The red cell levels of 6MMP rapidly declined in the first month. The red cell levels of 6TGN transiently increased in spite of the lower 6MP dose. There was no decrease in absolute neutrophil count or hemoglobin. Platelets decreased slightly not requiring therapy modification. Elevated bilirubin normalized, and alanine aminotransferase decreased significantly with most normalizing. All patients continued on allopurinol with reduced dose 6MP until completing therapy. Allopurinol, in conjunction with a reduced dose of 6MP, effectively resolves 6MMP related side-effects in ALL patients on maintenance chemotherapy. This approach may lead to increased adherence to oral 6MP during ALL maintenance in patients with 6MMP induced side-effects.",
"affiliations": "Children's Hospitals and Clinics of Minnesota, Minneapolis, MN.",
"authors": "Kamojjala|Ruchika|R|;Bostrom|Bruce|B|",
"chemical_list": "D000964:Antimetabolites, Antineoplastic; D004791:Enzyme Inhibitors; D000493:Allopurinol; D015122:Mercaptopurine",
"country": "United States",
"delete": false,
"doi": "10.1097/MPH.0000000000002117",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1077-4114",
"issue": "43(3)",
"journal": "Journal of pediatric hematology/oncology",
"keywords": null,
"medline_ta": "J Pediatr Hematol Oncol",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000493:Allopurinol; D000964:Antimetabolites, Antineoplastic; D002648:Child; D002675:Child, Preschool; D004791:Enzyme Inhibitors; D005260:Female; D006801:Humans; D008297:Male; D015122:Mercaptopurine; D054198:Precursor Cell Lymphoblastic Leukemia-Lymphoma; D012189:Retrospective Studies; D055815:Young Adult",
"nlm_unique_id": "9505928",
"other_id": null,
"pages": "95-100",
"pmc": null,
"pmid": "33750748",
"pubdate": "2021-04-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Allopurinol to Prevent Mercaptopurine Adverse Effects in Children and Young Adults With Acute Lymphoblastic Leukemia.",
"title_normalized": "allopurinol to prevent mercaptopurine adverse effects in children and young adults with acute lymphoblastic leukemia"
} | [
{
"companynumb": "US-DRREDDYS-LIT/USA/21/0137388",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "MERCAPTOPURINE"
},
"drugadditional": "1"... |
{
"abstract": "BACKGROUND\nKidney transplantation is the treatment of choice for end-stage renal disease, with improved mortality and quality of life compared with dialysis. Desensitization protocols have allowed kidney transplantation of highly sensitized patients, who have a lower probability to receive a matching kidney from a deceased or living donor. The aim of this work was to analyze the post-transplantation period of highly HLA-sensitized patients with positive flow cytometry crossmatch against donor cells.\n\n\nMETHODS\nFollowing an observational, retrospective design, we investigated 16 highly sensitized patients who underwent kidney or kidney-pancreas transplantation, assessing the impact of desensitization protocols and investigating treatment-related complications, graft function, antibody-mediated rejection (AMR) rate, and graft and patient survivals.\n\n\nRESULTS\nWe studied 16 patients with positive flow cytometry crossmatch, who were divided into 2 groups based on whether they were submitted to a desensitization protocol or not. Patients who were desensitized underwent transplantation in later years, had higher immunologic risk (panel reactive antibody peak 62% vs 33%; P = .038), higher percentage of 2nd kidney transplant (75% vs 25%; P = .066), and higher percentage of donor-specific anti-HLA antibodies identified (P = .028). A majority of patients were desensitized with high-dose intravenous immunoglobulin and plasmapheresis, and 5 patients received rituximab. Acute AMR rate was of 38%, and rituximab was associated with fewer episodes of AMR. Only 1 patient had graft failure, due to chronic humoral rejection, and the remaining maintained good graft function (mean serum creatinine value of 1.33 mg/dL). No patient died and few complications related to immunossupression were observed.\n\n\nCONCLUSIONS\nDesensitization protocols were safe and allowed kidney transplantation in highly sensitized patients that probably would never undergo transplantation and gave the opportunity of living-donor transplant to patients with anti-HLA antibodies against the donor.",
"affiliations": "Nephrology Department, Hospital Santo António, Centro Hospitalar Porto, Porto, Portugal. Electronic address: mclaracsantos@gmail.com.;Nephrology Department, Hospital Santo António, Centro Hospitalar Porto, Porto, Portugal.;Nephrology Department, Hospital Santo António, Centro Hospitalar Porto, Porto, Portugal.;Nephrology Department, Hospital Santo António, Centro Hospitalar Porto, Porto, Portugal.;Nephrology Department, Hospital Santo António, Centro Hospitalar Porto, Porto, Portugal.;Nephrology Department, Hospital Santo António, Centro Hospitalar Porto, Porto, Portugal.;Nephrology Department, Hospital Santo António, Centro Hospitalar Porto, Porto, Portugal.;Centro Histocompatibilidade Norte, Porto, Portugal.;Nephrology Department, Hospital Santo António, Centro Hospitalar Porto, Porto, Portugal.;Nephrology Department, Hospital Santo António, Centro Hospitalar Porto, Porto, Portugal.",
"authors": "Santos|C|C|;Costa|R|R|;Malheiro|J|J|;Pedroso|S|S|;Almeida|M|M|;Martins|L S|LS|;Dias|L|L|;Tafulo|S|S|;Henriques|A C|AC|;Cabrita|A|A|",
"chemical_list": "D000906:Antibodies; D058846:Antibodies, Monoclonal, Murine-Derived; D006680:HLA Antigens; D016756:Immunoglobulins, Intravenous; D007155:Immunologic Factors; D000069283:Rituximab",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-1345",
"issue": "46(6)",
"journal": "Transplantation proceedings",
"keywords": null,
"medline_ta": "Transplant Proc",
"mesh_terms": "D000328:Adult; D000906:Antibodies; D058846:Antibodies, Monoclonal, Murine-Derived; D003888:Desensitization, Immunologic; D005260:Female; D005434:Flow Cytometry; D006084:Graft Rejection; D006680:HLA Antigens; D006650:Histocompatibility Testing; D006801:Humans; D016756:Immunoglobulins, Intravenous; D007155:Immunologic Factors; D016030:Kidney Transplantation; D008297:Male; D010956:Plasmapheresis; D012086:Reoperation; D012189:Retrospective Studies; D000069283:Rituximab",
"nlm_unique_id": "0243532",
"other_id": null,
"pages": "1705-9",
"pmc": null,
"pmid": "25131017",
"pubdate": "2014",
"publication_types": "D016428:Journal Article; D064888:Observational Study",
"references": null,
"title": "Kidney transplantation across a positive crossmatch: a single-center experience.",
"title_normalized": "kidney transplantation across a positive crossmatch a single center experience"
} | [
{
"companynumb": "PT-BAXTER-2014BAX056465",
"fulfillexpeditecriteria": "1",
"occurcountry": "PT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "HUMAN IMMUNOGLOBULIN G"
},
"drugadditional": nu... |
{
"abstract": "A 60-year-old man had received octreotide for a metastatic neuroendocrine tumor (NET) in the rectum. Computed tomography and ultrasonography revealed a cardiac tumor, diffuse thickness of the ventricular wall and pericardial effusion, which was diagnosed as cardiac metastasis. The metastatic lesions continued to grow despite the alteration of chemotherapy, and the patient complained of repeated syncope and was admitted to our hospital at 11 months after the diagnosis of cardiac metastasis. An electrocardiogram during syncope showed sustained ventricular tachycardia, which was considered to be caused by the cardiac metastasis. We herein report a case of NET with cardiac metastasis which caused lethal arrhythmia along with a review of the pertinent literature.",
"affiliations": "Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan.",
"authors": "Ando|Katsuyoshi|K|;Fujiya|Mikihiro|M|;Yoshida|Moe|M|;Kobayashi|Yu|Y|;Sugiyama|Yuya|Y|;Murakami|Yuki|Y|;Iwama|Takuya|T|;Sato|Hiroki|H|;Sasaki|Takahiro|T|;Kunogi|Takehito|T|;Takahashi|Keitaro|K|;Ueno|Nobuhiro|N|;Kashima|Shin|S|;Moriichi|Kentaro|K|;Tanabe|Hiroki|H|;Okumura|Toshikatsu|T|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": "10.2169/internalmedicine.5208-20",
"fulltext": "\n==== Front\nIntern Med\nIntern Med\nInternal Medicine\n0918-2918 1349-7235 The Japanese Society of Internal Medicine \n\n33518610\n10.2169/internalmedicine.5208-20\nCase Report\nCardiac Metastasis Caused Fatal Ventricular Arrhythmia in a Patient with a Rectal Neuroendocrine Tumor\nAndo Katsuyoshi 1 Fujiya Mikihiro 1 Yoshida Moe 1 Kobayashi Yu 1 Sugiyama Yuya 1 Murakami Yuki 1 Iwama Takuya 1 Sato Hiroki 1 Sasaki Takahiro 1 Kunogi Takehito 1 Takahashi Keitaro 1 Ueno Nobuhiro 1 Kashima Shin 1 Moriichi Kentaro 1 Tanabe Hiroki 1 Okumura Toshikatsu 1 \n1 Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Japan\nCorrespondence to Dr. Mikihiro Fujiya, fjym@asahikawa-med.ac.jp\n\n\n1 2 2021 \n1 2 2021 \n60 3 373 378\n29 4 2020 29 6 2020 Copyright © 2021 by The Japanese Society of Internal MedicineThe Internal Medicine is an Open Access journal distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).A 60-year-old man had received octreotide for a metastatic neuroendocrine tumor (NET) in the rectum. Computed tomography and ultrasonography revealed a cardiac tumor, diffuse thickness of the ventricular wall and pericardial effusion, which was diagnosed as cardiac metastasis. The metastatic lesions continued to grow despite the alteration of chemotherapy, and the patient complained of repeated syncope and was admitted to our hospital at 11 months after the diagnosis of cardiac metastasis. An electrocardiogram during syncope showed sustained ventricular tachycardia, which was considered to be caused by the cardiac metastasis. We herein report a case of NET with cardiac metastasis which caused lethal arrhythmia along with a review of the pertinent literature. \n\ncardiac metastasisneuroendocrine tumorventricular arrhythmia\n==== Body\nIntroduction\nNeuroendocrine tumors (NETs) are relatively rare, but their incidence is reportedly 3.51 and 6.98 per 100,000 persons-year in nationwide cohorts of Japan and the United States, respectively, with 2- to 3-fold increases noted in the last several decades (1,2). NETs originate mainly in the gastrointestinal tract, pancreas and pulmonary tract. Metastases of NET generally occur in the liver, lung and bone, with other sites suggested to be rare (3). However, despite their rare frequency, metastases to sites such as the heart and brain still occur and can cause serious complications in patients with metastatic NET. While quite a few cases of cardiac metastases in NET with fatal arrhythmia have been reported (4,5), the clinical course and optimal therapeutic strategy remain unclear.\n\nWe herein report a rare case of cardiac metastases in a rectal NET patient with fatal arrhythmia.\n\nCase Report\nA 60-year-old man who complained of bloody stool was diagnosed to have a rectal NET (WHO classification grade 2) with multiple metastases to the lymph node, liver and bone three years previously (Fig. 1). He had no relevant medical or familial history. In addition, he had no typical symptoms of carcinoid syndrome, hyperparathyroidism, hyperthyroidism or hyperepinephrinemia. The laboratory data at the time of the initial diagnosis are shown in Table 1. The electrolyte and hormone values were within the normal ranges. The serum carcinoembryonic antigen (CEA) level had increased at the time of the initial diagnosis; however, this abnormality was not considered to be due to the tumor because the change was not proportional to the degree of tumor progression, and there were no other tumorous lesions on CT or endoscopic examinations. The patient's smoking history was thought to have caused the high level of CEA. Furthermore, computed tomography showed no abnormal findings of the endocrine organs, which excluded functional NET and multiple endocrine neoplasia. The endoscopic, histologic and immunohistochemical findings at the initial diagnosis are shown in Fig. 2. He had been treated with octreotide for 17 months after the first diagnosis; however, the liver metastases increased, and lung metastases were newly detected with computed tomography (CT). Therefore, chemotherapy was changed to everolimus.\n\nFigure 1. CT findings at the initial diagnosis of NET. Computed tomography at the initial diagnosis showed swelling of multiple lymph nodes (A: arrowheads) without the detection of the primary lesion and liver metastasis (B: arrowhead), consolidation of the vertebra and iliac bone (C), and findings of a tumor and an abnormal enhancement in the left ventricle and septum (D).\n\nTable 1. Laboratory Data at the Initial Diagnosis.\n\n\t\tMeasured value\t\tNormal range\t\t\t\tMeasured value\t\tNormal range\t\nWBC\t\t6,070\t/µL\t\t3,500-8,500\t\tFT3\t\t2.44\tpg/mL\t\t2.30-4.00\t\nHb\t\t12.3\tg/dL\t\t13.5-17.0\t\tFT4\t\t1.28\tng/dL\t\t0.90-1.70\t\nPlt\t\t20.2\t104/µL\t\t15.0-35.0\t\tTSH\t\t2.12\tµIU/mL\t\t0.50-5.00\t\nAlb\t\t3.8\tg/dL\t\t3.9-4.9\t\ti-PTH\t\t60.9\tpg/mL\t\t15.0-65.0\t\nNa\t\t141\tmmol/L\t\t135-150\t\tIRI\t\t<0.20\tµU/mL\t\t0.0-18.7\t\nK\t\t4.3\tmmol/L\t\t3.5-5.0\t\tGlucagon\t\t81\tpg/mL\t\t70-174\t\nCl\t\t103\tmmol/L\t\t96-110\t\tGastrin\t\t95\tpg/mL\t\t≤ 200\t\nCa\t\t9.0\tmg/dL\t\t8.7-11.0\t\tCEA\t\t17.4\tng/mL\t\t≤ 5.0\t\nCRP\t\t0.37\tmg/dL\t\t≤ 0.30\t\tNSE\t\t14.9\tng/mL\t\t≤ 16.3\t\nWBC: white blood cell count, Hb: hemoglobin, Plt: Platelet, Alb: serum albumin, Na: sodium, K: potassium, Cl: chlorine, Ca: calcium, CRP: C-reactive protein, FT3: free T3, FT4: free T4, TSH: thyroid stimulating hormone, i-PTH: intact parathyroid hormone, IRI: immunoreactive insulin, CEA: carcinoembryonic antigen, NSE: neuron-specific enolase\n\nFigure 2. Endoscopic, histological and immunohistochemical findings at the initial diagnosis of the rectal tumor. Colonoscopy revealed a yellowish submucosal tumor measuring 25 mm in diameter, accompanied by dilated vessels at the surface and depression in the central part (A). Histological findings of the biopsied specimen (Hematoxylin and Eosin staining; B ×100) showed a rope-shaped or ribbon-like arrangement of cells with elliptic nuclei and eosinophilic cytoplasm, and the immunohistochemical findings were positive for CD56 (C ×100) and synaptophysin (D ×100), with about 10% of cells positively reactive for MIB-1 (E ×100), consistent with NET grade 2 according to the WHO classification 2010.\n\nHe complained of dyspnea and general fatigue six months after starting chemotherapy with everolimus. CT showed bilateral pleural effusion, pericardial effusion, wall thickening in the ventricular septum and areas of poor enhancement in the left ventricle (Fig. 3A, B) in addition to the progression of liver and lung metastases and the appearance of new metastases in the right kidney. Transthoracic echocardiography (TTE) revealed pericardial effusion, a tumor measuring 15 mm in diameter in the ventricular septum (Fig. 3C) and heterogenous thickening of the left ventricular wall (Fig. 3D) at 24 months after the initial diagnosis. In addition, TTE revealed no right-sided valvular disease (tricuspid and pulmonary arterial valve), which excluded carcinoid heart syndrome. The pericardial effusion fluid obtained by a puncture was bloody, but negative for neuroendocrine cells. While the tumor in the heart was not biopsied, both the tumor and the irregular thickening of the ventricular wall were diagnosed as cardiac metastases derived from the rectal NET based on the progression of metastases in other organs. The bilateral pleural effusion was thought to represent leakage due to a low serum albumin level rather than pleural metastasis or diastolic dysfunction because of the rapid improvement after the intake of a diuretic drug and albumin supplementation. However, although a cytological examination was negative for pleural metastasis, the coexistence of pleural metastasis could not be ruled out.\n\nFigure 3. CT and TTE findings in the heart at the time of the detection of cardiac metastases. Contrast-enhanced CT revealed a tumor with a poor enhancement in the ventricular septum (A; arrowhead) and heterogenous wall thickening of the left ventricle (B; arrowheads) along with pericardial effusion (A, B). TTE showed that the mass originated from the ventricular septum and protruded into the right ventricle lumen on a parasternal long-axis tomogram (C; arrowhead), and diffuse wall thickening of the left and right ventricle was noted on an apical 4-chamber tomogram (D; arrowheads).\n\nThe cardiac metastases continued to grow regardless of the chemotherapy being changed to streptozocin and lanreotide. He complained of repeated syncope and was admitted to our hospital at 34 months after the initial diagnosis (which was 11 months after the diagnosis of cardiac metastases). An electrocardiogram during syncope showed ventricular tachycardia (VT) (Fig. 4). In addition, the patient's pulse was not detected on palpation while VT was detected on the monitor and electrocardiogram. VT successfully recovered by defibrillation; however, CT and TTE showed progression of the ventricular tumor and wall thickening, which by now had invaded almost the entire ventricular wall (Fig. 5). Thereafter, pulseless VT occurred repeatedly and the patient died on the following day. An autopsy was not performed based on his family's request. Sustained pulseless VT was considered to be the final cause of death.\n\nFigure 4. Electrocardiogram recorded at syncope. An electrocardiogram recorded at syncope showed ventricular tachycardia.\n\nFigure 5. CT and TTE findings in the heart when complicated with ventricular arrhythmia. The progression of the tumor and wall thickening with the poor enhancement in the ventricular septum and wall are observed on CT (A; arrowheads), and the progression of the protruding mass in the ventricular septum (B; arrowhead) and exacerbation of diffuse thickening of the ventricular wall were detected with TTE (B; arrows).\n\nDiscussion\nWe herein report a rare case of cardiac metastases in a patient with rectal NET causing fatal ventricular arrhythmia. The incidence of metastatic cardiac tumor in patients with malignant tumor has been reported to range from 2.3% to 18.3%, the main primary sites of which consisted of malignant melanoma and mediastinal tumor (6). According to the European Neuroendocrine Tumor Society (ENETS) Consensus Guidelines for the Management of Brain, Cardiac and Ovarian Metastases from Neuroendocrine Tumors (3), cardiac metastases are extremely rare, with only 36 previously reported cases. Most cases with cardiac metastases in NETs have been reported to be derived from the mid-gut, such as ileo-cecal NETs, while in our case, the primary tumor existed in the hindgut rectum.\n\nOnly two NET patients with cardiac metastases causing arrhythmia have been previously reported (Table 2) (4,5). In these three cases, including our own, the primary sites consisted of the bronchus, ileo-cecum and rectum, and two cases (excluding one with no description) had previously and/or synchronously multiple distant metastases in addition to those in the heart. Cardiac metastases were detected in the ventricular wall and/or septum in the heart in all cases. The lesions were diagnosed with US and CT, and one case was diagnosed with somatostatin scintigraphy plus US and CT. Chemotherapy was performed in two cases, while a solitary cardiac metastasis was surgically removed in one case who exhibited a long-term survival after resection.\n\nTable 2. Summary of the Reported Cases of Cardiac Metastasis Causing Fatal Arrhythmia in Patients with NETs.\n\nNo.\tAge (years)\tgender\tLocation\tPE\tDiagnostic procedure\tPrimary site\tTumor grade\tCarcinoid syndrome\tDistant metastasis\tTypes of a rrhythmia\tTreatment\tPrognosis after the diagnosis (or treatment) of cardiac metastases\tReference\t\n1\t78\tF\tLVwall RV wall Septum\t+\tTTE CT MRI\tBronchus\t-\t-\tND\tVA\tSomatostatin\tDead 1 year after diagnosis\t4\t\n2\t54\tM\tRV wall\t-\tTTE CT Scintigraphy\tIleo-ecum\t-\t+\tPer LN\tVA\tResection, Sandostatin therapy after resection\tSurvive at least 2 years after the resection\t5\t\n3\t60\tM\tLV wall RV wall Septum\t+\tTTE CT\tRectum\tG2\t-\tLiver Lung Bone\tVT\tEverolimus Store ptozocin lanreotide\tDead at 11 months after the diagnosis\tPresent case\t\nLV: left ventricle, RV: right ventricle, PE: pericardial effusion, TTE: transthoracic echocardiography, CT: computed tomography, MRI: magnetic resonance imaging, ND: not described, Per: peritoneum, LN: lymph node, VA: ventricular arrhythmia, VT: ventricular tachycardia\n\nWhile detecting cardiac metastases measuring less than 10 mm in a diameter has been difficult using CT and/or TTE, somatostatin receptor-positron emission CT has demonstrated a high efficacy for detecting small cardiac metastases in NET patients (7-9). Following the development of this CT procedure, the incidence of cardiac metastases has increased from 0.7% to 4.3%. Because cardiac metastases might cause severe complications, such as heart failure, lethal arrhythmia and cardiac tamponade, surveillance of cardiac metastases in NET patients using somatostatin receptor-positron emission CT is recommended.\n\nRecently, multidisciplinary therapeutic approaches, including chemotherapy, such as somatostatin analogue, molecular-targeted drugs and cytotoxic agents, have been rapidly developed for the treatment of patients with metastatic NETs (10), thus contributing to a prolonged survival of such patients (11). However, in our case, somatostatin analogues, molecular-targeted drugs and cytotoxic agents were not sufficiently effective as the cardiac metastasis had already markedly progressed by the time that it was detected. The establishment of appropriate therapeutic strategies for cardiac metastases as well as an aggressive screening program for small cardiac metastasis using somatostatin receptor-positron emission CT are expected to improve the outcomes of NET patients.\n\nNETs have been reported to cause carcinoid heart disease in more than 50% of the patients with carcinoid syndrome, which is present in about 20% of patients with NETs at the time of diagnosis (12,13). Carcinoid heart disease was suggested to induce atrial fibrillation and ventricular tachycardia due to right-sided heart failure, valvular disease and serotonin-associated diseases (14,15). According to previous reports, the incidence of cardiac metastases in NETs was suggested to be rarer than that of carcinoid heart disease (16). However, given the differences in the treatment plan, we need to accurately distinguish cardiac metastases from carcinoid-associated heart diseases when NET patients have chest symptoms, cardiac effusion, arrhythmia and heart failure. In our case, normal hormone levels and the absence of any concomitant symptoms indicated a non-functional NET without carcinoid syndrome. TTE revealed signs of right-sided heart failure which was suggested to have resulted from bloody pericardial effusion, while TTE revealed no right-sided valvular disease or dysfunction associated with carcinoid heart syndrome. On the other hand, a tumor and heterogenous wall thickening were detected in the right and left ventricular walls and septa. Furthermore, the patient had no history of heart disease and other factors which were possible to cause ventricular arrhythmia such as abnormal electrolyte. These findings strongly suggested that the patient's ventricular tachycardia had been caused by cardiac metastases from the rectal NET.\n\nIn conclusion, we encountered a rare case of cardiac metastases in a patient with a rectal NET causing fatal ventricular arrhythmia. Because of the risk of severe complications, such as fatal arrhythmia and pericardial effusion, appropriate screening and optimal therapeutic approaches for NET patients with cardiac metastases need to be established based on studies in a large number of such patients.\n\n\nAuthor's disclosure of potential Conflicts of Interest (COI).\n\nMikihiro Fujiya: Honoraria, Teijin Pharma and Nobelpharma; Research funding, Nobelpharma.\n==== Refs\n1. Ito T , Igarashi H , Nakamura K , et al . Epidemiological trends of pancreatic and gastrointestinal neuroendocrine tumors in Japan: a nationwide survey analysis\n. J Gastroenterol \n50 : 58 -64\n, 2015 .24499825 \n2. Cives M , Strosberg JR . Gastroenteropancreatic neuroendocrine tumors\n. CA Cancer J Clin \n68 : 471 -487\n, 2018 .30295930 \n3. Pavel M , Grossman A , Arnold R , et al . ENETS consensus guidelines for the management of brain, cardiac and ovarian metastases from neuroendocrine tumors\n. Neuroendocrinology \n91 : 326 -332\n, 2010 .20453466 \n4. Maréchaux S , Dagorn J , Gaxotte V , et al . Myocardial metastasis of a bronchial carcinoid\n. Eur Heart J \n28 : 391 , 2007 .16966342 \n5. Yeung HW , Imbriaco M , Zhang JJ , et al . Visualization of myocardial metastasis of carcinoid tumor by indium-111-pentetreotide\n. J Nucl Med \n37 : 1528 -1530\n, 1996 .8790210 \n6. Bussani R , De-Giorgio F , Abbate A , et al . Cardiac metastases\n. J Clin Pathol \n60 : 27 -34\n, 2007 .17098886 \n7. Carreras C , Kulkarni HR , Baum RP . Rare metastases detected by (68) Ga-somatostatin receptor PET/CT in patients with neuroendocrine tumors\n. Recent Results Cancer Res \n194 : 379 -384\n, 2013 .22918770 \n8. Calissendorff J , Sundin A , Falhammar H . 68Ga-DOTA-TOC-PET/CT detects heart metastases from ileal neuroendocrine tumors\n. Endocrine \n47 : 169 -176\n, 2014 .24272595 \n9. Kunz WG , Eschbach RS , Stahl R , et al . Identification and characterization of myocardial metastases in neuroendocrine tumor patients using 68Ga-DOTATATE PET-CT\n. Cancer Imaging \n18 : 34 , 2018 .30236163 \n10. Tsoli M , Chatzellis E , Koumarianou A , et al . Current best practice in the management of neuroendocrine tumors\n. Ther Adv Endocrinol Metab \n10 : 2042018818804698 , 2018 .30800264 \n11. Yao JC , Hassan M , Phan A , et al . One hundred years after “carcinoid”: epidemiology of and prognostic factors for neuroendocrine tumors in 35,825 cases in the United States\n. J Clin Oncol \n26 : 3063 -3072\n, 2008 .18565894 \n12. Hassan SA , Banchs J , Iliescu C , et al . Carcinoid heart disease\n. Heart \n103 : 1488 -1495\n, 2017 .28596302 \n13. Halperin DM , Shen C , Dasari A , et al . Frequency of carcinoid syndrome at neuroendocrine tumour diagnosis: a population-based study\n. Lancet Oncol \n18 : 525 -534\n, 2017 .28238592 \n14. Langer C , Piper C , Vogt J , et al . Atrial fibrillation in carcinoid heart disease: the role of serotonin. A review of the literature\n. Clin Res Cardiol \n96 : 114 -118\n, 2007 .17115326 \n15. Rupp AB , Ahmadjee A , Morshedzadeh JH , et al . Carcinoid syndrome-induced ventricular tachycardia\n. Case Rep Cardiol \n2016 : 9142598 , 2016 .27088017 \n16. Calissendorff J , Maret E , Sundin A , et al . Ileal neuroendocrine tumors and heart: not only valvular consequences\n. Endocrine \n48 : 743 -755\n, 2015 .25319177\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0918-2918",
"issue": "60(3)",
"journal": "Internal medicine (Tokyo, Japan)",
"keywords": "cardiac metastasis; neuroendocrine tumor; ventricular arrhythmia",
"medline_ta": "Intern Med",
"mesh_terms": "D001145:Arrhythmias, Cardiac; D006338:Heart Neoplasms; D006801:Humans; D008297:Male; D008875:Middle Aged; D018358:Neuroendocrine Tumors; D010190:Pancreatic Neoplasms; D012004:Rectal Neoplasms",
"nlm_unique_id": "9204241",
"other_id": null,
"pages": "373-378",
"pmc": null,
"pmid": "33518610",
"pubdate": "2021",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": "28596302;18565894;25319177;27088017;22918770;30800264;8790210;17115326;28238592;30295930;16966342;24272595;17098886;24499825;20453466;30236163",
"title": "Cardiac Metastasis Caused Fatal Ventricular Arrhythmia in a Patient with a Rectal Neuroendocrine Tumor.",
"title_normalized": "cardiac metastasis caused fatal ventricular arrhythmia in a patient with a rectal neuroendocrine tumor"
} | [
{
"companynumb": "JP-SUN PHARMACEUTICAL INDUSTRIES LTD-2021RR-315532",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "OCTREOTIDE ACETATE"
},
... |
{
"abstract": "Epilepsy affects about 50 million people worldwide and around 30% of these patients have refractory epilepsy, with potential consequences regarding quality of life, morbidity and premature mortality.\n\n\n\nThe aim of treatment with antiseizure medications (ASMs) is to allow patients to remain without seizures, with good tolerability. Levetiracetam is a broad-spectrum ASM with a unique mechanism of action that differs it from other ASMs. It has been shown to be effective and safe for treating adults and children with epilepsy.\n\n\n\nThis was a phase III, multicenter, randomized, double-blind, placebo-controlled trial to evaluate the efficacy and safety of levetiracetam in children and adults (4-65 years) as an adjuvant treatment for focal-onset seizures. It was conducted among 114 patients undergoing treatment with up to three ASMs. The primary efficacy analysis was based on the proportion of patients who achieved a reduction of ≥ 50% in the mean number of focal seizures per week, over a 16-week treatment period. The patients were randomized to receive placebo or levetiracetam, titrated every two weeks from 20 mg/kg/day or 1,000 mg/day up to 60 mg/kg/day or 3,000 mg/day.\n\n\n\nLevetiracetam was significantly superior to placebo (p = 0.0031); 38.7% of the participants in the levetiracetam group and 14.3% in the control group shows reductions in focal seizures. Levetiracetam was seen to have a favorable safety profile and an adverse event rate similar to that of placebo.\n\n\n\nCorroborating the results in the literature, levetiracetam was shown to be effective and safe for children and adults with refractory focal-onset epilepsy.",
"affiliations": "Universidade de São Paulo, Faculdade de Medicina, Hospital das Clínicas, Centro de Pesquisa, São Paulo SP, Brazil.;Aché Laboratórios Farmacêuticos S.A., Núcleo de Inovação, Núcleo Médico-Científico, Guarulhos SP, Brazil.;Aché Laboratórios Farmacêuticos S.A., Núcleo de Inovação, Núcleo Médico-Científico, Guarulhos SP, Brazil.;Aché Laboratórios Farmacêuticos S.A., Núcleo de Inovação, Núcleo Médico-Científico, Guarulhos SP, Brazil.;Aché Laboratórios Farmacêuticos S.A., Núcleo de Inovação, Núcleo Médico-Científico, Guarulhos SP, Brazil.;Aché Laboratórios Farmacêuticos S.A., Núcleo de Inovação, Núcleo Médico-Científico, Guarulhos SP, Brazil.;STATS Estatística em Ciências e Negócios, São Paulo SP, Brazil.;Universidade Federal Fluminense, Hospital Universitário Antônio Pedro, Rio de Janeiro RJ, Brazil.;Universidade Federal de Santa Catarina, Hospital Universitário, Núcleo de Pesquisa em Neurologia Experimental e Clínica, Florianópolis SC, Brazil.;Universidade de São Paulo, Faculdade de Medicina de Ribeirão Preto, Hospital das Clínicas, Unidade de Pesquisa Clínica, Ribeirão Preto SP, Brazil.;Instituto de Neurologia de Curitiba, Curitiba PR, Brazil.;Pontifícia Universidade Católica do Rio Grande do Sul, Hospital São Lucas, Centro de Pesquisa Clínica, Porto Alegre RS, Brazil.;Instituto de Medicina Integral Prof. Fernando Figueira, Recife PE, Brazil.;Aché Laboratórios Farmacêuticos S.A., Núcleo de Inovação, Núcleo Médico-Científico, Guarulhos SP, Brazil.;Universidade Federal de São Paulo, Escola Paulista de Medicina, Departamento de Neurologia e Neurocirurgia, São Paulo SP, Brazil.",
"authors": "Manreza|Maria Luiza Giraldes de|MLG|0000-0003-0346-3417;Pan|Tatiane Amaral|TA|0000-0001-8560-6762;Carbone|Eduardo Quinalha|EQ|0000-0002-2876-8156;Vattimo|Antonio Carlos Amedeo|ACA|0000-0002-1976-7434;Herrera|Renata|R|0000-0001-5137-086X;Morais|Douglas Costa|DC|0000-0001-5160-2501;Cardoso|Rita Antonelli|RA|0000-0003-3023-8936;Lacerda|Glenda Corrêa Borges de|GCB|0000-0003-0776-0769;Lin|Katia|K|0000-0002-5401-7524;Nakano|Frederico Nakane|FN|0000-0002-6860-3487;Kowacs|Pedro André|PA|0000-0001-7770-7475;Palmini|André Luis Fernandes|ALF|0000-0002-4163-6924;Souza|Adélia Maria de Miranda Henriques|AMMH|0000-0002-5303-5528;Zung|Stevin|S|0000-0002-8172-0928;Yacubian|Elza Márcia Targas|EMT|0000-0001-8367-0189",
"chemical_list": "D000927:Anticonvulsants; D000077287:Levetiracetam",
"country": "Brazil",
"delete": false,
"doi": "10.1590/0004-282X-ANP-2020-0082",
"fulltext": "\n==== Front\nArq Neuropsiquiatr\nArq Neuropsiquiatr\nanp\nArquivos de Neuro-Psiquiatria\n0004-282X\n1678-4227\nAcademia Brasileira de Neurologia - ABNEURO\n\n34133509\n10.1590/0004-282X-ANP-2020-0082\nArticle\nEfficacy and safety of levetiracetam as adjunctive therapy for refractory focal epilepsy\nEficácia e segurança do levetiracetam como terapia adjunta na epilepsia focal refratáriahttps://orcid.org/0000-0003-0346-3417\nde MANREZA Maria Luiza Giraldes 1\nhttps://orcid.org/0000-0001-8560-6762\nPAN Tatiane Amaral 2\nhttps://orcid.org/0000-0002-2876-8156\nCARBONE Eduardo Quinalha 2\nhttps://orcid.org/0000-0002-1976-7434\nVATTIMO Antonio Carlos Amedeo 2\nhttps://orcid.org/0000-0001-5137-086X\nHERRERA Renata 2\nhttps://orcid.org/0000-0001-5160-2501\nMORAIS Douglas Costa 2\nhttps://orcid.org/0000-0003-3023-8936\nCARDOSO Rita Antonelli 3\nhttps://orcid.org/0000-0003-0776-0769\nde LACERDA Glenda Corrêa Borges 4\nhttps://orcid.org/0000-0002-5401-7524\nLIN Katia 5\nhttps://orcid.org/0000-0002-6860-3487\nNAKANO Frederico Nakane 6\nhttps://orcid.org/0000-0001-7770-7475\nKOWACS Pedro André 7\nhttps://orcid.org/0000-0002-4163-6924\nPALMINI André Luis Fernandes 8\nhttps://orcid.org/0000-0002-5303-5528\nSOUZA Adélia Maria de Miranda Henriques 9\nhttps://orcid.org/0000-0002-8172-0928\nZUNG Stevin 2\nhttps://orcid.org/0000-0001-8367-0189\nYACUBIAN Elza Márcia Targas 10\n1 Universidade de São Paulo, Faculdade de Medicina, Hospital das Clínicas, Centro de Pesquisa, São Paulo SP, Brazil. Universidade de São Paulo Universidade de São Paulo Faculdade de Medicina Hospital das Clínicas São Paulo SP Brazil\n2 Aché Laboratórios Farmacêuticos S.A., Núcleo de Inovação, Núcleo Médico-Científico, Guarulhos SP, Brazil. Aché Laboratórios Farmacêuticos S.A. Núcleo de Inovação Núcleo Médico-Científico Guarulhos SP Brazil\n3 STATS Estatística em Ciências e Negócios, São Paulo SP, Brazil. STATS Estatística em Ciências e Negócios São Paulo SP Brazil\n4 Universidade Federal Fluminense, Hospital Universitário Antônio Pedro, Rio de Janeiro RJ, Brazil. Universidade Federal Fluminense Universidade Federal Fluminense Hospital Universitário Antônio Pedro Rio de Janeiro RJ Brazil\n5 Universidade Federal de Santa Catarina, Hospital Universitário, Núcleo de Pesquisa em Neurologia Experimental e Clínica, Florianópolis SC, Brazil. Universidade Federal de Santa Catarina Universidade Federal de Santa Catarina Hospital Universitário Núcleo de Pesquisa em Neurologia Experimental e Clínica Florianópolis SC Brazil\n6 Universidade de São Paulo, Faculdade de Medicina de Ribeirão Preto, Hospital das Clínicas, Unidade de Pesquisa Clínica, Ribeirão Preto SP, Brazil. Universidade de São Paulo Universidade de São Paulo Faculdade de Medicina de Ribeirão Preto Hospital das Clínicas Ribeirão Preto SP Brazil\n7 Instituto de Neurologia de Curitiba, Curitiba PR, Brazil. Instituto de Neurologia de Curitiba Curitiba PR Brazil\n8 Pontifícia Universidade Católica do Rio Grande do Sul, Hospital São Lucas, Centro de Pesquisa Clínica, Porto Alegre RS, Brazil. Pontifícia Universidade Católica do Rio Grande do Sul Pontifícia Universidade Católica do Rio Grande do Sul Hospital São Lucas Centro de Pesquisa Clínica Porto Alegre RS Brazil\n9 Instituto de Medicina Integral Prof. Fernando Figueira, Recife PE, Brazil. Instituto de Medicina Integral Professor Fernando Figueira Instituto de Medicina Integral Prof. Fernando Figueira Recife PE Brazil\n10 Universidade Federal de São Paulo, Escola Paulista de Medicina, Departamento de Neurologia e Neurocirurgia, São Paulo SP, Brazil. Universidade Federal de São Paulo Universidade Federal de São Paulo Escola Paulista de Medicina Departamento de Neurologia e Neurocirurgia São Paulo SP Brazil\nCorrespondence: Eduardo Quinalha Carbone; E-mail: ducarbone@gmail.com\nConflict of interest: The author is an employee of Aché Laboratórios Farmacêuticos S.A., sponsor of the study.\n\nAuthors’ contributions: All authors participated in the preparation and review of the article and were responsible for the submission.\n\n08 5 2021\n4 2021\n79 4 290298\n04 3 2020\n30 7 2020\n10 8 2020\nhttps://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License\nABSTRACT\n\nBackground:\n\nEpilepsy affects about 50 million people worldwide and around 30% of these patients have refractory epilepsy, with potential consequences regarding quality of life, morbidity and premature mortality.\n\nObjective:\n\nThe aim of treatment with antiseizure medications (ASMs) is to allow patients to remain without seizures, with good tolerability. Levetiracetam is a broad-spectrum ASM with a unique mechanism of action that differs it from other ASMs. It has been shown to be effective and safe for treating adults and children with epilepsy.\n\nMethods:\n\nThis was a phase III, multicenter, randomized, double-blind, placebo-controlled trial to evaluate the efficacy and safety of levetiracetam in children and adults (4-65 years) as an adjuvant treatment for focal-onset seizures. It was conducted among 114 patients undergoing treatment with up to three ASMs. The primary efficacy analysis was based on the proportion of patients who achieved a reduction of ≥ 50% in the mean number of focal seizures per week, over a 16-week treatment period. The patients were randomized to receive placebo or levetiracetam, titrated every two weeks from 20 mg/kg/day or 1,000 mg/day up to 60 mg/kg/day or 3,000 mg/day.\n\nResults:\n\nLevetiracetam was significantly superior to placebo (p = 0.0031); 38.7% of the participants in the levetiracetam group and 14.3% in the control group shows reductions in focal seizures. Levetiracetam was seen to have a favorable safety profile and an adverse event rate similar to that of placebo.\n\nConclusion:\n\nCorroborating the results in the literature, levetiracetam was shown to be effective and safe for children and adults with refractory focal-onset epilepsy.\n\nRESUMO\n\nIntrodução:\n\nA epilepsia afeta cerca de 50 milhões de pessoas em todo o mundo e aproximadamente 30% desses pacientes apresentam epilepsia refratária, com possíveis consequências na qualidade de vida, morbidade e mortalidade prematura.\n\nObjetivo:\n\nO objetivo do tratamento com fármacos antiepilépticos (FAEs) é permitir que os pacientes permaneçam sem crises epilépticas com boa tolerabilidade. O levetiracetam (LEV) é um FAE de amplo espectro, com mecanismo de ação único, diferente dos demais e que demonstra ser eficaz e seguro no tratamento de adultos e crianças.\n\nMétodos:\n\nEstudo de fase III, multicêntrico, randomizado, duplo-cego e controlado por placebo avalia a eficácia e a segurança do LEV em crianças e adultos (4-65 anos) como tratamento adjuvante para crises de início focal em 114 pacientes já tratados com até três FAEs. A análise de eficácia primária foi baseada na proporção de pacientes que apresentaram redução ≥50% no número médio de crises epilépticas focais semanais, durante 16 semanas. Os pacientes foram randomizados para receber placebo ou LEV, titulado a cada duas semanas de 20 mg/kg/dia ou 1.000 mg/dia até 60 mg/kg/dia ou 3.000 mg/dia.\n\nResultados:\n\nLEV foi significativamente superior ao placebo (p=0,0031), com 38,7% dos participantes no grupo LEV e 14,3% no grupo controle que apresentaram redução das crises focais. LEV apresenta bom perfil de segurança com eventos adversos semelhantes ao placebo.\n\nConclusão:\n\nCorroborando com os resultados da literatura, o levetiracetam mostra-se eficaz e seguro para crianças e adultos com epilepsia focal refratária.\n\nKeywords:\n\nLevetiracetam\nRefractory Epilepsy\nFocal Seizures\nAntiseizure Medications\nSeizures\nPalavras-chave:\n\nLevetiracetam\nEpilepsia Refratária\nCrises Focais\nFármacos Anticrise\nCrises Epilépticas\n==== Body\npmcINTRODUCTION\n\nEpilepsy is one of the most common neurological diseases and affects approximately 50 million people worldwide1,2. It is characterized by recurrent epileptic seizures caused by excessive and synchronous neuronal discharges1. Individuals with epilepsy are more susceptible to physical trauma (such as fractures and bruises), psychiatric disorders (such as depression and anxiety) and premature death. The risk that they face is up to three times higher than that of the general population2.\n\nThe aim of antiseizure medications (ASMs) is to combine seizure prevention with good drug tolerability3. However, around 30% of patients have refractory epilepsy4, which is particularly common in individuals with focal seizures5. This makes refractory epilepsy a high-cost health problem and a major concern for patients, families and society in general4.\n\nFor treating refractory epilepsy, there is an expectation that new ASMs can be developed6 or that effective combinations of two or more existing treatments can be found1. Several combinations of ASMs can be used to achieve this purpose, leading to different success rates and tolerability profiles.\n\nLevetiracetam (LEV) is a broad-spectrum ASM with a unique mechanism of action that make it one of the most commonly prescribed drugs of its class. It is recommended as a first-line add-on agent for focal seizures and, additionally, has a favorable pharmacokinetic profile. Studies have shown that LEV is an effective anti-seizure medication for both adults and children with generalized or focal-onset refractory seizures, at doses of 1,000-3,000 mg/day or 60 mg/kg/day, with an acceptable adverse event profile7. However, little information about LEV use in the Brazilian population is available.\n\nThe present clinical study was designed to evaluate the efficacy and safety of LEV, in Brazilian adults and children, as an adjunctive treatment for refractory focal epilepsy.\n\nMETHODS\n\nPopulation\n\nThis study included participants between 4 and 65 years old with refractory focal epilepsy, with or without focal to bilateral tonic-clonic seizure, as defined by the International League Against Epilepsy (ILAE)8, They needed to have had this condition for at least two years, without any progressive or expansive brain injury previously documented, with a minimum of 12 seizures in the last 12 weeks before screening; and they needed to have been on a stable therapeutic regimen of up to three ASMs for at least one month. Women needed to be using contraception and have a negative pregnancy test result throughout the study period.\n\nThe exclusion criteria comprised presentation of any of the following: non-epileptic events; psychogenic non-epileptic seizures; ≥ 3 occurrences of subintrant epileptic seizures in the last 12 weeks prior to the study screening visit; cognitive or progressive epileptic syndromes; history of schizophrenia or suicide attempt; severe intellectual disability of any etiology; or clinically significant diseases of hematopoietic, gastrointestinal, cardiovascular, hepatic, renal, neurological, endocrine, psychiatric, autoimmune, pulmonary or other origin, at the discretion of the investigator.\n\nAll participants aged 18 years old or above provided written consent prior to undergoing any study procedure. For participants between 12 and 17 years old, consent was obtained from them as well from their legal guardians. For participants under 12 years old, only the consent of legal guardians was obtained.\n\nStudy design\n\nThis was a phase III, multicenter, randomized, double-blind, placebo-controlled clinical trial to evaluate the efficacy and safety of levetiracetam as a therapeutic adjunct for controlling focal epileptic seizures (focal aware seizures (IA), focal seizures with impaired awareness (IB) and focal to bilateral tonic-clonic seizures (IC), as defined in the ILAE classification8.\n\nThis study was conducted at eight research centers in Brazil: three in the state of São Paulo (Universidade Federal de São Paulo [UNIFESP], Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo [HC-FMUSP] and Universidade de São Paulo [USP], Ribeirão Preto campus); one in Rio Grande do Sul (Pontifícia Universidade Católica do Rio Grande do Sul [PUC-RS]); one in Paraná (Instituto de Neurologia de Curitiba [INC]); one in Pernambuco (Instituto de Medicina Integral Professor Fernando Figueira [IMIP]); one in Rio de Janeiro (Hospital Universitário Clementino Fraga Filho [HUFF]); and one in Santa Catarina (Universidade Federal de Santa Catarina [UFSC]). The study protocol was approved by the independent ethics committees of each institution.\n\nThe total study period comprised 30 weeks, from January 2013 to August 2015, divided into three parts (Figure 1):\n\nFigure 1. Design of the clinical study.\n\nOC: optical visit.\n\nBaseline: 8 weeks. The treatment regimen followed by the patient before the study was maintained in the four weeks prior to enrollment. In the last four weeks, it became a simple-blind study with the addition of placebo.\n\nTreatment: 16-week double-blind period. Participants were randomized 1:1 to levetiracetam or placebo, with progressive titration performed every two weeks, starting with 20 mg/kg/day or 1,000 mg/day and going up to 40 mg/kg/day or 2,000 mg/day from the 3rd to 4th week and to 60 mg/kg/day or 3,000 mg/day from the 5th to 20th week. If the participant did not tolerate a higher dose, it could return to 2,000 mg/day or 40 mg/kg/day. If participants did not tolerate this lower dose, they were excluded from the study.\n\nExtension: 6-week double-blind period. For this, participants who agreed to continue taking part in the study were included. Treatment was maintained for the levetiracetam group, and placebo group participants were converted to active treatment, starting with titration every two weeks.\n\nLevetiracetam and placebo products were both available as coated tablets or oral solution, for participants over or below 15 years old, respectively.\n\nAdherence to treatment was verified by counting the tablets or, in the case of oral solution, evaluating the participant's diary that was given to the subject’s parents. This diary was given to all participants in order to register the number of seizures.\n\nParticipants who had a serious adverse event, loss of follow-up or adherence, pregnancy, change in baseline therapy for epilepsy or a change in the LEV dose not allowed by the protocol were discontinued from the study.\n\nObjectives\n\nThe primary efficacy variable was a reduction of ≥ 50% in the mean number of focal seizures per week during treatment (4-week dose adjustment + 12-week evaluation) from baseline (4 weeks without study drug + 4 weeks on placebo).\n\nThe secondary objectives were to determine the following: the change in the average weekly number of IA, IB and IC seizures; the proportion of the participants with ≥ 50% reduction in the average number of days a week with focal seizures; the proportion of participants with no epileptic seizures during the period; and tolerability of LEV in relation to occurrences of adverse events.\n\nThe exploratory endpoint was the quality of life, evaluated through the questionnaires QOLIE-AD-48 (11 to 17 years old) or QOLIE-31 (≥18 years old) and the inventory of depression in neurological disorders for epilepsy (≥ 18 years old)9,10,11. Student's t test was used for the analyses.\n\nSafety assessment\n\nThe safety assessment for the study was performed based on measurement of adverse event occurrences and on evaluation of clinical examination results, ECG findings and laboratory tests, including blood chemistry (sodium, potassium, TGO, TGP, alkaline phosphatase, total bilirubin and fractions, creatinine, urea, gamma-GT and total protein and fractions), hematology (platelet count and leukogram), fasting blood glucose and B-HCG serum (pregnancy test). Laboratory tests and electrocardiograms were performed in 3 visits: visit 1 (initial visit), visit 8 (after treatment period) and visit 11 (last visit, after the extension period).\n\nStatistical method\n\nBased on the bilateral test for proportions, with a significance level of 5%, it was determined that 54 participants per group would provide 80% power. The discontinuation rate was estimated at 20% and, therefore, randomization of 136 participants (68 per group) was planned.\n\nEligible participants were assigned to receive levetiracetam or placebo using a computer-generated randomization list prepared by an independent biostatistician. The randomization schedule was based on randomly permuted blocks of size four. Participants were stratified according to age (≥ 4 and < 16 years; and ≥ 16 and < 66 years).\n\nThe main analysis was performed using the Intention to Treat (ITT) population, which was defined as all the randomized participants who received at least one dose of the products (levetiracetam or placebo). To assess the robustness of the results, efficacy analyses were performed on the population, using a protocol (PP) that was defined as including all the participants in the ITT population who did not violate the inclusion or exclusion criteria, and who did not discontinue treatment before week 16 unless due to adverse events or a clinical need to change the basic therapy, with adherence greater than 80% and no major protocol violations. The safety population was defined using the same criteria as the ITT population.\n\nA logistic regression model was used to analyze the primary and secondary variables involved in the therapeutic response. The following were included in the model: treatment, age range according to stratification, treatment versus age interaction and baseline and center values as covariates. Estimates and 95% confidence intervals (95% CI) for the risk ratio between treatments were obtained. The absolute variation in the average number of focal seizures per week and the average number of days with focal seizures of each subtype (IA, IB and IC) were evaluated as secondary variables of effectiveness, by means of the Wilcoxon rank sum test.\n\nThe last observation carried forward (LOCF) estimation was used only for one participant in the levetiracetam group who used the drug for which this individual had been randomized but did not make any subsequent journal entries. The analyses were performed using the SAS V 9.2 system (Statistical Analysis System, SAS Institute) and the bilateral significance level was taken to be equal to 5%.\n\nRESULTS\n\nDemographics and baseline characteristics\n\nAt the end of the study, 114 participants had completed the 16 weeks of treatment: 59 (95.2%) with levetiracetam and 55 (85.9%) with placebo (Figure 2).\n\nFigure 2. Distribution of the participants in the study\n\nThe baseline characteristics of the participants are described in Table 1.\n\nTable 1. Demographic characteristics and antiepileptic drugs used for the Intention to Treat population.\n\n\t\tLevetiracetam\n\nn = 62 (%)\n\n\tPlacebo\n\nn = 63 (%)\n\n\tTotal\n\nn = 125 (%)\n\n\t\nSex\tMale\t38 (61.3)\t32 (50.8)\t70 (56.0)\t\nFemale\t24 (38.7)\t31 (49.2)\t55 (44.0)\t\nAge (years)\tMean (SD)\t23.63 (15.35)\t25.49 (15.91)\t24.57 (15.60)\t\nAge group\t4 to 15 years\t28 (45.16)\t29 (46.03)\t54 (45.6)\t\nAbove 15 years\t34 (54.84)\t34 (53.97)\t68 (54.4)\t\nRace\tWhite\t43 (69.4)\t44 (69.8)\t87 (69.6)\t\nNonwhite\t19 (30.7)\t19 (30.1)\t38 (30.4)\t\nTime (month) under therapeutic regimen\tMean (SD)\t6.48 (7.65)\t7.13 (9.35)\t6.81 (8.52)\t\nNo. of antiepileptic drugs in the therapeutic regimen\t1\t6 (9.7)\t6 (9.5)\t12 (9.6)\t\n2\t30 (48.4)\t26 (41.3)\t56 (44.8)\t\n3\t26 (41.9)\t31 (49.2)\t57 (45.6)\t\nAntiepileptic drugs used\tCLB\t29 (46.8)\t34 (54.0)\t63 (50.4)\t\nCBZ\t35 (56.5)\t22 (34.9)\t57 (45.6)\t\nOCBZ\t12 (19.4)\t19 (30.2)\t31 (24.8)\t\nLTG\t12 (19.4)\t15 (23.8)\t27 (21.6)\t\nVPA\t14 (22.6)\t13 (20.6)\t27 (21.6)\t\nTPM\t13 (21.0)\t13 (20.6)\t26 (20.8)\t\nPB\t10 (16.1)\t12 (19.0)\t22 (17.6)\t\nPHT\t6 (9.7)\t6 (9.5)\t12 (9.6)\t\nCNZ\t4 (6.5)\t6 (9.5)\t10 (8.0)\t\nDVPA\t3 (4.8)\t7 (11.1)\t10 (8.0)\t\nNZP\t5 (8.1)\t0 (0.0)\t5 (4.0)\t\nVGB\t1 (1.6)\t1 (1.6)\t2 (1.6)\t\nESM\t0 (0.0)\t1 (1.6)\t1 (0.8)\t\nPRM\t0 (0.0)\t1 (1.6)\t1 (0.8)\t\nOthers\t0 (0.0%)\t1 (1.6%)\t1 (0.8)\t\nn (%): number and percentage of participants in relation to the total treatment group; SD: standard deviation; CLB: clobazam; CBZ: carbamazepine; OCBZ: oxcarbazepine; LTG: lamotrigine; VPA: sodium valproate; TPM: topiramate; PB: phenobarbital; PHT: phenytoin; CNZ: clonazepam; DVPA: divalproex sodium; NZP: nitrazepam; VGB: vigabatrin; ESM: ethosuximide; PRM: primidone.\n\nRegarding the characteristics of seizures, it was observed that focal seizures with impaired awareness were more frequent, affecting 91.9% of the participants in the levetiracetam group and 88.9% of the participants in the placebo group (Table 2).\n\nTable 2. Characteristics of the participants in relation to focal epileptic seizures during the baseline period, for the Intention to Treat population.\n\n\tFocal seizures\n\n(IA + IB + IC)\n\n\tFocal aware seizures (lA)\tFocal seizure with impaired awareness (lB)\tFocal to bilateral tonic-clonic seizure (lC)\t\nLevetiracetam\n\n(n = 62)\n\n\tPlacebo\n\n(n = 63)\n\n\tLevetiracetam\n\n(n = 62)\n\n\tPlacebo\n\n(n = 63)\n\n\tLevetiracetam\n\n(n = 62)\n\n\tPlacebo\n\n(n = 63)\n\n\tLevetiracetam\n\n(n = 62)\n\n\tPlacebo\n\n(n = 63)\n\n\t\nFrequency of participants with seizures, n (%)\t62 (100.0%)\t63 (100.0%)\t26 (41.9%)\t23 (36.5%)\t57 (91.9%)\t56 (88.9%)\t27 (43.5%)\t26 (41.3%)\t\nFrequency of seizures/week*\t\nMedian (Q1-Q3)\t3 (2-8)\t4 (2-10)\t0 (0-1)\t0 (0-1)\t2 (1-4)\t2 (1-5)\t0 (0-1)\t0 (0-1)\t\nMean (SD)\t6.18 (7.22)\t8.22 (10.22)\t1.03 (2.45)\t2.34 (6.25)\t4.04 (5.14)\t4.75 (7.13)\t1.10 (3.42)\t1.13 (2.82)\t\nFrequency of days with seizures/week**\t\nMedian (Q1-Q3)\t2 (1-4)\t2 (1-5)\t0 (0-0)\t0 (0-1)\t2 (1-3)\t2 (1-3)\t0 (0-0)\t0 (0-1)\t\nMean (SD)\t2.76 (1.87)\t2.99 (2.06)\t0.63 (1.33)\t0.92 (1.92)\t2.13 (1.90)\t2.12 (1.94)\t0.58 (1.36)\t0.55 (1.14)\t\nIA: focal aware seizures; IB: focal seizures with impaired awareness; IC: focal to bilateral tonic-clonic seizures; n (%): number and percentage of study participants who presented at least one episode of epileptic seizure during the baseline period (week 1 to week 8); this percentage was established in relation to the number of participants in the treatment group; SD: standard deviation; Min-Max: minimum and maximum values observed; Q1 and Q3: 25th and 75th percentiles; *calculated as the ratio between the total number of seizures and the number of days evaluated during the baseline period, multiplied by 7; **calculated as the ratio between the total number of days with epileptic seizures and the number of days evaluated during the baseline period, multiplied by 7\n\nEfficacy evaluation\n\nRegarding the primary outcome, 38.7% of the levetiracetam group and 14.3% of the placebo group showed reductions in the mean number of focal seizures/week ≥ 50% (Table 3).\n\nTable 3. Proportion of responders with reduction ≥ 50% regarding the average number of focal seizures/week without treatment period, for the Intention to Treat population.\n\nAge range\tLevetiracetam\tPlacebo\tVariation\t\nTotal\tn (%)\t24/62 (38.71%)\t9/63 (14.29%)\t24.42%\t\n95% CI (%)\t26.60-51.90%\t6.75-25.40%\t6.57-40.30%\t\nn (%): number and proportion of responders with therapeutic response in each treatment group; 95% CI: 95% confidence intervals for proportion of responders with therapeutic response.\n\nThe estimation of the risk ratio indicated that the chance of ≥ 50% reduction in the mean number of focal seizures/week at the end of treatment for participants in the levetiracetam group was 3.91 times higher than in the placebo group (Figure 3).\n\nFigure 3. Proportion of participants with a reduction ≥ 50% in the mean number of focal epileptic seizures/week during the treatment period, for the Intention to Treat population.\n\nThe median percentage change in the average number of focal seizures per week for the different study periods in relation to the baseline period is shown in Figure 4.\n\nFigure 4. Median percentage variation of the mean number of epileptic seizures/week for each study period in relation to the baseline period, for the Intention to Treat population.\n\nIn the analysis of secondary variables, the absolute variation from baseline for each subtype is summarized according to treatment group and study period in Table 4.\n\nTable 4. Variation of the mean number of seizures or days with focal seizures/week for each subtype, for the Intention to Treat population.\n\n\tLevetiracetam (n = 62)\tPlacebo (n = 63)\t\nMean (SD)\tMedian\n\n(Q1-Q3)\n\n\tMean (SD)\tMedian\n\n(Q1-Q3)\n\n\t\nMean number of seizures/week\t\nFocal seizures (IA + IB + IC + III)\t2.33 (4.20)\t1.2 (0.3-3.1)\t0.61 (4.02)\t0.4 (-0.4-2.0)\t\nFocal aware seizures (IA)\t0.52 (2.13)\t0.0 (0.0-0.3)\t0.39 (1.68)\t0.0 (0.0-0.4)\t\nFocal seizure with impaired awareness (IB)\t1.29 (3.55)\t0.7 (0.1-1.7)\t0.46 (3.05)\t0.2 (-0.4-1.0)\t\nFocal to bilateral tonic-clonic (IC)\t0.52 (2.03)\t0.0 (0.0-0.4)\t-0.24 (1.95)\t0.0 (0.0-0.1)\t\nMean number of days/week\t\nFocal seizures (IA + IB + IC + III)\t0.72 (1.01)\t0.7 (0.1-1.3)\t0.13 (1.06)\t0.2 (-0.1-0.8)\t\nFocal aware seizures (IA)\t0.33 (1.05)\t0.0 (0.0-0.3)\t0.22 (0.62)\t0.0 (0.0-0.2)\t\nFocal seizure with impaired awareness (IB)\t0.62 (0.94)\t0.6 (0.0-1.2)\t0.05 (0.97)\t0.1 (-0.3-0.5)\t\nFocal to bilateral tonic-clonic (IC)\t0.19 (0.67)\t0.0 (0.0-0.2)\t-0.04 (0.47)\t0.0 (0.0-0.1)\t\nVariation: mean number of days or seizures/week during the baseline period - mean number of days or seizures/week during the treatment period; SD: standard deviation; Q1 and Q3: 25th and 75th percentiles.\n\nAt the baseline, the medians of the average number of focal seizures with impaired awareness per week were 2.4 and 2.3 for the levetiracetam and placebo groups, respectively; and in the treatment period, these were 1.0 and 2.1, respectively. The medians of the average number of days with focal seizures with impaired awareness per week during the baseline period were 1.6 and 1.5 in the levetiracetam and placebo groups, respectively. On the other hand, the median for focal aware seizures or focal to bilateral tonic-clonic seizure was zero.\n\nA statistically significant difference was observed between the treatment groups regarding the number of focal seizures with impaired awareness (p = 0.0031), but there was no statistically significant difference between treatments regarding the subtypes of focal aware seizures (p = 0.4046) and focal to bilateral tonic-clonic seizures (p = 0.1397).\n\nThe proportion of the responder participants with ≥ 50% reduction in the average number of days/week with focal seizures during the treatment period was 20 (32.3%) participants in the levetiracetam group and 10 (15.9%) participants in the placebo group, The difference between the groups was 16.4% (95%CI -1.52- 32.8; p = 0.0382) (Figure 5).\n\nFigure 5. Proportion of the participants with reduction ≥ 50% in the mean number of days/week of focal epileptic seizures during the treatment period, for the Intention to Treat population.\n\nThe proportion of the participants free from focal seizures during the evaluation period was estimated at 7.0% (95% CI 2.0-17.0) in the levetiracetam group and 5.7% (95%CI 1.2-15.7) in the placebo group, considering the ITT population. There was no difference between the treatment groups in this regard.\n\nComparison between groups in relation to QOLIE-31 showed that there was no statistically significant difference between the treatments. QOLIE AD-48 showed a statistically significant difference regarding the impact of epilepsy (p = 0.0255) and total score (p = 0.0362), thus indicating a slight improvement for the placebo group.\n\nThere was no statistically significant effect from treatment regarding the response to the NDDI-E Depression Inventory at week 24 (p = 0.1716), in an evaluation using the logistic regression model and considering the classification of week 8 as the covariate.\n\nTreatment adherence was above 90% in both groups.\n\nSafety assessment\n\nAdverse events with an incidence greater than or equal to 5% are described in Table 5.\n\nTable 5. Adverse effects according to systems and organs (Medical Dictionary for Regulatory Activities).\n\nOrgans and systems (MedDRA)\tTreatment (Week 9-Week 24)\t\nLevetiracetam\n\nn = 62 (%)\n\n\tPlacebo\n\nn = 63 (%)\n\n\t\nNervous system complaints\t19 (30.6)\t20 (31.7)\t\nGastrointestinal complaints\t10 (16.1)\t11 (17.5)\t\nInfections and infestations\t12 (19.4)\t12 (19.0)\t\nPsychiatric disturbances\t10 (16.1)\t8 (12.7)\t\nRespiratory, thoracic and mediastinal diseases\t4 (6.5)\t8 (12.7)\t\nComplications of interventions relating to injuries and intoxications\t6 (9.7)\t6 (9.5)\t\nGeneral disturbances on the administration site\t4 (6.5)\t8 (12.7)\t\nCutaneous and subcutaneous tissue conditions\t5 (8.1)\t2 (3.2)\t\nMusculoskeletal and conjunctive tissue conditions\t2 (3.2)\t4 (6.3)\t\nMetabolism and nutrition-related diseases\t2 (3.2)\t5 (7.9)\t\nEar and labyrinth diseases\t2 (3.2)\t3 (4.8)\t\nEye conditions\t3 (4.8)\t2 (3.2)\t\nVascular disorders\t1 (1.6)\t4 (6.3)\t\nMedDRA: Medical Dictionary for Regulatory Activities.\n\nIn all periods of the study, adverse events of mild intensity predominated. These were unrelated to the study drug, with no need for medication adjustments, and they had all resolved by the end of the study. During the treatment period, medication to treat adverse events was more frequently needed in the levetiracetam group (69.1%) than in the placebo group (52.4%).\n\nNo difference was found between the groups regarding vital signs such as blood pressure, heart rate and respiratory rate, and no abnormal and clinically significant vital signs were recorded.\n\nDISCUSSION\n\nLevetiracetam is a broad-spectrum ASM that is recommended as a first-line add-on agent for focal seizures, with a favorable profile of efficacy and safety for both children and adults. It is one of the most-prescribed new-generation ASMs12.\n\nPrevious studies have proven the efficacy and safety of LEV in relation to focal seizures in both adults and children.\n\nIn a systematic review evaluating the use of levetiracetam among children with focal onset seizures, levetiracetam had a mean response rate of 56% occurrence of adverse events, which was comparable to placebo, with a low discontinuation rate13.\n\nIn a meta-analysis that included a total of 3,205 participants (both children and adults), a reduction of 50% from baseline was reported, and the results suggested that patients treated with leveti racetam had a substantially higher responder rate than did those who received placebo (RR = 2.17; 95% CI 1.93-2.43; p = 0.05). Use of 2,000 mg/day showed the best efficacy and safety ratio. There was a 75% reduction in seizures through using LEV, with similar results for doses of 2,000 and 3,000 mg. The safety of LEV was comparable to that of placebo7.\n\nThree pivotal studies have demonstrated that levetiracetam at doses of 1,000-3,000 mg/day is effective as add-on therapy among adults with refractory focal seizures14,15,16. The European Levetiracetam Study Group showed that there was a significant reduction in seizure frequency, of ≥ 50%, in 22.8% and 31.6% of patients in the 1,000 and 2,000 mg groups, respectively, compared to placebo (10.4%), with no significant difference in the incidence of adverse events between the groups14.\n\nIn our study, we explored the efficacy, tolerability and safety profile of LEV in the Brazilian population. We showed that its use gave rise to large reductions of at least 50% in the average number of focal seizures per week in 38.7% of the LEV group and 14.3% of the placebo group, with statistically significance (p = 0.0031), while no significant difference in adverse events was found between the groups. Treatment adherence was above 90% in both groups.\n\nAlthough several studies have shown that levetiracetam as an adjuvant therapy positively influences health-related quality of life13, the present study did not show any statistically significant difference between the groups regarding QOLIE-319 variation. Most likely, this assessment was hampered by the small number of study participants. QOLIE AD-4810 showed differences regarding the impact of epilepsy (p = 0.0255) and the total score (p = 0.0362), which indicated a slight improvement for the placebo group. This result may have been influenced by caregivers’ perceptions regarding participants under the age of 18 years.\n\nIn summary, the findings from this study demonstrate that levetiracetam at doses of 1,000-3,000 mg/day or 60 mg/kg/day (children) is an effective and safe ASM for patients with refractory focal epilepsy, both among Brazilian children over 4 years old and among adults.\n\nACKNOWLEDGEMENTS\n\nTo Fernanda Tizzot, Angelica Richart Csipak, Grace Chinen Higa, Jessica Lorenzo Abreu, Talita Poli Biason, Mario Luiz Bochembuzio and Thais Cuperman-Pohl, for contributing to the development and conduction of this study.\n==== Refs\nReferences\n\n1 1. Lyseng-Williamson KA. Spotlight on levetiracetam in epilepsy. CNS Drugs. 2011 Oct;25(10):901-5. https://doi.org/10.2165/11208340-000000000-00000\nLyseng-Williamson KA Spotlight on levetiracetam in epilepsy CNS Drugs 10 2011 25 10 901 905 10.2165/11208340-000000000-00000 21936590\n2 2. World Health Organization. Epilepsy: Key facts. 2018. Available in: http://www.who.int/news-room/fact-sheets/detail/epilepsy.\nWorld Health Organization Epilepsy: Key facts 2018 http://www.who.int/news-room/fact-sheets/detail/epilepsy\n3 3. Mbizvo GK, Dixon P, Hutton JL, Marson AG. The adverse effects profile of levetiracetam in epilepsy: a more detailed look. Int J Neurosci. 2014 Sep;124(9):627-34. https://doi.org/10.3109/00207454.2013.866951\nMbizvo GK Dixon P Hutton JL Marson AG The adverse effects profile of levetiracetam in epilepsy: a more detailed look Int J Neurosci 09 2014 124 9 627 634 10.3109/00207454.2013.866951 24256446\n4 4. Engel J Jr. Approaches to refractory epilepsy. Ann Indian Acad Neurol. 2014 Mar;17(Suppl 1):S12-7. https://doi.org/10.4103/0972-2327.128644.\nEngel J Jr Approaches to refractory epilepsy Ann Indian Acad Neurol 03 2014 17 1 S12 S17 10.4103/0972-2327.128644 24791078\n5 5. Mbizvo GK, Dixon P, Hutton JL, Marson AG. Levetiracetam add-on for drug-resistant focal epilepsy: an updated Cochrane Review. Cochrane Database Syst Rev. 2012 Sep;2012(9):CD001901. https://doi.org/10.1002/14651858.CD001901.pub2\nMbizvo GK Dixon P Hutton JL Marson AG Levetiracetam add-on for drug-resistant focal epilepsy: an updated Cochrane Review Cochrane Database Syst Rev 09 2012 2012 9 CD001901 CD001901 10.1002/14651858.CD001901.pub2\n6 6. Huber B, Bömmel W, Hauser I, Horstmann V, Liem S, May T, et al. Efficacy and tolerability of levetiracetam in patients with therapy-resistant epilepsy and learning disabilities. Seizure. 2004 Apr;13(3):168-75. https://doi.org/10.1016/S1059-1311(03)00154-7\nHuber B Bömmel W Hauser I Horstmann V Liem S May T Efficacy and tolerability of levetiracetam in patients with therapy-resistant epilepsy and learning disabilities Seizure 04 2004 13 3 168 175 10.1016/S1059-1311(03)00154-7 15010054\n7 7. Chen D, Bian H, Zhang L. A meta-analysis of levetiracetam for randomized placebo-controlled trials in patients with refractory epilepsy. Neuropsychiatr Dis Treat. 2019 Apr;15:905-917. https://doi.org/10.2147/NDT.S188111\nChen D Bian H Zhang L A meta-analysis of levetiracetam for randomized placebo-controlled trials in patients with refractory epilepsy Neuropsychiatr Dis Treat 04 2019 15 905 917 10.2147/NDT.S188111 31043782\n8 8. Fischer RS, Cross JH, French JA, Higurashi N, Hirsch E, Jansen FE, et al. Operational classification of seizure types by the International League Against Epilepsy: Position Paper of the ILAE Commission for Classification and Terminology. Epilepsia. 2017 Apr;58(4):522-30. https://doi.org/10.1111/epi.13670\nFischer RS Cross JH French JA Higurashi N Hirsch E Jansen FE Operational classification of seizure types by the International League Against Epilepsy: Position Paper of the ILAE Commission for Classification and Terminology Epilepsia 04 2017 58 4 522 530 10.1111/epi.13670 28276060\n9 9. da Silva TI, Ciconelli RM, Alonso NB, Azevedo AM, Westphal-Guitti AC, Pascalicchio TF, et al. Validity and reliability of the Portuguese version of the quality of life in epilepsy inventory (QOLIE-31) for Brazil. Epilepsy Behav. 2007 Mar;10(2):234-41. https://doi.org/10.1016/j.yebeh.2006.08.022\nda Silva TI Ciconelli RM Alonso NB Azevedo AM Westphal-Guitti AC Pascalicchio TF Validity and reliability of the Portuguese version of the quality of life in epilepsy inventory (QOLIE-31) for Brazil Epilepsy Behav 03 2007 10 2 234 241 10.1016/j.yebeh.2006.08.022 17292675\n10 10. Barbosa FD. Versão brasileira do inventario de qualidade de vida para adolescentes com epilepsia \"QOLIE - AD - 48\" [thesis]. Campinas: Universidade Estadual de Campinas, Faculdade de Ciências Médicas; 2007. Available from: http://www.repositorio.unicamp.br/handle/REPOSIP/309061\nBarbosa FD Versão brasileira do inventario de qualidade de vida para adolescentes com epilepsia \"QOLIE - AD - 48\" [thesis] Campinas Universidade Estadual de Campinas, Faculdade de Ciências Médicas 2007 http://www.repositorio.unicamp.br/handle/REPOSIP/309061\n11 11. de Oliveira GN, Kummer A, Salgado JV, Portela EJ, Sousa-Pereira SR, David AS, et al. Brazilian version of the Neurological Disorders Depression Inventory for Epilepsy (NDDI-E). Epilepsy Behav. 2010 Nov;19(3):328-31. https://doi.org/10.1016/j.yebeh.2010.07.013\nde Oliveira GN Kummer A Salgado JV Portela EJ Sousa-Pereira SR David AS Brazilian version of the Neurological Disorders Depression Inventory for Epilepsy (NDDI-E) Epilepsy Behav 11 2010 19 3 328 331 10.1016/j.yebeh.2010.07.013 20729151\n12 12. Cao Y, He X, Zhao L, He Y, Wang S, Zhang T, et al. Efficacy and safety of Levetiracetam as adjunctive treatment in children with focal onset seizures: A systematic review and meta-analysis. Epilepsy Res. 2019 Jul;153:40-8. https://doi.org/10.1016/j.eplepsyres.2019.04.001\nCao Y He X Zhao L He Y Wang S Zhang T Efficacy and safety of Levetiracetam as adjunctive treatment in children with focal onset seizures: A systematic review and meta-analysis Epilepsy Res 07 2019 153 40 48 10.1016/j.eplepsyres.2019.04.001 30965274\n13 13. López-Góngora M, Martínez-Domeño A, García C, Escartín A. Effect of levetiracetam on cognitive functions and quality of life: a one-year follow-up study. Epileptic Disord. 2008 Dec;10(4):297-305. https://doi.org/10.1684/epd.2008.0227.\nLópez-Góngora M Martínez-Domeño A García C Escartín A Effect of levetiracetam on cognitive functions and quality of life: a one-year follow-up study Epileptic Disord. 12 2008 10 4 297 305 10.1684/epd.2008.0227 19017572\n14 14. Shorvon SD, Löwenthal A, Janz D, Bielen E, Loiseau P. Multicenter double-blind, randomized, placebo-controlled trial of levetiracetam as add-on therapy in patients with refractory partial seizures. Epilepsia. 2000 Sep;41(9):1179-86. https://doi.org/10.1111/j.1528-1157.2000.tb00323.x.\nShorvon SD Löwenthal A Janz D Bielen E Loiseau P Multicenter double-blind, randomized, placebo-controlled trial of levetiracetam as add-on therapy in patients with refractory partial seizures Epilepsia 09 2000 41 9 1179 1186 10.1111/j.1528-1157.2000.tb00323.x 10999557\n15 15. Cereghino JJ, Biton V, Abou-Khalil B, Dreifuss F, Gauer LJ, Leppik I. Levetiracetam for partial seizures: results of a double-blind, randomized clinical trial. Neurology. 2000 Jul;55(2):236-42. https://doi.org/10.1212/wnl.55.2.236\nCereghino JJ Biton V Abou-Khalil B Dreifuss F Gauer LJ Leppik I Levetiracetam for partial seizures: results of a double-blind, randomized clinical trial Neurology 07 2000 55 2 236 242 10.1212/wnl.55.2.236 10908898\n16 16. Ben-Menachem E, Falter U. Efficacy and tolerability of levetiracetam 3000 mg in patients with refractory partial seizures: a multicenter, double-blind, responder-selected study evaluating monotherapy. Epilepsia. 2000 Oct;41(10):1276-83. https://doi.org/10.1111/j.1528-1157.2000.tb04605.x\nBen-Menachem E Falter U Efficacy and tolerability of levetiracetam 3000 mg in patients with refractory partial seizures: a multicenter, double-blind, responder-selected study evaluating monotherapy Epilepsia 10 2000 41 10 1276 1283 10.1111/j.1528-1157.2000.tb04605.x 11051122\n\n",
"fulltext_license": "CC BY",
"issn_linking": "0004-282X",
"issue": "79(4)",
"journal": "Arquivos de neuro-psiquiatria",
"keywords": null,
"medline_ta": "Arq Neuropsiquiatr",
"mesh_terms": "D000328:Adult; D000927:Anticonvulsants; D002648:Child; D004311:Double-Blind Method; D000069279:Drug Resistant Epilepsy; D004359:Drug Therapy, Combination; D004828:Epilepsies, Partial; D006801:Humans; D000077287:Levetiracetam; D011788:Quality of Life; D016896:Treatment Outcome",
"nlm_unique_id": "0125444",
"other_id": null,
"pages": "290-298",
"pmc": null,
"pmid": "34133509",
"pubdate": "2021-04",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial",
"references": null,
"title": "Efficacy and safety of levetiracetam as adjunctive therapy for refractory focal epilepsy.",
"title_normalized": "efficacy and safety of levetiracetam as adjunctive therapy for refractory focal epilepsy"
} | [
{
"companynumb": "BR-UCBSA-2021033739",
"fulfillexpeditecriteria": "1",
"occurcountry": "BR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEVETIRACETAM"
},
"drugadditional": "3",
... |
{
"abstract": "We report a case of phaeohyphomycosis caused by Alternaria infectoria in a 61-year-old heart transplant recipient with multiple skin lesions and pulmonary infiltrates. The infection spread via the haematogenous route from the primary cutaneous lesions into the lungs. The diagnosis was based on the histopathological examination, direct microscopy, skin lesion cultures and detection of Alternaria DNA in the bronchoalveolar lavage fluid using molecular methods. The treatment consisted of a combination of surgical excision and systemic antifungal therapy. Voriconazole was the first agent used but had a weak effect. Posaconazole was subsequently used to achieve a successful response. The isolate was identified as A. infectoria by sequencing of the rDNA ITS region and the partial β-tubulin gene.",
"affiliations": "Laboratory of Medical Mycology, Department of Parasitology, Mycology and Mycobacteriology Prague, Public Health Institute in Usti nad Labem, Sokolovska 60, 186 00, Prague 8, Czech Republic. pavlina.lyskova@zuusti.cz.;Department of Cardiology, Institute for Clinical and Experimental Medicine, Videnska 1958, 140 21, Prague 4, Czech Republic.;Department of Botany, Faculty of Science, Charles University in Prague, Benatska 2, 128 01, Prague 2, Czech Republic.;Department of Pathology, Institute for Clinical and Experimental Medicine, Videnska 1958, 140 21, Prague 4, Czech Republic.;Department of Pathology, Institute for Clinical and Experimental Medicine, Videnska 1958, 140 21, Prague 4, Czech Republic.;Department of Diagnostic and Interventional Radiology, Institute for Clinical and Experimental Medicine, Videnska 1958, 140 21, Prague 4, Czech Republic.;Department of Botany, Faculty of Science, Charles University in Prague, Benatska 2, 128 01, Prague 2, Czech Republic.;Department of Microbiology, Faculty of Medicine and Dentistry, Palacky University, Olomouc, Hnevotinska 3, 775 15, Olomouc, Czech Republic.;Department of Respiratory Medicine, Thomayer Hospital, 1st Medical School and Charles University, Prague Videnska 800, 140 59, Prague 4, Czech Republic.",
"authors": "Lyskova|Pavlina|P|http://orcid.org/0000-0002-3131-5924;Kubanek|Milos|M|;Hubka|Vit|V|;Sticova|Eva|E|;Voska|Ludek|L|;Kautznerova|Dana|D|;Kolarik|Miroslav|M|;Hamal|Petr|P|;Vasakova|Martina|M|",
"chemical_list": "D000935:Antifungal Agents; D004271:DNA, Fungal; D021903:DNA, Ribosomal Spacer; D014230:Triazoles; D014404:Tubulin; C101425:posaconazole",
"country": "Netherlands",
"delete": false,
"doi": "10.1007/s11046-016-0094-4",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0301-486X",
"issue": "182(3-4)",
"journal": "Mycopathologia",
"keywords": "Alternariosis; Heart transplantation; Phaeohyphomycosis; Pulmonary infection",
"medline_ta": "Mycopathologia",
"mesh_terms": "D000528:Alternaria; D000935:Antifungal Agents; D004271:DNA, Fungal; D021903:DNA, Ribosomal Spacer; D003646:Debridement; D003881:Dermatomycoses; D016027:Heart Transplantation; D006651:Histocytochemistry; D006801:Humans; D008172:Lung Diseases, Fungal; D008297:Male; D008853:Microscopy; D008875:Middle Aged; D060446:Phaeohyphomycosis; D017422:Sequence Analysis, DNA; D066027:Transplant Recipients; D016896:Treatment Outcome; D014230:Triazoles; D014404:Tubulin",
"nlm_unique_id": "7505689",
"other_id": null,
"pages": "297-303",
"pmc": null,
"pmid": "27866319",
"pubdate": "2017-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "22142219;23714342;12201372;23687125;26951037;18337384;23381982;17136699;20002611;15003897;24440281;25592669;24628809;20846592;24014900;20569383;24483780;11326020;19336452;18815820;24951723;11797173;22871097;22771424;21299373;24112410;20930077;20594890;25750855;20218877;21921077;19594865;22247442;19158282;19501664;25908651;18727797",
"title": "Successful Posaconazole Therapy of Disseminated Alternariosis due to Alternaria infectoria in a Heart Transplant Recipient.",
"title_normalized": "successful posaconazole therapy of disseminated alternariosis due to alternaria infectoria in a heart transplant recipient"
} | [
{
"companynumb": "CZ-TEVA-2018-CZ-909384",
"fulfillexpeditecriteria": "1",
"occurcountry": "CZ",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "MYCOPHENOLATE MOFETIL"
},
"drugadditional": "1",... |
{
"abstract": "Background: Muscle spasticity is a common sequela of spinal cord injury (SCI) that may impact daily function. Spasticity dynamically varies and is an important physiologic response to illness or other stressors. The challenge for the general practitioner is in recognizing, treating, and developing an effective plan focused on the patient's individual goals. Objective: To provide the general practitioner with a basic contextual, diagnostic, and therapeutic approach to spasticity management for individuals with neurologic injury such as SCI. Discussion: Muscle spasticity can be disabling and can be managed effectively by using a comprehensive approach. We discuss a representative case and the assessment and planning for individuals with SCI and spasticity. Through an understanding of pathophysiology, careful history taking, and physical exam, a cause for increased spasticity can be identified, such as infection, constipation, or pregnancy. Symptomatology of these triggers is often quite different in the SCI population than in the general population. Management includes the treatment of this causative stressor as well as the thoughtful management of spasticity itself. Conclusion: Muscle spasticity is dynamic and requires a patient-centered approach. The general practitioner can play a key role in recognizing and treating spasticity in an individual with SCI. Comprehensive management to meet patient and caregiver goals involves primary care providers, specialists, and allied health practitioners.",
"affiliations": "International Center for Spinal Cord Injury, Kennedy Krieger Institute, Baltimore, Maryland.;The Centre for Family Medicine Family Health Team, Kitchener, Ontario.;Rancho Los Amigos National Rehabilitation Center, Downey, California.;Carolinas Rehabilitation, Charlotte, North Carolina.",
"authors": "Cabahug|Philippines|P|;Pickard|Charles|C|;Edmiston|Travis|T|;Lieberman|Jesse A|JA|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.46292/sci2603-157",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1082-0744",
"issue": "26(3)",
"journal": "Topics in spinal cord injury rehabilitation",
"keywords": "myelopathy; neurorehabilitation; paralysis; primary care; spasticity; spinal cord injury",
"medline_ta": "Top Spinal Cord Inj Rehabil",
"mesh_terms": "D006801:Humans; D009128:Muscle Spasticity; D010808:Physical Examination; D011320:Primary Health Care; D013119:Spinal Cord Injuries",
"nlm_unique_id": "9515174",
"other_id": null,
"pages": "157-165",
"pmc": null,
"pmid": "33192042",
"pubdate": "2020",
"publication_types": "D016428:Journal Article",
"references": "30626507;24860447;31333064;15838527;27780743;9826984;20927008;17043680;19723923;27282329;10084445;23186904;19894005;29339776;15037862;30626519;17637764;22562332;29428347;22464657;30725362;29432722;20434606;27618974;24090290;29449241;15799140",
"title": "A Primary Care Provider's Guide to Spasticity Management in Spinal Cord Injury.",
"title_normalized": "a primary care provider s guide to spasticity management in spinal cord injury"
} | [
{
"companynumb": "US-ROCHE-2806410",
"fulfillexpeditecriteria": "1",
"occurcountry": null,
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DIAZEPAM"
},
"drugadditional": "3",
"drugadm... |
{
"abstract": "Blood dyscrasias associated with levetiracetam use can be difficult to identify, especially when other potential differential diagnoses are concurrently present. Here we present a 57-year-old man with metastatic adenocarcinoma of unknown primary origin on levetiracetam who initially presented with an in-stent thrombosis of the right external iliac vein and then developed worsening thrombocytopenia followed by pancytopenia. Levetiracetam was not identified as the culprit until other causes like platelet consumption, heparin-induced thrombocytopenia, idiopathic immune thrombocytopenic purpura, and bone marrow involvement by metastatic disease were ruled out.\nLevetiracetam can cause both acute and delayed-onset pancytopenia through bone marrow suppression.The phenomenon is normally reversible and blood counts improve with drug cessation.Clinicians should consider checking a complete blood profile within a month of drug initiation, particularly in high-risk patients.",
"affiliations": "Internal Medicine, Rochester General Hospital, Rochester, New York, USA.;Internal Medicine, Rochester General Hospital, Rochester, New York, USA.;Hematology/Oncology, Rochester General Hospital, Rochester, New York, USA.",
"authors": "Ammad Ud Din|Mohammad|M|;Ather Hussain|Syed|S|;Bodrog|Amy|A|",
"chemical_list": null,
"country": "Italy",
"delete": false,
"doi": "10.12890/2021_002449",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2284-2594",
"issue": "8(3)",
"journal": "European journal of case reports in internal medicine",
"keywords": "Drug-induced-pancytopenia; anti-epileptics; hematology; levetiracetam; thrombocytopenia",
"medline_ta": "Eur J Case Rep Intern Med",
"mesh_terms": null,
"nlm_unique_id": "101648453",
"other_id": null,
"pages": "002449",
"pmc": null,
"pmid": "33869106",
"pubdate": "2021",
"publication_types": "D016428:Journal Article",
"references": "19813778;19417118;29899787;27927707;26744695;28202425;21078583;15230717;20221962;21204814;22270796;33099358;18424076",
"title": "Delayed Recognition of Levetiracetam-induced Pancytopenia.",
"title_normalized": "delayed recognition of levetiracetam induced pancytopenia"
} | [
{
"companynumb": "US-UCBSA-2021020355",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "LEVETIRACETAM"
},
"drugadditional": "1",
... |
{
"abstract": "OBJECTIVE\nKidney transplantation is the best option for patients with end-stage renal disease (ESRD) failure. Prolonged use of immunosuppressive drugs often causes opportunistic infections and malignancies of skin and mucosae, but due to lack of a careful dermatological screening in several transplantation centers the diagnosis and the treatment of dermatological lesions in kidney transplant patients are underestimated. In addition after the introduction of interleukin (IL)-2 -receptor antagonists (basiliximab/daclizumab), mTOR inhibitors and mycophenolate mofetil (MMF)/mycophenolic acid (MPA) in new immunosuppressive protocols only a few studies have analyzed the skin and mucosal lesions in kidney transplant patients. This study was undertaken to evaluate the cutaneous and mucosal diseases after kidney transplantation, and to investigate the association between these and different immunosuppressive protocols and/or demographic features.\n\n\nMETHODS\nA retrospective analysis was done using medical records of kidney transplantation between 2000 and 2009 at the Transplant Unit of Fondazione IRCCS Policlinico San Matteo, Pavia, Italy. The study included 183 patients (M 57.3%, F 42.7%) aged 51.5 ± 11.8 yr) with transplant age 52.3 ± 34.9 months. Induction therapy was basiliximab and steroids based; maintenance therapy included combination-regimes from cyclosporine, tacrolimus, steroids, mycophenolate mofetil (MM), mycophenolic acid (MPA), rapamycin, everolimus. Anti-rejection therapy was steroid and/or thymoglobulines based. Diagnosis of cutaneous disease was made through examination of skin, mucous membranes, nails and hair evaluation. Skin biopsies, specific cultures and serological tests were done when required.\n\n\nRESULTS\nSkin and mucosal diseases were reported in 173 (95.7%) of patients; 88 (50.81%) showed viral lesions; 92 (53.01%) immunosuppression-related lesions; 28 (16.39%) benign tumours; 26 (15.3%) precancers /neoplastic lesions; 24 (14.21%) mycosis; 16 (9.29%) cutaneous xerosis, 15 (8.74%) dermatitis, while absence of cutaneous disease was evident only in 8 (4.37%) cases. An association between drug side effects and anti-rejection treatment ( P ≤ 0.01) and/or calcineurin-inhibitors (CNI) exposure ( P ≤ 0.01) was found. Longer exposure to immunosuppressive drugs (>60 months) was associated with pre-malignancy and malignancy lesions.\n\n\nCONCLUSIONS\nCutaneous diseases are frequent in kidney transplanted patients. Continuous skin monitoring is necessary to make an early diagnosis and to start appropriate treatment.",
"affiliations": "Dermatology Unit, University and Fondazione IRCCS Policlinico San Matteo, Pavia, Italy. michelacastello@gmail.com",
"authors": "Castello|Michela|M|;Gregorini|Marilena|M|;Rampino|Teresa|T|;Bosio|Francesca|F|;Bedino|Giulia|G|;Piotti|Giovanni|G|;Soccio|Grazia|G|;Esposito|Pasquale|P|;Klersy|Catherine|C|;Abelli|Massimo|M|;Borroni|Giovanni|G|;Dal Canton|Antonio|A|",
"chemical_list": "D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; D007074:Immunoglobulin G; D007166:Immunosuppressive Agents; D011993:Recombinant Fusion Proteins; D000077552:Basiliximab; D000077561:Daclizumab; D058570:TOR Serine-Threonine Kinases; D009173:Mycophenolic Acid",
"country": "India",
"delete": false,
"doi": null,
"fulltext": "\n==== Front\nIndian J Med ResIndian J. Med. ResIJMRThe Indian Journal of Medical Research0971-59160975-9174Medknow Publications & Media Pvt Ltd India 23852300IJMR-137-1188Original ArticleA retrospective analysis of dermatological lesions in kidney transplant patients Castello Michela *Gregorini Marilena 1*Rampino Teresa 1Bosio Francesca 1Bedino Giulia 1Piotti Giovanni 1Soccio Grazia 1Esposito Pasquale 1Klersy Catherine 2Abelli Massimo 3Borroni Giovanni Canton Antonio Dal 1Dermatology Unit, University and Fondazione IRCCS Policlinico San Matteo, Pavia, Italy1 Nephrology, Dialysis & Transplantation Unit, University & Fondazione IRCCS Policlinico San Matteo, Pavia, Italy2 Biometry & Statistics Unit, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy3 Surgery Unit, University & Fondazione IRCCS Policlinico San Matteo, Pavia, ItalyReprint requests: Dr Michela Castello, Dermatology Unit, Fondazione IRCCS Policlinico San Matteo, Piazzale Golgi 2, 27100, Pavia, Italy e-mail: michelacastello@gmail.com* Michela Castello and Marilena Gregorini equally contributed to this paper\n\n6 2013 137 6 1188 1192 03 11 2011 Copyright: © The Indian Journal of Medical Research2013This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Background & objectives:\nKidney transplantation is the best option for patients with end-stage renal disease (ESRD) failure. Prolonged use of immunosuppressive drugs often causes opportunistic infections and malignancies of skin and mucosae, but due to lack of a careful dermatological screening in several transplantation centers the diagnosis and the treatment of dermatological lesions in kidney transplant patients are underestimated. In addition after the introduction of interleukin (IL)-2 -receptor antagonists (basiliximab/daclizumab), mTOR inhibitors and mycophenolate mofetil (MMF)/mycophenolic acid (MPA) in new immunosuppressive protocols only a few studies have analyzed the skin and mucosal lesions in kidney transplant patients. This study was undertaken to evaluate the cutaneous and mucosal diseases after kidney transplantation, and to investigate the association between these and different immunosuppressive protocols and/or demographic features.\n\nMethods:\nA retrospective analysis was done using medical records of kidney transplantation between 2000 and 2009 at the Transplant Unit of Fondazione IRCCS Policlinico San Matteo, Pavia, Italy. The study included 183 patients (M 57.3%, F 42.7%) aged 51.5±11.8 yr) with transplant age 52.3±34.9 months. Induction therapy was basiliximab and steroids based; maintenance therapy included combination-regimes from cyclosporine, tacrolimus, steroids, mycophenolate mofetil (MM), mycophenolic acid (MPA), rapamycin, everolimus. Anti-rejection therapy was steroid and/or thymoglobulines based. Diagnosis of cutaneous disease was made through examination of skin, mucous membranes, nails and hair evaluation. Skin biopsies, specific cultures and serological tests were done when required.\n\nResults:\nSkin and mucosal diseases were reported in 173 (95.7%) of patients; 88 (50.81%) showed viral lesions; 92 (53.01%) immunosuppression-related lesions; 28 (16.39%) benign tumours; 26 (15.3%) precancers /neoplastic lesions; 24 (14.21%) mycosis; 16 (9.29%) cutaneous xerosis, 15 (8.74%) dermatitis, while absence of cutaneous disease was evident only in 8 (4.37%) cases. An association between drug side effects and anti-rejection treatment (P≤0.01) and/or calcineurin-inhibitors (CNI) exposure (P≤0.01) was found. Longer exposure to immunosuppressive drugs (>60 months) was associated with pre-malignancy and malignancy lesions.\n\nInterpretation & conclusions:\nCutaneous diseases are frequent in kidney transplanted patients. Continuous skin monitoring is necessary to make an early diagnosis and to start appropriate treatment.\n\nAnti-rejection treatmentbenign tumourend-stage renal diseaseimmunosuppressionkidney transplantskin lesions\n==== Body\nKidney transplantation is the standard form of treatment for patients with end-stage renal failure disease (ESRD). Immunosuppressive treatment, however, elicits the risk of complications, as cutaneous and mucosal diseases1. The diagnosis and treatment of dermatological lesions may be underestimated, because of the absence of dermatologists working in touch with several Transplant Units and/or the lack of a careful dermatological screening in several Transplantation Centers. The frequency of skin and mucosal lesions in kidney transplant patients has been evaluated by a limited number of studies. In addition, a few studies have been carried out after the introduction of basiliximab in induction therapy and after the use of mTOR (mammation target of rapamycin) inhibitors and mycophenolate mofetil (MMF)/mycophenolic acid (MPA) in new immunosuppressive protocols234.\n\nSkin cancer has been a cause of concern after kidney transplantation, despite a wide spectrum of non tumoural skin and mucosal diseases affecting these patients5678. The aim of this study was to evaluate all mucosal and cutaneous diseases found in kidney transplant patients treated with anti-interleukin-2 (IL-2) receptor monoclonal antibody basiliximab, mTOR inhibitors, calcineurin inhibitors (CNI), antimetabolites such as MMF/MPA, and steroids, and to investigate whether the mucosal and cutaneous diseases were associated with specific immunosuppressive drugs and/or demographic features.\n\nMaterial & Methods\nAll kidney transplant patients who underwent regular clinical follow up visits between January 1, 2000 and January 1, 2010 at Transplantation Center of Policlinico San Matteo, Pavia, Italy, were included in the study. Written informed consent was obtained from each patient and the study protocol was approved by the local ethical committee.\n\nA total of 183 patients were enrolled. They were seen regularly every 3 months at the renal transplant outpatient clinic and every 6 months a dermatologic examination, including skin, mucous membranes, nails and hair analysis was done. Dermoscopic evaluation of pigmented lesions and, when necessary, serologic, cultural and histological evaluation were done.\n\nDetailed clinical records were available for all patients. For each patient the following information was recorded: age, sex, transplant date, transplant age (i.e. time after transplantation), type of immunosuppressive therapy, rejection episodes, anti-rejection treatment, aetiology of end stage renal disease (ESRD), a detailed history of skin lesions and physical examination findings. Muco-cutaneous lesions were classified in eight groups: (i) viral lesions, (ii) mycotic lesions, (iii) drug side effects (DSE), (iv) xerosis, (v) dermatitis, (vi), precancer / neoplastic lesions (PN/N), (vii) benign lesions, and (viii) pigmentary disorders.\n\nAll patients were treated with the following immunosuppressive regimen:\n\n(i) induction therapy: IL- 2 receptor antagonist (Simulect) (Novartis; Basel, CH) or anti-thymocyte immunoglobulins (Genzyme, Cambridge, MA, USA), methylprednisolone.\n\n(ii) long-term maintenance therapy: combination of MMF 1.5-2 g per day or MPA (0.720-1.440 g per day), cyclosporine (3-9 mg/kg per day), tacrolimus (0.15-0.30 mg/kg per day), sirolimus (trough level 10-15 ng/ml per day) or everolimus (trough level 5-8 ng/ml per day).\n\nAcute rejection was usually treated with pulse therapy with methylprednisolone (0.5-1 g per day for 3 days) and corticosteroid resistant acute rejection or vascular rejection was treated with anti-thymocyte immunoglobulins.\n\nStatistical analysis: All data were expressed as mean and standard deviation for normally distributed variables and as median and percentiles (25 and 75) for not normally distributed variables. Frequencies were expressed as percentage. To assess the relationship between data Fisher's exact test was used. For variables with skewed distribution, non-parametric test was used (Mann-Whitney U-test). Statistical analysis was performed using stata version software (StataCorp LP, College Station, Texas, USA).\n\nResults & Discussion\nA total of 183 consecutive renal transplant patients were studied. Mean age was 51.5±11.8 yr. There was a male predominance (57.38%). Median transplant age was 49 months (range 3-230 months). A majority (42.08%) of patients had transplant age between 25 and 60 months. The main cause of renal failure was chronic glomerulonephritis (23.5%), followed by polycystic kidney (21.86%), reflux nephropathy (9.29%), nephroangiosclerosis (8.2%), genetic nephropathies (5.46%), and systemic lupus erythematous (1.64%). In our population, 20.22 per cent had chronic renal failure of uncertain origin. Diabetes, vasculitis, amyloidosis, drug nephrotoxicity, thrombotic microangiopathy and kidney stones were included in the miscellaneous group.\n\nAmong 183 patients studied, 132 (76.7%) never had acute rejection episodes, 31 (18%) had at least one rejection episode and nine (5.23%) had more than one. 11 (6.3%) had a subclinical rejection. The acute rejection in 24 patients (13.11%) was treated with thymoglobulines and in 37 patients (20.2%) with steroid pulses.\n\nSpectrum of dermatology-mucous membranes diseases: Our retrospective analysis revealed that only six patients (4.3%) had no dermatological involvement, neither inflammatory nor neoplastic. The reported muco-cutaneous lesions were: (i) viral lesions: warts, herpes simplex 1 and 2, herpes zooster and genital warts; (ii) mycotic lesions: dermatophytosis and onychomycosis; (iii) drug side effects: telangectases, acne, sebaceous hyperplasia, gingival hyperplasia, hypertrichosis, aphthae, ecchymosis and folliculitis; (iv) dermatitides: allergic dermatitis, eczema, seborrhoeic dermatitis, psoriasis; (v) xerosis; (vi) precancer/neoplasia: actinic keratoses, dysplastic naevi, basal cell carcinomas, melanoma; and (vii) benign lesions: seborrhoeic keratosis and onycodystrophy.\n\nNinety nine patients (54.1%) presented with more than one kind of cutaneous lesions; two lesions were observed in 40 patients (i.e. folliculitis and xerosis), three in 29 cases, four in 17 patients and more than four in 13 cases.\n\nThe most common lesion was drug side effects and was present in 92 (DSE, 53.01%), patients; followed by viral lesions 88 (50.81%), benign tumours 28 (16.39%), pre-malignant or malignant lesions 26 (15.3%), mycosis 24 (14.21%), xerosis 16 (9.29%) and dermatitis 15 (8.74%). Among DSE, folliculitis was the most frequent disease, being 30.91% (30 cases), followed by gingival hyperplasia reported in 29 (30.00%) patients; oral aphtae in 12 (12.33%) cases; telangectases in 9 patients (9.28%); acne in 8 cases (8.24%) and hypertrichosis in four patients (4.13%). Only three patients had ecchymosis and two had sebaceous hyperplasia.\n\nViral lesions due to Herpes Simplex 1 and 2 were the most frequent and were found in 47 patients (51% viral lesions); Herpes Zoster lesions in 27 (29%) patients (Fig.); warts in 16 patients (17%); genital and perianal warts in three cases (3%).\n\nFig. Some of most frequent skin lesions seen in kidney transplant patients: (A) Herpes Zoster; (B) folliculitis; (C) Herpes Simplex; (D) hyperthricosis.\n\nSeborrhoeic keratosis was the most common benign lesion observed (24 cases), while onycodystrophy was reported in six patients.\n\nPrecancer and neoplastic lesions were reported in 15.3 per cent of patients: dysplastic naevi in 15 cases, non melanoma skin cancer in 15 and one case of melanoma. No case of squamous cell carcinoma was diagnosed. Diagnosis of cutaneous mycosis was reported in 25 patients, while there was only one case of onycomycosis. Skin xerosis was reported in 17 patients. Seborrhoeic dermatitis was the most frequent lesion reported in the group of dermatitides with seven cases, followed by eczema in six cases, psoriasis in five and in one case allergic dermatitis.\n\nAssociation between muco-cutaneous diseases and immunosuppressive treatments: An association between DSE and anti-rejection treatment (P≤0.01) and/or calcineurin-inhibitors (CNI) exposure (P≤0.01) was found. Longer exposure to immunosuppressive drugs (> 60 months) was associated with pre-cancerous and cancerous lesions (P≤0.003). However, no association was found between thymoglobulin treatment and/or pulse steroid treatment and precancer and malignant diseases. The Table summarizes the significant associations found between single muco-cutaneous lesions and the immunosuppressive drugs or demographic features.\n\nTable. Significant associations between micro-cutaneous lesions and immunosuppressive treatment\n\nOnly 8 (4.3%) patients had a normal skin, confirming the importance of a dermatological examination in renal transplant patient which should be part of the post-transplant programme for a prompt and correct diagnosis. The Fig. shows some of the most frequent skin diseases: vesicles of herpes zoster, papules and pustules of folliculitis, Herpes Simplex papules and vesicles and hyperthricosis.\n\nIn our study the prevalent lesions resulted in DSE which were significantly related with transplant age. CNI and anti-rejection treatment were associated with a higher risk of developing DSE. A longer duration of immunosuppressive treatment and higher doses of anti-rejection drugs increase the risk of developing DSE. The DSE included common cosmetic lesions such as acneiform eruptions, hypertrichosis, gingival hyperplasia, and folliculitis. Moloney et al1 demonstrated that cosmetic skin problems had most impact on quality of life than a history of skin cancer. This might contribute to the poor compliance with immunosuppressant regimens which is a major cause of graft failure9. Acne and folliculitis, very frequently observed in our study (39.1%), were related to sirolimus-based immunosuppressive regimen. In literature, the frequency of acne related to sirolimus, has been reported between 15 and 25 per cent10. A French study described acne in 45 per cent of renal transplant recipients, erupting soon, mainly in men. These authors proposed that the role of sirolimus in the pathogenesis of acne might be due to direct toxic effect on follicles or to a toxic modification of sebum.\n\nOur results agree with the studies performed in Caucasic race2, but not with Indian and Latin-American which show a high prevalence of skin infections, but probably this difference is justified by different climatic and health-social conditions341114. Viral lesions, the second most frequent, were manifested more often in the first two years. We suppose that the immunosuppressive regimen, including basiliximab and MMF/MPA15, and our choice to not use a cytomegalovirus (CMV) prophylactic treatment, may justify this high prevalence, because it is known that CMV can reactivate Herper Simplex or Zoster (HSV or HZV) infection16. According to this hypothesis, a higher incidence of HZV infection was found, within the first four years after transplantation171819, because the patients were treated with antiviral treatment which postponed the acquisition of immunologic memory. A low occurrence of non-melanoma skin cancer was found in our patient population, may be because of periodical dermatologic screening and education about sun exposure. Moreover our patients live at latitude with a lower risk of skin cancer compared to other populations6202122232425. Finally, the follow up of our study (median 5 years) was short to see neoplastic degeneration.\n\nIn conclusion, our study demonstrated the importance of a careful dermatological screening and follow up, associated with an appropriate education in kidney transplant recipients in reducing muco-cutaneous complications.\n==== Refs\n1 Moloney FJ Keane S O’Kelly P Conlon PJ Murphy GM The impact of skin disease following renal transplantation on quality of life Br J Dermatol 2005 153 574 8 16120145 \n2 Formicone F Fargnoli MC Pisani F Rascente M Famulari A Peris K Cutaneous manifestations in Italian kidney transplant recipients Transplant Proc 2005 37 2527 8 16182734 \n3 Prakash J Singh S Prashant GK Kar B Tripathi K Singh PB Mucocutaneous lesions in transplant recipient in tropical country Transplant Proc 2004 36 2162 4 15518786 \n4 Sandoval M Ortiz M Diaz C Majerson D Molgò M Cutaneous manifestation in renal transplant recipients of Santiago, Chile Transplant Proc 2009 41 3752 4 19917380 \n5 Barba A Tessari G Boschiero L Chieregato GC Renal transplantation and skin disease: review of the literature and results of a 5-years follow-up of 285 patients Nephron 1996 73 131 6 8773333 \n6 Strumia R Perini L Tarroni G Fiocchi O Gilli P Skin lesions in kidney transplant recipients Nephron 1992 62 137 41 1331833 \n7 Rascente M Pisani F Barletta A D’Angelo M Giammaria A Parzanese I Malignancies after kidney transplantation Transplant Proc 2005 37 2529 31 16182735 \n8 Ramsay HM Fryer AA Hawley CM Smith AG Harden PN Non-melonoma skin cancer risk in the Queensland renal transplant population Br J Dermatol 2002 147 950 6 12410706 \n9 Didlake RH Dreyfus K Kerman RH Van Buren CT Kahan BD Patient noncompliance: a major cause of late graft failure in cyclosporine-treated renal transplants Transplant Proc 1988 20 63 9 3291299 \n10 Kahan BD Efficacy of sirolimus compared with azathioprin for reduction of acute renal allograft rejection: a randomized multicenter study. The Rapamune US study group Lancet 2000 356 194 202 10963197 \n11 Mahè E Morelon E Lechaton S Drappier JC de Prost Y Kreis H Acne in recipients of renal transplantation treated with sirolimus: clinical, microbiological, histologic, therapeutic and pathogenica aspects J Am Acad Dermatol 2006 55 139 42 16781309 \n12 George L John GT Jacob CK Eapen P Pulimood S George R Skin lesions in renal transplant recipients: a single center analysis Indian J Dermatol Venereol Leprol 2009 75 255 61 19439877 \n13 Grimaldi A Barletta A Rascente M Pisani F Iaria G Maccarone D Infectious complications in the renal transplant recipient Transplant Proc 2005 37 2502 3 16182725 \n14 Chugh KS Sharma SC Singh V Sakhuja V Jha V Gupta KL Spectrum of dermatological lesions in renal allograft recipients in a tropical environment Dermatology 1994 188 108 12 8136535 \n15 Song A Abdala E Bonazzi P Bacchella T Machado M Does mycophenolate mofetil increase the risk of cytomegalovirus infection in solid organ transplant recipients? A mini-review Braz J Infect Dis 2006 10 132 8 16878265 \n16 Fishman JA Infection in solid-organ transplant recipients N Engl J Med 2007 357 2601 14 18094380 \n17 Arness T Pedersen R Dierkhising R Kremers W Patel R Varicella zoster virus-associated disease in adult kidney transplant recipients: incidence and risk-factor analysis Transpl Infect Dis 2008 10 260 8 18086277 \n18 Ritter ML Pirofski L Mycophenolate mofetil: effects on cellular immune subsets, infectious complications, and antimicrobial activity Transpl Infect Dis 2009 4 290 7 19497072 \n19 Lilleri D Zelini P Fornara C Comolli G Revello MG Gerna G Human cytomegalovirus-specific CD4+ and CD8+ T cell responses in primary infection of the immunocompetent and the immunocompromised host Clin Immunol 2009 131 395 403 19268633 \n20 Gallagher MP Kelly PJ Jardine M Perkovic V Cass A Craig JC Long-term cancer risk of immunosuppressive regimens after kidney transplantation J Am Soc Nephrol 2010 21 852 8 20431040 \n21 Moyal DD Fourtanier AM Broad-spectrum sunscreens provide better protection from solar ultraviolet-simulated radiation and natural sunlight-induced immunosuppression in human being J Am Acad Dermatol 2008 58 149 54 18158925 \n22 Urwin HR Jones PW Hander PN Ramsay HM Hawley CM Nicol DL Predicting risk of Nonmelanoma skin cancer and premalignant skin lesions in renal transplant recipients Transplantation 2009 87 1667 71 19502958 \n23 Tessari G Naldi L Boschiero L Nacchia F Fior F Forni A Incidence and clinical predictors of a subsequent nonmelanoma skin cancer in solid organ transplant recipients with a first nonmelanoma skin cancer Arch Dermatol 2010 146 294 9 20231501 \n24 Bordea C Wojnarowska F Millard PR Doll H Welsh K Morris PJ Skin cancers in renal-transplant recipients occur more frequently than previously recognized in a temperate climate Transplantation 2004 77 574 9 15084938 \n25 Naldi L Belloni Fortina A Lovati S Barba A Gotti E Risk of non-melanoma skin cancer in italian organo transplant recipients. A registry-based study Transplantation 2000 70 1479 84 11118094\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "0971-5916",
"issue": "137(6)",
"journal": "The Indian journal of medical research",
"keywords": null,
"medline_ta": "Indian J Med Res",
"mesh_terms": "D000328:Adult; D000368:Aged; D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; D000077552:Basiliximab; D000077561:Daclizumab; D005260:Female; D006084:Graft Rejection; D006801:Humans; D007074:Immunoglobulin G; D007165:Immunosuppression Therapy; D007166:Immunosuppressive Agents; D007676:Kidney Failure, Chronic; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D009173:Mycophenolic Acid; D009181:Mycoses; D011993:Recombinant Fusion Proteins; D012189:Retrospective Studies; D012871:Skin Diseases; D058570:TOR Serine-Threonine Kinases; D016896:Treatment Outcome; D014777:Virus Diseases",
"nlm_unique_id": "0374701",
"other_id": null,
"pages": "1188-92",
"pmc": null,
"pmid": "23852300",
"pubdate": "2013-06",
"publication_types": "D016428:Journal Article",
"references": "12410706;15518786;20431040;16182725;11118094;15084938;16781309;1331833;19497072;19917380;19502958;18086277;8773333;10963197;20231501;16878265;8136535;16182735;18094380;19439877;16120145;18410801;19268633;16182734;3291299",
"title": "A retrospective analysis of dermatological lesions in kidney transplant patients.",
"title_normalized": "a retrospective analysis of dermatological lesions in kidney transplant patients"
} | [
{
"companynumb": "NVSC2019IT026851",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "EVEROLIMUS"
},
"drugadditional": "3",
"druga... |
{
"abstract": "COVID-19 can occasionally be associated with cranial nerve involvement, but facial palsy, particularly if bilateral, is exceptional. We here report a patient who presented with severe bilateral facial palsy and evidence of SARS-CoV-2 infection preceded by upper respiratory symptoms. He also had serological evidence of coinfection with Epstein-Barr virus, which could have also played a role in his neurological manifestations. PCR in the cerebrospinal fluid was negative for both EBV and SARS-CoV-2, which suggests an indirect, immune-mediated mechanism rather than direct, viral-induced damage. The patient was treated with prednisone 60 mg/24h with a tapering schedule and had a favorable outcome, with an almost complete recovery in 3 weeks. SARS-CoV-2 adds to the list of infectious agents causative of bilateral facial palsy. Coinfection with SARS-CoV-2 is not rare and should be considered in the differential diagnosis.",
"affiliations": "Neurology Department, Hospital Universitario de Basurto, Bilbao, Spain.;Neurology Department, Hospital Universitario de Basurto, Bilbao, Spain.;Neurology Department, Hospital Universitario de Basurto, Bilbao, Spain.;Neurology Department, Hospital Universitario de Basurto, Bilbao, Spain.;Radiology Department, Hospital Universitario de Basurto, Bilbao, Spain.;Neurology Department, Hospital Universitario de Basurto, Bilbao, Spain.",
"authors": "Cabrera Muras|A|A|;Carmona-Abellán|M M|MM|;Collía Fernández|A|A|;Uterga Valiente|J M|JM|;Antón Méndez|L|L|;García-Moncó|J C|JC|0000-0003-2556-1288",
"chemical_list": "D000893:Anti-Inflammatory Agents; D011241:Prednisone",
"country": "England",
"delete": false,
"doi": "10.1111/ene.14561",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1351-5101",
"issue": "28(1)",
"journal": "European journal of neurology",
"keywords": "COVID-19; Epstein-Barr virus; SARS-CoV-2 virus; bilateral facial palsy; peripheral facial palsy",
"medline_ta": "Eur J Neurol",
"mesh_terms": "D000893:Anti-Inflammatory Agents; D000086382:COVID-19; D020031:Epstein-Barr Virus Infections; D005158:Facial Paralysis; D006801:Humans; D008279:Magnetic Resonance Imaging; D008297:Male; D011241:Prednisone; D020127:Recovery of Function; D012141:Respiratory Tract Infections; D016896:Treatment Outcome; D055815:Young Adult",
"nlm_unique_id": "9506311",
"other_id": null,
"pages": "358-360",
"pmc": null,
"pmid": "32997868",
"pubdate": "2021-01",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Bilateral facial nerve palsy associated with COVID-19 and Epstein-Barr virus co-infection.",
"title_normalized": "bilateral facial nerve palsy associated with covid 19 and epstein barr virus co infection"
} | [
{
"companynumb": "ES-GYP-000011",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "1",
"drugadmi... |
{
"abstract": "The prevalence and treatment of behavioral and mental illnesses in the adolescent population are increasing, and many of the medications used are continued into adulthood. Increased vigilance is necessary when caring for this population to prevent side effects and drug interactions. In this short communication, we present a case of myocardial infarction in a male likely related to drug interactions between bupropion, erythromycin, and methylphenidate.",
"affiliations": "Department of Medicine, SUNY Upstate Medical University, Syracuse, New York 13210, USA.",
"authors": "George|Anil K|AK|;Kunwar|Arun R|AR|;Awasthi|Ashish|A|",
"chemical_list": "D000900:Anti-Bacterial Agents; D018687:Antidepressive Agents, Second-Generation; D000697:Central Nervous System Stimulants; D016642:Bupropion; D008774:Methylphenidate; D004917:Erythromycin",
"country": "United States",
"delete": false,
"doi": "10.1089/cap.2005.15.693",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1044-5463",
"issue": "15(4)",
"journal": "Journal of child and adolescent psychopharmacology",
"keywords": null,
"medline_ta": "J Child Adolesc Psychopharmacol",
"mesh_terms": "D000293:Adolescent; D000900:Anti-Bacterial Agents; D018687:Antidepressive Agents, Second-Generation; D016642:Bupropion; D000697:Central Nervous System Stimulants; D004347:Drug Interactions; D004562:Electrocardiography; D004917:Erythromycin; D006801:Humans; D008297:Male; D008774:Methylphenidate; D009203:Myocardial Infarction",
"nlm_unique_id": "9105358",
"other_id": null,
"pages": "693-5",
"pmc": null,
"pmid": "16190800",
"pubdate": "2005-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Acute myocardial infarction in a young male on methylphenidate, bupropion, and erythromycin.",
"title_normalized": "acute myocardial infarction in a young male on methylphenidate bupropion and erythromycin"
} | [
{
"companynumb": "GXKR2005US02075",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHYLPHENIDATE"
},
"drugadditional": "1",
"d... |
{
"abstract": "To determine prognostic factors and overall survival (OS) in therapy-related myeloid neoplasm (t-MN) of patients after receiving peptide receptor radionuclide therapy (PRRT).\n\n\n\nAll patients treated from February 1999 until September 2019 at our center who had bone marrow biopsy-proven t-MN after PRRT were included. Patient characteristics, laboratory results, and all tumor-directed therapies before t-MN diagnosis were collected. Cox regression analysis was performed to identify parameters associated with OS. Receiver operating characteristic (ROC) curve analysis was used to define cutoff values as well as sensitivity and specificity of the parameters.\n\n\n\nOut of 1631 patients treated with PRRT, 30 patients developed t-MN comprising myelodysplastic syndrome (MDS) in 23 patients (77%) and acute myeloid leukemia (AML) in 7 patients (23%). The median OS of t-MN patients was 13 months (range 9.1-16.9 months): 6 months for AML and 15 months for the MDS subgroup, respectively. Higher platelet level was a significant prognostic parameter for longer OS (hazard ratio (HR): 0.99, P < 0.05). Using ROC analysis, the best cutoff value for thrombocyte count was 183.5 Gpt/L, resulting in a sensitivity of 92.3% and a specificity of 50%. Other factors, such as hemoglobin level, did not show a significant correlation with OS.\n\n\n\nEven rarely occurred, the OS is gravely compromised in t-MN patients after PRRT, and even less in the AML subgroup (6 months). Higher platelet value was a significant prognostic parameter for longer OS in t-MN patients.",
"affiliations": "Theranostics Center for Molecular Radiotherapy and Precision Oncology, ENETS Center of Excellence, Zentralklinik Bad Berka, 99437, Bad Berka, Germany. aueng_tw45@hotmail.com.;Theranostics Center for Molecular Radiotherapy and Precision Oncology, ENETS Center of Excellence, Zentralklinik Bad Berka, 99437, Bad Berka, Germany.;Theranostics Center for Molecular Radiotherapy and Precision Oncology, ENETS Center of Excellence, Zentralklinik Bad Berka, 99437, Bad Berka, Germany.",
"authors": "Chantadisai|M|M|http://orcid.org/0000-0003-1691-3958;Kulkarni|H R|HR|;Baum|R P|RP|",
"chemical_list": "D011868:Radioisotopes; D018000:Receptors, Peptide",
"country": "Germany",
"delete": false,
"doi": "10.1007/s00259-020-05127-9",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1619-7070",
"issue": "48(5)",
"journal": "European journal of nuclear medicine and molecular imaging",
"keywords": "Acute myeloid leukemia (AML); Myelodysplastic syndrome (MDS); Overall survival; Peptide receptor radionuclide therapy (PRRT); Prognostic factors; Therapy-related myeloid neoplasm",
"medline_ta": "Eur J Nucl Med Mol Imaging",
"mesh_terms": "D006801:Humans; D015470:Leukemia, Myeloid, Acute; D018358:Neuroendocrine Tumors; D011379:Prognosis; D016016:Proportional Hazards Models; D011868:Radioisotopes; D018000:Receptors, Peptide",
"nlm_unique_id": "101140988",
"other_id": null,
"pages": "1390-1398",
"pmc": null,
"pmid": "33247328",
"pubdate": "2021-05",
"publication_types": "D016428:Journal Article",
"references": "27069254;27621757;24331189;28835720;19336749;27419665;29682195;25273832;28775205;31187162;27353035;30267116;24714208;26932783;22740453;28270344;30271175;24875590;20620439;25578419;30270204;29903756;29477250",
"title": "Therapy-related myeloid neoplasm after peptide receptor radionuclide therapy (PRRT) in 1631 patients from our 20 years of experiences: prognostic parameters and overall survival.",
"title_normalized": "therapy related myeloid neoplasm after peptide receptor radionuclide therapy prrt in 1631 patients from our 20 years of experiences prognostic parameters and overall survival"
} | [
{
"companynumb": "NVSC2020DE320202",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "LUTETIUM OXODOTREOTIDE LU-177"
},
"drugadditional": nu... |
{
"abstract": "Hyperammonemic encephalopathy is an uncommon, potentially lethal adverse effect of 5-fluorouracil (5-FU). Being one of the most common and versatile chemotherapy agents, it is important to understand this important side effect of 5FU. There is paucity of data in this subject. Here, we report a case of 5FU-induced encephalopathy in a patient on induction chemotherapy for head and neck cancer. In this case report, the clinical presentation, diagnosis, and management of 5FU-induced encephalopathy is reported.",
"affiliations": "Department of Radiotherapy, All India Institute of Medical Sciences, Bhopal, Madhya Pradesh, India.;Department of Radiotherapy, All India Institute of Medical Sciences, Bhopal, Madhya Pradesh, India.;Department of Radiotherapy, All India Institute of Medical Sciences, Bhopal, Madhya Pradesh, India.;Department of Radiotherapy, All India Institute of Medical Sciences, Bhopal, Madhya Pradesh, India.;Department of Radiotherapy, All India Institute of Medical Sciences, Bhopal, Madhya Pradesh, India.",
"authors": "Das|Saikat|S|;Ahmad|Aftab|A|;Prasun|Pallav|P|;Kharade|Vipin|V|;Gupta|Manish|M|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1055/s-0041-1736154",
"fulltext": "\n==== Front\nJ Neurosci Rural Pract\nJ Neurosci Rural Pract\n10.1055/s-00043281\nJournal of Neurosciences in Rural Practice\n0976-3147\n0976-3155\nThieme Medical and Scientific Publishers Pvt. Ltd. A-12, 2nd Floor, Sector 2, Noida-201301 UP, India\n\n10.1055/s-0041-1736154\n2151754\nCase Report\nHyperammonemic Encephalopathy Associated with 5-Flurouracil Infusion in Head and Neck Cancer: Case Report and Review of the Literature\nDas Saikat 1\nAhmad Aftab 1\nPrasun Pallav 1\nKharade Vipin 1\nGupta Manish 1\n1 Department of Radiotherapy, All India Institute of Medical Sciences, Bhopal, Madhya Pradesh, India\nAddress for correspondence Saikat Das, MBBS, MTech, DMRT, MD, PhD, DNB, MNAMS Department of Radiotherapy, All India Institute of Medical SciencesBhopal 462020, Madhya PradeshIndiaSaikat.radiotherapy@aiimsbhopal.edu.in\n10 2021\n28 9 2021\n1 10 2021\n12 4 811812\nAssociation for Helping Neurosurgical Sick People. This is an open access article published by Thieme under the terms of the Creative Commons Attribution-NonDerivative-NonCommercial License, permitting copying and reproduction so long as the original work is given appropriate credit. Contents may not be used for commercial purposes, or adapted, remixed, transformed or built upon. ( https://creativecommons.org/licenses/by-nc-nd/4.0/ )\n2021\nAssociation for Helping Neurosurgical Sick People.\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License, which permits unrestricted reproduction and distribution, for non-commercial purposes only; and use and reproduction, but not distribution, of adapted material for non-commercial purposes only, provided the original work is properly cited.\nHyperammonemic encephalopathy is an uncommon, potentially lethal adverse effect of 5-fluorouracil (5-FU). Being one of the most common and versatile chemotherapy agents, it is important to understand this important side effect of 5FU. There is paucity of data in this subject. Here, we report a case of 5FU-induced encephalopathy in a patient on induction chemotherapy for head and neck cancer. In this case report, the clinical presentation, diagnosis, and management of 5FU-induced encephalopathy is reported.\n\nKeywords\n\nemergency neurology\noncology\npharmacokinetics\nFunding None.\n==== Body\npmcIntroduction\n\n5-flurouracil (5FU) is one of the most common anticancer drugs used in clinical oncology either alone or in combination with other systemic agents. 5FU-induced encephalopathy is a rare central nervous system (CNS) toxicity, which is characterized by altered neurological status with or without radiological and biochemical abnormality. 1 Very few cases of 5FU-induced encephalopathy has been reported in the literature, 2 and the reported annual incidence in Asian population is 0.1 to 1.1%. 1 We report a very rare case of 5FU-induced acute neurotoxicity, characterized by confusion and ataxia in a patient undergoing 5FU-based induction chemotherapy for carcinoma of the buccal mucosa.\n\nCase Report\n\nA 44-year-old man, diagnosed with carcinoma right buccal mucosa (stage: T4a N2b M 0 ) with type 2 diabetes mellitus (managed on oral hypoglycemic drugs), was planned for induction chemotherapy with docetaxel, cisplatin and 5-day 5-FU. After the completion of the third day 5FU infusion in the first cycle of chemotherapy, he started experiencing vertigo and talking irrelevantly. There was transient episode of unresponsiveness to any command. Subsequently, he was agitated with altered sensorium. Serum electrolyte were within normal limits (serum Na—133, serum K—3.98 mg/dl). Serum phosphate level was mildly elevated (5.58 mg/dl). His arterial blood gas (ABG) analysis revealed respiratory alkalosis. Midazolam and haloperidol were used to calm him down during episodes of agitation. The patient was well-hydrated with normal saline infusion, and he improved after 12 hours, starting to respond to commands. Next day, he was again disoriented to time and place, and SpO2 level was 92%. He was put on oxygen at the rate of 4L/min, and SpO2 improved to 96%. In the afternoon, the patient again had an episode of blank stare, with rigidity affecting all the four limbs and unresponsive to painful stimuli. The diagnostic possibility of 5FU-induced acute encephalopathy was considered. Magnetic resonance imaging (MRI) of the brain revealed diffuse areas of hyperintensity in B/L centrum semiovale and subcortical areas and in the deep white matter along corpus callosum and B/L posterior limb of internal capsule, with corresponding drop in apparent diffusion coefficient (ADC) mapping and possibility of acute toxic encephalopathy ( Fig. 1 ). Blood ammonia level was elevated (66.4 µmol/L), indicating the possibility of hyperammonemic encephalopathy associated with 5FU infusion. He was started on injection valproate. Blood urea level was above normal limits (59.93 mg/dL), and serum creatinine level was 1.32 mg/dL. With intravenous hydration after 3 days, he was oriented to time, place and person, but with intermittent episodes of altered sensorium and disorientation, which were treated symptomatically. With supportive treatment, he gradually recovered, and biochemical parameters were normalized over another 3 days. After complete recovery from encephalopathy, he was planned for postoperative radiotherapy. No further symptoms or signs of neurotoxicity were noticed.\n\nFig. 1 Magnetic resonance imaging scan: ( A ) transverse section and ( B ) sagittal section showing diffuse areas of hyperintensity.\n\nDiscussion\n\nGastrointestinal and hematological toxicity are the main side effects of 5FU. Encephalopathy is a rare toxicity of 5FU infusion often associated with the high-dose continuous administration of 5FU. 3 Although encephalopathy can present with broad spectrum of symptoms, ranging from mild to moderate (disorientation, altered sensorium), in some cases, it can be very severe, with clinical signs like generalized rigidity and seizure, leading to hepatorenal dysfunction and even death. 1 The mechanism behind this neurotoxicity is not completely understood. It is postulated that accumulation of the by-products of 5-FU metabolism like fluoroacetate and fluorocitrate leads to metabolic derangement of citric acid cycle and urea cycle, causing accumulation of ammonia, which, in turn, leads to hyperammonemic neurotoxicity. 4 Patients with genetic polymorphisms of dihydropyrimidine dehydrogenase enzyme (leading to dihydropyrimidine dehydrogenase deficiency, DPD) or the TYMS gene are predisposed to 5FU-associated hyperammonemic encephalopathy due to the inability to detoxify the fluoropyrimidine derivatives in the liver. 4 Pharmacokinetics of 5FU is also influenced by chronomodulation and circadian rhythm. 5 This may be linked to the waxing and waning clinical presentation seen in our case.\n\nAcute 5FU neurotoxicity is often reversible on discontinuation of the drug. The exclusion of intracranial metastases, carcinomatous meningitis, paraneoplastic syndrome and neurologic manifestations of other medications and coexisting diseases with CNS effects is imperative. Approximately 57% patients with 5FU encephalopathy require intensive care, and the morality rate of this condition is 17%. 1 There is no consensus on the treatment of 5FU-induced hyperammonemic encephalopathy, but conservative supportive measures are important. Our patient recovered gradually over a few days after ceasing the infusion of 5FU, fluid supplement and lactulose. Some studies have reported that administration of branched-chain amino acid or thiamine (in patients with cerebellar ataxia) are useful, which was not required in this case, as the patient improved with supportive measures. The French national survey study 1 has shown high chance of relapse of encephalopathy on rechallenge (57%). We planned for postoperative radiotherapy for our patient. Patient is free of any residual neurological toxicity to date.\n\nConclusion\n\nHyperammonemic encephalopathy is rare, and with early diagnosis and supportive measures, it is often reversible on withdrawal of the drug. The role of circadian rhythm and chronomodulation remains to be investigated.\n\nConflict of Interest None declared.\n==== Refs\nReferences\n\n1 Boilève A Thomas L Lillo-Le Louët A 5-Fluorouracil-induced hyperammonaemic encephalopathy: A French national survey Eur J Cancer 2020 129 32 40 32120273\n2 Boisdron-Celle M Capitain O Faroux R Prevention of 5-fluorouracil-induced early severe toxicity by pre-therapeutic dihydropyrimidine dehydrogenase deficiency screening: Assessment of a multiparametric approach Semin Oncol 2017 44 01 13 23 28395758\n3 Chue A L Fernando I N Hussain S A Yates D A Chemotherapy related encephalopathy in a patient with Stage IV cervical carcinoma treated with cisplatin and 5-fluorouracil: a case report Cases J 2009 2 8526 19830079\n4 Kim S R Park C H Park S Park J O Lee J Lee S Y Genetic polymorphisms associated with 5-Fluorouracil-induced neurotoxicity Chemotherapy 2010 56 04 313 317 20714149\n5 Lévi F A Zidani R Vannetzel J-M Chronomodulated versus fixed-infusion-rate delivery of ambulatory chemotherapy with oxaliplatin, fluorouracil, and folinic acid (leucovorin) in patients with colorectal cancer metastases: a randomized multi-institutional trial J Natl Cancer Inst 1994 86 21 1608 1617 7932825\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0976-3155",
"issue": "12(4)",
"journal": "Journal of neurosciences in rural practice",
"keywords": "emergency neurology; oncology; pharmacokinetics",
"medline_ta": "J Neurosci Rural Pract",
"mesh_terms": null,
"nlm_unique_id": "101533710",
"other_id": null,
"pages": "811-812",
"pmc": null,
"pmid": "34737523",
"pubdate": "2021-10",
"publication_types": "D002363:Case Reports",
"references": "19830079;7932825;28395758;32120273;20714149",
"title": "Hyperammonemic Encephalopathy Associated with 5-Flurouracil Infusion in Head and Neck Cancer: Case Report and Review of the Literature.",
"title_normalized": "hyperammonemic encephalopathy associated with 5 flurouracil infusion in head and neck cancer case report and review of the literature"
} | [
{
"companynumb": "IN-MLMSERVICE-20211013-3162747-1",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FLUOROURACIL"
},
"drugadditional": "3"... |
{
"abstract": "Little is known about the role of left atrial appendage closure using the Watchman device (Boston Scientific) in patients who are at very high risk for stroke.\n\n\n\nThe purpose of this study was to assess the role of Watchman in patients with CHA2DS2-VASc ≥5.\n\n\n\nAll patients undergoing procedures for Watchman implant at our institution were enrolled in a prospective registry. All 104 consecutive recipients with CHA2DS2-VASc ≥5 were included.\n\n\n\nMedian patient age was 78.5 ± 6.4 years, 56% were male, mean CHA2DS2-VASc was 5.7 ± 0.9, and mean HASBLED was 4.0 ± 1.0. Indications for implantation were significant prior bleeding (73%), unacceptable bleeding risk (21%), and unacceptable stroke and bleeding risk (6%). Watchman implantation was successful in all patients. All but 2 patients completed 45 days of postprocedural anticoagulation; 56% used warfarin and 44% used a novel oral anticoagulant. Transesophageal echocardiogram at 45 days revealed no significant peridevice leak. One patient was found to have a small mobile, filamentous echodensity attached on the medial aspect of the Watchman device. This resolved with longer anticoagulation with dabigatran and did not result in adverse outcome. At 1-year follow up, ischemic stroke had occurred in 3 patients (2.8%) at 96, 119, and 276 days after the procedure.\n\n\n\nIn a population of patients with mean CHA2DS2-VASc of 5.7, Watchman implantation seemed to be safe and efficacious, with a residual annual ischemic stroke risk of 2.8%. In an atrial fibrillation population with a similar CHA2DS2-VASc score, the estimated annual risk of stroke is ≈12% off anticoagulation and >4% on warfarin.",
"affiliations": "Department of Internal Medicine, Cleveland Clinic Foundation, Cleveland, Ohio.;Section of Cardiac Pacing and Electrophysiology, Cleveland Clinic Foundation, Cleveland, Ohio.;Department of Internal Medicine, Cleveland Clinic Foundation, Cleveland, Ohio.;Section of Cardiac Pacing and Electrophysiology, Cleveland Clinic Foundation, Cleveland, Ohio.;Section of Cardiac Pacing and Electrophysiology, Cleveland Clinic Foundation, Cleveland, Ohio.;Section Head of Invasive and Interventional Cardiology, Cleveland Clinic Foundation, Cleveland, Ohio.;Department of Internal Medicine, Cleveland Clinic Foundation, Cleveland, Ohio.;Department of Cardiovascular Medicine, University of Pittsburgh Medical Center, Pittsburgh, Pennsylvania.;Section of Clinical Cardiology, Cleveland Clinic Foundation, Cleveland, Ohio.;Section of Cardiovascular Imaging, Cleveland Clinic Foundation, Cleveland, Ohio.;Department of Cerebrovascular Medicine, Cleveland Clinic Foundation, Cleveland, Ohio.;Department of Cerebrovascular Medicine, Cleveland Clinic Foundation, Cleveland, Ohio.;Department of Cerebrovascular Medicine, Cleveland Clinic Foundation, Cleveland, Ohio.;Department of Cerebrovascular Medicine, Cleveland Clinic Foundation, Cleveland, Ohio.;Section of Cardiac Pacing and Electrophysiology, Cleveland Clinic Foundation, Cleveland, Ohio.;Section of Cardiac Pacing and Electrophysiology, Cleveland Clinic Foundation, Cleveland, Ohio.;Section of Cardiac Pacing and Electrophysiology, Cleveland Clinic Foundation, Cleveland, Ohio. Electronic address: husseia@ccf.org.",
"authors": "Hutt|Erika|E|;Wazni|Oussama M|OM|;Kaur|Simrat|S|;Saliba|Walid I|WI|;Tarakji|Khaldoun G|KG|;Kapadia|Samir|S|;Aguilera|Jose|J|;Barakat|Amr F|AF|;Abdallah|Mouin|M|;Jaber|Wael|W|;Rasmussen|Peter|P|;Hussain|Shazam|S|;Uchino|Ken|K|;Wisco|Dolora|D|;Lindsay|Bruce D|BD|;Kanj|Mohamed|M|;Hussein|Ayman A|AA|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.hrthm.2019.07.011",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1547-5271",
"issue": "17(1)",
"journal": "Heart rhythm",
"keywords": "Anticoagulation; Atrial fibrillation; Left atrial appendage closure; Stroke; Watchman device",
"medline_ta": "Heart Rhythm",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D020517:Atrial Appendage; D001281:Atrial Fibrillation; D006328:Cardiac Catheterization; D006348:Cardiac Surgical Procedures; D017548:Echocardiography, Transesophageal; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D008297:Male; D011446:Prospective Studies; D019919:Prosthesis Implantation; D012307:Risk Factors; D020521:Stroke; D013997:Time Factors; D016896:Treatment Outcome",
"nlm_unique_id": "101200317",
"other_id": null,
"pages": "27-32",
"pmc": null,
"pmid": "31302250",
"pubdate": "2020-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Left atrial appendage closure device implantation in patients at very high risk for stroke.",
"title_normalized": "left atrial appendage closure device implantation in patients at very high risk for stroke"
} | [
{
"companynumb": "US-BAYER-2020-013661",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ASPIRIN"
},
"drugadditional": null,
"dru... |
{
"abstract": "OBJECTIVE\nThe risk of severe neutropenia from treatment with irinotecan is related in part to UGT1A1*28, a variant that reduces the elimination of SN-38, the active metabolite of irinotecan. We aimed to identify the maximum-tolerated dose (MTD) and dose-limiting toxicity (DLT) of irinotecan in patients with advanced solid tumors stratified by the *1/*1, *1/*28, and *28/*28 genotypes.\n\n\nMETHODS\nSixty-eight patients received an intravenous flat dose of irinotecan every 3 weeks. Forty-six percent of the patients had the *1/*1 genotype, 41% had the *1/*28 genotype, and 13% had the *28/*28 genotype. The starting dose of irinotecan was 700 mg in patients with the *1/*1 and *1/*28 genotypes and 500 mg in patients with the *28/*28 genotype. Pharmacokinetic evaluation was performed at cycle 1.\n\n\nRESULTS\nIn patients with the *1/*1 genotype, the MTD was 850 mg (four DLTs per 16 patients), and 1,000 mg was not tolerated (two DLTs per six patients). In patients with the *1/*28 genotype, the MTD was 700 mg (five DLTs per 22 patients), and 850 mg was not tolerated (four DLTs per six patients). In patients with the *28/*28 genotype, the MTD was 400 mg (one DLT per six patients), and 500 mg was not tolerated (three DLTs per three patients). The DLTs were mainly myelosuppression and diarrhea. Irinotecan clearance followed linear kinetics. At the MTD for each genotype, dosing by genotype resulted in similar SN-38 areas under the curve (AUCs; r(2) = 0.0003; P = .97), but the irinotecan AUC was correlated with the actual dose (r(2) = 0.39; P < .001). Four of 48 patients with disease known to be responsive to irinotecan achieved partial response.\n\n\nCONCLUSIONS\nThe UGT1A1*28 genotype can be used to individualize dosing of irinotecan. Additional studies should evaluate the effect of genotype-guided dosing on efficacy in patients receiving irinotecan.",
"affiliations": "Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL. innocent@unc.edu.;Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL.;Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL.;Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL.;Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL.;Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL.;Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL.;Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL.;Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL.;Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL.;Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL.;Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL.;Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL.;Federico Innocenti, Richard L. Schilsky, Jacqueline Ramírez, Linda Janisch, Samir Undevia, Larry K. House, Soma Das, Kehua Wu, Michelle Turcich, Theodore Karrison, Michael L. Maitland, Ravi Salgia, and Mark J. Ratain, University of Chicago, Chicago; and Robert Marsh, NorthShore University Health System, Evanston, IL.",
"authors": "Innocenti|Federico|F|;Schilsky|Richard L|RL|;Ramírez|Jacqueline|J|;Janisch|Linda|L|;Undevia|Samir|S|;House|Larry K|LK|;Das|Soma|S|;Wu|Kehua|K|;Turcich|Michelle|M|;Marsh|Robert|R|;Karrison|Theodore|T|;Maitland|Michael L|ML|;Salgia|Ravi|R|;Ratain|Mark J|MJ|",
"chemical_list": "D000972:Antineoplastic Agents, Phytogenic; D000077146:Irinotecan; C418331:UGT1A1 enzyme; D014453:Glucuronosyltransferase; D002166:Camptothecin",
"country": "United States",
"delete": false,
"doi": "10.1200/JCO.2014.55.2307",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0732-183X",
"issue": "32(22)",
"journal": "Journal of clinical oncology : official journal of the American Society of Clinical Oncology",
"keywords": null,
"medline_ta": "J Clin Oncol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000972:Antineoplastic Agents, Phytogenic; D002166:Camptothecin; D004305:Dose-Response Relationship, Drug; D005838:Genotype; D014453:Glucuronosyltransferase; D006801:Humans; D000077146:Irinotecan; D008297:Male; D008875:Middle Aged; D009369:Neoplasms",
"nlm_unique_id": "8309333",
"other_id": null,
"pages": "2328-34",
"pmc": null,
"pmid": "24958824",
"pubdate": "2014-08-01",
"publication_types": "D017426:Clinical Trial, Phase I; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't",
"references": "20709386;12464801;19889737;17558305;9060548;11773157;17184208;20038727;16636344;7786822;24071849;15007088;17192505;10591539;11990381;17728214;17440429;24136381;15689586;12525507;21654688;10340924;23589555;17898154;16616487;16809730;19726797",
"title": "Dose-finding and pharmacokinetic study to optimize the dosing of irinotecan according to the UGT1A1 genotype of patients with cancer.",
"title_normalized": "dose finding and pharmacokinetic study to optimize the dosing of irinotecan according to the ugt1a1 genotype of patients with cancer"
} | [
{
"companynumb": "US-CIPLA LTD.-2016US17270",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "IRINOTECAN"
},
"drugadditional": null,
... |
{
"abstract": "Patients with solid-organ transplants usually present at the emergency department with nonspecific symptoms. The physician should consider a great variety of syndromes and diseases, given the greater risk that solid-organ transplant patients carry because of immunosuppression and transplant-related conditions. Myocardial infarction caused by cardiac allograft vasculopathy must be always suspected and ruled out, even when initial symptoms do not orientate in that direction. We present a case that conjugates signs that can be present in different pathologies. It shows that fever is not always related to infection or rejection but could also appear in acute cardiac allograft vasculopathy. It emphasizes the need of a multi-disciplinary team led by a heart transplant specialist when dealing with this sort of clinical case.",
"affiliations": "Department of Cardiology, Hospital Universitario Central de Asturias (HUCA), Oviedo, Spain. Electronic address: albertobarca@hotmail.com.;Department of Cardiology, Hospital Universitario Central de Asturias (HUCA), Oviedo, Spain.;Department of Cardiology, Hospital Universitario Central de Asturias (HUCA), Oviedo, Spain.;Department of Cardiology, Hospital Universitario Central de Asturias (HUCA), Oviedo, Spain.;Department of Cardiology, Hospital Universitario Central de Asturias (HUCA), Oviedo, Spain.;Department of Cardiology, Hospital Universitario Central de Asturias (HUCA), Oviedo, Spain.;Department of Cardiology, Hospital Universitario Central de Asturias (HUCA), Oviedo, Spain.;Department of Cardiology, Hospital Universitario Central de Asturias (HUCA), Oviedo, Spain.;Department of Cardiology, Hospital Universitario Central de Asturias (HUCA), Oviedo, Spain.",
"authors": "Alperi|A|A|;Pascual|I|I|;Molina|B D|BD|;Silva|I|I|;Lorca|R|R|;Hernández-Vaquero|D|D|;Avanzas|P|P|;Lambert|J L|JL|;de la Tassa|C M|CM|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.transproceed.2017.04.008",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-1345",
"issue": "49(7)",
"journal": "Transplantation proceedings",
"keywords": null,
"medline_ta": "Transplant Proc",
"mesh_terms": "D003327:Coronary Disease; D058065:Diabetic Cardiomyopathies; D004417:Dyspnea; D005334:Fever; D016027:Heart Transplantation; D006801:Humans; D007165:Immunosuppression Therapy; D008297:Male; D008875:Middle Aged; D011183:Postoperative Complications",
"nlm_unique_id": "0243532",
"other_id": null,
"pages": "1667-1671",
"pmc": null,
"pmid": "28838461",
"pubdate": "2017-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Fever, Malaise, and Dyspnea in a Diabetic Heart Transplant Patient: A Case Report.",
"title_normalized": "fever malaise and dyspnea in a diabetic heart transplant patient a case report"
} | [
{
"companynumb": "ES-ASTELLAS-2017US036518",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ATORVASTATIN"
},
"drugadditional": "3",
... |
{
"abstract": "In renal transplant recipients, delayed graft function and accompanying renal impairment may lead to therapeutic underexposure of valganciclovir. We describe a case of a cytomegalovirus (CMV)-seronegative kidney transplant recipient from a CMV-seropositive donor, whose course was complicated during valganciclovir prophylaxis by CMV disease, ultimately progressing to ganciclovir, foscarnet, and cidofovir resistance. Assessments and adjustments for renal dysfunction, according to both Cockgroft-Gault and Modification of Diet in Renal Disease study equations, are described. Therapy was complicated by outpatient parenteral therapy with pump-administered antiviral therapy, which may have led to drug underexposure and the fostering of antiviral resistance. Suppression was ultimately achieved in conjunction with reduction in immunosuppressive therapy, CMV immunoglobulin, and initiation of leflunomide. At-risk recipients may benefit from 24 hour creatinine clearance assessments, direct creatinine clearance measurement, or therapeutic drug monitoring. Optimal dosing strategies in recipients with impaired kidney function remain undefined, with limited pharmacokinetic data to date.",
"affiliations": "Department of Infectious Disease, Cleveland Clinic Florida, Weston, Florida, USA. Electronic address: echenii@ccf.org.;Department of Pharmacy, Cleveland Clinic Florida, Weston, Florida, USA.;Department of Pharmacy, Cleveland Clinic Florida, Weston, Florida, USA.;Department of Transplant Nephrology, Cleveland Clinic Florida, Weston, Florida, USA.;Department of Transplant Nephrology, Cleveland Clinic Florida, Weston, Florida, USA.",
"authors": "Echenique|I A|IA|;Beltran|D|D|;Ramirez-Ruiz|L|L|;Najafian|N|N|;Agrawal|N|N|",
"chemical_list": "D000998:Antiviral Agents; D007136:Immunoglobulins; D016756:Immunoglobulins, Intravenous; D007555:Isoxazoles; D063065:Organophosphonates; C045781:cytomegalovirus-specific hyperimmune globulin; D017245:Foscarnet; D003596:Cytosine; D000077339:Leflunomide; D000077404:Cidofovir; D015774:Ganciclovir",
"country": "United States",
"delete": false,
"doi": "10.1016/j.transproceed.2017.02.046",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-1345",
"issue": "49(7)",
"journal": "Transplantation proceedings",
"keywords": null,
"medline_ta": "Transplant Proc",
"mesh_terms": "D000368:Aged; D000998:Antiviral Agents; D000077404:Cidofovir; D003587:Cytomegalovirus; D003586:Cytomegalovirus Infections; D003596:Cytosine; D004305:Dose-Response Relationship, Drug; D024882:Drug Resistance, Viral; D017245:Foscarnet; D015774:Ganciclovir; D006801:Humans; D007136:Immunoglobulins; D016756:Immunoglobulins, Intravenous; D007555:Isoxazoles; D007668:Kidney; D016030:Kidney Transplantation; D000077339:Leflunomide; D008297:Male; D063065:Organophosphonates; D011183:Postoperative Complications; D014019:Tissue Donors",
"nlm_unique_id": "0243532",
"other_id": null,
"pages": "1560-1564",
"pmc": null,
"pmid": "28838440",
"pubdate": "2017-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Ganciclovir Dosing Strategies and Development of Cytomegalovirus Resistance in a Kidney Transplant Recipient: A Case Report.",
"title_normalized": "ganciclovir dosing strategies and development of cytomegalovirus resistance in a kidney transplant recipient a case report"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/17/0093554",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "SULFAMETHOXAZOLE"
},
"drugadditional": ... |
{
"abstract": "BACKGROUND\nCardiac surgery patients undergoing coronary artery bypass grafting with cardiopulmonary bypass.\n\n\nOBJECTIVE\nEvaluate the effect of adding intrathecal sufentanil to general anesthesia on hemodynamics.\n\n\nMETHODS\nProspective, randomized, not blinded study, after approval by local ethics in Research Committee.\n\n\nMETHODS\nMonocentric study performed at Dante Pazzanese Institute of Cardiology, Sao Paulo, Brazil.\n\n\nMETHODS\n40 consenting patients undergoing elective coronary artery bypass, both genders.\n\n\nMETHODS\nChronic kidney disease; emergency procedures; reoperations; contraindication to spinal block; left ventricular ejection fraction less than 40%; body mass index above 32kg/m(2) and use of nitroglycerin.\n\n\nMETHODS\nPatients were randomly assigned to receive intrathecal sufentanil 1μg/kg or not. Anesthesia induced and maintained with sevoflurane and continuous infusion of remifentanil.\n\n\nMETHODS\nHemodynamic variables, blood levels of cardiac troponin I, B-type natriuretic peptide, interleukin-6 and tumor necrosis factor alfa during and after surgery.\n\n\nRESULTS\nPatients in sufentanil group required less inotropic support with dopamine when compared to control group (9.5% vs 58%, p=0.001) and less increases in remifentanil doses (62% vs 100%, p=0.004). Hemodynamic data at eight different time points and biochemical data showed no differences between groups.\n\n\nCONCLUSIONS\nPatients receiving intrathecal sufentanil have more hemodynamical stability, as suggested by the reduced inotropic support and fewer adjustments in intravenous opioid doses.",
"affiliations": "Instituto de Cardiologia Dante Pazzanese, Universidade Federal de São Paulo, São Paulo, SP, Brazil. Electronic address: caenigro@uol.com.br.;Universidade Federal de São Paulo, São Paulo, SP, Brazil.;Instituto de Cardiologia Dante Pazzanese, Universidade Federal de São Paulo, São Paulo, SP, Brazil.;Universidade Federal de São Paulo, São Paulo, SP, Brazil.;Università Vita-Salute San Raffaele, Milano, Italy.",
"authors": "Nigro Neto|Caetano|C|;do Amaral|Jose Luiz Gomes|JL|;Arnoni|Renato|R|;Tardelli|Maria Angela|MA|;Landoni|Giovanni|G|",
"chemical_list": "D000701:Analgesics, Opioid; D017409:Sufentanil",
"country": "Brazil",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": null,
"issue": "64(2)",
"journal": "Brazilian journal of anesthesiology (Elsevier)",
"keywords": "Cardiac surgery; Interleukin 6; Spinal anesthesia; Sufentanil",
"medline_ta": "Braz J Anesthesiol",
"mesh_terms": "D000368:Aged; D000701:Analgesics, Opioid; D001026:Coronary Artery Bypass; D005260:Female; D006439:Hemodynamics; D006801:Humans; D007278:Injections, Spinal; D008297:Male; D008875:Middle Aged; D011183:Postoperative Complications; D011446:Prospective Studies; D017409:Sufentanil",
"nlm_unique_id": "101624623",
"other_id": null,
"pages": "73-8",
"pmc": null,
"pmid": "24794447",
"pubdate": "2014",
"publication_types": "D016428:Journal Article; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Intrathecal sufentanil for coronary artery bypass grafting.",
"title_normalized": "intrathecal sufentanil for coronary artery bypass grafting"
} | [
{
"companynumb": "BR-BAXTER-2015BAX032767",
"fulfillexpeditecriteria": "1",
"occurcountry": "BR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "TRAMADOL"
},
"drugadditional": null,
... |
{
"abstract": "The warfarin dose requirement and therapeutic response of a 42-year-old African-American male with genotype CYP2C9 *11/*11, VKORC1 -1639GG and CYP4F2 433Val/Val anticoagulated for ischemic stroke is described herein. Warfarin was dosed according to the institution's personalized medicine program recommendations of a 10 mg mini-load dose, followed by dose decreases to 4-6 mg/day through discharge. Stable international normalized ratio was achieved after eight doses, with good overall long-term maintenance of therapeutic international normalized ratio over several years with warfarin doses of 3.1-4.3 mg/day. This case report sheds further light on the clinical impact of CYP2C9 *11/*11 on warfarin dose requirements, short- and long-term treatment response and practical considerations for warfarin management in suspected carriers of rare variant CYP2C9 alleles.",
"affiliations": "National Pharmacy, Kaiser Permanente, Aurora, CO 80011, USA.;Department of Pharmacy Practice, Boston Medical Center, Boston, MA 02118, USA.;Department of Pharmacy Practice, University of Illinois at Chicago, Chicago, IL 60612, USA.",
"authors": "Quinn|Alison Lh|AL|0000-0001-7206-7472;Bhat|Shubha|S|0000-0002-7023-9506;Lee|James C|JC|0000-0002-3101-7281",
"chemical_list": "D000925:Anticoagulants; D014859:Warfarin; C450260:CYP2C9 protein, human; D065729:Cytochrome P-450 CYP2C9",
"country": "England",
"delete": false,
"doi": "10.2217/pgs-2020-0125",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1462-2416",
"issue": "21(18)",
"journal": "Pharmacogenomics",
"keywords": "CYP2C9*11; anticoagulation; pharmacogenetics; stroke; warfarin",
"medline_ta": "Pharmacogenomics",
"mesh_terms": "D000328:Adult; D000553:Ambulatory Care; D000925:Anticoagulants; D065729:Cytochrome P-450 CYP2C9; D005787:Gene Frequency; D005838:Genotype; D006801:Humans; D006973:Hypertension; D019934:International Normalized Ratio; D000083242:Ischemic Stroke; D008297:Male; D057285:Precision Medicine; D014859:Warfarin",
"nlm_unique_id": "100897350",
"other_id": null,
"pages": "1271-1277",
"pmc": null,
"pmid": "33350885",
"pubdate": "2020-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Effect of CYP2C9 *11/*11 genotype on initial and long-term warfarin dose requirement and therapeutic response.",
"title_normalized": "effect of cyp2c9 11 11 genotype on initial and long term warfarin dose requirement and therapeutic response"
} | [
{
"companynumb": "US-BRISTOL-MYERS SQUIBB COMPANY-BMS-2021-005116",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "WARFARIN SODIUM"
},
"dr... |
{
"abstract": "Idiopathic membranous nephropathy is a common cause of nephrotic syndrome in adults. The nephrotic syndrome due to idiopathic membranous nephropathy is often resistant to glucocorticosteroids and requires an alkylating agent such as chlorambucil or cyclophosphamide to induce remission. Recent studies illustrate that antibodies against the autoantigen M-type phospholipase A2 receptor contribute to a vast majority but not all cases of idiopathic membranous nephropathy. Herein, we report a patient with nephrotic syndrome due to membranous nephropathy that was resistant to 6 months of therapy with ramipril and high-dose glucocorticosteroids but responded to a single cycle of bortezomib infusion.",
"affiliations": "The Rogosin Institute, 505 East 70th Street, Box 102, New York, NY, 10021, USA, chh2001@nyp.org.",
"authors": "Hartono|Choli|C|;Chung|Miriam|M|;Kuo|Sheng F|SF|;Seshan|Surya V|SV|;Muthukumar|Thangamani|T|",
"chemical_list": "D001897:Boronic Acids; D061988:Proteasome Inhibitors; D011719:Pyrazines; D000069286:Bortezomib",
"country": "Italy",
"delete": false,
"doi": "10.1007/s40620-013-0028-x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1121-8428",
"issue": "27(1)",
"journal": "Journal of nephrology",
"keywords": null,
"medline_ta": "J Nephrol",
"mesh_terms": "D001897:Boronic Acids; D000069286:Bortezomib; D005260:Female; D015433:Glomerulonephritis, Membranous; D006801:Humans; D008875:Middle Aged; D009404:Nephrotic Syndrome; D061988:Proteasome Inhibitors; D011719:Pyrazines",
"nlm_unique_id": "9012268",
"other_id": null,
"pages": "103-6",
"pmc": null,
"pmid": "24430762",
"pubdate": "2014-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural",
"references": "19571279;23813556;23312808;2642605;9067928;18976291;20110379;22773590;23281998;17556412;22822077;21784898",
"title": "Bortezomib therapy for nephrotic syndrome due to idiopathic membranous nephropathy.",
"title_normalized": "bortezomib therapy for nephrotic syndrome due to idiopathic membranous nephropathy"
} | [
{
"companynumb": "US-CIPLA LTD.-2016US17531",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RAMIPRIL"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nSub-retinal abscess as the presenting feature in the setting of endogenous fungal endophthalmitis is extremely infrequent. Immunodeficiency states are major predisposing risk factors. To the best of our knowledge, this is the first case report of Candida sub-retinal abscess as initial presentation in an immunocompetent patient.\n\n\nMETHODS\nA 32-year old, generally fit and well, female presented to us with gradually deteriorating vision in her right eye. Visual acuity was counting fingers in the right eye and, 20/30 in the left eye. Right eye fundus examination showed a full thickness, yellowish-white foveal lesion, and significant vitreous haze. Left eye examination was normal. Upon direct questioning, the patient disclosed history of backstreet abortion 3 weeks prior to the onset of her ocular symptoms. She underwent vitreous tap and intravitreal antibiotics (amphotericin B, 5 μg/0.5 ml). Vitreous culture showed profuse growth of Candida albicans. Because her condition was progressively deteriorating, she underwent 25 g vitrectomy plus repeat intravitreal amphotericin B under general anaesthesia. Three weeks post-vitrectomy, vitreous inflammation resolved completely, and the sub-retinal abscess healed with a macular scar formation. Over a follow-up of 4 years, no recurrences were observed.\n\n\nCONCLUSIONS\nOur case highlights the importance of considering Candida albicans infection in the differential diagnosis of sub-retinal abscesses. Although immunocompromised states are traditionally identified as predisposing factors for fungal infections, fungal endogenous endophthalmitis can occur in healthy individuals as well.",
"affiliations": "Section of Ophthalmology, Aga Khan University Hospital, Stadium Road Karachi, Karachi, Pakistan. sidrazafariqbal@gmail.com.;Section of Ophthalmology, Aga Khan University Hospital, Stadium Road Karachi, Karachi, Pakistan.",
"authors": "Zafar|Sidra|S|;Siddiqui|M A Rehman|MAR|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s13104-018-3682-1",
"fulltext": "\n==== Front\nBMC Res NotesBMC Res NotesBMC Research Notes1756-0500BioMed Central London 368210.1186/s13104-018-3682-1Case ReportSub-retinal abscess as presenting feature of endogenous Candida endophthalmitis Zafar Sidra sidrazafariqbal@gmail.com 1Siddiqui M. A. Rehman rehman.siddiqui@gmail.com 121 0000 0004 0606 972Xgrid.411190.cSection of Ophthalmology, Aga Khan University Hospital, Stadium Road Karachi, Karachi, Pakistan 2 Section of Ophthalmology, South City Hospital, Karachi, Pakistan 17 8 2018 17 8 2018 2018 11 59820 1 2018 4 8 2018 © The Author(s) 2018Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nSub-retinal abscess as the presenting feature in the setting of endogenous fungal endophthalmitis is extremely infrequent. Immunodeficiency states are major predisposing risk factors. To the best of our knowledge, this is the first case report of Candida sub-retinal abscess as initial presentation in an immunocompetent patient.\n\nCase presentation\nA 32-year old, generally fit and well, female presented to us with gradually deteriorating vision in her right eye. Visual acuity was counting fingers in the right eye and, 20/30 in the left eye. Right eye fundus examination showed a full thickness, yellowish-white foveal lesion, and significant vitreous haze. Left eye examination was normal. Upon direct questioning, the patient disclosed history of backstreet abortion 3 weeks prior to the onset of her ocular symptoms. She underwent vitreous tap and intravitreal antibiotics (amphotericin B, 5 μg/0.5 ml). Vitreous culture showed profuse growth of Candida albicans. Because her condition was progressively deteriorating, she underwent 25 g vitrectomy plus repeat intravitreal amphotericin B under general anaesthesia. Three weeks post-vitrectomy, vitreous inflammation resolved completely, and the sub-retinal abscess healed with a macular scar formation. Over a follow-up of 4 years, no recurrences were observed.\n\nConclusion\nOur case highlights the importance of considering Candida albicans infection in the differential diagnosis of sub-retinal abscesses. Although immunocompromised states are traditionally identified as predisposing factors for fungal infections, fungal endogenous endophthalmitis can occur in healthy individuals as well.\n\nKeywords\nCandidaFungalEndophthalmitisSubretinal abscessissue-copyright-statement© The Author(s) 2018\n==== Body\nBackground\nEndogenous endophthalmitis is an uncommon clinical condition accounting for approximately 2–8% of all endophthalmitis cases [1]. Sub-retinal abscess as the predominant presentation of severe endophthalmitis is even rarer. Here, we present a case of endogenous Candida endophthalmitis complicated by sub-retinal abscess following surgical abortion in an immunocompetent woman.\n\nCase presentation\nA 32-year old female presented to us with progressively deteriorating vision in her right eye for 2 months.\n\nWhen the patient presented to us, visual acuity (VA) in her right eye was counting fingers and in the left eye, it was 20/30. Anterior segment examination was within normal limits for both eyes and intraocular pressures were 14 mmHg. Right eye fundus examination was significant for vitritis, with vitreous clumps manifesting as classic ‘pearls on a string’ appearance. A full thickness, yellowish-white foveal lesion was also appreciated (Fig. 1). Left eye examination was normal. Uveitis workup was unremarkable, except for an elevated erythrocyte sedimentation rate (ESR = 38). Mantoux test (0 mm), VDRL, FT-ABS, ANA, ASMA, AMA, and Toxoplasma IgG and IgM were all negative. Prior to consulting us, she had seen outside ophthalmologists where she was given intravitreal triamcinolone acetate in the affected eye. In addition, systemic prednisolone therapy had also been given. However, no improvement was observed with these treatments. A diagnosis of Toxoplasma retinochoroiditis was presumed and the patient was started on empiric Septran DS (sulfamethoxazole and trimethoprim).Fig. 1 a–d Right eye fundus photographs showing presence of a sub-retinal abscess, with vitreous clumps resembling ‘pearls on a string’. a At presentation to outside ophthalmologist, b upon presentation to us, and c, d progressive worsening even with intravitreal anti-fungal therapy\n\n\n\n\nOn direct questioning, the patient revealed having undergone back-alley abortion 3 weeks prior to onset of her ocular symptoms, and that she was also suffering from vaginal discharge. She was referred to gynaecology, who felt, that the two problems were unrelated. Vaginal swabs were however taken, and Gram-positive rods were identified on Gram staining. A diagnosis of bacterial vaginosis was made, and she was commenced on Metronidazole.\n\nBased on the patient’s history and clinical findings, we strongly suspected a fungal sub-retinal abscess. Retinal imaging, which included optical coherence tomography (OCT) and fundus fluorescein angiography (FFA), were ordered. OCT of the right eye showed a sub-foveal conical lesion extending from the choroid into the full thickness of retina (Fig. 2). The apex of the lesion was directed towards the inner retina and formed a tiny protuberance (roof of the abscess). Blood cultures were requested but did not reveal any microbial growth. A vitreous tap was subsequently performed, and intravitreal amphotericin B 5 μg/0.5 ml was administered. Vitreous culture showed profuse Candida albicans growth. Because of limited response to intravitreal antibiotics, therapeutic 25 g pars plana vitrectomy, with gas tamponade and repeat intra-vitreal amphotericin B was performed. She was also commenced on oral voriconazole. The eye responded well to debulking surgery. Three weeks post-vitrectomy, inflammation resolved completely with macular scar formation (Fig. 3). During the subsequent 4 years follow-up, the patient had no recurrences.Fig. 2 Right eye OCT image depicts a sub-foveal conical lesion extending from the choroid into the full thickness of retina, corresponding to Candida sub-retinal abscess\n\n\nFig. 3 Status post-vitrectomy fundus photograph. Inflammation has resolved and a macular scar can be appreciated\n\n\n\n\nDiscussion and conclusion\nEndogenous Candida endophthalmitis is a potentially devastating ocular condition. Visual outcomes are often poor and incidence rates vary around 9.9–45% in individuals with underlying candidemia. Predisposing risk factors include intravenous drug abuse, immunodeficiency states, and prolonged systemic corticosteroid or antibiotic therapy [2–4]. Albeit very rare, cases of Candida endophthalmitis have also been described in young immunocompetent women either during pregnancy or in the post-partum period. Presence of intrauterine devices, Candida vaginitis, antibiotic/steroid therapy and invasive procedures, including surgical abortion are identified as possible predisposing factors for pregnancy-associated Candida sepsis [5–10]. Once in the bloodstream, Candida gains access to the eyes via the short posterior ciliary artery. Infection typically progresses, vertically, via chorioretinal infiltration and vitreous is a primary site of localisation. It is suggested that, the higher glucose concentration in vitreous supports the growth of Candida [11]. In contrast, if the infection assumes a horizontal course spreading under the sensory retina or retinal pigment epithelium, a sub-retinal abscess may result [12, 13]. To the best of our knowledge, sub-retinal abscess formation with endogenous Candida endophthalmitis has only been reported twice in literature [13, 14]. Additionally, the lesion was not observed in any of the obstetric cases that were complicated by Candidemia and endophthalmitis.\n\nSub-retinal abscess is an extremely uncommon manifestation of endogenous endophthalmitis. The abscess typically appears as a solitary, yellowish-white mass-like elevation. Additional accompanying features may include retinal haemorrhages and cellular vitreous reaction. Visual prognosis is often poor and because of disease rarity, there are no definite guidelines for sub-retinal abscess treatment. Both bacterial and fungal etiologies have been implicated, with bacterial etiology being more common [12–14].\n\nAlthough Candida is the most common fungal cause of endogenous endophthalmitis, only two cases of Candida-associated sub-retinal abscess have been described to date. Kaburaki et el [14] reported a case of Candida albicans endophthalmitis complicated by sub-retinal abscess formation in a liver transplant patient. Arai et al. described a similar case but with bilateral presentation in a patient on high-dose systemic corticosteroids for interstitial pneumonia and with underlying rheumatoid arthritis [13]. In comparison, our patient was immunocompetent, and had an unremarkable past medical history, barring a surgical abortion. We believe that, use of oral prednisolone even for a short duration, may have predisposed our patient to developing a more severe and aggressive disease course. Chen et al. for instance, reported Candida endophthalmitis in two healthy females following surgical abortion. Despite both women receiving the same treatment, one of them had a more severe clinical course. The patient in this scenario had received prior systemic corticosteroid therapy; her disease course was complicated by recurrent retinal detachments and final visual acuity of counting fingers [6].\n\nBoth Kaburaki et al. and Arai et al. reported difficulty in isolating the causative microorganism using vitreous fluid specimens. Kaburaki et al. performed histopathological examination of epiretinal proliferative tissue for diagnostic confirmation [14], whereas Arai et al. performed repeated vitreous taps and polymerase chain reaction (PCR) assays [13]. In the present case, we were able to successfully isolate Candida albicans twice; once on initial vitreous tap, and then from vitrectomy fluid sample. In a 20-year review of fungal endophthalmitis cases, vitrectomy yielded positive results in 92% of eyes when used as the initial diagnostic procedure. In comparison, anterior chamber paracentesis and vitreous tap without vitrectomy yielded positive culture results in 25% and 44% of eyes, respectively [15].\n\nCandida associated inflammation often manifests as formation of multiple micro abscesses in the vitreous which necessitates vitrectomy for complete resolution of infection [11]. However, despite multi-modal management, final visual acuity is often sub-optimal. A recently published study evaluated OCT changes in patients with established Candida endogenous endophthalmitis. They reported that in eyes with a chorioretinal pattern of Candida involvement, extension of the microorganism beyond inner nuclear layers was highly associated with scar formation and relatively poor visual recovery [16].\n\nOur case highlights the importance of including Candida albicans infection in the differential diagnosis of sub-retinal abscesses, even in the immunocompetent. The correct diagnosis for our patient was made after a delay of almost 2 months requiring multiple visits. Ophthalmologists should also be more careful when initiating corticosteroids until infectious etiology has been completely ruled out.\n\nAbbreviations\nFFAfundus fluorescein angiography\n\nI/Vintravitreal\n\nOCToptical coherence tomography\n\nAuthors’ contributions\nSZ and RS contributed to collection of relevant data, drafting and critically revising the manuscript. Both authors read and approved the final manuscript.\n\nAcknowledgements\nNot applicable.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nAvailability of data and materials\nThe dataset supporting the conclusions of this article is included within the article.\n\nConsent for publication\nWritten, informed consent was obtained from the patient to publish this case report.\n\nEthics approval and consent to participate\nNot applicable.\n\nFunding\nNot applicable.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Sadiq MA Hassan M Agarwal A Sarwar S Toufeeq S Soliman MK Endogenous endophthalmitis: diagnosis, management, and prognosis J Ophthal Inflamm Inf 2015 5 32 10.1186/s12348-015-0063-y \n2. Fishman LS Griffin JR Sapico FL Hecht R Hematogenous Candida endophthalmitis —a complication of Candidemia N Engl J Med 1972 286 13 675 681 10.1056/NEJM197203302861301 4551385 \n3. Riddell JT Comer GM Kauffman CA Treatment of endogenous fungal endophthalmitis: focus on new antifungal agents Clin Infect Dis 2011 52 5 648 653 10.1093/cid/ciq204 21239843 \n4. Sallam A Taylor SR Khan A McCluskey P Lynn WA Manku K Factors determining visual outcome in endogenous Candida endophthalmitis Retina. 2012 32 6 1129 1134 10.1097/IAE.0b013e31822d3a34 22298012 \n5. Sikic J Vukojevic N Katusic D Saric B Bilateral endogenous Candida endophthalmitis after induced abortion Croat Med J 2001 42 6 676 678 11740854 \n6. Chen SJ Chung YM Liu JH Endogenous Candida endophthalmitis after induced abortion Am J Ophthalmol 1998 125 6 873 875 10.1016/S0002-9394(98)00052-X 9645729 \n7. Tsai C-C Chen S-J Chung Y-M Yu K-W Hsu W-M Postpartum endogenous Candida endophthalmitis J Formos Med Assoc 2002 101 6 432 436 12189651 \n8. Doshi RR Wender JD Jumper JM Sanislo SR Leng T Endogenous Candida albicans endophthalmitis following spontaneous abortion and IUD removal Ophthal Surg Lasers Imaging 2011 42 e132 e134 10.3928/15428877-20110210-02 \n9. Chang TS Chen WC Chen HS Lee HW Endogenous Candida endophthalmitis after two consecutive procedures of suction dilatation and curettage Chang Gung Med J 2002 25 11 778 782 12553368 \n10. Håskjold E Lippe B Endogenous Candida endophthalmitis Acta Ophthalmol 1987 65 6 741 744 10.1111/j.1755-3768.1987.tb07074.x 3434242 \n11. Rao NA Hidayat AA Endogenous mycotic endophthalmitis: variations in clinical and histopathologic changes in candidiasis compared with aspergillosis Am J Ophthalmol 2001 132 2 244 251 10.1016/S0002-9394(01)00968-0 11476686 \n12. Harris EW D’Amico DJ Bhisitkul R Priebe GP Petersen R Bacterial subretinal abscess: a case report and review of the literature Am J Ophthalmol 2000 129 6 778 785 10.1016/S0002-9394(00)00355-X 10926988 \n13. Arai Y Sato Y Yoshida A Kawashima H Kaburaki T Gomi H Bilateral endogenous Candida albicans subretinal abscess with suspected mixed bacterial infection Clin Ophthalmol 2014 8 2151 2154 10.2147/OPTH.S70289 25378901 \n14. Kaburaki T Takamoto M Araki F Fujino Y Nagahara M Kawashima H Endogenous Candida albicans infection causing subretinal abscess Int Ophthalmol 2010 30 2 203 206 10.1007/s10792-009-9304-0 19360381 \n15. Lingappan A Wykoff CC Albini TA Miller D Pathengay A Davis JL Endogenous fungal endophthalmitis: causative organisms, management strategies, and visual acuity outcomes Am J Ophthalmol 2012 153 1 162 166 10.1016/j.ajo.2011.06.020 21917234 \n16. Invernizzi A Symes R Miserocchi E Cozzi M Cereda M Fogliato G Spectral domain optical coherence tomography findings in endogenous candida endophthalmitis and their clinical relevance Retina. 2018 38 5 1011 1018 10.1097/IAE.0000000000001630 28492430\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1756-0500",
"issue": "11(1)",
"journal": "BMC research notes",
"keywords": "Candida; Endophthalmitis; Fungal; Subretinal abscess",
"medline_ta": "BMC Res Notes",
"mesh_terms": "D000038:Abscess; D000328:Adult; D002175:Candida; D002177:Candidiasis; D009877:Endophthalmitis; D015821:Eye Infections, Fungal; D005260:Female; D006801:Humans; D014821:Vitrectomy",
"nlm_unique_id": "101462768",
"other_id": null,
"pages": "598",
"pmc": null,
"pmid": "30119688",
"pubdate": "2018-08-17",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "12189651;3434242;9645729;21917234;10926988;25378901;12553368;22298012;22165949;4551385;26525563;11476686;19360381;28492430;21239843;11740854",
"title": "Sub-retinal abscess as presenting feature of endogenous Candida endophthalmitis.",
"title_normalized": "sub retinal abscess as presenting feature of endogenous candida endophthalmitis"
} | [
{
"companynumb": "PK-MYLANLABS-2018M1089473",
"fulfillexpeditecriteria": "1",
"occurcountry": "PK",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "TRIAMCINOLONE"
},
"drugadditional": null,
... |
{
"abstract": "Topiramate is an anticonvulsant that is being increasingly used for a number of different off-label indications. Its inhibition of carbonic anhydrase isoenzymes can lead to metabolic acidosis, elevated urine pH, reduced urine citrate, and hypercalciuria, thereby creating a milieu that is ripe for calcium phosphate stone formation. In this review, we describe a case of topiramate-induced metabolic acidosis. We review the frequency of metabolic acidosis among children and adults, as well as the mechanism of hyperchloremic metabolic acidosis and renal tubular acidosis in topiramate users. Finally, we describe the long-term effects of topiramate-induced metabolic acidosis, including nephrolithiasis, nephrocalcinosis, and bone degradation. Patients who are prescribed topiramate should be carefully monitored for metabolic derangements, and they may benefit from alkali supplementation, or in extreme cases, discontinuation of the drug altogether.",
"affiliations": "a Harvard Medical School , Massachusetts General Hospital , Boston , MA , USA.;a Harvard Medical School , Massachusetts General Hospital , Boston , MA , USA.;b Department of Internal Medicine , Baylor University Medical Center , Dallas , TX , USA.;a Harvard Medical School , Massachusetts General Hospital , Boston , MA , USA.",
"authors": "Gupta|Shruti|S|;Gao|Jennifer J|JJ|;Emmett|Michael|M|;Fenves|Andrew Z|AZ|http://orcid.org/0000-0003-2817-3280",
"chemical_list": "D002257:Carbonic Anhydrase Inhibitors; D000077236:Topiramate; D005632:Fructose",
"country": "England",
"delete": false,
"doi": "10.1080/21548331.2017.1370969",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2154-8331",
"issue": "45(5)",
"journal": "Hospital practice (1995)",
"keywords": "Nephrology; acid base; drug side effects; nephrolithiasis",
"medline_ta": "Hosp Pract (1995)",
"mesh_terms": "D000138:Acidosis; D000328:Adult; D002257:Carbonic Anhydrase Inhibitors; D005260:Female; D005632:Fructose; D006801:Humans; D008881:Migraine Disorders; D000077236:Topiramate",
"nlm_unique_id": "101268948",
"other_id": null,
"pages": "192-195",
"pmc": null,
"pmid": "28828886",
"pubdate": "2017-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Topiramate and metabolic acidosis: an evolving story.",
"title_normalized": "topiramate and metabolic acidosis an evolving story"
} | [
{
"companynumb": "US-JNJFOC-20180122812",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CLONAZEPAM"
},
"drugadditional": null,
... |
{
"abstract": "We report a case of fatal fulminant hepatic failure related to the use of disulfiram. This is a commonly used medication; however there are few reported cases in the medical literature of fatal liver failure related to its use. Patients using disulfiram for alcohol cessation typically have multiple risk factors for liver disease and are not acutely candidates for orthotopic liver transplant due to recent alcohol dependence. This case demonstrates a rare adverse reaction to a commonly used medication with a fatal outcome. Our patient was a sixty-six year old man who had recently started using disulfiram for the purpose of alcohol cessation. He developed hepatotoxicity that progressed to fulminant hepatic failure. Despite cessation of the medication and supportive care, the outcome was fatal.",
"affiliations": null,
"authors": "Watts|Thomas E|TE|;Pandey|Richa A|RA|;Vancil|Tobias J|TJ|",
"chemical_list": "D000427:Alcohol Deterrents; D004221:Disulfiram",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0004-1858",
"issue": "110(13)",
"journal": "The Journal of the Arkansas Medical Society",
"keywords": null,
"medline_ta": "J Ark Med Soc",
"mesh_terms": "D000368:Aged; D000427:Alcohol Deterrents; D000437:Alcoholism; D004221:Disulfiram; D017809:Fatal Outcome; D006801:Humans; D017114:Liver Failure, Acute; D008297:Male",
"nlm_unique_id": "7503069",
"other_id": null,
"pages": "280-3",
"pmc": null,
"pmid": "25004669",
"pubdate": "2014-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Fatal fulminant hepatic failure related to the use of disulfiram.",
"title_normalized": "fatal fulminant hepatic failure related to the use of disulfiram"
} | [
{
"companynumb": "US-TEVA-506694USA",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SIMVASTATIN"
},
"drugadditional": null,
"dr... |
{
"abstract": "Pulmonary hypertension in children is commonly caused by underlying cardiac and pulmonary disease. Within the past 10 years, scurvy has been identified as a cause for pulmonary hypertension. We describe the case of a 3-year-old autistic boy with undiagnosed scurvy who was scheduled for cardiac catheterization. Immediately after induction, the patient became hemodynamically unstable, which worsened with administration of nitrous oxide. Cardiac catheterization revealed pulmonary hypertension, which dramatically improved with administration of vitamin C. Anesthesiologists should be aware that scurvy is more common than previously thought, even in developed countries and can cause unexpected circulatory collapse from pulmonary hypertensive crisis.",
"affiliations": "From the Department of Anesthesiology, Aichi Children's Health and Medical Center, Aichi, Japan.;From the Department of Anesthesiology, Aichi Children's Health and Medical Center, Aichi, Japan.;Department of Anesthesiology, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio.;From the Department of Anesthesiology, Aichi Children's Health and Medical Center, Aichi, Japan.;From the Department of Anesthesiology, Aichi Children's Health and Medical Center, Aichi, Japan.",
"authors": "Ichiyanagi|Shogo|S|;Takeshita|Itsuki|I|;Kandil|Ali I|AI|;Miyazu|Mitsunori|M|;Kojima|Taiki|T|",
"chemical_list": "D009609:Nitrous Oxide; D001205:Ascorbic Acid",
"country": "United States",
"delete": false,
"doi": "10.1213/XAA.0000000000001087",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2575-3126",
"issue": "13(10)",
"journal": "A&A practice",
"keywords": null,
"medline_ta": "A A Pract",
"mesh_terms": "D000768:Anesthesia, General; D001205:Ascorbic Acid; D001321:Autistic Disorder; D006328:Cardiac Catheterization; D002675:Child, Preschool; D006801:Humans; D006976:Hypertension, Pulmonary; D008297:Male; D009609:Nitrous Oxide; D012614:Scurvy; D016896:Treatment Outcome",
"nlm_unique_id": "101714112",
"other_id": null,
"pages": "379-381",
"pmc": null,
"pmid": "31567273",
"pubdate": "2019-11-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Pulmonary Hypertensive Crisis During General Anesthesia in a 3-Year-Old Autistic Boy With Undiagnosed Scurvy, Undergoing Cardiac Catheterization: A Case Report.",
"title_normalized": "pulmonary hypertensive crisis during general anesthesia in a 3 year old autistic boy with undiagnosed scurvy undergoing cardiac catheterization a case report"
} | [
{
"companynumb": "JP-ALSI-201900419",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "SEVOFLURANE"
},
"drugadditional": null,
"d... |
{
"abstract": "Women with neuromyelitis optica, an acute inflammatory demyelinating condition of the central nervous system, have an unpredictable clinical course in pregnancy. Providing neuraxial anesthesia for these patients is controversial, although relapses may occur after exposure to either general or neuraxial anesthesia and are common. We report the successful obstetric anesthesia management of a parturient with neuromyelitis optica, review the medical literature, and discuss specific considerations for obstetric anesthesia in patients with underlying demyelinating disease.",
"affiliations": "Department of Anesthesiology, Brigham and Women’s Hospital, Boston, MA, USA. Neeti-Sadana@ouhsc.edu",
"authors": "Sadana|N|N|;Houtchens|M|M|;Farber|M K|MK|",
"chemical_list": "D000305:Adrenal Cortex Hormones; D000701:Analgesics, Opioid; D000732:Androstanols; D018685:Anesthetics, Inhalation; D018686:Anesthetics, Intravenous; D058846:Antibodies, Monoclonal, Murine-Derived; D007136:Immunoglobulins; D007155:Immunologic Factors; D008738:Methyl Ethers; D003473:Neuromuscular Nondepolarizing Agents; D000077149:Sevoflurane; D000069283:Rituximab; D010100:Oxygen; D005283:Fentanyl; D000077123:Rocuronium; D015742:Propofol",
"country": "Netherlands",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0959-289X",
"issue": "21(4)",
"journal": "International journal of obstetric anesthesia",
"keywords": null,
"medline_ta": "Int J Obstet Anesth",
"mesh_terms": "D000305:Adrenal Cortex Hormones; D000328:Adult; D000701:Analgesics, Opioid; D000732:Androstanols; D000768:Anesthesia, General; D000773:Anesthesia, Obstetrical; D018685:Anesthetics, Inhalation; D018686:Anesthetics, Intravenous; D058846:Antibodies, Monoclonal, Murine-Derived; D017604:Cesarean Section, Repeat; D005260:Female; D005283:Fentanyl; D005500:Follow-Up Studies; D006801:Humans; D007136:Immunoglobulins; D007155:Immunologic Factors; D008279:Magnetic Resonance Imaging; D008738:Methyl Ethers; D003473:Neuromuscular Nondepolarizing Agents; D009471:Neuromyelitis Optica; D010100:Oxygen; D011183:Postoperative Complications; D011247:Pregnancy; D011248:Pregnancy Complications; D015742:Propofol; D000069283:Rituximab; D000077123:Rocuronium; D000077149:Sevoflurane; D013116:Spinal Cord",
"nlm_unique_id": "9200430",
"other_id": null,
"pages": "371-5",
"pmc": null,
"pmid": "22922089",
"pubdate": "2012-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Anesthetic management of a parturient with neuromyelitis optica.",
"title_normalized": "anesthetic management of a parturient with neuromyelitis optica"
} | [
{
"companynumb": "US-APOTEX-2017AP017066",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "VALACYCLOVIR HYDROCHLORIDE"
},
"drugadditional":... |
{
"abstract": "Hypohidrosis is an uncommon and reversible side effect of topiramate treatment, reported mainly in children. This report presents an adult patient with complex partial seizures who was treated with topiramate and developed hypohidrosis coupled with hyperthermia, related to high environmental temperature and physical exercise. Reduced sweat response was confirmed using the Neuropad test. Signs and symptoms ceased after drug discontinuation. During topiramate treatment, it is important to recognise this side effect, although the exact causal mechanism has not yet been clarified.",
"affiliations": "Department of Neurology, Aristotle University of Thessaloniki, Thessaloniki, Greece. stellakarax@gmail.com",
"authors": "Karachristianou|Styliani|S|;Papamichalis|Evangelos|E|;Sarantopoulos|Alexandros|A|;Boura|Panagiota|P|;Georgiadis|George|G|",
"chemical_list": "D000927:Anticonvulsants; D000077236:Topiramate; D005632:Fructose",
"country": "France",
"delete": false,
"doi": "10.1684/epd.2013.0568",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1294-9361",
"issue": "15(2)",
"journal": "Epileptic disorders : international epilepsy journal with videotape",
"keywords": "adverse effect; hypohidrosis; sweat function; topiramate",
"medline_ta": "Epileptic Disord",
"mesh_terms": "D000328:Adult; D000927:Anticonvulsants; D017029:Epilepsy, Complex Partial; D005334:Fever; D005632:Fructose; D006801:Humans; D007007:Hypohidrosis; D008297:Male; D000077236:Topiramate",
"nlm_unique_id": "100891853",
"other_id": null,
"pages": "203-6",
"pmc": null,
"pmid": "23773932",
"pubdate": "2013-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Hypohidrosis induced by topiramate in an adult patient.",
"title_normalized": "hypohidrosis induced by topiramate in an adult patient"
} | [
{
"companynumb": "US-JNJFOC-20130712025",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "TOPIRAMATE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nPerforin, encoded by PRF1, is a pore-forming protein crucial for lymphocyte cytotoxicity. Biallelic PRF1 nonsense mutations invariably result in early-onset hemophagocytic lymphohistiocytosis (HLH), termed familial HLH type 2 (FHL2). In contrast, biallelic PRF1 missense mutations may give rise to later-onset disease and more variable manifestations.\n\n\nMETHODS\nWe retrospectively searched our database for patients from families with siblings carrying biallelic PRF1 missense mutations where at least one sibling did not develop HLH, and for patients with biallelic PRF1 missense mutations and an atypical presentation of disease. We reviewed their clinical, genetic, and immunological characteristics.\n\n\nRESULTS\nIn all, we identified 10 such patients, including three sibling pairs with discordant manifestations. Interestingly, in two families, siblings of late-onset HLH patients developed Hodgkin lymphoma but no HLH. In a third family, one sibling presented with recurrent HLH episodes, whereas the other remains healthy. Of note, the affected sibling also suffered from systemic lupus erythematosus. Additional unrelated patients with biallelic PRF1 missense mutations were affected by neurological disease without classical signs of HLH, gastrointestinal inflammation as initial presentation of disease, as well as a hematological malignancy. Compared to early-onset FHL2 patients, the patients with an atypical presentation displayed a partial recovery of NK cell cytotoxicity upon IL-2 stimulation in vitro.\n\n\nCONCLUSIONS\nOur findings substantiate and expand the spectrum of clinical presentations of perforin deficiency, linking PRF1 missense mutations to lymphoma susceptibility and highlighting clinical variability within families. PRF1 mutations should, therefore, be considered as a cause of several diseases disparate to HLH.",
"affiliations": "Childhood Cancer Research Unit, Department of Women's and Children's Health, Karolinska Institutet, Karolinska University Hospital Solna, Stockholm, Sweden.;Department of Medicine, Center for Infectious Medicine, Karolinska Institutet, Karolinska University Hospital Huddinge, Stockholm, Sweden.;Pediatric Allergy and Immunology Unit, Children's Hospital, Ain Shams University, Cairo, Egypt.;Bone Marrow and Stem Cell Transplantation Program, King Hussein Cancer Center, Amman, Jordan.;Department of Women's and Children's Health, Queen Silviás Childreńs Hospital, University of Gothenburg, Gothenburg, Sweden.;Shaukat Khanum Memorial Cancer Hospital & Research Center, Lahore, Pakistan.;Department of Oncology and Pediatrics, Aga Khan University, Karachi, Pakistan.;Institute for Research and Innovation on Health and Center for Predictive and Preventive Genetics of the IBMC-Institute for Cell and Molecular Biology, University of Porto, Portugal.;Hematology Service, University Clinic of Navarra, Pamplona, Spain.;Division of Pediatric Hematology, Hacettepe University, Ankara, Turkey.;Clinical Genetics Unit, Department of Molecular Medicine and Surgery, Center for Molecular Medicine, Karolinska Institutet, Karolinska University Hospital Solna, Stockholm, Sweden.;Department of Medicine, Center for Infectious Medicine, Karolinska Institutet, Karolinska University Hospital Huddinge, Stockholm, Sweden.;Childhood Cancer Research Unit, Department of Women's and Children's Health, Karolinska Institutet, Karolinska University Hospital Solna, Stockholm, Sweden.;Childhood Cancer Research Unit, Department of Women's and Children's Health, Karolinska Institutet, Karolinska University Hospital Solna, Stockholm, Sweden.",
"authors": "Tesi|Bianca|B|;Chiang|Samuel C C|SC|;El-Ghoneimy|Dalia|D|;Hussein|Ayad Ahmed|AA|;Langenskiöld|Cecilia|C|;Wali|Rabia|R|;Fadoo|Zehra|Z|;Silva|João Pinho|JP|;Lecumberri|Ramón|R|;Unal|Sule|S|;Nordenskjöld|Magnus|M|;Bryceson|Yenan T|YT|;Henter|Jan-Inge|JI|;Meeths|Marie|M|",
"chemical_list": "C510468:PRF1 protein, human; D054353:Perforin",
"country": "United States",
"delete": false,
"doi": "10.1002/pbc.25646",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1545-5009",
"issue": "62(12)",
"journal": "Pediatric blood & cancer",
"keywords": "hemophagocytic lymphohistiocytosis; lymphocyte cytotoxicity; lymphoma; missense mutation; perforin",
"medline_ta": "Pediatr Blood Cancer",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D005260:Female; D006689:Hodgkin Disease; D006801:Humans; D008180:Lupus Erythematosus, Systemic; D051359:Lymphohistiocytosis, Hemophagocytic; D008297:Male; D020125:Mutation, Missense; D009422:Nervous System Diseases; D054353:Perforin; D012189:Retrospective Studies",
"nlm_unique_id": "101186624",
"other_id": null,
"pages": "2094-100",
"pmc": null,
"pmid": "26184781",
"pubdate": "2015-12",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Spectrum of Atypical Clinical Presentations in Patients with Biallelic PRF1 Missense Mutations.",
"title_normalized": "spectrum of atypical clinical presentations in patients with biallelic prf1 missense mutations"
} | [
{
"companynumb": "PHHY2015SE086189",
"fulfillexpeditecriteria": "1",
"occurcountry": "SE",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ETOPOSIDE"
},
"drugadditional": null,
"drug... |
{
"abstract": "During the nosocomial coronavirus disease 2019 (COVID-19) outbreak, patients with hematological disorders showed poorer survival and aggressive course of respiratory failure than patients with other disorders. Two patients with immune thrombocytopenia who were being treated with prednisolone experienced severe respiratory failure related to COVID-19 and finally died. Patients who were yet to achieve remission and those receiving chemotherapy with steroids had a higher risk of death, and the mortality rate was higher in patients with lymphoid malignancies, including lymphoma and myeloma, than in those with myeloid malignancies. We describe the case of a myeloma patient in whom high-dose steroid administration was able to achieve considerable resolution of respiratory failure. In patients with unsuccessful seroconversion of anti-SARS-CoV-2 IgG antibodies, recurrence or re-infection of COVID-19 should be closely monitored.",
"affiliations": "Eiju General Hospital.",
"authors": "Hagihara|Masao|M|",
"chemical_list": "D000914:Antibodies, Viral",
"country": "Japan",
"delete": false,
"doi": "10.11406/rinketsu.62.1178",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0485-1439",
"issue": "62(8)",
"journal": "[Rinsho ketsueki] The Japanese journal of clinical hematology",
"keywords": "Anti-SARS-CoV-2 IgG; Coronavirus disease 2019; Nosocomial infection; Survival",
"medline_ta": "Rinsho Ketsueki",
"mesh_terms": "D000914:Antibodies, Viral; D000086382:COVID-19; D006801:Humans; D007564:Japan; D009364:Neoplasm Recurrence, Local; D058873:Pandemics; D000086402:SARS-CoV-2",
"nlm_unique_id": "2984782R",
"other_id": null,
"pages": "1178-1185",
"pmc": null,
"pmid": "34497205",
"pubdate": "2021",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Practical guidance for the management of patients with hematological disorders during the coronavirus disease 2019 pandemic in Japan.",
"title_normalized": "practical guidance for the management of patients with hematological disorders during the coronavirus disease 2019 pandemic in japan"
} | [
{
"companynumb": "JP-ROCHE-2935876",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RITUXIMAB"
},
"drugadditional": "3",
"drugad... |
{
"abstract": "Post transplant lymphoproliferative disorder include a spectrum of conditions occurring in immunosuppressed post transplant recipients, lymphoma being the most ominous. (18)F-fludeoxyglucose positron emission tomography with computed tomography CT) is the current imaging gold standard for lymphoma imaging as it allows both morphological and functional assessment. CT and/or conventional magnetic resonance imaging (MRI) are used for morphological evaluation in transplant recipients. Integrating diffusion weighted imaging with apparent diffusion coefficient analysis in MRI protocol enhances its sensitivity and may prove invaluable in response assessment in transplant recipients.",
"affiliations": "Department of Radiology, All India Institute of Medical Sciences, Ansari Nagar, New Delhi, India.;Department of Radiology, All India Institute of Medical Sciences, Ansari Nagar, New Delhi, India.;Department of Radiology, All India Institute of Medical Sciences, Ansari Nagar, New Delhi, India.;Department of Nephrology, All India Institute of Medical Sciences, Ansari Nagar, New Delhi, India.",
"authors": "Singh|A|A|;Das|C J|CJ|;Gupta|A K|AK|;Bagchi|S|S|",
"chemical_list": null,
"country": "India",
"delete": false,
"doi": "10.4103/0971-4065.163430",
"fulltext": "\n==== Front\nIndian J NephrolIndian J NephrolIJNIndian Journal of Nephrology0971-40651998-3662Medknow Publications & Media Pvt Ltd India IJN-26-21210.4103/0971-4065.163430Case ReportRole of diffusion weighted imaging in diagnosis of post transplant lymphoproliferative disorders: Case reports and review of literature Singh A. Das C. J. Gupta A. K. Bagchi S. 1Department of Radiology, All India Institute of Medical Sciences, Ansari Nagar, New Delhi, India1 Department of Nephrology, All India Institute of Medical Sciences, Ansari Nagar, New Delhi, IndiaAddress for correspondence: Dr. C. J. Das, Department of Radiology, All India Institute of Medical Sciences, Ansari Nagar, New Delhi - 110 029, India. E-mail: dascj@yahoo.comMay-Jun 2016 26 3 212 215 Copyright: © 2016 Indian Journal of Nephrology2016This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.Post transplant lymphoproliferative disorder include a spectrum of conditions occurring in immunosuppressed post transplant recipients, lymphoma being the most ominous. 18F-fludeoxyglucose positron emission tomography with computed tomography CT) is the current imaging gold standard for lymphoma imaging as it allows both morphological and functional assessment. CT and/or conventional magnetic resonance imaging (MRI) are used for morphological evaluation in transplant recipients. Integrating diffusion weighted imaging with apparent diffusion coefficient analysis in MRI protocol enhances its sensitivity and may prove invaluable in response assessment in transplant recipients.\n\n18F-fludeoxyglucose positron emission tomography with computed tomographydiffusion weighted imagingmagnetic resonance imagingpost transplant lymphoproliferative disorders\n==== Body\nIntroduction\nPost transplant lymphoproliferative disorders (PTLD) include myriad of lymphoproliferative manifestations occurring in transplant recipients ranging from innocuous flu like conditions (mononucleosis) to the development of aggressive widely disseminated malignancy (lymphoma).[1] PTLD is a rare, but potentially fatal complication seen in ~1% of transplant recipients (solid and stem cell).[12]\n\nRisk factors for developing PTLD are multifactorial which includes Epstein–Barr virus (EBV) seronegativity, immunosuppression administered to recipients (intensity, amount, and duration), co-existing cytomegalo virus or hepatitis C infection, cadaveric donor and use of anti CD3 monoclonal antibody. The incidence of PTLD is higher in pediatric patients who are usually EBV seronegative.[13]. The overall incidence of PTLD is least in renal transplant (nearly 13%) as compared to other solid organ transplant recipients (~15%).[4] PTLD most frequently involves extra nodal sites with reportedly highest incidence in gastro-intestinal tract and allograft. However, it can involve any organ including skin and brain.[15] Clinically, PTLD is a great masquerader, the diagnosis of which rests on a high index of clinical suspicion. It can manifests with a variety of nonspecific symptoms that may resemble any other post transplant complications including graft rejection and sepsis.[16]\n\nCompared to lymphoma occurring in general population, PTLD lymphoma carries a dismal prognosis (nearly 30–60% mortality)[157] with an aggressive downhill course; hence, timely diagnosis is warranted. As majority of these cases are diagnosed on imaging, radiologists should be familiar with its morphological gamut. Further, timely diagnosis will expedite the management which in most cases consists of mere reduction of the degree of immunosuppresant only.\n\nCase Reports\nCase 1\nA 36 years old male presented in emergency with complaints of fever, weight loss, and vague upper abdominal pain of 1-month duration. Renal allograft transplantation had been done 1-year back and he was kept on immunosuppresants (azathioprine, cyclosporine and prednisolone). Ultrasonography (USG) abdomen revealed multiple conglomerate as well discrete hypoechoic solid lesions in upper abdomen in mesentery and peripancreatic locations. Contrast enhanced computed tomography (CECT) abdomen showed multiple non-necrotic, non calcified lesions in central mesentery and upper retroperitoneum [Figure 1a]. Bowel and vascular encasement were present with no obstruction or luminal compromise. On magnetic resonance imaging (MRI), lesions were mildly hyperintense on T2-weighted image, however, marked diffusion restriction was present with corresponding hypointensity on apparent diffusion coefficient (ADC) images [Figure 1b–e]. Provisional diagnosis of PTLD related lymphoma was kept. USG guided biopsy revealed diffuse large B-cell lymphoma. Subsequently immunosuppressants doses were lowered and chemotherapy started. Follow-up MRI 2 months later revealed complete resolution of lesions.\n\nFigure 1 (a) Contrast enhanced computed tomography abdomen showing homogeneously hypodense conglomerate and discrete circumscribed lesions (arrow) in mesentery and peripancreatic locations. Axial (b) and coronal. (c) T2-weighted fat suppressed images showing mild T2 hyperintensity (arrow) with restricted diffusion on DWI (d) and ADC hypointensity (e)\n\nCase 2\nA 40 years old male renal transplant recipient came to emergency with vomiting and jaundice, 2 years post transplant, maintained on immunosuppression (cyclosporine and prednisolone). USG showed mild bilobar intrahepatic biliary dilatation and dilated common bile duct (CBD). CECT abdomen revealed circumferential nodular hypodense mural thickening involving second part of duodenum causing mild upstream dilatation of CBD and intrahepatic biliary radicles [Figure 2a]. MRI done 2 weeks later showed similar findings with mildly T2 hypointense mural thickening involving second part of duodenum showing markedly restricted diffusion and hypointensity on ADC images [Figure 2b–e]. Degree of proximal CBD dilatation and intrahepatic biliary dilatation had increased. Upper gastrointestinal (GI) endoscopy and biopsy revealed diffuse large B-cell lymphoma. Immunnosuppressants were stopped and patient was put on chemotherapy. However, the patient succumbed to his illness 15 days after initiation of chemotherapy due to fungal pneumonia.\n\nFigure 2 (a) Contrast enhanced computed tomography abdomen coronal reformat showing circumferential infiltrative nodular hypodense mural thickening involving second part of duodenum (arrow) with mild upstream dilatation of intrahepatic biliary radicals and common bile duct. (b) Coronal T2-weighted image showing mild T2 hyperintense duodenal mural thickening (arrow) with marked diffusion restriction on diffusion weighted imaging (c and d) and hypointensity on corresponding ADC images (e)\n\nDiscussion\nPTLD of abdomen can present with nonspecific symptoms like pyrexia of unknown origin, weight loss, irritability, lymphadenopathy, or more specific symptoms which may vary from indolent pharyngitis and diarrhea to acute abdomen due to obstruction, GI bleed or perforation due to its higher tendency for ulceration as compared to lymphoma occurring in immunocompetent individuals.[8910]\n\nPTLD related lymphoma most commonly involves gastrointestinal tract (GIT), followed by the central nervous system and kidneys.[10] Distal small intestine is the most common hollow viscera to be involved, followed by proximal colon, stomach, duodenum, and esophagus. For GIT associated PTLD, pan endoscopy remains useful tool for the initial diagnosis, management, and treatment.[3] CECT is the most widespread imaging modality in diagnosing lymphoma due to its relative low cost and easy availability. Diagnosis of PTLD on CECT rests on morphological evaluation with the lesions being solid and either hypo or nonenhancing. Failure to provide functional information coupled with inability to distinguish residual disease from fibrosis remains its lacunae.[2101112] 18F-fludeoxyglucose positron emission tomography with computed tomography (18 F-FDG PET/CT) is currently the imaging gold standard for lymphoma evaluation with lesions being FDG avid. It provides the dual advantage of providing both morphological and functional information, thus proving invaluable in diagnosing, staging, and response assessment. Sensitivity and specificity of PET/CT in initial staging approaches 100% regardless of lymphoma grade. Moreover, quantifying standardized uptake value helps in assessing metabolic activity in tumor and may help in vitro diagnosing the aggressiveness of lymphoma. However, high radiation exposure and costs remain its limitations.[1112131415]\n\nConventional MRI sequences, much like CT helps in morphological assessment only. However, due to its superior spatial resolution and radiation free modality, it scores over CT, hence benefitting in evaluating extra-nodal disease. Due to compromised renal function in postrenal transplant recipients, iodinated nonionic contrast usage is discouraged; hence MRI is preferred over CECT for morphological assessment if available.[13]\n\nLymphoma is hypointense on T1-weighted, mildly hyperintense on T2 weighted sequences and shows minimal enhancement if any on postcontrast images. Diffusion weighted imaging (DWI) is increasingly being used in lymphoma evaluation on which it shows restricted diffusion due to hypercellularity.[11] Calculation of ADC value provide quantitative information which adds to the functional assessment of disease, thus, helping in staging, grading, and response assessment following treatment.[11]\n\nBy adding whole body diffusion weighted imaging with background suppression (DWIBS) in lymphoma assessment protocol, MRI is comparable to FDG-PET/CT as it also provides one stop shop for diagnosis, staging and therapeutic response assessment. Furthermore, inverted gray scale DWIBS images are alike PET images with added advantage of increased lesion conspicuity and no radiation exposure.[1011]\n\nTo the best of our knowledge, no study in literature until date has described the incremental utility of DWI in management of PTLD. Due to increased accuracy in lymphoma detection we recommend incorporation of DWI in while performing MRI in PTLD which not only guide tissue sampling of these lesions but can also be very useful to evaluate treatment response in terms of ADC calculation.\n\nFinancial support and sponsorship\nNil.\n\nConflicts of interest\nThere are no conflicts of interest.\n==== Refs\nReferences\n1 Bakker NA van Imhoff GW Verschuuren EA van Son WJ Presentation and early detection of post-transplant lymphoproliferative disorder after solid organ transplantation Transpl Int 2007 20 207 18 17291214 \n2 Vrachliotis TG Vaswani KK Davies EA Elkahammas EA Bennett WF Bova JG CT findings in posttransplantation lymphoproliferative disorder of renal transplants AJR Am J Roentgenol 2000 175 183 8 10882272 \n3 Cader RA Mohd R Gafor HA Kong NC Post transplant lymphoproliferative disorder: A case series and review of literature EXCLI J 2013 12 144 9 26417223 \n4 Chia SC Chau YP Tan YM Late-onset post-transplant lymphoproliferative disease presenting as massive occult gastrointestinal haemorrhage Singapore Med J 2008 49 e117 20 18465033 \n5 O'Connor JA Cogley C Burton M Lancaster-Weiss K Cordle RA Posttransplantation lymphoproliferative disorder: Endoscopic findings J Pediatr Gastroenterol Nutr 2000 31 458 61 11045850 \n6 Badham K Mirchandani A Arumainayagam N West DR Epstein-Barr virus associated with a post-transplant lymphoproliferative disorder presenting as isolated gastrointestinal tract bleeding Endoscopy 2007 39 Suppl 1 E64 5 17323282 \n7 Caillard S Lelong C Pessione F Moulin B French PTLD Working Group. Post-transplant lymphoproliferative disorders occurring after renal transplantation in adults: Report of 230 cases from the French Registry Am J Transplant 2006 6 2735 42 17049061 \n8 Loren AW Porter DL Stadtmauer EA Tsai DE Post-transplant lymphoproliferative disorder: A review Bone Marrow Transplant 2003 31 145 55 12621474 \n9 Mishra S Khan NH Bonsal R Kher V Ahlawat R Yadav RV Lymphoproliferative disorder following renal transplantation Indian J Transplant 2005 1 33 6 \n10 Camacho JC Moreno CC Harri PA Aguirre DA Torres WE Mittal PK Posttransplantation lymphoproliferative disease: Proposed imaging classification Radiographics 2014 34 2025 38 25384299 \n11 Gu J Chan T Zhang J Leung AY Kwong YL Khong PL Whole-body diffusion-weighted imaging: The added value to whole-body MRI at initial diagnosis of lymphoma AJR Am J Roentgenol 2011 197 W384 91 21862763 \n12 Juweid ME Stroobants S Hoekstra OS Mottaghy FM Dietlein M Guermazi A Use of positron emission tomography for response assessment of lymphoma: Consensus of the Imaging Subcommittee of International Harmonization Project in Lymphoma J Clin Oncol 2007 25 571 8 17242397 \n13 Ali MG Coakley FV Hricak H Bretan PN Complex posttransplantation abnormalities of renal allografts: Evaluation with MR imaging Radiology 1999 211 95 100 10189458 \n14 Schöder H Noy A Gönen M Weng L Green D Erdi YE Intensity of 18fluorodeoxyglucose uptake in positron emission tomography distinguishes between indolent and aggressive non-Hodgkin's lymphoma J Clin Oncol 2005 23 4643 51 15837966 \n15 La Fougère C Hundt W Bröckel N Pfluger T Haug A Scher B Value of PET/CT versus PET and CT performed as separate investigations in patients with Hodgkin's disease and non-Hodgkin's lymphoma Eur J Nucl Med Mol Imaging 2006 33 1417 25 16858568\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "0971-4065",
"issue": "26(3)",
"journal": "Indian journal of nephrology",
"keywords": "18F-fludeoxyglucose positron emission tomography with computed tomography; diffusion weighted imaging; magnetic resonance imaging; post transplant lymphoproliferative disorders",
"medline_ta": "Indian J Nephrol",
"mesh_terms": null,
"nlm_unique_id": "8914356",
"other_id": null,
"pages": "212-5",
"pmc": null,
"pmid": "27194838",
"pubdate": "2016",
"publication_types": "D002363:Case Reports",
"references": "25384299;18465033;10189458;17291214;21862763;17049061;17242397;12621474;15837966;10882272;16858568;26417223;17323282;11045850",
"title": "Role of diffusion weighted imaging in diagnosis of post transplant lymphoproliferative disorders: Case reports and review of literature.",
"title_normalized": "role of diffusion weighted imaging in diagnosis of post transplant lymphoproliferative disorders case reports and review of literature"
} | [
{
"companynumb": "IN-WATSON-2016-12273",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "CYCLOSPORINE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nAlthough the antidiarrheal loperamide is a potent opiate, it does not produce opioid central nervous system effects at usual doses in patients. On the basis of in vitro studies demonstrating that loperamide is a substrate for the adenosine triphosphate-dependent efflux membrane transporter P-glycoprotein, we postulated that inhibition of P-glycoprotein with quinidine would increase entry of loperamide into the central nervous system with resultant respiratory depression.\n\n\nMETHODS\nTo test this hypothesis, a 16-mg dose of loperamide was administered to eight healthy male volunteers in the presence of either 600 mg quinidine, a known inhibitor of P-glycoprotein, or placebo. Central nervous system effects were measured by evaluation of the respiratory response to carbon dioxide rebreathing as a measure of opiate-induced respiratory depression.\n\n\nRESULTS\nLoperamide produced no respiratory depression when administered alone, but respiratory depression occurred when loperamide (16 mg) was given with quinidine at a dose of 600 mg (P < .001). These changes were not explained by increased plasma loperamide concentrations.\n\n\nCONCLUSIONS\nThis study therefore demonstrates first the potential for important drug interactions to occur by a new mechanism, namely, inhibition of P-glycoprotein, and second that the lack of respiratory depression produced by loperamide, which allows it to be safely used therapeutically, can be reversed by a drug causing P-glycoprotein inhibition, resulting in serious toxic and abuse potential.",
"affiliations": "Division of Clinical Pharmacology, Vanderbilt University School of Medicine, Nashville, TN 37232-6602, USA.",
"authors": "Sadeque|A J|AJ|;Wandel|C|C|;He|H|H|;Shah|S|S|;Wood|A J|AJ|",
"chemical_list": "D020168:ATP Binding Cassette Transporter, Subfamily B, Member 1; D000317:Adrenergic alpha-Antagonists; D000930:Antidiarrheals; D002245:Carbon Dioxide; D008139:Loperamide; D011802:Quinidine",
"country": "United States",
"delete": false,
"doi": "10.1067/mcp.2000.109156",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0009-9236",
"issue": "68(3)",
"journal": "Clinical pharmacology and therapeutics",
"keywords": null,
"medline_ta": "Clin Pharmacol Ther",
"mesh_terms": "D020168:ATP Binding Cassette Transporter, Subfamily B, Member 1; D000317:Adrenergic alpha-Antagonists; D000328:Adult; D000930:Antidiarrheals; D001921:Brain; D002245:Carbon Dioxide; D004311:Double-Blind Method; D004347:Drug Interactions; D006801:Humans; D008139:Loperamide; D008297:Male; D011802:Quinidine; D012119:Respiration",
"nlm_unique_id": "0372741",
"other_id": null,
"pages": "231-7",
"pmc": null,
"pmid": "11014404",
"pubdate": "2000-09",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article; D016449:Randomized Controlled Trial; D013487:Research Support, U.S. Gov't, P.H.S.",
"references": null,
"title": "Increased drug delivery to the brain by P-glycoprotein inhibition.",
"title_normalized": "increased drug delivery to the brain by p glycoprotein inhibition"
} | [
{
"companynumb": "US-JNJFOC-20180541233",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LOPERAMIDE"
},
"drugadditional": "3",
"... |
{
"abstract": "Chronic allograft dysfunction (CAD), defined as the replacement of functional renal tissue by extracellular matrix proteins, remains the first cause of graft loss. The aim of our study was to explore the potential role of the cannabinoid receptor 1 (CB1) during CAD. We retrospectively quantified CB1 expression and correlated it with renal fibrosis in 26 kidney-transplanted patients who underwent serial routine kidney biopsies. Whereas CB1 expression was low in normal kidney grafts, it was highly expressed during CAD, especially in tubular cells. CB1 expression significantly increased early on after transplantation, from day 0 (D0) to month 3 post-transplant (M3) (22.5% ± 15.4% vs 33.4% ± 13.8%, P < .01), and it remained stable thereafter. CB1 expression correlated with renal fibrosis at M3 (P = .04). In an in vitro model of tacrolimus-mediated fibrogenesis by tubular cells, we found that tacrolimus treatment significantly induced mRNA and protein expression of CB1 concomitantly to col3a1 and col4a3 up regulation. Administration of rimonabant, a CB1 antagonist, blunted collagen synthesis by tubular cells (P < .05). Overall, our study strongly suggests an involvement of the cannabinoid system in the progression of fibrosis during CAD and indicates the therapeutic potential of CB1 antagonists in this pathology.",
"affiliations": "Inserm UMR_S 1155, Hôpital Tenon, Paris, France.;Galapagos SASU, Romainville, France.;Inserm UMR_S 1155, Hôpital Tenon, Paris, France.;Inserm UMR_S 1155, Hôpital Tenon, Paris, France.;AP-HP, Service d'Anatomie et de Cytologie Pathologiques, Hôpital Bicêtre, Université Paris Sud, Le Kremlin Bicêtre, France.;AP-HP, Service d'Anatomie et de Cytologie Pathologiques, Hôpital Bicêtre, Université Paris Sud, Le Kremlin Bicêtre, France.;AP-HP, Service de Néphrologie, Hôpital Bicêtre, Université Paris Sud, Le Kremlin Bicêtre, France.;AP-HP, Service d'Hépatologie Pédiatrique, Hôpital Bicêtre, Le Kremlin Bicêtre, France.;AP-HP, Service d'Anatomie et de Cytologie Pathologiques, Hôpital Bicêtre, Université Paris Sud, Le Kremlin Bicêtre, France.;Inserm UMR_S 1155, Hôpital Tenon, Paris, France.;Inserm UMR_S 1155, Hôpital Tenon, Paris, France.",
"authors": "Dao|Myriam|M|0000-0001-5505-1364;Lecru|Lola|L|;Vandermeersch|Sophie|S|;Ferreira|Mélanie|M|;Ferlicot|Sophie|S|;Posseme|Katia|K|;Dürrbach|Antoine|A|;Hermeziu|Bogdan|B|;Mussini|Charlotte|C|;Chatziantoniou|Christos|C|;François|Hélène|H|",
"chemical_list": "D007166:Immunosuppressive Agents; D043884:Receptor, Cannabinoid, CB1; D016559:Tacrolimus",
"country": "England",
"delete": false,
"doi": "10.1111/jcmm.14570",
"fulltext": "\n==== Front\nJ Cell Mol MedJ. Cell. Mol. Med10.1111/(ISSN)1582-4934JCMMJournal of Cellular and Molecular Medicine1582-18381582-4934John Wiley and Sons Inc. Hoboken 10.1111/jcmm.14570JCMM14570Original ArticleOriginal ArticlesThe cannabinoid receptor 1 is involved in renal fibrosis during chronic allograft dysfunction: Proof of concept DAO et al.Dao Myriam https://orcid.org/0000-0001-5505-1364\n1\n\n2\nLecru Lola \n3\nVandermeersch Sophie \n1\nFerreira Mélanie \n1\nFerlicot Sophie \n4\nPosseme Katia \n4\nDürrbach Antoine \n5\nHermeziu Bogdan \n6\nMussini Charlotte \n4\nChatziantoniou Christos \n1\nFrançois Hélène \n1\n\n7\nhelene.francois@aphp.fr \n1 \nInserm UMR_S 1155\nHôpital Tenon\nParis\nFrance\n\n2 \nAPHP, Service de Néphrologie Adulte\nHôpital Necker\nParis\nFrance\n\n3 \nGalapagos SASU\nRomainville\nFrance\n\n4 \nAP‐HP, Service d'Anatomie et de Cytologie Pathologiques\nHôpital Bicêtre, Université Paris Sud\nLe Kremlin Bicêtre\nFrance\n\n5 \nAP‐HP, Service de Néphrologie\nHôpital Bicêtre, Université Paris Sud\nLe Kremlin Bicêtre\nFrance\n\n6 \nAP‐HP, Service d'Hépatologie Pédiatrique\nHôpital Bicêtre\nLe Kremlin Bicêtre\nFrance\n\n7 \nAP‐HP, Unité de Néphrologie et de Transplantation rénale, Hôpital Tenon\nSorbonne Université\nParis\nFrance\n* Correspondence\n\nHélène François, Service d'Urgence Néphrologique et de Transplantation Rénale, INSERM UMR_S1155, Hôpital Tenon, 4 rue de la Chine, 75020 Paris, France.\n\nEmail: helene.francois@aphp.fr\n30 8 2019 11 2019 23 11 10.1111/jcmm.v23.117279 7288 18 1 2019 14 5 2019 28 6 2019 © 2019 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.Abstract\nChronic allograft dysfunction (CAD), defined as the replacement of functional renal tissue by extracellular matrix proteins, remains the first cause of graft loss. The aim of our study was to explore the potential role of the cannabinoid receptor 1 (CB1) during CAD. We retrospectively quantified CB1 expression and correlated it with renal fibrosis in 26 kidney‐transplanted patients who underwent serial routine kidney biopsies. Whereas CB1 expression was low in normal kidney grafts, it was highly expressed during CAD, especially in tubular cells. CB1 expression significantly increased early on after transplantation, from day 0 (D0) to month 3 post‐transplant (M3) (22.5% ± 15.4% vs 33.4% ± 13.8%, P < .01), and it remained stable thereafter. CB1 expression correlated with renal fibrosis at M3 (P = .04). In an in vitro model of tacrolimus‐mediated fibrogenesis by tubular cells, we found that tacrolimus treatment significantly induced mRNA and protein expression of CB1 concomitantly to col3a1 and col4a3 up regulation. Administration of rimonabant, a CB1 antagonist, blunted collagen synthesis by tubular cells (P < .05). Overall, our study strongly suggests an involvement of the cannabinoid system in the progression of fibrosis during CAD and indicates the therapeutic potential of CB1 antagonists in this pathology.\n\ncannabinoid receptor 1chronic allograft dysfunctionrenal fibrosisrenal transplantation source-schema-version-number2.0component-idjcmm14570cover-dateNovember 2019details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_NLMPMC version:5.7.0 mode:remove_FC converted:28.10.2019\n\n\nDao \nM \n, \nLecru \nL \n, \nVandermeersch \nS \n, et al. The cannabinoid receptor 1 is involved in renal fibrosis during chronic allograft dysfunction: Proof of concept . J Cell Mol Med . 2019 ;23 :7279 –7288 . 10.1111/jcmm.14570 \n\n\n\n\nData Availability Statement: ‘The data that support the findings of this study are available from the corresponding author upon reasonable request.’\n==== Body\n1 INTRODUCTION\nThe progressive and inevitable impairment of renal graft function, called chronic allograft dysfunction (CAD), remains the first cause of graft loss.1 CAD corresponds to the replacement of functional renal tissue by extracellular matrix (ECM) proteins, mainly collagens, leading to both interstitial fibrosis and tubular atrophy (IF/TA). Other histological damages include glomerulosclerosis, splitting of glomerular capillary basement membranes and vascular intimal hyperplasia.2 Because this process is multifactorial and complex, there is still to date no efficient treatment of CAD.3, 4, 5, 6, 7 CAD is a multifactorial process in which a lot of immunological and non‐immunological causes are involved,3, 4, 5, 6, 7 related to donor,8, 9 recipient, organ conservation and transfer,10 surgery, rejection, recurrence of primary renal diseases… Antibody‐mediated rejection has recently emerged as one of the major cause of CAD.7, 11, 12 Calcineurin inhibitor (CNI) nephrotoxicity has been considered for a long time as the most prominent cause of renal allograft failure, but its role may have been overstated. However, CNI toxicity is well demonstrated in other organ recipients and in native kidneys.13, 14, 15, 16 In the specific case of renal transplantation, CNI nephrotoxicity can produce renal fibrosis but progression to graft failure from CNI nephrotoxicity alone is uncommon.7, 11 However, renal fibrogenesis leading to IF/TA during CAD resembles what is seen during chronic kidney disease (CKD) in native kidneys. Therefore, a better understanding of renal fibrogenesis during CAD is an essential therapeutic approach.17\n\n\nWe and others have recently showed the potential role of the endocannabinoid system, and especially of the cannabinoid receptors 1 and 2 (CB1, CB2) in renal metabolic and non‐metabolic disease.18, 19, 20, 21, 22, 23, 24 CB1 is best known to be involved in the regulation of behaviour in the central nervous system and in metabolic pathways in peripheral tissues 25, 26, 27 whereas CB2 is mainly expressed in the immune system.28 Whereas expression of CB1 is low in normal kidneys,18, 29, 30 we previously found that its expression is increased in IgA nephropathy, acute interstitial nephritis and diabetic nephropathy.18 Experimental studies in animals showed that in injured kidneys, CB1 is expressed in various structures in glomeruli,18, 19, 20, 21, 31 especially in podocytes and mesangial cells, in the tubules,18, 32 in the interstitium18 and in vessels.18 Recent studies found that CB1 is involved in the development of renal disease during diabetes and/or obesity,19, 21, 22, 23, 24 both by its role on metabolism and through a direct action in podocytes and tubules. Our group previously demonstrated for the first time an anti‐fibrotic role of CB1 blockade in non‐metabolic experimental renal fibrosis in mice in the unilateral ureteral obstruction (UUO) model.18 In this model, both the pharmacological blockade and the genetic disruption of CB1 profoundly reduced the development of renal fibrosis. This effect was mainly due to a direct paracrine/autocrine role of CB1 in myofibroblasts, which are the final effector cells in renal fibrogenesis. We found that upon TGFβ stimulation, renal myofibroblasts expressed CB1 and secreted endocannabinoid ligands, whereas CB1 blockade reduced collagen synthesis. These results suggest that the CB1 pathway may be a major target against the development of renal fibrosis in various types of renal injury.33\n\n\nThe aim of the present study was to examine whether the activation of the CB1 receptor is involved in the progression of renal fibrosis during CAD. In the first part of our work, we quantified CB1 expression by immunohistochemistry (IHC) and a morphometry software, and we correlated it with renal fibrosis, Banff scoring and clinical data. In the second part, we studied the in vitro expression of CB1 after tubular injury induced by tacrolimus and the effects of rimonabant, a CB1 antagonist, in tacrolimus‐induced fibrogenesis, which we used as an in vitro model of CAD.\n\n2 MATERIALS AND METHODS\n2.1 Patients and kidney graft biopsies\nWe retrospectively included all kidney‐transplanted patients in Bicêtre hospital who received a kidney graft in 2012 and 2013 and who underwent a routine kidney graft biopsy at day 0 (D0), month 3 (M3) and month 12 (M12). Kidney donation followed the 2008 Declaration of Istanbul principles and the French Agence Nationale de la Biomedecine regulation. Informed written consent was given by the patients for the use of part of the biopsy for scientific purposes. All procedures and the use of tissues were performed in accordance with the Declaration of Helsinki principles. We reviewed clinical reports from the 26 patients. Biological tests were performed on blood samples harvested concurrently with the kidney allograft biopsy. Kidney graft biopsies were processed for routine light microscopy. Biopsy samples were fixed in formalin, acetic acid and alcohol (FAA) and sliced 3 µm thick. The slides were stained with Masson's trichrome, haematoxylin, eosin and saffron (HES), periodic acid Schiff and Jones methenamine silver stains. Biopsies were reviewed for histological features according to 2018 Banff recommendations.2 Semi‐quantitative scoring for acute and chronic lesions (glomerulitis, peritubular capillaritis, interstitial inflammation, total inflammation, tubulitis, intimal arteritis, allograft glomerulopathy, mesangial matrix increase, interstitial fibrosis, tubular atrophy, vascular fibrous intimal thickening and arteriolar hyaline thickening) and C4d immunostaining provided the morphologic basis for main diagnosis classification: normal biopsy or nonspecific changes (after exclusion of any diagnosis from the Banff Diagnostic Categories), antibody‐mediated changes, suspicious (borderline) for acute T cell–mediated rejection, T cell–mediated rejection, IF/TA, other changes not considered to be caused by acute or chronic rejection (such as BK‐virus nephropathy, CNI toxicity, acute tubular injury, recurrent disease, de novo glomerulopathy other than transplant glomerulopathy…).2\n\n\n2.2 Histopathological analysis of renal fibrosis\nInterstitial fibrosis (ci) and tubular atrophy (ct) were separately assessed using the Banff classification: respectively ci0 = interstitial fibrosis in up to 5% of cortical area; ci1 = interstitial fibrosis in 6 to 25% of cortical area (mild interstitial fibrosis); ci2 = interstitial fibrosis in 26 to 50% of cortical area (moderate interstitial fibrosis); ci3 = interstitial fibrosis >50% of cortical area (severe interstitial fibrosis) and ct0 = no tubular atrophy; ct1 = tubular atrophy in up to 25% of the area of cortical tubules; ct2 = tubular atrophy involving 26 to 50% of the area of cortical tubules; ct3 = tubular atrophy in >50% of the area of cortical tubules. Taking together, ci and ct allowed to semi‐quantitatively grade IF/TA according to Banff classification: grade I, mild (ci1 or ct1); grade II, moderate (ci2 or ct2); and grade III, severe (ci3 or ct3).2 To improve accuracy of interstitial fibrosis evaluation, renal biopsy sections (3 µm) were stained with Sirius red. Sirius red specifically stains collagen fibres. Renal cortex fibrosis was quantified using a computer‐based morphogenic analysis software (Calopix, Tribvn, Montrouge, France). The red positive area was expressed as a percentage of the entire cortical kidney section.\n\n2.3 Cannabinoid receptor 1 immunohistochemical staining\nCannabinoid receptor 1 immunohistochemical staining was performed using rabbit polyclonal anti‐CB1 antibody (Abcam; dilution 1/100). Epitope retrieval was achieved using heat‐mediated retrieval method in citrate buffer (10 mmol/L Sodium Citrate, 0.05% Tween 20, pH 6.0). Endogenous peroxidase activity was blocked by 0.3% hydrogen peroxide in methanol for 10 minutes. Primary CB1 antibody was incubated for 2h at room temperature. Horseradish peroxidase (HRP) secondary antibody was applied for 1h at room temperature. Staining was revealed by applying a 3'‐diaminobenzidine (DAB) kit (DakoCytomation). Appropriate positive and negative controls were run concurrently. Morphometric analyses and quantification were quantified using computer‐based morphogenic analysis software (Calopix, Tribvn,). The brown positive area was expressed as a percentage of the entire cortical kidney section.\n\n2.4 Cell cultures and treatments\nHuman proximal tubule epithelial cells (HK‐2) from American Type Culture Collection (ATCC) were cultured in Quantum 286 (Medium for epithelial cells, PAA, France) supplemented with 1% (v/v) penicillin/streptomycin, at 37°C in 95% air–5% CO2. The cells were subcultured at 80% confluence using 0.05% trypsin with 0.02% EDTA. Cells were used between passages 15 to 17. Murine proximal tubular epithelial cells (mPTEC) were isolated and cultured from C57/BL6 mice, as previously described.34 Cells were used between passages 5 to 9.\n\nTacrolimus was preserved as a stock solution (PROGRAF 5 mg/mL, Astellas). Working solution was prepared by extemporaneous mixture of stock solution in 100% ethanol. Rimonabant (Sanofi‐Aventis R&D) was preserved as a stock solution (10 mmol/L). Working solution was prepared by extemporaneous mixture of stock solution in DMSO.\n\n2.5 Real‐time quantitative PCR (RT‐qPCR)\nRNA was extracted from cells cultures using EZ‐10 Spin Column Total RNA Mini‐preps Super Kit (Bio Basic Inc) according to the manufacturer's instructions. RNA concentration was measured by NanoDrop1000 spectrophotometer (Thermo Scientific). cDNA was synthesized using Maxima First Strand cDNA Synthesis Kit (Thermo scientific), and PCR was performed using SYBR green and specific primers (Table 1) on a Light Cycler 480 (Roche). Expression levels were normalized to the house‐keeping gene GAPDH using Lightcycler advanced relative quantification programme (Roche).\n\nTable 1 Primers (Eurogentec) used for RT‐qPCR\n\nmRNA\tStrand\tSequence\t\ncnr1\tSense\t5′‐GGGCAAATTTCCTTGTAGCA‐3′\t\nAntisense\t5′‐GGCTCAACGTGACTGAGAAA‐3′\t\ncol3a1\tSense\t5′‐TCCCCTGGAATCTGTGAATC‐3′\t\nAntisense\t5′‐TGAGTCGAATTGGGGAGAAT‐3′\t\ncol4a3\tSense\t5′‐CACGGGTTCCAAAGGTGTAA‐3′\t\nAntisense\t5′‐AGTCCGTAAGGCCCGGTAT‐3′\t\ngapdh\tSense\t5′‐AGCTTGTCATCAACGGGAAG‐3′\t\nAntisense\t5′‐TTTGATGTTAGTGGGGTCTCG‐3′\t\nJohn Wiley & Sons, Ltd2.6 Western blotting\nCells were lysed in PhosphoP38 buffer containing protease inhibitors (Roche, Mannheim, Germany) and quantified by Bradford's method. Proteins were separated in a 7% SDS‐PAGE gel and transferred to a polyvinylidene fluoride membrane. Immunoblotting was performed using a rabbit anti CB1 (Abcam) diluted 1:800 or a rabbit beta‐actin diluted 1:5000 for loading control. The membranes were then probed with a HRP‐conjugated secondary antibody diluted 1:5,000 (Amersham), and the bands were detected by enhanced chemiluminescence using ECL Plus (Amersham). A PXi (Syngen) imaging system was used to reveal bands, and densitometric analysis was used for quantification. Membranes were then incubated with anti‐rabbit antibody conjugated to HRP (Millipore), and proteins were visualized by the addition of chemiluminescent HRP substrate (Immobilon Western, Millipore).\n\n2.7 Sirius red collagen assay\nTotal collagen content in the culture cell supernatant was quantified using the Sirius red collagen detection kit (Chondrex) according to the manufacturer's instructions. Each supernatant was diluted in 1:2.5 in 0.05 mol/L. Optical density was read at 530 nm against the reagent blank using a spectrophotometer (Xenius, SAFAS, Monaco).\n\n2.8 Statistical analyses\nDescriptive statistical methods (means, medians, standard deviations and ranges) were used to assess the distributions of variables. Associations between categorical variables were assessed with Fisher's exact test (2 groups) or chi‐square test (3 groups). Associations between quantitative variables were assessed with Mann‐Whitney test (2 groups) or Kruskal‐Wallis test (3 groups). Correlations between quantitative variables were assessed with Pearson product‐moment correlation coefficient. For all analyses, a P value <.05 was regarded as significant. Analyses were performed using the R software (version 3.2.0) and GraphPad 5.0.35\n\n\n3 RESULTS\n3.1 Patients\nWe selected patients transplanted in Bicêtre hospital between 2012 and 2013 who underwent a routine kidney biopsy at D0, M3 and M12. We included 26 patients in our study. The patients included 11 females and 15 males. The mean age at the time of kidney transplantation was 54 ± 13 years. The indications for kidney transplantation were hypertensive nephrosclerosis and/or diabetic nephropathy (n = 8), other glomerulopathies (n = 4), tubulointerstitial nephritis (n = 3), uropathy (n = 3) and autosomal dominant polycystic kidney disease (n = 2). Nephropathy remained undetermined in 3 patients. Patients received induction therapy with anti‐lymphocyte serum or basiliximab. They also received mycophenolate mofetil, corticosteroids and tacrolimus per local practice (mean through tacrolimus level at M3: 9.0 ± 3.9 ng/mL and at M12: 7.8 ± 4.4 ng/mL). Four patients received belatacept in place of calcineurin inhibitors. All patients received a kidney graft from a deceased donor. Among the donors, 22 were brain‐dead donors (8 standard donors [SD] and 14 extended criteria donors [ECD]) and 4 were cardiac‐dead donors (CDD) deceased after unforeseeable irreversible circulatory arrest (Maastricht 2). Donor age, history of diabetes or active smoking, use of catecholamines and serum creatinine were similar among the different groups of donors. As expected, vascular causes of deaths and prevalence of high blood pressure were more frequent in brain‐dead donors (respectively, SD 75%, ECD 71% vs CDD 0%, P = .02 and SD 63%, ECD 86% vs CDD 0%, P < .01).\n\n3.2 Histological features of renal biopsies at D0, M3 and M12 and renal graft function\nHistological features of the 78 renal biopsies, reviewed according to the 2018 Banff recommendations, are summarized in Table 2. They were similar by donor type (Table S1). In preimplantation biopsies, IF/TA was absent or mild in 24/26 samples (92%), respectively 10/26 (38%), and 14/26 (54%) biopsies. Preimplantation biopsies also exhibited mild to moderate lesions of arteriosclerosis (cv1 or cv2, 62%) and acute tubular necrosis (85%). The most relevant findings were a significant decrease of acute tubular necrosis (ATN) over time (85% at D0% vs 19% at M3 and M12, P < .01) and a significant increase of renal graft fibrosis (0.6 ± 0.7 at D0 vs 1.1 ± 0.9 at M3 and 1.3 ± 1.0 at M12, P = .04). At M3, mean creatininemia was 143 ± 59 µmol/L (median: 121 µmol/L, ranges: 69‐289 µmol/L) and mean estimated glomerular filtration rate (eGFR) was 47 ± 19 mL/min/1.73 m2 by CKD‐EPI. At M12, mean creatininemia slightly increased at 160 ± 75 µmol/L (median: 127 µmol/L, ranges: 69‐389 µmol/L) and mean GFR slightly decreased at 41 ± 19 mL/min/1.73 m2 (P = .5). Taken together, both the significant increase in IF/TA and the decline in eGFR established that CAD was developed in these patients.\n\nTable 2 Histological features of renal biopsies at D0, M3 and M12\n\n \tD0 (n = 26)\tM3 (n = 26)\tM12 (n = 26)\t\nP\n\t\nSpecimen adequacy according to the Banff recommendations\t\nAdequate samples (n)\t19\t15\t9\t.019\t\nLimit samples (n)\t6\t7\t11\t.28\t\nInadequate samples (n)\t1\t4\t6\t.13\t\nAcute lesions\t\nGlomerulitis «g»\tNA\t0.31 ± 0.55\t0 ± 0\t<.01\t\nPeritubular capillaritis «ptc»\tNA\t0.15 ± 0.37\t0.083 ± 0.41\t.23\t\nInterstitial inflammation «i»\tNA\t0.042 ± 0.20\t0.087 ± 0.29\t.55\t\nTotal inflammation «ti»\tNA\t0.38 ± 0.74\t0.5 ± 0.72\t.41\t\nTubulitis «t»\tNA\t0.08 ± 0.28\t0.4 ± 0.71\t.059\t\nIntimal arteritis «v»\tNA\t0 ± 0\t0 ± 0\tNA\t\nAcute tubular necrosis\t85% (n = 22)\t19% (n = 5)\t19% (n = 5)\t<.01\t\nChronic lesions\t\nSclerotic glomeruli\t10.3% ± 11.3%\t9.1% ± 11.6%\t13.9% ± 13.7%\t.42\t\nAllograft glomerulopathy «cg»\t0 ± 0\t0.08 ± 0.28\t0.042 ± 0.20\t.15\t\nMesangial matrix increase «mm»\t0.12 ± 0.59\t0.42 ± 0.86\t0.42 ± 0.88\t.077\t\nInterstitial fibrosis «ci»\t0.64 ± 0.7\t1.08 ± 0.93\t1.33 ± 0.96\t.040\t\nTubular atrophy «ct»\t0.4 ± 0.71\t0.81 ± 0.75\t1.13 ± 0.95\t.083\t\nVascular fibrous intimal thickening «cv»\t0.92 ± 0.89\t0.76 ± 0.78\t1.32 ± 0.99\t.62\t\nArteriolar hyaline thickening «ah»\t0.56 ± 0.92\t0.69 ± 0.84\t0.8 ± 0.91\t.33\t\nC4d (immunofluorescence)\t\nNegative (0 or minimal 1)\tNA\t88% (22/25)\t92% (22/24)\t1\t\nPositive (focal 2 or diffuse 3)\tNA\t12% (3/25)\t8% (2/24)\t1\t\nRejection\t\nAntibody‐mediated rejection\tNA\t12% (n = 3)a\n\t0\t.24\t\nBorderline rejection\tNA\t8% (n = 2)\t23% (n = 6)\t.13\t\nT cell–mediated rejection\tNA\t0\t0\tNA\t\nOther pathologies\t0\t2b\n\t8c\n\t \t\nNote\nDigital data are means ± standard deviation.\n\na Antibody‐mediated rejection included 1 acute antibody‐mediated rejection, 1 chronic active antibody‐mediated rejection and 1 ‘suspicious’ for acute antibody‐mediated rejection.\n\nb Other pathologies were 1 diabetic glomerulonephritis and 1 recurrence of focal segmental glomerulosclerosis.\n\nc Other pathologies were 1 diabetic glomerulonephritis, 2 BK‐polyomavirus‐associated nephropathy, 1 de novo membranous glomerulonephritis, 2 focal segmental glomerulosclerosis (including 1 recurrence of original disease), 1 acute bacterial pyelonephritis and 1 thrombotic micro‐angiopathy.\n\nJohn Wiley & Sons, Ltd3.3 Cannabinoid receptor 1 expression in kidney transplants during chronic allograft dysfunction\nWe found that 23% ± 15% of cortical area was positive for CB1 staining at D0 in preimplantation biopsies. CB1 expression at D0 was similar by donor type and by IF/TA grade. It was not associated with donor last creatininemia (Figure 1). At M3 and M12, whereas CB1 expression was low in normal graft, it was induced in many cell types during CAD (Figure 2) such as proximal and distal tubular epithelial cells, medium‐sized arteries and arterioles vascular smooth muscle cells, interstitial inflammatory infiltrate and glomeruli, mainly podocytes. Specifically, CB1 expression significantly increased from D0 to M3 (23% ± 15% of stained cortical area vs 33% ± 14%, P = .01) and then it remained increased up to M12 (33% ± 19% of stained cortical area) (Figure 3A and 3). Patients with stable interstitial fibrosis from D0 to M12 tended to have lower CB1 progression (n = 8, CB1 expression −0.62% ± 7.8%) than patients in whom interstitial fibrosis increased (n = 16, 14.1% ± 4.1%, P = .08) (Figure 3C). We also found a positive correlation between CB1 expression and renal fibrosis at M3 (P = .04, R = .44) but not at M12 (Figure 3D). This result may be due to a lack of power (only 35% biopsies were adequate according to Banff classification at M12). However, we did not find a significant correlation between CB1 expression and eGFR.\n\nFigure 1 Cannabinoid receptor 1 expression on preimplantation biopsies was not associated with donor characteristics. A, CB1 expression was similar by donor type. B, CB1 expression was not associated by IF/TA on preimplantation biopsies. C, Donor creatininemia at time of organ removal was not associated with CB1 expression. Abbreviations: CDD, cardiac death donor; ECD, extended criteria donor; IF/TA, interstitial fibrosis and tubular atrophy; SD, standard donor\n\nFigure 2 Cannabinoid receptor 1 expression in 3 mo biopsies of renal grafts developing CAD revealed by peroxidase immunohistochemistry. A, Absence of CAD: CB1 was not expressed. The biopsy was performed in a 66‐y‐old man who received a kidney graft from extended criteria donor. Early allograft history was unremarkable. M3 graft biopsy exhibited a normal graft according to the Banff classification, without lesions nor IF/TA. M3 creatininemia was 128 µmol/L and immunosuppressive regimen included prednisone, mycophenolate mofetil and tacrolimus (T0 4.5 ng/mL). B, CB1 expression in tubular epithelial cells. C, CB1 glomerular expression is mainly found in the podocyte (in the inset). D, CB1 expression in medium‐sized arteries: endothelial cells, smooth muscle cells of media and to a lesser extent intimal cells express CB1. E, CB1 expression in the interstitial inflammatory infiltrate. Bar scales = 50 µm. Abbreviations: CAD, chronic allograft dysfunction; IF/TA, interstitial fibrosis and tubular atrophy\n\nFigure 3 Cannabinoid receptor 1 expression is induced during CAD and correlates with renal fibrosis. A, Quantification of CB1 expression by a morphometry software (Calopix, Tribvn). *P < .05 and **P < .05 compared to D0. Means ± standard deviation. B, Illustrative case of CB1 expression at D0, M3 and M12 revealed by peroxidase immunohistochemistry. The biopsies were performed in a 68‐y‐old woman who received a kidney graft from an extended criteria donor. Preimplantation biopsy was normal according to Banff classification, with IF/TA grade 0. Creatininemia at organ removal was 89 µmol/L. From M3, graft biopsies exhibited IF/TA grade 1 according to the Banff classification, without other changes. At M3 and M12, creatininemia were, respectively, at 155 µmol/L and 122 µmol/L. Her immunosuppressive regimen included prednisone, mycophenolate mofetil and tacrolimus (T0 3.2 ng/mL at M3 and 4.3 ng/mL at M12). Quantification of CB1 expression by a morphometry software was 21% at D0, 48% at M3 and 57% at M12. C, Patients with unchanged ci from D0 to M12 tended to have less CB1 progression evaluated by a morphometry software (Calopix, Tribvn) (−0.62 ± 7.8 vs 14.1% ± 4.1%, P = .08). D, Correlation between CB1 expression and renal fibrosis assessed by morphometry software (Calopix, Tribvn) at M3 (n = 26, NA = 3, Pearson correlation test, P = .04, R = .44). Abbreviations: CAD, chronic allograft dysfunction; D0, day 0; IF/TA, interstitial fibrosis and tubular atrophy; M3, month 3; M12, month 12\n\n3.4 Cannabinoid receptor 1 expression in the tacrolimus‐induced model of tubule injury in vitro\nWe next studied the role of CNI in CB1 expression using HK‐2 as a model of CAD. We hypothesized that tubular stress induced by CNI would increase CB1 expression. Protein expression was evaluated by Western blot analysis. Tacrolimus significantly increased CB1 expression (n = 4, 3.5 ± 3.4 vs 1.0 ± 0, relative quantification after normalization, P = .03) (Figure 4). This result was confirmed by RT‐qPCR analysis on mPTEC. We found a significant increase in cnr1 (encoding for CB1) expression after 24 hours of treatment with tacrolimus (n = 4, 2.4 ± 0.7 vs 1.0 ± 0, relative quantification after normalization, P = .02).\n\nFigure 4 In vitro model of tacrolimus‐mediated fibrogenesis: tacrolimus increased CB1 expression, cnr1 (encoding for CB1) expression as well as col3a1 (encoding for Collagen 3) and col4a3 (encoding for Collagen 4). Cnr1, col3a1 and col4a3 expression were significantly blunted by rimonabant, a CB1 antagonist. A, Tacrolimus significantly increased CB1 expression (Western blot, n = 4, 3.5 ± 3.4 vs 1.0 ± 0, relative quantification after normalization, P = .03) in human proximal tubule epithelial cells (HK2) after 48 h of daily treatment with tacrolimus (FK) (10 ng/mL and 25 ng/mL). B, Expression of cnr1 mRNA evaluated by RT‐qPCR after 24 h of treatment (n = 4 for each group). *P < .05 vs ethanol 5 µL/mL. **P < 0.05 vs FK 10 µg/mL. C, Expression of col3a1 mRNA evaluated by RT‐qPCR after 24 h of treatment (n = 4 for each group). *P < 0.05 vs ethanol 5 µL/mL. **P < .05 vs FK 10 µg/mL. D, Expression of col4a3 mRNA evaluated by RT‐qPCR after 24 h of treatment (n = 4 for each group). *P < .05 vs ethanol 5 µL/mL. **P < .05 vs FK 10 µg/mL\n\n3.5 Cannabinoid receptor 1 blockade decreased expression of mesenchymal markers on mPETC in the tacrolimus‐induced model of renal injury\nIn addition, tacrolimus administration on epithelial tubular cells increased not only CB1 expression but also col3a1 (encoding for collagen III) and col4a3 (encoding for collagen IV) (Figure 4) and total collagen in cell supernatants (Figure S1). Addition of rimonabant, a CB1 inverse agonist, strongly blunted col3a1 and col4a3 expressions (Figure 4) and decreased total collagen in cell supernatants (Figure S1).\n\n4 DISCUSSION\nThe general objective of our research is to find new pathways in the development of renal interstitial fibrosis which is a key feature of CAD. In the present study, we establish for the first time an interaction between abnormal CB1 expression and progression of renal fibrosis, leading to CAD. We and others have previously published that CB1 is a major mediator in both metabolic renal disease 22, 23, 24 and non‐metabolic renal fibrosis,18 but its expression was never assessed in renal grafts. In our work, we found that 23% ± 15% of cortical area was positive for CB1 staining at D0 in preimplantation biopsies whereas IF/TA was absent or mild in most of preimplantation biopsies. Out of the 26 graft D0 biopsies, 10/26 (38%) showed no IF/TA and 14/26 (54%) mild IF/TA according to the Banff classification. In our previous study,18 we found a low level of CB1 expression (6.5% ± 4.8%, n = 5) in normal kidneys, which is lower than the D0 biopsies (ie 23% ± 15%). However, the preimplantation biopsies of our series do not correspond to the ‘normal’ category of our previous paper since they were performed at the end of the cold preservation period just before graft transplantation and as expected revealed significant ATN, which is the consequence of ischaemia (22/26, 85% revealed ATN). Indeed, previous studies described the metabolic consequences of ischaemia: compromised mitochondrial ATP production and activation of anaerobic glycolysis leading to ATN.36, 37, 38, 39 Therefore, the high level of D0 CB1 expression that we observed is not associated with concurrent IF/TA but is a consequence of cold ischaemia‐induced ATN. In addition, recent studies demonstrated that renal hypoxia‐induced ATN promotes tubulointerstitial fibrosis.40, 41, 42 Hence, our hypothesis is that CB1 expression at D0 is predictive for the development of kidney graft fibrosis as a consequence of ischaemia‐induced ATN and that early CB1 expression could be used as a biomarker.\n\nWe next studied CB1 expression at M3 and M12. CB1 expression was low in normal kidney grafts, similar to CB1 expression in normal native kidneys. Interestingly, we found that CB1 was induced in many different cell types during CAD: tubular epithelial cells, medium‐sized arteries (endothelial cells, smooth muscle cells of media), interstitial inflammatory infiltrate and glomeruli (mainly in podocytes). During CAD, CB1 expression significantly increased early on after transplantation, from D0 to M3 and it remained stable and high (around 30% of the total cortical area of the kidney graft) thereafter. This high expression corresponds to a plateau of CB1 expression which is reached at M3. It is noteworthy that in CAD, CB1 expression was higher (33% from M3) than in native nephropathies (18%) 18 and found mostly in tubules. We also found a parallel increase of IF/TA from D0 to M3, in accordance with the literature regarding the development of IF/TA assessed by routine kidney biopsies.43 We found that not only CB1 and IF/TA increased from D0 to M3 in kidney grafts but also that there was a significant positive correlation between CB1 expression and renal fibrosis at M3 (P = .04). Moreover, individual CB1 expression trajectories from D0 to M3 then M12 allowed to distinguish groups of patients: patients with stable interstitial fibrosis from D0 to M12 tended to have lower CB1 progression (n = 8, CB1 expression −0.62% ± 7.8%) than patients in whom interstitial fibrosis increased (n = 16, 14.1% ± 4.1%, P = .08). Therefore, CB1 could be a key player in the early steps of the development of IF/TA in kidney grafts or at least be a marker of renal fibrosis. Conversely to what we found in a small cohort of patients with various nephropathies in native kidneys,18 we could not establish that CB1 expression correlated with kidney graft function. This difference can be due to the slow decline of kidney graft function in our CAD cohort as well as the short‐term follow‐up. However, the development of IF/TA usually precedes kidney graft dysfunction. As previous studies demonstrated that early interstitial fibrosis was associated with chronic allograft dysfunction and kidney graft outcome,7, 44, 45, 46 early increased CB1 expression may be an early event before the development of IF/TA in kidney grafts. Such correlation between renal CB1 expression and renal fibrosis was never described in kidney grafts. We also suggested that CB1 is expressed by initially injured cells and by cells involved in synthesizing extracellular matrix proteins similarly to what is seen with the expression of DDR1, another important pathway in renal fibrosis.47 The high tubular expression of CB1 that we observed during CAD, using the exact same primary antibody and protocol that was previously used in the other types of CKD,18 enhances this hypothesis and strongly suggests a key role of CB1 in tubules in the IF/TA process.\n\nTo support this hypothesis, we tested whether CB1 expressed in tubules plays a causative role in the progression of fibrosis in an in vitro model mimicking CAD. Indeed, CAD is a multifactorial process in which a lot of immunological and non‐immunological causes are involved, including CNI toxicity. Since, it is impossible to completely reproduce the entire CAD process in vitro, we chose a simple model of epithelial‐to‐mesenchymal (EMT) transition in vitro. We therefore studied the effect of CNI on epithelial tubular cells because direct toxic effects of calcineurin inhibition on tubular function have been already well documented.48 Direct effects of CNI tubular toxicity include upregulation of TGFβ expression by tubular epithelial cells.49, 50, 51, 52 We developed a model of tacrolimus‐induced tubular injury and collagen synthesis in vitro which reproduces the first steps of CAD. We found increased expression of cnr1, col3a1 and col4a3 after treatment of mPETC by tacrolimus. Therefore, CB1 could be involved in the first steps of the development of CAD, possibly due to tacrolimus‐induced tubular epithelial injury. Interestingly, expression of col3a1 and col4a3 was significantly blunted by rimonabant, a CB1 antagonist (P < .05). Our results are in accordance with the recent literature where the specific deletion of CB1 in proximal tubules not only decreased renal fibrosis, injury and inflammation, but also preserved renal function in obesity‐induced nephropathy in mice.22\n\n\nTo conclude, our study strongly suggests an involvement of CB1 activation during CAD and paves the way to the development of CB1 inhibitors in CAD. However, the impact of cannabinoid system modulation on the evolution of chronic allograft dysfunction, as well as the cellular and molecular pathways involved, remains to be clarified.\n\nCONFLICT OF INTEREST\nThe authors confirm that there are no conflicts of interest.\n\nAUTHOR CONTRIBUTIONS\nMD: conception of the work, data collection, data analysis and interpretation, drafting the article; LL: conception of the work, data collection, critical revision of the article; SV: data collection, data analysis and interpretation; MF: data collection, data analysis and interpretation; SF: data analysis and interpretation; KP: data collection; AD: revision of the article and Head of the Division of the Bicetre nephrology and transplantation department from which the patients were recruited; BH: data collection; CM: data collection; CC: conception of the work, critical revision of the article; HF: conception of the work, data collection, data analysis and interpretation, drafting the article. All authors reviewed the manuscript.\n\nSupporting information\n \n\nClick here for additional data file.\n\n \n\nClick here for additional data file.\n\n DATA AVAILABILITY STATEMENT\n‘The data that support the findings of this study are available from the corresponding author upon reasonable request.’\n==== Refs\nREFERENCES\n1 \n\nHaas \nM \n. Chronic allograft nephropathy or interstitial fibrosis and tubular atrophy: what is in a name? \nCurr Opin Nephrol Hypertens . 2014 ;23 :245 ‐250 .24626060 \n2 \n\nRoufosse \nC \n, \nSimmonds \nN \n, \nClahsen‐van Groningen \nM \n, et al. A 2018 Reference guide to the banff classification of renal allograft pathology . Transplantation . 2018 ;102 (11 ):1795 ‐1814 .30028786 \n3 \n\nRacusen \nLC \n, \nRegele \nH \n. The pathology of chronic allograft dysfunction . Kidney Int . 2010 ;78 :S27 ‐S32 .\n4 \n\nPascual \nJ \n, \nPérez‐Sáez \nMJ \n, \nMir \nM \n, \nCrespo \nM \n. Chronic renal allograft injury: early detection, accurate diagnosis and management . Transplant Rev . 2012 ;26 :280 ‐290 .\n5 \n\nHeemann \nU \n, \nLutz \nJ \n. Pathophysiology and treatment options of chronic renal allograft damage . Nephrol Dial Transplant . 2013 ;28 :2438 ‐2446 .23625970 \n6 \n\nMaluf \nDG \n, \nDumur \nCI \n, \nSuh \nJL \n, et al. Evaluation of molecular profiles in calcineurin inhibitor toxicity post‐kidney transplant: input to chronic allograft dysfunction . Am J Transplant . 2014 ;14 :1152 ‐1163 .24698514 \n7 \n\nVenner \nJM \n, \nFamulski \nKS \n, \nReeve \nJ \n, \nChang \nJ \n, \nHalloran \nPF \n. Relationships among injury, fibrosis, and time in human kidney transplants . JCI Insight . 2016 ;1 :e85323 .27699214 \n8 \n\nMerion \nRM \n, \nAshby \nVB \n, \nWolfe \nRA \n, et al. Deceased‐donor characteristics and the survival benefit of kidney transplantation . JAMA . 2005 ;294 :2726 ‐2733 .16333008 \n9 \n\nAubert \nO \n, \nKamar \nN \n, \nVernerey \nD \n, et al. Long term outcomes of transplantation using kidneys from expanded criteria donors: prospective, population based cohort study . BMJ . 2015 ;351 :h3557 .26232393 \n10 \n\nWong \nG \n, \nTeixeira‐Pinto \nA \n, \nChapman \nJR \n, et al. the impact of total ischemic time, donor age and the pathway of donor death on graft outcomes after deceased donor kidney transplantation . Transplantation . 2017 ;101 :1152 ‐1158 .27479168 \n11 \n\nEl‐Zoghby \nZM \n, \nStegall \nMD \n, \nLager \nDJ \n, et al. Identifying specific causes of kidney allograft loss . Am J Transplant . 2009 ;9 :527 ‐535 .19191769 \n12 \n\nSellarés \nJ \n, \nde Freitas \nDG \n, \nMengel \nM \n, et al. Understanding the causes of kidney transplant failure: the dominant role of antibody‐mediated rejection and nonadherence . Am J Transplant . 2012 ;12 :388 ‐399 .22081892 \n13 \n\nMyers \nBD \n, \nRoss \nJ \n, \nNewton \nL \n, \nLuetscher \nJ \n, \nPerlroth \nM \n. Cyclosporine‐associated chronic nephropathy . N Engl J Med . 1984 ;311 :699 ‐705 .6382005 \n14 \n\nPalestine \nAG \n, \nAustin \nHA \n, \nBalow \nJE \n, et al. Renal histopathologic alterations in patients treated with cyclosporine for uveitis . N Engl J Med . 1986 ;314 :1293 ‐1298 .3702930 \n15 \n\nGreenberg \nA \n, \nEgel \nJW \n, \nThompson \nME \n, et al. Early and late forms of cyclosporine nephrotoxicity: studies in cardiac transplant recipients . Am J Kidney Dis . 1987 ;9 :12 ‐22 .3544821 \n16 \n\nOjo \nAO \n, \nHeld \nPJ \n, \nPort \nFK \n, et al. Chronic renal failure after transplantation of a nonrenal organ . N Engl J Med . 2003 ;349 :931 ‐940 .12954741 \n17 \n\nFrançois \nH \n, \nChatziantoniou \nC \n. Renal fibrosis: recent translational aspects . Matrix Biol J . 2018 ;68–69 :318 ‐332 .\n18 \n\nLecru \nL \n, \nDesterke \nC \n, \nGrassin‐Delyle \nS \n, et al. Cannabinoid receptor 1 is a major mediator of renal fibrosis . Kidney Int . 2015 ;88 :72 ‐84 .25760323 \n19 \n\nBarutta \nF \n, \nCorbelli \nA \n, \nMastrocola \nR \n, et al. Cannabinoid receptor 1 blockade ameliorates albuminuria in experimental diabetic nephropathy . Diabetes . 2010 ;59 :1046 ‐1054 .20068137 \n20 \n\nNam \nDH \n, \nLee \nMH \n, \nKim \nJE \n, et al. Blockade of cannabinoid receptor 1 improves insulin resistance, lipid metabolism, and diabetic nephropathy in db/db mice . Endocrinology . 2012 ;153 :1387 ‐1396 .22234468 \n21 \n\nJourdan \nT \n, \nSzanda \nG \n, \nRosenberg \nAZ \n, et al. Overactive cannabinoid 1 receptor in podocytes drives type 2 diabetic nephropathy . Proc Natl Acad Sci . 2014 ;111 :E5420 ‐E5428 .25422468 \n22 \n\nUdi \nS \n, \nHinden \nL \n, \nEarley \nB \n, et al. Proximal tubular cannabinoid‐1 receptor regulates obesity‐induced CKD . J Am Soc Nephrol . 2017 ;28 :3518 ‐3532 .28860163 \n23 \n\nHinden \nL \n, \nUdi \nS \n, \nDrori \nA \n, et al. Modulation of renal GLUT2 by the cannabinoid‐1 receptor: implications for the treatment of diabetic nephropathy . J Am Soc Nephrol . 2018 ;29 :434 ‐448 .29030466 \n24 \n\nJourdan \nT \n, \nPark \nJK \n, \nVarga \nZV \n, et al. Cannabinoid‐1 receptor deletion in podocytes mitigates both glomerular and tubular dysfunction in a mouse model of diabetic nephropathy . Diabetes Obes. Metab . 2018 ;20 :698 ‐708 .29106063 \n25 \n\nLedent \nC \n, \nValverde \nO \n, \nCossu \nG \n, et al. Unresponsiveness to cannabinoids and reduced addictive effects of opiates in CB1 receptor knockout mice . Science . 1999 ;283 :401 ‐404 .9888857 \n26 \n\nHowlett \nAC \n, \nBlume \nLC \n, \nDalton \nGD \n. CB1 cannabinoid receptors and their associated proteins . Curr Med Chem . 2010 ;17 :1382 .20166926 \n27 \n\nO'Keefe \nL \n, \nSimcocks \nAC \n, \nHryciw \nDH \n, \nMathai \nML \n, \nMcAinch \nAJ \n. The cannabinoid receptor 1 and its role in influencing peripheral metabolism . Diabetes Obes Metab . 2014 ;16 :294 ‐304 .23782485 \n28 \n\nMunro \nS \n, \nThomas \nKL \n, \nAbu‐Shaar \nM \n. Molecular characterization of a peripheral receptor for cannabinoids . Nature . 1993 ;365 :61 ‐65 .7689702 \n29 \n\nKoura \nY \n, \nIchihara \nA \n, \nTada \nY \n, et al. Anandamide decreases glomerular filtration rate through predominant vasodilation of efferent arterioles in rat kidneys . J Am Soc Nephrol . 2004 ;15 :1488 ‐1494 .15153559 \n30 \n\nLarrinaga \nG \n, \nVarona \nA \n, \nPérez \nI \n, et al. Expression of cannabinoid receptors in human kidney . Histol Histopathol . 2010 ;25 :1133 ‐1138 .20607655 \n31 \n\nLim \nJC \n, \nLim \nSK \n, \nPark \nMJ \n, \nKim \nGY \n, \nHan \nHJ \n, \nPark \nSH \n. Cannabinoid receptor 1 mediates high glucose‐induced apoptosis via endoplasmic reticulum stress in primary cultured rat mesangial cells . Am J Physiol Renal Physiol . 2011 ;301 :F179 ‐F188 .21325497 \n32 \n\nJenkin \nKA \n, \nMcAinch \nAJ \n, \nZhang \nY \n, \nKelly \nDJ \n, \nHryciw \nDH \n. Elevated cannabinoid receptor 1 and G protein‐coupled receptor 55 expression in proximal tubule cells and whole kidney exposed to diabetic conditions . Clin Exp Pharmacol Physiol . 2015 ;42 :256 ‐262 .25545857 \n33 \n\nFrancois \nH \n, \nLecru \nL \n. The role of cannabinoid receptors in renal diseases . Curr Med Chem . 2018 ;25 :793 ‐801 .28901271 \n34 \n\nLegouis \nD \n, \nBataille \nA \n, \nHertig \nA \n, et al. Ex vivo analysis of renal proximal tubular cells . BMC Cell Biol . 2015 ;16 :12 .25881040 \n35 \nR Core Team \n. A Language and Environment for Statistical Computing . Vienna, Austria : R Foundation for Statistical Computing ; 2014 .\n36 \n\nBasile \nDP \n, \nDonohoe \nD \n, \nRoethe \nK \n, \nOsborn \nJL \n. Renal ischemic injury results in permanent damage to peritubular capillaries and influences long‐term function . Am J Physiol Renal Physiol . 2001 ;281 :F887 ‐F899 .11592947 \n37 \n\nBonventre \nJV \n, \nWeinberg \nJM \n. Recent advances in the pathophysiology of ischemic acute renal failure . J Am Soc Nephrol . 2003 ;14 :2199 ‐2210 .12874476 \n38 \n\nRauen \nU \n, \nde Groot \nH \n. New insights into the cellular and molecular mechanisms of cold storage injury . J Investig Med . 2004 ;52 :299 ‐309 .\n39 \n\nSalahudeen \nAK \n. Cold ischemic injury of transplanted kidneys: new insights from experimental studies . Am J Physiol Renal Physiol . 2004 ;287 :F181 ‐187 .15271685 \n40 \n\nTanaka \nS \n, \nTanaka \nT \n, \nNangaku \nM \n. Hypoxia as a key player in the AKI‐to‐CKD transition . Am J Physiol Renal Physiol . 2014 ;307 :F1187 ‐F1195 .25350978 \n41 \n\nHirakawa \nY \n, \nTanaka \nT \n, \nNangaku \nM \n. Renal Hypoxia in CKD; pathophysiology and detecting methods . Front Physiol . 2017 ;8 :99 .28270773 \n42 \n\nLiu \nM \n, \nNing \nX \n, \nLi \nR \n, et al. Signalling pathways involved in hypoxia‐induced renal fibrosis . J Cell Mol Med . 2017 ;21 :1248 ‐1259 .28097825 \n43 \n\nSerón \nD \n, \nMoreso \nF \n, \nFulladosa \nX \n, \nHueso \nM \n, \nCarrera \nM \n, \nGrinyó \nJM \n. Reliability of chronic allograft nephropathy diagnosis in sequential protocol biopsies . Kidney Int . 2002 ;61 :727 ‐733 .11849416 \n44 \n\nSerón \nD \n, \nMoreso \nF \n, \nBover \nJ \n, et al. Early protocol renal allograft biopsies and graft outcome . Kidney Int . 1997 ;51 :310 ‐316 .8995748 \n45 \n\nPape \nL \n, \nHenne \nT \n, \nOffner \nG \n, et al. Computer‐assisted quantification of fibrosis in chronic allograft nephropaty by picosirius red‐staining: a new tool for predicting long‐term graft function . Transplantation . 2003 ;76 :955 ‐958 .14508360 \n46 \n\nGrimm \nPC \n, \nNickerson \nP \n, \nGough \nJ \n, et al. Computerized image analysis of Sirius Red‐stained renal allograft biopsies as a surrogate marker to predict long‐term allograft function . J Am Soc Nephrol . 2003 ;14 :1662 ‐1668 .12761269 \n47 \n\nKavvadas \nP \n, \nDussaule \nJ‐C \n, \nChatziantoniou \nC \n. Searching novel diagnostic markers and targets for therapy of CKD . Kidney Int Suppl . 2014 ;4 :53 ‐57 .\n48 \n\nNaesens \nM \n, \nKuypers \nD \n, \nSarwal \nM \n. Calcineurin inhibitor nephrotoxicity . Clin J Am Soc Nephrol . 2009 ;4 :481 ‐508 .19218475 \n49 \n\nWolf \nG \n, \nKillen \nPD \n, \nNeilson \nEG \n. Cyclosporin A stimulates transcription and procollagen secretion in tubulointerstitial fibroblasts and proximal tubular cells . J Am Soc Nephrol . 1990 ;1 :918 ‐922 .2103851 \n50 \n\nVieira \nJM \n, \nNoronha \nIL \n, \nMalheiros \nDM \n, \nBurdmann \nEA \n. Cyclosporine‐induced interstitial fibrosis and arteriolar TGF‐beta expression with preserved renal blood flow . Transplantation . 1999 ;68 :1746 ‐1753 .10609952 \n51 \n\nKhanna \nA \n, \nPlummer \nM \n, \nBromberek \nC \n, \nBresnahan \nB \n, \nHariharan \nS \n. Expression of TGF‐beta and fibrogenic genes in transplant recipients with tacrolimus and cyclosporine nephrotoxicity . Kidney Int . 2002 ;62 :2257 ‐2263 .12427154 \n52 \n\nRoos‐van Groningen \nMC \n, \nScholten \nEM \n, \nLelieveld \nPM \n, et al. Molecular comparison of calcineurin inhibitor‐induced fibrogenic responses in protocol renal transplant biopsies . J Am Soc Nephrol . 2006 ;17 :881 ‐888 .16467444\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1582-1838",
"issue": "23(11)",
"journal": "Journal of cellular and molecular medicine",
"keywords": "cannabinoid receptor 1; chronic allograft dysfunction; renal fibrosis; renal transplantation",
"medline_ta": "J Cell Mol Med",
"mesh_terms": "D000818:Animals; D002478:Cells, Cultured; D002908:Chronic Disease; D005260:Female; D005355:Fibrosis; D006801:Humans; D007166:Immunosuppressive Agents; D016030:Kidney Transplantation; D008297:Male; D051379:Mice; D008810:Mice, Inbred C57BL; D008875:Middle Aged; D055031:Primary Graft Dysfunction; D043884:Receptor, Cannabinoid, CB1; D012189:Retrospective Studies; D016559:Tacrolimus",
"nlm_unique_id": "101083777",
"other_id": null,
"pages": "7279-7288",
"pmc": null,
"pmid": "31469511",
"pubdate": "2019-11",
"publication_types": "D016428:Journal Article",
"references": "3544821;28860163;10609952;9888857;7689702;25545857;22902496;21325497;12761269;14508360;20607655;20166926;12427154;31469511;12874476;2103851;23625970;22081892;27699214;24626060;27479168;15153559;8995748;25881040;16467444;20068137;15271685;29106063;12954741;28901271;15551652;25350978;23782485;29292218;11849416;16333008;19218475;25422468;25760323;6382005;26232393;22234468;24698514;19191769;28097825;11592947;30028786;3702930;28270773;21116314;29030466;26312150",
"title": "The cannabinoid receptor 1 is involved in renal fibrosis during chronic allograft dysfunction: Proof of concept.",
"title_normalized": "the cannabinoid receptor 1 is involved in renal fibrosis during chronic allograft dysfunction proof of concept"
} | [
{
"companynumb": "FR-ASTELLAS-2019US046109",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": null,
... |
{
"abstract": "Amiodarone is a class III antiarrhythmic drug containing 37% iodine by weight, with a structure similar to that of thyroid hormones. Deiodination of amiodarone releases large amounts of iodine that can impair thyroid function, causing either hypothyroidism or thyrotoxicosis in susceptible individuals reflecting ~20% of patients administered the drug. Not only the excess iodine, but also the amiodarone (or its metabolite, desethylamiodarone) itself may cause thyroid dysfunction by direct cytotoxicity on thyroid cells. We present an overview of the epidemiology and pathophysiology of amiodarone-induced thyroid disorders, with a focus on the various forms of clinical presentation and recommendations for personalized management of each form.",
"affiliations": "Endocrine Section, MedStar Washington Hospital Center, Washington, DC.;Endocrine Section, MedStar Washington Hospital Center, Washington, DC.;Endocrine Section, MedStar Washington Hospital Center, Washington, DC.",
"authors": "Ylli|Dorina|D|;Wartofsky|Leonard|L|;Burman|Kenneth D|KD|",
"chemical_list": "D000638:Amiodarone",
"country": "United States",
"delete": false,
"doi": "10.1210/clinem/dgaa686",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0021-972X",
"issue": "106(1)",
"journal": "The Journal of clinical endocrinology and metabolism",
"keywords": "amiodarone; hypothyroidism; management; thyroid; thyroiditis; thyrotoxicosis",
"medline_ta": "J Clin Endocrinol Metab",
"mesh_terms": "D000415:Albania; D000638:Amiodarone; D001145:Arrhythmias, Cardiac; D003324:Coronary Artery Disease; D006801:Humans; D008297:Male; D008875:Middle Aged; D009203:Myocardial Infarction; D013959:Thyroid Diseases; D013960:Thyroid Function Tests",
"nlm_unique_id": "0375362",
"other_id": null,
"pages": "226-236",
"pmc": null,
"pmid": "33159436",
"pubdate": "2021-01-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't; D016454:Review",
"references": null,
"title": "Evaluation and Treatment of Amiodarone-Induced Thyroid Disorders.",
"title_normalized": "evaluation and treatment of amiodarone induced thyroid disorders"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/20/0129687",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "AMIODARONE HYDROCHLORIDE"
},
"drugadditi... |
{
"abstract": "Serotonin syndrome is an unexpected fatal adverse event related to serotonergic medication. This case report is the first report describing the possible treatment effect of famotidine on serotonin syndrome. Furthermore, this is the first case report of serotonin syndrome induced by meperidine alone in a patient with no previous history suggesting a susceptibility to serotonin syndrome. A 70-year-old male with no recent history of serotonergic drug use presented with severe serotonin syndrome following ureteroscopy, possibly due to postoperative meperidine administration. The patient's symptoms included hypertension, tachycardia, tachypnea, hyperthermia, myoclonus, diaphoresis, retching, nausea, agitation, and semicoma mentality with no pupillary light reflex. Symptoms began to subside immediately after the administration of intravenous famotidine for prevention of aspiration pneumonia, with mental and neurological symptoms showing improvement initially, followed by autonomic symptoms. This case report suggests that the histamine type 2 receptor antagonist famotidine may be an effective emergency treatment for serotonin syndrome.",
"affiliations": "Department of Psychiatry, Bugok National Hospital, Changnyeong, Korea.;Department of Anesthesiology and Pain Medicine, Daegu Fatima Hospital, Daegu, Korea.;Department of Anesthesiology and Pain Medicine, Daegu Fatima Hospital, Daegu, Korea.;Department of Anesthesiology and Pain Medicine, Daegu Fatima Hospital, Daegu, Korea.;Department of Anesthesiology and Pain Medicine, Daegu Fatima Hospital, Daegu, Korea.;Department of Anesthesiology and Pain Medicine, Daegu Fatima Hospital, Daegu, Korea.",
"authors": "Joe|Soohyun|S|;Kim|Eunju|E|0000-0002-7299-4644;Park|Junyi|J|;Lee|Dongwon|D|;Son|Jongchul|J|;Kim|Hyun|H|",
"chemical_list": null,
"country": "Korea (South)",
"delete": false,
"doi": "10.4097/kjae.2017.70.2.221",
"fulltext": "\n==== Front\nKorean J AnesthesiolKorean J AnesthesiolKJAEKorean Journal of Anesthesiology2005-64192005-7563The Korean Society of Anesthesiologists 10.4097/kjae.2017.70.2.221Case ReportFamotidine-induced reversal of meperidine-related serotonin syndrome: a case report Joe Soohyun 1http://orcid.org/0000-0002-7299-4644Kim Eunju 2Park Junyi 2Lee Dongwon 2Son Jongchul 2Kim Hyun 21 Department of Psychiatry, Bugok National Hospital, Changnyeong, Korea.2 Department of Anesthesiology and Pain Medicine, Daegu Fatima Hospital, Daegu, Korea.Corresponding author: Eunju Kim, M.D. Department of Anesthesiology and Pain Medicine, Daegu Fatima Hospital, 99, Ayang-ro, Dong-gu, Daegu 41199, Korea. Tel: 82-53-940-7434, Fax: 82-53-940-7443, iloveshins@gmail.com4 2017 11 1 2017 70 2 221 223 21 9 2016 17 10 2016 02 11 2016 Copyright © the Korean Society of Anesthesiologists, 20172017This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.Serotonin syndrome is an unexpected fatal adverse event related to serotonergic medication. This case report is the first report describing the possible treatment effect of famotidine on serotonin syndrome. Furthermore, this is the first case report of serotonin syndrome induced by meperidine alone in a patient with no previous history suggesting a susceptibility to serotonin syndrome. A 70-year-old male with no recent history of serotonergic drug use presented with severe serotonin syndrome following ureteroscopy, possibly due to postoperative meperidine administration. The patient's symptoms included hypertension, tachycardia, tachypnea, hyperthermia, myoclonus, diaphoresis, retching, nausea, agitation, and semicoma mentality with no pupillary light reflex. Symptoms began to subside immediately after the administration of intravenous famotidine for prevention of aspiration pneumonia, with mental and neurological symptoms showing improvement initially, followed by autonomic symptoms. This case report suggests that the histamine type 2 receptor antagonist famotidine may be an effective emergency treatment for serotonin syndrome.\n\nFamotidineHistamine H2 antagonistsMeperidineSerotonin syndrome\n==== Body\nMeperidine-induced serotonin syndrome is a very rare adverse event that may occur during anesthesia that is often missed or treated inadequately. Untreated serotonin syndrome can be fatal. The mortality rate of severe serotonin syndrome ranges from 2% to 12% [1]. The syndrome usually occurs in the context of usage of antidepressants or other medications that increase serotonin prior to surgery. However, a previous report described the occurrence of meperidine-induced serotonin syndrome in a patient with a past history of clomipramine-induced serotonin syndrome [2]. The present report is the first case of meperidine-induced serotonin syndrome in a patient with no use of other serotonergic medication and also with no history of susceptibility. Furthermore, an unexpected paradoxical rapid reversal of the neurologic symptoms of serotonin syndrome was observed in this case in association with the administration of famotidine.\n\nCase Report\nA 70-year-old male was admitted for the ureteroscopic removal of ureter stones. He had been receiving treatment with glimepiride for diabetes; atorvastatin for hyperlipidemia; and aspirin, thiazide, valsartan, and carvedilol for hypertension and atrial fibrillation for several years prior to admission. The patient had undergone two previous surgeries, knee arthroplasty and cataract operation, with no report of significant perioperative events. He had not taken serotonergic medications for at least 4 weeks prior to admission. Atrial fibrillation was well controlled before surgery. His physical status classification was American Society of Anesthesiologists class II.\n\nSpinal anesthesia was achieved with the administration of hyperbaric bupivacaine (12.5 mg). Surgery required 40 min and was uneventful. Stable vital signs and alert mentality were maintained in the postanesthesia care unit for more than 30 min. Intravenous meperidine (25 mg) was injected to relieve shivering. Fig. 1 illustrates changes in vital signs with time following meperidine treatment. Five minutes after the injection of meperidine, the patient complained of the sudden onset of chest discomfort and difficulty breathing. Diaphoresis, agitation, and tachypnea (28 breaths/min) were observed at the same time. Severe rigidity and tremors along with myoclonus began within 10 min, but were limited to the upper extremities because of the prior administration of spinal anesthesia. The patient soon became drowsy, confused, and uncooperative with staff. Blood pressure (BP) was elevated from 98/65 mmHg at postoperative baseline to 199/95 mmHg, and pulse rate increased from 77 beats/min to 150 beats/min. Invasive BP monitoring was initiated at the radial artery. Body temperature measured 25 min after meperidine injection was 39.8℃. Mental status deteriorated to stupor. Arterial blood gas analysis showed a pH of 7.436, PaCO2 of 27.2 mmHg, PaO2 of 114.6 mmHg, SaO2 of 98.4%, Na+ of 137 mEq/L, K+ of 4.46 mEq/L, and Ca2+ of 3.64 mg/dl. Esmolol (15 mg) was injected to lower the heart rate (HR), and ipratropium bromide inhalation was initiated for bronchodilation. Despite supportive care, hypertension and tachycardia continued and body temperature increased further to 40.1℃. Esmolol infusion was initiated at 0.5 mg/kg/min. Despite this treatment, mental deterioration progressed to semicoma. Pupils were dilated (8 mm) and unresponsive to light. At 50 min after meperidine injection, we decided to perform emergency brain computed tomography (CT).\n\nImmediately prior to transfer for CT, the patient was administered intravenous injections of metoclopramide (10 mg) and famotidine (20 mg) for retching and vomiting. During transfer for CT and within 15 min of famotidine administration, his mental state demonstrated marked improvement. He was able to recognize people and even appeared awake to the nursing staff. The results of the brain CT were unremarkable. Following the CT examination, the patient was transferred to the intensive care unit. Immediately after arrival, his mental and neurological status were assessed, and he was found to be alert, with no neurological abnormalities (myoclonus, tremor, agitation, or mydriasis). Vital signs slowly improved over the next hour with continued supportive care. Only systolic BP and HR remained elevated at 2 h after the onset of serotonin syndrome (Fig. 1).\n\nDiscussion\nThis case met Sternbach's diagnostic criteria for serotonin toxicity [3], and the medical history, laboratory data, neurological examination, and neuroimaging excluded other possible diagnoses. Meperidine was the most likely causative agent in this case because of the close temporal relationship between meperidine injection and the onset of serotonin syndrome. No other potentially causative medication was administered before the onset of the syndrome. It is very rare that meperidine alone induces serotonin syndrome. This is the first case report of serotonin syndrome induced by meperidine alone in a patient with no history to suggest a susceptibility to serotonin syndrome.\n\nAlthough serotonin syndrome is a potentially life-threatening situation, specific treatment for serotonin syndrome has not yet been established. Serotonin syndrome is caused by hyperactivity of central and/or peripheral serotonin receptors [4]; therefore, several previous treatment attempts have aimed to suppress serotonergic transmission using chlorpromazine [5], cyproheptadine [6], risperidone [7], propranolol [8], or even electroconvulsive therapy [9]. However, the efficacy of these treatments has not been proven, and none are routinely recommended because of side effects and the availability of the above-mentioned pharmaceutical agents only in the oral form.\n\nThe present report describes a case of serotonin syndrome exhibiting immediate paradoxical reversal of unconsciousness and neurological symptoms following the intravenous administration of famotidine. Famotidine is a histamine receptor antagonist with high selectivity for histamine 2 (H2) receptors. It has been reported to be associated with several unexpected central nervous system (CNS) effects such as delirium, mania, and seizures [10]. Delirium associated with famotidine has been reported in several cases, possibly associated with central anticholinergic effects [11].\n\nThe mechanisms underlying famotidine-mediated reversal of serotonin syndrome are a matter of speculation. Perhaps this H2-selective blocker increases the histamine concentration at CNS synapses, resulting in hyperactivation of histamine H1 receptors and mental arousal. Another possible explanation is that histamine H2 antagonists may have an effect on reduction of blood serotonin levels [12].\n\nFamotidine, a drug that has been the subject of attention at times, has been reported to result in a paradoxical treatment response via an unknown mechanism in the CNS. The present case did not confirm whether the pharmacological effects of famotidine alone caused a dramatic recovery of neurologic symptoms or whether the interaction of famotidine and the patient's individual genetic specificity resulted in an improvement of the symptoms. However, it is useful to note that this is the first report that famotidine may be an effective treatment for serotonin syndrome. It is also worthwhile to note that the intravenous formulation of famotidine enables rapid medication administration in non-cooperative patients. In addition, famotidine is known to be a relatively safe drug with few drug interactions. Further preclinical and clinical studies are necessary to confirm the efficacy and safety of this treatment.\n\nThis case had two idiosyncratic features. First, the patient's mental and neurological state improved immediately following famotidine administration. The half-life of meperidine is 2.5–4 h. The patient's neurological symptoms recovered beginning approximately 60 min after the administration of meperidine. In addition, the recovery from moderate to severe serotonin syndrome takes 24 h to several days. Therefore, the course in this case is not thought to represent the natural course of recovery.\n\nAlthough the mechanisms are uncertain, the close temporal relationship between the administration of the medication and the recovery of the neurological symptoms strongly suggests that famotidine contributed to symptom reversal in this case. While metoclopramide was also administered, it is unlikely to have contributed to recovery because metoclopramide has been reported to actually cause or exacerbate serotonin syndrome [1314]. Second, the recovery of individual symptoms followed a distinct time course, with mental condition showing immediate improvement, followed by mitigation of neurological symptoms and the more gradual remission of autonomic symptoms. In contrast, recovery from serotonin syndrome is generally gradual, spanning a period of over several hours.\n\nIn summary, anesthesiologists should keep in mind that meperidine alone can induce serotonin syndrome and the administration of famotidine, a relatively safe drug with few drug interactions, may be useful in critical patients with suspected serotonin syndrome.\n\nFig. 1 Time course of symptoms of serotonin syndrome during medication administration. SS: serotonin syndrome, SBP: systolic blood pressure (mmHg), DBP: diastolic blood pressure (mmHg), HR: heart rate (beats/min), BT: body temperature (℃).\n==== Refs\n1 Frank C Recognition and treatment of serotonin syndrome Can Fam Physician 2008 54 988 992 18625822 \n2 Guo SL Wu TJ Liu CC Ng CC Chien CC Sun HL Meperidine-induced serotonin syndrome in a susceptible patient Br J Anaesth 2009 103 369 370 19556270 \n3 Sternbach H The serotonin syndrome Am J Psychiatry 1991 148 705 713 2035713 \n4 Volpi-Abadie J Kaye AM Kaye AD Serotonin syndrome Ochsner J 2013 13 533 540 24358002 \n5 Gillman PK Serotonin syndrome treated with chlorpromazine J Clin Psychopharmacol 1997 17 128 129 10950482 \n6 Horowitz BZ Mullins ME Cyproheptadine for serotonin syndrome in an accidental pediatric sertraline ingestion Pediatr Emerg Care 1999 15 325 327 10532660 \n7 Shioda K Nisijima K Yoshino T Kuboshima K Iwamura T Yui K Risperidone attenuates and reverses hyperthermia induced by 3,4-methylenedioxymethamphetamine (MDMA) in rats Neurotoxicology 2008 29 1030 1036 18722468 \n8 Guzé BH Baxter LR Jr The serotonin syndrome: case responsive to propranolol J Clin Psychopharmacol 1986 6 119 120 3700697 \n9 Nisijima K Nibuya M Kato S Toxic serotonin syndrome successfully treated with electroconvulsive therapy J Clin Psychopharmacol 2002 22 338 339 12006909 \n10 von Einsiedel RW Roesch-Ely D Diebold K Sartor K Mundt C Bergemann N H(2)-histamine antagonist (famotidine) induced adverse CNS reactions with long-standing secondary mania and epileptic seizures Pharmacopsychiatry 2002 35 152 154 12163986 \n11 Catalano G Catalano MC Alberts VA Famotidine-associated delirium. A series of six cases Psychosomatics 1996 37 349 355 8701013 \n12 Lai KH Cho CH Ogle CW Wang JY Effects of eight-week treatment with histamine H2-antagonists or an antacid on plasma levels of histamine and serotonin in duodenal ulcer patients Pharmacol Res Commun 1986 18 807 812 2432622 \n13 Fisher AA Davis MW Serotonin syndrome caused by selective serotonin reuptake-inhibitors-metoclopramide interaction Ann Pharmacother 2002 36 67 71 11816261 \n14 Vandemergel X Beukinga I Nève P Serotonin syndrome secondary to the use of sertraline and metoclopramide Rev Med Brux 2000 21 161 163 10925598\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2005-6419",
"issue": "70(2)",
"journal": "Korean journal of anesthesiology",
"keywords": "Famotidine; Histamine H2 antagonists; Meperidine; Serotonin syndrome",
"medline_ta": "Korean J Anesthesiol",
"mesh_terms": null,
"nlm_unique_id": "101502451",
"other_id": null,
"pages": "221-223",
"pmc": null,
"pmid": "28367296",
"pubdate": "2017-04",
"publication_types": "D016428:Journal Article",
"references": "10950482;8701013;10925598;2432622;3700697;12163986;24358002;11816261;12006909;2035713;18625822;10532660;18722468;19556270",
"title": "Famotidine-induced reversal of meperidine-related serotonin syndrome: a case report.",
"title_normalized": "famotidine induced reversal of meperidine related serotonin syndrome a case report"
} | [
{
"companynumb": "KR-VALIDUS PHARMACEUTICALS LLC-KR-2017VAL000617",
"fulfillexpeditecriteria": "1",
"occurcountry": "KR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "MEPERIDINE HYDROCHLORIDE"
},
... |
{
"abstract": "The SARS-CoV-2 pandemic triggered increasing symptoms of an undiagnosed delusional disorder at a mid-60-year-old woman resulting in an attempted suicide. Because of a pandemic with noticeable and visible social changes, it seems likely that people with previously subclinical psychotic illnesses are more often admitted to psychiatric care for the first time. Building a therapeutic relationship and integrating her into an outpatient clinic was possible despite her lack of insight into the illness and her rejection of medical treatment.",
"affiliations": "Klinik und Poliklinik für Psychiatrie und Psychotherapie, Universitätsklinikum Leipzig.;Klinik und Poliklinik für Psychiatrie und Psychotherapie, Universitätsklinikum Leipzig.;Klinik und Poliklinik für Psychiatrie und Psychotherapie, Universitätsklinikum Leipzig.",
"authors": "Weise|Judith|J|;Schomerus|Georg|G|;Speerforck|Sven|S|",
"chemical_list": null,
"country": "Germany",
"delete": false,
"doi": "10.1055/a-1158-1745",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0303-4259",
"issue": "47(4)",
"journal": "Psychiatrische Praxis",
"keywords": null,
"medline_ta": "Psychiatr Prax",
"mesh_terms": "D000073640:Betacoronavirus; D000086382:COVID-19; D018352:Coronavirus Infections; D005260:Female; D005858:Germany; D006801:Humans; D008875:Middle Aged; D058873:Pandemics; D011024:Pneumonia, Viral; D045473:SARS Virus; D000086402:SARS-CoV-2; D012563:Schizophrenia, Paranoid; D013406:Suicide, Attempted",
"nlm_unique_id": "0423204",
"other_id": null,
"pages": "218-220",
"pmc": null,
"pmid": "32340051",
"pubdate": "2020-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "The SARS-CoV-2 Pandemic and an Attempted Suicide of a Patient with Delusional Disorder.",
"title_normalized": "the sars cov 2 pandemic and an attempted suicide of a patient with delusional disorder"
} | [
{
"companynumb": "DE-JNJFOC-20200503128",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "IBUPROFEN"
},
"drugadditional": null,
"... |
{
"abstract": "Here, we report a case of a 15-year-old girl who presented to the emergency department with symptoms of abdominal pain, nausea, vomiting and seizures. She was diagnosed with acute intermittent porphyria. Treatment was started by removing all porphogenic drugs, providing high glucose intake (oral and intravenous), which initially resulted in good clinical outcomes. However, she deteriorated again and also developed neurological manifestation (paraplegia) for which she required mechanical ventilation because of acute respiratory failure. This time she was initiated on human hemin for four consecutive days. After 2 days of therapy, her porphobilinogen levels decreased to 50% of the initial raised value. Increased lactic acid and blood urea nitrogen were the two side effects observed after the treatment, with no apparent signs of acute kidney injury. To the best of our knowledge, in paediatric population, this is the first reported case of treatment of acute intermittent porphyria with human hemin in Pakistan.",
"affiliations": "Department of Pharmacy Services, Aga Khan University Hospital, Karachi, Pakistan s.anumrizvi@gmail.com.;Pediatrics and Child Health, Aga Khan University Hospital, Karachi, Pakistan.;Pediatrics and Child Health, Aga Khan University Hospital, Karachi, Pakistan.;Pediatrics and Child Health, Aga Khan University Hospital, Karachi, Pakistan.",
"authors": "Fatima|Syeda Anum|SA|http://orcid.org/0000-0001-6580-0728;Jurair|Humaira|H|;Abbas|Qalab|Q|;Rehman|Arshalooz Jamila|AJ|",
"chemical_list": "D006427:Hemin",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2019-232236",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "13(1)",
"journal": "BMJ case reports",
"keywords": "nutritional support; paediatrics (drugs and medicines); pharmacology and therapeutics",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D015746:Abdominal Pain; D000293:Adolescent; D003906:Developing Countries; D005260:Female; D006427:Hemin; D006801:Humans; D010154:Pakistan; D017118:Porphyria, Acute Intermittent; D014839:Vomiting",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "31919062",
"pubdate": "2020-01-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Paediatric porphyria and human hemin: a treatment challenge in a lower middle income country.",
"title_normalized": "paediatric porphyria and human hemin a treatment challenge in a lower middle income country"
} | [
{
"companynumb": "PK-PFIZER INC-2020064343",
"fulfillexpeditecriteria": "1",
"occurcountry": "PK",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "DIAZEPAM"
},
"drugadditional": null,
... |
{
"abstract": "Abdominal dystonia is very rare. To our knowledge, no clinical study has reported its specific treatment. Stereotactic therapy has been used to treat several movement disorders, including focal and general dystonia. We investigated the use of internal globus pallidum (GPi) pallidotomy for abdominal dystonia after failed oral medication.\n\n\n\nA 48-year-old man presented with abdominal dystonia and complaints of involuntary undulating and contraction movements of his left abdominal wall for 5 years. Treatment with oral medication for 4 years was ineffective. Lesioning of the right GPi successfully relieved his symptoms. The symptoms recurred at 3 months and right GPi pallidotomy was repeated with complete resolution of symptoms after the second procedure. There was no recurrence or focal deficit at the 2-year follow-up.\n\n\n\nGPi pallidotomy is feasible and effective for the treatment of abdominal dystonia that is resistant to standard medical therapy.",
"affiliations": "Post Graduate Doctoral Program, Faculty of Medicine, Universitas Airlangga, Surabaya, Indonesia; Department of Neurosurgery, Faculty of Medicine, Universitas Airlangga, Surabaya, Indonesia; Dr. Soetomo General Academic Hospital, Surabaya, Indonesia. Electronic address: achmad.fahmi-13@fk.unair.ac.id.;Department of Neurosurgery, Faculty of Medicine, Universitas Airlangga, Surabaya, Indonesia; Dr. Soetomo General Academic Hospital, Surabaya, Indonesia.;Department of Neurosurgery, Faculty of Medicine, Universitas Airlangga, Surabaya, Indonesia; Dr. Soetomo General Academic Hospital, Surabaya, Indonesia.;Department of Neurosurgery, Faculty of Medicine, Universitas Airlangga, Surabaya, Indonesia; Dr. Soetomo General Academic Hospital, Surabaya, Indonesia.;Department of Neurosurgery, Faculty of Medicine, Universitas Airlangga, Surabaya, Indonesia; Dr. Soetomo General Academic Hospital, Surabaya, Indonesia.;Department of Neurosurgery, Faculty of Medicine, Universitas Airlangga, Surabaya, Indonesia; Dr. Soetomo General Academic Hospital, Surabaya, Indonesia.",
"authors": "Fahmi|Achmad|A|;Asadullah|||;Aji|Yunus Kuntawi|YK|;Aprianto|Dirga Rachmad|DR|;Subianto|Heri|H|;Turchan|Agus|A|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.wneu.2020.08.152",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1878-8750",
"issue": "144()",
"journal": "World neurosurgery",
"keywords": "Abdominal dystonia; GPi pallidotomy",
"medline_ta": "World Neurosurg",
"mesh_terms": "D000009:Abdominal Muscles; D004421:Dystonia; D005917:Globus Pallidus; D006801:Humans; D008297:Male; D008875:Middle Aged; D053860:Pallidotomy; D016896:Treatment Outcome",
"nlm_unique_id": "101528275",
"other_id": null,
"pages": "68-70",
"pmc": null,
"pmid": "32882456",
"pubdate": "2020-12",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Successful Relief of Abdominal Dystonia After Sequential GPi Pallidotomy with 2-Year Follow-Up.",
"title_normalized": "successful relief of abdominal dystonia after sequential gpi pallidotomy with 2 year follow up"
} | [
{
"companynumb": "ID-SUN PHARMACEUTICAL INDUSTRIES LTD-2020RR-268650",
"fulfillexpeditecriteria": "1",
"occurcountry": "ID",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CLONAZEPAM"
},
"drug... |
{
"abstract": "Not required for Clinical Vignette.",
"affiliations": "Endocrinology Unit, Department of Internal Medicine and Oncological Chemotherapy, Faculty of Medical Sciences in Katowice, Medical University of Silesia, Katowice, Poland. mary@swierkot.com.;Endocrinology Unit, Department of Internal Medicine and Oncological Chemotherapy, Faculty of Medical Sciences in Katowice, Medical University of Silesia, Katowice, Poland.;Department of Ophthalmology, Faculty of Medical Sciences in Katowice, Medical University of Silesia, Katowice, Poland.;Department of Haematology and Bone Marrow Transplantation, Faculty of Medical Sciences in Katowice, Medical University of Silesia, Katowice, Poland.;Department of Ophthalmology, Faculty of Medical Sciences in Katowice, Medical University of Silesia, Katowice, Poland.;Endocrinology Unit, Department of Internal Medicine and Oncological Chemotherapy, Faculty of Medical Sciences in Katowice, Medical University of Silesia, Katowice, Poland.",
"authors": "Świerkot|Maria|M|;Kulawik|Grażyna|G|;Sarnat-Kucharczyk|Monika|M|;Jagoda|Krystyna|K|;Mrukwa-Kominek|Ewa|E|;Chudek|Jerzy|J|",
"chemical_list": "D000961:Antilymphocyte Serum; D005938:Glucocorticoids; D007166:Immunosuppressive Agents",
"country": "Poland",
"delete": false,
"doi": "10.5603/EP.a2019.0067",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0423-104X",
"issue": "71(2)",
"journal": "Endokrynologia Polska",
"keywords": "Graves’ orbitopathy; anti-thymocyte globulin; dysthyroid optic neuropathy",
"medline_ta": "Endokrynol Pol",
"mesh_terms": "D000961:Antilymphocyte Serum; D004351:Drug Resistance; D005260:Female; D005938:Glucocorticoids; D049970:Graves Ophthalmopathy; D006801:Humans; D007166:Immunosuppressive Agents; D008875:Middle Aged; D012074:Remission Induction",
"nlm_unique_id": "0370674",
"other_id": null,
"pages": "198-199",
"pmc": null,
"pmid": "32096552",
"pubdate": "2020",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Long-term remission of steroid-resistant Graves' orbitopathy after administration of anti-thymocyte globulin.",
"title_normalized": "long term remission of steroid resistant graves orbitopathy after administration of anti thymocyte globulin"
} | [
{
"companynumb": "PL-PFIZER INC-2020105472",
"fulfillexpeditecriteria": "1",
"occurcountry": "PL",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CYCLOSPORINE"
},
"drugadditional": null,
... |
{
"abstract": "We herein report a 46-year-old man who suffered an intentional acetaminophen overdose. Laboratory results revealed leukocytosis and an elevated procalcitonin level (8.48 ng/mL). Computed tomography showed findings suggesting possible colitis. Due to concerns about sepsis in addition to acetaminophen overdose, oral N-acetyl cysteine and piperacillin/tazobactam were started. His procalcitonin levels further increased; however, the patient remained afebrile, and the C-reactive protein levels were normal. Piperacillin/tazobactam was discontinued, and he remained stable without antibiotics. The present case shows that the toxicokinetics of acetaminophen overdose can cause an elevated procalcitonin level. Furthermore, procalcitonin levels alone should not guide the need for antibiotics in such cases.",
"affiliations": "Department of Medicine, John A. Burns School of Medicine, University of Hawai'i, USA.;Department of Medicine, John A. Burns School of Medicine, University of Hawai'i, USA.;Hospitalist Program, Queen's Medical Center, USA.",
"authors": "Nishimura|Yoshito|Y|;Kewcharoen|Jakrin|J|;Narimasu|Toni|T|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": "10.2169/internalmedicine.7192-21",
"fulltext": "\n==== Front\nIntern Med\nIntern Med\nInternal Medicine\n0918-2918\n1349-7235\nThe Japanese Society of Internal Medicine\n\n34176834\n10.2169/internalmedicine.7192-21\nCase Report\nExtremely Elevated Procalcitonin in a Case of Acetaminophen Overdose and Acute Liver Injury\nNishimura Yoshito 1\nKewcharoen Jakrin 1\nNarimasu Toni 2\n1 Department of Medicine, John A. Burns School of Medicine, University of Hawai‘i, USA\n2 Hospitalist Program, Queen's Medical Center, USA\nCorrespondence to Dr. Yoshito Nishimura, yoshiton@hawaii.edu\n\n26 6 2021\n1 1 2022\n61 1 115118\n31 1 2021\n10 5 2021\nCopyright © 2022 by The Japanese Society of Internal Medicine\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ The Internal Medicine is an Open Access journal distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).\nWe herein report a 46-year-old man who suffered an intentional acetaminophen overdose. Laboratory results revealed leukocytosis and an elevated procalcitonin level (8.48 ng/mL). Computed tomography showed findings suggesting possible colitis. Due to concerns about sepsis in addition to acetaminophen overdose, oral N-acetyl cysteine and piperacillin/tazobactam were started. His procalcitonin levels further increased; however, the patient remained afebrile, and the C-reactive protein levels were normal. Piperacillin/tazobactam was discontinued, and he remained stable without antibiotics. The present case shows that the toxicokinetics of acetaminophen overdose can cause an elevated procalcitonin level. Furthermore, procalcitonin levels alone should not guide the need for antibiotics in such cases.\n\nacetaminophen\noverdose\nprocalcitonin\nacute liver injury\n==== Body\npmcIntroduction\n\nAcetaminophen is an analgesic and antipyretic commonly used by millions of people, with over 600 marketed products, including over-the-counter (OTC) drugs. Given its popularity, acetaminophen overdose is the most common cause of drug-induced acute liver injury in the United States (1), and intentional acetaminophen overdose is often cited as a common suicidal activity (2).\n\nPatients with acetaminophen overdose often have non-specific symptoms, such as generalized weakness, abdominal pain, and nausea. While acetaminophen-induced liver injury is considered to occur in a dose-dependent fashion, those who overdose with relatively low-dose acetaminophen over several days may still suffer liver toxicity. The serum aminotransferase levels on admission are frequently within normal limits but may rapidly increase within 24 hours after hospitalization (3). The standard treatment for acetaminophen overdose is N-acetyl cysteine administration, which effectively mitigates liver injury if administered early (4).\n\nProcalcitonin (PCT), an active precursor of calcitonin, is associated with the response to bacterial infection (5). Despite its usefulness for guiding antibiotic therapy in cases of severe infection, such as sepsis (6-8), dependence on PCT to diagnose sepsis has been the subject of debate over the past several years (9,10).\n\nWe herein report a case of intentional acetaminophen overdose in a patient with a significantly elevated PCT level. While the patient received antibiotics initially, the medical team ruled out sepsis following an observation period. The elevated PCT level was considered to be acetaminophen-induced. This case shows that acetaminophen overdose can significantly increase PCT levels and mimic sepsis, resulting in unnecessary antibiotic use.\n\nCase Report\n\nA 46-year-old Vietnamese man with a relevant medical history of schizophrenia, recurrent suicidal ideation (SI), hypertension (HTN), and insulin-dependent diabetes type 2 (IDDM2) presented to the emergency department (ED) with an altered mental status and SI. According to the patient, he had been in his usual state of health until 4 days prior to the ED visit, when he began to have SI and ingested large amounts of OTC acetaminophen tablets. He mentioned having taken approximately 15 tabs of a 325-mg formula (about 4.9 g of acetaminophen) every day for the past 4 days. He denied any recent use of alcohol or other illicit drugs, including methamphetamine, marijuana, or benzodiazepines. He was brought to the ED by his family after admitting taking acetaminophen in a suicide attempt.\n\nThe patient had diffuse abdominal pain without radiation, associated with nausea and watery diarrhea. His medical history was significant for HTN, IDDM2, chronic kidney disease (CKD) stage 3a, a history of right post-capsular ischemic stroke, schizophrenia, anxiety disorder, and polysubstance abuse, including benzodiazepines and methamphetamine. His daily medications were significant for multiple psychiatric drugs, including Aripiprazole, Sertraline, and Trazodone.\n\nUpon presentation, he was hypertensive with a blood pressure of 159/103 mmHg, pulse rate of 84 beats per minute, and no fever. He was lethargic and irritable and was unable to provide a reliable history. No scleral icterus was noted. There was left upper quadrant tenderness without guarding on an abdominal examination. On a neurological examination, his cranial nerves were grossly intact without focal deficits. The results of initial laboratory investigations are summarized in Table 1. On admission, the white blood cell (WBC) count was 20,000/μL with a neutrophil predominance (86.9%). The basic metabolic panel, liver function tests (LFTs), coagulation studies, and urinalysis findings were grossly normal. His serum acetaminophen level was elevated to 75 μg/mL (reference range: 10-30 μg/mL), while serum ethanol and urine toxicology findings were negative. However, his PCT and lactic acid levels were significantly elevated at 8.48 ng/mL (reference range: <0.05 ng/mL) and 5.9 mEq/L (reference range: 0.5-2.2 mEq/L), respectively.\n\nTable 1. Laboratory Results on Admission.\n\nParameter\t\tValue\t\t(Reference range)/units\t\nWBC\t\t20,000\t\t(3,800-10,800)/µL\t\nHemoglobin\t\t16.6\t\t(13.7-17.5) g/dL\t\nPlatelet\t\t304\t\t(151-424×103)/µL\t\nSodium\t\t136\t\t(133-145) mEq/L\t\nPotassium\t\t3.3\t\t(3.3-5.1) mEq/L\t\nChloride\t\t95\t\t(95-108) mEq/L\t\nCalcium\t\t10.1\t\t(8.3-10.5) mg/dL\t\nBUN\t\t17\t\t(6-23) mg/dL\t\nCreatinine\t\t1.3\t\t(0.6-1.4) mg/dL\t\nAST\t\t24\t\t(0-40) IU/L\t\nALT\t\t42\t\t(0-41) IU/L\t\nALP\t\t120\t\t(35-129) IU/L\t\nTotal bilirubin\t\t0.6\t\t(0-1.2) mg/dL\t\nTotal protein\t\t9.4\t\t(6.4-8.3) g/dL\t\nAlbumin\t\t5.4\t\t(3.5-5.2) g/dL\t\nPT-INR\t\t1.1\t\t\t\nProcalcitonin\t\t8.48\t\t(<0.05) ng/mL\t\nLactate\t\t5.9\t\t(0.5-2.2) mEq/L\t\nAcetaminophen\t\t75\t\t(10-30) µg/mL\t\nALP: alkaline phosphatase, ALT: alanine transaminase, AST: aspartate transaminase, BUN: blood urea nitrogen, PT-INR: prothrombin time of the international normalized ratio, WBC: white blood cell\n\nThese findings raised concerns about sepsis and prompted further diagnostics, including chest X-ray and contrast-enhanced computed tomography (CT) from the abdomen to the pelvis, given his reported gastrointestinal symptoms. Chest X-ray showed no cardiomegaly or new infiltrates, but CT revealed fluid-filled loops of bowel associated with colonic wall thickening, suggesting possible enterocolitis. No hepatic abscess, choledocholithiasis, or urinary tract obstruction noted.\n\nGiven his clinical presentation, leukocytosis with an extremely elevated PCT level, and the CT findings, empiric treatment for both acetaminophen overdose and sepsis secondary to possible bacterial enterocolitis were started. For the acetaminophen overdose, he was immediately started on a 72-hour course with oral N-acetyl cysteine (NAC) (70 mg/kg every 4 hours for 17 doses). For sepsis, the patient was given piperacillin/tazobactam (PIPC/TAZ) 4.5 g every 6 hours after two sets of blood cultures were collected.\n\nTable 2 summarizes the trends in WBCs, LFTs, PCT levels, and other relevant laboratory results during hospitalization. While his gastrointestinal symptoms had resolved and remained clinically stable without a fever, his PCT level had risen to 31.29 ng/mL on hospital day 3. However, his C-reactive protein (CRP) level on the same day was within normal limits (0.93 mg/dL; reference range: 0.0-1.0 mg/dL), and his WBC count continued to show a decreasing trend. Given the isolated elevation in his PCT level, underlying sepsis was deemed unlikely, and PIPC/TAZ was discontinued. This WBC count continued to normalize after discontinuation of the antibiotics, and he remained afebrile. The final result of blood cultures obtained on admission was negative. Liver enzyme levels peaked on hospital day 4, requiring an extension of oral NAC therapy. Due to persistent SI, he was transferred to the inpatient psychiatric unit on hospital day 5.\n\nTable 2. Trends of Creatine Kinase, Creatinine, and Liver Function Tests.\n\nParameter\t\tDay 1\t\tDay 2\t\tDay 3\t\tDay 4\t\tDay 5\t\tDay 6\t\t(Reference range)/units\t\nWBC\t\t20,000\t\t23,610\t\t12,130\t\t11,320\t\t10,350\t\t\t\t(3,800-10,800) /µL\t\nPCT\t\t8.48\t\t\t\t31.29\t\t13.54\t\t\t\t\t\t(<0.05) ng/mL\t\nCRP\t\t\t\t\t\t0.93\t\t\t\t\t\t\t\t(0.0-1.0) mg/dL\t\nAST\t\t24\t\t17\t\t65\t\t484\t\t190\t\t73\t\t(0-40) IU/L\t\nALT\t\t42\t\t33\t\t69\t\t520\t\t500\t\t359\t\t(0-41) IU/L\t\nALT: alanine transaminase, AST: aspartate transaminase, BUN: blood urea nitrogen, CRP: C-reactive protein, PCT: procalcitonin, WBC: white blood cell\n\nDiscussion\n\nSerum PCT has become a standard laboratory test performed in daily practice. While PCT might be useful for diagnosing sepsis or reducing the duration of antibiotic therapy in some cases of bacterial infections (5-9,11), previous studies have reported that the PCT level is also increased in other disorders, including shock, trauma, hepatic or renal failure, malignancy, and some autoimmune disorders (11,12). As in the present case with a significantly elevated PCT level (31.29 ng/mL), a few case reports have also noted that patients with acute liver failure due to acetaminophen intoxication without infection had high PCT levels (Table 3) (13-15). Our patient had increased PCT levels ahead of AST and ALT elevation, which might have been due to the relatively rapid induction time of PCT (about two to four hours after the insults) (11). While the reason why patients with acetaminophen intoxication have markedly elevated PCT levels is unclear, it has been speculated that acetaminophen-induced hepatocyte damage and subsequent activation of inflammasomes may induce interleukin-2 and tumor necrosis factor-alpha release, which leads to PCT release from hepatocytes (14). Further research is needed to clarify the pathophysiology underlying PCT elevation in cases of acetaminophen intoxication, but providers should be aware that extremely elevated PCT levels are not synonymous with sepsis in these cases.\n\nTable 3. Summary of Adult Cases with Acetaminophen Toxicity who Had Elevated Procalcitonin.\n\nCase\tRef\tAge/\nSex\tTotal acetaminophen dose (mg)\tAcetaminophen concentration (µg/mL)\tPCT (ng/mL)\tCRP (mg/dL)\tAST (IU/L)\tALT (IU/L)\t\n1\t14\t24/F\t8,000\t<0.5\t31.89\t<0.05\t20\t11\t\n2\t14\t51/M\t23,600\t116.9\t45.66\t0.18\t2,508\t1,473\t\n3\t15\t65/-\t20,000\t162.4\t23.15\t<0.03\t11,939\t6,988\t\n4\t15\t34/-\t38,000\t149.6\t79.78\t<0.03\tN/A\t18\t\n5\tPresent case\t46/M\t19,600\t75.0\t31.29\t0.93\t484\t520\t\nThe sex of cases 3 and 4 was not specified in the manuscript.\n\nALT: alanine transaminase, AST: aspartate transaminase, CRP: C-reactive protein, PCT: procalcitonin, Ref: reference\n\nIn addition, previous case reports on acetaminophen intoxication without sepsis noted normal or low serum CRP level despite PCT elevation (14,15), which echoes the findings in this case report. Although a previous study showed no significant correlation between serum PCT levels and the clinical prognosis in pediatric patients with acetaminophen toxicity (13), whether or not the extent of PCT elevation correlates with a poor clinical prognosis in adult cases of acetaminophen overdose is still unclear. Future studies should clarify whether or not elevated PCT levels can predict acetaminophen-induced liver injury at an earlier stage, and the discrepancy in serum PCT and CRP levels might be useful in determining if patients have concomitant sepsis with acetaminophen intoxication.\n\nGlobal health experts have recently noted that antimicrobial resistance (AMR) and stewardship are urgent public health agendas (16,17). While the PCT-guided use of antibiotics is useful in some cases, the utility of the PCT level alone in acetaminophen intoxication as an indicator of sepsis is questionable. The clinical decision on whether or not to start antibiotics with acetaminophen intoxication should be based on a comprehensive assessment of the clinical presentation, which is the gold standard of sepsis, in order to decrease the unnecessary use of antibiotics and reduce the risk of resistant pathogens in the future.\n\nThe authors state that they have no Conflict of Interest (COI).\n==== Refs\n1. Bari K , Fontana RJ . Acetaminophen overdose: what practitioners need to know. Clin Liver Dis (Hoboken) 4 : 17-21, 2014.30992913\n2. de Achaval S , Suarez-Almazor M . Acetaminophen overdose: a little recognized public health threat. Pharmacoepidemiol Drug Saf 20 : 827-829, 2011.21717529\n3. Myers RP , Li B , Fong A , Shaheen AA , Quan H . Hospitalizations for acetaminophen overdose: a Canadian population-based study from 1995 to 2004. BMC Public Health 7 : 143, 2007.17615056\n4. Smilkstein MJ , Knapp GL , Kulig KW , Rumack BH . Efficacy of oral N-acetylcysteine in the treatment of acetaminophen overdose. Analysis of the national multicenter study (1976 to 1985). N Engl J Med 319 : 1557-1562, 1988.3059186\n5. Simon P , Milbrandt EB , Emlet LL . Procalcitonin-guided antibiotics in severe sepsis. Crit Care 12 : 309, 2008.19090974\n6. Bouadma L , Luyt CE , Tubach F , et al . Use of procalcitonin to reduce patients' exposure to antibiotics in intensive care units (PRORATA trial): a multicentre randomised controlled trial. Lancet 375 : 463-474, 2010.20097417\n7. Schuetz P , Wirz Y , Sager R , et al . Procalcitonin to initiate or discontinue antibiotics in acute respiratory tract infections. Cochrane Database Syst Rev 10 : CD007498, 2017.29025194\n8. Huang DT , Yealy DM , Filbin MR , et al . Procalcitonin-guided use of antibiotics for lower respiratory tract infection. N Engl J Med 379 : 236-249, 2018.29781385\n9. Wacker C , Prkno A , Brunkhorst FM , Schlattmann P . Procalcitonin as a diagnostic marker for sepsis: a systematic review and meta-analysis. Lancet Infect Dis 13 : 426-435, 2013.23375419\n10. Rule JA , Hynan LS , Attar N , et al . Procalcitonin identifies cell injury, not bacterial infection, in acute liver failure. PLoS One 10 : e0138566, 2015.26393924\n11. Meisner M . Update on procalcitonin measurements. Ann Lab Med 34 : 263-273, 2014.24982830\n12. Sugihara T , Koda M , Okamoto T , et al . Serum procalcitonin in patients with acute liver failure. Yonago Acta Med 60 : 40-46, 2017.28331420\n13. Tschiedel E , Assert R , Felderhoff-Muser U , et al . Undue elevation of procalcitonin in pediatric paracetamol intoxication is not explained by liver cell injury alone. Ann Hepatol 17 : 631-637, 2018.29893707\n14. Ahn JH , Cho YS , Cho GC . Elevated procalcitonin levels in patients with acetaminophen intoxication: two case reports: a CARE-compliant article. Medicine (Baltimore) 99 : e18882, 2020.32049787\n15. García de , Guadiana Romualdo L , Rodríguez Rojas C , Ramos Arenas V , Cárdenas Gámez R , López Abellán MD , González Morales M . Increased concentrations of procalcitonin in patients with paracetamol intoxication. Adv Lab Med 2 : 287-290, 2021.\n16. Nishizawa H , Nishimura Y , Matsumura H , et al . G20 Okayama Health Ministers' meeting: conclusions and commitments. J Glob Health 10 : 010320, 2020.32509281\n17. Matsumura H , Nishimura Y , Horiuchi H , Higashira T , Kita Y , Nishizawa H . G20 Okayama Health Ministers' meeting: lessons learned and way forward. Glob Health Med 1 : 65-70, 2019.33330757\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0918-2918",
"issue": null,
"journal": "Internal medicine (Tokyo, Japan)",
"keywords": "acetaminophen; acute liver injury; overdose; procalcitonin",
"medline_ta": "Intern Med",
"mesh_terms": null,
"nlm_unique_id": "9204241",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34176834",
"pubdate": "2021-06-26",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Extremely Elevated Procalcitonin in a Case of Acetaminophen Overdose and Acute Liver Injury.",
"title_normalized": "extremely elevated procalcitonin in a case of acetaminophen overdose and acute liver injury"
} | [
{
"companynumb": "US-VISTAPHARM, INC.-VER202107-001707",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN\\HYDROCODONE"
},
"dr... |
{
"abstract": "We present a 57-year-old Caucasian man with hepatocellular carcinoma (HCC) twice achieving complete remission with reduced dose sorafenib. His initial diagnosis of HCC rapidly improved with sorafenib and he achieved a complete biochemical and radiographic response within 7 months. Remission lasted only 5 months but we noted that the timing of his relapse was immediately after he incidentally discontinued clopidogrel. It was restarted and within 5 months of restarting clopidogrel he once again achieved complete remission. The course of his remission was followed and temporal association of sorafenib remission with use of clopidogrel was observed.",
"affiliations": "Section of Hematology Oncology, Veteran Affairs Medical Center, Pittsburgh, Pennsylvania, USA.",
"authors": "Tan-Shalaby|Jocelyn L|JL|",
"chemical_list": "D000970:Antineoplastic Agents; D010671:Phenylurea Compounds; D010975:Platelet Aggregation Inhibitors; D009536:Niacinamide; D000077157:Sorafenib; D000077144:Clopidogrel; D040262:Receptors, Vascular Endothelial Growth Factor; D013988:Ticlopidine",
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2014()",
"journal": "BMJ case reports",
"keywords": null,
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000970:Antineoplastic Agents; D006528:Carcinoma, Hepatocellular; D000077144:Clopidogrel; D004305:Dose-Response Relationship, Drug; D004359:Drug Therapy, Combination; D005500:Follow-Up Studies; D006801:Humans; D008113:Liver Neoplasms; D008297:Male; D008875:Middle Aged; D009536:Niacinamide; D010671:Phenylurea Compounds; D010975:Platelet Aggregation Inhibitors; D040262:Receptors, Vascular Endothelial Growth Factor; D012074:Remission Induction; D000077157:Sorafenib; D013988:Ticlopidine; D013997:Time Factors; D014057:Tomography, X-Ray Computed",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "25178887",
"pubdate": "2014-09-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "22212950;19095497;20714941;20309643;10972499;18757292;4801854;10510244;22826219;18650514;12417048;20616599;20975882;21347197;17316876;18928548;21040448;11114740;23742914;21071699;6386144;21241463",
"title": "Reproducible complete remission of advanced hepatocellular carcinoma with sorafenib in combination with clopidogrel.",
"title_normalized": "reproducible complete remission of advanced hepatocellular carcinoma with sorafenib in combination with clopidogrel"
} | [
{
"companynumb": "US-BAYER-2014-134557",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CLOPIDOGREL BISULFATE"
},
"drugadditional": null,... |
{
"abstract": "A 9-year-old girl with autistic spectrum disorder (ASD) was admitted for a flare-up of chronic recurrent multi-osteomyelitis (CRMO). She complained of leg pain over 3 months, was unable to weight-bear and had a petechial rash for 10 days. She had bleeding gums and a long history of only eating custard and crackers.CRMO was diagnosed at age 3. She'd had shoulder, knee, and ankle involvement, two courses of pamidronate (2011 and 2015) and was currently taking simple analgesia.On examination, she was afebrile, with a widespread petechial rash, most pronounced over her ankles/shins. Her knees and ankles were tender; her ankles had small medial effusions.\n\n\n\nMild hypochromic anaemia, normal platelets, white cell countand coagulation. CRP 16. Figures 1 and 2 show her knee radiograph and MRI, respectively.edpract;103/6/304/F1F1F1Figure 1edpract;103/6/304/F2F2F2Figure 2 QUESTION 1: Give four differential diagnoses of petechial rash, bleeding gums and leg pain in an afebrile child? QUESTION 2: Name three behaviours associated with ASD with health consequences. Answers to the questions are on page 02 ANSWERS TO THE QUESTIONS ON PAGE 02.",
"affiliations": "Department of Paediatric Infectious Diseases and Immunology, Bristol Royal Hospital for Children, Bristol, UK.;Department of Radiology, Bristol Royal Hospital for Children, Bristol, UK.;Department of Rheumatology, Bristol Royal Hospital for Children, Bristol & Royal National Hospital for Rheumatic Diseases, Bath, UK.;Department of Rheumatology, Bristol Royal Hospital for Children, Bristol & Royal National Hospital for Rheumatic Diseases, Bath, UK.",
"authors": "Metz|Jane|J|;Holjar-Erlic|Izidora|I|;Kelly|Alison|A|;Ramanan|Athimalaipet V|AV|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1136/archdischild-2017-312993",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1743-0585",
"issue": "103(6)",
"journal": "Archives of disease in childhood. Education and practice edition",
"keywords": "autism; scurvy; vitamin C",
"medline_ta": "Arch Dis Child Educ Pract Ed",
"mesh_terms": "D000067877:Autism Spectrum Disorder; D002648:Child; D005260:Female; D006801:Humans; D007719:Knee Joint; D008279:Magnetic Resonance Imaging; D010019:Osteomyelitis; D012614:Scurvy; D014057:Tomography, X-Ray Computed",
"nlm_unique_id": "101220684",
"other_id": null,
"pages": "304-306",
"pmc": null,
"pmid": "29122830",
"pubdate": "2018-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Think about the 'C' (in custard and crackers).",
"title_normalized": "think about the c in custard and crackers"
} | [
{
"companynumb": "GB-MYLANLABS-2020M1011267",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PAMIDRONATE DISODIUM"
},
"drugadditional": nu... |
{
"abstract": "We describe a 29-year-old female who presented with rhabdomyolysis shortly after starting a course of sodium valproate. A thorough investigation revealed a likely mitochondrial origin inducing this susceptibility. An underlying mitochondrial disorder should be considered in all patients who present with undifferentiated disease whilst taking sodium valproate.",
"affiliations": "Robina Hospital, Gold Coast Health, Gold Coast, Qld., Australia.;Robina Hospital, Gold Coast Health, Gold Coast, Qld., Australia.;Robina Hospital, Gold Coast Health, Gold Coast, Qld., Australia.",
"authors": "Bellinge|Jamie|J|;Herath|Sanjaya|S|;Sonigra|Dharmesh|D|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.1159/000447087",
"fulltext": "\n==== Front\nCase Rep NeurolCase Rep NeurolCRNCase Reports in Neurology1662-680XS. Karger AG Allschwilerstrasse 10, P.O. Box · Postfach · Case postale, CH–4009, Basel, Switzerland · Schweiz · Suisse, Phone: +41 61 306 11 11, Fax: +41 61 306 12 34, karger@karger.ch 10.1159/000447087crn-0008-0185Case ReportSodium Valproate Exacerbating an Underlying Disorder of Fatty Acid Metabolism Bellinge Jamie *Herath Sanjaya Sonigra Dharmesh Robina Hospital, Gold Coast Health, Gold Coast, Qld., Australia*Jamie Bellinge, Unit 1, 26 Hood Street, Subiaco, WA 6008 (Australia), E-Mail jamiebellinge@hotmail.comSep-Dec 2016 12 9 2016 12 9 2016 8 3 185 192 24 5 2016 24 5 2016 Copyright © 2016 by S. Karger AG, Basel2016This article is licensed under the Creative Commons Attribution-NonCommercial-4.0 International License (CC BY-NC) (http://www.karger.com/Services/OpenAccessLicense). Usage and distribution for commercial purposes requires written permission.We describe a 29-year-old female who presented with rhabdomyolysis shortly after starting a course of sodium valproate. A thorough investigation revealed a likely mitochondrial origin inducing this susceptibility. An underlying mitochondrial disorder should be considered in all patients who present with undifferentiated disease whilst taking sodium valproate.\n\nKey Words\nSodium valproateMitochondrial disorderRhabdomyolysis\n==== Body\nIntroduction\nMitochondrial respiratory chain disorders are increasingly recognised in today's era of medicine. In Australia alone, the prevalence of mitochondrial disease is now 13.1/100,000 [1], owing to the advancements in laboratory diagnostic techniques and growth in practitioner education and recognition. Often, these conditions are identified in the neonatal and paediatric age group, when patients present with some of the findings described in table 1 [2].\n\nDisorders of this biochemical pathway may also manifest later in life, frequently involving multiple bodily systems [3]. Organs commonly involved are those with a high concentration of mitochondria. The liver, heart, central nervous system and skeletal muscle tissue are typical examples. If mitochondrial disease is suspected, a skeletal muscle biopsy is indicated [4].\n\nSodium valproate is a frequently prescribed broad-spectrum anti-epileptic medication. It is often tolerated well with minimal side effects, though on multiple occasions it has been shown to cause life-threatening adverse events. There is a vast quantity of publishing surrounding certain patient susceptibilities to these detrimental effects. In this particular case, sodium valproate's impact on the mitochondrial respiratory chain has likely induced a life-threating disease state in the patient reported here [5].\n\nCase Report\nWe describe the case of a 29-year-old Caucasian female who presented to the emergency department with a 4-day history of acute-onset proximal muscle weakness and associated mild myalgia. A 3-week history of preceding lethargy and fatigue was also described.\n\nHer background was significant for depression, insomnia, alcoholism and epilepsy. Her epilepsy was diagnosed at the age of 24 years with 10 tonic-clonic seizures (associated with incontinence) since diagnosis. She had experienced her last seizure approximately 12 months prior to presenting. She was initially managed with levetiracetam 1,000 mg b.d. but self-ceased this medication 6 months prior to presentation. The patient was commenced on sodium valproate 200 mg b.d. after a 4-month medication-free period. She ceased the sodium valproate 1 week prior to presentation due to symptoms of lethargy, depression and fatigue that she attributed to the medication. She has no allergies and has never experienced an adverse drug reaction before.\n\nThe patient described multiple episodes of a similar myopathic nature occurring intermittently over the previous 4 years. These were described as extreme difficulty walking up stairs or getting out of bed. This would occur for a day or so and then resolve.\n\nThe patient denied the consumption of alcohol or illicit drugs prior to the onset of weakness, and this was confirmed by a reliable collateral history. No other precipitating factors were identified in a thorough history. Surgical history and family history were both unremarkable.\n\nOn examination, the patient appeared malnourished, underweight and pale. Her speech was slurred, and bilateral ptosis (without fatigability) was present. Her vital signs were stable, and she was afebrile. Abdominal exam revealed a mild hepatomegaly (21 cm) and splenomegaly (18 cm). There was conjunctival pallor, and multiple bruises were found on the legs.\n\nNeuromuscular system examination revealed symmetrical bilateral proximal muscle weakness of the shoulders, hips and knees. The hips were affected the worst (2/5 power), followed by the knees (3/5 power) and shoulders (4/5 power). There was no involvement of distal muscles. There was muscle atrophy noted around the quadriceps and gluteal region. The patient experienced significant difficulty standing from a seating position alone, though when assisted, displayed a classical waddling gait indicative of proximal muscle weakness. The remainder of the examination was unremarkable.\n\nInvestigations\nA urine dipstick identified protein (+++), heme (++) and a dark brown colouring. In combination with the physical examination, a provisional diagnosis of rhabdomyolysis was made. This prompted the following investigations. A full blood count revealed a mild macrocytic anaemia with no indications of infection. Liver function tests were significantly deranged (ALP 195 IU/l, GGT 342 IU/l, ALT 347 IU/l and AST 1,460 IU/l), and INR was 1.3. In the context of the clinical scenario, the marked elevation of AST and the smaller elevation of ALT are likely a result of muscular release of these enzymes. An admission 18 months previously had shown similar results (ALP 298 IU/l, GGT 2,810 IU/l, ALT 155 IU/l and AST 179 IU/l), indicating a likely chronic impairment of liver function. Urine MCS and drug screen indicated no signs of infection or drug abuse. Erythrocyte sedimentation rate and C-reactive protein were 32 mm/h and 24 mg/l, respectively. Serum calcium, potassium and phosphate were within the normal ranges. The serum urea measured 5.5 mmol/l (2.1–7.1 mmol/l), and the serum creatinine measured 42 μmol/l (46–90 μmol/l), which resulted in a urea/creatinine ratio of 131 (46–100). A baseline measurement from 18 months prior showed urea to be 2.9 mmol/l and creatinine to be 32 μmol/l with a urea/creatinine ratio of 90. One should expect a low urea/creatinine ratio in the early stages of rhabdomyolysis when muscle release of phosphocreatinine (metabolised to creatinine) exceeds that of the serum urea. However, in later stages of rhabdomyolysis, the catabolism of muscle proteins results in an elevation of serum urea and a resulting increase in the urea/creatinine ratio. If this patient had presented earlier in her disease state, we would have likely found a significantly higher serum creatinine. A urinalysis was negative for red blood cells, suggesting (in combination with the dipstick findings) myoglobinuria. A urine myoglobin assay was performed on day 5 of admission after rigorous fluid resuscitation. The result was negative, not unexpected due to the half-life of myoglobin (1–3 h) and the significant dilution of urine. Serum glucose, thyroid function tests and serum lactate were normal. Viral serologies for HIV, hepatitis B and hepatitis C were negative. Rheumatoid factor, anti-nuclear antibodies, anti-MuSK antibodies and anti-acetylcholine receptor antibodies were also negative. On admission, creatine kinase was elevated to 14,600 U/l. This declined to 1,020 U/l after 5 days of treatment and resolved to normal levels by day 9. An abdominal ultrasound confirmed hepatosplenomegaly (21 and 18 cm) and identified fatty changes of the liver. An acylcarnitine assay was performed after the possibility of mitochondrial involvement was suspected (fig 1; table 2).\n\nDiscussion\nThe patient was diagnosed with rhabdomyolysis and myoglobinuria. Appropriate treatment was commenced. The common causes of rhabdomyolysis are listed in table 3.\n\nAfter a review of the patient's differentials, each of the common causes of rhabdomyolysis was carefully excluded. An acute alcoholic myopathy would often present days after a large binge episode, where the patient would remain immobilised and malnourished. A chronic alcoholic myopathy commonly presents in an older individual with a slow and insidious onset. A urine drug screen and history (subjective and collateral) reduced the likelihood that illicit drugs were the causative agents. The history alone was deemed significant enough to rule out any toxic and exertive causes of the rhabdomyolysis. Although selective serotonin reuptake inhibitors (SSRIs) are known to cause rhabdomyolysis, this is regularly on the background of serotonin syndrome, which the presentation did not denote. Her history, clinical exam and blood results did not indicate any signs of infection, endocrine disorder, trauma or autoimmune disease.\n\nSodium valproate is becoming a well-known antagonist in patients with underlying disorders such as mitochondrial disease. Papadimitriou and Servidei [6] in 1991 described a 47-year-old male who presented with a proximal myopathy after 4 months of sodium valproate treatment. A muscle biopsy confirmed the diagnosis of multiple acyl-CoA dehydrogenase deficiency. Kottlors et al. [7] in 2001 described a different 47-year-old male with previous episodes of myoglobinuria, who developed a serious rhabdomyolysis with associated acute kidney injury 4 days after commencing sodium valproate. A muscle biopsy confirmed a CPT-2 deficiency. Njolstad et al. [8] in 1997 described the case of an 11-year-old boy who developed fulminant liver failure with myopathic involvement after being treated with sodium valproate for epilepsy. A diagnosis of medium-chain acyl-CoA dehydrogenase deficiency was made. Similar cases have been described [9, 10, 11, 12, 13].\n\nThe clinical information mentioned above suggests a vulnerability to the toxic effects of sodium valproate. The patient's history of exercise intolerance, epilepsy, chronic liver disease and rhabdomyolysis supports a disorder of mitochondrial respiratory chain function. From prior case reports, associations between this susceptibility (to sodium valproate) and two inborn errors of mitochondrial metabolism are noted: MCAD deficiency and CPT-2 deficiency. Figure 1 shows the acylcarnitine assay of our patient. This serum analysis is helpful in identifying disorders of the mitochondrial respiratory chain and resulting metabolism of fatty acids. There are significant elevations across most chain lengths of acylcarnitines, but most notable are the elevations in chain lengths C10 and C12. Developing a differential diagnosis from this investigation involves the interpretation of patterns of elevations and deficiencies in differing isomers of the acylcarnitine species. Comparisons are then made between the patterns seen in the patient's blood and classical findings in mitochondrial diseases. Our patient's results are similar to those seen in glutaric aciduria type 2, MCAD deficiency and CPT-2 deficiency. Sodium valproate has been shown to induce abnormal levels of acylcarnitines, though the results seen in our patient have not yet been described [14, 15].\n\nThe clinical picture of her presentation fits that of a late-onset CPT-2 deficiency. Although this is a likely diagnosis, it cannot be confirmed without a muscle biopsy, to which the patient did not consent.\n\nUsing the Naranjo adverse drug reaction probability scale, it is probable that our patient's rhabdomyolysis is due to sodium valproate (Naranjo score +5). The key message, however, is not to attribute all responsibility to sodium valproate but rather to consider the likelihood of an underlying mitochondrial disorder in patients exhibiting a severe undifferentiated presentation after commencing this medication.\n\nStatement of Ethics\nStudies on human subjects were conducted in accordance with the Declaration of Helsinki. Accordingly, the authors declare that the subject has given her informed written consent.\n\nDisclosure Statement\nThere are no conflicts of interest.\n\nFig. 1 Results of our patient's acylcarnitine assay. Similar elevations may be seen in other mitochondrial respiratory chain disorders. Additional information can be found in table 2.\n\nTable 1 Clinical findings in defects of mitochondrial respiratory chain function [2]\n\nSuggestive symptoms\tReye syndrome (especially recurrent]\t\n\tHypotonia and myopathy\t\n\tPeripheral neuropathy\t\n\tAltered levels of consciousness\t\n\tSudden unexplained death\t\n\t\nSuggestive findings\tHypoketotic or ketotic hypoglycemia\t\n\tCardiomyopathy\t\n\tCardiac arrhythmia\t\n\tUnexplained metabolic acidosis with or without hyperammonemia\t\n\tAcute fatty liver of pregnancy and HELLP syndrome (haemolysis, elevated\t\n\tliver enzymes and low platelets]\t\n\tRecurrent rhabdomyolysis\t\n\tDicarboxylic aciduria\t\n\tCarnitine deficiency\t\n\tRecurrent/fulminant liver failure\t\nTable 2 Additional information to figure 1\n\nAcylcarnitine isomer\tResult, μmol/l\tReference range, μmol/l\t\nTotal carnitine\t182\t21–70\t\nFree carnitine\t76\t13–56\t\nAcetylcarnitine (C2)\t066\t3–23\t\nPropionylcarnitine (C3)\t1.4\t<0.66\t\nTiglylcarnitine (C5:1)\t<0.1\t<0.2\t\nButyrylcarnitine (C4)\t01.1\t0.12–0.67\t\nIsovalerylcarnitine (C5)\t02.2\t<0.28\t\nHexanoylcarnitine (C6)\t01.3\t<0.13\t\n3-Hydroxyisovalerylcarnitine (C5-OH)\t<0.1\t<0.31\t\nOctanoylcarnitine (C8)\t02.2\t<0.24\t\nDecenoylcarnitine (C10:1)\t00.32\t<0.5\t\nDecanoylcarnitine (C10)\t04.6\t<0.4\t\nGlutarylcarnitine (C5-DC)\t00.21\t<0.34\t\nDodecanoylcarnitine (C12)\t03.2\t<0.62\t\nTetradecenoylcarnitine (C14:1)\t010\t<0.73\t\nTetradecanoylcarnitine (C14)\t02.7\t<0.34\t\nPalmitoylcarnitine (C16)\t02.4\t<0.65\t\n3-Hydroxypalmitylcarnitine (C16-OH)\t00.08\t<0.07\t\n3-Hydroxybutyrylcarnitine\t00.74\t–\t\nOleoylcarnitine\t06.52\t–\t\n3-Hydroxyoleoylcarnitine\t00.13\t–\t\nStearoylcarnitine\t00.78\t–\t\nTable 3 Common causes of rhabdomyolysis\n\nAlcohol\tImmobilisation\t\n\tDirect myotoxicity\t\n\tElectrolyte disturbances\t\n\t\nEndocrine\tHypo-/hyperthyroidism\t\nabnormalities\tDiabetic ketoacidosis\t\n\tNon-ketotic hyperosmolar diabetic coma\t\n\t\nExcessive exercise\tMarathon running\t\n\tStatus epilepticus\t\n\tAcute psychosis\t\n\tSevere dystonia\t\n\t\nGenetic disorders\tImpaired carbohydrate metabolism\t\n\tImpaired lipid metabolism\t\n\t\nIllicit drugs\tCocaine\t\n\tHeroin\t\n\tAmphetamines\t\n\tMDMA\t\n\t\nImmobilisation\tAnaesthesia\t\n\tComa\t\n\tDrug-/alcohol-related unconsciousness\t\n\t\nInfection\tInfluenza A and B\t\n\tHuman immunodeficiency virus\t\n\tEpstein-Barr virus\t\n\tCoxsackie virus\t\n\tCytomegalovirus\t\n\tHerpes simplex virus\t\n\t\nMedications\tStatins\t\n\tFibrates\t\n\tSSRIs\t\n\tLithium\t\n\tCorticosteroids\t\n\t\nMuscle disease\tDermatomyositis\t\n\tPolymyositis\t\n\t\nTemperature\tHyper-/hypothermia\t\nextremes\tSerotonin syndrome\t\n\tNeuroleptic malignant syndrome\t\n\tMalignant hyperthermia\t\n\t\nToxins\tCarbon monoxide\t\n\tSnake bite\t\n\tSpider bite\t\n\tHemlock\t\n\t\nTrauma\tCrush injuries\t\n\tBlunt trauma\t\n\tElectrocution\t\n\tSevere burns\n==== Refs\nReferences\n1 Skladal D Halliday J Thorburn DR Minimum birth prevalence of mitochondrial respiratory chain disorders in children Brain 2003 126 1905 1912 12805096 \n2 Moczulski D Majak I Mamczur D An overview of beta-oxidation disorders Postepy Hig Med Dosw (Online) 2009 63 266 277 19535822 \n3 DiMauro S Schon E Mitochondrial respiratory-chain diseases N Engl J Med 2003 348 2656 2668 12826641 \n4 Chinnery P Turnbull D Clinical features, investigation, and management of patients with defects of mitochondrial DNA J Neurol Neurosurg Psychiatry 1997 63 559 563 9408091 \n5 Finsterer J Segall L Drugs interfering with mitochondrial disorders Drug Chem Toxicol 2010 33 138 151 19839725 \n6 Papadimitriou A Servidei S Late onset lipid storage myopathy due to multiple acyl CoA dehydrogenase deficiency triggered by valproate Neuromuscul Disord 1991 1 247 252 1822802 \n7 Kottlors M Jaksch M Ketelsen U Valproic acid triggers acute rhabdomyolysis in a patient with carnitine palmitoyltransferase type II deficiency Neuromuscul Disord 2001 11 757 759 11595519 \n8 Njolstad PR Skjeldal OH Agsteribbe E Medium chain acyl-CoA dehydrogenase deficiency and fatal valproate toxicity Pediatr Neurol 1997 16 160 162 9090694 \n9 Meyer S Martin T Loffler G Severe rhabdomyolysis caused by valproic acid in a neonate with seizures and chromosomal abnormalities Klin Padiatr 2011 223 434 435 21614743 \n10 Kotbi N Mahgoub N Mokonogho J Rhabdomyolysis associated with mania in late life Int J Geriatr Psychiatry 2009 24 1478 1479 19918958 \n11 Chattergoon DS McGuigan MA Koren G Multiorgan dysfunction and disseminated intravascular coagulation in children receiving lamotrigine and valproic acid Neurology 1997 49 1442 1444 9371937 \n12 Pinkston R Walker LA Multiorgan system failure caused by valproic acid toxicity Am J Emerg Med 1997 15 504 506 9270391 \n13 Roodhooft AM Van Dam K Haentjens D Acute sodium valproate intoxication: occurrence of renal failure and treatment with haemoperfusion-haemodialysis Eur J Pediatr 1990 149 363 364 2107081 \n14 Okun J Kolker S Schulze A A method for quantitative acylcarnitine profiling in human skin fibroblasts using unlabelled palmitic acid: diagnosis of fatty acid oxidation disorders and differentiation between biochemical phenotypes of MCAD deficiency Biochim Biophys Acta 2002 1584 91 98 12385891 \n15 Rinaldo P Cowan T Matern D Acylcarnitine profile analysis Genet Med 2008 10 151 156 18281923\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1662-680X",
"issue": "8(3)",
"journal": "Case reports in neurology",
"keywords": "Mitochondrial disorder; Rhabdomyolysis; Sodium valproate",
"medline_ta": "Case Rep Neurol",
"mesh_terms": null,
"nlm_unique_id": "101517693",
"other_id": null,
"pages": "185-192",
"pmc": null,
"pmid": "27790123",
"pubdate": "2016",
"publication_types": "D002363:Case Reports",
"references": "12826641;9270391;2107081;19839725;19535822;9408091;9090694;11595519;1822802;19918958;21614743;18281923;12385891;9371937;12805096",
"title": "Sodium Valproate Exacerbating an Underlying Disorder of Fatty Acid Metabolism.",
"title_normalized": "sodium valproate exacerbating an underlying disorder of fatty acid metabolism"
} | [
{
"companynumb": "AU-MYLANLABS-2017M1013873",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "VALPROIC ACID"
},
"drugadditional": "1",
... |
{
"abstract": "CONCLUSIONS\nTakotsubo cardiomyopathy (TC) is an atypical, severe but reversible form of acute heart insufficiency. It typically presents with left ventricular failure, transient apical and mid-segments hypokinesis, absence of significant coronary stenosis and new electrographic abnormalities and/or elevation in serum cardiac enzymes. Although TC ('broken heart syndrome') has classically been associated with emotional trauma, evidence suggests that other precipitants might exist, including iatrogenic and thyroid-mediated forms. Thyroid disease is a relatively common comorbidity in TC patients. We report a case of TC in a postmenopausal female with no history of emotional trauma or other potential precipitant factors who was diagnosed with amiodarone-induced hyperthyroidism during her hospital stay. Though some case reports of thyroid-related TC exist, we are not aware of any other reported case of TC precipitated by amiodarone-induced hyperthyroidism.\nTC is a relatively new, rare, transient, severe, but reversible cardiovascular condition that is characterized by an acute left ventricular cardiac failure, which can clinically, analytically and electrocardiographically mimic an acute myocardial infarction.Many precipitant factors have been described in TC, being the most classical and emotional trauma. However, thyroid dysfunction is also a significant condition frequently found in patients with TC.A hypercatecholaminergic state leading to cardiomyocyte damage has been established as the main fact of TC physiopathology. Hyperthyroidism induces an upregulation of β-adrenergic receptors.Both hyperthyroidism and hypothyroidism have been related with TC development. Most reported cases of TC involving thyroid dysfunction correspond to hyperthyroidism due to Graves-Basedow disease, but there are also descriptions with severe hypothyroidism, radioiodine treatment or thyroid surgery.Amiodarone is a class III antiarrhythmic agent widely used, and it is a well-known cause of thyroid dysfunction, which can present either with hypothyroidism or hyperthyroidism, as approximately 40 percent of the amiodarone molecule is composed of iodine.In this case, a type II amiodarone-induced hyperthyroidism was the precipitant factor of a TC in a patient with a pre-existing atrial fibrillation. Given the high prevalence of atrial fibrillation and the wide use of amiodarone, the risk of this iatrogenic effect should be taken into account.",
"affiliations": "Endocrinology Department, Parc Taulí Sabadell University Hospital, Sabadell Barcelona, Spain.;Endocrinology Department, Parc Taulí Sabadell University Hospital, Sabadell Barcelona, Spain.;Endocrinology Department, Parc Taulí Sabadell University Hospital, Sabadell Barcelona, Spain.;Endocrinology Department, Parc Taulí Sabadell University Hospital, Sabadell Barcelona, Spain.;Endocrinology Department, Parc Taulí Sabadell University Hospital, Sabadell Barcelona, Spain.;Endocrinology Department, Parc Taulí Sabadell University Hospital, Sabadell Barcelona, Spain.;Endocrinology Department, Parc Taulí Sabadell University Hospital, Sabadell Barcelona, Spain.",
"authors": "Capel|Ismael|I|;Tasa-Vinyals|Elisabet|E|;Cano-Palomares|Albert|A|;Bergés-Raso|Irene|I|;Albert|Lara|L|;Rigla|Mercedes|M|;Caixàs|Assumpta|A|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1530/EDM-16-0116",
"fulltext": "\n==== Front\nEndocrinol Diabetes Metab Case RepEndocrinol Diabetes Metab Case RepEDMEndocrinology, Diabetes & Metabolism Case Reports2052-0573Bioscientifica Ltd Bristol 10.1530/EDM-16-0116EDM160116Unusual Effects of Medical TreatmentTakotsubo cardiomyopathy in amiodarone-induced hyperthyroidism I Capel and othersTakotsubo in amiodarone hyperthyroidismCapel Ismael Tasa-Vinyals Elisabet Cano-Palomares Albert Bergés-Raso Irene Albert Lara Rigla Mercedes Caixàs Assumpta Endocrinology Department, Parc Taulí Sabadell University Hospital, Sabadell Barcelona, SpainCorrespondence should be addressed to I Capel; Email: icapel@tauli.cat15 2 2017 2017 2017 16-011621 12 2016 23 1 2017 © 2017 The authors2017The authors This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License.Summary\nTakotsubo cardiomyopathy (TC) is an atypical, severe but reversible form of acute heart insufficiency. It typically presents with left ventricular failure, transient apical and mid-segments hypokinesis, absence of significant coronary stenosis and new electrographic abnormalities and/or elevation in serum cardiac enzymes. Although TC (‘broken heart syndrome’) has classically been associated with emotional trauma, evidence suggests that other precipitants might exist, including iatrogenic and thyroid-mediated forms. Thyroid disease is a relatively common comorbidity in TC patients. We report a case of TC in a postmenopausal female with no history of emotional trauma or other potential precipitant factors who was diagnosed with amiodarone-induced hyperthyroidism during her hospital stay. Though some case reports of thyroid-related TC exist, we are not aware of any other reported case of TC precipitated by amiodarone-induced hyperthyroidism.\n\nLearning points:\nTC is a relatively new, rare, transient, severe, but reversible cardiovascular condition that is characterized by an acute left ventricular cardiac failure, which can clinically, analytically and electrocardiographically mimic an acute myocardial infarction.\n\nMany precipitant factors have been described in TC, being the most classical and emotional trauma. However, thyroid dysfunction is also a significant condition frequently found in patients with TC.\n\nA hypercatecholaminergic state leading to cardiomyocyte damage has been established as the main fact of TC physiopathology. Hyperthyroidism induces an upregulation of β-adrenergic receptors.\n\nBoth hyperthyroidism and hypothyroidism have been related with TC development. Most reported cases of TC involving thyroid dysfunction correspond to hyperthyroidism due to Graves–Basedow disease, but there are also descriptions with severe hypothyroidism, radioiodine treatment or thyroid surgery.\n\nAmiodarone is a class III antiarrhythmic agent widely used, and it is a well-known cause of thyroid dysfunction, which can present either with hypothyroidism or hyperthyroidism, as approximately 40 percent of the amiodarone molecule is composed of iodine.\n\nIn this case, a type II amiodarone-induced hyperthyroidism was the precipitant factor of a TC in a patient with a pre-existing atrial fibrillation. Given the high prevalence of atrial fibrillation and the wide use of amiodarone, the risk of this iatrogenic effect should be taken into account.\n==== Body\nBackground\nTakotsubo syndrome (TC) also known as transient apical ballooning syndrome, left ventricular apical ballooning syndrome or the more poetic broken heart syndrome is a relatively new, rare, transient, severe, but reversible cardiovascular condition in which clinical and research interest has been growing recently (1, 2). It is characterized by an acute left ventricular cardiac failure which can clinically, analytically and electrocardiographically mimic an acute myocardial infarction. Its hallmark features are an anodyne coronarography, with no evidence of stenosis or obstruction of the coronary arteries, and characteristic ventriculographic findings, which reveal a characteristic pattern of left ventricular dyskinesis. First described in 1991 in Japan (3), TC owes its name to a Japanese device used in traditional octopus fishing, the takotsubo, the shape of which is characteristic of the ventriculographic images found in these patients.\n\nAn international collaborative systematic review including more than 1100 patients that examined the most frequent comorbidities in TC patients concluded that thyroid disease is among them: the study found that TC patients had a relatively high prevalence of psychological disorders, pulmonary diseases, malignancy, neurologic diseases, chronic kidney disease and thyroid diseases (4). Moreover, hyperthyroidism – and particularly thyrotoxicosis – is a well-known cause of cardiac complications.\n\nThough thyroid-related agents such as levothyroxine and radioiodine therapy for toxic multinodular goiter have been linked to TC (5), as far as we are aware, the literature does not currently include amiodarone, among the commonly described iatrogenic causes of TC. Amiodarone is a class III antiarrhythmic agent used to treat various types of cardiac arrhythmias, both ventricular and atrial. It is commonly prescribed in patients suffering from atrial fibrillation, which is commonly diagnosed in elderly people. Amiodarone is a well-known cause of thyroid dysfunction, which can present either with hypothyroidism or hyperthyroidism, as approximately 40 percent of the amiodarone molecule is composed of iodine that can interact with the thyroid gland. Amiodarone-induced hyperthyroidism is classified in type I, type II or mixed states. Type I amiodarone-induced hyperthyroidism usually occurs in patients with pre-existing thyroid pathology, usually multinodular goiter or latent Graves’ disease, and is caused by an increase in the synthesis and secretion of thyroid hormones; conversely, type II amiodarone-induced hyperthyroidism occurs in previously healthy thyroid glands and is a consequence of destructive thyroiditis, which causes stored thyroid hormone to be abruptly released into the bloodstream. Although type II hyperthyroidism is usually transitory, type I tends to persist after the administration of amiodarone is suspended.\n\nCase presentation\nA 79-year-old female was admitted to our hospital presenting with dyspnea and palpitations, not associated with chest pain, present for several hours. Her medical history included hypertension, type 2 diabetes mellitus, atrial fibrillation, colonic diverticulosis, depressive syndrome, osteoporosis and mastectomy due to breast cancer three years prior to admission. Her history of cardiovascular disease included a single episode of ischemic cardiomyopathy two years before admission, when she had been diagnosed with a single-vase (anterior descendant artery) acute myocardial infarction, successfully re-vascularized with percutaneous angioplasty, after which the remaining left ventricle ejection fraction (LVEF) was 64 percent. Barthel Index was 85. The patient was receiving the following medication: omeprazole 20 mg q.d., metformin 850 mg b.i.d., calcifediol 266 µg q. 1 month, calcium 500 mg q.d., alendronate 70 mg q. 1 week, acenocumarol 4 mg (periodic dosing), amiodarone 200 mg q.d., torasemide 5 mg q.d., enalapril 5 mg q.d., letrozole 2.5 mg q.d., citalopram 10 mg q.d., acetaminophen on demand (up to 3 g q.d.) and lormetazepam on demand up to 2 mg q.d.\n\nThough conscious and orientated, the patient was pale and diaphoretic, slightly hypothermic at 35.6°C and presented tachycardia (146/min) despite not being hypotense (156/108 mmHg) nor anoxic (SpO2 96 percent). Cardiac auscultation revealed arrhythmic tones with an aortic murmur II/VI, chronic venous insufficiency signs and no edemas. Respiratory auscultation revealed hypophonesis with some crackles on the right pulmonary base. After a few hours in the emergency department, the patient developed cardiac insufficiency and was electrocardiographically found to be in atrial fibrillation with a fast ventricular response (150/min).\n\nDiuretics, vasodilators and digoxin were administered. \n\nInvestigation\nEchocardiogram showed apical and mid-segment akinesia, with hypokinesis in basal segments. Myocardial damage was objectivized with elevated cardiac troponin, accompanied by a slight leucocytosis and increased inflammatory markers. Thoracic radiography showed a pattern of vascular redistribution, cardiomegaly and signs of pulmonary edema. Coronary angiography did not demonstrate any stenotic or spasmodic changes when compared to previous data, which already showed a stent stenosis of approximately 30 percent. Ventriculography was compatible with apical dyskinesia, with the classical Takotsubian apical ballooning and a preserved LVEF. The patient was admitted to the cardiology hospitalization unit with her usual treatment plus transdermal nitrates and digoxin. Periodic controls showed a decrease in myocardial damage makers and electrocardiographic stability with remaining normofrequent atrial fibrillation.\n\nFive days after initial hospital admission, a routine analytical control objectivized hyperthyroidism: thyrotropin (TSH), 0.014 µU/mL (reference range (RR): 0.4–4.0) and free thyroxine (FT4), 4.48 ng/dL (RR: 0.8–1.8). The patient was asymptomatic and had no history of personal or family thyroid disease. She was physically re-examined and no goiter, exophthalmos or pretibial myxedema was found. Antibody study was negative, with thyroid-stimulating immunoglobulin (TSI): <0.9 mUI/mL (reference value (RV): <2), anti-thyroperoxidase: 6.16 UI/mL (RV: <15), anti-thyroglobulin 14.88 UI/mL (RV: <100). Exogenous sources of iodine were investigated and discarded except for amiodarone, an antiarrhythmic drug she had been receiving for the past two months with doses of 200 mg every 24 h. A diagnosis of type I amiodarone-induced hyperthyroidism was first suspected, and this drug was suspended.\n\nTreatment\nShe was empirically treated with antithyroidal drugs (methimazole 10 mg q. 8 h), which proved ineffective to control thyroid function: thyrotropin (TSH): <0.014 µU/mL, free thyroxine (FT4): 7.55 ng/dL and free triiodothyronine (FT3): 4.04 pg/mL (RR: 3.0–6.9). The patient nevertheless remained asymptomatic. The new diagnostic hypothesis was type II amiodarone-induced hyperthyroidism, for which prednisone 45 mg q.d. was added to the previous treatment with a good response: thyrotropin (TSH): <0.014 µU/mL; free thyroxine (T4): 3.9 ng/dL and free triiodothyronine (T3): 1.65 pg/mL. The patient remained asymptomatic at all times. \n\nOutcome and follow-up\nA few days after the hyperthyroid state was detected, methimazole had to be stopped due to the need for urgent abdominal surgery (ischemic colitis with perforation requiring right hemicolectomy), a circumstance that was most likely unrelated to the TC or the hyperthyroidism. Descendant doses of corticoids were maintained during the patient’s stay at the intensive care unit until the thyroid function was totally normalized. After six weeks in the hospital, the patient was discharged with normal thyroid function and a complete resolution of the TC, with cardiovascular symptoms and signs back to the patient’s baseline situation.\n\nUnfortunately, three months later, patient developed a new episode of ischemic colitis with bowel perforation and generalized sepsis and fatal outcome. Thyroid function was assessed again during this second hospital stay, and it remained normal.\n\nDiscussion\nTC has been linked with many thyroid disorders, the most frequent being hyperthyroidism due to Graves–Basedow disease, but there are also reports in patients with hypothyroidism, euthyroid syndrome, thyroid surgery or thyroid cancer (6, 7).\n\nWhen reviewing TC physiopathology, most authors acknowledge that hypercatecholaminergic states lead to cardiomyocyte damage via calcium overload, which can be histologically observed in the form of contraction band necrosis and other typical TC anatomopathological findings. However, it has been hypothesized that hyperthyroid states clinically, physiologically and biochemically mimic hyperadrenergic states, and/or interact with those in a way that creates synergic pathways to cardiac overload and failure. Thyroid hormones have been described to have direct and indirect effects on cardiomyocytes via complex mechanisms that likely involve the upregulation of β-adrenergic receptors (8). Regarding hypothyroid states, though they appear to relate to TC far less often than do hyperthyroid states, it has been suggested that they may have a link with TC in and of themselves, irrespective of the thyroid profile’s restoration or inversion with the levothyroxine replacement. Hypothyroid patients may present alterations of the autonomic nervous system regardless of their thyroid status at a given time. Hypothyroidism could also induce coronary artery spasm and a decrease in coronary reserve, hypocontractility, cardiac atrophy and dilatation. Another suggested mechanism in those few cases where hypothyroidism has led to TC involves the development of a ventricular thrombus, a phenomenon that has been described in rare cases of left ventricular systolic dysfunction such as TC. In such cases, the systolic dysfunction is associated with cardioembolic adverse events, such as strokes (9).\n\nHere, we present a case of TC in a patient with amiodarone-induced hyperthyroidism. In our opinion, the plausible mechanism of the heart dysfunction in this case would be the high levels of thyroid hormones and not a direct effect of the drug. Although we may think that here amiodarone has only an anecdotal role in causing hyperthyroidism, we believe it is important to emphasize the cause of thyroid dysfunction because it is a widely used antiarrhythmic drug in patients with underlying heart disease, in which a TC would be particularly problematic.\n\nOur search has failed to identify any studies specifically associating TC and amiodarone-induced thyroid disorders in any of its presentations (hyperthyroid or hypothyroid forms). We have identified some case studies reporting the need for amiodarone administration after arrhythmic complications of TC (10). The most common thyroid-related iatrogenic agent associated with TC that we have identified among the studies retrieved by our search is thyroxine, usually in its therapeutic use as levothyroxine for the treatment of hypothyroidism but also in non-medical uses, such as self-administration of porcine thyroxine purchased on the internet (5, 6). \n\nIn conclusion, we can say that thyroid disorders are a frequent condition in patients with TC, and that amiodarone, a well-known thyroid dysfunction causing agent, can be involved in the development of TC, an especially severe problem if it presents in a patient with underlying heart disease. \n\nDeclaration of interest\nThe authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.\n\nFunding\nThis research did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector.\n\nPatient consent\nA written informed consent was not obtained from the patient as the patient is dead. The patient’s identity remained anonymous in this report.\n\nAuthor contribution statement\nI Capel, I Bergés-Raso, L Albert and A Caixàs were involved in the patient care, reviewed the literature and prepared the manuscript. E Tasa-Vinyals, A Cano-Palomares and M Rigla reviewed the literature and prepared the manuscript.\n==== Refs\nReferences\n1 Pellicia F Greco C Vitale C Rosano G Gaudio C Kaski JC \n2014 \nTakotsubo syndrome (stress cardiomyopathy): an intriguing clinical condition in search of its identity . American Journal of Medicine \n127 \n699 –704 . (10.1016/j.amjmed.2014.04.004 )24754972 \n2 Yoshikawa T \n2015 \nTakotsubo cardiomyopathy, a new concept of cardiomyopathy: clinical features and pathophysiology . International Journal of Cardiology \n182 \n297 –303 . (10.1016/j.ijcard.2014.12.116 )25585367 \n3 Dote K Sato H Tateishi H Uchida T Ishihara M \n1991 \nMyocardial stunning due to simultaneous multivessel coronary spasms: a review of 5 cases . Journal of Cardiology \n21 \n203 –214 .1841907 \n4 Pelliccia F Parodi G Greco C Antoniucci D Brenner R Bossone E Cacciotti L Capucci A Citro R Delmas C \n2015 \nComorbidities frequency in Takotsubo syndrome: an international collaborative systematic review including 1109 patients . American Journal of Medicine \n128 \n654.e11 –654.e19 . (10.1016/j.amjmed.2015.01.016 )\n5 Izumi Y \n2013 \nDrug-induced Takotsubo cardiomyopathy . Heart Failure Clinics \n9 \n225 –231 . (10.1016/j.hfc.2012.12.004 )23562123 \n6 Aggarwal S Papani R Gupta V \n2015 \nCan thyroid break your heart? Role of thyroid in Takotsubo cardiomyopathy: a single center retrospective study . International Journal of Cardiology \n184 \n545 –546 . (10.1016/j.ijcard.2015.02.058 )25767013 \n7 Lee SJ Kang JG Ryu OH Kim CS Ihm SH Choi MG Yoo HJ Hong KS \n2009 \nThe relationship of thyroid hormone status with myocardial function in stress cardiomyopathy . European Journal of Endocrinology \n160 \n799 –806 . (10.1530/EJE-08-0808 )19221174 \n8 Eliades M El-Maouche D Choudhary C Zinsmeister B Burman KD \n2014 \nTakotsubo cardiomyopathy associated with thyrotoxicosis: a case report and review of the literature . Thyroid \n24 \n383 –389 . (10.1089/thy.2012.0384 )23560557 \n9 Micallef T Gruppetta M Cassar A Fava S \n2011 \nTakotsubo cardiomyopathy and severe hypothyroidism . Journal of Cardiovascular Medicine \n12 \n824 –827 . (10.2459/JCM.0b013e3283403454 )21135592 \n10 Al-Salameh A Allain J Meimoun P Benali T Desailloud R \n2014 \nTakotsubo cardiomyopathy can occur in patients with apathetic hyperthyroidism . Thyroid \n24 \n400 –401 . (10.1089/thy.2013.0354 )23885758\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2052-0573",
"issue": "2017()",
"journal": "Endocrinology, diabetes & metabolism case reports",
"keywords": null,
"medline_ta": "Endocrinol Diabetes Metab Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101618943",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "28458899",
"pubdate": "2017",
"publication_types": "D016428:Journal Article",
"references": "23560557;1841907;23562123;19221174;21135592;24754972;25660245;25585367;23885758;25767013",
"title": "Takotsubo cardiomyopathy in amiodarone-induced hyperthyroidism.",
"title_normalized": "takotsubo cardiomyopathy in amiodarone induced hyperthyroidism"
} | [
{
"companynumb": "ES-MYLANLABS-2018M1013827",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "AMIODARONE"
},
"drugadditional": "1",
... |
{
"abstract": "A 66-year-old man was transferred to our hospital on November 2010 owing to a diagnosis of miliary tuberculosis. Treatment was initially started with INH, RFP, PZA, and EB. However, PZA and EB were discontinued because of their adverse effects. Subsequently, chest radiographic and laboratory findings gradually improved. However, the patient experienced lumbago, which exacerbated towards the end of March 2011. An abdominal CT scan showed an abdominal mass at the L3-L5 level between the abdominal aorta and lumbar vertebra. On the basis of the findings of abdominal ultrasonography, MRI, and PET-CT, infectious abdominal aortic aneurysm was highly suspected. Therefore, vascular graft replacement surgery was performed at the beginning of May 2011. The result of histopathological analysis showed the presence of acid-fast bacteria in the aneurysm and the lymph nodes around it, revealing that the aneurysm was due to systemic miliary tuberculosis. After the surgery, the patient was administered LVFX in addition to INH and RFP for 18 months and showed no recurrence.",
"affiliations": null,
"authors": "Matsutake|Toyoshi|T|;Hashizume|Kouji|K|;Kinoshita|Naoe|N|;Sueyoshi|Eijun|E|;Ehara|Naomi|N|;Nakano|Reiji|R|;Yoshida|Shintaro|S|;Fukushima|Kiyoyasu|K|;Kakeya|Hiroshi|H|;Kohno|Shigeru|S|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0022-9776",
"issue": "90(4)",
"journal": "Kekkaku : [Tuberculosis]",
"keywords": null,
"medline_ta": "Kekkaku",
"mesh_terms": "D000368:Aged; D017541:Aneurysm, False; D017544:Aortic Aneurysm, Abdominal; D006801:Humans; D008297:Male; D014391:Tuberculosis, Miliary",
"nlm_unique_id": "0422132",
"other_id": null,
"pages": "463-8",
"pmc": null,
"pmid": "26489149",
"pubdate": "2015-04",
"publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "A TUBERCULOUS PSEUDO-ANEURYSM OF THE ABDOMINAL AORTA COMPLICATED BY MILIARY TUBERCULOSIS.",
"title_normalized": "a tuberculous pseudo aneurysm of the abdominal aorta complicated by miliary tuberculosis"
} | [
{
"companynumb": "JP-LUPIN PHARMACEUTICALS INC.-2016-00995",
"fulfillexpeditecriteria": "2",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ETHAMBUTOL HYDROCHLORIDE"
},
"... |
{
"abstract": "Glioblastoma Multiforme (GBM) is the most common primary central nervous system (CNS) malignancy in adults. It is very aggressive and is notorious for its fast and local invasion of nearby brain parenchyma. Consequently, the overall survival (OS) of patients with GBM is short despite resection, radiotherapy and chemotherapy regimens. The most common sites of metastasis of GBM are the lungs and pleura, cervical lymph nodes, and bone. Metastasis to the skin is a rare event and to our knowledge, there are less than 30 cases of GBM metastasizing to cutaneous or subcutaneous tissue described in the literature. None of these cases were diagnosed and/or treated in the Middle East region; and the majority of the metastases found were adjacent to the site of surgery undergone to remove the primary malignancy. We present the case of a 53-year-old male diagnosed with GBM and later showing signs of metastases at the anterio-auricular side of his face near-distant from the site of previous surgery done to remove the primary tumor.",
"affiliations": "Department of Internal Medicine, Naef K. Basile Cancer Institute, American University of Beirut Medical Center, Beirut, Lebanon.;Department of Internal Medicine, Naef K. Basile Cancer Institute, American University of Beirut Medical Center, Beirut, Lebanon.;Department of Internal Medicine, Naef K. Basile Cancer Institute, American University of Beirut Medical Center, Beirut, Lebanon.;Department of Neurosurgery, American University of Beirut Medical Center, Beirut, Lebanon.;Department of Radiation Oncology, American University of Beirut Medical Center, Beirut, Lebanon.;Department of Pediatrics, Lebanese University, Beirut, Lebanon.;Department of Pathology, American University of Beirut Medical Center, Beirut, Lebanon.;Department of Internal Medicine, Naef K. Basile Cancer Institute, American University of Beirut Medical Center, Beirut, Lebanon.;Department of Internal Medicine, Naef K. Basile Cancer Institute, American University of Beirut Medical Center, Beirut, Lebanon.",
"authors": "Nakib|Clara El|CE|;Hajjar|Rayan|R|;Zerdan|Maroun Bou|MB|;Darwish|Hussein|H|;Zeidan|Youssef|Y|;Alame|Saada|S|;Kassouf|Hala Kfoury|HK|;Chamseddine|Nathalie|N|;Assi|Hazem I|HI|",
"chemical_list": null,
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.radcr.2021.10.029",
"fulltext": "\n==== Front\nRadiol Case Rep\nRadiol Case Rep\nRadiology Case Reports\n1930-0433\nElsevier\n\nS1930-0433(21)00747-0\n10.1016/j.radcr.2021.10.029\nCase Report\nGlioblastoma multiforme metastasizing to the skin, a case report and literature review\nNakib Clara El a\nHajjar Rayan a\nZerdan Maroun Bou a\nDarwish Hussein b\nZeidan Youssef c\nAlame Saada d\nKassouf Hala Kfoury e\nChamseddine Nathalie a\nAssi Hazem I. MD ha157@aub.edu.lb\na⁎\na Department of Internal Medicine, Naef K. Basile Cancer Institute, American University of Beirut Medical Center, Beirut, Lebanon\nb Department of Neurosurgery, American University of Beirut Medical Center, Beirut, Lebanon\nc Department of Radiation Oncology, American University of Beirut Medical Center, Beirut, Lebanon\nd Department of Pediatrics, Lebanese University, Beirut, Lebanon\ne Department of Pathology, American University of Beirut Medical Center, Beirut, Lebanon\n⁎ Corresponding author ha157@aub.edu.lb\n11 11 2021\n1 2022\n11 11 2021\n17 1 171175\n7 6 2021\n11 10 2021\n11 10 2021\n© 2021 The Authors. Published by Elsevier Inc. on behalf of University of Washington.\n2021\n\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).\nGlioblastoma Multiforme (GBM) is the most common primary central nervous system (CNS) malignancy in adults. It is very aggressive and is notorious for its fast and local invasion of nearby brain parenchyma. Consequently, the overall survival (OS) of patients with GBM is short despite resection, radiotherapy and chemotherapy regimens. The most common sites of metastasis of GBM are the lungs and pleura, cervical lymph nodes, and bone. Metastasis to the skin is a rare event and to our knowledge, there are less than 30 cases of GBM metastasizing to cutaneous or subcutaneous tissue described in the literature. None of these cases were diagnosed and/or treated in the Middle East region; and the majority of the metastases found were adjacent to the site of surgery undergone to remove the primary malignancy.\n\nWe present the case of a 53-year-old male diagnosed with GBM and later showing signs of metastases at the anterio-auricular side of his face near-distant from the site of previous surgery done to remove the primary tumor.\n\nKeywords\n\nCNS (Central Nervous System)\nGlioblastoma Multiforme (GBM)\nMetastasis\nSkin\n==== Body\npmcIntroduction\n\nGlioblastoma (GBM) is known to be the most ubiquitous primary central nervous system tumor in the adult population, representing up to 25% of these tumors [1]. It's a malignant proliferation of astrocytes that carries a very high relapse and mortality rate and a median overall survival (OS) of 20 months regardless of the modality of treatment or surgeries used to eradicate it such as surgery, chemotherapy, and radiotherapy [2,3]. GBM being a very invasive tumor has the potential to rapidly occupy brain parenchyma around the primary site. Nonetheless, it's not very common for this tumor to spread to the bloodstream and beyond the central nervous system [4]. In the literature, the lungs and pleura were found to be the most common site of extra-cranial metastasis, accounting for 60% of reported cases [5][17]. The next most frequent sites are the cervical lymph nodes described in 51% of cases [6], the bone marrow and bones seen in 30% of cases [5], the liver seen in 22% of cases [7] and skull[10] [24]. The spread to other organs including the skin is extremely rare [8][13] and there are fewer than 30 cases of GBM cutaneous and/or subcutaneous metastases reported in the literature with the most common location of metastasis being the skull [8], one of them occurring in a child [9]. The majority of this patient population were found to have a skin metastasis at the exact site of previous surgery done to remove the primary tumor[15], whereas fewer patients have a more distant location [8], and none of these patients reside in the Middle East region.\n\nIn this report, we present the clinical, and pathologic features of the first case of GBM with metastasis to skin described in the Middle East region with the location of metastasis being distant to the site of primary surgery.\n\nCase presentation\n\nThe patient is a 53-year-old Lebanese male who presented with left sided lower extremity weakness and heaviness. MRI of the brain showed ring enhancing lesion with a central enhancing solid component centered in the posterior limb of the right internal capsule and right thalamus measuring 2.4 × 2.4 × 2.3 cm (Fig. 1, Fig. 2). A biopsy was done and the patient was found to have a high-grade glioma (at least anaplastic astrocytoma WHO grade III) diffusely positive for GFAP and p53 with focal Olig2 expression and a high Ki-67 proliferation index. A Positron Emission Tomography (PET) scan showed a hypodense mass in the right cerebral hemisphere centered in the right internal capsule and thalamus, with decreased FDG uptake, concerning for a primary malignancy. One month later, he underwent subtotal resection of the mass and the pathology revealed IDH-wild type glioblastoma (WHO grade IV) with no residual disease. He then received concurrent radiation (60 Gy) and chemotherapy (Temozolomide) followed by adjuvant Temozolomide. Five months later, an MRI of the brain showed interval appearance of nodular enhancement along the medial aspect of the surgical cavity measuring 1.2 × 1.1 cm and interval appearance of a 1.5 × 1.2 nodular focus of enhancement in the right superior frontal gyrus with significant high FLAIR signal in the surrounding white matter, likely in part related to tumor infiltration and in part to vasogenic edema; as well as another adjacent tiny focus of enhancement in the right frontal lobe measuring 1 × 0.4 cm. The patient was subsequently started on Bevacizumab -later put on hold after minor bleeding- as well as temozolomide. An MRI of the brain 4 months later showed interval increase in the nodular enhancement in the surgical cavity and surrounding high FLAIR signal in keeping with tumor progression. Bevacizumab was then restarted, temozolomide was discontinued and the patient was shifted to lomustine. MRI of the brain was done 2 months later and showed increase in the size of the patient's known tumor as well as in the mass effect on the right cerebral hemisphere with associated midline shift and no herniation. Moreover, multiple new foci of increased FLAIR signal were evident on the left hemisphere that were indicative of disease progression. The patient also had a hard bulge on the right anterio-auricular side of his face on follow up with his oncologist who shifted him to irinotecan and bevacizumab. A month later, the patient underwent biopsy of that anterio-auricular lesion which was consistent with gliosacroma (with the following positive markers: Vimentin and SMA, S-100 and Desmin focally, Ki-67 60%; and the following characteristics on histology: proliferation of malignant spindle to oval cells with hyperchromatic pleiomorphic nuclei portrayed in Fig. 3). The patient's case was then raised to the tumor board of the hospital, and it was decided that the patient would undergo palliative treatment and receive bevacizumab since it was not possible for him to receive regorafenib at the time. Two months later, the patient was admitted to the hospital due to respiratory difficulty and decreased level of consciousness; brain imaging findings were suspicious of an acute stroke and showed disease progression with multifocal GBM as well as increase in the size of the lesion in the subcutaneous soft tissues overlying the right temporal bones. His hospital course was complicated by seizures, bacteremia, and multiple pneumonias (including resistant strains of Klebsiella and Acinetobacter) as well as sepsis requiring pressors. He eventually required intubation, mechanical ventilation, and tracheostomy placement. He subsequently had asystole and passed away a bit more than one month after being hospitalized.Fig. 1 MRI brain at diagnosis: T1 post-Gadolinium.\n\nFig 1\n\nFig. 2 MRI brain at diagnosis: T2 FLAIR.\n\nFig 2\n\nFig. 3 Histology section of the skin metastasis showing proliferation of malignant spindle to oval cells with hyperchromatic pleiomorphic nuclei. (H&E x 200).\n\nFig 3\n\nRing enhancing lesion with a central enhancing solid component centered in the posterior limb of the right internal capsule and right thalamus measuring 2.4 × 2.4 × 2.3 cm in the AP, transverse, and craniocaudal dimensions.\n\nThere is secondary 2 mm leftward midline shift.\n\nSignificant peri-lesional high FLAIR signal extending inferiorly to the right cerebral peduncle and involving the right optic tract and right aspect of the optic chiasm, also extending medially and significantly involving the right thalamus.\n\nDiscussion\n\nGlioblastoma Multiforme, although very aggressive, does not have a propensity to metastasize to the skin, and soft tissue [4]. There have been less than 30 cases of GBM spreading to the skin in the literature and none of the adult patients described in these cases originated from the Middle East region. Most of these patients were adults aged 19 and above, and there was one patient aged 13.5 [9].\n\nIt's perplexing how such an aggressive tumor doesn't have a high tendency to metastasize outside the central nervous system [6]. A theory behind the scarcity of GBM cases metastasizing to the skin is the lethality of primary GBM leading to early death, thus not enough time to develop metastases [20]. It's also possible that the tumor cannot spread outside the CNS due to the blood brain barrier, strong basement membrane, and robust dura as well as the deprived lymphatic system in the brain [6].\n\nA meta-analysis conducted by Pietschmann et al.[27] reviewing publications about GBM with extra-cranial metastasis noted an overall increased frequency of these cases. This was possibly attributed to better awareness in the medical field, improvement in medical diagnostic tools [26], and longer survival of GBM patients with improvement of treatment modalities. It was also observed in one of the studies that the cumulative effect of surgery, chemotherapy, radiotherapy as well as cerebrospinal fluid (CSF) shunting showed the longest average survival from time of metastasis detection to time of death [27]. This meta-analysis also distinguished that younger patients potentially have a tendency for extra-cerebrospinal metastasis due to longer survival [27].\n\nPatients diagnosed with cutaneous or subcutaneous GBM invasion have seen a wide OS range (2 weeks-1 year) [4], and there haven't been studies focused on finding optimal treatment for such cases. As seen in the literature, these patients were either treated by surgical removal of the metastasis alone or in adjunction with chemotherapy and/or radiotherapy. Some cases have avoided surgery at the site of metastasis altogether and have focused on chemotherapy and/or local radiotherapy of the region [11]. Most patients in this category showed evidence of skin metastasis concomitantly with progression of primary CNS disease as evident in MRI reports showing increased size of primary tumor or increased edema around the mass. Similarly, most patients with GBM and skin metastasis described in the literature as well as our patient, developed skin metastasis at the site of previous surgery done to remove the primary tumor or around the facial region. Two cases described scalp metastasis along the area of stereotactic biopsy previously done for diagnostic purposes [5,11]. This implies that there may be iatrogenic tumor cell seeding or leakage along the procedure tract outward to the subcutaneous and cutaneous tissues [4,20]. Other proposed hypotheses are: glial defect formed after surgery ([6],[22]), extension of the primary tumor [20], post-operative neovascularization contributing to dissemination [18], or perineural invasion [14]. There's also the possibility of spread via the external jugular vein [16], and that the primitive neuronal component within primary tumor has a tendency to disseminate via CSF [4].\n\nInterestingly, metastasis at the scalp or anywhere around the initial surgical site happens despite previous local radiotherapy administration, implying that radiation around the surgery scar does not confer a protective factor against future local cutaneous or subcutaneous invasion of the tumor. One can argue that radiation to the cutaneous and subcutaneous tissue is at a subtherapeutic dose, but increasing the dose is controversial due to the increased risk of toxicity to the area.\n\nFurthermore, a review paper submitted by Sundahl et al [28] highlighted pre-clinical evidence showing pro-metastatic effects of radiotherapy through angiogenesis, motility, and invasion. However, this occurrence has not been confirmed clinically, and the long-term benefits of radiation therapy outweigh its negative effects and more data is still needed regarding this matter [28].\n\nOn the other hand, some papers have reported cutaneous or subcutaneous metastases that are distant from primary surgery site [12,21,23], and similarly to other GMB extracranial metastases, this could indicate hematogenic or lymphatic spread [19].\n\nConclusion\n\nThere are very few cases of Glioblastoma Multiforme metastasizing to extracranial locations and only a minor subset of them represents the subcutaneous and/or cutaneous tissue metastases. The scarcity of extracranial metastases might be due to the aggressive nature of the disease leading to early death of patients.\n\nWe described the case of a 53-year-old male diagnosed with GBM and later showing signs of metastases at the anterio-auricular side of his face. Our patient shares many similarities with the majority of the cased described in the literature like the appearance of the skin metastasis concomitantly with CNS disease progression, the combination of surgery and radiotherapy and/or chemotherapy to eradicate the primary tumor and the location of the metastasis at or near the previous site of surgery to remove the primary CNS tumor. This may indicate the role of tumor seeding along the procedure tract outward to the skin, glial defect formed after surgery, extension of primary tumor, perineural invasion or post-operative neovascularization possibly due to radiation therapy side effects. However, these hypotheses wouldn't explain the few cases of skin metastases that are distant to previous surgery sites and distant to the craniofacial area, which might be due to hematogenic or lymphatic spread. Therefore, more research should go into investigating the mechanism behind GBM tumors metastasizing to the cutaneous and/or subcutaneous tissues.\n\nFunding\n\nThis research received no specific grant from any funding agency in the public, commercial, or not-for profit sector.\n\nEthics approval\n\nthe authors complied with the ethical requirements of their institution\n\nPatient consent\n\nSince the patient was deceased, no consent was taken from the patient to proceed with this case report.\n\nAppendix Supplementary materials\n\nImage, application 1\n\nCompeting Interests: The authors have no conflicts of interest to declare that are relevant to the content of this article.\n\nSupplementary material associated with this article can be found, in the online version, at doi:10.1016/j.radcr.2021.10.029.\n==== Refs\nReferences\n\n1 Bauchet L Mathieu-Daudé H Fabbro-Peray P Rigau V Fabbro M Chinot O Oncological patterns of care and outcome for 952 patients with newly diagnosed glioblastoma in 2004 Neuro Oncol 12 7 2010 725 735 20364023\n2 Jackson C Choi J Khalafallah AM Price C Bettegowda C Lim M A systematic review and meta-analysis of supratotal versus gross total resection for glioblastoma Journal of Neuro-Oncology 148 3 2020 419 431 32562247\n3 Socha J Kepka L Ghosh S Roa W Kumar N Sinaika V Outcome of treatment of recurrent glioblastoma multiforme in elderly and/or frail patients Journal of Neuro-Oncology 126 3 2016 493 498 26542030\n4 Lewis GD Rivera AL Tremont-Lukats IW Ballester-Fuentes LY Zhang YJ Teh BS GBM skin metastasis: a case report and review of the literature CNS Oncol 6 3 2017 203 209\n5 Houston SC Crocker IR Brat DJ Olson JJ Extraneural metastatic glioblastoma after interstitial brachytherapy Int J Radiat Oncol Biol Phys 48 3 2000 831 836 11020581\n6 Wallace CJ Forsyth PA Edwards DR Lymph node metastases from glioblastoma multiforme AJNR Am J Neuroradiol 17 10 1996 1929 1931 8933881\n7 Astner ST Pihusch R Nieder C Rachinger W Lohner H Tonn JC Extensive local and systemic therapy in extraneural metastasized glioblastoma multiforme Anticancer Res 26 6c 2006 4917 4920 17214362\n8 Senetta R Cassoni P Skin metastases of glioblastoma Hayat MA Tumors of the Central Nervous System. Volume 2: Gliomas: Glioblastoma (Part 2) 2011 Springer Science & Business Media Dordrecht Heidelberg London New York 143 149\n9 Saad AG Sachs J Turner CD Proctor M Marcus KJ Wang L Extracranial metastases of glioblastoma in a child: case report and review of the literature J Pediatr Hematol Oncol 29 3 2007 190 194 17356401\n10 Allan RS Scalp metastasis from glioblastoma J Neurol Neurosurg Psychiatry 75 4 2004 559 15026496\n11 Bouillot-Eimer S Loiseau H Vital A Subcutaneous tumoral seeding from a glioblastoma following stereotactic biopsy: case report and review of the literature Clin Neuropathol 24 6 2005 247 251 16320817\n12 Anghileri E Castiglione M Nunziata R Boffano C Nazzi V Acerbi F Extraneural metastases in glioblastoma patients: two cases with YKL-40-positive glioblastomas and a meta-analysis of the literature Neurosurg Rev 39 1 2016 37 45 26212701\n13 Figueroa P Lupton JR Remington T Olding M Jones RV Sekhar LN Cutaneous metastasis from an intracranial glioblastoma multiforme J Am Acad Dermatol 46 2 2002 297 300 11807444\n14 Forsyth TM Bi WL Abedalthagafi M Dunn IF Chiocca EA Extracranial growth of glioblastoma multiforme J Clin Neurosci 22 9 2015 1521 1523 25956620\n15 Ginat DT Kelly HR Schaefer PW Davidson CJ Curry W Recurrent scalp metastasis from glioblastoma following resection Clin Neurol Neurosurg 115 4 2013 461 463 22727368\n16 Guo L Qiu Y Ge J Zhou D Glioblastoma multiforme with subcutaneous metastases, case report and literature review J Korean Neurosurg Soc 52 5 2012 484 487 23323171\n17 Hata N Katsuta T Inoue T Arikawa K Yano T Takeshita M Extracranial metastasis of glioblastoma to the lung and heart with a histological resemblance to small cell carcinoma of the lung: an autopsy case No Shinkei Geka 29 5 2001 433 438 11449715\n18 Jain N Mirakhur M Flynn P Choudhari KA Cutaneous metastasis from glioblastoma Br J Neurosurg 19 1 2005 65 68 16147588\n19 Magdaleno-Tapial J Valenzuela-Oñate C Pérez-Pastor G Alegre de Miquel V Skin metastasis of glioblastoma multiforme: a case report and literature review Actas Dermosifiliogr 110 9 2019 780 783 31006478\n20 Mentrikoski M Johnson MD Korones DN Scott GA Glioblastoma multiforme in skin: a report of 2 cases and review of the literature Am J Dermatopathol 30 4 2008 381 384 18645311\n21 Miliaras G Tsitsopoulos PP Markoula S Kyritsis A Polyzoidis KS Malamou-Mitsi V Multifocal glioblastoma with remote cutaneous metastasis: a case report and review of the literature Cent Eur Neurosurg 70 1 2009 39 42 19191206\n22 Moon KS Jung S Lee MC Kim IY Kim HW Lee JK Metastatic glioblastoma in cervical lymph node after repeated craniotomies: report of a case with diagnosis by fine needle aspiration J Korean Med Sci 19 6 2004 911 914 15608410\n23 Nguyen B Samara J Lee A Fadia M Ngu C Pranavan G A case of subgaleal metastasis from glioblastoma multiforme Intern Med J 48 6 2018 741 742 29898273\n24 Pérez-Bovet J Rimbau-Muñoz J Glioblastoma multiforme metastases to the masticator muscles and the scalp J Clin Neurosci 53 2018 237 239 29685418\n26 Schultz S Pinsky GS Wu NC Chamberlain MC Rodrigo AS Martin SE Fine needle aspiration diagnosis of extracranial glioblastoma multiforme: Case report and review of the literature Cytojournal 2 2005 19 16287502\n27 Pietschmann S von Bueren AO Henke G Kerber MJ Kortmann RD Müller K An individual patient data meta-analysis on characteristics, treatments and outcomes of the glioblastoma/gliosarcoma patients with central nervous system metastases reported in literature until 2013 J Neurooncol 120 3 2014 451 457 25160993\n28 Sundahl N Duprez F Ost P De Neve W Mareel M Effects of radiation on the metastatic process Mol Med 24 1 2018 16 30134800\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "1930-0433",
"issue": "17(1)",
"journal": "Radiology case reports",
"keywords": "CNS (Central Nervous System); Glioblastoma Multiforme (GBM); Metastasis; Skin",
"medline_ta": "Radiol Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101467888",
"other_id": null,
"pages": "171-175",
"pmc": null,
"pmid": "34815821",
"pubdate": "2022-01",
"publication_types": "D002363:Case Reports",
"references": "16147588;23323171;16287502;22727368;11807444;25956620;28718312;30134800;29898273;29685418;16320817;11449715;25160993;15608410;32562247;11020581;26212701;20364023;18645311;17214362;15026496;17356401;19191206;26542030;8933881;31006478",
"title": "Glioblastoma multiforme metastasizing to the skin, a case report and literature review.",
"title_normalized": "glioblastoma multiforme metastasizing to the skin a case report and literature review"
} | [
{
"companynumb": "LB-ROCHE-2969462",
"fulfillexpeditecriteria": "1",
"occurcountry": null,
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BEVACIZUMAB"
},
"drugadditional": "3",
"drug... |
{
"abstract": "Drug-induced dystonic reactions are a common presentation to the Pediatric Emergency Department frequently with antiemetics, antidepressants, dopamineblocking agents and antipyschotics. We report a case of generalized form of dystonia after taking albendazole and cetirizine. There is only one case with albendazole induced and two cases with cetirizine induced dystonia in the literature.",
"affiliations": "Department of Pediatrics, Dr. Sami Ulus Maternity and Children's Research and Training Hospital, Ankara, Turkey. osgee_87@hotmail.com.",
"authors": "Yılmaz-Topa|Özge|Ö|;Tuygun|Nilden|N|;Akça|Halise|H|;Polat|Emine|E|;Karacan|Can Demir|CD|",
"chemical_list": "D000871:Anthelmintics; D039563:Histamine H1 Antagonists, Non-Sedating; D018727:Muscarinic Antagonists; D001712:Biperiden; D015766:Albendazole; D017332:Cetirizine",
"country": "Turkey",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-4301",
"issue": "57(4)",
"journal": "The Turkish journal of pediatrics",
"keywords": null,
"medline_ta": "Turk J Pediatr",
"mesh_terms": "D015766:Albendazole; D000871:Anthelmintics; D001712:Biperiden; D017332:Cetirizine; D002675:Child, Preschool; D004421:Dystonia; D004636:Emergency Service, Hospital; D039563:Histamine H1 Antagonists, Non-Sedating; D006801:Humans; D008297:Male; D018727:Muscarinic Antagonists",
"nlm_unique_id": "0417505",
"other_id": null,
"pages": "407-408",
"pmc": null,
"pmid": "27186707",
"pubdate": "2015",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Cetirizine and albendazole induced dystonia in a child.",
"title_normalized": "cetirizine and albendazole induced dystonia in a child"
} | [
{
"companynumb": "TR-RANBAXY-2014RR-86389",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CETIRIZINE HYDROCHLORIDE"
},
"drugadditional": ... |
{
"abstract": "The ocular side-effects of bisphosphonates have the potential to escalate with their widespread use. We report a patient of osteoporosis who was treated with zoledronic acid infusion. He developed ocular pain, redness, watering, photophobia and swelling of both the eyes. He was diagnosed with acute anterior uveitis and conjunctivitis and treated with topical 1% prednisolone acetate and 1% atropine sulphate. The signs of inflammation abated by one week and the steroids were tapered over the next six weeks. There were no further recurrences. Patients must be educated about the ocular side-effects of bisphosphonate therapy, monitored closely after intravenous infusion and advised to seek ophthalmic consultation promptly if any ocular symptoms or signs develop.",
"affiliations": "Consultants, Cornea and Anterior Segment Service, MGM Eye Institute, Raipur, Chhattisgarh.;Consultants, Cornea and Anterior Segment Service, MGM Eye Institute, Raipur, Chhattisgarh.",
"authors": "Chatterjee|Samrat|S|;Agrawal|Deepshikha|D|",
"chemical_list": "D050071:Bone Density Conservation Agents; D004164:Diphosphonates; D007093:Imidazoles; D000077211:Zoledronic Acid",
"country": "India",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0004-5772",
"issue": "65(7)",
"journal": "The Journal of the Association of Physicians of India",
"keywords": null,
"medline_ta": "J Assoc Physicians India",
"mesh_terms": "D000368:Aged; D050071:Bone Density Conservation Agents; D003231:Conjunctivitis; D004164:Diphosphonates; D006801:Humans; D007093:Imidazoles; D008297:Male; D010024:Osteoporosis; D014606:Uveitis, Anterior; D000077211:Zoledronic Acid",
"nlm_unique_id": "7505585",
"other_id": null,
"pages": "110-111",
"pmc": null,
"pmid": "28792180",
"pubdate": "2017-07",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Bilateral Acute Anterior Uveitis and Conjunctivitis following Intravenous Zoledronic Acid.",
"title_normalized": "bilateral acute anterior uveitis and conjunctivitis following intravenous zoledronic acid"
} | [
{
"companynumb": "IN-DRREDDYS-USA/IND/17/0093161",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ZOLEDRONIC ACID"
},
"drugadditional": "3... |
{
"abstract": "OBJECTIVE\nTo evaluate the usefulness of the uterine artery mean pulsatility index (mPI-UtA) and the sFlt-1/PlGF ratio in women with systemic lupus erythematosus (SLE) or antiphospholipid syndrome (APS) for the prediction of placental dysfunction-related adverse outcomes (AO), namely pre-eclampsia (PE) and intrauterine growth restriction (IUGR), and for differential diagnosis between PE and SLE flares.\n\n\nMETHODS\nObservational prospective cohort study of 57 pregnant women with SLE or APS.\n\n\nMETHODS\nmPI-UtA and sFlt-1/PlGF ratio in maternal serum were obtained at four gestational age periods (11-14, 19-22, 24-29 and 32-34 weeks). Comparisons among pregnancies with normal outcome, SLE flare and AO were performed.\n\n\nRESULTS\nOverall, we had 44 ongoing pregnancies (36 with SLE and 8 with APS) of which most (n = 35, 80%) were uncomplicated. The overall rate of AO was 9% (n = 4), that was diagnosed at a mean (SD) gestational age of 34.1 (7.5) weeks. Five SLE patients (14%) suffered a SLE flare. No differences for these markers were found between normal pregnancies and those affected by SLE flare. mUtA-PI values were significantly higher in the AO group when compared with normal and SLE flare groups, at 19-22 weeks (1.52, 0.95 and 0.76) and 32-34 weeks (1.13, 0.68 and 0.65), respectively. The sFlt-1/PlGF ratio was significantly higher in the AO group at 24-29 weeks (191.1, 3.1 and 9.2), respectively.\n\n\nCONCLUSIONS\nOur preliminary results indicate that mPI-UtA and sFlt1/PlGF ratio may be useful to predict AO in women with SLE, and to make the differential diagnosis with a lupus flare.",
"affiliations": "Department of Rheumatology, Hospital Universitario 12 de Octubre, Instituto de Investigación 12 de Octubre (imas12), Universidad Complutense, Madrid, Spain.;Fetal Medicine Unit-SAMID, Department of Obstetrics and Gynaecology, Hospital Universitario 12 de Octubre, Instituto de Investigación 12 de Octubre (imas12), Universidad Complutense, Madrid, Spain. Electronic address: ignacio.herraiz@salud.madrid.org.;Fetal Medicine Unit-SAMID, Department of Obstetrics and Gynaecology, Hospital Universitario 12 de Octubre, Instituto de Investigación 12 de Octubre (imas12), Universidad Complutense, Madrid, Spain.;Fetal Medicine Unit-SAMID, Department of Obstetrics and Gynaecology, Hospital Universitario 12 de Octubre, Instituto de Investigación 12 de Octubre (imas12), Universidad Complutense, Madrid, Spain.;Department of Rheumatology, Hospital Universitario 12 de Octubre, Instituto de Investigación 12 de Octubre (imas12), Universidad Complutense, Madrid, Spain.;Department of Rheumatology, Hospital Universitario 12 de Octubre, Instituto de Investigación 12 de Octubre (imas12), Universidad Complutense, Madrid, Spain.;Department of Biochemistry, Hospital Universitario 12 de Octubre, Instituto de Investigación 12 de Octubre (imas12), Universidad Complutense, Madrid, Spain.;Fetal Medicine Unit-SAMID, Department of Obstetrics and Gynaecology, Hospital Universitario 12 de Octubre, Instituto de Investigación 12 de Octubre (imas12), Universidad Complutense, Madrid, Spain.;Department of Rheumatology, Hospital Universitario 12 de Octubre, Instituto de Investigación 12 de Octubre (imas12), Universidad Complutense, Madrid, Spain.",
"authors": "Rodríguez-Almaraz|M E|ME|;Herraiz|I|I|;Gómez-Arriaga|P I|PI|;Vallejo|P|P|;Gonzalo-Gil|E|E|;Usategui|A|A|;López-Jiménez|E A|EA|;Galindo|A|A|;Galindo|M|M|",
"chemical_list": "D015415:Biomarkers; C000608036:PGF protein, human; D000072483:Placenta Growth Factor; C501162:FLT1 protein, human; D040281:Vascular Endothelial Growth Factor Receptor-1",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.preghy.2018.01.008",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2210-7789",
"issue": "11()",
"journal": "Pregnancy hypertension",
"keywords": "PlGF; Preeclampsia; Systemic lupus erythematosus; Uterine artery Doppler; sFlt-1",
"medline_ta": "Pregnancy Hypertens",
"mesh_terms": "D016736:Antiphospholipid Syndrome; D015415:Biomarkers; D003937:Diagnosis, Differential; D018450:Disease Progression; D005260:Female; D005317:Fetal Growth Retardation; D005865:Gestational Age; D006801:Humans; D008180:Lupus Erythematosus, Systemic; D000072483:Placenta Growth Factor; D011225:Pre-Eclampsia; D011237:Predictive Value of Tests; D011247:Pregnancy; D011446:Prospective Studies; D011673:Pulsatile Flow; D012039:Regional Blood Flow; D012307:Risk Factors; D018608:Ultrasonography, Doppler; D055988:Uterine Artery; D040281:Vascular Endothelial Growth Factor Receptor-1",
"nlm_unique_id": "101552483",
"other_id": null,
"pages": "99-104",
"pmc": null,
"pmid": "29523283",
"pubdate": "2018-01",
"publication_types": "D016428:Journal Article; D064888:Observational Study",
"references": null,
"title": "The role of angiogenic biomarkers and uterine artery Doppler in pregnant women with systemic lupus erythematosus or antiphospholipid syndrome.",
"title_normalized": "the role of angiogenic biomarkers and uterine artery doppler in pregnant women with systemic lupus erythematosus or antiphospholipid syndrome"
} | [
{
"companynumb": "ES-CONCORDIA PHARMACEUTICALS INC.-GSH201805-001555",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "HYDROXYCHLOROQUINE"
},
... |
{
"abstract": "Behçet's disease (BD) is a multi-systemic disorder of unknown etiology characterized by relapsing oral-genital ulcers, uveitis, and involvement of the articular, gastrointestinal, neurologic, and vascular systems. The choice of treatment is based on the severity of systemic involvement, clinical presentation and the site affected, and includes corticosteroids, azathioprine, interferon, cyclophosphamide, methotrexate or tumor necrosis factor-alpha and interleukin-1 blockers. We present a case series of four refractory BD patients successfully treated with intravenous immunoglobulins (IVIG). All patients fulfilled International Study Group criteria. The patients' mean age was 38.75 ± 12.09 years and mean disease duration 10.25 ± 8.5 years. Human leukocyte antigen B51 was positive in two of four patients. In addition to oral aphthosis, all patients suffered from genital ulcers and cutaneous BD-related manifestations; central nervous system involvement and arthralgia were found in two patients. Peripheral nervous system, gastrointestinal and eye involvement occurred in 25% of cases. In all patients, previously treated according to EULAR recommendations without reaching satisfactory results, IVIG induced immediate and sustained response over time without incurring any side effects. We propose IVIG administration as an additional effective and safe treatment option in patients with severe and resistant BD.",
"affiliations": null,
"authors": "Cantarini|Luca|L|;Stromillo|Maria L|ML|;Vitale|Antonio|A|;Lopalco|Giuseppe|G|;Emmi|Giacomo|G|;Silvestri|Elena|E|;Federico|Antonio|A|;Galeazzi|Mauro|M|;Iannone|Florenzo|F|;De Stefano|Nicola|N|",
"chemical_list": "D018501:Antirheumatic Agents; D059949:HLA-B51 Antigen; D016756:Immunoglobulins, Intravenous",
"country": "Israel",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": null,
"issue": "18(3-4)",
"journal": "The Israel Medical Association journal : IMAJ",
"keywords": null,
"medline_ta": "Isr Med Assoc J",
"mesh_terms": "D061605:Administration, Intravenous; D000328:Adult; D018501:Antirheumatic Agents; D001528:Behcet Syndrome; D004351:Drug Resistance; D005260:Female; D059949:HLA-B51 Antigen; D006801:Humans; D016756:Immunoglobulins, Intravenous; D008297:Male; D008875:Middle Aged; D055502:Secondary Prevention; D012720:Severity of Illness Index; D063189:Symptom Assessment; D016896:Treatment Outcome",
"nlm_unique_id": "100930740",
"other_id": null,
"pages": "238-42",
"pmc": null,
"pmid": "27228652",
"pubdate": "2016",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Efficacy and Safety of Intravenous Immunoglobulin Treatment in Refractory Behcet's Disease with Different Organ Involvement: A Case Series.",
"title_normalized": "efficacy and safety of intravenous immunoglobulin treatment in refractory behcet s disease with different organ involvement a case series"
} | [
{
"companynumb": "IT-AMGEN-ITASP2018036712",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CYCLOSPORINE"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nTo show that immunotherapy with medications such mycophenolate mofetil (MMF) can cause serious complications in patients with neuromuscular disorders.\n\n\nMETHODS\nTwo patients with neuromuscular disorders on immunotherapy with long-term MMF who developed toxoplasmic encephalitis (TE) were included in this case series.\n\n\nRESULTS\nOne patient with myasthenia gravis and one patient with inflammatory myopathy on immunotherapy with long-term MMF developed severe TE. Diagnosis was based on clinical presentation, MRI brain imaging characteristics, and CSF PCR positivity for Toxoplasma gondii. Both patients were treated with pyrimethamine, sulfadiazine, and leucovorin for 2 months without clinical improvement, and both died.\n\n\nCONCLUSIONS\nImmunotherapy with medications such as MMF can cause devastating TE in non-HIV patients with neuromuscular disorders. Early consideration and recognition of this complication is important to possibly prevent unfavorable outcomes. The utility of screening and prophylaxis against toxoplasmosis in individuals with neuroimmunologic disorders and other autoimmune disorders who receive immunosuppressive therapy requires future study.",
"affiliations": "Department of Neurology, University of North Carolina School of Medicine, Chapel Hill.;Department of Neurology, University of North Carolina School of Medicine, Chapel Hill.",
"authors": "Bernardo|Danilo R|DR|;Chahin|Nizar|N|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1212/NXI.0000000000000063",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2332-7812",
"issue": "2(1)",
"journal": "Neurology(R) neuroimmunology & neuroinflammation",
"keywords": null,
"medline_ta": "Neurol Neuroimmunol Neuroinflamm",
"mesh_terms": null,
"nlm_unique_id": "101636388",
"other_id": null,
"pages": "e63",
"pmc": null,
"pmid": "25635260",
"pubdate": "2015-02",
"publication_types": "D016428:Journal Article",
"references": "23589123;12180115;17289556;16207863;8793397;24191065;10770418;15194258;19433092;15803924;15329448;19776379;20955469;20451437;15940766;19357635;11495859;23274022;9145736;20360202",
"title": "Toxoplasmic encephalitis during mycophenolate mofetil immunotherapy of neuromuscular disease.",
"title_normalized": "toxoplasmic encephalitis during mycophenolate mofetil immunotherapy of neuromuscular disease"
} | [
{
"companynumb": "US-ALKEM LABORATORIES LIMITED-US-ALKEM-000851",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugaddit... |
{
"abstract": "Intravenous immunoglobulin (IVIG) is an important therapeutic tool for the treatment of a variety of conditions, including immune thrombocytopenic purpura (ITP). Although IVIG has many approved indications and is typically well tolerated, a number of adverse effects have been reported. Hemolysis is a documented but under-recognized adverse effect associated with large individual or cumulative doses of IVIG. Hemolytic complications are typically mild and detected incidentally when screening tests, such as a complete blood count (CBC) showing decreased hemoglobin or a complete metabolic panel (CMP) resulting in elevated bilirubin, are performed for another reason. Herein, we report a case of significant hemolytic anemia in a 59 year old Caucasian woman, who required packed red blood cell transfusion after administration of IVIG for the treatment of ITP. Increased awareness of the potential for clinically significant hemolysis after the use of moderate cumulative doses of IVIG is needed, particularly in patients with risk factors for hemolysis.",
"affiliations": "Department of Pathology, Microbiology and Immunology, Vanderbilt University Medical Center, Nashville, Tennessee.;Department of Pathology, Microbiology and Immunology, Vanderbilt University Medical Center, Nashville, Tennessee.;Department of Pathology, Microbiology and Immunology, Vanderbilt University Medical Center, Nashville, Tennessee.",
"authors": "Jacobs|Jeremy|J|;Kneib|Jessica|J|;Gabbard|Amy|A|",
"chemical_list": "D016756:Immunoglobulins, Intravenous",
"country": "England",
"delete": false,
"doi": "10.1093/labmed/lmaa019",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0007-5027",
"issue": "51(5)",
"journal": "Laboratory medicine",
"keywords": null,
"medline_ta": "Lab Med",
"mesh_terms": "D000743:Anemia, Hemolytic; D005260:Female; D006801:Humans; D016756:Immunoglobulins, Intravenous; D008875:Middle Aged; D016553:Purpura, Thrombocytopenic, Idiopathic",
"nlm_unique_id": "0250641",
"other_id": null,
"pages": "e47-e50",
"pmc": null,
"pmid": "32339244",
"pubdate": "2020-09-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Intravenous Immunoglobulin-Associated Hemolytic Anemia.",
"title_normalized": "intravenous immunoglobulin associated hemolytic anemia"
} | [
{
"companynumb": "US-SHIRE-US202015199",
"fulfillexpeditecriteria": "1",
"occurcountry": "UM",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HUMAN IMMUNOGLOBULIN G"
},
"drugadditional": "3",
... |
{
"abstract": "Gemcitabine has been associated with thrombotic microangiopathy (TMA). We conducted a national retrospective study of gemcitabine-associated TMA (G-TMA).\n\n\n\nFrom 1998 to 2015, all cases of G-TMA reported to the French Pharmacovigilance Network and the French TMA Reference Center, and cases explored for complement alternative pathway abnormalities, were analysed.\n\n\n\nG-TMA was diagnosed in 120 patients (median age 61.5 years), after a median of 210 days of treatment, and a cumulative dose of 12 941 mg m-2 . Gemcitabine indications were: pancreatic (52.9%), pulmonary (12.6%) and breast (7.6%) cancers, metastatic in 34.2% of cases. Main symptoms were oedema (56.7%) and new-onset or exacerbated hypertension (62.2%). Most patients presented with haemolytic anaemia (95.6%) and thrombocytopenia (74.6%). Acute kidney injury was reported in 97.4% and dialysis was required in 27.8% of patients. Treatment consisted of: plasma exchange (PE; 39.8%), fresh frozen plasma (21.4%), corticosteroids (15.3%) and eculizumab (5.1%). A complete remission of TMA was obtained in 42.1% of patients and haematological remission in 23.1%, while 34.7% did not improve. The survival status was known for 52 patients, with 29 deaths (54.7%). Patients treated with PE, despite a more severe acute kidney injury, requiring dialysis more frequently, displayed comparable rates of remission, but with more adverse events. No abnormality in complement alternative pathway was documented in patients explored.\n\n\n\nThis large cohort confirms the severity of G-TMA, associated with severe renal failure and death. Oedema and hypertension could be monitored in patients treated with gemcitabine to detect early TMA. The benefit of PE or eculizumab deserves further investigation.",
"affiliations": "Department of Nephrology, Aix-Marseille University, AP-HM Hôpital de la Conception, Marseille, France.;Department of Clinical Pharmacology and Pharmacovigilance, Regional Centre of Pharmacovigilance, Aix-Marseille University, AP-HM Hôpital de la Timone, Marseille, France.;Department of Apheresis, Regional Reference Center for Thrombotic Microangiopathy, Aix-Marseille University, AP-HM Hôpital de la Conception, Marseille, France.;Department of Nephrology, Aix-Marseille University, AP-HM Hôpital de la Conception, Marseille, France.;Department of Nephrology, Aix-Marseille University, AP-HM Hôpital de la Conception, Marseille, France.;Department of Nephrology, Aix-Marseille University, AP-HM Hôpital de la Conception, Marseille, France.;Department of Public Health, Aix-Marseille University, AP-HM Hôpital de la Timone, Marseille, France.;Department of Clinical Oncology, Aix-Marseille University, AP-HM Hôpital de la Timone, Marseille, France.;Department of Clinical Oncology, Institut Paoli Calmettes, Laboratory of Molecular Oncology, Aix-Marseille University, CRCM INSERM UMR 1068, Marseille, France.;Department of Parmacy, OncoPharma Unit, Aix-Marseille University, AP-HM Hôpital de la Timone, Marseille, France.;Regional Center of Pharmacovigilance, Dijon University Hospital, Dijon, France.;Medical intensive care unit, Regional Center for Thrombotic Microangiopathy, Hôpital Charles Nicolle, Rouen University Hospital, Rouen, France.;Laboratory of Immunology, AP-HP Hôpital Européen Georges Pompidou, Paris, France.;Department of Hematology, French Reference Center for Thrombotic Microangiopathy (www.cnr-mat.fr), Paris 6 University, Paris, France.;Department of Clinical Pharmacology and Pharmacovigilance, Regional Centre of Pharmacovigilance, Aix-Marseille University, AP-HM Hôpital de la Timone, Marseille, France.;Department of Nephrology, Aix-Marseille University, AP-HM Hôpital de la Conception, Marseille, France.",
"authors": "Daviet|Florence|F|;Rouby|Franck|F|;Poullin|Pascale|P|;Moussi-Francès|Julie|J|;Sallée|Marion|M|;Burtey|Stéphane|S|;Mancini|Julien|J|;Duffaud|Florence|F|;Sabatier|Renaud|R|;Pourroy|Bertrand|B|;Grandvuillemin|Aurélie|A|;Grange|Steven|S|;Frémeaux-Bacchi|Véronique|V|;Coppo|Paul|P|;Micallef|Joëlle|J|;Jourde-Chiche|Noémie|N|0000-0001-9315-1577",
"chemical_list": "D000964:Antimetabolites, Antineoplastic; D003841:Deoxycytidine; C056507:gemcitabine",
"country": "England",
"delete": false,
"doi": "10.1111/bcp.13808",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0306-5251",
"issue": "85(2)",
"journal": "British journal of clinical pharmacology",
"keywords": "acute kidney injury; adverse drug reactions; chemotherapy; medication safety; pharmacovigilance",
"medline_ta": "Br J Clin Pharmacol",
"mesh_terms": "D000368:Aged; D000964:Antimetabolites, Antineoplastic; D003841:Deoxycytidine; D005260:Female; D005602:France; D006801:Humans; D008297:Male; D008875:Middle Aged; D009369:Neoplasms; D060735:Pharmacovigilance; D012189:Retrospective Studies; D057049:Thrombotic Microangiopathies",
"nlm_unique_id": "7503323",
"other_id": null,
"pages": "403-412",
"pmc": null,
"pmid": "30394581",
"pubdate": "2019-02",
"publication_types": "D016428:Journal Article",
"references": "25943718;19116715;20568098;15790464;10223245;24516709;23298275;9414181;26833144;20799915;27743743;25414441;22356625;7960602;10528696;17613425;19816959;19096082;15340761;30394581;27433282;25651368;15367421;21813634;22081912;16006690;25500702;24091354;15197810;21411201;25964641;10070921;12324937;24237646;19845597;8893879;2497229;19203505;27884283;23738544",
"title": "Thrombotic microangiopathy associated with gemcitabine use: Presentation and outcome in a national French retrospective cohort.",
"title_normalized": "thrombotic microangiopathy associated with gemcitabine use presentation and outcome in a national french retrospective cohort"
} | [
{
"companynumb": "FR-ACCORD-112341",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "GEMCITABINE\\GEMCITABINE HYDROCHLORIDE"
},
"drugadditi... |
{
"abstract": "Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are both rare but serious idiosyncratic drug reactions characterized by diffuse muco-epidermoid injury and high mortality. Keratinocytes in both skin and mucous membranes (including eyes, mouth and genitalia) are injured resulting in a diffuse maculopapular rash, blistering lesions and epithelial detachment with minimal force (Nikolsky's sign). SJS is typically diagnosed when less than 10% of the skin surface is involved and the term TEN is used in cases with more than 30% involvement. Respiratory involvement in SJS-TEN is common with 30-50% of cases demonstrating respiratory epithelial sloughing with severe short and long term complications. Patients who survive SJS-TEN are often left with impaired respiratory function and bronchiolitis obliterans. Cases of bronchiolitis obliterans with SJS/TEN have been very rarely reported. We report a case of phenytoin induced SJS/TEN followed by severe bronchiolitis obliterans in an adult patient. The presentation, pathophysiology and management of SJS/TEN related bronchiolitis obliterans is also reviewed.",
"affiliations": "Division of Pulmonary and Critical Care Medicine, Mayo Clinic, Rochester, MN, USA.;Division of General Internal Medicine, Mayo Clinic, Rochester, MN, USA.;Division of Pulmonary and Critical Care Medicine, Mayo Clinic, Rochester, MN, USA.",
"authors": "Pannu|Bibek S|BS|;Egan|Ashley M|AM|;Iyer|Vivek N|VN|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1016/j.rmcr.2016.01.006",
"fulltext": "\n==== Front\nRespir Med Case RepRespir Med Case RepRespiratory Medicine Case Reports2213-0071Elsevier S2213-0071(16)30006-510.1016/j.rmcr.2016.01.006Case ReportPhenytoin induced Steven–Johnson syndrome and bronchiolitis obliterans – case report and review of literature Pannu Bibek S. aEgan Ashley M. bIyer Vivek N. iyer.vivek@mayo.edua∗a Division of Pulmonary and Critical Care Medicine, Mayo Clinic, Rochester, MN, USAb Division of General Internal Medicine, Mayo Clinic, Rochester, MN, USA∗ Corresponding author. Division of Pulmonary & Critical Care Medicine, Mayo Clinic, Rochester, MN 55905, USA.Division of Pulmonary & Critical Care MedicineMayo ClinicRochesterMN55905USA iyer.vivek@mayo.edu20 1 2016 2016 20 1 2016 17 54 56 14 1 2016 18 1 2016 © 2016 The Authors2016This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Stevens–Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are both rare but serious idiosyncratic drug reactions characterized by diffuse muco-epidermoid injury and high mortality. Keratinocytes in both skin and mucous membranes (including eyes, mouth and genitalia) are injured resulting in a diffuse maculopapular rash, blistering lesions and epithelial detachment with minimal force (Nikolsky's sign). SJS is typically diagnosed when less than 10% of the skin surface is involved and the term TEN is used in cases with more than 30% involvement. Respiratory involvement in SJS-TEN is common with 30–50% of cases demonstrating respiratory epithelial sloughing with severe short and long term complications. Patients who survive SJS-TEN are often left with impaired respiratory function and bronchiolitis obliterans. Cases of bronchiolitis obliterans with SJS/TEN have been very rarely reported. We report a case of phenytoin induced SJS/TEN followed by severe bronchiolitis obliterans in an adult patient. The presentation, pathophysiology and management of SJS/TEN related bronchiolitis obliterans is also reviewed.\n\nKeywords\nStevens Johnson syndromeToxic epidermal necrolysisPhenytoinBronchiolitis obliterans\n==== Body\n1 Case\nA 67 year old nonsmoking Caucasian male was evaluated for hypertension and a history of partial seizures. He had no prior history of chronic obstructive pulmonary disease or asthma. His family history was positive for GTP cyclohydrolase 1 gene mutation in his sister and niece, which is an autosomal dominant condition with childhood-onset dystonia.\n\nIn 2003, he was started on phenytoin for his partial seizures. He had previously had an anaphylactic reaction to carbamazepine. Three weeks after starting phenytoin, he broke out in a generalized body rash involving both skin and mucous membranes. A diagnosis of Steven–Johnson syndrome (SJS) was made and patient was hospitalized for a week. During the hospitalization he developed pneumonia and a staphylococcal skin infection for which he was treated with antibiotics. His valproic acid dose needed to be reduced due to a mild increase in liver enzymes and development of a tremor.\n\nSoon after hospital discharge, he noticed significant shortness of breath and inability to perform even basic activities of daily living. He did not have any other symptoms of respiratory disease such as cough, fever, hemoptysis or subsequent respiratory infections. His dyspnea failed to improve over time and he remained markedly impaired in his overall functioning. Chest radiographs done over the years showed bilateral apical scarring with fibrosis and volume loss in upper lung fields (Fig. 1). Pulmonary function testing performed in 2014 (11 years after the episode of SJS) showed very severe obstruction with marked air trapping. His FEV1 was 1.02 L (25% predicted), FVC was 2.80 L (52% predicted) and TLC (total lung capacity) was 7.80 L (103% predicted). His residual volume was markedly elevated at 4.88 L (222% predicted) with a RV/TLC ratio of 62.5%. No bronchodilator response was noted. His diffusing capacity was surprisingly normal (77% predicted) confirming an airway-centric obstructive process rather than a defect in pulmonary gas-exchange. His resting and exercise oxygen concentrations were also within normal limits. He was prescribed an albuterol inhaler but was non-compliant. A chest CT scan showed findings compatible with a diffuse airway centric-process affecting the large and small airways (Fig. 2). The chest CT scan showed marked air trapping with areas of mosaic attenuation along with diffuse thickening of visible airway walls. In addition, there were areas of peri-bronchial linear scarring noted in the upper lung fields and marked stenosis at the origin of the bronchi to the lingula. Given the lack of other plausible explanations, all these findings were compatible with a diagnosis of constrictive bronchiolitis/bronchiolitis obliterans secondary to the episode of SJS-TEN that had occurred 11 years earlier. Repeat pulmonary function testing obtained 1 year later in 2015 showed stable lung function.\n\n2 Discussion\nBoth Stevens – Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are typically medication induced and are characterized by widespread epidermal necrosis and mucous membrane involvement. Mortality rates are generally below 5% for SJS but approaches 30–50% or higher in patients with TEN with higher mortality rates seen in older patients [1]. The cardinal manifestation of SJS-TEN is a febrile illness along with headache, cough, malaise, rhinorrhea occurring along with prodromal ‘target’ type skin lesions that later develop into a diffuse erythematous rash involving both skin and mucous membranes [2]. As the disease evolves, the epidermis undergoes necrosis in broad sheets and classically detaches from the underlying dermis with even minimal effort (Nikolsky sign). Mucous membrane involvement is reported to occur in 90%–100% of cases and can involve virtually all areas of the body including the mouth, nose, genitalia, eyes and visceral organs. Visceral involvement is common and seen in over 2/3rd of patients. Manifestations include sloughing of the gastrointestinal mucosa, diffuse tracheal and bronchial inflammation with mucosal injury and sloughing, glomerulonephritis and hepatitis [1], [2], [3], [3], [4].\n\nThe pathogenesis of SJS-TEN induced constrictive bronchiolitis/bronchiolitis obliterans (BO) is not completely clear, but likely reflects severe bronchial epithelial injury and subsequent scarring in a process akin to that seen in other mucous membranes. Damage to the bronchiolar epithelium due to immune complex deposition in SJS-TEN may initiate necrosis and subsequent exudation of fibrin and inflammatory cells into the airways [5]. Obliteration of bronchiolar lumens can then develop due to formation of fibrous granulation tissue. BO is a clinical diagnosis and pathologic confirmation is not mandatory for diagnosis. Lung involvement in SJS-TEN appears to be quite common with both early and delayed presentations. Onset of BO has been reported to occur from 5 days to 10 months after the development of SJS [5], [6], [7], [7], [8]. In a prospective study of 41 SJS-TEN patients by Lebargy and colleagues, bronchial epithelial involvement was noted in 27% of cases [5]. Bronchoscopy findings were consistent with epithelial sloughing in the proximal airways. In the autopsied lungs of patients with BO after SJS-TEN, Sugino and colleagues noted extensive occlusion of bronchi at the 4th and 5th generation bronchi and beyond [7]. These occlusive lesions were sporadically and intermittently located from the small bronchi all the way to the membranous bronchioles. Common pulmonary manifestations included dyspnea, bronchial hypersecretion, hypoxemia, atelectasis, pulmonary edema, need for mechanical ventilation and superimposed bacterial pneumonias.\n\nThe risk for SJS-TEN appears to be the highest in the first few weeks (≤8 weeks) after initiation of the culprit medication as was the case in our patient. Treatment of SJS-TEN should begin with the prompt withdrawal of the culprit drug. A multidisciplinary approach is necessary to manage the diffuse skin, ocular, mucous membrane and visceral organ involvement. Respiratory involvement is treated with airway humidification, bronchodilators and chest physiotherapy. Around 25% of TEN cases may require mechanical ventilation with poor outcomes and high mortality rates in patients with severe respiratory tract involvement. Severe cases of SJS-TEN are best treated in burn centers with studies showing that prompt referral to a burn center is associated with improved survival [2]. No randomized controlled studies exist for intravenous immunoglobulins, systemic corticosteroids, cyclosporine, cyclophosphamide, plasmapheresis, hemodialysis and other therapies that are sporadically used in SJS-TEN.\n\n3 Conclusion\nIn conclusion, we present a rare case of severe bronchiolitis obliterans following phenytoin induced SJS-TENS. This case serves to highlight the severe and long term respiratory impairment that can occur in the setting of SJS-TEN induced bronchiolitis obliterans. Unfortunately, effective therapies for the treatment of SJS-TEN do not exist and supportive therapies with prompt discontinuation of the offending agent remain the standard of care.\n\nFunding\nNone.\n\nDisclosure\nNone for all authors.\n\nFig. 1 Chest X-ray.\n\nFig. 2 Chest CT scan.\n==== Refs\nReferences\n1 Borchers A.T. Lee J.L. Stevens-Johnson syndrome and toxic epidermal necrolysis Autoimmun. Rev. 7 2008 598 605 18603022 \n2 Letko E. Papaliodis B.S. Stevens-Johnson syndrome and toxic epidermal necrolysis: a review of the literature Ann. Allergy Asthma Immunol. 94 2005 419 436 15875523 \n3 Patterson R. Miller M. Kaplan M. Effectiveness of early therapy with corticosteroids in Stevens-Johnson syndrome: experience with 41 cases and a hypothesis regarding pathogenesis Ann. Allergy 73 1994 27 34 8030799 \n4 Schopf E. Stuhmer A. Rzany B. Toxic epidermal necrolysis and Stevens-Johnson syndrome: an epidemiologic study from West Germany Arch. Dermatol. 127 1991 839 842 2036029 \n5 Lebargy F. Pulmonary complications in toxic epidermal necrolysis: a prospective clinical study Intensive Care Med. 23 1997 1237 1244 9470079 \n6 de Prost N. Mekontso-Dessap A. Acute respiratory failure in patients with toxic epidermal necrolysis: clinical features and factors associated with mechanical ventilation Crit. Care Med. 42 2014 118 128 23989174 \n7 Sugino K. Hebisawa A. Uekusa T. Hatanaka K. Abe H. Homma S. Bronchiolitis obliterans associated with Stevens-Johnson syndrome: histopathological bronchial reconstruction of the whole lung and immunohistochemical study Diagn. Pathol. 8 2013 134 23919759 \n8 Virant F.S. Redding G.J. Novack A.H. Multiple pulmonary complications in a patient with Stevens-Johnson syndrome Clin. Pediatr. Phila 23 1984 412 414 6426841\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2213-0071",
"issue": "17()",
"journal": "Respiratory medicine case reports",
"keywords": "Bronchiolitis obliterans; Phenytoin; Stevens Johnson syndrome; Toxic epidermal necrolysis",
"medline_ta": "Respir Med Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101604463",
"other_id": null,
"pages": "54-6",
"pmc": null,
"pmid": "27222786",
"pubdate": "2016",
"publication_types": "D002363:Case Reports",
"references": "23919759;6426841;18603022;23989174;8030799;9470079;2036029;15875523",
"title": "Phenytoin induced Steven-Johnson syndrome and bronchiolitis obliterans - case report and review of literature.",
"title_normalized": "phenytoin induced steven johnson syndrome and bronchiolitis obliterans case report and review of literature"
} | [
{
"companynumb": "US-MYLANLABS-2016M1006269",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PHENYTOIN"
},
"drugadditional": null,
... |
{
"abstract": "ZEN-3694 is a bromodomain extraterminal inhibitor (BETi) with activity in androgen-signaling inhibitor (ASI)-resistant models. The safety and efficacy of ZEN-3694 plus enzalutamide was evaluated in a phase Ib/IIa study in metastatic castration-resistant prostate cancer (mCRPC).\n\n\n\nPatients had progressive mCRPC with prior resistance to abiraterone and/or enzalutamide. 3+3 dose escalation was followed by dose expansion in parallel cohorts (ZEN-3694 at 48 and 96 mg orally once daily, respectively).\n\n\n\nSeventy-five patients were enrolled (N = 26 and 14 in dose expansion at low- and high-dose ZEN-3694, respectively). Thirty (40.0%) patients were resistant to abiraterone, 34 (45.3%) to enzalutamide, and 11 (14.7%) to both. ZEN-3694 dosing ranged from 36 to 144 mg daily without reaching an MTD. Fourteen patients (18.7%) experienced grade ≥3 toxicities, including three patients with grade 3 thrombocytopenia (4%). An exposure-dependent decrease in whole-blood RNA expression of BETi targets was observed (up to fourfold mean difference at 4 hours post-ZEN-3694 dose; P ≤ 0.0001). The median radiographic progression-free survival (rPFS) was 9.0 months [95% confidence interval (CI), 4.6-12.9] and composite median radiographic or clinical progression-free survival (PFS) was 5.5 months (95% CI, 4.0-7.8). Median duration of treatment was 3.5 months (range, 0-34.7+). Lower androgen receptor (AR) transcriptional activity in baseline tumor biopsies was associated with longer rPFS (median rPFS 10.4 vs. 4.3 months).\n\n\n\nZEN-3694 plus enzalutamide demonstrated acceptable tolerability and potential efficacy in patients with ASI-resistant mCRPC. Further prospective study is warranted including in mCRPC harboring low AR transcriptional activity.",
"affiliations": "University of California, San Francisco, San Francisco, California. rahul.aggarwal@ucsf.edu jalumkal@med.umich.edu abidam@mskcc.org.;University of Washington and Fred Hutchinson Cancer Research Center, Seattle, Washington.;Weill-Cornell Medicine, New York, New York.;University of California, Los Angeles, Los Angeles, California.;Karmanos Cancer Institute, Wayne State University, Detroit, Michigan.;Zenith Epigenetics Ltd., Calgary, Alberta, Canada.;Zenith Epigenetics Ltd., Calgary, Alberta, Canada.;Zenith Epigenetics Ltd., Calgary, Alberta, Canada.;Zenith Epigenetics Ltd., Calgary, Alberta, Canada.;Zenith Epigenetics Ltd., Calgary, Alberta, Canada.;Zenith Epigenetics Ltd., Calgary, Alberta, Canada.;University of California, San Francisco, San Francisco, California.;University of California, San Francisco, San Francisco, California.;Memorial Sloan Kettering Cancer Center, New York, New York. rahul.aggarwal@ucsf.edu jalumkal@med.umich.edu abidam@mskcc.org.;Oregon Health & Science University, Portland, Oregon. rahul.aggarwal@ucsf.edu jalumkal@med.umich.edu abidam@mskcc.org.",
"authors": "Aggarwal|Rahul R|RR|;Schweizer|Michael T|MT|;Nanus|David M|DM|;Pantuck|Allan J|AJ|;Heath|Elisabeth I|EI|0000-0003-1381-2713;Campeau|Eric|E|0000-0002-7121-9785;Attwell|Sarah|S|;Norek|Karen|K|;Snyder|Margo|M|0000-0002-8326-6247;Bauman|Lisa|L|;Lakhotia|Sanjay|S|;Feng|Felix Y|FY|;Small|Eric J|EJ|;Abida|Wassim|W|;Alumkal|Joshi J|JJ|0000-0003-1278-0166",
"chemical_list": "D000736:Androstenes; D000970:Antineoplastic Agents; D001549:Benzamides; D009570:Nitriles; D011944:Receptors, Androgen; D010669:Phenylthiohydantoin; C540278:enzalutamide; C089740:abiraterone",
"country": "United States",
"delete": false,
"doi": "10.1158/1078-0432.CCR-20-1707",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1078-0432",
"issue": "26(20)",
"journal": "Clinical cancer research : an official journal of the American Association for Cancer Research",
"keywords": null,
"medline_ta": "Clin Cancer Res",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D000736:Androstenes; D000970:Antineoplastic Agents; D000971:Antineoplastic Combined Chemotherapy Protocols; D001549:Benzamides; D018572:Disease-Free Survival; D019008:Drug Resistance, Neoplasm; D006801:Humans; D008297:Male; D008875:Middle Aged; D009362:Neoplasm Metastasis; D009570:Nitriles; D010669:Phenylthiohydantoin; D000077982:Progression-Free Survival; D064129:Prostatic Neoplasms, Castration-Resistant; D011944:Receptors, Androgen; D016896:Treatment Outcome",
"nlm_unique_id": "9502500",
"other_id": null,
"pages": "5338-5347",
"pmc": null,
"pmid": "32694156",
"pubdate": "2020-10-15",
"publication_types": "D017426:Clinical Trial, Phase I; D017427:Clinical Trial, Phase II; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't; D013486:Research Support, U.S. Gov't, Non-P.H.S.",
"references": "23228172;31912902;31150574;30987939;16618720;24315100;28844372;30340047;28302679;24449231;29985747;31515154;28891793;30028657;31727538;18519708;24293458;32694156;24881730;21949397;30846826;25184630;30996246;18309951;32152435;32328561",
"title": "A Phase Ib/IIa Study of the Pan-BET Inhibitor ZEN-3694 in Combination with Enzalutamide in Patients with Metastatic Castration-resistant Prostate Cancer.",
"title_normalized": "a phase ib iia study of the pan bet inhibitor zen 3694 in combination with enzalutamide in patients with metastatic castration resistant prostate cancer"
} | [
{
"companynumb": "US-ASTELLAS-2020US032702",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ENZALUTAMIDE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nIn December 2019, the novel coronavirus disease 2019 (COVID-19) caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) emerged in China, and now, it has spread all over the world. Pregnant women are a susceptible population, but there is scant information about COVID-19 in this population. Here, we report a case of a mother with substance use disorders who was infected with COVID-19 in her pregnancy.\n\n\nMETHODS\nThe patient was a 29-year-old, primigravida mother at the 37th gestational week who was referred to our center because of vaginal bleeding and severe uterine contractions. The patient was abusing opioids. With the suspicion of placental abruption, she was admitted for cesarean section. One day after delivery, she developed dyspnea, rhinorrhea, and vomiting. These were thought of as withdrawal signs. Despite methadone administration, these signs persisted. After ruling out deprivation syndrome and possible obstetric causes, a SARS-CoV-2 Polymerase chain reaction (PCR) test was ordered; the result was positive.\n\n\nCONCLUSIONS\nIn this case, because of the flu-like symptoms of substance withdrawal and postpartum causes of shortness of breath, the medical team's attention was drawn to these causes. SARS-CoV-2 infection should be considered as a differential diagnosis for these patients.",
"affiliations": null,
"authors": "Nagdi Dorabati|Peymaneh|P|0000-0002-4045-2429;Khoshnam Rad|Mahsa|M|0000-0001-5353-0556;Hedayat Yaghoobi|Mojtaba|M|;Mahmoodi|Zohreh|Z|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1097/JAN.0000000000000437",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1088-4602",
"issue": "32(4)",
"journal": "Journal of addictions nursing",
"keywords": null,
"medline_ta": "J Addict Nurs",
"mesh_terms": null,
"nlm_unique_id": "9616159",
"other_id": null,
"pages": "260-262",
"pmc": null,
"pmid": "34855325",
"pubdate": "2021",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "A Pregnant Mother Infected With Severe Acute Respiratory Syndrome Coronavirus 2 With Substance Dependence: A Case Report.",
"title_normalized": "a pregnant mother infected with severe acute respiratory syndrome coronavirus 2 with substance dependence a case report"
} | [
{
"companynumb": "IR-SUN PHARMACEUTICAL INDUSTRIES LTD-2022R1-329845",
"fulfillexpeditecriteria": "1",
"occurcountry": "IR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ALBUTEROL"
},
"druga... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.