article
dict
reports
listlengths
1
3.97k
{ "abstract": "Restless legs syndrome (RLS) is a chronic disorder causing clinically significant discomfort to approximately 3% of adults. Although RLS was first identified centuries ago, our understanding of this disorder, its causes, and its treatments is still evolving. In particular, our knowledge of the potential negative effects of RLS treatments, including dopaminergic augmentation, continues to expand. Augmentation, which refers to a paradoxical treatment-related increase in RLS symptoms, has been associated with all three dopamine agonists approved for the treatment of RLS - rotigotine, pramipexole, and ropinirole. This review presents key information on prevention and treatment of dopaminergic augmentation from the recently published consensus-based guidelines issued by the International RLS Study Group task force in conjunction with the European RLS Study Group and the RLS Foundation for first-line treatment of RLS/Willis-Ekbom disease. If dopamine agonists are used to treat RLS, it is recommended that the dosage should be kept as low as possible without exceeding the maximum dose recommended for RLS treatment. As the frequency of augmentation with the rotigotine patch may only be slightly lower than that associated with pramipexole or ropinirole, medications that are effective and have little risk of augmentation, such as alpha-2-delta ligands, may be considered for initial RLS treatment. In addition, we present our clinical experience with treating patients with dopaminergic augmentation by highlighting 2 case studies and practical considerations when treating different patient populations. Applying current RLS augmentation diagnosis and treatment guidelines, as well as collecting detailed histories of worsening RLS symptoms, is critical for patient safety and effective management of RLS augmentation.", "affiliations": "a Alabama Neurology & Sleep Medicine and Unosano, LLC , Tuscaloosa , AL , USA.;b University of South Carolina School of Medicine and SleepMed, Inc. , Columbia , SC , USA.", "authors": "Geyer|James|J|;Bogan|Richard|R|", "chemical_list": "D052160:Benzothiazoles; D018491:Dopamine Agonists; D007211:Indoles; D008024:Ligands; D013764:Tetrahydronaphthalenes", "country": "England", "delete": false, "doi": "10.1080/00325481.2017.1360747", "fulltext": null, "fulltext_license": null, "issn_linking": "0032-5481", "issue": "129(7)", "journal": "Postgraduate medicine", "keywords": "Alpha-2-delta ligand; augmentation; dopamine; gabapentin enacarbil; restless legs syndrome; treatment", "medline_ta": "Postgrad Med", "mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D052160:Benzothiazoles; D018491:Dopamine Agonists; D005260:Female; D006801:Humans; D007211:Indoles; D008024:Ligands; D008297:Male; D008875:Middle Aged; D012148:Restless Legs Syndrome; D013764:Tetrahydronaphthalenes; D016896:Treatment Outcome", "nlm_unique_id": "0401147", "other_id": null, "pages": "667-675", "pmc": null, "pmid": "28818004", "pubdate": "2017-09", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Identification and treatment of augmentation in patients with restless legs syndrome: practical recommendations.", "title_normalized": "identification and treatment of augmentation in patients with restless legs syndrome practical recommendations" }
[ { "companynumb": "US-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2017-BI-048660", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "PRAMIPEXOLE" }, ...
{ "abstract": "Fingolimod (FTY) is a disease modifying therapy for relapsing remitting multiple sclerosis (RRMS) which can lead to severe lymphopenia requiring therapy discontinuation in order to avoid adverse events. However, this can result in severe disease reactivation occasionally presenting with tumefactive demyelinating lesions (TDLs). TDLs, which are thought to originate from a massive re-entry of activated lymphocytes into the central nervous system, are larger than 2 cm in diameter and may feature mass effect, perifocal edema, and gadolinium enhancement. In these cases, it can be challenging to exclude important differential diagnoses for TDLs such as progressive multifocal leukoencephalopathy (PML) or other opportunistic infections. Here, we present the case of a 26-year-old female patient who suffered a massive rebound with TDLs following FTY discontinuation with primarily neuropsychiatric symptoms despite persisting lymphopenia. Two cycles of seven plasmaphereses each were necessary to achieve remission and ocrelizumab was used for long-term stabilization.", "affiliations": "Department of Neurology, Medical Faculty, University Hospital Düsseldorf, Heinrich Heine University, Düsseldorf, Germany.;Department of Neurology, Medical Faculty, University Hospital Düsseldorf, Heinrich Heine University, Düsseldorf, Germany.;Department of Neurology, Medical Faculty, University Hospital Düsseldorf, Heinrich Heine University, Düsseldorf, Germany.;Department of Neurology, Medical Faculty, University Hospital Düsseldorf, Heinrich Heine University, Düsseldorf, Germany.;Department of Neurology, Medical Faculty, University Hospital Düsseldorf, Heinrich Heine University, Düsseldorf, Germany.;Department of Neurology, Medical Faculty, University Hospital Düsseldorf, Heinrich Heine University, Düsseldorf, Germany.;Department of Neurology, Medical Faculty, University Hospital Düsseldorf, Heinrich Heine University, Düsseldorf, Germany.;Department of Neurology, Medical Faculty, University Hospital Düsseldorf, Heinrich Heine University, Düsseldorf, Germany.;Department of Neurology, Medical Faculty, University Hospital Düsseldorf, Heinrich Heine University, Düsseldorf, Germany.", "authors": "Koska|Valeria|V|;Förster|Moritz|M|;Brouzou|Katja|K|;Arat|Ercan|E|;Albrecht|Philipp|P|;Aktas|Orhan|O|;Küry|Patrick|P|;Meuth|Sven G|SG|;Kremer|David|D|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.3389/fneur.2021.785180", "fulltext": "\n==== Front\nFront Neurol\nFront Neurol\nFront. Neurol.\nFrontiers in Neurology\n1664-2295\nFrontiers Media S.A.\n\n10.3389/fneur.2021.785180\nNeurology\nCase Report\nCase Report: Persisting Lymphopenia During Neuropsychiatric Tumefactive Multiple Sclerosis Rebound Upon Fingolimod Withdrawal\nKoska Valeria\nFörster Moritz\n\nBrouzou Katja\nArat Ercan\nAlbrecht Philipp\nAktas Orhan\nKüry Patrick\n\nMeuth Sven G.\nKremer David *\n\nDepartment of Neurology, Medical Faculty, University Hospital Düsseldorf, Heinrich Heine University, Düsseldorf, Germany\nEdited by: Hideyuki Takeuchi, Yokohama City University, Japan\n\nReviewed by: Yusei Miyazaki, National Hospital Organization, Japan; Yoshiki Takai, Tohoku University Hospital, Japan\n\n*Correspondence: David Kremer david.kremer@med.uni-duesseldorf.de\nThis article was submitted to Multiple Sclerosis and Neuroimmunology, a section of the journal Frontiers in Neurology\n\n29 10 2021\n2021\n12 78518028 9 2021\n11 10 2021\nCopyright © 2021 Koska, Förster, Brouzou, Arat, Albrecht, Aktas, Küry, Meuth and Kremer.\n2021\nKoska, Förster, Brouzou, Arat, Albrecht, Aktas, Küry, Meuth and Kremer\nhttps://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.\nFingolimod (FTY) is a disease modifying therapy for relapsing remitting multiple sclerosis (RRMS) which can lead to severe lymphopenia requiring therapy discontinuation in order to avoid adverse events. However, this can result in severe disease reactivation occasionally presenting with tumefactive demyelinating lesions (TDLs). TDLs, which are thought to originate from a massive re-entry of activated lymphocytes into the central nervous system, are larger than 2 cm in diameter and may feature mass effect, perifocal edema, and gadolinium enhancement. In these cases, it can be challenging to exclude important differential diagnoses for TDLs such as progressive multifocal leukoencephalopathy (PML) or other opportunistic infections. Here, we present the case of a 26-year-old female patient who suffered a massive rebound with TDLs following FTY discontinuation with primarily neuropsychiatric symptoms despite persisting lymphopenia. Two cycles of seven plasmaphereses each were necessary to achieve remission and ocrelizumab was used for long-term stabilization.\n\nmultiple sclerosis\nrebound\ntumefactive\nlymphopenia\nneuropsychiatric\nfingolimod\n==== Body\npmcIntroduction\n\nFingolimod (FTY), an effective oral disease modifying therapy (DMT) for relapsing remitting multiple sclerosis (RRMS), sequesters lymphocytes in lymphatic tissue such as the lymph nodes. Accordingly, in some cases it can lead to severe lymphopenia. This prompts many neurologists to discontinue therapy in order to avoid opportunistic infections even though clear proof of such a risk is still lacking (1). Since 2012, several cases have been reported describing severe disease reactivation following FTY withdrawal featuring tumefactive demyelinating lesions (TDLs) (2, 3). TDLs are defined as demyelinating lesions larger than 2 cm in diameter and may feature mass effect, perifocal edema and gadolinium (Gad) enhancement (4). Important differential diagnoses for TDLs are progressive multifocal leukoencephalopathy (PML) and/or opportunistic infections. In almost, all of these cases disease reactivation is accompanied by rapid lymphocyte reconstitution. Here, we present the case of a 26-year-old female patient (after obtaining written and informed consent) who suffered a massive rebound with subcortical edematous TDLs after FTY discontinuation due to lymphopenia which persisted for more than 6 weeks after therapy was halted. Her clinical symptoms were primarily neuropsychiatric including affective incontinence and motoric aphasia. To our knowledge, only one similar case was reported in the literature by Ashtari et al. (3).\n\nCase Presentation\n\nIn a 26-year-old female patient with a 9-year history of RRMS, FTY treatment was discontinued due to lymphopenia of 225/μl and persisting disease activity in the form of optic neuritis. Prior to FTY she had been treated with interferon beta 1a and dimethylfumarate under which she had developed several relapses. Six weeks after FTY withdrawal the patient developed neuropsychiatric symptoms over the course of a few days including apathy, affective incontinence, and motoric aphasia. MRI revealed numerous tumefactive lesions with Gad enhancement and edema atypical of her prior disease course (Figure 1A prior MRI; Figure 1B MRI at admission). Under intravenous methylprednisolone therapy (1 g/d) over 5 days her neurological status deteriorated further. She could neither drink nor eat, suffered from psychomotor agitation and was unable to communicate with her caregivers, corresponding to an Expanded Disability Status Scale (EDSS) of 9.5. Her peripheral blood lymphocyte count at that time was 190/μl. After transfer to our clinic, we performed CSF analysis to rule out an infectious etiology. While we found a mild pleocytosis of 16/μl, three independent PCRs for JCV-DNA from serum and CSF were negative ruling out PML as a differential diagnosis. An extensive PCR and serological workup for borrelia, lues, and cryptococcosis was also negative, as well as anti-Aquaporin-4- and anti-MOG-antibodies. MR spectroscopy of a progressive lesion in the left frontal lobe yielded results suggestive of acute MS lesions (creatinin, cholin, and N-acetylaspartate slightly decreased, lactate slightly increased). The following day plasmapheresis was initiated, and the patient began to improve slowly. After the fourth plasmapheresis, she regained the ability to communicate and walk and was able to ingest small amounts of food. Follow-up MRI showed a decrease of the lesion size and number as well as the Gad enhancement (Figure 1C). After completion of seven plasmaphereses the patient could be transferred to a rehabilitation facility with an EDSS of 7.5. However, 2 weeks later she developed right sided hemiparesis. Corticosteroid therapy was started, and she was eventually readmitted to our hospital. Peripheral lymphocytes had increased to 890/μl but were still below the lower limit of normal. While MRI showed an overall decrease of Gad-enhancing lesions one subcortical lesion had remained active (Figure 1D, asterisk). As her symptoms had failed to improve under corticosteroids, a second cycle of seven plasmaphereses was initiated and the patient improved daily so that she was, again, released to a rehabilitation facility. The first dose of ocrelizumab (300 mg) was administered 7 weeks later. Six months after ocrelizumab initiation the patient remained relapse-free and showed clinical improvement now walking 1 km without help (EDSS 4.5). MRI showed a further remission with no remaining Gad enhancement (Figure 1E). Figure 2 shows an overview of the clinical course including relapses and DMT switches as well as total lymphocyte counts.\n\nFigure 1 MR-imaging during disease course. Sagittal FLAIR- and axial T1 gadolinium sequences. (A) Moderate lesion load under fingolimod treatment. (B) Frontoparietal tumefactive lesions with disseminated Gadolinium-enhancement 6 weeks after discontinuation of fingolimod. (C) Remittent Gadolinium-enhancement after four cycles of plasmapheresis. (D) Further remission at re-admission 2 weeks after the last cycle of plasmapheresis; asterisk indicates active lesion. (E) Lesions decreasing in size 6 months after ocrelizumab initiation (only axial FLAIR available).\n\nFigure 2 Clinical course and total lymphocyte count. Total lymphocyte count (TLC)/μl is depicted over the disease course. Relapses are shown as red squares. Duration of disease modifying therapies is shown with the black symbols, respectively. Ocrelizumab therapy was initiated and is still ongoing.\n\nDiscussion\n\nSeveral case reports describe tumefactive disease rebounds associated with fingolimod treatment (5) which may be linked to fingolimod-induced modulation of vascular permeability as observed in macular edema (6). However, the cases that occurred after FTY discontinuation are of particular interest as post-hoc analyses of the FREEDOMS and FREEDOMS II trials did not find a significantly increased risk of severe disease reactivation after FTY discontinuation (7). Sato et al. (8) presented a case series of 19 patients who were switched from fingolimod to dimethylfumarate. Ten of them experienced disease reactivation after cessation, with seven meeting the definition of rebound. Two patients suffered from persisting lymphopenia after 4 weeks but experienced no rebound. The seven rebound patients had a normal total lymphocyte count (TLC) at reactivation. However, most other case reports report either a normal lymphocyte count or provide no information on TLC. In rebound cases, it is hypothesized that rapid lymphocyte reconstitution and consecutive re-entry of lymphocytes into the CNS may cause an immune reconstitution inflammatory syndrome (IRIS)-like condition (9). This concept is corroborated by the fact that severe rebound events typically occur 2–4 months after therapy discontinuation at which time lymphocyte counts usually reach normal levels again. Furthermore, in mice FTY discontinuation can induce sphingosine-1-phosphate 1 (S1P1) overexpression in lymph-node entrapped lymphocytes leading to a massive sequential egress of lymphocytes (10). The resulting inflammatory spinal cord infiltrates are significantly higher than in vehicle-treated mice. However, in our patient disease reactivation occurred during persisting lymphopenia, which has been shown to be associated with low TCL before and under FTY treatment (11). In this context, the activity of brain-resident astrocytes may play a pivotal role. Giordana et al. (12) reported a fatal case of disease reactivation initially presenting with TDLs and symptoms similar to our patient. Autopsy revealed a strong S1P1 immunoreactivity on hypertrophic reactive astrocytes in active demyelinating lesions and in the periplaque normal appearing white matter (NAWM). The authors propose that upon FTY withdrawal, overexpression of S1P receptors on hyperactive astrocytes may lead to an activation of the pro-inflammatory transcription factor NFκB. A subsequent massive release of inflammatory cytokines and nitric oxide (NO) may explain the remarkable radiological characteristics and velocity of clinical deterioration. Due to an impaired blood brain barrier (BBB), these brain-derived inflammatory cytokines might diffuse into the peripheral blood where they would be cleared by plasmapheresis. This could explain the clinical improvement observed in our case. However, in vitro or in vivo data describing the precise mechanism of astrocyte cytokine release after FTY withdrawal is currently lacking. The main aspect to be learned from this case is that lymphocyte counts following FTY cessation are not a reliable tool to predict the probability of rebound. One of the most important risk factors is, however, persisting disease activity under FTY treatment flaring up after cessation (13). Moreover, with regard to impending disease reactivation a 6-week drug-free period before starting a new DMT could be too long even with persistent lymphopenia as stated by Bigaut et al. (14) in the Guidelines of the French Multiple Sclerosis Society. The authors recommend starting a new first-line therapy without a washout period and starting therapy with ocrelizumab and natalizumab after a washout period of 1 month. In both cases, TLC should not be taken into account concerning pre-therapeutic assessments. Thirdly, as suggested by Sato et al. (8), it is worthwhile to measure the ratio of TLCs even if that was not applicable in our case. This could help to decide when to start a new DMT after FTY cessation despite persisting lymphopenia. However, further studies are needed to define a cut-off value. Regarding differential diagnoses for tumefactive lesions the clinician should always rule out opportunistic infections such as herpes simplex virus (HSV), varicella zoster virus (VZV), cerebral cryptococcosis and PML. As of February 2020, 37 MS patients had contracted PML in the context of FTY therapy. Even though several studies could not confirm an increased infection rate due to lymphopenia (1) the European Medicines Agency (EMA) recommends discontinuation of FTY treatment when lymphocyte counts drop below 200/μl. Irrespective of these considerations, in the case presented here FTY discontinuation was indicated due to persisting disease activity.\n\nConclusion\n\nIn summary, we conclude that more detailed and standardized guidelines are needed for either continuation or termination of therapy in persistent lymphopenia. However, a definitive potential risk factor for rebound to be considered is persistent disease activity under prior treatment (13). Secondly, the washout period after FTY cessation before starting a new DMT should not exceed 1 month and should not be dependent on TLC at the time of cessation (14). Finally, for the clinician it is important to bear in mind that neuropsychiatric symptoms in young MS patients might indicate disease rebound.\n\nData Availability Statement\n\nThe raw data supporting the conclusions of this article will be made available by the authors, withoutundue reservation.\n\nEthics Statement\n\nEthical review and approval was not required for the study on human participants in accordance with the local legislation and institutional requirements. The patients/participants provided their written informed consent to participate in this study. Written informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article.\n\nAuthor Contributions\n\nVK, SM, and DK gave the idea of case reporting. VK and DK analyzed the case and prepared the MRI scans as well as the figure and the table. VK drafted the manuscript for intellectual content. MF, KB, EA, PA, OA, PK, SM, and DK critically reviewed the manuscript and were involved inpatients' healthcare. All the authors contributed to the article and approved the submitted version.\n\nConflict of Interest\n\nPA received compensation for serving on Scientific Advisory Boards for Allergan, Biogen, Celgene, Ipsen, Merck Serono, Merz Pharmaceuticals, Novartis, and Roche. He received speaker honoraria and travel support from Allergan, Bayer Vital GmbH, Biogen, Celgene, Ipsen, Merck Serono, Merz Pharmaceuticals, Novartis, Roche and research support from Allergan, Biogen, Celgene, Ipsen, Merck Serono, Merz Pharmaceuticals, Novartis, and Roche. OA has received grant support from Bayer, Biogen, Novartis, and Sanofi and consultancy or speaking fees and fees for serving on steering committees from Bayer, Biogen, Celgene, Medimmune, Merck, Novartis, Roche, Sanofi, and Teva. PK was supported by the Stifterverband/Novartisstiftung. SM received honoraria for lecturing and travel expenses for attending meetings from Almirall, Amicus Therapeutics Germany, Bayer Health Care, Biogen, Celgene, Diamed, Genzyme, MedDay Pharmaceuticals, Merck Serono, Novartis, Novo Nordisk, ONO Pharma, Roche, Sanofi-Aventis, Chugai Pharma, QuintilesIMS, and Teva. His research was funded by the German Ministry for Education and Research (BMBF), Deutsche Forschungsgemeinschaft (DFG), Else Kröner Fresenius Foundation, German Academic Exchange Service, Hertie Foundation, Interdisciplinary Center for Clinical Studies (IZKF) Muenster, German Foundation Neurology and by Almirall, Amicus Therapeutics Germany, Biogen, Diamed, Fresenius Medical Care, Genzyme, Merck Serono, Novartis, ONO Pharma, Roche, and Teva. DK received travel grants from GeNeuro and Merck, refund of congress participation fees from GeNeuro, Merck and Servier, consulting fees from Grifols, payment for lectures from Grifols, support for research projects from Teva and was funded by the Deutsche Forschungsgemeinschaft (DFG) while carrying research on human endogenous retroviruses at Cleveland Clinic. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n\nPublisher's Note\n\nAll claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.\n\nWe acknowledge the support by Heinrich-Heine-University Düsseldorf.\n==== Refs\nReferences\n\n1. Boffa G Bruschi N Cellerino M Lapucci C Novi G Sbragia E . Fingolimod and dimethyl-fumarate-derived lymphopenia is not associated with short-term treatment response and risk of infections in a real-life MS population. CNS Drugs. (2020) 34 :425–32. 10.1007/s40263-020-00714-8 32193826\n2. Fragoso YD Adoni T Gomes S Goncalves MVM Parolin LF Rosa G . Severe exacerbation of multiple sclerosis following withdrawal of fingolimod. Clin Drug Investig. (2019) 39 :909–13. 10.1007/s40261-019-00804-6 31152369\n3. Ashtari F Sahraian MA Oustad M Nilipour Y . Tumefactive rebound of multiple sclerosis after the short-term cessation of fingolimod: a case report. Mult Scler Relat Disord. (2019) 39 :101883. 10.1016/j.msard.2019.101883 31862655\n4. Hardy TA Chataway J . Tumefactive demyelination: an approach to diagnosis and management. J Neurol Neurosurg Psychiatry. (2013) 84 :1047–53. 10.1136/jnnp-2012-304498 23334629\n5. Jander S Turowski B Kieseier BC Hartung H-P . Emerging tumefactive multiple sclerosis after switching therapy from natalizumab to fingolimod. Mult Scler. (2012) 18 :1650–2. 10.1177/1352458512463768 23100527\n6. McVerry BJ Garcia JGN . In vitro and in vivo modulation of vascular barrier integrity by sphingosine 1-phosphate: mechanistic insights. Cell Signal. (2005) 17 :131–9. 10.1016/j.cellsig.2004.08.006 15494205\n7. Vermersch P Radue E-W Putzki N Ritter S Merschhemke M Freedman MS . A comparison of multiple sclerosis disease activity after discontinuation of fingolimod and placebo. Mult Scler J Exp Transl Clin. (2017) 3 :2055217317730096. 10.1177/2055217317730096 28989795\n8. Sato K Niino M Kawashima A Yamada M Miyazaki Y Fukazawa T . Disease exacerbation after the cessation of fingolimod treatment in Japanese patients with multiple sclerosis. Intern Med. (2018) 57 :2647–55. 10.2169/internalmedicine.0793-18 29709955\n9. Havla JB Pellkofer HL Meinl I Gerdes LA Hohlfeld R Kümpfel T . Rebound of disease activity after withdrawal of fingolimod (FTY720) treatment. Arch Neurol. (2012) 69 :262–4. 10.1001/archneurol.2011.1057 22332194\n10. Cavone L Felici R Lapucci A Buonvicino D Pratesi S Muzzi M . Dysregulation of sphingosine 1 phosphate receptor-1 (S1P1) signaling and regulatory lymphocyte-dependent immunosuppression in a model of post-fingolimod MS rebound. Brain Behav Immun. (2015) 50 :78–86. 10.1016/j.bbi.2015.06.019 26130058\n11. Ohtani R Mori M Uchida T Uzawa A Masuda H Liu J . Risk factors for fingolimod-induced lymphopenia in multiple sclerosis. Mult Scler J Exp Transl Clin. (2018) 4 :2055217318759692. 10.1177/2055217318759692 29497558\n12. Giordana MT Cavalla P Uccelli A Laroni A Bandini F Vercellino M . Overexpression of sphingosine-1-phosphate receptors on reactive astrocytes drives neuropathology of multiple sclerosis rebound after fingolimod discontinuation. Mult Scler. (2018) 24 :1133–7. 10.1177/1352458518763095 29708466\n13. Berger B Baumgartner A Rauer S Mader I Luetzen N Farenkopf U . Severe disease reactivation in four patients with relapsing-remitting multiple sclerosis after fingolimod cessation. J Neuroimmunol. (2015) 282 :118–22. 10.1016/j.jneuroim.2015.03.022 25903738\n14. Bigaut K Cohen M Durand-Dubief F Maillart E Planque E Zephir H . How to switch disease-modifying treatments in multiple sclerosis: Guidelines from the French Multiple Sclerosis Society (SFSEP). Mult Scler Relat Disord. (2021) 53 :103076. 10.1016/j.msard.2021.103076 34161898\n\n", "fulltext_license": "CC BY", "issn_linking": "1664-2295", "issue": "12()", "journal": "Frontiers in neurology", "keywords": "fingolimod; lymphopenia; multiple sclerosis; neuropsychiatric; rebound; tumefactive", "medline_ta": "Front Neurol", "mesh_terms": null, "nlm_unique_id": "101546899", "other_id": null, "pages": "785180", "pmc": null, "pmid": "34777236", "pubdate": "2021", "publication_types": "D002363:Case Reports", "references": "32193826;15494205;22332194;29497558;23334629;26130058;23100527;28989795;34161898;29708466;31152369;29709955;25903738;31862655", "title": "Case Report: Persisting Lymphopenia During Neuropsychiatric Tumefactive Multiple Sclerosis Rebound Upon Fingolimod Withdrawal.", "title_normalized": "case report persisting lymphopenia during neuropsychiatric tumefactive multiple sclerosis rebound upon fingolimod withdrawal" }
[ { "companynumb": "DE-Accord-245851", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "FINGOLIMOD" }, "drugadditional": "1", "druga...
{ "abstract": "We report a unique case of probable drug-induced CD30-positive lymphomatoid reaction. A 58-year-old woman presented with bilateral facial eruptions of 3 weeks duration composed of erythematosus papules in a linear distribution. The pathological features demonstrated a dense dermal and follicular infiltrate of many medium- to large-sized atypical CD30-positive lymphoid cells. The rash resolved rapidly after discontinuation of her medication 1 week later and did not recur. This case highlights the importance of clinicopathological correlation.", "affiliations": "*Department of Dermatology, Mackay Memorial Hospital, Taipei, Taiwan; and †Department of Medicine, Mackay Medical College, New Taipei City, Taiwan.", "authors": "Chen|Yi-Chin|YC|;Wu|Yu-Hung|YH|", "chemical_list": "D017730:Ki-1 Antigen; D010080:Oxazoles; C100282:mephenoxalone", "country": "United States", "delete": false, "doi": "10.1097/DAD.0000000000000795", "fulltext": null, "fulltext_license": null, "issn_linking": "0193-1091", "issue": "39(5)", "journal": "The American Journal of dermatopathology", "keywords": null, "medline_ta": "Am J Dermatopathol", "mesh_terms": "D001707:Biopsy, Needle; D003937:Diagnosis, Differential; D064420:Drug-Related Side Effects and Adverse Reactions; D005148:Facial Dermatoses; D005260:Female; D006801:Humans; D007150:Immunohistochemistry; D017730:Ki-1 Antigen; D008214:Lymphocytes; D016410:Lymphoma, T-Cell, Cutaneous; D008875:Middle Aged; D010080:Oxazoles; D018570:Risk Assessment; D012878:Skin Neoplasms; D028761:Withholding Treatment", "nlm_unique_id": "7911005", "other_id": null, "pages": "e62-e65", "pmc": null, "pmid": "27893468", "pubdate": "2017-05", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Linear Folliculotropic CD30-Positive Lymphomatoid Drug Reaction.", "title_normalized": "linear folliculotropic cd30 positive lymphomatoid drug reaction" }
[ { "companynumb": "TW-ACCORD-052276", "fulfillexpeditecriteria": "1", "occurcountry": "TW", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "AMLODIPINE BESYLATE" }, "drugadditional": "1", ...
{ "abstract": "Metastatic colorectal cancer (mCRC) is a common and high-risk malignant tumor. Fruquintinib is a novel small-molecule compound with high selective inhibition of vascular endothelial growth factor (VEGF) receptor (VEGFR) for mCRC for which second-line or higher standard chemotherapy has been ineffective. A female patient with mCRC developed severe rashes after 2 weeks of taking fruquintinib. Considering the relationship between fruquintinib and the rashes, she discontinued taking the drug, and her condition improved. Although fruquintinib has shown good safety and manageable toxicity in previous trials, the patient in the present case developed severe rashes after 2 weeks of taking fruquintinib. The common skin reactions of hand and foot are erythema and paresthesia of hand and foot. Because few people have reported a severe rash caused by fruquintinib, which is different from the common hand foot skin reaction. We hope the case attracts the attention of oncologists.", "affiliations": "Department of Medical Oncology, Affiliated Hangzhou Cancer Hospital, Zhejiang University School of Medicine, Hangzhou, China.;Department of Medical Oncology, Affiliated Hangzhou Cancer Hospital, Zhejiang University School of Medicine, Hangzhou, China.", "authors": "Shu|Yefei|Y|;Zheng|Song|S|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.3389/fonc.2021.688231", "fulltext": "\n==== Front\nFront Oncol\nFront Oncol\nFront. Oncol.\nFrontiers in Oncology\n2234-943X\nFrontiers Media S.A.\n\n10.3389/fonc.2021.688231\nOncology\nCase Report\nCase Report: Severe Rashes Associated With Fruquintinib in a Patient With Metastatic Colorectal Cancer\nShu Yefei 1 *\n\nZheng Song 1 2 *\n1 Department of Medical Oncology, Affiliated Hangzhou Cancer Hospital, Zhejiang University School of Medicine, Hangzhou, China\n2 Department of Medical Oncology, Affiliated Hangzhou First People’s Hospital, Zhejiang University School of Medicine, Hangzhou, China\nEdited by: Kulmira Nurgali, Victoria University, Australia\n\nReviewed by: Teodora Alexa-Stratulat, Grigore T. Popa University of Medicine and Pharmacy, Romania; Marcel Verheij, Antoni van Leeuwenhoek Hospital, Netherlands\n\n*Correspondence: Yefei Shu, shuyefei360423@163.com; Song Zheng, tztree@126.com\nThis article was submitted to Pharmacology of Anti-Cancer Drugs, a section of the journal Frontiers in Oncology\n\n05 7 2021\n2021\n11 68823130 3 2021\n14 6 2021\nCopyright © 2021 Shu and Zheng\n2021\nShu and Zheng\nhttps://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.\nMetastatic colorectal cancer (mCRC) is a common and high-risk malignant tumor. Fruquintinib is a novel small-molecule compound with high selective inhibition of vascular endothelial growth factor (VEGF) receptor (VEGFR) for mCRC for which second-line or higher standard chemotherapy has been ineffective. A female patient with mCRC developed severe rashes after 2 weeks of taking fruquintinib. Considering the relationship between fruquintinib and the rashes, she discontinued taking the drug, and her condition improved. Although fruquintinib has shown good safety and manageable toxicity in previous trials, the patient in the present case developed severe rashes after 2 weeks of taking fruquintinib. The common skin reactions of hand and foot are erythema and paresthesia of hand and foot. Because few people have reported a severe rash caused by fruquintinib, which is different from the common hand foot skin reaction. We hope the case attracts the attention of oncologists.\n\ncolorectal cancer\nfruquintinib\nrash\nvascular endothelial growth factor receptor\ncase report\n==== Body\nIntroduction\n\nColorectal cancer ranks third and second in the incidence rate of male and female malignancies respectively all over the world (1). There are approximately 1.36 million new patients with colorectal cancer and nearly 700,000 related deaths every year, which is a huge global challenge. In China, the number of new cases is 376,000 every year, and this number continues to grow. In approximately 50% of all cases, colorectal cancer may eventually develop into mCRC or advanced colorectal cancer. After failure of second-line standard treatment, effective treatments of mCRC are limited, and some patients have good resilience and a strong desire for survival.\n\nFruquintinib is a novel small-molecule compound with high selective inhibition of vascular endothelial growth factor (VEGF) receptor (VEGFR) for mCRC for which second-line or higher standard chemotherapy has been ineffective (2). Although fruquintinib has shown the advantages of a strong effect, low toxicity, and good tolerance for colorectal cancer, it is associated with some unrecognized adverse reactions.\n\nCase Report\n\nA 71-year-old woman was admitted to hospital due to increased stool frequency and abdominal discomfort. She had no family history of cancer or drug allergies. She underwent radical resection of rectal cancer in May 2018. Postoperative pathology showed that rectal moderately differentiated adenocarcinoma was 3.5 × 2.5 cm with negative margin. The depth of ulcer was full-thickness infiltration, involving serosa. One of nine lymph nodes had cancer metastasis. Special examination showed MSH2 (+), MSH6 (+), MLH1 (+), PMS2 (+), CDX2 (+). According to the Union for International Cancer Control/American Joint Committee on Cancer tumor–node–metastasis staging system (8th Edition, 2017), the postoperative pathological stage was stage IIIB (T3N1M0). The patient did not receive preoperative and postoperative radiotherapy. Eleven cycles of the FOLFOX6 regimen and one cycle of Xeloda were administered after the surgery, and the patient was then followed up regularly. In May 2019, intrahepatic nodules and peri-intestinal metastasis were considered. Positron emission tomography–computed tomography (CT) showed ascending-colon mesangial and omental nodules, liver S4 and S2 nodules, with increased fluorodeoxyglucose metabolism. Gene detection indicated she harbored wild-type KRAS/NRAS/BRAF, and microsatellite instability detection indicated microsatellite stability (MSS). Therefore, from May 16, 2019, FOLFIRI combined with cetuximab was administered for 12 courses, and from January 20, 2020, cetuximab (700 mg) was administered for two courses as maintenance treatment. When liver metastasis occurred, stereotactic body radiation therapy was performed in other hospital. The plan of radiotherapy is unknown. From May 19, 2020, three courses of raltitrexed, oxaliplatin, bevacizumab (q2w) were administered. On July 21, 2020, pelvic and abdominal cavity CT was performed to evaluate disease progression. Although the patient was a MSS colorectal patient, based on the regonivo study (3) with ORR 36% and PFS 7.9 months and her strong desire for survival, she tried small molecule targeted drugs combined with immunotherapy. From July 24, 2020, regorafenib (80 mg QD) oral targeted therapy plus treprizumab (240 mg) immunotherapy were administered. On September 30, 2020, because of fatigue, hand and foot skin reaction, and loss of appetite, the treatment plan was adjusted to TAS-102. Then, physical examination revealed a large amount of ascites. On December 17, 2020, the whole abdominal enhanced CT in our hospital showed liver II and V metastases considered, a large number of peritoneal effusion, and multiple metastases of omentum and mesentery ( Figure 1 ). The disease progressed; therefore, the treatment was changed to fruquintinib. On January 12, 2021, the patient developed severe rashes after receiving fruquintinib (3 mg qd) for approximately 2 weeks ( Figures 2A, B ). The patient developed severe rashes (Common Terminology Criteria for Adverse Events grade 3) in both lower limbs, which affected the patient’s quality of life. Blood routine and coagulation function were basically normal. A dermatology consultation revealed dark purple infiltrative rashes scattered on both lower limbs and pustules observed locally. Betamethasone (1 ml, intramuscular injection), chlorphenamine maleate (10 mg, intramuscular injection), mupirocin ointment (0.2 g, bid for external use), and mometasone furoate cream (5 mg, QN for external use) were recommended. The dermatologist diagnosed these rashes as drug-induced rashes. Then the patient discontinued taking fruquintinib due to severe rashes. The severe rashes disappeared gradually after discontinuation of fruquintinib for 1 week. On January 22, 2021, the patient began to reduce the use of fruquintinib (1 mg QD), and there was no recurrence of rashes. On March 2, 2021, the intraperitoneal tumor was found to have progressed; therefore, fruquintinib was discontinued. In the follow-up, the patient is receiving the best supportive treatment. The case timeline is presented in Figure 3 .\n\nFigure 1 On December 17, 2020, the whole abdominal enhanced CT in our hospital showed a large number of peritoneal effusion, multiple metastases of omentum and mesentery (A, B), liver II metastases (C, red arrow) and V metastases (D, yellow arrow).\n\nFigure 2 (A, B) The severe rashes after receiving fruquintinib for approximately 2 weeks.\n\nFigure 3 The case timeline.\n\nInformed written consent was obtained from the patient prior to publication of this report and ethical approval was given by Hangzhou Cancer Hospital.\n\nDiscussion\n\nFruquintinib is a novel small molecule compound with high selective inhibition of VEGFR1, -2, and, -3 (4). It inhibits VEGF-induced VEGFR2 phosphorylation, endothelial cell proliferation, and tubule formation (5). The approval of fruquintinib is based on a multicenter, randomized, double-blind, placebo-controlled phase III clinical study, Fresco. The results of the Fresco study showed that the median overall survival of patients with mCRC treated with fruquintinib was 9.3 months, which was 2.7 months longer than that in the placebo group; in addition, the median progression free survival of patients treated with fruquintinib was 3.7 months, which was significantly longer than 1.8 months in the placebo group, with a significant survival benefit (6).\n\nHowever, in the Fresco study, grades 3 and 4 treatment-emergent adverse events occurred in 61.2% of patients who received fruquintinib. The most common adverse reactions affecting patients in the fruquintinib group were hypertension, proteinuria, hand foot skin reactions, etc., which were related to the target VEGFR, and the prevalence was relatively low, which was also controllable clinically, and most reactions were tolerable (7). Hand foot syndrome (palmar or plantar swelling, or pain or fingertip erythema) is the most common skin adverse reaction to fruquintinib, which is usually mild to moderate (grade 1–2). Fruquintinib also exhibits cross-toxicity with other anti-vascular drugs (such as bevacizumab), including hypertension, proteinuria, bleeding. A meta-analysis has shown that fruquintinib exhibits less toxicity among all-grade toxicities when compared with that of regorafenib (8).\n\nThe common skin reactions of hand and foot are erythema and paresthesia of hand and foot. Because few people have reported a severe rash caused by fruquintinib, which is different from the common hand foot skin reaction. The mechanism of fruquintinib induced rash is not very clear. We think it may be related to the inhibition of VEGFR2/3 phosphorylation by fruquintinib, thus inhibiting the proliferation and lumen formation of endothelial cells. The specific mechanism of severe skin rash caused by fruquintinib deserves further exploration.\n\nConclusion\n\nCancer therapy faces the challenge of handling a double-edged sword. Fruquintinib brings not only clinical benefits, but also some adverse reactions. How to manage fruquintinib to maximize the therapeutic effect and avoid adverse reactions as much as possible is a problem we need to explore.\n\nData Availability Statement\n\nThe raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.\n\nEthics Statement\n\nThe studies involving human participants were reviewed and approved by Hangzhou Cancer Hospital. Written informed consent to participate in this study was provided by the participants’ legal guardian/next of kin. Written informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article.\n\nAuthor Contributions\n\nConceptualization: SZ. Project administration: YS. Writing – original draft: YS. Writing – review and editing: SZ. All authors contributed to the article and approved the submitted version\n\nConflict of Interest\n\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n==== Refs\nReferences\n\n1 GBD 2017 Colorectal Cancer Collaborators. The Global, Regional, and National Burden of Colorectal Cancer and Its Attributable Risk Factors in 195 Countries and Territories, 1990-2017: A Systematic Analysis for the Global Burden of Disease Study 2017. Lancet Gastroenterol Hepatol (2019) 4 (12 ):913–33.  10.1016/S2468-1253(19)30345-0\n2 Zhang Y Zou JY Wang Z Wang Y . Fruquintinib: A Novel Antivascular Endothelial Growth Factor Receptor Tyrosine Kinase Inhibitor for the Treatment of Metastatic Colorectal Cancer. Cancer Manag Res (2019) 11 :7787–03.  10.2147/CMAR.S215533\n3 Fukuoka S Hara H Takahashi N Kojima T Kawazoe A Asayama M . Regorafenib Plus Nivolumab in Patients With Advanced Gastric or Colorectal Cancer: An Open-Label, Dose-Escalation, and Dose-Expansion Phase Ib Trial (REGONIVO, EPOC1603). J Clin Oncol 38 (18 ):2053–61.  10.1200/JCO.19.03296\n4 Chen Z Jiang L . The Clinical Application of Fruquintinib on Colorectal Cancer. Expert Rev Clin Pharmacol (2019) 12 (8 ):713–21.  10.1080/17512433.2019.1630272\n5 Deng Y Li X . Fruquintinib and its Use in the Treatment of Metastatic Colorectal Cancer. Future Oncol (2019) 15 (22 ):2571–6.  10.2217/fon-2018-0454\n6 Li J Qin S Xu RH Shen L Xu J Bai Y . Effect of Fruquintinib vs Placebo on Overall Survival in Patients With Previously Treated Metastatic Colorectal Cancer: The FRESCO Randomized Clinical Trial. Drugs (2018) 78 (16 ):1757–61. 10.1007/s40265-018-0998-z\n7 Shirley M . Fruquintinib: First Global Approval. Drugs (2018) 78 (16 ):1757–61.  10.1007/s40265-018-0998-z\n8 Chen J Wang J Lin H Peng Y . Comparison of Regorafenib, Fruquintinib, and TAS-102 in Previously Treated Patients With Metastatic Colorectal Cancer: A Systematic Review and Network Meta-Analysis of Five Clinical Trials. Med Sci Monit (2019) 25 :9179–91.  10.12659/MSM.918411\n\n", "fulltext_license": "CC BY", "issn_linking": "2234-943X", "issue": "11()", "journal": "Frontiers in oncology", "keywords": "case report; colorectal cancer; fruquintinib; rash; vascular endothelial growth factor receptor", "medline_ta": "Front Oncol", "mesh_terms": null, "nlm_unique_id": "101568867", "other_id": null, "pages": "688231", "pmc": null, "pmid": "34290985", "pubdate": "2021", "publication_types": "D002363:Case Reports", "references": "31648977;31407939;29946728;31177854;30357594;32343640;31790382;31496821", "title": "Case Report: Severe Rashes Associated With Fruquintinib in a Patient With Metastatic Colorectal Cancer.", "title_normalized": "case report severe rashes associated with fruquintinib in a patient with metastatic colorectal cancer" }
[ { "companynumb": "CN-SUN PHARMACEUTICAL INDUSTRIES LTD-2021R1-315641", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "OXALIPLATIN" }, "dru...
{ "abstract": "Single-agent anti-PD1 antibodies are usually very well tolerated, but serious toxicity can still occur. Despite the PD-1 pathway seems to be relevant in the pathogenesis of immune-related myositis, anti-PD1-related myositis is generally a rare side effect of the treatment and usually not serious. However, its frequency is likely to increase as the use of immune checkpoint blockades. We present here a case of life-threatening polymyositis with associated spontaneous muscular hematoma in a patient treated with single-agent nivolumab in the adjuvant setting. Spontaneous hematoma is an extremely rare complication with unclear etiology of idiopathic myositis. Very few cases have been reported in the literature and their outcome has been often fatal. To our knowledge, this is the first case of autoimmune myositis and spontaneous heamatoma associated with the administration of single-agent checkpoint blockade. Anti-PD1 antibodies have changed the treatment landscape for a number of cancer entities in the past few years. When given as single agent they are usually very well tolerated, but serious rare toxicity can still occur. We present here a case of polymyositis with associated spontaneous muscular hematoma in a patient treated with single agent nivolumab.", "affiliations": "Department of Oncology.;Department of Oncology.;Rheumatology.;Radiology, St Georges University Hospital, London, UK.;Department of Oncology.", "authors": "Liu|Wing K|WK|;Naban|Nabeel|N|;Kaul|Arvind|A|;Patel|Nirav|N|;Fusi|Alberto|A|", "chemical_list": "D000074322:Antineoplastic Agents, Immunological; D000077594:Nivolumab", "country": "England", "delete": false, "doi": "10.1097/CMR.0000000000000706", "fulltext": null, "fulltext_license": null, "issn_linking": "0960-8931", "issue": "31(1)", "journal": "Melanoma research", "keywords": null, "medline_ta": "Melanoma Res", "mesh_terms": "D000368:Aged; D000074322:Antineoplastic Agents, Immunological; D006406:Hematoma; D006801:Humans; D008297:Male; D008545:Melanoma; D000077594:Nivolumab; D017285:Polymyositis; D012878:Skin Neoplasms", "nlm_unique_id": "9109623", "other_id": null, "pages": "85-87", "pmc": null, "pmid": "33196530", "pubdate": "2021-02-01", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Life-threatening polymyositis with spontaneous hematoma induced by nivolumab in a patient with previously resected melanoma.", "title_normalized": "life threatening polymyositis with spontaneous hematoma induced by nivolumab in a patient with previously resected melanoma" }
[ { "companynumb": "GB-BRISTOL-MYERS SQUIBB COMPANY-BMS-2020-103927", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "NIVOLUMAB" }, "drugaddi...
{ "abstract": "OBJECTIVE\nTo evaluate the outcome of photodynamic therapy (PDT) in the management of extrafoveolar choroidal osteoma.\n\n\nMETHODS\nThe authors performed a retrospective chart review of all patients with choroidal osteoma that did not involve the foveola and were treated with standard-fluence PDT.\n\n\nRESULTS\nNine eyes with extrafoveolar choroidal osteoma were studied. Mean logarithm of the minimum angle of resolution best-corrected visual acuity at initial examination was 0.07 (Snellen ∼20/25). The osteoma was treated with 1 (8/9) or 2 (1/9) PDT sessions using 50 J/cm. After a mean follow-up of 49 months, the treated area of osteoma demonstrated complete (4/9) or partial (5/9) regression, with a mean of 73% regression in the PDT-treated areas. Tumor growth in the region of PDT was noted in 3 cases (3/9) (one tumor toward the foveola and two tumors at the margin away from the foveola), but in no case did the tumor reach the foveola. Therefore, PDT controlled tumor growth in 8 of 9 cases with only 1 of 9 cases showing growth through the PDT scar into foveola. Mean logarithm of the minimum angle of resolution visual acuity at last follow-up was 0.04 (Snellen ∼20/20) (P = 0.59).\n\n\nCONCLUSIONS\nPhotodynamic therapy is an effective modality for the management of extrafoveolar choroidal osteoma, minimizing tumor growth toward the foveola and preserving visual acuity.", "affiliations": "Ocular Oncology Service, Wills Eye Hospital, Thomas Jefferson University, Philadelphia, Pennsylvania; and.;Ocular Oncology Service, Wills Eye Hospital, Thomas Jefferson University, Philadelphia, Pennsylvania; and.;Ocular Oncology Service, Wills Eye Hospital, Thomas Jefferson University, Philadelphia, Pennsylvania; and.;Ocular Oncology Service, Wills Eye Hospital, Thomas Jefferson University, Philadelphia, Pennsylvania; and.;Ocular Oncology Service, Wills Eye Hospital, Thomas Jefferson University, Philadelphia, Pennsylvania; and.", "authors": "Mazloumi|Mehdi|M|;Dalvin|Lauren A|LA|;Ancona-Lezama|David|D|;Mashayekhi|Arman|A|;Shields|Carol L|CL|", "chemical_list": "D017319:Photosensitizing Agents; D000077362:Verteporfin", "country": "United States", "delete": false, "doi": "10.1097/IAE.0000000000002534", "fulltext": null, "fulltext_license": null, "issn_linking": "0275-004X", "issue": "40(5)", "journal": "Retina (Philadelphia, Pa.)", "keywords": null, "medline_ta": "Retina", "mesh_terms": "D000293:Adolescent; D000328:Adult; D002829:Choroid; D002830:Choroid Neoplasms; D005260:Female; D006801:Humans; D008297:Male; D010016:Osteoma; D010778:Photochemotherapy; D017319:Photosensitizing Agents; D012189:Retrospective Studies; D041623:Tomography, Optical Coherence; D000077362:Verteporfin; D014792:Visual Acuity; D055815:Young Adult", "nlm_unique_id": "8309919", "other_id": null, "pages": "966-971", "pmc": null, "pmid": "30950971", "pubdate": "2020-05", "publication_types": "D016428:Journal Article", "references": null, "title": "PHOTODYNAMIC THERAPY FOR EXTRAFOVEOLAR CHOROIDAL OSTEOMA.", "title_normalized": "photodynamic therapy for extrafoveolar choroidal osteoma" }
[ { "companynumb": "US-BAUSCH-BL-2021-018081", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "VERTEPORFIN" }, "drugadditional": null, ...
{ "abstract": "Mycobacterium abscessus is a ubiquitous, saprophytic organism with low pathogenic potential. The authors describe the previously unreported clinical features of meningitis and native valve endocarditis caused by this rapidly growing atypical mycobacterium. The fatal outcome of this unusual case coincides with the grim prognosis of this disseminated infection and the significant mortality rate associated with neurologic complications of infective endocarditis.", "affiliations": "Comprehensive Stroke Center, University of Pennsylvania, Philadelphia 19104-4283, USA. davidliebeskind@yahoo.com", "authors": "Liebeskind|D S|DS|;Ostrzega|N|N|;Wasterlain|C G|CG|;Buttner|E A|EA|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1212/wnl.56.6.810", "fulltext": null, "fulltext_license": null, "issn_linking": "0028-3878", "issue": "56(6)", "journal": "Neurology", "keywords": null, "medline_ta": "Neurology", "mesh_terms": "D000328:Adult; D001921:Brain; D006801:Humans; D008279:Magnetic Resonance Imaging; D008297:Male; D009161:Mycobacterium; D009164:Mycobacterium Infections", "nlm_unique_id": "0401060", "other_id": null, "pages": "810-3", "pmc": null, "pmid": "11274327", "pubdate": "2001-03-27", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Neurologic manifestations of disseminated infection with Mycobacterium abscessus.", "title_normalized": "neurologic manifestations of disseminated infection with mycobacterium abscessus" }
[ { "companynumb": "US-PFIZER INC-2018175808", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "DIAZEPAM" }, "drugadditional": null, ...
{ "abstract": "Drug-induced thrombotic microangiopathies (DTMAs) are increasingly being recognized as an important category of thrombotic microangiopathies (TMAs). Cancer therapeutic agents including proteasome inhibitors (PIs) are among the most common medications reported to cause DTMA. PIs could cause DTMA either by an immune mechanism or dose-dependent/cumulative toxicity. Eleven cases of DTMA have been reported with bortezomib and carfilzomib. To the best of our knowledge, only one case of DTMA has been reported with ixazomib due to an immune-mediated mechanism. Here, we report the first case of ixazomib-induced DTMA due to cumulative toxicity rather than immune-mediated mechanism. In this article, we discuss the precipitating factors for cumulative toxicity of ixazomib, resulting in DTMA, diagnostic workup, and management of DTMA. We also discuss clinical reasoning based analysis of DTMA versus cancer-associated TMA as well as DTMA versus cyclic thrombocytopenia seen in PI use.", "affiliations": "Department of Medicine, Baystate-University of Massachusetts Medical School, Springfield, MA, USA.;Department of Medicine, Baystate-University of Massachusetts Medical School, Springfield, MA, USA.", "authors": "Atallah-Yunes|Suheil Albert|SA|0000-0003-3380-5326;Soe|Myat Han|MH|0000-0003-1380-0165", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1155/2018/7063145", "fulltext": "\n==== Front\nCase Rep HematolCase Rep HematolCRIHEMCase Reports in Hematology2090-65602090-6579Hindawi 10.1155/2018/7063145Case ReportDrug-Induced Thrombotic Microangiopathy due to Cumulative Toxicity of Ixazomib http://orcid.org/0000-0003-3380-5326Atallah-Yunes Suheil Albert http://orcid.org/0000-0003-1380-0165Soe Myat Han myathansoe@gmail.comDepartment of Medicine, Baystate–University of Massachusetts Medical School, Springfield, MA, USAAcademic Editor: Alessandro Gozzetti\n\n2018 3 7 2018 2018 70631451 5 2018 5 6 2018 Copyright © 2018 Suheil Albert Atallah-Yunes and Myat Han Soe.2018This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Drug-induced thrombotic microangiopathies (DTMAs) are increasingly being recognized as an important category of thrombotic microangiopathies (TMAs). Cancer therapeutic agents including proteasome inhibitors (PIs) are among the most common medications reported to cause DTMA. PIs could cause DTMA either by an immune mechanism or dose-dependent/cumulative toxicity. Eleven cases of DTMA have been reported with bortezomib and carfilzomib. To the best of our knowledge, only one case of DTMA has been reported with ixazomib due to an immune-mediated mechanism. Here, we report the first case of ixazomib-induced DTMA due to cumulative toxicity rather than immune-mediated mechanism. In this article, we discuss the precipitating factors for cumulative toxicity of ixazomib, resulting in DTMA, diagnostic workup, and management of DTMA. We also discuss clinical reasoning based analysis of DTMA versus cancer-associated TMA as well as DTMA versus cyclic thrombocytopenia seen in PI use.\n==== Body\n1. Introduction\nThrombotic microangiopathies are a group of disorders characterized by thrombocytopenia, microangiopathic hemolytic anemia, and ischemic end organ damage mostly involving the kidneys and brain caused by disseminated occlusive microvascular thrombosis [1]. TMA is well known to occur in the setting of thrombotic thrombocytopenic purpura (TTP) and hemolytic uremic syndrome (HUS). Other causes of TMA include atypical HUS, various malignancies, rheumatological diseases, and medications [1, 2]. TMA caused by malignancy has been mostly reported with adenocarcinomas metastasizing to bone marrow. Common solid tumors that have been linked to cancer-induced TMA include gastric, breast, lung, and prostate adenocarcinomas, with gastric adenocarcinoma being the most reported. It has also been reported with hematologic malignancies such as lymphoma and multiple myeloma [3]. TMA caused by drugs is called drug-induced TMA (DTMA) [4], and cancer therapeutic agents are among the most common medications reported to cause DTMA. Many cases of DTMA linked to bortezomib and carfilzomib have been reported [5]. Table 1 illustrates the most common cancer therapeutic agents known to cause DTMA, with the most common mechanism being either toxic or immune mediated or both [6–8].\n\nProteasomes are multicatalytic enzymatic complexes located in both nucleus and cytoplasm that aid in intracellular protein homeostasis by degradation and recycling of proteins [9]. They are an important target in the treatment of multiple myeloma as plasma cells producing paraproteins are highly dependent on these enzyme complexes for survival. PIs prevent degradation of proapoptotic factors and permit activation of programmed cell death in myeloma cells [10]. They also act by stabilization of nuclear factor kB (NF-kB) which ultimately decreases the proliferation of myeloma cells. Bortezomib and carfilzomib are the first and second generation PIs approved by FDA for treatment of multiple myeloma [11–14]. Side effects with these two PIs include gastrointestinal disturbances, peripheral neuropathy, and cyclic thrombocytopenia. The presence of a wide range of side effects and the emergence of chemoresistance required the introduction of newer generation of PIs with fewer side effects such as ixazomib.\n\nIxazomib is the third generation proteasome inhibitor used in the treatment of refractory or relapsing multiple myeloma in combination with dexamethasone and lenalidomide. It has less side effects and several advantages over bortezomib and carfilzomib [15]. Studies show that ixazomib is associated with less frequent and less severe peripheral neuropathy [16, 17]. Another advantage is that ixazomib could be administered orally [18]. The most common side effects reported with ixazomib are gastrointestinal disturbances including nausea, vomiting, diarrhea, and constipation [15].\n\nThrombocytopenia is also another commonly reported adverse effect as PIs interfere directly with the budding of megakaryocytes rather than causing direct damage to the bone marrow [19]. Thrombocytopenia commonly seen with PIs is called cyclic thrombocytopenia in which the platelet count usually nadirs around day 11 of the cycle and then improves. The decrease in the platelet count is rarely severe, and the platelet count usually nadirs to a minimum of 60% of baseline [19]. The literature also provides a strong evidence of PIs causing TMA in which thrombocytopenia is more severe and accompanied by intravascular hemolytic anemia and renal dysfunction. Clinicians should be familiar with this thrombocytopenia pattern and severity in order to differentiate between benign cyclic thrombocytopenia and TMA in the setting of PI use. When proven to be TMA, another challenge is to differentiate whether TMA is caused by the PI or the multiple myeloma itself as both are managed differently. It is crucial to be familiar with this very rare side effect of ixazomib and other PIs causing TMA, as the principle treatment is to stop the implicated medication [2]. To the best of our knowledge, only one case of immune-mediated DTMA caused by ixazomib has been reported [6]. Here, we report the first case of ixazomib-induced DTMA due to cumulative toxicity rather than immune-mediated mechanism.\n\n2. Case Description\nA 71-year-old female with multiple myeloma status after 5 cycles of ixazomib, lenalidomide, and dexamethasone, chronic kidney disease stage III, previous stroke, hypertension, gout, and peripheral arterial disease presented to the hospital with generalized weakness, vomiting, and diarrhea as well as acute on chronic kidney injury in which serum creatinine and creatinine clearance (CrCl) were 3.3 mg/dl and 15 ml/min, respectively (baseline creatinine of 1.9 mg/dl with CrCl of 30 ml/min). Blood test showed thrombocytopenia with a platelet count of 84000/dl and anemia with hemoglobin of 12 g/dl. Regarding multiple myeloma, she was diagnosed with kappa light chain multiple myeloma with extensive lytic lesions in bones as well as renal dysfunction a few years ago. Diagnosis was made by bone marrow biopsy which demonstrated 80%–90% cellular marrow with 61% plasma cells. FISH study was abnormal for chromosome 1q, chromosome 13q, and 17p deletion. Based on patient's average CrCl of 30 ml/min, ixazomib was started at a dose of 3 mg on days 1, 8, and 15 of a 28-day treatment cycle along with lenalidomide and dexamethasone. After the second cycle of ixazomib, the patient had been having intermittent GI disturbances including diarrhea, and biweekly blood test revealed thrombocytopenia with a nadir of about 75000/dl (Figure 1), which were both attributed to ixazomib. Ixazomib was held on admission due to significant vomiting, abdominal pain, and diarrhea. Clostridium difficile toxin and stool culture were negative, ruling out infectious causes. One week after admission, the platelet count decreased dramatically to 9000/dl from 84000/dl on admission. The patient also developed intravascular hemolysis evident by an elevated LDH level (1366 units/L), decreased haptoglobin level (10 mg/dl), elevated total bilirubin (1.6 mg/dl), and indirect bilirubin (1.3 mg/dl). Peripheral blood smear also showed profound schistocytes. Coomb's test was negative, and DIC was ruled out as the fibrinogen level was normal (521 mg/dl). Acute thrombocytopenia, Coomb's negative hemolytic anemia with profound schistocytes, and acute renal injury raised the concern for TMA. Given the high morbidity of TMA, the patient received fresh frozen plasma and underwent plasmapheresis while further workup was in progress. Normal ADAMTS13 activity ruled out TTP. Normal complement levels and negative stool culture made atypical HUS and HUS less likely. Plasmapheresis was stopped after 5 days due to lack of clinical improvement and negative workup for TTP. Approximately three weeks after the onset of TMA, the platelet count started to improve spontaneously with supportive management. The gradual and spontaneous improvement in the platelet count pointed suspicion away from malignancy-induced TMA and favored DTMA caused by cumulative toxicity of ixazomib, likely precipitated by acute renal dysfunction and hypoproteinemia from malnutrition and chronic diarrhea related to ixazomib side effect. The presentation of this patient was consistent with ixazomib-induced DTMA from cumulative toxicity as the clinical picture of TMA improved after stopping ixazomib, independently of plasmapheresis. Also, the lack of recurrence of TMA after stopping ixazomib supported the diagnosis in our case.\n\n3. Discussion\nIn the presence of possible offending medication, DTMA should be suspected in patients having acute onset thrombocytopenia, nonimmune intravascular hemolytic anemia with schistocytes and renal injury, with resolution of TMA after stopping the medication and ruling out other causes of TMA. Diagnosis of DTMA is supported if TMA reoccurs after reintroducing the drug. There is no specific time frame in which DTMA develops after introducing the medication. It could range from days to years after the initial dose [5].\n\nThe literature describes two main mechanisms causing DTMA which are immune-mediated and dose-dependent toxicity [5, 6, 20]. Immune-mediated reactions are also called idiosyncratic reactions as it involves the formation of reactive antibodies against drugs that cause damage to the endothelium leading to TMA [20]. DTMA due to an idiosyncratic reaction has been mostly reported with quinidine [21] and quetiapine [22]. However, DTMA occurring due to a toxic reaction is usually a dose-dependent toxicity, and results from either direct toxicity of the drug to microvasculature or inhibition of VEGF leading to endothelial damage [6, 20]. Most case reports linking DTMA to PIs favor immune-mediated mechanism as the cause of DTMA (Table 1) although drug-dependent antibodies were not documented.\n\nEleven cases of DTMA have been reported with bortezomib and carfilzomib [5]. To the best of our knowledge, it has been reported only once with ixazomib due to immune- mediated mechanism [6]. In this case report, we report the second case of DTMA caused by ixazomib. Contrary to the first case report, ixazomib-induced DTMA in our case is likely due to cumulative toxicity. Lack of improvement with plasmapheresis in our case makes immune-mediated mechanism less likely. According to pharmacokinetic data, 99% of ixazomib is plasma protein bound, and the mean area under the curve (AUC) could be 39% higher in patients with severe renal impairment (creatinine clearance <30 ml/min) [18]. We assume that severe renal impairment and hypoproteinemia (total protein: 4.9 g/dl; albumin: 2.4 g/dl) from persistent diarrhea and malnutrition might have precipitated the cumulative toxicity of ixazomib in our case.\n\nTMA could be also caused by malignancies including multiple myeloma [23, 24]. It is important to differentiate between cancer-related TMA and DTMA in cancer patients receiving chemotherapeutic agents such as in multiple myeloma patients receiving PIs. TMA caused by multiple myeloma is usually treated with chemotherapy including PIs. Previous case reports suggest that TMA caused by monoclonal gammopathy resolved with bortezomib. This contrasts with cases of DTMA caused by bortezomib in which TMA resolved after stopping the medication. In our case, paraproteins were close to the normal limit at the time of TMA occurrence. Hemolytic anemia and thrombocytopenia resolved after stopping ixazomib and never reoccurred after that, suggesting TMA was caused by ixazomib rather than multiple myeloma itself.\n\nOne of the most commonly reported side effects of ixazomib is thrombocytopenia [15]. It is also crucial to differentiate between cyclic thrombocytopenia and thrombocytopenia due to DTMA. In general, cyclic thrombocytopenia related to PIs is caused by a direct effect on megakaryocyte function and the platelet budding from bone marrow rather than direct damage to the bone marrow with a nadir platelet count at day 11 of the cycle and resolving just before the next cycle [19], as seen in this case (Figure 1). This coincides with the elimination half-life of ixazomib of 7.5 days [15]. Cyclic thrombocytopenia is rarely severe and usually does not require platelet transfusion. This contrasts to the dramatic thrombocytopenia seen in DTMA. In our case, the patient developed cyclic thrombocytopenia after introducing ixazomib with a nadir platelet count of 75000/dl which usually improved before the next cycle of chemotherapy. The dramatic decrease in the platelet count during this hospitalization raised the concern for DTMA especially in the presence of conclusive hemolysis workup with profound schistocytes and acute renal dysfunction.\n\nPathophysiology behind which PIs cause DTMA is still unclear. The most reported theory in the literature suggests that PIs stabilize and inhibit NF-kB which decreases the production of VEGF leading to microvascular injury. This theory supports cumulative dose-dependent toxicity of PIs. Other theories suggest that PIs act as proinflammatory agents leading to production of TNF and IL-6 which induce the production of autoantibodies against ADAMTS13 [6, 25]. However, the latter theory is unlikely to be the cause of DTMA in our case as our patient had normal levels of ADAMTS13, and also platelet count did not improve with plasmapheresis. Current data report more cases of DTMA with carfilzomib than bortezomib, as carfilzomib irreversibly inhibits proteasomes while bortezomib causes reversible inhibition of proteasomes [20]. The only treatment of DTMA is immediate withdrawal of the implicated agent [2]. In our case, thrombocytopenia did not improve despite 5 days of plasmapheresis. It improved independently about 20 days after stopping ixazomib, which reflects approximately three elimination half-lives of ixazomib. Outpatient records showed that the patient never developed TMA after stopping ixazomib.\n\nThe question of whether to reintroduce PIs after causing DTMA depends on the mechanism of DTMA. If DTMA is caused by immune-mediated mechanism, the implicated PI should never be reintroduced again, even with lower doses. However, if DTMA is mediated by dose-dependent cumulative toxicity as in our case, it could be reintroduced with caution. The decision must balance the potential risk of recurrent DTMA and the potential benefits of restarting the medication [26]. Based on our experience from this case, medication dosage, renal function, and total protein/albumin levels should also be taken into consideration in the decision-making process. After the resolution of DTMA, our patient has regular follow-up visits every two months for a year till now. Her blood counts have been stable and paraproteins have not been elevated, indicating nonprogressive disease. Hence, ixazomib is not reintroduced again.\n\n4. Conclusion\nDTMA is a very rare side effect of PIs. Ixazomib is indicated in the treatment of refractory and relapsing multiple myeloma. DTMA due to ixazomib should be suspected in the setting of TMA occurring after introducing ixazomib with no evidence of other causes of TMA. The literature reported only one case of ixazomib-induced DTMA due to immune-mediated mechanism, whereas this case highlights the cumulative toxicity of ixazomib causing DTMA. Clinicians should pay attention to changes in renal function, nutrition status, and total protein/albumin level in addition to side effect profile in the management of patients being treated with PIs to prevent cumulative toxicity which could lead to DTMA. It is also important to differentiate DTMA from malignancy-induced TMA especially in multiple myeloma patients treated with PIs such as ixazomib, as both are treated differently.\n\nConflicts of Interest\nThe authors declare that they have no conflicts of interest.\n\nFigure 1 Cyclic thrombocytopenia in relation to cycles of ixazomib indicated by orange arrows (I1–I5) and the onset of DTMA indicated by green arrow.\n\nTable 1 Common anticancer chemotherapeutic agents causing drug-induced thrombotic microangiopathy via immune-mediated mechanism or dose-dependent toxicity or both [4, 7].\n\nCancer therapeutic agent\tImmune-mediated mechanism\tDose-dependent toxicity\t\nBevacizumab\t—\tX\t\nBortezomib\tX\t—\t\nCarfilzomib\tX\t—\t\nIxazomib\tX\t—\t\nGemcitabine\tX\tX\t\nMitomycin\t—\tX\t\nOxaliplatin\tX\t—\t\nPentostatin\t—\tX\t\nSunitinib\t—\tX\t\nImatinib\tX\t—\t\nDocetaxel\t—\tX\n==== Refs\n1 Lodhi A. Kumar A. Saqlain M. U. Thrombotic microangiopathy associated with proteasome inhibitors Clinical Kidney Journal 2015 8 5 632 636 10.1093/ckj/sfv059 2-s2.0-84954039367 26413293 \n2 George J. N. Nester C. M. Syndromes of thrombotic microangiopathy New England Journal of Medicine 2014 371 7 654 666 10.1056/nejmra1312353 2-s2.0-84906077328 25119611 \n3 Lechner K. Obermeier H. L. Cancer-related microangiopathic hemolytic anemia: clinical and laboratory features in 168 reported cases Medicine 2012 91 4 195 205 10.1097/MD.0b013e3182603598 2-s2.0-84863719861 22732949 \n4 Reese J. A. Bougie D. W. Curtis B. R. Drug induced thrombotic microangiopathy: experience of the Oklahoma registry and the blood center of Wisconsin American Journal of Hematology 2015 90 5 406 410 10.1002/ajh.23960 2-s2.0-84928297740 25639727 \n5 Yui J. C. Van K. J. Weiss B. M. Proteasome inhibitor associated thrombotic microangiopathy American Journal of Hematology 2016 91 9 E348 E352 10.1002/ajh.24447 2-s2.0-84983060381 27286661 \n6 Yui J. C. Dispenzieri A. Leung N. Ixazomib-induced thrombotic microangiopathy American Journal of Hematology 2017 92 4 E53 E55 10.1002/ajh.24662 2-s2.0-85013829791 28133842 \n7 Al-Nouri Z. L. Reese J. A. Terrell D. R. Drug-induced thrombotic microangiopathy: a systematic review of published reports Blood 2015 125 4 616 618 10.1182/blood-2014-11-611335 2-s2.0-84921646968 25414441 \n8 George J. N. Platelets on the Web http://www.ouhsc.edu/platelets/ \n9 Thrower J. S. Hoffman L. Rechsteiner M. Pickart C. M. Recognition of the polyubiquitin proteolytic signal EMBO Journal 2000 19 1 94 102 10.1093/emboj/19.1.94 10619848 \n10 Gelman J. S. Sironi J. Berezniuk I. Alterations of the intracellular peptidome in response to the proteasome inhibitor bortezomib PLoS One 2013 8 1 e53263 10.1371/journal.pone.0053263 2-s2.0-84872122278 \n11 Richardson P. G. Sonneveld P. Schuster M. W. Bortezomib or high-dose dexamethasone for relapsed multiple myeloma New England Journal of Medicine 2005 352 24 2487 2498 10.1056/nejmoa043445 2-s2.0-20444433230 15958804 \n12 Richardson P. G. Barlogie B. Berenson J. A phase 2 study of bortezomib in relapsed, refractory myeloma New England Journal of Medicine 2003 348 26 2609 2617 10.1056/nejmoa030288 2-s2.0-0037973279 12826635 \n13 Vij R. Siegel D. S. Jagannath S. An openlabel, single-arm, phase 2 study of single-agent carfilzomib in patients with relapsed and/or refractory multiple myeloma who have been previously treated with bortezomib British Journal of Haematology 2012 158 6 739 748 10.1111/j.1365-2141.2012.09232.x 2-s2.0-84865552564 22845873 \n14 Siegel D. S. Martin T. Wang M. A phase 2 study of single-agent carfilzomib (PX-171-003A1) in patients with relapsed and refractory multiple myeloma Blood 2012 120 14 2817 2825 10.1182/blood-2012-05-425934 2-s2.0-84867295563 22833546 \n15 Richardson P. G. Baz R. Wang M. Phase 1 study of twice-weekly ixazomib, an oral proteasome inhibitor, in relapsed/refractory multiple myeloma patients Blood 2014 124 7 1038 1046 10.1182/blood-2014-01-548826 2-s2.0-84905962613 24920586 \n16 Chauhan D. Tian Z. Zhou B. In vitro and in vivo selective antitumor activity of a novel orally bioavailable proteasome inhibitor MLN9708 against multiple myeloma cells Clinical Cancer Research 2011 17 16 5311 5321 10.1158/1078-0432.ccr-11-0476 2-s2.0-80051691845 21724551 \n17 Richardson P. G. Baz R. Wang L. Investigational agent MLN9708, an oral proteasome inhibitor, in patients (Pts) with relapsed and/or refractory multiple myeloma (MM): results from the expansion cohorts of a phase 1 dose-escalation study Blood 2011 118 21 p. 140 \n18 Ninlaro, ixazomib Prescribing Information 2016 Cambridge, MA, USA Takeda Pharmaceutical Company Limited \n19 Lonial S. Waller E. K. Richardson P. G. Risk factors and kinetics of thrombocytopenia associated with bortezomib for relapsed, refractory multiple myeloma Blood 2005 106 12 3777 84 10.1182/blood-2005-03-1173 2-s2.0-28444436266 16099887 \n20 Edwards I. R. Aronson J. K. Adverse drug reactions: definitions, diagnosis, and management Lancet 2000 356 9237 1255 1259 10.1016/s0140-6736(00)02799-9 2-s2.0-0034619028 11072960 \n21 Kojouri K. Vesely S. K. George J. N. Quinine-associated thrombotic thrombocytopenic purpura–hemolytic uremic syndrome: frequency, clinical features, and long-term outcomes Annals of Internal Medicine 2001 135 12 1047 1051 10.7326/0003-4819-135-12-200112180-00008 11747383 \n22 Huynh M. Chee K. Lau D. H. M. Thrombotic thrombocytopenic purpura associated with quetiapine Annals of Pharmacotherapy 2005 39 7-8 1346 1348 10.1345/aph.1g067 2-s2.0-21744436488 15914516 \n23 Xiao X. Zhong H. Y. Zhang G. S. Deng M.-Y. Thrombotic thrombocytopenic purpura as initial and major presentation of multiple myeloma Journal of Thrombosis and Thrombolysis 2013 36 4 422 423 10.1007/s11239-013-0893-0 2-s2.0-84889083636 23397497 \n24 Yao H. Monge M. Renou M. Thrombotic thrombocytopenic purpura due to anti-ADAMTS13 antibodies in multiple myeloma Clinical Nephrology 2014 81 3 210 215 10.5414/cn107579 2-s2.0-84894050393 23073062 \n25 Moore H. Romeril K. Multiple myeloma presenting with a fever of unknown origin and development of thrombotic thrombocytopenic purpura post-bortezomib Internal Medicine Journal 2011 41 4 348 350 10.1111/j.1445-5994.2011.02458.x 2-s2.0-79955040869 21507163 \n26 George J. N. Cuker A. Drug Induced Thrombotic Microangiopathy 2017 Waltham, MA, USA Uptodate\n\n", "fulltext_license": "CC BY", "issn_linking": "2090-6579", "issue": "2018()", "journal": "Case reports in hematology", "keywords": null, "medline_ta": "Case Rep Hematol", "mesh_terms": null, "nlm_unique_id": "101576456", "other_id": null, "pages": "7063145", "pmc": null, "pmid": "30057831", "pubdate": "2018", "publication_types": "D002363:Case Reports", "references": "28133842;22833546;24920586;26413293;22732949;11747383;21724551;23308178;25639727;22845873;27286661;10619848;12826635;15914516;23397497;25414441;25119611;16099887;23073062;15958804;11072960;21507163", "title": "Drug-Induced Thrombotic Microangiopathy due to Cumulative Toxicity of Ixazomib.", "title_normalized": "drug induced thrombotic microangiopathy due to cumulative toxicity of ixazomib" }
[ { "companynumb": "US-TAKEDA-2018MPI010374", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "LENALIDOMIDE" }, "drugadditional": "3", ...
{ "abstract": "BACKGROUND\nMetformin is considered a first choice for oral treatment of patients with type 2 diabetes in the absence of contraindications. Colorectal cancer is the second most frequent cancer among the general population; low anterior resections and temporary diverting ileostomies are commonly performed in this population. As the incidence of type 2 diabetes increases, the use of metformin in patients with both type 2 diabetes and an ileostomy will most likely increase as well.\n\n\nMETHODS\nWe present the case of a patient affected by colorectal cancer who developed a severe metformin-associated lactic acidosis (MALA) after creation of a temporary ileostomy to protect a low colorectal anastomosis. High-volume output from his ileostomy led to significant fluid loss and electrolyte imbalance, his condition was complicated by MALA, resulting in death.\n\n\nCONCLUSIONS\nThe population of ileostomy patients who also have type 2 diabetic and taking metformin is at risk for MALA. High stomal output can lead to dehydration, with a loss of fluids and electrolytes and metformin could aggravate this condition, potentiating the risk of MALA.", "affiliations": "Flavio Tirelli, MD, General Surgery Unit, Department of Surgery, \"A. Gemelli\" Foundation Policlinic Universitary, Catholic University of Rome, Rome, Italy. Alberto Biondi, MD, General Surgery Unit, Department of Surgery, \"A. Gemelli\" Foundation Policlinic Universitary, Catholic University of Rome, Rome, Italy. Roberto Persiani, MD, General Surgery Unit, Department of Surgery, \"A. Gemelli\" Foundation Policlinic Universitary, Catholic University of Rome, Rome, Italy.", "authors": "Tirelli|Flavio|F|;Biondi|Alberto|A|;Persiani|Roberto|R|", "chemical_list": "D008687:Metformin", "country": "United States", "delete": false, "doi": "10.1097/WON.0000000000000447", "fulltext": null, "fulltext_license": null, "issn_linking": "1071-5754", "issue": "45(4)", "journal": "Journal of wound, ostomy, and continence nursing : official publication of The Wound, Ostomy and Continence Nurses Society", "keywords": null, "medline_ta": "J Wound Ostomy Continence Nurs", "mesh_terms": "D000140:Acidosis, Lactic; D000369:Aged, 80 and over; D015179:Colorectal Neoplasms; D006801:Humans; D007081:Ileostomy; D015994:Incidence; D008297:Male; D008687:Metformin; D012307:Risk Factors", "nlm_unique_id": "9435679", "other_id": null, "pages": "364-365", "pmc": null, "pmid": "29846279", "pubdate": "2018", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Fatal Case of Metformin-Associated Lactic Acidosis Associated With Temporary Ileostomy: A Case Report.", "title_normalized": "fatal case of metformin associated lactic acidosis associated with temporary ileostomy a case report" }
[ { "companynumb": "IT-TEVA-2019-IT-1007343", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "ACARBOSE" }, "drugadditional": null, ...
{ "abstract": "Full-thickness macular hole (FTMH) formation in Polypoidal choroidal vasculopathy (PCV) after intravitreal anti-vascular endothelial growth factor (anti-VEGF) treatment is a rare complication. Spontaneous closure of FTMH following anti-VEGF therapy has not been described in PCV till date. We present a case of Asian woman with PCV who developed a FTMH following treatment with intra-vitreal anti-VEGF injections which subsequently closed spontaneously on further course of treatment.", "affiliations": "Department of Vitreo-Retina, Giridhar Eye Institute, Ernakulam, Kochi, Kerala, India.;Department of Vitreo-Retina, Giridhar Eye Institute, Ernakulam, Kochi, Kerala, India.;Department of Vitreo-Retina, Giridhar Eye Institute, Ernakulam, Kochi, Kerala, India.;Department of Vitreo-Retina, Giridhar Eye Institute, Ernakulam, Kochi, Kerala, India.", "authors": "Sethia|Abhishek|A|;Sheth|Jay|J|;Gopalakrishnan|Mahesh|M|;Anantharaman|Giridhar|G|", "chemical_list": "D020533:Angiogenesis Inhibitors; D000068258:Bevacizumab; D040262:Receptors, Vascular Endothelial Growth Factor", "country": "India", "delete": false, "doi": "10.4103/ijo.IJO_1597_18", "fulltext": "\n==== Front\nIndian J OphthalmolIndian J OphthalmolIJOIndian Journal of Ophthalmology0301-47381998-3689Wolters Kluwer - Medknow India 31546555IJO-67-175610.4103/ijo.IJO_1597_18Case ReportsSpontaneous formation and closure of full thickness macular hole after treatment with anti-vascular endothelial growth factor therapy in polypoidal choroidal vasculopathy Sethia Abhishek Sheth Jay Gopalakrishnan Mahesh Anantharaman Giridhar Department of Vitreo-Retina, Giridhar Eye Institute, Ernakulam, Kochi, Kerala, IndiaCorrespondence to: Dr. Abhishek Sethia, Bothra Chowk, New Lane, Gangashahar, Bikaner - 334 401, Rajasthan, India. E-mail: dr.abhishekjain29@gmail.com10 2019 67 10 1756 1758 21 9 2018 16 4 2019 Copyright: © 2019 Indian Journal of Ophthalmology2019This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.Full-thickness macular hole (FTMH) formation in Polypoidal choroidal vasculopathy (PCV) after intravitreal anti-vascular endothelial growth factor (anti-VEGF) treatment is a rare complication. Spontaneous closure of FTMH following anti-VEGF therapy has not been described in PCV till date. We present a case of Asian woman with PCV who developed a FTMH following treatment with intra-vitreal anti-VEGF injections which subsequently closed spontaneously on further course of treatment.\n\nFull-thickness macular holeintra-vitreal anti-vascular endothelial growth factorpolypoidal choroidal vasculopathy\n==== Body\nPolypoidal choroidal vasculopathy (PCV), is a distinctive form of choroidal neovascular membrane (CNVM) seen commonly in Asian population. It preferentially presents as multiple recurrent serosanguinous detachments of neurosensory retina and is characterized by a branching vascular network terminating in polyp-like lesions beneath the retinal pigment epithelium (RPE).[1]\n\nSpontaneous massive sub-macular hemorrhage (SMH) from rupture of thin walled choroidal vessel is not an infrequent presentation of PCV, requiring intravitreal anti-vascular endothelial growth factor (anti-VEGF) therapy with or without intra-vitreal gas injection and tissue plasminogen activator (tPA).[2] Management of PCV with anti-VEGF therapy is associated with complications such as RPE rips and rarely full thickness macular hole (FTMH) development.[3] We present a rare case of Asian woman with PCV who developed a FTMH following treatment with intra-vitreal anti-VEGF injections and which subsequently closed spontaneously on further course of treatment with anti-VEGF.\n\nCase Report\nA 63-year-old pseudophakic female of Asian origin presented with sudden loss of vision in left eye (LE) for 3 days (CF 2M) and long standing decreased vision (HM+) in right eye (RE). Fundus examination showed scarred CNVM in RE with presence of significant exudative maculopathy and nasal exudative detachment in LE [Fig. 1a]. A provisional diagnosis of PCV was made and she underwent two monthly injection of intra-vitreal bevacizumab (IVB) in LE. Complete resolution of sub-retinal fluid [Fig. 1c and d] was noted at two months with improvement in BCVA to 6/18. She underwent an ICGA [Fig. 1b], which confirmed the diagnosis of PCV with an abnormal branching vascular network (BVN) and focal laser was performed for extrafoveal polyps. At 28 months from baseline, she presented with SMH [Fig. 2a] and drop in BCVA to 6/24. Spectral domain-optical coherence tomography (SD-OCT) shows hemorrhagic notched pigment epithelial detachment (PED), hyper-reflective shallow-irregular PED (Double-layer sign; DLS) and lamellar macular hole (LMH) [Fig. 3a]. Following this she received monthly injection of IVB. After second dose of IVB, her BCVA dropped to 6/36. On SD-OCT, there was a reduction in height of PED, resolution of sub-retinal fluid (SRF), but the LMH was converted into a FTMH [Figs. 2b and 3b]. Subsequently, she was periodically observed, and was noted to have recurrence of hemorrhagic PED [Fig. 3c] at 41 months from baseline for which she underwent two more monthly injection of IVB. Following this, her BCVA was maintained at 6/36, with resolution of hemorrhage clinically and presence of trace SRF on SD-OCT. Furthermore, we also observed spontaneous closure of the FTMH [Figs. 2c and 3d].\n\nFigure 1 (a) Color photograph (baseline) showing exudative changes at inferior and nasal retina (b) ICGA Shows Cluster of nodular polyp nasal to disc at peripapillary area (yellow arrow) with large branch vascular network (red arrow). (c) SD-OCT at foveal sections how sub macular detachment (yellow arrow) which resolved after treatment with anti-VEGF (d)\n\nFigure 2 (a) Color photograph (28 months) shows appearance of hemorrhage at macula (yellow arrow). (b) After treatment with anti-VEGF complete resolution of hemorrhage with formation of full thickness macular hole. (c) After 2 more anti-VEGF closure of FTMH occurs at final follow-up\n\nFigure 3 (a) SD-OCT at foveal section (28 month) showing large hemorrhagic notched PED (yellow arrow) nasal to fovea, sub retinal hyper reflectivity (pink arrow), SRF (blue arrow) with LMH (red arrow). (b) Decrease in height of hemorrhagic PED, resolution of sub retinal hyperreflectivity and SRF with conversion of LMH into FTMH (red arrow) after anti-VEGF treatment. (c) Increase in height of PED, reappearance of sub retina hyper reflectivity, SRF and IRF during follow-up (41 months). (d) With further treatment, spontaneous closure of FTMH (red arrow) with thin ERM, persistence of FVPED and trace SRF at foveal section\n\nDiscussion\nThe choice of treatment in PCV depends on location of the polypoidal network, extent of network and associated clinical features, which primarily involves intra-vitreal anti-VEGF therapy with or without photodynamic therapy and thermal laser.[1] We present a rare case of Asian woman having PCV who developed a FTMH following treatment with intravitreal anti-VEGF injections which spontaneously closed on further course of treatment with anti-VEGF.\n\nVEGF is significantly increased in eyes with PCV[4] and treatment with intra-vitreal anti-VEGF has been the standard treatment of choroidal neovascularization (CNV) secondary to age-related macular degeneration (ARMD) as well as PCV.[5] So the same treatment has been used in our case to treat exudative maculopathy and SMH due to PCV.\n\nBaskaran P et al. reported that SMH can damage the relatively thin fovea resulting in atrophy, or very rarely, development of FTMH. The presence of blood at base of MH, bridge of remnant retinal tissue, and break through vitreous hemorrhage are indirect evidence for that.[2] MH development following subretinal hemorrhage in ruptured retinal arterial macroaneurysm (RAM) was reported by Sagara N et al.[6] MH formation after SMH has been reported in a 75-year-old female with ARMD.[7] All above studies support that presence of SMH can cause FTMH as seen in our case.\n\nHowever, Cho JH et al. have reported MH following intra-vitreal Ranibizumab in PCV.[4] Although macular hole is not a complication of PCV itself, it is likely to be because of interactions between the neovascular tissue complex and anti-VEGF agents. Anti-VEGF agents may cause formation of macular hole by modulating the activity of the choroidal neovascularization and inducing contraction of the vascular membrane, leading to exacerbation of the tangential traction on the overlying retina.[8] Raiji VR et al. have also reported FTMH development overlying PED after treatment with anti-VEGF agent and have suggested pushing or stretching forces of choroidal neovascular complex as an additional mechanism for MH development.[9] Thus, shearing force associated with contraction of the polypoidal choroidal vessels and decrease in height of PED after anti-VEGF on the overlying retina might also influence the development of the MH in our case.\n\nHence, MH seems to be potential rare sequelae after intra-vitreal anti-VEGF injection and should be suspected for patients who do not show an improvement or who worsen after intra-vitreal anti-VEGF therapy.\n\nAdditionally, changes in PED and centripetal contraction of thin ERM after anti-VEGF therapy seemed to release the mechanical stress on the retina. This can potentially allow approximation of the MH edges and closure of the hole in our case report. Storch MW et al. reported a case of MH closure after intra-vitreal Bevacizumab therapy for an underlying PED due to exudative AMD.[10] Spontaneous closure of FTMH in PCV has not been described in literature.\n\nIn conclusion our case report is complementary to Cho et al., describing FTMH development following intra-vitreal Ranibizumab therapy in PCV. In addition, our case report is unique since it describes development of FTMH following intra-vitreal Bevacizumab for the first time in literature. Furthermore, this is a singular case to illustrate spontaneous formation as well as spontaneous closure of FTMH secondary to intra-vitreal anti-VEGF therapy for PCV.\n\nDeclaration of patient consent\nThe authors certify that they have obtained all appropriate patient consent forms. In the form the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.\n\nFinancial support and sponsorship\nNil.\n\nConflicts of interest\nThere are no conflicts of interest.\n==== Refs\n1 Anantharaman G Sheth J Bhende M Narayanan R Natarajan S Rajendran A Polypoidal choroidal vasculopathy: Pearls in diagnosis and management Indian J Ophthalmol 2018 66 896 908 29941728 \n2 Baskaran P Pan U Macular hole secondary to polypoidal choroidal vasculopathy Middle East Afr J Ophthalmol 2017 24 159 61 29279658 \n3 Oshima Y Apte RS Nakao S Yoshida S Ishibashi T Full thickness macular hole case after intravitreal aflibercept treatment BMC Ophthalmol 2015 15 30 25881212 \n4 Cho JH Park SE Han JR Kim HK Nam WH Macular hole after intra- vitreal ranibizumab injection for polypoidal choroidal vasculopathy Clin Exp Optom 2011 94 586 8 21517972 \n5 Rosenfeld PJ Brown DM Heier JS Boyer DS Kaiser PK Chung CY Ranibizumab for neovascular age-related macular degeneration N Engl J Med 2006 355 1419 31 17021318 \n6 Sagara N Kawaji T Koshiyama Y Inomata Y Fukushima M Tanihara H Macular hole formation after macular haemorrhage associated with rupture of retinal arterial macroaneurysm Br J Ophthalmol 2009 93 1337 40 19520697 \n7 Wan MJ Sheidow TG Macular hole secondary to a sub retinal hemorrhage Retin Cases Brief Rep 2009 3 86 8 25390850 \n8 Querques G Souied EH Soubrane G Macular hole following intra-vitreal ranibizumab injection for choroidal neovascular membrane caused by age-related macular degeneration Acta Ophthalmol 2009 87 235 7 \n9 Raiji VR Eliott D Sadda SR Macular hole overlying pigment epithelial detachment after intravitreal injection with ranibizumab Retin Cases Brief Rep 2013 7 91 4 25390533 \n10 Storch MW Hoerauf H Case report of a secondary macular hole closure after intra-vitreal bevacizumab therapy in a patient with retinal pigment epithelial detachment Indian J Ophthalmol 2017 65 632 3 28724829\n\n", "fulltext_license": "CC BY-NC-SA", "issn_linking": "0301-4738", "issue": "67(10)", "journal": "Indian journal of ophthalmology", "keywords": "Full-thickness macular hole; intra-vitreal anti-vascular endothelial growth factor; polypoidal choroidal vasculopathy", "medline_ta": "Indian J Ophthalmol", "mesh_terms": "D020533:Angiogenesis Inhibitors; D000068258:Bevacizumab; D002829:Choroid; D015862:Choroid Diseases; D005260:Female; D005451:Fluorescein Angiography; D005654:Fundus Oculi; D006801:Humans; D058449:Intravitreal Injections; D008875:Middle Aged; D011127:Polyps; D040262:Receptors, Vascular Endothelial Growth Factor; D012075:Remission, Spontaneous; D012167:Retinal Perforations; D041623:Tomography, Optical Coherence", "nlm_unique_id": "0405376", "other_id": null, "pages": "1756-1758", "pmc": null, "pmid": "31546555", "pubdate": "2019-10", "publication_types": "D002363:Case Reports", "references": "17021318;29941728;25390533;21517972;19292858;29279658;25390850;28724829;25881212;19520697", "title": "Spontaneous formation and closure of full thickness macular hole after treatment with anti-vascular endothelial growth factor therapy in polypoidal choroidal vasculopathy.", "title_normalized": "spontaneous formation and closure of full thickness macular hole after treatment with anti vascular endothelial growth factor therapy in polypoidal choroidal vasculopathy" }
[ { "companynumb": "IN-ROCHE-2617090", "fulfillexpeditecriteria": "1", "occurcountry": "IN", "patient": { "drug": [ { "actiondrug": "4", "activesubstance": { "activesubstancename": "BEVACIZUMAB" }, "drugadditional": null, "dru...
{ "abstract": "Little is known about hepatotoxicity associated with valproic acid (VPA), a widely used substance in neuropsychiatry.All reported cases to the German Federal Institute for Drugs and Medical Devices between 1993 and 2009 of VPA-induced serious hepatic side effects were evaluated.A total of 132 cases of serious VPA-associated liver failure were identified. Approximately one third (34.8%) occurred under VPA monotherapy, while the majority was seen with VPA plus co-medication, most frequently antiepileptics (34.8%) and benzodiazepines (16.7%). A subgroup of 34 cases (25.8%) had a fatal outcome, the largest number reported to date. Of these, 32.4% were under VPA monotherapy and 67.6% under VPA plus concomitant medication. Within the study period a significant increase in the total number of reported cases and the subgroup of fatal cases was found.This first pharmacovigilance study of VPA-associated liver failure indicates a higher rate of non-fatal and fatal liver failure when VPA is given with co-medication as compared to monotherapy. However, co-medication per se does not increase the risk of fatalities.", "affiliations": "Department of Psychiatry and Psychotherapy III, University of Ulm, Ulm, Germany. markus.schmid@uni-ulm.de", "authors": "Schmid|M M|MM|;Freudenmann|R W|RW|;Keller|F|F|;Connemann|B J|BJ|;Hiemke|C|C|;Gahr|M|M|;Kratzer|W|W|;Fuchs|M|M|;Schönfeldt-Lecuona|C|C|", "chemical_list": "D000927:Anticonvulsants; D001569:Benzodiazepines; D014635:Valproic Acid", "country": "Germany", "delete": false, "doi": "10.1055/s-0032-1323671", "fulltext": null, "fulltext_license": null, "issn_linking": "0176-3679", "issue": "46(2)", "journal": "Pharmacopsychiatry", "keywords": null, "medline_ta": "Pharmacopsychiatry", "mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000927:Anticonvulsants; D001569:Benzodiazepines; D056486:Chemical and Drug Induced Liver Injury; D002648:Child; D002675:Child, Preschool; D004359:Drug Therapy, Combination; D005260:Female; D005858:Germany; D006801:Humans; D007223:Infant; D008297:Male; D008875:Middle Aged; D060735:Pharmacovigilance; D014635:Valproic Acid", "nlm_unique_id": "8402938", "other_id": null, "pages": "63-8", "pmc": null, "pmid": "22915484", "pubdate": "2013-03", "publication_types": "D016428:Journal Article", "references": null, "title": "Non-fatal and fatal liver failure associated with valproic acid.", "title_normalized": "non fatal and fatal liver failure associated with valproic acid" }
[ { "companynumb": "DE-MYLANLABS-2014S1014050", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "VALPROIC ACID" }, "drugadditional": null, ...
{ "abstract": "We present the case of a woman who was found to have severe hypercalcaemia, staghorn calculus formation and renal impairment from the long-standing ingestion of calcium carbonate antacids from a supermarket outlet. The dosage was reported to be approximately 1,800 mg of elemental calcium each day which would constitute only a marginal increase on the recommended intake for daily elemental calcium. Furthermore, she was concomitantly taking a prescribed anti-hypertensive medication that may have exacerbated the hypercalcaemia and subsequent renal calcification. While calcium-alkali syndrome is well documented, it can be overlooked by clinicians as the predominant cause of hypercalcaemia, especially if a thorough drug history is not actively sought. This is particularly important as calcium carbonate products are increasingly being purchased as over-the-counter remedies for dyspepsia management as well as osteoporosis prevention. Explicit product labelling regarding limiting duration usage, potential drug interactions and risk of calcification is therefore recommended.", "affiliations": "Good Hope Hospital, Sutton Coldfield, UK a.maarouf@nhs.net.;Good Hope Hospital, Sutton Coldfield, UK.", "authors": "Maarouf|Amro|A|;Jones|Sharon|S|", "chemical_list": "D000468:Alkalies; D000863:Antacids; D002119:Calcium Carbonate; D002118:Calcium", "country": "England", "delete": false, "doi": "10.7861/clinmed.2020-0208", "fulltext": null, "fulltext_license": null, "issn_linking": "1470-2118", "issue": "20(4)", "journal": "Clinical medicine (London, England)", "keywords": "Hypercalcaemia; alkalosis; antacids; calcium-alkali syndrome; calculus", "medline_ta": "Clin Med (Lond)", "mesh_terms": "D000468:Alkalies; D000863:Antacids; D002118:Calcium; D002119:Calcium Carbonate; D005260:Female; D006801:Humans; D006934:Hypercalcemia", "nlm_unique_id": "101092853", "other_id": null, "pages": "e129-e130", "pmc": null, "pmid": "32675162", "pubdate": "2020-07", "publication_types": "D016428:Journal Article", "references": "19252114;21170875;12513010;15825066;24288027", "title": "Lessons of the month: Over-the-counter antacids causing hypercalcaemia: The emergence of calcium-alkali syndrome.", "title_normalized": "lessons of the month over the counter antacids causing hypercalcaemia the emergence of calcium alkali syndrome" }
[ { "companynumb": "GB-MICRO LABS LIMITED-ML2020-02392", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "CALCIUM CARBONATE" }, "drugadditiona...
{ "abstract": "Patients with coccidioidal meningitis require lifelong antifungal therapy. Cumulative toxicity and lack of antifungal efficacy require salvage therapy in the treatment of some patients. In a retrospective review of nine patients with coccidioidal meningitis treated with isavuconazole, successful therapy was seen in three patients and stable disease was confirmed in six patients. Isavuconazole may be a useful addition to the therapeutic choices currently available for coccidioidal meningitis.", "affiliations": "Kern County Medical Center, Bakersfield, California, USA.;Kern County Medical Center, Bakersfield, California, USA.;Department of Internal Medicine, University of California Davis Medical Center, Sacramento, California, USA.;Sutter Medical Center, Sacramento, California, USA.;Department of Internal Medicine, Division of Infectious Diseases, University of California San Francisco-Fresno, Fresno, California, USA.;Department of Internal Medicine, Division of Infectious Diseases, University of California San Francisco-Fresno, Fresno, California, USA.;Department of Pharmacy, University of California Davis Medical Center, Sacramento, California, USA.;Department of Internal Medicine, Division of Infectious Diseases, University of California Davis Medical Center, Sacramento, California, USA.;Department of Medical Microbiology and Immunology, University of California Davis, Davis, California, USA.;Kern County Medical Center, Bakersfield, California, USA.;Department of Internal Medicine, Division of Infectious Diseases, University of California Davis Medical Center, Sacramento, California, USA grthompson@ucdavis.edu.", "authors": "Heidari|Arash|A|;Quinlan|Miriam|M|;Benjamin|David J|DJ|;Laurence|Brett|B|;Mu|Anandit|A|;Ngai|Tiffany|T|;Hoffman|Wes J|WJ|;Cohen|Stuart H|SH|;McHardy|Ian|I|0000-0002-2121-5460;Johnson|Royce|R|;Thompson|George R|GR|", "chemical_list": "D000935:Antifungal Agents; D009570:Nitriles; D011725:Pyridines; D014230:Triazoles; C508735:isavuconazole", "country": "United States", "delete": false, "doi": "10.1128/AAC.02232-18", "fulltext": null, "fulltext_license": null, "issn_linking": "0066-4804", "issue": "63(3)", "journal": "Antimicrobial agents and chemotherapy", "keywords": "coccidioides; isavuconazole; meningitis", "medline_ta": "Antimicrob Agents Chemother", "mesh_terms": "D000328:Adult; D000935:Antifungal Agents; D003047:Coccidioidomycosis; D005260:Female; D006801:Humans; D008297:Male; D016921:Meningitis, Fungal; D008875:Middle Aged; D009570:Nitriles; D011725:Pyridines; D012189:Retrospective Studies; D016896:Treatment Outcome; D014230:Triazoles", "nlm_unique_id": "0315061", "other_id": null, "pages": null, "pmc": null, "pmid": "30559134", "pubdate": "2019-03", "publication_types": "D016428:Journal Article", "references": "26739609;22005993;19101837;22045955;20524153;29340909;20827104;19139290;24963554;30289478;8554225;27927853;30257902;27470238;23717579;24046296;27324761;7625624;27169478;8498760;26969258;26684607", "title": "Isavuconazole in the Treatment of Coccidioidal Meningitis.", "title_normalized": "isavuconazole in the treatment of coccidioidal meningitis" }
[ { "companynumb": "US-DRREDDYS-USA/USA/19/0109260", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "FLUCONAZOLE" }, "drugadditional": "1", ...
{ "abstract": "We describe a patient in whom long-term, therapeutic infusion of the selective gamma-amino-butyric acid type B (GABAB) receptor agonist, baclofen, into the cerebrospinal fluid (CSF) gave rise to three distinct varieties of memory impairment: i) repeated, short periods of severe global amnesia, ii) accelerated long-term forgetting (ALF), evident over intervals of days and iii) a loss of established autobiographical memories. This pattern of impairment has been reported in patients with temporal lobe epilepsy (TLE), in particular the subtype of Transient Epileptic Amnesia (TEA). The amnesic episodes and accelerated forgetting remitted on withdrawal of baclofen, while the autobiographical amnesia (AbA) persisted. This exceptional case highlights the occurrence of 'non-standard' forms of human amnesia, reflecting the biological complexity of memory processes. It suggests a role for GABAB signalling in the modulation of human memory over multiple time-scales and hints at its involvement in 'epileptic amnesia'.", "affiliations": "Cognitive Neurology Research Group, University of Exeter Medical, School, College House, St Luke's Campus, Exeter, UK. Electronic address: a.zeman@exeter.ac.uk.;Human Cognitive Neuroscience, University of Edinburgh, 7 George Square, UK. Electronic address: sergehoefeijzers@gmail.com.;Discipline of Psychology, University of Exeter, Washington Singer Laboratories, Exeter, UK. Electronic address: F.N.Milton@Exeter.ac.uk.;Human Cognitive Neuroscience, University of Edinburgh, 7 George Square, UK; Department of Psychology, Heriot-Watt University, Edinburgh, UK. Electronic address: m.dewar@hw.ac.uk.;Cognitive Neurology Research Group, University of Exeter Medical, School, College House, St Luke's Campus, Exeter, UK.;Cognitive Neurology Research Group, University of Exeter Medical, School, College House, St Luke's Campus, Exeter, UK.", "authors": "Zeman|Adam|A|;Hoefeijzers|Serge|S|;Milton|Fraser|F|;Dewar|Michaela|M|;Carr|Melanie|M|;Streatfield|Claire|C|", "chemical_list": "D000700:Analgesics; D001418:Baclofen", "country": "Italy", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0010-9452", "issue": "74()", "journal": "Cortex; a journal devoted to the study of the nervous system and behavior", "keywords": "Accelerated long term forgetting; Autobiographical amnesia; Baclofen; Transient amnesia; Transient epileptic amnesia", "medline_ta": "Cortex", "mesh_terms": "D000647:Amnesia; D000700:Analgesics; D001418:Baclofen; D005260:Female; D006801:Humans; D061212:Memory, Episodic; D008570:Memory, Short-Term; D008875:Middle Aged; D010146:Pain; D012153:Retention, Psychology", "nlm_unique_id": "0100725", "other_id": null, "pages": "9-19", "pmc": null, "pmid": "26599496", "pubdate": "2016-01", "publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "The GABAB receptor agonist, baclofen, contributes to three distinct varieties of amnesia in the human brain - A detailed case report.", "title_normalized": "the gabab receptor agonist baclofen contributes to three distinct varieties of amnesia in the human brain a detailed case report" }
[ { "companynumb": "GB-SUN PHARMACEUTICAL INDUSTRIES LTD-2015R1-107609", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "BACLOFEN" }, "drugad...
{ "abstract": "Toxic epidermal necrolysis (TEN) is an adverse reaction that can be induced by various drugs; the associated mortality rate is 20-25%. A previous report showed a weak association between TEN and acetaminophen. Recently, the US Food and Drug Administration declared that acetaminophen is associated with a risk of serious skin reactions, including TEN. Here, we describe the case of a 43-year-old Japanese woman with TEN caused by acetaminophen. She had poorly controlled ulcerative colitis and was treated with high doses of prednisolone, infliximab, acetaminophen and lansoprazole. Nine days after administrating acetaminophen, targetoid erythematous and bullous lesions appeared on the patient's trunk, palms and the soles of her feet. The skin lesions expanded rapidly; within 3 weeks, skin detachment was detected across nearly 100% of the patient's body. However, no mucosal involvement of the eyes, oral cavity or genitalia was found. We performed lymphocyte transformation tests using various drugs; however, a high stimulation index was obtained only with acetaminophen. The patient recovered following treatment with plasmapheresis, i.v. immunoglobulin therapy, topical medication and supportive therapy. Acetaminophen is included in many prescription and over-the-counter products; thus, clinicians should monitor their patients for severe drug reactions, including TEN.", "affiliations": "Department of Dermatology, Showa University School of Medicine, Tokyo, Japan.;Department of Dermatology, Showa University School of Medicine, Tokyo, Japan.;Department of Dermatology, Showa University School of Medicine, Tokyo, Japan.;Department of Dermatology, Showa University School of Medicine, Tokyo, Japan.;Department of Emergency and Critical Care Medicine, Showa University, Tokyo, Japan.;Department of Emergency and Critical Care Medicine, Showa University, Tokyo, Japan.;Department of Emergency and Critical Care Medicine, Showa University, Tokyo, Japan.;Department of Dermatology, Showa University School of Medicine, Tokyo, Japan.", "authors": "Watanabe|Hideaki|H|;Kamiyama|Taisuke|T|;Sasaki|Shun|S|;Kobayashi|Kae|K|;Fukuda|Kenichiro|K|;Miyake|Yasufumi|Y|;Aruga|Tohru|T|;Sueki|Hirohiko|H|", "chemical_list": "D000082:Acetaminophen; D011239:Prednisolone", "country": "England", "delete": false, "doi": "10.1111/1346-8138.13073", "fulltext": null, "fulltext_license": null, "issn_linking": "0385-2407", "issue": "43(3)", "journal": "The Journal of dermatology", "keywords": "acetaminophen; lymphocyte transformation test; severe cutaneous adverse reaction; toxic epidermal necrolysis", "medline_ta": "J Dermatol", "mesh_terms": "D000082:Acetaminophen; D000328:Adult; D003093:Colitis, Ulcerative; D005260:Female; D006801:Humans; D011239:Prednisolone; D013262:Stevens-Johnson Syndrome", "nlm_unique_id": "7600545", "other_id": null, "pages": "321-4", "pmc": null, "pmid": "26362011", "pubdate": "2016-03", "publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Toxic epidermal necrolysis caused by acetaminophen featuring almost 100% skin detachment: Acetaminophen is associated with a risk of severe cutaneous adverse reactions.", "title_normalized": "toxic epidermal necrolysis caused by acetaminophen featuring almost 100 skin detachment acetaminophen is associated with a risk of severe cutaneous adverse reactions" }
[ { "companynumb": "JP-SUN PHARMACEUTICAL INDUSTRIES LTD-2015RR-104045", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "PREDNISOLONE" }, "dr...
{ "abstract": "Adrenocortical carcinoma (ACC) is a rare and highly aggressive malignancy. ACCs often secrete adrenal steroid hormones including cortisol and androgens; however, aldosterone-producing ACC is very rare. Although adrenal production of aldosterone is assessed by adrenal venous sampling, the use of sampling from the relevant vein to assess aldosterone production from a tumor arising from ACC metastasis has not been previously reported. Case Presentation. We report the case of a 69-year-old Japanese man with aldosterone-producing ACC with hepatic metastasis. He presented with a history of treatment-resistant hypertension and hypokalemia. Endocrinological examination showed markedly increased plasma aldosterone concentration and suppressed plasma renin activity. Serum cortisol concentration was not suppressed by administration of dexamethasone 1 mg, and normal circadian variation of cortisol secretion was disrupted. Abdominal computed tomography showed a large tumor in the left adrenal gland and multiple tumors in the liver. Together, these results strongly suggested ACC with multiple liver metastases causing primary aldosteronism and subclinical Cushing syndrome. Adrenal and hepatic venous sampling showed markedly increased aldosterone concentration in the left adrenal vein but no increase in the hepatic vein, despite a pathological diagnosis of ACC with hepatic metastasis, with immunohistochemical investigation showing both primary and secondary tumors to have synthetic capability for aldosterone. The patient received mitotane but declined combination chemotherapy and died 2 months later.\nThis is the first report of adrenal and hepatic venous sampling in a case of aldosterone-producing ACC with hepatic metastasis. The case suggests that hepatic venous sampling is unable to detect aldosterone production from liver metastases arising from ACC.", "affiliations": "Division of Endocrinology and Metabolism, Japanese Red Cross Musashino Hospital, Tokyo, Japan.;Division of Endocrinology and Metabolism, Japanese Red Cross Musashino Hospital, Tokyo, Japan.;Department of Pathology, Tohoku University School of Medicine, Sendai, Miyagi, Japan.;Division of Endocrinology and Metabolism, Japanese Red Cross Musashino Hospital, Tokyo, Japan.", "authors": "Sugiyama|Toru|T|https://orcid.org/0000-0003-3656-437X;Sasahara|Yuriko|Y|;Sasano|Hironobu|H|;Hayakawa|Eri|E|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1155/2021/5584198", "fulltext": "\n==== Front\nCase Rep Endocrinol\nCase Rep Endocrinol\nCRIE\nCase Reports in Endocrinology\n2090-6501\n2090-651X\nHindawi\n\n10.1155/2021/5584198\nCase Report\nAdrenal and Hepatic Venous Sampling in a Case of Aldosterone-Producing Adrenocortical Carcinoma with Hepatic Metastasis\nhttps://orcid.org/0000-0003-3656-437X\nSugiyama Toru tsugiyama@musashino.jrc.or.jp\n1\nSasahara Yuriko 1\nSasano Hironobu 2\nHayakawa Eri 1\n1Division of Endocrinology and Metabolism, Japanese Red Cross Musashino Hospital, Tokyo, Japan\n2Department of Pathology, Tohoku University School of Medicine, Sendai, Miyagi, Japan\nAcademic Editor: Lucy Mastrandrea\n\n2021\n14 4 2021\n2021 558419820 1 2021\n8 4 2021\nCopyright © 2021 Toru Sugiyama et al.\n2021\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.\nBackground\n\nAdrenocortical carcinoma (ACC) is a rare and highly aggressive malignancy. ACCs often secrete adrenal steroid hormones including cortisol and androgens; however, aldosterone-producing ACC is very rare. Although adrenal production of aldosterone is assessed by adrenal venous sampling, the use of sampling from the relevant vein to assess aldosterone production from a tumor arising from ACC metastasis has not been previously reported. Case Presentation. We report the case of a 69-year-old Japanese man with aldosterone-producing ACC with hepatic metastasis. He presented with a history of treatment-resistant hypertension and hypokalemia. Endocrinological examination showed markedly increased plasma aldosterone concentration and suppressed plasma renin activity. Serum cortisol concentration was not suppressed by administration of dexamethasone 1 mg, and normal circadian variation of cortisol secretion was disrupted. Abdominal computed tomography showed a large tumor in the left adrenal gland and multiple tumors in the liver. Together, these results strongly suggested ACC with multiple liver metastases causing primary aldosteronism and subclinical Cushing syndrome. Adrenal and hepatic venous sampling showed markedly increased aldosterone concentration in the left adrenal vein but no increase in the hepatic vein, despite a pathological diagnosis of ACC with hepatic metastasis, with immunohistochemical investigation showing both primary and secondary tumors to have synthetic capability for aldosterone. The patient received mitotane but declined combination chemotherapy and died 2 months later.\n\nConclusion\n\nThis is the first report of adrenal and hepatic venous sampling in a case of aldosterone-producing ACC with hepatic metastasis. The case suggests that hepatic venous sampling is unable to detect aldosterone production from liver metastases arising from ACC.\n==== Body\n1. Introduction\n\nAdrenocortical carcinoma (ACC) is a rare, highly aggressive malignancy with an estimated annual incidence of 0.7–2.0 cases per million population. It has a heterogeneous clinical presentation, and prognosis is generally poor. Approximately 60–70% of ACCs secrete hormones, mostly glucocorticoids or androgens. Less than 10% of hormone-secreting ACCs produce aldosterone, in which cases the excessive production can cause primary aldosteronism [1–3].\n\nCommon causes of primary aldosteronism are an aldosterone-producing adenoma or bilateral idiopathic adrenal hyperplasia. The condition frequently results in difficult-to-treat arterial hypertension, sodium retention, and hypokalemia.\n\nIn cases of primary aldosteronism, adrenal venous sampling (AVS) is considered the gold standard test for determining whether the excessive aldosterone production is uni- or bilateral and identifying the adrenal gland responsible [4]. However, there have been no reports of the use of sampling from the relevant vein to assess aldosterone production from a tumor arising from ACC metastasis.\n\nHere, we report what we believe to be the first case of aldosterone-producing ACC with hepatic metastasis in which adrenal and hepatic venous sampling were carried out to assess the production of aldosterone from the primary and secondary tumor, respectively.\n\n2. Case Presentation\n\nA 69-year-old man with an 8-month history of treatment-resistant hypertension and hypokalemia was referred to our hospital for investigation of suspected secondary hypertension. On physical examination, the only abnormal finding was hypertension (178/105 mmHg); there were no signs of Cushing syndrome (e.g., moon facies, central obesity, and buffalo hump).\n\nLaboratory findings showed hypokalemia (2.3 mEq/L) (Table 1). The results of endocrine examination (Table 2) showed a markedly increased plasma aldosterone concentration (PAC; 1710 pg/mL) and suppressed plasma renin activity (PRA: 0.2 ng/mL/h). Serum DHEA-S (35 μg/dL) was within the normal range (12–133 μg/dL). Fasting plasma concentrations of the adrenocorticotropic hormone (ACTH) and serum cortisol were 2.1 pg/mL (below the lower limit of normal, 7.2 pg/mL) and 9.4 μg/dL (within the normal range, 4.0–18.2 μg/dL), respectively. Serum cortisol concentration was not suppressed in response to an overnight low-dose (1 mg) dexamethasone suppression test, and normal circadian variation of cortisol secretion was disrupted. Both urinary aldosterone concentration and cortisol concentration were increased: 549 μg/24 h (normal, <10 μg/24 h) and 328 μg/24 h (upper limit of normal, 80.3 μg/24 h), respectively.\n\nAbdominal computed tomography (CT) showed a left adrenal tumor (diameter, 7 cm) and multiple liver tumors (diameter, ∼4 cm) (Figure 1).\n\nThe combined examination and investigation results strongly suggested ACC with multiple liver metastases causing primary aldosteronism and subclinical Cushing syndrome. Such cases are classified as clinical stage IV and therefore ineligible for surgery to remove the adrenal tumor. However, the patient hoped to have the adrenal tumor removed, so he requested investigation of the liver tumors to confirm that they had arisen from the ACC.\n\nAdrenal and hepatic venous sampling were carried out. Aldosterone concentration was markedly increased in the left adrenal vein (64,500 μg/dL) but not in the right adrenal or hepatic vein (4870 and 1210 μg/dL, respectively) (Table 3). These findings suggested that the liver tumors were not secreting aldosterone; therefore, biopsies of tissue from both the left adrenal tumor and the liver tumors were carried out to enable pathological diagnosis. Based on the Weiss criteria, the biopsy results for the left adrenal and liver tumors were pathologically consistent with the diagnosis of ACC with hepatic metastasis. Immunohistochemical investigation showed strong positive staining for SF-1, P450c17, P450c21, 3βHSD2, CYP11B1, and CYP11B2 and partial positive staining for P450scc and 3βHSD1 in both the ACC and the liver metastases (Figure 2); these findings indicated synthetic capability for aldosterone and cortisol. The DHEA-ST test result was negative for both the ACC and the liver metastases.\n\nThe patient received mitotane (1500 mg/day) but declined combination chemotherapy. Hypoalbuminemia and severe edema of the lung and lower extremities developed rapidly despite administration of high doses of spironolactone, and he died 2 months later.\n\n3. Discussion\n\nTo our knowledge, this is the first report of a case of aldosterone-producing ACC with hepatic metastasis in which adrenal and hepatic venous sampling were carried out to assess the production of aldosterone from metastasis of ACC. This was an unusual case because hypersecretion of aldosterone from ACC is rare; in the majority of cases (approximately 60–70%), ACCs present with an excess of adrenal hormone (mostly glucocorticoids or androgens) [1–3].\n\nAlthough AVS is considered the gold standard test for determining whether the right, the left, or both adrenal glands are responsible for the aldosterone excess in cases of primary aldosteronism, to our knowledge, there have been no reports of the use of sampling from the relevant vein to assess aldosterone production from a tumor suspected to have arisen from ACC metastasis. In the case presented in this report, we used hepatic venous sampling to try to help determine whether the liver tumors were ACC metastases or other hepatic tumors (e.g., hepatocellular carcinoma). However, aldosterone concentration in the hepatic veins was not increased, despite the pathological diagnosis of hepatic metastasis of ACC and its synthetic capability for aldosterone.\n\nIn cases of insulinoma, hepatic venous sampling after selective intra-arterial injections of calcium into the relevant hepatic artery is carried out to exclude hepatic metastasis of insulinoma [5–8]. In a similar way, liver metastases arising from ACC might be expected to be detected by hepatic venous sampling. Because aldosterone is a lipophilic steroid hormone, it should be released into the blood circulation once synthesized. Our experience in this case suggests that hepatic venous sampling is unsuitable for diagnosis of ACC with hepatic metastasis. Although the liver tumors were found by immunohistochemical investigation to have synthetic capability for aldosterone and cortisol, aldosterone concentration in the hepatic veins was found not to be increased. This might be explained by the limited transportation of aldosterone to the hepatic vein or degradation of aldosterone during its passage through the liver. Further basic research is required to explain this finding.\n\nAdrenocortical carcinoma has a generally poor prognosis, with overall 5-year survival ranging from 60–80% in patients with stage I disease to 13% in those with stage IV. Clinical outcomes vary greatly due to differences in tumor biology, disease presentation, and management options [1, 2, 9, 10]. The results of a recent systematic review and meta-analysis show that cortisol-secreting ACCs are associated with worse overall survival [11]. This higher mortality rate could be explained by negative effects of cortisol on the immune and cardiovascular systems. In cases of aldosterone-secreting ACCs, scarcity of data means that prognosis is uncertain. In the case presented here, the marked hyperaldosteronism could have negatively affected the cardiovascular system and electrolyte balance and thus contributed to the poor outcome.\n\nManagement of ACC remains challenging due to the heterogeneous and often unpredictable nature of this disease. If our patient's liver metastases had not produced excessive aldosterone, surgical resection of the primary tumor might have resolved the hyperaldosteronism, and this might have led to a better outcome.\n\n4. Conclusion\n\nWe report the first case of adrenal and hepatic venous sampling in a patient with aldosterone-producing ACC with hepatic metastasis. Hepatic venous sampling did not detect aldosterone production from the liver tumors.\n\nAcknowledgments\n\nThe authors would like to thank the Tama Society of Clinical Endocrinology and Metabolism, whose members participated in helpful discussions.\n\nAbbreviations\n\n3βHSD: 3β-Hydroxysteroid dehydrogenase\n\nACC: Adrenocortical carcinoma\n\nACTH: Adrenocorticotropic hormone\n\nAlb: Albumin\n\nALP: Alkaline phosphatase\n\nALT: Alanine aminotransferase\n\nAST: Aspartate aminotransferase\n\nCK: Creatine kinase\n\nCr: Creatinine\n\nCRP: C-reactive protein\n\nCYP: Cytochrome P450\n\nDHEA-ST: Dehydroepiandrosterone sulfotransferase\n\nDST: Dexamethasone suppression test\n\nHDL-c: High-density lipoprotein cholesterol\n\nHE: Hematoxylin and eosin\n\nLDH: Lactase dehydrogenase\n\nLDL-c: Low-density lipoprotein cholesterol\n\nP450c17: Cytochrome P450 17\n\nP450c21: Cytochrome P450 21\n\nP450scc: Cytochrome P450 side-chain cleavage\n\nPAC: Plasma aldosterone concentration\n\nRBC: Red blood cell\n\nSF-1: Steroidogenic factor 1\n\nT-Bil: Total bilirubin\n\nT-chol: Total cholesterol\n\nTG: Triglycerides\n\nTP: Total protein\n\nUA: Uric acid\n\nUN: Urea nitrogen\n\nWBC: White blood cell\n\nγ-GT: γ-Glutamyltranspeptidase.\n\nData Availability\n\nThe datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.\n\nEthical Approval\n\nThe need for ethical approval and consent to the submission of case reports were waived by the ethics review committee of Japanese Red Cross Musashino Hospital. We followed the principles of the Declaration of Helsinki and paid careful attention to protecting the patient's identity.\n\nConsent\n\nThe patient's family provided their informed consent to publication of this case report, including the figures.\n\nConflicts of Interest\n\nThe authors declare that they have no conflicts of interest.\n\nAuthors' Contributions\n\nTS was the main author to treat this patient and wrote the manuscript. YS cared for the patient when he was admitted to the hospital. HS carried out the pathological and immunohistochemical investigation. EH provided professional opinions regarding the patient's care and commented on the manuscript. All authors read and approved the final submitted version of the manuscript.\n\nFigure 1 Abdominal computed tomography scan. The red arrow indicates the left adrenal tumor (diameter, 7 cm). The yellow arrows indicate multiple liver tumors (diameter, ∼4 cm).\n\nFigure 2 Results of histopathological and immunohistochemical investigation of left adrenal and liver biopsy specimens (magnification, ×200). Microscopic appearance (hematoxylin and eosin, HE, staining) showed eosinophilic tumor cell cytoplasm, nuclear atypia, diffuse architecture, and sinusoidal invasion. Immunohistochemical staining showed strong positive reactivity for SF-1, P450c17, 3βHSD2, P450c21, CYP11B1, and CYP11B2 and partial positive reactivity for P450scc and 3βHSD1 in both the left adrenal tumor (upper panel) and the liver tumor (lower panel). The DHEA-ST test result was negative for both specimens.\n\nTable 1 Laboratory findings.\n\nBlood cell count\tBiochemistry\t\nWBC (/μL)\t6000\tTP (g/dL)\t7.0\tUN (mg/dL)\t11.5\t\nNeutrophil (%)\t62.2\tAlb (g/dL)\t4.2\tCr (mg/dL)\t0.59\t\nLymphocyte (%)\t28.3\tLDH (IU/L)\t330\tUA (mg/dL)\t4.1\t\nMonocyte (%)\t8.3\tAST (IU/L)\t22\tNa (mEq/L)\t147\t\nEosinophil (%)\t0.7\tALT (IU/L)\t39\tK (mEq/L)\t2.3\t\nBasophil (%)\t0.5\tγ-GT (IU/L)\t31\tCl (mEq/L)\t95\t\nRBC (× 106/μL)\t4.47\tT-Bil (mg/dL)\t0.8\tCa (mg/dL)\t8.7\t\nHemoglobin (g/dL)\t13.0\tALP (IU/L)\t308\tP (mg/dL)\t2.6\t\nHematocrit (%)\t38.2\tPlasma glucose (mg/dL)\t95\tT-chol (mg/dL)\t167\t\nPlatelet (× 104/μL)\t24.5\tCK (IU/L)\t216\tHDL-c (mg/dL)\t60.7\t\n \t \tCRP (mg/dL)\t0.17\tLDL-c (mg/dL)\t95.6\t\n \tTG (mg/dL)\t95\t\n\nTable 2 Endocrinological examination.\n\nHormonal profile\t\tNormal range\t\t\nPlasma ACTH (pg/mL)\t2.1\t7.2–63.3\t\nSerum cortisol (μg/dL)\t9.4\t4.0–18.3\t\nPlasma renin activity (ng/mL/h)\t0.2\t0.3–2.9\t\nPAC (pg/mL)\t1710\t140–1030\t\nSerum DHEA-S (μg/dL)\t35\t12–133\t\nUrinary free cortisol (μg/24 h)\t328\t11.2–80.3\t\nUrinary free aldosterone (μg/24 h)\t549\t<10\t\nCircadian variation of plasma ACTH and serum cortisol and low-dose (1 mg) DST results\t\nTime\t06:00\t16:00\t23:00\t1 mg DST\t\nPlasma ACTH (pg/mL)\t<1.0\t<1.0\t<1.0\t<1.0\t\nSerum cortisol (μg/dL)\t9.8\t11.3\t11.6\t12.0\t\n\nTable 3 Adrenal and hepatic venous sampling.\n\n \tSampling point\tPAC (pg/mL)\tCortisol (μg/dL)\tPAC : cortisol ratio\t\nBefore ACTH loading\tInferior vena cava\t3890\t18.3\t21.3 × 10−3\t\nLeft adrenal vein\t35,000\t44.7\t78.3 × 10−3\t\nRight adrenal vein\t3310\t23.2\t14.3 × 10−3\t\nHepatic vein\t1360\t18.8\t7.2 × 10−3\t\n\t\nAfter ACTH loading\tInferior vena cava\t4260\t21.4\t19.9 × 10−3\t\nLeft adrenal vein\t64,500\t58.2\t110.8 × 10−3\t\nRight adrenal vein\t4870\t132\t3.7 × 10−3\t\nHepatic vein\t1210\t21.2\t5.7 × 10−3\n==== Refs\n1 Else T. Kim A. C. Sabolch A. Adrenocortical carcinoma Endocrine Reviews 2014 35 2 282 326 10.1210/er.2013-1029 2-s2.0-84897465103 24423978\n2 Fassnacht M. Kroiss M. Allolio B. Update in adrenocortical carcinoma The Journal of Clinical Endocrinology & Metabolism 2013 98 12 4551 4564 10.1210/jc.2013-3020 2-s2.0-84889853637 24081734\n3 Seccia T. M. Fassina A. Nussdorfer G. G. Pessina A. C. Rossi G. P. Aldosterone-producing adrenocortical carcinoma: an unusual cause of Conn’s syndrome with an ominous clinical course Endocrine-Related Cancer 2005 12 1 149 159 10.1677/erc.1.00867 2-s2.0-16444385246 15788646\n4 Rossi G. P. Primary aldosteronism Journal of the American College of Cardiology 2019 74 22 2799 2811 10.1016/j.jacc.2019.09.057 31779795\n5 Guettier J.-M. Kam A. Chang R. Localization of insulinomas to regions of the pancreas by intraarterial calcium stimulation: the NIH experience The Journal of Clinical Endocrinology & Metabolism 2009 94 4 1074 1080 10.1210/jc.2008-1986 2-s2.0-65249106727 19190102\n6 Moreno-Moreno P. Alhambra-Expósito M. R. Herrera-Martínez A. D. Arterial calcium stimulation with hepatic venous sampling in the localization diagnosis of endogenous hyperinsulinism International Journal of Endocrinology 2016 2016 6 4581094 10.1155/2016/4581094 2-s2.0-84992206675\n7 Imamura M. Takahashi K. Adachi H. Usefulness of selective arterial secretin injection test for localization of gastrinoma in the zollinger-ellison syndrome Annals of Surgery 1987 205 3 230 239 10.1097/00000658-198703000-00003 2-s2.0-0023100332 3548610\n8 Pereira P. L. Roche A. J. Maier G. W. Insulinoma and islet cell hyperplasia: value of the calcium intraarterial stimulation test when findings of other preoperative studies are negative Radiology 1998 206 3 703 709 10.1148/radiology.206.3.9494488 2-s2.0-0031932017 9494488\n9 Jasim S. Habra M. A. Management of adrenocortical carcinoma Current Oncology Reports 2019 21 3 p. 20 10.1007/s11912-019-0773-7 2-s2.0-85062026788\n10 Else T. Williams A. R. Sabolch A. Jolly S. Miller B. S. Hammer G. D. Adjuvant therapies and patient and tumor characteristics associated with survival of adult patients with adrenocortical carcinoma The Journal of Clinical Endocrinology & Metabolism 2014 99 2 455 461 10.1210/jc.2013-2856 2-s2.0-84896739925 24302750\n11 Vanbrabant T. Fassnacht M. Assie G. Dekkers O. M. Influence of hormonal functional status on survival in adrenocortical carcinoma: systematic review and meta-analysis European Journal of Endocrinology 2018 179 6 429 436 10.1530/eje-18-0450 2-s2.0-85054396757 30325179\n\n", "fulltext_license": "CC BY", "issn_linking": "2090-651X", "issue": "2021()", "journal": "Case reports in endocrinology", "keywords": null, "medline_ta": "Case Rep Endocrinol", "mesh_terms": null, "nlm_unique_id": "101576457", "other_id": null, "pages": "5584198", "pmc": null, "pmid": "33953990", "pubdate": "2021", "publication_types": "D002363:Case Reports", "references": "30325179;9494488;3548610;30798468;24302750;31779795;15788646;24081734;19190102;27795707;24423978", "title": "Adrenal and Hepatic Venous Sampling in a Case of Aldosterone-Producing Adrenocortical Carcinoma with Hepatic Metastasis.", "title_normalized": "adrenal and hepatic venous sampling in a case of aldosterone producing adrenocortical carcinoma with hepatic metastasis" }
[ { "companynumb": "JP-SUN PHARMACEUTICAL INDUSTRIES LTD-2021R1-305630", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "SPIRONOLACTONE" }, "...
{ "abstract": "OBJECTIVE\nWe report disease remission and recovery of fifth and seventh nerve paresis in a case of primary mucosal melanoma of the middle ear and petrous temporal bone.\n\n\nMETHODS\nA 74-year-old man developed sudden, profound, right sided sensorineural hearing loss, disequilibrium, otalgia, and cranial nerve V and VII dysfunction. Imaging demonstrated an unresectable, osteolytic lesion involving the middle ear and anterior petrous apex. Melanoma was diagnosed via in-office biopsy; whole-body metabolic imaging revealed no other primary site.\n\n\nMETHODS\nMultidisciplinary management included radiation therapy (30 Gy, 10 fractions) followed by induction (five cycles, q2w) and maintenance nivolumab (six cycles, q3w).\n\n\nMETHODS\nComplete metabolic response of primary site and metastases on imaging, recovery of cranial neuropathies.\n\n\nRESULTS\nFollowing palliative radiation therapy and induction nivolumab, cranial neuropathies resolved. With maintenance-dose nivolumab, primary site and metastases exhibited a complete response. Therapy was stopped at 16 months post-diagnosis. Complete remission was maintained until 22 months after diagnosis. The patient developed a solitary cerebral metastasis which was refractory to radiosurgery and biopsy confirmed melanoma. He expired 2 years, 8 months post-diagnosis.\n\n\nCONCLUSIONS\nMucosal melanoma of the middle ear and petrous temporal bone is exceedingly rare. Management is individualized and surgery is undertaken when possible. Key observations in this case are the complete metabolic response and reversal of cranial nerve neuropathies following radiation and anti-programed cell death receptor ligand 1 therapy. Non-surgical treatment is worthy of study as initial management for similar lesions.", "affiliations": "Department of Otolaryngology-Head and Neck Surgery, Eastern Virginia Medical School, Norfolk, Virginia.", "authors": "Carlson|Kevin J|KJ|;Volsky|Peter G|PG|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1097/MAO.0000000000003293", "fulltext": null, "fulltext_license": null, "issn_linking": "1531-7129", "issue": "42(10)", "journal": "Otology & neurotology : official publication of the American Otological Society, American Neurotology Society [and] European Academy of Otology and Neurotology", "keywords": null, "medline_ta": "Otol Neurotol", "mesh_terms": null, "nlm_unique_id": "100961504", "other_id": null, "pages": "e1560-e1564", "pmc": null, "pmid": "34282102", "pubdate": "2021-12-01", "publication_types": "D016428:Journal Article", "references": null, "title": "Remission of Mucosal Melanoma of the Middle Ear and Petrous Temporal Bone and Reversal of Cranial Nerve Paresis Following Radiation and Single Agent Nivolumab: Clinical Capsule and Review of the Literature.", "title_normalized": "remission of mucosal melanoma of the middle ear and petrous temporal bone and reversal of cranial nerve paresis following radiation and single agent nivolumab clinical capsule and review of the literature" }
[ { "companynumb": "US-MYLANLABS-2022M1048187", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "DEXAMETHASONE" }, "drugadditional": "3", ...
{ "abstract": "BACKGROUND\nA report of the second known case of bilateral cystoid macular edema in a patient taking risperidone.\n\n\nMETHODS\nWe report a case of a 69-year-old African American woman using risperidone who presented with worsening visual acuity and was found to have bilateral cystoid macular edema. Upon decreasing the dosage of risperidone, the cystoid macular edema resolved and visual acuity markedly improved. Fluorescein angiography and optical coherence tomography were used to document the severity of cystoid macular edema and subsequent resolution after decreased dosage of risperidone.\n\n\nCONCLUSIONS\nThe documentation of a patient who developed cystoid macular edema associated with risperidone usage indicates that it may be beneficial to monitor patients taking risperidone for the development of maculopathy.", "affiliations": "Department of Ophthalmology, State University of New York, Downstate Medical Center, 450 Clarkson Ave, Brooklyn, NY, 11203, USA.;Department of Ophthalmology, State University of New York, Downstate Medical Center, 450 Clarkson Ave, Brooklyn, NY, 11203, USA.;Department of Ophthalmology, State University of New York, Downstate Medical Center, 450 Clarkson Ave, Brooklyn, NY, 11203, USA. Rony.Gelman@downstate.edu.", "authors": "Kozlova|Anna|A|;McCanna|Charles D|CD|;Gelman|Rony|R|http://orcid.org/0000-0002-9149-9518", "chemical_list": "D014150:Antipsychotic Agents; D018967:Risperidone", "country": "England", "delete": false, "doi": "10.1186/s13256-019-1978-y", "fulltext": "\n==== Front\nJ Med Case RepJ Med Case RepJournal of Medical Case Reports1752-1947BioMed Central London 197810.1186/s13256-019-1978-yCase ReportRisperidone-related bilateral cystoid macular edema: a case report Kozlova Anna annakozlov501@gmail.com 12McCanna Charles D. charles.d.mccanna@gmail.com 1http://orcid.org/0000-0002-9149-9518Gelman Rony Rony.Gelman@downstate.edu 11 0000 0001 0693 2202grid.262863.bDepartment of Ophthalmology, State University of New York, Downstate Medical Center, 450 Clarkson Ave, Brooklyn, NY 11203 USA 2 Downstate College of Medicine, State University of New York, Brooklyn, NY USA 13 3 2019 13 3 2019 2019 13 5916 10 2018 10 1 2019 © The Author(s). 2019Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nA report of the second known case of bilateral cystoid macular edema in a patient taking risperidone.\n\nCase presentation\nWe report a case of a 69-year-old African American woman using risperidone who presented with worsening visual acuity and was found to have bilateral cystoid macular edema. Upon decreasing the dosage of risperidone, the cystoid macular edema resolved and visual acuity markedly improved. Fluorescein angiography and optical coherence tomography were used to document the severity of cystoid macular edema and subsequent resolution after decreased dosage of risperidone.\n\nConclusion\nThe documentation of a patient who developed cystoid macular edema associated with risperidone usage indicates that it may be beneficial to monitor patients taking risperidone for the development of maculopathy.\n\nKeywords\nCystoid macular edemaRisperidoneOCTFluorescein angiographyCase reportissue-copyright-statement© The Author(s) 2019\n==== Body\nBackground\nCystoid macular edema (CME) develops with the accumulation of fluid in the macula, causing blurred or diminished central vision. It has a broad differential diagnosis that includes surgical, vascular, structural, and medication-related causes [1].\n\nThe retina is vulnerable to medication-induced changes through a variety of mechanisms, although, ultimately, CME develops when the capillary filtration rate is greater than the rate of fluid removal by glial and retinal pigment epithelium (RPE) cells. Although mechanisms have not been proven, some medications are associated with CME. E2 prostaglandins can disrupt the tight junctions of retinal capillaries causing CME. Niacin, in a dose-dependent manner, can also result in CME [2].\n\nIn 2013, the first case of risperidone-related bilateral CME was reported by Manousaridis and Gupta [3]. They described a 65-year-old woman with a past medical history of depression who presented with a 5-week history of bilateral blurred vision. Bilateral CME was noted and confirmed with fluorescein angiography (FA) and optical coherence tomography (OCT). The CME resolved with drug removal, with “probable” likelihood of the effect being an adverse drug reaction [4]. Here we describe the second known case of risperidone-associated bilateral CME in the medical literature.\n\nCase presentation\nOur patient is a 69-year-old African American woman who presented with gradually decreased and blurred vision of approximately 1 year’s duration without other ocular symptoms. Her past medical history was significant for hypertension, schizophrenia, and depression with no history of diabetes. Her past ocular history was significant for: uncomplicated cataract extraction of both eyes 2 years prior; primary open-angle glaucoma treated with latanoprost, brimonidine, and timolol in both eyes; and dry eye syndrome with past punctal plug placement. Medications included citalopram, risperidone, amlodipine, enalapril, and metoprolol. She reported no difficulty with medication compliance. Of note, an eye examination approximately 1 year prior to presentation showed 20/20 visual acuity bilaterally. A chart review revealed that she had been taking risperidone 2 mg/day for at least 3 years prior to presentation. Her dosage was increased by her psychiatrist 2 years prior to presentation to 3 mg/day, with ocular symptoms developing approximately 1 year after the dosage increase (or 1 year prior to presentation).\n\nVisual acuity on presentation was 20/150 in her right eye and 20/200 in her left eye and intraocular pressures were within normal limits. An anterior segment examination showed decreased tear film, but was otherwise unremarkable. A posterior segment examination showed bilateral CME with no vitreous cells. FA demonstrated bilateral petaloid leakage (Fig. 1) and CME was confirmed by OCT (Fig. 2). The CME was suspected to be secondary to risperidone and a recommendation about the possible association between the risperidone and macular edema was made to our patient’s psychiatrist, who decreased risperidone dosage from 3 to 2 mg/day when she followed up with them 2 months later. Her psychiatry team expressed concern with fully eliminating her risperidone or switching to another agent and risking a breakthrough psychotic episode. Thus, the psychiatrist recommended to first attempt dose reduction. At 4-months follow-up, her CME resolved bilaterally (Fig. 2) and vision improved to 20/40 in both eyes. OCT imaging 6 and 12 months after this visit showed no recurrence of CME. She has had no new ocular complaints since dosage adjustments as per record review, and no edema was noted on funduscopic examination at the last follow-up 18 months after presentation.Fig. 1 Fluorescein angiography of the right (a) and left (b) eye showing late petaloid leakage with a hot nerve in both eyes\n\nFig. 2 Spectral-domain optical coherence tomography horizontal line scans through the fovea showing cystoid macular edema and subretinal fluid in (a) right eye and (b) left eye on presentation. Spectral-domain optical coherence tomography following decreased dosing of risperidone showing resolved cystoid macular edema and subretinal fluid in the (c) right eye and (d) left eye at 4-months follow-up\n\n\n\nDiscussion and conclusions\nCME has a broad differential diagnosis that includes surgical, vascular, structural, and medication-related causes such as from niacin [2] and E2 prostaglandins [1]. Multiple neurotrophic agents have adverse effects on the retina as well. Risperidone has effects on a variety of cellular receptors that may result in CME. These include a high affinity for serotonin receptors, a1-adrenergic and a2-adrenergic receptor blockade, and dopaminergic receptor blockade [5]. Research suggests that mechanisms such as vasorelaxation via alpha adrenergic blockade or direct effects on the retinal vascular endothelium may be responsible for risperidone-induced CME [6].\n\nThe Naranjo Probability Scale was used to assess the likelihood that the adverse drug reaction (CME) was due to the drug in question (risperidone) as opposed to other factors [4]. The probability results are classified as definite, probable, possible, or doubtful. We describe a second case in which a patient developed bilateral CME in association with risperidone and in our setting this was due to a “possible” adverse drug reaction linked to risperidone.\n\nWe note a limitation of our report is that our patient was concurrently using a topical prostaglandin analog and risperidone. Although the CME could have been secondary to the topical agent, the resolution of the CME occurred after the risperidone dosage was decreased while continuing the latanoprost. Another limitation is that our patient did not have the risperidone entirely discontinued as a precaution against breakthrough psychosis. She was stabilized on a lower dosage that has as of the last follow-up not resulted in recurrence of CME. Another limitation is that we elected not to retest at the higher dosage as her vision is stable and her psychiatry team is satisfied with current management. While the original report of Manousaridis and Gupta [3] showed resolution with risperidone elimination, we achieved a positive result with reduction. It is unclear whether the impact of risperidone on the development of CME is dose-dependent due to the scarcity of data regarding this effect and the rare occurrence of suspected risperidone-related macular edema. Further research would be of benefit.\n\nThe documentation of a second patient who developed CME associated with risperidone usage indicates that it may be beneficial to monitor patients taking risperidone for the development of maculopathy. In the first documented case, cessation of risperidone usage demonstrated a resolution of the patient’s condition. In our patient, resolution of CME was seen with a decrease in dosage. Awareness of the potential side effects of risperidone provides additional information to weigh in determining the most appropriate dosage and medication choice for patients requiring antipsychotic drugs.\n\nAbbreviations\nCMECystoid macular edema\n\nFAFluorescein angiography\n\nOCTOptical coherence tomography\n\nAcknowledgements\nNone.\n\nFunding\nNone.\n\nAvailability of data and materials\nNot applicable.\n\nAuthors’ contributions\nCDM and RG managed the patient. AK and CDM drafted the initial manuscript which was modified by RG. All authors read and approved the final manuscript.\n\nEthics approval and consent to participate\nNot applicable.\n\nConsent for publication\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Rotsos TG Moschos MM Cystoid macular edema Clin Ophthalmol (Auckland) 2008 2 4 919 930 10.2147/OPTH.S4033 \n2. Gass JDM Nicotinic acid maculopathy Am J Ophthalmol 1973 76 4 500 510 10.1016/0002-9394(73)90738-1 4743805 \n3. Manousaridis K Gupta R Risperidone-related bilateral cystoid macular oedema Graefes Arch Clin Exp Ophthalmol 2013 251 1037 1038 10.1007/s00417-012-2071-z 22684902 \n4. Naranjo CA Busto U Sellers EM A method for estimating the probability of adverse drug reactions Clin Pharmacol Ther 1981 30 2 239 245 10.1038/clpt.1981.154 7249508 \n5. Nasrallah HA Atypical antipsychotic metabolic side-effects: insights from receptor binding profiles Mol Psychiatry 2008 13 27 35 10.1038/sj.mp.4002066 17848919 \n6. Okamura T Fujioka H Ayajiki K Effects of nipradilol on alpha-adrenoceptor function in ocular arteries Pharmacology 2002 65 110 118 10.1159/000056195 11937782\n\n", "fulltext_license": "CC BY", "issn_linking": "1752-1947", "issue": "13(1)", "journal": "Journal of medical case reports", "keywords": "Case report; Cystoid macular edema; Fluorescein angiography; OCT; Risperidone", "medline_ta": "J Med Case Rep", "mesh_terms": "D000368:Aged; D014150:Antipsychotic Agents; D004305:Dose-Response Relationship, Drug; D005260:Female; D005451:Fluorescein Angiography; D006801:Humans; D008269:Macular Edema; D018967:Risperidone; D012720:Severity of Illness Index; D041623:Tomography, Optical Coherence; D014792:Visual Acuity", "nlm_unique_id": "101293382", "other_id": null, "pages": "59", "pmc": null, "pmid": "30862314", "pubdate": "2019-03-13", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "11937782;17848919;19668445;22684902;4743805;7249508", "title": "Risperidone-related bilateral cystoid macular edema: a case report.", "title_normalized": "risperidone related bilateral cystoid macular edema a case report" }
[ { "companynumb": "US-ZYDUS-035890", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "4", "activesubstance": { "activesubstancename": "LATANOPROST" }, "drugadditional": null, "drug...
{ "abstract": "Linear immunoglobulin A disease (LAD) is a rare, autoimmune, vesicular-bullous disease that is either idiopathic or drug-induced, most commonly by vancomycin and in rare instances by amlodipine. In drug-induced LAD, certain uncommon and atypical clinical features can occur. In our patient, a 49-year-old woman with amlodipine-induced LAD, atypical features such as koebnerization and palmo-plantar involvement occurred. She presented with tense, clear fluid-filled vesicles, bullae, and erosions all over her body, especially on the palms and soles, with some lesions showing a string-of-pearls appearance. The lesions were preceded by pruritus, and the patient had changed her anti-hypertensive medication from telmisartan to telmisartan-amlodipine for previous 10 days. Skin biopsy and direct immunofluorescence testing confirmed LAD. During the hospital stay, along with new crops of lesions, a few vesicles were present along the lines where she had scratched and the band of tight elastic sleeves of the sterile gown she wore, which is suggestive of koebnerization. Knowing the atypical manifestations of drug-induced LAD may aid clinicians in determining an early diagnosis, and LAD should be an important consideration in the differential diagnosis of vesiculobullous disease with palmar-plantar involvement. Amlodipine is a commonly used anti-hypertensive drug, so knowledge of its potential to cause this disease is important. Furthermore, knowing the potential for koebnerization, avoidance of trauma and the gentle handling of these patients can lead to early recovery from this self-limiting disease.", "affiliations": "Department of Dermatology, Maulana Azad Medical College, New Delhi, India.;Department of Dermatology, Maulana Azad Medical College, New Delhi, India.;Department of Dermatology, Maulana Azad Medical College, New Delhi, India.", "authors": "Ailawadi|Pallavi|P|;Narang|Isha|I|;Garg|Vijay K|VK|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1016/j.ijwd.2018.11.004", "fulltext": "\n==== Front\nInt J Womens DermatolInt J Womens DermatolInternational Journal of Women's Dermatology2352-6475Elsevier S2352-6475(18)30071-610.1016/j.ijwd.2018.11.004ArticleAn array of unusual clinical features in a woman with amlodipine-induced linear immunoglobulin A disease☆ Ailawadi Pallavi Narang Isha ishanarang.d1@gmail.com⁎Garg Vijay K. Department of Dermatology, Maulana Azad Medical College, New Delhi, India⁎ Corresponding author. ishanarang.d1@gmail.com24 1 2019 6 2019 24 1 2019 5 2 92 95 10 8 2018 11 11 2018 18 11 2018 © 2018 Published by Elsevier Inc. on behalf of Women's Dermatologic Society.2018This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Linear immunoglobulin A disease (LAD) is a rare, autoimmune, vesicular-bullous disease that is either idiopathic or drug-induced, most commonly by vancomycin and in rare instances by amlodipine. In drug-induced LAD, certain uncommon and atypical clinical features can occur. In our patient, a 49-year-old woman with amlodipine-induced LAD, atypical features such as koebnerization and palmo-plantar involvement occurred. She presented with tense, clear fluid-filled vesicles, bullae, and erosions all over her body, especially on the palms and soles, with some lesions showing a string-of-pearls appearance. The lesions were preceded by pruritus, and the patient had changed her anti-hypertensive medication from telmisartan to telmisartan-amlodipine for previous 10 days. Skin biopsy and direct immunofluorescence testing confirmed LAD. During the hospital stay, along with new crops of lesions, a few vesicles were present along the lines where she had scratched and the band of tight elastic sleeves of the sterile gown she wore, which is suggestive of koebnerization. Knowing the atypical manifestations of drug-induced LAD may aid clinicians in determining an early diagnosis, and LAD should be an important consideration in the differential diagnosis of vesiculobullous disease with palmar-plantar involvement. Amlodipine is a commonly used anti-hypertensive drug, so knowledge of its potential to cause this disease is important. Furthermore, knowing the potential for koebnerization, avoidance of trauma and the gentle handling of these patients can lead to early recovery from this self-limiting disease.\n\nKeywords\nAmlodipidelinear IgA diseasedrug-induced eruptionvesiculo-bullous disorders\n==== Body\nIntroduction\nLinear immunoglobulin A (IgA) disease (LAD) is a rare autoimmune, sub-epidermal vesicular-bullous disease. Patients may exhibit widely scattered muco-cutaneous lesions or expanding annular plaques arranged in a cluster-of-jewels pattern (Cauza et al., 2004). LAD is either spontaneous or drug-induced (Gottlieb et al., 2017). Among the drug-induced cases, vancomycin (VCM) has been the most frequently reported as the culprit drug (Whitworth et al., 1996), but amlodipine has also been identified in rare instances (Low et al., 2012). Drug-related LAD has been associated with rapid onset, significantly more atypical and severe forms, with koebnerization, palmoplantar involvement, positive Nikolskiy sign, and erosions that mimic toxic epidermal necrolysis (Chanal et al., 2013). We present a case of a patient with rare and atypical clinical features in drug-induced LAD.\n\nCase synopsis\nA 49-year-old woman presented with complaints of multiple fluid-filled lesions for 5 to 6 days, which were preceded by mild pruritus, and appeared first on the back and progressed to involve the entire body over next 3 to 4 days. The patient had a history of intake of telmisartan for hypertension for 1 year, and a recent change to telmisartan-amlodipine for the previous 10 days. There was no other drug intake or positive history.\n\nA physical examination revealed tense, clear, fluid-filled vesicles, bullae, and erosions distributed over the face, trunk, buttocks, and bilateral upper and lower limbs. Similar lesions were also seen on the palms and soles (Fig. 1). Multiple polycyclic lesions with central crusting and a marginal rim of vesicles were observed, forming a classic string-of-pearls appearance (Fig. 2). Similar lesions with marginal activity were also present on the vermillion border of the lips and the periorbital region. These were present either on normal-looking or erythematous skin. There was no mucosal involvement.Fig. 1 Typical lesions on the palms and sole.\n\nFig. 1Fig. 2 String-of-pearls appearance.\n\nFig. 2\n\nDuring the hospital stay, the patient developed crops of new lesions. Interestingly, few of these vesicles were present in a linear pattern on the arms along lines of scratching, as well as along the band of tight elastic sleeves of the sterile gown worn by the patient, which was highly suggestive of koebnerization (Fig. 3).Fig. 3 Koebnerization at the (A) initial stage and (B) after evolution.\n\nFig. 3\n\nA skin biopsy was performed, and the histopathology test results of the lesion showed a typical subepidermal blister with predominant neutrophillic infiltrate and few eosinophils, but perilesional direct immunofluorescence showed linear deposition of IgA at the basement membrane zone. Thus, a diagnosis of LAD was made. Indirect immunofluorescence was not performed, because this was a limited-resource, government-run setting, but could have helped rule out a relatively rare entity, such as IgA epidermolysis bullosa acquisita. All other investigations tested normal, and the infection and malignancy screening results were negative.\n\nDue to the temporal correlation and absence of any other trigger, the onset of LAD was attributed to the introduction of the new drug, amlodipine. The medication was stopped immediately, and oral prednisolone (1 mg/kg) with dapsone (100 mg/day) was started, which led to a rapid resolution of the lesions within a week. Also, the patient was advised to wear loose clothing and avoid scratching, after which no new bullae developed over the next 2 weeks. Treatment with prednisolone was tapered and stopped in the following 2 months, but dapsone was continued for 6 months. Patient was followed every 6 months for a year after stopping treatment with dapsone, and there was no recurrence of the condition.\n\nCase discussion\nAmong the various drugs implicated, VCM is the most common. Other drugs include captopril, penicillin, ceftriaxone, sulphonamides, furosemide, lithium, phenytoin, carbamazepine, glibenclamide, atorvastatin, and non-steroidal anti-inflammatory drugs (Chanal et al., 2013, Pastuszczak et al., 2012). The mechanism of drug-induced LAD remains elusive, and two proteins (i.e., 97-kD and 285-kD) in the basement membrane zone are potential antigens. Drugs may elicit an autoimmune response by acting as haptens, complexing or modifying proteins, and breaking self-tolerance to these antigens (Fortuna et al., 2012, Paul et al., 1997).\n\nIn a study utilizing sera from a typical case of VCM-induced LAD, co-incubation with VCM resulted in linear IgA deposition at the basement membrane zone by indirect immunofluorescence, which indicates that COL7 is a target autoantigen in VCM-induced LAD, and VCM mediates IgA autoreactivity against COL7 (Yamagami et al., 2018). The lesions in drug-induced LAD can occur as rapidly as within 24 hours to 780 days after initiation of medication (Fortuna et al., 2012).\n\nIn our patient, LAD occurred with amlodipine, and a rash appeared 10 days after starting the drug. A similar pathomechanism can also be attributed to amlodipine. Amlodipine is a very rare cause of such an eruption, and there has been only a single case report of amlodipine-induced LAD in the literature where the rash began after 7 days (Low et al., 2012). Other amlodipine-induced presentations include bullous pemphigoid, erythematic multiforme, alopecia, peripheral edema, and angio-edema (Low et al., 2012).\n\nIrrespective of etiology, LAD has a predilection for the trunk, and only a few patients have presented with involvement of the palmar-plantar surfaces. These patients had either a generalized eruption with prominent palmar-plantar or sole involvement (Cauza et al., 2004, Norris et al., 2015, Walsh et al., 2009). The majority of these patients had drug-induced LAD, which substantiates the observation that such atypical clinical features are common in this subtype. Of note, LAD should be an important consideration in the differential diagnosis of vesiculobullous disease with palmar-plantar involvement.\n\nThe Koebner phenomenon is the development of isomorphic pathologic lesions in traumatized uninvolved skin (Kuner et al., 2003). Our patient developed linear lesions at the sites of the tight sleeves of the sterile gowns she wore, as well as along the lines of where she scratched her arms. This has been seldom seen in LAD. Document VCM-induced LAD cases show occurrences of koebnerization at sites of adhesive placement on the skin (McDonald et al., 2010) and scar sites of cardiac surgery on the abdomen (Mori and Yamamoto, 2013), but metronidazole and hyoscine-N-butylbromide-induced LAD had evidence of koebnerization as reported in one case (Rashid Dar and Raza, 2008).\n\nOur findings are consistent with those of previously reported cases in the literature, and strengthen this association. Among various hypotheses, one is that traumatized epidermis may express antigens or expose new epitopes (Mori and Yamamoto, 2013). Another hypothesis is that the development of new lesions could be due to increased blood flow in areas of scratching due to trauma and friction, thus bringing in more auto-antibodies to the site (Rashid Dar and Raza, 2008). Moreover, since our patient had palmoplantar involvement, the koebnerization phenomena can be speculated to have led to the development of blisters in acral areas as well.\n\nDrug-induced LAD is usually expected to rapidly resolve after withdrawal from the offending agent, but additional systemic therapy such as corticosteroid or other immunosuppressive drugs may be required. Furthermore, care should also be taken for gentle skin handling, loose clothing, or avoiding the use of tapes and adhesives, when possible, to avoid koebnerization.\n\nThe atypical features in our case can be substantiated by the fact that in one series, in comparison with spontaneous LAD, drug-induced LAD was characterized by a significantly more atypical and severe form (Chanal et al., 2013). This knowledge of atypical manifestations may aid clinicians with an early diagnosis and intervention when suspecting such disorders. Also, amlodipine is a commonly used hypertensive agent, and knowing its potential to cause this vesiculo-bullous disease is important. Furthermore, the significance of koebnerization in drug-induced LAD implies that an avoidance of trauma and the gentle handling of these patients can lead to an early recovery from this self-limiting disease.\n\n☆ Conflicts of interest: The authors have no conflicts of interest to disclose.\n==== Refs\nReferences\nCauza K. Hinterhuber G. Sterniczky B. Brugger K. Pieczkowski F. Karlhofer F. Unusual clinical manifestation of linear IgA dermatosis: A report of two cases J Am Acad Dermatol 51 2 2004 112 117 \nChanal J. Ingen-Housz-Oro S. Ortonne N. Duong T.A. Thomas M. Valeyrie-Allanore L. Linear IgA bullous dermatosis: comparison between the drug-induced and spontaneous forms Br J Dermatol 169 5 2013 1041 1048 23815152 \nFortuna G. Salas-Alanis J.C. Guidetti E. Marinkovich M.P. Acritical reappraisal of the current data on drug-induced linearimmunoglobulin A bullous dermatosis: a real and separate nosological entity? J Am Acad Dermatol 66 2012 988 994 22169257 \nGottlieb J. Ingen-Housz-Oro S. Alexandre M. Grootenboer-Mignot S. Aucouturier F. Sbidian E. Idiopathic linear IgA bullous dermatosis: prognostic factors based on a case series of 72 adults Br J Dermatol 177 1 2017 212 222 27995619 \nKuner N. Hartschuh W. Khan-Durani B. Heinrich Kobner and the \"isomorphic phenomenon\". History and review of the literature Hautarzt 54 3 2003 274 278 12634998 \nLow L. Zaheri S. Wakelin S. Amlodipine-induced linear IgA disease Clin Exp Dermatol 37 6 2012 649 651 22299719 \nMcDonald H.C. York N.R. Pandya A.G. Drug-induced linear IgA bullous dermatosis demonstrating the isomorphic phenomenon J Am Acad Dermatol 62 5 2010 897 898 20398825 \nMori T. Yamamoto T. Vancomycin-induced linear IgA bullous dermatosis with isomorphic response Dermatol Online 4 3 2013 619 620 \nNorris I.N. Haeberle M.T. Callen J.P. Malone J.C. Generalized linear IgA dermatosis with palmar involvement Dermatol Online J 21 9 2015 \nPastuszczak M. Lipko-Godlewska S. Jaworek A.K. Wojas-Pelc A. Drug-induced linear IgA bullous dermatosis after discontinuation of cefuroxime axetil treatment J Dermatol Case Rep 6 4 2012 117 119 23329991 \nPaul C. Wolkenstein P. Prost C. Caux F. Rostoker G. Heller M. Drug-induced linear IgA disease: Target antigens are heterogenous Br J Dermatol 136 1997 406 411 9115927 \nRashid Dar N. Raza N. Drug induced linear IgA disease with unusual features: Koebner phenomenon, local insulin sensitivity and annular blister of the nipples Acta Dermatovenerol Croat 16 4 2008 215 217 19111146 \nWalsh S.N. Kerchner K. Sangueza O.P. Localized palmar vancomycin-induced linear IgA bullous dermatosis occurring at supratherapeutic levels Arch Dermatol 145 5 2009 603 604 19451516 \nWhitworth J.M. Thomas I. Peltz S.A. Sullivan B.C. Wolf A.H. Cytryn A.S. Vancomycin-induced linear IgA bullous dermatosis (LABD) J Am Acad Dermatol 34 1996 890 891 8621822 \nYamagami J. Nakamura Y. Nagao K. Funakoshi T. Takahashi H. Tanikawa A. Vancomycin mediates IgA autoreactivity in drug-induced linear IgA bullous dermatosis J Invest Dermatol 138 7 2018 1473 1480 29410066\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2352-6475", "issue": "5(2)", "journal": "International journal of women's dermatology", "keywords": "Amlodipide; drug-induced eruption; linear IgA disease; vesiculo-bullous disorders", "medline_ta": "Int J Womens Dermatol", "mesh_terms": null, "nlm_unique_id": "101654170", "other_id": null, "pages": "92-95", "pmc": null, "pmid": "30997380", "pubdate": "2019-06", "publication_types": "D002363:Case Reports", "references": "12634998;15280828;19111146;19451516;20398825;22169257;22299719;23329991;23815152;26437279;27995619;29410066;8621822;9115927", "title": "An array of unusual clinical features in a woman with amlodipine-induced linear immunoglobulin A disease.", "title_normalized": "an array of unusual clinical features in a woman with amlodipine induced linear immunoglobulin a disease" }
[ { "companynumb": "IN-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2019-BI-005821", "fulfillexpeditecriteria": "1", "occurcountry": "IN", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "AMLODIPINE BESYLATE\\TELMISARTAN" ...
{ "abstract": "Intravitreal injection of conbercept (IVC) is the latest applied treatment that could be used in retinopathy of prematurity (ROP) patients. The structural outcomes and recurrence of ROP among patients treated with IVC or intravitreal injection of ranibizumab (IVR) were compared.\n\n\n\nA consecutive case series of ROP treated with IVC or IVR were retrospectively studied. The primary outcome was treatment success defined as regression of plus disease. The secondary outcomes were recurrence of plus, times of injection, and the final regression of disease.\n\n\n\nA total of 48 eyes (24 patients) with ROP were included. Twenty eyes (10 patients) received IVC, and 28 eyes (14 patients) received IVR. For the IVC group, 18 eyes had Zone II 3+ ROP and 2 eyes had aggressive posterior ROP. Among the 28 eyes treated with IVR, 6 eyes had Zone I 2/3+ ROP, 6 eyes had aggressive posterior ROP, and 16 eyes had Zone II 3+ ROP. For the IVC group, the mean gestational age, birth weight, postmenstrual age at initial treatment, and follow-up period for the infants were 29.49 ± 1.37 weeks, 1,369.0 ± 161.9 g, 38.47 ± 2.72 weeks, and 52.6 ± 21.4 weeks, respectively. And for the infants who received IVR, these were 28.35 ± 1.62 weeks, 1,171.4 ± 279.9 g, 38.53 ± 3.54 weeks, and 42.9 ± 9.8 weeks, respectively. For the IVC group, 17 (85%) of 20 eyes received the injection only once, and the regression of plus disease occurred 4.3 ± 2.08 weeks later. Three eyes (15%) did not healed with one injection received a second IVC, and the regression of plus disease occurred within 3 weeks. For the IVR group, 15/28 (53.6%) eyes received a second IVR. Among them, 10 recurrent eyes and 5 eyes did not recover with one injection. No retinal detachment was observed in both group infants.\n\n\n\nBoth conbercept and ranibizumab are effective choice for the treatment of ROP. Conbercept is a novel effective treatment strategy for ROP providing a new treatment option for ophthalmologists.", "affiliations": "Department of Ophthalmology, Ophthalmology & Optometry Center, Peking University People's Hospital, Beijing Key Laboratory of Diagnosis and Therapy of Retinal and Choroid Diseases, Beijing, China.", "authors": "Jin|Enzhong|E|;Yin|Hong|H|;Li|Xiaoxin|X|;Zhao|Mingwei|M|", "chemical_list": "D011993:Recombinant Fusion Proteins; C527363:KH902 fusion protein; D000069579:Ranibizumab", "country": "United States", "delete": false, "doi": "10.1097/IAE.0000000000001763", "fulltext": null, "fulltext_license": null, "issn_linking": "0275-004X", "issue": "38(8)", "journal": "Retina (Philadelphia, Pa.)", "keywords": null, "medline_ta": "Retina", "mesh_terms": "D005260:Female; D006801:Humans; D007231:Infant, Newborn; D007234:Infant, Premature; D058449:Intravitreal Injections; D008297:Male; D000069579:Ranibizumab; D011993:Recombinant Fusion Proteins; D012008:Recurrence; D012178:Retinopathy of Prematurity; D012189:Retrospective Studies", "nlm_unique_id": "8309919", "other_id": null, "pages": "1595-1604", "pmc": null, "pmid": "28699927", "pubdate": "2018-08", "publication_types": "D016428:Journal Article", "references": null, "title": "SHORT-TERM OUTCOMES AFTER INTRAVITREAL INJECTIONS OF CONBERCEPT VERSUS RANIBIZUMAB FOR THE TREATMENT OF RETINOPATHY OF PREMATURITY.", "title_normalized": "short term outcomes after intravitreal injections of conbercept versus ranibizumab for the treatment of retinopathy of prematurity" }
[ { "companynumb": "CN-ROCHE-2648355", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "RANIBIZUMAB" }, "drugadditional": "3", "drug...
{ "abstract": "BACKGROUND\nPatients with early-stage, nonbulky classic Hodgkin lymphoma (cHL) undergo intensive posttreatment radiologic surveillance despite having a low risk of disease recurrence. The current study attempted to evaluate the risk of disease recurrence and the value of radiologic surveillance in patients treated with the combination of doxorubicin, bleomycin, vinblastine, and dacarbazine (ABVD) alone who achieved a complete remission (CR) as noted on posttreatment positron emission tomography (PET).\n\n\nMETHODS\nForty-seven patients who underwent therapy with interim and/or posttreatment PET scans were evaluated for disease recurrence during ≥ 24 months of follow-up. Their presenting characteristics and imaging results were assessed and interpreted in relation to clinical outcome.\n\n\nRESULTS\nAll 47 patients were eligible for analysis. The majority of patients were female (35 patients) with a median age of 28 years (range, 17 years-65 years.). The nodular sclerosing subtype was the predominant histology (41 patients). A total of 34 patients were staged with IIA disease, 6 with IA disease, 6 with IIB disease, and 1 with IIEA disease (lung) (according to Cotswolds modification of the Ann Arbor staging system). All patients completed 6 cycles of planned ABVD therapy and achieved a CR. Two had a positive PET scan (1 interim scan and 1 posttreatment scan); both were biopsy-proven sarcoidosis. Two patients developed disease recurrence at 7 months and 24 months, respectively, after negative interim and posttreatment imaging. One case of recurrence was identified through surveillance imaging and the other was identified simultaneously by the patient and surveillance scan. A total of 45 patients experienced a durable CR; 21 had additional unscheduled imaging/workup during surveillance to investigate symptoms or imaging signs of concern.\n\n\nCONCLUSIONS\nBecause of a low risk of disease recurrence, posttreatment radiologic surveillance appears to be unnecessary in patients with early-stage, nonbulky (CD20 negative) cHL who achieve a PET-detected CR with the ABVD combination alone. This will reduce cumulative radiation exposure and health care costs in a predominantly young patient population.", "affiliations": "Department of Medicine, Memorial Sloan-Kettering Cancer Center, New York, New York 10065, USA.", "authors": "Hartridge-Lambert|Sidonie K|SK|;Schöder|Heiko|H|;Lim|Remy C|RC|;Maragulia|Jocelyn C|JC|;Portlock|Carol S|CS|", "chemical_list": "D019788:Fluorodeoxyglucose F18; D001761:Bleomycin; D014747:Vinblastine; D003606:Dacarbazine; D004317:Doxorubicin", "country": "United States", "delete": false, "doi": "10.1002/cncr.27873", "fulltext": null, "fulltext_license": null, "issn_linking": "0008-543X", "issue": "119(6)", "journal": "Cancer", "keywords": null, "medline_ta": "Cancer", "mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D001761:Bleomycin; D003606:Dacarbazine; D018572:Disease-Free Survival; D004317:Doxorubicin; D005260:Female; D019788:Fluorodeoxyglucose F18; D006689:Hodgkin Disease; D006801:Humans; D008297:Male; D008875:Middle Aged; D049268:Positron-Emission Tomography; D011379:Prognosis; D011834:Radiation Monitoring; D011859:Radiography; D012008:Recurrence; D012074:Remission Induction; D016896:Treatment Outcome; D014747:Vinblastine; D055815:Young Adult", "nlm_unique_id": "0374236", "other_id": null, "pages": "1203-9", "pmc": null, "pmid": "23132361", "pubdate": "2013-03-15", "publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "ABVD alone and a PET scan complete remission negates the need for radiologic surveillance in early-stage, nonbulky Hodgkin lymphoma.", "title_normalized": "abvd alone and a pet scan complete remission negates the need for radiologic surveillance in early stage nonbulky hodgkin lymphoma" }
[ { "companynumb": "US-JNJFOC-20130313793", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "DOXORUBICIN" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nIncontinentia pigmenti is a rare X-linked neurocutaneous disorder that can present in the neonatal period with seizures and encephalopathy. Brain magnetic resonance imaging and magnetic resonance angiography may reveal cerebral infarction and arteriopathy.\n\n\nMETHODS\nWe describe a neonate with the typical rash of incontinentia pigmenti along with seizures and brain magnetic resonance imaging abnormalities.\n\n\nRESULTS\nBrain magnetic resonance imaging, magnetic resonance angiography, and magnetic resonance spectroscopy at age one week revealed chronic and acute brain injury, arteriopathy of the small and medium-sized cerebral vessels, and elevation of a lactate metabolite peak. By age six months, her magnetic resonance angiogram had normalized. At age 2.5 years, she has well-controlled complex partial seizures, global developmental delay, and residual hemiplegia.\n\n\nCONCLUSIONS\nDespite extensive cerebral arteriopathy in association with incontinentia pigmenti, this girl had a relatively stable early clinical course, steady developmental progress over time, and seizures that have been well controlled. Later brain imaging revealed resolution of the arteriopathy.", "affiliations": "Department of Pediatrics, University of Arkansas for Medical Sciences, Little Rock, Arkansas. Electronic address: MulkeySarah@uams.edu.;Department of Radiology, University of Arkansas for Medical Sciences, Little Rock, Arkansas.;Department of Pediatrics, University of Arkansas for Medical Sciences, Little Rock, Arkansas.", "authors": "Mulkey|Sarah B|SB|;Ramakrishnaiah|Raghu H|RH|;Balmakund|Tonya M|TM|", "chemical_list": null, "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0887-8994", "issue": "54()", "journal": "Pediatric neurology", "keywords": "arteriopathy; incontinentia pigmenti; neonatal seizures; newborn; stroke", "medline_ta": "Pediatr Neurol", "mesh_terms": "D001921:Brain; D002539:Cerebral Arterial Diseases; D002675:Child, Preschool; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D007184:Incontinentia Pigmenti; D007223:Infant; D007231:Infant, Newborn; D018810:Magnetic Resonance Angiography; D008279:Magnetic Resonance Imaging; D009682:Magnetic Resonance Spectroscopy", "nlm_unique_id": "8508183", "other_id": null, "pages": "76-81", "pmc": null, "pmid": "26706482", "pubdate": "2016-01", "publication_types": "D002363:Case Reports; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural", "references": "15956533;14580659;18241293;20615640;21397174;25371735;17950640;12975158;23180410;23079196;18065513;7735415;19151364;23406512;11966763;22864149;25238668;1267462;24682289;13679126;12351572", "title": "Cerebral Arteriopathy in a Newborn With Incontinentia Pigmenti.", "title_normalized": "cerebral arteriopathy in a newborn with incontinentia pigmenti" }
[ { "companynumb": "US-UCBSA-2016003261", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "LEVETIRACETAM" }, "drugadditional": null, ...
{ "abstract": "OBJECTIVE\nThis single-center study evaluated the effect of comorbidities on progression-free and overall survival in elderly patients with glioblastoma multiforme (GBM).\n\n\nMETHODS\nComorbid conditions were identified in each patient with the modified version of the cumulative illness rating scale (CIRS).\n\n\nRESULTS\nTotal of 118 patients with GBM were enrolled. An age of >75 years at diagnosis, high CIRS, comorbidity index and performance status play a predictive role on survival.\n\n\nCONCLUSIONS\nComorbidities play an important prognostic role in elderly patients with GBM, a factor too often neglected in clinical practice. If the prognostic role of comorbidity measured by CIRS on outcome will be confirmed, it would be interesting to add it in the algorithm for treatment choice in elderly GBM patients.", "affiliations": "Neuro-Oncology Unit, 'Regina Elena' National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy.;Neuro-Oncology Unit, 'Regina Elena' National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy.;Division of Neurosurgery, 'Regina Elena' National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy.;Biostatistic Unit, Scientific Direction, 'Regina Elena' National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy.;Service of Neuroradiology, 'Regina Elena' National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy.;Division of Medical Oncology, 'Regina Elena' National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy.;Neurology Unit, 'Azienda Ospedaliera Universitaria Integrata' Piazzale Aristide Stefani 1, 37126 Verona, Italy.;Division of Neurosurgery, 'Regina Elena' National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy.;Radiotherapy Unit, 'Regina Elena' National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy.;Division of Neuropathology, 'Regina Elena' National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy.;Division of Neuropathology, 'Regina Elena' National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy.;Division of Neurosurgery, 'Regina Elena' National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy.;Neuro-Oncology Unit, 'Regina Elena' National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy.", "authors": "Villani|Veronica|V|;Tanzilli|Antonio|A|;Telera|Stefano M|SM|;Terrenato|Irene|I|;Vidiri|Antonello|A|;Fabi|Alessandra|A|;Zucchella|Chiara|C|;Carapella|Carmine M|CM|;Marucci|Laura|L|;Casini|Beatrice|B|;Carosi|Mariantonia|M|;Oppido|Piero M|PM|;Pace|Andrea|A|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.2217/fon-2018-0524", "fulltext": null, "fulltext_license": null, "issn_linking": "1479-6694", "issue": "15(8)", "journal": "Future oncology (London, England)", "keywords": "comorbidities; elderly; glioblastoma; progression-free survival; survival", "medline_ta": "Future Oncol", "mesh_terms": "D000367:Age Factors; D000368:Aged; D000369:Aged, 80 and over; D001932:Brain Neoplasms; D015897:Comorbidity; D005260:Female; D005909:Glioblastoma; D006801:Humans; D008297:Male; D011379:Prognosis; D000077982:Progression-Free Survival; D016019:Survival Analysis", "nlm_unique_id": "101256629", "other_id": null, "pages": "841-850", "pmc": null, "pmid": "30656982", "pubdate": "2019-03", "publication_types": "D016428:Journal Article", "references": null, "title": "Comorbidities in elderly patients with glioblastoma: a field-practice study.", "title_normalized": "comorbidities in elderly patients with glioblastoma a field practice study" }
[ { "companynumb": "IT-TEVA-2019-IT-1040602", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "TEMOZOLOMIDE" }, "drugadditional": "3", ...
{ "abstract": "BACKGROUND\nDRESS syndrome is a severe adverse drug reaction with visceral involvement. Its physiopathology includes immunological disorders associated with human herpes virus (HHV) reactivation. We report two cases of auto-immune thyroiditis occurring in the context of DRESS syndrome associated with HHV-6 reactivation.\n\n\nMETHODS\nCase 1 : A 39-year-old woman presented DRESS syndrome with HHV-6 reactivation, cutaneous, lymph node, hepatic and renal disorders treated with systemic corticosteroids for 10 months. Following discontinuation of the corticosteroids, she developed Graves's disease, which was stabilized with carbimazole and a beta-blocker. CASE 2: A 31-year-old woman was hospitalized for DRESS syndrome with delayed HHV-6 reactivation and severe hepatic involvement. She was successfully treated by topical steroids. Six weeks later, she presented De Quervain thyroiditis associated with moderate relapsing DRESS, which were treated by sodium levothyroxine and topical steroids.\n\n\nCONCLUSIONS\nThere is currently debate about the implication of viral reactivation, in particular HHV-6, in chronic DRESS, relapse and development of auto-immune diseases. These observations highlight the potential risk of patients developing auto-immune diseases and underline the need for prolonged clinical and laboratory follow-up of patients with DRESS.", "affiliations": "Service de dermatologie, hôpital Henri-Mondor, université Paris XII, centre de référence des maladies bulleuses immunologiques et toxiques, 51, avenue du Maréchal-de-Lattre-de-Tassigny, 94010 Créteil, France. elisa.funckbrentano@gmail.com", "authors": "Funck-Brentano|E|E|;Duong|T|T|;Family|D|D|;Bouaziz|J-D|JD|;Ortonne|N|N|;Bagot|M|M|;Roujeau|J-C|JC|;Wolkenstein|P|P|;Valeyrie-Allanore|L|L|", "chemical_list": "D000305:Adrenal Cortex Hormones; D000319:Adrenergic beta-Antagonists; D014580:Ursodeoxycholic Acid; D002231:Carbimazole; D013974:Thyroxine", "country": "France", "delete": false, "doi": "10.1016/j.annder.2011.01.048", "fulltext": null, "fulltext_license": null, "issn_linking": "0151-9638", "issue": "138(8-9)", "journal": "Annales de dermatologie et de venereologie", "keywords": null, "medline_ta": "Ann Dermatol Venereol", "mesh_terms": "D000305:Adrenal Cortex Hormones; D000319:Adrenergic beta-Antagonists; D000328:Adult; D018771:Arthralgia; D002231:Carbimazole; D003875:Drug Eruptions; D004802:Eosinophilia; D005260:Female; D006111:Graves Disease; D006525:Hepatitis, Viral, Human; D015654:Herpesvirus 6, Human; D006801:Humans; D019349:Roseolovirus Infections; D013577:Syndrome; D013968:Thyroiditis, Subacute; D013974:Thyroxine; D014580:Ursodeoxycholic Acid; D014775:Virus Activation", "nlm_unique_id": "7702013", "other_id": null, "pages": "580-5", "pmc": null, "pmid": "21893231", "pubdate": "2011", "publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article", "references": null, "title": "Auto-immune thyroiditis and drug reaction with eosinophilia and systemic symptoms (DRESS) associated with HHV-6 viral reactivation.", "title_normalized": "auto immune thyroiditis and drug reaction with eosinophilia and systemic symptoms dress associated with hhv 6 viral reactivation" }
[ { "companynumb": "FR-MYLANLABS-M-EU-2011110227", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "TRAMADOL" }, "drugadditional": "3", ...
{ "abstract": "BACKGROUND\nResistance to trastuzumab in breast cancer is an ongoing challenge. Clinical and biological effects of co-targeting HER2 and mammalian target of rapamycin (mTOR) in patients with HER2-positive early operable breast cancer via the addition of everolimus to preoperative trastuzumab were evaluated in a phase II randomised study.\n\n\nMETHODS\nPatients were randomised 1:1 to receive trastuzumab (4 mg/kg initial dose then 2 mg/kg weekly for 5 weeks) alone or combined with everolimus (10 mg/day for 6 weeks) and then underwent surgery. Tumours were assessed by clinical examination and echography at the baseline and on treatment. The primary end-point was the clinical response rate at 6 weeks. Pathological response and safety were also evaluated. Baseline and surgery tumour samples were assessed by immunohistochemistry and multiplex immunoanalysis for predictive downstream effectors of the PI3K/AKT/mTOR and MAP kinase (MAPK) pathways.\n\n\nRESULTS\nEighty-two patients were enrolled, 41 per arm. The clinical response rates were 34.1% and 43.9% with trastuzumab alone and combined with everolimus, respectively. Pathological response rates were 43.6% and 47.5%, respectively. Addition of everolimus increased toxicity, notably mucositis (82.5% versus 5.0%) and rash (57.5% versus 10.0%), but grade III/IV events were rare. No correlation between response to treatments and baseline candidate biomarkers was identified, except for PIK3CA mutations which were found to predict trastuzumab resistance. Significant changes were seen in several MAPK pathway effectors after combination therapy.\n\n\nCONCLUSIONS\nThe addition of everolimus did not improve the efficacy, but induced MAPK signalling. Combination therapy to overcome pathway cross-talk should be considered to maximise the effectiveness of trastuzumab in this setting. ClinicalTrial.gov Identifier NCT00674414.", "affiliations": "Department of Medical Oncology/ Cancer Research Center UMR-INSERM U892/CNRS 6299/ Bioinformatics Unit, Institut de Cancérologie de L'Ouest, Nantes, France.;Department of Medical Oncology, Centre Léon Bérard, INSERM U1052, Lyon, France.;Department of Pathology and Biopathology, Centre Léon Bérard, Lyon, France.;Department of Medicine, Gustave Roussy, Villejuif, France.;Methodology and Biostatistics Unit, Institut de Cancérologie de Lorraine, Vandoeuvre-Les-Nancy, France.;Oncology Data Factory and Analytics, Institut de Cancérologie de L'Ouest, Nantes, France.;Department of Medicine, Gustave Roussy, Villejuif, France.;Department of Pathology, Hôpital G&R Laënnec, St. Herblain, France.;Genomic Platform-Cancer Research Center of Lyon, Centre Léon Bérard, Lyon, France.;Department of Medical Oncology, Centre Oscar Lambret, Lille, France.;R&D Unicancer, UNICANCER, Paris, France.;Department of Medical Oncology, Institut de Cancérologie de Lorraine, Vandoeuvre-les-Nancy, France.;Department of Medical Oncology, Institut Curie, Paris, France.;Department of Biopathology, Institut de Cancérologie de Lorraine, Université de Lorraine, CNRS UMR 7039, CRAN, Vandoeuvre-Les-Nancy, France.;François Rabelais University, CNRS, UMR 7292, Genetics, Immunotherapy, Chemistry and Cancer, Tours, France.;Radio-Pharmacology Department, Institut Curie-Hôpital Rene Huguenin, Saint-Cloud, France.;Department of Medicine, Gustave Roussy, Villejuif, France.;Department of Biopathology, Institut de Cancérologie de Lorraine, Université de Lorraine, CNRS UMR 7039, CRAN, Vandoeuvre-Les-Nancy, France.;Department of Biopathology, Institut de Cancérologie de Lorraine, Université de Lorraine, CNRS UMR 7039, CRAN, Vandoeuvre-Les-Nancy, France. Electronic address: jl.merlin@nancy.unicancer.fr.", "authors": "Campone|Mario|M|;Bachelot|Thomas|T|;Treilleux|Isabelle|I|;Pistilli|Barbara|B|;Salleron|Julia|J|;Seegers|Valérie|V|;Arnedos|Monica|M|;Loussouarn|Delphine|D|;Wang|Qing|Q|;Vanlemmens|Laurence|L|;Jimenez|Marta|M|;Rios|Maria|M|;Diéras|Véronique|V|;Leroux|Agnès|A|;Paintaud|Gilles|G|;Rezai|Keyvan|K|;André|Fabrice|F|;Lion|Maëva|M|;Merlin|Jean-Louis|JL|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1016/j.ejca.2021.09.017", "fulltext": null, "fulltext_license": null, "issn_linking": "0959-8049", "issue": "158()", "journal": "European journal of cancer (Oxford, England : 1990)", "keywords": "Biomarker; Everolimus; HER2+ breast cancer; PI3K/AKT/mTOR; Trastuzumab", "medline_ta": "Eur J Cancer", "mesh_terms": null, "nlm_unique_id": "9005373", "other_id": null, "pages": "169-180", "pmc": null, "pmid": "34678678", "pubdate": "2021-10-19", "publication_types": "D016428:Journal Article", "references": null, "title": "A phase II randomised study of preoperative trastuzumab alone or combined with everolimus in patients with early HER2-positive breast cancer and predictive biomarkers (RADHER trial).", "title_normalized": "a phase ii randomised study of preoperative trastuzumab alone or combined with everolimus in patients with early her2 positive breast cancer and predictive biomarkers radher trial" }
[ { "companynumb": "FR-NOVARTISPH-NVSC2021FR266725", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "EVEROLIMUS" }, "drugadditional": null, ...
{ "abstract": "Obstetricians infrequently encounter conjoined twins. Much of the clinical care literature focuses on postnatal management from a neonatology and pediatric surgery perspective; guidance on obstetrical management is limited. We outline steps for prenatal evaluation, obstetrical care, and delivery planning.\n\n\n\nExperiences with two cases of conjoined twins.\n\n\n\nWe identified several points throughout the planning, delivery, and postnatal process that are important to highlight for optimizing clinical outcome, patient safety, and parental satisfaction.\n\n\n\nAfter diagnosis, patients should be referred to a center experienced in the management of conjoined twins. Specialists in fields including maternal fetal medicine, pediatric surgery, neonatology, and radiology play a vital role in the management of these patients. Early referral allows for timely family counseling and decision-making. Prenatal evaluation beyond the first trimester should include a detailed ultrasound, fetal echocardiogram, and fetal MRI. 3D printed life-sized models can improve delivery planning and patient understanding.", "affiliations": "Department of Obstetrics and Gynecology, University of Michigan, Ann Arbor, MI, USA. psszmal@med.umich.edu.;Department of Obstetrics and Gynecology, University of Michigan, Ann Arbor, MI, USA.;Department of Pediatrics, University of Michigan, Ann Arbor, MI, USA.;Department of Pediatrics, University of Michigan, Ann Arbor, MI, USA.;Department of Pediatrics, University of Michigan, Ann Arbor, MI, USA.;Department of Surgery, University of Michigan, Ann Arbor, MI, USA.;Department of Obstetrics and Gynecology, University of Michigan, Ann Arbor, MI, USA.;Department of Obstetrics and Gynecology, University of Michigan, Ann Arbor, MI, USA.", "authors": "Greco|Patricia S|PS|http://orcid.org/0000-0002-3347-1445;Pitts|D'Angela|D|;Weadock|William J|WJ|http://orcid.org/0000-0002-1414-4553;Ladino-Torres|Maria|M|;Laventhal|Naomi T|NT|http://orcid.org/0000-0002-8110-7621;Mychaliska|George|G|;Treadwell|Marjorie C|MC|;Carver|Alissa|A|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1038/s41372-021-01107-5", "fulltext": null, "fulltext_license": null, "issn_linking": "0743-8346", "issue": "41(10)", "journal": "Journal of perinatology : official journal of the California Perinatal Association", "keywords": null, "medline_ta": "J Perinatol", "mesh_terms": "D002648:Child; D005260:Female; D006801:Humans; D011247:Pregnancy; D011261:Pregnancy Trimester, First; D011295:Prenatal Care; D014428:Twins, Conjoined; D014463:Ultrasonography; D016216:Ultrasonography, Prenatal", "nlm_unique_id": "8501884", "other_id": null, "pages": "2424-2431", "pmc": null, "pmid": "34158580", "pubdate": "2021-10", "publication_types": "D016428:Journal Article", "references": "17767883;21905053;9770956;26461924", "title": "Conjoined twins: an obstetrician's guide to prenatal care and delivery management.", "title_normalized": "conjoined twins an obstetrician s guide to prenatal care and delivery management" }
[ { "companynumb": "US-ORGANON-O2111USA000504", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "BETAMETHASONE ACETATE\\BETAMETHASONE SODIUM PHOSPHATE" ...
{ "abstract": "Late-onset gemcitabine pulmonary toxicity is rare and association between pulmonary toxicity and radiotherapy to the extrapulmonary sites is controversial. Here, we report a case of acute exacerbated fatal interstitial pneumonia during radiotherapy to the extrapulmonary site. A 73-year-old woman with pelvic lymph node metastases from urothelial carcinoma underwent palliative radiotherapy after failure of gemcitabine-containing and gemcitabine-non-containing chemotherapy. Gemcitabine-containing chemotherapy had finished 13 months prior to the radiotherapy due to grade 3 pulmonary toxicity. During the course of radiotherapy to the pelvic lesion, she was complicated with fatal acute interstitial pneumonia even though the lung tissue was not irradiated. To the best of our knowledge, this is the first reported case of fatal gemcitabine-related pulmonary toxicity during radiotherapy for extrapulmonary lesion. Although the association between late-onset pulmonary toxicity and radiotherapy is controversial, caution should be paid to a patient with a history of gemcitabine-related pulmonary toxicity who will undergo radiotherapy even though the lung volume is not irradiated.", "affiliations": "Tokyo-Edogawa Cancer Center, Edogawa Hospital, 2-24-18 Higashikoiwa, Edogawa-ku, Tokyo, 133-0052 Japan.", "authors": "Hama|Yukihiro|Y|", "chemical_list": null, "country": "Singapore", "delete": false, "doi": "10.1007/s13691-016-0267-5", "fulltext": null, "fulltext_license": null, "issn_linking": "2192-3183", "issue": "6(1)", "journal": "International cancer conference journal", "keywords": "Adverse events; Immunogenic; Ionizing radiation; Pulmonary complications", "medline_ta": "Int Cancer Conf J", "mesh_terms": null, "nlm_unique_id": "101734231", "other_id": null, "pages": "35-37", "pmc": null, "pmid": "31149466", "pubdate": "2017-01", "publication_types": "D002363:Case Reports", "references": "11956096;12928125;15062597;15277266;15782312;16568459;19487963;21695101;23264910;23787994", "title": "Exacerbation of gemcitabine-related pneumonia during radiotherapy for extrapulmonary lesion.", "title_normalized": "exacerbation of gemcitabine related pneumonia during radiotherapy for extrapulmonary lesion" }
[ { "companynumb": "JP-ACCORD-048344", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "GEMCITABINE\\GEMCITABINE HYDROCHLORIDE" }, "drugadditi...
{ "abstract": "A 27-year-old male with HIV-associated naïve and high-risk Burkitt's lymphoma sequentially received short-term, high-dose non-myeloablative chemotherapy and autologous CD34-positive stem cell transfusion in the setting of combined antiretroviral therapy (cART). Prompt hematopoietic recovery was observed after 2 weeks and clinical remission from Burkitt's lymphoma within approximately 30 months after transplantation. The HIV RNA load was inhibited persistently, and drug resistance was not observed. The CD4+ T cell count approached 323 cells/μL in a recent follow-up study. This case suggests that the use of intensive non-myeloablative chemotherapy with transplantation, combined with antiretroviral therapy, in HIV-related naive and high-risk Burkitt's lymphoma was tolerated and safe.", "affiliations": "Yunnan Provincial Hospital of Infectious Diseases, Kunming, 650301, China.;The Third People's Hospital of Yunnan Province, Kunming, 650011, China.;Kunming General Hospital of Chengdu Military Region, Kunming, 650118, China.;Yunnan Provincial Hospital of Infectious Diseases, Kunming, 650301, China.;Beijing Cancer Hospital, Peking University, Beijing, 100142, China.;Beijing Cancer Hospital, Peking University, Beijing, 100142, China.;Yunnan Provincial Hospital of Infectious Diseases, Kunming, 650301, China.;Yunnan Provincial Hospital of Infectious Diseases, Kunming, 650301, China.;Yunnan Provincial Hospital of Infectious Diseases, Kunming, 650301, China.;Treatment and Research Centre for Infectious Disease, Beijing 302 Hospital, Beijing, 100039, China.;Treatment and Research Centre for Infectious Disease, Beijing 302 Hospital, Beijing, 100039, China.;Yunnan Provincial Hospital of Infectious Diseases, Kunming, 650301, China. wxch62597@foxmail.com.;Treatment and Research Centre for Infectious Disease, Beijing 302 Hospital, Beijing, 100039, China. xuruonan2004@aliyun.com.", "authors": "Min|Haiyan|H|;Yang|Jianwei|J|;Wang|Sanbin|S|;Tao|Pengfei|P|;Song|Yuqin|Y|;Wang|Xiaopei|X|;Li|Huiqin|H|;Yang|Xinping|X|;Dong|Xingqi|X|;Wang|Fu-Sheng|FS|;Shi|Ming|M|;Wang|Xicheng|X|;Xu|Ruonan|R|", "chemical_list": "D044966:Anti-Retroviral Agents", "country": "England", "delete": false, "doi": "10.1186/s13287-018-1089-5", "fulltext": "\n==== Front\nStem Cell Res TherStem Cell Res TherStem Cell Research & Therapy1757-6512BioMed Central London 108910.1186/s13287-018-1089-5Short ReportRemission of HIV-related naïve and high-risk Burkitt’s lymphoma treated by autologous stem cell transplantation plus cART Min Haiyan 454755295@qq.com 1Yang Jianwei mhyyjw@163.com 2Wang Sanbin 1204800896@qq.com 3Tao Pengfei 584842336@qq.com 1Song Yuqin songyuqin622@163.com 4Wang Xiaopei cadillac570@163.com 4Li Huiqin 787923852@qq.com 1Yang Xinping yxpkm@qq.com 1Dong Xingqi dongxq8001@126.com 1Wang Fu-Sheng fswang302@163.com 5Shi Ming shiming302@sina.com 5Wang Xicheng wxch62597@foxmail.com 1Xu Ruonan +86-13810461089xuruonan2004@aliyun.com 51 Yunnan Provincial Hospital of Infectious Diseases, Kunming, 650301 China 2 grid.440281.bThe Third People’s Hospital of Yunnan Province, Kunming, 650011 China 3 0000 0004 4903 1844grid.415551.1Kunming General Hospital of Chengdu Military Region, Kunming, 650118 China 4 0000 0001 2256 9319grid.11135.37Beijing Cancer Hospital, Peking University, Beijing, 100142 China 5 0000 0004 1764 3045grid.413135.1Treatment and Research Centre for Infectious Disease, Beijing 302 Hospital, Beijing, 100039 China 20 12 2018 20 12 2018 2018 9 3532 4 2018 9 11 2018 22 11 2018 © The Author(s). 2018Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.A 27-year-old male with HIV-associated naïve and high-risk Burkitt’s lymphoma sequentially received short-term, high-dose non-myeloablative chemotherapy and autologous CD34-positive stem cell transfusion in the setting of combined antiretroviral therapy (cART). Prompt hematopoietic recovery was observed after 2 weeks and clinical remission from Burkitt’s lymphoma within approximately 30 months after transplantation. The HIV RNA load was inhibited persistently, and drug resistance was not observed. The CD4+ T cell count approached 323 cells/μL in a recent follow-up study. This case suggests that the use of intensive non-myeloablative chemotherapy with transplantation, combined with antiretroviral therapy, in HIV-related naive and high-risk Burkitt’s lymphoma was tolerated and safe.\n\nKeywords\nHIVNaïveBurkitt’s lymphomaAutologous stem cell transplantationAntiretroviral therapyCD4+TThe Capital Characteristic Clinic ProjectZ161100000516011Wang Fu-Sheng issue-copyright-statement© The Author(s) 2018\n==== Body\nBackground\nAntiretroviral therapy (ART) has changed the outcome of patients with human immunodeficiency virus (HIV) infection by efficiently inhibiting virus replication, recovering the cluster of CD4+ T cell count, and reducing the risk of opportunistic infections [1]. However, HIV-associated adverse events will continue to occur in some patients despite ART, especially in those patients who never achieve complete immunological reconstitution.\n\nBurkitt’s lymphoma (BL) accounts for < 2% of the total cases of lymphoma in China. BL originates from a germinal center that is closely related to c-Myc rearrangement and infection with the Epstein–Barr virus (EBV). More than half of patients with BL have advanced disease when diagnosed [2]. A combination of ART with intensive chemotherapy can lead to good outcomes for BL. Furthermore, patients with HIV-associated lymphomas (HRLs) have been considered candidates for allogeneic or autologous stem cell transfusion (ASCT) when the criteria for transplantation have been met [3]. Currently, patients with relapsed/persistent HRLs have achieved good outcomes, comparable with those of non-HIV-infected individuals, after transfusion of stem cells [4]. In the present study, we report the outcome for a patient with HIV-associated naïve and high-risk BL who received ASCT after intensive chemotherapy plus combined antiretroviral therapy (cART).\n\nMaterials and methods\nPatient\nA 27-year-old male was admitted to our unit upon presentation of a painless mass in the right groin in April 2015. Biopsies of the lesion revealed lymphoma, and antibodies against HIV were positive. He refused to accept any treatment for the concomitant HIV infection. In the following 3 months, the mass became larger and ulcers formed on the skin. In addition, the right thigh also became involved. He suffered from recurrent fever, with a body temperature fluctuating from 38 to 40.5 °C, and his body weight decreased by approximately 12 kg within 3 months.\n\nIn August 2015, a biopsy of the mass aspirate showed BL, and the immunohistochemical results were positive for CD20 and EBV-encoded RNA (EBER)1/2. In addition, a bone marrow biopsy showed the total chromosomes to be normal, whereas the percentage of unidentified cells was 1.8%.\n\nUsing positron emission tomography–computed tomography (PET–CT), we found increased abnormal metabolism of fludeoxyglucose (FDG) in the right groin; the region had dimensions (in cm) of 12.0 × 16.5 × 27.0, and the boundaries were not clear. The right thigh, anterior to the bilateral mandible, neck, axillary, retroperitoneal vessel, right iliac fossa, pelvic wall, and right inguinal lymph nodes shown increased metabolism of FDG. A blood count showed abnormal levels of lactate dehydrogenase (LDH; 1579 U/L) as well as a white blood cell (WBC) count of 4.42 × 109/L, a neutrophil count of 2.92 × 109/L, a hemoglobin level of 122 g/L, and platelet count of 330 × 109/L. The patient was diagnosed as having stage IV BL.\n\nThe HIV RNA load was 51,386 copies/mL, and the CD4+ T cell count was 107 cells/μL at the time of BL diagnosis. In addition, the patient was co-infected with EBV, and the EBV DNA load was 4.09 × 104 copies/mL. No other serious opportunistic infections were present, and the CD4+ T cell count was < 200 cells/μL; therefore, he was started on cART immediately with lamivudine (300 mg daily), tenofovir (300 mg daily), and efavirenz (600 mg daily) on the 25th of August 2015. These medications were not changed, and drug resistance did not occur.\n\nThe patient was started on a standard dose of rituximab, piraubicin, vincristine, etoposide, cyclophosphamide, and prednisone acetate (R-EPOCH) chemotherapy on the 31st of August 2015 (day 0). The patient developed a fever on the 6th of September because of a Staphylococcus aureus infection in his ulcer, based on a drug-sensitivity test. The patient is allergic to penicillin; therefore, he received lincomycin (400 mg, q.d.s.). Local debridement was performed every day, and his temperature returned to normal 7 days after treatment. Lincomycin was stopped on day 16 because of a continuous negative result in blood culture. He was diagnosed with agranulemia (neutrophil count = 0.01 × 109/L) on day 13, and granulocyte-colony stimulating factor (G-CSF; 150 μg, q.d.s) was given until the neutrophil count reached 0.5 × 109/L. Meanwhile, he suffered a pulmonary infection and meropenem (0.5 g, b.d.s.) was added until the symptoms were controlled completely (achieved on day 30). A bone marrow biopsy showed that proliferation of the bone marrow was active, and abnormal cells were not detected.\n\nThe second cycle of chemotherapy comprised rituximab, methotrexate, and cytosine arabinoside (Ara-C). It was started on the 21st of September (day 22) and stopped on the 23rd of September (day 24). No serious complications occurred, and the EBV DNA load was reduced to 5 × 103 copies/mL on day 30.\n\nFrom the 9th of October (day 40) to the 23rd of October (day 54), he received a third cycle of chemotherapy with rituximab, cyclophosphamide, vinorelbine, pirarubicin, and dexamethasone (R + HyperCVAD). The EBV DNA load was undetectable after the third cycle of chemotherapy.\n\nFrom the 30th of October (day 61) to the 1st of November (day 63), a fourth cycle of chemotherapy (rituximab plus methotrexate/Ara-C (R-MA)) was undertaken. In addition, six intrathecal injections of methotrexate, Ara-C, and dexamethasone were used during the second and fourth cycles of chemotherapy. After the fourth cycle of chemotherapy, the HIV RNA load was < 40 copies/mL, the CD4+ T cell count was 193 cells/μL, and the LDH level was 91 U/L. PET–CT showed that the tumor volume in the right groin and the maximum standardized uptake value (SUVmax) were reduced significantly, which suggested that tumor activity had been inhibited (Fig. 1a).Fig. 1 a Tumor regression in the right groin after chemotherapy. Tumor evaluation by positron emission tomography–computed tomography is shown before the first cycle and after the fourth cycle of R-EPOCH. b HIV RNA load in plasma and CD4+ T cell count before and after autologous bone marrow transplantation. Continuous lines show the viral load and CD4+ T cell counts measured using a standard clinical test before and after autologous stem cell transplantation. 3TC, lamivudine; TDF, tenofovir; EFV, efaviren; R-EPOCH, rituximab, etoposide phosphate, prednisone, vincristine sulfate (Oncovin), cyclophosphamide, doxorubicin hydrochloride (hydroxydaunorubicin)\n\n\n\nDuring the second and fourth cycles of chemotherapy, when the neutrophil count was < 0.5 × 109/L, G-CSF (150 μg, q.d.s.) was administered until the neutrophil count reached 0.5 × 109/L. Symptoms of myelosuppression were treated by infusion of packed red blood cells (RBCs) and concentrated platelets, and oral mucositis was treated by gargling with chlorhexidine. The details of the chemotherapy regimens are summarized in Fig. 2.Fig. 2 The clinical course and treatment of the patient. cART, combined antiretroviral therapy; THP, piraubicin; VCR, vincristine; VP16, etoposide; CTX, cyclophosphamide; DXM, dexamethasone; MTX, methotrexate; Ara-C, cytosine arabinoside; ADM, pirarubicin; BCNU, carmustine; Mel, melphalan; ASCT, autologous stem cell transfusion\n\n\n\nApheresis and processing of peripheral blood stem cells (PBSCs)\nBefore stem cell mobilization, the R-EPOCH regimen was used between the 20th of November (day 113) and the 25th of November (day 118) 2015 (Fig. 2). On the 27th of November, the WBC count was 0.5 × 109/L, and G-CSF (5 μg/kg per day) was used for PBSC mobilization for the next 5 days. When the WBC count reached 4 × 109/L on the 2nd of December (day 125), PBSC apheresis was undertaken using a continuous blood-cell separator (COBE® Spectra; Terumo BCT, Lakewood, CO, USA). Then, CD34-positive cells were analyzed using a FACScan™ flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA). A total of 1.03 × 106/kg CD34-positive cells were obtained after undertaking apheresis twice on two consecutive days. PBSC products were combined with a cytoprotectant containing a final concentration of 10% dimethylsulfoxide (Research Industries, Salt Lake City, UT, USA) and freezing at − 150 °C for transfusion.\n\nConditioning regimen and PBSC transfusion\nThe conditioning regimen consisted of carmustine, etoposide, Ara-C, and melphalan, which began on the 11th of January (day 164) and stopped on the 16th of January 2016 (day 169). During PBSC transfusion, only myelosuppression occurred, and serious infections were not observed. Neutropenia was treated by G-CSF (1.5 μg/kg per day), and symptoms of anemia and thrombocytopenia were treated by infusion of packed RBCs and concentrated platelets. Mobilized PBSCs were infused 2 days after completion of melphalan treatment on the 18th of January (day 171) and the 19th of January (day 172).\n\nResults\nRemission status\nAfter the fourth cycle of chemotherapy, PET–CT scans of the bilateral mandible and neck, chest, abdomen, spine, and big vessels in the para-retroperitoneal, pelvic bones, and bilateral upper femur showed that multiple FDG metabolic abnormalities had disappeared. A follow-up study using bone marrow biopsies showed no morphological evidence of lymphoma, and laboratory studies did not show abnormal blood parameters. The patient remains in complete remission from his lymphoma 30 months after transplantation. In addition, after the third cycle of chemotherapy, EBV DNA was undetectable, and the EBV infection has never recurred in the follow-up study.\n\nEngraftment\nThe patient reached a total neutrophil count of 0.5 × 109/L at 14 days and a platelet count > 25 × 109/L without further infusion of platelets at 25 days after ASCT. A bone marrow biopsy showed active proliferation of nucleated cells, as well as recovery of normal hematopoiesis of the bone marrow at 30 days after ASCT.\n\nHIV viral load and CD4+ T cell count\nThe patient has remained in complete remission from BL for 30 months after ASCT. The HIV RNA load was < 40 copies/mL after the fourth cycle of chemotherapy, and the CD4+ T cell count was 323 cells/μL in August 2018, as shown in Fig. 1b.\n\nDiscussion\nWith the development of cART, the clinical outcome and life expectancy of HIV-infected patients have improved. Nevertheless, some patients with a low CD4+ T cell count (< 200 cells/μL) have a greater probability of acquiring HIV-associated and non-HIV-associated events [5]. The risk of developing HIV-related lymphoma in patients with AIDS is much higher than that in patients without AIDS [6].\n\nAlthough studies have shown that chemotherapy and cART strategies are feasible and tolerated in patients with HIV [7, 8], however, it has been suggested that the use of cART plus chemotherapy should be considered carefully because of the emergence of treatment-related anemia, neurotoxicity, and mucositis; hence, there has been very limited enthusiasm for the use of high-dose chemotherapy plus cART for patients with HIV-associated lymphoma. In our study, cART was started immediately after diagnosis and throughout the course of treatment, viral duplication was well controlled, and viral rebound and drug resistance did not occur. In addition, both the standard chemotherapeutic approaches and chemoimmunotherapy were used and well tolerated.\n\nFor patients with HIV-related lymphoma, different doses of chemotherapy have been adopted considering their cytotoxicity and safety. Low and standard doses of chemotherapy carry a similar incidence of adverse effects; however, the prevalence of complete remission is 30% and 48%, respectively [9], which suggests that a standard dose of chemotherapy should be used. Apart from the use of a standard dose of chemotherapy, short-term, high-intensity chemotherapy combined with central prevention has also been reported to improve significantly the survival of HIV patients with high-risk BL [10], which suggests that active chemotherapy may benefit patients with HIV-related lymphoma.\n\nMeanwhile, the availability of rituximab has changed treatment outcomes for patients with BL or B cell lymphoma. Particularly in patients with HIV-associated CD20-positive non-Hodgkin lymphoma, rituximab plus concurrent EPOCH chemotherapy is highly effective [11]. Four cycles of rituximab with EPOCH and hyper-CVAD regimens were used in our chemotherapy regimen, and one cycle of rituximab was used for conditioning. This strategy did not lead to serious treatment-related toxicities during chemotherapy or subsequent ASCT. More importantly, concomitant chemoimmunotherapy with cART was never stopped because of drug interactions. These results suggested that molecular-targeted drugs combined with cART were safe and well tolerated.\n\nSequential therapy combined with ASCT complementation was superior to single-agent chemotherapy for the treatment of malignant lymphoma [12]. However, for HIV-positive patients, hematopoietic stem cells and progenitor cells have deficiencies with regard to erythropoiesis, myelopoiesis, and lymphopoiesis, and mobilization using G-CSF may be limited in specific cell populations. In addition, hematopoietic stem cells can be infected by HIV-1 and might become a latent reservoir of HIV [13]. Hence, the choice of ASCT or allogeneic hematopoietic cell transplantation is a major challenge. Considering the high risk of mortality and graft-versus-host-disease response in allogeneic hematopoietic cell transplantation, after obtaining written informed consent, we chose ASCT. We made this choice because there was no obvious bone marrow involvement after chemotherapy. The recovery time of neutrophils and platelets were 14 days and 25 days, respectively, which were similar to those in non-AIDS patients. In addition, we found after three cycles of chemotherapy, the EBV load was significantly reduced, without specific anti-EBV treatment; therefore, recovery of immunological function by cART and efficient chemoimmunotherapy might be associated with the reconstruction of the anti-EBV response. Although the sustained disappearance of EBV was regarded as a good prognostic marker for EBV-positive diffuse large B cell lymphoma [14], the reason for the good control of EBV in our patient requires further study.\n\nRecently, two HIV patients with NHL at the time of the first remission and recurrence showed good tolerance to ASCT after a transplantation-conditioning regimen comprising a high dose of cyclophosphamide, carmustine, and etoposide [4]. Those results were confirmed by a large-scale study that suggested that patients with HIV should not be denied ASCT if they meet the standard criteria for transplantation [12]. However, until now, the efficacy of short-term high-intensity chemoimmunotherapy combined with ASCT has not been identified in patients with naïve or high-risk BL when accepting concomitant cART.\n\nHere, we reported an HIV patient with naïve and high-risk BL who accepted short-term, high-dose chemotherapy followed by ASCT. cART was not stopped because of chemotherapy-related cytotoxicity, viral resistance did not occur, and complications were well controlled by effective symptomatic treatment. Given the poor outcome of HIV-related initial and high-risk Burkitt’s lymphoma, combined conventional chemotherapy with ASCT should be considered.\n\nAbbreviations\nAra-CCytosine arabinoside\n\nARTAntiretroviral therapy\n\nASCTAutologous stem cell transfusion\n\nBLBurkitt’s lymphoma\n\ncARTCombined antiretroviral therapy\n\nFDGFludeoxyglucose\n\nG-CSFGranulocyte-colony stimulating factor\n\nHIVHuman immunodeficiency virus\n\nHRLsHIV-associated lymphomas\n\nHSCTHematopoietic stem cell transplantation\n\nLDHLactate dehydrogenase\n\nPBSCsPeripheral blood stem cells\n\nPET–CTPositron emission tomography–computed tomography\n\nRBCsRed blood cells\n\nWBCWhite blood cell\n\nAcknowledgements\nWe thank the patient who participated in this study for his cooperation. In addition, we would like to thank the native English-speaking scientists of Elixigen Company (Huntington Beach, California) for editing our manuscript.\n\nFunding\nThis work was supported by the Capital Characteristic Clinic Project [grant number Z161100000516011].\n\nAvailability of data and materials\nThe datasets used during this study are available from the corresponding author on reasonable request.\n\nAuthors’ contributions\nHYM, JWY, SBW, FPT, and QHL were responsible for the clinical management of the patient. YQS and XPW managed the HSCT for the patient. XPY, XQD, and MS revised the manuscript. CXW, F-SW, and RNX provided research funding. All authors read and approved the final manuscript.\n\nEthics approval and consent to participate\nThis study was approved by the Ethics Committee of Peking University, China. Written informed consent was obtained from our patients before hematopoietic stem cell transplantation (HSCT).\n\nConsent for publication\nNot applicable.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Mellors JW Rinaldo CR Jr Gupta P White RM Todd JA Kingsley LA Prognosis in HIV-1 infection predicted by the quantity of virus in plasma Science 1996 272 1167 1170 10.1126/science.272.5265.1167 8638160 \n2. Chen Y Dave BJ Zhu X Chan WC Iqbal J Sanger WG Differences in the cytogenetic alteration profiles of diffuse large B-cell lymphoma among Chinese and American patients Cancer Genet 2013 206 183 190 10.1016/j.cancergen.2013.05.001 23849050 \n3. Rodrigo JA Hicks LK Cheung MC Song KW Ezzat H Leger CS HIV-associated Burkitt lymphoma: good efficacy and tolerance of intensive chemotherapy including CODOX-M/IVAC with or without rituximab in the HAART Era Adv Hematol 2012 2012 735392 10.1155/2012/735392 22190945 \n4. Bayraktar UD Ramos JC Petrich A Gupta N Lensing S Moore PC Outcome of patients with relapsed/refractory acquired immune deficiency syndrome-related lymphoma diagnosed 1999-2008 and treated with curative intent in the AIDS Malignancy Consortium Leuk Lymphoma 2012 53 2383 2389 10.3109/10428194.2012.697559 22642936 \n5. Carella AM Cavaliere M Lerma E Ferrara R Tedeschi L Romanelli A Autografting followed by nonmyeloablative immunosuppressive chemotherapy and allogeneic peripheral-blood hematopoietic stem-cell transplantation as treatment of resistant Hodgkin’s disease and non-Hodgkin’s lymphoma J Clin Oncol 2000 18 3918 3924 10.1200/JCO.2000.18.23.3918 11099321 \n6. Baker JV, Peng G, Rapkin J, Silverberg MJ, MacArthur RD, Cavert WP, et al. Terry Beirn Community Programs for Clinical Research on AIDS (CPCRA).CD4+ count and risk of non-AIDS diseases following initial treatment for HIV infection. AIDS 2008;22:841–848.\n7. Venturelli S Pria AD Stegmann K Smith P Bower M The exclusion of people living with HIV (PLWH) from clinical trials in lymphoma Br J Cancer 2015 113 861 863 10.1038/bjc.2015.301 26313666 \n8. Dunleavy K Wilson WH How I treat HIV associate lymphoma Blood 2012 119 3245 3255 10.1182/blood-2011-08-373738 22337719 \n9. Sparano JA Wiernik PH Hu X Schwartz EL Soeiro R Henry DH Pilot trial of infusional cyclophosphamide, doxorubicin, and etoposide plus didanosine and filgrastim in patients with human immunodeficiency virus-associated non-Hodgkin’s lymphoma J Clin Oncol 1996 14 3026 3035 10.1200/JCO.1996.14.11.3026 8918501 \n10. Ratner L Lee J Tang S Redden D Hamzeh F Herndier B Chemotherapy for human immunodeficiency virus-associated non-Hodgkin’s lymphoma in combination with highly active antiretroviral therapy J Clin Oncol 2001 19 2171 2178 10.1200/JCO.2001.19.8.2171 11304769 \n11. Re A Cattaneo C Michieli M Casari S Spina M Rupolo M High-dose therapy and autologous peripheral-blood stem-cell transplantation as salvage treatment for HIV-associated lymphoma in patients receiving highly active antiretroviral therapy J Clin Oncol 2003 21 4423 4427 10.1200/JCO.2003.06.039 14581441 \n12. Alvarnas JC Le Rademacher J Wang Y Little RF Akpek G Ayala E Autologous hematopoietic cell transplantation for HIV-associated lymphoma: results of the BMT CTN 0803/AMC 071 trial Blood 2016 128 1050 1058 10.1182/blood-2015-08-664706 27297790 \n13. van Rhee F Giralt S Barlogie B The future of autologous stem cell transplantation in myeloma Blood 2014 124 328 333 10.1182/blood-2014-03-561985 24894774 \n14. Castillo JJ Beltran BE Miranda RN Young KH Chavez JC Sotomayor EM EBV-positive diffuse large B-cell lymphoma, not otherwise specified: 2018 update on diagnosis, risk-stratification and management Am J Hematol 2018 93 953 962 10.1002/ajh.25112 29984868\n\n", "fulltext_license": "CC BY", "issn_linking": "1757-6512", "issue": "9(1)", "journal": "Stem cell research & therapy", "keywords": "Antiretroviral therapy; Autologous stem cell transplantation; Burkitt’s lymphoma; CD4+T; HIV; Naïve", "medline_ta": "Stem Cell Res Ther", "mesh_terms": "D000328:Adult; D044966:Anti-Retroviral Agents; D002051:Burkitt Lymphoma; D003131:Combined Modality Therapy; D015658:HIV Infections; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D008297:Male; D019172:Transplantation Conditioning; D014182:Transplantation, Autologous", "nlm_unique_id": "101527581", "other_id": null, "pages": "353", "pmc": null, "pmid": "30572947", "pubdate": "2018-12-20", "publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": "29984868;14581441;22642936;11304769;18427202;8638160;23849050;22190945;22337719;11099321;24894774;8918501;26313666;27297790", "title": "Remission of HIV-related naïve and high-risk Burkitt's lymphoma treated by autologous stem cell transplantation plus cART.", "title_normalized": "remission of hiv related na ve and high risk burkitt s lymphoma treated by autologous stem cell transplantation plus cart" }
[ { "companynumb": "CN-PFIZER INC-2019061812", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "METHOTREXATE" }, "drugadditional": "1", ...
{ "abstract": "Allogeneic transplantation is the only potentially curative strategy for myelofibrosis, even in the era of new drugs that so far only mitigate symptoms. The choice to proceed to allogeneic transplantation is based on several variables including age, disease phase, degree of splenomegaly, donor availability, comorbidities and iron overload. These factors, along with conditioning regimen and time to transplantation, may influence the outcome of ASCT. We report 14 patients affected by myelofibrosis with a median age of 57 years (range, 41-76) receiving a treosulfan-fludarabine based reduced toxicity conditioning. Patients (pts) received a stem cell transplantation from an HLA identical (n = 10) or matched unrelated donor (n = 4). All pts had a complete myeloablation followed by engraftment and in 12 out of 13 evaluated pts donor chimerism was 100% at 1 month. In most cases a reduction of splenomegaly and a reduction (or resolution) of bone marrow fibrosis was observed. After a median follow-up of 39 months (range, 3-106), the 3-year probability of overall survival and disease free survival was 54 +/- 14% and 46 +/- 14%, respectively. The cumulative incidence of non-relapse mortality at 2 years was 39 +/- 15%. Causes of non-relapse mortality were: infection (n = 2), GvHD (n = 2) and haemorrhage (n = 1). We can conclude that a treosulfan and fludarabine based conditioning has a potent myeloablative and anti-disease activity although non-relapse mortality remains high in this challenging clinical setting. Copyright © 2014 John Wiley & Sons, Ltd.", "affiliations": "Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.;Hematology and Bone Marrow Transplantation Unit, IRCCS San Raffaele Scientific Institute, Milano, Italy.", "authors": "Claudiani|Simone|S|;Marktel|Sarah|S|;Piemontese|Simona|S|;Assanelli|Andrea|A|;Lupo-Stanghellini|Maria Teresa|MT|;Carrabba|Matteo|M|;Guggiari|Elena|E|;Giglio|Fabio|F|;De Freitas|Tiago|T|;Marcatti|Magda|M|;Bernardi|Massimo|M|;Corti|Consuelo|C|;Peccatori|Jacopo|J|;Lunghi|Francesca|F|;Ciceri|Fabio|F|", "chemical_list": "C018404:treosulfan; D014740:Vidarabine; D002066:Busulfan; C024352:fludarabine", "country": "England", "delete": false, "doi": "10.1002/hon.2183", "fulltext": null, "fulltext_license": null, "issn_linking": "0278-0232", "issue": "34(3)", "journal": "Hematological oncology", "keywords": "bone marrow transplantation; hematopoietic stem cell transplantation; myeloproliferative disease; primary myelofibrosis; reduced-toxicity conditioning; treosulfan", "medline_ta": "Hematol Oncol", "mesh_terms": "D000368:Aged; D064591:Allografts; D002066:Busulfan; D018572:Disease-Free Survival; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D055728:Primary Myelofibrosis; D033581:Stem Cell Transplantation; D015996:Survival Rate; D019172:Transplantation Conditioning; D061349:Unrelated Donors; D014740:Vidarabine", "nlm_unique_id": "8307268", "other_id": null, "pages": "154-60", "pmc": null, "pmid": "25469485", "pubdate": "2016-09", "publication_types": "D016428:Journal Article", "references": null, "title": "Treosulfan based reduced toxicity conditioning followed by allogeneic stem cell transplantation in patients with myelofibrosis.", "title_normalized": "treosulfan based reduced toxicity conditioning followed by allogeneic stem cell transplantation in patients with myelofibrosis" }
[ { "companynumb": "IT-MYLANLABS-2016M1048987", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "LAPINE T-LYMPHOCYTE IMMUNE GLOBULIN" }, "drug...
{ "abstract": "We describe a case of repair of the antegrade anastomosis between the \"ileal segment\" and amputated ureter for recurrent rectal cancer, in which some postoperative complications occurred but eventually resolved. If the length of the ureter is inadequate for end-to-end anastomosis, an ileal segment can be used as a conduit. This surgical technique is not difficult because an ileal conduit is typically created during total pelvic exenteration of rectal cancers. Therefore, anastomosing the ureter to an \"ileal segment\" is easy and feasible. Hence, we consider that knowledge of this technique would be beneficial for surgical oncologists who perform colorectal surgeries.", "affiliations": "Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan. kkomori@aichi-cc.jp.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.;Department of Gastroenterological Surgery, Aichi Cancer Center Hospital, 1-1, Kanokoden, Chikusa, Nagoya, Aichi, 464-8681, Japan.", "authors": "Komori|Koji|K|http://orcid.org/0000-0002-6834-995X;Kinoshita|Takashi|T|;Sato|Yusuke|Y|;Ouchi|Akira|A|;Ito|Seiji|S|;Abe|Tetsuya|T|;Misawa|Kazunari|K|;Ito|Yuichi|Y|;Natsume|Seiji|S|;Higaki|Eiji|E|;Okuno|Masataka|M|;Fujieda|Hironori|H|;Shoji|Kawakatsu|K|;Kunitomo|Aina|A|;Oki|Satoshi|S|;Maeda|Shingo|S|;Nagao|Takuya|T|;Aritake|Tsukasa|T|;Tawada|Kakeru|K|;Akaza|Satoru|S|;Shimizu|Yasuhiro|Y|", "chemical_list": null, "country": "Japan", "delete": false, "doi": "10.1007/s12328-021-01525-0", "fulltext": null, "fulltext_license": null, "issn_linking": "1865-7265", "issue": "14(6)", "journal": "Clinical journal of gastroenterology", "keywords": "Antegrade anastomosis; Ileal segment; Recurrent rectal cancer", "medline_ta": "Clin J Gastroenterol", "mesh_terms": "D000714:Anastomosis, Surgical; D006801:Humans; D007082:Ileum; D009364:Neoplasm Recurrence, Local; D012004:Rectal Neoplasms; D014513:Ureter", "nlm_unique_id": "101477246", "other_id": null, "pages": "1687-1691", "pmc": null, "pmid": "34591287", "pubdate": "2021-12", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "18549432;26637891", "title": "Repair of antegrade anastomosis between ileal segment and amputated ureter for recurrent rectal cancer.", "title_normalized": "repair of antegrade anastomosis between ileal segment and amputated ureter for recurrent rectal cancer" }
[ { "companynumb": "JP-TEVA-2021-JP-1978003", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "OXALIPLATIN" }, "drugadditional": "1", ...
{ "abstract": "Mycobacterium chelonae is a non-tuberculous mycobacterium that can cause skin infections in immunocompetent individuals. We report a case of skin infection by this agent in a woman with dyslipidaemia, that culminated in statin-induced rhabdomyolysis due to the combination of clarithromycin, ciprofloxacin and simvastatin.\nSkin infection with Mycobacterium chelonae is an increasing global problem among immunocompetent individuals.Statin-induced rhabdomyolysis is an important and avoidable end-result of drug-drug interaction.Inhibition of cytochrome P450 isoenzyme 3A4 and of organic anion transporting polypeptide 1B1 are two important examples of statin interference with metabolism, and clarithromycin can inhibit both.", "affiliations": "Hospital Pedro Hispano, Sra. da Hora, Portugal.;Hospital Pedro Hispano, Sra. da Hora, Portugal.;Hospital Pedro Hispano, Sra. da Hora, Portugal.;Hospital Pedro Hispano, Sra. da Hora, Portugal.;Hospital Pedro Hispano, Sra. da Hora, Portugal.", "authors": "Bibi|Mário|M|;Ferro|Ana|A|;Guimarães|Filipa|F|;Coelho|Paulo|P|;Chora|Inês|I|", "chemical_list": null, "country": "Italy", "delete": false, "doi": "10.12890/2021_002661", "fulltext": "\n==== Front\nEur J Case Rep Intern Med\nEuropean Journal of Case Reports in Internal Medicine\n2284-2594\nSMC Media Srl\n\n34268273\n10.12890/2021_002661\n2661-1-23166-1-10-20210614\nArticles\nWhen Should Statins Be Stopped?\nBibi Mário\nFerro Ana\nGuimarães Filipa\nCoelho Paulo\nChora Inês\nHospital Pedro Hispano, Sra. da Hora, Portugal\n2021\n15 6 2021\n8 6 00266120 5 2021\n25 5 2021\n© EFIM 2021\n2021\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ This article is licensed under a Commons Attribution Non-Commercial 4.0 License\nMycobacterium chelonae is a non-tuberculous mycobacterium that can cause skin infections in immunocompetent individuals. We report a case of skin infection by this agent in a woman with dyslipidaemia, that culminated in statin-induced rhabdomyolysis due to the combination of clarithromycin, ciprofloxacin and simvastatin.\n\nLEARNING POINTS\n\nSkin infection with Mycobacterium chelonae is an increasing global problem among immunocompetent individuals.\n\nStatin-induced rhabdomyolysis is an important and avoidable end-result of drug–drug interaction.\n\nInhibition of cytochrome P450 isoenzyme 3A4 and of organic anion transporting polypeptide 1B1 are two important examples of statin interference with metabolism, and clarithromycin can inhibit both.\n\nMycobacterium chelonae\nstatin-induced rhabdomyolysis\nciprofloxacin\nclarithromycin\n==== Body\nCASE DESCRIPTION\n\nA 67-year-old woman with type 2 diabetes mellitus, essential arterial hypertension, dyslipidaemia and atrial fibrillation was being followed for basal cell carcinoma. She regularly used the water of a private well for drinking and washing. She reported no alcohol intake. She was medicated with simvastatin 40 mg/day for 2 years prior to the events described below, enalapril, furosemide, gliclazide, metformin and warfarin. In a follow-up consult, a nodular, erythematous and infiltrative lesion on the dorsal aspect of the left hand was found (Fig. 1). Biopsy results were compatible with cutaneous mycobacterial infection (granulomatous inflammatory process, with central necrosis and the presence of acid-alcohol resistant bacillus), and Mycobacterium chelonae was identified. Whole-body computed tomography was unremarkable. Antibiotic therapy was initiated, with ciprofloxacin 500 mg twice daily and clarithromycin 500 mg twice daily. One week later, the patient developed generalized muscular weakness, mainly proximal, myalgia, nausea and aqueous diarrhoea and attended our Emergency Department. At admission, she was dehydrated, with global diminished muscular strength (grade 4/5 on the Medical Research Council manual muscle testing scale), tenderness at muscular palpation and hard oedema of the extremities. She had an otherwise normal physical and neurological exam.\n\nThe initial work-up showed elevated serum creatine kinase (17,830 U/l) as well as aspartate transaminase (1,003 U/l) and alanine transaminase (556 U/l), that were interpreted in the context of rhabdomyolysis. The serum creatinine level was 2.3 mg/dl, associated with metabolic acidosis and mild hyperkalaemia; the remaining electrolytes were normal. Abdominal ultrasound showed no liver or urinary system changes. The patient was hospitalized and fluid administration was started. Statin and antibiotics were stopped.\n\nMuscle biopsy showed rare atrophic fibres without necrotic or regenerative fibres, and no inflammatory infiltrates or vasculitic lesions. Electromyography (EMG) findings were compatible with a myopathy. An autoimmune testing panel was negative. Serologies for syphilis, hepatitis B and C, human immunodeficiency virus and Borrelia were negative. Serologies for Epstein–Barr, cytomegalovirus, herpes simplex 1 and 2 were negative for acute infection. Thyroid hormones were within normal levels.\n\nThe patient exhibited a slow but total recovery with only supportive measures. After 3 weeks, rhabdomyolysis was substantially better (Fig. 2), with normalization after 6 months, associated with normal muscular strength and EMG.\n\nOne month after admission, the patient restarted antibiotic therapy with doxycycline 200 mg daily and moxifloxacin 400 mg daily. The antibiotic combination was prolonged for 9 months, with clinical resolution of the hand lesion and no new lesions formed. Statin was only reintroduced after antibiotic termination. During the 2 years of follow-up, the patient exhibited no new muscular events.\n\nDISCUSSION\n\nM. chelonae is a non-tuberculous mycobacterium which can be found in the soil, water and aquatic animals. The global incidence of infection with this mycobacterium is reportedly increasing [1]. In immunocompetent individuals, M. chelonae can cause localized skin infections, as in our patient. There are no descriptions in the literature of generalized myopathy in immunocompetent patients caused by this agent. For correct diagnosis, a skin biopsy is needed for histopathological examination, including acid-fast staining and mycobacterial culture. Guided by susceptibility testing, combination therapy with at least two antibiotic agents, for a minimum of 4 months for skin disease, is recommended [1].\n\nRhabdomyolysis is a condition resulting from muscle injury and involves necrosis of muscle tissue that leads to the release of intracellular content into the blood stream. Typical clinical findings include muscle weakness, pain and dark tea-coloured urine. CK elevation more than 10 times the upper limit of normal or above 1,000 U/l is diagnostic. The management of rhabdomyolysis relies on treating/removing the underlying cause of muscle injury and preventing acute kidney injury (AKI). The cornerstone intervention to prevent AKI is fluid administration [2].\n\nThe case presented is typical of a drug-induced rhabdomyolysis, given the temporal correlation, subsequent evolution with only supportive measures, and the absence of trauma, infection or autoimmune disease. Statins have been associated with rhabdomyolysis [3]. Almost 50% of cases of statin-induced rhabdomyolysis are precipitated by another drug that interferes with statin metabolism, increasing its concentration. Inhibition of the cytochrome P450 isoenzyme 3A4 (CYP3A4) plays a major role in most cases of statin-induced rhabdomyolysis. Statins metabolized by CYP3A4 include atorvastatin, simvastatin and lovastatin [3]. Both clarithromycin and ciprofloxacin are known CYP3A4 inhibitors and have separately been implicated in statin-induced rhabdomyolysis in case reports [4, 5]. Clarithromycin is also an inhibitor of organic anion transporting polypeptide 1B1 (OATP1B1), a transporter protein involved in the metabolism pathway of all statins, including those not metabolized by CYP3A4 [3].\n\nWhen a patient is on simvastatin, atorvastatin or lovastatin, drugs with potential CYP3A4 inhibition should be avoided and alternatives considered. If no equivalent alternatives to a CYP3A4 inhibitor exist (Table 1), temporary suspension of simvastatin, atorvastatin or lovastatin or a switch to a non-CYP3A4-metabolized statin should be considered. Attention should also be directed to OATP1B1 inhibitors given the potential interaction with all statins [3]. The main complication of maintaining statins in a potential drug–drug interaction is statin-induced rhabdomyolysis, with potentially devastating renal consequences, as seen in our case. Ultimately, it can lead to death if the statin is not stopped in time. In a world of increasing polypharmacy, identifying the possibility of drug–drug interaction is of major importance in order to prevent unwanted effects.\n\nFigure 1 Skin lesion on the dorsal aspect of the patient’s left hand\n\nFigure 2 Rhabdomyolysis evolution.\n\nALT, alanine transaminase; AST, aspartate transaminase; CK, creatinine kinase\n\nTable 1 Known CYP3A4 inhibitors (adapted from Wiggins et al [1].\n\nAmiodarone\tAmlodipine\tCimetidine\t\nCiprofloxacin\tClarithromycin*\tCyclosporine*\t\nDiltiazem\tFluconazole\tFluoxitine\t\nGrapefruit\tImatinib\tIsoniazid\t\nItraconazole\tMidalozam\tPosaconazole\t\nProtease inhibitors*\tRanolazine\tSertraline\t\nTacrolimus\tTicagrelor\tTricyclic antidepressants\t\n* Simultaneous inhibition of CYP3A4 and OATP1B1.\n\nConflicts of Interests: The authors declare there are no competing interests.\n==== Refs\nREFERENCES\n\n1 Uslu U Böhm O Heppt F Sticherling M Skin and soft tissue infections caused by Mycobacterium chelonae: more common than expected? Acta Derm Venereol 2019 99 10 889 893 31141157\n2 Cabral BMI Edding SN Portocarrero JP Lerma EV Rhabdomyolysis Dis Mon 2020 66 8 101015 32532456\n3 Wiggins BS Saseen JJ Page RL 2nd Reed BN Sneed K Kostis JB American Heart Association Clinical Pharmacology Committee of the Council on Clinical Cardiology; Council on Hypertension; Council on Quality of Care and Outcomes Research; and Council on Functional Genomics and Translational Biology Recommendations for management of clinically significant drug-drug interactions with statins and select agents used in patients with cardiovascular disease: a scientific statement from the American Heart Association Circulation 2016 134 21 e468 e495 27754879\n4 Patel AM Shariff S Bailey DG Juurlink DN Gandhi S Mamdani M Statin toxicity from macrolide antibiotic coprescription: a population-based cohort study Ann Intern Med 2013 158 12 869 876 23778904\n5 Goldie FC Brogan A Boyle JG Ciprofloxacin and statin interaction: a cautionary tale of rhabdomyolysis BMJ Case Rep 2016 2016 bcr2016216048\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2284-2594", "issue": "8(7)", "journal": "European journal of case reports in internal medicine", "keywords": "Mycobacterium chelonae; ciprofloxacin; clarithromycin; statin-induced rhabdomyolysis", "medline_ta": "Eur J Case Rep Intern Med", "mesh_terms": null, "nlm_unique_id": "101648453", "other_id": null, "pages": "002661", "pmc": null, "pmid": "34268273", "pubdate": "2021", "publication_types": "D016428:Journal Article", "references": "27754879;32532456;31141157;27469384;23778904", "title": "When Should Statins Be Stopped?", "title_normalized": "when should statins be stopped" }
[ { "companynumb": "NVSC2019PT061077", "fulfillexpeditecriteria": "1", "occurcountry": "PT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "GLICLAZIDE" }, "drugadditional": "3", "druga...
{ "abstract": "OBJECTIVE\nLymphangioleiomyomatosis (LAM) is a rare, cystic lung disease that generally results in progressive decline in lung function. Despite advancement of pharmacological therapy for LAM, lung transplantation remains an important option for women with end-stage LAM.\n\n\nMETHODS\nPatients with LAM undergoing lung transplantation at the Mayo Clinic campuses in Rochester, Minnesota and Jacksonville, Florida since 1995 were retrospectively reviewed.\n\n\nRESULTS\nOverall, 12 women underwent lung transplantation. Nine of 12 (75%) underwent double lung transplant. The mean age was 42 ± 8 years at the time of transplant. One patient (8%) had a chylothorax and 7 (58%) had recurrent pneumothoraces, 4 (33%) of which required pleurodesis. All had diffuse, cystic lung disease on chest CT consistent with LAM which was confirmed in the explant of all patients. The average length of ICU and hospital stays were 5 ± 4 and 19 ± 19 days, respectively. Mild to moderate anastomotic ischemia was evident in all patients but resolved with time. No patient was treated with sirolimus pre-transplant. Seven patients received sirolimus post-transplant; however, clinical benefit was documented in only 2 patients, 1 of which was treated for large retroperitoneal cysts with ureteral obstruction and another with persistent chylothorax and retroperitoneal lymphangioleimyomas. Five patients are deceased. The median survival by Kaplan-Meier analysis was 119 months with a median follow-up of 68 months (range 2-225 months).\n\n\nCONCLUSIONS\nLung transplant remains a viable treatment for patients with end-stage LAM. The role of sirolimus peri-transplantation remains ill-defined.", "affiliations": "Pulmonary and Critical Care Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL 32224, USA. Electronic address: Ussavarungsi.Kamonpun@mayo.edu.;Pulmonary and Critical Care Medicine, Mayo Clinic, 200 First St. SW, Rochester, MN 55901, USA. Electronic address: hu.xiaowen@hotmail.com.;Pulmonary and Critical Care Medicine, Mayo Clinic, 200 First St. SW, Rochester, MN 55901, USA. Electronic address: scott.john@mayo.edu.;Transplant Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL 32224, USA. Electronic address: Erasmus.David@mayo.edu.;Transplant Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL 32224, USA. Electronic address: Mallea.Jorge@mayo.edu.;Transplant Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL 32224, USA. Electronic address: Alvarez.Franciscog@mayo.edu.;Pulmonary and Critical Care Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL 32224, USA. Electronic address: Lee.Augustine@mayo.edu.;Transplant Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL 32224, USA. Electronic address: Keller.Cesar@mayo.edu.;Pulmonary and Critical Care Medicine, Mayo Clinic, 200 First St. SW, Rochester, MN 55901, USA. Electronic address: Ryu.Jay@mayo.edu.;Pulmonary and Critical Care Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL 32224, USA. Electronic address: burger.charles@mayo.edu.", "authors": "Ussavarungsi|Kamonpun|K|;Hu|Xiaowen|X|;Scott|J P|JP|;Erasmus|David B|DB|;Mallea|Jorge M|JM|;Alvarez|Francisco|F|;Lee|Augustine S|AS|;Keller|Cesar A|CA|;Ryu|Jay H|JH|;Burger|Charles D|CD|", "chemical_list": "D007166:Immunosuppressive Agents; D020123:Sirolimus", "country": "England", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0954-6111", "issue": "109(10)", "journal": "Respiratory medicine", "keywords": "Lung transplantation; Lymphangioleiomyomatosis; Outcome; Sirolimus", "medline_ta": "Respir Med", "mesh_terms": "D000328:Adult; D004452:Echocardiography; D005260:Female; D006801:Humans; D007166:Immunosuppressive Agents; D008175:Lung Neoplasms; D016040:Lung Transplantation; D018192:Lymphangioleiomyomatosis; D008875:Middle Aged; D018700:Pleurodesis; D012189:Retrospective Studies; D012720:Severity of Illness Index; D020123:Sirolimus; D014057:Tomography, X-Ray Computed; D016896:Treatment Outcome", "nlm_unique_id": "8908438", "other_id": null, "pages": "1354-9", "pmc": null, "pmid": "26321137", "pubdate": "2015-10", "publication_types": "D016428:Journal Article", "references": null, "title": "Mayo clinic experience of lung transplantation in pulmonary lymphangioleiomyomatosis.", "title_normalized": "mayo clinic experience of lung transplantation in pulmonary lymphangioleiomyomatosis" }
[ { "companynumb": "US-DRREDDYS-USA/USA/15/0054042", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "CYCLOSPORINE" }, "drugadditional": null...
{ "abstract": "Palifermin has been proven to decrease the frequency of severe oral mucositis in adult patients with sarcoma and metastatic colorectal cancer receiving chemotherapy. The impact of palifermin on the incidence of mucositis in nonhematopoietic stem cell transplantation (HSCT) pediatric population receiving chemotherapy has never been reported to date.\n\n\n\nThis is a retrospective analysis of pediatric patients who received palifermin as secondary prophylaxis to prevent chemotherapy-induced mucositis at Memorial Sloan Kettering Cancer Center from January 1, 2008 to 2014. Data from electronic medical records on days to mucositis resolution, use of opioids, use of total parenteral nutrition, duration of hospitalization, and antibiotics are collected and presented here.\n\n\n\nA total of 18 patients received palifermin for secondary prophylaxis after developing mucositis from the prior chemotherapy cycle. Mucositis did not reoccur in the subsequent cycle for 13 of the 18 patients. The majority of patients who received palifermin prophylaxis had decreased opioids and antibiotics use and decreased duration of hospitalization. Six of the 7 patients previously requiring total parenteral nutrition due to mucositis had decreased supplemental nutritional needs following the use of palifermin.\n\n\n\nPalifermin may provide benefit as secondary prophylaxis in pediatric patients to prevent chemotherapy-induced mucositis.", "affiliations": "Departments of *Pharmacy Service †Pediatrics ‡Epidemiology and Statistics, Memorial Sloan Kettering, Cancer Center, New York, NY.", "authors": "Liu|Dazhi|D|;Seyboth|Brian|B|;Mathew|Sherry|S|;Gilheeney|Stephen W|SW|;Chou|Alexander J|AJ|;Drill|Esther|E|;Kobos|Rachel|R|", "chemical_list": "D000701:Analgesics, Opioid; D000900:Anti-Bacterial Agents; D000970:Antineoplastic Agents; D051523:Fibroblast Growth Factor 7", "country": "United States", "delete": false, "doi": "10.1097/MPH.0000000000000791", "fulltext": null, "fulltext_license": null, "issn_linking": "1077-4114", "issue": "39(4)", "journal": "Journal of pediatric hematology/oncology", "keywords": null, "medline_ta": "J Pediatr Hematol Oncol", "mesh_terms": "D000701:Analgesics, Opioid; D000900:Anti-Bacterial Agents; D000970:Antineoplastic Agents; D002648:Child; D005260:Female; D051523:Fibroblast Growth Factor 7; D006760:Hospitalization; D006801:Humans; D008297:Male; D052016:Mucositis; D009369:Neoplasms; D012189:Retrospective Studies; D016896:Treatment Outcome", "nlm_unique_id": "9505928", "other_id": null, "pages": "e177-e182", "pmc": null, "pmid": "28234746", "pubdate": "2017-05", "publication_types": "D023362:Evaluation Study; D016428:Journal Article", "references": null, "title": "Retrospective Evaluation of Palifermin Use in Nonhematopoietic Stem Cell Transplant Pediatric Patients.", "title_normalized": "retrospective evaluation of palifermin use in nonhematopoietic stem cell transplant pediatric patients" }
[ { "companynumb": "PHHY2017US105259", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "DOXORUBICIN" }, "drugadditional": "3", "drug...
{ "abstract": "After allogeneic hematopoietic stem cell transplantation (HSCT), BK virus-associated hemorrhagic cystitis (BKV-HC) is a common complication. Although supportive measures have been the standard of care for many years, several studies suggested the efficacy of cidofovir. The aim of this study was to assess the safety profile and efficacy of cidofovir. A retrospective study was conducted on all patients treated with cidofovir in our HSCT unit between March 2011 and May 2013. Data for efficacy (partial [PR] or complete response [CR]), prescription (dose, frequency, number of doses, and administration route), and toxicity were collected from published reports and medical files. Renal toxicity was evaluated using creatinine clearance calculated with the Cockcroft and Gault formula. A parallel literature search using PubMed (last search, May 2015) was performed. From March 2011 to June 2013, 27 of 181 patients undergoing allogeneic HSCT in our department received cidofovir for BKV-HC: 24 (88.9%) intravenously, 1 intravesically, and 2 via both routes. Mean dose was 5 mg/kg per administration, for a median of 4 injections (range, 1 to 11), from twice a week to once every 2 weeks. CR was achieved in 22 patients (81.5%), PR in 2, and no response in 2 patients. Eight patients presented renal failure (29.6%): 6 moderate (creatinine clearance < 60 mL/min) and 2 severe (creatinine clearance < 30 mLmin). Mean decrease in creatinine clearance after cidofovir was 27% (35 mL/min; range, 2 to 159). In 3 cases renal insufficiency and hematologic toxicity led to discontinuation of treatment or switch to intravesical instillation. For 3 patients cidofovir dose was reduced because of nephrotoxicity. Thirteen studies have reported on the use of cidofovir for BKV-HC (204 patients) since 2005. Intravenous cidofovir was used for 91.3% of patients, with doses ranging from .5 to 5 mg/kg. The main toxicity reported was renal failure (9% to 50% in 9 studies). Between 60% and 100% of CRs were observed independently of cidofovir dose or administration route. Cidofovir is an effective therapy for BKV-HC but requires very precise renal function management to avoid toxicity. Cidofovir treatment modalities (high dose, intravesical instillation, or low dose [≤1 mg/kg]) needs to be investigated in randomized controlled trials.", "affiliations": "Clinical Oncology Pharmacy Department, Groupement Hospitalier Sud, Hospices Civils de Lyon, Pierre Bénite, France.;Clinical Oncology Pharmacy Department, Groupement Hospitalier Sud, Hospices Civils de Lyon, Pierre Bénite, France; EMR 3738, University Lyon 1, Lyon, France.;Hematology Department, Blood and Marrow Transplantation Unit, Hospices Civils de Lyon, Pierre Bénite, France.;Clinical Oncology Pharmacy Department, Groupement Hospitalier Sud, Hospices Civils de Lyon, Pierre Bénite, France.;Clinical Oncology Pharmacy Department, Groupement Hospitalier Sud, Hospices Civils de Lyon, Pierre Bénite, France.;Infectious Diseases Department, Hôpital de la Croix-Rousse, Hospices Civils de Lyon, Lyon, France; INSERM U1052, CRCL, Centre Léon Bérard, Lyon, France.;Hematology Department, Blood and Marrow Transplantation Unit, Hospices Civils de Lyon, Pierre Bénite, France.;Hematology Department, Blood and Marrow Transplantation Unit, Hospices Civils de Lyon, Pierre Bénite, France.;Hematology Department, Blood and Marrow Transplantation Unit, Hospices Civils de Lyon, Pierre Bénite, France; INSERM U1052, CRCL, Centre Léon Bérard, Lyon, France.;Hematology Department, Blood and Marrow Transplantation Unit, Hospices Civils de Lyon, Pierre Bénite, France.;Hematology Department, Blood and Marrow Transplantation Unit, Hospices Civils de Lyon, Pierre Bénite, France.;Hematology Department, Blood and Marrow Transplantation Unit, Hospices Civils de Lyon, Pierre Bénite, France.;Hematology Department, Blood and Marrow Transplantation Unit, Hospices Civils de Lyon, Pierre Bénite, France.;Hematology Department, Blood and Marrow Transplantation Unit, Hospices Civils de Lyon, Pierre Bénite, France.;Hematology Department, Blood and Marrow Transplantation Unit, Hospices Civils de Lyon, Pierre Bénite, France.;Clinical Oncology Pharmacy Department, Groupement Hospitalier Sud, Hospices Civils de Lyon, Pierre Bénite, France; EMR 3738, University Lyon 1, Lyon, France. Electronic address: catherine.rioufol@chu-lyon.fr.", "authors": "Philippe|Michael|M|;Ranchon|Florence|F|;Gilis|Lila|L|;Schwiertz|Vérane|V|;Vantard|Nicolas|N|;Ader|Florence|F|;Labussiere-Wallet|Hélène|H|;Thomas|Xavier|X|;Nicolini|Franck-Emmanuel|FE|;Wattel|Eric|E|;Ducastelle-Leprêtre|Sophie|S|;Barraco|Fiorenza|F|;Lebras|Laure|L|;Salles|Gilles|G|;Michallet|Mauricette|M|;Rioufol|Catherine|C|", "chemical_list": "D000998:Antiviral Agents; D019653:Myeloablative Agonists; D063065:Organophosphonates; D003596:Cytosine; D000077404:Cidofovir", "country": "United States", "delete": false, "doi": "10.1016/j.bbmt.2015.12.009", "fulltext": null, "fulltext_license": null, "issn_linking": "1083-8791", "issue": "22(4)", "journal": "Biology of blood and marrow transplantation : journal of the American Society for Blood and Marrow Transplantation", "keywords": "BK virus; Cidofovir; Hematopoietic stem cell transplantation; Hemorrhagic cystitis", "medline_ta": "Biol Blood Marrow Transplant", "mesh_terms": "D000328:Adult; D000998:Antiviral Agents; D001739:BK Virus; D000077404:Cidofovir; D003556:Cystitis; D003596:Cytosine; D004334:Drug Administration Schedule; D005260:Female; D005919:Glomerular Filtration Rate; D006085:Graft Survival; D019337:Hematologic Neoplasms; D018380:Hematopoietic Stem Cell Transplantation; D006470:Hemorrhage; D006801:Humans; D008297:Male; D008875:Middle Aged; D019653:Myeloablative Agonists; D063065:Organophosphonates; D027601:Polyomavirus Infections; D012189:Retrospective Studies; D016019:Survival Analysis; D019172:Transplantation Conditioning; D014184:Transplantation, Homologous; D014412:Tumor Virus Infections; D019562:Viral Load", "nlm_unique_id": "9600628", "other_id": null, "pages": "723-730", "pmc": null, "pmid": "26718666", "pubdate": "2016-04", "publication_types": "D016428:Journal Article", "references": null, "title": "Cidofovir in the Treatment of BK Virus-Associated Hemorrhagic Cystitis after Allogeneic Hematopoietic Stem Cell Transplantation.", "title_normalized": "cidofovir in the treatment of bk virus associated hemorrhagic cystitis after allogeneic hematopoietic stem cell transplantation" }
[ { "companynumb": "PHHY2016FR019181", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "MYCOPHENOLATE MOFETIL" }, "drugadditional": null, ...
{ "abstract": "The first case of invasive pulmonary infection due to the thermophilic fungus Thermoascus crustaceus in a kidney transplant recipient is described. For the identification of the fungal isolate, morphological aspects and molecular analysis have been used. The case report emphasizes this fungal species as an opportunistic human pathogen and underlines the importance of an accurate laboratory diagnosis for the correct management of the patient.", "affiliations": "Laboratory of Antimicrobial Chemotherapy, Ion Ionescu de la Brad University, Iași, Romania.;4th Department, \"Matei Balș\" National Institute of Infectious Diseases, Bucharest, Romania.;Department of Nephrology, \"Gr. T. Popa\" University of Medicine and Pharmacy, Iași, Romania.;Intelcentru, \"Petru Poni\" Institute of Macromolecular Chemistry, Iași, Romania.;Department of Nephrology, \"Gr. T. Popa\" University of Medicine and Pharmacy, Iași, Romania.;Department of Microscopic Morphology/Histology, Angiogenesis Research Center, \"Victor Babeș\" University of Medicine and Pharmacy, Timișoara, Romania.", "authors": "Mareș|Mihai|M|;Moroti-Constantinescu|Valentina-Ruxandra|VR|;Voroneanu|Luminița|L|;Doroftei|Florica|F|;Covic|Adrian|A|;Mederle|Ovidiu-Alexandru|OA|", "chemical_list": null, "country": "New Zealand", "delete": false, "doi": "10.2147/IDR.S209164", "fulltext": "\n==== Front\nInfect Drug ResistInfect Drug ResistIDRidrInfection and Drug Resistance1178-6973Dove 20916410.2147/IDR.S209164Case ReportInvasive pulmonary infection due to Thermoascus crustaceus in a kidney transplant recipient Mareș et alMareș et alMareș Mihai 1Moroti-Constantinescu Valentina-Ruxandra 23Voroneanu Luminița 45Doroftei Florica 6Covic Adrian 45Mederle Ovidiu-Alexandru 71 Laboratory of Antimicrobial Chemotherapy, Ion Ionescu de la Brad University, Iași, Romania2 4th Department, “Matei Balș” National Institute of Infectious Diseases, Bucharest, Romania3 Department of Infectious Diseases, “Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania4 Department of Nephrology, “Gr. T. Popa” University of Medicine and Pharmacy, Iași, Romania5 Renal Transplantation Center, “C. I. Parhon” Clinical Hospital, Iași, Romania6 Intelcentru, “Petru Poni” Institute of Macromolecular Chemistry, Iași, Romania7 Department of Microscopic Morphology/Histology, Angiogenesis Research Center, “Victor Babeș” University of Medicine and Pharmacy, Timișoara, RomaniaCorrespondence: Mihai MareșLaboratory of Antimicrobial Chemotherapy, Ion Ionescu de la Brad University, 8 Aleea Mihail Sadoveanu, P4, 1st Floor700489Iași, RomaniaTel +40 72 246 5789Fax +40 23 240 7316Email mihaimares@fungi.ro* These authors contributed equally to this work\n\n03 7 2019 2019 12 1929 1934 19 3 2019 17 6 2019 © 2019 Mareș et al.2019Mareș et al.This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php).Abstract\nThe first case of invasive pulmonary infection due to the thermophilic fungus Thermoascus crustaceus in a kidney transplant recipient is described. For the identification of the fungal isolate, morphological aspects and molecular analysis have been used. The case report emphasizes this fungal species as an opportunistic human pathogen and underlines the importance of an accurate laboratory diagnosis for the correct management of the patient.\n\nKeywords\nThermoascus crustaceusthermophilic fungipulmonary infectioncaspofunginimmunosuppression\n==== Body\nIntroduction\nMore than thirty distinct fungal species belonging to various taxonomical groups are able to thrive at higher temperatures and to exhibit an extremely active metabolic pattern including secretory enzymes like protease, lipase, amylase, laccase, trehalaze and others.1 Thermophilic fungi are uncommon isolates in clinical specimens despite their ubiquitous existence in the environment. They can affect immunocompromised hosts and some species can pose serious diagnostic problems due to their morphological resemblance with other related fungi.2 An accurate laboratory diagnostic is crucial for the subsequent management of the infection, particularly in patients at risk.\n\nCase report\nA 33-year-old Romanian woman, who had undergone kidney transplantation eight years before, from a living related donor, was admitted to our clinic with fever, rhinorrhea, cough and serous expectoration, four days after the onset of the symptoms (D4).\n\nShe had been diagnosed with nephrotic syndrome eleven years ago while working in Italy. One year later, after having returned to Romania, continuous ambulatory peritoneal dialysis (CAPD) was started because of severe impairment of the renal function (Chronic Kidney Disease – stage 5). After two years of CAPD, kidney transplantation from a living related donor (mother) was performed in Bucharest and follow-up was assured by the same clinic until last year. During this period, a chronic graft dysfunction (CGD) occurred, with a creatinine baseline of 2.5–2.8 mg/dL. Since January last year, the patient has been monitored in a clinic at the Renal Transplantation Center (Iași, Romania) and her history revealed four severe episodes of urinary tract infection and secondary serositis due to tacrolimus over dosage (amended after dose reduction). Anemia and arterial hypertension secondary to CGD were also diagnosed. The home treatment consisted of tacrolimus 0.5 mg twice a day, mofetil mycophenolate 1 g twice a day, prednisone 5 mg every two days, metoprolol 50 mg twice a day, moxonidine 0.4 mg twice a day, enalapril 5 mg daily, furosemide 0.5 mg/kg twice a day, and erythropoietin 5,000 U twice a week.\n\nOn D0, in the first day of the onset of the symptoms (fever, cough and rhinorrhea), the patient presented to the outpatient department of the county hospital where she was diagnosed with interstitial pneumonia and empirically treated with amoxicillin/clavulanic acid 1 g twice a day. Because of fever persistence under antibiotic therapy, the patient asked a consultation in our clinic four days later. On hospital admission, the patient was in mild stress, dehydrated and with low-grade fever. The vital signs and oxygen saturation were normal except a sinusal tachycardia (95 beats/minute) and crackles on the left lung base. Urine output was of 1,000 mL within the first 24 hrs. Laboratory tests revealed inflammatory syndrome (erythrocyte sedimentation rate: 42 mm/1 hr, C-Reactive Protein: 46 mg/dL, fibrinogen: 706 mg/dL), and renal dysfunction (creatinine − 4.8 mg/dL, urea − 200 mg/dL). The white blood cells count was normal (6,500/mm3). Although chest X-ray evidenced interstitial lung opacity, the microbiological examination of the sputum was negative. At that time, an interdisciplinary consultation team recommended moxifloxacin, pulsed-therapy with methylprednisolone, parenteral fluid therapy, and cancelation of diuretics and angiotensin-converting-enzyme inhibitors administration. This therapeutic approach improved the renal function with an important decrease of the nitrogen retention but had no effect against the respiratory symptoms. The fever persisted (38.0−38.7°C) while the cough and dyspnea were progressively exacerbating. Fiberoptic bronchoscopy revealed a normal aspect of the airways and the culture of bronchial aspirate exhibited Candida krusei in one sample. Most probably, it was an oral contamination because five other samples gave negative cultures. High-resolution computed tomography (CT) scan performed on D38 evidenced left basal condensation. In that context, the therapeutic protocol was modified with co-trimoxazole, plus meropenem, plus voriconazole, and valganciclovir being added to the previous schema to target the possible etiologies of infection in this immunocompromised patient. Under this therapy, the patient’s general status progressively deteriorated, the fever increased up to 40°C, dyspnea and cough got aggravated, hemoptysis and two episodes of acute pulmonary edema occurred. Crackles in both lower hemithorax were identified. Another CT scan performed on D51 revealed multiple condensation areas throughout both lungs (Figure 1A). There were identified non-systematized ground-glass diffuse areas around the bronchial vessels, disseminated in both lungs. The thickening of the alveolar septa and the lobar and segmental bronchial walls, an important increase in number and volume of previously described processes, and two 1.5 cm pulmonary condensation processes in the upper right lobe have also occurred. Air bronchogram was present.Figure 1 CT scan aspects of the pulmonary tissue: at D51, before starting the caspofungin treatment (A) and at D78, after the appropriate treatment was done (B).\n\n\n\nNo conclusive figures of Aspergillus infection (ie, “halo” sign or “air crescent” sign) were detected. The inflammatory syndrome became more severe (erythrocyte sedimentation rate: >150 mm/1 hr, C-Reactive Protein: 200 mg/dL, fibrinogen: 902 mg/dL). Another fiberoptic bronchoscopy showed mucopurulent and sanguinolent secretions. A bronchial aspirate and a transbronchial biopsy were performed and the samples were directed for microbiological investigations. Direct microscopic examination using calcofluor white revealed septate hyphal elements in both specimens. All cultures were negative for bacteria, but a filamentous fungus grew after 48 hrs of incubation at 37°C on all Sabouraud Dextrose Agar plates (Bio-Rad Laboratories, Hercules, USA) inoculated with both clinical samples. The fungus was presumptively identified as Paecilomyces sp. and the antifungal susceptibility testing was performed using Sensititre YO-10 plates (Trek Diagnostic Systems, East Grinstead, UK). Although no clinical breakpoints were available for this organism, low minimal inhibitory concentrations (MICs) were obtained for posaconazole (0.008 mg/L) and echinocandins (anidulafungin − 0.015 mg/L, caspofungin − 0.015 mg/L and micafungin − 0.008 mg/L) suggesting at least in vitro susceptibility.\n\nAt that point, the therapeutic protocol was modified with caspofungin being used as single antimicrobial agent for 28 days. Under this therapy, the patient improved continuously, the physical signs normalized, and the inflammatory syndrome disappeared (the last value of the C-Reactive Protein − 3.6 mg/dL). The last CT scan performed on D78 showed a marked reduction of condensation areas in both lungs (Figure 1B). In the anterior and posterior upper right lobe and apical-posterior and anterior upper left lobe segment, there was an increase of the peri- and intralobular pulmonary design, with a residual pneumonitis aspect associated with the sketching of fewer focal areas of residual ground-glass appearance at this level. Compared with the previous tomographic investigation, focal areas are much diminished in intensity and extension. The patient was discharged two weeks later, and no relapses occurred during a two-year follow-up.\n\nThe isolate was subsequently processed for taxonomic purposes at Centraalbureau voor Schimmelcultures (now Westerdijk Fungal Biodiversity Institute) in Utrecht (The Netherlands) and “Petru Poni” Institute of Macromolecular Chemistry, and it was identified as Thermoascus crustaceus (anamorph Paecilomyces crustaceus) using morphological and molecular methods. The strain is available for access in the CBS Collection of Fungi (CBS 133,504). The main morphological aspects are shown in the Figure 2A–D. Colonies of our strain on malt-agar were spreading broadly, attaining a diameter of 8 cm within 7 days at 40°C. They were avellaneous at first, later switching to orange colors. Conidiophores arising from submerged hyphae or sometimes also as branches of the aerial hyphae, were up to 100 μm in length and 4–10 μm in diameter. Phialides were cylindrical with an abruptly tapering neck and measured 11–23×2.5–4.0 μm. Conidia varied from ellipsoidal to cylindrical, rounded at both ends, smooth-walled, hyaline to pale brown, 7–10×3–6 μm (Figure 2A). Chlamydospores were absent. Superficial ascomata were appearing in crusts, subspherical to hemispherical, non-ostiolate, yellowish-orange to reddish-orange, mostly 600–800 μm diameter, surrounded by a loose cover of aerial hyphae (Figure 2B). Peridium pseudoparenchymatous, asci ripening within 14 days on Oatmeal Agar, 8-spored, subspherical, irregularly arranged in the centrum (Figure 2C). Ascospores were pale yellow to pale brown, ovoidal to ellipsoidal, 7–8×4.5–6 μm, thick-walled, finely echinulate (Figure 2D). The isolate is thermophilic, growing faster between 37°C and 42°C than to lower temperatures. There was a clear difference between the colonies developed at 30°C and 37°C respectively, with the first exhibiting numerous ascomata on their surface (Figure 3A and B).Figure 2 Morphological aspects of the T. crustaceus isolate in scanning electron microscopy (ESEM Quanta 200-FEI, Hillsboro – USA): chains of conidia; (A) subspherical to hemispherical, non-ostiolate ascoma; (B) 8-spored asci; (C) thick-walled, finely echinulate ascospores (D).\n\nFigure 3 Macroscopic aspects of the T. crustaceus isolate after 5 days incubation at different temperatures on Potatoes Dextrose Agar: 30°C (A); 37°C (B).\n\n\n\nThe phenotypic identification was further confirmed by molecular tests. DNA extraction was performed using the MoBio-UltraCleanTM Microbial DNA Isolation Kit according to the instructions of the manufacturer. Fragments containing the 26S ribosomal RNA gene, Large Subunit D1 and D2 region (LSU) were amplified using the primers LR0R (ACCCGCTGAACTTAAGC) and LR5 (TCCTGAGGGAAACTTCG).3 Fragments containing the Internal Transcribed Spacer 1 and 2, and the 5.8S gene (ITS) were amplified using the primers LS266 (GCATTCCCAAACAACTCGACTC) and V9G (TTACGTCCCTGCCCTTTGTA).4 The PCR fragments were sequenced with the ABI Prism® Big DyeTM Terminator v. 3.0 Ready Reaction Cycle sequencing kit. Samples were analyzed on an ABI PRISM 3700 Genetic Analyzer and contigs were assembled using the forward and reverse sequences with the SeqMan software from the LaserGene package. The sequences of our T. crustaceus isolate have been deposited in the GenBank database under the accession number JX845310. High percentages of similarity with other T. crustaceus strains were achieved for our isolate (Figure 4): 98.55% to T. crustaceus NRRL 1563 (GenBank accession No. EU021597.1), and 98.49% to T. crustaceus CBS181.67 (GenBank accession No. NR_144915.1).Figure 4 Phylogenetic tree of Thermoascus crustaceus based on confidently aligned internal transcribed spacer (ITS) sequences available in GenBank (constructed with BLASTN 2.9.0+).\n\n\n\nDiscussion\nT. crustaceus is an ascomycetous thermophilic fungus ubiquitously distributed in compost, domestic wastes, soil, air, stored cereal grains, nesting materials of birds etc. from where it can be easily inhaled by humans.5 Also, it is more and more frequently isolated from pasteurized acid products being recognized as one of the most heat-resistant fungal species.6 Due to its capability to grow above the body temperature of mammals, this kind of fungi can act as potential human pathogens.2 Thermophilic fungi also have a pattern of protein expression that assures high levels of protein secretion outside the cells – especially thermotolerant enzymes (proteases, lipases).1,5 This may be responsible for the inflammatory syndrome occurred in our patient, even under glucocorticoid therapy.\n\nThe main risk factor for the development of an invasive pulmonary infection in our transplant patient was the long-term immunosuppression while the extension of the lesions was due to the lack of appropriate investigations and treatment in the first stages of the illness. Later, a proven invasive fungal infection was documented according to EORTC/MSG Consensus Group guidelines and an effective therapy was started.7\n\nTo our knowledge, this is the first report of an invasive fungal infection caused by T. crustaceus and it emphasizes the pathogenic abilities of the fungus to cause severe illness in humans, especially under immunosuppressive conditions. Only two cases of colonization with T. crustaceus of the peritoneal catheter were previously described in the literature.8,9 At 37°C, the colonies of T. crustaceus can mimic other related species (especially Paecilomyces variotii) due to their avellaneous color and powdery appearance. This could result in misidentification of the isolates, if additional investigations like thermotolerance and molecular tests are not performed.\n\nAcknowledgments\nThe Ministry of Education and Research from Romania supported Mihai Mareș by CNCSIS-UEFISCDI PN II-RU 159/2010 grant. The authors are grateful to Martin Meijer and Professor Robert A. Samson from Westerdijk Fungal Biodiversity Institute (Utrecht, The Netherlands) for assistance with molecular identification and morphological description. Prior to initial manuscript submission, a written informed consent has been obtained from the patient stating that all case details and accompanying images can be published in a specialty journal. Also, the institutional approval for publication has been obtained from Renal Transplantation Center, C. I. Parhon Hospital in Iasi (Romania). The ethics committee of the same institution agreed on the publication of all case details.\n\nDisclosure\nThe authors report no conflicts of interest in this work.\n==== Refs\nReferences\n1. Maheshwari \nR , Bharadwaj \nG , Bhat \nM . Thermophilic fungi: their physiology and enzymes . Microbiol Mol Biol Rev . 2000 ;64 :461 –488 . doi:10.1128/mmbr.64.3.461-488.2000 10974122 \n2. Luangsa-ard \nJJ , Manoch \nL , Hywel-Jones \nN , Artjariyasripong \nS , Samson \nAR . Thermotolerant and thermoresistant paecilomyces and its teleomorphic states isolated from Thai forest and mountain soils . Kasetsart J . 2004 ;37 :94 –101 .\n3. Vilgalys \nR , Hester \nM . Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several cryptococcus species . J Bacteriol . 1990 ;172 :4239 –4246 . doi:10.1128/jb.172.8.4238-4246.1990 \n4. Gerrits van den Ende \nAHG , de Hoog \nGS . Variability and molecular diagnostics of the neurotropic species Cladophialophora bantiana . Stud Mycol . 1999 ;43 :151 –159 .\n5. Shaik \nYB . Inflammatory thermophilic fungi are used in biotechnology applications . Eur J Inflamm . 2006 ;4 :147 –155 . doi:10.1177/1721727X0600400303 \n6. Scaramuzza \nN , Berni \nE . Heat-resistance of hamigera avellanea and Thermoascus crustaceus isolated from pasteurized acid products . Int J Food Microbiol . 2014 ;168-169 :63 –68 . doi:10.1016/j.ijfoodmicro.2013.10.007 24239977 \n7. Pauw \nBD , Walsh \nTJ , Donnelly \nJP , et al. Revised definitions of invasive fungal disease from the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus Group . Clin Infect Dis . 2008 ;46 :1813 –1821 . doi:10.1086/588660 18462102 \n8. Oz \nY , Kiraz \nN , Ozkurt \nS , Soydan \nM . Colonization of peritoneal catheter with a thermophilic fungus, Thermoascus crustaceus: a case report . Med Mycol . 2010 ;48 :1105 –1107 . doi:10.3109/13693781003793838 20446887 \n9. Alvarez \nE , Castillo \nA , Iturrieta \nI . Fungal peritonitis by Thermoascus crustaceus in a peritoneal dialysis patient from Chile . Rev Iberoam Micol . 2017 ;34 (4 ):225 –228 . doi:10.1016/j.riam.2017.01.004 28625762\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "1178-6973", "issue": "12()", "journal": "Infection and drug resistance", "keywords": "Thermoascus crustaceus; caspofungin; immunosuppression; pulmonary infection; thermophilic fungi", "medline_ta": "Infect Drug Resist", "mesh_terms": null, "nlm_unique_id": "101550216", "other_id": null, "pages": "1929-1934", "pmc": null, "pmid": "31308712", "pubdate": "2019", "publication_types": "D016428:Journal Article", "references": "10974122;18462102;20446887;2376561;24239977;28625762", "title": "Invasive pulmonary infection due to Thermoascus crustaceus in a kidney transplant recipient.", "title_normalized": "invasive pulmonary infection due to thermoascus crustaceus in a kidney transplant recipient" }
[ { "companynumb": "RO-SUN PHARMACEUTICAL INDUSTRIES LTD-2021R1-277024", "fulfillexpeditecriteria": "1", "occurcountry": "RO", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "VORICONAZOLE" }, "dr...
{ "abstract": "Thrombotic storm (TS) is a rare disease, especially with thrombus in the heart of pediatric patient. We present a case of a 4-year-old boy, who was diagnosed with TS during his first hospitalization due to lower extremity deep venous thrombosis, pulmonary embolism, and thrombosis of the inferior vena cava, cerebral, left internal jugular, portal, renal, and iliac veins. He was eventually prescribed with rivaroxaban to control thrombosis after 30 days of successive use of low-molecular-weight heparin, unfractionated heparin, and warfarin, which were demonstrating little effect on preventing thrombosis, and the patient was intolerant to argatroban. While his lupus anticoagulant ratio was slightly above the normal range and no other potential causes such as congenital thrombophilia, severe infection, malignancy, and trauma were confirmed, we suspected antiphospholipid antibody syndrome and prescribed glucocorticoid and rituximab to control the disease. After 36 days of admission, ultrasonography showed recanalization of the former thrombus. One month after discharge, a tumor embolus resembling a mass emerged in his right atrium under effective anticoagulant therapy. During his second admission, he underwent surgical thrombectomy, and pathological examination confirmed the mass to be a platelet-rich thrombus rather than tumor embolus or infection. Considering the suspected antiphospholipid antibody syndrome as the cause of the TS, we prescribed aspirin combined with rivaroxaban to prevent thrombosis. In this case, surgery and pathology shed light on the type of thrombus that emerged from the inferior vena cava and traveled to the heart, which is the possible potential cause of TS. It also changed our therapeutic strategy to antiplatelet therapy combined with anticoagulant therapy to control the disease.", "affiliations": "1 Beijing Key Laboratory of Pediatric Hematology Oncology; National Key Discipline of Pediatrics (Capital Medical University); Key Laboratory of Major Diseases in Children, Ministry of Education; Hematology Oncology Center, Beijing Children's Hospital, Capital Medical University, National Center for Children's Health, China.;2 Heart Center, Beijing Children's Hospital, Capital Medical University, National Center for Children's Health, Beijing, China.;2 Heart Center, Beijing Children's Hospital, Capital Medical University, National Center for Children's Health, Beijing, China.;3 Department of Pathology, Beijing Children's Hospital, Capital Medical University, National Center for Children's Health, Beijing, China.;2 Heart Center, Beijing Children's Hospital, Capital Medical University, National Center for Children's Health, Beijing, China.;1 Beijing Key Laboratory of Pediatric Hematology Oncology; National Key Discipline of Pediatrics (Capital Medical University); Key Laboratory of Major Diseases in Children, Ministry of Education; Hematology Oncology Center, Beijing Children's Hospital, Capital Medical University, National Center for Children's Health, China.;1 Beijing Key Laboratory of Pediatric Hematology Oncology; National Key Discipline of Pediatrics (Capital Medical University); Key Laboratory of Major Diseases in Children, Ministry of Education; Hematology Oncology Center, Beijing Children's Hospital, Capital Medical University, National Center for Children's Health, China.;2 Heart Center, Beijing Children's Hospital, Capital Medical University, National Center for Children's Health, Beijing, China.", "authors": "Ma|Jing-Yao|JY|https://orcid.org/0000-0003-3737-0876;Zhang|Xin|X|;Li|Xiao-Feng|XF|;He|Le-Jian|LJ|;Ma|Ning|N|;Wei|Yun-Yun|YY|;Wu|Run-Hui|RH|;Wang|Fang-Yun|FY|", "chemical_list": "D000925:Anticoagulants; D010975:Platelet Aggregation Inhibitors", "country": "England", "delete": false, "doi": "10.1177/2058738418778121", "fulltext": "\n==== Front\nInt J Immunopathol PharmacolInt J Immunopathol PharmacolIJIspijiInternational Journal of Immunopathology and Pharmacology0394-63202058-7384SAGE Publications Sage UK: London, England 10.1177/205873841877812110.1177_2058738418778121Letter to the EditorThrombotic storm in a 4-year-old boy with a thrombus in the right\natrium https://orcid.org/0000-0003-3737-0876Ma Jing-Yao 1Zhang Xin 2Li Xiao-Feng 2He Le-Jian 3Ma Ning 2Wei Yun-Yun 1Wu Run-Hui 1Wang Fang-Yun 21 Beijing Key Laboratory of Pediatric\nHematology Oncology; National Key Discipline of Pediatrics (Capital Medical\nUniversity); Key Laboratory of Major Diseases in Children, Ministry of Education;\nHematology Oncology Center, Beijing Children’s Hospital, Capital Medical University,\nNational Center for Children’s Health, China2 Heart Center, Beijing Children’s\nHospital, Capital Medical University, National Center for Children’s Health,\nBeijing, China3 Department of Pathology, Beijing\nChildren’s Hospital, Capital Medical University, National Center for Children’s\nHealth, Beijing, ChinaRun-Hui Wu, Hematology Oncology Center,\nBeijing Children’s Hospital, Capital Medical University, National Center for\nChildren’s Health, 56 Nanlishi Road, Beijing 100045, China. Email:\nrunhuiwu@hotmail.comFang-Yun Wang, Heart Center, Beijing\nChildren’s Hospital, Capital Medical University, National Center for Children’s\nHealth, 56 Nanlishi Road, Beijing 100045, China. Email:\nwfyy1026@sina.com25 5 2018 Mar-Dec 2018 32 205873841877812123 12 2017 19 4 2018 © The Author(s) 20182018SAGE Publications Ltd unless otherwise noted.\nManuscript content on this site is licensed under Creative Commons\nLicensesThis article is distributed under the terms of the Creative Commons\nAttribution-NonCommercial 4.0 License (http://www.creativecommons.org/licenses/by-nc/4.0/) which\npermits non-commercial use, reproduction and distribution of the work\nwithout further permission provided the original work is attributed as\nspecified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).Thrombotic storm (TS) is a rare disease, especially with thrombus in the heart of\npediatric patient. We present a case of a 4-year-old boy, who was diagnosed with\nTS during his first hospitalization due to lower extremity deep venous\nthrombosis, pulmonary embolism, and thrombosis of the inferior vena cava,\ncerebral, left internal jugular, portal, renal, and iliac veins. He was\neventually prescribed with rivaroxaban to control thrombosis after 30 days of\nsuccessive use of low-molecular-weight heparin, unfractionated heparin, and\nwarfarin, which were demonstrating little effect on preventing thrombosis, and\nthe patient was intolerant to argatroban. While his lupus anticoagulant ratio\nwas slightly above the normal range and no other potential causes such as\ncongenital thrombophilia, severe infection, malignancy, and trauma were\nconfirmed, we suspected antiphospholipid antibody syndrome and prescribed\nglucocorticoid and rituximab to control the disease. After 36 days of admission,\nultrasonography showed recanalization of the former thrombus. One month after\ndischarge, a tumor embolus resembling a mass emerged in his right atrium under\neffective anticoagulant therapy. During his second admission, he underwent\nsurgical thrombectomy, and pathological examination confirmed the mass to be a\nplatelet-rich thrombus rather than tumor embolus or infection. Considering the\nsuspected antiphospholipid antibody syndrome as the cause of the TS, we\nprescribed aspirin combined with rivaroxaban to prevent thrombosis. In this\ncase, surgery and pathology shed light on the type of thrombus that emerged from\nthe inferior vena cava and traveled to the heart, which is the possible\npotential cause of TS. It also changed our therapeutic strategy to antiplatelet\ntherapy combined with anticoagulant therapy to control the disease.\n\ncardiacthrombosisthrombotic stormBeijing Natural Science Foundation of China7152053Beijing Municipal Administration of Hospitals Clinical\nmedicine Development of special funding supportZY201404National Natural Science Foundation of Chinahttps://doi.org/10.13039/50110000180981700287Beijing Municipal Science and Technology Project “The\nCapital characteristic Clinical Application Research”Z141107002514130cover-dateMarch-December 2018\n==== Body\nIntroduction\nThrombotic storm (TS) is a rare disease that manifests through hypercoagulable\nclinical conditions with at least two arterial and/or venous thromboembolic events,\ntypically at unusual sites.1 It progresses rapidly, and depending on the affected blood vessels, it often\nleads to severe complications.2 TS has multiple causes, which make it difficult to diagnose the primary disease.1 Some patients have to face cardiopulmonary insufficiency and even amputation\nduring follow-up.3 In China, data on children with TS are limited. Given the scarce and\nlife-threatening traits of this disease, it is critical to recognize the disease and\nto determine suitable management. We describe a patient diagnosed with TS, which was\nhighly suspected to be caused by antiphospholipid antibody syndrome (APS), who had a\nthrombus that emerged in the right atrium (RA).\n\nCase report\nA 4-year-old boy diagnosed with TS was admitted to our hospital again, as\nechocardiography showed an isoechoic to hyperechoic mass that emerged from his RA\nduring follow-up visit. One month prior, the boy was initially admitted to our\nhospital with symptoms of intermittent headache and vomiting for 20 days and left\nlower limb swelling for 1 day. Ultrasonography and magnetic resonance imaging (MRI)\nshowed thrombi in the cerebral venous sinus, inferior vena cava (IVC), left internal\njugular, portal, left renal, common iliac, internal iliac, and external iliac veins.\nEchocardiography showed an enlarged right heart, pulmonary hypertension, and\npulmonary embolisms (PEs). The enhanced lung computed tomography (CT) scan showed\nbilateral pneumonia and multiple PEs.\n\nDuring his first hospitalization, the patient was examined for conditions which could\ndrive the pathogenesis of thrombosis, such as factor V Leiden mutation, protein C\nand S deficiency, APS, severe infection, trauma, systemic lupus erythematosus, and\nmalignancy. The evaluation showed that only his lupus anticoagulant (LA) ratio was\nslightly positive (1.22–1.53), whereas other indicators (e.g. protein C, protein S,\nplatelet factor4 (PF4)-heparin antibodies, tumor markers, bone marrow cytology,\nextractable nuclear antigen, anticardiolipin antibodies, and anti-β2-glycoprotein I\nantibodies) were within the normal range. Besides, his family history of thrombosis\nwas negative. Severe infection and history of trauma were both excluded. Thus, a\nsuspected diagnosis of APS was made according to the onset age, major thrombotic\nevent, and positive LA ratio.\n\nHe was prescribed low-molecular-weight heparin, unfractionated heparin, and warfarin\nsuccessively, by which the disease progress was not slowed down as expected after\n30 days of treatment. Notably, the international normalized ratio had already\nreached 2.89 after warfarin therapy (0.09 mg/kg/day) for 4 days; while considering\nthat the thrombus in the IVC was reaching the RA within a length of 1 cm, we used\nargatroban, a small molecule direct thrombin inhibitor, to prevent disease from\ndeterioration, with the informed consent from patient’s parents. However, it aroused\nanaphylactic shock and disseminated intravascular coagulation 2 h later. We\ndiscontinued argatroban and prescribed antiallergic drugs, prothrombin complex\nconcentrates, and plasma to stabilize the condition. In an attempt to inhibit\nthrombosis, we finally chose rivaroxaban after obtaining the parent’s written\ninformed consent, an active direct factor Xa inhibitor, which is taken by mouth,\nwhich was well tolerated by the patient. Apart from the anticoagulants, he received\nimmunosuppressors (a glucocorticoid and rituximab), plasma transfusion, and\nantibiotics as well. After 36 days of admission, ultrasonography showed thrombus\nrecanalization in the IVC, left renal vein, and left internal jugular vein. The boy\nwas discharged from the hospital and followed up in an outpatient clinic. During a\nfollow-up visit, his echocardiography showed an isoechoic to hyperechoic mass in the\nRA (Figure 1). The mass,\nwhich was 47.1 mm × 21.8 mm, from the IVC to the RA, passed through the tricuspid\nvalve into the right ventricle (RV) in diastole while the former thrombi in other\nvessels had already vanished. To determine the properties of the mass, we performed\nultrasound, contrast-enhanced CT, MRI, positron emission tomography–CT, and assessed\ntumor markers; however, all results were negative. The bone marrow smear, peripheral\nblood smear, and bone marrow myelodysplasia/myeloproliferative neoplasm test results\nwere negative.\n\nFigure 1. Echocardiography showing an isoechoic to hyperechoic mass (arrow) emerged\nfrom the IVC to the RA, passing through the tricuspid valve into the RV in\ndiastole. RA: right atrium; RV: right ventricle; IVC: inferior vena\ncava.\n\nPhysicians from hematology, oncology, cardiac surgery, and the intensive care unit\nconsulted and decided to perform a cardiac operation to excise the thrombus. After\nreceiving an informed consent from the patient’s guardian, cardiac surgeons\nperformed the operation, during which they found a huge embolus (40 mm × 30 mm),\nwhich was reddish, hard, and fragile; it could be seen in the RA, was connected to\nthe IVC, and invaded the tricuspid valve. The surgeons removed the embolus and\ncleaned the IVC.\n\nWith regard to the pathological findings, light microscopic examination showed a\nplatelet-rich thrombus, scattered with lymphocytes, neutrophils, and eosinophils,\nwithout tumor components (Figure\n2). Based on the histopathological features, as well as the consideration\nof APS as the cause of the disease, we administered antiplatelet therapy to prevent\nrecurrence of thrombosis.\n\nFigure 2. Light microscopic examination showing platelet-rich thrombus, scattered with\nlymphocytes, neutrophils, and eosinophils, without tumor components.\n\nSince then, the patient has taken aspirin combined with rivaroxaban for more than\n1 year. During follow-up, we found no new thromboses by Doppler ultrasonography.\nEchocardiography showed no abnormal mass within the heart chamber or IVC. The\ncoagulation function test indicated prothrombin time of 12.0–12.2 s, fibrinogen of\n2.88–3.77 g/L, activated partial thromboplastin time of 32.4–36.9 s,\nd-dimer of 0.05 mg/L, and antithrombin-III of 100%−108%. The LA turned\nnegative 6 months after surgery, with other indicators related to APS remained\nnegative. No aggravation or recurrence occurred during the patient’s follow-up\nperiod.\n\nDiscussion\nKitchens et al.1 suggested that TS has certain clinical characteristics; for example, it\naffects younger individuals, presents as two or more arterial or venous\nthromboemboli, has an unusual location, is progressive or has a recent unexplained\nrecurrence, is refractory to acute therapy, has an atypical response to therapy, and\nso on.1 Triggers of TS include infection,4 inflammation, trauma, medications, and overlapping diseases such as APS.\nKitchens suggested that TS is a phenomenon of which “thrombosis begets thrombosis.”4 Studies have indicated that antiphospholipid antibody is either absent or\npresent at a low level in children with TS during the acute course of the disease,\nbut children become positive for this antibody later during the follow-up period.5 Our patient’s symptoms manifested as generalized phlebothrombosis combined\nwith PE during his first hospitalization; thus, he was diagnosed as having TS with\nsuspected APS. With effective treatment of anticoagulation and immunosuppression\ntherapy, the enormous mass with its tumor embolus–like morphology emerged from the\nRA less than 1 month after recanalization of the former thrombus, which indicated\nthat the primary disease may be malignant, although there was insufficient evidence\nof a solid tumor or hematopoietic tumor according to radiography, pathology, and\nimmunology examinations. As the disease progressed, the neoplastic neck of the mass\nbecame narrow, and the length of its extrusion into the RV increased. Inter-hospital\nconsultation suggested that malignancy should not be excluded even though there was\nno sufficient evidence. Patients should immediately undergo surgery to excise the\nprogressively enlarged mass which was life threatening, and as we could not confirm\nits nature, it might as well affect our therapeutic options. However, there were two\nrisks associated with cardiac operation: (1) hemorrhage and poor healing of\nincisions during and after the surgery because of anticoagulation and\nimmunosuppression therapy, and (2) hypercoagulability during extracorporeal\ncirculation due to non-heparinization during the patient’s first hospitalization.\nFortunately, the embolectomy was successful, and the mass inside the RA was\nconfirmed to be a platelet-rich thrombus instead of a tumor or infection according\nto pathological examination results. Considering that the thrombus was emerged from\nIVC to the RA under the condition of recanalization of others during anticoagulant\ntherapy, as well as its pathological features and the suspected diagnosis of APS, we\nprescribe aspirin combined with rivaroxaban to prevent thrombosis from relapse.\n\nThis case shows that a thrombus emerging from the IVC to the heart within a short\nperiod can appear like a giant tumor. Previously, we considered that the thrombus in\nthe venous system was fibrinous, but the pathology of the mass indicated that it\ncould be a platelet-rich thrombus, and antiplatelet therapy would be needed. We\nstill could not identify whether it was related to the potential cause of TS, like\nAPS, which was suspected in our patient. Further investigation is needed for the\nmechanism of how a platelet-rich thrombus forms inside the IVC and extends to the\nheart, as well as the way to prevent this condition in patients with TS.\n\nJ.-Y.M. and X.Z. contributed equally to this work. They take responsibility for all\naspects of the reliability and freedom from bias of the data presented and their\ndiscussed interpretation.\n\nDeclaration of conflicting interests: The author(s) declared no potential conflicts of interest with respect to the\nresearch, authorship, and/or publication of this article.\n\nFunding: The report was supported by Beijing Natural Science Foundation of China\n(7152053), National Natural Science Foundation of China (81700287), Beijing\nMunicipal Science and Technology Project titled “The Capital Characteristic\nClinical Application Research” (Z141107002514130), and Beijing Municipal\nAdministration of Hospitals Clinical Medicine Development of Special Funding\nSupport (ZY201404).\n\nInformed consent: The patient’s parents provided informed consent to publish this case.\n\nORCID iD: Jing-Yao Ma \nhttps://orcid.org/0000-0003-3737-0876\n==== Refs\nReferences\n1 \nKitchens CS Erkan D Brandao LR et al (2011 ) Thrombotic storm revisited:\nPreliminary diagnostic criteria suggested by the thrombotic storm study\ngroup . The American Journal of Medicine \n124 : 290 –296 .21435416 \n2 \nManco-Johnson MJ Wang M Goldenberg NA et al (2012 ) Treatment, survival, and\nthromboembolic outcomes of thrombotic storm in children .\nThe Journal of Pediatrics \n161 :\n682.e1 –688.e1 .22578585 \n3 \nMaggi U Rossi G Avesani EC et al (2013 ) Thrombotic storm in a\nteenager with previously undiagnosed ulcerative colitis .\nPediatrics \n131 :\ne1288 –e1291 .23460680 \n4 \nKitchens CS (1998 ) Thrombotic storm: When\nthrombosis begets thrombosis . The American Journal\nof Medicine \n104 : 381 –385 .9576413 \n5 \nMiret C Cervera R Reverter JC et al (1997 ) Antiphospholipid syndrome\nwithout antiphospholipid antibodies at the time of the thrombotic event:\nTransient “seronegative” antiphospholipid syndrome? \nClinical and Experimental Rheumatology \n15 : 541 –544 .9307863\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "0394-6320", "issue": "32()", "journal": "International journal of immunopathology and pharmacology", "keywords": "cardiac; thrombosis; thrombotic storm", "medline_ta": "Int J Immunopathol Pharmacol", "mesh_terms": "D000925:Anticoagulants; D016736:Antiphospholipid Syndrome; D001706:Biopsy; D001777:Blood Coagulation; D002675:Child, Preschool; D004359:Drug Therapy, Combination; D004452:Echocardiography; D006325:Heart Atria; D006331:Heart Diseases; D006801:Humans; D008297:Male; D010975:Platelet Aggregation Inhibitors; D011655:Pulmonary Embolism; D017131:Thrombectomy; D013923:Thromboembolism; D016896:Treatment Outcome; D020246:Venous Thrombosis", "nlm_unique_id": "8911335", "other_id": null, "pages": "2058738418778121", "pmc": null, "pmid": "29798687", "pubdate": "2018", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "21435416;22578585;23460680;9307863;9576413", "title": "Thrombotic storm in a 4-year-old boy with a thrombus in the right atrium.", "title_normalized": "thrombotic storm in a 4 year old boy with a thrombus in the right atrium" }
[ { "companynumb": "CN-MYLANLABS-2018M1078440", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "WARFARIN" }, "drugadditional": null, ...
{ "abstract": "We report the case of a 53- year-old man in whom the diagnosis of small cell lung cancer (SCLC) was made by the biopsy of a mass of the right trapezius muscle. A tumor was revealed on flexible bronchoscopy which pathological study showed tuberculosis (TB). Chest computed tomography (CT) scan revealed findings related to the SCLC associated to micronodules and nodules compatible with pulmonary TB. Cerebral CT scan revealed a nodule of 4.5 mm in diameter presenting enhancement after contrast material injection thought to be a metastasis. The patient was administered antitubercular treatment. Fiveteen days later, the patient started chemoptherapy with etoposid and carboplatin. A control cerebral CT scan realized after the end of the chemotherapy (2 months and a half of antitubercular treatment) revealed numerous cortical and subcortical infracentimetric nodules with contrast enhancement with a tentorial and subtentorial location considered to be in relation with cerebral miliary TB. The nodule discovered on the first cerebral scan was therefore a posteriori considered to have been of tubercular origin. The PS of the patient rapidly worsened. He presented mental confusion and died in some days.", "affiliations": null, "authors": "Zendah|Ines|I|;Kammoun|Hela|H|;Kwas|Hamida|H|;Khattab|Amel|A|;Ayadi|Aida|A|;Zidi|Asma|A|;Ghedira|Habib|H|", "chemical_list": null, "country": "Tunisia", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0041-4131", "issue": "93(2)", "journal": "La Tunisie medicale", "keywords": null, "medline_ta": "Tunis Med", "mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D001932:Brain Neoplasms; D003937:Diagnosis, Differential; D017809:Fatal Outcome; D006801:Humans; D008175:Lung Neoplasms; D008297:Male; D008875:Middle Aged; D011859:Radiography; D055752:Small Cell Lung Carcinoma; D020306:Tuberculosis, Central Nervous System", "nlm_unique_id": "0413766", "other_id": null, "pages": "104-6", "pmc": null, "pmid": "26337309", "pubdate": "2015-02", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Patient taking chemotherapy for a small cell lung cancer: not every cerebral nodule is a metastasis: the tree that hides the forest.", "title_normalized": "patient taking chemotherapy for a small cell lung cancer not every cerebral nodule is a metastasis the tree that hides the forest" }
[ { "companynumb": "TN-ACCORD-035000", "fulfillexpeditecriteria": "1", "occurcountry": "TN", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "ETOPOSIDE" }, "drugadditional": null, "drug...
{ "abstract": "The use of oral methadone in opioid substitution treatment (OST) for the management of opioid use disorder is established clinical practice. Confounding treatment is the increased risks of contracting Mycobacterium tuberculosis, the mainstay treatment of which incorporates the potent CYP 2B6 inducer rifampicin.\n\n\n\nThis study applied pharmacokinetic modelling using virtual clinical trials, to pharmacokinetically quantify the extent and impact of rifampicin-mediated drug-drug interactions (DDI) on methadone plasma concentrations. An R-methadone model was developed and validated against 11 retrospective clinical studies prior to use in all subsequent studies. The aims were to investigate: (i) the impact of the DDI on daily methadone doses of 60 mg, 90 mg and 120 mg; (ii) dose escalation during rifampicin and (iii) dose reduction following rifampicin cessation.\n\n\n\nA dose increase to 160 mg daily during rifampicin treatment phases was required to maintain peak methadone plasma concentrations within a derived therapeutic window of 80-700 ng/mL. Dose escalation prior to rifampicin initiation was not required and resulted in an increase in subjects with supra-therapeutic concentrations. However, during rifampicin cessation, a dose reduction of 10 mg every 2 days commencing prior to rifampicin cessation, ensured that most patients possessed a peak methadone plasma concentration within an optimal therapeutic window.\n\n\n\nRifampicin significantly alters methadone plasma concentrations and necessitates dose adjustments. Daily doses of almost double those used perhaps more commonly in clinical practice are required for optimal plasma concentration and careful consideration of dose reduction strategies would be required during the deinduction phase.", "affiliations": "Medicines Optimisation Research Group, Aston Pharmacy School, Aston University, Birmingham, B4 7ET, United Kingdom. Electronic address: r.k.s.badhan@aston.ac.uk.;Addaction, 67-69 Cowcross St., London EC1M 6PU, United Kingdom.;Medicines Optimisation Research Group, Aston Pharmacy School, Aston University, Birmingham, B4 7ET, United Kingdom.", "authors": "Badhan|Raj K S|RKS|;Gittins|Rosalind|R|;Al Zabit|Dina|D|", "chemical_list": "D000701:Analgesics, Opioid; D019384:Nucleic Acid Synthesis Inhibitors; D008691:Methadone; D012293:Rifampin", "country": "Ireland", "delete": false, "doi": "10.1016/j.drugalcdep.2019.03.013", "fulltext": null, "fulltext_license": null, "issn_linking": "0376-8716", "issue": "200()", "journal": "Drug and alcohol dependence", "keywords": "Dose; Methadone; Optimization; PBPK; Pharmacokinetics; Rifampicin", "medline_ta": "Drug Alcohol Depend", "mesh_terms": "D000328:Adult; D000701:Analgesics, Opioid; D004305:Dose-Response Relationship, Drug; D004347:Drug Interactions; D004359:Drug Therapy, Combination; D005260:Female; D006801:Humans; D008297:Male; D008691:Methadone; D008875:Middle Aged; D008954:Models, Biological; D019384:Nucleic Acid Synthesis Inhibitors; D058850:Opiate Substitution Treatment; D009293:Opioid-Related Disorders; D012189:Retrospective Studies; D012293:Rifampin", "nlm_unique_id": "7513587", "other_id": null, "pages": "168-180", "pmc": null, "pmid": "31122724", "pubdate": "2019-07-01", "publication_types": "D016428:Journal Article", "references": null, "title": "The optimization of methadone dosing whilst treating with rifampicin: A pharmacokinetic modeling study.", "title_normalized": "the optimization of methadone dosing whilst treating with rifampicin a pharmacokinetic modeling study" }
[ { "companynumb": "GB-ALKEM LABORATORIES LIMITED-GB-ALKEM-2019-06107", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "RIFAMPIN" }, "drugadd...
{ "abstract": "CONCLUSIONS\nPatients with Cushing's syndrome and excess exogenous glucocorticoids have an increased risk for venous thromboembolism, as well as arterial thrombi. The patients are at high risk of thromboembolic events, especially during active disease and even in cases of remission and after surgery in Cushing's syndrome and withdrawal state in glucocorticoid users. We present a case of Cushing's syndrome caused by adrenocorticotropic hormone-secreting lung carcinoid tumor. Our patient developed acute mesenteric ischemia after video-assisted thoracoscopic surgery despite administration of sufficient glucocorticoid and thromboprophylaxis in the perioperative period. In addition, our patient developed hepatic infarction after surgical resection of the intestine. Then, the patient was supported by total parenteral nutrition. Our case report highlights the risk of microthrombi, which occurred in our patient after treatment of ectopic Cushing's syndrome. Guidelines on thromboprophylaxis and/or antiplatelet therapy for Cushing's syndrome are acutely needed.\nThe present case showed acute mesenteric thromboembolism and hepatic infarction after treatment of ectopic Cushing's syndrome.Patients with Cushing's syndrome are at increased risk for thromboembolic events and increased morbidity and mortality.An increase in thromboembolic risk has been observed during active disease, even in cases of remission and postoperatively in Cushing's syndrome.Thromboprophylaxis and antiplatelet therapy should be considered in treatment of glucocorticoid excess or glucocorticoid withdrawal.", "affiliations": "Departments of Endocrinology and Metabolism.;Departments of Endocrinology and Metabolism.;Departments of Endocrinology and Metabolism.;Departments of Endocrinology and Metabolism.;Departments of Endocrinology and Metabolism.;Departments of Endocrinology and Metabolism.;Departments of Endocrinology and Metabolism.;Departments of Endocrinology and Metabolism.;Departments of Endocrinology and Metabolism.;Departments of Endocrinology and Metabolism.;Departments of Endocrinology and Metabolism.;Departments of Endocrinology and Metabolism.", "authors": "Takayasu|Shinobu|S|;Murasawa|Shingo|S|;Yamagata|Satoshi|S|;Kageyama|Kazunori|K|;Nigawara|Takeshi|T|;Watanuki|Yutaka|Y|;Kimura|Daisuke|D|;Tsushima|Takao|T|;Sakamoto|Yoshiyuki|Y|;Hakamada|Kenichi|K|;Terui|Ken|K|;Daimon|Makoto|M|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1530/EDM-16-0144", "fulltext": "\n==== Front\nEndocrinol Diabetes Metab Case RepEndocrinol Diabetes Metab Case RepEDMEndocrinology, Diabetes & Metabolism Case Reports2052-0573Bioscientifica Ltd Bristol 10.1530/EDM-16-0144EDM160144Insight into Disease Pathogenesis or Mechanism of TherapyAcute mesenteric ischemia and hepatic infarction after treatment of ectopic Cushing’s syndrome S Takayasu and othersCushing’s syndrome and risk of thromboembolismTakayasu Shinobu 1Murasawa Shingo 1Yamagata Satoshi 1Kageyama Kazunori 1Nigawara Takeshi 1Watanuki Yutaka 1Kimura Daisuke 2Tsushima Takao 2Sakamoto Yoshiyuki 3Hakamada Kenichi 3Terui Ken 1Daimon Makoto 11 Departments of Endocrinology and Metabolism2 Departments of Thoracic and Cardiovascular Surgery3 Gastroenterological Surgery, Hirosaki University Graduate School of Medicine and Hospital, Hirosaki, AomoriJapanCorrespondence should be addressed to S Takayasu; Email: stakayas@hirosaki-u.ac.jp28 2 2017 2017 2017 16-014419 1 2017 1 2 2017 © 2017 The authors2017The authors This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License.Summary\nPatients with Cushing’s syndrome and excess exogenous glucocorticoids have an increased risk for venous thromboembolism, as well as arterial thrombi. The patients are at high risk of thromboembolic events, especially during active disease and even in cases of remission and after surgery in Cushing’s syndrome and withdrawal state in glucocorticoid users. We present a case of Cushing’s syndrome caused by adrenocorticotropic hormone-secreting lung carcinoid tumor. Our patient developed acute mesenteric ischemia after video-assisted thoracoscopic surgery despite administration of sufficient glucocorticoid and thromboprophylaxis in the perioperative period. In addition, our patient developed hepatic infarction after surgical resection of the intestine. Then, the patient was supported by total parenteral nutrition. Our case report highlights the risk of microthrombi, which occurred in our patient after treatment of ectopic Cushing’s syndrome. Guidelines on thromboprophylaxis and/or antiplatelet therapy for Cushing’s syndrome are acutely needed.\n\nLearning points:\nThe present case showed acute mesenteric thromboembolism and hepatic infarction after treatment of ectopic Cushing’s syndrome.\n\nPatients with Cushing’s syndrome are at increased risk for thromboembolic events and increased morbidity and mortality.\n\nAn increase in thromboembolic risk has been observed during active disease, even in cases of remission and postoperatively in Cushing’s syndrome.\n\nThromboprophylaxis and antiplatelet therapy should be considered in treatment of glucocorticoid excess or glucocorticoid withdrawal.\n==== Body\nBackground\nCushing’s syndrome (CS) results from chronic exposure to excess cortisol production and secretion from the adrenal cortex. Hypertension, glucose intolerance, dyslipidemia and osteoporosis are common complications in CS. Complications of CS may greatly affect the quality of life and mortality. Patients with CS have an increased risk for venous thromboembolism, myocardial infarction and stroke (1). In addition, excess exogenous glucocorticoids increase venous thromboembolism (VTE) risk (2). However, specific guidelines for the prevention of thrombosis in such patients have not been described. Our patient developed acute mesenteric ischemia and hepatic infarction, which occurred after treatment and glucocorticoid withdrawal period of ectopic CS. This case has a merit of clinical attention.\n\nCase presentation\nA 65-year-old Japanese woman was referred for further evaluation of Cushing’s syndrome (CS). Her case history included the following: 20 years of paroxysmal arterial fibrillation under treatment with warfarin potassium; 10 years of hypertension and diabetes with drug resistance and 5 years of proximal muscle weakness. She presented with a moon face, central obesity, skin atrophy and plethora. Blood pressure was 128/78 mmHg and was treated with antihypertensive agents (40 mg telmisartan, 5 mg amlodipine, 5 mg bisoprolol, 40 mg furosemide and 25 mg spironolactone). The HbA1c level was 9.3%, even under treatment with oral hypoglycemic agents (1 mg glimepiride, 15 mg pioglitazone and 100 mg vildagliptin).\n\nBasal ACTH and cortisol levels in plasma were up to 205 pg/mL and 79 μg/dL, respectively. Urinary free cortisol (UFC):creatinine ratio was up to 2035  μg/g. Salivary free cortisol was not measured. The patient was diagnosed with ectopic ACTH syndrome after endocrinological analyses. She was administered steroidogenesis inhibitors, metyrapone and mitotane, to suppress cortisol secretion. Serum cortisol and UFC levels fell to around 20 μg/dL and 200 μg/g of creatinine, respectively. We were unable to identify the source of ACTH secretion for 7 months. Finally, repeated computed tomography (CT) scans and FDG-PET/CT showed a nodule of 10 mm diameter in segment four of the right lung (Fig. 1). Trans-bronchial lung biopsy was performed, and the patient was histologically diagnosed with a typical carcinoid with immunoreactive ACTH (Fig. 1).\nFigure 1 CT scans show a 10-mm-diameter nodule in segment four of the right lung (left upper panel). Formalin-fixed and paraffin-embedded sample from the lung tumor shows cells with an eosinophilic cytoplasm, low nuclear grade and oval nuclei. The cells show rosette structures (right panel). The tumor was histologically diagnosed as a typical carcinoid with immunoreactive ACTH (left lower panel).\n\n\n\n\nVideo-assisted thoracoscopic surgery was performed, and the right middle lobe of the lung was resected. Complete anatomical resection with a negative resection margin was confirmed. The level of plasma ACTH (minimum detection limit 1 pg/mL) fell to 3 pg/mL immediately after the operation, and glucocorticoid replacement therapy was subsequently administered. Therefore, disease cure was evaluated. She was administered 200 mg of hydrocortisone intravenously on the day of the operation and on postoperative day (POD) 1, 100 mg at POD 2 and 50 mg at PODs 3 and 4.\n\nInvestigation\nThe patient’s clinical features improved during the follow-up. However, she presented with a body temperature up to 38.5°C on POD 4. Blood tests showed a white blood cell count of 13 350/mL, C-reactive protein level of 6.7 mg/L and blood sugar level of 250 mg/dL. Blood culture did not detect any bacteria. CT scans showed a thrombus at the merging section of the left jugular and subclavian veins and revealed no notable origin of infection. She was administered 10 000 IU of heparin sodium by continuous intravenous infusion in the perioperative period. Warfarin potassium was added to a heparin infusion since POD 27. Echocardiography showed normal chamber sizes, normal function of heart valves, absence of a thrombus or vegetation and normal ventricular systolic function on POD 29. A total of 50 mg of hydrocortisone was administered enterally from PODs 5 to 8, and then it was reduced to 30 mg since POD 9. The dosage of hydrocortisone was further reduced from 30 mg to 15 mg on POD 29. Thirty days after the operation, the patient went into sudden shock. Blood pressure and heart rate were 64/43 mmHg and 120 bpm, respectively. An electrocardiogram showed sinus tachycardia. She had abdominal pain, distention and guarding. Blood tests indicated a white blood cell count of 34 140/mL, C-reactive protein level of 40.2 mg/L, arterial blood pH of 7.50, bicarbonate level of 29.3 mmol/L, base deficit of 0.9 mmol/L, international normalized ratio of prothrombin time of 1.2 and activated partial thromboplastin time of 45.6 s (range, 26–36). Enhanced CT findings showed intestinal dilatation and hepatic portal venous gas (Fig. 2). Occlusion of either the superior mesenteric or celiac arteries could not be found.\nFigure 2 Contrast-enhanced transverse CT scan shows intestinal dilatation with collection of gas, gas in the bowel wall (left upper panel, arrowheads) and hepatic portal venous gas (right upper panel, arrow). Continual necrosis was found between the ileum and transverse colon (left lower panel). Formalin-fixed and paraffin-embedded sample shows capillary microthrombi of the mucous membrane (right lower panel, arrow).\n\n\n\n\nTreatment\nAn emergency laparotomy was performed, which showed continual necrosis between the ileum and transverse colon (Fig. 2). A total length of 3 m of intestine was resected and ileostomy was performed. Hemorrhagic infarction due to multiple microthrombi in the capillaries was histologically identified (Fig. 2).\n\nOutcome and follow-up\nThe patient was administered 15 000 IU of heparin sodium by continuous intravenous infusion in the perioperative period followed by warfarin potassium. Heparin was discontinued when the international normalized ratio of prothrombin time was prolonged into the therapeutic range (around 2.0). Surgical resection of the intestine was associated with the impairment of absorption and digestion of nutrients. She was supported by total parenteral nutrition. After the operation, laboratory tests showed a continuous increase in serum transaminase levels. CT scans demonstrated the presence of peripheral hepatic infarction, with irregular contours and extending over the entire liver segments (Fig. 3). Uptake of Tc-99m-labeled galactosyl human serum albumin in the liver, which evaluates hepatic function, was reduced at the lesions (Fig. 3). The indocyanine green clearance test showed 22% retention at 15 min. She continued to receive warfarin potassium for the treatment of hepatic infarction. She was transferred to another hospital for long-term hospitalization. She developed repeated bouts of pneumonia and was treated with antibiotics. She died 2 years and 3 months later in a state of renal failure.\nFigure 3 CT scan shows irregularly shaped infarctions extending over the entire liver segment (left panel). The uptake of Tc-99m-labeled galactosyl human serum albumin in the liver was reduced at the infarctions (right panel).\n\n\n\n\nDiscussion\nThe etiology of mesenteric ischemia represents a complex of diseases, including acute arterial mesenteric ischemia, acute venous mesenteric ischemia, non-occlusive mesenteric ischemia and ischemia/reperfusion injury. The risk for acute mesenteric thromboembolic events has a variety of causes, including mesenteric arterial/venous occlusion, inflammation, low flow and vasospasm (3). However, hepatic infarctions are thought to be extremely rare because many accessory and collateral vessels create a complex compensatory system that prevents ischemia or infarction. Hepatic infarction may result from shock, sepsis, anesthesia, biliary disease and diabetic ketoacidosis or surgical factors (4). The occurrence of multiple peripheral and extending infarctions in our case might have been due to a mixed origin of arterial thromboembolism and reduced portal flow from intestinal resection.\n\nIncreased coagulability has been observed in patients treated with glucocorticoids and in patients with CS (5). Patients with CS who are treated with glucocorticoids have an increased risk for thromboembolism, especially venous thromboembolism, myocardial infarction and stroke (2, 6). Mortality is increased in patients with CS, with the highest risk observed in patients with persistent disease. In fact, cortisol excess is known to stimulate the synthesis of fibrinogen and von Willebrand factor, which facilitate platelet aggregation. Additionally, glucocorticoids upregulate the synthesis of plasminogen activator inhibitor type 1. In a previous study, survival analysis showed a significantly higher morbidity and mortality due to thromboembolic events in the group without anticoagulants than that in the group treated with anticoagulants in the perioperative period in patients with CS (5). Therefore, use of low-dose heparin has been suggested in the perioperative period (7, 8). However, specific guidelines for the prevention of thrombosis with CS have not been described (8). Furthermore, an increase in cardiovascular risk has been observed, even in the cases of remission of CS (9). The risk for postoperative events increases in patients with Cushing’s disease (10). The source of excess ACTH and malignancy was considered to be totally resected in our patient. However, malignancy itself may induce a thromboembolic state and affect mortality in patients with CS who suffer from an ectopic ACTH source.\n\nIn conclusion, this case report emphasizes that patients with excess glucocorticoids or glucocorticoid withdrawal have a high risk for thromboembolism. In addition to thromboprophylaxis, cautious lowering of glucocorticoids and antiplatelet therapy should be considered in treatment of such patients, when additional risk factors for thromboembolism, such as diabetes, immobility and surgery, are encountered.\n\nDeclaration of interest\nThe authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.\n\nFunding\nThis research did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector.\n\nPatient consent\nThe patient died. Consent was obtained from the husband for publication of this case report.\n\nAuthor contribution statement\nS T, S M, S Y, K K, T N, Y W, K T and M D contributed equally to the diagnosis and management of the patient. D K and T T performed video-assisted thoracoscopic surgery. Y S and K H performed intestinal resection and ileostomy. S T wrote the report. All authors read and approved the final manuscript. Written consent to publish was obtained.\n==== Refs\nReferences\n1 Etxabe J Vazquez JA \n1994 \nMorbidity and mortality in Cushing’s disease: an epidemiological approach . Clinical Endocrinology \n40 \n479 –484 . (10.1111/j.1365-2265.1994.tb02486.x )8187313 \n2 Johannesdottir SA Horváth-Puhó E Dekkers OM Cannegieter SC Jørgensen JO Ehrenstein V Vandenbroucke JP Pedersen L Sørensen HT \n2013 \nUse of glucocorticoids and risk of venous thromboembolism: a nationwide population-based case-control study . JAMA Internal Medicine \n173 \n743 –752 . (10.1001/jamainternmed.2013.122 )23546607 \n3 Wiesner W Khurana B Ji H Ros PR \n2013 \nCT of acute bowel ischemia . Radiology \n226 \n635 –650 . (10.1148/radiol.2263011540 )\n4 Deng YG Zhao ZS Wang M Su SO Yao XX \n2006 \nDiabetes mellitus with hepatic infarction: a case report with literature review\nWorld Journal of Gastroenterology \n12 \n5091 –5093 . (10.3748/wjg.v12.i31.5091 )16937516 \n5 Boscaro M Sonino N Scarda A Barzon L Fallo F Sartori MT Patrassi GM Girolami A \n2002 \nAnticoagulant prophylaxis markedly reduces thromboembolic complications in Cushing’s syndrome . Journal of Clinical Endocrinology and Metabolism \n87 \n3662 –3666 . (10.1210/jc.87.8.3662 )12161492 \n6 Dekkers OM Horváth-Puhó E Jørgensen JO Cannegieter SC Ehrenstein V Vandenbroucke JP Pereira AM Sørensen HT \n2013 \nMultisystem morbidity and mortality in Cushing’s syndrome: a cohort study . Journal of Clinical Endocrinology and Metabolism \n98 \n2277 –2284 . (10.1210/jc.2012-3582 )23533241 \n7 Geerts WH Bergqvist D Pineo GF Heit JA Samama CM Lassen MR Colwell CW \n2008 \nPrevention of venous thromboembolism: American College of Chest Physicians evidence-based clinical practice guidelines (8th edition ). Chest \n133 \n381S –453S . (10.1378/chest.08-0656 )18574271 \n8 van der Pas R Leebeek FW Hofland LJ de Herder WW Feelders RA \n2013 \nHypercoagulability in Cushing’s syndrome: prevalence, pathogenesis and treatment . Clinical Endocrinology \n78 \n481 –488 . (10.1111/cen.12094 )23134530 \n9 Colao A Pivonello R Spiezia S Faggiano A Ferone D Filippella M Marzullo P Cerbone G Siciliani M Lombardi G \n1999 \nPersistence of increased cardiovascular risk in patients with Cushing’s disease after five years of successful cure . Journal of Clinical Endocrinology and Metabolism \n84 \n2664 –2672 . (10.1210/jc.84.8.2664 )10443657 \n10 Stuijver DJ van Zaane B Feelders RA Debeij J Cannegieter SC Hermus AR van den Berg G Pereira AM de Herder WW Wagenmakers MA , et al\n2011 \nIncidence of venous thromboembolism in patients with Cushing’s syndrome: a multicenter cohort study . Journal of Clinical Endocrinology and Metabolism \n96 \n3525 –3532 . (10.1210/jc.2011-1661 )21880802\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2052-0573", "issue": "2017()", "journal": "Endocrinology, diabetes & metabolism case reports", "keywords": null, "medline_ta": "Endocrinol Diabetes Metab Case Rep", "mesh_terms": null, "nlm_unique_id": "101618943", "other_id": null, "pages": null, "pmc": null, "pmid": "28480039", "pubdate": "2017", "publication_types": "D016428:Journal Article", "references": "12161492;23533241;18574271;8187313;23546607;10443657;16937516;23134530;12601205;21880802", "title": "Acute mesenteric ischemia and hepatic infarction after treatment of ectopic Cushing's syndrome.", "title_normalized": "acute mesenteric ischemia and hepatic infarction after treatment of ectopic cushing s syndrome" }
[ { "companynumb": "JP-PFIZER INC-2018077579", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "HYDROCORTISONE SODIUM SUCCINATE" }, "drugaddit...
{ "abstract": "BACKGROUND Non-alcoholic fatty liver disease (NAFLD) is the most common cause of chronic liver disease in the United States, and 25% of patients with NAFLD progress to non-alcoholic steatohepatitis (NASH). NAFLD is predicted to be the most common indication for liver transplantation by 2030. Despite associated high morbidity and mortality, there is currently no approved therapy for NASH. PCSK9 inhibitors are approved for reducing LDL in patients who are statin-intolerant or need further LDL reduction. Increased LDL levels are independently associated with an elevated risk of NAFLD. CASE REPORT We present a case of a 39-year-old woman with acute NASH with familial hypercholesterolemia that was refractory to lifestyle modifications and HMG-CoA reductase inhibitors. An episode of rhabdomyolysis warranted a search for alternatives to statin therapy. Results of a liver biopsy showed microvesicular and macrovesicular steatosis with ballooning degeneration, indicating acute NASH. She was started on PCSK9 inhibitors as salvage therapy. Three monthly doses resulted in a more than an 80% reduction in ALT and AST and a 48% reduction in LDL levels. A liver biopsy done 8 months after the first biopsy showed normalization of liver histology. CONCLUSIONS The use of PCSK9 inhibitors showed a dramatic response in this patient who failed conventional therapies, and the encouraging results seen in this case merit further research into the use of PCSK9 inhibitors as first-line therapy for the acute phase of NASH.", "affiliations": "Texas A&M-affiliated DeTar Family Medicine Residency Program, Victoria, TX, USA.;Texas A&M-affiliated DeTar Family Medicine Residency Program, Victoria, TX, USA.;Research Department, Texas A&M-affiliated DeTar Family Medicine Residency Program, Victoria, TX, USA.;Department of Pathology, DeTar Hospital, Victoria, TX, Turkey.;Research Department, Texas A&M-affiliated DeTar Family Medicine Residency Program, Victoria, TX, USA.;Department of Critical Care, Hospital CEMESA, San Pedro Sula, Cortés, Honduras.;Research Department, Texas A&M-affiliated DeTar Family Medicine Residency Program, Victoria, TX, USA.", "authors": "Sekhon|Anupamjeet Kaur|AK|;Gollapalli|Aniruddha|A|;Kaur|Dharamjeet|D|;Janssen|Bryan|B|;Stevens|Mark L|ML|0000-0002-1813-6403;Valerio|Fernando|F|;Sierra-Hoffman|Miguel A|MA|", "chemical_list": "D019161:Hydroxymethylglutaryl-CoA Reductase Inhibitors; C472125:PCSK9 protein, human; D000071449:Proprotein Convertase 9", "country": "United States", "delete": false, "doi": "10.12659/AJCR.932961", "fulltext": "\n==== Front\nAm J Case Rep\nAm J Case Rep\namjcaserep\nThe American Journal of Case Reports\n1941-5923\nInternational Scientific Literature, Inc.\n\n34826302\n10.12659/AJCR.932961\n932961\nArticles\nA New Potential Strategy for Acute Non-Alcoholic Steatohepatitis (NASH)\nSekhon Anupamjeet Kaur B D E F 1\nGollapalli Aniruddha E 1\nKaur Dharamjeet E 2\nJanssen Bryan D 3\nStevens Mark L. E 2 https://orcid.org/0000-0002-1813-6403\n\nValerio Fernando A E 4\nSierra-Hoffman Miguel A. E 2\n1 Texas A&M-affiliated DeTar Family Medicine Residency Program, Victoria, TX, USA\n2 Research Department, Texas A&M-affiliated DeTar Family Medicine Residency Program, Victoria, TX, USA\n3 Department of Pathology, DeTar Hospital, Victoria, TX, USA\n4 Department of Critical Care, Hospital CEMESA, San Pedro Sula, Cortés, Honduras\nCorresponding Author: Anupamjeet Kaur Sekhon, e-mail: anupamsekhon@yahoo.com\nAuthors’ Contribution:\n\nA Study Design\n\nB Data Collection\n\nC Statistical Analysis\n\nD Data Interpretation\n\nE Manuscript Preparation\n\nF Literature Search\n\nG Funds Collection\n\nFinancial support: None declared\n\nConflict of interest: None declared\n\n2021\n26 11 2021\n22 e932961-1e932961-7\n01 5 2021\n20 9 2021\n23 10 2021\n© Am J Case Rep, 2021\n2021\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ This work is licensed under Creative Common Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0)\nPatient: Female, 38-year-old\n\nFinal Diagnosis: Non-alcoholic steatohepatitis (NASH)\n\nSymptoms: Elevated liver enzymes\n\nMedication:—\n\nClinical Procedure: —\n\nSpecialty: General and Internal Medicine\n\nObjective:\n\nUnusual or unexpected effect of treatment\n\nBackground:\n\nNon-alcoholic fatty liver disease (NAFLD) is the most common cause of chronic liver disease in the United States, and 25% of patients with NAFLD progress to non-alcoholic steatohepatitis (NASH). NAFLD is predicted to be the most common indication for liver transplantation by 2030. Despite associated high morbidity and mortality, there is currently no approved therapy for NASH. PCSK9 inhibitors are approved for reducing LDL in patients who are statin-intolerant or need further LDL reduction. Increased LDL levels are independently associated with an elevated risk of NAFLD.\n\nCase Report:\n\nWe present a case of a 39-year-old woman with acute NASH with familial hypercholesterolemia that was refractory to lifestyle modifications and HMG-CoA reductase inhibitors. An episode of rhabdomyolysis warranted a search for alternatives to statin therapy. Results of a liver biopsy showed microvesicular and macrovesicular steatosis with ballooning degeneration, indicating acute NASH. She was started on PCSK9 inhibitors as salvage therapy. Three monthly doses resulted in a more than an 80% reduction in ALT and AST and a 48% reduction in LDL levels. A liver biopsy done 8 months after the first biopsy showed normalization of liver histology.\n\nConclusions:\n\nThe use of PCSK9 inhibitors showed a dramatic response in this patient who failed conventional therapies, and the encouraging results seen in this case merit further research into the use of PCSK9 inhibitors as first-line therapy for the acute phase of NASH.\n\nKeywords:\n\nHyperlipidemia, Familial Combined\nLiver Function Tests\nNon-Alcoholic Fatty Liver Disease\nPCSK9 Protein, Human\nHypercholesterolemia\nFatty Liver\n==== Body\npmcBackground\n\nNon-alcoholic fatty liver disease (NAFLD) is estimated to be the most common cause of chronic liver disease in the United States. It affects from 80 million to 100 million individuals, among whom nearly 25% progress to non-alcoholic steatohepatitis (NASH) [1]. About 20% of NASH ases progress to end-stage liver disease or cirrhosis [2]. NAFLD is predicted to be the most common indication for liver transplantation by 2030 [3]. Despite it having high morbidity and mortality, there is no approved therapy for NASH. We present a case of NASH with statin- refractory hypercholesterolemia in which liver enzymes, cholesterol indices, and liver histology normalized after proprotein convertase subtilisin/kexin type 9 (PCSK9) inhibitor treatment.\n\nCase Report\n\nA 39-year-old woman with familial hypercholesterolemia had suboptimal control of cholesterol indices despite HMG-CoA reductase inhibitor therapy (Table 1). She had a body mass index of 25 kg/m2 (normal range, 18–25 kg/m2). She had been on rosuvastatin 10 mg for 10 years along with lifestyle modifications, including vigorous physical activity 4 to 5 times per week and a low-fat diet, with minimal results. Subsequently, in April 2019, the patient developed rhabdomyolysis (creatinine kinase 131 632 U/L [reference range, 22–269 U/L] and myoglobin 325 ng/mL [range, 14–66 ng/mL]) secondary to statin use, requiring cessation of her rosuvastatin regimen. During this time, she had an increase in her liver function tests (LFTs) (Table 2), which was deemed secondary to rhabdomyolysis. Six months after this episode, persistent elevation of her LFTs necessitated ultrasound imaging, which showed a 1.3-cm septated lesion of the right hepatic lobe. The patient was consequently diagnosed with a liver hemangioma, and her oral contraceptive pills were stopped.\n\nAdditional tests were performed to determine the underlying etiology of her persistently elevated LFTs. The hepatitis panel, ceruloplasmin levels, autoimmune panel, alpha-1 antitrypsin antibody, ferritin levels, hemoglobin A1c, and thyroid panel all came back within normal limits (Table 3). Genetic testing for the solute carrier organic anion transporter family member 1B1 genotype showed normal organic anion transporter poly-peptide 1B1 function, suggesting a typical risk for myopathy and no excessive circulating levels of statins. She had a fibrosis score of 0.46, classified as stage F1–F2, with portal and bridging fibrosis with few septa, and moderate steatosis grade S2, with a steatosis score of 0.63. Her occasional alcohol consumption and an aspartate transaminase/alanine transaminase (AST/ALT) ratio of less than 2 suggested against alcoholic liver disease.\n\nLater, she developed nausea and elevated gamma-glutamyl transpeptidase (GGT) (212 U/L; reference range <40 U/L), secondary to chronic cholelithiasis. She underwent a laparoscopic cholecystectomy and a liver biopsy in December 2019. Liver histology showed mixed microvesicular and macrovesicular steatosis with megamitochondria and foci of ballooning degeneration, pointing to a diagnosis of NASH (Figure 1).\n\nThe patient’s LFTs continued to rise despite the cholecystectomy, with ALT levels reaching 1862 U/L (range, 5–40 U/L). She was then referred to a hepatologist and learned that her condition could either reverse and resolve or progress from NASH to end-stage liver disease, eventually requiring a liver transplant.\n\nOwing to the lack of desired results with the standard of care and her statin intolerance, the patient was started on evolocumab, a monoclonal antibody that inhibits PCSK9, as salvage therapy. After receiving evolocumab, she had a significant improvement in her lipid and LFT levels. After the first dose, ALT decreased by 89% (1251 to 133 U/L), AST by 86% (366 to 53 U/L [range, 9–40 U/L]), alkaline phosphatase (ALP) by 16% (140 to 118 U/L [range, 40–112 U/L]), total cholesterol (TC) by 36% (306 to 197 mg/dL [range, <200 mg/dL]), and low-density lipoprotein (LDL) by 48% (226 to 117 mg/dL [range, <100 mg/dL]). Liver enzymes and cholesterol indices normalized after the third dose of evolocumab (ALT of 33 U/L, AST of 33 U/L, ALP of 93 U/L, TC of 173 mg/dL, and LDL of 98 mg/dL). Since then, the values have stayed within normal limits, and she has continued to tolerate evolocumab well (Figures 2, 3). A follow-up liver biopsy in August 2020, performed 8 months after the initial biopsy, was negative for active and chronic hepatitis and steatosis (Figure 4). There was no pericellular fibrosis or hepatocyte ballooning on histology, but only occasional histiocytes containing debris, suggestive of prior hepatic injury and indicating a successful PCSK9 inhibitor treatment.\n\nDiscussion\n\nNAFLD encompasses the entire spectrum of fatty liver disease in individuals lacking significant alcohol consumption, ranging from fatty liver to steatohepatitis to cirrhosis. The pathological progression of NAFLD follows a “3-hit” process, namely steatosis, lipotoxicity, and inflammation. NASH is defined as the presence of ≥5% hepatic steatosis with inflammation and hepatocyte injury (ballooning), with or without fibrosis. NASH can progress to cirrhosis, decompensated liver failure, and liver cancer [4]. NASH has an all-cause mortality rate of 25.6 per 1000 person-years and a liver-specific mortality rate of 11.8 per 1000 person-years [5]. Younossi et al described a 9% annual increase of hepatocellular carcinoma cases related to NAFLD over a period of 6 years, from 2004 to 2009 [6]. According to the World Gastroenterology Organization (WGO), American Association for the Study of Liver Diseases (AASLD), and European Association of Study of Liver (EASL), the current mainstay of treatment for NAFLD/NASH includes lifestyle modifications, such as diet, exercise, and weight loss. Weight loss ≥ 5% of the current body weight has been linked to improvement in hepatic steatosis, while ≥ 7% weight loss is linked to histo-logical improvement in NASH [7]. Johnson et al demonstrated that aerobic exercises might lower the hepatic and visceral lipids in individuals with obesity even without weight loss [8].\n\nPharmacological therapy is indicated only in patients with progressive fibrosis, in patients with biopsy-proven NASH, and in patients who fail lifestyle interventions after a period of 6 months [4,9]. Currently, there is no universally approved treatment for NASH; however, EASL and AASLD recommend HMG-CoA reductase inhibitors for NASH patients with hyper-cholesterolemia to reduce LDL cholesterol, despite no proven improvement in liver histology. Pioglitazone has been shown to improve histology, metabolism, and ALT levels in NASH [6,10]. The Pioglitazone, Vitamin E, or Placebo for Non-Alcoholic Steatohepatitis (PIVENS) trial demonstrated that vitamin E improved the histological features of NASH in 43% of patients, compared with in 19% of patients who received placebo for 94 weeks [11]. Various drugs, including elafibranor, obeticholic acid, glucagon-like peptide-1 (GLP-1) agonists, ursodeoxycholic acid, and antifibrotic agents (anti-lysyl oxidase-like monoclonal antibodies), are being tested in late-phase clinical trials for the treatment of NASH [4,12,13]. Semaglutide, a GLP-1 agonist in a phase 2 trial, showed NASH resolution, compared with placebo [14]. Bariatric surgery-induced weight loss has been proven to improve NASH in 85% of patients after 1 year [15]. Surgical intervention is recommended by the WGO, AASLD, and EASL only in patients with morbid obesity who fail to improve with lifestyle changes and pharmacological measures. Liver transplantation is advocated in patients with end-stage liver disease and liver fibrosis despite cardiovascular mortality, NASH recurrence, and transplant failure. Thus far, there is no recognized pharmacological treatment for the acute phase of NASH.\n\nThere is growing interest in the use of the PCSK9 inhibitor in alcoholic liver disease and NAFLD. PCSK9 is an enzyme that plays a crucial role in cholesterol metabolism [16]. LDL receptors, which are proteins on the surface of hepatocytes, bind to LDLs and remove them from the bloodstream. The LDL receptor, at that point, will either be recycled or targeted for destruction by PCSK9 [16]. PCSK9 inhibitors, which are primarily monoclonal antibodies, function by binding to PCSK9, thereby allowing recycling of LDL receptors to the cell surface [16]. This increases availability of LDL receptors on the cell surface to further facilitate reduction in circulating LDL. The PCSK9 inhibitors evolocumab and alirocumab significantly lowered LDL levels in 2 recent randomized controlled trials: The Open-Label Study of Long-Term Evaluation Against LDL Cholesterol (OSLER) study and the ODYSSEY Outcomes study [17].\n\nThe OSLER extension study program showed a 61% reduction in LDL when patients were placed on adjuvant therapy with evolocumab as opposed to standard of care alone [18]. In 2015, the U.S. Food and Drug Administration (FDA) approved the use of PCSK9 inhibitors for the prevention of major adverse cardiac events in adults with established atherosclerotic cardiovascular disease on maximally tolerated statin therapy who require further reduction in LDL [19]. These medications also play a significant role in LDL reduction in patients who are statin intolerant, as statin-related myopathy is an issue that is reported by 5% to 20% of the patient population. The Goal Achievement after Utilizing an Anti-PCSK9 Antibody in Statin Intolerant Subjects-3 (GAUSS-3) randomized clinical trial found that the use of evolocumab in statin-intolerant patients, compared with ezetimibe, resulted in a significant decrease in lipid levels after a 24-week period [20].\n\nEvolocumab and alirocumab can both be administered as a biweekly or monthly subcutaneous injection for primary hyper-lipidemia as well as cardiovascular event prevention, which makes patient compliance easier, compared to oral medications that need to be taken every day. A recent study done by Lee et al in rat models showed that anti-PCSK9 treatment with alirocumab decreases alcohol-induced hepatocellular steatosis, inflammation, and oxidative injury; however, PCSK9 inhibitors are not currently indicated or approved for the treatment of NASH [21]. Ruscica et al suggested that PCSK9 levels are associated with severity of steatosis and lipogenesis and might be associated with the pathogenesis of NAFLD [22]. By contrast, a meta-analysis by Wargny et al suggested that PCSK9 levels have no correlation with the severity of hepatic fat accumulation and histological markers of NASH [23]. A recent study in Wenzhou, China, by Sun et al has hinted at a significant correlation between LDL-C levels and the incidence of NAFLD [24]. To the best of our knowledge, the successful use of PCSK9 inhibitors for NAFLD has not been reported in the literature.\n\nThis present case illustrates a novel indication for PCSK9 inhibitor to reverse NASH-related liver changes. The patient had familial hypercholesterolemia, with more than 10 years of lifestyle modifications and HMG-CoA reductase inhibitor use, and her cholesterol and liver enzymes did not normalize, nor was the progression of NAFLD to NASH halted. She was then started on PCSK9 inhibitors as salvage therapy, and after the first dose of evolocumab, her liver enzymes and cholesterol indices started trending down. Eight months after the initial biopsy and evolocumab treatment, a repeat biopsy was negative for NASH-related histologic changes.\n\nThere are limitations to this case report, as it was observed in 1 patient, and we need more patients to corroborate these results. High cost and prior authorization from insurance providers are some of the other barriers in the accessibility of PCSK9 inhibitors. Therefore, they are currently used for secondary prevention in high-risk groups only.\n\nPCSK9 inhibitors have been evaluated for safety for up to 5 years in clinical trials. Immunologic effects, such as local injection site reactions, are the most commonly reported adverse effects, which include erythema, pain, and bruising. Post-hoc analysis and post-marketing surveillance will shed light on serious adverse effects that were noticed in animal studies, but additional data are needed in humans [21].\n\nConclusions\n\nPCSK9 Inhibitors are FDA approved for major adverse cardiac event prevention and they play a significant role in cholesterol metabolism. In the present case, the use of PCSK9 inhibitors in the management of acutely progressive NASH showed reversal of liver histology in a patient that failed conventional therapies, with normalization of both liver enzymes and cholesterol indices. Further research, including clinical trials, is warranted on PCSK9 inhibitor use as a first-line therapy in NAFLD, as it is expected to become the leading cause of chronic liver disease in the foreseeable future and there is no approved therapy for the acute phase of NASH, which has high morbidity and mortality.\n\nFigure 1. Liver histology pretreatment with PCSK9 inhibitor in 2019 showing (A) ballooning degeneration of hepatocytes and (B) Mallory hyaline, which is a characteristic of cytoplasmic hyaline inclusion in hepatocytes and thus resemble a peculiar manifestation of liver cell injury. (Hematoxylineosin staining, original magnification ×200).\n\nFigure 2. Liver function test (LFT) values in a graph showing rapidly increasing LFTs in the acute phase of non-alcoholic steatohepatitis and decreasing after PCSK9 inhibitor treatment.\n\nFigure 3. Lipid panel values in a graph with elevated values before PCSK9 inhibitor treatment and decreasing after initiation of therapy.\n\nFigure 4. Liver histology after PCSK9 inhibitor treatment in 2020 showing (C) normal liver parenchyma (hematoxylineosin staining, original magnification ×200).\n\nTable 1. Lipid panel from initial diagnosis.\n\nDate\tTC (<200 mg/dL)\tTG (<150 mg/dL)\tHDL (>39 mg/dL)\tLDL (<100 mg/dL)\t\n11/14/2007\t193\t112\t48\t126\t\n12/04/2017\t258\t201\t46\t172\t\n03/05/2018\t184\t112\t52\t110\t\n06/06/2018\t165\t157\t47\t87\t\n12/12/2018\t180\t193\t42\t99\t\n03/12/2019\t181\t108\t50\t109\t\n05/15/2019\t266\t225\t39\t182\t\n09/13/2019\t306\t120\t56\t226\t\n01/07/2020\t197\t139\t53\t117\t\n03/26/2020\t173\t123\t53\t98\t\n09/04/2020\t201\t56\t64\t122\t\n10/09/2020\t175\t82\t67\t91\t\n\nTable 2. Liver function tests from initial diagnosis.\n\nDate\tALP (30–101 U/L)\tAST (9–40 U/L)\tALT (5–40 U/L)\t\n05/06/2013\t99\t85\t114\t\n12/04/2017\t54\t22\t39\t\n03/05/2018\t49\t22\t37\t\n06/06/2018\t42\t21\t28\t\n12/12/2018\t36\t24\t31\t\n03/12/2019\t42\t24\t27\t\n04/16/2019\t48\t847\t138\t\n05/15/2019\t80\t117\t146\t\n09/13/2019\t119\t66\t135\t\n11/20/2019\t99\t110\t254\t\n12/04/2019\t76\t741\t1862\t\n12/10/2019\t140\t366\t1251\t\n01/07/2020\t118\t53\t133\t\n02/24/2020\t83\t42\t42\t\n03/26/2020\t93\t33\t33\t\n09/04/2020\t107\t42\t70\t\n10/09/2020\t103\t25\t32\t\n\nTable 3. Laboratory studies before first liver biopsy.\n\nTest\tResult\tReference range\t\nFerritin\t72 ng/mL\t13–200 ng/mL\t\nCeruloplasmin\t42.9 mg/dL\t16–45 mg/dL\t\nLKM antibody\t1.2 U\t<20 U\t\nAlpha-1-antitrypsin\t212 mg/dL\t90–200 mg/dL\t\nSmooth muscle AB (F-Actin)\t8.0 U\t<20 U\t\nSoluble liver AG AB\t1.6 U\t0–24.9 U\t\nGGT\t212 U/L\t< 40 U/L\t\nAFP marker\t1.6 ng/mL\t<9.0 ng/mL\t\nHepatitis A total Ab\tReactive\tNon-reactive\t\nHepatitis A IgM\tNon-reactive\tNon-reactive\t\nHep B core total Ab\tNon-reactive\tNon-reactive\t\nHepatitis B surface Ag\tNon-reactive\tNon-reactive\t\nHepatitis B surface Ab\tReactive\tNon-reactive\t\nHepatitis Bs AB Quant\t25.30 MIU/mL\t>11.50 MIU/mL\t\nHepatitis C antibody\tNon-reactive\tNon-reactive\t\nHepatitis C antibody\t0.11\t<0.80\t\nMitochondrial M2 AB\t1.9 U\t<20.0 U\t\nTTG IgG\t<1.2 U/L\t<6.0 U/L\t\nTTG IgA\t<1.2 U/L\t<4.0 U/L\t\nAnti-nuclear antibodies\tNegative\tNegative\t\nSjogren’s SS-A antibody\t<0.2 AI\t<1.0 AI\t\nSjogren’s SS-B antibody\t<0.2 AI\t<1.0 AI\t\nSmith (Sm) antibody\t<0.2 AI\t<1.0 AI\t\nRNP antibody\t<0.2 AI\t<1.0 AI\t\nSCL-70 antibody\t<0.2 AI\t<1.0 AI\t\nJo-1 antibody\t<0.2 AI\t<1.0 AI\t\nCentromere B antibody\t<0.2 AI\t<1.0 AI\t\nRibosomal P antibody\t<0.2 AI\t<1.0 AI\t\nChromatin antibody\t<0.2 AI\t<1.0 AI\t\nThyroid peroxidase antibody\t<1 IU/mL\t<9 IU/mL\t\nRheumatoid Factor, Quant\t<10 IU/mL\t<14 IU/mL\t\nComplement C3\t145 mg/dL\t90–180 mg/dL\t\nComplement C4\t22 mg/dL\t10–40 mg/dL\t\ndsDNA antibody\t<1.0 IU/mL\t<4 IU/mL\t\nTSH\t2.370 UIU/mL\t0.4–4.1 UIU/mL\t\nT4 (thyroxine)\t7.3 UG/dL\t4.5–10.5 UG/dL\t\nCorrected T4 (FTI)\t6.6 UG/dL\t4.2–11.6 UG/dL\t\nT-uptake\t30.2%\t24.3–39.0%\t\nThyroxine binding capacity\t1.1\t0.8–1.3\t\n\nDeclaration of Figures’ Authenticity\n\nAll figures submitted have been created by the authors who confirm that the images are original with no duplication and have not been previously published in whole or in part.\n==== Refs\nReferences:\n\n1. Perumpail BJ Khan MA Yoo ER Clinical epidemiology and disease burden of non-alcoholic fatty liver disease World J Gastroenterol 2017 23 47 8263 76 29307986\n2. Matteoni CA Younossi ZM Gramlich T Non-alcoholic fatty liver disease: A spectrum of clinical and pathological severity Gastroenterology 1999 116 6 1413 19 10348825\n3. Wong RJ Aguilar M Cheung R Non-alcoholic steatohepatitis is the second leading etiology of liver disease among adults awaiting liver transplantation in the United States Gastroenterology 2015 148 3 547 55 25461851\n4. Chalasani N Younossi Z Lavine JE The diagnosis and management of non-alcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases Hepatology 2018 67 1 328 57 28714183\n5. Sheka AC Adeyi O Thompson J Nonalcoholic steatohepatitis: A review JAMA 2020 323 12 1175 83 32207804\n6. Younossi ZM Otgonsuren M Henry L Association of non-alcoholic fatty liver disease (NAFLD) with hepatocellular carcinoma (HCC) in the United States from 2004 to 2009 Hepatology 2015 62 6 1723 30 26274335\n7. Musso G Cassader M Rosina F Impact of current treatments on liver disease, glucose metabolism and cardiovascular risk in non-alcoholic fatty liver disease (NAFLD): A systematic review and meta-analysis of randomised trials Diabetologia 2012 55 4 885 904 22278337\n8. Johnson NA Sachinwalla T Walton DW Aerobic exercise training reduces hepatic and visceral lipids in obese individuals without weight loss Hepatology 2009 50 4 1105 12 19637289\n9. Review TeamLaBrecque DR Abbas Z World Gastroenterology Organisation global guidelines: Non-alcoholic fatty liver disease and non-alcoholic steatohepatitis J Clin Gastroenterol 2014 48 6 467 73 24921212\n10. Belfort R Harrison SA Brown K A placebo-controlled trial of pioglitazone in subjects with non-alcoholic steatohepatitis N Engl J Med 2006 355 22 2297 307 17135584\n11. Sanyal AJ Chalasani N Kowdley KV Pioglitazone, vitamin E, or placebo for nonalcoholic steatohepatitis N Engl J Med 2010 362 18 1675 85 20427778\n12. European Association for the Study of the Liver (EASL)European Association for the Study of Diabetes (EASD)European Association for the Study of Obesity (EASO) EASL-EASD-EASO Clinical Practice Guidelines for the management of non-alcoholic fatty liver disease J Hepatol 2016 64 6 1388 402 27062661\n13. Sumida Y Yoneda M Current and future pharmacological therapies for NAFLD/NASH J Gastroenterol 2018 53 3 362 76 29247356\n14. Newsome PN Buchholtz K Cusi K A placebo-controlled trial of sub-cutaneous semaglutide in nonalcoholic steatohepatitis N Eng J Med 2021 384 1113 24\n15. Lassailly G Caiazzo R Buob D Bariatric surgery reduces features of nonalcoholic steatohepatitis in morbidly obese patients Gastroenterology 2015 149 2 379 88 25917783\n16. Horton JD Cohen JC Hobbs HH PCSK9: A convertase that coordinates LDL catabolism J Lipid Res 2008 50 Suppl. S172 77 19020338\n17. Kastelein JJ Ginsberg HN Langslet G ODYSSEY FH I and FH II: 78-week results with alirocumab treatment in 735 patients with heterozygous familial hypercholesterolaemia Eur Heart J 2015 36 2996 3003 26330422\n18. Sabatine M Giugliano R Wiviott S Efficacy and safety of evolocumab in reducing lipids and cardiovascular events J Vasc Surg 2015 62 4 1089\n19. Bandyopadhyay D Ashish K Hajra A Cardiovascular outcomes of PCSK9 inhibitors: With special emphasis on its effect beyond LDL-cholesterol lowering J Lipids 2018 2018 1 13\n20. Nissen SE Stroes E Dent-Acosta RE Efficacy and tolerability of evolocumab vs ezetimibe in patients with muscle-related statin intolerance: The GAUSS-3 randomized clinical trial JAMA 2016 315 15 1580 90 27039291\n21. Lee JS Mukhopadhyay P Matyas C PCSK9 inhibition as a novel therapeutic target for alcoholic liver disease Sci Rep 2019 9 1 17167 31748600\n22. Ruscica M Ferri N Macchi C Liver fat accumulation is associated with circulating PCSK9 Ann Med 2016 48 5 384 91 27222915\n23. Wargny M Ducluzeau PH Petit JM Circulating PCSK9 levels are not associated with the severity of hepatic steatosis and NASH in a high-risk population Atherosclerosis 2018 278 82 90 30261472\n24. Sun D-Q Liu W-Y Wu S-J Increased levels of low-density lipoprotein cholesterol within the normal range as a risk factor for non-alcoholic fatty liver disease Oncotarget 2015 7 5 5728 37\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "1941-5923", "issue": "22()", "journal": "The American journal of case reports", "keywords": null, "medline_ta": "Am J Case Rep", "mesh_terms": "D000328:Adult; D005260:Female; D006801:Humans; D019161:Hydroxymethylglutaryl-CoA Reductase Inhibitors; D008099:Liver; D065626:Non-alcoholic Fatty Liver Disease; D000071449:Proprotein Convertase 9", "nlm_unique_id": "101489566", "other_id": null, "pages": "e932961", "pmc": null, "pmid": "34826302", "pubdate": "2021-11-26", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "A New Potential Strategy for Acute Non-Alcoholic Steatohepatitis (NASH).", "title_normalized": "a new potential strategy for acute non alcoholic steatohepatitis nash" }
[ { "companynumb": "US-APOTEX-2022AP004130", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "ROSUVASTATIN" }, "drugadditional": "1", ...
{ "abstract": "The standard treatment of non-metastatic anal squamous cell carcinoma (ASCC) consists of chemotherapy with mitomycin (MMC) plus 5-fluorouracil (5FU) for 1-2 cycles concomitant with pelvic radiotherapy. Subsequent studies introduced cisplatin (CDDP) combined with 5FU, with unclear results. We evaluated the doublet capecitabine (C) and CDDP as a possible alternative to MMC-5FU regimen concomitant with intensity-modulated radiation therapy (IMRT).\nWe carried out a retrospective study on 67 patients affected by stage I-III ASCC, treated with CDDP (60-70 mg/m2 every 21 days for two courses) plus C (825 mg/m2 twice daily for 5 days/week) chemotherapy concomitant with IMRT for curative intent.\nAt a median follow up of 41 months, the clinical complete response calculated at the 6-month time-point (6-moCR), the 6-month objective response rate and the 6-month disease control rate were 93%, 94%, and 99%, respectively.Disease-free survival rates at 1, 2, and 3 years were 89%, 87%, and 85%, while the overall survival rates at 1 and 2 years were 100% and 95%. The colostomy-free survival rates were 90% at 1 year and 88% at 2 years. Grade 3-4 acute adverse events were reported in 61% of patients; predominantly skin toxicity (46%) and limited hematological toxicity (12%).\nIn this retrospective study, chemotherapy with C plus CDDP concomitant with IMRT proved safe and effective, and may represent a possible alternative option to standard MMC-containing regimen for curative intent.", "affiliations": "Division of Gastrointestinal Medical Oncology and Neuroendocrine Tumors, European Institute of Oncology IRCCS, Milan, Italy.;Division of Gastrointestinal Medical Oncology and Neuroendocrine Tumors, European Institute of Oncology IRCCS, Via Ripamonti 435, Milan 20141, Italy.;Division of Gastrointestinal Medical Oncology and Neuroendocrine Tumors, European Institute of Oncology IRCCS, Milan, Italy.;Department of Statistics and Quantitative Methods, University of Milan-Bicocca, Milan, Lombardia, Italy.;Department of Statistics and Quantitative Methods, University of Milan-Bicocca, Milan, Lombardia, Italy.;Division of Radiotherapy, European Institute of Oncology IRCCS, Milan, Lombardia, Italy.;Division of Radiotherapy, European Institute of Oncology IRCCS, Milan, Lombardia, Italy.;Division of Endoscopy, European Institute of Oncology IRCCS, Milan, Lombardia, Italy.;Division of Pathology, European Institute of Oncology IRCCS, Milan, Lombardia, Italy.;Division of Gastrointestinal Surgery, European Institute of Oncology IRCCS, Milan, Italy.;Division of Gastrointestinal Surgery, European Institute of Oncology IRCCS, Milan, Italy.;Division of Gastrointestinal Surgery, European Institute of Oncology IRCCS, Milan, Italy.;Division of Gastrointestinal Medical Oncology and Neuroendocrine Tumors, European Institute of Oncology IRCCS, Milan, Italy.", "authors": "Rotundo|Maria Saveria|MS|;Zampino|Maria Giulia|MG|;Ravenda|Paola Simona|PS|;Bagnardi|Vincenzo|V|;Peveri|Giulia|G|;Dell'Acqua|Veronica|V|;Surgo|Alessia|A|;Trovato|Cristina|C|;Bottiglieri|Luca|L|;Bertani|Emilio|E|;Petz|Wanda Luisa|WL|;Fumagalli Romario|Uberto|U|;Fazio|Nicola|N|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1177/1758835920940945", "fulltext": "\n==== Front\nTher Adv Med Oncol\nTher Adv Med Oncol\nTAM\nsptam\nTherapeutic Advances in Medical Oncology\n1758-8340 1758-8359 SAGE Publications Sage UK: London, England \n\n10.1177/1758835920940945\n10.1177_1758835920940945\nOriginal Article\nCisplatin plus capecitabine concomitant with intensity-modulated radiation therapy in non-metastatic anal squamous cell carcinoma: the experience of a single research cancer center\nRotundo Maria Saveria Division of Gastrointestinal Medical Oncology and Neuroendocrine Tumors, European Institute of Oncology IRCCS, Milan, Italy\n Zampino Maria Giulia Division of Gastrointestinal Medical Oncology and Neuroendocrine Tumors, European Institute of Oncology IRCCS, Via Ripamonti 435, Milan 20141, Italy\n Ravenda Paola Simona Division of Gastrointestinal Medical Oncology and Neuroendocrine Tumors, European Institute of Oncology IRCCS, Milan, Italy\n Bagnardi Vincenzo Department of Statistics and Quantitative Methods, University of Milan-Bicocca, Milan, Lombardia, Italy\n Peveri Giulia Department of Statistics and Quantitative Methods, University of Milan-Bicocca, Milan, Lombardia, Italy\n Dell’Acqua Veronica Division of Radiotherapy, European Institute of Oncology IRCCS, Milan, Lombardia, Italy\n Surgo Alessia Division of Radiotherapy, European Institute of Oncology IRCCS, Milan, Lombardia, Italy\n Trovato Cristina Division of Endoscopy, European Institute of Oncology IRCCS, Milan, Lombardia, Italy\n Bottiglieri Luca Division of Pathology, European Institute of Oncology IRCCS, Milan, Lombardia, Italy\n Bertani Emilio Division of Gastrointestinal Surgery, European Institute of Oncology IRCCS, Milan, Italy\n Petz Wanda Luisa Division of Gastrointestinal Surgery, European Institute of Oncology IRCCS, Milan, Italy\n Fumagalli Romario Uberto Division of Gastrointestinal Surgery, European Institute of Oncology IRCCS, Milan, Italy\n Fazio Nicola Division of Gastrointestinal Medical Oncology and Neuroendocrine Tumors, European Institute of Oncology IRCCS, Milan, Italy\n maria.zampino@ieo.it\n15 7 2020 \n2020 \n12 17588359209409459 2 2020 12 6 2020 © The Author(s), 20202020SAGE Publications Ltd unless otherwise noted. Manuscript content on this site is licensed under Creative Commons LicensesThis article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).Background and Aims:\nThe standard treatment of non-metastatic anal squamous cell carcinoma (ASCC) consists of chemotherapy with mitomycin (MMC) plus 5-fluorouracil (5FU) for 1–2 cycles concomitant with pelvic radiotherapy. Subsequent studies introduced cisplatin (CDDP) combined with 5FU, with unclear results. We evaluated the doublet capecitabine (C) and CDDP as a possible alternative to MMC-5FU regimen concomitant with intensity-modulated radiation therapy (IMRT).\n\nPatients and Methods:\nWe carried out a retrospective study on 67 patients affected by stage I–III ASCC, treated with CDDP (60–70 mg/m2 every 21 days for two courses) plus C (825 mg/m2 twice daily for 5 days/week) chemotherapy concomitant with IMRT for curative intent.\n\nResults:\nAt a median follow up of 41 months, the clinical complete response calculated at the 6-month time-point (6-moCR), the 6-month objective response rate and the 6-month disease control rate were 93%, 94%, and 99%, respectively.\n\nDisease-free survival rates at 1, 2, and 3 years were 89%, 87%, and 85%, while the overall survival rates at 1 and 2 years were 100% and 95%. The colostomy-free survival rates were 90% at 1 year and 88% at 2 years. Grade 3–4 acute adverse events were reported in 61% of patients; predominantly skin toxicity (46%) and limited hematological toxicity (12%).\n\nConclusion:\nIn this retrospective study, chemotherapy with C plus CDDP concomitant with IMRT proved safe and effective, and may represent a possible alternative option to standard MMC-containing regimen for curative intent.\n\nanal cancercapecitabinechemotherapycisplatinimage-guidedintensity-modulatedradiotherapysquamous cell neoplasmscover-dateJanuary-December 2020typesetterts1\n==== Body\nIntroduction\nAnal cancer is a rare malignancy (2.7% of gastrointestinal tumors).1 Risk factors include female gender, tobacco consumption, human papillomavirus (HPV) or human immunodeficiency virus (HIV) infection, previous vulvar or cervical cancer and chronic immunosuppression. Poor prognostic features at tumor diagnosis are tumor size >5 cm and regional nodal involvement.2–4\n\nBased on results of the phase II trial by Nigro, confirmed by phase III trials that established the clear advantage of chemo-radiotherapy (C-RT) over radiotherapy (RT) alone, systemic chemotherapy with mitomycin (MMC) plus 5-fluorouracil (5FU) for 1–2 cycles concomitant with pelvic RT represents the standard treatment for non-metastatic anal squamous cell carcinoma (ASCC).5–8 Surgery is reserved as salvage therapy for progressive/recurrent local disease only.9\n\nThe well-known radiosensitizing properties of platinum-salt agents in different squamous cell tumors have stimulated a growing interest in the combination of cisplatin (CDDP) with 5FU in studies. However, even though efficacy data are comparable, there is no clear advantage in terms of toxicity and so no consensus for replacing the standard MMC in ASCC treatment.10\n\nDevelopments in RT have allowed dynamic variations in dose intensity to be delivered more precisely to the tumor tissue with reduced damage to surrounding normal tissue and consequent reduced genitourinary and bowel toxicity. Currently intensity-modulated radiation therapy (IMRT) represents the standard of care in the United States (US), even if it is not adopted worldwide for ASCC; its better management in terms of efficacy and toxicity could allow the concomitant role of CDDP to be reassessed.11\n\nSince 2010, IMRT has been proposed in our institute, concomitantly with CDDP plus oral fluoropyrimidine capecitabine (C) as a possible alternative to the MMC-5FU regimen in patients who preferred to avoid central vein catheter and/or when an increased hematological toxicity related to clinical history was expected.\n\nHere, we report the largest case series treated with this combination to date.\n\nPatients and methods\nPatient selection\nWe carried out a retrospective study on consecutive patients with ASCC treated between June 2010 and December 2017 at the Gastrointestinal Division of the European Institute of Oncology, Milan, Italy.\n\nInclusion criteria were: histologically proven diagnosis of ASCC, absence of distant metastases (stage I–III), measurable disease according to the Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1,12 age >18 years, Eastern Cooperative Oncology Group (ECOG) performance status (PS) ⩽2, treatment with CDDP plus C chemotherapy concomitant to IMRT for curative intent. All patients had life expectancy of at least 3 months, adequate bone marrow (hemoglobin ⩾9 g/dl, neutrophil count ⩾1500/mm3, platelet count ⩾100,000/mm3), liver (serum total bilirubin ⩽1.5× upper limit normal, transaminases ⩽3× upper limit normal) and renal function (serum creatinine within normal ranges and calculated creatinine clearance ⩾50 ml/min).\n\nExclusion criteria were: previous pelvic RT, different chemotherapy schedules, medical or psychological impairments associated with restricted ability to give consent or difficulty in adhering to the regular treatment plan. Patients with past or current malignancies, other than ASCC, were allowed if treated with curative intent.\n\nStudy procedures\nThe present study was part of the research project “Image guided radiotherapy in gastrointestinal malignancies”, approved by the European Institute of Oncology Ethical Committee, Milan, Italy (registration number: IEO N87/11). Clinical and technical analyses for this project, carried out both retrospectively and prospectively, were conducted according to the Declaration of Helsinki and in line with the Recommendations for the Conduct, Reporting, Editing and Publication of Scholarly Work in Medical Journals. All patients gave written informed consent for the research and educational purposes, and their data were extrapolated anonymously.\n\nTreatment\nRadiotherapy\nAll patients, with a full urinary bladder and empty rectum, underwent planning computed tomography (CT) scan in the supine position. The gross tumor volume, including primary tumor and involved lymph nodes, was delineated on the CT scan. Magnetic resonance imaging (MRI) and/or positron emission computed tomography with 18fluorodeoxyglucose (18FDG-PET/CT) were used to better define the anatomical structures during contouring procedures. The clinical target volume and the planning target volume (PTV) were contoured according to Radiation Therapy Oncology Group (RTOG) 0529 and Australasian Gastrointestinal Trials Group (AGITG) guidelines.13,14 For all patients, RT to the bilateral inguinal nodes was planned as prophylactic or curative. Patients with early stage disease were evaluated for a boost with brachytherapy (BRT) depending on clinical factors (age, PS, clinical tumor stage). The low-risk (bilateral external and internal iliac, presacral, and inguinal nodes), the high-risk (strictly adjacent tumor tissues) and the tumor PTVs were scheduled to receive at least 32 Gy, 40 Gy, and 50 Gy, respectively. Dosimetric parameters followed the International Commission on Radiation Units and Measurements (ICRU) recommendations (report No. 83).15 The dose volume constraints for the organs at risk, delineated by the CT scan, were adopted from RTOG 0529 and RTOG 0921 trials.13,16,17 IMRT was performed using either RapidArc® or Tomotherapy® image-guided RT.\n\nChemotherapy\nThe chemotherapy scheme consisted of CDDP 70 mg/m2 (60 mg/m2 for patients >70 years) every 21 days for two courses plus C 825 mg/m2 twice daily for 5 days/week concomitant with IMRT until the evening of the last dose of RT.\n\nAt baseline, complete medical history, including age, gender, ethnicity, ECOG PS, Charlson comorbidity index (CCI, a score based on the patient comorbidities weights able to predict outcomes, such as mortality or higher resource use),18 histological type, HPV genotype, tumor-node-metastasis stage 7th edition, was recorded. Clinical and instrumental evaluation were performed by digital anorectal examination (DRE), anorectal endoscopy with tumor biopsy for histology and HPV status, anorectal ultrasound and/or pelvic MRI with contrast and chest-abdominal-pelvic CT scan with contrast. In case of suspected extra regional disease (44 patients), 18FDG-PET/CT was carried out. Female patients underwent a gynecological examination at the beginning of the treatment and they were followed up regularly at the discretion of the gynecologist.\n\nECOG PS, vital signs, weight and body mass index, physical examination, blood samples for bone marrow, renal and liver function were performed at baseline, at weekly intervals during therapy (including before each CDDP administration) and at the end of treatment. Subsequent analyses were carried out at 8 weeks and 6 months after treatment start, and then every 4 months during the first 2 years and every 6 months during the subsequent 3-year follow-up period.\n\nDuring treatment, and at the same time points as previously mentioned, all toxicities were recorded according to Common Terminology Criteria for Adverse Events (CTCAE) version 4.03.19 Patients with abnormal values after the termination of C-RT were monitored for toxicity weekly and, if necessary, every 4 weeks until normalization of the values.\n\nAssessment of tumor response was planned at 6 months from the start of C-RT by DRE, anorectal endoscopy, and pelvic MRI, and repeated every 4 months during the first 2 years and every 6 months for the subsequent 3 years if a CR was obtained. Distant disease monitoring was conducted by chest-abdominal-pelvic CT scan every 6 months for 2 years and annually thereafter.\n\nStatistical analysis\nThe primary endpoint was the proportion of patients with observed CR at 6-months after the start of C-RT (6-moCR). Secondary end-points were: the 6-month objective response rate (6-moORR), that is the percentage of patients who achieved CR and partial response at the 6-month time-point; the 6-month disease control rate (6-moDCR), that is the percentage of patients with CR, partial response, and stable disease at the 6-month time-point; the disease-free survival (DFS), calculated only in patients achieving CR from 6-months after the start of therapy to the date of the first documented tumor recurrence, other primary tumor, or death due to any cause; the overall survival (OS), calculated in all patients from the start of the study treatment until death from any cause; the tumor-related and treatment-related colostomy-free survival (CFS), calculated in all patients from the baseline to the day of surgery for colostomy or death, whichever occurred first; the incidence of acute (within 3 months of treatment) severe toxicity [grade (G)3–G4, according to CTCAE version 4.03]. The maximum toxic effect grade was used for each patient and each event type. Exact confidence intervals (CIs) for binomial proportion were calculated. The DFS, OS, and CFS were estimated using the Kaplan–Meier method. All analyses were performed using SAS software version 9.4 (SAS Institute, Cary, NC, USA). A p value less than 0.05 was considered statistically significant.\n\nResults\nThe main patient characteristics are reported in Table 1.\n\nTable 1. Baseline patient characteristics (N = 67).\n\n\tOverall\t\n\nAge, median (range)\n\t61.2 (39–81)\t\n\nSex, N (%)\n\t\nMale\t7 (10)\t\nFemale\t60 (90)\t\n\nECOG PS\n\t\n0\t62 (93)\t\n1\t5 (7)\t\n2\t0\t\n\nCCI, median (range)\n\t4 (2–8)\t\n\nBMI, median (range)\n\t23.6 (16.2–36.8)\t\n\nSmoke, N (%)\n\t\nNo\t56 (84)\t\nYes\t6 (9)\t\nMissing\t5 (7)\t\n\nHIV positivity, N (%)\n\t\nNegative\t20 (30)\t\nPositive\t1 (1)\t\nMissing\t46 (69)\t\n\nHPV infection and types, N (%)\n\t\nNegative\t1 (1)\t\n16\t52 (78)\t\n16 + 18\t3 (4)\t\n16 + 45\t1 (1)\t\n16 + 51 + 58\t1 (1)\t\n16 + 31 + 33\t1 (1)\t\n31 + 33\t1 (1)\t\n33\t2 (3)\t\nMissing\t5 (7)\t\n\nHistology, N (%)\n\t\nSCC\t62 (93)\t\nBasaloid\t5 (7)\t\n\nGrading, N (%)\n\t\nG1\t3 (4)\t\nG2\t14 (21)\t\nG3\t20 (30)\t\nNot reported\t30 (45)\t\n\nStage, N (%)\n\t\nI\t2 (3)\t\nII\t19 (28)\t\nIIIA\t23 (34)\t\nIIIB\t23 (34)\t\nBMI, body mass index; CCI, Charlson comorbidity index; ECOG, Eastern Cooperative Oncology Group; HIV, human immunodeficiency virus; HPV, human papillomavirus; PS, performance status; SCC, squamous cell carcinoma.\n\nOut of 96 screened consecutive patients, 67 [60 females (F) and 7 males (M)], all Caucasian, were eligible for treatment evaluation in terms of toxicity and efficacy. A total of 29 patients were excluded due to metastatic disease (4 cases), treatment choice different from the CDDP-C doublet schedule (24 cases) or to C monotherapy (1 patient with kidney failure).\n\nHIV positivity was identified in 1/21 evaluated patients. Of the cases with HPV, 52 were HPV16+, 6 had multiple HPV genotypes in combination with HPV16+, and 3 were HPV33+.\n\nTumor location in all patients was the anal canal. Basaloid histology was described in 5 patients (4 F HPV16+ and 1 M HPV16+/18+). Based on medical history, 17 patients (25%) reported cancer diagnoses: 7 cervical intraepithelial neoplasia type 3; 1 cervical cancer; 1 cervical cancer plus lymphoma; 5 breast cancer; 1 melanoma; 1 squamous penile cancer (HPV16+18+, HIV+), and 1 concomitant diagnosis of papillary thyroid carcinoma treated with surgery after completing C-RT for ASCC.\n\nThe elective low-risk PTV received a median dose of 41.4 Gy (range 32.4–48.6 Gy), high-risk PTV received a median dose of 46 Gy (range 40–56 Gy), while tumor and positive nodes received a total median dose of 56 Gy (range 36–60 Gy). The boost on macroscopic disease was given using either a sequential boost technique or a simultaneous integrated boost strategy. Some patients received boost with BRT after 36–50 Gy of external RT. Both high dose rate (HDR) and pulsed dose rate (PDR) BRT were used. In case of PDR treatment, the dose administered was 10 Gy with dose rate of 0.4 Gy/h and 20 Gy with dose rate of 0.4 or 0.5 Gy/h; in case of HDR treatment, a mean dose of 16 Gy (range 8–25 Gy in 3–5 fractions) prescribed to 5 mm depth was given. Median time gap between EBRT and BRT was 21 days (range 12–53 days). Only two patients received the BRT boost after a time gap of longer than 1 month. One of them received the boost after 39 days because of skin and gastrointestinal toxicity; the second patient underwent a restaging MRI to evaluate the response and to optimize boost parameters. Objectives for target volume were set so that, for PTV, 95% of the prescribed volume should receive at least 95% of the prescribed dose. The prescribed dose was delivered in a median of 28 fractions (range 18–29), with daily fractions of 1.7–2 Gy, 5 days per week. The minimum and maximum dose, as the accepted variation in the dose distribution, was 93% <0.03 cm3 of the PTV <110%.\n\nDue to G2–4 systemic or local adverse events (AEs), a median break in C-RT of 7 days (range 1–21) was necessary in 56 patients (84%), though all patients completed the planned RT. RT details are shown in Table 2.\n\nTable 2. Radiotherapy details.\n\n\nIMRT dose—Gy, median (range)\n\t\t56 (36–60)\t\n\nRT interruption, N (%)\n\tNo\t11 (16)\t\n\tYes\t56 (84)\t\n\nBreak in RT—days, median (range)\n\t\t7 (1–21)\t\n\nOverall treatment time—days, median (range)\n\t\t48 (35–75)\t\n\nBoost RT, N (%)\n\tNo\t2 (3)\t\n\tYes\t65 (97)\t\n\nBrachytherapy, N (%)\n\tNo\t57 (85)\t\n\tYes\t10 (15)\t\nIMRT, intensity-modulated radiation therapy; RT, radiotherapy.\n\nA total of 62 patients (93%) were able to complete both the two cycles of chemotherapy, while 5 patients underwent only one cycle.\n\nAll patients experienced some acute toxicity, of which 61% had G3–4: 39 (58%) patients reported G3 AEs, mainly skin toxicity (46%), with one case of anal-cutaneous fistula that developed during EBRT; G4 AEs occurred in only two cases (one gastrointestinal and one hematological, with leuco-neutropenia and thrombocytopenia). Toxicity details are shown in Table 3.\n\nTable 3. Acute toxicity (N = 67). The maximum toxic effect grade was considered for each patient and each event type.\n\nGRADE, N\t\nType\tG1\tG2\tG3\tG4\tGrade 3 or 4, N/67 (%)\t\nAsthenia\t0\t1\t0\t0\t0 (0)\t\nNeutropenia\t8\t16\t5\t1\t6 (9)\t\nThrombocytopenia\t17\t3\t0\t1\t1 (1)\t\nLeucopenia\t12\t28\t1\t1\t2 (3)\t\nAnaemia\t24\t6\t2\t0\t2 (3)\t\nUrogenital toxicity\t28\t8\t1\t0\t1 (1)\t\nMucositis\t1\t0\t2\t0\t2 (3)\t\nLocal mucosal and skin toxicity\t5\t15\t31\t0\t31 (46)\t\nGastrointestinal toxicity\t21\t25\t6\t1\t7 (11)\t\nTotal\t\t\t\t\t52 (77)\t\n\nPatients with acute toxicity*\n\t\n5\n\t\n21\n\t\n39\n\t\n2\n\t\n41 (61)\n\t\n* Only the maximum grade observed for each patient is reported.\n\nThe 6-moCR, the 6-moORR and the 6-moDCR were 93% (62/67 patients), 94% (63/67), and 99% (66/67), respectively.\n\nAt a median follow up of 41 months, the median DFS was not reached in 62 patients with CR at the 6-month time-point (Figure 1A), with a DFS rate of 89% (95% CI 77–95%], 87% (95% CI 75–94%), and 85% (95% CI 72–92%) at 1, 2, and 3 years, respectively. The median OS of all 67 patients was not reached (Figure 1B), with an OS rate of 100% and 95% (95% CI 85–98%) at 1 and 2 years, respectively.\n\nFigure 1. (A) DFS in patients with CR at 6 months from the start of treatment (N = 62). (B) OS in all patients (N = 67).\n\nCR, complete remission; DFS, disease-free survival; OS, overall survival.\n\nUsing an exact Fisher’s text, we compared the 6-moCR for all 67 patients between different levels of possible predictors. We included the 62 patients with 6-moCR in a survival analysis, modelling the DFS with a Cox univariate model for each predictor. No statistically significant difference was observed. A better trend in response was seen for patients who developed G3 cutaneous toxicity, but the small sample size does not allow its predictive value to be estimated (Table 4).\n\nTable 4. The 6-moCR (N = 67) and the DFS (N = 62) according to different possible predictors.\n\n\t\t6-moCR, N (%)\t\t\tDFS for patients with 6-moCR\t\t\n\tLevel\tNo, 5 (7)\tYes, 62 (93)\t\np\n\tLevel\tHR (95% CI)\t\np\n\t\n\nHistory of cancer\n\tNo\t2 (4)\t48 (96)\t\n0.10\n\tYes versus No\t3.3 (0.9–12.5)\t\n0.07\n\t\n\tYes\t3 (18)\t14 (82)\t\t\t\t\t\n\nSex\n\tMale\t2 (29)\t5 (71)\t\n0.08\n\tFemale versus Male\t1.1 (0.1–8.8)\t\n0.95\n\t\n\tFemale\t3 (5)\t57 (95)\t\t\t\t\t\n\nECOG PS\n\t0\t4 (6)\t58 (94)\t\n0.33\n\t1 versus 0\t2.3 (0.3–18.7)\t\n0.44\n\t\n\t1\t1 (20)\t4 (80)\t\t\t\t\t\n\nHistology\n\tSCC\t5 (8)\t57 (92)\t\n1.00\n\tBasaloid versus SCC\t1.3 (0.2–10.3)\t\n0.83\n\t\n\tBasaloid\t0 (0)\t5 (100)\t\t\t\t\t\n\nGrading\n\tG1–G2\t1 (6)\t16 (94)\t\n1.00\n\tG3 versus G1–G2\t0.4 (0.0–4.7)\t\n0.48\n\t\n\tG3\t2 (10)\t18 (90)\t\t\t\t\t\n\nStage\n\tI–II\t1 (5)\t20 (95)\t\n1.00\n\tIIIA–IIIB versus I–II\t5.1 (0.6–40.7)\t\n0.13\n\t\n\tIIIA–IIIB\t4 (9)\t42 (91)\t\t\t\t\t\n\nBrachytherapy\n\tNo\t4 (7)\t53 (93)\t\n0.57\n\tYes versus No\t0.5 (0.1–4.4)\t\n0.57\n\t\n\tYes\t1 (10)\t9 (90)\t\t\t\t\t\n\nBoost RT\n\tNo\t1 (50)\t1 (50)\t\n0.14\n\tYes versus No\t–\t–\t\n\tYes\t4 (6)\t61 (94)\t\t\t\t\t\n\nLocal mucosal and skin toxicity\n\tNo-G1–G2\nG3\t5 (14)\n0 (0)\t31 (86)\n31 (100)\t\n0.06\n\tG3 versus No-G1–G2\t1.0 (0.3–3.9)\t\n0.96\n\t\nDFS, disease-free survival; ECOG, Eastern Cooperative Oncology Group; HR, hazard ratio; 6-moCR, complete response at the 6-month time-point; PS, performance status; RT, radiotherapy; SCC, squamous cell carcinoma.\n\nWhen stratified for other cancer diagnoses, patients did not show differences in DFS (p = 0.058; Figure 2A) and in OS (p = 0.345; Figure 2B), although the DFS curve suggests a slightly better prognosis at 3 years in terms of recurrence of disease for the subgroup without any history of cancer.\n\nFigure 2. DFS (A) and OS (B) in patients with (dashed line) and without (continuous line) history of cancer.\n\nDFS, disease-free survival; OS, overall survival.\n\nEight (13%) patients with 6-moCR presented recurrence within 2 years: four local relapses treated with abdominoperineal resection and four distant relapses treated with systemic chemotherapy.\n\nThe CFS rates were 90% (95% CI 79–95%) and 88% (95% CI 77–94%) at 1 and 2 years, respectively: three patients underwent colostomy before C-RT and never reversed, three patients underwent colostomy due to local progressive disease within 1 year after C-RT, and one patient due to the onset of an anal-cutaneous fistula.\n\nDiscussion\nThe primary aim of the treatment of non-metastatic ASCC is to achieve complete local control at 6 months from the start of treatment. This is the optimum time-point for minimizing loco-regional and systemic early and late toxicities.20,21\n\nThe doublet MMC-5FU concomitant with RT is considered the gold standard treatment, based on the results from phase III trials indicating its statistical improvement over RT alone/combined to 5FU.6–8,22\n\nIn the ACT I trial, the benefit of C-RT was confirmed beyond a median of 13 years, with an expected 25.3% fewer patients with locoregional relapse and 12.5% fewer anal cancer deaths compared with RT alone.6\n\nThe contribution of CDDP as a curative therapy for ASCC is still unclear mainly because the available studies were addressed specifically to investigating its role as induction or maintenance therapy before or after C-RT.\n\nIntergroup study RTOG 98-11 compared 5FU (1000 mg/m2 days 1–4 and 29–32) plus MMC (10 mg/m2 on days 1 and 29) and RT (45–59 Gy) with 5FU (1000 mg/m2 days 1–4, 29–32, 57–60 and 85–88) plus CDDP (75 mg/m2 on days 1, 29, 57 and 85) and RT (45–59 Gy; start day: 57). In the last 2012 update of 649/682 evaluable patients, DFS and OS resulted statistically better for the MMC arm versus the CDDP arm (5-year DFS: 67.8% versus 57.8%, p = 0.006; 5-year OS: 78.3% versus 70.7%, p = 0.026), with a trend toward statistical significance for CFS (p = 0.05). Conversely, increased hematological toxicity was described in the MMC group (61.8% versus 42%, p < 0.001).23\n\nIn the ACT II trial, patients were randomly assigned to one of four groups: MMC (12 mg/m2 on day 1) or CDDP (60 mg/m2 on days 1 and 29), with 5FU (1000 mg/m2 days 1–4 and 29–32) and RT (50.4 Gy), with or without two courses of maintenance chemotherapy (5FU and CDDP weeks 11 and 14). At a median follow up of 5 years, no difference in terms of ORR, progression-free survival (PFS) and OS was found between MMC for one cycle plus RT and CDDP-5FU for two cycles plus RT ± two additional CDDP-5FU courses, confirming higher hematological toxicity in the MMC arm (G3–G4 26% versus 16%).24\n\nFurthermore, the role of CDDP was excluded both as an induction and maintenance treatment: this failure could be due to the delay in the start of the RT and the longer duration of the treatment, with a consequently greater probability of radio-resistance to platinum through the process of ‘cell repopulation’ (persistence of tumor cell clones that proliferate during treatment intervals), or could be determined by the increased radiosensitizing effect of MMC under hypoxic conditions.25–28\n\nLimited data are available regarding the role of oral fluoropyrimidines, such as C, that represents a cost-effective alternative to infusional 5FU widely used in several malignancies, also concurrently with RT.29–31\n\nThe administration of C on a continuous daily basis can be assumed to increase the radiosensitizer effect compared with 5FU administration during the first and the last 4 days of RT, and to improve patient compliance also by avoiding venous central catheter.\n\nThe evidence of efficacy and manageable toxicity of the doublet MMC-C derived from retrospective studies (similar activity, but better tolerability of MMC-C versus MMC-5FU concomitant to IMRT, with lower hematologic toxicity and fewer treatment interruptions) and from phase II trials, with CR and locoregional control ranged from 77% to 89.1% and 79% to 94%, respectively, and high treatment completion rates despite the appearance of radiation dermatitis as the main toxicity (ranged from 23% to 63%).32–40 The data regarding the combination of C with CDDP or oxaliplatin are more limited.41–43 The main studies including C are reported in Table 5.\n\nTable 5. Main studies including capecitabine.\n\nStudies\t\n\tGlynne-Jones et al.37\tWan et al.32\tMeulendijks et al.35\tThind et al.36\tOliveira et al.38\tGoodman et al.33\tJones et al.34\tOur data\t\n\nNo. of patients\n\t31\t106\t58\t62\t43\t44\t52\t67\t\n\nDesign\n\tProspective, phase II\tRetrospective\tRetrospective\tRetrospective\tProspective, phase II\tRetrospective\tProspective observational cohort study\tRetrospective\t\n\nChemotherapy regimen\n\tMMC 12 mg/m2 d1\n+ C 825 mg/m2 bid\tMMC\n+\nC\tMMC 10 mg/m2 d1\n+ C 500–825 mg/m2 bid\tMMC 12 mg/m2 d1\n+ C 825 mg/m2 bid\tMMC 15 mg/m2 d1\n+ C 825 mg/m2 bid\tMMC 10 mg/m2 d1\n+ C 825 mg/m2 bid\tMMC 12 mg/m2 d1\n+ C 825 mg/m2 bid\tCDDP 60–70 mg/m2 d1\n+ C 825\nmg/m2 bid\t\n\nRT doses\n\t50.4 Gy\t50–54 Gy\t59.4 Gy\n(for IMRT)\t51.9 Gy\n(24% IMRT)\t–\tIMRT\n56 Gy\tIMRT\n50.4–53.2 Gy\tIMRT\n56 Gy\t\n\nCR\n\t90%\nat 6 months\t91.5%\t89.7%\nat 3 weeks from the last RT day\t93.5%\nat 20 months\t86%\nat 6 months\t–\t88.1%\nat 6 months\t93%\nat 6 months\t\n\nORR\n\t93.5%\t–\t–\t–\t93%\t–\t–\t94%\t\n\nDCR\n\t93.5%\t–\t–\t–\t93%\t–\t–\t99%\t\n\nDFS\n\t–\t93.9%\nat 12 months\t–\t–\t–\t–\t–\t85%\nat 36 months\t\n\nOS\n\t93.5%\nat 14 months\t–\t86%\nat 36 months\t95%\nat 20 months\t97.7%\nat 23 months\t98%\nat 24 months\t–\t95%\nat 24 months\t\n\nCFS\n\t–\t–\t79%\nat 36 months\t–\t–\t–\t77.5%\nat 12 months\t88%\nat 24 months\t\nBid, bi-daily; C, capecitabine; CDDP, cisplatin; CFS, colostomy-free survival; CR, complete response; D, day; DCR, disease control rate; DFS, disease-free survival; IMRT, intensity-modulated radiation therapy; MMC, mitomycin; ORR, objective response rate; OS, overall survival; RT, radiotherapy.\n\nDefinitive conclusions regarding CT treatment choices from the past studies are difficult to draw, because primary outcome measures were different in terms of DFS, PFS, local failure or CFS and the definitions of primary and secondary endpoints were not consistent across trials, as observed in a recent review of six randomized controlled trials, describing endpoints in curative ASCC treatment on 2877 patients.44 Now the main goal is to find the best parameters to evaluate outcome in this setting.\n\nOur mono-institutional retrospective study investigated well-defined endpoints and represents the largest trial conducted with the CDDP-C doublet concomitant with IMRT with curative intent in Stage I–III ASCC.\n\nAt a median follow up of 41 months, we showed substantial local control, with rates of 93%, 94%, and 99% for 6-moCR, ORR, DCR, respectively, and a satisfactory 3-year DFS rate of 85%, in agreement with the previous literature with the MMC-5FU regimen (26 weeks-CR: 89.6% in the CDDP group versus 90.5% in the MMC group, 3-year PFS: 74% for maintenance versus 73% for no maintenance in the ACT II trial).24\n\nIn this study the CDDP-C schedule did not appear to affect adversely CFS. In fact, the cumulative rate of colostomies was 10% (7/67 patients), with three colostomies performed before treatment, due to locally extended disease, and only four colostomies within 1 year after the C-RT. The number of colostomies is smaller compared with ⩾20% historical results of CDDP-5FU plus RT.23,24,45\n\nIn our study, toxicity results were manageable and comparable with previous studies: 61% had G3–4 AEs, related mainly to local skin toxicity (46%). This apparent increased toxicity could potentially be related to the possible cutaneous effects of C, which could be reinforced by its daily radiosensitizing activity, and this could potentially be predictive for clinical outcome.46\n\nG3–4 hematologic AEs were less (12%) than with the MMC regimens (61.8% in the RTOG 98-11 trial; 26% in the ACT II trial).23,24 No treatment-related deaths occurred.\n\nThe patients included in our study had several comorbidities and often a high CCI. Previous malignancies, mostly HPV-related, were pre-treated with local and or systemic treatments in some cases. These adverse clinical features are often exclusion criteria preventing patient inclusion in clinical trials. However, in our study these comorbidities do not represent a problem as patients have already been treated with chemotherapeutical agents and so the proposed scheme is manageable in the context of real-life care.\n\nConsidering our favorable results in terms of efficacy, toxicity and CFS, C plus CDDP concurrent with IMRT should be considered an interesting alternative curative approach for patients with ASCC.\n\nThe main limitation is that this is a retrospective study and so does not allow definitive conclusions.\n\nConclusion\nC plus CDDP chemotherapy concomitant with IMRT proves to be effective and well manageable in non-metastatic ASCC and it could represent a valid option to standard MMC-containing regimen, also for patients with unfavorable clinical characteristics. Prospective trials are needed to confirm these results.\n\nThe authors thank the patients, their families and all care givers; Cristina Mazzon and Darina Tamayo for data management; and Linda A. Cairns for English language editing.\n\nConflict of interest statement: The authors declare that there is no conflict of interest.\n\nFunding: The authors received no financial support for the research, authorship, and/or publication of this article.\n==== Refs\nReferences\n1. \nSiegel RL Miller KD Jemal A. \nCancer statistics, 2019\n. CA Cancer J Clin \n2019 ; 69 : 7 –34\n.30620402 \n2. \nDaling JR Madeleine MM Johnson LG , et al\nHuman papillomavirus, smoking, and sexual practices in the etiology of anal cancer\n. Cancer \n2004 ; 101 : 270 –280\n.15241823 \n3. \nSunesen KG Nørgaard M Thorlacius-Ussing O , et al\nImmunosuppressive disorders and risk of anal squamous cell carcinoma: a nationwide cohort study in Denmark, 1978–2005\n. Int J Cancer \n2010 ; 127 : 675 –684\n.19960431 \n4. \nFrisch M. \nHuman papillomavirus-associated cancers in patients with human immunodeficiency virus infection and acquired immunodeficiency syndrome\n. J Natl Cancer Inst \n2000 ; 92 : 1500 –1510\n.10995805 \n5. \nNigro ND Vaitkevicius VK Considine B. \nCombined therapy for cancer of the anal canal: a preliminary report\n. Dis Colon Rectum \n1993 ; 36 : 709 –711\n.8348857 \n6. \nNorthover J Glynne-Jones R Sebag-Montefiore D , et al\nChemoradiation for the treatment of epidermoid anal cancer: 13-year follow-up of the first randomised UKCCCR Anal Cancer Trial (ACT I)\n. Br J Cancer \n2010 ; 102 : 1123 –1128\n.20354531 \n7. \nFlam M John M Pajak TF , et al\nRole of mitomycin in combination with fluorouracil and radiotherapy, and of salvage chemoradiation in the definitive nonsurgical treatment of epidermoid carcinoma of the anal canal: results of a phase III randomized intergroup study\n. J Clin Oncol \n1996 ; 14 : 2527 –2539\n.8823332 \n8. \nBartelink H Roelofsen F Eschwege F , et al\nConcomitant radiotherapy and chemotherapy is superior to radiotherapy alone in the treatment of locally advanced anal cancer: results of a phase III randomized trial of the European organization for research and treatment of cancer radiotherapy and gastrointestinal cooperative groups\n. J Clin Oncol \n1997 ; 15 : 2040 –2049\n.9164216 \n9. \nGlynne-Jones R Nilsson PJ Aschele C , et al\nAnal cancer: ESMO-ESSO-ESTRO clinical practice guidelines for diagnosis, treatment and follow-up\n. Eur J Surg Oncol \n2014 ; 40 : 1165 –1176\n.25239441 \n10. \nTeicher BA Holden SA. \nAntitumor and radiosensitizing activity of several platinum-(+) dye complexes\n. Radiat Res \n1987 ; 109 : 58 –67\n.3809392 \n11. \nNg M Ho H Skelton J , et al\nIntensity-modulated radiotherapy for anal cancer: dose–volume relationship of acute gastrointestinal toxicity and disease outcomes\n. Clin Oncol \n2018 ; 30 : 634 –641\n.\n12. \nEisenhauer EA Therasse P Bogaerts J , et al\nNew response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1)\n. Eur J Cancer \n2009 ; 45 : 228 –247\n.19097774 \n13. \nKachnic LA Winter K Myerson RJ , et al\nRTOG 0529: a phase 2 evaluation of dose-painted intensity modulated radiation therapy in combination with 5-fluorouracil and mitomycin-C for the reduction of acute morbidity in carcinoma of the anal canal\n. Int J Radiat Oncol Biol Phys \n2013 ; 86 : 27 –33\n.23154075 \n14. \nNg M Leong T Chander S , et al\nAustralasian Gastrointestinal Trials Group (AGITG) contouring atlas and planning guidelines for intensity-modulated radiotherapy in anal cancer\n. Int J Radiat Oncol Biol Phys \n2012 ; 83 : 1455 –1462\n.22401917 \n15. \nMenzel HG. \nPrescribing, recording and reporting photon-beam intensity-modulated radiation therapy (IMRT). ICRU Report 83\n. J ICRU \n2010 ; 10 : 1 –106\n.\n16. \nViswanathan AN Moughan J Miller BE , et al\nNRG Oncology/RTOG 0921: a phase 2 study of postoperative intensity-modulated radiotherapy with concurrent cisplatin and bevacizumab followed by carboplatin and paclitaxel for patients with endometrial cancer\n. Cancer \n2015 ; 121 : 2156 –2163\n.25847373 \n17. \nMenkarios C Azria D Laliberté B , et al\nOptimal organ-sparing intensity-modulated radiation therapy (IMRT) regimen for the treatment of locally advanced anal canal carcinoma: a comparison of conventional and IMRT plans\n. Radiat Oncol \n2007 ; 2 : 41 .18005443 \n18. \nCharlson ME Pompei P Ales KL , et al\nA new method of classifying prognostic comorbidity in longitudinal studies: development and validation\n. J Chronic Dis \n1987 ; 40 : 373 –383\n.3558716 \n19. \nNational Cancer Institute . Common terminology criteria for adverse events (CTCAE) version 4.0 . NIH Publ 2009 .\n20. \nGlynne-Jones R Sebag-Montefiore D Meadows HM , et al\nBest time to assess complete clinical response after chemoradiotherapy in squamous cell carcinoma of the anus (ACT II): a post-hoc analysis of randomised controlled phase 3 trial\n. Lancet Oncol \n2017 ; 18 : 347 –356\n.28209296 \n21. \nPepek JM Willett CG Czito BG. \nRadiation therapy advances for treatment of anal cancer\n. J Natl Compr Cancer Netw \n2010 ; 8 : 123 –129\n.\n22. \nNorthover JMA Arnott SJ Cunningham D , et al\nEpidermoid anal cancer: results from the UKCCCR randomised trial of radiotherapy alone versus radiotherapy, 5-fluorouracil, and mitomycin\n. Lancet \n1996 ; 348 : 1049 –1054\n.8874455 \n23. \nGunderson LL Winter KA Ajani JA , et al\nLong-term update of US GI intergroup RTOG 98-11 phase III trial for anal carcinoma: survival, relapse, and colostomy failure with concurrent chemoradiation involving fluorouracil/mitomycin versus fluorouracil/cisplatin\n. J Clin Oncol \n2012 ; 30 : 4344 –4351\n.23150707 \n24. \nJames RD Glynne-Jones R Meadows HM , et al\nMitomycin or cisplatin chemoradiation with or without maintenance chemotherapy for treatment of squamous-cell carcinoma of the anus (ACT II): a randomised, phase 3, open-label, 2 × 2 factorial trial\n. Lancet Oncol \n2013 ; 14 : 516 –524\n.23578724 \n25. \nGlynne-Jones R Hoskin P. \nNeoadjuvant cisplatin chemotherapy before chemoradiation: a flawed paradigm?\n\nJ Clin Oncol \n2007 ; 25 : 5281 –5286\n.18024876 \n26. \nDolling JA Boreham DR Brown DL , et al\nModulation of radiation-induced strand break repair by cisplatin in mammalian cells\n. Int J Radiat Biol \n1998 ; 74 : 61 –69\n.9687976 \n27. \nKim JJ Tannock IF. \nRepopulation of cancer cells during therapy: an important cause of treatment failure\n. Nat Rev Cancer \n2005 ; 5 : 516 –525\n.15965493 \n28. \nGrau C Overgaard J. \nRadiosensitizing and cytotoxic properties of mitomycin C in a C3H mouse mammary carcinoma in vivo\n. Int J Radiat Oncol Biol Phys \n1991 ; 20 : 265 –269\n.1899413 \n29. \nDunst J Reese T Sutter T , et al\nPhase I trial evaluating the concurrent combination of radiotherapy and capecitabine in rectal cancer\n. J Clin Oncol \n2002 ; 20 : 3983 –3991\n.12351595 \n30. \nDe Paoli A Chiara S Luppi G , et al\nCapecitabine in combination with preoperative radiation therapy in locally advanced, resectable, rectal cancer: a multicentric phase II study\n. Ann Oncol \n2006 ; 17 : 246 –251\n.16282246 \n31. \nHofheinz RD Wenz F Post S , et al\nChemoradiotherapy with capecitabine versus fluorouracil for locally advanced rectal cancer: a randomised, multicentre, non-inferiority, phase 3 trial\n. Lancet Oncol \n2012 ; 13 : 579 –588\n.22503032 \n32. \nWan DDC Schellenberg D Hay J , et al\nA comparison between 5-fluorouracil/mitomycin (FM) and capecitabine/mitomycin (CM) in combination with radiation (RT) for squamous cell carcinoma (SCC) of the anal canal\n. J Clin Oncol \n2014 ; 32(5s): 4031 .\n33. \nGoodman KA Julie D Cercek A , et al\nCapecitabine with mitomycin reduces acute hematologic toxicity and treatment delays in patients undergoing definitive chemoradiation using intensity modulated radiation therapy for anal cancer\n. Int J Radiat Oncol Biol Phys \n2017 ; 98 : 1087 –1095\n.28721892 \n34. \nJones CM Adams R Downing A , et al\nToxicity, tolerability, and compliance of concurrent capecitabine or 5-fluorouracil in radical management of anal cancer with single-dose mitomycin-C and intensity modulated radiation therapy: evaluation of a national cohort\n. Int J Radiat Oncol Biol Phys \n2018 ; 101 : 1202 –1211\n.29859793 \n35. \nMeulendijks D Dewit L Tomasoa NB , et al\nChemoradiotherapy with capecitabine for locally advanced anal carcinoma: an alternative treatment option\n. Br J Cancer \n2014 ; 111 : 1726 –1733\n.25167226 \n36. \nThind G Johal B Follwell M , et al\nChemoradiation with capecitabine and mitomycin-C for stage I–III anal squamous cell carcinoma\n. Radiat Oncol \n2014 ; 9 : 124 .24885554 \n37. \nGlynne-Jones R Meadows H Wan S , et al\nEXTRA—a multicenter phase II study of chemoradiation using a 5 day per week oral regimen of capecitabine and intravenous mitomycin C in anal cancer\n. Int J Radiat Oncol Biol Phys \n2008 ; 72 : 119 –126\n.18472366 \n38. \nOliveira SCR Moniz CMV Riechelmann R , et al\nPhase II study of capecitabine in substitution of 5-FU in the chemoradiotherapy regimen for patients with localized squamous cell carcinoma of the anal canal\n. J Gastrointest Cancer \n2016 ; 47 : 75 –81\n.26691173 \n39. \nChong LC Healey T Michele T , et al\nCapecitabine in locally advanced anal cancer, do we need randomised evidence?\n\nExpert Rev Anticancer Ther \n2017 ; 17 : 411 –416\n.28277833 \n40. \nSouza KT Pereira AAL Araujo RL , et al\nReplacing 5-fluorouracil by capecitabine in localised squamous cell carcinoma of the anal canal: systematic review and meta-analysis\n. Ecancermedicalscience \n2016 ; 10 .\n41. \nEng C Chang GJ You YN , et al\nLong-term results of weekly/daily cisplatin-based chemoradiation for locally advanced squamous cell carcinoma of the anal canal\n. Cancer \n2013 ; 119 : 3769 –3775\n.24037775 \n42. \nYu IS Cheung WY. \nComparison of 5-FU versus capecitabine in combination with mitomycin or cisplatin in the treatment of anal cancer\n. J Clin Oncol \n2017 : 680 .\n43. \nEng C Chang GJ Das P , et al\nPhase II study of capecitabine and oxaliplatin with concurrent radiation therapy (XELOX-XRT) for squamous cell carcinoma of the anal canal\n. J Clin Oncol \n2009 ; 27 : 4116 .19636016 \n44. \nGlynne-Jones R Adams R Lopes A , et al\nClinical endpoints in trials of chemoradiation for patients with anal cancer\n. Lancet Oncol \n2017 ; 18 : e218 –e227\n.28368260 \n45. \nGlynne-Jones R Kadalayil L Meadows HM , et al\nTumour- and treatment-related colostomy rates following mitomycin C or cisplatin chemoradiation with or without maintenance chemotherapy in squamous cell carcinoma of the anus in the ACT II trial\n. Ann Oncol \n2014 ; 25 : 1616 –1622\n.24827136 \n46. \nRzepecki AK Cheng H McLellan BN. \nCutaneous toxicity as a predictive biomarker for clinical outcome in patients receiving anticancer therapy\n. J Am Acad Dermatol \n2018 ; 79 : 545 –555\n.29733938\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "1758-8340", "issue": "12()", "journal": "Therapeutic advances in medical oncology", "keywords": "anal cancer; capecitabine; chemotherapy; cisplatin; image-guided; intensity-modulated; radiotherapy; squamous cell neoplasms", "medline_ta": "Ther Adv Med Oncol", "mesh_terms": null, "nlm_unique_id": "101510808", "other_id": null, "pages": "1758835920940945", "pmc": null, "pmid": "32728394", "pubdate": "2020", "publication_types": "D016428:Journal Article", "references": "24037775;8823332;28209296;22401917;28721892;29733938;9164216;29859793;18472366;23150707;20354531;15965493;16282246;22503032;19097774;18005443;25167226;19960431;23578724;8874455;15241823;1899413;8348857;3809392;23154075;30620402;28277833;3558716;20064294;30049649;26691173;28368260;25239441;24885554;24827136;10995805;12351595;18024876;25847373;28105070;9687976", "title": "Cisplatin plus capecitabine concomitant with intensity-modulated radiation therapy in non-metastatic anal squamous cell carcinoma: the experience of a single research cancer center.", "title_normalized": "cisplatin plus capecitabine concomitant with intensity modulated radiation therapy in non metastatic anal squamous cell carcinoma the experience of a single research cancer center" }
[ { "companynumb": "IT-ACCORD-194781", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CISPLATIN" }, "drugadditional": "3", "drugad...
{ "abstract": "Philadelphia or BCR-ABL positive acute lymphoblastic leukemia (PH+ ALL) is the most common and severe of adult ALL. The only potentially curator treatment remains allogeneic hematopoietic stem cells transplantation (SCT) in first complete remission. The use of imatinib has revolutionized the treatment of chronic myeloid leukemia. Its incorporation into PH + ALL protocols also improved the prognosis of this disease giving better complete remission rates compared to chemotherapy alone. The treatment of patients not eligible for SCT remains controversial. Prolonged use of high dose tyrosine kinase inhibitors (TKI) (ie: imatinib at 600 or 800 mg/j) as maintenance therapy seems to be a reasonable approach. We present a case of prolonged molecular remission of PH+ ALL under TKI alone as maintenance therapy.", "affiliations": "Service d'hématologie clinique, Hôpital militaire d'instruction Mohamed V, Rabat, Maroc.;Service d'hématologie clinique, Hôpital militaire d'instruction Mohamed V, Rabat, Maroc.;Service d'hématologie clinique, Hôpital militaire d'instruction Mohamed V, Rabat, Maroc.;Service d'hématologie clinique, Hôpital militaire d'instruction Mohamed V, Rabat, Maroc.;Service d'hématologie clinique, Hôpital militaire d'instruction Mohamed V, Rabat, Maroc.;Service d'hématologie clinique, Hôpital militaire d'instruction Mohamed V, Rabat, Maroc.;Service d'hématologie clinique, Hôpital militaire d'instruction Mohamed V, Rabat, Maroc.", "authors": "Raissi|Abderrahim|A|;Bouaouad|Majdouline|M|;Drideb|Noufissa Alami|NA|;Jennane|Selim|S|;Mahtat|El Mahdi|el M|;Doghmi|Kamal|K|;Mikdame|Mohammed|M|", "chemical_list": "D014408:Biomarkers, Tumor; D014750:Vincristine; D003907:Dexamethasone; D004317:Doxorubicin; D000068877:Imatinib Mesylate; D003520:Cyclophosphamide", "country": "France", "delete": false, "doi": "10.1684/abc.2015.1039", "fulltext": null, "fulltext_license": null, "issn_linking": "0003-3898", "issue": "73(2)", "journal": "Annales de biologie clinique", "keywords": "Bcr-Abl + ALL; hematopoetic stem cell transplantation; prolonged molecular remission", "medline_ta": "Ann Biol Clin (Paris)", "mesh_terms": "D000328:Adult; D000971:Antineoplastic Combined Chemotherapy Protocols; D014408:Biomarkers, Tumor; D003520:Cyclophosphamide; D003907:Dexamethasone; D004317:Doxorubicin; D006801:Humans; D000068877:Imatinib Mesylate; D010677:Philadelphia Chromosome; D054198:Precursor Cell Lymphoblastic Leukemia-Lymphoma; D012074:Remission Induction; D014750:Vincristine", "nlm_unique_id": "2984690R", "other_id": null, "pages": "195-8", "pmc": null, "pmid": "25847743", "pubdate": "2015", "publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article; D016454:Review", "references": null, "title": "Prolonged molecular response induced by imatinib in Philadelphia positive acute lymphoblastic leukemia A case report and brief review.", "title_normalized": "prolonged molecular response induced by imatinib in philadelphia positive acute lymphoblastic leukemia a case report and brief review" }
[ { "companynumb": "MA-PFIZER INC-2016470009", "fulfillexpeditecriteria": "1", "occurcountry": "MA", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "INSULIN NOS" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND Acute promyelocytic leukemia (APL) is a very rare leukemia in children. Extramedullary involvement by APL has been reported in between 3-5% of cases, mainly associated with cases of relapse. A rare case of relapse of APL in a 9-year-old child is presented with skin involvement with myeloid sarcoma. CASE REPORT A 9-year-old male child was admitted to the Oncology Service of the hospital complaining of fever, progressive fatigue, oral petechiae with severe bleeding in the oral cavity. Bone marrow examination showed some promyelocytes. Flow cytometry showed 86% immature myeloid cells with the t(15;17) translocation, and molecular analysis showed expression of the PML/RARa fusion protein, which confirmed the diagnosis of APL. The patient completed a course of daunorubicin, cytarabine, and AII trans-retinoic acid (ATRA) with complete remission. After six months, the patient was re-admitted to hospital with a violaceous lesion on the scalp, with relapse of APL. Histological and immunohistochemistry of the lesion involving the skin of the scalp showed a myeloid sarcoma invading the dermis. CONCLUSIONS Myeloid sarcoma, also called granulocytic sarcoma, is an extramedullary tumor of immature myeloid cells, which very rarely presents in children with APL. The mechanisms that lead to myeloid sarcoma in children with APL and the possible association with ATRA therapy remain to be investigated.", "affiliations": "Center for Oncology, Santa Casa de Misericórdia de Maceió, Maceió, AL, Brazil.;State University of Health Sciences of Alagoas (UNCISAL), Maceió, AL, Brazil.;Faculty of Medicine, Federal University of Alagoas (UFAL), Maceió, AL, Brazil.;State University of Health Sciences of Alagoas (UNCISAL), Maceió, AL, Brazil.;Center for Oncology, Santa Casa de Misericórdia de Maceió, Maceió, AL, Brazil.;Center for Oncology, Santa Casa de Misericórdia de Maceió, Maceió, AL, Brazil.;State University of Health Sciences of Alagoas (UNCISAL), Maceió, AL, Brazil.;State University of Health Sciences of Alagoas (UNCISAL), Maceió, AL, Brazil.;Faculty of Medicine, Federal University of Alagoas (UFAL), Maceió, AL, Brazil.;State University of Health Sciences of Alagoas (UNCISAL), Maceió, AL, Brazil.;Department of Anatomy, State University of Health Sciences of Alagoas (UNCISAL), Maceió, AL, Brazil.", "authors": "Araújo|Nathalia Silva|NS|;Dos Santos Júnior|Claudio José|CJ|;Gomes|Vitória Mikaelly da Silva|VMDS|;Calheiros Leite|Luiz Arthur|LA|;Bomfim|Luana Novaes|LN|;Gusmão|Amanda Katielly Firmino da Silva|AKFDS|;Alves|Maria Jordana Rocha Gomes|MJRG|;Romão|Cyndi Myrelle da Silva Barros|CMDSB|;Batinga|Arthur Moacir Costa Sampaio|AMCS|;da Silva|Maria Rosa|MR|;de Sousa Rodrigues|Célio Fernando|CF|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.12659/ajcr.907847", "fulltext": "\n==== Front\nAm J Case RepAm J Case RepamjcaserepThe American Journal of Case Reports1941-5923International Scientific Literature, Inc. 2965094610.12659/AJCR.907847907847ArticlesA Rare Case of Relapsed Pediatric Acute Promyelocytic Leukemia with Skin Involvement by Myeloid Sarcoma Araújo Nathalia Silva ABCDEFG1Júnior Claudio José dos Santos ABCDEFG2Gomes Vitória Mikaelly da Silva ABDEF3Leite Luiz Arthur Calheiros ABDE2Bomfim Luana Novaes F1Gusmão Amanda Katielly Firmino da Silva D1Alves Maria Jordana Rocha Gomes ABEF2Romão Cyndi Myrelle da Silva Barros ABDE2Batinga Arthur Moacir Costa Sampaio DEF3da Silva Maria Rosa D2de Sousa Rodrigues Célio Fernando D4\n1 Center for Oncology, Santa Casa de Misericórdia of Maceió, Maceió, AL, Brazil\n2 State University of Health Sciences of Alagoas (UNCISAL), Maceió, AL, Brazil\n3 Faculty of Medicine, Federal University of Alagoas (UFAL), Maceió, AL< Brazil\n4 Department of Anatomy, State University of Health Sciences of Alagoas (UNCISAL), Maceió, AL, BrazilAuthors’ Contribution:\n\nA Study Design\n\nB Data Collection\n\nC Statistical Analysis\n\nD Data Interpretation\n\nE Manuscript Preparation\n\nF Literature Search\n\nG Funds Collection\n\nConflict of interest: None declared\n\nCorresponding Author: Luiz Arthur Calheiros Leite, e-mail: lahemato@hotmail.com2018 13 4 2018 19 438 441 01 11 2017 19 1 2018 © Am J Case Rep, 20182018This work is licensed under Creative Common Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0)Patient: Male, 9\n\nFinal Diagnosis: Acute promyelocytic leukemia (APL)\n\nSymptoms: Bleeding\n\nMedication: —\n\nClinical Procedure: —\n\nSpecialty: Hematology\n\nObjective:\nRare disease\n\nBackground:\nAcute promyelocytic leukemia (APL) is a very rare leukemia in children. Extramedullary involvement by APL has been reported in between 3–5% of cases, mainly associated with cases of relapse. A rare case of relapse of APL in a 9-year-old child is presented with skin involvement with myeloid sarcoma.\n\nCase Report:\nA 9-year-old male child was admitted to the Oncology Service of the hospital complaining of fever, progressive fatigue, oral petechiae with severe bleeding in the oral cavity. Bone marrow examination showed some promyelocytes. Flow cytometry showed 86% immature myeloid cells with the t(15;17) translocation, and molecular analysis showed expression of the PML/RARα fusion protein, which confirmed the diagnosis of APL. The patient completed a course of daunorubicin, cytarabine, and AII trans-retinoic acid (ATRA) with complete remission. After six months, the patient was re-admitted to hospital with a violaceous lesion on the scalp, with relapse of APL. Histological and immunohistochemistry of the lesion involving the skin of the scalp showed a myeloid sarcoma invading the dermis.\n\nConclusions:\nMyeloid sarcoma, also called granulocytic sarcoma, is an extramedullary tumor of immature myeloid cells, which very rarely presents in children with APL. The mechanisms that lead to myeloid sarcoma in children with APL and the possible association with ATRA therapy remain to be investigated.\n\nMeSH Keywords:\nAntineoplastic Combined Chemotherapy ProtocolsChildLeukemia, Promyelocytic, AcuteRecurrence\n==== Body\nBackground\nAcute promyelocytic leukemia (APL) is a subtype of acute myeloid leukemia that is characterized by a translocation between chromosomes 15 and 17 t(15;17)(q22;q21) and fusion between the PML gene and the retinoic acid receptor alpha gene, RARα. APL is common in adults and extremely rare in children and cytopenia, coagulopathies, and a severe bleeding diathesis are the clinical hallmarks of APL [1,2].\n\nExtramedullary involvement by APL has been reported in between 3–5% of cases, mainly associated with cases of relapse, and the most affected sites for extramedullary involvement are the skin, central nervous system, the gingiva, the lungs, the mediastinum, lymph nodes, the testes and breast [1,2]. Some studies have suggested that there is an association between treatment with AII-trans retinoic acid (ATRA) after induction therapy and complete remission followed by extramedullary relapses [3,4].\n\nIn the 1970s, it was demonstrated that malignant cells from patients with APL were sensitive to chemotherapy with anthracyclines (daunorubicin, idarubicin), achieving complete remission in up to 55% of cases, and in 1985, therapy with ATRA was introduced [5,6].\n\nATRA appeared to revolutionize therapy for APL by modifying the natural history of the disease from being a disease with a high mortality rate to curable disease with rates of complete remission in 90% of cases [5,6].\n\nHere, we report a rare case of APL in a child with skin infiltration with myeloid sarcoma after apparent complete remission following treatment with ATRA.\n\nCase Report\nA 9-year-old male child was admitted to the Oncology Service of the Santa Casa de Misericórdia of the Maceió, Brazil, with symptoms of fever, progressive fatigue, and with signs of petechiae and severe bleeding in the oral cavity.\n\nInvestigations included a bone marrow aspirate that showed hypercellularity with granular promyelocytes containing Auer rods. Flow cytometry analysis of the bone marrow sample, using labeled antibodies to leukocyte and granulocyte markers showed strongly positive expression of antibodies for CD13, CD33, CD34, CD117, whereas HLA-DR was negative. The cytogenetic and molecular findings showed translocation between chromosomes 15 and 17 t(15;17)(q22;q21) and fusion between the PML gene and the retinoic acid receptor alpha gene, RARα, confirming the diagnosis of APL. Antineoplastic treatment was commenced with intravenous daunorubicin 45 mg/m2/day and continuous oral treatment with AII trans-retinoic acid (ATRA) 45 mg/m2/day, which resulted in initial complete remission.\n\nAfter six months, the patient was re-admitted to hospital with a recurrence of symptoms, including a prominent violaceous lesion on the scalp (Figure 1A), gingival bleeding, fatigue, fever, and pain in the extremities. A blood test showed a hemoglobin level of 5.2 g/dL, a leukocyte count of 5.6×109/L and a platelet count of 14×109/L, with 64% blasts and 9% promyelocytes. Lactate dehydrogenase was measured at 4,942 U/L (normal, <610 U/L). The bone marrow aspirates showed 20% hypergranular promyelocytes with Auer rods. Histopathologic examination of the skin lesion showed a pattern of large cells and a diffuse infiltrate that also involved the dermis. Immunohistochemistry of the skin lesion showed positive immunostaining of the tumor cells with primary antibodies to myeloperoxidase (MPO), CD45, TDT, CD20, and CD79a; immunostaining for PAX, CD2, CD3, CD4, CD5, CD7, and CD8 were negative (Figure 2A–2C). The results from the immunohistochemical panel were consistent with a diagnosis of a myeloid neoplasm, a myeloid sarcoma, in the skin. Cytogenetic analysis showed t(15;17) (q22q21) in 40% of the metaphase preparations analyzed, and polymerase chain reaction (PCR) for the PML-RARα gene showed residual disease, compatible with relapse of APL.\n\nRemission induction chemotherapy was begun with intravenous cytarabine, 100 mg/m2/day for seven days), continuous treatment with ATRA, 45 mg/m2/day, and with intravenous daunorubicin, 60 mg/m2/day for three days. After 30 days of the second induction treatment, bone marrow analysis was performed, showing normal cell lines; regression of the lesion on the scalp was also seen (Figure 1B) with complete clinical remission. However, the patient died due to severe refractory hypokalemia as a complication of treatment with amphotericin B 50 mg, when he was hospitalized at a later date.\n\nDiscussion\nAcute promyelocytic leukemia (APL) exhibits genetic alterations involving the retinoic acid alpha-receptor gene, RARα. APL is characterized by a clonal expansion of malignant myeloid cells that are blocked at the promyelocyte stage of development. High doses of AII trans-retinoic acid (ATRA) is used to treat APL by overcoming the deficiency in the retinoic acid protein, resulting in clinical remission in 90% of cases [5,6]. Despite this, 10% of the treated patients undergo relapse, but extramedullary infiltration in children is extremely rare. Myeloid sarcoma is also called granulocytic sarcoma and is an extra-medullary tumor of immature myeloid cells, which very rarely occurs in children with APL.\n\nWillernick et al. studied 26 cases of APL with extramedullary involvement, and only two patients (7.6%) had extramedullary disease that included a pelvic mass and infiltration of the bone marrow and mandible after complete remission following treatment with ATRA [3]. Giralt et al. reported two cases of APL in children with relapse and skin involvement following remission induced by ATRA [7].\n\nThe factors associated with extramedullary relapse include age less than 45 years, elevated white blood cell (WBC) count >10.109/L, and the presence of the bcr3 isoform of PML-RARα. Park et al. showed that patients with a high leukocyte count were at greater risk of early mortality, despite ATRA treatment [8]. Botton et al. studied 31 children with ALP, seven children had relapses, with one patient who exhibited extra-medullary disease [9].\n\nTreatment with ATRA has been reported to be increasingly associated with extramedullary relapse following complete remission. There is a possibility that ATRA and anthracycline do not penetrate sites where extramedullary disease usually occurs. Also, the intensity of chemotherapy is often reduced after commencing treatment with ATRA, and its biological characteristics may favor relapse. In addition to inducing differentiation of promyelocytes, ATRA can alter the expression of adhesion molecules, increasing the ability of leukemic cells to migrate to other tissues, and may also promote the proliferation of keratinocytes, increasing the possibility of recurrence in the skin [10,11].\n\nThe differential diagnosis of skin manifestations of APL includes specific primary skin lesions resulting from direct infiltration of skin and subcutaneous tissue by leukemic cells. Papulonodular lesions of cutaneous leukemia appear as hard papules, plaques, or dermal nodules that are reddish-brown to violet (violaceous) in color. The initial lesions may be macular. Other clinical presentations of leukemic involvement of the skin include blisters, ulcers, and erythroderma. Myeloid, or granulocytic, sarcomas are extramedullary masses of leukemic cells that can be found in various regions of the body, with common sites being the skin of the face, the skin of the breast, the orbit, the paravertebral area, the long bones and lymph nodes. The extramedullary tumor masses are neoplastic infiltrates that are histologically are found only in an acute leukemia environment. The presence of cutaneous lesions is a marker of poor prognosis and can precede the relapse of systemic leukemia. Cutaneous lesions infiltration may be the first or the only sign of progression, and it is important that physicians are familiar with the clinical manifestations of myeloid, or granulocytic, sarcoma involving the skin, a condition that is also known as a form of ‘leukemia cutis’ [12].\n\nThis report has described a rare case of childhood APL with cutaneous infiltration of leukemic cells following treatment with ATRA. The diagnosis of APL was confirmed by the use of polymerase chain reaction (PCR) for the detection of PML/RARα gene expression. This case report reinforces the possibility that treatment with ATRA may be associated with a higher incidence of extramedullary APL at the time of relapse.\n\nConclusions\nMyeloid sarcoma, also called granulocytic sarcoma, is an extra-medullary tumor of immature myeloid cells, which very rarely presents in children with APL. Treatment for APL with AII transretinoic acid (ATRA) may be associated with an increased incidence of extramedullary disease, including cutaneous lesions. Further studies are important to elucidate the effects of chemotherapy with ATRA for the early prevention of extramedullary complications in children with APL.\n\nConflict of interest\n\nNone.\n\nFigure 1. The scalp lesion in a 9-year-old boy with acute promyelocytic leukemia (APL). (A) Extramedullary infiltration by promyelocytes in the scalp of a 9-year-old child after the first cycle of AII trans-retinoic acid (ATRA). (B) Regression of the tumor mass after relapse following chemotherapy with ATRA.\n\nFigure 2. Photomicrographs of the histology and immunohistochemistry of the biopsy tissue from the scalp lesion shows a myeloid sarcoma. (A) Photomicrograph of the histology of the scalp lesion shows a diffuse pattern of intermediate-to-large cells involving the papillary dermis and deep layers of the skin. Hematoxylin and eosin (H&E). (B, C) Photomicrographs of the staining findings from the immunohistochemical panel showing positive expression of myeloperoxidase (MPO), CD45, and TDT. Strong expression of the proliferation marker, KI-67 is seen. Positive immunostaining of the tumor cells is seen with primary antibodies to myeloperoxidase (MPO), CD45, TDT, CD20, and CD79a; immunostaining for PAX, CD2, CD3, CD4, CD5, CD7 and CD8 are negative. The histology and immunohistochemistry confirm a hematopoietic neoplasm of myeloid origin in the skin.\n==== Refs\nReferences:\n1. Stein EM Tallman MS Acute promyelocytic leukemia in children and adolescents Acta Haematologica 2014 132 307 12 25228556 \n2. Vega-Ruiz A Faderl S Estrov Z Incidence of extramedullary disease in patients with promyelocytic leukemia: A single institution experience Int J Hematol 2009 89 489 96 19340529 \n3. Willernick PH Bellis R Muxi P Extramedullary acute promyelocytic leukemia Cancer 1996 15 2510 14 \n4. Botton S Sanz MA Chevret S Extramedullary relapse in acute promyelocytic leukemia treated with alltrans retinoic acid and chemotherapy Leukemia 2006 20 35 41 16307026 \n5. Park JH Tallman MS Treatment of acute promyelocytic leukemia without cytotoxic chemotherapy Oncology 2011 25 733 41 21874835 \n6. Sanz MA Grimwade D Tallman MS Management of acute promyelocytic leukemia: Recommendations from an expert panel on behalf of the European LeukemiaNet Blood 2009 113 1875 91 18812465 \n7. Giralt S O’Brien S Weeks E Leukemia cutis in acute promyelocytic leukemia: Report of three cases after treatment with AII-trans retinoic acid Leuk Lymphoma 1994 14 453 56 7812204 \n8. Park JH Qiao B Panageas KS Early death rate in acute promyelocytic leukemia remains high despite all-trans retinoic acid Blood 2011 118 1248 54 21653939 \n9. Botton S Coiteux V Chevret S Outcome of childhood acute promyelocytic leukemia with all-trans-retinoic acid and chemotherapy J Clin Oncol 2004 22 1404 12 15084614 \n10. Testi AM Biondi A Lo Coco F GIMEMA-AIEOPAIDA protocol for the treatment of newly diagnosed acute promyelocytic leukemia (APL) in children Blood 2005 106 447 53 15677559 \n11. Bakst RL Tallman MD Douer D How I treat extramedullary acute myeloid leukemia Blood 2011 118 3785 93 21795742 \n12. Peña-Romero AG Domínguez-Cherit J Méndez-Flores S Leukemia cutis: Clinical features of 27 Mexican patients and a review of the literature Gac Med Mex 2016 152 5 439 43\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "1941-5923", "issue": "19()", "journal": "The American journal of case reports", "keywords": null, "medline_ta": "Am J Case Rep", "mesh_terms": "D001706:Biopsy; D002648:Child; D017809:Fatal Outcome; D005434:Flow Cytometry; D006801:Humans; D015473:Leukemia, Promyelocytic, Acute; D008297:Male; D022423:Myeloid Cells; D035583:Rare Diseases; D023981:Sarcoma, Myeloid; D012535:Scalp; D012878:Skin Neoplasms", "nlm_unique_id": "101489566", "other_id": null, "pages": "438-441", "pmc": null, "pmid": "29650946", "pubdate": "2018-04-13", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "7812204;18812465;27792708;15677559;19340529;21653939;21874835;25228556;21795742;16307026;15084614", "title": "A Rare Case of Relapsed Pediatric Acute Promyelocytic Leukemia with Skin Involvement by Myeloid Sarcoma.", "title_normalized": "a rare case of relapsed pediatric acute promyelocytic leukemia with skin involvement by myeloid sarcoma" }
[ { "companynumb": "BR-MYLANLABS-2018M1034688", "fulfillexpeditecriteria": "1", "occurcountry": "BR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "TRETINOIN" }, "drugadditional": "3", ...
{ "abstract": "Alemtuzumab is a monoclonal antibody approved for relapsing-remitting multiple sclerosis (RRMS). Although Immune thrombocytopenia (ITP) has been reported as a secondary autoimmune phenomenon following alemtuzumab infusion, immediate thrombocytopenia during the infusion has not been reported.\n\n\n\nWe report transient, reversible, self-limiting acute-onset thrombocytopenia during the first course with alemtuzumab.\n\n\n\nIn total, 3 of 22 paitents developed mild self-limited bruising associated with a drop in platelet count from their baseline during the intial 5-day course of alemtuzumab. Upon chart review, all 22 patients who received alemtuzumab developed an immediate mostly asymptomatic drop in platelet count which returned to normal within 2 months post-infusion.", "affiliations": "Department of Neurology, Weill Cornell Medical College, New York, NY, USA.;Department of Neurology, Weill Cornell Medical College, New York, NY, USA.;Department of Neurology, Weill Cornell Medical College, New York, NY, USA.;Department of Neurology, Weill Cornell Medical College, New York, NY, USA.;Department of Neurology, Weill Cornell Medical College, New York, NY, USA.", "authors": "Ranganathan|Usha|U|;Kaunzner|Ulrike|U|;Foster|Stacyann|S|;Vartanian|Timothy|T|;Perumal|Jai S|JS|", "chemical_list": "D000911:Antibodies, Monoclonal; D000074323:Alemtuzumab", "country": "England", "delete": false, "doi": "10.1177/1352458517699876", "fulltext": null, "fulltext_license": null, "issn_linking": "1352-4585", "issue": "24(4)", "journal": "Multiple sclerosis (Houndmills, Basingstoke, England)", "keywords": "Multiple sclerosis; alemtuzumab; thrombocytopenia", "medline_ta": "Mult Scler", "mesh_terms": "D000074323:Alemtuzumab; D000911:Antibodies, Monoclonal; D006801:Humans; D009103:Multiple Sclerosis; D016553:Purpura, Thrombocytopenic, Idiopathic; D013921:Thrombocytopenia; D016896:Treatment Outcome", "nlm_unique_id": "9509185", "other_id": null, "pages": "540-542", "pmc": null, "pmid": "28287030", "pubdate": "2018-04", "publication_types": "D016428:Journal Article", "references": null, "title": "Immediate transient thrombocytopenia at the time of alemtuzumab infusion in multiple sclerosis.", "title_normalized": "immediate transient thrombocytopenia at the time of alemtuzumab infusion in multiple sclerosis" }
[ { "companynumb": "US-SA-2018SA118444", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ALEMTUZUMAB" }, "drugadditional": "3", "dr...
{ "abstract": "The aim of this article is to emphasize that starvation is an important potential consequence of psychosis and to provide recommendations for management of this condition. A review of the literature on food refusal and starvation in patients with psychotic illnesses was performed. Our search strategy returned 54 articles with one article meeting inclusion criteria. Additional independent research returned an additional four cases of patients with psychosis engaging in self-starvation. The cases of several patients from our institution who engaged in self-starvation behaviors as a result of psychosis are also presented. The management and outcomes of each of these 10 patients are discussed. Starvation secondary to psychosis is an important but underappreciated consequence of psychosis that can lead to serious adverse outcomes in these patients. Few cases have been reported in the literature. More study is warranted to develop evidence-based management guidelines.", "affiliations": "School of Medicine.;Menninger Department of Psychiatry and Behavioral Sciences, Baylor College of Medicine, Houston, Texas.;Menninger Department of Psychiatry and Behavioral Sciences, Baylor College of Medicine, Houston, Texas.;Menninger Department of Psychiatry and Behavioral Sciences, Baylor College of Medicine, Houston, Texas.;Menninger Department of Psychiatry and Behavioral Sciences, Baylor College of Medicine, Houston, Texas.", "authors": "Pacilio|Rachel M|RM|;Coverdale|John H|JH|;Siddiqui|Sameera|S|;David|Elizabeth H|EH|;Gordon|Mollie R|MR|", "chemical_list": "D014150:Antipsychotic Agents", "country": "United States", "delete": false, "doi": "10.1097/NMD.0000000000001174", "fulltext": null, "fulltext_license": null, "issn_linking": "0022-3018", "issue": "208(9)", "journal": "The Journal of nervous and mental disease", "keywords": null, "medline_ta": "J Nerv Ment Dis", "mesh_terms": "D000328:Adult; D000368:Aged; D014150:Antipsychotic Agents; D003702:Delusions; D001068:Feeding and Eating Disorders; D005260:Female; D005440:Fluid Therapy; D006801:Humans; D008297:Male; D008875:Middle Aged; D010259:Paranoid Disorders; D010288:Parenteral Nutrition; D011618:Psychotic Disorders; D012559:Schizophrenia; D012565:Schizophrenic Psychology; D013217:Starvation; D055815:Young Adult", "nlm_unique_id": "0375402", "other_id": null, "pages": "654-657", "pmc": null, "pmid": "32868687", "pubdate": "2020-09", "publication_types": "D016428:Journal Article; D016454:Review", "references": null, "title": "Food Refusal Secondary to Psychosis: A Case Series and Literature Review.", "title_normalized": "food refusal secondary to psychosis a case series and literature review" }
[ { "companynumb": "US-MYLANLABS-2021M1024749", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "LORAZEPAM" }, "drugadditional": null, ...
{ "abstract": "OBJECTIVE\nHerpes simplex-associated uveitis is usually considered a unilateral eye disease, and rarely included in the differential diagnosis whenever there is bilateral involvement. We report three cases of bilateral herpetic anterior uveitis.\n\n\nMETHODS\nWe evaluated three patients who presented with clinical manifestations of bilateral uveitis suggestive of viral origin.\n\n\nRESULTS\nWe found intraocular hypertension, cells in the anterior chamber, paralytic mydriasis, iris atrophy with transillumination defects, and variable anterior vitreous cellularity. According to the clinical findings, supported with herpes-specific antibody titers and aqueous humor PCR results in two of them, they were diagnosed with bilateral anterior herpetic uveitis.\n\n\nCONCLUSIONS\nOur patients were initially misdiagnosed as having non-infectious uveitis and were treated with immunomodulatory medications, which could have favored the extension of infection bilaterally. Although uncommon, bilateral herpetic uveitis should always be considered in the differential diagnoses, when patients present with hypertensive uveitis in both eyes.", "affiliations": "a Immunology Department , School of Medicine and Health Sciences, Group of Public Health Research, Rosario University , Bogota Colombia.;b Biomedical Research Center, Faculty of Health Sciences , Quindio University, Group of Molecular Parasitology (GEPAMOL), Armenia , Quindio , Colombia.;c MERSI, Ocular Immunology and Uveitis Foundation , Cambridge , Massachusetts , USA.", "authors": "de-la-Torre|Alejandra|A|;Valdes-Camacho|Juanita|J|;Foster|C Stephen|CS|", "chemical_list": "D000914:Antibodies, Viral; D000998:Antiviral Agents", "country": "England", "delete": false, "doi": "10.3109/09273948.2016.1142572", "fulltext": null, "fulltext_license": null, "issn_linking": "0927-3948", "issue": "25(4)", "journal": "Ocular immunology and inflammation", "keywords": "Anterior; bilateral; herpes simplex virus (HSV); herpetic; uveitis", "medline_ta": "Ocul Immunol Inflamm", "mesh_terms": "D000328:Adult; D000867:Anterior Chamber; D000914:Antibodies, Viral; D000998:Antiviral Agents; D001082:Aqueous Humor; D001284:Atrophy; D004359:Drug Therapy, Combination; D015828:Eye Infections, Viral; D005260:Female; D006561:Herpes Simplex; D018259:Herpesvirus 1, Human; D018258:Herpesvirus 2, Human; D006801:Humans; D007498:Iris; D008297:Male; D008875:Middle Aged; D015878:Mydriasis; D009798:Ocular Hypertension; D014606:Uveitis, Anterior", "nlm_unique_id": "9312169", "other_id": null, "pages": "497-502", "pmc": null, "pmid": "27003735", "pubdate": "2017-08", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Bilateral Herpes Simplex Uveitis: Review of the Literature and Own Reports‏.", "title_normalized": "bilateral herpes simplex uveitis review of the literature and own reports" }
[ { "companynumb": "CO-SUN PHARMACEUTICAL INDUSTRIES LTD-2017R1-154387", "fulfillexpeditecriteria": "1", "occurcountry": "CO", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "BELIMUMAB" }, "druga...
{ "abstract": "Allogeneic hematopoietic stem cell transplantation and checkpoint blockade therapy are immune-based salvage therapies for Hodgkin's lymphoma; however, the use of programmed death 1 blocking agents in the allogeneic stem cell transplantation setting could augment the incidence of steroid refractory graft-versus-host disease. Few studies suggest that that nivolumab is safe in patients previously treated with an allogeneic stem cell transplantation. Likewise, there are very limited data on the use of nivolumab before allogeneic stem cell transplantation. Here, we report a case of fatal graft-versus-host disease in a patient who underwent allogeneic stem cell transplantation 26 days after the last administration of nivolumab. Careful monitoring and close clinical assessment of atypical presentation for graft-versus-host disease in these patients, interval of time from nivolumab administration to allogeneic stem cell transplantation, drug dosage adjustments or more effective allo prophilaxys should been evaluated in prospective clinical trial.", "affiliations": "1 Department of Hematology, 16473 Hospital Universitario 12 de Octubre , Madrid, Spain.;1 Department of Hematology, 16473 Hospital Universitario 12 de Octubre , Madrid, Spain.;1 Department of Hematology, 16473 Hospital Universitario 12 de Octubre , Madrid, Spain.;2 Department of Nuclear Medicine, 16473 Hospital Universitario 12 de Octubre , Madrid, Spain.;3 Department of Pathological Anatomy, 16473 Hospital Universitario 12 de Octubre , Madrid, Spain.;1 Department of Hematology, 16473 Hospital Universitario 12 de Octubre , Madrid, Spain.;1 Department of Hematology, 16473 Hospital Universitario 12 de Octubre , Madrid, Spain.;1 Department of Hematology, 16473 Hospital Universitario 12 de Octubre , Madrid, Spain.", "authors": "Jiménez-Ubieto|Ana|A|;Rodriguez|Antonia|A|;Martinez Sánchez|Pilar|P|;Gómez|Adolfo|A|;Rodriguez|Yolanda|Y|;Carreño-Tarragona|Gonzalo|G|;Martinez-López|Joaquín|J|;Grande|Carlos|C|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1177/1078155217743069", "fulltext": null, "fulltext_license": null, "issn_linking": "1078-1552", "issue": null, "journal": "Journal of oncology pharmacy practice : official publication of the International Society of Oncology Pharmacy Practitioners", "keywords": "Allogenic stem cell transplantation; Hodgkin lymphoma; graft versus host disease; nivolumab", "medline_ta": "J Oncol Pharm Pract", "mesh_terms": null, "nlm_unique_id": "9511372", "other_id": null, "pages": "1078155217743069", "pmc": null, "pmid": "29207936", "pubdate": "2017-01-01", "publication_types": "D016428:Journal Article", "references": null, "title": "Fatal graft-versus-host disease after allogeneic stem cell transplantation in a patient recently exposed to nivolumab.", "title_normalized": "fatal graft versus host disease after allogeneic stem cell transplantation in a patient recently exposed to nivolumab" }
[ { "companynumb": "ES-TEVA-2019-ES-1017300", "fulfillexpeditecriteria": "1", "occurcountry": "ES", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "MYCOPHENOLATE MOFETIL" }, "drugadditional": nul...
{ "abstract": "Q fever is a zoonosis caused by Coxiella burnetii that presents with a wide spectrum of acute and chronic manifestations. Progression to chronic Q fever is frequently associated with valve and vascular prosthesis, aneurisms, pregnancy, immunosuppression, and advanced chronic kidney disease. We present a case of a kidney transplant recipient with persistent fever of unknown origin, negative blood cultures, anemia, and increased erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP). Q fever serological tests were suggestive of chronic Q fever and the patient was diagnosed with probable chronic Q fever according to the Dutch Fever Consensus Group Guidelines. Initiation of doxycycline 200 mg/d and hydroxychloroquine 600 mg/d resulted in clinical remission. Chronic Q fever is a high-morbidity and -mortality disease if untreated and special attention has to be given to high-risk patients, such as kidney transplant recipients.", "affiliations": "Nephrology and Renal Transplantation Department, Hospital de Santa Maria, Centro Hospitalar Lisboa Norte, Lisboa, Portugal. Electronic address: iolandagodinho@gmail.com.;Nephrology and Renal Transplantation Department, Hospital de Santa Maria, Centro Hospitalar Lisboa Norte, Lisboa, Portugal.;Infectious Diseases Department, Hospital de Santa Maria, Centro Hospitalar Lisboa Norte, Lisboa, Portugal.;Infectious Diseases Department, Hospital de Santa Maria, Centro Hospitalar Lisboa Norte, Lisboa, Portugal.;Nephrology and Renal Transplantation Department, Hospital de Santa Maria, Centro Hospitalar Lisboa Norte, Lisboa, Portugal.;Nephrology and Renal Transplantation Department, Hospital de Santa Maria, Centro Hospitalar Lisboa Norte, Lisboa, Portugal.;Nephrology and Renal Transplantation Department, Hospital de Santa Maria, Centro Hospitalar Lisboa Norte, Lisboa, Portugal.", "authors": "Godinho|I|I|;Nogueira|E L|EL|;Santos|C M|CM|;Paulo|S E|SE|;Fortes|A|A|;Guerra|J O|JO|;Gomes da Costa|A|A|", "chemical_list": "D000900:Anti-Bacterial Agents; D000907:Antibodies, Bacterial; D004318:Doxycycline", "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0041-1345", "issue": "47(4)", "journal": "Transplantation proceedings", "keywords": null, "medline_ta": "Transplant Proc", "mesh_terms": "D000900:Anti-Bacterial Agents; D000907:Antibodies, Bacterial; D016997:Coxiella burnetii; D004318:Doxycycline; D006801:Humans; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D011183:Postoperative Complications; D011778:Q Fever; D012698:Serologic Tests", "nlm_unique_id": "0243532", "other_id": null, "pages": "1045-7", "pmc": null, "pmid": "26036515", "pubdate": "2015-05", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Chronic Q Fever in a renal transplant recipient: a case report.", "title_normalized": "chronic q fever in a renal transplant recipient a case report" }
[ { "companynumb": "PHHY2015PT163596", "fulfillexpeditecriteria": "1", "occurcountry": "PT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "MYCOPHENOLATE MOFETIL" }, "drugadditional": null, ...
{ "abstract": "OBJECTIVE\nTo evaluate safety and efficacy of oral propranolol administration in preterm newborns affected by an early phase of retinopathy of prematurity (ROP).\n\n\nMETHODS\nFifty-two preterm newborns with Stage 2 ROP were randomized to receive oral propranolol (0.25 or 0.5 mg/kg/6 hours) added to standard treatment or standard treatment alone. To evaluate safety of the treatment, hemodynamic and respiratory variables were continuously monitored, and blood samples were collected weekly to check for renal, liver, and metabolic balance. To evaluate efficacy of the treatment, the progression of the disease (number of laser treatments, number of bevacizumab treatments, and incidence of retinal detachment) was evaluated by serial ophthalmologic examinations, and plasma soluble E-selectin levels were measured weekly.\n\n\nRESULTS\nNewborns treated with propranolol showed less progression to Stage 3 (risk ratio 0.52; 95% CI 0.47-0.58, relative reduction of risk 48%) or Stage 3 plus (relative risk 0.42 95% CI 0.31-0.58, relative reduction of risk 58%). The infants required fewer laser treatments and less need for rescue treatment with intravitreal bevacizumab (relative risk 0.48; 95% CI 0.29-0.79, relative reduction of risk 52 %), a 100% relative reduction of risk for progression to Stage 4. They also had significantly lower plasma soluble E-selectin levels. However, 5 of the 26 newborns treated with propranolol had serious adverse effects (hypotension, bradycardia), in conjunction with episodes of sepsis, anesthesia induction, or tracheal stimulation.\n\n\nCONCLUSIONS\nThis pilot study suggests that the administration of oral propranolol is effective in counteracting the progression of ROP but that safety is a concern.", "affiliations": "Neonatal Intensive Care Unit, Medical Surgical Fetal-Neonatal Department, \"A. Meyer\" University Children's Hospital, Florence, Italy. Electronic address: l.filippi@meyer.it.", "authors": "Filippi|Luca|L|;Cavallaro|Giacomo|G|;Bagnoli|Paola|P|;Dal Monte|Massimo|M|;Fiorini|Patrizio|P|;Donzelli|Gianpaolo|G|;Tinelli|Francesca|F|;Araimo|Gabriella|G|;Cristofori|Gloria|G|;la Marca|Giancarlo|G|;Della Bona|Maria Luisa|ML|;La Torre|Agostino|A|;Fortunato|Pina|P|;Furlanetto|Sandra|S|;Osnaghi|Silvia|S|;Mosca|Fabio|F|", "chemical_list": "D000319:Adrenergic beta-Antagonists; D011433:Propranolol", "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0022-3476", "issue": "163(6)", "journal": "The Journal of pediatrics", "keywords": "GA; Gestational age; OIR; Oxygen-induced retinopathy; ROP; Retinopathy of prematurity; VEGF; Vascular endothelial growth factor; β-AR; β-adrenoreceptor", "medline_ta": "J Pediatr", "mesh_terms": "D000319:Adrenergic beta-Antagonists; D005260:Female; D006801:Humans; D007234:Infant, Premature; D008297:Male; D010865:Pilot Projects; D011433:Propranolol; D012178:Retinopathy of Prematurity; D012307:Risk Factors; D016037:Single-Blind Method", "nlm_unique_id": "0375410", "other_id": null, "pages": "1570-1577.e6", "pmc": null, "pmid": "24054431", "pubdate": "2013-12", "publication_types": "D016428:Journal Article; D016449:Randomized Controlled Trial", "references": null, "title": "Oral propranolol for retinopathy of prematurity: risks, safety concerns, and perspectives.", "title_normalized": "oral propranolol for retinopathy of prematurity risks safety concerns and perspectives" }
[ { "companynumb": "IT-IMPAX LABORATORIES, LLC-2019-IPXL-00145", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "PROPRANOLOL HYDROCHLORIDE" }, ...
{ "abstract": "OBJECTIVE\nThe purpose of this article is to determine the clinical features, imaging findings, and possible causes of pneumatosis intestinalis (PI) or pneumoperitoneum that developed in bilateral lung transplant recipients.\n\n\nMETHODS\nFrom December 2004 to July 2009, seven (2%) of 321 bilateral lung transplant recipients (two women and five men; age range, 25-66 years) who developed PI or pneumoperitoneum, or both, were identified. Medical records were reviewed to determine the clinical presentation, laboratory findings, and medications at the time of presentation of PI or pneumoperitoneum. Hospital course and time to resolution of PI or pneumoperitoneum were recorded. Common factors that might explain the cause of the PI and pneumoperitoneum were evaluated. Two experienced abdominal radiologists reviewed all imaging studies and recorded the specific findings for each patient.\n\n\nRESULTS\nAll patients had minimal or no symptoms, normal laboratory study results, and no systemic, intestinal, or proven respiratory infections. All patients but one were receiving triple immunosuppressive agents (i.e., prednisone, azathioprine, and tacrolimus). The imaging findings were similar in five of the patients with the PI dominated by a linear and cystic appearance and involving only the colon. Three of the six patients with PI had both PI and pneumoperitoneum. The mean time to resolution of PI was 24 days. No definite cause for the PI and pneumoperitoneum could be determined in the seven patients.\n\n\nCONCLUSIONS\nBilateral lung transplant recipients may develop benign PI or pneumoperitoneum after surgery. Benign PI in bilateral lung transplant recipients has a similar and specific linear and cystic appearance and is not due to ischemic bowel. No specific cause for the PI and pneumoperitoneum could be determined.", "affiliations": "Department of Radiology, Duke University Medical Center, Durham, NC, USA. william.thompson6@va.gov", "authors": "Thompson|William M|WM|;Ho|Lisa|L|;Marroquin|Carlos|C|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.2214/AJR.10.4468", "fulltext": null, "fulltext_license": null, "issn_linking": "0361-803X", "issue": "196(3)", "journal": "AJR. American journal of roentgenology", "keywords": null, "medline_ta": "AJR Am J Roentgenol", "mesh_terms": "D000328:Adult; D000368:Aged; D005260:Female; D006801:Humans; D016040:Lung Transplantation; D008297:Male; D008875:Middle Aged; D011006:Pneumatosis Cystoides Intestinalis; D011027:Pneumoperitoneum; D011860:Radiography, Abdominal; D012189:Retrospective Studies; D014057:Tomography, X-Ray Computed", "nlm_unique_id": "7708173", "other_id": null, "pages": "W273-9", "pmc": null, "pmid": "21343474", "pubdate": "2011-03", "publication_types": "D016428:Journal Article", "references": null, "title": "Pneumatosis intestinalis and pneumoperitoneum after bilateral lung transplantation in adults.", "title_normalized": "pneumatosis intestinalis and pneumoperitoneum after bilateral lung transplantation in adults" }
[ { "companynumb": "US-ALKEM LABORATORIES LIMITED-US-ALKEM-2022-01041", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "AZATHIOPRINE" }, "dru...
{ "abstract": "Purulent pericarditis is a rare condition with a high mortality rate. We report a case of purulent pericarditis subsequently caused by Candida parapsilosis, Peptostreptococcus asaccharolyticus, Streptococcus anginosus, Staphylococcus aureus, Prevotella oralis, and Mycobacterium tuberculosis in a previously healthy 17-year-old boy with mediastinal tuberculous lymphadenitis. The probable route of infection was a bronchomediastinal lymph node-pericardial fistula. The patient improved with antibiotic, antifungal, and antituberculous medication in addition to pericardiectomy.", "affiliations": "Department of Internal Medicine, Hanyang University College of Medicine, Seoul, Korea.;Department of Internal Medicine, Hanyang University College of Medicine, Seoul, Korea.;Department of Internal Medicine, Hanyang University College of Medicine, Seoul, Korea.;Department of Internal Medicine, Hanyang University College of Medicine, Seoul, Korea.;Department of Internal Medicine, Hanyang University College of Medicine, Seoul, Korea.;Department of Internal Medicine, Hanyang University College of Medicine, Seoul, Korea.;Department of Internal Medicine, Hanyang University College of Medicine, Seoul, Korea.;Department of Internal Medicine, Hanyang University College of Medicine, Seoul, Korea.;Department of Internal Medicine, Hanyang University College of Medicine, Seoul, Korea.;Department of Thoracic and Cardiovascular Surgery, Hanyang University College of Medicine, Seoul, Korea.;Department of Internal Medicine, Hanyang University College of Medicine, Seoul, Korea.", "authors": "Lee|Seung|S|0000-0001-7641-2384;Lee|Kanglok|K|;Ko|Jun Kwon|JK|;Park|Jaekeun|J|;Yu|Mi Yeon|MY|;Oh|Chang Kyo|CK|;Hong|Seung Pyo|SP|;Kim|Yeonjae|Y|;Lim|Younghyo|Y|;Kim|Hyuck|H|;Pai|Hyunjoo|H|0000-0003-4143-035X", "chemical_list": null, "country": "Korea (South)", "delete": false, "doi": "10.3947/ic.2015.47.4.261", "fulltext": "\n==== Front\nInfect ChemotherInfect ChemotherICInfection & Chemotherapy2093-23402092-6448The Korean Society of Infectious Diseases and Korean Society for Chemotherapy 10.3947/ic.2015.47.4.261Case ReportPolymicrobial Purulent Pericarditis Probably caused by a Broncho-Lymph Node-Pericardial Fistula in a Patient with Tuberculous Lymphadenitis http://orcid.org/0000-0001-7641-2384Lee Seung 1Lee Kanglok 1Ko Jun Kwon 1Park Jaekeun 1Yu Mi Yeon 1Oh Chang Kyo 1Hong Seung Pyo 1Kim Yeonjae 1Lim Younghyo 1Kim Hyuck 2http://orcid.org/0000-0003-4143-035XPai Hyunjoo 11 Department of Internal Medicine, Hanyang University College of Medicine, Seoul, Korea.2 Department of Thoracic and Cardiovascular Surgery, Hanyang University College of Medicine, Seoul, Korea.Corresponding Author: Hyunjoo Pai, MD, PhD. Department of Internal Medicine, Hanyang University College of Medicine, 222 Wangsimni-ro, Seongdong-gu, Seoul 04763, Korea. Tel: +82-2-2290-8356, Fax: +82-2-2298-9183, paihj@hanyang.ac.kr12 2015 30 12 2015 47 4 261 267 24 5 2014 04 9 2014 04 9 2014 Copyright © 2015 by The Korean Society of Infectious Diseases and Korean Society for Chemotherapy2015This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.Purulent pericarditis is a rare condition with a high mortality rate. We report a case of purulent pericarditis subsequently caused by Candida parapsilosis, Peptostreptococcus asaccharolyticus, Streptococcus anginosus, Staphylococcus aureus, Prevotella oralis, and Mycobacterium tuberculosis in a previously healthy 17-year-old boy with mediastinal tuberculous lymphadenitis. The probable route of infection was a bronchomediastinal lymph node-pericardial fistula. The patient improved with antibiotic, antifungal, and antituberculous medication in addition to pericardiectomy.\n\nTuberculous pericarditisTuberculous lymphadenitisBronchial fistulaPolymicrobial infectionPericarditis\n==== Body\nIntroduction\nPurulent pericarditis is a rare condition [1] that occurs most commonly from adjacent infectious intrathoracic lesions such as those due to pneumonia, empyema, myocarditis, and endocarditis [2]. Hematogenous spread from distant infections, a perforating injury, or direct inoculation during thoracic surgery or following catheter drainage are also possible pathogenic mechanisms, which lead to secondary purulent pericarditis [34]. The most common pathogen is Staphylococcus aureus, but cases of polymicrobial purulent pericarditis are occasionally reported as well [45678]. Polymicrobial purulent pericarditis develops most often after procedures [67], but primary infections in patients with esophageal cancer, diabetes, and human immunodeficiency virus (HIV) infection have also been reported [58]. A case of purulent pericarditis due to infection with Streptococcus pneumoniae and Mycobacterium tuberculosis in an HIV patient was reported in South Africa [9], but there have been no previous reports of polymicrobial pericarditis occurring as a complication of tuberculosis (TB) in an immunocompetent patient. To our knowledge, this is the first report of bacterial and fungal pericarditis to have occurred during mediastinal tuberculous lymphadenitis and pericarditis. In this report, we present a case of purulent pericarditis subsequently caused by Candida parapsilosis, Peptostreptococcus asaccharolyticus, Streptococcus anginosus, Staphylococcus aureus, Prevotella oralis, and Mycobacterium tuberculosis in a previously healthy 17-year-old boy with MTL.\n\nCase Report\nA 17-year-old boy presented to the emergency room (ER) complaining of shortness of breath and pleuritic chest pain that had developed 2 hours earlier. The patient was a high school student who had been well until 1 month before this visit. In the subsequent month, he had a dry cough, fatigue, and weight loss of 2 kg. He had no febrile sensation or myalgia. The day before, he developed fever, chills, and pleuritic chest pain rated 3 points on a 0-10 numeric pain intensity scale. The pain was located on the anterior chest wall and was aggravated when the patient inspired deeply. Two hours before visiting the ER, shortness of breath developed, and the pleuritic chest pain was aggravated and radiated to the shoulder and jaw. He did not smoke nor drink alcohol, and did not have any trauma.\n\nThe patient was alert but appeared acutely ill. Vital signs included a body temperature of 39.0℃, blood pressure of 107/70 mmHg, heart rate of 110 beats/min, respiratory rate of 30/min, and 98% oxygen saturation with pulse oximetry on room air. Results of examinations of the head, eye, ear, nose, and throat were unremarkable. The jugular vein was not distended. On chest examination, lung auscultation was normal, but a rapid and distant heart sound was heard. On abdominal examination, there was no tender point or organomegaly. No pitting edema on the peripheral limbs was observed.\n\nInitial laboratory findings were as follows: white blood cell count was 20,100/mm3 with 88.4% neutrophils, hemoglobin 12.6 g/dL, hematocrit 37.3% and the platelet count was 394,000/mm3. Additional findings included the following: blood urea nitrogen, 7.2 mg/dL (reference range, 7-20 mg/dL); serum creatinine, 0.78 mg/dL (reference range, 0.6-1.4 mg/dL); C-reactive protein, 21.7 mg/dL (reference range <0.3 mg/dL); aspartate aminotransferase, 84 U/L (reference range, 5-40 U/L); alanine aminotransferase, 177 U/L (reference range, 5-45 U/L), D-dimer, 2.97 mg/L (reference range, 0-0.24 mg/L); B-type natriuretic peptide, 97 pg/mL (reference range 0-100 pg/mL); and troponin I, 0.04 ng/mL (reference range 0.01-0.06 ng/mL). An HIV antibody test result was negative. On electrocardiography, sinus tachycardia (heart rate 116 beats/min), elevation of PR segment in aVR, and depression of PR in the other leads were observed. A chest radiograph showed cardiac silhouette enlargement with left lower lobar consolidation (Fig. 1). In a computed tomography (CT) scan of the chest, pericardial effusion with pericardial enhancement and multiple necrotic lymph nodes containing air in the mediastinal area were observed, which suggested a broncho-lymph nodal fistula (Fig. 2). Echocardiography showed a large amount of pericardial effusion with normal cardiac wall motion. TB pericarditis and lymphadenitis were presumed, and the patient was admitted to the intensive care unit. Intravenous ceftriaxone was administered from the first day of his arrival at the ER.\n\nSix hours after admission, he began to breathe faster (40 breaths/min) and his blood pressure dropped to 90/50 mmHg. Jugular venous distention was observed. Cardiac tamponade was presumed, and emergency fluoroscopy-guided percutaneous pericardiocentesis was performed during which 200 mL of pus-like fluid was drained. The catheter was left in the pericardial space for drainage. Fluid specimens were sent for culture and chemical analysis. Chemical analysis findings of initial pericardial fluid were as follows: white blood cell count, 197,840/mm3 with 98% neutrophils; red blood cell count, 70,000/mm3, lactate dehydrogenase, 1,894 U/L; triglycerides, 31 mg/dL; glucose, 3 mg/dL; and adenosine deaminase, 91.8 U/L. Microbiologic results of the pericardial fluid culture are shown in Figure 3.\n\nOn the following day, a Mycobacterium tuberculosis polymerase chain reaction (TB PCR) test performed on the pericardial fluid yielded positive results. Acid-fast bacillus (AFB) staining and Gram staining were all negative. Isoniazid, rifampin, ethambutol, and pyrazinamide with pyridoxine were administered. On hospital day 3, we learned that yeast was growing in the initial pericardial fluid culture so we added intravenous fluconazole. On hospital day 4, Candida parapsilosis was identified in the initial pericardial fluid culture. The amount of fluid drained from the pericardial catheter decreased to 70 mL/day, but his fever persisted. We learned that gram-positive bacterium was growing in the pericardial fluid drained on the first hospital day. We used vancomycin and ciprofloxacin in addition to fluconazole as treatment for pyogenic pericarditis. On hospital day 7, the fever developed daily, and vital signs included a body temperature of 38.1℃, blood pressure of 110/75 mmHg, heart rate of 98 beats/min and respiratory rate of 18/min. Chest radiography showed that the cardiac silhouette had decreased in size but that pneumopericardium had developed (Fig. 4). Subsequent chest CT image showed that pneumopericardium newly developed and the pericardial wall became more thickened and septated (Fig. 5). We switched vancomycin and ciprofloxacin with vancomycin and ertapenem for the uncontrolled, mixed infection because of the pneumopericardium. On hospital day 9, Peptostreptococcus asaccharolyticus and Streptococcus anginosus in addition to C. parapsilosis were identified from the initial pericardial fluid culture. Methicillin-sensitive S. aureus and Prevotella oralis were also determined to the causative organisms of pyogenic pericarditis in this case, isolated respectively from pericardial fluid drained on hospital day 4 and hospital day 7. At this point, we understood that the multiple organisms in the pericardial fluid would be from the oral cavity through a broncho-lymph nodal fistula and possibly a lymph nodal-pericardial fistula. Upon reviewing the chest CT image, we observed that the subcarinal lymph node with air density was shown to contact with the parietal pericardium at coronal section images (panel D in Fig. 2). Because of persistent pericardial drainage, pericardial thickening, and probable broncho-lymph node-pericardial fistula, a pericardiectomy was performed on hospital day 10. Pus, inflammatory material, and multiple septations were observed within the pericardium during the procedure, and irrigation with suction and removal of septations were performed for smooth drainage of the pericardial fluid. There was neither gross pericardial fistula nor evidence of mediastinitis. In order to identify the suspected tracheobronchial fistula, an air leakage test was performed, but no leakage was observed. The thickened pericardium and epicardium were removed (mostly on the anterior right ventricle side). Therefore, subcarinal and paratracheal lymph nodes were not dissected. Pericardial tissue biopsy revealed acute and chronic inflammation with liquefactive necrosis. The patient began to improve postoperatively. TB cultures of the pericardial fluid were all negative. One month after admission, the patient was discharged with oral antifungal, antibiotic and anti-TB medication. We stopped amoxicillin/clavulanic acid after three months and fluconazole after six months, but patient remained on anti-TB medication. Six months after discharge, the patient returned to normal activity including playing soccer, and his heart rate was around 70 beats/min. Echocardiography showed no cardiac relaxation abnormality, although the ejection fraction was minimally decreased.\n\nDiscussion\nTB lymphadenitis is observed in nearly 35% of cases of extrapulmonary TB, which constitutes approximately 15-20% of all cases of TB [10]. The incidence of pericardial involvement among pulmonary TB is estimated to be 1-8% [11]. In most cases, TB pericarditis occurs due to the progression of infection into the pericardium from the mediastinal lymph nodes, particularly those at the tracheobronchial bifurcation [2]. In our case, chest CT showed large, necrotizing lymph nodes containing air at the site of the tracheobronchial bifurcation coming into contact with the pericardium.\n\nThis case was unusual in that bacteria, candida, and mycobacteria were all identified at the same time from the pericardial fluid of a healthy young boy, and that a pneumopericardium occurred by possible broncho-lymph node-pericardial fistula rather than by direct bronchopericardial fistula formation. At first, we believed that the culture result of Candida parapsilosis was likely due to contamination. When the bacteria serially isolated were all from the oral cavity and the pneumopericardium appeared, we understood the mechanism of this unusual result.\n\nInitial Gram stain of the pericardial fluid was negative although the culture was positive, which may have been because of the administration of antibiotics before pericardiocentesis, or simply a false-negative result of the Gram stain. The false negative rate for Gram stain is reported to be 25-50% in septic arthritis [12], although the sensitivity of the Gram stain in pericardial fluid has not been reported.\n\nWhen the pneumopericardium developed on hospital day 7, we considered three explanations for this; first, that it developed because of pericardial drainage; second, that gas formation occurred by uncontrolled mixed infection with anaerobic bacteria; and third, that the air leak was worsened through enlargement of the fistula. A cardiologist gave the opinion that a pneumopericardium was less likely to occur with pericardial drainage because the intrapericardial pressure was higher than the atmospheric pressure. We performed a pericardiectomy early because of possible persistent mixed infection and broncho-lymph node-pericardial fistula. However, because the surgeons could not find the gross fistula intraoperatively, lymph node dissection and fistula closure were not performed, and the patient recovered without further problems.\n\nCases of lymphobronchial fistulae in patients with TB lymphadenitis have been reported in children and HIV patients [1314]. Although rare, bronchopericardial fistulae can occur as a complication of tuberculosis, histoplasmosis, and aspergillosis [1516] as well as be caused by neoplasm [17], iatrogenesis [18], and trauma [19]. The treatment for a bronchopericardial fistula is stent insertion and surgery [17], although there is at least one case in the literature reporting spontaneous healing of a bronchopericardial fistula after pericardial drainage [14]. In our case, we speculate that the fistula must have been very small (a microperforation), but large enough for bacteria to pass through, and that it may have been closed when inflammation was decreased with antibiotics, antifungals and anti-TB medication in addition to appropriate drainage of inflammatory materials. The sequence in which the organisms were isolated may have been a function of organism invasiveness or of their abundance in the oral cavity.\n\nIn summary, we report a case of polymicrobial purulent pericarditis that occurred in a patient with mediastinal tuberculous lymphadenitis, with the probable mechanism being a bronchomediastinal lymph node-pericardial fistula.\n\nFigure 1 Anteroposterior chest radiograph; the cardiac silhouette is globularly enlarged and looks like a \"water bottle\".\nFigure 2 Chest computed tomography. Transverse section image shows a large amount of pericardial effusion with pericardial enhancement (panel A). Multiple necrotic lymph nodes containing air density are observed in the pretracheal (panel B, arrow) and subcarinal areas (panel C, arrow). Coronal section image shows subcarinal lymph node with air density in contact with the parietal pericardium (panel D, arrow).\nFigure 3 Hospital course of the patient and identified pathogens from pericardial fluid cultures. Hospital day 2: The TB PCR text was positive for the initial pericardial fluid and also positive for those samples obtained at day 4 and 10. Hospital day 2 to 4: Serial AFB stains of sputum and pericardial fluid were all negative. Hospital day 3: The initial pericardial fluid culture yielded yeast growth. Hospital day 4: Candida parapsilosis was identified from the pericardial fluid and gram-positive cocci was observed in the pericardial fluid culture. Hospital day 7: AFB stain of pericardial fluid was positive. Hospital day 9: Polymicrobial pathogens were identified subsequently from the initial pericardial fluid culture. Hospital day 10: AFB stain of the pericardial fluid from the operation field was positive. TB cultures of pericardial fluid performed five times were all negative.\nAFB, acid fast staining; TB PCR, tuberculosis polymerase chain reaction; INH, isoniazid; RFP, rifampin; EMB, ethambutol; PZA, pyrazinamide; HD, hospital day; MSSA, methicillin susceptible Staphylococcus aureus.\n\naHD#1 - Culture was requested on hospital day 1.\n\nbPericardial fluid culture requested at hospital day 1 was reported at hospital day 4.\n\nFigure 4 Anteroposterior chest radiograph obtained on day 7 of hospitalization; the cardiac silhouette decreased in size but a newly developed radiolucent lesion around the heart with left costophrenic angle blunting can be seen (arrows).\nFigure 5 Chest computed tomography on day 7 of hospitalization: A transverse section image shows pericardial effusion was slightly decreased but multifocal air density and septations in pericardial space (panel A, arrow) were observed. In the coronal section image, subcarinal lymph node within air density (panel B, arrow) appears unchanged, and percutaneous pericardial drainage tube in pericardial space (panel B, arrowhead) is observed.\n==== Refs\n1 Maisch B Seferović PM Ristić AD Erbel R Rienmüller R Adler Y Tomkowski WZ Thiene G Yacoub MH Task Force on the Diagnosis and Management of Pricardial Diseases of the European Society of Cardiology Guidelines on the diagnosis and management of pericardial diseases executive summary; The Task force on the diagnosis and management of pericardial diseases of the European society of cardiology Eur Heart J 2004 25 587 610 15120056 \n2 Shiber JR Purulent pericarditis: Acute infections and chronic complications Hosp Physician 2008 44 9 18 \n3 Ferreira dos Santos L Moreira D Ribeiro P Rodrigues B Correia E Nunes L Sequeira M Albuquerque A Barros I Saraiva JP Santos O Purulent pericarditis: a rare diagnosis Rev Port Cardiol 2013 32 721 727 24011667 \n4 Rubin RH Moellering RC Jr Clinical, microbiologic and therapeutic aspects of purulent pericarditis Am J Med 1975 59 68 78 1138554 \n5 Parsons R Argoud G Palmer DL Mixed bacterial infection of the pericardium South Med J 1983 76 1046 1048 6879273 \n6 Epstein SK Winslow CJ Brecher SM Faling LJ Polymicrobial bacterial pericarditis after transbronchial needle aspiration. Case report with an investigation on the risk of bacterial contamination during fiberoptic bronchoscopy Am Rev Respir Dis 1992 146 523 525 1489151 \n7 Lu DC Chang SC Chen HC Polymicrobial bacterial pericarditis with mediastinitis after endotracheal intubation Diagn Microbiol Infect Dis 1995 23 115 118 8849656 \n8 Sawaya FJ Sawaya JI Gharzuddine W Eid EV Kanj SS Cardiac tamponade caused by polymicrobial gram-negative organisms Int J Infect Dis 2009 13 e483 e484 19395299 \n9 Louw A Tikly M Purulent pericarditis due to co-infection with Streptococcus pneumoniae and Mycobacterium tuberculosis in a patient with features of advanced HIV infection BMC Infect Dis 2007 7 12 17346343 \n10 World Health Organization (WHO) Global tuberculosis report 2013 Accessed 17 May 2014 Available at: http://reliefweb.int/sites/reliefweb.int/files/resources/9789241564656_eng.pdf \n11 Trauter BW Darouiche RO Tuberculous pericarditis: optimal diagnosis and management Clin Infect Dis 2001 33 954 961 11528565 \n12 Stirling P Faroug R Amanat S Ahmed A Armstrong M Sharma P Qamruddin A False-negative rate of Gram-stain microscopy for diagnosis of septic arthritis: suggestions for improvement Int J Microbiol 2014 2014 830857 24678320 \n13 Marchiori E Francisco FA Zanetti G Hochhegger B Lymphobronchial fistula: another complication associated with lymphobronchial tuberculosis in children Pediatr Radiol 2013 43 252 253 23114634 \n14 Yoon JH Jung JY Min JW Park SY Jeon YD Hong HC Bang JH Joh JS Lymphobronchial fistula of tuberculous lymphadenitis in acquired immunodeficiency syndrome Infect Chemother 2012 44 35 39 \n15 Bennett JA Haramati LB CT of bronchopericardial fistula: an unusual complication of multi drug-resistant tuberculosis in HIV infection AJR Am J Roentgenol 2000 175 819 820 10954473 \n16 Owens CM Hamon MD Graham TR Wood AJ Newland AC Bronchopericardial fistula and pneumopericardium complicating invasive pulmonary aspergillosis Clin Lab Haematol 1990 12 351 354 2272163 \n17 Dabar G Daher M Harmouche C Bronchopericardial fistula treatment by a metallic stent Rev Mal Respir 2013 30 429 432 23746818 \n18 Wattez H Bellier J Akkad R Porte H Bronchopericardial fistula after a pulmonary resection Ann Thorac Surg 2013 95 1099 23438547 \n19 Ali I Beg MH Traumatic bronchopericardial fistula presenting as cardiac tamponade J Thorac Cardiovasc Surg 1988 95 740 3352313\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "1598-8112", "issue": "47(4)", "journal": "Infection & chemotherapy", "keywords": "Bronchial fistula; Pericarditis; Polymicrobial infection; Tuberculous lymphadenitis; Tuberculous pericarditis", "medline_ta": "Infect Chemother", "mesh_terms": null, "nlm_unique_id": "101531537", "other_id": null, "pages": "261-7", "pmc": null, "pmid": "26788411", "pubdate": "2015-12", "publication_types": "D016428:Journal Article", "references": "8849656;19395299;23746818;11528565;10954473;6879273;23114634;2272163;24678320;1138554;1489151;3352313;24011667;23438547;15120056;17346343", "title": "Polymicrobial Purulent Pericarditis Probably caused by a Broncho-Lymph Node-Pericardial Fistula in a Patient with Tuberculous Lymphadenitis.", "title_normalized": "polymicrobial purulent pericarditis probably caused by a broncho lymph node pericardial fistula in a patient with tuberculous lymphadenitis" }
[ { "companynumb": "KR-BAYER-2016-042986", "fulfillexpeditecriteria": "1", "occurcountry": "KR", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "CIPROFLOXACIN" }, "drugadditional": null, ...
{ "abstract": "Leucovorin calcium, 5-fluorouracil, and oxaliplatin (FOLFOX) therapy is a standard chemotherapy regimen used to treat colorectal cancer. Peripheral nerve disorder and myelosuppression are frequently reported treatment-related adverse events. With modified FOLFOX6 (mFOLFOX6) therapy, adverse events of an altered mental state with reversible posterior leukoencephalopathy and hypoammonemia have been reported, while lactic acidosis is uncommon. We describe a case of mFOLFOX6 - induced lactic acidosis in a 64-year-old man with colorectal cancer who underwent pelvic exenteration following chemotherapy. Postoperative histopathological analysis revealed residual cancer. Following the commencement of mFOLFOX6 therapy, the patient experienced emesis, hiccupping, and an altered mental state. Laboratory testing revealed only severe lactic acidosis, while diagnostic imaging was unrevealing. All symptoms quickly improved upon the administration of intravenous infusion of sodium bicarbonate.", "affiliations": "Dept. of Surgery, Fukuyama City Hospital.", "authors": "Ito|Atene|A|;Kawamoto|Kazuyuki|K|;Park|Taebun|T|;Ito|Tadashi|T|", "chemical_list": "D009944:Organoplatinum Compounds; D002955:Leucovorin; D005472:Fluorouracil", "country": "Japan", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0385-0684", "issue": "41(11)", "journal": "Gan to kagaku ryoho. Cancer & chemotherapy", "keywords": null, "medline_ta": "Gan To Kagaku Ryoho", "mesh_terms": "D000140:Acidosis, Lactic; D000971:Antineoplastic Combined Chemotherapy Protocols; D005472:Fluorouracil; D006801:Humans; D002955:Leucovorin; D008297:Male; D008875:Middle Aged; D009367:Neoplasm Staging; D009944:Organoplatinum Compounds; D012004:Rectal Neoplasms; D012811:Sigmoid Neoplasms", "nlm_unique_id": "7810034", "other_id": null, "pages": "1445-7", "pmc": null, "pmid": "25434453", "pubdate": "2014-11", "publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article", "references": null, "title": "A case of mFOLFOX6-induced lactic acidosis in a patient with colon cancer.", "title_normalized": "a case of mfolfox6 induced lactic acidosis in a patient with colon cancer" }
[ { "companynumb": "JP-BAUSCH-BL-2015-003736", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "FLUOROURACIL" }, "drugadditional": null, ...
{ "abstract": "A 53-year-old man who used growth hormone (GH), anabolic steroids and testosterone (T) for over 20 years presented with severe constipation and hypercalcaemia. He had benign prostatic hyperplasia and renal stones but no significant family history. Investigations showed - (1) corrected calcium (reference range) 3.66 mmol/L (2.2-2.6), phosphate 1.39 mmol/L (0.80-1.50), and PTH 2 pmol/L (1.6-7.2); (2) urea 21.9 mmol/L (2.5-7.8), creatinine 319 mmol/L (58-110), eGFR 18 mL/min (>90), and urine analysis (protein 4+, glucose 4+, red cells 2+); (3) creatine kinase 7952 U/L (40-320), positive anti Jo-1, and Ro-52 antibodies; (4) vitamin D 46 nmol/L (30-50), vitamin D3 29 pmol/L (55-139), vitamin A 4.65 mmol/L (1.10-2.60), and normal protein electrophoresis; (5) normal CT thorax, abdomen and pelvis and MRI of muscles showed 'inflammation', myositis and calcification; (6) biopsy of thigh muscles showed active myositis, chronic myopathic changes and mineral deposition and of the kidneys showed positive CD3 and CD45, focal segmental glomerulosclerosis and hypercalcaemic tubular changes; and (7) echocardiography showed left ventricular hypertrophy (likely medications and myositis contributing), aortic stenosis and an ejection fraction of 44%, and MRI confirmed these with possible right coronary artery disease. Hypercalcaemia was possibly multifactorial - (1) calcium release following myositis, rhabdomyolysis and acute kidney injury; (2) possible primary hyperparathyroidism (a low but detectable PTH); and (3) hypervitaminosis A. He was hydrated and given pamidronate, mycophenolate and prednisolone. Following initial biochemical and clinical improvement, he had multiple subsequent admissions for hypercalcaemia and renal deterioration. He continued taking GH and T despite counselling but died suddenly of a myocardial infarction.\nThe differential diagnosis of hypercalcaemia is sometimes a challenge. Diagnosis may require multidisciplinary expertise and multiple and invasive investigations. There may be several disparate causes for hypercalcaemia, although one usually predominates. Maintaining 'body image' even with the use of harmful drugs may be an overpowering emotion despite counselling about their dangers.", "affiliations": "Section of Endocrinology, YYF Hospital, Ystrad Fawr Way, Caerphilly, UK.;Section of Endocrinology, YYF Hospital, Ystrad Fawr Way, Caerphilly, UK.;Section of Endocrinology, YYF Hospital, Ystrad Fawr Way, Caerphilly, UK.;Section of Endocrinology, YYF Hospital, Ystrad Fawr Way, Caerphilly, UK.;Section of Endocrinology, YYF Hospital, Ystrad Fawr Way, Caerphilly, UK.", "authors": "Ravindran|Ravikumar|R|;Witczak|Justyna|J|;Bahl|Suhani|S|;Premawardhana|Lakdasa D K E|LDKE|0000-0003-0931-3700;Adlan|Mohamed|M|", "chemical_list": null, "country": "England", "delete": false, "doi": null, "fulltext": "\n==== Front\nEndocrinol Diabetes Metab Case Rep\nEndocrinol Diabetes Metab Case Rep\nEDM\nEndocrinology, Diabetes & Metabolism Case Reports\n2052-0573 Bioscientifica Ltd Bristol \n\n10.1530/EDM-20-0032\nEDM200032\nAdult\nMale\nWhite\nUnited Kingdom\nBone\nBone\nTestosterone\nGH\nPTH\nThyroxine (T4)\nTSH\nRhabdomyolysis\nHypercalcaemia\nMyositis\nHyperparathyroidism (primary)\nConstipation\nHypercalcaemia\nMyocardial infarction\nKidney stones\nEnlarged prostate\nGlomerulosclerosis*\nVentricular hypertrophy\nAortic stenosis*\nHypervitaminosis A*\nOedema\nFocal segmental glomerulosclerosis*\nProteinuria\nCalcium (serum)\nPhosphate (serum)\nCreatinine\nCreatine kinase\nEstimated glomerular filtration rate\nPTH\nUrea and electrolytes\nVitamin D\nVitamin A*\n25-hydroxyvitamin-D3\nMRI\nRenal biopsy\nMuscle biopsy*\nCD-3*\nCD-45*\nEchocardiogram\nEjection fraction*\nAlbumin\nFT4\nUltrasound scan\nHistopathology\nFluid repletion\nSteroids\nMycophenolate*\nPamidronate\nBisphosphonates\nPrednisolone\nGlucocorticoids\nLansoprazole*\nTamulosin*\nCinacalcet\nCalcimimetics\nBisoprolol*\nFurosemide\nNephrology\nUnique/Unexpected Symptoms or Presentations of a Disease\nUnique/Unexpected Symptoms or Presentations of a Disease\nMyositis, rhabdomyolysis and severe hypercalcaemia in a body builder\nR Ravindran and othersHypercalcaemiaRavindran Ravikumar 1 Witczak Justyna 1 Bahl Suhani 1 http://orcid.org/0000-0003-0931-3700Premawardhana Lakdasa D K E 12 Adlan Mohamed 1 1 Section of Endocrinology, YYF Hospital, Ystrad Fawr Way, Caerphilly, UK\n2 Centre for Endocrine and Diabetes Sciences, University Hospital of Wales, Cardiff, UK\nCorrespondence should be addressed to R Ravindran; Email: dr.ravimrcp@gmail.com\n05 7 2020 \n2020 \n2020 20-003231 5 2020 15 6 2020 © 2020 The authors2020The authors This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License..Summary\nA 53-year-old man who used growth hormone (GH), anabolic steroids and testosterone (T) for over 20 years presented with severe constipation and hypercalcaemia. He had benign prostatic hyperplasia and renal stones but no significant family history. Investigations showed – (1) corrected calcium (reference range) 3.66 mmol/L (2.2–2.6), phosphate 1.39 mmol/L (0.80–1.50), and PTH 2 pmol/L (1.6–7.2); (2) urea 21.9 mmol/L (2.5–7.8), creatinine 319 mmol/L (58–110), eGFR 18 mL/min (>90), and urine analysis (protein 4+, glucose 4+, red cells 2+); (3) creatine kinase 7952 U/L (40–320), positive anti Jo-1, and Ro-52 antibodies; (4) vitamin D 46 nmol/L (30–50), vitamin D3 29 pmol/L (55–139), vitamin A 4.65 mmol/L (1.10–2.60), and normal protein electrophoresis; (5) normal CT thorax, abdomen and pelvis and MRI of muscles showed ‘inflammation’, myositis and calcification; (6) biopsy of thigh muscles showed active myositis, chronic myopathic changes and mineral deposition and of the kidneys showed positive CD3 and CD45, focal segmental glomerulosclerosis and hypercalcaemic tubular changes; and (7) echocardiography showed left ventricular hypertrophy (likely medications and myositis contributing), aortic stenosis and an ejection fraction of 44%, and MRI confirmed these with possible right coronary artery disease. Hypercalcaemia was possibly multifactorial – (1) calcium release following myositis, rhabdomyolysis and acute kidney injury; (2) possible primary hyperparathyroidism (a low but detectable PTH); and (3) hypervitaminosis A. He was hydrated and given pamidronate, mycophenolate and prednisolone. Following initial biochemical and clinical improvement, he had multiple subsequent admissions for hypercalcaemia and renal deterioration. He continued taking GH and T despite counselling but died suddenly of a myocardial infarction.\n\nLearning points:\nThe differential diagnosis of hypercalcaemia is sometimes a challenge.\n\nDiagnosis may require multidisciplinary expertise and multiple and invasive investigations.\n\nThere may be several disparate causes for hypercalcaemia, although one usually predominates.\n\nMaintaining ‘body image’ even with the use of harmful drugs may be an overpowering emotion despite counselling about their dangers.\n\nPatient Demographics\nAdultMaleWhiteUnited KingdomClinical Overview\nBoneBoneTestosteroneGHPTHThyroxine (T4)TSHRhabdomyolysisHypercalcaemiaMyositisHyperparathyroidism (primary)Diagnosis and Treatment\nConstipationHypercalcaemiaMyocardial infarctionKidney stonesEnlarged prostateGlomerulosclerosis*Ventricular hypertrophyAortic stenosis*Hypervitaminosis A*OedemaFocal segmental glomerulosclerosis*ProteinuriaCalcium (serum)Phosphate (serum)CreatinineCreatine kinaseEstimated glomerular filtration ratePTHUrea and electrolytesVitamin DVitamin A*25-hydroxyvitamin-D3MRIRenal biopsyMuscle biopsy*CD-3*CD-45*EchocardiogramEjection fraction*AlbuminFT4Ultrasound scanHistopathologyFluid repletionSteroidsMycophenolate*PamidronateBisphosphonatesPrednisoloneGlucocorticoidsLansoprazole*Tamulosin*CinacalcetCalcimimeticsBisoprolol*FurosemideRelated Disciplines\nNephrologyPublication Details\nUnique/unexpected symptoms or presentations of a diseaseJuly2020\n==== Body\nBackground\nPrimary hyperparathyroidism, drugs and malignant disease are common causes of hypercalcaemia in secondary care. However, granulomatous disorders, immobility, familial hypocalciuric hypercalcaemia (FHH) and vitamin D excess are also responsible occasionally (1, 2, 3). Inflammatory myositis and rhabdomyolysis may occasionally cause hypercalcaemia severe enough to require treatment. In this situation, calcium phosphate complexes laid down during the oliguric phase of acute kidney injury (AKI) are thought to be released during the polyuric phase of AKI causing significant hypercalcaemia (4). Subjects who present with these and other rarer causes of hypercalcaemia, either alone or in combination, are often a diagnostic and management dilemma. Multiple, complicated and sometimes invasive investigations may need to be done in order to diagnose a cause for their hypercalcaemia and to direct therapy. Their management often requires multidisciplinary expertise.\n\nCase presentation\nA 53-year-old retired fire-fighter, who was an obsessive body builder, presented with severe constipation of many weeks’ duration. He had no osmotic symptoms, bone or muscle pains, and denied other symptoms. He volunteered no erectile dysfunction or loss of libido and passed normal quantities of urine without discoloration or symptoms of renal dysfunction. His appetite and weight were normal, and he took lansoprazole and tamsulosin only without over-the-counter medications. However, he admitted to the use of growth hormone (GH) 2 IU/day and testosterone (T) 350 mg/day on a ‘6-weeks on and 4-weeks off’ regime for over 20 years. He did not smoke or consume alcohol. There was no significant family history and he had no children of his own.\n\nOn examination, he appeared well, had mild ankle oedema, but no clubbing, jaundice or lymphadenopathy. He had hard globular masses under both axillae which were difficult to characterize. His limb girdle muscles were bulky, well developed and non-tender. Muscle power in all muscle groups was normal. Systems examination was unremarkable and, in particular, there were no skin abnormalities, hepatosplenomegaly or palpable abdominal masses.\n\nInvestigation\nInvestigations at presentation and subsequently showed the following –\n\nBiochemistry – (1) Corrected calcium 3.66 mmol/L (2.2–2.6), phosphate 1.39 mmol/L (0.8–1.5), PTH 2 mmol/L (1.6–7.2); (2) serum urea 21.9 mmol/L (2.5–7.8), serum creatinine 319 mmol/L (58–110), eGFR 18 mL/min (>90) (79 for about 5 years and 43 for about 4 years before admission); (3) urine protein 4+, protein:creatinine ratio 493 mg/mmol (normal <50) (previous 24 h-protein output – 6.54 g/24 h (<0.2)); serum albumin 29–33 g/L; (4) serum creatine kinase (CK) 7952 U/L (40–320); (5) free thyroxine 8.9 pmol/L (9–19.1), TSH 1.76 mU/L (0.3–4.4); (6) no abnormal bands on protein electrophoresis; (7) vitamin D 46 nmol/L (>30); 1,25 vitamin D3 29 pmol/L (55–139); Vitamin A 4.65 mol/L (1.1–2.6); (8) Angiotensin converting enzyme (ACE) 28 U/L (8–52).\n\nImaging – (1) ultrasound scans – kidneys, ureters and bladder showed no intrinsic abnormalities or obstructive uropathy and the thyroid and parathyroid glands were normal; (2) CT and MRI scans – thorax, abdomen and pelvis were normal without lymphadenopathy and whole body MRI scans showed muscle oedema and appearances of ‘myositis’ with areas of calcification and ossification within the muscle bellies of the upper and lower limbs (Figs 1 and 2); (3) echocardiography showed concentric left ventricular hypertrophy (LVH), moderate bicuspid aortic stenosis (AS) with a peak gradient of 39 mmHg and an ejection fraction (EF) of 44–53%; (6) cardiac MRI confirmed AS with severely impaired LV function. Slightly worse function inferiorly suggested right coronary artery disease. Appearances suggested that his medications and myositis contributed to LVH.\nFigure 1 MRI scans of thighs. Transverse views of MRI scans of both thighs. Solid white arrows indicate areas of calcification; solid black arrow indicates areas of myositis and oedema.\n\n\nFigure 2 MRI scans of thighs. Longitudinal views of MRI scans of both thighs. Solid white arrows indicate areas of calcification; solid black arrow indicates areas of myositis and oedema.\n\n\n\n\nAutoimmune antibodies – (1) Anti Jo-1 and anti Ro antibodies were positive; (2) However, other myositis specific and myositis associated antibodies (anti Mi 2a and 2b, SRP, EJ, OJ, PL7, PL 12, PMScl75 and PMScl100, Ro 52, SRP, Ku, SAE 1, NPX 2, MDA 5 and TIF-1g), and anti-dsDNA, ENA and ANCA were negative; (3) complement C3 and C4 were within the reference range; and (4) anti–liver, anti-GBM and anti-cardiolipin (IgM and IgG) antibodies were also negative.\n\nHistopathology – (1) thigh muscle biopsy (vastus medialis and lateralis) showed an active inflammatory myositis with chronic myopathic changes and mineral deposition. Sections were positive for markers of inflammation (CD3) and fiber formation (CD45) confirming an acute on chronic inflammatory process. Special stains and paraffin sections ruled out amyloid and vasculitis within the muscle. There were no visible granulomata. (2) kidney – most glomeruli were globally sclerosed and some glomeruli showed segmental sclerosis, there was moderate to severe tubular atrophy with interstitial fibrosis and a moderate chronic inflammatory infiltrate. The surviving proximal tubules showed mild dilatation consistent with hyperplasia and mild acute tubular injury with occasional foci of calcification. A diagnosis of focal segmental glomerulosclerosis (FSGS) was made with no specific features to determine the cause –- tubular interstitial changes were thought to be due to hypercalcemia.\n\nTreatment\nAt his first admission the following diagnoses were made – (1) likely non-PTH mediated severe hypercalcaemia likely due to acute myositis and rhabdomyolysis; (2) acute kidney injury (AKI) with significant proteinuria complicating chronic kidney disease. Subsequent investigations pointed to contributions to hypercalcaemia from (1) likely primary hyperparathyroidism and (2) hypervitaminosis A. Acute myositis and rhabdomyolysis were of unknown aetiology but likely iatrogenic, non-traumatic or idiopathic.\n\nHe was rapidly rehydrated with normal saline according to protocols for hypercalcaemia and AKI and i.v. pamidronate 60 mg was given. Subsequently, prednisolone (30 mg/day and reducing) and mycophenolate mofetil (500 mg increased to 1 g bd) were given for acute inflammatory myositis. A trial of cinacalcet was tried as it was felt that primary hyperparathyroidism could be contributing to his hypercalcaemia – his PTH was not completely supressed despite markedly raised calcium levels, that is, 2 mmol/L (1.6–7.2). The cinacalcet helped lower his calcium levels when he was compliant. He improved symptomatically and metabolically – serum calcium (2.39 mmol/L), eGFR (26) and CK (2505 U/L) in a few months. Despite counselling, he continued to take GH and T on a ‘6-weeks on/4-weeks off’ regime, as he considered these vital for maintaining his body image.\n\nOutcome and follow-up\nHis subsequent clinical course was punctuated by repeated admissions for hypercalcaemia and renal deterioration with partial and incomplete recovery on treatment (Table 1). He also presented with an episode of left ventricular failure and was given furosemide 40 mg and bisoprolol 1.25 mg. Subsequently, cinacalcet was commenced – 30 mg bd reduced to 30 mg/day. Mycophenolate was stopped due to intolerance and prednisolone was stopped by the patient without consultation. He continued also to be on tamsulosin for prostatic hypertrophy. Despite regular multidisciplinary review, he passed away suddenly. Post-mortem examination revealed myocardial infarction as the cause of death.\nTable 1 Biochemical indices during acute admissions.\n\nAdmission\teGFR\tCreatinine\tCK\tCalcium\t\n1\t19\t298\t7952\t3.66\t\n2\t11\t418\t4362\t3.34\t\n3\t16\t346\t\t3.44\t\n4\t15\t362\t5421\t3.10\t\n5\t13\t424\t1858\t2.88\t\nBiochemical indices during 5 acute admissions demonstrating gradual renal deterioration and improvement in hypercalcaemia and myositis.\n\n\n\nDiscussion\nWe have presented a 53-year-old amateur body builder on long-term intermittent GH and T self-medication, who presented with severe symptomatic hypercalcaemia complicating acute inflammatory myositis and rhabdomyolysis. He also had AKI (with chronic kidney disease) and significant proteinuria due to FSGS.\n\nWe encountered significant diagnostic and management challenges in dealing with him.\n\nthe cause for hypercalcaemia –\n\nat admission, a low PTH, severe hypercalcaemia, and phosphate within the reference range suggested possible non-PTH mediated hypercalcaemia (although AKI may have contributed to phosphate retention). The common causes for non-PTH mediated hypercalcaemia were ruled out – for example, normal ACE concentrations; CT/MRI scans did not show chest, abdominal or pelvic masses or lymphadenopathy; muscle biopsy did not show granulomata; Vit D3 level was low (29 nmol/L); absent hyperthyroidism; and normal protein electrophoresis (2). The low active vitamin D3 is likely related to both low 1 alpha hydroxylase activity secondary to his renal dysfunction and low vitamin D binding protein secondary to nephrotic syndrome. His normal vitamin D is difficult to explain, but an excessive and persistent exposure to sun may have had a part to play (he routinely wore short sleeved shirts and shorts). Hypervitaminosis A may have been responsible too.\n\nthe likely cause for non-PTH mediated hypercalcaemia in this subject was acute myositis and rhabdomyolysis. A combination of inflammatory myositis (confirmed by (1) high CK, (2) presence of anti Jo-1 and myositis associated antibodies, (3) diagnostic muscle histopathology with mineral deposition, (4) MRI scan appearances and (5) an excellent response to prednisolone), non-traumatic rhabdomyolysis (caused by high intensity exercise as part of his fitness regime), and his use of medications for ‘body building’ may have all contributed to rhabdomyolysis (4).\n\ndetectable (though low) PTH and hypercalcaemia also raises the possibility of a contribution from primary hyperparathyroidism. We were not able to obtain a Sestamibi scan although his neck ultrasound did not show any thyroid or parathyroid related abnormalities.\n\nraised serum vitamin A levels may also be relevant as a cause for his hypercalcaemia. Vitamin A stimulates osteoclastic resorption and/or inhibit osteoblastic formation (5).\n\nsubjects who inject paraffin oil intramuscularly to enhance muscle hypertrophy (’bulking’), as part of a body building regime, develop paraffin oil granulomata which may cause hypercalcaemia mediated by vitamin D3 as reported earlier. However, this subject’s vitamin D3 was not diagnostic and there was no muscle granulomata on histopathology.\n\nThe prevalence of hypercalcaemia in rhabdomyolysis is quoted to be between 9.2 and 34% (6, 7, 8). The variable prevalence is probably related to incomplete identification of these subjects due to the late occurrence of hypercalcaemia (often in the polyuric or recovery phase of AKI) and its mild, often asymptomatic nature. Phosphate retention and PTH resistance cause hypocalcaemia and calcium and phosphate complex deposition in the oliguric early phase of rhabdomyolysis and AKI. However, during the polyuric phase, these calcium and phosphate complexes in muscle are mobilized, causing hypercalcaemia. This subject had widespread radiologically visible (Fig. 1) and histologically proven deposits of calcium in his muscles and soft tissue. He also had continuing muscle damage and rhabdomyolysis causing many episodes of hypercalcaemia – no doubt with contributions from primary hyperparathyroidism, hypervitaminosis A and his continuous GH and T use.\n\nHe was given cinacalcet on which his calcium was well controlled during times when he was compliant (9).\n\nthe cause for renal dysfunction –\n\nThis subject had AKI at admission. But review of previous results indicated gradually declining renal function (eGFR of 79 and 43 mL/min several years before) and significant proteinuria for which no cause was obvious then. In the absence of radiological evidence of an obstructive uropathy (despite medication for benign prostatic symptoms), we felt a renal biopsy was indicated because of significant proteinuria and AKI. This showed FSGS without particular diagnostic features of an underlying cause. The tubular changes seen were consistent with hypercalcaemia (10). Furthermore, although the initial impression at admission was that increased serum creatinine was due to his large muscle mass (satisfactory eGFR confirmed by isotope GFR), subsequent measurements confirmed deterioration and he was being prepared for possible dialysis. Although toxins such as drugs may cause FSGS, we cannot identify a single cause as being responsible in this gentleman.\n\nthe role of hypercalcemia as a cause of constipation –\n\nThe mechanism for constipation in hypercalcaemia is not well understood. Calcium activates the endocellular contractile apparatus in striated muscles, but contraction in smooth muscles is dependent on the extra cellular concentrations of calcium as it has less endoplasmic reticulum than striated muscles. It is possible that raised serum calcium causes gut atony due to reduction in neuromuscular excitability (11). The presence of constipation is usually associated with higher serum calcium. The prevalence of constipation in hypercalcaemia was 61.5% with a serum calcium level of 2.87 mmol as was seen in a study done in Italy in 2012 (11).\n\nDeclaration of interest\nThe authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.\n\nFunding\nThis research did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector.\n\nPatient consent\nWritten informed consent was obtained from the patient/patient’s mother for publication of this case report.\n\nAuthor contribution statement\nAll authors were involved in the diagnosis and management of this subject, either as part of the direct care team or as part of the multidisciplinary team. R R, L D P and M A wrote this manuscript (with contributions from the rest), which was finally approved by all authors.\n==== Refs\nReferences\n1 Minisola S Pepe J Piemonte S Cipriani C \nThe diagnosis and management of hypercalcaemia\n.BMJ \n2015 \n350 \nh2723 (10.1136/bmj.h2723 )26037642 \n2 Coltzman D \nNonparathyroid hypercalemia\n. Frontiers of Hormone Research \n2019 \n51 \n77 –90\n. (10.1159/000491040 )30641526 \n3 Silva BC Cusano NE Bilezakian JP \nPrimary hyperparathyroidism\n. Best Practice and Research: Clinical Endocrinology and Metabolism \n2018 \n32 \n593 –607\n. (10.1016/j.beem.2018.09.004 )30449543 \n4 Marcinowska-Suchowierska E Kupisz-Urbańska M Łukaszkiewicz J Płudowski P Glenville Jones \nVitamin D toxicity: a clinical perspective\n. Frontiers in Endocrinology \n2018 \n9 \n550 (10.3389/fendo.2018.00550.2018 )30294301 \n5 Cetari F Saponaro F Borsari S Marccoci C \nFamilial and hereditary forms of primary hyperparathyroidism\n. Frontiers of Hormone Research \n2019 \n51 \n40 –51\n. (10.1159/000491037 )30641519 \n6 Gracia-Maldonado G Castro-García RJ \nEndocrinological disorders related to the medical use of lithium. A narative review\n. Revista Colombiana de Psiquiatria \n2019 \n48 \n35 –43\n. (10.1016/j.rcp.2017.01.003 )30651171 \n7 Mirza ZB Hu S Amorosa LF \nBone scintigraphy of severe hypercalcaemia following simvastatin induced rhabdomyolysis\n. Clinical Cases in Mineral and Bone Metabolism \n2016 \n13 \n257 –261\n. (10.11138/ccmbm/2016.13.3.257 )28228795 \n8 Wang FY NG CY Wu J Kuo KL Chang YY Kuo TT \nAcquired perforating calcific collagenosis in a drug addict with rhabdomyolysis and transient hypercalcaemia\n. Journal of Cutaneous Pathology \n2019 \n46 \n84 –87\n. (10.1111/cup.13371 )30311260 \n9 Boyce BF Fell GS Elder HY Junor BJ Elliot HL Beastall G Fogelman I Boyle IT \nHypercalcaemic osteomalacia due to aluminium toxicity\n. Lancet \n1982 \n2 \n1009 –1013\n. (10.1016/s0140-6736(82)90049-6 )6127501 \n10 Jose N Kurian GP \nSchimidt syndrome: an unusual cause of severe hypercalcemia\n. Journal of Clinical and Diagnostic Research \n2016 \n10 \nOD21-2 (10.7860/JCDR/2016/16770.7783 )\n11 Ragno A Pepe J Badiali D Minisola S Romagnoli E Severi C D’Erasmo E \nChronic constipation in hypercalcaemic patients with primary hyperparathyroidism\n. European Review for Medical and Pharmacological Sciences \n2012 \n16 \n884 –889\n.22953636\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2052-0573", "issue": "2020()", "journal": "Endocrinology, diabetes & metabolism case reports", "keywords": "2020; 25-hydroxyvitamin-D3; Adult; Albumin; Aortic stenosis*; Bisoprolol*; Bisphosphonates; Bone; CD-3*; CD-45*; Calcimimetics; Calcium (serum); Cinacalcet; Constipation; Creatine kinase; Creatinine; Echocardiogram; Ejection fraction*; Enlarged prostate; Estimated glomerular filtration rate; FT4; Fluid repletion; Focal segmental glomerulosclerosis*; Furosemide; GH; Glomerulosclerosis*; Glucocorticoids; Histopathology; Hypercalcaemia; Hyperparathyroidism (primary); Hypervitaminosis A*; July; Kidney stones; Lansoprazole*; MRI; Male; Muscle biopsy*; Mycophenolate*; Myocardial infarction; Myositis; Nephrology; Oedema; PTH; Pamidronate; Phosphate (serum); Prednisolone; Proteinuria; Renal biopsy; Rhabdomyolysis; Steroids; TSH; Tamulosin*; Testosterone; Thyroxine (T4); Ultrasound scan; Unique/unexpected symptoms or presentations of a disease; United Kingdom; Urea and electrolytes; Ventricular hypertrophy; Vitamin A*; Vitamin D; White", "medline_ta": "Endocrinol Diabetes Metab Case Rep", "mesh_terms": null, "nlm_unique_id": "101618943", "other_id": null, "pages": null, "pmc": null, "pmid": "32698126", "pubdate": "2020-07-05", "publication_types": "D016428:Journal Article", "references": "27437284;30651171;30641519;30294301;28228795;30311260;22953636;30641526;26037642;30449543;6127501", "title": "Myositis, rhabdomyolysis and severe hypercalcaemia in a body builder.", "title_normalized": "myositis rhabdomyolysis and severe hypercalcaemia in a body builder" }
[ { "companynumb": "GB-EMD SERONO-E2B_90079815", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "LANSOPRAZOLE" }, "drugadditional": null, ...
{ "abstract": "A 71-year-old man was admitted to our hospital because of diffuse chest pain and a mass on routine chest radiography. He did not report cough, dyspnea, fever, night sweats, or weight loss. His medical history was remarkable for chronic lymphocytic leukemia diagnosed 13 years before presentation, and secondary myelodysplastic syndrome diagnosed 2 years before the onset of the current symptoms. As a curative approach, he had received a matched unrelated stem cell transplantation 16 months earlier, and he had been in complete remission since. He developed chronic graft-vs-host disease, presenting mainly as oral ulceration (grade 1, according to National Institute of Health consensus criteria), which had been treated with oral cyclosporine and extracorporeal photopheresis. The immunosuppression had been tapered 6 months before presentation. Routine medication included co-trimoxazole prophylaxis twice per week. He had no known allergies, and he denied recent travels and sick contacts.", "affiliations": "Institute of Medical Microbiology and Hygiene, Saarland University, Homburg/Saar, Germany. Electronic address: cihan.papan@uks.eu.;Department of Thoracic and Cardiovascular Surgery, Saarland University, Homburg/Saar, Germany.;Department of Internal Medicine I, Saarland University, Homburg/Saar, Germany.;Department of Thoracic and Cardiovascular Surgery, Saarland University, Homburg/Saar, Germany.;Institute of Pathology Saarland University, Homburg/Saar, Germany.;Department of Diagnostic and Interventional Radiology, Saarland University, Homburg/Saar, Germany.;Institute of Medical Microbiology and Hygiene, Saarland University, Homburg/Saar, Germany.", "authors": "Papan|Cihan|C|;Langer|Frank|F|;Bittenbring|Jörg T|JT|;Schäfers|Hans-Joachim|HJ|;Bohle|Rainer M|RM|;Fries|Peter|P|;Becker|Sören L|SL|", "chemical_list": "D000935:Antifungal Agents", "country": "United States", "delete": false, "doi": "10.1016/j.chest.2020.02.083", "fulltext": null, "fulltext_license": null, "issn_linking": "0012-3692", "issue": "158(3)", "journal": "Chest", "keywords": null, "medline_ta": "Chest", "mesh_terms": "D000368:Aged; D000935:Antifungal Agents; D002637:Chest Pain; D003937:Diagnosis, Differential; D006801:Humans; D008172:Lung Diseases, Fungal; D008297:Male; D009091:Mucormycosis; D000082763:Rhizopus oryzae", "nlm_unique_id": "0231335", "other_id": null, "pages": "e123-e126", "pmc": null, "pmid": "32892888", "pubdate": "2020-09", "publication_types": "D002363:Case Reports", "references": null, "title": "A 71-Year-Old Man With Chest Pain and a Solitary Pulmonary Mass.", "title_normalized": "a 71 year old man with chest pain and a solitary pulmonary mass" }
[ { "companynumb": "DE-MALLINCKRODT-T202004468", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "METHOXSALEN" }, "drugadditional": "3", ...
{ "abstract": "OBJECTIVE\nThe German-speaking Myeloma Multicenter Group (GMMG) conducted this trial to investigate efficacy and safety of the three-drug combination bendamustine/prednisone/bortezomib (BPV) as first-line therapy for elderly patients with multiple myeloma (MM).\n\n\nMETHODS\nElderly MM patients requiring first-line therapy and not eligible for intensive treatment were enrolled in this phase IIb multicenter study. Patients were treated with BPV regimen for a maximum of nine cycles.\n\n\nRESULTS\nForty-six patients were included in the trial with a median age of 76 years. Nineteen patients had renal impairment at baseline. The ORR was 78.8% for patients treated with 3 and more BPV cycles and 71.1% for all evaluable patients. The median progression-free survival was 25 months, and overall survival at 24 months was 83.3%. The clinical benefit rate including MR was 91.2%. In patients with renal impairment at baseline, a renal response was observed in 11 pts. with complete recovery of the renal function in six patients. The most frequent CTC grade 3/4 AEs experienced by patients were hematological (17.5%) and infectious (9.8%) complications. No new safety signals were observed for the study drugs under investigation.\n\n\nCONCLUSIONS\nBendamustine/prednisone/bortezomib may serve as a first-line regimen for transplant-ineligible elderly MM patients in particular for patients with renal impairment requiring a fast and durable renal response.", "affiliations": "Centrum Haematologie & Onkologie Bethanien, Frankfurt, Germany.;Onkologische Schwerpunktpraxis, Darmstadt, Germany.;Hämatologisch-Onkologische Schwerpunktpraxis, Würzburg, Germany.;Onkologische Praxis, Aschaffenburg, Germany.;IQVIA, Frankfurt, Germany.;Department of Biostatistics, German Cancer Research Center, Heidelberg, Germany.;Koordinierungszentrum für klinische Studien Heidelberg, FRG, Heidelberg, Germany.;Department of Biostatistics, German Cancer Research Center, Heidelberg, Germany.;Department of Biostatistics, German Cancer Research Center, Heidelberg, Germany.;Department of Medicine V, University of Heidelberg, Heidelberg, Germany.;Department of Medicine V, University of Heidelberg, Heidelberg, Germany.", "authors": "Knauf|Wolfgang|W|;Dingeldein|Gerrit|G|;Schlag|Rudolf|R|;Welslau|Manfred|M|;Moehler|Thomas|T|https://orcid.org/0000-0003-1495-8917;Terzer|Tobias|T|;Walter|Sarah|S|;Habermehl|Christina|C|;Kunz|Christina|C|;Goldschmidt|Hartmut|H|;Raab|Marc-Steffen|MS|;|||", "chemical_list": "D014408:Biomarkers, Tumor; D000069286:Bortezomib; D000069461:Bendamustine Hydrochloride; D011241:Prednisone", "country": "England", "delete": false, "doi": "10.1111/ejh.13409", "fulltext": null, "fulltext_license": null, "issn_linking": "0902-4441", "issue": "105(2)", "journal": "European journal of haematology", "keywords": "clinical trials; multiple myeloma; non-Hodgkin's lymphoma; plasma cell neoplasms", "medline_ta": "Eur J Haematol", "mesh_terms": "D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D000069461:Bendamustine Hydrochloride; D014408:Biomarkers, Tumor; D000069286:Bortezomib; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D009101:Multiple Myeloma; D009367:Neoplasm Staging; D011241:Prednisone; D011379:Prognosis; D000077982:Progression-Free Survival; D051437:Renal Insufficiency; D016896:Treatment Outcome", "nlm_unique_id": "8703985", "other_id": null, "pages": "116-125", "pmc": null, "pmid": "32155662", "pubdate": "2020-08", "publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study", "references": null, "title": "First-line therapy with bendamustine/prednisone/bortezomib-A GMMG trial for non-transplant eligible symptomatic multiple myeloma patients.", "title_normalized": "first line therapy with bendamustine prednisone bortezomib a gmmg trial for non transplant eligible symptomatic multiple myeloma patients" }
[ { "companynumb": "NVSC2020DE151501", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": "2", "activesubstance": { "activesubstancename": "PREDNISONE" }, "drugadditional": null, "drug...
{ "abstract": "Currently the use of idarucizumab to reverse the effect of dabigatran emerges as a possibility of treatment for those patients who present with an ischemic stroke despite taking this anticoagulant. We present our experience regarding the use of intravenous tissue plasminogen activator in a patient with ischemic stroke due to complete occlusion of the left middle cerebral artery after blocking the effect of dabigatran with idarucizumab and whose result was an almost total improvement of the neurologic deficit. The use of this monoclonal antibody without a prothrombotic effect seems safe to be an intravenous fibrinolytic treatment option for patients taking dabigatran and having an ischemic stroke; however, more extensive studies are needed to determine its safety and efficacy.", "affiliations": "University Hospital of Guadalajara, Guadalajara, Spain. Electronic address: garinho29@icloud.com.;University Hospital of Guadalajara, Guadalajara, Spain.;University Hospital of Guadalajara, Guadalajara, Spain.;University Hospital of Guadalajara, Guadalajara, Spain.", "authors": "Alvarez Bravo|Gary|G|;Orts Castro|Emilio|E|;Carvalho Monteiro|Guilherme|G|;López Zuazo|Ignacio|I|", "chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D000925:Anticoagulants; D005343:Fibrinolytic Agents; C000594745:idarucizumab; D010959:Tissue Plasminogen Activator; D000069604:Dabigatran", "country": "United States", "delete": false, "doi": "10.1016/j.jstrokecerebrovasdis.2017.04.032", "fulltext": null, "fulltext_license": null, "issn_linking": "1052-3057", "issue": "26(9)", "journal": "Journal of stroke and cerebrovascular diseases : the official journal of National Stroke Association", "keywords": "Ischemic stroke; dabigatran; idarucizumab; intravenous tissue plasminogen activator", "medline_ta": "J Stroke Cerebrovasc Dis", "mesh_terms": "D061605:Administration, Intravenous; D000368:Aged; D061067:Antibodies, Monoclonal, Humanized; D000925:Anticoagulants; D001777:Blood Coagulation; D000069604:Dabigatran; D038524:Diffusion Magnetic Resonance Imaging; D005260:Female; D005343:Fibrinolytic Agents; D006801:Humans; D020244:Infarction, Middle Cerebral Artery; D015912:Thrombolytic Therapy; D010959:Tissue Plasminogen Activator; D014057:Tomography, X-Ray Computed; D016896:Treatment Outcome", "nlm_unique_id": "9111633", "other_id": null, "pages": "e192-e193", "pmc": null, "pmid": "28663010", "pubdate": "2017-09", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Intravenous Fibrinolysis in Ischemic Stroke of Large Vessel after Reversing Effect of Dabigatran with Idarucizumab.", "title_normalized": "intravenous fibrinolysis in ischemic stroke of large vessel after reversing effect of dabigatran with idarucizumab" }
[ { "companynumb": "ES-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2017-BI-038010", "fulfillexpeditecriteria": "1", "occurcountry": "ES", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "DABIGATRAN ETEXILATE MESYLATE" ...
{ "abstract": "Anticoagulation therapy after coronary stent implantation is necessary and crucial for patients with severe coronary heart disease. Submucosal bleeding of the colon is an infrequent complication of anticoagulants.\n\n\n\nTWe present the case of a 70-year-old woman with spontaneous submucosal hematoma and active bleeding of her sigmoid colon due to anticoagulants after intracoronary stenting.\n\n\n\nThis patient underwent a timely surgical operation. Treated by our experienced multidisciplinary team, her recovery was smooth without any other major complications.\n\n\n\nSurgical intervention is an appropriate therapy for patients with intractable bleeding.", "affiliations": "Department of General Surgery, the Fourth Affiliated Hospital, Zhejiang University School of Medicine, N1 Shangcheng Road, Yiwu, Zhejiang, 322000, China. 3307013@zju.edu.cn.;Department of General Surgery, the Fourth Affiliated Hospital, Zhejiang University School of Medicine, N1 Shangcheng Road, Yiwu, Zhejiang, 322000, China.;Department of General Surgery, the Fourth Affiliated Hospital, Zhejiang University School of Medicine, N1 Shangcheng Road, Yiwu, Zhejiang, 322000, China.", "authors": "Zhou|Huijiang|H|;Wang|Shuai|S|;Zhu|Lin|L|", "chemical_list": "D000925:Anticoagulants", "country": "United States", "delete": false, "doi": "10.1007/s11605-018-3732-y", "fulltext": null, "fulltext_license": null, "issn_linking": "1091-255X", "issue": "22(11)", "journal": "Journal of gastrointestinal surgery : official journal of the Society for Surgery of the Alimentary Tract", "keywords": "Anticoagulant; Intracoronary stenting; Sigmoid colon; Submucosal hematoma; Surgery", "medline_ta": "J Gastrointest Surg", "mesh_terms": "D000368:Aged; D000925:Anticoagulants; D003113:Colonoscopy; D003327:Coronary Disease; D005260:Female; D006471:Gastrointestinal Hemorrhage; D006406:Hematoma; D006801:Humans; D012810:Sigmoid Diseases; D015607:Stents; D014057:Tomography, X-Ray Computed", "nlm_unique_id": "9706084", "other_id": null, "pages": "1995-1997", "pmc": null, "pmid": "29532358", "pubdate": "2018-11", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "23323902;23333139;28296600", "title": "Submucosal Hematoma of the Sigmoid Colon as a Complication of Anticoagulation Treatment.", "title_normalized": "submucosal hematoma of the sigmoid colon as a complication of anticoagulation treatment" }
[ { "companynumb": "CN-SUN PHARMACEUTICAL INDUSTRIES LTD-2019R1-225620", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ASPIRIN" }, "drugadd...
{ "abstract": "OBJECTIVE\nThere is limited evidence to guide the management of patients with oligometastatic anal squamous cell carcinoma (SCC). We aimed to address this question by reporting the outcome of SCC patients who were treated with organ-directed therapies at two large cancer centers.\n\n\nMETHODS\nPatients with advanced anal SCC who were treated with surgery, stereotactic radiotherapy, or radiofrequency ablation (RFA) with a curative intent from 2008 to 2017 were retrospectively identified from the institutional electronic patient records.\n\n\nRESULTS\nEight patients with liver or lung metastases met the study inclusion criteria. Seven were treated with surgery while one received RFA and radiotherapy. Median progression-free survival was 5 months (range, 4-39). Three patients underwent repeat organ-directed treatment upon failure of the initial surgery with no evidence of further recurrent disease at the last follow-up. Median overall survival from the time of the first organ-directed therapy was 31 months (range, 11-96) with two out of eight patients being alive and disease-free at 5 years.\n\n\nCONCLUSIONS\nOur study confirms that consideration should be given to the adoption of a multidisciplinary treatment approach in carefully selected, oligometastatic anal SCC patients as organ-directed therapies may offer the chance of achieving a relatively long disease control.", "affiliations": "Department of Medicine, The Royal Marsden NHS Foundation Trust, London, Surrey, UK.;Department of Radiation Oncology, St. George Hospital, Sydney, New South Wales, Australia.;Faculty of Medicine, University of New South Wales, Sydney, New South Wales, Australia.;Faculty of Medicine, University of New South Wales, Sydney, New South Wales, Australia.;Faculty of Medicine, University of New South Wales, Sydney, New South Wales, Australia.;Department of Medicine, The Royal Marsden NHS Foundation Trust, London, Surrey, UK.;Faculty of Medicine, University of New South Wales, Sydney, New South Wales, Australia.", "authors": "Sclafani|Francesco|F|http://orcid.org/0000-0003-0251-2627;Hesselberg|Gina|G|;Thompson|Stephen R|SR|;Truskett|Philip|P|;Haghighi|Koroush|K|;Rao|Sheela|S|;Goldstein|David|D|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1002/jso.25320", "fulltext": null, "fulltext_license": null, "issn_linking": "0022-4790", "issue": "119(4)", "journal": "Journal of surgical oncology", "keywords": "anal cancer; multidisciplinary treatment; radiofrequency ablation; radiotherapy; surgery", "medline_ta": "J Surg Oncol", "mesh_terms": "D000328:Adult; D000368:Aged; D001005:Anus Neoplasms; D002294:Carcinoma, Squamous Cell; D003131:Combined Modality Therapy; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D012189:Retrospective Studies", "nlm_unique_id": "0222643", "other_id": null, "pages": "489-496", "pmc": null, "pmid": "30636052", "pubdate": "2019-03", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Multimodality treatment of oligometastatic anal squamous cell carcinoma: A case series and literature review.", "title_normalized": "multimodality treatment of oligometastatic anal squamous cell carcinoma a case series and literature review" }
[ { "companynumb": "GB-ACCORD-118934", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "CARBOPLATIN" }, "drugadditional": null, "dru...
{ "abstract": "Tanax(®) (T-61) is a euthanasia solution commonly used in veterinary medicine in Europe. It consists of three active components: embutramide, mebezonium iodide, and tetracaine hydrochloride. Human consumption of Tanax(®) (T-61) is usually associated with suicide attempts. In our 15-year-long practice, embutramide was detected only three times but within a short period. First, it was found in the urine of a 42-year-old veterinarian, and the other two observations were made in a 16-year-old young man. Urine samples were analyzed using Shimadzu Prominence TOX.I.S.II. HPLC-DAD system with online SPE extraction system. Both of the two patients denied any intention to die. These cases show that this veterinary drug may also be considered as potential drugs of abuse.", "affiliations": "Department of Laboratory Medicine, Medical School, University of Pécs, Ifjúság str. 13., Pécs, H-7624, Hungary.;Institute of Forensic Medicine, Medical School, University of Pécs, Szigeti str. 12., Pécs, H-7624, Hungary.;Department of Laboratory Medicine, Medical School, University of Pécs, Ifjúság str. 13., Pécs, H-7624, Hungary.;Institute of Forensic Medicine, Medical School, University of Pécs, Szigeti str. 12., Pécs, H-7624, Hungary.;Department of Laboratory Medicine, Medical School, University of Pécs, Ifjúság str. 13., Pécs, H-7624, Hungary.", "authors": "Lajtai|Anikó|A|;Mayer|Mátyás|M|;Lakatos|Ágnes|Á|;Porpáczy|Zoltán|Z|;Miseta|Attila|A|", "chemical_list": "D000577:Amides; D004338:Drug Combinations; D000644:Quaternary Ammonium Compounds; D013748:Tetracaine; C059324:embutramide; C015591:T 61; C005317:drotaverin; D010208:Papaverine; D000525:Alprazolam", "country": "United States", "delete": false, "doi": "10.1111/1556-4029.13010", "fulltext": null, "fulltext_license": null, "issn_linking": "0022-1198", "issue": "61(2)", "journal": "Journal of forensic sciences", "keywords": "Tanax®(T-61); clinical toxicology; drugs of abuse; embutramide; forensic science; forensic toxicology", "medline_ta": "J Forensic Sci", "mesh_terms": "D000293:Adolescent; D000328:Adult; D000525:Alprazolam; D000577:Amides; D004338:Drug Combinations; D006801:Humans; D008297:Male; D010208:Papaverine; D000644:Quaternary Ammonium Compounds; D019966:Substance-Related Disorders; D013748:Tetracaine", "nlm_unique_id": "0375370", "other_id": null, "pages": "573-575", "pmc": null, "pmid": "27404634", "pubdate": "2016-03", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Embutramide, a Component of Tanax(®) (T-61) as a New Drug of Abuse?", "title_normalized": "embutramide a component of tanax t 61 as a new drug of abuse" }
[ { "companynumb": "HU-SA-2017SA107759", "fulfillexpeditecriteria": "1", "occurcountry": "HU", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "LEVOCETIRIZINE" }, "drugadditional": null, ...
{ "abstract": "Chloramphenicol (CP) is recently one of the rarely-used antibiotics. In this study, we present four patients with intractable bacterial meningitis, who were successfully treated with CP and discuss the therapeutic indications of CP in these pediatric cases. The patients were diagnosed as bacterial meningitis at the ages ranging from 2 months to 1 year and 4 months. The causative organisms found in three of the patients were H. influenzae and in the fourth patient, S. pneumoniae. According to the microbial sensitivity tests, these organisms were highly sensitive to antibiotics including ceftriaxone, meropenem and/or panipenem/betamipron. Treatment with these antibiotics was initially effective; however, recurrences of meningitis appeared in all patients. Administration of CP (100 mg/kg/day) started between the 11th and the 58th days, and was continued for 9 days up to 19 days. Their fever had disappeared within four days after the administration of CP, and it was confirmed that all patients completely recovered from meningitis. Two of the patients developed a mild degree of anemia, but soon recovered after the discontinuation of CP. None of them had neurological sequela. We recommend CP as one of the choices for the treatment of intractable bacterial meningitis.", "affiliations": null, "authors": "Morita|Kayo|K|;Abe|Yu-ichi|Y|;Itano|Atsushi|A|;Musha|Ikuma|I|;Koga|Takeshi|T|;Yamazaki|Taro|T|;Yamanouchi|Hideo|H|", "chemical_list": "D000900:Anti-Bacterial Agents; D002701:Chloramphenicol", "country": "Japan", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0029-0831", "issue": "48(1)", "journal": "No to hattatsu = Brain and development", "keywords": null, "medline_ta": "No To Hattatsu", "mesh_terms": "D000900:Anti-Bacterial Agents; D002701:Chloramphenicol; D005260:Female; D005334:Fever; D006801:Humans; D007223:Infant; D008279:Magnetic Resonance Imaging; D008297:Male; D016920:Meningitis, Bacterial; D012008:Recurrence", "nlm_unique_id": "0215224", "other_id": null, "pages": "29-33", "pmc": null, "pmid": "27012107", "pubdate": "2016-01", "publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article", "references": null, "title": "Successful treatment with chloramphenicol in four pediatric cases of intractable bacterial meningitis.", "title_normalized": "successful treatment with chloramphenicol in four pediatric cases of intractable bacterial meningitis" }
[ { "companynumb": "JP-ROCHE-1891763", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CEFTRIAXONE" }, "drugadditional": "3", "drug...
{ "abstract": "Objective This case series aimed to identify the clinical and pathological characteristics of elderly patients (≥60 years) with biopsy-proven IgA vasculitis with nephritis (IgAVN). Methods The clinical and pathological presentation and treatment outcomes were compared between two groups. Patients Patients with IgAVN who were ≥19 years old at the time of their renal biopsy were divided into elderly (≥60 years) and adult (19-59 years) groups. Results Of the 23 patients in our study, 13 were elderly. In the elderly group, the median age at the diagnosis was 68 years (range, 60-85 years), with a median follow-up period of 15 months (range, 3-80 months). Twelve elderly patients had comorbidities, including hypertension, diabetes mellitus, chronic kidney disease, cardiovascular disease, and malignancies. A decrease in the estimated glomerular filtration rate, as well as massive proteinuria and rapidly progressive nephritic syndrome, were more frequent in the elderly group than in the adult group. Furthermore, renal pathological changes, including cellular or fibrocellular crescents, interstitial fibrosis, tubular atrophy, and arteriosclerosis, were more severe among elderly patients than adult patients. All elderly patients were treated with glucocorticoids and had no incidence of end-stage renal disease at the final follow-up; in addition, nine elderly patients had reduced proteinuria with a preserved renal function. Adverse events, including infection, diabetes mellitus, and vascular disorders, were identified in nine patients. Three elderly patients died from severe infections. Conclusion IgAVN in elderly patients is characterized by severe renal involvement. Elderly patients are at higher risk than adults for treatment-related adverse events.", "affiliations": "Division of Nephrology and Hypertension, Department of Internal Medicine, The Jikei University School of Medicine, Japan.;Division of Nephrology and Hypertension, Department of Internal Medicine, The Jikei University School of Medicine, Japan.;Division of Nephrology and Hypertension, Department of Internal Medicine, The Jikei University School of Medicine, Japan.;Division of Nephrology and Hypertension, Department of Internal Medicine, The Jikei University School of Medicine, Japan.;Division of Nephrology and Hypertension, Department of Internal Medicine, The Jikei University School of Medicine, Japan.;Department of Internal Medicine, Tokyo Saiseikai Central Hospital, Japan.;Division of Nephrology and Hypertension, Department of Internal Medicine, The Jikei University School of Medicine, Japan.;Division of Nephrology and Hypertension, Department of Internal Medicine, The Jikei University School of Medicine, Japan.;Department of Internal Medicine, Tokyo Saiseikai Central Hospital, Japan.;Division of Nephrology and Hypertension, Department of Internal Medicine, The Jikei University School of Medicine, Japan.", "authors": "Ueda|Hiroyuki|H|;Miyazaki|Yoichi|Y|;Tsuboi|Nobuo|N|;Hirano|Keita|K|;Yokote|Shinya|S|;Kobayashi|Emi|E|;Ogura|Makoto|M|;Kawamura|Tetsuya|T|;Ryuzaki|Munekazu|M|;Yokoo|Takashi|T|", "chemical_list": "D005938:Glucocorticoids; D007070:Immunoglobulin A", "country": "Japan", "delete": false, "doi": "10.2169/internalmedicine.1379-18", "fulltext": "\n==== Front\nIntern MedIntern. MedInternal Medicine0918-29181349-7235The Japanese Society of Internal Medicine 3010194210.2169/internalmedicine.1379-18Original ArticleClinical and Pathological Characteristics of Elderly Japanese Patients with IgA Vasculitis with Nephritis: A Case Series Ueda Hiroyuki 1Miyazaki Yoichi 1Tsuboi Nobuo 1Hirano Keita 1Yokote Shinya 1Kobayashi Emi 2Ogura Makoto 1Kawamura Tetsuya 1Ryuzaki Munekazu 2Yokoo Takashi 1\n1 Division of Nephrology and Hypertension, Department of Internal Medicine, The Jikei University School of Medicine, Japan\n2 Department of Internal Medicine, Tokyo Saiseikai Central Hospital, JapanCorrespondence to Dr. Hiroyuki Ueda, hi-ro@jikei.ac.jp\n\n10 8 2018 1 1 2019 58 1 31 38 14 4 2018 28 5 2018 Copyright © 2019 by The Japanese Society of Internal Medicine2019The Internal Medicine is an Open Access journal distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).Objective \nThis case series aimed to identify the clinical and pathological characteristics of elderly patients (≥60 years) with biopsy-proven IgA vasculitis with nephritis (IgAVN). \n\nMethods \nThe clinical and pathological presentation and treatment outcomes were compared between two groups. \n\nPatients \nPatients with IgAVN who were ≥19 years old at the time of their renal biopsy were divided into elderly (≥60 years) and adult (19-59 years) groups. \n\nResults \nOf the 23 patients in our study, 13 were elderly. In the elderly group, the median age at the diagnosis was 68 years (range, 60-85 years), with a median follow-up period of 15 months (range, 3-80 months). Twelve elderly patients had comorbidities, including hypertension, diabetes mellitus, chronic kidney disease, cardiovascular disease, and malignancies. A decrease in the estimated glomerular filtration rate, as well as massive proteinuria and rapidly progressive nephritic syndrome, were more frequent in the elderly group than in the adult group. Furthermore, renal pathological changes, including cellular or fibrocellular crescents, interstitial fibrosis, tubular atrophy, and arteriosclerosis, were more severe among elderly patients than adult patients. All elderly patients were treated with glucocorticoids and had no incidence of end-stage renal disease at the final follow-up; in addition, nine elderly patients had reduced proteinuria with a preserved renal function. Adverse events, including infection, diabetes mellitus, and vascular disorders, were identified in nine patients. Three elderly patients died from severe infections. \n\nConclusion \nIgAVN in elderly patients is characterized by severe renal involvement. Elderly patients are at higher risk than adults for treatment-related adverse events. \n\nadultselderlypurpuraHenoch-Schönleinglomerulonephritis\n==== Body\nIntroduction\nImmunoglobulin A vasculitis (IgAV), also known as Henoch-Schönlein purpura, is a leukocytoclastic vasculitis characterized by the deposition of IgA immune complexes in small vessels. Renal involvement is common in IgAVN, along with involvement of the skin, joints, and gastrointestinal system. IgAV primarily affects children and is less frequent in adults. The annual incidence of IgAV in children is estimated to be 14 cases per 100,000 (1), but it is only 1.3 per 100,000 in adults with a mean age of 50 years at initial presentation (2).\n\nAlthough IgAV with nephritis (IgAVN) has been extensively studied in children, its natural history in adults, especially elderly patients, is not fully understood because of its rarity. However, we do know that renal involvement occurs more frequently in adults (up to 45-85%) than in children (30-40%) (3,4). Furthermore, the risk of progression to renal insufficiency, which ranges from 5% (5,6) to 15% (7-9) in children, seems to be much higher in adults, at approximately 30% (0-50%) (4,10-12). The onset of IgAVN in patients over 50 years of age seems to be a strong predictor of severe renal failure (4,13). However, only a few reports have focused on the clinical and histological features of IgAVN in elderly patients (≥60 years of age), including their response to treatment.\n\nTherefore, our aim in this case series was to investigate the renal manifestations and pathological findings of biopsy-proven IgAVN in 13 elderly Japanese patients compared to those of adult patients (19-59 years of age) to clarify the clinical and histological characteristics of IgAVN among elderly individuals.\n\nMaterials and Methods\nPatients\nOf all of the patients who underwent renal biopsies between January 2002 and December 2012 at Jikei University Hospital and Tokyo Saiseikai Central Hospital, those older than 18 years of age at the time of the biopsy and diagnosed with IgAVN were enrolled in this study. The institutional ethics committees of both institutions approved this study. All procedures were performed in accordance with the Ethical Guidelines for Medical and Health Research Involving Human Subjects issued by the Ministry of Health, Labour and Welfare of Japan.\n\nThe diagnosis of IgAVN was made based on a modification of the European League Against Rheumatism/the Paediatric Rheumatology International Trials Organisation/the Paediatric Rheumatology European Society (EULAR/PRINTO/PRES) classification criteria: purpura or petechiae with lower limb predominance and unrelated thrombocytopenia and the presence of urinary abnormalities, renal failure, and predominant mesangial IgA deposits on a renal biopsy. All patients except three underwent a skin biopsy and were confirmed to have leukocytoclastic vasculitis with predominant IgA deposits. The three patients without a skin biopsy did not have pre-existing malignant disease. We excluded patients with primary and secondary IgA nephropathy. In addition, patients with other diseases associated with nephropathy and a purpuric rash, such as systemic lupus erythematosus or cryoglobulinemia, were excluded. The remaining 23 patients were included in our study. Based on their age at the time of the biopsy, the patients were classified into the elderly group (≥60 years of age) or the adult group (19-59 years of age).\n\nDefinitions and Measurements\nThe following clinical and pathological features were compared between the two groups: sex, mean arterial pressure, hypertension at the diagnosis, joint and gastrointestinal (GI) involvement, the estimated glomerular filtration rate (eGFR), urinary protein excretion, a clinical diagnosis of renal involvement, global sclerosis, cellular or fibrocellular crescents, interstitial fibrosis and tubular atrophy (IF/TA), arteriosclerosis, prevalence of steroid treatment, and treatment outcomes. The eGFR was calculated using the modified three-variable equation previously reported for estimating the GFR in the Japanese population (14): eGFR=194×age-0.287×sCr-1.094×0.739 (if female), where sCr is the serum creatinine level. A clinical diagnosis of renal involvement was based on the modified classification of the World Health Organization (WHO) and included chronic nephritic syndrome, acute nephritic syndrome, recurrent or persistent hematuria, and rapidly progressive nephritic syndrome (15,16).\n\nThe following renal pathologies were evaluated: glomeruli with global sclerosis, cellular/fibrocellular crescents, and endocapillary hypercellularity were reported as the percentage of affected glomeruli over all glomeruli in the biopsy specimen. The IF/TA was expressed as the area occupied by the fibrosed interstitium and the atrophied tubules over the entire tubulointerstitial area in the biopsy specimen (17). Arteriosclerosis was graded from 0-2, as described in a previous report (18), with 0 indicating no intimal thickening, 1 indicating a thickening of the intima that was less than the thickness of the media, and 2 indicating a thickening of the intima that was the same as or greater than the thickness of the media.\n\nThe treatment protocols were determined by the attending physicians in accordance with the disease activity and severity. The following treatments and outcomes were evaluated: the prevalence of glucocorticoid or other immunosuppressant therapy, the prevalence of end-stage kidney disease, the prevalence of a decrease in eGFR ≥30% of the baseline value at the time of the diagnosis, the prevalence of a urinary protein excretion level <0.3 or <1.0 g/gCr at the last visit, the prevalence of adverse events during the course of treatment, and treatment-related adverse events and death.\n\nStatistical analyses\nThe Wilcoxon-Mann-Whitney two-sample rank-sum test was used to compare continuous variables between the two groups, while Fisher’s exact test was used to compare ordinal variables. Continuous variables were expressed as the median and the range or interquartile range. All statistical analyses were performed using EZR, which is a graphical user interface for R (19). A p value <0.05 was considered to be statistically significant.\n\nResults\nClinical and pathological characteristics of the elderly group\nThe elderly group included 8 men and 5 women with a median age of 68 years (range, 60-85 years) (Table 1). Of these, 12 patients had ≥1 comorbidity prior to the time of the renal biopsy: 9 had hypertension; 4 had diabetes mellitus; 4 had chronic kidney disease (CKD); 6 had cardiovascular diseases (coronary artery diseases and chronic atrial fibrillation); and 3 had malignant diseases (nasal squamous cell carcinoma, colon cancer, and acute myeloid leukemia). Two patients (cases 8 and 13) developed IgAVN during the course of treatment for a malignancy. Most patients in the elderly group presented with purpura as the first clinical manifestation of IgAVN, except for one patient (case 11) who presented with joint involvement. Four patients had GI involvement. The median eGFR was 36 mL/min/1.73 m2 (range, 17-87), with a median urinary protein excretion of 6.0 g/gCr (range, 0.8-10.5). Five of the 13 patients presented with a rapidly progressive nephritic syndrome. Regarding renal pathologies, all elderly patients had cellular or fibrocellular crescents and endocapillary hypercellularity to varying degrees, in addition to chronic lesions, such as global sclerosis, IT/FA, and arteriosclerosis (Table 2).\n\nTable 1. Clinical Characteristics of Elderly Patients with IgAVN at the Time of Renal Biopsy.\n\n\tAge (years)\tSex\tComorbidity\tExtra-renal involvement\teGFR (mL/min/1.73 m2)\tUPE (g/gCr)\tClinical diagnosis\t\nHTN\tDM\tCKD\tCVD\tMD\tJoints\tGI\t\nCase 1\t85\tF\t+\t+\t+\t+†\t-\t-\t+\t40\t4.3\tNS\t\nCase 2\t80\tF\t+\t-\t-\t-\t-\t-\t+\t66\t0.8\tCNS\t\nCase 3\t76\tF\t-\t-\t-\t-\t-\t-\t-\t72\t1.3\tCNS\t\nCase 4\t75\tF\t+\t-\t-\t+‡\t-\t-\t+\t17\t6.0\tRPNS\t\nCase 5\t71\tM\t+\t-\t-\t+§\t-\t-\t-\t47\t1.8\tCNS\t\nCase 6\t69\tM\t-\t+\t+\t-\t-\t-\t-\t38\t1.2\tCNS\t\nCase 7\t68\tF\t-\t-\t-\t-\t-\t-\t-\t63\t7.0\tANS\t\nCase 8\t63\tM\t+\t-\t-\t+†\t+††\t-\t-\t41\t7.2\tRPNS, NS\t\nCase 9\t63\tM\t+\t-\t-\t-\t-\t-\t-\t87\t4.4\tCNS\t\nCase 10\t62\tM\t+\t+\t+\t+†, §\t-\t-\t-\t29\t6.3\tRPNS, NS\t\nCase 11\t61\tM\t-\t-\t-\t+§, ¶\t+‡‡\t+\t+\t49\t9.8\tRPNS, NS\t\nCase 12\t61\tM\t+\t+\t+\t-\t-\t-\t-\t28\t10.5\tRPNS, NS\t\nCase 13\t60\tM\t+\t-\t-\t-\t+§§\t-\t-\t56\t7.4\tANS, NS\t\nThe median values or the totals¶¶\t68\tM/F 8/5\t9\t4\t4\t6\t3\t1\t4\t36\t6.0\tNS/CNS/RPNS/ANS 6/5/5/2\t\n†Coronary artery diseases, ‡Arterio-venous block, §Chronic atrial fibrillation, ¶Rheumatic mitral steno-insufficiency, ††Nasal squamous cell carcinoma, ‡‡Colon cancer, §§Acute myeloid leukemia, ¶¶Sex, comorbidity and clinical diagnosis are expressed as the totals.\n\nF: female, M: male, HTN: hypertension, DM: type 2 diabetes mellitus, CKD: chronic kidney disease, CVD: cardiovascular disease, MD: malignant disease, GI: gastrointestinal tract, eGFR: estimated glomerular filtration rate, UPE: urinary protein excretion, NS: nephrotic syndrome, CNS: chronic nephritic syndrome, RPNS: rapidly progressive nephritic syndrome, ANS: acute nephritic syndrome, IgAVN: IgA vasculitis with nephritis\n\nTable 2. The Severity of Renal Pathology Findings among Elderly Patients with IgAVN.\n\n\t\tGlobal sclerosis \n(%)†\t\tCellular or fibrocellular crescents \n(%)†\t\tEndocapillary hypercellularity \n(%)†\t\tIF/TA \n(%)‡\t\tArteriosclerosis \n(score 0-2)\t\nCase 1\t\t0\t\t100\t\t100\t\t20\t\t2\t\nCase 2\t\t10\t\t10\t\t10\t\t5\t\t2\t\nCase 3\t\t10\t\t20\t\t10\t\t20\t\t2\t\nCase 4\t\t10\t\t70\t\t50\t\t20\t\t1\t\nCase 5\t\t10\t\t10\t\t30\t\t5\t\t0\t\nCase 6\t\t20\t\t10\t\t10\t\t20\t\t1\t\nCase 7\t\t10\t\t10\t\t20\t\t10\t\t1\t\nCase 8\t\t10\t\t40\t\t60\t\t10\t\t2\t\nCase 9\t\t10\t\t30\t\t30\t\t5\t\t2\t\nCase 10\t\t20\t\t30\t\t30\t\t50\t\t0\t\nCase 11\t\t0\t\t20\t\t20\t\t10\t\t1\t\nCase 12\t\t80\t\t20\t\t20\t\t50\t\t2\t\nCase 13\t\t0\t\t20\t\t20\t\t30\t\t2\t\nMedian values\t\t10\t\t20\t\t20\t\t20\t\t2\t\n†Percentage of glomeruli affected, ‡Percentage of the tubulointerstitial area occupied with interstitial fibrosis or tubular atrophy.\n\nIF/TA: interstitial fibrosis and tubular atrophy, IgAVN: IgA vasculitis with nephritis\n\nA between-group comparison of clinical and pathological manifestations\nTo clarify the clinical and pathological features of elderly patients at the time of the renal biopsy, we compared the clinical and laboratory variables between the two groups (Table 3). The median age of the adult group was 31 years (range, 19-59). The mean arterial pressure was comparable between the 2 groups (p=0.40), whereas the prevalence of hypertension was significantly higher among elderly patients than among adult patients (69% vs. 0%, p=0.0016). Joint and GI involvement was comparable between the two groups (p=0.28 and 1.0, respectively). The eGFR at the time of the renal biopsy was lower in the elderly group than in the adult group (36 vs. 51 mL/min/1.73 m2, p=0.042). The prevalence of high proteinuria (>3.0 g/gCr) and rapidly progressive nephritic syndrome was greater among elderly patients than among adult patients (69% vs. 20%, p=0.036; and 38% vs. 0%, p=0.045, respectively). Furthermore, pathological findings were more frequently observed among elderly patients than among adult patients, including cellular or fibrocellular crescents (20% vs. 5%, p=0.008), IT/FA (20% versus 5%, p=0.012), and arteriosclerosis (score 2 vs. 0, p<0.001).\n\nTable 3. Comparison of Clinical and Pathological Manifestations between Elderly and Adult Patients with IgAVN.\n\n\t\tElderly patients \n≥60 years (n=13)\t\tAdult patients \n19-59 years (n=10)\t\tp values†\t\nAge, years\t\t68 [62, 75]\t\t31 [23, 42]\t\t\t\nMale sex, % (n)\t\t62 (8)\t\t80 (8)\t\t0.40\t\nMAP, mmHg\t\t95 [93, 110]\t\t91 [86, 101]\t\t0.27\t\nHTN, % (n)\t\t69 (9)\t\t0 (0)\t\t0.0016*\t\nJoint involvement, % (n)\t\t7 (1)\t\t30 (3)\t\t0.28\t\nGI involvement, % (n)\t\t30 (4)\t\t30 (3)\t\t1.0\t\neGFR, mL/min/1.73 m2\t\t36 [28, 63]\t\t51 [47, 64]\t\t0.042*\t\nUPE, g/gCr\t\t6.0 [1.8, 7.2]\t\t2.0 [1.0, 2.7]\t\t0.062\t\nUPE ≥3.0 g/gCr\t\t69 (9)\t\t20 (2)\t\t0.036*\t\nRPNS, % (n)\t\t38 (5)\t\t0 (0)\t\t0.045*\t\nNephrotic syndrome, % (n)\t\t46 (6)\t\t10 (1)\t\t0.088\t\n\t\t\t\t\t\t\t\nPathological findings\t\t\t\t\nGlobal sclerosis, %\t\t10 [10, 10]\t\t5 [0, 10]\t\t0.37\t\nCellular or fibrocellular crescents, %\t\t20 [10, 30]\t\t5 [0, 10]\t\t0.008*\t\nInterstitial fibrosis and tubular atrophy, %\t\t20 [10, 20]\t\t5 [5, 10]\t\t0.012*\t\nArteriosclerosis (score 0 to 2)\t\t2 [1, 2]\t\t0\t\t<0.001*\t\n\t\t\t\t\t\t\t\nTreatment and outcomes\t\t\t\t\t\t\t\nDuration of follow-up, mo\t\t16 [9, 45]\t\t28 [24, 57]\t\t0.21\t\nSteroid treatment, % (n)\t\t100 (13)\t\t70 (7)\t\t0.067\t\nESKD\t\t0 (0)\t\t0 (0)\t\t-\t\n≥30% decrease in eGFR, % (n)\t\t30 (4)\t\t10 (1)\t\t0.33\t\nUPE <1.0 g/gCr at the last visits, % (n)\t\t61 (8)\t\t100 (10)\t\t0.045*\t\nUPE <0.3 g/gCr at the last visits, % (n)\t\t46 (6)\t\t60 (6)\t\t0.68\t\nAdverse events during treatment curses, % (n)\t\t69 (9)\t\t10 (1)\t\t0.009*\t\nTreatment-related adverse events‡, % (n)\t\t46 (6)\t\t0 (0)\t\t0.019*\t\nDeath, % (n)\t\t23 (3)\t\t0 (0)\t\t0.22\t\nn represents the number of patients. Other values are expressed as the median values with interquartile range [IQR].\n\n†p<0.05 was defined as statistically significant. Wilcoxon-Mann-Whitney two-sample rank-sum test or Fisher’s exact test was used. ‡Treatment-related adverse events refer to infectious disease and steroid-induced diabetes mellitus. *statistically significant.\n\nMAP: mean arterial pressure, HTN: hypertension, GI gastrointestinal, UPE: urinary protein excretion, RPNS: rapidly progressive nephritic syndrome, ESKD: end-stage kidney disease, IgAVN: IgA vasculitis with nephritis, eGFR: estimated glomerular filtration rate\n\nTreatments and outcomes for the elderly group\nThe median follow-up period was 15 months (range, 3-80) (Table 4). All elderly patients were treated with corticosteroids, and no other immunosuppressive agents were used. At the end of the follow-up period, none of the patients were on dialysis, although two patients temporarily required dialysis during the course of their treatment (cases 10 and 12). These two patients had overt diabetic nephropathy before the onset of nephritis. A deterioration in the renal function (eGFR reduction rate ≥30% from baseline) was identified in 4 patients (case 1, 3, 10, and 12). Of these patients, three had pre-existing diabetes mellitus and CKD. Furthermore, these patients showed more severe IT/FA with a higher prevalence of persistent proteinuria (>1.0 g/gCr) at the final follow-up visit than the other 9 elderly patients with a preserved renal function. These 9 patients had a urinary protein excretion level <1.0 g/gCr, while the other 7 had a urinary protein excretion level <0.3 g/gCr. The rate of patients who achieved a protein excretion level of <0.3 g/gCr was not significantly different between the elderly and the adult groups (Table 3).\n\nTable 4. Treatments and Outcomes for Elderly Patients with IgAVN.\n\n\t\tTreatments\t\tInitial dose of PSL \n(mg/kg)\t\tDuration of follow-up \n(mo)\t\t% decrease in eGFR at the last visits \n(%)‡\t\tUPE at the last visits \n(g/gCr)\t\tAdverse events during treatment courses\t\nCase 1\t\tOS\t\t0.7\t\t8\t\t40\t\t1.8\t\tCMVI, pneumonia, sepsis, death\t\nCase 2\t\tOS\t\t0.7\t\t6\t\t0\t\t<0.3\t\tnone\t\nCase 3\t\tSP†+OS\t\t0.6\t\t20\t\t30\t\t3.8\t\tDM, HTN, DL\t\nCase 4\t\tSP†+OS\t\t0.7\t\t64\t\t0\t\t<0.3\t\tDM\t\nCase 5\t\tOS\t\t0.3\t\t55\t\t10\t\t<0.3\t\tPAD\t\nCase 6\t\tSP†+OS\t\t0.5\t\t8\t\t0\t\t<0.3\t\tnone\t\nCase 7\t\tOS\t\t0.6\t\t80\t\t20\t\t<0.3\t\tnone\t\nCase 8\t\tOS\t\t0.5\t\t20\t\t0\t\t0.9\t\tCI, DVT\t\nCase 9\t\tOS\t\t0.6\t\t45\t\t10\t\t<0.3\t\tDM, malignant mesothelioma\t\nCase 10\t\tOS\t\t0.4\t\t10\t\t60\t\t10.7\t\tpneumonia, death\t\nCase 11\t\tSP†+OS\t\t0.7\t\t9\t\t20\t\t0.4\t\tUTI, IE, sepsis, death\t\nCase 12\t\tOS\t\t0.4\t\t3\t\t30\t\t4.6\t\tduodenal perforation\t\nCase 13\t\tOS\t\t0.6\t\t15\t\t10\t\t<0.3\t\tnone\t\nMedian values or totals§\t\tSP+OS/OS 4/9\t\t0.6\t\t15\t\t10\t\t0.3\t\tinfectious diseases¶/DM/vascular disorders††/death 3/2/2/3\t\n†Intravenous administrations of 0.5 g of methylprednisolone for 3 consecutive days. ‡The percentage decrease in eGFR from that at renal biopsy. §Treatments and adverse events during treatment courses are expressed as the total. ¶Infectious diseases refer to CMVI, pneumonia, sepsis, and UTI. ††Vascular disorders refer to PAD, CI, and DVT.\n\nOS: oral steroid therapy with prednisolone, SP: steroid pulse therapy, PSL: prednisolone, eGFR: estimated glomerular filtration rate, UPE: urinary protein excretion, CMVI: cytomegalovirus infection, DM: steroid-induced diabetes mellitus, HTN: hypertension, DL: dyslipidemia, PAD: peripheral artery disease, CI: cerebral infarction, DVT: deep venous thrombosis, UTI: urinary tract infection, IE: Infections endocarditis, IgAVN: IgA vasculitis with nephritis\n\nNine elderly patients experienced adverse events during the follow-up period: three developed an infection, two developed steroid-induced diabetes mellitus, one developed malignant mesothelioma, one developed duodenal perforation, and two developed vascular disorders (peripheral artery disease, cerebral infarction, or deep venous thrombosis). In addition, three elderly patients died from severe infections, including pneumonia, sepsis, urinary tract infection, and infectious endocarditis. Infections and the development of diabetes mellitus were considered to be treatment-related adverse events. These adverse events were observed more often in the elderly group than in the adult group (Table 3).\n\nDiscussion\nThe prevalence of IgAVN varies with age. The patients involved in our study showed a bimodal distribution of the age at the diagnosis of IgAVN, with peaks at 20-29 and 60-69 years. Thus, in our study, we classified patients with IgAVN into two groups, based on the age at the diagnosis: elderly patients ≥60 years of age and adult patients 19-59 years of age. The age distribution was similar to that of patients registered for the Japan Renal Biopsy Registry (J-RBR), with peaks at 30-39 and 60-69 years (20). A decline in the eGFR, massive proteinuria, and rapidly progressive nephritic syndrome were observed more often in the elderly group than in the adult group. Although the differences in proteinuria were not statistically significant, this may simply be because of the small sample size. These clinical manifestations among elderly patients in our study group were similar to those reported in the J-RBR database (Table 5). Most elderly patients in our study had various types of pre-existing comorbidities at the time of the diagnosis, including hypertension, type 2 diabetes mellitus, cardiovascular disease, and malignant diseases (nasal squamous cell carcinoma, colon cancer, and acute myeloid leukemia) while the J-RBR database reported on hypertension alone. A higher incidence of hypertension among elderly patients than among adult patients has previously been reported (4,13,20). Although the relationship between IgAVN and malignant diseases is unclear, several reports have suggested an association between malignancy and IgAV (21-23). Mitsui et al. identified an underlying malignancy in 23 of 53 (43.4%) patients over 40 years of age who had a diagnosis of IgAV (21). In their report, lung cancer and hematological diseases were the most common malignancies. Another study reported lung (14%) and upper respiratory and digestive tract (8%) malignancies to be the leading cause of mortality among adults with IgAVN (4).\n\nTable 5. Comparison of Clinical Manifestations at the Time of Diagnosis between the Elderly and Adult Patients with IgAVN in Our Study and Those in the J-RBR Database.\n\n\t\tOur cases\t\tJ-RBR database20\t\nElderly† (n=13)\t\tAdult‡ (n=10)\tElderly§ (n=96)\t\tAdult¶ (n=259)\t\nAge (years), median [IQR]\t\t68 [62, 75]\t\t31 [23, 42]\t\t72 [68, 76]\t\t43 [30, 59]\t\nSex, male/female\t\t8/5††\t\t8/2††\t\t49/47††\t\t119/140††\t\nHypertension, % (n)\t\t69.2 (9)\t\t0 (0)\t\t67.7 (65)\t\t41.3 (107)\t\nRapidly progressive nephritic syndrome, % (n)\t\t38 (5)\t\t0 (0)\t\t13.5 (13)\t\t3.4 (9)\t\nNephrotic syndrome, % (n)\t\t46 (6)††\t\t10 (1)††\t\t18.8 (18)\t\t10.8 (28)\t\nEstimated GFR, mL/min/1.73 m2‡‡\t\t41.2±19.1\t\t60.4±22.4\t\t45.4±24.3\t\t74.2±28.6\t\nProteinuria (g/gCr)‡‡\t\t5.23±3.24††\t\t2.46±2.51††\t\t4.08±3.64\t\t2.53±2.84\t\n†≥60 years of age. ‡Between 19 and 59 years of age. §≥65 years of age. ¶Between the ages of 19 and 64 years. ††Not statistically significant. ‡‡Mean±standard deviation (SD).\n\nIgAVN: IgA vasculitis with nephritis, IQR: interquartile range, J-RBR: Japan renal biopsy registry\n\nThe renal biopsy findings in our case series revealed cellular and fibrocellular crescents, IF/TA, and arteriosclerosis to be more severe in elderly patients than in adult patients. A French group further reported a higher incidence of glomerular fibrinoid necrosis among patients over 60 years of age compared to that in patients under 30 years of age. According to the J-RBR database, endocapillary proliferative glomerulonephritis and crescentic/necrotizing glomerulonephritis were more common pathological diagnoses in elderly patients than in adult patients; however, those authors did not investigate the severity of the histological findings as we did in our study. Similar to the findings of the J-RBR, all elderly patients in our study had endocapillary hypercellularity of varying degrees, although the involvement was not significantly different between the elderly group and the adult group. Of note, elderly patients presented with more severe renal pathological changes than adult patients, including not only chronic lesions, such as IF/TA and arteriosclerosis, but also acute lesions, such as fibrinoid necrosis, cellular or fibrocellular crescents, and endocapillary hypercellularity. Although the underlying mechanisms remain unclear, one possible explanation might be an age-related decrease in the clearance of immune complexes from the glomeruli (24,25).\n\nMost patients in our study group received glucocorticoid therapy and achieved improvements in the renal function, including a reduction in urinary protein excretion and maintenance of a sufficient eGFR. However, in patients with pre-existing diabetes mellitus and CKD, more severe IT/FA lesions and persistent proteinuria resulted in a decline in the renal function.\n\nThere are no widely accepted treatment regimens for adult patients with IgAVN, especially elderly patients. Recently, a French multicenter cohort study reported that corticosteroid therapy as a single therapeutic agent was a reasonable first-line therapy for adult patients with IgAV (26). However, the study was not designed for elderly patients, and it did not assess the efficacy and safety of treatments in this age group. In our study, 9 of 13 elderly patients experienced adverse events during the course of their treatment, including infections, steroid-induced diabetes mellitus, hypertension, dyslipidemia, vascular disorders (e.g., peripheral artery disease, cerebral infarction, deep venous thrombosis), malignant mesothelioma, and duodenal perforation. Three patients died from severe infections, which we deemed to be partly associated with treatment. Similar findings were reported in studies evaluating adults with anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV) (27-29). AAV often occurs in older patients (>65 years of age), with the prognosis being worse in older patients than in younger ones due to a greater involvement of the kidneys and greater prevalence of adverse events secondary to treatment (29). According to a Japanese nationwide early survey of AAV/rapidly progressive glomerulonephritis (RPGN), Japanese patients developed AAV at an older age than did patients from other countries, with a lower survival rate partly because of opportunistic infections (28). In addition, treatment using a high dose of oral prednisolone (≥0.8 mg/kg/day) has been associated with a lower survival rate among patients with AAV/RPGN, whereas the initial prednisolone dosage did not affect the renal survival. Therefore, the treatment guidelines for Japanese patients with AAV/RPGN recommend the use of a reduced initial dose of prednisolone, with or without immunosuppressants, for elderly patients (>70 years old).\n\nNone of our patients received an initial high dose of oral prednisolone or immunosuppressants. In the prospective cohort of the “Japanese patients with myeloperoxidase (MPO)-ANCA-associated vasculitis” (JMAAV) study, the total amount of glucocorticoid used was associated with several glucocorticoid-associated adverse events, including infections, diabetes mellitus, and bone fractures (27). A review of our three cases that died suggested that their underlying disease conditions likely influenced their poor prognoses in addition to the initial and total dose of glucocorticoid used and their age at the diagnosis. Cases 1 and 10 had a longstanding history of poorly controlled type 2 diabetes mellitus and pre-existing CKD. The cumulative doses of glucocorticoid administered in these patients were comparable to those for other elderly patients without severe infections (data not shown). While case 11 received a higher dose of glucocorticoid therapy than other elderly patients, he had an untreated rheumatic mitral steno-insufficiency and ultimately died of uncontrollable infectious endocarditis originating from a urinary tract infection. Taken together, these findings suggest that further titration of glucocorticoid regimens should be considered for elderly patients, especially those with these underlying disease conditions.\n\nThere are some limitations to our study that need to be noted. First, as the number of patients was limited, there is a possibility of selection bias, especially with regard to comorbidities and adverse events during treatment, with the prevalence of extra-renal complications increasing with age. Thus, it is not possible to exclude the effects of age-related complications from our findings. Second, we used a cut-off of 60 years to define ‘elderly,’ based on the definition of the United Nations Population Fund, although the cut-off age used by the WHO is 65 years. As described above, IgAVN in our patients had a second peak of prevalence in the age group of 60-69 years; most of our patients were 60 to 64 years old and exhibited clinical and pathological features similar to those previously reported for patients ≥65 years of age.\n\nIn summary, we showed that the clinical and pathological presentation of patients with IgAVN was more severe in elderly patients than in adult patients. All elderly patients received glucocorticoid therapy due to their severe presentation. While glucocorticoid therapy resulted in beneficial renal outcomes in most elderly patients, it also caused severe adverse events in some patients, especially those with underlying disease conditions, such as pre-existing poorly controlled type 2 diabetes mellitus and CKD or mitral valve disease in the elderly group. Therefore, the optimum treatment regimen for elderly patients should be explored in future studies.\n\n\nThe authors state that they have no Conflict of Interest (COI).\n==== Refs\n1. \nRostoker G \nSchönlein-Henoch purpura in children and adults: diagnosis, pathophysiology and management . BioDrugs \n15 : 99 -138 , 2001 .11437679 \n2. \nFervenza FC \nHenoch-Schönlein purpura nephritis . Int J Dermatol \n42 : 170 -177 , 2003 .12653909 \n3. \nYang YH , Hung CF , Hsu CR , et al \nA nationwide survey on epidemiological characteristics of childhood Henoch-Schönlein purpura in Taiwan . Rheumatology (Oxford) \n44 : 618 -622 , 2005 .15671050 \n4. \nPillebout E , Thervet E , Hill G , Alberti C , Vanhille P , Nochy D \nHenoch-Schoölein Purpura in adults: outcome and prognostic factors . J Am Soc Nephrol \n13 : 1271 -1278 , 2002 .11961015 \n5. \nMeadow SR , Glasgow EF , White RH , Moncrieff MW , Cameron JS , Ogg CS \nSchönlein-Henoch nephritis . Q J Med \n41 : 241 -258 , 1972 .4538491 \n6. \nNiaudet P , Habib R \nSchönlein-Henoch purpura nephritis: pronostic factors and therapy . Ann Med Interne \n145 : 577 -580 , 1994 .\n7. \nYoshikawa N , White RH , Cameron AH \nPrognostic significance of the glomerular changes in Henoch-Schoenlein nephritis . Clin Nephrol \n16 : 223 -229 , 1981 .7030544 \n8. \nGoldstein AR , White RH , Akuse R , Chantler C \nLong-term follow-up of childhood Henoch-Schönlein nephritis . Lancet \n339 : 280 -282 , 1992 .1346291 \n9. \nScharer K , Krmar R , Querfeld U , Ruder H , Waldherr R , Schaefer F \nClinical outcome of Schönlein-Henoch purpura nephritis in children . Pediatr Nephrol \n13 : 816 -823 , 1999 .10603128 \n10. \nFillastre JP , Morel-Maroger L , Richet G \nSchönlein-Henoch purpura in adults . Lancet \n1 : 1243 -1244 , 1971 .\n11. \nLee HS , Koh HI , Kim MJ , Rha HY \nHenoch-Schoenlein nephritis in adults: a clinical and morphological study . Clin Nephrol \n26 : 125 -130 , 1986 .3769227 \n12. \nCoppo R , Mazzucco G , Cagnoli L , Lupo A , Schena FP \nLong-term prognosis of Henoch-Schönlein nephritis in adults and children. Italian Group of Renal Immunopathology Collaborative Study on Henoch-Schönlein purpura . Nephrol Dial Transplant \n12 : 2277 -2283 , 1997 .9394311 \n13. \nSchaier M , Freitag J , Dikow R , et al \nHenoch-Schönlein purpura in adults is not uncommon in elderly patients with an adverse prognosis . Clin Nephrol \n76 : 49 -56 , 2011 .21722605 \n14. \nMatsuo S , Imai E , Horio M , et al \nRevised equations for estimated GFR from serum creatinine in Japan . Am J Kidney Dis \n53 : 982 -992 , 2009 .19339088 \n15. \nSugiyama H , Yokoyama H , Sato H , et al \nJapan Renal Biopsy Registry and Japan Kidney Disease Registry: Committee Report for 2009 and 2010 . Clin Exp Nephrol \n17 : 155 -173 , 2013 .23385776 \n16. \nSugiyama H , Yokoyama H , Sato H , et al \nJapan Renal Biopsy Registry: the first nationwide, web-based, and prospective registry system of renal biopsies in Japan . Clin Exp Nephrol \n15 : 493 -503 , 2011 .21437579 \n17. \nUtsunomiya Y , Kawamura T , Abe A , et al \nSignificance of mesangial expression of alpha-smooth muscle actin in the progression of IgA nephropathy . Am J Kidney Dis \n34 : 902 -910 , 1999 .10561148 \n18. \nTervaert TW , Mooyaart AL , Amann K , et al \nPathologic classification of diabetic nephropathy . J Am Soc Nephrol \n21 : 556 -563 , 2010 .20167701 \n19. \nKanda Y \nInvestigation of the freely available easy-to-use software ‘EZR’ for medical statistics . Bone Marrow Transplant \n48 : 452 -458 , 2013 .23208313 \n20. \nKomatsu H , Fujimoto S , Yoshikawa N , Kitamura H , Sugiyama H , Yokoyama H \nClinical manifestations of Henoch-Schönlein purpura nephritis and IgA nephropathy: comparative analysis of data from the Japan Renal Biopsy Registry (J-RBR) . Clin Exp Nephrol \n20 : 552 -560 , 2016 .26456327 \n21. \nMitsui H , Shibagaki N , Kawamura T , Matsue H , Shimada S \nA clinical study of Henoch-Schönlein purpura associated with malignancy . J Eur Acad Dermatol Venereol \n23 : 394 -401 , 2009 .19207675 \n22. \nZurada JM , Ward KM , Grossman ME \nHenoch-Schönlein purpura associated with malignancy in adults . J Am Acad Dermatol \n55 : S65 -S70 , 2006 .17052537 \n23. \nPertuiset E , Liote F , Launay-Russ E , Kemiche F , Cerf-Payrastre I , Chesneau AM \nAdult Henoch-Schönlein purpura associated with malignancy . Semin Arthritis Rheum \n29 : 360 -367 , 2000 .10924021 \n24. \nHilhorst M , van Paassen P , van Breda Vriesman P , Cohen Tervaert JW \nImmune complexes in acute adult-onset Henoch-Schönlein nephritis . Nephrol Dial Transplant \n26 : 3960 -3967 , 2011 .21441402 \n25. \nGoldstein RS , Tarloff JB , Hook JB \nAge-related nephropathy in laboratory rats . FASEB J \n2 : 2241 -2251 , 1988 .3280378 \n26. \nAudemard-Verger A , Terrier B , Dechartres A , et al \nCharacteristics and management of IgA vasculitis (Henoch-Schönlein purpura) in adults: data from 260 patients included in a French multicenter retrospective survey . Arthritis Rheumatol \n69 : 1862 -1870 , 2017 .28605168 \n27. \nOzaki S , Atsumi T , Hayashi T , et al \nSeverity-based treatment for Japanese patients with MPO-ANCA-associated vasculitis: the JMAAV study . Mod Rheumatol \n22 : 394 -404 , 2012 .21928092 \n28. \nYamagata K , Usui J , Saito C , et al \nANCA-associated systemic vasculitis in Japan: clinical features and prognostic changes . Clin Exp Nephrol \n16 : 580 -588 , 2012 .22350463 \n29. \nHarper L , Savage CO \nANCA-associated renal vasculitis at the end of the twentieth century--a disease of older patients . Rheumatology (Oxford) \n44 : 495 -501 , 2005 .15613403\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "0918-2918", "issue": "58(1)", "journal": "Internal medicine (Tokyo, Japan)", "keywords": "Henoch-Schönlein; adults; elderly; glomerulonephritis; purpura", "medline_ta": "Intern Med", "mesh_terms": "D000328:Adult; D000367:Age Factors; D000368:Aged; D000369:Aged, 80 and over; D015331:Cohort Studies; D005260:Female; D005919:Glomerular Filtration Rate; D005938:Glucocorticoids; D006801:Humans; D007070:Immunoglobulin A; D007564:Japan; D008297:Male; D008875:Middle Aged; D009393:Nephritis; D016896:Treatment Outcome; D014657:Vasculitis; D055815:Young Adult", "nlm_unique_id": "9204241", "other_id": null, "pages": "31-38", "pmc": null, "pmid": "30101942", "pubdate": "2019-01-01", "publication_types": "D003160:Comparative Study; D016428:Journal Article", "references": "10561148;10603128;10924021;11437679;11961015;12653909;1346291;15613403;15671050;17052537;19207675;19339088;20167701;21437579;21441402;21722605;21928092;22350463;23208313;23385776;26456327;28605168;3280378;3769227;4103106;4538491;7030544;7710184;9394311", "title": "Clinical and Pathological Characteristics of Elderly Japanese Patients with IgA Vasculitis with Nephritis: A Case Series.", "title_normalized": "clinical and pathological characteristics of elderly japanese patients with iga vasculitis with nephritis a case series" }
[ { "companynumb": "JP-MYLANLABS-2019M1012627", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "PREDNISOLONE" }, "drugadditional": null, ...
{ "abstract": "OBJECTIVE\nSolid-organ transplant recipients can develop chronic hypercoagulation that increases the incidence of pulmonary embolism. Here, we evaluate the frequency of pulmonary embolism in solid-organ transplant recipients during the first 10 years after transplantation and evaluate the risk factors for its development.\n\n\nMETHODS\nThe medical records of solid-organ transplant recipients who were treated between 2003 and 2013 were retrospectively reviewed. The reviewed data included demographics, type of transplant, comorbidities, procoagulation factors, thromboembolism prophylaxis, and the timing and extent of pulmonary embolism.\n\n\nRESULTS\nIn total, 999 solid-organ transplant recipients are included in this study (661 renal and 338 liver transplant recipients) (male: female ratio = 665:334). Twelve renal (1.2%) and 1 liver transplant recipient (0.3%) were diagnosed with pulmonary embolism. Pulmonary embolism developed 1 year after transplantation in 10 patients: 1 patient developed pulmonary embolism < 3 months after transplantation, and the other 9 patients developed pulmonary embolism within 3 to 6 months. No patients had a prior history of deep venous thrombosis or pulmonary embolism. Five patients received tacrolimus, 7 patients received sirolimus, and 1 patient received cyclosporine. Ten patients received prednisolone, and 8 patients received mycophenolate mofetil. All patients were homozygous normal for factor V Leiden and prothrombin genes. One patient was homozygous abnormal, and 1 patient had a heterozygous mutation in the methylenetetrahydrofolate reductase gene. Two patients were treated with low-molecular-weight heparin, while the remaining patients received warfarin. Eight patients were treated for 6 months, and the remainder received longer treatments.\n\n\nCONCLUSIONS\nHere, the incidence of pulmonary embolism in solid-organ transplant recipients is 1.2%. Renal transplant recipients are at higher risk of developing pulmonary embolism than liver transplant recipients. The factors that increase the risk of pulmonary embolism in solid-organ transplant recipients appear to be multifactorial and include genetic predisposition.", "affiliations": "From the Pulmonary Department, Baskent University School of Medicine, Ankara, Turkey.", "authors": "Küpeli|Elif|E|;Ulubay|Gaye|G|;Doğrul|Ilgaz|I|;Birben|Özlem|Ö|;Seyfettin|Pınar|P|;Özsancak Uğurlu|Aylin|A|;Öner Eyüboğlu|Füsun|F|;Haberal|Mehmet|M|", "chemical_list": "D000925:Anticoagulants; D006495:Heparin, Low-Molecular-Weight; D007166:Immunosuppressive Agents; D014859:Warfarin", "country": "Turkey", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1304-0855", "issue": "13 Suppl 1()", "journal": "Experimental and clinical transplantation : official journal of the Middle East Society for Organ Transplantation", "keywords": null, "medline_ta": "Exp Clin Transplant", "mesh_terms": "D000328:Adult; D000925:Anticoagulants; D001777:Blood Coagulation; D015897:Comorbidity; D005260:Female; D020022:Genetic Predisposition to Disease; D006495:Heparin, Low-Molecular-Weight; D006801:Humans; D007166:Immunosuppressive Agents; D015994:Incidence; D016030:Kidney Transplantation; D016031:Liver Transplantation; D008297:Male; D008499:Medical Records; D008875:Middle Aged; D011655:Pulmonary Embolism; D012189:Retrospective Studies; D012307:Risk Factors; D013997:Time Factors; D016896:Treatment Outcome; D014421:Turkey; D014859:Warfarin", "nlm_unique_id": "101207333", "other_id": null, "pages": "223-7", "pmc": null, "pmid": "25894159", "pubdate": "2015-04", "publication_types": "D016428:Journal Article", "references": null, "title": "Long-term risk of pulmonary embolism in solid-organ transplant recipients.", "title_normalized": "long term risk of pulmonary embolism in solid organ transplant recipients" }
[ { "companynumb": "TR-MYLANLABS-2016M1006952", "fulfillexpeditecriteria": "1", "occurcountry": "TR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "MYCOPHENOLATE MOFETIL" }, "drugadditional": n...
{ "abstract": "Extragonadal germ cell tumors account for 2-5.7% of germ cell tumors (GCTs). Of these, primary mediastinal GCTs (PMGCTs) are responsible for 16-36% of cases. Given the rarity of these tumors, specific treatment strategies have not been well defined. We report our experience in treating these complex patients. In total, 318 men treated at our institution with chemotherapy for GCTs between 1980 and 2016 were reviewed. PMGCT was defined as clinically diagnosed mediastinal GCT with no evidence of testicular GCT (physical exam/ultrasound). We identified nine patients diagnosed with PMGCT. All patients presented with an anterior mediastinal mass and no gonadal lesion; four patients also had metastatic disease. Median age at diagnosis was 30 years (range, 14-56) and median mass size at diagnosis was 9 cm (range, 3.4-19). Eight patients had non-seminoma and one had pure seminoma. All patients received cisplatin-based chemotherapy initially. Surgical resection was performed in four patients; three patients had a complete resection and one patient was found to have an unresectable tumor. At a median follow-up of 2 years (range, 3 months-28 years) six patients had progressed. Progression-free survival was short with a median of 4.1 months from diagnosis (range 1.5-122.2 months). Five patients died at a median of 4.4 months from diagnosis. One and 5-year overall survivals were 50% and 38%, respectively. PMGCT are rare and aggressive. Our real-life Canadian experience is consistent with current literature suggesting that non-seminoma PMGCT has a poor prognosis despite prompt cisplatin-based chemotherapy followed by aggressive thoracic surgery.", "affiliations": "Department of Surgery, Urology Division, Schulich School of Medicine and Dentistry, University of Western Ontario, London, ON N6A 5W9, Canada.;Department of Surgery, Urology Division, Schulich School of Medicine and Dentistry, University of Western Ontario, London, ON N6A 5W9, Canada.;Department of Surgery, Urology Division, Schulich School of Medicine and Dentistry, University of Western Ontario, London, ON N6A 5W9, Canada.;Department of Surgery, Urology Division, Schulich School of Medicine and Dentistry, University of Western Ontario, London, ON N6A 5W9, Canada.;Department of Surgery, Urology Division, Schulich School of Medicine and Dentistry, University of Western Ontario, London, ON N6A 5W9, Canada.;Department of Oncology, Division of Medical Oncology, Schulich School of Medicine and Dentistry, University of Western Ontario, London, ON N6A 4L6, Canada.;Department of Oncology, Division of Medical Oncology, Schulich School of Medicine and Dentistry, University of Western Ontario, London, ON N6A 4L6, Canada.;Department of Surgery, Urology Division, Schulich School of Medicine and Dentistry, University of Western Ontario, London, ON N6A 5W9, Canada.", "authors": "Lavi|Arnon|A|;Winquist|Eric|E|0000-0002-8829-5979;Nair|Shiva M|SM|0000-0002-1075-3730;Chin|Joseph L|JL|;Izawa|Jonathan|J|;Fernandes|Ricardo|R|;Ernst|Scott|S|;Power|Nicholas E|NE|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.3390/curroncol28010010", "fulltext": "\n==== Front\nCurr Oncol\nCurr Oncol\ncurroncol\nCurrent Oncology\n1198-0052 1718-7729 MDPI \n\n10.3390/curroncol28010010\ncurroncol-28-00010\nArticle\nPrimary Mediastinal Germ Cell Tumors—The University of Western Ontario Experience\nLavi Arnon 1 https://orcid.org/0000-0002-8829-5979Winquist Eric 12 https://orcid.org/0000-0002-1075-3730Nair Shiva M. 1 Chin Joseph L. 1 Izawa Jonathan 1 Fernandes Ricardo 2 Ernst Scott 2 Power Nicholas E. 1* 1 Department of Surgery, Urology Division, Schulich School of Medicine and Dentistry, University of Western Ontario, London, ON N6A 5W9, Canada; arnon.lavi@lhsc.on.ca (A.L.); Eric.Winquist@lhsc.on.ca (E.W.); nair.shiva@gmail.com (S.M.N.); joseph.chin@lhsc.on.ca (J.L.C.); jonathan.izawa@lhsc.on.ca (J.I.)\n2 Department of Oncology, Division of Medical Oncology, Schulich School of Medicine and Dentistry, University of Western Ontario, London, ON N6A 4L6, Canada; ricardo.fernandes@lhsc.on.ca (R.F.); scott.ernst@lhsc.on.ca (S.E.)\n* Correspondence: Nicholas.power@lhsc.on.ca; Tel.: +1-519-685-8500; Fax: +1-519-685-8455\n08 12 2020 \n2 2021 \n28 1 78 85\n06 8 2020 01 12 2020 © 2020 by the authors.2020Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).Extragonadal germ cell tumors account for 2–5.7% of germ cell tumors (GCTs). Of these, primary mediastinal GCTs (PMGCTs) are responsible for 16–36% of cases. Given the rarity of these tumors, specific treatment strategies have not been well defined. We report our experience in treating these complex patients. In total, 318 men treated at our institution with chemotherapy for GCTs between 1980 and 2016 were reviewed. PMGCT was defined as clinically diagnosed mediastinal GCT with no evidence of testicular GCT (physical exam/ultrasound). We identified nine patients diagnosed with PMGCT. All patients presented with an anterior mediastinal mass and no gonadal lesion; four patients also had metastatic disease. Median age at diagnosis was 30 years (range, 14–56) and median mass size at diagnosis was 9 cm (range, 3.4–19). Eight patients had non-seminoma and one had pure seminoma. All patients received cisplatin-based chemotherapy initially. Surgical resection was performed in four patients; three patients had a complete resection and one patient was found to have an unresectable tumor. At a median follow-up of 2 years (range, 3 months–28 years) six patients had progressed. Progression-free survival was short with a median of 4.1 months from diagnosis (range 1.5–122.2 months). Five patients died at a median of 4.4 months from diagnosis. One and 5-year overall survivals were 50% and 38%, respectively. PMGCT are rare and aggressive. Our real-life Canadian experience is consistent with current literature suggesting that non-seminoma PMGCT has a poor prognosis despite prompt cisplatin-based chemotherapy followed by aggressive thoracic surgery.\n\ntesticular cancerextragonadal germ cell tumorprimary mediastinal germ cell tumor\n==== Body\n1. Introduction\nTesticular cancer accounts for 1% of malignancies among men in Canada. Among young adults aged 15–29, it is the second most common cancer accounting for 13% of cancer cases in that age group in Canada [1]. GCTs mainly arise within the testis and are broadly divided histologically to seminomas and non-seminomas. GCT’s are regarded as developmental cancers and hence can arise from extragonadal midline structures aside from the testis. Extragonadal germ cell tumors are a rare presentation of germ cell tumors (GCTs) and comprise 2–5.7% of GCT’s [2,3,4]. One common hypothesis is that these tumors originate from germ cells that migrated along the genital ridge and survived in the extragonadal environment, mainly in midline structures [5,6]. Primary mediastinal germ cell tumors (PMGCTs) are defined by a GCT of the mediastinum without a testicular primary, and account for 16–36% of extragonadal GCTs [2,7,8]. Other common sites of extragonadal GCT include the pineal gland and retroperitoneum, though the true existence of the latter is controversial [4]. PMGCTs comprise 15% of anterior mediastinal tumors in adults, and have been associated with other conditions, including Klinefelter’s syndrome and hematologic malignancies, especially megakaryoblastic leukemia [9,10,11]. Though sharing major histologic and genetic features, such as the gain in [12] isochromosome, non-seminomatous (NS), PMGCTs are more treatment-resistant and have a poorer prognosis compared to primary gonadal non-seminomas [13,14]. Hence, a diagnosis of NS-PMGCT is classified by the International Germ Cell Cancer Collaborative Group (IGCCCG) risk classification as poor prognosis, whereas the primary anatomical location of pure seminoma is not found in prognostic staging [15]. NS histology makes up the majority of PMGCT with 66–84% of cases [16,17]. NS-PMGCT have an overall survival (OS) rate of 49%, distinct from seminomatous PMGCT with an OS of 88% [17]. As these tumors are rare, data regarding the optimal treatment of PMGCTs is limited.\n\nIn this study, we summarize our experience as a regional referral center and present the institution’s experience managing these complex and challenging tumors.\n\n2. Methods\nThree hundred and eighteen men treated with chemotherapy at our institution between 1980 and 2016 for metastatic GCTs were identified from an electronic database and screened for a diagnosis of PMGCT. The site of origin for the primary tumor was recorded for all patients in the database. Demographic and clinical data, treatment details, and clinical outcomes, were extracted from the database and original medical records, as necessary. Descriptive statistics were used to analyze the data. This study was approved by the University of Western Ontario Research Ethics Board.\n\n3. Results\nNine patients with PMGCT were identified. All patients presented with an anterior mediastinal mass proven to be GCT either pathologically or clinically (marker positive) with no evident testicular primary lesion (based on ultrasound or physical examination). Patient and tumor characteristics are summarized in Table 1. Eight patients had non-seminoma and one had pure seminoma. The median age at diagnosis was 30 years (range, 14–56 years). The most common presenting symptoms were cough (three patients), followed by hemoptysis, weight loss, fatigue and superior vena cava syndrome (two patients each). Other symptoms included: dysphagia, wheezing, upper respiratory tract infection, chest pain and hoarseness. The median mediastinal mass size at diagnosis was 9 cm (range, 3.4–19 cm). Four patients presented with metastatic disease, with three having multiple sites of metastases. Metastases sites included: lung, lymph nodes, liver and bone. Eight patients were diagnosed by mediastinal biopsy. One patient, with an elevated serum alfa-fetoprotein level, started chemotherapy treatment without histology.\n\nThe median follow-up from diagnosis was 2 years (range, 3 months–28 years). Three patients were marker negative at presentation. All patients were treated initially with cisplatin-based chemotherapy (Table 1). Either bleomycin, etoposide and cisplatin (BEP) or etoposide, ifosfamide and cisplatin (VIP) were used. Four patients responded to chemotherapy, one had stable disease, and four progressed radiographically (Table 1). Eventually, six of the nine patients had disease progression.\n\nAggressive thoracic surgery to completely resect residual masses was considered in four patients. Of those patients, one patient had emergent surgery for hemodynamic instability caused by tumor mass effect. At surgery viable unresectable tumor was found, and the patient subsequently died of cardiac tamponade. The other three patients had complete debulking surgery after partial or no response following chemotherapy. Surgical pathology revealed necrosis, teratoma, and gastrointestinal adenocarcinoma with sarcomatoid features considered due to malignant transformation of NS-PMGCT in one patient each.\n\nOf the three patients that underwent complete resection, one appears to be cured, one had a long remission with recurrence after 10.1 years, and one died of treatment complications after 2 months. Apart from the cardiac tamponade noted, no major complications of thoracic surgery were noted.\n\nProgression-free survival for NS-PMGCT was short with a median of 4.1 months (range 1.5–122.8 months). Five of the six patients that progressed did so very rapidly. The remaining patient (patient no. 9), who presumably had NS-PMGCT, did not respond initially to BEP, and hence had complete thoracic debulking surgery. That patient had malignant transformation to GI adenocarcinoma and was NED for 10.1 years before recurring and dying shortly thereafter.\n\nOne-, three- and five-year overall survival for NS-PMGCT were 50%, 38% and 38%, respectively. Three patients died rapidly within 4 months of diagnosis. Two patients were diagnosed at ages of 50 and 56 (patients nos. 1 and 3, respectively), and both had mixed GCT’s with rapidly progressive disease. \n\nIt should be noted that the only patient with mediastinal seminoma (patient no. 6) was cured with chemotherapy alone.\n\n4. Discussion\nPMGCTs are uncommon. Over a 36-year period at our center, only nine cases were observed. Our experience is consistent with observations that most PMGCTs are of non-seminomatous histology, and that these are associated with a poor prognosis. However, for seminoma the occurrence of primary mediastinal disease does not appear to influence prognosis.\n\nStandard therapy is usually based on IGCCC prognostic criteria. These criteria classify NS-PMGCTs as poor prognosis, and typically six cycles of conventional-dose cisplatin-based chemotherapy followed by complete surgical resection of residual masses are recommended. All patients in our cohort received either BEP or VIP. Although some of our patients received BEP, expert opinion currently suggests that VIP may be preferred as equally effective but associated with fewer post-surgical respiratory complications [18]. In our cohort, three of four patients having thoracic surgery had also received pre-operative bleomycin without notable pulmonary complications. One patient died after emergent surgery with unresected viable GCT due to cardiac tamponade. The other three patients had complete resections. Complete resection has been reported to be achieved in up to 86% of patients [19].\n\nElevated serum tumor markers are considered to be poor prognostic factors, especially β-human chorionic gonadotropin (β-HCG) [17,20]. Three NS-PMGCT patients in our cohort were marker negative at presentation. One patient appears to have been cured with chemotherapy alone, but the others rapidly progressed despite treatment. As follow-up of marker negative patients is more challenging, using novel markers can be of use. MiR-371-a-3p has been shown to outperform β-HCG and αFP with regard to sensitivity and specificity [21]. Five patients had elevated β-HCG at diagnosis, and three succumbed to progressive disease with time from diagnosis to death ranging from 2.8 to 24 months. Another patient appeared to be cured but had a lethal late recurrence at 10.1 years. Interestingly one patient had choriocarcinoma with a β-HCG of 400,000 mIU/ml with liver and lung metastasis and was cured with chemotherapy and thoracic surgery. This is unusual for mediastinal choriocarcinoma [22,23,24]. Patient 9 had malignant transformation to adenocarcinoma and sarcoma. Malignant transformation of mature teratomas into non-germ cell malignancies is a known phenomenon of GCTs [25]. Transformation can occur at presentation or in a delayed fashion and can occur to various malignancies with adenocarcinoma being one of the most common. As these tumors are chemo-resistant, prognosis is often poor [25]. Malignant transformation of PMGCT has been reported in the past [25,26,27,28,29].\n\nSeminoma PMGCT is even more rare than NS PMGCT but harbors a much better prognosis as outlined in the IGCCCG [15]. In our cohort the single patient with seminoma PMGCT was cured with chemotherapy alone.\n\nNone of our PMGCT patients achieved marker-negative complete radiographic response. However, this is not always correlated with prognosis, as at least 25% of post-chemotherapy residual masses consist of necrotic or fibrotic tissue [19]. Indeed, in our cohort, four patients had marker-negative partial response, and three appeared cured and one had a late recurrence.\n\nTwo of our patients were diagnosed at older ages (50 and 56 years, respectively). These patients did very poorly with rapidly progressive disease despite chemotherapy and death within 4 months of diagnosis. This is consistent with previous reports suggesting older age is a poor prognostic factor [17,30]. As previously reported, patients with NS-PMGCT and visceral metastasis have an extremely poor prognosis [17,20,30]. In the current study, all three patients with visceral metastasis (liver) died within 4 months of diagnosis. One of these patients had bone metastases and died rapidly within 2.8 months of diagnosis. Indeed, bone metastasis, though very rare in GCT’s, harbor a very poor prognosis [31]. The remaining patient having choriocarcinoma (patient no.4) with initial liver and lung metastasis was cured with chemotherapy (BEP) followed by consolidative thoracic surgery.\n\nAs mentioned, an association between hematologic malignancies and PMGCT has been reported. This has been reported to occur in 1 of 17 PMGCT patients with isochromosome 12p expressed in both malignancies. This association is believed to be secondary to either an embryonic progenitor capable to differentiate to both GCT and myeloid neoplasms or alternatively leukemia derived directly from the GCT [12]. One patient in our cohort died of bone marrow suppression secondary to myelodysplastic syndrome (MDS) developed 18 months after chemotherapy completion. Obviously, we cannot determine a causative correlation between either the disease or chemotherapy and the development of MDS.\n\nThe prognosis of NS-PMGCT is much worse compared to gonadal NS [13,14,15]. Certain genomic alteration distinctions between NS-PMGCT and gonadal NS have been reported, including TP53, PIK3CA, and other cell cycle pathway genomic alterations [32]. This, along with known associations with Klinefelter’s syndrome and hematological malignancy supports the concept of a different developmental biology of NS-PMGCT compared to its gonadal counterpart.\n\nResponse rates to primary chemotherapy are lower, and cure rates with tandem high-dose chemotherapy and stem cell rescue are dismal [33]. This has led some expert opinion to recommend against use of high-dose chemotherapy for persistent or recurrent NS-PMGCT, and advocate for palliative approaches only. Intensified chemotherapy in poor prognosis NS GCT patients with inadequate tumor marker decline after their first cycle of chemotherapy appeared to improve outcomes in a randomized trial [34]. In total, 26% of the patients in this trial had NS-PMGCTs; however, subgroup analysis suggested little benefit of intensified chemotherapy in these patients. Immune check point inhibitors may benefit a subset of patients with overexpression of PD-L1, but further investigation is required [35].\n\nOur study is limited by its small sample size, retrospective and descriptive nature. Patients were identified over a long time period at a tertiary academic center and the incidence of PMGCTs was relatively low. Certainly, treatment approaches changed over the period reviewed. However, there have been few reports on PMGCTs from Canadian expert centers.\n\nIn summary, PMGCTs are rare tumors and those with non-seminomatous histology have a poor prognosis. Primary chemotherapy followed by complete resection of residual masses is a critical component of therapy for NS-PMGCT. These tumors present a challenge for the most experienced urological and thoracic cancer teams, and we strongly recommend treatment by a multidisciplinary team at a testicular cancer expert center to optimize patient outcomes [36]. Although excellent outcomes are achieved with standard therapies for primary mediastinal seminoma, more effective drug treatment will be required to improve survival in NS-PMGCT. Due to their rarity, international collaboration will likely be required to achieve this.\n\n5. Conclusions\nPrimary mediastinal germ cell tumors are particularly challenging to manage. Prompt aggressive chemotherapy and aggressive surgery to resect all residual disease are necessary to provide patients with an opportunity for cure. Better systemic treatment is necessary to improve cure rates. Treatment at a testicular cancer referral center is recommended.\n\nPublisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAuthor Contributions\nConceptualization, A.L. and N.E.P.; methodology, A.L., S.M.N. and N.E.P.; validation E.W., J.L.C., J.I., R.F., S.E. and N.E.P.; formal analysis, A.L.; investigation, A.L. and N.E.P.; resources, A.L. and N.E.P.; data curation A.L. and N.E.P.; writing—original draft preparation, A.L., E.W., S.M.N. and N.E.P.; writing—review and editing, A.L., E.W., S.M.N., J.L.C., J.I., R.F., S.E. and N.E.P.; visualization, A.L., E.W., S.M.N. and N.E.P.; supervision, E.W. and N.E.P.; project administration, A.L. All authors have read and agreed to the published version of the manuscript.\n\nFunding\nThis research received no external funding. \n\nConflicts of Interest\nThe authors declare no conflict of interest.\n\ncurroncol-28-00010-t001_Table 1Table 1 Patient characteristics.\n\nPt No.\tAge\tInitial Histology\tβhcg (mIU/mL)\tαFP (ng/mL)\tMetastasis\tInitial Chemotherapy\tRadiologic Response\tThoracic Surgery\tDeath\tTime from Diagnosis to Death\t\n1\t50\tMixed GCT\t0\t0\tCervical LN×2\nLung×1\tBEP×3\tProgressive disease\t-\tDied of disease\t2.8 months\t\n2\t30\tMixed GCT\t300\t18,000\tLiver×4\nBone×2\nLung×2\tBEP×3\tProgressive disease\tPartial resection—viable tumor\tDied of disease\t2.8 months\t\n3\t56\tPoorly differentiated GCT\t0\t0\tLiver×1\tBEP×3\tProgressive disease\t-\tDied of disease\t4.3 months\t\n4\t42\tChorio-carcinoma\t400,000\t0\tLiver×2\nLung×2\tVIP×4\tPartial response\tResection - necrosis\t-\t-\t\n5\t39\tMixed GCT\t16\t0\t-\tBEP×4\tPartial response\t-\t-\t-\t\n6\t27\tPure seminoma\t0\t0\t-\tVIP×4\tPartial response\t-\t-\t-\t\n7\t14\tTeratoma+\nEmbryonal\nCarc­inoma\t19,220\t8417\t-\tBEP×4\tStable disease\tResection—Teratoma\tDied of BM suppression\t24 months\t\n8\t19\tEmbryonal\nCarcinoma\t531\t1670\t-\tBEP×4\tProgressive\ndisease\t\n\tDied of disease\t11 months\t\n9\t28\tNon-seminoma *\t287\t381\t-\tBEP×4\tPartial response\tGI adenoCa+\nSarcoma\tDied of disease\t11.2 years\t\nβhcg—β-human chorionic gonadotropin; GCT—Germ cell tumor; BEP—Bleomycin, Etoposide, Cisplatin; VIP—Etoposide, Ifosfamide, Cisplatin; BM—bone marrow; LN—lymph node. * No histological confirmation initially. Presence of a teratoma and non-seminoma elements most reasonable d/t clinical course and positive αFP.\n==== Refs\nReferences\n1. Canadian Cancer Statistics 2019 Available online: https://www.cancer.ca/~/media/cancer.ca/CW/cancer information/cancer 101/Canadian cancer statistics/Canadian-Cancer-Statistics-2019-EN.pdf?la=en (accessed on 20 November 2020) \n2. Stang A. Trabert B. Wentzensen N. Cook M.B. Rusner C. Oosterhuis J.W. McGlynn K.A. Gonadal and extragonadal germ cell tumours in the United States, 1973–2007 Int. J. Androl. 2012 35 616 625 10.1111/j.1365-2605.2011.01245.x 22320869 \n3. Trama A. Mallone S. Nicolai N. Necchi A. Schaapveld M. Gietema J. Znaor A. Ardanaz E. Berrino F. RARECARE Working Group Burden of testicular, paratesticular and extragonadal germ cell tumours in Europe Eur. J. Cancer 2011 10.1016/j.ejca.2011.08.020 \n4. Punjani N. Winquist E. Power N. Do retroperitoneal extragonadal germ cell tumours exist? J. Can. Urol. Assoc. 2015 9 381 384 10.5489/cuaj.3024 26788225 \n5. Houldsworth J. Korkola J.E. Bosl G.J. Chaganti R.S.K. Biology and genetics of adult male germ cell tumors J. Clin. Oncol. 2006 24 5512 5518 10.1200/JCO.2006.08.4285 17158536 \n6. Genetics and Biology of Adult Human Male Germ Cell Tumors-PubMed Available online: https://pubmed.ncbi.nlm.nih.gov/10749107/ (accessed on 20 November 2020) \n7. Pauniaho S.L. Salonen J. Helminen M. Vettenranta K. Heikinheimo M. Heikinheimo O. The incidences of malignant gonadal and extragonadal germ cell tumors in males and females: A population-based study covering over 40 years in Finland Cancer Causes Control 2012 23 1921 1927 10.1007/s10552-012-0069-9 23011538 \n8. Rusner C. Trabert B. Katalinic A. Kieschke J. Emrich K. Stang A. Incidence patterns and trends of malignant gonadal and extragonadal germ cell tumors in Germany, 1998 Cancer Epidemiol. 2013 37 370 373 10.1016/j.canep.2013.04.003 23683844 \n9. Nichols C.R. Heerema N.A. Palmer C. Loehrer P.J. Williams S.D. Einhorn L.H. Klinefelter’s syndrome associated with mediastinal germ cell neoplasms J. Clin. Oncol. 1987 5 1290 1294 10.1200/JCO.1987.5.8.1290 3040921 \n10. Mukherjee S. Ibrahimi S. John S. Adnan M.M. Scordino T. Khalil M.O. Cherry M. Non-seminomatous mediastinal germ cell tumor and acute megakaryoblastic leukemia Ann. Hematol. 2017 96 1435 1439 10.1007/s00277-017-3037-3 28578457 \n11. den Bakker M.A. Marx A. Mukai K. Ströbel P. Mesenchymal tumours of the mediastinum—Part I Virchows Arch. 2015 467 487 500 10.1007/s00428-015-1830-8 26358059 \n12. Taylor J. Donoghue M. Rampal R.K. Tamari R. Tallman M.S. Feldman D.R. Taylor B.S. Abdel-Wahab O.I. Hematologic Malignancies Arising in Patients with Germ Cell Tumors: Secondary Somatic Differentiation of Hematopoietic Malignancies from Germ Cell Precursors Blood 2018 132 Suppl. 1 87 10.1182/blood-2018-99-111976 \n13. Nichols C.R. Saxman S. Williams S.D. Loehrer P.J. Miller M.E. Wright C. Einhorn L.H. Primary mediastinal nonseminomatous germ cell tumors. A modern single institution experience Cancer 1990 65 1641 1646 10.1002/1097-0142(19900401)65:7<1641::AID-CNCR2820650731>3.0.CO;2-U 1690077 \n14. Albany C. Einhorn L.H. Extragonadal germ cell tumors: Clinical presentation and management Curr. Opin. Oncol. 2013 25 261 265 10.1097/CCO.0b013e32835f085d 23422328 \n15. International Germ Cell Consensus Classification: A prognostic factor-based staging system for metastatic germ cell cancers. International Germ Cell Cancer Collaborative Group J. Clin. Oncol. 1997 15 594 603 9053482 \n16. Liu Y. Wang Z. Peng Z.-M. Yu Y. Management of the primary malignant mediastinal germ cell tumors: Experience with 54 patients Diagn. Pathol. 2014 9 33 10.1186/1746-1596-9-33 24552239 \n17. Bokemeyer C. Nichols C.R. Droz J.-P. Schmoll H.-J. Horwich A. Gerl A. Fossa S.D. Beyer J. Pont J. Kanz L. Extragonadal germ cell tumors of the mediastinum and retroperitoneum: Results from an international analysis J. Clin. Oncol. 2002 20 1864 1873 10.1200/JCO.2002.07.062 11919246 \n18. Kesler K.A. Rieger K.M. Hammoud Z.T. Kruter L.E. Perkins S.M. Turrentine M.W. Schneider B.P. Einhorn L.H. Brown J.W. A 25-Year Single Institution Experience with Surgery for Primary Mediastinal Nonseminomatous Germ Cell Tumors Ann. Thorac. Surg. 2008 85 371 378 10.1016/j.athoracsur.2007.09.020 18222228 \n19. Caso R. Jones G.D. Bains M.S. Hsu M. Tan K.S. Feldman D.R. Funt S.A. Reuter V.E. Bosl G.J. McHugh D. Outcomes After Multidisciplinary Management of Primary Mediastinal Germ Cell Tumors Ann. Surg. 2020 10.1097/SLA.0000000000003754 \n20. Hartmann J.T. Nichols C.R. Droz J.-P. Horwich A. Gerl A. Fossa S.D. Beyer J. Pont J. Kanz L. Einhorn L. Prognostic variables for response and outcome in patients with extragonadal germ-cell tumors Ann. Oncol. 2002 13 1017 1028 10.1093/annonc/mdf176 12176779 \n21. Dieckmann K.P. Radtke A. Spiekermann M. Balks T. Matthies C. Becker P. Ruf C. Oing C. Oechsle K. Bokemeyer C. Serum Levels of MicroRNA miR-371a-3p: A Sensitive and Specific New Biomarker for Germ Cell Tumours Eur. Urol. 2017 71 213 220 10.1016/j.eururo.2016.07.029 27495845 \n22. Yamane T. Egawa H. Deguchi N. Moritani C. A case of primary mediastinal choriocarcinoma Nihon Kokyuki Gakkai Zasshi 2006 44 48 54 16502867 \n23. Nakahara Y. Fukuyama K. Kojima M. Nagata M. Matsubara S. Tominaga M. Naitoh K. Hayashi S. A case of primary mediastinal choriocarcinoma Nihon Kyobu Shikkan Gakkai Zasshi 1997 35 1020 1024 9396264 \n24. Zhang F. Zhang W. Shi H. Ye G. Shi W. Shu Y. Li G. Primary choriocarcinoma of the posterior mediastinum in a male: A case report and review of the literature Oncol. Lett. 2014 8 739 741 10.3892/ol.2014.2222 25013493 \n25. Giannatempo P. Pond G.R. Sonpavde G. Albany C. Loriot Y. Sweeney C.J. Salvioni R. Colecchia M. Nicolai N. Raggi D. Treatment and Clinical Outcomes of Patients with Teratoma with Somatic-Type Malignant Transformation: An International Collaboration J. Urol. 2016 196 95 100 10.1016/j.juro.2015.12.082 26748165 \n26. Kim J.Y. Lee C.H. Park W.Y. Kim J.-Y. Kim A. Shin N. Park D.Y. Huh G.Y. Adenocarcinoma with sarcomatous dedifferentiation arising from mature cystic teratoma of the anterior mediastinum Pathol. Res. Pract. 2012 208 741 745 10.1016/j.prp.2012.09.005 23089288 \n27. Abid H. Neji H. Haddar S. Ammar I. Ayadi L. Msaad S. Mahfoudh K.B. Mnif J. Tératome médiastinal mature avec transformation maligne spontanée Rev. Mal. Respir. 2013 30 424 428 10.1016/j.rmr.2012.11.006 23746817 \n28. Habougit C. Yvorel V. Sulaiman A. Hag B. Péoc H.M. Forest F. Mediastinal mature teratoma with malignant carcinomatous transformation (somatic-type malignancy) with metastatic course Int. J. Surg. Pathol. 2015 23 682 684 10.1177/1066896915591583 26113666 \n29. Morinaga S. Nomori H. Kobayashi R. Atsumi Y. Well-differentiated adenocarcinoma arising from mature cystic teratoma of the mediastinum (teratoma with malignant transformation): Report of a surgical case Am. J. Clin. Pathol. 1994 101 531 534 10.1093/ajcp/101.4.531 8160647 \n30. Alanee S.R. Feldman D.R. Russo P. Konety B. Long-term mortality in patients with germ cell tumors: Effect of primary cancer site on cause of death Urol. Oncol. Semin. Orig. Investig. 2014 32 26.e9 26.e15 10.1016/j.urolonc.2012.09.003 \n31. Oing C. Oechsle K. Necchi A. Loriot Y. De Giorgi U. Fléchon A. Daugaard G. Fedyanin M. Faré E. Bokemeyer C. Impact of primary metastatic bone disease in germ cell tumors: Results of an International Global Germ Cell Tumor Collaborative Group G3 Registry Study Ann. Oncol. 2017 28 576 582 10.1093/annonc/mdw648 27993806 \n32. Necchi A. Bratslavsky G. Chung J. Millis S. Gay L.M. Ali S.M. Ross J.S. Genomic Features for Therapeutic Insights of Chemotherapy-Resistant, Primary Mediastinal Nonseminomatous Germ Cell Tumors and Comparison with Gonadal Counterpart Oncologist 2019 24 e142 e145 10.1634/theoncologist.2018-0430 30659078 \n33. Adra N. Abonour R. Althouse S.K. Albany C. Hanna N.H. Einhorn L.H. High-dose chemotherapy and autologous peripheral-blood stem-cell transplantation for relapsed metastatic germ cell tumors: The Indiana university experience J. Clin. Oncol. 2017 35 1096 1102 10.1200/JCO.2016.69.5395 27870561 \n34. Fizazi K. Pagliaro L. Laplanche A. Fléchon A. Mardiak J. Geoffrois L. Kerbrat P. Chevreau C. Delva R. Rolland F. Personalised chemotherapy based on tumour marker decline in poor prognosis germ-cell tumours (GETUG 13): A phase 3, multicentre, randomised trial Lancet Oncol. 2014 15 1442 1450 10.1016/S1470-2045(14)70490-5 25456363 \n35. Zschäbitz S. Lasitschka F. Hadaschik B.A. Hofheinz R.-D. Jentsch-Ullrich K. Grüner M. Jäger D. Grüllich C. Response to anti-programmed cell death protein-1 antibodies in men treated for platinum refractory germ cell cancer relapsed after high-dose chemotherapy and stem cell transplantation Eur. J. Cancer 2017 76 1 7 10.1016/j.ejca.2017.01.033 28262583 \n36. Tandstad T. Kollmannsberger C.K. Roth B.J. Jeldres C. Gillessen S. Fizazi K. Daneshmand S. Lowrance W.T. Hanna N.H. Albany C. Practice makes perfect: The rest of the story in testicular cancer as a model curable neoplasm J. Clin. Oncol. 2017 35 3525 3528 10.1200/JCO.2017.73.4723 28854068\n\n", "fulltext_license": "CC BY", "issn_linking": "1198-0052", "issue": "28(1)", "journal": "Current oncology (Toronto, Ont.)", "keywords": "extragonadal germ cell tumor; primary mediastinal germ cell tumor; testicular cancer", "medline_ta": "Curr Oncol", "mesh_terms": "D006801:Humans; D008297:Male; D008479:Mediastinal Neoplasms; D009373:Neoplasms, Germ Cell and Embryonal; D009864:Ontario; D018239:Seminoma; D013736:Testicular Neoplasms", "nlm_unique_id": "9502503", "other_id": null, "pages": "78-85", "pmc": null, "pmid": "33704177", "pubdate": "2020-12-08", "publication_types": "D016428:Journal Article", "references": "28854068;26113666;9396264;27993806;22142457;3040921;23683844;1690077;28578457;25013493;27495845;26788225;31977510;12176779;24552239;9053482;23089288;23746817;22320869;27870561;17158536;23422328;28262583;16502867;26748165;25456363;11919246;8160647;23410944;30659078;23011538;26358059;18222228", "title": "Primary Mediastinal Germ Cell Tumors-The University of Western Ontario Experience.", "title_normalized": "primary mediastinal germ cell tumors the university of western ontario experience" }
[ { "companynumb": "CA-TEVA-2021-CA-1902745", "fulfillexpeditecriteria": "1", "occurcountry": "CA", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "BLEOMYCIN SULFATE" }, "drugadditional": null, ...
{ "abstract": "Invasive aspergillosis is a life-threatening infectious complication in immunocompromised patients, especially with malignancy, and in some cases, it causes extensive tissue destruction and subsequent systemic illness, leading to multiorgan failure and death. Skin involvement and amphotericin B resistance are very rare findings of aspergillosis. Herein, we report the case of a primary hemophagocytic syndrome patient who developed subcutaneous nodules in the 3(rd) month of bone marrow transplantation from which Aspergillus fumigatus was cultivated despite the fact that she was under antifungal therapy. In immunocompromised patients with prolonged fever, atypical presentations of invasive mycosis should be kept in mind, and early appropriate therapy should be initiated promptly to decrease morbidity and mortality.", "affiliations": "Hacettepe University Medical Faculty, Pediatric Infectious Disease Department, Ankara, Turkey. Electronic address: aslinur.o@gmail.com.;Hacettepe University Medical Faculty, Pediatrics Department, Ankara, Turkey.;Hacettepe University Medical Faculty, Pediatric Infectious Disease Department, Ankara, Turkey.;Hacettepe University Medical Faculty, Pediatric Hematology Department, Ankara, Turkey.;Hacettepe University Medical Faculty, Pediatric Pathology Department, Ankara, Turkey.;Hacettepe University Medical Faculty, Mycology Department, Ankara, Turkey.;Hacettepe University Medical Faculty, Radiology Department, Ankara, Turkey.", "authors": "Ozkaya-Parlakay|Aslinur|A|;Ozer-Bekmez|Buse|B|;Kara|Ates|A|;Kuskonmaz|Baris|B|;Akcoren|Zuhal|Z|;Arikan-Dagli|Sevtap|S|;Oguz|Berna|B|", "chemical_list": "D000935:Antifungal Agents; D000666:Amphotericin B", "country": "Singapore", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1875-9572", "issue": "57(4)", "journal": "Pediatrics and neonatology", "keywords": "Aspergillus fumigatus; child; primary hemophagocytic syndrome; skin", "medline_ta": "Pediatr Neonatol", "mesh_terms": "D000293:Adolescent; D000666:Amphotericin B; D000935:Antifungal Agents; D001228:Aspergillosis; D001232:Aspergillus fumigatus; D016026:Bone Marrow Transplantation; D025141:Drug Resistance, Fungal; D005260:Female; D006801:Humans; D016867:Immunocompromised Host; D018805:Sepsis", "nlm_unique_id": "101484755", "other_id": null, "pages": "343-6", "pmc": null, "pmid": "24326152", "pubdate": "2016-08", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "An Important Finding of Systemic Aspergillosis: Skin Involvement and Amphotericin B Resistance in an Adolescent.", "title_normalized": "an important finding of systemic aspergillosis skin involvement and amphotericin b resistance in an adolescent" }
[ { "companynumb": "TR-FRESENIUS KABI-FK201610249", "fulfillexpeditecriteria": "1", "occurcountry": "TR", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "VANCOMYCIN" }, "drugadditional": null, ...
{ "abstract": "The evolving coronavirus disease 2019 (COVID-19) pandemic, caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has led to a rapid expansion of knowledge on the disease's clinical manifestations, laboratory and radiographic abnormalities, and patient trajectories. One area of particular focus is the effect that this illness may have on pregnancy and maternal-fetal disease. As of April 24, 2020, we identified 55 English language reports in the scientific literature summarizing data for 339 women and 258 fetuses and neonates. The majority of these data have focused on maternal-fetal transmission and neonatal outcomes. One systematic review and meta-analysis including the spectrum of coronaviruses [Severe Acute Respiratory Syndrome (SARS), Middle East Respiratory Syndrome (MERS), and COVID-19] in pregnancy noted increased rates of adverse outcomes associated with this group of infections. Here, we report the case of a COVID-19 positive woman presenting to our emergency department (ED) at 34 weeks gestation with preeclampsia. This case highlights the unique diagnostic and therapeutic challenges associated with treating patients with these concomitant diseases.", "affiliations": "Department of Emergency Medicine, Maine Medical Center, 22 Bramhall Street, Portland, ME 04102, United States of America. Electronic address: Jhansen@mmc.org.;Southern Maine Healthcare, Department of Emergency Medicine, Tufts University School of Medicine, 1 Medical Center Drive, Biddeford, ME 04005, United States of America. Electronic address: jfhine@smhc.org.;Maine Medical Center, Department of Emergency Medicine, Tufts University School of Medicine, 22 Bramhall Street, Portland, ME 04102, United States of America. Electronic address: Strout@mmc.org.", "authors": "Hansen|John N|JN|;Hine|Jason|J|;Strout|Tania D|TD|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1016/j.ajem.2020.06.052", "fulltext": null, "fulltext_license": null, "issn_linking": "0735-6757", "issue": "39()", "journal": "The American journal of emergency medicine", "keywords": "COVID-19; Emergency department; Emergency medicine; Preeclampsia; SARS-CoV-2", "medline_ta": "Am J Emerg Med", "mesh_terms": "D000328:Adult; D000086382:COVID-19; D005260:Female; D005865:Gestational Age; D006801:Humans; D011225:Pre-Eclampsia; D011247:Pregnancy; D011251:Pregnancy Complications, Infectious; D013902:Radiography, Thoracic; D014057:Tomography, X-Ray Computed", "nlm_unique_id": "8309942", "other_id": null, "pages": "252.e3-252.e5", "pmc": null, "pmid": "33008706", "pubdate": "2021-01", "publication_types": "D002363:Case Reports", "references": "32338708;32151335;21345415;24897084;28742678;32292902", "title": "COVID-19 and preeclampsia with severe features at 34-weeks gestation.", "title_normalized": "covid 19 and preeclampsia with severe features at 34 weeks gestation" }
[ { "companynumb": "NVSC2021US006761", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "LABETALOL\\LABETALOL HYDROCHLORIDE" }, "drugadditional...
{ "abstract": "The European Academy of Allergy and Clinical Immunology (EAACI)/Global Allergy and Asthma European Network (GA(2) LEN)/European Dermatology Forum (EDF)/World Allergy Organization (WAO) recently published updated recommendations for the classification, diagnosis and management of chronic urticaria (CU). This article discusses several case histories that provide examples of how these recommendations can be implemented in the treatment of CU in a variety of real-life patients.", "affiliations": "Division of Allergy and Clinical Immunology, St. Michael's Hospital and University of Toronto, Toronto, ON, Canada.;Clinic of Dermatology, University Hospital and Faculty of Medicine, University of Coimbra, Coimbra, Portugal.;Allergy and Clinical Immunology Department, Centro Médico-Docente La Trinidad, Caracas, Venezuela.", "authors": "Sussman|G|G|;Gonçalo|M|M|;Sánchez-Borges|M|M|", "chemical_list": "D000806:Angiotensin-Converting Enzyme Inhibitors; D000894:Anti-Inflammatory Agents, Non-Steroidal", "country": "England", "delete": false, "doi": "10.1111/jdv.13199", "fulltext": null, "fulltext_license": null, "issn_linking": "0926-9959", "issue": "29 Suppl 3()", "journal": "Journal of the European Academy of Dermatology and Venereology : JEADV", "keywords": null, "medline_ta": "J Eur Acad Dermatol Venereol", "mesh_terms": "D000328:Adult; D000799:Angioedema; D000806:Angiotensin-Converting Enzyme Inhibitors; D000894:Anti-Inflammatory Agents, Non-Steroidal; D002908:Chronic Disease; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D014581:Urticaria", "nlm_unique_id": "9216037", "other_id": null, "pages": "33-7", "pmc": null, "pmid": "26053293", "pubdate": "2015-06", "publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Treatment dilemmas in chronic urticaria.", "title_normalized": "treatment dilemmas in chronic urticaria" }
[ { "companynumb": "CA-LUPIN PHARMACEUTICALS INC.-2016-01735", "fulfillexpeditecriteria": "1", "occurcountry": "CA", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "DICLOFENAC" }, "drugadditiona...
{ "abstract": "A 21-year-old woman was admitted to the emergency department (ED) with severe sepsis. Both the mechanism of infection and organisms discovered were unusual.", "affiliations": "University of California, Irvine, School of Medicine, Department of Emergency Medicine, Irvine, California.;University of California, Irvine, School of Medicine, Department of Emergency Medicine, Irvine, California.;University of California, Irvine, School of Medicine, Department of Emergency Medicine, Irvine, California.", "authors": "Kesler|Kelly A|KA|;Langdorf|Mark I|MI|;Burns|Michael J|MJ|", "chemical_list": "D000701:Analgesics, Opioid; D000900:Anti-Bacterial Agents; D000935:Antifungal Agents; D054714:Echinocandins; D055666:Lipopeptides; D002939:Ciprofloxacin; D015725:Fluconazole; D000077551:Micafungin", "country": "United States", "delete": false, "doi": "10.5811/westjem.2016.9.31515", "fulltext": "\n==== Front\nWest J Emerg MedWest J Emerg MedWestJEMWestern Journal of Emergency Medicine1936-900X1936-9018Department of Emergency Medicine, University of California, Irvine School of Medicine 10.5811/westjem.2016.9.31515wjem-17-798Behavioral HealthCase ReportOpioid Dependent Malingerer with Self-Induced Sepsis Kesler Kelly A. MDLangdorf Mark I. MD, MHPEBurns Michael J. MDUniversity of California, Irvine, School of Medicine, Department of Emergency Medicine, Irvine, CaliforniaAddress for Correspondence: Kelly Kesler, MD, University of California, Irvine, School of Medicine, Department of Emergency Medicine, 333 The City Boulevard West, Suite 640, Orange, CA 92868. Email: kkesler@uci.edu.11 2016 20 10 2016 17 6 798 800 08 7 2016 15 9 2016 21 9 2016 © 2016 Kesler et al.2016This is an open access article distributed in accordance with the terms of the Creative Commons Attribution (CC BY 4.0) License. See: http://creativecommons.org/licenses/by/4.0/A 21-year-old woman was admitted to the emergency department (ED) with severe sepsis. Both the mechanism of infection and organisms discovered were unusual.\n==== Body\nINTRODUCTION\nPhysicians learn to identify and treat disease through pattern recognition. But what if the traditional patterns are violated, and the resulting diseases are unknown? How is a bizarre clinical finding rationalized? We present a case in which a societal epidemic, patient subterfuge and microbiologic mystery all intersected to provide a truly unique case report.\n\nThere have been few reports of unusual organism bacteremia in intravenous (IV) drug users, and none that we could find in the emergency medicine (EM) literature. A 2016 comprehensive review from Postgraduate Medical Journal (from the BMJ) of infective endocarditis (IE) lists common culprits as Staphylococcus aureus, Candida albicans and Pseudomonas species, among others, and alludes to saliva contamination among addicts.1 A 2012 review in the microbiology/infectious disease (ID) literature lists multiple unusual organisms causing IE,2 and a 2016 case report in the ID literature describes a case of persistent Bacillus cereus and Flavimonas bacteremia.3 However, none of these reports identify the organisms found in our patient’s blood. Even though blood culture results return after a patient is admitted from the emergency department (ED), emergency physicians frequently treat IV drug users with malingering behavior, and ferret out unusual causes for life-threatening presentations such as sepsis.\n\nPrescription opioid abuse has risen to epidemic proportions globally. Over the past 2.5 decades, prescriptions for oral narcotics have close to tripled or quadrupled.4 The United States is no exception; in 2014, 47,055 individuals in this country died from drug overdose with 18,893 of those related to prescription narcotics alone.5 This staggering number represents a 3.4 fold increase since 2000.5 In 2008, ED visits for non-medical use of prescribed or over-the-counter medications equaled that of visits related to illicit drugs.6 The increase in overdoses from opioid pain medications has risen in conjunction with the increase in narcotic prescriptions.7\n\nThese opioid analgesics can be taken in many forms; traditionally, the pills are taken by mouth but they can also be crushed and snorted or dissolved and injected intravenously (“mainlining”) or subcutaneously (“skin popping”).\n\nCASE REPORT\nA 21-year-old woman was transported to the ED via ambulance with a complaint of one week of fever, shortness of breath and generalized weakness. She also had a cough productive of green sputum, chest tightness, and redness to both arms at sites of previous peripheral IV insertions and her current midline catheter (peripheral long line to the axillary vein) in her left arm.\n\nShe provided a medical history of pulmonary alveolar proteinosis and asthma, and, per chart review, had a history of pseudoseizures, anxiety, and borderline personality. She had been hospitalized multiple times for pulmonary infections, most recently at another hospital twice in the previous week for similar symptoms. She was treated there for both cellulitis and pneumonia and was discharged home on IV daptomycin. She later received a phone call from the other hospital that IV aztreonam would be prescribed in response to a new positive blood culture. She did not recall the names of the bacteria. She self-administered aztreonam and daptomycin just prior to ED arrival. The patient stated that the other hospital inserted a peripheral IV near her left thumb that was removed when her surrounding skin turned red and drained pus. She reported frequent infections, citing cellulitis from multiple small insults, such as IV placements. She also reported anaphylaxis to many antibiotics.\n\nOn arrival, her vital signs were blood pressure 99/61 mm/Hg, heart rate 160 beats per minute, respiratory rate 22 respirations per minute, oxygen saturation 100% on 4 liters nasal cannula (NC, chronic home O2), and oral temperature 39.5° C. Physical exam showed moderate respiratory distress with the patient only able to speak in short sentences. She was tachycardic without audible murmur, had diffuse rhonchi in all lung fields, and flushed, warm skin. There was redness to her right antecubital fossa at the prior IV insertion site, the dorsum of her left hand, the previous PICC site in her left arm, and also her left antecubital fossa with tenderness over her current home midline IV. In fact, all her current and former upper extremity IV sites appeared red. However, there was no purulent drainage, induration, or areas of fluctuance.\n\nIn the ED, the patient received IV fluids and antipyretics. Electrocardiogram revealed sinus tachycardia. Chest radiograph demonstrated hazy bilateral mid and lower lung opacities with low lung volumes with possible subsegmental atelectasis, although consolidation could not be excluded. Serum chemistries measured Na+ 128 mmol/L (normal 135–145 mmol/L), K+ 2.8 mmol/L (normal 3.4–5.0 mmol/L), HCO3− 17 mmol/L (normal 20–29 mmol/L), lactate 0.8 mmol/L, and Mg++ 1.3 mg/dL (normal 1.8–2.5mg/dL) and PO4− < 1.0 mg/dL (normal 2.5–4.5mg/dL). Complete blood count demonstrated: white blood cell count 2.7 × 103/uL with a normal differential.\n\nThe patient was admitted to the internal medicine service on a telemetry bed with a working diagnosis of sepsis from a pulmonary source. As an inpatient, the medicine team obtained her previous medical records. The blood cultures from the other hospital grew Cronobacter sakazakii (formerly Enterobacter sakazakii) and Candida parapsilosis. The current admission blood cultures also grew C. parapsilosis as well as Staphylococcus saccharolyticus, and the patient was administered micafungin. The patient attempted to block access to other hospital records and only acquiesced if specific documents were not requested (e.g. discharge summary) because they were “wrong.” The ED case manager was notified by the case manager from the patient’s insurance company that the patient was abusive toward staff and left against medical advice (AMA) if she did not receive IV narcotics. She refused lab draws and some antibiotics on the basis of “anaphylaxis” unless she also received IV diphenhydramine and threatened to sign out AMA from the hospital. Her history of pseudoseizures was ultimately confirmed, including resolution of one episode of “convulsions” with IV normal saline. She also maintained that she required continuous NC O2, and yet did not desaturate when it was discontinued without her knowledge.\n\nShe was transitioned to oral fluconazole and levofloxacin as recommended by the ID consultant. However, the patient refused levofloxacin due to reported anaphylaxis, and she was treated with ciprofloxacin.\n\nDue to her history of line infections, the patient was placed on a 1:1 sitter for suspected line manipulation. The morning of discharge on hospital day 4, the patient was discovered with a syringe filled with partially dissolved hydromorphone that was hidden under her blankets. The sitter reported that the patient had been taking her oral pain medication underneath her blanket and, thus, had not been observed swallowing the pills. The organisms discovered in this patient’s blood, C. parapsilosis, C. sakazakii, and S. saccharolyticus, have been found in food and on human skin, and in hospital environs. It is likely that the patient was injecting her oral pain medications IV after dissolving them in her mouth, and contaminated her paraphernalia with organisms from her bedding, food, and saliva. She was discharged to home on two weeks of oral ciprofloxacin and fluconazole.\n\nDISCUSSION\nThis patient was so debilitated by her substance abuse disorder that she went to extreme measures to potentiate the effects of her oral narcotics by injecting them. The patient caused substantial self-harm and developed recurrent sepsis from pathogens typically found in the mouth, skin and environment. This explained the infection of all her former and current IV lines.\n\nCronobacter sakazakii is a gram negative bacterium that typically does not cause significant infection in adults, but can cause fatal meningitis infections in neonates and young children with underdeveloped immune systems.8 This organism is also found in some foods, especially plants, and oral contamination during IV drug use is the likely source of this bacteremia.9\n\nCandida parapsilosis is a lesser known fungal pathogen in the Candida genus that is commonly found on human skin and was previously unknown as a source of severe infections.6 However, it actually can cause significant fungemia and is reported to be the second leading cause of fungemia 10,11 behind C. albicans in certain populations. 9,12\n\nStaphylococcus saccharolyticus is an anaerobic, coagulase negative pathogen found as native skin flora.13 It has been rarely reported to cause nosocomial cases of bacteremia and infectious endocarditis.14\n\nCONCLUSION\nThe lesson to the astute clinician is to look beyond the usual patterns of disease when faced with atypical presentations. Given the patient’s pseudoseizures, multiple hospitalizations, unusual blood culture results, abusive and obstructive behavior, and deceitful information, it was prudent to investigate her previous records for malingering behavior. Further, the inpatient team astutely assigned a sitter for the patient, who ultimately exposed the root cause of her otherwise puzzling multi-organism bacteremia and sepsis.\n\nSection Editor: Rick A. McPheeters, DO\n\nFull text available through open access at http://escholarship.org/uc/uciem_westjem\n\nConflicts of Interest: By the WestJEM article submission agreement, all authors are required to disclose all affiliations, funding sources and financial or management relationships that could be perceived as potential sources of bias. The authors disclosed none.\n==== Refs\nREFERENCES\n1 Colville T Sharma V Albouaini K Infective Endocarditis in Intravenous Drug Users. Colville T Postgrad Med J 2016 92 105 11 26719453 \n2 Sousa C Botelho C Rodrigues D Infective endocarditis in intravenous drug abusers: an update Eur J Clin Microbiol Infect Dis 2012 31 2905 10 22714640 \n3 Goel N Munshi LB Thyagarajan B Intravenous Drug Abuse by Patients Inside the Hospital: A Cause for Sustained Bacteremia Case Rep Infect Dis 2016 2016 1 3 \n4 Paulozzi LJ Jones C Mack K Vital signs: overdoses of prescription opioid pain relievers—United States, 1999–2008 MMWR Morb Mortal Wkly Rep 2011 60 1487 92 22048730 \n5 Drugs of Abuse: Opioids National Institute on Drug Abuse website Available at: www.drugabuse.gov/drugs-abuse/opioids . Updated May 2016 Accessed June 1, 2016 \n6 Emergency department visits involving nonmedical use of selected prescription drugs—United States, 2004–2008 MMWR Morb Mortal Wkly Rep 2010 59 705 9 20559200 \n7 Bowen AB Braden CR Invasive Enterobacter sakazakii Disease in Infants Emerg Infect Diseases 2006 12 8 1 5 16610160 \n8 Hochel I Růžičková H Krásný L Occurrence of Cronobacter spp. in retail foods J Appl Microbiol 2012 112 6 1257 65 22443682 \n9 Van Asbeck EC Clemons KV Stevens DA Candida parapsilosis: a review of its epidemiology, pathogenesis, clinical aspects, typing and antimicrobial susceptibility Crit Rev Microbiol 2009 35 4 283 309 19821642 \n10 Lupetti A Tavanti A Davini P Horizontal transmission of Candida parapsilosis candidemia in a Neonatal Intensive Care Unit J Clin Microbiol 2002 40 7 2363 9 12089249 \n11 Weems JJ Jr Candida parapsilosis: epidemiology, pathogenicity, clinical manifestations, and antimicrobial susceptibility Clin Infect Dis 1992 14 3 756 66 1345554 \n12 Trofa D Gácser A Nosanchuk JD Candida parapsilosis, an emerging fungal pathogen Clin Microbiol Rev 2008 21 4 606 25 18854483 \n13 Manual of Clinical Microbiology 11th Edition Washington, D.C. ASM Press 2015 \n14 Krishnan S Haglund L Ashfaq A Prosthetic valve endocarditis due to Staphylococcus saccharolyticus Clin Infect Dis 1996 22 722 3 8729221\n\n", "fulltext_license": "CC BY", "issn_linking": "1936-900X", "issue": "17(6)", "journal": "The western journal of emergency medicine", "keywords": null, "medline_ta": "West J Emerg Med", "mesh_terms": "D000701:Analgesics, Opioid; D000900:Anti-Bacterial Agents; D000935:Antifungal Agents; D002939:Ciprofloxacin; D054714:Echinocandins; D004636:Emergency Service, Hospital; D005260:Female; D015725:Fluconazole; D006801:Humans; D055666:Lipopeptides; D008306:Malingering; D000077551:Micafungin; D009293:Opioid-Related Disorders; D018805:Sepsis; D013203:Staphylococcal Infections; D055815:Young Adult", "nlm_unique_id": "101476450", "other_id": null, "pages": "798-800", "pmc": null, "pmid": "27833691", "pubdate": "2016-11", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "16965695;22443682;8729221;27433362;19821642;18854483;26719453;12089249;22714640;22048730;20559200;1345554", "title": "Opioid Dependent Malingerer with Self-Induced Sepsis.", "title_normalized": "opioid dependent malingerer with self induced sepsis" }
[ { "companynumb": "US-GLENMARK PHARMACEUTICALS-2016GMK025505", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "LEVOFLOXACIN" }, "drugadditio...
{ "abstract": "OBJECTIVE\nTo present an atypical case of acute posterior multifocal placoid pigment epitheliopathy in a 15 year old treated with immunosuppressive therapy.\n\n\nMETHODS\nInterventional case report.\n\n\nRESULTS\nOn initial presentation, the vision was 20/200 in the right eye and 20/300 in the left eye. The posterior poles of both eyes showed numerous creamy-white placoid lesions. Fundus autofluorescence demonstrated hypoautofluorescence lesions with hyperautofluorescence rims, while fluorescein angiography showed early blockage followed by late staining. These findings were consistent with a diagnosis of acute posterior multifocal placoid pigment epitheliopathy. Optical coherence tomography demonstrated outer retinal disruptions and thinning. Due to the severity of his disease, the patient was treated first with oral prednisone and later transitioned to mycophenolate mofetil by 2 months. His poor vision persisted beyond a 5-month follow-up visit despite fading of the lesions and reconstitution of the outer retinal layers and thickness on optical coherence tomography. By 8 months of follow-up, the visual acuity returned to 20/20 bilaterally without any further recurrences.\n\n\nCONCLUSIONS\nAlthough most patients with acute posterior multifocal placoid pigment epitheliopathy have a relatively short course and recover vision quickly, the use of steroids and immunosuppression may be of benefit for those patients with severe and prolonged visual loss.", "affiliations": "Department of Ophthalmology, Scheie Eye Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania; and.;Department of Ophthalmology, Scheie Eye Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania; and.;Chester County Eye Care, West Chester, Pennsylvania.;Department of Ophthalmology, Scheie Eye Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania; and.", "authors": "Sulewski|Michael E|ME|;Kolomeyer|Anton M|AM|;Saran|Bruce R|BR|;Brucker|Alexander J|AJ|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1097/ICB.0000000000000881", "fulltext": null, "fulltext_license": null, "issn_linking": "1935-1089", "issue": "15(6)", "journal": "Retinal cases & brief reports", "keywords": null, "medline_ta": "Retin Cases Brief Rep", "mesh_terms": null, "nlm_unique_id": "101298744", "other_id": null, "pages": "756-759", "pmc": null, "pmid": "31764882", "pubdate": "2021-11-01", "publication_types": "D016428:Journal Article", "references": null, "title": "A 15-YEAR-OLD BOY WITH PROTRACTED VISION LOSS FROM ACUTE POSTERIOR MULTIFOCAL PLACOID PIGMENT EPITHELIOPATHY.", "title_normalized": "a 15 year old boy with protracted vision loss from acute posterior multifocal placoid pigment epitheliopathy" }
[ { "companynumb": "US-STRIDES ARCOLAB LIMITED-2020SP009629", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "MYCOPHENOLATE MOFETIL" }, "dru...
{ "abstract": "To compare the effects of gadoxetic acid and gadoteric acid on the image quality of single-breath-hold, triple (first, second, and third) arterial hepatic magnetic resonance imaging (MRI).\n\n\n\nTwo hundred and eleven patients were divided into two groups according to the contrast materials used (gadoxetic acid, 108 patients and gadoteric acid, 103 patients). All 3.0-T MR examinations included triple arterial phase acquisition using the 4D enhanced T1-weighted high-resolution isotropic volume examination (eTHRIVE) keyhole technique. The image qualities of the pre-contrast and triple arterial phases were assessed in terms of image artifacts, sharpness of the intrahepatic vessel and liver edge, and overall image quality with a 5-point scale for qualitative analysis.\n\n\n\nThe image quality of gadoxetic acid-enhanced liver MRI in the triple arterial phases was significantly degraded compared with that of gadoteric acid-enhanced liver MRI, although better image scores were observed in the pre-contrast images in the gadoxetic acid group (P < 0.001). The overall image quality gradually improved from the first to the third arterial phases in both groups (P < 0.003).\n\n\n\nIntravenous gadoxetic acid could have a detrimental effect on image quality of triple arterial phase MRI with the 4D eTHRIVE Keyhole technique. The third arterial phase images had the best image qualities; thus, they could be used as key scans.", "affiliations": "Department of Radiology, Korea University Anam Hospital, Korea University College of Medicine, 73, Goryeodae-ro, Seongbuk-gu, Seoul, 02841, Korea.;Department of Radiology, Korea University Anam Hospital, Korea University College of Medicine, 73, Goryeodae-ro, Seongbuk-gu, Seoul, 02841, Korea. radiolbj226@gmail.com.;Department of Radiology, Korea University Anam Hospital, Korea University College of Medicine, 73, Goryeodae-ro, Seongbuk-gu, Seoul, 02841, Korea.;Department of Radiology, Korea University Anam Hospital, Korea University College of Medicine, 73, Goryeodae-ro, Seongbuk-gu, Seoul, 02841, Korea.;Department of Radiology, Korea University Anam Hospital, Korea University College of Medicine, 73, Goryeodae-ro, Seongbuk-gu, Seoul, 02841, Korea.;Department of Radiology, Korea University Anam Hospital, Korea University College of Medicine, 73, Goryeodae-ro, Seongbuk-gu, Seoul, 02841, Korea.", "authors": "Sim|Ki Choon|KC|0000-0002-3344-8018;Park|Beom Jin|BJ|0000-0001-9729-4313;Han|Na Yeon|NY|;Sung|Deuk Jae|DJ|;Kim|Min Ju|MJ|;Han|Yeo Eun|YE|", "chemical_list": "D003287:Contrast Media; D006571:Heterocyclic Compounds; D009942:Organometallic Compounds; C073590:gadolinium ethoxybenzyl DTPA; C062402:gadoteridol; D005682:Gadolinium; D019786:Gadolinium DTPA", "country": "United States", "delete": false, "doi": "10.1007/s00261-019-02202-0", "fulltext": null, "fulltext_license": null, "issn_linking": null, "issue": "44(12)", "journal": "Abdominal radiology (New York)", "keywords": "Artifacts; Contrast media; Gd-EOB-DTPA; Image quality; Liver; Magnetic resonance imaging", "medline_ta": "Abdom Radiol (NY)", "mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D062485:Breath Holding; D003287:Contrast Media; D005260:Female; D005682:Gadolinium; D019786:Gadolinium DTPA; D006499:Hepatic Artery; D006571:Heterocyclic Compounds; D006801:Humans; D007089:Image Enhancement; D008279:Magnetic Resonance Imaging; D008297:Male; D008875:Middle Aged; D009942:Organometallic Compounds; D012189:Retrospective Studies", "nlm_unique_id": "101674571", "other_id": null, "pages": "4037-4047", "pmc": null, "pmid": "31471706", "pubdate": "2019-12", "publication_types": "D016428:Journal Article", "references": null, "title": "Effects of gadoxetic acid on image quality of arterial multiphase magnetic resonance imaging of liver: comparison study with gadoteric acid-enhanced MRI.", "title_normalized": "effects of gadoxetic acid on image quality of arterial multiphase magnetic resonance imaging of liver comparison study with gadoteric acid enhanced mri" }
[ { "companynumb": "KR-BAYER-2019-172864", "fulfillexpeditecriteria": "1", "occurcountry": "KR", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "GADOXETATE DISODIUM" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nPatients on linezolid-containing drug-resistant TB (DR-TB) regimen often develop adverse-events, particularly peripheral and optic neuropathy. Programmatic data and experiences of linezolid-associated optic neuropathy from high DR-TB burden settings are lacking. The study aimed to determine the frequency of and risk-factors associated with linezolid-associated optic neuropathy and document the experiences related to treatment/care of DR-TB patients on linezolid-containing regimens.\n\n\nMETHODS\nThis was a retrospective cohort study using routine clinical and laboratory data in Médecins Sans Frontières (MSF) HIV/DR-TB clinic in collaboration with Lilavati Hospital & Research Center, Mumbai, India. All DR-TB patients on linezolid-containing treatment regimens were included in the study and underwent routine evaluations for systemic and/or ocular complaints. Ophthalmological evaluation by a consultant ophthalmologist included visual-acuity screening, slit-lamp examination and dilated fundus examination.\n\n\nRESULTS\nDuring January 2013-April 2016, 86 of 136 patients (with/without HIV co-infection) initiated linezolid-containing DR-TB treatment. The median age of these 86 patients was 25 (20-35) years and 47% were males. 20 percent of them had HIV co-infection. Of 86, 24 (27.9%) had at least one episode of ocular complaints (the majority blurred-vision) and among them, five (5.8%) had optic neuropathy. Patients received appropriate treatment and improvements were observed. None of the demographic/clinical factors were associated with optic neuropathy in Poissons or multivariate binary logistic-regression models.\n\n\nCONCLUSIONS\nThis is the first report focusing on optic neuropathy in a cohort of complex DR-TB patients, including patients co-infected with HIV, receiving linezolid-containing regimens. In our study, one out of four patients on linezolid had at least one episode of ocular complaints; therefore, systematic monitoring of patients by primary physicians/nurses, and access to specialized diagnostic-services by specialists are needed. As linezolid will be increasingly added to treatment regimens of DR-TB patients, programmes should allocate adequate resources for early diagnosis, prevention and management of this disabling adverse event.", "affiliations": "Ophthalmology Department, Lilavati Hospital and Research Centre, Mumbai, India.;Médecins Sans Frontières, Mumbai, India.;Médecins Sans Frontières, Mumbai, India.;Médecins Sans Frontières, Mumbai, India.;Médecins Sans Frontières, Mumbai, India.;Médecins Sans Frontières, Mumbai, India.", "authors": "Mehta|Salil|S|;Das|Mrinalini|M|;Laxmeshwar|Chinmay|C|;Jonckheere|Sylvie|S|;Thi|Sein Sein|SS|;Isaakidis|Petros|P|", "chemical_list": "D000995:Antitubercular Agents; D000069349:Linezolid", "country": "United States", "delete": false, "doi": "10.1371/journal.pone.0162138", "fulltext": "\n==== Front\nPLoS OnePLoS ONEplosplosonePLoS ONE1932-6203Public Library of Science San Francisco, CA USA 2761143410.1371/journal.pone.0162138PONE-D-16-22332Research ArticleMedicine and Health SciencesNeurologyNeuropathyOptic NeuropathyBiology and Life SciencesNeuroscienceSensory PerceptionVisionBiology and Life SciencesPsychologySensory PerceptionVisionSocial SciencesPsychologySensory PerceptionVisionBiology and Life SciencesAnatomyHeadEyesMedicine and Health SciencesAnatomyHeadEyesBiology and Life SciencesAnatomyOcular SystemEyesMedicine and Health SciencesAnatomyOcular SystemEyesMedicine and Health SciencesOphthalmologyVisual ImpairmentsScotomaMedicine and Health SciencesDiagnostic MedicineDiagnostic RadiologyTomographyResearch and Analysis MethodsImaging TechniquesDiagnostic RadiologyTomographyMedicine and Health SciencesRadiology and ImagingDiagnostic RadiologyTomographyBiology and Life SciencesAnatomyOcular SystemOptic NerveMedicine and Health SciencesAnatomyOcular SystemOptic NerveBiology and Life SciencesNeuroscienceSensory PerceptionVisionVisual AcuityBiology and Life SciencesPsychologySensory PerceptionVisionVisual AcuitySocial SciencesPsychologySensory PerceptionVisionVisual AcuityMedicine and Health SciencesOphthalmologyLinezolid-Associated Optic Neuropathy in Drug-Resistant Tuberculosis Patients in Mumbai, India LZD-Associated Optic NeuropathyMehta Salil 1Das Mrinalini 2*Laxmeshwar Chinmay 2Jonckheere Sylvie 2Thi Sein Sein 2Isaakidis Petros 231 \nOphthalmology Department, Lilavati Hospital and Research Centre, Mumbai, India2 \nMédecins Sans Frontières, Mumbai, India3 \nMédecins Sans Frontières, Operational Research Unit, Luxembourg city, LuxembourgBhattacharya Sanjoy EditorBascom Palmer Eye Institute, UNITED STATESCompeting Interests: The authors have declared that no competing interests exist.\n\nConceived and designed the experiments: SM PI.\n\nPerformed the experiments: SM.\n\nAnalyzed the data: SM MD CL SJ PI.\n\nContributed reagents/materials/analysis tools: SJ SST PI MD CL.\n\nWrote the paper: SM MD PI CL SST SJ.\n\n\n\n\n* E-mail: msfocb-delhi-epi@brussels.msf.org9 9 2016 2016 11 9 e01621383 6 2016 24 7 2016 © 2016 Mehta et al2016Mehta et alThis is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.Background\nPatients on linezolid-containing drug-resistant TB (DR-TB) regimen often develop adverse-events, particularly peripheral and optic neuropathy. Programmatic data and experiences of linezolid-associated optic neuropathy from high DR-TB burden settings are lacking. The study aimed to determine the frequency of and risk-factors associated with linezolid-associated optic neuropathy and document the experiences related to treatment/care of DR-TB patients on linezolid-containing regimens.\n\nMethods\nThis was a retrospective cohort study using routine clinical and laboratory data in Médecins Sans Frontières (MSF) HIV/DR-TB clinic in collaboration with Lilavati Hospital & Research Center, Mumbai, India. All DR-TB patients on linezolid-containing treatment regimens were included in the study and underwent routine evaluations for systemic and/or ocular complaints. Ophthalmological evaluation by a consultant ophthalmologist included visual-acuity screening, slit-lamp examination and dilated fundus examination.\n\nResults\nDuring January 2013-April 2016, 86 of 136 patients (with/without HIV co-infection) initiated linezolid-containing DR-TB treatment. The median age of these 86 patients was 25 (20–35) years and 47% were males. 20 percent of them had HIV co-infection. Of 86, 24 (27.9%) had at least one episode of ocular complaints (the majority blurred-vision) and among them, five (5.8%) had optic neuropathy. Patients received appropriate treatment and improvements were observed. None of the demographic/clinical factors were associated with optic neuropathy in Poissons or multivariate binary logistic-regression models.\n\nDiscussion\nThis is the first report focusing on optic neuropathy in a cohort of complex DR-TB patients, including patients co-infected with HIV, receiving linezolid-containing regimens. In our study, one out of four patients on linezolid had at least one episode of ocular complaints; therefore, systematic monitoring of patients by primary physicians/nurses, and access to specialized diagnostic-services by specialists are needed. As linezolid will be increasingly added to treatment regimens of DR-TB patients, programmes should allocate adequate resources for early diagnosis, prevention and management of this disabling adverse event.\n\nThe author(s) received no specific funding for this work. Data AvailabilityAll relevant data are within the paper.Data Availability\nAll relevant data are within the paper.\n==== Body\nIntroduction\nLinezolid, a synthetic oxazolidinone antibiotic, has been shown to be efficacious in the treatment of mycobacterial infections, including multi-drug-resistant tuberculosis (MDR-TB, defined as tuberculosis resistant to rifampicin and isoniazid) [1]. It has shown a significant treatment benefit in two randomized-controlled trials and in small cohorts of MDR-TB patients, with this benefit being most pronounced in patients with additional resistance to fluoroquinolones and injectable anti-TB agents [2, 3]. In the most recent treatment guidelines by the World Health Organization (WHO, 2016) linezolid is recommended as a core second-line drug in the MDR-TB regimen [4].\n\nPatients on linezolid should be under close monitoring for adverse events, particularly anaemia, peripheral and optic neuropathy and lactic acidosis as these can be severe and life threatening. Linezolid inhibits bacterial protein synthesis but it has no major effect on the protein synthesis in mammalian cells. However, intracellular mitochondria are affected by linezolid and long-term administration of the drug may affect protein synthesis. It has been hypothesized that optic and peripheral neuropathy may potentially be the result of this mitochondrial dysfunction [5, 6].\n\nData on the frequency of linezolid-associated optic neuropathy are still relatively limited and rather inconclusive. Earlier studies of small cohorts and case series have reported relatively low prevalence of optic neuropathy among patients on linezolid ranged between 1.3% and 3.3% [7–9]. However, two recent meta-analyses have reported significantly higher prevalence at 13.2% (10/76 patients) in 2012 and 8% 923/246) in 2015 [10–11]. Programmatic data and experiences from high drug-resistant TB (DR-TB) burden settings are still lacking and the cascade of care of patients on linezolid is still not well described.\n\nLinezolid has recently come off patent and the traditionally high price of this drug is expected to drastically drop due to availability of generic products. It is also expected that the reduced price in combination with the increasing evidence on linezolid’s efficacy and safety and the new WHO treatment guidelines will lead in a dramatic increase in the global use of this drug. It is therefore important to report safety data, as well as programmatic experiences with the ophthalmological monitoring of DR-TB patients on linezolid-containing regimens.\n\nThe aim of this study was to determine the frequency of and risk factors associated with linezolid-associated optic neuropathy and document the experiences related to treatment and care of a cohort of DR-TB patients on linezolid-containing regimens in Mumbai.\n\nMethods\nEthics\nThe study has satisfied the criteria for reports using programmatic data, set by the Médecins Sans Frontières independent Ethics Review Board (MSF ERB), Geneva, Switzerland. Since the data used in the study were routinely collected, informed consent of the patient was not obtained. The MSF ERB specifically approved the study and waived the need for consent.\n\nStudy design\nThis study was a retrospective cohort study using routine clinical and laboratory data.\n\nStudy setting\nMédecins Sans Frontières (MSF) in Mumbai, India has been providing treatment and care to HIV and/or DR-TB patients since 2006, described elsewhere [12, 13]. All patients are managed on an out-patient basis by a multi-disciplinary team of trained clinicians, nurses, psychologists, counselors and social workers. Consultant clinical specialists (ophthalmologist, psychiatrist, gastroenterologist etc.) are contacted when needed during treatment and follow-up of the enrolled patients. Patients in need of ophthalmological evaluation were referred to a consultant ophthalmologist at Lilavati Hospital & Research Center, Mumbai, India, a large tertiary health care center.\n\nStudy population\nAll DR-TB patients, with or without HIV co-infection, who were initiated on linezolid-containing treatment regimens between January 2013 and April 2016 were included in this study.\n\nPatient follow-up and monitoring\nClinical evaluations\nSystemic evaluation was conducted as per the clinic follow-up protocol: this consisted of clinical assessment and laboratory monitoring, including complete and differential blood counts, hepatic and renal function tests, HIV markers (subtype of infection, viral load and CD4-counts), sputum collection or extrapulmonary biopsy as necessary. All collected samples underwent molecular studies, culture and drug susceptibility testing for first and second line anti-TB drugs. Appropriate radiography was also carried out. All patients on linezolid-containing regimens underwent a detailed clinical evaluation: patients were asked for systemic and ocular complaints. Visual acuity examination and Ishihara test was carried out by non-specialist clinicians on a routine basis. All self-reported symptomatic patients and all patients with positive findings during the clinical evaluation were referred for ophthalmological evaluation.\n\nOphthalmological evaluations\nPatients underwent a full ophthalmological evaluation by a consultant ophthalmologist including visual acuity screening, slit lamp examination and dilated fundus examination of the entire retina in all patients using an indirect ophthalmoscope.\n\nOptical coherence tomography was done whenever deemed necessary by the physician.\n\nData collection and analysis\nData were routinely collected during each consultation and entered into handwritten patient files and an electronic database.\n\nSelf-reported symptomatic patients and patients with positive findings during the clinical evaluation were defined as “presumptive linezolid-associated optic neuropathy”, while patients with “linezolid-associated optic neuropathy” were diagnosed by a specialist ophthalmologist.\n\nPatient characteristics were summarized using descriptive statistics. We used t-test, chi-square or Fisher’s exact test to assess differences of variables between groups, as appropriate. To identify factors associated with linezolid-associated neuropathy in DR-TB patients, bivariate and multivariate analyses were performed using Poisson and binary logistic regression models. A p-value of less than 0.05 was considered to indicate statistical significance. SPSS (Version 20.0, Armonk, NY: IBM Corp. Released 2011) was used for analysis.\n\nResults\nPatient characteristics\nBetween January 2013 and April 2016, 136 patients (with or without HIV co-infection) initiated DR-TB treatment. Of these, 86 had linezolid in their treatment regimen. The median age of these patients was 25 (20–35) years and 47% were males. 20 per cent of the patients were co-infected with HIV and 42% had DR-TB that was also resistant to a fluoroquinolone or an aminoglycoside.\n\nOf these 86 DR-TB patients on linezolid, 24 (27.9%) had at least one episode of ocular complaints (the majority blurred vision) and were referred to the consultant ophthalmologist. Of these, five patients (5.8%, 95% Confidence Intervals: 0.9% to 10.7%) were diagnosed with optic neuropathy. The diagnosis cascade of patients on linezolid-containing regimens in this Mumbai cohort is shown in Fig 1.\n\n10.1371/journal.pone.0162138.g001Fig 1 Linezolid-associated optic neuropathy cascade in DR-TB patients, Mumbai, India.\nClinical characteristics of patients on linezolid-containing regimens are presented in Table 1 while characteristics of patients with linezolid-associated optic neuropathy are shown in Table 2. None of the factors were associated with ‘presumptive linezolid-associated optic neuropathy’ or ‘linezolid-associated optic neuropathy’ in Poissons or multivariate binary logistic regression models.\n\n10.1371/journal.pone.0162138.t001Table 1 Demographic and clinical characteristics of drug-resistant tuberculosis patients on Linezolid-containing regimen in Mumbai, India, January 2013-April 2016.\nExplanatory Variable\tDR-TB patients on Lzd-containing regimen (N = 86), n(%)\tPatients with presumptive optic neuropathy┼ (N = 24), n(%)\tPatients without presumptive optic neuropathy┼(N = 62), n (%)\tChi-square/ t-test (p-value)\t\nAge [years, mean (SD)]\t27.5 (9.9)\t29.1 (10.1)\t26.9 (9.9)\t0.94 (0.35)\t\nSex of patients\t\t\t\t\t\nMale\t40 (46.5)\t13 (32.5)\t27 (67.5)\t0.78 (0.38)\t\nFemale\t46 (53.5)\t11 (23.9)\t35 (76.1)\t\t\nHIV co-infection\t17 (19.8)\t6 (35.3)\t11 (64.7)\t0.58 (0.45)\t\nTB site\t\t\t\t\t\nPulmonary\t80 (93.0)\t22 (27.5)\t58 (72.5)\t0.2 (1.0)\t\nExtra-pulmonary\t6 (7.0)\t2 (33.3)\t4 (66.7)\t\t\nDR-TB resistance pattern\t\t\t\t\t\nPDR or MDR\t7 (8.1)\t3 (42.9)\t4 (57.1)\t6.1 (<0.05)\t\nPre-XDR\t36 (41.9)\t5 (13.9)\t31 (86.1)\t\t\nXDR and above\t43 (50.0)\t16 (37.2)\t27 (62.8)\t\t\n┼Row percentage in parenthesis; Lzd: linezolid; SD: Standard deviation; PDR: Poly-drug resistant; MDR: Multi-drug resistant; Pre-XDR: Pre-extensively-drug resistant; XDR: Extensively drug resistant\n\n10.1371/journal.pone.0162138.t002Table 2 Demographic and clinical characteristics of drug-resistant tuberculosis patients with linezolid-associated optic neuropathy, Mumbai, January 2013-April 2016.\nCase\tSex /Age\tTB site\tDR-TB pattern\tClinical symptoms/ signs\tOphthalmological Evaluation (in either eye)\tTreatment regimen\tLZD(m)\t\n1\tF/22\tPTB\tXDR\t- B/L blurring of vision, -S/S of Peripheral neuropathy\t-VA: 6/60, NV<N36, -OM & ASE with slit lamp: N, DLE: B/L hyperemic, mildly elevated optic nerve heads, -R&V: N\tCapreomycin inj 750 mg OD, levofloxacin 750 mg OD, cycloserine 500 mg OD, Para-amino-salicylate 9gm/day, amoxicilline-clavulanate 625mg TDS, clofazimine 100mg OD, linezolid 600 mg OD), bedaquilline\t11\t\n2\tF/22\tPTB\tXDR\t- B/L blurring of vision-S/S of Peripheral neuropathy\t-VA: 6/24, NV<N36, -OM & ASE with slit lamp: N, -DLE: B/L mildly hyperemic, elevated optic nerve heads-R&V: N\tCapreomycin 1g OD, Ethambutol 800 mg/day levofloxacin 1000 mg OD, cycloserine 500 mg OD, Para-amino-salicylate PAS, 9.2 gm/day, clofazimine 100 mg OD, amoxycilin-clavulanic acid 625mg TDS, linezolid 600 mg OD\t11\t\n3\tM/25\tPTB\tMDR\t- B/L blurring of vision\t-VA: 6/60, NV<N36-OM & ASE with slit lamp: N-DLE: B/L mildly hyperemic, elevated optic nerve heads-R&V: N\tlevofloxacin 1000 mg OD, cycloserine 500 mg OD, Para-amino-salicylate 9.2 gm/day, clofazimine 100 mg OD, amoxycilin-clavulanic acid 1000 mg/250 mg/ day, linezolid 600 mg OD\t10\t\n4\tF/29\tPTB\tXXDR\t- B/L blurring of vision\t-VA: 6/45 (R), 6/30 (L), NV<N36-OM & ASE with slit lamp: N-DLE: B/L mildly hyperemic, elevated optic nerve heads-R&V: N\tCapreomycin inj 750 mg OD, clofazimine 100 mg OD, amoxycilin-clavulanic acid 1000 mg/250 mg/ day, linezolid 600 mg OD\t7\t\n5\tM/32\tPTB\tXXDR\t- B/L blurring of vision\t-VA: 6/60, NV<N36-OM & ASE with slit lamp: N-DLE: B/L mildly hyperemic, elevated optic nerve heads-R&V: N\tCapreomycin inj 1000 mg OD, ethionamide 750 mg OD, clofazimine 100 mg OD, linezolid 600 mg OD, Delamanid 100mg BD, Imipenem 1g BD, Amoxi-Clav 625mg TDS\t11\t\nF: Female; M: Male; PTB: Pulmonary TB; DR-TB: Drug resistant TB; XDR: Extensively drug-resistant; MDR: Multi drug-resistant; XXDR: Extremely drug-resistant; B/L: Bilateral; S/S: Symptoms & Signs; VA: Visual acuity; R: right; L: left; NV: near vision; OM & ASE: ocular motility and anterior segment evaluation; DLE: Dilated fundus examination; R &V: retina & vasculature; OD: once daily; Lzd (m): Duration of Linezolid administration in months\n\nOphthalmological findings and patient management\nCase 1\nA 23 year old female presented with bilateral blurring of vision for 15 days. Significant medical history included pain and difficulty in walking, suggestive of a peripheral neuropathy since a few weeks prior to the visual symptoms.\n\nOn examination, her best corrected visual acuity was 6/60 and near vision < N36 in either eye. Examination of ocular motility and anterior segment evaluation with a slit lamp were normal. Dilated fundus examination revealed hyperemic, mildly elevated optic nerve heads bilaterally. The retina and vasculature were normal. A preliminary diagnosis of optic neuropathy, presumably due to linezolid toxicity was suggested. She underwent fundus photography and an optical coherence tomography (OCT, RNFL program, Stratus OCT, Carl Zeiss Meditec Inc., Dublin, CA) of the optic nerve head bilaterally but declined to undergo perimetry.\n\nShe was started empirically on oral prednisolone (40 mg daily tapering by 10 mg weekly), linezolid was discontinued and the patient was followed up. She underwent repeat OCT on day 8 and on day 22. By her last follow up her visual acuity improved to 6/6 bilaterally with N6 near vision. There was a marked reduction of the optic nerve head swelling to near normalcy.\n\nAt the first OCT examination (RNFL), there was a generalised increase in the RNFL thickness in all quadrants, which rapidly decreased over the follow up period.\n\nAfter 10 weeks of interruption, Linezolid 300mg OD was re-introduced and patient was doing well during the treatment.\n\nCase 2\nA 24-year-old female patient presented with bilateral blurring of vision for 10 days and paresthesia and pain in both hands (suggestive of a peripheral neuropathy).\n\nOn examination, her best corrected visual acuity was 6/24 and near vision < N36 in either eye. Examination of ocular motility and anterior segment evaluation with a slit lamp were normal. Dilated fundus examination revealed mildly hyperemic and elevated optic nerve heads bilaterally. The retina and vasculature were normal. A preliminary diagnosis of linezolid induced optic neuropathy with an additional differential diagnosis of ethambutol toxicity. She underwent a perimetry (SITA fast, central 30–2, Carl Zeiss Meditec Inc., Dublin, CA), fundus photography and an optical coherence tomography (OCT) of the optic nerve head bilaterally.\n\nShe was started empirically on oral prednisolone (40 mg daily tapering by 10 mg weekly) and was followed up. Ethambutol was discontinued permanently, and linezolid was interrupted for about four months. She underwent repeat OCT on day 18 and on day 25 and repeat perimetry on day 45. During the last follow-up (day 45) of the patient, visual acuity has improved to 6/6 bilaterally with N6 near vision. There was a marked reduction of the optic nerve head swelling to normalcy.\n\nThe OCT test results showed similar findings of generalized RNFL thickness, which rapidly subsided. The visual field analysis performed on the Humphrey 24–2 SITA fast program showed dense central bitemporal defects that respected the vertical midline and had associated cecocentral scotomas bilaterally. There was a rapid reduction in scotoma size and intensity over the follow-up. No recurrence of adverse events after re-initiation of Linezolid 60 mg in the treatment regimen of the patient. The perimetric findings are shown in Fig 2.\n\n10.1371/journal.pone.0162138.g002Fig 2 Perimetric Findings of Case 2; A) Right eye at diagnosis showing centrocecal scotomas with an associated bitemporal central scotoma and B) Right eye at day 45 showing resolution. Similar findings are seen in the Left eye at diagnosis (C) and at day 45 (D).\n\nCase 3\nA 25 year old male presented with bilateral blurring of vision for one week and no signs or symptoms of peripheral neuropathy.\n\nThe vision as tested on his initial visit was 6/6 bilaterally with a normal appearing fundus. This visual loss rapidly progressed over a week to 6/60 with near vision < N36 in either eye. He was fully reevaluated. Examination of ocular motility and anterior segment evaluation with a slit lamp were normal. Dilated fundus examination revealed mildly hyperemic and elevated optic nerve heads bilaterally. The retina and vasculature were normal.\n\nA preliminary diagnosis of linezolid induced optic neuropathy was made and he was started on oral prednisolone (40 mg daily tapering by 10 mg weekly) and was followed up. Linezolid tablets were discontinued. He underwent a magnetic resonance imaging (MRI) of the brain and orbits with gadolinium contrast and it was normal.\n\nHe underwent a perimetry (central 30–2), fundus photography and an optical coherence tomography (OCT) of the optic nerve head bilaterally. He underwent repeat OCT on day 10 and day 45 and a repeat perimetry on day 45.\n\nThe vision improved significantly over the next few weeks and at day 45 follow-up he was reading 6/6 with normal N6 visual acuity.\n\nThe OCT test results showed similar findings of generalized RNFL thickness, which rapidly subsided. The initial perimetry showed generalized reduction of sensitivity bilaterally along with centrocecal scotomas in the left eye with a central temporal scotoma. No such scotoma was seen in the right eye. There was a rapid reduction in scotoma size and intensity over the follow-up period.\n\nCase 4\nA 29-year-old female patient presented with a 7-day history of bilateral blurred vision. There were no symptoms or signs suggestive of peripheral neuropathy. She was fully evaluated and examination of ocular motility and anterior segment evaluation with a slit lamp were normal. Her visual acuity was 6/45 in the right eye and 6/30 in the left with <N36 near acuity. Dilated fundus examination revealed mildly hyperemic and elevated optic nerve heads bilaterally. The retina and vasculature were normal. A preliminary diagnosis of linezolid induced optic neuropathy was made and linezolid tablets were discontinued.\n\nShe underwent an initial perimetry (central 30–2) and fundus photography. The initial perimetry showed generalized reduction of sensitivity bilaterally along with centrocecal scotomas in either eye along with a central bitemporal scotoma. She underwent a magnetic resonance imaging (MRI) of the brain and orbits with gadolinium contrast but it was normal in all respects.\n\nAt day 38 follow-up, her visual acuity had improved to 6/15 bilaterally and N8 for near but there was a worsening of her visual fields bilaterally. A quadrantanopia had developed in the right eye.\n\nOn her last follow-up at day 78, her visual acuity was 6/6 bilaterally and a repeat perimetry showed a marked improvement of her left eye to near normalcy and a significant reduction of the scotomas in her right eye.\n\nThe perimetric findings are shown in Fig 3.\n\n10.1371/journal.pone.0162138.g003Fig 3 Perimetric Findings of Case 4; A) Right eye at diagnosis showing centrocecal scotomas with an associated bitemporal central scotoma and B) Right eye at day 38 showing worsening. Similar findings are seen in the Left eye at diagnosis (C) and at day 38 (D).\n\nCase 5\nA 25-year-old male presented with complaints of bilateral blurring of vision for two weeks. The patient reported no symptoms or signs suggestive of peripheral neuropathy.\n\nThe vision as tested on his initial visit was 6/60 with near vision < N36 in either eye. Examination of ocular motility and anterior segment evaluation with a slit lamp were normal. Dilated fundus examination revealed mildly hyperemic and elevated optic nerve heads bilaterally. The retina and vasculature were normal. Linezolid tablets were discontinued. There were no symptoms or signs suggestive of peripheral neuropathy.\n\nHe underwent an initial perimetry (central 30–2) and fundus photography. He declined to undergo an optical coherence tomography (OCT) of the optic nerve heads. The perimetry showed generalized reduction of sensitivity bilaterally along with centrocecal scotoma in the left eye associated with a central temporal scotoma. No scotoma was seen in the right eye. Linezolid (600mg on alternate days) was re-introduced after 3 weeks of discontinuation. He underwent a magnetic resonance imaging (MRI) of the brain and orbits with gadolinium contrast and it was normal in all respects.\n\nDiscussion\nIn this study we report relative low rates of linezolid-associated optic neuropathy in a cohort of complex DR-TB patients, including patients co-infected with HIV, receiving linezolid-containing regimens in Mumbai, India. This is among the first studies that report on the programmatic use of linezolid in India and to our knowledge, this is the first detailed report focusing specifically on optic neuropathy among DR-TB patients receiving linezolid.\n\nWe describe a satisfactory cascade of treatment and care among patients receiving linezolid in this Mumbai cohort. The clinical team has been systematically monitoring the patients using verbal screening, visual acuity and Ishihara tests; virtually all patients on linezolid-containing regimens have been screened at least once. Having access to specialized ophthalmological services and a consultant ophthalmologist was an essential component in the cascade.\n\nOverall, one out of four patients on linezolid had at least one episode of ocular complaints, usually blurred vision. Of symptomatic patients one in five were finally diagnosed with linezolid-associated optic neuropathy and the overall prevalence of optic neuropathy was 6 per cent. We needed to screen 5 symptomatic patients to find a new case of optic neuropathy (NNS = 5).\n\nOur findings compare with the latest systematic review and meta-analysis of a total of 367 patients on linezolid-containing regimens. Among 246 patients with data on optic neuritis 23 (8%) had optic neuritis and there was no statistically significant difference between high and low dose of the drug, using a cut-off of 600mg/day [11]. A previous meta-analysis of 121 patients has reported higher frequency of optic neuropathy (10/76, 13.2%) [10]. Interestingly, previous case-series and small programmatic cohorts have reported lower prevalence of optic neuropathy among patients on linezolid. Schecter at al reported 1/30 (3.3%) patients with optic neuropathy in a North American cohort, Udwadia and colleagues from Mumbai reported 1/78 (1.3%), while in a previous analysis of the Mumbai cohort pooled with a South African MSF cohort we found 1/34 (2.9%) patients with optic neuropathy [7–9]. The global cohort of patients with DR-TB on linezolid-containing regimens remains very small and we need more data from randomized studies and large programmatic cohorts in order to understand the true magnitude of linezolid toxicity.\n\nIn this cohort linezolid neuropathy was presented as an acute, profound and bilateral visual loss but with a varied fundus picture. The visual acuities of the patients ranged from 6/24 to 6/60 while the near vision was <N36 in these five patients. Examination of ocular motility and anterior segment evaluation with a slit lamp were normal. A dilated fundus examination revealed bilateral hyperemic, mildly elevated optic nerve heads in these five patients while the retina and vasculature were normal.\n\nThe optical coherence tomography (OCT) showed generalised increases that rapidly improved over the follow up period. This is a common finding in all toxic neuropathies and did not appear to be specific for linezolid toxicity. This increase in the RNFL thickness is due to axoplasmic stasis for the axons of the ganglion cells.\n\nWe used the Guided Progression Analysis (GPA) software (ver. 6.0) to study potential RNFL loss over subsequent visits. All three patients demonstrated areas of possible or likely loss. The normative database is relatively small and has been extensively used for open angle glaucoma. No data exists on its applicability in toxic or drug neuropathies and thus, we are unable to comment on whether this constitutes true subclinical RNFL loss as most eyes recovered to normalcy without residual scotomas or is a statistical fallacy. Recently, there has been a resurgence of interest in using GPA in demyelinating optic nerve disease, associated with multiple sclerosis, specifically for prognosticating outcomes. Further data might suggest a role for serial OCTs in drug induced optic neuropathies.\n\nThere were consistent perimetric findings and these may reflect toxicity in a specific topographic pattern especially to the papillomacular bundle as well as to chiasmal fibers. Improvement was seen in all patients over a few weeks (usually a month). This was seen in patients who received oral steroids (tapered over a month) as well as those not receiving steroid treatment. Saijo et al. have suggested that oral corticosteroid treatment might be deleterious in these patients but we noted a marked improvement in all treated patients [14]. However, a larger dataset would be needed to allow any definite conclusions on the benefit of steroids in this condition.\n\nWe looked at the available literature for data or images to assess the visual field pathologies. Eight studies have described the perimetric findings of 11 patients and this included one patient with unspecified bilateral visual field defects, four patients with bilateral centrocecal scotoma, two with bilateral central scotomas and one patient with quadrantanopia [14–23]. We analyzed the perimetric data of eight eyes of four patients and six eyes demonstrated a distinct pattern of a cecocentral scotoma associated with a central bitemporal scotoma that respects the vertical midline. This is unusual in that most toxic and nutritional optic neuropathies conventionally described lack this finding. None of the authors of studies of linezolid neuropathy have described this distinctive finding so far. There was a rapid decrease in the depth and size of the scotoma over a few weeks with most eyes returning to the baseline.\n\nSimilar findings were seen in the visual fields of patients with ethambutol toxicity. Kho et al described the perimetric findings in 19 patients [24]. The majority showed scotomas that were denser in the temporal fields, usually with margination along the vertical midline with associated central or cecocentral scotomas. These were similar to our findings. They postulated that ethambutol might selectively affect the fibers in the chiasm that cross over and recommended neuroimaging but their imaging was normal.\n\nEthambutol and linezolid appear to have similar and specific perimetric patterns that may reflect a related mechanism of toxicity involving mitochondrial dysfunction.\n\nThere are some limitations to this study. First, the study design was retrospective and the data were routinely collected in a specific programmatic setting. Our findings may not be applicable to other populations. Second, the cohort size was small and the finding should be interpreted with caution. However given the small size of the global cohort of DR-TB patients on linezolid-containing regimens we believe that our study contributed a significant amount of data to the evidence-base.\n\nAs linezolid will be increasingly added to treatment regimens of DR-TB patients around the world, regular ophthalmological screening may help in early identification of patients with linezolid-associated neuropathy. Clinicians, ophthalmologists, public health specialists and programme managers will increasingly encounter linezolid-associated toxicity, including a small but important proportion of patients with optic neuropathy. Systematic monitoring of patients by primary physicians and nurses, as well as access to specialized diagnostic services by specialists will be needed. Programmes should be prepared and allocate adequate resources in order to early diagnose, prevent and aggressively manage this disabling adverse event.\n\nThe authors wish to acknowledge the contributions of health care workers from the Lilavati Hospital and Research Centre, Médecins Sans Frontières clinic and the patients suffering from drug resistant tuberculosis and their families.\n==== Refs\nReferences\n1 Alcala L , Ruiz-Serrano MJ , Perez-Fernandez Turegano C , et al\nIn vitro activities of linezolid against clinical isolates of Mycobacterium tuberculosis that are susceptible or resistant to first-line antituberculous drugs . Antimicrob Agents Chemother \n2003 ; 47 : 416 –417 . 12499228 \n2 Tang S , Yao L , Hao X , Zhang X , Liu G , Liu X , et al\nEfficacy, safety and tolerability of linezolid for the treatment of XDR-TB: a study in China . Eur Respir J . 2015 \n1 ;45 (1 ):161 –170 . 10.1183/09031936.00035114 \n25234807 \n3 Lee M , Lee J , Carroll MW , Choi H , Min S , Song T , et al\nLinezolid for Treatment of Chronic Extensively Drug-Resistant Tuberculosis . N Engl J Med . 2012 ;367 (16 ):1508 –1518 . 10.1056/NEJMoa1201964 \n23075177 \n4 WHO treatment guidelines for drug-resistant tuberculosis 2016 update. Available: http://www.who.int/tb/areas-of-work/drug-resistant-tb/treatment/resources/en/\n5 Javaheri M , Khurana RN , O'hearn TM , Lai MM , Sadun AA . Linezolid-induced optic neuropathy: a mitochondrial disorder? \nBr J Ophthalmol . 2007 \n1 ;91 (1 ):111 –115 . 17179125 \n6 Rucker JC , Hamilton SR , Bardenstein D , Isada CM , Lee MS . Linezolid-associated toxic optic neuropathy . Neurology . 2006 \n2 \n28 ;66 (4 ):595 –598 . 16505322 \n7 Schecter GF , Scott C , True L , Raftery A , Flood J , Mase S . Linezolid in the treatment of multidrug-resistant tuberculosis . Clin Infect Dis . 2010 \n1 \n1 ; 50 (1 ):49 –55 . 10.1086/648675 \n19947856 \n8 Udwadia ZF , Sen T , Moharil G . Assessment of linezolid efficacy and safety in MDR- and XDR-TB: an Indian perspective . Eur Respir J . 2010 \n4 ;35 (4 ):936 –8 ; author reply 938–940. 10.1183/09031936.00132009 \n20356997 \n9 Hughes J , Isaakidis P , Andries A , Mansoor H , Cox V , Meintjes G , Cox H . Linezolid for multidrug-resistant tuberculosis in HIV-infected and–uninfected patients . Eur Respir J . 2015 \n7 ;46 (1 ):271 –274 . 10.1183/09031936.00188114 \n25837033 \n10 Sotgiu G , Centis R , D'Ambrosio L , Alffenaar JW , Anger HA , Caminero JA \net al\nEfficacy, safety and tolerability of linezolid containing regimens in treating MDR-TB and XDR-TB: systematic review and meta-analysis . Eur Respir J . 2012 \n12 ; 40 (6 ):1430 –1442 . 10.1183/09031936.00022912 \n22496332 \n11 Zhang X , Falagas ME , Vardakas KZ , Wang R , Qin R , Wang J , Liu Y . Systematic review and meta-analysis of the efficacy and safety of therapy with linezolid containing regimens in the treatment of multidrug-resistant and extensively drug-resistant tuberculosis . J Thorac Dis . 2015 \n4 ;7 (4 ):603 –615 . 10.3978/j.issn.2072-1439.2015.03.10 \n25973226 \n12 Isaakidis P , Cox HS , Varghese B , Montaldo C , Silva ED , Mansoor H et al. Ambulatory multi-drug resistant tuberculosis treatment outcomes in a cohort of HIV-infected patients in a slum setting in Mumbai, India . PloS ONE \n2011 ; 6 (12 ): e28066 \n10.1371/journal.pone.0028066 \n22145022 \n13 Isaakidis P , Varghese B , Mansoor H , Cox HS , Ladomirska J , Saranchuk P , Da Silva E , Khan S , Paryani R , Udwadia Z , Migliori GB , Sotgiu G , Reid T . Adverse events among HIV/MDR-TB co-infected patients receiving antiretroviral and second line anti-TB treatment in Mumbai, India . PLoS One . 2012 ;7 (7 ):e40781 \n10.1371/journal.pone.0040781 \n22792406 \n14 Saijo T , Hayashi K , Yamada H , Wakakura M . Linezolid-induced optic neuropathy . Am J Ophthalmol . 2005 \n6 ; 139 (6 ):1114 –1116 . 15953450 \n15 Agrawal R , Addison P , Saihan Z , Pefkianaki M , Pavesio C . Optic neuropathy secondary to Linezolid for multidrug-resistant mycobacterial spinal tuberculosis . Ocul Immunol Inflamm . 2015 \n2 ; 23 (1 ): 90 –92 . 10.3109/09273948.2013.874447 \n24432953 \n16 Karuppannasamy D , Raghuram A , Sundar D . Linezolid-induced optic neuropathy . Indian J Ophthalmol . 2014 \n4 ; 62 (4 ): 497 –500 . 10.4103/0301-4738.118451 \n24088636 \n17 Han J , Lee K , Rhiu S , Lee JB , Han SH . Linezolid-associated optic neuropathy in a patient with drug-resistant tuberculosis . J Neuroophthalmol . 2013 \n9 ; 33 (3 ): 316 –318 . 10.1097/WNO.0b013e31829b4265 \n23912768 \n18 Kiuchi K , Miyashiro M , Kitagawa C , Wada S . Linezolid-associated optic neuropathy in a patient with ocular sarcoidosis . Jpn J Ophthalmol . 2009 \n7 ; 53 (4 ): 420 –424 . 10.1007/s10384-009-0678-3 \n19763761 \n19 Cleveland KO , Gelfand MS . Optic neuropathy following linezolid use in a patient with acute lymphocytic leukemia . Clin Infect Dis . 2009 \n8 \n15 ; 49 (4 ): 645 –646 .\n20 Joshi L , Taylor SR , Large O , Yacoub S , Lightman S . A case of optic neuropathy after short-term linezolid use in a patient with acute lymphocytic leukemia . Clin Infect Dis . 2009 \n4 \n1 ; 48 (7 ): e73 –74 . 10.1086/597298 \n19231981 \n21 Kulkarni K , Del Priore LV . Linezolid induced toxic optic neuropathy . Br J Ophthalmol . 2005 \n12 ; 89 (12 ): 1664 –1665 . 16299156 \n22 McKinley SH , Foroozan R . Optic neuropathy associated with linezolid treatment . J Neuroophthalmol . 2005 \n3 ; 25 (1 ): 18 –21 . 15756127 \n23 Lee E , Burger S , Shah J , Melton C , Mullen M , Warren F \net al\nLinezolid-associated toxic optic neuropathy: a report of 2 cases . Clin Infect Dis . 2003 \n11 \n15 ; 37 (10 ): 1389 –91 . Epub 2003 Oct 17. 14583875 \n24 Kho RC , Al-Obailan M , Arnold AC . Bitemporal visual field defects in ethambutol-induced optic neuropathy . J Neuroophthalmol . 2011 \n6 ;31 (2 ):121 –126 . 10.1097/WNO.0b013e318205a148 \n21597402\n\n", "fulltext_license": "CC BY", "issn_linking": "1932-6203", "issue": "11(9)", "journal": "PloS one", "keywords": null, "medline_ta": "PLoS One", "mesh_terms": "D000328:Adult; D000995:Antitubercular Agents; D005260:Female; D006801:Humans; D007194:India; D000069349:Linezolid; D008297:Male; D009901:Optic Nerve Diseases; D012189:Retrospective Studies; D018088:Tuberculosis, Multidrug-Resistant; D055815:Young Adult", "nlm_unique_id": "101285081", "other_id": null, "pages": "e0162138", "pmc": null, "pmid": "27611434", "pubdate": "2016", "publication_types": "D016428:Journal Article", "references": "21597402;22145022;19947856;15756127;25837033;14583875;19619050;25234807;22496332;25973226;16299156;20356997;17179125;24432953;22792406;24088636;19763761;23075177;23912768;15953450;16505322;19231981;12499228", "title": "Linezolid-Associated Optic Neuropathy in Drug-Resistant Tuberculosis Patients in Mumbai, India.", "title_normalized": "linezolid associated optic neuropathy in drug resistant tuberculosis patients in mumbai india" }
[ { "companynumb": "IN-GLENMARK GENERICS (EUROPE) LTD-2016GMK024819", "fulfillexpeditecriteria": "1", "occurcountry": "IN", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "LEVOFLOXACIN" }, "drug...
{ "abstract": "Immune checkpoint inhibitors (ICIs) have demonstrated marked efficacy in some cancer patients, but they may cause various severe immune-related adverse events. Alectinib is a second-generation anaplastic lymphoma kinase (ALK)-tyrosine kinase inhibitor (TKI) approved for ALK-rearranged non-small-cell lung cancer (NSCLC). Alectinib is said to be safer than other TKIs. We conducted an investigator-initiated trial of alectinib, which also has RET kinase-inhibitory activity, against RET-rearranged NSCLC. Two RET-rearranged NSCLC patients experienced severe skin toxicity with alectinib after first undergoing anti-PD-1 antibody treatment with an ICI. These findings suggest that we should carefully follow patients for adverse effects of targeted drugs following ICI treatment.", "affiliations": "Division of Medical Oncology, Cancer Research Institute, Kanazawa University, Japan.;Department of Thoracic Oncology, Hyogo Cancer Center, Japan.;Division of Medical Oncology, Cancer Research Institute, Kanazawa University, Japan.;Division of Medical Oncology, Cancer Research Institute, Kanazawa University, Japan.;Department of Thoracic Oncology, Hyogo Cancer Center, Japan.;Innovative Clinical Research Center (iCREK), Kanazawa University Hospital, Japan.;Division of Medical Oncology, Cancer Research Institute, Kanazawa University, Japan.", "authors": "Nishiyama|Akihiro|A|;Hattori|Yoshihiro|Y|;Takeuchi|Shinji|S|;Tanimoto|Azusa|A|;Satouchi|Miyako|M|;Murayama|Toshinori|T|;Yano|Seiji|S|", "chemical_list": null, "country": "Japan", "delete": false, "doi": "10.2169/internalmedicine.7472-21", "fulltext": "\n==== Front\nIntern Med\nIntern Med\nInternal Medicine\n0918-2918\n1349-7235\nThe Japanese Society of Internal Medicine\n\n34803090\n10.2169/internalmedicine.7472-21\nCase Report\nSevere Skin Toxicity Caused by Sequential Anti-PD-1 Antibody and Alectinib in Non-small-cell Lung Cancer: A Report of Two Cases and a Literature Review\nNishiyama Akihiro 12\nHattori Yoshihiro 3\nTakeuchi Shinji 12\nTanimoto Azusa 12\nSatouchi Miyako 3\nMurayama Toshinori 4\nYano Seiji 12\n1 Division of Medical Oncology, Cancer Research Institute, Kanazawa University, Japan\n2 Cancer Center, Kanazawa University Hospital, Japan\n3 Department of Thoracic Oncology, Hyogo Cancer Center, Japan\n4 Innovative Clinical Research Center (iCREK), Kanazawa University Hospital, Japan\nCorrespondence to Dr. Akihiro Nishiyama, an0510@staff.kanazawa-u.ac.jp\n\n20 11 2021\n1 6 2022\n61 11 17351738\n3 3 2021\n1 9 2021\nCopyright © 2022 by The Japanese Society of Internal Medicine\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ The Internal Medicine is an Open Access journal distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).\nImmune checkpoint inhibitors (ICIs) have demonstrated marked efficacy in some cancer patients, but they may cause various severe immune-related adverse events. Alectinib is a second-generation anaplastic lymphoma kinase (ALK)-tyrosine kinase inhibitor (TKI) approved for ALK-rearranged non-small-cell lung cancer (NSCLC). Alectinib is said to be safer than other TKIs. We conducted an investigator-initiated trial of alectinib, which also has RET kinase-inhibitory activity, against RET-rearranged NSCLC. Two RET-rearranged NSCLC patients experienced severe skin toxicity with alectinib after first undergoing anti-PD-1 antibody treatment with an ICI. These findings suggest that we should carefully follow patients for adverse effects of targeted drugs following ICI treatment.\n\nsevere skin toxicity\nanti-PD-1 antibody\nalectinib\nICIs\n==== Body\npmcIntroduction\n\nImmune checkpoint inhibitors (ICIs), such as anti-programmed death-1 (PD-1) antibody and anti-PD-ligand 1 (PD-L1) antibody, show anti-tumor efficacy by activating the immune system. ICIs have been approved for various types of tumors, including small-cell lung cancer (SCLC) and non-SCLC (NSCLC). While ICIs demonstrate marked efficacy in some patients, they may cause various severe immune-related adverse events (irAEs), including drug-induced skin toxicity and interstitial lung disease (ILD), presumably by activating the autoimmune system. Previous studies have reported that severe irAEs, including ILD (1), were induced by a concurrent combination of ICIs and osimertinib, a third-generation epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) (2). However, severe adverse events associated with concurrent or sequential treatment with ICIs and other TKIs are not well reported.\n\nAlectinib is a second-generation anaplastic lymphoma kinase (ALK)-TKI approved for ALK-rearranged NSCLC (3). Although several severe adverse events of alectinib, including dysgeusia, increased AST levels, increased bilirubin levels, rashes, and constipation, have been reported, their incidence is generally lower than those of other TKIs, such as crizotinib, an FDA-approved inhibitor for ALK and ROS1 kinases, and EGFR-TKIs (4-6).\n\nWe conducted an investigator-initiated trial of alectinib, which also has RET kinase-inhibitory activity, against RET-rearranged NSCLC (UMIN000020628) (7). In the trial, two NSCLC patients with RET rearrangements experienced severe skin toxicity with alectinib administration after first having undergone anti-PD-1 antibody treatment. These findings suggest that we should carefully follow the patients for the adverse effects of targeted drugs following ICIs.\n\nCase Reports\n\nCase 1\n\nA woman in her 40s, a non-smoker, with a history of stage IIIB NSCLC (cT1aN3M0), was initially treated with concurrent chemotherapy (cisplatin and docetaxel) and radiation therapy. She had developed multiple metastases in the brain and bone that were controlled for eight years by multidisciplinary treatment, including stereotactic radiation and brain tumor resection. She showed disease progression with a primary lung tumor in the left upper lobe and was treated with conventional chemotherapy (second-line carboplatin+pemetrexed, third-line docetaxel, fourth-line vinorelbine). As the fifth-line treatment, she received anti-PD-1 antibody nivolumab for six cycles. Nonetheless, her disease progressed. Genome testing revealed a KIF5B-RET rearrangement, and she entered the Investigator-initiated Trial with alectinib (UMIN000020628).\n\nAlectinib 600 mg twice daily (FDA-approved dose for ALK-rearranged NSCLC) was started 24 days after the final administration of nivolumab. She presented with fever (38.0 °C: Grade 1) on day 10. Skin rash (erythema multiforme, Grade 3; Fig. 1), increase in AST (Grade 3), and increased ALT (Grade 2) appeared on day 13. At that time, she had no mucosal lesion. Thus, alectinib was stopped, and 50 mg prednisolone was administered intravenously for 7 days, followed by decreasing doses of oral prednisolone for 4 weeks. These symptoms, including rash, resolved by day 22.\n\nFigure 1. a: Skin rash observed in case 1. A woman in her 40s. Alectinib 600 mg twice daily was started 24 days after the final administration of nivolumab. Picture shows erythema multiforme on day 13. b: Close-up picture of (a).\n\nCase 2\n\nA woman in her 30s, a non-smoker, had a history of stage IV NSCLC (cTaN3M1b, OSS, HEP, PUL). She received seven lines of chemotherapy. As the eighth-line treatment, she received anti-PD-1 antibody nivolumab for four cycles. Nonetheless, her disease progressed. Genome testing revealed KIF5B-RET rearrangement, and she entered the Investigator-initiated Trial with alectinib (UMIN000020628).\n\nAlectinib 600 mg twice daily was started 8 weeks after the final administration of nivolumab. On day 5, she noticed that the right hypochondrial pain due to liver metastases decreased. However, she presented with a skin rash (Grade 2) on day 11, and alectinib was discontinued. On day 12, a severe skin rash and erythema multiforme were observed (Fig. 2), but she had no mucosal lesions. She was administered steroid pulse therapy of 1,000 mg methylprednisolone for 3 days. Her skin rash resolved by day 16.\n\nFigure 2. Skin rash observed in Case 2. A woman in her 30s. Alectinib 600 mg twice daily was started eight weeks after the final administration of nivolumab. Picture shows erythema multiforme on day 12.\n\nDiscussion\n\nSevere skin rashes (Grade 3) because of alectinib treatment are rare events (0-3%) (3,4). Table summarizes five case reports of severe skin rash caused by alectinib (8-12). Erythema multiforme caused by alectinib was reported in one case by Kimura et al. (8). In this case, erythema multiforme was observed on day 11 of alectinib treatment and improved by suspension of alectinib and introduction of a histamine-1 receptor antagonist, external preparation of nadifloxacin, and a medium-class steroid.\n\nTable. Literature Review of Patients with Severe Skin Rash Caused by Alectinib, Including Our Cases.\n\nRef.\tAge/\nGender\tTumor and gene alteration\tLine of alectinib\tPreviously given ICI\tInterval of ICI to alectinib\tOnset of rash\tType of rash\tSymptomatic treatment\tDat to improvement\tRe-challenge of alectinib\t\n9\t30/F\tNSCLC with EML4-ALK\t4th\tAnti-PD-1 Ab\tNot reported\t2weeks\tNot reported\tAnti-histamine\tnot reported\tYes\t\n11\t76/F\tNSCLC with EML4-ALK\t2nd\tNo\t\t10 days\tMaculopapular\tAnti-histamine, topical steroid\t7 days\tYes\t\n8\t39/F\tNSCLC with EML4-ALK\t5th\tNo\t\t11 days\tErythema multiforme\tHT1 antagonist, nadifloxacin, PSL 20-40mg\tNot reported PSL 35days\tYes\t\n12\t71/F\tNSCLC with ALK rearrangement\t2nd\tPembrolizumab\t3 weeks\t2 weeks\tMaculopapular\tHT1 antagonist, mPSL\t1 week\tYes\t\n10\t57/ F\tNSCLC with EML4-ALK\t3rd\tDulvalumab, atezolizumab\t4 weeks\t12 days\tMaculopapular\tmPSL\t7 days\tYes\t\nOur cases\t40s/F\tNSCLC with KIF5B-RET\t6th\tNivolumab\t26 days\t13 days\tErythema multiforme\tmPSL 50mg\tdays\tNo\t\n\t30s/F\tNSCLC with KIF5B-RET\t9th\tNivolumab\t8 weels\t11 days\tErythema multiforme\tmPSL 1000mg\tdays\tNo\t\nF: female, NSCLC: non-small cell lung cancer, EML4: echinoderm microtubule-associated protein-like4, ALK: anaplastic lymphoma kinase, KIF5: kinesin family member 5B, RET: rearranged during transfection, ICI; immune checkpoint inhibitor, HT1: hydroxytryptamine1, mPSL: methylprednisolone, PSL: prednisolone\n\nSevere skin rash (maculopapular) associated with sequential use of alectinib after ICI was reported in two cases (9,10) (Table). As in the two cases reported here, erythema multiforme was observed after alectinib following treatment with anti-PD-1 antibody. This suggests that anti-PD-1 antibody triggers serious skin toxicity upon alectinib treatment. The details of the mechanism are unknown, but it is possible that PD-1 inhibition activated the immune system and induced an immune response to alectinib. The intervals between nivolumab and alectinib treatments in our Cases 1 and 2 were one and two months, respectively.\n\nSince previous reports showed that the onset of severe skin toxicity by alectinib treatment was 10-14 days with or without an ICI treatment history, particular attention is required during this period. In these case reports, the rash was improved by the suspension of alectinib and the addition of steroids with or without histamine-1 receptor antagonist, and the patients were re-challenged with a gradual increase in the dose of alectinib, which successfully controlled tumor progression. Our two cases with RET-rearrangement received alectinib as the protocol treatment in the Investigator-initiated Trial, so alectinib was terminated at the onset of erythema multiforme, and patients were not re-challenged. Particularly in Case 2, we administered steroid pulse therapy because the severe erythema multiforme worsened, but the state of her lung cancer remained stable during steroid therapy.\n\nThe NCCN guidelines recommend TKI treatment for front-line treatment, as ICIs are not sufficiently effective in lung cancer with driver gene alterations. From the perspective of side effects, including serious skin toxicity, TKIs should be used on the front line, rather than ICIs, particularly in cases where TKIs might eventually be used.\n\nThe authors state that they have no Conflict of Interest (COI).\n==== Refs\n1. Ramos-Casals M , Brahmer JR , Callahan MK , et al . Immune-related adverse events of checkpoint inhibitors. Nat Rev Dis Primers 6 : 38, 2020.32382051\n2. Schoenfeld AJ , Arbour KC , Rizvi H , et al . Severe immune-related adverse events are common with sequential PD-(L)1 blockade and osimertinib. Ann Oncol 30 : 839-844, 2019.30847464\n3. Hida T , Nokihara H , Kondo M , et al . Alectinib versus crizotinib in patients with ALK-positive non-small-cell lung cancer (J-ALEX): an open-label, randomised phase 3 trial. Lancet 390 : 29-39, 2017.28501140\n4. Peters S , Camidge DR , Shaw AT , et al . Alectinib versus crizotinib in untreated ALK-positive non-small-cell lung cancer. N Engl J Med 377 : 829-838, 2017.28586279\n5. Solomon BJ , Mok T , Kim DW , et al . First-line crizotinib versus chemotherapy in ALK-positive lung cancer. N Engl J Med 371 : 2167-2177, 2014.25470694\n6. Soria JC , Ohe Y , Vansteenkiste J , et al . Osimertinib in untreated EGFR-mutated advanced non-small-cell lung cancer. N Engl J Med 378 : 113-125, 2018.29151359\n7. Takeuchi S , Yanagitani N , Seto T , et al . Phase I/II study of alectinib in RET-rearranged previously-treated non-small cell lung cancer (ALL-RET). Transl Lung Cancer Res 10 : 314-325, 2021.33569315\n8. Kimura T , Sowa-Osako J , Nakai T , et al . Alectinib-induced erythema multiforme and successful rechallenge with alectinib in a patient with anaplastic lymphoma kinase-rearranged lung cancer. Case Rep Oncol 9 : 826-832, 2016.28101031\n9. Okuma Y , Tanaka Y , Kamei T , Hosomi Y , Okamura T . Alectinib for choroidal metastasis in a patient with crizotinib-resistant ALK rearranged positive non-small cell lung cancer. OncoTargets Ther 8 : 1321-1325, 2015.\n10. Seegobin K , Majeed U , Lou Y , Zhao Y , Manochakian R . Patients with high-grade alectinib-induced skin rash: how do we desensitize these patients? A case report and review of literature. SAGE Open Med Case Rep 8 : 2050313X20966895, 2020.\n11. Shirasawa M , Kubotaa M , Harada S , et al . Successful oral desensitization against skin rash induced by alectinib in a patient with anaplastic lymphoma kinase-positive lung adenocarcinoma: a case report. Lung Cancer 99 : 66-69, 2016.27565916\n12. Anderson BE , Luczak TS , Ries LM , Hoefs GE , Silva-Benedict AC . Successful alectinib desensitization in a patient with anaplastic lymphoma kinase-positive adenocarcinoma of the lung and alectinib-induced drug rash. J Oncol Pharm Pract 26 : 2028-2030, 2020.32476587\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "0918-2918", "issue": null, "journal": "Internal medicine (Tokyo, Japan)", "keywords": "ICIs; alectinib; anti-PD-1 antibody; severe skin toxicity", "medline_ta": "Intern Med", "mesh_terms": null, "nlm_unique_id": "9204241", "other_id": null, "pages": null, "pmc": null, "pmid": "34803090", "pubdate": "2021-11-20", "publication_types": "D016428:Journal Article", "references": null, "title": "Severe Skin Toxicity Caused by Sequential Anti-PD-1 Antibody and Alectinib in Non-small-cell Lung Cancer: A Report of Two Cases and a Literature Review.", "title_normalized": "severe skin toxicity caused by sequential anti pd 1 antibody and alectinib in non small cell lung cancer a report of two cases and a literature review" }
[ { "companynumb": "JP-BRISTOL-MYERS SQUIBB COMPANY-2022-061636", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "NIVOLUMAB" }, "drugaddition...
{ "abstract": "Diagnosing the cause of hypoxemia and dyspnea can be complicated in complex patients with multiple comorbidities. This \"Case Study in Physiology\" describes an man with obesity admitted to the hospital for relapse of acute lymphoblastic leukemia, who experienced progressive hypoxemia, shortness of breath, and dyspnea on exertion during his hospitalization. After initial empirical treatment with diuresis and antibiotics failed to improve his symptoms and because an arterial blood gas measurement was not readily available, we applied a novel, recently described physiological method to estimate the arterial partial pressure of oxygen from the peripheral saturation measurement and calculate the alveolar-arterial oxygen difference to discern the source of his hypoxemia and dyspnea. Using basic physiological principles, we describe how hypoventilation, anemia, and the use of a β blocker and furosemide, collaborated to create a \"perfect storm\" in this patient that impaired oxygen delivery and limited utilization. This case illustrates the application of innovative physiology methodology in medicine and provides a strong rationale for continuing to integrate physiology education in medical education.NEW & NOTEWORTHY Discerning the cause of dyspnea and hypoxemia in complex patients can be difficult. We describe the \"real world\" application of an innovative methodology to untangle the underlying physiology in a patient with multiple comorbidities. This case further demonstrates the importance of applying physiology to interrogate the underlying cause of a patient's symptoms when treatment based on probability fails.", "affiliations": "Department of Internal Medicine, Division of Pulmonary, Critical Care, and Occupational Medicine, University of Iowa, Iowa City, Iowa.;Department of Health and Human Physiology, University of Iowa, Iowa City, Iowa.;Department of Internal Medicine, Division of Pulmonary, Critical Care, and Occupational Medicine, University of Iowa, Iowa City, Iowa.;Department of Internal Medicine, Division of Hematology, Oncology, and Bone Marrow Transplant, University of Iowa, Iowa City, Iowa.;Department of Health and Human Physiology, University of Iowa, Iowa City, Iowa.;Department of Surgery, University of Iowa, Iowa City, Iowa.;Department of Internal Medicine, Division of Hematology, Oncology, and Bone Marrow Transplant, University of Iowa, Iowa City, Iowa.;Department of Internal Medicine, Division of Hematology, Oncology, and Bone Marrow Transplant, University of Iowa, Iowa City, Iowa.", "authors": "Amaza|Iliya|I|;Kalra|Hardik|H|;Eberlein|Michael|M|;Jethava|Yogesh|Y|;McDonell|Joseph|J|;Wolfe|Bobby|B|;Tomasson|Michael H|MH|;Bates|Melissa L|ML|0000-0002-2605-0984", "chemical_list": "D010100:Oxygen", "country": "United States", "delete": false, "doi": "10.1152/japplphysiol.00867.2020", "fulltext": null, "fulltext_license": null, "issn_linking": "0161-7567", "issue": "131(2)", "journal": "Journal of applied physiology (Bethesda, Md. : 1985)", "keywords": "A-aDO2; Hill equation; blood cancer; obesity hypoventilation syndrome; physiology education", "medline_ta": "J Appl Physiol (1985)", "mesh_terms": "D006801:Humans; D000860:Hypoxia; D007938:Leukemia; D008297:Male; D009765:Obesity; D010100:Oxygen; D010313:Partial Pressure", "nlm_unique_id": "8502536", "other_id": null, "pages": "788-793", "pmc": null, "pmid": "33955261", "pubdate": "2021-08-01", "publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't", "references": "29351442;292309;32105294;7789503;21831952;19910329;22781215;27351710;21487024;19129271;14621112;3812481;11032352;31436512;30335497;16164401;790460;2254603;16303205;9635634;26266464", "title": "Case Studies in Physiology: Untangling the cause of hypoxemia in a patient with obesity with acute leukemia.", "title_normalized": "case studies in physiology untangling the cause of hypoxemia in a patient with obesity with acute leukemia" }
[ { "companynumb": "US-BAXTER-2021BAX037159", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "FUROSEMIDE" }, "drugadditional": "4", ...
{ "abstract": "OBJECTIVE\nPost-renal-transplanted patients frequently present hyperglycemia immediately after the procedure. The goal of this work was to evaluate the effect of linagliptin + insulin in post-renal-transplanted patients with hyperglycemia.\n\n\nMETHODS\nRetrospective comparative study in post-renal transplanted patients with hyperglycemia after transplantation who were treated with linagliptin 5 mg daily plus insulin vs insulin alone for 5 days after renal transplantation with hyperglycemia. Main outcomes were glucose levels, insulin dose and severity of hypoglycemia.\n\n\nRESULTS\nThere were 14 patients treated with linagliptin + insulin and 14 patients treated only with insulin. Glucose levels and insulin doses were lower in the linagliptin + insulin group in comparison with the insulin alone group, 131.0 ± 15.1 vs 191.1 ± 22.5 mg/dl (7.27 ± 0.84 vs 10.61 ± 1.25 mmol/l) and 37.5 ± 6.3 vs 24.2 ± 6.6 U, respectively (p < 0.05). Hypoglycemia was less severe in the linagliptin + insulin group, 65.1 ± 2.2 vs 54.2 ± 3.3 mg/dl (3.61 ± 0.12 vs 3.00 ± 3.3 ± 0.18 mmol/l), p 0.036.\n\n\nCONCLUSIONS\nThe combination of linagliptin + insulin provided better glycemic control with a lower insulin dose and less severe hypoglycemia in comparison to insulin alone in patients with hyperglycemia immediately after renal transplantation.", "affiliations": "Hospital Regional de Alta Especialidad del Bajío, University of Guanajuato, León, Guanajuato, Mexico. Electronic address: rguardado@ugto.mx.;Hospital Regional de Alta Especialidad del Bajío, León, Guanajuato, Mexico.;Hospital Regional de Alta Especialidad del Bajío, León, Guanajuato, Mexico.;Hospital Regional de Alta Especialidad del Bajío, León, Guanajuato, Mexico.;Hospital Regional de Alta Especialidad del Bajío, León, Guanajuato, Mexico.;Hospital Regional de Alta Especialidad del Bajío, León, Guanajuato, Mexico.", "authors": "Guardado-Mendoza|Rodolfo|R|;Cázares-Sánchez|David|D|;Evia-Viscarra|María Lola|ML|;Jiménez-Ceja|Lilia M|LM|;Durán-Pérez|Edgar G|EG|;Aguilar-García|Alberto|A|", "chemical_list": "D007004:Hypoglycemic Agents; D007328:Insulin; D000069476:Linagliptin", "country": "Ireland", "delete": false, "doi": "10.1016/j.diabres.2019.107864", "fulltext": null, "fulltext_license": null, "issn_linking": "0168-8227", "issue": "156()", "journal": "Diabetes research and clinical practice", "keywords": "Hyperglycemia; Linagliptin; Renal transplantation", "medline_ta": "Diabetes Res Clin Pract", "mesh_terms": "D004359:Drug Therapy, Combination; D005260:Female; D006801:Humans; D006943:Hyperglycemia; D007004:Hypoglycemic Agents; D007328:Insulin; D016030:Kidney Transplantation; D000069476:Linagliptin; D008297:Male; D008875:Middle Aged; D012189:Retrospective Studies", "nlm_unique_id": "8508335", "other_id": null, "pages": "107864", "pmc": null, "pmid": "31539565", "pubdate": "2019-10", "publication_types": "D016428:Journal Article", "references": null, "title": "Linagliptin plus insulin for hyperglycemia immediately after renal transplantation: A comparative study.", "title_normalized": "linagliptin plus insulin for hyperglycemia immediately after renal transplantation a comparative study" }
[ { "companynumb": "MX-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2019-BI-103969", "fulfillexpeditecriteria": "1", "occurcountry": "MX", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "MYCOPHENOLIC ACID" }, ...
{ "abstract": "Direct oral anticoagulants have become increasingly used for atrial fibrillation and venothromboembolic disease. Thus far, there have been a few published cases of pericardial effusion associated with rivaroxban. However, there has been little published regarding the effects of concurrent medications and their effect on the cytochrome enzyme systems involved in rivaroxaban metabolism. We present a case of a 76-year-old female who develops a spontaneous haemopericardium after initiating rivaroxaban. After thorough medical reconciliation, we offer pharmacokinetic mechanisms that may have contributed to the haemopericardium. This case demonstrates the importance of reviewing patients medication lists and utilizing basic pharmacokinetics to prevent adverse events.", "affiliations": "Texas Heart Institute.;Texas Heart Institute.;Texas Heart Institute.", "authors": "Mehta|Adwait|A|;Burkland|David|D|;Mathuria|Nilesh|N|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.4081/cp.2019.1096", "fulltext": "\n==== Front\nClin PractCPClinics and Practice2039-72752039-7283PAGEPress Publications, Pavia, Italy 10.4081/cp.2019.1096Case ReportIsolated hemopericardium after initiation of rivaroxaban: Implications and potential mechanisms Mehta Adwait 1Burkland David 12Mathuria Nilesh 11 Texas Heart Institute2 Baylor College of Medicine, Texas, USATexas Heart Institute, Texas, USA. nimathuria@texasheart.orgConflict of interest: the authors declare no potential conflict of interest.\n\n30 1 2019 29 1 2019 9 1 109610 7 2018 17 1 2019 ©Copyright A. Mehta et al., 20192019Licensee PAGEPress, ItalyThis work is licensed under a Creative Commons Attribution NonCommercial 4.0 License (CC BY-NC 4.0).Direct oral anticoagulants have become increasingly used for atrial fibrillation and venothromboembolic disease. Thus far, there have been a few published cases of pericardial effusion associated with rivaroxban. However, there has been little published regarding the effects of concurrent medications and their effect on the cytochrome enzyme systems involved in rivaroxaban metabolism. We present a case of a 76-year-old female who develops a spontaneous haemopericardium after initiating rivaroxaban. After thorough medical reconciliation, we offer pharmacokinetic mechanisms that may have contributed to the haemopericardium. This case demonstrates the importance of reviewing patients medication lists and utilizing basic pharmacokinetics to prevent adverse events.\n\nKey words\nDirect oral anticoagulantRivaroxabanPeericardial effusionFunding: none.\n==== Body\nIntroduction\nAtrial Fibrillation (Afib) is associated with an increased risk of ischemic stroke.1 Anticoagulation with Warfarin reduces the risk of ischemic stroke (and other embolic events) by about two-thirds, irrespective of baseline risk.2\n\nIn the rivaroxaban Once-Daily Oral Direct Factor Xa Inhibition Compared with Vitamin K Antagonism for Prevention of Stroke and Embolism Trial in Atrial Fibrillation (ROCKET-AF), rivaroxaban was shown to be non-inferior to warfarin for the prevention of stroke and systemic embolism, with less intracranial and fatal bleeding.1,3\n\nDuring this trial, there were no documented cases of hemopericardium.3 Furthermore, based on best available evidence, no safety alerts have been raised for an increased risk of pericardial bleeding with Direct Oral Anticoagulants (DOACs).4\n\nHere we report a case of Spontaneous Haemopericardium associated with rivaroxaban use for prevention of thromboembolic events in Afib.\n\nCase Report\n76-year-old female with a past medical history significant for Paroxysmal Afib with Tachy-Brady Syndrome, hyperlipidemia and muscle spasms who presented to the emergency room (ER) with dizziness, chest discomfort and presyncope. The patient underwent uneventful placement of a dual chamber permanent pace maker (PPM) placed 3 weeks before the ER visit being described. Rivaroxaban 20 mg PO daily was started as a new medication 3 days after placement of the PPM. Blood work confirmed no renal or hepatic impairment. Her CHADS2VAsc score at time of initiating rivaroxaban was 3.\n\nHer home medicine consisted of Flecainide, Pravastatin, Cyclobenzaprine and a Multivitamin complex. These were also continued post procedure. Patient’s past surgical and family history were unremarkable.\n\nIn the ED, her systolic blood pressure was 70, Heart rate of 74. Physical exam revealed an alert and oriented patient. Normal jugular venous pressure and normal intensity heart sounds with no friction rub. Her lungs were clear on auscultation and abdomen was soft without tenderness.\n\nAn echocardiogram revealed a moderate- large Pericardial Effusion with early tamponade physiology. Her lab investigations were significant for an INR (International Normalized Ratio) of 1.7 with a PTT (PLEASE EXPLAIN THE ABBREVIATION) of 39 seconds, platelet count was 216, creatinine of 0.89 mg/dL and creatinine Clearance of 64.7 mL/min based on Cockcroft-Gault equation. ECG revealed sinus rhythm at a rate of 74 bpm with normal QRS amplitude. There was no evidence of ST segment abnormalities or electrical alternans.\n\nThe patient was stabilized with intravenous fluid and vasopressors and taken to the cath lab for pericardiocentesis.A total of 350 cc of gross bloody fluid was removed. Post-procedure, drains were placed and removed 48 hours thereafter with no evidence of reaccumulation. Evaluation of the fluid confirmed a haemopericardium (RBC (red blood cell) count of 472,000 cells/microliter) with gram stain and culture negative for microbes.\n\nOn interrogation, the PPM had no changes in the lead parameters (threshold, impedance or sensing). Post-pericardiocentesis, a CT-angiogram protocoled for both pulmonary and aortic vasculature was negative for pulmonary embolism and aortic dissection. Furthermore, CT images showed well-placed PPM leads with no evidence of perforation or migration.\n\nThe patient was discharged on Aspirin 81mg given concern for DOAC after recent pericardial effusion. She had an interval echocardiogram with her primary cardiologist that confirmed no recurrence of the pericardial effusion. Patient was noted to have recurrent atrial fibrillation 1 year later and Apixaban was initiated without complication.\n\nDiscussion\nSpontaneous hemopericardium unrelated to trauma is known to occur in 2.5-11% of patients receiving any anticoagulation.5 Although a rare clinical event, there are published cases of hemopericardium associated with DOACs.5-7\n\nUnlike other DOACs, rivaroxaban is not administered as a prodrug. More specifically, the pharmacologically active compounds are active prior to oxidative metabolism by the Cytochrome P450 enzymes associated with the drug: CYP3A4, CYP 3A5 and CYP2J2.8,9\n\nGiven the above described pharmacokinetics of rivaroxaban, it is possible that the co-administration of Cyclobenzaprine and Pravastatin, both minor substrates of CYP 3A4.10,11 and thus competitive compounds, lead to a higher serum concentration of metabolically active rivaroxaban and thus an increased bleeding risk.\n\nCompetitive compound binding describes individual compounds (i.e. medications) that compete for the active site of an enzyme to form an enzyme-compound complex.12 This becomes clinically relevant when drugs are given concurrently, who themselves are either enzyme substrates, inducers, or inhibitors of an oxidative enzyme system (e.g. CYP 450) resulting in variable pharmacokinetics of each coadministered drug.13\n\nConclusions\nThe use of DOACs has provided increasing options in the management of atrial fibrillation and venothromboembolic disease.\n\nThrough a process of exclusion, we suspect our patient suffered a spontaneous hemopericardium after exposure to rivaroxaban. Furthermore, the inherent bleeding risk associated with rivaroxaban was increased by simultaneous use of other CYP 3A4 substrates.\n\nWe hope our case contributes to the post marketing surveillance of rivaroxaban and facilitates comprehensive decision making for prescribing professionals. Therefore, we recommend a careful medication reconciliation when prescribing rivaroxaban. Special consideration should be paid to medications whose pharmacokinetics is closely linked to the CYP 3A4, CYP 3A5 and CYP 2J2 oxidative cycles.\n==== Refs\nReferences\n1. Manesh RP Mahaffey KW Garg J \nRivaroxaban versus warfarin in nonvalvular atrial fibrillation . N Engl J Med \n2011 ;365 :883 -91 .21830957 \n2. Friberg L Rosenqvist M Lip GY \nNet clinical benefit of warfarin in patients with atrial fibrillation: a report from the Swedish atrial fibrillation cohort study . Circulation \n2012 ;125 :2298 -307 .22514252 \n3. Piccini JP Garg J Patel MR \nManagement of major bleeding events in patients treated with rivaroxaban vs. warfarin: results from the ROCKET AF trial . Eur Heart J \n2014 ;35 :1873 -80 .24658769 \n4. Caldeira D Barra M Goncalves N \nPericardial bleeding risk with nonvitamin K oral anticoagulants: a metaanalysis . Int J Cardiol \n2015 ;182 :187 -8 .25577761 \n5. Shivamurthy P Brar N Therrien ML \nIsolated hemopericardium associated with rivaroxaban: first case report . Pharmacotherapy \n2014 ;34 :e169 -72 .25074401 \n6. Xu B MacIsaac A. \nLife-threatening haemorrhagic pericarditis associated with rivaroxaban . Int J Cardiol \n2014 ; 174 :e75 -6 .24794963 \n7. DY EA Shiltz DL \nHemopericardium and cardiac tamponade associated with Dabigatran use . Ann Pharmacother \n2012 ;46 :e18 .22786838 \n8. Mueck W Stampfuss J Kubitza D Becka M. \nClinical pharmacokinetic and pharmacodynamic profile of Rivaroxaban . Clin Pharmacokinet \n2014 ;53 :1 -16 .23999929 \n9. Mueck W Stephan S Stampfus J. \nRivaroxaban and other novel oral anticoagulants pharmacokinetics in health subjects, specific patient populations and relevance of coagulation monitoring . Thromb J \n2013 ;11 :10 .23809871 \n10. Moody DE Fu Y Fang WB \nInhibition of in vitro metabolism of opioids by skeletal muscle relaxants . Basic Clin Pharmacol Toxicol \n2018 ;123 :327 -34 .29504673 \n11. Lee CK Choi JS Choi DH \nEffects of pravastatin on the pharmacokinetic parameters of nimodipine after oral and intravenous administration in rats: possible role of CYP3A4 inhibition by pravastatin . Indian J Pharmacol \n2012 ; 44 :624 -8 .23112426 \n12. Bjelakovic G Stojanovic I Bjelakovic GB \nCompetitive inhibitors of enzymes and their therapeutic application . Med Biol \n2002 ;9 :201 -6 .\n13. Lynch T Price A. \nThe effect of cytochrome P450 metabolism on drug response, interactions, and adverse effects . Am Fam Physician \n2007 ;76 : 391 -6 .17708140\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2039-7275", "issue": "9(1)", "journal": "Clinics and practice", "keywords": "Direct oral anticoagulant; Peericardial effusion; Rivaroxaban", "medline_ta": "Clin Pract", "mesh_terms": null, "nlm_unique_id": "101563282", "other_id": null, "pages": "1096", "pmc": null, "pmid": "30815244", "pubdate": "2019-01-29", "publication_types": "D016428:Journal Article", "references": "17708140;21830957;22514252;22786838;23112426;23809871;23999929;24658769;24794963;25074401;25577761;29504673", "title": "Isolated hemopericardium after initiation of rivaroxaban: Implications and potential mechanisms.", "title_normalized": "isolated hemopericardium after initiation of rivaroxaban implications and potential mechanisms" }
[ { "companynumb": "US-ZYDUS-040219", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "RIVAROXABAN" }, "drugadditional": "1", "druga...
{ "abstract": "A 38-year-old man presented with cough, shortness of breath, and fatigue. He was diagnosed with Coronavirus Disease-2019 (COVID-19) as well as Enterococcus faecalis bacteremia. Imaging revealed a subaortic membrane with aortic valve endocarditis and severe aortic insufficiency. He had successful aortic valve replacement with a mechanical prosthesis and subaortic membrane resection. This case highlights some of the diagnostic and therapeutic challenges presented by COVID-19 pandemic.", "affiliations": "Department of Internal Medicine, Section of Cardiology, Rush University Medical Center, Chicago, IL, USA.;Department of Internal Medicine, Section of Cardiology, Rush University Medical Center, Chicago, IL, USA.;Department of Cardiovascular and Thoracic Surgery, Rush University Medical Center, Chicago, IL, USA.;Department of Internal Medicine, Section of Cardiology, Rush University Medical Center, Chicago, IL, USA.;Department of Internal Medicine, Section of Cardiology, Rush University Medical Center, Chicago, IL, USA.", "authors": "Sanders|David J|DJ|https://orcid.org/0000-0002-5050-4333;Sutter|Joanne S|JS|;Tatooles|Antone|A|;Suboc|Tisha M|TM|;Rao|Anupama K|AK|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1155/2020/8844255", "fulltext": "\n==== Front\nCase Rep Cardiol\nCase Rep Cardiol\nCRIC\nCase Reports in Cardiology\n2090-6404 2090-6412 Hindawi \n\n33014475\n10.1155/2020/8844255\nCase Report\nEndocarditis Complicated by Severe Aortic Insufficiency in a Patient with COVID-19: Diagnostic and Management Implications\nhttps://orcid.org/0000-0002-5050-4333Sanders David J. david_j_sanders@rush.edu\n1\n Sutter Joanne S. \n1\n Tatooles Antone \n2\n Suboc Tisha M. \n1\n Rao Anupama K. \n1\n \n1Department of Internal Medicine, Section of Cardiology, Rush University Medical Center, Chicago, IL, USA\n\n2Department of Cardiovascular and Thoracic Surgery, Rush University Medical Center, Chicago, IL, USA\nAcademic Editor: Luigi Sciarra\n\n\n2020 \n29 9 2020 \n2020 88442553 5 2020 26 8 2020 23 9 2020 Copyright © 2020 David J. Sanders et al.2020This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.A 38-year-old man presented with cough, shortness of breath, and fatigue. He was diagnosed with Coronavirus Disease-2019 (COVID-19) as well as Enterococcus faecalis bacteremia. Imaging revealed a subaortic membrane with aortic valve endocarditis and severe aortic insufficiency. He had successful aortic valve replacement with a mechanical prosthesis and subaortic membrane resection. This case highlights some of the diagnostic and therapeutic challenges presented by COVID-19 pandemic.\n==== Body\n1. Introduction\nThe Coronavirus Disease-2019 (COVID-19) pandemic is an unparalleled global crisis that has commanded health resources and public attention. Although there is an overwhelming focus on this new disease, the emergence of SARS-CoV-2, COVID-19's causative organism, has not eliminated other maladies. Patients continue to have common etiologies for their presentation, and multiple illnesses can complicate and coexist with COVID-19. Additionally, concerns about the infectivity and potential aerosolization of SARS-CoV-2 impose barriers to performing invasive procedures on such patients.\n\nHere, we present a case of aortic valve infective endocarditis (IE) complicated by severe aortic insufficiency (AI) in a patient simultaneously diagnosed with COVID-19. We illustrate how COVID-19 can have similar clinical characteristics to IE, among other cardiovascular diseases. We also highlight our thought process on the risks and benefits of transesophageal echocardiogram (TEE) and aortic valve replacement surgery in this patient and discuss the importance of individualized decision-making.\n\n2. Case\nA 38-year-old man with end-stage renal disease from hypertensive nephropathy requiring hemodialysis through a tunneled dialysis catheter presented with two weeks of nonproductive cough, shortness of breath, and fatigue. The patient's initial vital signs were notable for a blood pressure of 84/46, pulse of 83, respirations of 20, and oxygen saturation of 97% on room air. Though initially afebrile, he mounted a temperature of 101.5°F several hours after presentation. On admission, his physical exam was notable for a II/VI systolic ejection murmur, not previously documented.\n\nA chest X-ray revealed pulmonary vascular congestion and a right retrocardiac opacity. ECG showed sinus rhythm, borderline 1st degree AV block, and left anterior fascicular block. Laboratory evaluation demonstrated white blood cell count of 14.5 K/μL, troponin of 0.1 ng/mL, BNP of 148 pg/mL, C-reactive protein of 108 mg/L, and ferritin of 1685 ng/mL. A nasopharyngeal swab detected SARS-CoV-2 RNA, confirming the diagnosis of COVID-19. Blood cultures were also obtained on admission, which grew Enterococcus faecalis from consecutive specimens.\n\nThe patient was initiated on an IV antibiotic regimen of vancomycin and gentamicin. However, persistent bacteremia was noted despite several days of antibiotic therapy. His dialysis catheter was exchanged in case it was the infectious source. Given the murmur on exam and ongoing bacteremia, the patient underwent a transthoracic echocardiogram (TTE) for further evaluation. This revealed a 10 × 11 mm mobile echodensity on the right coronary cusp as well as a possible smaller vegetation on the left coronary cusp of the aortic valve. Additionally, there was eccentric aortic insufficiency (AI) graded as moderate in severity by qualitative assessment (Figure 1).\n\nTo further characterize the aortic valve and assess for paravalvular abscess, a transesophageal echocardiogram (TEE) was then performed. All personnel donned appropriate personal protective equipment (PPE) including controlled air purifying respirators (CAPR). The TEE confirmed two aortic valve vegetations: (1) 8 × 14 mm on the right coronary cusp and (2) 3 × 4 mm on the left coronary cusp. There was nonspecific thickening of the posterior aortic root, raising concern for a paravalvular abscess. Multiple parameters suggested his AI was severe: jet width ratio > 65%, jet area ratio > 60%, vena contracta of 0.6, and premature closure of the mitral valve. Interestingly, a linear structure in the left ventricular outflow tract (LVOT) was visualized, suggestive of a subaortic membrane (Figure 2).\n\nA multispecialty team including cardiology, cardiovascular surgery, and infectious disease determined that despite his COVID-19, the patient required urgent aortic valve surgery given the severity of his AI, persistent bacteremia, vegetation size > 10 mm, and concerns for paravalvular abscess. The day following his TEE, the patient was taken to the operating room. He was found to have extensive phlegmon on the right coronary cusp and a perforation of the left coronary cusp of the aortic valve (Figure 3). Additionally, inspection of the LVOT confirmed a fibrotic subaortic membrane extending from the interventricular septum to the anterior annular region of the mitral valve (Figure 4). The native aortic valve was resected and replaced with a 25 mm St Jude mechanical prosthesis. The subaortic membrane was resected.\n\nThe patient tolerated the procedure well and did not have any postoperative complications. He was extubated a few hours following the surgery. His aortic valve culture grew Enterococcus faecalis. His SARS-CoV-2 PCR was also repeated and remained positive. The patient's antibiotics for IE were switched to ampicillin and ceftriaxone based on sensitivity data, and he was discharged home to complete a six-week course.\n\n3. Discussion\nAs our case illustrates, the COVID-19 pandemic has presented new challenges for the diagnosis and treatment of cardiovascular disease. Patients with COVID-19 most commonly present with fever and cough and can have an array of nonspecific complaints [1]. There is a symptom overlap with other cardiovascular conditions such as acute coronary syndrome, decompensated heart failure, non-COVID-19 myocarditis, and IE. Clinicians have to remain vigilant to the possibility of these other illnesses, or they may be overlooked. Relying on heuristics, or mental shortcuts, in making a diagnosis could lead to delays and adverse outcomes [2]. In particular, the dominant focus on COVID-19 brings this diagnosis to mind more easily than others (availability bias) [2]. Attributing all of the given patient's symptoms to COVID-19 after a positive test (premature closure) may lead to other common prepandemic diagnoses, such as IE, being missed [2].\n\nFor our patient, it was not clear which disease process caused his symptoms: COVID-19 respiratory infection, bacterial IE with pulmonary congestion from AI, or some combination of the two conditions. Testing for multiple diagnoses from the beginning was critical for timely diagnosis.\n\nThe original source for the patient's bacteremia was suspected to be his tunneled dialysis catheter. Additionally, his previously undiagnosed subaortic membrane likely created an ideal substrate for aortic valve seeding. The patient's TTE identified a vegetation > 10 mm and associated AI, high-risk features that suggested a greater chance of a complicated course or need for surgery [3]. This earned a class I indication for urgent TEE to further assess for complications [3].\n\nIn this patient with COVID-19, it was especially necessary to carefully consider the risks and benefits of a TEE. TEEs are aerosol-generating procedures that could increase the risk of transmitting SARS-CoV-2 to those involved [4, 5]. To minimize staff exposure, computed tomography (CT) or magnetic resonance imaging (MRI) can serve as an alternative for some indications [6]. While multimodality imaging might be a useful adjunct for IE, CT and MRI may not have comparable spatial and temporal resolution to a TEE for the diagnosis of endocarditis [6]. Postponing this procedure would have delayed characterizing the intracardiac complications and determining the need for surgical intervention. Thus, in our case, TEE was deemed essential and performed utilizing proper personal protective equipment (PPE).\n\nThe TEE results produced a similar dilemma for surgical planning. The study confirmed large vegetation size, severe AI, and possible early aortic root abscess, all indications for early surgery, which is associated with reduced embolic events and mortality [3, 7, 8]. Additionally, the patient had persistent bacteremia despite being on appropriate antibiotic therapy. And, given the unpredictable course of acute severe AI and potential for abrupt clinical deterioration, the multispecialty team determined that delaying surgery would be too unsafe. Lastly, postponing surgery risked further valve destruction and, given the vegetation's location, progression to aortic root abscess formation and subsequent heart block.\n\nProceeding with surgery before the patient had cleared the COVID-19 infection did pose hazards to the surgical staff and required special precautions. This included minimizing the number of operating room personnel, using N95 masks and other PPE throughout surgery, and coordinated handling of equipment and specimens.\n\nAs the pandemic continues, we will have to continue to carefully weigh the risks of delaying care to the potential hazards of exposing clinical staff to the virus. Cases that are elective or time sensitive now have the potential to become urgent or emergent. As with this case, individualized decision-making may be key to providing timely and appropriate care.\n\nConsent\nInformed oral consent was given by the patient.\n\nConflicts of Interest\nThe authors declare that they have no conflicts of interest.\n\nFigure 1 TTE from parasternal long axis view showing large echodensity on the right coronary cusp. Color Doppler demonstrates AI.\n\nFigure 2 TEE from transgastric long axis view with beam path at 120 degrees showing aortic valve echodensity. Color Doppler demonstrates severe AI. Yellow arrow points to subaortic membrane.\n\nFigure 3 Resected aortic valve with vegetation on the left coronary cusp and perforation of the right coronary cusp.\n\nFigure 4 Intraoperative images showing the thin fibrotic subaortic membrane visible above the suction cannula.\n==== Refs\n1 Guan W. Ni Z. Hu Y. Clinical characteristics of coronavirus disease 2019 in China The New England Journal of Medicine 2020 382 18 1708 1720 10.1056/NEJMoa2002032 32109013 \n2 Croskerry P. The importance of cognitive errors in diagnosis and strategies to minimize them Academic Medicine 2003 78 8 775 780 10.1097/00001888-200308000-00003 2-s2.0-0041853567 12915363 \n3 Baddour L. M. Wilson W. R. Bayer A. S. Infective endocarditis in adults: diagnosis, antimicrobial therapy, and management of complications. A scientific statement for healthcare professionals from the American Heart Association Circulation 2015 132 15 1435 1486 10.1161/CIR.0000000000000296 2-s2.0-84944054071 26373316 \n4 van Doremalen N. Bushmaker T. Morris D. H. Aerosol and surface stability of SARS-CoV-2 as compared with SARS-CoV-1 The New England Journal of Medicine 2020 382 16 1564 1567 10.1056/NEJMc2004973 32182409 \n5 Kirkpatrick J. N. Mitchell C. Taub C. Kort S. Hung J. Swaminathan M. ASE statement on protection of patients and echocardiography service providers during the 2019 novel coronavirus outbreak Journal of the American College of Cardiology 2020 75 24 3078 3084 10.1016/j.jacc.2020.04.002 32272153 \n6 Erba P. A. Pizzi M. N. Roque A. Multimodality imaging in infective endocarditis Circulation 2019 140 21 1753 1765 10.1161/CIRCULATIONAHA.119.040228 31738598 \n7 Lalani T. Cabell C. H. Benjamin D. K. Analysis of the impact of early surgery on in-hospital mortality of native valve endocarditis Circulation 2010 121 8 1005 1013 10.1161/CIRCULATIONAHA.109.864488 2-s2.0-77649249197 20159831 \n8 Kang D. H. Kim Y. J. Kim S. H. Early surgery versus conventional treatment for infective endocarditis The New England Journal of Medicine 2012 366 26 2466 2473 10.1056/NEJMoa1112843 2-s2.0-84862892407 22738096\n\n", "fulltext_license": "CC BY", "issn_linking": "2090-6404", "issue": "2020()", "journal": "Case reports in cardiology", "keywords": null, "medline_ta": "Case Rep Cardiol", "mesh_terms": null, "nlm_unique_id": "101576452", "other_id": null, "pages": "8844255", "pmc": null, "pmid": "33014475", "pubdate": "2020", "publication_types": "D002363:Case Reports", "references": "32109013;12915363;32272153;20159831;22738096;26373316;32182409;31738598", "title": "Endocarditis Complicated by Severe Aortic Insufficiency in a Patient with COVID-19: Diagnostic and Management Implications.", "title_normalized": "endocarditis complicated by severe aortic insufficiency in a patient with covid 19 diagnostic and management implications" }
[ { "companynumb": "US-MYLANLABS-2021M1023586", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "VANCOMYCIN" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nHypotension following intubation and return of spontaneous circulation (ROSC) after cardiac arrest is associated with poorer patient outcomes. In patients with a sustained ROSC requiring emergency anaesthesia, there is limited evidence to guide anaesthetic practice. At the Essex & Herts Air Ambulance Trust, a UK-based helicopter emergency medical service, we assessed the relative haemodynamic stability of two different induction agents for post-cardiac arrest medical patients requiring prehospital emergency anaesthesia (PHEA).\n\n\nMETHODS\nWe performed a retrospective database review over a 5-year period between December 2014 and December 2019 comparing ketamine-based and midazolam-based anaesthesia in this patient cohort. Our primary outcome was clinically significant hypotension within 30 min of PHEA, defined as a new systolic BP less than 90 mm Hg, or a 10% drop if less than 90 mm Hg before induction.\n\n\nRESULTS\nOne hundred ninety-eight patients met inclusion criteria. Forty-eight patients received a ketamine-based induction, median dose (IQR) 1.00 (1.00-1.55) mg/kg, and a 150 midazolam-based regime, median dose 0.03 (0.02-0.04) mg/kg. Hypotension occurred in 54.2% of the ketamine group and 50.7% of the midazolam group (p=0.673). Mean maximal HRs within 30 min of PHEA were 119 beats/min and 122 beats/min, respectively (p=0.523). A shock index greater than 1.0 beats/min/mm Hg and age greater than 70 years were both associated with post-PHEA hypotension with ORs 1.96 (CI 1.02 to 3.71) and 1.99 (CI 1.01 to 3.90), respectively. Adverse event rates did not significantly differ between groups.\n\n\nCONCLUSIONS\nPHEA following a medical cardiac arrest is associated with potentially significant cardiovascular derangements when measured up to 30 min after induction of anaesthesia. There was no demonstrable difference in post-induction hypotension between ketamine-based and midazolam-based PHEA. Choice of induction agent alone is insufficient to mitigate haemodynamic disturbance, and alternative strategies should be used to address this.", "affiliations": "Essex & Herts Air Ambulance Trust, Essex, UK christopher.king2@nhs.net.;Essex & Herts Air Ambulance Trust, Essex, UK.;Essex & Herts Air Ambulance Trust, Essex, UK.;Research Department, Essex & Herts Air Ambulance, Essex, UK.;University College London Medical School, London, UK.;University College London Medical School, London, UK.;Essex & Herts Air Ambulance Trust, Essex, UK.", "authors": "King|Christopher|C|http://orcid.org/0000-0002-2127-0902;Lewinsohn|Asher|A|;Keeliher|Chris|C|;McLachlan|Sarah|S|;Sherrin|James|J|;Khan-Cheema|Hafsah|H|;Sherren|Peter|P|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1136/emermed-2020-210531", "fulltext": null, "fulltext_license": null, "issn_linking": "1472-0205", "issue": null, "journal": "Emergency medicine journal : EMJ", "keywords": "anaesthesia - rsi; cardiac arrest; clinical management; pre-hospital; prehospital care", "medline_ta": "Emerg Med J", "mesh_terms": null, "nlm_unique_id": "100963089", "other_id": null, "pages": null, "pmc": null, "pmid": "34588175", "pubdate": "2021-09-29", "publication_types": "D016428:Journal Article", "references": null, "title": "Cardiovascular complications of prehospital emergency anaesthesia in patients with return of spontaneous circulation following medical cardiac arrest: a retrospective comparison of ketamine-based and midazolam-based induction protocols.", "title_normalized": "cardiovascular complications of prehospital emergency anaesthesia in patients with return of spontaneous circulation following medical cardiac arrest a retrospective comparison of ketamine based and midazolam based induction protocols" }
[ { "companynumb": "GB-PFIZER INC-202101441135", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "KETAMINE HYDROCHLORIDE" }, "drugadditional":...
{ "abstract": "Posttherapy scan in a 21-year-old woman with papillary carcinoma of thyroid with lymph node metastasis, who received 5.55 GBq of radioiodine (I), revealed halo-like diffuse tracer uptake in the pericardial region. Echocardiography showed no abnormality except pericardial effusion, which subsided after reinstitution of levothyroxine therapy. Although rare, false-positive radioiodine uptake can occur in pericardial effusion secondary to thyroxine withdrawal-related hypothyroidism and needs close monitoring of the patient.", "affiliations": "From the Radiation Medicine Centre, Bhabha Atomic Research Centre, Mumbai, India.", "authors": "Malhotra|Gaurav|G|;Moghe|Surendra H|SH|;Ranade|Rohit|R|;Asopa|R Ramesh V|RR|", "chemical_list": "D007457:Iodine Radioisotopes; D019275:Radiopharmaceuticals", "country": "United States", "delete": false, "doi": "10.1097/RLU.0000000000001223", "fulltext": null, "fulltext_license": null, "issn_linking": "0363-9762", "issue": "41(7)", "journal": "Clinical nuclear medicine", "keywords": null, "medline_ta": "Clin Nucl Med", "mesh_terms": "D002291:Carcinoma, Papillary; D005189:False Positive Reactions; D005260:Female; D006801:Humans; D007037:Hypothyroidism; D007457:Iodine Radioisotopes; D010490:Pericardial Effusion; D011877:Radionuclide Imaging; D019275:Radiopharmaceuticals; D013964:Thyroid Neoplasms; D055815:Young Adult", "nlm_unique_id": "7611109", "other_id": null, "pages": "568-9", "pmc": null, "pmid": "27055143", "pubdate": "2016-07", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "An Unusual False-Positive Uptake of Radioiodine in Pericardial Effusion on Posttherapy Scan.", "title_normalized": "an unusual false positive uptake of radioiodine in pericardial effusion on posttherapy scan" }
[ { "companynumb": "AKRIMAX-TIR-2016-0786", "fulfillexpeditecriteria": "1", "occurcountry": "IN", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "LEVOTHYROXINE" }, "drugadditional": null, ...
{ "abstract": "A PHY906 and capecitabine combination could be effective as a salvage therapy for patients with hepatocellular carcinoma (HCC) previously treated with multiple systemic therapies. This traditional Chinese medicine formulation can work with Western cancer chemotherapeutic agents to improve clinical outcomes or alleviate side effects for patients with advanced HCC.\n\n\n\nThis study aimed to evaluate efficacy and safety of capecitabine combined with a PHY906 (a pharmaceutical-grade formulation of four traditional Chinese herbs) in the treatment of advanced hepatocellular carcinoma (HCC) in Asian patients who were positive for hepatitis B virus (HBV).\n\n\n\nThis study was an open-label, phase II safety and efficacy clinical trial of PHY906 and capecitabine in patients with advanced HCC. Patients received 750 mg/m2 capecitabine b.i.d. 14 days plus 800 mg of PHY906 b.i.d. on days 1-4 and days 8-11 every 21-day cycle. The primary endpoint was 6-month survival rate, and secondary endpoints were progression-free survival, overall survival, disease control rate, and safety.\n\n\n\nThirty-nine subjects completed the study with a 46.2% stable disease rate. The median progression-free survival was 1.5 months, and median overall survival (mOS) was 6 months with a 51.3% 6-month survival rate. The most common adverse events included lower hemoglobin, diarrhea, pain, abdomen (not otherwise specified), fatigue, increased aspartate aminotransferase, and bilirubin. Patients who (a) had not received previous chemotherapies or targeted therapy or (b) had lower starting alpha-fetoprotein (AFP) levels or (c) had HBV infection showed better clinical outcome.\n\n\n\nOur data showed that PHY906 increases the therapeutic index of capecitabine by enhancing its antitumor activity and reduces its toxicity profile in advanced HCC.", "affiliations": "The PhD program for Cancer Molecular Biology and Drug Discovery, College of Medical Science and Technology, Taipei Medical University and Academia Sinica, Taipei, Taiwan.;The PhD program for Cancer Molecular Biology and Drug Discovery, College of Medical Science and Technology, Taipei Medical University and Academia Sinica, Taipei, Taiwan.;National Health Research Institutes, Tainan, Taiwan.;Sino-American Cancer Foundation, Covina, California, USA.;Sino-American Cancer Foundation, Covina, California, USA.;Yiviva Inc., New York, New York, USA.;Yale University School of Medicine, New Haven, Connecticut, USA.;The PhD program for Cancer Molecular Biology and Drug Discovery, College of Medical Science and Technology, Taipei Medical University and Academia Sinica, Taipei, Taiwan.", "authors": "Changou|Chun A|CA|0000-0003-2166-7421;Shiah|Her-Shyong|HS|;Chen|Li-Tzong|LT|;Liu|Servina|S|;Luh|Frank|F|;Liu|Shwu-Huey|SH|;Cheng|Yung-Chi|YC|;Yen|Yun|Y|", "chemical_list": "D004365:Drugs, Chinese Herbal; C476037:PHY 906; D000069287:Capecitabine; D005472:Fluorouracil", "country": "United States", "delete": false, "doi": "10.1002/onco.13582", "fulltext": "\n==== Front\nOncologist\nOncologist\n10.1002/(ISSN)1549-490X\nONCO\ntheoncologist\nThe Oncologist\n1083-7159\n1549-490X\nJohn Wiley & Sons, Inc. Hoboken, USA\n\n33140457\n10.1002/onco.13582\nONCO13582\n4\n12\nClinical Trial Results\nClinical Trial Results\nA Phase II Clinical Trial on the Combination Therapy of PHY906 Plus Capecitabine in Hepatocellular Carcinoma\nPHY906 + Capecitabine in HCC\nChangou, Shiah, Chen et al.\nChangou Chun A. https://orcid.org/0000-0003-2166-7421\n1 2 3 austinc99@tmu.edu.tw\n\nShiah Her‐Shyong 1\nChen Li‐Tzong 4\nLiu Servina 5\nLuh Frank 5\nLiu Shwu‐Huey 6\nCheng Yung‐Chi 7\nYen Yun 1 yyen@tmu.edu.tw\n\n1 The PhD program for Cancer Molecular Biology and Drug Discovery, College of Medical Science and Technology, Taipei Medical University and Academia Sinica Taipei Taiwan\n2 The PhD program for Translational Medicine, College of Medical Science and Technology, Taipei Medical University Taipei Taiwan\n3 The Core Facility Center, Office of Research and Development, Taipei Medical University Taipei Taiwan\n4 National Health Research Institutes Tainan Taiwan\n5 Sino‐American Cancer Foundation Covina, California USA\n6 Yiviva Inc. New York New York USA\n7 Yale University School of Medicine New Haven Connecticut USA\n* Correspondence: Yun Yen, M.D., Ph.D., The PhD Program for Cancer Molecular Biology and Drug Discovery, College of Medical Science and Technology, Taipei Medical University and Academia Sinica, 250 Wu‐Hsing Street, Taipei, 110, Taiwan. Telephone: 0000‐0003‐2166‐7421; e‐mail: yyen@tmu.edu.tw\n25 11 2020\n3 2021\n26 3 10.1002/onco.v26.3 e367e373\n19 6 2020\n23 10 2020\n© 2020 The Authors. The Oncologist published by Wiley Periodicals LLC on behalf of AlphaMed Press.\nThis is an open access article under the terms of the http://creativecommons.org/licenses/by-nc-nd/4.0/ License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non‐commercial and no modifications or adaptations are made.\n\nAbstract\n\nLessons Learned\n\nA PHY906 and capecitabine combination could be effective as a salvage therapy for patients with hepatocellular carcinoma (HCC) previously treated with multiple systemic therapies.\n\nThis traditional Chinese medicine formulation can work with Western cancer chemotherapeutic agents to improve clinical outcomes or alleviate side effects for patients with advanced HCC.\n\nBackground\n\nThis study aimed to evaluate efficacy and safety of capecitabine combined with a PHY906 (a pharmaceutical‐grade formulation of four traditional Chinese herbs) in the treatment of advanced hepatocellular carcinoma (HCC) in Asian patients who were positive for hepatitis B virus (HBV).\n\nMethods\n\nThis study was an open‐label, phase II safety and efficacy clinical trial of PHY906 and capecitabine in patients with advanced HCC. Patients received 750 mg/m2 capecitabine b.i.d. 14 days plus 800 mg of PHY906 b.i.d. on days 1–4 and days 8–11 every 21‐day cycle. The primary endpoint was 6‐month survival rate, and secondary endpoints were progression‐free survival, overall survival, disease control rate, and safety.\n\nResults\n\nThirty‐nine subjects completed the study with a 46.2% stable disease rate. The median progression‐free survival was 1.5 months, and median overall survival (mOS) was 6 months with a 51.3% 6‐month survival rate. The most common adverse events included lower hemoglobin, diarrhea, pain, abdomen (not otherwise specified), fatigue, increased aspartate aminotransferase, and bilirubin. Patients who (a) had not received previous chemotherapies or targeted therapy or (b) had lower starting alpha‐fetoprotein (AFP) levels or (c) had HBV infection showed better clinical outcome.\n\nConclusion\n\nOur data showed that PHY906 increases the therapeutic index of capecitabine by enhancing its antitumor activity and reduces its toxicity profile in advanced HCC.\n\nPHY906\nCapecitabine\nHepatocellular carcinoma\nChinese herbal medicine\nsource-schema-version-number2.0\ncover-dateMarch 2021\ndetails-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:5.9.9 mode:remove_FC converted:04.03.2021\n==== Body\nDiscussion\n\nIn 2007, sorafenib was approved by the U.S. Food and Drug Administration (FDA). Results from two phase III clinical trials indicated that sorafenib increased mOS from 7.9 months to 10.7 months (in the U.S. SHARP trial) and from 4.2 months to 6.5 months (in the Asia‐Pacific trial). One potential explanation for the difference between the two populations was the etiology of the underlying hepatitis, with HBV‐positive HCC more prevalent in Asian countries. Any regimens capable of increasing the therapeutic index of current therapies among HBV‐positive patients with HCC would benefit the global HCC population.\n\nYIV‐906 (PHY906) was developed as an orphan drug for treating patients with advanced liver cancer. In March 2018, the FDA granted YIV‐906 orphan drug designation for the indication of HCC. Based on the encouraging safety profile and the median overall survival from previous U.S. and Taiwan studies of YIV‐906 and capecitabine combination therapy and a phase I YIV‐906 and sorafenib combination therapy, an ongoing phase II randomized placebo‐controlled study investigating the combination of YIV‐906 and sorafenib (Nexavar, Bayer, Leverkusen, Germany) in HBV‐positive patients with advanced hepatocellular carcinoma is being conducted by Yiviva Inc. at 22 study sites in the U.S., China, Hong Kong, and Taiwan. The goal is to seek approval in the U.S. and China for YIV‐906 as a prescription drug for first‐line (sorafenib), second‐line (PD‐1), or third‐line (capecitabine) therapy.\n\nIn this study, the combination of PHY906 plus capecitabine was found to have an mOS of 6 months with a 6‐month survival rate of 51% among 39 patients assessed by intention to treat. Results indicated that patients who were systemic therapy naïve, including chemotherapy (n = 7), thalidomide, or everolimus treatments, could have better clinical outcome than those who have received multiple prior systemic therapies, with mOS of 9.2 and 5.45 months, respectively. Interestingly, patients with lower starting AFP also showed better mOS (9.2 months). In addition, 27 patients were treated with at least two cycles of study drug, whereas 12 patients had fewer than two cycles of treatment. A subgroup analysis was performed comparing these 27 evaluable patients with nonevaluable patients (fewer than two cycles of treatment, n = 12). The data indicated an mOS of 8.4 months versus 1.8 months (Fig. 1A; p = .0084).\n\nFigure 1 Kaplan‐Meier plots: percentage survival. (A): Impact of treatment cycles on the clinical outcomes. (B): Chemotherapy‐naïve evaluable patients with hepatocellular carcinoma and hepatitis B virus benefited most with PHY906 plus capecitabine drug treatment (combination of both U.S. and Taiwan studies).Abbreviations: CI, confidence interval; HR, hazard ratio; mOS, median overall survival.\n\nIn our previous study of PHY906/capecitabine in the U.S., better clinical outcomes were reported in evaluable Asian patients (who completed at least two cycles of treatment) than in the evaluable non‐Asian patients, with mOS of 16.5 and 6.9 months, respectively. By combining HBV‐positive, evaluable, Asian patients with HCC who were naïve to systemic therapy in both the Taiwan and the U.S. trials, the mOS was 16.5 months (Fig. 1B), suggesting that the PHY906/capecitabine combination may provide a survival benefit and has a tolerable safety profile for patients with HCC and HBV infection. This effect has also been observed in colon cancer, pancreatic cancer, and chemoradiation therapy.\n\nBased on the encouraging safety profile and the mOS from previous studies, an ongoing phase II randomized placebo‐controlled study investigating the combination of PHY906 and sorafenib in HBV‐positive patients with advanced hepatocellular carcinoma is being conducted at 22 study sites in the U.S., China, Hong Kong, and Taiwan. The goal is to seek approval in the U.S. and China for PHY906 as a prescription drug for first‐line (sorafenib), second‐line (PD‐1), or third‐line (capecitabine) therapy.\n\nTrial Information\n\nDisease\tHepatocellular carcinoma\t\nStage of Disease/Treatment\tMetastatic/advanced\t\nPrior Therapy\tOne prior regimen\t\nType of Study\tPhase II, single arm\t\nPrimary Endpoint\tSix‐month survival rate\t\nSecondary Endpoints\tDisease control rate (complete response/partial response + stable disease), progression‐free survival, overall survival, AFP reduction, change in quality of life, safety\t\nInvestigator's Analysis\tActive and should be pursued further\t\n\nDrug Information\n\nDrug 1\t \t\n  Generic/Working Name\tPHY906, KD018, YIV‐906\t\n  Trade Name\tYIV‐906\t\n  Company Name\tYiviva Inc.\t\n  Dose\t800 b.i.d. milligrams (mg) per day\t\n  Route\tOral (p.o.)\t\n  Schedule of Administration\tPatients were initially treated for two 21‐day courses with PHY906 800 mg b.i.d. + capecitabine 750 mg/m2 b.i.d. according to the following schedule: capecitabine 14 days on treatment, days 1 through 14, and 7 days off treatment; PHY906 days 1 through 4 and days 8 through 11 of each course. Patients might remain on study beyond their initial two courses of treatment until tumor progression or unacceptable toxicity mandated their removal.\t\nDrug 2\t \t\n  Generic/Working Name\tXeloda\t\n  Trade Name\tCapecitabine\t\n  Company Name\tRoche\t\n  Dose\t750 milligrams (mg) per squared meter (m2)\t\n  Route\tOral (p.o.)\t\n  Schedule of Administration\tPatients were initially be treated for two 21‐day courses with PHY906 800 mg b.i.d. + capecitabine 750 mg/m2 b.i.d. according to the following schedule: capecitabine 14 days on treatment and 7 days off treatment and PHY906 days 1 through 4 and days 8 through 11 of each course. Patients might remain on study beyond their initial two courses of treatment until tumor progression or unacceptable toxicity mandated their removal.\t\n\nPatient Characteristics\n\nNumber of Patients, Male\t32\t\nNumber of Patients, Female\t7\t\nStage\tStage II: 1 (2.6%); stage IIIA: 14 (35.9%); stage IIIB: 3 (7.7%); stage IIIC 4 (10.3%); stage IV 17 (43.6%)\t\nAge\tMedian (range): 54 (32–75) years\t\nNumber of Prior Systemic Therapies\tMedian (range): 1 (0–3)\t\nPerformance Status: ECOG\t0 — 0\n\n1 — 39\n\n2 — 0\n\n3 — 0\n\nUnknown — 0\n\n\t\nCancer Types or Histologic Subtypes\tHepatocellular carcinoma: 39\n\nHepatocellular carcinoma + HBV: 27\n\nHepatocellular carcinoma + hepatitis C virus: 7\n\nHepatocellular carcinoma + HBV + hepatitis C virus: 5\n\n\t\n\nPrimary Assessment Method\n\nTitle\tResponse Assessment\t\nNumber of Patients Screened\t45\t\nNumber of Patients Enrolled\t39\t\nNumber of Patients Evaluable for Toxicity\t39\t\nNumber of Patients Evaluated for Efficacy\t39\t\nEvaluation Method\tRECIST 1.0\t\nResponse Assessment CR\tn = 0 (0%)\t\nResponse Assessment PR\tn = 0 (0%)\t\nResponse Assessment SD\tn = 18 (46.2%)\t\nResponse Assessment PD\tn = 20 (51.3%)\t\nResponse Assessment OTHER\tn = 1 (2.6%)\t\n(Median) Duration Assessments PFS\t1.50 months; confidence interval: 95%\t\n(Median) Duration Assessments OS\t6.03 months\t\n\nAdverse Events\n\nAll Cycles\t\t\t\t\t\t\t\t\nName\tNC/NA, %\tGrade 1, %\tGrade 2, %\tGrade 3, %\tGrade 4, %\tGrade 5, %\tAll grades, %\t\nDiarrhea\t49\t38\t10\t3\t0\t0\t51\t\nFatigue (asthenia, lethargy, malaise)\t51\t31\t18\t0\t0\t0\t49\t\nINR of prothrombin time\t62\t33\t5\t0\t0\t0\t38\t\nBilirubin (hyperbilirubinemia)\t56\t5\t26\t10\t3\t0\t44\t\nRash: hand‐foot skin reaction\t85\t10\t5\t0\t0\t0\t15\t\nInsomnia\t66\t26\t8\t0\t0\t0\t34\t\nHyperpigmentation\t74\t26\t0\t0\t0\t0\t26\t\nAnorexia\t74\t10\t13\t3\t0\t0\t26\t\nDistension/bloating, abdominal\t71\t5\t21\t3\t0\t0\t29\t\nNausea\t71\t26\t3\t0\t0\t0\t29\t\nEdema: limb\t74\t18\t8\t0\t0\t0\t26\t\nAlkaline phosphatase\t95\t5\t0\t0\t0\t0\t5\t\nALT, SGPT\t66\t21\t5\t8\t0\t0\t34\t\nAST, SGOT\t51\t5\t18\t18\t8\t0\t49\t\nSodium, serum‐low (hyponatremia)\t76\t13\t0\t8\t3\t0\t24\t\nPain: abdomen NOS\t49\t23\t18\t10\t0\t0\t51\t\nDyspnea (shortness of breath)\t73\t21\t3\t3\t0\t0\t27\t\nPlatelets\t71\t21\t5\t0\t3\t0\t29\t\nHemoglobin\t46\t23\t28\t3\t0\t0\t54\t\nLeukocytes (total WBC)\t81\t8\t8\t0\t3\t0\t19\t\nLymphopenia\t77\t0\t8\t15\t0\t0\t23\t\nNeutrophils/granulocytes (ANC/AGC)\t91\t3\t3\t0\t3\t0\t9\t\nAbbreviations: AGC, atypical glandular cells; ALT, alanine aminotransferase; ANC, absolute neutrophil count; AST, aspartate aminotransferase; INR, international normalized ratio; NC/NA, no change from baseline/no adverse event; NOS, not otherwise specified; SGPT, serum glutamic pyruvic transaminase; SGOT, serum glutamic oxaloacetic transaminase; WBC, white blood cell.\n\nAssessment, Analysis, and Discussion\n\nCompletion\tStudy completed\t\nInvestigator's Assessment\tActive and should be pursued further\t\n\nHepatocellular carcinoma (HCC) is a leading cause of death from cancer worldwide. The median survival time of patients with unresectable and recurrent HCC ranges from 3 to 7 months [1, 2, 3]. The etiology of the disease is multifactorial; hepatitis B virus (HBV) and C virus infections are strongly linked to its development [4, 5, 6, 7, 8]. Over the last few years, the number of cases of HCC has increased in the U.S., mainly because of hepatitis C virus infection. Worldwide, 55% of all HCC cases are reported from China, and more than 60% of HCC cases are associated with HBV infection [9, 10, 11, 12]. In most instances, HCC is associated with a background history of decompensated liver disease and cirrhosis. Usually patients with HCC present with advanced disease, whereby surgical resection and/or chemical embolism is not feasible; treatment options for such patients are limited [13, 14, 15, 16]. Inoperable HCC cases are mostly treated with sorafenib as first‐line treatment [17], and the efficacy of sorafenib has been evaluated in two large multicenter, randomized, double‐blind, placebo‐controlled phase III trials: the Sorafenib HCC Assessment Randomized Protocol (SHARP) trial and a phase III trial conducted in the Asia‐Pacific region [18, 19]. Both trials demonstrated that sorafenib enhanced median overall survival (mOS) and time to tumor progression when compared with placebo. A noninferior alternative to sorafenib is lenvatinib, which received FDA approval for the first‐line treatment of unresectable HCC in 2018 [20]. Capecitabine, an oral 5‐fluorouracil prodrug approved for the treatment of metastatic colorectal and breast cancer, has been used off label to treat HCC and showed modest activity before any anti‐HCC drugs were approved [21, 22, 23, 24]. Studies also showed that capecitabine plus bevacizumab, or capecitabine plus bevacizumab/oxaliplatin in advanced HCC, were also effective and tolerable [25, 26]. The most common side effects associated with capecitabine are myelosuppression and skin toxicity, and the most limiting side effect is severe gastrointestinal (GI) toxicity. In contrast, common side effects associated with sorafenib include abdominal pain, anorexia, diarrhea, fatigue, hair loss, hand or foot skin reaction, nausea, rash or superficial skin shedding, and weight loss in patients with HCC [18, 19, 27, 28]. Among all side effects caused by sorafenib, 55% of recipients report diarrhea [29, 30]. Therefore, any agent that can alleviate the toxicity caused by HCC therapeutics without compromising the antitumor efficacy will provide an additive benefit. The FDA has approved several immunotherapies for HCC, including atezolizumab plus bevacizumab as first‐line treatment and nivolumab or pembrolizumab as second‐line treatments.\n\nTraditional Chinese medicine has been used to treat a variety of diseases for centuries, especially for GI symptoms like nausea, vomiting, diarrhea, and abdominal spasms [31, 32, 33]. One traditional Chinese medicine formulation, PHY906 or YIV‐906, comprising a mixture of four herbs (Scutellaria baicalensis Georgi, Glycyrrhiza uralensis Fisch., Paeonia lactiflora Pall., and Ziziphus jujube Mill.), has been used for approximately 1,800 years for a variety of maladies, most notably severe gastrointestinal distress, for example, nausea, vomiting, diarrhea, and abdominal spasms. It is prepared under current Good Manufacturing Practice conditions and has been well characterized by both chemical and biological fingerprints. Multiple clinical batches of PHY906 have been documented to have more than 90% consistency using integration of chemical and biological fingerprints. Stability studies indicated that PHY906 capsules remained stable for at least 6 years at room temperature.\n\nNotably, PHY906/YIV‐906 does not exhibit toxicities with other agents used for HCC chemotherapy in preclinical and clinical studies [33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45]. In fact, in nearly all cases, the combination regimen was found to imply a better therapeutic outcome than the historical efficacy of the chemotherapeutic agent alone and did not exhibit toxicities [34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44]. More importantly, quality of life scores did not deteriorate significantly from baseline scores. For example, the mechanism of action in reducing CPT‐11–induced diarrhea and intestinal damage involves inhibition of several inflammatory processes, such as NF‐κB, COX‐2, IL‐6, iNOs, and promoting intestinal progenitor cell repopulation [35, 36]. In addition, the mechanism of enhancing antitumor agents are due to the activation of innate and adaptive immunity in the tumor tissue microenvironment [37, 39, 46, 47].\n\nPHY906/capecitabine combination therapy resulted in limited deleterious side effects. Previous data from a U.S.‐based phase I/II clinical trial involving PHY906/capecitabine therapy revealed beneficial effects and reduced toxicities for the Asian subpopulation with an mOS of 16.5 months and no capecitabine‐induced grade 3/4 GI toxicities in advanced nonresectable patients (with HCC) with the PHY906 plus capecitabine combination therapy from a phase I/II study of PHY906 plus capecitabine in the U.S [49]. This study sought to validate similar effects of reduced chemotherapy‐induced gastrointestinal toxicity and enhanced antitumor activity for patient populations with HCC in Taiwan.\n\nIn the present study, capecitabine/PHY906 combination therapy resulted in only a few grade 3 and 4 drug‐related toxicities. In essence, this combination was well tolerated by patients in both the current Taiwan and previous U.S. HCC studies. The incidence of nausea and emesis was lower with the PHY906/capecitabine combination than with the capecitabine treatment alone. Moreover, only two patients (5.13%) discontinued treatment in the current combination because of adverse effects from capecitabine [18, 19, 23, 24]. Similar to the earlier trial in the U.S., toxicities were manageable with minimal grade 3 or 4 toxicities [48]. As in the previous U.S. trial, quality of life scores did not deteriorate significantly from baseline scores during the combination therapy of PHY906 and capecitabine. These observations concur with previous studies involving irinotecan‐based chemotherapy in colorectal cancer, gemcitabine‐refractory pancreatic cancer, and chemoradiation therapy in rectal cancer [37, 39, 46, 47, 49].\n\nSorafenib has been standard for HCC treatment. Based on results of the SHARP and Asia‐Pacific phase III studies, 95% of patients were classified as Child‐Pugh A and had no previous treatment. The mOS of patients enrolled in the SHARP and Asian studies was 10.7 and 6.5 months, respectively, whereas that of placebo was 7.9 and 4.2 months, respectively [18, 19]. The patients enrolled in the current study had a poorer prognosis; 90% were previously treated with chemotherapy or targeted therapy involving chemoembolization or radiation, and > 60% had had two prior treatments. The antitumor outcome (mOS, 6‐month‐ or 12‐month survival rate) in our Taiwan study (n = 39) was not as promising as that of U.S. study (n = 42). The combination regimen of PHY906 plus capecitabine was mainly used as the first‐line treatment in the U.S. study, whereas it was mainly used as a second‐ or third‐line treatment in the Taiwan study. Patients in the present Taiwan study were heavily pretreated with various procedures or regimens, including targeted therapies, chemotherapies, transarterial chemoembolization/percutaneous ethanol injection, surgery, radiation therapy, or a combination. The starting alpha‐fetoprotein (AFP) levels were relatively higher in Taiwan, with 33.3% of patients having AFP higher than 12,000 ng/mL, compared with the counterpart U.S. study (16.7%) [48].\n\nIn the Taiwan study, the PHY906/capecitabine combination increased the median overall survival time to 6 months, whereas the average survival time was around 3 months for patients with HCC whose previous treatments had failed. Patients who did not receive prior targeted therapy or chemotherapy, or who had lower starting AFP level, had a better clinical outcome. Because some of the patients did not finish two courses of combination therapy, additional analysis was done to compare the differences between patients who had fewer than two cycles of treatment (n = 12) and patients who completed at least two cycles of treatment (n = 27). The mOS difference between these two groups of patients was 1.8 and 8.4 months, respectively (p = .0084) (Fig. 1A). Interestingly our data also indicated that HBV‐positive evaluable patients (with two or more courses of combination therapy) had an mOS of 8.4 months. In our previous PHY906/capecitabine U.S. study, Asian patients (n = 10) had an mOS of 16.5 months, relative to 6.7 months for the non‐Asian counterpart (n = 10). Notably, patients in the group infected with HBV only (n = 9) did not reach 50% overall survival, whereas a median survival of 6.7 months was estimated for others (n = 11). The results implied that combination therapy might benefit Asian patients with HBV infection. By combining Asian HBV‐infected patients (with HCC) who (a) did not receive prior systemic therapy and (b) finished two or more cycles of combination treatment from the U.S. and Taiwan trials, the mOS was 16.5 months (Fig. 1B). These results support the notion that the PHY906/capecitabine combination therapy may provide a survival benefit with a tolerable safety profile in patients with advanced HCC. Moreover, Asian patients with HBV seem to have remarkable mOS in both previous and current HCC studies. These results suggest that PHY906/capecitabine combination therapy may provide a selective clinical advantage for patients with HCC and HBV infection.\n\nThe mechanism underlying the function of PHY906 is multifactorial and could involve inhibition of multidrug‐resistant protein and CYP450, which may facilitate the uptake of chemotherapeutic drugs. Several pathways have been implicated in the mechanism of PHY906. The inhibition of tachykinin NK‐1, opiate δ receptors, and acetylcholinesterase could be reasons for the reduction of gastrointestinal toxicity [51]. Moreover, reports have shown that NF‐κB and matrix metalloproteases can be inhibited by PHY906. PHY606 may also affect the integrity of blood vessels and HIF‐α and Fos/Juk pathway. In mouse models, PHY906 was found to increase the inflammation in the tumor microenvironment through activation of M1 macrophages, resulting in tumor rejection [44]. Some or all of these mechanisms could play a critical role in PHY906 enhancement of antitumor properties when combined with other chemotherapeutic agents.\n\nBased on previous studies, the Chinese herb medicine extract PHY906 is a formula that enhances antitumor activity and reduces chemotherapy‐induced gastrointestinal toxicity in hepatocellular cancer. Results from this study also suggest that PHY906 combination therapy could be an alternative to currently available treatment options for HCC. Further larger cohorts for phase II/III clinical studies involving PHY906 combination therapy are warranted. For future consideration, the trial design can be improved by using a double‐blind, randomized placebo control to reduce the potential bias. Moreover, the inclusion criteria can be redefined on the number of prior treatments to confirm whether PHY906 selectively benefits naïve patients with HCC or those receiving second, third, or multiple lines of treatment. The combination treatment options could also be redesigned and use FDA‐approved standard of care, such as sorafenib or lenvatinib instead of capecitabine, in the trial. Therefore, an ongoing study entitled “A Phase II Randomized Placebo‐Controlled Study Investigating the Combination of YIV‐906 and Sorafenib (Nexavar) in HBV(+) Patients with Advanced Hepatocellular Carcinoma” (ClinicalTrials.gov identifier: NCT04000737) was designed to resolve the previously mentioned issues. We plan to conduct a phase III study to combination therapy of PHY906 plus capecitabine as a third‐line therapy for Asian patients with HCC and HBV infection.\n\nDisclosures\n\nShwu‐Huey Liu: Yiviva (E, OI [cofounder]), PHY906 (YIV‐906) patents (IP); Yung‐Chi Cheng: Yiviva (E, OI [cofounder], C/A, SAB, RF‐institutional), PHY906 (YIV‐906) patents (IP). The other authors indicated no financial relationships.\n\n(C/A) Consulting/advisory relationship; (RF) Research funding; (E) Employment; (ET) Expert testimony; (H) Honoraria received; (OI) Ownership interests; (IP) Intellectual property rights/inventor/patent holder; (SAB) Scientific advisory board\n\nAcknowledgments\n\nThe authors thank National Health Research Institutes and TTY Biopharm Co., Ltd for conducting and sponsoring the study in Taiwan. The authors also thank TTY Biopharm Co., Ltd. for supporting this clinical trial in Taiwan between 2008 and 2012. Parts of this study were supported by Sino‐American Cancer Foundation. The authors wish to acknowledge An Lu for her assistance in the preparation of this manuscript.\n\nClinicalTrials.gov Identifier: NCT00076609\n\nSponsor: Yiviva Inc.\n\nPrincipal Investigator: Yun Yen\n\nIRB Approved: Yes\n\nClick here to access other published clinical trials.\n==== Refs\nReferences\n\n1 Llovet JM , Bustamante J , Castells A et al. Natural history of untreated nonsurgical hepatocellular carcinoma: Rationale for the design and evaluation of therapeutic trials. Hepatology 1999;29 :62–67.9862851\n2 Di Bisceglie AM , Rustgi VK , Hoofnagle JH et al. Hepatocellular carcinoma. Ann Intern Med 1998;108 :390–401.\n3 Yang JD , Hainaut P , Gores GJ et al. A global view of hepatocellular carcinoma: Trends, risk, prevention, and management. Nat Rev Gastroenterol Hepatol 2019;16 :589–604.31439937\n4 Tsukuma H , Hiyama T , Tanaka S et al. Risk factors for hepatocellular carcinoma among patients with chronic liver disease. N Engl J Med 1993;328 :1797–1801.7684822\n5 Yang JD , Roberts LR . Hepatocellular carcinoma: A global view. Nat Rev Gastroenterol Hepatol 2010;7 :448–458.20628345\n6 Omata M , Cheng AL , Kokudo N et al. Asia‐Pacific clinical practice guidelines on the management of hepatocellular carcinoma: A 2017 update. Hepatol Int 2017;11 :317–370.28620797\n7 Schietroma I , Scheri GC , Pinacchio C et al. Hepatitis C virus and hepatocellular carcinoma: Pathogenetic mechanisms and impact of direct‐acting antivirals. Open Virol J 2018;12 :16–25.29541275\n8 Shi J , Zhu L , Liu S et al. A meta‐analysis of case‐control studies on the combined effect of hepatitis B and hepatitis C virus infections in causing hepatocellular carcinoma in China. Br J Cancer 2005;92 :607–612.15685242\n9 Hassan MM , Frome A , Patt YZ et al. Rising prevalence of hepatitis C virus infection among patients recently diagnosed with hepatocellular carcinoma in the United States. J Clin Gastroenterol 2002;35 :266–269.12192205\n10 Makarova‐Rusher OV , Altekruse SF , McNeel TS et al. Population attributable fractions of risk factors for hepatocellular carcinoma in the United States. Cancer 2016;122 :1757–1767.26998818\n11 Davila JA , Morgan RO , Shaib Y et al. Hepatitis C infection and the increasing incidence of hepatocellular carcinoma: A population‐based study. Gastroenterology 2004;127 :1372–1380.15521006\n12 Di Bisceglie AM , Lyra AC , Schwartz M et al.; Liver Cancer Network. Hepatitis C‐related hepatocellular carcinoma in the United States: Influence of ethnic status. Am J Gastroenterol 2003;98 :2060–2063.14499788\n13 Lu M , Li J , Rupp LB et al. Hepatitis C treatment failure is associated with increased risk of hepatocellular carcinoma. J Viral Hepat 2016;23 :718–729.27028626\n14 Venook AP . Treatment of hepatocellular carcinoma: Too many options? J Clin Oncol 1994;12 :1323–1334.8201395\n15 Goldberg D , Ditah IC , Saeian K et al. Changes in the prevalence of hepatitis C virus infection, nonalcoholic steatohepatitis, and alcoholic liver disease among patients with cirrhosis or liver failure on the waitlist for liver transplantation. Gastroenterology 2017;152 :1090–1099.28088461\n16 Kim D , Li AA , Perumpail BJ et al. Changing trends in etiology‐based and ethnicity‐based annual mortality rates of cirrhosis and hepatocellular carcinoma in the United States. Hepatology 2019;69 :1064–1074.30014489\n17 Llovet JM . Clinical and molecular classification of hepatocellular carcinoma. Liver Transpl 2007;3 (11 suppl 2 ):S13–S16.\n18 Llovet JM , Ricci S , Mazzaferro V et al.; SHARP Investigators Study Group. Sorafenib in advanced hepatocellular carcinoma. N Engl J Med 2008;359 :378–390.\n19 Cheng A , Kang Y , Chen Z et al. Efficacy and safety of sorafenib in patients in the Asia‐Pacific region with advanced hepatocellular carcinoma: A phase III randomized, double‐blind, placebo‐controlled trial. Lancet Oncol 2009;10 :25–34.19095497\n20 Kudo M , Finn RS , Qin S et al. Lenvatinib versus sorafenib in first‐line treatment of patients with unresectable hepatocellular carcinoma: A randomized phase 3 non‐inferiority trial. Lancet 2018;391 :1163–1173.29433850\n21 Yang TS , Lin YC , Chen JS et al. Phase II study of gemcitabine in patients with advanced hepatocellular carcinoma. Cancer 2000;89 :750–756.10951336\n22 Yang TS , Yang CH , Hsieh RK et al. Gemcitabine and doxorubicin for the treatment of patients with advanced hepatocellular carcinoma: A phase I‐II trial. Ann Oncol 2002;13 :1771–1778.12419750\n23 Patt YZ , Hassan MM , Aguayo A et al. Oral capecitabine for the treatment of hepatocellular carcinoma, cholangiocarcinoma, and gallbladder carcinoma. Cancer 2004;101 :578–586.15274071\n24 von Delius S , Lersch C , Mayr M et al. Capecitabine for treatment of advanced hepatocellular carcinoma. Hepatogastroenterology 2007;54 :2310–2314.18265654\n25 Murer F , Pozzan C , Peserico G et al. Capecitabine in advanced hepatocellular carcinoma. Dig Liver Dis 2016;48 :1260–1261.27476466\n26 Hsu CH , Yang TS , Hsu C et al. Phase II study of bevacizumab + capecitabine in patients with advanced/metastatic hepatocellular carcinoma: Final report. J Clin Oncol 2008;26 :4603a.\n27 Sun W , Haller DG , Mykulowycz K et al. Combination of capecitabine, oxaliplatin with bevacizumab in treatment of advanced hepatocellular carcinoma (HCC): A phase II study. J Clin Oncol 2007;25 (suppl 18 ):4574a.\n28 Li Y , Gao ZH , Qu XJ . The adverse effects of sorafenib in patients with advanced cancers. Basic Clin Pharmacol Toxicol 2015;116 :216–221.25495944\n29 Hsu CH , Shen YC , Shao YY et al. Sorafenib in advanced hepatocellular carcinoma: Current status and future perspectives. J Hepatocell Carcinoma 2014;12 :1 :85–99.\n30 O'Neil BH , Venook AP . Hepatocellular carcinoma: The role of the North American GI Steering Committee Hepatobiliary Task Force and the advent of effective drug therapy. The Oncologist 2007;12 :1425–1432.18165619\n31 Abou‐Alfa GK , Venook AP . The impact of new data in the treatment of advanced hepatocellular carcinoma. Curr Oncol Rep 2008;10 :199–205.18765149\n32 Liu SH , Chuang WC , Lam W et al. Safety surveillance of traditional Chinese medicine: Current and future. Drug Saf 2015;38 :117–128.25647717\n33 Liu SH , Cheng YC . Old formula, new Rx: The journey of PHY906 as cancer adjuvant therapy. J Ethnopharmacol 2012;140 :614–623.22326673\n34 Chinese Botany. Vol. 7 . 1st ed. Shanghai, China: Shanghai Science and Technology Publishing Company, 1999.\n35 Liu SH , Jiang Z , Cheng YC. A Chinese medicine formulation, PHY‐906, can enhance the therapeutic index of CPT‐11 and other anticancer drugs against cancer in mice. Proc Am Assoc Cancer Res 2001;42:458a .\n36 Lam W , Bussom S , Guan F et al. PHY906, a four‐herb Chinese medicine formula first described 1800 years ago, reduces irinotecan‐induced intestinal damage through anti‐inflammatory effects and by promotion of the repopulation of intestinal progenitor cells. Sci Transl Med 2010;2 :45ra59.\n37 Wang E , Bussom S , Chen J et al. Interaction of a traditional Chinese medicine (PHY906) and CPT‐11 on the inflammatory process in the tumor environment. BMC Med Genomics 2011;11 :4:38.\n38 Kummar S , Copur MS , Rose M et al. A phase I study of the Chinese herbal medicine PHY906 as a modulator of irinotecan‐based chemotherapy in patients with advanced colorectal cancer. Clin Colorectal Cancer 2011;10 :85–96.21859559\n39 Lam W , Jiang Z , Guan F et al. The number of intestinal bacteria is not critical for the enhancement of antitumor activity and reduction of intestinal toxicity of irinotecan by the Chinese herbal medicine PHY906 (KD018). BMC Complement Altern Med 2014;15 :14:490.\n40 Saif MW , Lansigan F , Ruta S et al. Phase I study of the botanical formulation PHY906 with capecitabine in advanced pancreatic and other gastrointestinal malignancies. Phytomedicine 2010;17 :161–169.20092990\n41 Sze DM , Chan GCF . Supplements for immune enhancement in hematologic malignancies. Hematology Am Soc Hematol Educ Program 2009;2009 :313–319.\n42 Liu SH , Jiang Z , Gao W. PHY906, a Chinese herbal formulation enhances the therapeutic effect of cancer chemotherapy in human colorectal and liver cancer. Proc Am Soc Clin Oncol 2003;22:864a .\n43 Liu SH , Foo A , Jiang Z et al. PHY906 as a broad‐spectrum enhancer in therapy: Clinical and preclinical results in hepatocellular carcinoma. Proc Am Assoc Cancer Res 2006 ;47:2142a.\n44 Lam W , Jiang Z , Guan F et al. PHY906(KD018), an adjuvant based on a 1800‐year‐old Chinese medicine, enhanced the anti‐tumor activity of sorafenib by changing the tumor microenvironment. Sci Rep 2015;30 :5:9384.\n45 Liu SH , Jiang Z , Su TM et al. Developing PHY906 as a broad‐spectrum modulator of chemotherapeutic agents in cancer therapy. Cancer Res 2004;64 (suppl 7 ):557a.\n46 Rockwell S , Grove TA , Liu Y et al. Preclinical studies of the Chinese Herbal Medicine formulation PHY906 (KD018) as a potential adjunct to radiation therapy. Int J Radiat Biol 2013;89 :16–25.22856538\n47 Farrell MP , Kummar S . Phase I/IIA randomized study of PHY906, a novel herbal agent, as a modulator of chemotherapy in patients with advanced colorectal cancer. Clin Colorectal Cancer 2003;2 :253–256.12620148\n48 Yen Y , So S , Rose M et al. Phase I/II study of PHY906/capecitabine in advanced hepatocellular carcinoma. Anticancer Res 2009;29 :4083–4092.19846955\n49 Yen Y , Chen LT , Liu SH et al. A comparison of US and Taiwan phase II clinical trials on combination therapy of PHY906 plus capecitabine in hepatocellular carcinoma. Abstract presented at: 11th Meeting of the Consortium for Globalization of Chinese Medicine (CGCM); August 21–23, 2012; Macau.\n50 Johung K , Kann B , Lacy J et al. Pilot trial of YIV‐906 with neoadjuvant chemoradiotherapy (CRT) in patients with locally advanced rectal cancer. Ann Oncol 2018;29 (suppl 5 ):V90.\n51 Liu SH , Jiang Z , Foo A et al. PHY906 in hepatocellular carcinoma. Proc Am Assoc Cancer Res 2007;48:1841a .\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "1083-7159", "issue": "26(3)", "journal": "The oncologist", "keywords": "Capecitabine; Chinese herbal medicine; Hepatocellular carcinoma; PHY906", "medline_ta": "Oncologist", "mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D000069287:Capecitabine; D006528:Carcinoma, Hepatocellular; D004365:Drugs, Chinese Herbal; D005472:Fluorouracil; D006801:Humans; D008113:Liver Neoplasms; D016896:Treatment Outcome", "nlm_unique_id": "9607837", "other_id": null, "pages": "e367-e373", "pmc": null, "pmid": "33140457", "pubdate": "2021-03", "publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": "14499788;19095497;7684822;20092990;30014489;18765149;29541275;28620797;21859559;9862851;8201395;27028626;20008216;28088461;22326673;18650514;26998818;18265654;15685242;12192205;15274071;29433850;2449110;25647717;12620148;10951336;17969094;27476466;18165619;31439937;25495944;21569348;25510341;12419750;27508178;15521006;20628345;19846955;22856538;25819872", "title": "A Phase II Clinical Trial on the Combination Therapy of PHY906 Plus Capecitabine in Hepatocellular Carcinoma.", "title_normalized": "a phase ii clinical trial on the combination therapy of phy906 plus capecitabine in hepatocellular carcinoma" }
[ { "companynumb": "TW-ROCHE-2713983", "fulfillexpeditecriteria": "1", "occurcountry": "TW", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CAPECITABINE" }, "drugadditional": "3", "dru...
{ "abstract": "OBJECTIVE\nNeonatal seizures are common complications. Phenobarbital is the agent of choice but leads to adverse neurologic outcomes. There has been increased use of newer agents like levetiracetam. The objective of this study was determining the rate of seizure resolution in neonates treated with phenobarbital or levetiracetam.\n\n\nMETHODS\nThis was a retrospective, single-center, cohort study from June 1, 2012-June 1, 2018 evaluating seizure resolution in neonates following first-line treatment with phenobarbital versus levetiracetam. Data were collected via review of the patient's charts in the electronic medical record. The primary outcome was seizure resolution without addition of a second antiepileptic agent. Logistic regression was used to assess the impact of pertinent variables.\n\n\nRESULTS\nEach group included 73 patients. The mean gestational age was 36.01 and 37.91 weeks for the phenobarbital and levetiracetam groups, respectively (p = 0.011). The phenobarbital group had higher rates of intraventricular hemorrhage at baseline. The median birth weight was 2750 and 3002 grams in the phenobarbital and levetiracetam groups, respectively (p = 0.10). Forty-five neonates (61.6%) achieved seizure resolution with phenobarbital compared with 30 neonates (41.1%) with levetiracetam (p = 0.01). In neonates who did not receive a benzodiazepine, seizure resolution was similar between groups (51-52%). In neonates who received a benzodiazepine, seizure resolution rate was 94.1% (16/17 neonates) for phenobarbital and 18.2% (4/22 neonates) for levetiracetam.\n\n\nCONCLUSIONS\nThese findings suggest seizure resolution with levetiracetam, and phenobarbital may be impacted by benzodiazepine administration. If no benzodiazepine is used, these agents demonstrated similar efficacy. Further research into the pharmacodynamic interaction with benzodiazepines is necessary.", "affiliations": null, "authors": "Wagner|Charlotte B|CB|;Kreimer|Alexander M|AM|;Carrillo|Nina P|NP|;Autry|Elizabeth|E|;Schadler|Aric|A|;Cook|Aaron M|AM|;Leung|Noelle R|NR|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.5863/1551-6776-26.2.144", "fulltext": null, "fulltext_license": null, "issn_linking": "1551-6776", "issue": "26(2)", "journal": "The journal of pediatric pharmacology and therapeutics : JPPT : the official journal of PPAG", "keywords": "benzodiazepines; efficacy; epilepsy; levetiracetam; newborn; phenobarbital; seizures", "medline_ta": "J Pediatr Pharmacol Ther", "mesh_terms": null, "nlm_unique_id": "101089851", "other_id": null, "pages": "144-150", "pmc": null, "pmid": "33603577", "pubdate": "2021", "publication_types": "D016428:Journal Article", "references": "21233461;29179233;28553374;2242106;27012547;18639748;27752944;27106855;33384298;25964725;21094062;17675022;24051577;12853301;29435578;25331445;30296665;22264706;23266150;16585324;21397167;2471436;10441604;21592494;31337995;19182150", "title": "Levetiracetam Compared to Phenobarbital as a First Line Therapy for Neonatal Seizures: An Unexpected Influence of Benzodiazepines on Seizure Response.", "title_normalized": "levetiracetam compared to phenobarbital as a first line therapy for neonatal seizures an unexpected influence of benzodiazepines on seizure response" }
[ { "companynumb": "US-UCBSA-2021010940", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "LEVETIRACETAM" }, "drugadditional": "3", ...
{ "abstract": "BACKGROUND\nPilomyxoid astrocytoma (PMA) is a rare variant of pilocytic astrocytoma. Compared with pilocytic astrocytoma, PMA is more aggressive, has a higher rate of local recurrence, and often disseminates to the leptomeninges. Leptomeningeal gliomatosis is another rare but often intractable neoplasm. PMA presenting as leptomeningeal gliomatosis can be a therapeutic challenge, particularly in young children for whom many pediatric oncologists consider radiation therapy only as a back-up treatment. However, chemotherapy, usually considered a frontline treatment for low-grade tumors such as PMA, has little impact on leptomeningeal gliomatosis.\n\n\nMETHODS\nWe report on a 5-year-old boy with an approximately 2-month history of progressively worsening loss of vision. Radiographic studies with contrast revealed an enhanced mass within the optic nerve, an enhanced lesion in the leptomeninges, and diffusely scattered nonenhanced white matter lesions in the craniospinal axis. The patient was treated with a 10-week carboplatin and vincristine regimen without a biopsy. After completing induction and 1 maintenance cycle, however, the patient developed coma caused by hydrocephalus. External ventricular drainage was performed and a biopsy was taken through ventriculoscopy, revealing PMA. The patient was then treated with craniospinal irradiation and concomitant temozolomide, a regimen to which he had a complete response. Two years after initial presentation the patient was free of disease.\n\n\nCONCLUSIONS\nThis report documents a rare, intractable tumor and provides evidence that radiation therapy, given as craniospinal irradiation, can be effective for leptomeningeal gliomatosis.", "affiliations": "Department of Neurosurgery, Kurume University School of Medicine, 67 Asahimachi, Kurume, Fukuoka, Japan. jintara@med.kurume-u.ac.jp", "authors": "Terasaki|Mizuhiko|M|;Bouffet|Eric|E|;Maeda|Mitsuhide|M|;Sugita|Yasuo|Y|;Sawamura|Yutaka|Y|;Morioka|Motohiro|M|", "chemical_list": "D018906:Antineoplastic Agents, Alkylating; D003606:Dacarbazine; D000077204:Temozolomide", "country": "United States", "delete": false, "doi": "10.1097/NRL.0b013e31823d7a92", "fulltext": null, "fulltext_license": null, "issn_linking": "1074-7931", "issue": "18(1)", "journal": "The neurologist", "keywords": null, "medline_ta": "Neurologist", "mesh_terms": "D018906:Antineoplastic Agents, Alkylating; D001254:Astrocytoma; D002675:Child, Preschool; D003131:Combined Modality Therapy; D016371:Cranial Irradiation; D003606:Dacarbazine; D006801:Humans; D008279:Magnetic Resonance Imaging; D008297:Male; D008577:Meningeal Neoplasms; D000077204:Temozolomide", "nlm_unique_id": "9503763", "other_id": null, "pages": "32-5", "pmc": null, "pmid": "22217612", "pubdate": "2012-01", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Successful treatment of leptomeningeal gliomatosis of pilomyxoid astrocytoma after failed frontline chemotherapy.", "title_normalized": "successful treatment of leptomeningeal gliomatosis of pilomyxoid astrocytoma after failed frontline chemotherapy" }
[ { "companynumb": "JP-CIPLA LTD.-2012JP00485", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "CARBOPLATIN" }, "drugadditional": "1", ...
{ "abstract": "Recently, a new form of congenital neutropenia that is caused by germline biallelic loss-of-function mutations in the SMARCD2 gene was described in four patients. Given the rarity of the condition, the clinical spectrum of the disease has remained elusive. We here report a new patient with a novel frameshift mutation and compare our patient with the previously reported SMARCD2-mutant patients, aiming to provide a more comprehensive understanding of the natural course of the disease.\n\n\n\nClinical and laboratory findings of all reported patients were reviewed. Next-generation sequencing was performed to identify the causative genetic defect. Data on the hematopoietic stem cell transplantation including stem cell sources, conditioning regimen, engraftment, graft-versus-host disease, and infections were also collected.\n\n\n\nAn 11-year-old female patient had a variety of infections including sepsis, deep tissue abscesses, otitis, pneumonia, gingivitis, and diarrhea since infancy. A novel homozygous mutation in SMARCD2 (c.93delG, p.Ala32Argfs*80) was detected. Bone marrow examination showed hypocellularity and decreased neutrophils with diminished granules and myeloid dysplasia, but no blast excess as in previously reported patients. The neutropenia was non-responsive even to higher doses of granulocyte colony-stimulating factor (G-CSF); therefore, the patient was transplanted at 10 years of age from a HLA-A allele-mismatched unrelated donor using a reduced toxicity conditioning regimen and recovered successfully. Compared with the previous four cases, our patient showed longer survival before transplantation without blastic transformation.\n\n\n\nDistinctive myeloid features and long-term follow-up including therapy options are presented for the newly described case of SMARCD2 deficiency. This disorder is apparent at infancy and requires early transplantation due to the unrelenting disease course despite conventional therapy.", "affiliations": "Istanbul Faculty of Medicine, Division of Pediatric Allergy and Immunology, Istanbul University, Istanbul, Turkey.;Faculty of Medicine, Division of Pediatric Allergy/Immunology, Marmara University, Fevzi Çakmak Mah. No: 41, Pendik, Istanbul, Turkey.;Ludwig Boltzmann Institute for Rare and Undiagnosed Diseases, Vienna, Austria.;Faculty of Medicine, Division of Pediatric Allergy and Immunology, Istanbul Cerrahpasa University, Istanbul, Turkey.;Ludwig Boltzmann Institute for Rare and Undiagnosed Diseases, Vienna, Austria.;Istanbul Faculty of Medicine, Division of Pediatric Allergy and Immunology, Istanbul University, Istanbul, Turkey.;Faculty of Medicine, Department of Pediatrics, Istinye University, Istanbul, Turkey.;Faculty of Medicine, Division of Pediatric Allergy/Immunology, Marmara University, Fevzi Çakmak Mah. No: 41, Pendik, Istanbul, Turkey.;Faculty of Medicine, Division of Pediatric Allergy/Immunology, Marmara University, Fevzi Çakmak Mah. No: 41, Pendik, Istanbul, Turkey.;Istanbul Faculty of Medicine, Division of Pediatric Hematology and Oncology, Istanbul University, Istanbul, Turkey.;Ludwig Boltzmann Institute for Rare and Undiagnosed Diseases, Vienna, Austria.;Faculty of Medicine, Division of Pediatric Allergy/Immunology, Marmara University, Fevzi Çakmak Mah. No: 41, Pendik, Istanbul, Turkey. safabaris@hotmail.com.", "authors": "Yucel|Esra|E|;Karakus|Ibrahim Serhat|IS|;Krolo|Ana|A|;Kiykim|Ayca|A|;Heredia|Raul Jimenez|RJ|;Tamay|Zeynep|Z|;Cipe|Funda Erol|FE|;Karakoc-Aydiner|Elif|E|;Ozen|Ahmet|A|;Karaman|Serap|S|;Boztug|Kaan|K|;Baris|Safa|S|0000-0002-4730-9422", "chemical_list": null, "country": "Netherlands", "delete": false, "doi": "10.1007/s10875-020-00878-4", "fulltext": null, "fulltext_license": null, "issn_linking": "0271-9142", "issue": "41(1)", "journal": "Journal of clinical immunology", "keywords": "CEBPE; SMARCD2; SWI/SNF complex; hematopoietic stem cell transplantation; neutropenia; specific granule deficiency", "medline_ta": "J Clin Immunol", "mesh_terms": null, "nlm_unique_id": "8102137", "other_id": null, "pages": "59-65", "pmc": null, "pmid": "33025377", "pubdate": "2021-01", "publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": "13326376", "title": "Novel Frameshift Autosomal Recessive Loss-of-Function Mutation in SMARCD2 Encoding a Chromatin Remodeling Factor Mediates Granulopoiesis.", "title_normalized": "novel frameshift autosomal recessive loss of function mutation in smarcd2 encoding a chromatin remodeling factor mediates granulopoiesis" }
[ { "companynumb": "TR-AMGEN-TURSP2021069086", "fulfillexpeditecriteria": "2", "occurcountry": "TR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "FILGRASTIM" }, "drugadditional": "3", ...
{ "abstract": "BACKGROUND\nLegionellosis is a well-known cause of pneumonia. Primary cutaneous and subcutaneous infection caused by Legionella pneumophila is rare and the diagnosis is challenging.\n\n\nMETHODS\nA 38-year-old Thai woman with systemic lupus erythematosus and myasthenia gravis treated with prednisolone and azathioprine presented to our hospital with low-grade fever, diarrhea, and indurated skin lesions on both thighs. Initial examination showed plaques on both inner thighs. Magnetic resonance imaging showed myositis and swelling of the skin and subcutaneous tissue. Diagnosis of panniculitis due to L. pneumophila was carried out by histopathology, Gram stain, and 16S rRNA gene sequencing method of tissue biopsy from multiple sites on both thighs. Myocarditis was diagnosed by echocardiography. The final diagnosis was disseminated extrapulmonary legionellosis. Treatment comprised intravenous azithromycin for 3 weeks and the skin lesions, myositis and myocarditis resolved. Oral azithromycin and ciprofloxacin were continued for 3 months to ensure eradication of the organism. The patient's overall condition improved.\n\n\nCONCLUSIONS\nTo our knowledge, we report the first case of L. pneumophila infection manifesting with panniculitis, possible myositis, and myocarditis in the absence of pneumonia. The diagnosis of extrapulmonary Legionella infection is difficult, especially in the absence of pneumonia. A high index of suspicion and appropriate culture with special media or molecular testing are required. Initiation of appropriate treatment is critical because delaying therapy was associated with progressive infection in our patient.", "affiliations": "Division of Infectious Disease, Department of Medicine, Faculty of Medicine, Ramathibodi Hospital, Mahidol University, 270 Rama VI Road, Ratchathewi District, Bangkok, 10400, Thailand. mchitasombat@gmail.com.;Division of Dermatology, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand.;Department of Pathology, Faculty of Medicine Ramathibodi Hospital, Mahidol University, 270 Rama VI Road, Ratchathewi District, Bangkok, Thailand.", "authors": "Chitasombat|Maria N|MN|http://orcid.org/0000-0002-3902-219X;Ratchatanawin|Natta|N|;Visessiri|Yingluck|Y|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1186/s12879-018-3378-0", "fulltext": "\n==== Front\nBMC Infect DisBMC Infect. DisBMC Infectious Diseases1471-2334BioMed Central London 337810.1186/s12879-018-3378-0Case ReportDisseminated extrapulmonary Legionella pneumophila infection presenting with panniculitis: case report and literature review http://orcid.org/0000-0002-3902-219XChitasombat Maria N. +66 8 1929 9010mchitasombat@gmail.com 1Ratchatanawin Natta ranrj@mahidol.ac.th 2Visessiri Yingluck yingluckja@hotmail.com 31 0000 0004 1937 0490grid.10223.32Division of Infectious Disease, Department of Medicine, Faculty of Medicine, Ramathibodi Hospital, Mahidol University, 270 Rama VI Road, Ratchathewi District, Bangkok, 10400 Thailand 2 0000 0004 1937 0490grid.10223.32Division of Dermatology, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand 3 0000 0004 1937 0490grid.10223.32Department of Pathology, Faculty of Medicine Ramathibodi Hospital, Mahidol University, 270 Rama VI Road, Ratchathewi District, Bangkok, Thailand 17 9 2018 17 9 2018 2018 18 4679 10 2017 10 9 2018 © The Author(s). 2018Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nLegionellosis is a well-known cause of pneumonia. Primary cutaneous and subcutaneous infection caused by Legionella pneumophila is rare and the diagnosis is challenging.\n\nCase presentation\nA 38-year-old Thai woman with systemic lupus erythematosus and myasthenia gravis treated with prednisolone and azathioprine presented to our hospital with low-grade fever, diarrhea, and indurated skin lesions on both thighs. Initial examination showed plaques on both inner thighs. Magnetic resonance imaging showed myositis and swelling of the skin and subcutaneous tissue. Diagnosis of panniculitis due to L. pneumophila was carried out by histopathology, Gram stain, and 16S rRNA gene sequencing method of tissue biopsy from multiple sites on both thighs. Myocarditis was diagnosed by echocardiography. The final diagnosis was disseminated extrapulmonary legionellosis. Treatment comprised intravenous azithromycin for 3 weeks and the skin lesions, myositis and myocarditis resolved. Oral azithromycin and ciprofloxacin were continued for 3 months to ensure eradication of the organism. The patient’s overall condition improved.\n\nConclusions\nTo our knowledge, we report the first case of L. pneumophila infection manifesting with panniculitis, possible myositis, and myocarditis in the absence of pneumonia. The diagnosis of extrapulmonary Legionella infection is difficult, especially in the absence of pneumonia. A high index of suspicion and appropriate culture with special media or molecular testing are required. Initiation of appropriate treatment is critical because delaying therapy was associated with progressive infection in our patient.\n\nElectronic supplementary material\nThe online version of this article (10.1186/s12879-018-3378-0) contains supplementary material, which is available to authorized users.\n\nKeywords\nLegionella pneumophilaPanniculitisLupusMyositisMyocarditisissue-copyright-statement© The Author(s) 2018\n==== Body\nBackground\nLegionella is a well-known cause of pneumonia. Extrapulmonary manifestations of Legionnaires’ disease include myocarditis [1, 2], neurological involvement (acute disseminated encephalomyelitis), and multiorgan failure [3, 4]. Legionnaires’ disease has been reported together with several types of skin lesions such as maculopapular rash, petechial rash, erythema with focal blister, cellulitis, pustules, abscesses, and subcutaneous masses [5]. Various species of Legionella, including L. pneumophila, L. micdadei, L. cincinnatiensis, L. maceachernii, and L. feeleii, cause skin/soft tissue infection, mostly among immunocompromised patients with pneumonia [6]. Primary cutaneous infection is a rare distinctive feature of direct inoculation of Legionella into skin and soft tissue, which occurs as cellulitis necrotizing fasciitis, as a postoperative complication [6–9]. The diagnosis of legionellosis can be challenging in the absence of pneumonia. To the best of our knowledge, this is the first description of panniculitis due to Legionella. This report highlights the challenges, pitfalls and importance of diagnosing extrapulmonary Legionella infection.\n\nCase presentation\nWe describe a case of disseminated extrapulmonary legionellosis in an immunocompromised 38-year-old Thai woman. The patient was diagnosed in 2002 with systemic lupus erythematosus (SLE) with fever, polyarthritis, oral ulcer, alopecia, and proteinuria. Since then, she has been treated with prednisolone with azathioprine. She achieved clinical remission but remained on prednisolone (5 mg daily) and azathioprine (50 mg daily) for 13 years. In August 2015, 3 months prior to admission, she suffered from cramping abdominal pain, watery diarrhea two or three times daily, and low-grade fever. She was diagnosed with enteritis and treated with ceftriaxone without clinical improvement. The dose of immunosuppressive medication was increased to prednisolone 45 mg daily and hydroxychloroquine 400 mg daily. In September 2015, 2 months prior to admission, she developed proximal muscle weakness with low-grade fever. She was diagnosed with myasthenia gravis and received treatment with pyridostigmine (Mestinon™) 240 mg daily. She remained weak and lost significant weight because of poor appetite and diarrhea. She was admitted to her local hospital in October 2015 for intravenous fluid hydration and pyridostigmine was discontinued because of diarrhea. As her condition was becoming increasingly compromised with high-grade fever, generalized vesicular rash, and proximal muscle weakness, she was referred to our hospital in November, 2015. She did not recall any exposure to potentially contaminated water or animals. She worked as a school teacher. Upon admission, her temperature was 39 °C, heart rate 100 beats/min, and respiratory rate 20 breaths/min. Blood pressure was 90/60 mmHg. Physical examination revealed a cachectic woman with mild pale conjunctivae and anicteric sclerae. Skin examination showed generalized discrete erythematous papules and macules with dry necrotic crust on the scalp, facial area, trunk and extremities. She also had plaques measuring 15 × 15 cm on both inner thighs (Fig. 1). Abdominal examination showed mild tenderness and distension. The examination did not reveal any cardiac or pulmonary findings. Neurological examination revealed ptosis in both eyes, proximal muscle weakness (grade IV) of all extremities, but normal sensation and tendon reflexes. Laboratory data shown in Table 1. Skin biopsy of the crusted lesion revealed varicella zoster virus from polymerase chain reaction (PCR). She was diagnosed with varicella zoster virus infection. At admission, plasma cytomegalovirus (CMV) viral load (Cobas® Taqman amplicon) was 363,000 copies/mm3. She received intravenous ganciclovir injection with adjuvant granulocyte colony-stimulating factor for leukopenia. The timeline of the patient’s illness is illustrated in Additional file 1. She was also treated empirically for skin and soft tissue infection with piperacillin/tazobactam (12 days), and then meropenem (5 days) and then cefepime (5 days), without any clinical response. Further investigations, computed tomography of the abdomen showed a long segment of jejunal wall thickening and mild rectal wall thickening. Colonoscopy revealed generalized edematous mucosa of the colon without ulceration, and random biopsy was negative. She was diagnosed with CMV syndrome with suspected CMV jejunitis, which later improved with ganciclovir therapy. She was also diagnosed with myasthenia gravis by electromyography, nerve conduction velocity, and presence of acetylcholine receptor antibody. Later on, she developed chest pain and shortness of breath. Computed tomography of the chest revealed bilateral pleural effusion and small pericardial effusion. Echocardiography revealed impaired left ventricular systolic function with 40% ejection fraction along with global hypokinesia. She was diagnosed with lupus myocarditis, and treated with a 5-day course of intravenous immunoglobulin (0.4 g/kg/day) and 5 mg/day intravenous dexamethasone. During her hospitalization for 21 days, she remained febrile with a maximum temperature of 38.5–39 °C, despite the previously mentioned therapy. At that time, she had worsening pain in both thighs at the site of the plaques. Magnetic resonance imaging of both lower extremities revealed diffuse enhancing, hyperintense T2 signals in the muscles at the pelvis at both thighs and legs, with diffuse muscle atrophy and swelling of the skin and subcutaneous tissue (Fig. 2a, b). Multiple subcutaneous biopsy specimens were taken from both thighs (site of skin lesions) showed suppurative panniculitis (Fig. 3) and presence of Gram-negative bacilli. Acid-fast and Gomori methenamine stains were negative. Tissue biopsies for aerobic microorganisms showed no growth. Bacterial broad-range 16S ribosomal RNA sequencings revealed L. pneumophila (99% similarity to L. pneumophila consensus sequence). Culture for fungi and mycobacteria was negative. Her antimicrobial regimen was changed to intravenous azithromycin, and fever subsided within 5 days. Her thigh lesions gradually improved over the first week of therapy (Fig. 4). She was diagnosed with disseminated L. pneumophila infection resulting in panniculitis, myositis and myocarditis. She received intravenous azithromycin for 21 days. Oral azithromycin and ciprofloxacin were continued for 3 months to ensure eradication of the organism from our immunosuppressed patient. She received intravenous ganciclovir until the clearance of CMV viremia (total of 48 days), and then switched to oral valganciclovir maintenance therapy. She underwent physical rehabilitation and was discharged after 64 days hospitalization. Clinically, she is doing well at 1-year follow-up. She did not have any further tests done as follow-up proved successful clinical resolution and eradication of Legionella infection.Fig. 1 Multiple erythematous indurated plaques on the proximal right thigh, multiple healed crusted papules on the right lower extremity, and whitish striae (before treatment)\n\nTable 1 Laboratory data on admission\n\nParameter\tRecorded value\tStandard value\t\nWhite blood cell count\t1,860 cells/mm3\t4,500–7,500 cells/mm3\t\nNeutrophils\t83 %\t\t\nLymphocytes\t14 %\t\t\nHemoglobin\t10.8 g/dL\t11.3–15.2 g/dL\t\nHematocrit\t32.4 %\t36–45 %\t\nPlatelet count\t179,000 cells/mm3\t130,000–350,000 cells/mm3\t\nTotal protein\t33 g/L\t69-84 g/L\t\nAlbumin\t12.3 g/L\t39–51 g/L\t\nTotal bilirubin\t0.6 mg/dL\t0.2–1.2 mg/dL\t\nDirect billirubin\t0.3 mg/dL\t0.1–0.3 mg/dL\t\nAspartate aminotransferase\t23 U/L\t11–30 U/L\t\nAlanine aminotransferase\t34 U/L\t4–30 U/L\t\nAlkaline phosphatase\t57 U/L\t44–147 U/L\t\nBlood urea nitrogen\t9.0 mg/dL\t8–20 mg/dL\t\nCreatinine\t0.32 mg/dL\t0.63–1.03 mg/dL\t\nFig. 2 a. Coronal T2-weighted MRI of the thighs. b. Axial T2-weighted MRI of the thighs demonstrating enhancement of subcutaneous tissue and muscle. MRI, magnetic resonance imaging\n\nFig. 3 Histopathology of subcutaneous tissue of right thigh. Photomicrograph revealed neutrophil infiltration in the deep dermis to subcutaneous tissue and fat necrosis (200×, hematoxylin and eosin)\n\nFig. 4 Proximal right thigh showed resolution of indurated plaque after 8 days of treatment for Legionella, biopsy stiches, healed scar of varicella lesions, and whitish striae\n\n\n\nDiscussion\nHere, we describe a patient with SLE and myasthenia gravis who suffered multiple infectious complications including varicella, CMV syndrome/jejunitis and Legionella panniculitis with possible dissemination (myositis and myocarditis). Panniculitis cause by Legionella has not been reported in the literature. Our initial presumptive diagnosis of panniculitis was lupus panniculitis or CMV related panniculitis. However, our patient did not improve during the course of treatment for both diseases. The diagnosis of lupus panniculitis should not be assumed in SLE patients, given that immunosuppressive drugs are a predisposing factor for infective panniculitis, and both conditions require different treatment strategies [10]. Infective panniculitis has been described in association with many infectious agents including bacteria (Nocardia spp. and Actinomyces spp.), mycobacteria, fungi and parasites [11]. Anatomical pathology is the key to distinguishing the etiology of panniculitis by the type of white blood cell infiltrates. Lupus panniculitis presents with lymphocytic infiltrates with or without vasculitis. CMV panniculitis must have evidence of viral cytopathic changes with the characteristic owl’s eye inclusion bodies. Our patient had neutrophilic panniculitis that suggested infective panniculitis. Gram staining showed intracellular Gram-negative bacilli that failed to grow on routine culture media, and they were identified as L. pneumophila by molecular methods. It was difficult to distinguish whether the panniculitis resulted from primary inoculation or secondary hematogenous spread of Legionella. Several features, such as prolonged fever despite broad-spectrum beta-lactam antibiotics, myositis and myocarditis, suggested disseminated Legionella infection. Myositis has been reported in one patient with pneumonia [12]. The etiology of myocarditis in our patient remains debatable, and whether it resulted from lupus or Legionella infection. Myocardial biopsy was not performed because of the excessive risk in our case, and therapy for both lupus and Legionella was initiated at the same time. Follow-up echocardiography showed normal cardiac function. Legionella myocarditis has been reported as a complication of Legionnaires’ disease [13, 14]. Only one adult patient developed perimyocarditis due to L. pneumophila in the absence of respiratory involvement, which resulted in multiorgan failure [1]. The atypical multiorgan involvement of Legionella infection in our patient could have resulted from immunosuppression that led to lymphopenia and cell-mediated immunodeficiency. Our patient did not have evidence of pneumonia at any time point before or during hospitalization.\n\nCutaneous and subcutaneous Legionella infection is rare and mostly occurs in immunosuppressed patients, as described previously [5]. Primary extrapulmonary infection of skin/subcutaneous tissue (cellulitis, multiple subcutaneous abscesses, and tenosynovitis) by L. pneumophila led to disseminated infection (pneumonia and respiratory failure) in an immunocompromised liver transplant recipient [15]. The diagnosis was made from culture of bronchoalveolar lavage fluid and later, Legionella was isolated from the abscesses using special culture media and was confirmed by molecular methods [15]. This highlights the challenging aspect in the diagnosis of Legionella infection, as it is a facultative Gram-negative aerobic bacillus that resides within tissue and alveolar macrophages, and it requires specialized media [16]. Non-culture-based diagnostic methods include urinary antigen tests for L. pneumophila, which is a rapid diagnostic tool; however, these tests are limited to the detection of L. pneumophila serogroup 1, L. micdadei and Legionella longbeachae [17].\n\nThe diagnosis of extrapulmonary Legionella infection relies on clinician alertness and a good level of cooperation with the microbiology laboratory, as Legionella species must be grown on special media. In our setting we did not have the selective media, Legionella urinary antigen and antibody to detect Legionella, or direct fluorescent antibody against Legionella. The diagnosis in our patient was made by 16S rRNA gene sequencing method. Initiation of appropriate treatment is critical because delay is associated with increased mortality in Legionella pneumonia [18]. Effective antimicrobial treatment of legionellosis includes antibiotics that achieve therapeutic intracellular concentrations within macrophages, such as the macrolides, fluoroquinolones, and cyclin families [16]. Azithromycin or levofloxacin are commonly used to treat Legionella infection [16, 19]. Optimal treatment duration for cutaneous legionellosis has not been established. Most patients with Legionella pneumonia are successfully treated with a 7-to 14-day course of antibiotics. Disseminated legionellosis requires longer duration of therapy, although the duration is not well defined. Immunocompromised patients with cutaneous legionellosis may require 3 weeks of treatment [5, 16].\n\nConclusion\nLegionella infection may cause extrapulmonary manifestations involving skin/subcutaneous and muscle that leads to dissemination, especially in immunocompromised patients. Infective panniculitis caused by Legionella should be considered in the differential diagnosis of skin/subcutaneous infection that fails to respond to beta-lactam antibiotics. The diagnosis of extrapulmonary Legionella infection is challenging because special culture media are required. In our case, the diagnosis was based on 16S rRNA gene sequencing method. Clinicians should be aware of extrapulmonary manifestation of legionellosis in the absence of pneumonia.\n\nAdditional file\n\nAdditional file 1: The timeline of the patient’s illness. The patient visited the local hospital with low-grade fever and diarrhea for 3 months. She had varicella and cytomegalovirus syndrome with jejunitis. She had persistence high-grade fever and panniculitis despite broad-spectrum antibiotics. She developed myocarditis. She recovered after receiving specific therapy. (DOCX 70 kb)\n\n \n\n\nAbbreviations\nPCRPolymerase chain reaction\n\nrRNAribosomal ribonucleic acid\n\nAcknowledgements\nWe are grateful to Siriorn Watcharananan MD for helpful comment, Parawee Chevaisarakul MD for clinical management, Patawee Boontanon MD for providing the picture, Apichart Sudatis MD for data collection, Teerawut Sirikum MD for performing tissue biopsy, and Suthep Jirasuthat MD who gave an opinion on the pathological report. We thank Cathel Kerr, PhD, from Edanz Group (www.edanzediting.com/ac) for editing a draft of this manuscript.\n\nAvailability of data and materials\nThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\n\nAuthors’ contributions\nMNC drafted the manuscript. MNC and NR and were responsible for the clinical management and therapy. YV performed the histological examination of the tissue biopsy. All authors read and approved the final manuscript.\n\nEthics approval and consent to participate\nThis study was approved by the Committee on Human Rights Related to Research Involving Human Subjects, Faculty of Medicine Ramathibodi Hospital, Mahidol University.\n\nConsent for publication\nThe patient gave written consent for publication of her potentially identifying information (including individual details and images).\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Burke PT, Thabolingam R, Saba S. Suspected Legionella-induced Perimyocarditis in an adult in the absence of pneumonia: a rare clinical entity. Tex Heart Inst J. 2009;36(6):601–3.\n2. Ishimaru Naoto Suzuki Hiromichi Tokuda Yasuharu Takano Tomoko Severe Legionnaires' Disease with Pneumonia and Biopsy-Confirmed Myocarditis Most Likely Caused by Legionella pneumophila Serogroup 6 Internal Medicine 2012 51 22 3207 3212 10.2169/internalmedicine.51.7952 23154735 \n3. Bodur H. Savran Y. Koca U. Kilinç O. Albayrak S. Itil O. Akoğlu S. Legionella pneumonia with acute respiratory distress syndrome, myocarditis and septic shock successfully treated with Drotrecogin Alpha (activated) European Journal of Anaesthesiology 2006 23 9 808 810 10.1017/S0265021506221252 16884556 \n4. Sommer JB, Erbguth FJ, Neundorfer B. Acute disseminated encephalomyelitis following Legionella pneumophila infection. Eur Neurol. 2000;44(3):182–4.\n5. Padrnos LJ Kusne S DiCaudo DJ Mikhael JR Cutaneous legionellosis: case report and review of the medical literature Transpl Infect Dis. 2014 16 307 14 10.1111/tid.12201 24628820 \n6. Han Jennifer H. Harada Shuko Edelstein Paul H. Nguyen Josephine C. Baddour Larry M. Edelstein Paul H. Relapsing Legionella pneumophila cellulitis: a case report and review of the literature Journal of Infection and Chemotherapy 2010 16 6 439 442 10.1007/s10156-010-0072-6 20526646 \n7. Brabender Wayne Legionella pneumophila Wound Infection JAMA: The Journal of the American Medical Association 1983 250 22 3091 10.1001/jama.1983.03340220059036 6644990 \n8. Kilborn Joyce A. Manz Lisa A. O'Brien Mark Douglass Margaret C. Horst H.Mathilda Kupin Warren Fisher Evelyn J. Necrotizing cellulitis caused by Legionella micdadei The American Journal of Medicine 1992 92 1 104 106 10.1016/0002-9343(92)90024-6 1731498 \n9. Loridant S, Lagier JC, La Scola B. Identification of Legionella feeleii cellulitis. Emer Infect Dis. 2011;17(1):145–6.\n10. Chan MP Neutrophilic panniculitis: algorithmic approach to a heterogeneous group of disorders Arch Pathol Lab Med 2014 138 10 1337 43 10.5858/arpa.2014-0270-CC 25268197 \n11. Morrison LK Rapini R Willison CB Tyring S Infection and panniculitis Dermatol Ther 2010 23 4 328 40 10.1111/j.1529-8019.2010.01333.x 20666820 \n12. Warner C. L. Fayad P. B. Heffner R. R. Legionella myositis Neurology 1991 41 5 750 752 10.1212/WNL.41.5.750 2027497 \n13. Gowani SA, Kumar A, Arora S, Lahiri B. Legionella pneumonia complicated by myocarditis and torsades de pointes: a case report and review of literature. Conn Med. 2013;77(6):331–4.\n14. Briceño David F. Fernando Rajeev R. Nathan Sriram Loyalka Pranav Kar Biswajit Gregoric Igor D. TandemHeart as a Bridge to Recovery in Legionella Myocarditis Texas Heart Institute Journal 2015 42 4 357 361 10.14503/THIJ-14-4131 26413019 \n15. Valve Kirsi Vaalasti Annikki Anttila Veli-Jukka Vuento Risto Disseminated Legionella pneumophila infection in an immunocompromised patient treated with tigecycline Scandinavian Journal of Infectious Diseases 2009 42 2 152 155 10.3109/00365540903359895 \n16. Phin N Parry-Ford F Harrison T Stagg HR Zhang N Kumar K Lortholary O Zumla A Abubakar I Epidemiology and clinical management of legionnaires’ disease Lancet Infect Dis. 2014 14 1011 21 10.1016/S1473-3099(14)70713-3 24970283 \n17. Pierre DM Baron J Yu VL Stout JE Diagnostic testing for legionnaires’ disease Ann Clin Microbiol Antimicrob. 2017 16 59 10.1186/s12941-017-0229-6 28851372 \n18. Heath CH Grove DI Looke DF Delay in appropriate therapy of Legionella pneumonia associated with increased mortality Eur J Clin Microbiol Infect Dis 1996 15 4 286 90 10.1007/BF01695659 8781878 \n19. Pedro-Botet ML Yu VL Treatment strategies for Legionella infection Expert Opin Pharmacother 2009 10 7 1109 21 10.1517/14656560902900820 19405787\n\n", "fulltext_license": "CC BY", "issn_linking": "1471-2334", "issue": "18(1)", "journal": "BMC infectious diseases", "keywords": "Legionella pneumophila; Lupus; Myocarditis; Myositis; Panniculitis", "medline_ta": "BMC Infect Dis", "mesh_terms": "D000328:Adult; D005260:Female; D006801:Humans; D016952:Legionella pneumophila; D007877:Legionnaires' Disease; D008180:Lupus Erythematosus, Systemic; D015434:Panniculitis; D017192:Skin Diseases, Bacterial", "nlm_unique_id": "100968551", "other_id": null, "pages": "467", "pmc": null, "pmid": "30223775", "pubdate": "2018-09-17", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": "2027497;25268197;28851372;20526646;16884556;20069090;1731498;6644990;20666820;19405787;8781878;21192884;24970283;26413019;11053969;23154735;19916901;23923249;24628820", "title": "Disseminated extrapulmonary Legionella pneumophila infection presenting with panniculitis: case report and literature review.", "title_normalized": "disseminated extrapulmonary legionella pneumophila infection presenting with panniculitis case report and literature review" }
[ { "companynumb": "TH-BAUSCH-BL-2018-027995", "fulfillexpeditecriteria": "1", "occurcountry": "TH", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "AZATHIOPRINE" }, "drugadditional": "3", ...
{ "abstract": "OBJECTIVE\nOne of the reasons for the failure of infliximab (IFX) is immediate hypersensitivity reactions (IHR). We aimed to report the efficacy and safety of a tolerance induction protocol in inflammatory bowel diseases (IBD) patients who had previously experienced IHR during IFX infusions.\n\n\nMETHODS\nWe reported all cases of IBD patients who had previously experienced IHR due to IFX and who were submitted to a standardized protocol of tolerance induction to IFX from 2010 to 2015.\n\n\nRESULTS\nIHR occurred in a majority of patients (69%) during the first 3 infusions and for half of them after a period of IFX withdrawn. Skin prick tests were negative and only 2 intradermal tests were positive. Basophil activation tests and antidrug antibody measurements were performed in 8 out of 16 patients and were positive in 3 and 4 patients respectively. Induction of tolerance was successful in 69% of patients and IFX was pursued with clinical efficacy > 1 year in 7 patients (44%). Allergologic investigations were not predictive of tolerance induction success.\n\n\nCONCLUSIONS\nA majority of IHR to IFX infusions occurred during the beginning or restarting of treatment and was related to a nonallergic hypersensitivity. Induction of tolerance to IFX is feasible and effective and may safely allow retreatment of IFX in almost 70% of IBD patients.", "affiliations": "Hospices Civils de Lyon, Department of Gastroenterology, Centre Hospitalier Lyon Sud, Pierre-Bénite, France.;Hospices Civils de Lyon, Department of Gastroenterology, Centre Hospitalier Lyon Sud, Pierre-Bénite, France.;Hospices Civils de Lyon, Department of Clinical Immunology and Allergology, Centre Hospitalier Lyon Sud, Pierre-Bénite, France.;Department of Gastroenterology, Saint-Etienne University Hospital, Saint-Etienne, France.;Department of Gastroenterology, Saint-Etienne University Hospital, Saint-Etienne, France.;Department of Gastroenterology, Tours University Hospital, Tours, France.;CIRI, International Center for Infectiology Research, INSERM U1111, Lyon, France.;Hospices Civils de Lyon, Department of Gastroenterology, Centre Hospitalier Lyon Sud, Pierre-Bénite, France.;Hospices Civils de Lyon, Department of Gastroenterology, Centre Hospitalier Lyon Sud, Pierre-Bénite, France.", "authors": "Pauchard|Isabelle|I|;Nancey|Stéphane|S|;Hacard|Florence|F|;Williet|Nicolas|N|;Roblin|Xavier|X|;Moussata|Driffa|D|;Bérard|Frédéric|F|;Flourié|Bernard|B|;Boschetti|Gilles|G|", "chemical_list": "D005765:Gastrointestinal Agents; D000069285:Infliximab", "country": "Switzerland", "delete": false, "doi": "10.1159/000491078", "fulltext": null, "fulltext_license": null, "issn_linking": "0257-2753", "issue": "36(6)", "journal": "Digestive diseases (Basel, Switzerland)", "keywords": "Crohn’s disease; Hypersensitivity; Infliximab; Tolerance; Ulcerative colitis", "medline_ta": "Dig Dis", "mesh_terms": "D000328:Adult; D004342:Drug Hypersensitivity; D004361:Drug Tolerance; D005260:Female; D005765:Gastrointestinal Agents; D006801:Humans; D006969:Hypersensitivity, Immediate; D015212:Inflammatory Bowel Diseases; D000069285:Infliximab; D008297:Male; D008875:Middle Aged; D016896:Treatment Outcome; D055815:Young Adult", "nlm_unique_id": "8701186", "other_id": null, "pages": "417-426", "pmc": null, "pmid": "30130790", "pubdate": "2018", "publication_types": "D016428:Journal Article", "references": null, "title": "Efficacy and Safety of Infliximab Tolerance Induction in Patients with Inflammatory Bowel Diseases who Experienced Acute Infusion Reactions.", "title_normalized": "efficacy and safety of infliximab tolerance induction in patients with inflammatory bowel diseases who experienced acute infusion reactions" }
[ { "companynumb": "FR-SAMSUNG BIOEPIS-SB-2019-00080", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "INFLIXIMAB" }, "drugadditional": "3", ...
{ "abstract": "LiMAx 13C-methacetin breath test results should be interpreted with caution in patients sedated with isoflurane.", "affiliations": "Department of Anesthesiology Surgical Intensive Care, Emergency and Pain Medicine Ruhr University Bochum Klinikum Herford Herford Germany.;Department of General and Visceral Surgery Thoracic Surgery and Proctology Ruhr University Bochum Klinikum Herford Herford Germany.;Department of Anesthesiology Surgical Intensive Care, Emergency and Pain Medicine Ruhr University Bochum Klinikum Herford Herford Germany.;Department of General and Visceral Surgery Thoracic Surgery and Proctology Ruhr University Bochum Klinikum Herford Herford Germany.;Department of Anesthesiology Surgical Intensive Care, Emergency and Pain Medicine Ruhr University Bochum Klinikum Herford Herford Germany.;Department of Anesthesiology Surgical Intensive Care, Emergency and Pain Medicine Ruhr University Bochum Klinikum Herford Herford Germany.", "authors": "Schwier|Elke|E|https://orcid.org/0000-0002-9279-2986;Kirchner|Carmen|C|;Eickmeyer|Claas|C|;Winde|Günther|G|;Henzler|Dietrich|D|;Köhler|Thomas|T|https://orcid.org/0000-0003-0399-8382", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1002/ccr3.4862", "fulltext": "\n==== Front\nClin Case Rep\nClin Case Rep\n10.1002/(ISSN)2050-0904\nCCR3\nClinical Case Reports\n2050-0904\nJohn Wiley and Sons Inc. Hoboken\n\n10.1002/ccr3.4862\nCCR34862\nCase Report\nCase Reports\nProfound decrease of liver maximum function capacity test of isoflurane sedated patients: A report of three cases\nSCHWIER et al.\nSchwier Elke https://orcid.org/0000-0002-9279-2986\n1\nKirchner Carmen 2\nEickmeyer Claas 1\nWinde Günther 2\nHenzler Dietrich 1\nKöhler Thomas https://orcid.org/0000-0003-0399-8382\n1 thomas.koehler@klinikum-herford.de\n\n1 Department of Anesthesiology Surgical Intensive Care, Emergency and Pain Medicine Ruhr University Bochum Klinikum Herford Herford Germany\n2 Department of General and Visceral Surgery Thoracic Surgery and Proctology Ruhr University Bochum Klinikum Herford Herford Germany\n* Correspondence\nThomas Köhler, Universitätsklinik für Anästhesiologie, Operative Intensivmedizin, Rettungsmedizin und Schmerztherapie der Ruhr‐Universität Bochum, Klinikum Herford, Schwarzenmoorstr. 70, D‐32049 Herford, Germany.\nEmail: thomas.koehler@klinikum-herford.de\n\n24 9 2021\n9 2021\n9 9 10.1002/ccr3.v9.9 e0486215 7 2021\n01 4 2021\n17 7 2021\n© 2021 The Authors. Clinical Case Reports published by John Wiley & Sons Ltd.\nhttps://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by-nc/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.\n\nABSTRACT\n\nLiMAx 13C‐methacetin breath test results should be interpreted with caution in patients sedated with isoflurane.\n\nLiMAx 13C‐methacetin breath test results should be interpreted with caution in patients sedated with isoflurane.\n\nAnaConDa\nCYP1A2\nisoflurane\nLiMAx\nsource-schema-version-number2.0\ncover-dateSeptember 2021\ndetails-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.0.8 mode:remove_FC converted:24.09.2021\nSchwierE, KirchnerC, EickmeyerC, WindeG, HenzlerD, KöhlerT. Profound decrease of liver maximum function capacity test of isoflurane sedated patients: A report of three cases. Clin Case Rep. 2021;9 :e04862. 10.1002/ccr3.4862\n\nFunding information\n\nThere are no financial arrangements related to the report or assistance with manuscript preparation\n==== Body\npmc1 BACKGROUND\n\nUnexpectedly low LiMAx values were measured in isoflurane sedated patients. Possible causes are a reduced cytochrome P450 (CYP) 1A2 enzyme activity or interaction of isoflurane with CYP1A2 or with the breath test itself. We propose that LiMAx test results should be interpreted with caution in isoflurane sedated patients.\n\nTreatment of critically ill patients often requires mechanical ventilation accompanied by sedation. The most common first‐line sedative drug is intravenous propofol.1 Despite pharmacological advantages over other intravenous sedatives, propofol has substantial side effects. These are impairment of the cell function, overload with triglycerides and triggering or amplification of delirium. An increasingly used alternative to propofol is the inhalative sedation with isoflurane that is available for intensive care settings since the approval of the Anaesthetic Conserving Device (AnaConDa, 100 ml, Sedana Medical) in 2004. Due to its ease of use, safe application of volatile anesthetics, and compatibility with all common types of intensive care respirators, the system has quickly found its way into many intensive care units.2 We use isoflurane in cases of chronic obstructive pulmonary disease and pneumonia with recurrent bronchoobstruction, intracranial pathology, assuming an ICP measurement is established, or when the required sedation period exceeds the recommended limit of propofol application (7 days).\n\nIntensive care patients are continuously monitored with regard to various organ systems and functional parameters. The development of acute liver failure (ALF) or acute‐on‐chronic liver failure (ACLF) is associated with increased mortality in sepsis.2, 3 In general, differentiated assessment of liver function is essential for early diagnosis and treatment. If treatment for ACLF is started during the therapeutic „golden window the chances for liver recovery are increased.4\n\nOnly few parameters of liver function are available in septic patients, such as serum bilirubin concentration and INR.5 The model of end‐stage liver disease (MELD) score6 had been developed for non‐ICU patients and is unprecise for dialyzed patients. Other prognostic scoring systems such as the Chronic Liver Failure Consortium ACLF score (CLIF‐C ACLFs), CLIF Consortium Acute Decompensation (CLIF‐C ADs) score, and the Child‐Pugh score7, 8, 9 assess among others the impairment of consciousness and are thus not suitable for sedated patients.\n\nA prognostic test with higher sensitivity and specificity and a good correlation with Child‐Pugh‐ and MELD Score in non‐sedated patients is the LiMAx test (Humedics GmbH).10, 11 Measurements are independent of neurologic function, which allows application of the test in sedated patients in the intensive care setting. The LiMAx test delivers a quantitative measurement of maximal liver function capacity within 60 min and has been evaluated in various clinical situations including mechanical ventilation.11, 12 Briefly, the patient is injected 2 mg/kg body weight of 13C‐methacetin intravenously, which is exclusively metabolized to paracetamol in subtherapeutic dose and 13CO2 by the hepatic, microsomally localized, hemoprotein enzyme 1A2 (CYP1A2) from the cytochrome P450 group.13CO2 is a naturally occurring, stable non‐radioactive carbon isotope. The exhaled amount of 13CO2 is proportional to the total liver function capacity.13 The measurement of 13CO2 can also be performed via the expiration valve in ventilated patients. A value of 315 µg/kg/h or above is physiological.12, 14, 15 Below this level, an impairment of liver function should be considered. Any value below 140 µg/kg/h strongly indicates significant hepatic injury16 or an advanced liver cirrhosis.17 A value of less than 100 µg/kg/h in combination with respiratory dysfunction has been associated with increased mortality and may be of prognostic relevance with regard to patient survival.18 A value of 29–98 µg/kg/h was observed for patients suffering from terminal liver cirrhosis.17\n\nWe present a series of three patients from a university hospital surgical intensive care unit for whom extremely low LiMAx test results were observed while receiving inhaled sedation with isoflurane, a finding that had not been reported before. The aim of our investigation was to discuss hypotheses helping to explain these data and a putative causal connection.\n\n2 CASE PRESENTATION\n\nPatient A: A 21‐year‐old, before healthy female patient suffered a severe polytrauma in a motorcycle accident with an injury severity score (ISS) of 75. The main injuries were severe craniocerebral trauma, severe blunt abdominal trauma with liver rupture and a decollement in the area of the left thigh extending to gluteal. Primary surgical treatment included laparotomy and liver suturing. On the first post‐traumatic day LiMAx‐value was 305 µg/kg/h, while static liver parameters were massively increased. Hemicraniectomy was performed due to rapidly increasing brain edema. Persistently high intracranial pressure (ICP) values prompted to change the sedation regimen to an inhalative concept with isoflurane under continuous ICP control. While laboratory liver parameters quickly normalized, LiMAx test results were 2 and 3 µg/kg/h after 25 and 123 h. After the cessation of isoflurane, the LiMAx returned spontaneously to 180 µg/kg/h.\n\nPatient B: A 65‐year‐old man who had undergone rectum resection for advanced rectal carcinoma developed anastomosis insufficiency with abdominal sepsis. The antimicrobial chemotherapy included the liver‐toxic antibiotic linezolid. LiMAx was used to monitor a possible deterioration of liver function at an early stage. The first test result was 151 µg/kg/h. Since the respirator therapy had to be continued for longer than 7 days, sedation was switched to isoflurane. In the further course of treatment, LiMAx decreased to 2 and 10 µg/kg/h. After isoflurane was discontinued LiMAx increased to 254 µg/kg/h while transaminases also increased.\n\nPatient C: A 49‐year‐old man had received thoracotomy for a suspicious pulmonary node. After an atypical resection of the right lower lobe, he was transferred to the intensive care unit. In the course of the first post‐operative day, an endobronchial hemorrhage occurred with acute deterioration of gas exchange. The bleeding from the middle lobe segment 4 was stopped by epinephrine instillation and tamponades in repeated bronchoscopies. A re‐thoracotomy could be avoided. Due to recurrent bronchospastic episodes, isoflurane sedation was established early on. LiMAx test was performed sequentially to assess liver function in perceived sepsis. After an initial reading of 376 µg/kg/h with propofol, LiMAx values of 33 and 77 µg/kg/h, respectively, were measured under isoflurane sedation. Clinical and laboratory assessment did not correlate with this decrease. After discontinuation of isoflurane LiMAx increased back up to 496 µg/kg/h, other parameters also indicated normal liver function. The patient's demographics and clinical data are listed in detail in Tables 1 and 2, for LiMAx test results in correlation with standard liver parameter and isoflurane see Figure 1. The LiMAx tests were performed according to the manufacturer's specifications (Humedics Inc) and the clinical standard. To avoid a possible influence of the metabolism of the hydrophilic 13C‐methacetin by the continuous renal replacement therapy (CRRT), the latter was paused directly before the start and during each measurement. CRRT was re‐started immediately after the end of the measurement.\n\nTABLE 1 Patients' demographics\n\n\tPatient A\tPatient B\tPatient C\t\nGender\tFemale\tMale\tMale\t\nAge (years)\t21\t65\t49\t\nBMI\t21.7\t30.9\t29.8\t\nMajor medical history\tPolytrauma\tRectum‐cancer; post‐operative complications\tLung cancer, right upper lobe resection post‐operation complications\t\nHistory of liver disease\tNo\tNo\tNo\t\nCRRT treatment\tYes\tYes\tNo\t\nSmoker\tNo\tNo\tYes\t\nReason for suspected liver damage\tTrauma\tSepsis, Linezolid\tSepsis\t\nSource of a potential infection\tPulmonary\tAbdominal\tPulmonary\t\n28 day survival\tYes\tYes\tYes\t\nAbbreviations: BMI, Body Mass Index; CRRT, continuous renal replacement therapy.\n\nJohn Wiley & Sons, Ltd\n\nTABLE 2 Patients laboratory parameters at the time of LiMAx testing\n\n\tPatient A\tPatient B\tPatient C\t\nTime of LiMAx test in relation to start of isoflurane application [h]\t−45\t25\t123\t431\t−4\t24\t79\t186\t−2\t41\t89\t282\t\nLiMAx [µg/kg/h]\t305\t3\t1\t180\t151\t2\t10\t254\t372\t33\t71\t496\t\nAST [U/L] (Ref. <35)\t1434\t288\t59\t48\tnd\t34\t63\t1260\t24\t28\t43\t99\t\nALT [U/L] (Ref. <35)\t968\t209\t19\t36\tnd\t13\t26\t505\t29\t18\t21\t146\t\nSerum Albumin [g/L] (Ref. 35–52)\t23.5\t15.5\t21.5\t18.9\t20.8\t20\t24.2\t16.4\t32.6\t31.3\t30.7\t32\t\nSerum Bilirubin [mg/dl] (Ref <1.2)\t2.1\t1.75\t1.6\t0.71\t0.59\t0.6\t0.86\t1.27\t1.47\t1.26\t1.23\t1.2\t\nSerum Sodium [mmol/L]\t139\t138\t141\t144\t135\t137\t140\t136\t141\t148\t145\t138\t\nLactate [mmol/L]\t2.33\t3.29\t1.62\t1.01\t4.02\t3.43\t1.1\t4.5\t0.8\t1.32\t0.68\t0.43\t\nINR\t1.41\t1.25\t1.19\t0.98\t1.77\t1.35\t1.26\t1.73\t1.02\t1.05\t1.02\t1.21\t\nGGT [U/L] (Ref.<40)\t31\t69\t36\t76\tnd\t38\t301\t174\t365\t295\t356\t774\t\nCreatinine [mg/dl] (Ref. <0.95)\t2.06\t2.33\t1.87\t3.12\t1.18\t0.81\t0.91\t1.24\t0.85\t0.84\t0.83\t0.74\t\nPlatelet count [G//L] (Ref. 150–400)\t51\t35\t90\t296\t106\t83\t65\t89\t293\t303\t307\t390\t\nMELD (pts)\t26\t24\t23\t20\t26\t25\t22\t23\t8\t11\t7\t10\t\nIsoflurane dose [ml/h]\tna\t4\t5\tna\tna\t6\t3\tna\tna\t10\t10\tna\t\nIsoflurane insp [%]\tna\tnd\t0.4\tna\tna\t0.25\t0.1\tna\tna\t0.55\t0.65\tna\t\nIsoflurane et [%]\tna\t0.4\tnd\tna\tna\t0.65\t0.35\tna\tna\t1.2\t0.75\tna\t\nEnteral feeding\tYes\tYes\tYes\tYes\tNo\tYes\tYes\tYes\tYes\tYes\tYes\tYes\t\nNorepinephrine [µg/kg/min]\t0.005\t0.1\t0.05\t0\t0.8\t0.78\t0.53\t0.11\t0\t0.04\t0.05\t0\t\nFiO2\t0.25\t0.35\t0.35\t0.3\t0.7\t0.8\t0.65\t0.45\t0.5\t0.5\t0.5\t0.45\t\nNote\n\nLaboratory parameter was taken for patient A: 18, 20, 51, 22 h, for patient B: 8,16, 33, 22 h, and for patient C: 15, 44, 20, 42 h after the corresponding LiMAx measurement. Isoflurane insp/et corresponds to the time of LiMAx measurement. MELD Score was calculated according to http://www.klinikum.uni‐muenchen.de/Lebercentrum/de/fuer_aerzte/meld_score_rechner/index.html.\n\nAbbreviations: ALP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartate aminotransferase; et, expiratory; GGT, gamma‐glutamyltransferase; INR, international normalized ratio; insp, inspiratory; LiMAx, liver maximum capacity; MELD, model for end‐stage liver disease; na, not applicable; nd, no data; PT, prothrombin time.\n\nJohn Wiley & Sons, Ltd\n\nFIGURE 1 Enzymatic liver function measurement with LiMAx in correlation with standard liver parameter and isoflurane (gray shading). Upper panel: patient A; middle panel: patient B; lower panel: patient C. Abbreviations: ALT: Alanine aminotransferase; AST, Aspartate aminotransferase; INR, International normalized ratio; LiMAx, Liver maximum capacity\n\n3 DISCUSSION AND CONCLUSIONS\n\nMeasurement of liver function capacity in patients at high risk for liver failure is a standard procedure in our institution as a diagnostic tool that can routinely be performed at the bedside when a compromise of liver function is suspected. Since LiMAx can be assessed independently from consciousness it may also be applied for sedated patients. In the three presented cases during isoflurane sedation, the measured values were unexpectedly low in the range of 1–71 µg/kg/h (Figure 2). We consider several mechanisms for this observation: Interaction of isoflurane with the test procedure itself, interference of isoflurane with CYP1A2 or temporary decrease in liver enzyme activity without liver cell damage (“liver hibernation”).\n\nFIGURE 2 LiMAx test results. Time points; 1 and 4 before/after isoflurane sedation; 2 and 3 with isoflurane sedation. Abbreviation: LiMAx, Liver maximum capacity\n\nNone of the patients had a history of liver disease (e.g. alcoholic liver disease, hepatitis, non‐alcoholic fatty liver or cirrhosis) that could have explained reduced liver enzyme activity. Under certain conditions (e.g. shock of different etiology) the liver enzyme activity may be temporarily reduced. The \"standard liver parameters\" are quantified from the blood and indicate liver damage, however, without reflecting the CYP1A2 enzyme activity. Extremely low LiMAx values were measured in the three patients equally after the start of isoflurane that spontaneously returned to previous values after discontinuation of the inhaled sedative. Meanwhile, neither clinical nor laboratory findings suggested almost complete liver failure, which would be expected from such low LiMAx values.17 Polytrauma‐caused high liver‐associated enzyme (LAE) values of patient A declined continuously over time while LAEs were elevated clinical significantly only at the last measurement in patients B and C (Table 2), matching the clinical pictures in all three cases. Here, isoflurane seems to suspend the known correlation10 of LiMAx and LAEs. To rule out toxic effects, all administered drugs were scanned for a known interaction with CYP1A2 in the Flockhart Table19 and for a high likelihood of hepatotoxicity in LiverTox.20 With the exception of patient B, who received linezolid, none of the patients were treated with a listed drug during the relevant time (Figure 3). The hepatotoxic effect of the oxazolidinone antibiotic linezolid is well known. It is commonly associated with lactic acidosis and leads to an increase in transaminases. Lactic acidosis was not detected and an increase in transaminases was only observed at the time of the last LiMAx measurement, so that a serious impairment of liver function by linezolid at the time of CYP1A2 activity determination is not plausible. Therefore, true liver failure (pre‐existing or toxic) as the cause for the significant decrease in LiMAx values seems quite unlikely.\n\nFIGURE 3 LiMAx test results, isoflurane (gray shading), and antibiotics over time for the three described patients. (A): patient A; (B): patient B; (C): patient C. Abbreviation: LiMAx, Liver maximum capacity\n\nThe supply of 13C contained in food or infusions and oxygen have a major influence on the 13CO2:12CO2 ratio measurement.21, 22 Genetic polymorphisms of CYP1A2 and smoking are supposed only to have a slight influence on the test results.22 During the investigated period, food, infusions, and oxygen supply were almost unchanged suggesting no influence on test results.\n\nThe LiMAx instruction manual does not mention a possible influence of isoflurane on test results.\n\nOnly few studies have investigated a possible interaction of isotope measurement with isoflurane. After measurement of several pig breath samples that contained isoflurane, the quality control drifted further and more quickly from its known value. The authors hypothesized that isoflurane was adsorbed by the gas chromatography column in isotope ratio mass spectrometry (IRMS).23 In contrast, LiMAx technology uses laser‐based spectrometry and was validated in five patients with total intravenous anesthesia to avoid interference by volatile anesthetics.24 Ensle et al.25 measured intestinal glucose absorption with a 13C glucose breathing test. Two isoflurane sedated patients were excluded from the analysis because of suspected isoflurane interaction with the 13C measured values, although no excluded values were reported. One could expect decreased LiMAx values if isoflurane prevents the 13C‐methacetin pre‐hepatic transport from the blood stream to the liver. This, however, is unlikely since lipophilic isoflurane accumulates in the fatty tissue while only low concentrations are available in the blood. We conclude that there is no evidence of a relevant interaction between methacetin or 13CO2 and isoflurane.\n\nPhysiologically, isoflurane is almost inert in endogenous metabolism. It is oxidatively metabolized to a small extent (~0.2%) in the liver via CYP2E119, 26 while an interaction of isoflurane and CYP1A2 activity has not yet been described.26, 27 Even so, negative effects of isoflurane on the liver are well known. The liver damage is caused by trifluoroacetylation of liver proteins and a subsequent inflammatory reaction and rapid increase of transaminases termed hepatitis. This effect has been particularly well studied for halothane, but is also known for isoflurane.26 If in fact, isoflurane does compromise CYP1A2 activity genetic polymorphism could explain the differences in enzyme depression, which was less profound in patient C (−91%) as compared to the other patients (−98% and −99%, respectively).28\n\nFinally, it remains unclear whether the apparent influence of isoflurane on the LiMAx test is substance‐specific or whether other inhaled anesthetics cause similar effects.\n\nTo our knowledge, this is the first description of a profound decrease of LiMAx values during simultaneous isoflurane sedation, the reason for which remains unclear. Possible mechanisms are test‐specific interactions, an isoflurane‐induced reduction in CYP1A2 activity or a temporary shut‐down of enzymatic liver function without cell damage, suggesting a hibernating liver in the early phase of severe inflammatory disease. A more frequent measurement of Cyp1A2 activity would be desirable, to describe the development of enzyme activity more precisely. Due to the increasing use of both LiMAx and inhaled sedation in the ICU, we consider it important to further investigate this possible interaction in order to prevent erroneous measurements and possible wrong clinical decisions. We propose that, until the breath test on enzymatic liver function has been validated in the critical care setting, LiMAx test results should be interpreted with caution in patients sedated with isoflurane.\n\nCONFLICT OF INTEREST\n\nNone declared.\n\nAUTHOR CONTRIBUTIONS\n\nES performed literature research and wrote the manuscript. CK analyzed and interpreted LiMAx data and reviewed the manuscript. CE performed functional liver testing with LiMAx on intensive care unit, treated the patients, and reviewed the manuscript. DH participated in analyzing and interpreting the data and revised the manuscript. GW helped to interpret the data and to review the manuscript. TK treated the patients on intensive care unit and analyzed and interpreted data and was a major contributor in writing the manuscript. All authors gave final approval of the version to be published and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.\n\nETHICAL APPROVAL\n\nThe ethics committee of the medical faculty of the Ruhr University Bochum had approved the anonymous collection and publication of data.\n\nACKNOWLEDGEMENTS\n\nThe authors have confirmed during submission that patient consent has been signed and collected in accordance with the journal's patient consent policy.\n\nA preprint publication is available under https://www.researchgate.net/publication/348895799_Profound_Decrease_of_Liver_Maximum_Function_Capacity_Test_of_Isoflurane_Sedated_Patients_A_Report_of_Three_Cases Open access funding enabled and organized by ProjektDEAL.\n\nDATA AVAILABILITY STATEMENT\n\nThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\n==== Refs\nREFERENCES\n\n1 BaronR, BinderA, BiniekR, et al. Evidence and consensus based guideline for the management of delirium, analgesia, and sedation in intensive care medicine. Revision 2015 (DAS‐Guideline 2015) ‐ short version. Ger Med Sci. 2015;13 :Doc19.26609286\n2 FarrellR, OomenG, CareyP. A technical review of the history, development and performance of the anaesthetic conserving device \"AnaConDa\" for delivering volatile anaesthetic in intensive and post‐operative critical care. J Clin Monit Comput. 2018;32 :595‐604.29388094\n3 ArroyoV, MoreauR, JalanR. Acute‐on‐chronic liver failure. N Engl J Med. 2020;382 :2137‐2145.32459924\n4 SarinSK, ChoudhuryA. Acute‐on‐chronic liver failure. Curr Gastroenterol Rep. 2016;18 :61.27747458\n5 WoźnicaEA, InglotM, WoźnicaRK, ŁysenkoL. Liver dysfunction in sepsis. Adv Clin Exp Med. 2018;27 :547‐551.29558045\n6 KamathPS, KimWR, Group ALDS . The model for end‐stage liver disease (MELD). Hepatology. 2007;45 :797‐805.17326206\n7 JalanR, SalibaF, PavesiM, et al. Development and validation of a prognostic score to predict mortality in patients with acute‐on‐chronic liver failure. J Hepatol. 2014;61 :1038‐1047.24950482\n8 JalanR, PavesiM, SalibaF, et al. The CLIF consortium acute decompensation score (CLIF‐C ADs) for prognosis of hospitalised cirrhotic patients without acute‐on‐chronic liver failure. J Hepatol. 2015;62 :831‐840.25463539\n9 PughRN, Murray‐LyonIM, DawsonJL, PietroniMC, WilliamsR. Transection of the oesophagus for bleeding oesophageal varices. Br J Surg. 1973;60 :646‐649.4541913\n10 MalinowskiM, JaraM, LüttgertK, et al. Enzymatic liver function capacity correlates with disease severity of patients with liver cirrhosis: a study with the LiMAx test. Dig Dis Sci. 2014;59 :2983‐2991.24993690\n11 BuechterM, GerkenG, HoyerDP, et al. Liver maximum capacity (LiMAx) test as a helpful prognostic tool in acute liver failure with sepsis: a case report. BMC Anesthesiol. 2018;18 :71.29925334\n12 KaffarnikMF, AhmadiN, LockJF, et al. Correlation between plasma endothelin‐1 levels and severity of septic liver failure quantified by maximal liver function capacity (LiMAx test). A prospective study. PLoS One. 2017;12 :e0178237.28542386\n13 StockmannM, LockJF, MalinowskiM, NiehuesSM, SeehoferD, NeuhausP. The LiMAx test: a new liver function test for predicting postoperative outcome in liver surgery. HPB. 2010;12 :139‐146.20495659\n14 StockmannM, VondranFWR, FahrnerR, et al. Randomized clinical trial comparing liver resection with and without perioperative assessment of liver function. BJS Open. 2018;2 :301‐309.30263981\n15 WichaSG, FreyOR, RoehrAC, et al. Linezolid in liver failure: exploring the value of the maximal liver function capacity (LiMAx) test in a pharmacokinetic pilot study. Int J Antimicrob Agents. 2017;50 :557‐563.28711678\n16 Humedics . LiMAx Quantifying functional liver capacity. https://www.humedics.eu/en/why‐limax.html. Accessed October 12, 2020.\n17 StockmannM, LockJF, MalinowskiM, ScharfenbergA, MorawietzL, NeuhausP. Accurate diagnosis and grading of cirrhosis using the new LiMAx Test. J Hepatol. 2012;56 :S422.\n18 KaffarnikMF, LockJF, VetterH, et al. Early diagnosis of sepsis‐related hepatic dysfunction and its prognostic impact on survival: a prospective study with the LiMAx test. Crit Care. 2013;17 :R259.24172237\n19 FlockhartDA. Drug interactions: cytochrome P450 drug interaction table. 2007. Indiana University School of Medicine, Indianapolis. https://drug‐interactions.medicine.iu.edu. Accessed October 12, 2020.\n20 National Institute of Diabetes and Digestive and Kidney Diseases LiverTox, clinical and research information on drug‐induced liver injury. Bethesda. 2012. https://www.ncbi.nlm.nih.gov/books/NBK547852/. Accessed October 12, 2020.\n21 RieckeB, NeuhausP, StockmannM. Major influence of oxygen supply on 13CO2:12CO2 ratio measurement by nondispersive isotope‐selective infrared spectroscopy. Helicobacter. 2005;10 (6 ):620‐622.16302989\n22 StockmannM. Predictive value of a new method for the determination of the liver function in liver surgery (LiMAx test). 2009. https://refubium.fu‐berlin.de/handle/fub188/11367. Accessed October 12, 2020.\n23 MatthewsT, TrochslerM, BarryS, KuchelT, ZacharakisB, MaddernG. Possible isoflurane effect observed in isotope ratio mass spectrometry from a large animal model. J Exp Appl Anim Sci. 2016;2 :71.\n24 StockmannM, LockJF, RieckeB, et al. Prediction of postoperative outcome after hepatectomy with a new bedside test for maximal liver function capacity. Ann Surg. 2009;250 :119‐125.19561474\n25 EnsleF. Messung der Glukoseabsorption mittels 13C‐Atemgastest als Marker für die intestinale Funktionalität bei Intensivpatienten. Open Access Repositorium der Universität Ulm und Technischen Hochschule Ulm. Dissertation. 2020. 10.18725/OPARU-25246. Accessed October 13, 2020.\n26 NjokuD, LasterMJ, GongDH, EgerEI, ReedGF, MartinJL. Biotransformation of halothane, enflurane, isoflurane, and desflurane to trifluoroacetylated liver proteins: association between protein acylation and hepatic injury. Anesth Analg. 1997;84 :173‐178.8989020\n27 NeeJ, SchroederT, VornholtF, et al. Dynamic determination of functional liver capacity with the LiMAx test in post‐cardiac arrest patients undergoing targeted temperature management‐a prospective trial. Acta Anaesthesiol Scand. 2020;64 :501‐507.31828754\n28 Genetic polymorphisms of cytochrome P450 (CYP) 1A2. Evidence‐Based Medicine Consult. 2015. https://www.ebmconsult.com/articles/pharmacogenetics‐cyp1a2‐genetic‐polymorphisms‐table. Accessed October 1, 2020.\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2050-0904", "issue": "9(9)", "journal": "Clinical case reports", "keywords": "AnaConDa; CYP1A2; LiMAx; isoflurane", "medline_ta": "Clin Case Rep", "mesh_terms": null, "nlm_unique_id": "101620385", "other_id": null, "pages": "e04862", "pmc": null, "pmid": "34594555", "pubdate": "2021-09", "publication_types": "D002363:Case Reports", "references": "24172237;28542386;8989020;31828754;26609286;16302989;24993690;24950482;25463539;29558045;4541913;28711678;29388094;20495659;30263981;29925334;17326206;32459924;19561474;27747458", "title": "Profound decrease of liver maximum function capacity test of isoflurane sedated patients: A report of three cases.", "title_normalized": "profound decrease of liver maximum function capacity test of isoflurane sedated patients a report of three cases" }
[ { "companynumb": null, "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "LINEZOLID" }, "drugadditional": "3", "drugadministrationro...
{ "abstract": "Adverse drug reactions are not unusual during Anti-Tubercular Therapy (ATT). One of the common complications of anti-tubercular treatment is drug induced hepatitis and renal insufficiency has also been reported. Renal failure and/or hepatitis encountered during treatment of tuberculosis can have varied aetiologies: drug induced, concomitant viral infection, pre-existing co-morbidities or a combination of these. Since, hepatitis and/or renal insufficiency can be life threatening a prompt diagnosis is warranted, where drugs should be kept as one of the important cause. Identifying the drug helps in treating hepatitis and/or renal insufficiency along with helping the physician to change the combination of ATT regimen. Rifampicin is one of the most important first line drugs in the treatment of tuberculosis. Hepatitis, epigastric distress, anaemia, thrombocytopenia, and interstitial nephritis are reported adverse drug reactions to rifampicin. As per literature rifampicin induced renal toxicity is usually seen on rifampicin re-exposure, or rifampicin administration on alternate days, both being present in this case. Here we are reporting a case of ATT induced renal failure with concomitant hepatitis where rifampicin was suspected to be the cause.", "affiliations": "Associate Professor, Department of Pharmacology, Kasturba Medical College, Manipal University , Manipal, Karnataka, India .;Postgraduate Student, Department of Pulmonary Medicine, Kasturba Medical College, Manipal University , Manipal, Karnataka, India .;Professor, Department of Pulmonary Medicine, Kasturba Medical College, Manipal University , Manipal, Karnataka, India .;Associate Professor, Department of Pulmonary Medicine, Kasturba Medical College, Mangalore, Manipal University , Karnataka, India .;Student, Kasturba Medical College, Manipal University , Manipal, Karnataka, India .", "authors": "Chogtu|Bharti|B|;Surendra|Vyshak Uddur|VU|;Magazine|Rahul|R|;Acharya|Preetam Rajgopal|PR|;Yerrapragada|Devesh Bhaskar|DB|", "chemical_list": null, "country": "India", "delete": false, "doi": "10.7860/JCDR/2016/21030.8578", "fulltext": null, "fulltext_license": null, "issn_linking": "0973-709X", "issue": "10(9)", "journal": "Journal of clinical and diagnostic research : JCDR", "keywords": "Anti tubercular drugs; Liver function tests; Serum creatinine; Serum urea", "medline_ta": "J Clin Diagn Res", "mesh_terms": null, "nlm_unique_id": "101488993", "other_id": null, "pages": "OD18-OD19", "pmc": null, "pmid": "27790502", "pubdate": "2016-09", "publication_types": "D002363:Case Reports", "references": "20693595;18998303;24190152;20196116;26819490;25755470;20927254;15195854;12324902", "title": "Rifampicin-Induced Concomitant Renal Injury and Hepatitis.", "title_normalized": "rifampicin induced concomitant renal injury and hepatitis" }
[ { "companynumb": "IN-LUPIN PHARMACEUTICALS INC.-2016-04768", "fulfillexpeditecriteria": "1", "occurcountry": "IN", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "STREPTOMYCIN\\STREPTOMYCIN SULFATE" }, ...
{ "abstract": "BACKGROUND\nDelayed intracranial hemorrhage can occur up to several weeks after head trauma and was reported more frequently in patients with antithrombotic therapy. Due to the risk of delayed intracranial hemorrhage, some hospitals follow extensive observation and cranial computed tomography (CT) protocols for patients with head trauma, while others discharge asymptomatic patients after negative CT.\n\n\nMETHODS\nWe retrospectively analyzed data on patients with head trauma and antithrombotic therapy without pathologies on their initial CT. During the observation period, we followed a protocol of routine repeat CT before discharge for patients using vitamin K antagonists, clopidogrel or direct oral anticoagulants.\n\n\nRESULTS\n793 patients fulfilled the inclusion criteria. Acetylsalicylic acid (ASA) was the most common antithrombotic therapy (46.4%), followed by vitamin K antagonists (VKA) (32.2%) and Clopidogrel (10.8%). We observed 11 delayed hemorrhages (1.2%) in total. The group of 390 patients receiving routine repeat CT showed nine delayed hemorrhages (2.3%). VKA were used in 6 of these 11 patients. One patient needed an urgent decompressive craniectomy while the other patients were discharged after an extended observation period. The patient requiring surgical intervention due to delayed hemorrhage showed neurological deterioration during the observation period.\n\n\nCONCLUSIONS\nRoutine repeat CT scans without neurological deterioration are not necessary if patients are observed in a clinical setting. Patients using ASA as single antithrombotic therapy do not require in-hospital observation after a negative CT scan.", "affiliations": "Department of Orthopedics and Trauma-Surgery, Medical University of Vienna, 1090 Vienna, Austria.;Department of Orthopedics and Trauma-Surgery, Medical University of Vienna, 1090 Vienna, Austria.;Department of Orthopedics and Trauma-Surgery, Medical University of Vienna, 1090 Vienna, Austria.;Department of Orthopedics and Trauma-Surgery, Medical University of Vienna, 1090 Vienna, Austria.;Department of Anesthesia, Intensive Care Medicine and Pain Medicine, Medical University of Vienna, 1090 Vienna, Austria.;Department of Orthopedics and Trauma-Surgery, Medical University of Vienna, 1090 Vienna, Austria.", "authors": "Antoni|Anna|A|;Schwendenwein|Elisabeth|E|;Binder|Harald|H|;Schauperl|Martin|M|;Datler|Philip|P|;Hajdu|Stefan|S|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.3390/jcm8111780", "fulltext": "\n==== Front\nJ Clin MedJ Clin MedjcmJournal of Clinical Medicine2077-0383MDPI 10.3390/jcm8111780jcm-08-01780ArticleDelayed Intracranial Hemorrhage in Patients with Head Trauma and Antithrombotic Therapy Antoni Anna 1*Schwendenwein Elisabeth 1Binder Harald 1Schauperl Martin 1Datler Philip 2Hajdu Stefan 11 Department of Orthopedics and Trauma-Surgery, Medical University of Vienna, 1090 Vienna, Austria; elisabeth.schwendenwein@muv.ac.at (E.S.); harald.binder@muv.ac.at (H.B.); martin.schauperl@muv.ac.at (M.S.); stefan.hajdu@muv.ac.at (S.H.)2 Department of Anesthesia, Intensive Care Medicine and Pain Medicine, Medical University of Vienna, 1090 Vienna, Austria* Correspondence: anna.antoni@muv.ac.at; Tel.: +43-0664-3953-43825 10 2019 11 2019 8 11 178014 9 2019 23 10 2019 © 2019 by the authors.2019Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).Background: Delayed intracranial hemorrhage can occur up to several weeks after head trauma and was reported more frequently in patients with antithrombotic therapy. Due to the risk of delayed intracranial hemorrhage, some hospitals follow extensive observation and cranial computed tomography (CT) protocols for patients with head trauma, while others discharge asymptomatic patients after negative CT. Methods: We retrospectively analyzed data on patients with head trauma and antithrombotic therapy without pathologies on their initial CT. During the observation period, we followed a protocol of routine repeat CT before discharge for patients using vitamin K antagonists, clopidogrel or direct oral anticoagulants. Results: 793 patients fulfilled the inclusion criteria. Acetylsalicylic acid (ASA) was the most common antithrombotic therapy (46.4%), followed by vitamin K antagonists (VKA) (32.2%) and Clopidogrel (10.8%). We observed 11 delayed hemorrhages (1.2%) in total. The group of 390 patients receiving routine repeat CT showed nine delayed hemorrhages (2.3%). VKA were used in 6 of these 11 patients. One patient needed an urgent decompressive craniectomy while the other patients were discharged after an extended observation period. The patient requiring surgical intervention due to delayed hemorrhage showed neurological deterioration during the observation period. Conclusions: Routine repeat CT scans without neurological deterioration are not necessary if patients are observed in a clinical setting. Patients using ASA as single antithrombotic therapy do not require in-hospital observation after a negative CT scan.\n\ndelayed intracranial hemorrhagehead traumatraumatic brain injuryantithrombotic therapy\n==== Body\n1. Introduction\nWhile numerous guidelines for the management of mild traumatic brain injury (TBI) exist, there is still controversy regarding the treatment of head trauma patients with antithrombotic therapy (ATT). The management of mild TBI on ATT is complicated by the heterogeneity of patients with different medications and varying patient characteristics. Most authors define mild TBI based on a Glasgow Coma Scale (GCS) of 13 to 15, others include any impact to the brain, not necessarily causing symptoms [1]. For patients using ATT, several studies show an increased risk for abnormal computed tomography (CT) findings, even with a normal neurological exam and a history lacking neurological symptoms [2,3,4]. Therefore, in most centers patients on ATT receive a routine CT at presentation, even if common definitions of mild TBI are not fulfilled and head trauma is merely reported, or visible signs of head trauma are present.\n\nVitamin K antagonists (VKA) were shown to increase the risk for clinically significant TBI and mortality [5,6,7] and numerous studies indicate an increased risk and mortality for patients on all other kinds of ATT [8,9,10,11,12].\n\nDelayed traumatic intracranial hemorrhage (DIH) can occur up to several weeks after trauma to the head [13] and was reported to occur more frequently in patients with ATT, ranging from 0.2% to 6% [14,15,16,17].\n\nDue to studies showing a high number of DIH, international guidelines and recommendations in literature suggest admitting patients with ATT for observation after negative CT [18,19,20,21]. Many trauma centers adopted management protocols highly cautious of DIH and performed repeat CT after head trauma for asymptomatic patients. These extensive management protocols with in-hospital observation and repeat CT were evaluated in numerous studies, and most authors concluded that a routine repeat CT is not necessary [22,23]. Some authors even question the necessity for clinical observation after negative CT [18,24,25].\n\n2. Materials and Methods\nOur level I trauma center follows a high level of precaution for head injury patients. CT are performed based on the Canadian CT Head Rule, which, however, excludes patients with ATT [26]. At the time of data collection, all cases of head trauma with ongoing ATT regardless of clinical signs for TBI received a CT and were admitted for a minimum of 24 h of in-hospital observation. Patients receiving VKA, Clopidogrel or direct oral anticoagulants (DOAC) received a routine repeat CT before discharge to detect delayed hemorrhages. Patients using acetylsalicylic acid (ASA) or low molecular weight heparin (LMWH) underwent clinical observation but did not receive a routine repeat CT.\n\nAfter two years of said management, we analyzed our clinical protocol to determine the frequency of delayed intracranial hemorrhage in patients with head trauma and antithrombotic therapy, adjusting our practice and thereby contributing to the ongoing international debate on the management of head trauma patients on ATT.\n\nThe study was performed in a level I trauma center with authorization by the local Institutional Review Board (1632/2014). Between January 2012 and April 2014 patients aged 18 years or older were retrospectively included if they were admitted for observation after blunt head trauma with ongoing ATT and no pathologies in their initial CT. Management of these patients followed the described standard clinical protocol. This included an initial CT, clinical and GCS assessment including history of unconsciousness and laboratory tests including S100 and coagulation studies at time of admission. We did not routinely perform laboratory tests for evaluation of therapeutic levels during the observation period (viscoelastic tests, platelet function or anti-Xa assays) for ATT other than VKA. In-hospital observation for a minimum of 24 h followed, and patients received their applicable protocols:Patients using ATT with an expected higher risk for DIH based on the literature, such as vitamin K antagonists (VKA), direct oral anticoagulants (DOAC) and Clopidogrel received a routine repeat CT prior to discharge from hospital.\n\nPatients using ATT with an expected low risk for DIH including acetylsalicylic acid (ASA) and prophylactic doses of low molecular weight heparin (LMWH) did not receive a routine repeat CT and were discharged after observation only. Due to the greater number of patients receiving ASA compared to other ATT we included only patients from January 2013 until December 2013 in this study.\n\n\n\nThe primary endpoint of this study was the occurrence of delayed intracranial hemorrhages. Data was collected and analyzed using SPSS version 24 and descriptive statistics were performed. Due to the low number of delayed intracranial hemorrhages the variables age, GCS and prothrombin time were tested using the Mann–Whitney–U test while the remaining nominal variables were tested using Fisher’s exact test. The significance level alpha for all implemented tests was set to α < 0.05.\n\n3. Results\nDuring the study period 793 patients fulfilled the inclusion criteria, with a majority of 453 (57.1%) women and 340 (42.9%) men. A routine repeat CT was performed in 395 cases and in-hospital observation without routine repeat CT in 398 patients. The average patient age at presentation was 81 years (range 32–102). The most prevalent ATT was acetylsalicylic acid in 368 patients (46.4%), followed by vitamin K antagonists in 255 (32.2%) and Clopidogrel in 86 patients (10.8%), see Table 1. Since patients using ASA were included from only one year whereas all other patients were collected from a two-year observation period, the distribution of different types of ATT is not representative of the total population at our institution.\n\nOnly blunt trauma was included in the study, with low energy trauma due to falls accounting for 95.2% of all cases. Most patients presented with a normal neurological status, only 16.5% of patients showed any neurological symptoms at presentation. The average GCS at presentation at the hospital was 15 and in 75.5% there was no history of unconsciousness or amnesia reported by either the patients or others. Lesions to the head such as abrasions and lacerations were present in 57.4%. The mean prothrombin time of the 255 patients using VKA was 32%, and 91.8% of the VKA patients were in their therapeutic range at time of admission.\n\nThe timing of the routine repeat CT as well as discharge from hospital followed the clinical protocol and occurred after a minimum observation time of 24 h, which resulted in an average of two nights of in-hospital observation, depending on the time of admission, with discharge after morning rounds.\n\nIn total, there were 11 cases (1.2%) of delayed intracranial hemorrhages. The routine repeat CT group showed nine DIH, resulting in 2.3% of cases detected with routine repeat CT. In the observation-only group, 16 patients showed a worsening of GCS or other symptoms indicating TBI. Two of these repeat CTs based on clinical judgement found minor DIH (0.5% of the observation group). One of the 11 patients with DIH needed an urgent decompressive craniectomy due to subdural hematoma with midline shift on the second day of observation. This was an 84-year-old female with vitamin K antagonist therapy, who showed no clinical signs of traumatic brain injury, no exterior injury to the head and an international normalized ratio of 2.9 at admission. The repeat CT was performed due to neurological deterioration with reduced Glasgow Coma Scale 27 h after admission. The patient underwent immediate decompressive craniectomy and was consecutively discharged to a neurological rehabilitation facility with a mild left-sided hemiparesis. The other patients with small delayed intracranial hemorrhage did not undergo surgical intervention and were discharged from hospital after an average observation period of 12 days (range 5–23). A review of the cases of delayed intracranial hemorrhages in the repeat CT group by a radiologist revealed, that small epi- and subdural hematomas, minimal intracerebral and subarachnoid hematomas were visible but not described in the initial CT report in four of the eleven cases. Excluding the four cases of initially undiagnosed pathologies in the CT report, an adjusted number of seven DIH (1.8%) were found in the repeat CT group, and in 0.9% overall. There were no significant differences between patients with or without delayed intracranial hemorrhage regarding age, sex, mechanism of injury, extent of external head injury, S100 level and coagulation studies or neurological status at admission. Characteristics of patients with DIH in our study population can be seen in Table 2. Four patients died during the in-hospital observation, all due to non-TBI-related causes such as pneumonia or heart failure.\n\n4. Discussion\nNo feasible diagnostic or observation protocol will be able to exclude all cases of fatal delayed bleeding as DIH can occur up to several weeks after head trauma. Most clinically significant DIH will be detected within an observation period of 24 h, but there will always be cases that occur unusually late or in surprisingly neurologically intact patients [14,15,16,17,19,20,21].\n\nThe results of our study, with only one clinically significant case of delayed intracranial hemorrhage (0.3% in the repeat CT group, 0.1% in total), support other investigations which concluded that a routine repeat CT is not necessary for patients with antithrombotic therapy, due to the low clinical significance of most detected DIH [27,28,29,30,31,32]. The single case of a clinically significant DIH in our study showed an altered neurological status and would therefore have received an additional CT during the observation period regardless of clinical protocol for routine repeat CT. In our study population the routine repeat CT was effective in detecting DIH, but was superior to clinical observation only for the detection of cases of little clinical significance and devoid of therapeutic consequence.\n\nBased on our results and on the growing international consensus eliminating repeat CT, we have changed our clinical protocol to a 24-h observation period after the initial negative CT, and discharge from hospital without repeat CT. Due to the low number of DIH in the observation group using ASA and/or LMWH with 0.5%, we no longer admit these patients for in-hospital observation after a negative CT. Since we only included patients using ASA from one year compared to a two-year observation period for all other ATT, the total impact of not routinely admitting these patients after a negative CT is even greater, uses less resources and can improve patient satisfaction.\n\nMost studies addressing the management of head injury patients on ATT do not explicitly discuss the degree of head injury. Most patients in our study would have not received a CT based on the commonly applied Canadian CT Head Rule had they not been treated with ATT, as the majority of patients had a normal neurological exam at presentation and only 57.4% of patients in our study had visible signs of a head injury. Because of the potential higher risk for intracranial pathologies in patients with all types of ATT we support the recommendation of performing an initial CT as suggested by the Scandinavian Guidelines [18] and the recent Austrian consensus statement [33]. However, the increasing number of patients with ATT in a time of limited resources raises questions about a clear definition of head trauma to determine risk factors for DIH. Whether a reported minor impact to the head without visible injuries justifies the cost and patient inconvenience of enduring a CT and in-hospital observation cannot be answered by our study and remains a decision based on clinical judgement.\n\nDespite all guidelines, it is still necessary to make decisions based on risk stratification while considering the consequences for the individual patient. Chenoweth et al. [28] found a 0.3% rate of DIH in their prospective study including patients with and without ATT, and concluded that “this (the low risk of DIH and fact that they can occur later than 24 h) highlights the importance of clinical judgment regarding the severity of trauma, additional injuries, and ability to monitor the patient for deterioration when making decisions about admission for older patients after blunt head trauma.”\n\nHowever, our patient requiring surgical intervention, while only representing 0.1% of our study population, initially showed no clinical signs of a massive trauma to the head and her only risk factors for significant TBI were her age and her vitamin K therapy. This patient could have died at home if she were discharged without observation by relatives or nurses after the initial CT. \n\nClearly, the admission of patients must be indicated based on economic factors as well as on aspects of the patient’s will and ethical considerations for elderly patients, who might experience massive stress due to the changed environment in the hospital [34]. A relevant but unanswered question underlying this study is, how does the fear of legal consequences affect clinical management, although a potentially fatal DIH may not lead to an escalation of care due to advanced patient age? If a patient admitted for observation were to incur a DIH, would the same patient be operated on if he or she was 95 years old, not living independently and suffering from dementia?\n\nThe average age of patients in our study was 81 years. Unfortunately, data on dementia, degree of dependency or existence of a living will was not available for our retrospective study design. \n\nIn our study some 91.8% of patients using VKA were in a therapeutic range and we did not perform further coagulation assays specific to other ATT during the observation period. Assessing additional therapeutic effects of ATT at time of presentation could possibly reduce admissions and save resources, while informing patients of their insufficient hypocoagulative protection.\n\nLimitations of the study are explained by the retrospective study design and lack of data about DIH after discharge. Furthermore, the number of patients using DOAC was relatively low at the time of data collection but is now a controversial topic in literature. Since there may have been cases of undetected DIH in the group without routine repeat CT and the low number of patients using DOAC this study cannot address the relative risk of various ATT for DIH. The large number of patients and relative homogenous population constitute a significant strength of our study, but multicenter prospective trials are needed to further investigate this matter. \n\nConsistent with current studies, our results indicate that routine repeat CT seem to be no more effective than in-hospital observation, due to the fact that clinically significant DIH reveal themselves by neurological deterioration. Furthermore, we conclude that in-hospital observation for head trauma patients using acetylsalicylic acid is not necessary due to the rarity of clinically relevant DIH. But neither our study nor current literature can answer the ethical questions behind the data. They must be answered by individual centers and countries based on existing resources and their cultural environment.\n\nAcknowledgments\nWe thank Daniel Toth for reviewing the CT images of delayed intracranial hemorrhage cases, Claudia Gahleitner for support with statistics and Leonard Höchtl-Lee for his contribution as native English proof reader. \n\nAuthor Contributions\nConceptualization, S.H., E.S., A.A.; methodology, S.H., E.S., A.A.; software, A.A.; validation, A.A.; formal analysis, A.A.; investigation, A.A., H.B., M.S., P.D.; resources, A.A.; data curation, A.A., H.B., M.S., P.D.; writing—original draft preparation, A.A.; writing—review and editing, S.H., E.S., H.B., M.S., P.D.; visualization, A.A.; supervision, S.H.; project administration, A.A.\n\nFunding\nThis research received no external funding.\n\nConflicts of Interest\nThe authors declare no conflict of interest.\n\njcm-08-01780-t001_Table 1Table 1 Type and frequency of antithrombotic therapy in total and in the subgroups of the study.\n\nAntithrombotic Therapy\tTotal \nn (%)\tRepeat CT Group\nn (% of Group)\tObservation Group Only\nn (% of Group)\t\nAcetylsalicylic acid\t368 (46.4%)\t0\t368 (92.5%)\t\nVitamin K antagonists\t255 (32.2%)\t255 (64.6%)\t0\t\nClopidogrel\t86 (10.8%)\t86 (21.8%)\t0\t\nClopidogrel and acetylsalicylic acid\t22 (2.8%)\t22 (5.6%)\t0\t\nDOAC (dabigatran and rivaroxaban)\t32 (4.0%)\t32 (8.1%)\t0\t\nLow molecular weight heparin\t26 (3.3%)\t0\t26 (6.5%)\t\nLow molecular weight heparin and acetylsalicylic acid\t4 (0.5%)\t0\t4 (1.0%)\t\njcm-08-01780-t002_Table 2Table 2 Characteristics of patients with delayed intracranial hemorrhage in our study population including sex and age, antithrombotic therapy, reported unconsciousness and amnesia, prothrombin time at admission, neurological symptoms during in-hospital observation, type of delayed intracranial hemorrhage (EDH = epidural hematoma, SDH = subdural hematoma, SAH = subarachnoid hematoma, ICH = intracerebral hematoma) and necessity of surgery. ASA = acetylsalicylic acid.\n\nPatient\tAntithrombotic Therapy\tUnconsciousness\tAmnesia\tGlasgow Coma Scale\tHead Wound\tProthrombin Time\tNeurological Symptoms\tDelayed Intracranial Hemorrhage\tSurgery\t\nm, 72y\tVitamin K antagonist\tyes\tyes\t15\tyes\t56\tno\tEDH, SDH\tno\t\nf, 93y\tVitamin K antagonist\tno\tno\t15\tyes\t47\tno\tSAH\tno\t\nf, 83y\tVitamin K antagonist\tno\tno\t15\tyes\t20\tno\tSAH\tno\t\nf, 82y\tVitamin K antagonist\tno\tno\t15\tyes\t48\tno\tSAH\tno\t\nm, 92y\tVitamin K antagonist\tno\tno\t15\tyes\t33\tno\tSAH\tno\t\nf, 84y\tVitamin K antagonist\tno\tno\t15\tno\t27\tyes\tSDH\tyes\t\nm, 90y\tClopidogrel + ASA\tno\tno\t15\tyes\t89\tno\tHygroma\tno\t\nm, 54y\tClopidogrel + ASA\tno\tyes\t15\tyes\t105\tno\tICH\tno\t\nm, 89y\tDabigatran\tno\tno\t15\tyes\t89\tno\tSDH\tno\t\nf, 82y\tASA\tno\tno\t15\tyes\t104\tno (repeat CT was recommended by radiologist after review of initial CT)\tEDH\tno\t\nf, 79\tASA\tyes\tyes\t14\tyes\t88\tyes\tEDH\tno\n==== Refs\nReferences\n1. Snedden T.R. Concept analysis of concussion J. Spec. Pediatr. Nurs. 2013 18 211 220 10.1111/jspn.12038 23822845 \n2. Vilke G.M. Chan T.C. Guss D.A. Use of a complete neurological examination to screen for significant intracranial abnormalities in minor head injury Am. J. Emerg. Med. 2000 18 159 163 10.1016/S0735-6757(00)90009-3 10750921 \n3. Ibanez J. Arikan F. Pedraza S. Sánchez E. Poca M.A. Rodriguez D. Rubio E. Reliability of clinical guidelines in the detection of patients at risk following mild head injury: Results of a prospective study J. Neurosurg. 2004 100 825 834 10.3171/jns.2004.100.5.0825 15137601 \n4. Vos P.E. Alekseenko Y. Battistin L. Ehler E. Gerstenbrand F. Muresanu D.F. Potapov A. Stepan C.A. Traubner P. Vecsei L. Mild traumatic brain injury Eur. J. Neurol. 2012 19 191 198 10.1111/j.1468-1331.2011.03581.x 22260187 \n5. Pieracci F.M. Eachempati S.R. Shou J. Hydo L.J. Barie P.S. Use of long-term anticoagulation is associated with traumatic intracranial hemorrhage and subsequent mortality in elderly patients hospitalized after falls: Analysis of the New York State Administrative Database J. Trauma Acute Care Surg. 2007 63 519 524 10.1097/TA.0b013e31812e519b \n6. Dossett L.A. Riesel J.N. Griffin M.R. Cotton B.A. Prevalence and implications of preinjury warfarin use: An analysis of the National Trauma Databank Arch. Surg. 2011 146 565 570 10.1001/archsurg.2010.313 21242422 \n7. Batchelor J.S. Grayson A. A meta-analysis to determine the effect of anticoagulation on mortality in patients with blunt head trauma* Br. J. Neurosurg. 2012 26 525 530 10.3109/02688697.2011.650736 22324438 \n8. McMillian W.D. Rogers F.B. Management of prehospital antiplatelet and anticoagulant therapy in traumatic head injury: A review J. Trauma Acute Care Surg. 2009 66 942 950 10.1097/TA.0b013e3181978e7b \n9. Brewer E.S. Reznikov B. Liberman R.F. Baker R.A. Rosenblatt M.S. David C.A. Flacke S. Incidence and predictors of intracranial hemorrhage after minor head trauma in patients taking anticoagulant and antiplatelet medication J. Trauma Acute Care Surg. 2011 70 E1 E5 10.1097/TA.0b013e3181e5e286 \n10. Beynon C. Hertle D.N. Unterberg A.W. Sakowitz O.W. Clinical review: Traumatic brain injury in patients receiving antiplatelet medication Crit. Care 2012 16 228 22839302 \n11. Van den Brand C.L. Tolido T. Rambach A.H. Hunink M.G. Patka P. Jellema K. Systematic Review and Meta-Analysis: Is Pre-Injury Antiplatelet Therapy Associated with Traumatic Intracranial Hemorrhage? J. Neurotrauma 2017 34 1 7 10.1089/neu.2015.4393 26979949 \n12. Prexl O. Bruckbauer M. Voelckel W. Grottke O. Ponschab M. Maegele M. Schöchl H. The impact of direct oral anticoagulants in traumatic brain injury patients greater than 60-years-old Scand. J. Trauma Acute Care Surg. Resusc. Emerg. Med. 2018 26 20 10.1186/s13049-018-0487-0 29580268 \n13. Matsuda W. Sugimoto K. Sato N. Watanabe T. Fujimoto A. Matsumura A. Delayed onset of posttraumatic acute subdural hematoma after mild head injury with normal computed tomography: A case report and brief review J. Trauma Acute Care Surg. 2008 65 461 463 10.1097/01.ta.0000202465.13784.2a 18288015 \n14. Parra M.W. Zucker L. Johnson E.S. Gullett D. Avila C. Wichner Z.A. Kokaram C.R. Dabigatran bleed risk with closed head injuries: Are we prepared? J. Neurosurg. 2013 119 760 765 10.3171/2013.3.JNS12503 23634730 \n15. Peck K.A. Sise C.B. Shackford S.R. Sise M.J. Calvo R.Y. Sack D.I. Walker S.B. Schechter M.S. Delayed intracranial hemorrhage after blunt trauma: Are patients on preinjury anticoagulants and prescription antiplatelet agents at risk? J. Trauma Acute Care Surg. 2011 71 1600 1604 10.1097/TA.0b013e31823b9ce1 22182870 \n16. Menditto V.G. Lucci M. Polonara S. Pomponio G. Gabrielli A. Management of minor head injury in patients receiving oral anticoagulant therapy: A prospective study of a 24-hour observation protocol Ann. Emerg. Med. 2012 59 451 455 10.1016/j.annemergmed.2011.12.003 22244878 \n17. Nishijima D.K. Offerman S.R. Ballard D.W. Vinson D.R. Chettipally U.K. Rauchwerger A.S. Reed M.E. Holmes J.F. Immediate and delayed traumatic intracranial hemorrhage in patients with head trauma and preinjury warfarin or clopidogrel use Ann. Emerg. Med. 2012 59 460 468.e7 10.1016/j.annemergmed.2012.04.007 22626015 \n18. Undén J. Ingebrigtsen T. Romner B. Scandinavian guidelines for initial management of minimal, mild and moderate head injuries in adults: An evidence and consensus-based update BMC Med. 2013 11 50 10.1186/1741-7015-11-50 23432764 \n19. Schoonman G.G. Bakker D.P. Jellema K. Low risk of late intracranial complications in mild traumatic brain injury patients using oral anticoagulation after an initial normal brain computed tomography scan: Education instead of hospitalization Eur. J. Neurol. 2014 21 1021 1025 10.1111/ene.12429 24684394 \n20. Swap C. Sidell M. Ogaz R. Sharp A. Risk of Delayed Intracerebral Hemorrhage in Anticoagulated Patients after Minor Head Trauma: The Role of Repeat Cranial Computed Tomography Perm. J. 2016 20 14 16 10.7812/TPP/15-095 26901269 \n21. Verschoof M.A. Zuurbier C.C.M. de Beer F. Coutinho J.M. Eggink E.A. van Geel B.M. Evaluation of the yield of 24-h close observation in patients with mild traumatic brain injury on anticoagulation therapy: A retrospective multicenter study and meta-analysis J. Neurol. 2018 265 315 321 10.1007/s00415-017-8701-y 29236167 \n22. Sifri Z.C. Homnick A.T. Vaynman A. Lavery R. Liao W. Mohr A. Hauser C.J. Manniker A. Livingston D. A prospective evaluation of the value of repeat cranial computed tomography in patients with minimal head injury and an intracranial bleed J. Trauma Acute Care Surg. 2006 61 862 867 10.1097/01.ta.0000224225.54982.90 17033552 \n23. Ding J. Yuan F. Guo Y. Chen S.W. Gao W.W. Wang G. Cao H.L. Ju S.M. Chen H. Zhang P.Q. A prospective clinical study of routine repeats computed tomography (CT) after traumatic brain injury (TBI) Brain Inj. 2012 26 1211 1216 10.3109/02699052.2012.667591 22571813 \n24. Jagoda A.S. Bazarian J.J. Bruns J.J. Jr. Cantrill S.V. Gean A.D. Howard P.K. Ghajar J. Riggio S. Wright D.W. Wears R.L. Clinical policy: Neuroimaging and decisionmaking in adult mild traumatic brain injury in the acute setting Ann. Emerg. Med. 2008 52 714 748 10.1016/j.annemergmed.2008.08.021 19027497 \n25. Kuczawski M. Stevenson M. Goodacre S. Teare M.D. Ramlakhan S. Morris F. Mason S. Should all anticoagulated patients with head injury receive a CT scan? Decision-analysis modelling of an observational cohort BMJ Open 2016 6 e013742 10.1136/bmjopen-2016-013742 27974370 \n26. Stiell I.G. Wells G.A. Vandemheen K. Clement C. Lesiuk H. Laupacis A. McKnight R.D. Verbeek R. Brison R. Cass D. The Canadian CT Head Rule for patients with minor head injury Lancet 2001 357 1391 1396 10.1016/S0140-6736(00)04561-X 11356436 \n27. Bauman Z.M. Ruggero J.M. Squindo S. McEachin C. Jaskot M. Ngo W. Barnes S. Lopez P.P. Repeat Head CT? Not Necessary for Patients with a Negative Initial Head CT on Anticoagulation or Antiplatelet Therapy Suffering Low-Altitude Falls Am. Surg. 2017 83 429 435 28541850 \n28. Chenoweth J.A. Gaona S.D. Faul M. Holmes J.F. Nishijima D.K. Incidence of Delayed Intracranial Hemorrhage in Older Patients After Blunt Head Trauma JAMA Surg. 2018 153 570 575 10.1001/jamasurg.2017.6159 29450470 \n29. Cohn B. Keim S.M. Sanders A.B. Can anticoagulated patients be discharged home safely from the emergency department after minor head injury? J. Emerg. Med. 2014 46 410 417 10.1016/j.jemermed.2013.08.107 24360352 \n30. Hill J.H. Bonner P. O’Mara M.S. Wood T. Lieber M. Delayed intracranial hemorrhage in the patient with blunt trauma on anticoagulant or antiplatelet agents: Routine repeat head computed tomography is unnecessary Brain Inj. 2018 32 735 738 10.1080/02699052.2018.1441442 29485294 \n31. McCammack K.C. Sadler C. Guo Y. Ramaswamy R.S. Farid N. Routine repeat head CT may not be indicated in patients on anticoagulant/antiplatelet therapy following mild traumatic brain injury West. J. Emerg. Med. 2015 16 43 49 10.5811/westjem.2014.10.19488 25671007 \n32. Scantling D. Fischer C. Gruner R. Teichman A. McCracken B. Eakins J. The role of delayed head CT in evaluation of elderly blunt head trauma victims taking antithrombotic therapy Eur. J. Trauma Emerg. Surg. 2017 43 741 746 10.1007/s00068-017-0793-7 28439613 \n33. Wiegele M. Schöchl H. Haushofer A. Ortler M. Leitgeb J. Kwasny O. Beer R. Ay C. Schaden E. Diagnostic and therapeutic approach in adult patients with traumatic brain injury receiving oral anticoagulant therapy: An Austrian interdisciplinary consensus statement Crit. Care 2019 23 62 10.1186/s13054-019-2352-6 30795779 \n34. Mudge A.M. Hubbard R.E. Management of frail older people with acute illness Intern. Med. J. 2019 49 28 33 10.1111/imj.14182 30680905\n\n", "fulltext_license": "CC BY", "issn_linking": "2077-0383", "issue": "8(11)", "journal": "Journal of clinical medicine", "keywords": "antithrombotic therapy; delayed intracranial hemorrhage; head trauma; traumatic brain injury", "medline_ta": "J Clin Med", "mesh_terms": null, "nlm_unique_id": "101606588", "other_id": null, "pages": null, "pmc": null, "pmid": "31731421", "pubdate": "2019-10-25", "publication_types": "D016428:Journal Article", "references": "19276776;20693913;21242422;28439613;23822845;28541850;18073595;29236167;25671007;24360352;22260187;23634730;22839302;30795779;26901269;29580268;30680905;15137601;29485294;23432764;27974370;22626015;10750921;17033552;19027497;22182870;18288015;26979949;24684394;22244878;11356436;22571813;29450470;22324438", "title": "Delayed Intracranial Hemorrhage in Patients with Head Trauma and Antithrombotic Therapy.", "title_normalized": "delayed intracranial hemorrhage in patients with head trauma and antithrombotic therapy" }
[ { "companynumb": "AT-ACCORD-162341", "fulfillexpeditecriteria": "1", "occurcountry": "AT", "patient": { "drug": [ { "actiondrug": "4", "activesubstance": { "activesubstancename": "CLOPIDOGREL BISULFATE" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nPost-hypoxic myoclonus (PHM) is a syndrome that occurs when a patient has suffered hypoxic brain injury. The myoclonus is usually multifocal and generalized, often stemming from both cortical and subcortical origins. In severe cases, pharmacological treatments with antiepileptic medications may not satisfactorily control the myoclonus.\n\n\nMETHODS\nWe present a case of a 23-year-old male with chronic medication refractory PHM following a cardiopulmonary arrest related to an asthmatic attack who improved with bilateral globus pallidus internus (GPi) deep brain stimulation (DBS). We review the clinical features of PHM, as well as the preoperative and postoperative Unified Myoclonus Rating Scale scores and DBS programming parameters in this patient and compare them with the three other published PHM-DBS cases in the literature.\n\n\nRESULTS\nThis patient experienced an alleviation of myoclonic jerks at rest and a 39% reduction in action myoclonus with improvement in both positive and negative myoclonus with bilateral GPi-DBS. High frequency stimulation (130 Hz) with amplitudes >2.5 V were needed for the therapeutic response.\n\n\nCONCLUSIONS\nWe demonstrate a robust improvement in a medication refractory PHM patient with bilateral GPi-DBS, and suggest that it is a viable therapeutic option for debilitating post-hypoxic myoclonus.", "affiliations": "Division of Movement Disorders, Department of Neurology, Icahn School of Medicine at Mount Sinai, New York, NY, USA.;Division of Movement Disorders, Department of Neurology, Icahn School of Medicine at Mount Sinai, New York, NY, USA.;Division of Movement Disorders, Department of Neurology, Icahn School of Medicine at Mount Sinai, New York, NY, USA.", "authors": "Ramdhani|Ritesh A|RA|;Frucht|Steven J|SJ|;Kopell|Brian H|BH|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.7916/D8NZ8DXP", "fulltext": "\n==== Front\nTremor Other Hyperkinet Mov (N Y)Tremor Other Hyperkinet Mov (N Y)TOHMTremor and Other Hyperkinetic Movements2160-8288Columbia University Libraries/Information Services 10.7916/D8NZ8DXPBrief ReportsImprovement of Post-hypoxic Myoclonus with Bilateral Pallidal Deep Brain Stimulation: A Case Report and Review of the Literature DBS for Post-hypoxic MyoclonusRamdhani Ritesh A. 12*Frucht Steven J. 1Kopell Brian H. 12341 Division of Movement Disorders, Department of Neurology, Icahn School of Medicine at Mount Sinai, New York, NY, USA2 Department of Neurosurgery, Icahn School of Medicine at Mount Sinai, New York, NY, USA3 Department of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, NY, USA4 Department of Neuroscience, Icahn School of Medicine at Mount Sinai, New York, NY, USALouis Elan D. Yale University, USA*To whom correspondence should be addressed. E-mail: ritesh.ramdhani@mssm.edu2017 19 5 2017 7 46109 3 2017 20 4 2017 © 2017 Ramdhani et al.2017Ramdhani et al.This is an open-access article distributed under the terms of the Creative Commons Attribution–Noncommerical–No Derivatives License, which permits the user to copy, distribute, and transmit the work provided that the original author and source are credited; that no commercial use is made of the work; and that the work is not altered or transformed.Background\nPost-hypoxic myoclonus (PHM) is a syndrome that occurs when a patient has suffered hypoxic brain injury. The myoclonus is usually multifocal and generalized, often stemming from both cortical and subcortical origins. In severe cases, pharmacological treatments with antiepileptic medications may not satisfactorily control the myoclonus.\n\nMethods\nWe present a case of a 23-year-old male with chronic medication refractory PHM following a cardiopulmonary arrest related to an asthmatic attack who improved with bilateral globus pallidus internus (GPi) deep brain stimulation (DBS). We review the clinical features of PHM, as well as the preoperative and postoperative Unified Myoclonus Rating Scale scores and DBS programming parameters in this patient and compare them with the three other published PHM-DBS cases in the literature.\n\nResults\nThis patient experienced an alleviation of myoclonic jerks at rest and a 39% reduction in action myoclonus with improvement in both positive and negative myoclonus with bilateral GPi-DBS. High frequency stimulation (130 Hz) with amplitudes >2.5 V were needed for the therapeutic response.\n\nDiscussion\nWe demonstrate a robust improvement in a medication refractory PHM patient with bilateral GPi-DBS, and suggest that it is a viable therapeutic option for debilitating post-hypoxic myoclonus.\n\nPost-hypoxic myoclonusdeep brain stimulationglobus pallidus internus\n==== Body\nIntroduction\nThe syndrome of post-hypoxic myoclonus (PHM) emerges within days to weeks of a patient suffering hypoxic brain injury, usually from cardiopulmonary arrest (CPA).1,2 PHM is commonly cortical, manifesting as multifocal, generalized muscle jerks that increase during movement and/or accentuate with sensory stimuli.3 Subcortical, brainstem myoclonus can often coexist. First described by Lance and Adams,1 PHM can also be associated with other neurological symptoms including cerebellar ataxia and seizures. Myoclonus may be positive or negative, and patients usually have a combination of cortical/subcortical and positive/negative myoclonus.\n\nTreatment for chronic myoclonus is difficult, requiring a polypharmacy approach using antiepileptic medications such as leviteracetam, piracetam, clonazepam, and valproate.4,5 Primidone, valproate, and clonazepam are usually insufficient monotherapies and their side effects can exacerbate the underlying myoclonus.6 Levetiracetam and piracetam have been shown in clinical trials to be tolerable and effective in cortical myoclonus,7,8 but the high doses needed for these drugs can engender non-compliance. As a result, patients with PHM usually require a combination of the classes of aforementioned medications with variable responses. Deep brain stimulation (DBS) has been suggested in patients with chronic PHM, but there have been only three reported cases of PHM treated with DBS.9–11 We report a fourth case of a patient with PHM following an asthmatic attack and CPA who was effectively treated with DBS, and only the second case to utilize bilateral globus pallidus internus (GPi) stimulation. We suggest that this approach should be considered in patients with severe disability from PHM when medications fail.\n\nCase\nA 23-year-old male with a history of asthma and gastric bypass surgery suffered an asthmatic attack en route to a scheduled endoscopy. He went into cardiopulmonary arrest and was resuscitated after three rounds of defibrillation and cardiopulmonary resuscitation for 15 minutes. Within 24 hours of this event, he developed generalized and multifocal myoclonus while in intensive care and was comatose for approximately 1 month before regaining consciousness. Electroencephalogram monitoring did not reveal seizure activity. He underwent a tracheostomy and a percutaneous endoscopic gastrostomy, both of which were eventually reversed. He was referred to our center 2 years after the hypoxic and despite early gains in his mental status, respiratory function and dysphagia, his myoclonus persisted—occurring at rest and worsened with movement of his hands and legs. He was unable to hold a cup with either hand because of action myoclonus (Video 1). He required assistance with all activities of daily living and was unable to ambulate more than a few steps even using a walker. Throughout the day he had several episodes of myoclonic “volleys,” characterized as frequent, relentless flurries of generalized myoclonus that would last 20 minutes to 1 hour (Video 2). The patient would sweat profusely during these events and consumption of several shots of vodka was found to substantially dampen the myoclonus. A regimen of levetiracetam 1,500 mg twice a day, clonazepam 2 mg three times a day, and valproate 250 mg three times a day provided only modest control of his rest and action myoclonus and further increases failed to decrease the severity or frequency of his myoclonic volleys.\n\nVideo 1 Myoclonus at rest and with action. Cortical and subcortical myoclonus affecting the patient’s speech and limb movements.\nVideo 2 Myoclonic volley. Episode of myoclonic volley with frequent generalized myoclonus at rest and with action.\nOn examination, while in the seated position, there were mild spontaneous myoclonic jerks in his arms and hands. His speech was incomprehensible with frequent arrests. He had one or two jerks of his neck when rotating his head and infrequent facial myoclonus. Action myoclonus emerged when his arms were outstretched and increased on finger to nose movements with myoclonic jerks in flexor more than extensor muscle groups. There was no stimulus-induced myoclonus with tactile or pinprick stimulation of the arms or legs. He required two-person assistance to stand, which triggered negative myoclonus in his legs with frequent truncal jerks (Video 3). His stance was broad based and he was unable to take a step forward.\n\nVideo 3 Myoclonus when standing. Negative myoclonus observed in the patient’s legs when standing.\nFollowing a multidisciplinary deliberation that took into consideration this patient’s preserved cognition, lack of other medical comorbidity, and severity of disability stemming from medication refractory myoclonus, a recommendation for DBS was taken as an attempt to recuperate some level of meaningful quality of life. The decision to choose bilateral GPi as the target for implantation was in part based on our experience along with published data of treating myoclonus in myoclonus–dystonia patients with GPi-DBS.12–15\n\nMethods\nThe patient underwent staged implantation of bilateral DBS electrodes (Medtronic 3389, Medtronic Inc., St. Paul, MN) 3 years after his anoxic event. The electrodes were placed into the posteroventrolateral globus pallidus internus using a Leksell stereotactic frame and O-Arm guidance. The operative target was localized as 20 mm lateral to the midline, 2.5 mm anterior to the middle cerebral peduncle (MCP), and 4 mm inferior to the commissural line. The target was then cross correlated with the reformatted Schaltenbrand and Wahren atlas and with the Quantitative Susceptibility Mapping (QSM)16 images showing the GPi. Intraoperative microelectrode recording provided further targeting refinement and a postoperative CT co-registered with preoperative magnetic resonance imaging provided confirmation of electrode placement (Figure 1).\n\nFigure 1 Bilateral DBS electrode position. Preoperative magnetic resonance imaging quantitative susceptibility mapping of coronal sequences showing the co-registered postoperative computed tomography location of the centroid (red dot) of the left (A) and right (B) electrodes in the globus pallidus internus.\nResults\nPostoperative programming commenced 2 weeks after the pulse generators were implanted. Of note, there was no objective clinical change in the patient’s physical condition or functional improvement before stimulation started. Initial programming consisted of a monopolar review (pulse width (PW) 90 ms, frequency 130 Hz) that evaluated each contact and mapped their myoclonus reduction along with any unwanted side effects. There was immediate reduction of both rest and action myoclonus, greater on the left hemibody during initial programming. However, he developed an infection of the left implanted pulse generator (IPG) 2 months from initial programming that spared the left electrode. The IPG was removed, and as a result his right upper extremity rest and action myoclonus returned. Following 6 weeks of antibiotics, his IPG was reimplanted.\n\nSix months from the first programming session, there was only mild action myoclonus in both his arms and legs. His lower extremity negative myoclonus also showed improvement by this time following a very modest rate of response up until that point. This allowed him to stand by pushing off with both hands and walk several meters using a walker in physical therapy with one-person assistance. He was able to hold items with each hand, drink from a cup with one hand, and open a bottle cap (Video 4). He started brushing his teeth independently and assisted his caretakers with dressing and hygiene. In addition, his myoclonic volleys were no longer a daily occurrence.\n\nVideo 4 6 months after with Bilateral GPi-DBS. Reduction in myoclonus with pallidal deep brain stimulation. The patient is able to drink from a water bottle, push himself up to stand, and takes a few steps with assistance.\nProgramming parameters and changes in his Unified Myoclonus Rating Scale Motor scores from an unblinded rater are shown in Table 1 along with the three other published PHM-DBS cases. His action myoclonus in his arms required large stimulation amplitudes. Furthermore, a tripolar configuration of the left DBS was used to create a broad stimulation field as a means to attenuate his right upper extremity myoclonus.\n\n\nTable 1 Post-hypoxic Myoclonus Cases Treated with Deep Brain Stimulation\n\tAge/Gender\tEtiology\tBody Region Affected\tPreoperative UMRS\tPostoperative UMRS\tMedication\tDBS Target/Electrode\tDBS Parameters (contacts: amplitude/PW/Freq)\t\nRest\tAction\tStimulus Sensitive\tRest\tAction\tStimulus Sensitive\t\nYamada et al.9\t71M\tRight putaminal hemorrhage and CPA\tRight Hemibody\t24\t52\tNA\t6\t15\tNA\tClonazepam (1.5 mg/day)\nValproate (800 mg/day)\nGabapentin (400 mg/day)\tLeft Gpi (Medtronic 3387)\tL: 1–2+1, 8V/450 µs/130 Hz\t\nKobayashi et al.10\t36M\tPerinatal anoxia\tUpper limbs\tNA\tLUE 12\nRUE 9\tNA\tNA\tLUE 2\nRUE 2\tNA\tN/A\tB/L VIM (Medtronic 3387)\tR: 1–3+ settings unavailable\nL: 1–3+ settings unavailable\t\nAsahi et al.11\t54M\tCPA\tGeneralized\t8\t25\t5\t0\t5\t0\tValproate acid Clonazepam Intrathecal Baclofen\tBL Gpi (Medtronic 3387)\tInterleaved\nR: 1(–) 2(+) 2.5 V/60 µsec/125 Hz\nL: 0(–) 1(+) 2.0 V/60 µs/125 Hz\t\nCurrent case\t26M\tAsthmatic attack and CPA\tGeneralized\t751\t52\nRUE 6\nRLE 2\nLUE 6\nLLE 2\t0\t0\t32\nRUE 2\nRLE 2\nLUE 0\nLLE 2\t0\tClonazepam (6 mg/day)\nLevetiracetam (3,000 mg/day)\nValproate (750 mg/day)\tBL Gpi Medtronic/3389\tR: 3-c+: 2.8 V/90 µs/130 Hz\nL: 1-2-3-C+: 2.5 V/60 µs/130 Hz\t\nAbbreviations: CPA, Cardiopulmonary Arrest; LLE, Left Lower Extremity; LUE, Left Upper Extremity; NA, Not Available; RLE, Right Lower Extremity; RUE, Right Upper Extremity; UMRS, Unified Myoclonus Rating Scale.\n\n1 Assessed during an episode of a myoclonic volley.\n\n\n\n\nAs a result of reduced PHM, the patient’s underlying mild appendicular dysmetria and gait ataxia, which were not initially appreciated because of the extent of his muscle jerks, were unmasked, and remained unresponsive to stimulation. His myoclonic medications also remained unchanged as attempts to reduce them increased his myoclonus.\n\nDiscussion\nThough neurophysiological studies were not conducted, phenomenologically this patient manifested both chronic cortical and subcortical myoclonus. The presence of multifocal, distal muscle jerks that increased with movement was consistent with a cortical process. Subcortical or reticular myoclonus was evident with observed jerks in his face, neck, and proximal upper extremity flexor muscles during movement, as well as negative myoclonus in his legs.17,18\n\nPallidal and thalamic DBS have been shown to be quite effective in suppressing myoclonus, especially in patients with myoclonus–dystonia.12,13 However, to the best of our knowledge, there have only been three reported cases of PHM treated with DBS (Table 1). Two of those cases were pallidal stimulation—one of which was unilateral to treat hemimyoclonus following a stroke,9 while the other was a bilateral implantation that effectively treated CPA-induced myoclonus in all extremities.11 Khobayashi et al.10 reported a case of perinatal anoxia-induced action myoclonus successfully treated with bilateral VIM-DBS. The programming parameters for these cases all utilized a bipolar configuration to achieve therapeutic gain, whereas a monopolar and tripolar configuration in our patient, produced robust responses at amplitudes >2.5 V without any side effects.\n\nThe pathophysiology of post-hypoxic myoclonus remains unknown. However, the rat arrest model with myoclonus19 demonstrated degeneration in pyramidal cells of layers III and IV of the cerebral cortex and reticular thalamus along with extensive Purkinje cell damage in the cerebellum. Concomitantly, decreases in 5-HTP (hydroxytryptophan), 5-HT (hydroxytryptamine receptors), and 5-HIAA (hydroxyindoleacetic acid) in the cortex, mesencephalic regions, striatum, and cerebellum highlighted a potential role of the serotonergic system in the pathophysiology of PHM. Recent human brain imaging studies in PHM showed minimal anatomical changes but significant cortical and cerebellar connectivity, metabolic, and blood flow changes2,20–25 (Table 2). Of note, fludeoxyglucose positron emission tomography findings by Frucht and colleagues20 revealed elevated glucose metabolism in the ventrolateral thalamus and pontine tegmentum in seven patients with PHM, suggesting involvement of the basal ganglia-thalamocortical network. When compared to myoclonus–dystonia (DYT-11), shared metabolic increases were seen in the parasagittal cerebellar nuclei.21 Combining these findings with the neuronal injury in the paravermal and vermal regions of the rat arrest model, suggests that dysfunctional ascending pathways intricate to motor execution19 are contributory to the generation of PHM. Furthermore, the unmasking of cerebellar symptoms following attenuation of our patient’s myoclonus underscores the potential putative role of the cerebellum in the pathogenesis of myoclonus, especially cortical myoclonus.\n\n\nTable 2 Neuroimaging Findings in Post-Hypoxic Myoclonus\nStudy\tNo. Patients\tImaging Modality\tResults\t\nFrucht et al.20\t7\tFDG-PET\tBilateral increase in glucose metabolism in pontine tegmentum, ventrolateral thalamus, and medial temporal lobes\t\nCarbon et al.21\t7\tFDG-PET\tConjunction analysis with DYT-11 revealed shared increases in parasagittal cerebellar nuclei bilaterally\t\nPark et al.22,a\t1\trs-fMRI\tIncreased connectivity between:\n1) primary motor cortex and right somatosensory association cortex\n2) primary sensory cortex and left visual association cortex\n3) supplementary motor cortex and right inferior temporal, right orbito-temporal, left primary auditory, and left somatosensory association cortex\t\nFerlazzo et al.23\t1\tSerial MRIs\t4 days after CPA, DWI lesions in cerebellum and thalami, FLAIR was normal\n 20 days after CPA–DWI and FLAIR normal\n6 months after CPA–3T MRI with quantitative volumetric analysis no atrophy of thalami, cerebellum, caudate nuclei, putamina, pallidus nuclei, hippocampi, as well as normal volumes of whole encephalic tissue, gray and white matter\t\nWerhahn et al.2,b\t14\tMRI\tMean 2.5 years from CPA:\n4 patients – mild cortical and cerebellar atrophy\n4 patients – hemispheric or cerebellar infarcts\n4 patients – normal\t\nZhang et al.24\t2\tSPECT MRS FDG-PET\t1 patient 2 months from CPA\nSPECT – revealed mild left temporal lobe hypoperfusion\n1 patient 10 months from CPA\nMRS – moderate reduction in N-acetyl aspartate peak in her left hippocampus and a mild decrease in the right hippocampus\nPET – metabolic reduction in frontal lobes\t\nHuang et al.25\t1\tfMRI\tIncreased BOLD bilateral cortical areas, particularly the motor cortex of legs. Of note patient has only muscle jerks in her legs\t\nAbbreviations: BOLD, Blood Oxygenation Level Dependent; CPA, Cardiopulmonary Arrest; DWI, Diffusion-weighted Image; FDG-PET, [18F]-fludeoxyglucose-positron Emission Tomography; MRS, Magnetic Resonance Spectroscopy; PET, Positron Emission Tomography; rs-fMRI, Resting State Functional Magnetic Resonance Imaging; SPECT - Single-photon emission computed tomography.\n\na One post-hypoxic myoclonus patient compared with four age matched controls\n\nb 12 of 14 PHM patients had brain MRI.\n\n\n\n\nThere are limited data regarding the neuronal activity of the GPi in the context of PHM. However, aberrations in GPi neuronal recordings have been reported in a constellation of hyperkinetic disorders such as myoclonus–dystonia,26 generalized and secondary dystonia, and hemiballismus.27,28 The response of cortical myoclonus to pallidal stimulation in this patient suggests the possibility that dysfunctional motor cortical relays and/or cerebellar efferents converge on the basal ganglia–thalamocortical network triggering changes in the nature of neuronal processing. Unlike cortical myoclonus, the pathophysiology of subcortical myoclonus is less clear; however, its response to stimulation infers a possible role for this network in its pathogenesis.\n\nIn summary, we present a patient with medication-refractory post-hypoxic myoclonus following cardiopulmonary arrest manifesting with cortical (positive and negative myoclonus) and subcortical myoclonus who experienced significant improvement with pallidal deep brain stimulation. Based on our growing understanding of the pathophysiology of cortical myoclonus as well as the robust nature by which it responds to DBS in myoclonus–dystonia and a small cohort of published PHM cases, it is not unreasonable to consider DBS as a therapeutic option in debilitating Lance Adam’s syndrome.\n\nFunding: None.\n\nFinancial Disclosures: None.\n\nConflict of Interest: The authors report no conflict of interest.\n\nEthics Statement: All patients that appear on video have provided written informed consent; authorization for the videotaping and for publication of the videotape was provided.\n==== Refs\nReferences\n1 Lance JW Adams RD The syndrome of intention or action myoclonus as a sequel to hypoxic encephalopathy Brain 1963 86 111 136 doi: 10.1093/brain/86.1.111 13928398 \n2 Werhahn KJ Brown P Thompson PD Marsden CD The clinical features and prognosis of chronic posthypoxic myoclonus Mov Disord 1997 12 216 20 doi: 10.1002/mds.870120212 9087980 \n3 Hallett M Physiology of human posthypoxic myoclonus Mov Disord 2000 15 (Suppl. 1) 8 13 doi: 10.1002/mds.870150703 10755266 \n4 Fahn S Post-anoxic action myoclonus: improvement with valproic acid N Engl J Med 1978 299 313 314 \n5 Obeso JA Therapy of myoclonus Clin Neurosci 1995 3 253 257 8891399 \n6 Ikeda A Shibasaki H Tashiro K Mizuno Y Kimura J Clinical trial of piracetam in patients with myoclonus: nationwide multiinstitution study in Japan. The Myoclonus/Piracetam Study Group Mov Disord 1996 11 691 700 doi: 10.1002/mds.870110615 8914096 \n7 Striano P Manganelli F Boccella P Perretti A Striano S Levetiracetam in patients with cortical myoclonus: a clinical and electrophysiological study Mov Disord 2005 20 1610 1614 doi: 10.1002/mds.20530 16078205 \n8 Frucht SJ Louis ED Chuang C Fahn S A pilot tolerability and efficacy study of levetiracetam in patients with chronic myoclonus Neurology 2001 57 1112 1114 doi: 10.1212/WNL.57.6.1112 11571347 \n9 Yamada K Sakurama T Soyama N Kuratsu J Gpi pallidal stimulation for Lance-Adams syndrome Neurology 2011 76 1270 1272 doi: 10.1212/WNL.0b013e31821482f4 21464432 \n10 Kobayashi K, Katayama Y Otaka T et al Thalamic deep brain stimulation for the treatment of action myoclonus caused by perinatal anoxia Stereotact Funct Neurosurg 2010 88 259 263 doi: 10.1159/000315464 20530980 \n11 Asahi T Kashiwazaki D Dougu N et al Alleviation of myoclonus after bilateral pallidal deep brain stimulation for Lance-Adams syndrome J Neurol 2015 262 1581 1583 doi: 10.1007/s00415-015-7748-x 25929661 \n12 Ramdhani RA Frucht SJ Behnegar A Kopell BH Improvement of isolated myoclonus phenotype in myoclonus dystonia after pallidal deep brain stimulation Tremor Other Hyperkinet Mov 2016 6 doi: 10.7916/D8F47P0C \n13 Gruber D Kuhn AA Schoenecker T et al Pallidal and thalamic deep brain stimulation in myoclonus-dystonia Mov Disord 2010 25 1733 17343 doi: 10.1002/mds.23312 20623686 \n14 Azoulay-Zyss J Roze E Welter ML et al Bilateral deep brain stimulation of the pallidum for myoclonus-dystonia due to epsilon-sarcoglycan mutations: a pilot study Arch Neurol 2011 68 94 98 doi: 10.1001/archneurol.2010.338 21220679 \n15 Kurtis MM San Luciano M Yu Q et al Clinical and neurophysiological improvement of SGCE myoclonus-dystonia with GPi deep brain stimulation Clin Neurol Neurosurg 2010 112 149 152 doi: 10.1016/j.clineuro.2009.10.001 19896264 \n16 Deistung A Schafer A Schweser F Biedermann U Turner R Reichenbach JR Toward in vivo histology: a comparison of quantitative susceptibility mapping (QSM) with magnitude-, phase-, and R2*-imaging at ultra-high magnetic field strength Neuroimage 2013 65 299 314 doi: 10.1016/j.neuroimage.2012.09.055 23036448 \n17 Tassinari CA Rubboli G Shibasaki H Neurophysiology of positive and negative myoclonus Electroencephalogr Clin Neurophysiol 1998 107 181 195 doi: 10.1016/S0013-4694(98)00058-3 9803948 \n18 Rubboli G Tassinari CA Negative myoclonus. An overview of its clinical features, pathophysiological mechanisms, and management Neurophysiol Clin 2006 36 337 343 doi: 10.1016/j.neucli.2006.12.001 17336779 \n19 Tai KK Bhidayasiri R Truong DD Post-hypoxic animal model of myoclonus Parkinsonism Relat Disord 2007 13 377 381 doi: 10.1016/j.parkreldis.2007.07.001 17720608 \n20 Frucht SJ Trost M Ma Y Eidelberg D The metabolic topography of posthypoxic myoclonus Neurology 2004 62 1879 1881 doi: 10.1212/01.WNL.0000125336.05001.23 15159501 \n21 Carbon M Raymond D Ozelius L et al Metabolic changes in DYT11 myoclonus-dystonia Neurology 2013 80 385 391 doi: 10.1212/WNL.0b013e31827f0798 23284065 \n22 Park KM Han YH Kim TH et al Increased functional connectivity between motor and sensory cortex in a patient with Lance-Adams syndrome Clin Neurol Neurosurg 2015 139 241 243 doi: 10.1016/j.clineuro.2015.10.021 26519896 \n23 Ferlazzo E Gasparini S Cianci V Cherubini A Aguglia U Serial MRI findings in brain anoxia leading to Lance-Adams syndrome: a case report Neurol Sci 2013 34 2047 2050 doi: 10.1007/s10072-013-1356-2 23494722 \n24 Zhang YX Liu JR Jiang B et al Lance-Adams syndrome: a report of two cases J Zhejiang Univ Sci B 2007 8 715 720 doi: 10.1631/jzus.2007.B0715 17910113 \n25 Huang HC Chen JC Lu MK Chen JM Tsai CH Post-hypoxic cortical myoclonus mimicking spinal myoclonus - electrophysiological and functional MRI manifestations Eur J Neurol 2011 18 e4 5 doi: 10.1111/j.1468-1331.2010.03186.x 20722712 \n26 Welter ML Grabli D Karachi C et al Pallidal activity in myoclonus dystonia correlates with motor signs Mov Disord 2015 30 992 926 doi: 10.1002/mds.26244 25880339 \n27 Vitek JL Chockkan V Zhang JY et al Neuronal activity in the basal ganglia in patients with generalized dystonia and hemiballismus Ann Neurol 1999 46 22 35 doi: 10.1002/1531-8249(199907)46:1<22::AID-ANA6>3.0.CO;2-Z 10401777 \n28 Sanghera MK Grossman RG Kalhorn CG Hamilton WJ Ondo WG Jankovic J Basal ganglia neuronal discharge in primary and secondary dystonia in patients undergoing pallidotomy Neurosurgery 2003 52 1358 70 discussion 1370–133 doi: 10.1227/01.NEU.0000064805.91249.F5 12762881\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2160-8288", "issue": "7()", "journal": "Tremor and other hyperkinetic movements (New York, N.Y.)", "keywords": "Post-hypoxic myoclonus; deep brain stimulation; globus pallidus internus", "medline_ta": "Tremor Other Hyperkinet Mov (N Y)", "mesh_terms": null, "nlm_unique_id": "101569493", "other_id": null, "pages": "461", "pmc": null, "pmid": "28616357", "pubdate": "2017", "publication_types": "D016428:Journal Article", "references": "8891399;10401777;351404;21464432;20722712;20530980;17910113;19896264;21220679;15159501;23284065;16078205;9087980;26519896;25929661;17720608;9803948;23494722;26989574;8914096;23036448;11571347;13928398;20623686;17336779;25880339;12762881;10755266", "title": "Improvement of Post-hypoxic Myoclonus with Bilateral Pallidal Deep Brain Stimulation: A Case Report and Review of the Literature.", "title_normalized": "improvement of post hypoxic myoclonus with bilateral pallidal deep brain stimulation a case report and review of the literature" }
[ { "companynumb": "US-UCBSA-2017029529", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "LEVETIRACETAM" }, "drugadditional": "3", ...
{ "abstract": "Fibrosing cholestatic hepatitis (FCH) is a less common but well-recognized severe complication of recurrent hepatitis C virus (HCV) infection post-liver transplant. This condition is fatal without successful treatment and to date; post-transplant antiviral interferon-based antiviral therapy has been associated with guarded success. The new era of protease inhibitors in the treatment of chronic HCV infection may alter the dismal outcome of this condition. To date, however, the experience with protease inhibitors in this condition is unreported. We report a post-liver transplant recipient with HCV associated FCH treated successfully with boceprevir, peginteferon and ribavirin for severe FCH. The patient was young woman who was a null responder pre-transplant to peginterferon and ribavirin. The peak serum bilirubin 391 μmol/L normalized to 15 μmol/L by week 8 of therapy. The pre-treatment HCV viral load of > 78 million IU/mL, decreased to 78 IU/mL at week 8 of therapy and was undetectable by week 12 and at the end of 48 week of treatment. 12 weeks post treatment, the HCV viral load remains undetectable. Significant anemia and neutropenia were encountered. Tacrolimus dosage titrated to trough levels, required marked reduction to 0.5 mg three times weekly. Despite the suboptimal peginterferon and ribavirin dosing, limited by adverse effects, full boceprevir dosing was maintained, with resolution of liver dysfunction. Boceprevir was obtained on compassionate grounds from the manufacturer before its licensure in Canada and this was the first use of boceprevir in the world for post-transplant FCH.", "affiliations": "Division of Gastroenterology, University of British Columbia, Canada.", "authors": "Al Nahdi|Nawal|N|;Ford|Jo-Ann|JA|;Greanya|Erica D|ED|;Harrigan|Jo-Ann|JA|;Tse|Irene|I|;Steinbrecher|Urs P|UP|;Erb|Siegfried R|SR|;Yoshida|Eric M|EM|", "chemical_list": "D000998:Antiviral Agents; D007166:Immunosuppressive Agents; D000077190:Interferon alpha-2; D016898:Interferon-alpha; D012367:RNA, Viral; D011994:Recombinant Proteins; D011092:Polyethylene Glycols; D012254:Ribavirin; C512204:N-(3-amino-1-(cyclobutylmethyl)-2,3-dioxopropyl)-3-(2-((((1,1-dimethylethyl)amino)carbonyl)amino)-3,3-dimethyl-1-oxobutyl)-6,6-dimethyl-3-azabicyclo(3.1.0)hexan-2-carboxamide; D011392:Proline; C417083:peginterferon alfa-2b; D016559:Tacrolimus", "country": "Mexico", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1665-2681", "issue": "12(1)", "journal": "Annals of hepatology", "keywords": null, "medline_ta": "Ann Hepatol", "mesh_terms": "D000328:Adult; D000998:Antiviral Agents; D004359:Drug Therapy, Combination; D005260:Female; D016174:Hepacivirus; D019698:Hepatitis C, Chronic; D006801:Humans; D007166:Immunosuppressive Agents; D000077190:Interferon alpha-2; D016898:Interferon-alpha; D016031:Liver Transplantation; D011092:Polyethylene Glycols; D011392:Proline; D012367:RNA, Viral; D011994:Recombinant Proteins; D012254:Ribavirin; D016559:Tacrolimus; D016896:Treatment Outcome; D019562:Viral Load", "nlm_unique_id": "101155885", "other_id": null, "pages": "156-60", "pmc": null, "pmid": "23293209", "pubdate": "2013", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "First successful treatment of post-liver transplant hepatitis C fibrosing cholestatic hepatitis with boceprevir, peginterferon and ribavirin in a pre-transplant null responder.", "title_normalized": "first successful treatment of post liver transplant hepatitis c fibrosing cholestatic hepatitis with boceprevir peginterferon and ribavirin in a pre transplant null responder" }
[ { "companynumb": "CA-009507513-1306CAN005422", "fulfillexpeditecriteria": "1", "occurcountry": "CA", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "PEGINTERFERON ALFA-2B\\RIBAVIRIN" }, "drugad...
{ "abstract": "We report a case of disseminated cryptococcosis in a patient with multiple myeloma (MM) during treatment with daratumumab, lenalidomide, and dexamethasone (DRd). A 62-year-old woman, who was diagnosed with IgGλ type MM, was treated with three cycles of bortezomib and dexamethasone and subsequently treated with three cycles of DRd before admission. She reached a stringent complete response and presented with lethargy and seizure. Laboratory findings revealed severe CD4 lymphopenia, and Cryptococcus neoformans was detected in her cerebrospinal fluid and blood culture. The risk of developing an opportunistic infection should be considered in patients treated with daratumumab.", "affiliations": "Division of Hematology, Shonan Kamakura General Hospital, Japan.;Division of Hematology, Shonan Kamakura General Hospital, Japan.;Division of Hematology, Shonan Kamakura General Hospital, Japan.", "authors": "Sato|Shuku|S|;Kambe|Emiko|E|;Tamai|Yotaro|Y|", "chemical_list": "D000911:Antibodies, Monoclonal; D000970:Antineoplastic Agents; C556306:daratumumab; D003907:Dexamethasone; D000077269:Lenalidomide", "country": "Japan", "delete": false, "doi": "10.2169/internalmedicine.1726-18", "fulltext": "\n==== Front\nIntern MedIntern. MedInternal Medicine0918-29181349-7235The Japanese Society of Internal Medicine 3044980110.2169/internalmedicine.1726-18Case ReportDisseminated Cryptococcosis in a Patient with Multiple Myeloma Treated with Daratumumab, Lenalidomide, and Dexamethasone Sato Shuku 1Kambe Emiko 1Tamai Yotaro 1\n1 Division of Hematology, Shonan Kamakura General Hospital, JapanCorrespondence to Dr. Shuku Sato, ocukuhs719@gmail.com\n\n19 11 2018 15 3 2019 58 6 843 847 19 6 2018 6 9 2018 Copyright © 2019 by The Japanese Society of Internal Medicine2019The Internal Medicine is an Open Access journal distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).We report a case of disseminated cryptococcosis in a patient with multiple myeloma (MM) during treatment with daratumumab, lenalidomide, and dexamethasone (DRd). A 62-year-old woman, who was diagnosed with IgGλ type MM, was treated with three cycles of bortezomib and dexamethasone and subsequently treated with three cycles of DRd before admission. She reached a stringent complete response and presented with lethargy and seizure. Laboratory findings revealed severe CD4 lymphopenia, and Cryptococcus neoformans was detected in her cerebrospinal fluid and blood culture. The risk of developing an opportunistic infection should be considered in patients treated with daratumumab. \n\ndaratumumabdisseminated cryptococcosislymphopenia\n==== Body\nIntroduction\nCryptococcosis is a life-threatening, opportunistic fungal infection that predominantly affects immunocompromised hosts (1). Although the disease may occur in apparently normal, healthy hosts, most patients with symptomatic disseminated cryptococcosis have an underlying immunocompromised condition, such as human immunodeficiency virus (HIV) infection or especially CD4 lymphocytopenia; they may also have had prolonged treatment with corticosteroids, cirrhosis, organ transplantation, advanced malignancy, and diabetes (1-4). CNS involvement is the most common manifestation of disseminated cryptococcosis (3).\n\nIn patients with multiple myeloma (MM), cell-mediated immunity is suppressed with primary disease and treatments, such as steroids, proteasome inhibitors (PIs), and other immunosuppressive drugs. Daratumumab, a human IgGκ monoclonal antibody that targets CD38, in combination with lenalidomide and dexamethasone (DRd) significantly lengthened the progression-free survival of patients with relapsed or refractory MM, but it is known that daratumumab suppresses a patient's immunity to some degree (5). The National Comprehensive Cancer Network guidelines recommend the use of antifungal and antiviral agents as prophylaxis against Pneumocystis jiroveci pneumonia and herpes infection in MM patients treated with high-dose dexamethasone, PIs, or Daratumumab (6). There are several reports of cases of multiple myeloma (MM), in which fungal infections, including cryptococcosis, developed during autologous hematopoietic stem cell transplantation (7). Furthermore, there are also reports of cases of relapsed and refractory MM, treated with novel immunosuppressive therapies and high doses of corticosteroids (8,9).\n\nWe herein report a case of disseminated cryptococcosis in a patient with MM during DRd treatment. To date, no cases of disseminated cryptococcosis during DRd treatment have been reported as adverse events of daratumumab. Given that there are unclear points, particular attention is needed to identify the effects of the immunosuppressive action of daratumumab on lymphocytes.\n\nCase Report\nThe patient was a 62-year-old woman who had been diagnosed with IgGλ type MM (Internal Staging System: ISS=III, Revised ISS=III) with renal dysfunction. She was treated with three cycles of bortezomib (1.3 mg/m2 days 1, 4, 8, 11) and dexamethasone (20 mg on the day of and the day after bortezomib on a 21-day cycle) (BD). She showed a partial response to treatment; however, after she experienced grade 3 diarrhea in association with bortezomib therapy, we decided to discontinue BD. Thereafter, stem cells were harvested using granulocyte colony stimulating factor (G-CSF) alone. She was subsequently treated with three cycles of DRd (daratumumab, 16 mg/kg, every week; lenalidomide, 10 mg/day, for 21 days, and dexamethasone, 40 mg/week), after which she showed a stringent complete response (sCR).\n\nShe was referred to the emergency room of our hospital again after presenting lethargy, rolling of the eyes and loss of consciousness for 3 minutes. Her past medical history included hemorrhagic cerebral infarction and symptomatic epilepsy one month before she was diagnosed MM-after which she was treated with levetiracetam (1,000 mg, once daily) to prevent epilepsy. On admission, she was afebrile but slightly somnolent. A physical examination revealed the absence of meningeal irritation and abnormal neurological symptoms. The laboratory data revealed lymphopenia [white blood cell count, 3,700/μL (lymphocytes, 7.7%; 284.9/μL), and CD4+ count, 224/μL], a normal C-reactive protein level (0.158 mg/dL), and severely low immunoglobulin levels (IgA, 4 mg/dL; IgG, 292 mg/dL; and IgM, 11 mg/dL) (Table). A chest X-ray and brain and chest computed tomography scan showed normal findings. Brain magnetic resonance imaging revealed previous hemorrhagic cerebral infarction (Fig. 1A and B). The patient's clinical course is shown in Fig. 2.\n\nTable. Laboratory Data on Admission.\n\nHematology\t\tBiochemistry\t\tImmunology\t\nWBC\t3,700\t/μL\t\tT-Bil\t1\tU/L\t\tIgG\t292\tmg/dL\t\nNeut\t84.6\t%\t\tTP\t5.6\tmg/dL\t\tIgA\t4\tmg/dL\t\nLym\t7.7\t%\t\tAlb\t3.5\tmg/dL\t\tIgM\t11\tmg/dL\t\nMono\t2\t%\t\tAST\t16\tU/L\t\tCD4\t78.9\t%\t\nEosino\t0\t%\t\tALT\t60\tU/L\t\tCD8\t16.0\t%\t\nBaso\t0\t%\t\tLDH\t242\tU/L\t\tCD4/8\t4.93\t\t\nRBC\t330×104\t/μL\t\tγGTP\t59\tU/L\t\t\t\t\t\nHb\t10.7\tg/dL\t\tALP\t246\tU/L\t\tCerebrospinal fluid\t\nMCV\t93.6\tfl\t\tBUN\t22.2\tmg/dL\t\tCell count\t66\t/μL\t\nPlt\t10.9×104\t/μL\t\tCre\t2.0\tmg/dL\t\tMonocyte\t48\t/μL\t\nCoagulation\t\teGFR\t20.5\t\t\tPolynuclear\t18\t/μL\t\nPT-INR\t1.01\t\t\tNa\t139\tmEq/L\t\tTP\t93.3\tmg/dL\t\nAPTT\t23.6\tsec\t\tK\t3.8\tmEq/L\t\tCl\t111\tmEq/L\t\n\t\t\t\tCl\t102\tmEq/L\t\tGlu\t9.7\tmg/dL\t\n\t\t\t\tGLU\t143\tmg/dL\t\t\t\t\t\n\t\t\t\tCRP\t0.15\tmg/dL\t\t\t\t\t\n\t\t\t\tHbA1c\t5.7\t%\t\t\t\t\t\nWBC: white blood cell, Neu: neutrophil, Lym; lymphocyte, Mono; monocyte, Eosino; Eosinophil, Baso; Basophil, RBC: red blood cell, Hb: hemoglobin, Plt: platelet, PT: prothrombin time activity, PT-INR: prothrombin time activity-international normalized ratio, APTT: activated partial thromboplastin time, T-Bil: total bilirubin, TP: total protein, Alb: albumin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LDH: lactate dehydrogenase, BUN: blood urea nitrogen, Cre: creatinine, eGFR: estimate glomerular filtration rate, Glu: glucose, CRP: C-reactive protein, HbA1c: hemoglobin A1c\n\nFigure 1. A) B) Brain magnetic resonance imaging revealed previous hemorrhagic cerebral infarction. C) India ink method of cerebrospinal fluid was positive.\n\nFigure 2. Transitive graph of IgG and lymphocyte count during treatment with BD and a DRd regimen.\n\nOn the day of admission, partial seizure only affecting the patient's right arm was observed. She was then treated with diazepam (5 mg, intravenously), and the epilepsy stopped. Because she remained drowsy 3 days after admission, a cerebrospinal fluid (CSF) analysis was performed, which revealed the following findings: white blood cell count, 66/μL (mononucleosis, 48/μL); glucose, 9.7 mg/dL; and CSF pressure, 85 mmHg. Based on the suspicion of meningitis, treatment with broad-spectrum antibiotics, dexamethasone and an anti-herpes virus drug was initiated. However, on the evening of the same day, the patient suddenly suffered respiratory arrest. She was given emergency medical care and her vital signs stabilized. However, she remained unconscious with no spontaneous breathing. The India ink method detected the presence of Cryptococcus in the patient's CSF (Fig. 1C). CSF and serum cryptococcal antigen tests were also positive, and Cryptococcus neoformans was detected in the patient's blood and CSF cultures. The patient was treated with liposomal amphotericin-B (250 mg/day) and flucytosine (1,500 mg/day), and CSF drainage was performed to reduce the CSF pressure. However, despite these treatments, the patient remained unconscious and died 17 days after admission.\n\nDiscussion\nThe presentation of cryptococcosis was nonspecific and mimicked that of other common entities, both infectious and noninfectious (10). Typical symptoms of cryptococcal meningitis include headache, fever, and neck stiffness. Although these symptoms do not occur in many cases, atypical symptoms, such as disturbance of consciousness, personality disorder, and changes in character, may occur (10). This patient had a past medical history of hemorrhagic cerebral infarction and symptomatic epilepsy; she was suspected to have recurrent symptomatic epilepsy, as she was lethargic and experienced seizure attacks. She had no fever, and laboratory studies showed no signs of inflammation. Since she remained in a somnolent state, we decided to perform a lumbar puncture. Based on the results, the patient was diagnosed with cryptococcal meningitis. In this patient, an immunosuppressive state, MM, DRd treatment, hypogammaglobinemia and severe lymphopenia might have contributed to cryptococcal infection. The international standard induction treatment for cryptococcal meningitis prescribes 2 weeks of liposomal amphotericin B (3-4 mg/kg/day, intravenously) plus flucytosine (100 mg/kg/day); if the CSF pressure is ≥25 cm of CSF and there are symptoms of increased intracranial pressure during induction therapy, CSF drainage should be performed to reduce the pressure by 50% or to a normal pressure of ≤20 cm of CSF (11,12). She was treated according to this protocol.\n\nDaratumumab is a human immunoglobulin monoclonal antibody that targets CD38 and which causes myeloma cell death through multiple mechanisms (13). CD38 is ubiquitously expressed on myeloma cells (14,15) and other immune cells, including normal plasma cells, myeloid-derived suppressor cells (MDSCs), regulatory T cells (Tregs), and regulatory B cells (Bregs) (16,17). It is also expressed at relatively low levels on normal lymphoid and myeloid cells (18). Krejcik et al. reported that treatment with daratumumab caused a reduction in the immunosuppressive function of MDSCs, Tregs, and Bregs. Thus, in both peripheral blood and bone marrow, daratumumab induced significant increases of T cells and increased CD8:CD4 and CD8:Treg ratios (19). Van de Donk et al. also reported that the proportion of T cells preferentially increased in deep treatment responders, which is correlated with a higher CD8/CD4 T cell ratio (20). However, these results were different from our case. In the phase 3 trial of DRd treatment and the daratumumab plus bortezomib and dexamethasone (DBd) regimen, the rates of lymphopenia were reported to be 6.0% and 13.2%, respectively; lymphopenia also occurred in patients who were treated with daratumumab (5,21). Until now, the mechanism through which lymphopenia occurs in patients treated daratumumab was not known. The CD38 expression in Tregs, Bregs, and another lymphocytes may be diverse in each MM patient. We would be interested to learn whether it does not increase the lymphocyte count in all cases, especially in deep responders. Immunomodulatory drugs (IMiDs) led to the upregulation of CD38 on myeloma cells (22) and Tregs (23); the expression rate of CD38 may change according to the previous lines of therapy. In this case, we hypothesized that the CD38 expression in T cells was upregulated by lenalidomide, and that it was more susceptible to daratumumab. As a result, lymphopenia may have occurred as a serious adverse event.\n\nAlthough our patient had an sCR after three cycles of DRd treatment, severe lymphopenia occurred from the beginning of daratumumab treatment, and the lymphopenia did not resolve; furthermore, the number of CD8 (+) T cells decreased. Additional studies must be conducted to examine the effects of daratumumab on lymphocytes.\n\nIn our case, severe hypogammaglobinemia was also noted. CD38 is expressed by normal plasma cells because daratumumab directly targets normal plasmacytic CD38; daratumumab may cause a reduction in the production of immunoglobulins. Intravenous immunoglobulin therapy may be considered for hypogammaglobinemia, which occurred in our patient, to prevent infection.\n\nAs in our case, cryptococcal infection in MM patients with a small number of previous lines of therapy is rare. Disseminated cryptococcosis should be considered in patients with MM treated with daratumumab who have psychological symptoms, such as lethargy and seizure, especially if lymphocytopenia, a decreased CD4 cell count, or severe hypogammaglobinemia are observed. Regular monitoring of the CD4 cell counts and the gammaglobulin level is warranted in patients treated with daratumumab. Hematologists and general practitioners should be aware of the risk of opportunistic cryptococcal infection when encountering patients treated with daratumumab.\n\n\nThe authors state that they have no Conflict of Interest (COI).\n==== Refs\n1. Chayakulkeeree M , Perfect JR \nCryptococcosis . Infect Dis Clin North Am \n20 : 507 -544 , 2006 .16984867 \n2. Lui G , Lee N , Ip M , et al \nCryptococcosis in apparently immunocompetent patients . QJM - Mon J Assoc Physicians \n99 : 143 -151 , 2006 .\n3. Baddley JW , Perfect JR , Oster RA , et al \nPulmonary cryptococcosis in patients without HIV infection: factors associated with disseminated disease . Eur J Clin Microbiol Infect Dis \n27 : 937 -943 , 2008 .18449582 \n4. Zonios DI , Falloon J , Huang CY , Chaitt D , Bennett JE \nCryptococcosis and idiopathic CD4 lymphocytopenia . Medicine (Baltimore) \n86 : 78 -92 , 2007 .17435588 \n5. Dimopoulos MA , Oriol A , Nahi H , et al \nDaratumumab, lenalidomide, and dexamethasone for multiple myeloma . N Engl J Med \n375 : 1319 -1331 , 2016 .27705267 \n6. \nKumar SK, Sybil Biermann J, Castillo JJ, et al NCCN Guidelines Version 1.2019 Multiple Myeloma NCCN Guidelines Panel Disclosures Continue [Internet]. [cited 2018 Apr. 12]. Available from:\nhttps://www.nccn.org/professionals/physician_gls/pdf/myeloma.pdf\n7. Teh BW , Harrison SJ , Worth LJ , Spelman T , Thursky KA , Slavin MA \nRisks, severity and timing of infections in patients with multiple myeloma: a longitudinal cohort study in the era of immunomodulatory drug therapy . Br J Haematol \n171 : 100 -108 , 2015 .26105211 \n8. Bowcock SJ , Yip K , Majumder K , Atta M , Ceesay MM \nCryptococcosis in late stage multiple myeloma: consider it . Br J Haematol \n176 : 687 , 2017 .28109161 \n9. Oshima K , Kanda Y , Nannya Y , et al \nClinical and pathologic findings in 52 consecutively autopsied cases with multiple myeloma . Am J Hematol \n67 : 1 -5 , 2001 .11279649 \n10. Kontoyiannis DP , Peitsch WK , Reddy BT , et al \nCryptococcosis in patients with cancer . Clin Infect Dis \n32 : E145 -E150 , 2001 .\n11. Perfect JR , Dismukes WE , Dromer F , et al \nClinical practice guidelines for the management of cryptococcal disease: 2010 update by the infectious diseases society of America . Clin Infect Dis \n50 : 291 -322 , 2010 .20047480 \n12. Sun HY , Alexander BD , Lortholary O , et al \nLipid formulations of amphotericin B significantly improve outcome in solid organ transplant recipients with central nervous system cryptococcosis . Clin Infect Dis \n49 : 1721 -1728 , 2009 .19886800 \n13. de Weers M , Tai Y-T , van der Veer MS , et al \nDaratumumab, a novel therapeutic human CD38 monoclonal antibody, induces killing of multiple myeloma and other hematological tumors . J Immunol \n186 : 1840 -1848 , 2011 .21187443 \n14. Lin P , Owens R , Tricot G , Wilson CS \nFlow cytometric immunophenotypic analysis of 306 cases of multiple myeloma . Am J Clin Pathol \n121 : 482 -488 , 2004 .15080299 \n15. Santonocito AM , Consoli U , Bagnato S , et al \nFlow cytometric detection of aneuploid CD38(++) plasmacells and CD19(+) B-lymphocytes in bone marrow, peripheral blood and PBSC harvest in multiple myeloma patients . Leuk Res \n28 : 469 -477 , 2004 .15068900 \n16. Karakasheva TA , Waldron TJ , Eruslanov E , et al \nCD38-expressing myeloid-derived suppressor cells promote tumor growth in a murine model of esophageal cancer . Cancer Res \n75 : 4074 -4085 , 2015 .26294209 \n17. Flores-Borja F , Bosma A , Ng D , et al \nCD19+CD24hiCD38hi B cells maintain regulatory T cells while limiting TH1 and TH17 differentiation . Sci Transl Med \n5 : 173ra23 , 2013 .\n18. Deaglio S , Vaisitti T , Billington R , et al \nCD38/CD19: a lipid raft-dependent signaling complex in human B cells . Blood \n109 : 5390 -5398 , 2007 .17327405 \n19. Krejcik J , Casneuf T , Nijhof IS , et al \nDaratumumab depletes CD38+ immune regulatory cells, promotes T-cell expansion, and skews T-cell repertoire in multiple myeloma . Blood \n128 : 384 -395 , 2016 .27222480 \n20. Van de Donk NW , Adams H , Vanhoof G , et al \nDaratumumab in combination with lenalidomide plus dexamethasone results in persistent natural killer (NK) cells with a distinct phenotype and expansion of effector memory T-cells in pollux, a phase 3 randomized study . Blood \n130 : 3124 , 2017 .\n21. Palumbo A , Chanan-Khan A , Weisel K , et al \nDaratumumab, bortezomib, and dexamethasone for multiple myeloma . N Engl J Med \n375 : 754 -766 , 2016 .27557302 \n22. Rainer B , Stefan Steidl JE \nEffect of IMiD compounds on CD38 expression on multiple myeloma cells: MOR202, a human CD38 antibody in combination with pomalidomide . J Clin Oncol \n33 : 8588 , 2015 .\n23. Feng X , Zhang L , Acharya C , et al \nTargeting CD38 suppresses induction and function of T regulatory cells to mitigate immunosuppression in multiple myeloma . Clin Cancer Res \n23 : 4290 -4300 , 2017 .28249894\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "0918-2918", "issue": "58(6)", "journal": "Internal medicine (Tokyo, Japan)", "keywords": "daratumumab; disseminated cryptococcosis; lymphopenia", "medline_ta": "Intern Med", "mesh_terms": "D000911:Antibodies, Monoclonal; D000970:Antineoplastic Agents; D000971:Antineoplastic Combined Chemotherapy Protocols; D003453:Cryptococcosis; D003455:Cryptococcus neoformans; D003907:Dexamethasone; D017809:Fatal Outcome; D005260:Female; D006801:Humans; D000077269:Lenalidomide; D008875:Middle Aged; D009101:Multiple Myeloma; D009894:Opportunistic Infections", "nlm_unique_id": "9204241", "other_id": null, "pages": "843-847", "pmc": null, "pmid": "30449801", "pubdate": "2019-03-15", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "11279649;11340547;15068900;15080299;16504989;16984867;17327405;17435588;18449582;19886800;20047480;21187443;23427243;26105211;26294209;27222480;27557302;27705267;28109161;28249894", "title": "Disseminated Cryptococcosis in a Patient with Multiple Myeloma Treated with Daratumumab, Lenalidomide, and Dexamethasone.", "title_normalized": "disseminated cryptococcosis in a patient with multiple myeloma treated with daratumumab lenalidomide and dexamethasone" }
[ { "companynumb": "JP-ASPEN-GLO2019JP003477", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "DEXAMETHASONE" }, "drugadditional": null, ...
{ "abstract": "In stress-induced takotsubo cardiomyopathy (TC) high levels of catecholamines, including epinephrine, may be detected in blood. On the other hand, administration of exogenous epinephrine may occasionally result in TC.\nThe authors describe a case of a 58-year-old, otherwise healthy female, with TC which occurred after intravenous injection of 1 mg of epinephrine against cardiac arrest provoked by pneumoperitoneum performed before planned laparoscopic cholecystectomy. She was admitted 3 days earlier due to biliary colic following a dietary mistake. Bradycardia followed by asystole took place immediately after carbon dioxide insufflation into the peritoneal cavity. Normal heart rhythm, with transient tachycardia, recurred after a short cardiac massage, intravenous atropine and epinephrine administration as well as pneumoperitoneum decompression. ECG after the episode showed nonspecific ST segment changes. Left ventricular dysfunction assessed in echocardiography as contractile abnormalities and decreased global longitudinal strain (GLS) represented an unusual type of TC - intermediate between mid-basal and focal one. These abnormalities, involving mainly the posterior wall, resolved rapidly within 24 hours without any specific treatment. The absence of coronary artery disease was confirmed by 128-row multidetector computed tomography. TC should be considered as a potential complication of epinephrine action; however, different factors related to laparoscopic procedure including general anesthesia, intubation, underlying disease and mental stress might have been also involved in TC triggering in the case presented.", "affiliations": "Józef Struś Hospital, Poznań, Poland: Department of Internal Medicine.;Poznań University of Medical Sciences, Poland: 2nd Department of Cardiology.;Józef Struś Hospital, Poznań, Poland: Department of General and Colorectal Surgery.;Józef Struś Hospital, Poznań, Poland: Department of Anesthesiology and Intensive Therapy.;Józef Struś Hospital, Poznań, Poland: Radiology Unit.;Józef Struś Hospital, Poznań, Poland: Department of General and Colorectal Surgery.", "authors": "Elikowski|Waldemar|W|;Małek-Elikowska|Malgorzata|M|;Karoń|Jacek|J|;Mrozińska|Maria|M|;Baszko|Alina|A|;Horbacka|Karolina|K|", "chemical_list": "D004837:Epinephrine", "country": "Poland", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1426-9686", "issue": "42(250)", "journal": "Polski merkuriusz lekarski : organ Polskiego Towarzystwa Lekarskiego", "keywords": "Aypical takotsubo cardiomyopathy; cardiac arrest; epinephrine; global longitudinal strain; laparoscopy; pneumoperitoneum", "medline_ta": "Pol Merkur Lekarski", "mesh_terms": "D061605:Administration, Intravenous; D004837:Epinephrine; D005260:Female; D006323:Heart Arrest; D006801:Humans; D008875:Middle Aged; D011027:Pneumoperitoneum; D054549:Takotsubo Cardiomyopathy", "nlm_unique_id": "9705469", "other_id": null, "pages": "165-169", "pmc": null, "pmid": "28530215", "pubdate": "2017-04-21", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Takotsubo cardiomyopathy after intravenous epinephrine administration following cardiac arrest provoked by pneumoperitoneum - a case report.", "title_normalized": "takotsubo cardiomyopathy after intravenous epinephrine administration following cardiac arrest provoked by pneumoperitoneum a case report" }
[ { "companynumb": "US-IMPAX LABORATORIES, INC-2018-IPXL-00359", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "EPINEPHRINE" }, "drugadditio...
{ "abstract": "Thalidomide is an immunomodulatory drug and first choice in the treatment of erythema nodosum leprosum. Given its teratogenic potential, it is essential that an effective contraceptive method is used, especially a long-acting reversible contraceptive (LARC) method. The subdermal etonogestrel (ENG)-releasing implant is an adequate method due to the high effectiveness and long-term use. However, interaction between thalidomide and ENG has not been well documented. Concern arises because thalidomide interacts with cytochrome P450 (CYP450) enzymes that metabolize sexual steroids. AIM: We aimed to study the effectiveness and safety of the ENG-implant in a thalidomide user.\nCase report of a sexually active 21-year-old patient with both Hansen's disease and leprosy reaction type 2 treated with thalidomide requiring effective contraception. Follow-up was up to 36 months after implant placement.\nContraception with ENG-implant was effective and safe, based on clinical parameters (reduction of menstrual flow and cervical mucus thickening) and laboratory parameters (gonadotropins and sexual steroids).\nTo the best of our knowledge, this is the first case reported which presents a patient in simultaneous use of thalidomide and ENG-implant. Although this case report preliminary supports effectiveness and safety of ENG-implant as a contraceptive option in women using thalidomide, rigorous drug-drug interaction research is needed to better characterize the interaction between thalidomide and the ENG-implant.", "affiliations": "Divisão de Ginecologia, Hospital das Clínicas HCFMUSP, Faculdade de Medicina, Universidade de São Paulo, São Paulo, Brazil.;Family Planning Clinic, Department of Obstetrics and Gynecology, Faculty of Medical Sciences, University of Campinas, Campinas, Brazil.;Divisão de Ginecologia, Hospital das Clínicas HCFMUSP, Faculdade de Medicina, Universidade de São Paulo, São Paulo, Brazil.;Disciplina de Dermatologia, Faculdade de Medicina FMUSP, Universidade de São Paulo, São Paulo, Brazil.;Divisão de Ginecologia, Hospital das Clínicas HCFMUSP, Faculdade de Medicina, Universidade de São Paulo, São Paulo, Brazil.;Divisão de Ginecologia, Hospital das Clínicas HCFMUSP, Faculdade de Medicina, Universidade de São Paulo, São Paulo, Brazil.;Divisão de Ginecologia, Hospital das Clínicas HCFMUSP, Faculdade de Medicina, Universidade de São Paulo, São Paulo, Brazil.;Divisão de Ginecologia, Hospital das Clínicas HCFMUSP, Faculdade de Medicina, Universidade de São Paulo, São Paulo, Brazil.", "authors": "Ferreira-Filho|Edson Santos|ES|0000-0002-0017-3273;Bahamondes|Luis|L|0000-0002-7356-8428;Duarte|Daniele Coelho|DC|;Guimarães|Ana Lúcia Monteiro|ALM|0000-0002-1919-0751;de Almeida|Patrícia Gonçalves|PG|0000-0002-8004-3515;Soares-Júnior|José Maria|JM|0000-0003-0774-9404;Baracat|Edmund Chada|EC|0000-0003-0111-9030;Sorpreso|Isabel Cristina Esposito|ICE|0000-0002-5475-5957", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1080/09513590.2021.1974380", "fulltext": null, "fulltext_license": null, "issn_linking": "0951-3590", "issue": null, "journal": "Gynecological endocrinology : the official journal of the International Society of Gynecological Endocrinology", "keywords": "Thalidomide; case report; contraceptive agents; etonogestrel; leprosy; subdermal implant", "medline_ta": "Gynecol Endocrinol", "mesh_terms": null, "nlm_unique_id": "8807913", "other_id": null, "pages": "1-4", "pmc": null, "pmid": "34486922", "pubdate": "2021-09-06", "publication_types": "D016428:Journal Article", "references": null, "title": "Etonogestrel-releasing contraceptive implant in a patient using thalidomide for the treatment of erythema nodosum leprosum: a case report.", "title_normalized": "etonogestrel releasing contraceptive implant in a patient using thalidomide for the treatment of erythema nodosum leprosum a case report" }
[ { "companynumb": "BR-LUPIN PHARMACEUTICALS INC.-2022-07031", "fulfillexpeditecriteria": "2", "occurcountry": "BR", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "RIFAMPIN" }, "drugadditional":...
{ "abstract": "BACKGROUND\nNeoadjuvant chemotherapy with concurrent docetaxel, doxorubicin and cyclophosphamide is commonly used for patients with locally advanced breast cancer. Epirubicin is another anthracycline used in breast cancer but the concurrent use of epirubicin and taxane is not well-established. We conducted a single institution, phase II study to assess the efficacy and safety of concurrent docetaxel, epirubicin and cyclophosphamide (TEC) as a neoadjuvant chemotherapy regimen in breast cancer.\n\n\nMETHODS\nPatients with newly diagnosed locally advanced breast cancer defined as T2 >3 cm, T3, T4 with any N, or any T with N1-3 were eligible. A chemotherapy regimen of docetaxel 75mg/m(2), epirubicin 75mg/m(2) and cyclophosphamide 600mg/m(2 )was given with filgrastim support every 3 weeks for 6 cycles. The primary end-point was pathologic complete response rate.\n\n\nRESULTS\nTwenty patients were enrolled from 2003 to 2006. The median age was 51 (29-70) year-old. Eight patients were premenopausal. Ten patients had positive hormone receptors. Four patients had HER2 positive receptor. Nineteen patients completed six cycles of TEC chemotherapy. The pathologic complete response rate was 25%. Eight of sixteen patients with N1-3 disease had pathological negative lymph nodes. With a median follow up of 57.5 (16-71) months, four patients relapsed including one death from recurrence. The estimated 5 year relapse-free survival was 79.3% and the 5-year overall survival was 94.7%. No patient had cardiac failure or death during treatment. The most common grade 3-4 toxicity was neutropenia (35%).\n\n\nCONCLUSIONS\nTEC regimen is a well- tolerated and effective neoadjuvant chemotherapy regimen for locally advanced breast cancer that results in a pathologic complete response rate of 25%.", "affiliations": "Division of Hematology and Oncology, Department of Medicine, Medical College of Wisconsin, Milwaukee, Wisconsin, USA.", "authors": "Yao|Xin|X|;Hosenpud|Janet|J|;Chitambar|Christopher R|CR|;Charlson|John|J|;Cheng|Yee Chung|YC|", "chemical_list": null, "country": "Australia", "delete": false, "doi": "10.7150/jca.3980", "fulltext": "\n==== Front\nJ CancerJ CancerjcaJournal of Cancer1837-9664Ivyspring International Publisher Sydney 10.7150/jca.3980jcav03p0145Research PaperA Phase II Study of Concurrent Docetaxel, Epirubicin and Cyclophosphamide as a Neoadjuvant Chemotherapy Regimen in Patients with Locally Advanced Breast Cancer Yao Xin Hosenpud Janet Chitambar Christopher R. Charlson John Cheng Yee Chung ✉Division of Hematology and Oncology, Department of Medicine, Medical College of Wisconsin, Milwaukee, Wisconsin, USA✉ Corresponding author: Yee Chung Cheng, M.D., Division of Hematology and Oncology, Department of Medicine, Medical College of Wisconsin, 9200 W Wisconsin Ave, Milwaukee, Wisconsin 53226. Tel: 414-805-4600; Fax: 414-805-4606; Email: ycheng@mcw.eduCompeting Interests: The authors have declared that no competing interest exists.\n\n2012 1 4 2012 3 145 151 18 12 2011 11 2 2012 © Ivyspring International Publisher. This is an open-access article distributed under the terms of the Creative Commons License (http://creativecommons.org/licenses/by-nc-nd/3.0/). Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited.2012Background: Neoadjuvant chemotherapy with concurrent docetaxel, doxorubicin and cyclophosphamide is commonly used for patients with locally advanced breast cancer. Epirubicin is another anthracycline used in breast cancer but the concurrent use of epirubicin and taxane is not well-established. We conducted a single institution, phase II study to assess the efficacy and safety of concurrent docetaxel, epirubicin and cyclophosphamide (TEC) as a neoadjuvant chemotherapy regimen in breast cancer. Methods: Patients with newly diagnosed locally advanced breast cancer defined as T2 >3 cm, T3, T4 with any N, or any T with N1-3 were eligible. A chemotherapy regimen of docetaxel 75mg/m2, epirubicin 75mg/m2 and cyclophosphamide 600mg/m2 was given with filgrastim support every 3 weeks for 6 cycles. The primary end-point was pathologic complete response rate. Results: Twenty patients were enrolled from 2003 to 2006. The median age was 51 (29-70) year-old. Eight patients were premenopausal. Ten patients had positive hormone receptors. Four patients had HER2 positive receptor. Nineteen patients completed six cycles of TEC chemotherapy. The pathologic complete response rate was 25%. Eight of sixteen patients with N1-3 disease had pathological negative lymph nodes. With a median follow up of 57.5 (16-71) months, four patients relapsed including one death from recurrence. The estimated 5 year relapse-free survival was 79.3% and the 5-year overall survival was 94.7%. No patient had cardiac failure or death during treatment. The most common grade 3-4 toxicity was neutropenia (35%). Conclusion: TEC regimen is a well- tolerated and effective neoadjuvant chemotherapy regimen for locally advanced breast cancer that results in a pathologic complete response rate of 25%.\n\nNeoadjuvant ChemotherapyDocetaxelEpirubicinCyclophosphamideLocally AdvancedBreast Cancer\n==== Body\nIntroduction\nNeoadjuvant chemotherapy is a standard of care for patients with locally advanced breast cancer. Compared to adjuvant therapy in which there is no measurable disease, the primary tumor can be used as a surrogate marker of occult metastatic disease response in the setting of neoadjuvant therapy. The hypothesis is that if the primary tumor responds well to systemic chemotherapy, the systemic micrometastatic disease should respond as well and will result in improved survival. The change in tumor size can be assessed by either a clinical examination or by imaging studies. Therefore, neoadjuvant chemotherapy allows the clinician to perform a real-time assessment of tumor response and offers the flexibility of changing therapy if patients do not show an adequate response to the current chemotherapy.1 Several studies have demonstrated that the pathological response to neoadjuvant therapy is a marker for long-term survival.2 In addition, neoadjuvant therapy provides a platform to identify new molecular and genetic markers to predict tumor response.\n\nThere is no standard neoadjuvant chemotherapy regimen. In the United States, four cycles of doxorubicin and cyclophosphamide (AC) followed by four cycles of taxane (paclitaxel or docetaxel) is commonly used. In Canada and Europe, fluorouracil, epirubicin and cyclophosphamide for 6 cycles is more popular. The addition of taxane augments the efficacy of anthracycline-based chemotherapy regimen. The NSABP-B27 study demonstrated that preoperative administration of docetaxel following AC increased the pathological complete response (pCR) rate from 13.7% to 26.1%.2 An M.D. Anderson study showed adding paclitaxel prior to preoperative fluorouracil, doxorubicin and cyclophosphamide regimen increased a pCR rate from 15.7% to 28.2%.3 Compared to sequential treatment, concurrent use of taxane with anthracycline may provide a similar response but with shorten treatment duration. The GeparTrio trial found that the six cycles of docetaxel, doxorubicin and cyclophosphamide (TAC) produced a pCR of 21% if the primary tumor size decreased by ≥ 50% and a pCR of 5.3% if the decrease was < 50% after two cycles of chemotherapy.1,4 Epirubicin has comparable efficacy to doxorubicin but less cardiotoxicity. Theoretically, the concurrent administration of docetaxel, epirubicin and cyclophosphamide (TEC) should be as effective as TAC regimen but may have a less toxicity profile. The use of TEC regimen as neoadjuvant chemotherapy has not been well-established. We conducted a single institution phase II study to assess the efficacy and safety of neoadjuvant TEC regimen in patients with locally advanced breast cancer.\n\nPatients and Methods\nPatient population: All patients signed an informed consent form. The inclusion criteria were female patients with histologically confirmed breast cancer; either T2 > 3 cm, T3, T4 with any N, or any T with N1-3, and M0. Patients were registered within 45 days of diagnosis. The age was ≥ 18 years old. Patients were required to have Eastern Cooperative Oncology Group performance status scale 0-1 and were candidate for systemic chemotherapy. The exclusion criteria were patients who were pregnant or lactating, had undergone lumpectomy, had received any prior systemic or radiation therapy for the breast cancer, had any other serious medical or psychiatric illness, had any history of chronic liver disease, active infection, prior malignancies except non-melanoma skin cancer, in-situ carcinoma of the cervix, or other non-breast cancer if disease free > 5 years.\n\nBiopsy: Patients with palpable axillary lymph nodes underwent an excisional or core needle biopsy of the nodes. If there was no palpable disease, the patient underwent standard pre-surgical radio-lymphatic mapping followed by sentinel lymph node biopsy.\n\nInitial evaluation: All patients had whole body bone scan, computed tomography scan of chest, abdomen and pelvis to rule out distant metastasis. Patients had ultrasound, mammography, or magnetic resonance imaging to determine the longest diameter of the primary breast tumor. Patients had a left ventricular ejection fraction measurement by either MUGA scan or Echocardiogram. For patients who were of childbearing potential, negative pregnancy test was documented.\n\nNeoadjuvant chemotherapy: All eligible patients received 6 cycles of neoadjuvant chemotherapy consisting of docetaxel 75 mg/m2, epirubicin 75 mg/m2 and cyclophosphamide 600 mg/m2 every 3 weeks. All three agents were given on day 1 of each cycle. Patients were offered either filgrastim 5 µg/kg subcutaneously on day 5-15 or pegfilgrastim 6 µg subcutaneously on day 2. To receive chemotherapy, patients must have absolute granulocyte count > 1,500/µl, platelet count > 100,000/µl, hemoglobin > 10 g/dl, creatinine < 1.5 x upper limit normal (ULN), AST < 1.5 x UNL, alkaline phosphates < 5 x UNL, and total bilirubin < ULN. Administration of chemotherapy might be delayed because of hematological, renal or gastrointestinal toxicity on day 1 of any cycle. No dose reduction was allowed for hematological toxicities only.\n\nTumor size was assessed after two cycles of chemotherapy. If the tumor remained stable or shrank, the patient would proceed with another four cycles of chemotherapy treatment. If the patient had progressive disease, she would then be removed from the study and further treatment would be given according to the best standard of care.\n\nSurgery, radiation and other therapy: Three to six weeks after completion of last cycle of neoadjuvant chemotherapy, the patients underwent primary surgical resection. Surgery for the primary tumor was either lumpectomy or mastectomy and the choice was left to the surgeon according to best practice standards or available protocols. Axillary lymph node dissection was performed on all patients with nodal involvements. All lumpectomy patients had adjuvant radiation therapy. The radiation oncologist determined the need for chest wall radiation for mastectomy patients and /or axillary radiation according to best practice standards. Adjuvant anti-hormone therapy was given to patients with positive hormone receptors. Adjuvant trastuzumab was given if the tumor was HER2 receptor positive. After surgery, patients were followed every 3 months for 2 years and then every 6 months for another 3 years. Further disease follow up was at the discretion of the treating physician.\n\nToxicity: All patients who received neoadjuvant chemotherapy were evaluated for treatment related toxicity. Adverse events were summarized using the Common Toxicity Criteria of the National Cancer Institute for Adverse Events, version 3.0.\n\nStatistical analysis: The primary endpoint of the study was pCR rate. The pCR was defined as no histological evidence of invasive tumor cells in the surgical breast specimen and axillary lymph nodes. The secondary endpoints were clinical response to neoadjuvant chemotherapy, adverse events, relapse-free survival (RFS) and overall survival (OS). The primary tumors were evaluated by imaging and physical examination at baseline, after the second cycle and the last cycle of chemotherapy. RECIST guidelines were used to document clinical response. RFS was defined as the time from the date of histological diagnosis to the first date of disease relapse or the date of death of any cause. OS was defined as the time from the date of diagnosis to the date of death of any cause.\n\nA 25% of pCR rate and a 70% of clinical response rate was anticipated. Approximately 40 patients were planned to be enrolled into this protocol to produce a confidence interval of 53.5% to 83.4%. The study was terminated early after an interim analysis was conducted half way through the proposal. The RFS and OS were estimated using the Kaplan-Meier analysis.\n\nResults\nPatient characteristics: Twenty one female patients were registered from Dec 2003 to Dec 2006. One patient was excluded because of a history of papillary thyroid cancer. Twenty patients were evaluated (Table 1). The median age was 51 year-old (range 29-70). Eight of them (40%) were premenopausal. Two patients had invasive lobular carcinoma and the others had invasive ductal carcinoma. One patient had inflammatory breast cancer. The median size of the primary tumor was 5.5 (range 0-11) cm by physical examination and 3.3 (range 1.5-12) cm by imaging studies. Sixteen patients (80%) had axillary lymph node involvements. Ten patients (50%) had positive hormone receptors. Four patients (20%) were HER2 receptor positive. All but one patient received adjuvant radiation therapy. All patients with positive hormone receptor received adjuvant hormonal treatment at a median duration of 52 (range 12-60) months. The 4 patients with HER2 positive tumor also received 12 months adjuvant trastuzumab treatment.\n\nOutcome: Fourteen patients (70%) had lumpectomy and six patients (30%) underwent mastectomy. For three of these six patients, mastectomy was done because of presence of residual disease. Two mastectomies were performed because patients had multicentric disease. One patient was offered lumpectomy but she decided to have mastectomy.\n\nNineteen patients (95%) showed primary tumor shrinkage measured by either clinical examination or imaging studies after six cycles of TEC chemotherapy. Five patients had pCR (25%). Sixteen patients with nodal involvement had lymph node dissection after completion of chemotherapy; eight of them (50%) had pathological negative lymph nodes.\n\nWith a median 57.5 (range 16-71) months follow-up, four patients (20%) relapsed. All of them had lymph nodes involvement at diagnosis and failed to achieve pCR. Two of them had triple negative disease, one patient was ER-PR-HER2+ and another one was ER+PR+HER2- . The median time of relapse was 43 months (range 22-50). One patient had a relapse at 22 months and died at 24 months after diagnosis. One relapsed patient transferred her care to another institution. One patient who was in remission at 22 months moved out and lost follow up. All other patients remained alive at the latest follow up. The estimated 5-year RFS was 79.3% (Figure 1) and the 5-year OS was 94.7% (Figure 2).\n\nSafety and Tolerability: No patients had progressive disease after two cycles of chemotherapy. All patients proceeded to receive a full course of treatment and were assessable for toxicity. Patients tolerated the chemotherapy well. Nineteen patients (95%) completed all six cycles of TEC chemotherapy. One patient had five cycles of chemotherapy. The early discontinuation was due to emotional stress but not due to adverse effects. One hundred twenty five (99.2%) of 126 planned cycles of TEC were administered. No dose reduction of epirubicin or cyclophosphamide was required. For three patients (15%), the dose of docetaxel was reduced by 25% after cycle 3, 4, and 5 respectively because of grade 3 peripheral neuropathy. Any adverse event, irrespective of whether it is directly caused by chemotherapy, was taken into account (Table 2). Two patients had grade 1-2 tachycardia and 1 patient had palpitation. No patient developed cardiac failure. The most common grade 3-4 adverse effects were neutropenia, 35%. Three patients (15%) had neutropenic fever. No death occurred during the treatment.\n\nDiscussion\nThis phase II study demonstrates that TEC regimen is an efficacious neoadjuvant chemotherapy regimen with a 25% pCR rate for patients with locally advanced breast cancer. A German study using TEC neoadjuvant chemotherapy regimen recently reported the same pCR rate.5 This supports that our results are likely to be reproducible.\n\nThe 25% pCR rate in our study is higher than that of most of the old chemotherapy regimens and is comparable to that of 26% in NSABP-B27 study6 and that of 21% in GeparTrio trial4 (Table 3). In NSABP-B27 study, chemotherapy of AC x 4 cycles was followed by docetaxel x 4 cycles.6 In GeparTiro trial, patients were given six cycles of TAC chemotherapy. A 21% pCR rate was obtained from a selected population in which patients demonstrated ≥ 50% of shrinkage of tumor after two cycles of TAC chemotherapy.4 For those who had < 50% of response after two cycles of TAC treatment and continued to receive six cycles of TAC chemotherapy, the pCR rate was only 5.3%.1 The definition of pCR was different among these three studies (Table 3). In NSABP-B27 study, pCR was defined as no invasive tumor only in the primary breast site but residual tumor in regional lymph node was allowed.6 In GeparTrio trial, pCR was defined as no microscopic evidence of viable tumor (invasive and non invasive) in all resected specimens including breast and regional lymph nodes.4 In our study, pCR was defined as absence of invasive tumor in both breast and lymph nodes but in situ cancer can be present. If only NSABP-B27 criteria is used for a direct comparison, the pCR rate of NSABP-B27, GeparTrio and our study would be 26%, 30.6% and 30% respectively. In our study, one patient who achieved pCR was not included in the analysis because she had a history of thyroid cancer. Taking account of this patient, the pCR rate would be even higher in our study.\n\nThe patient characteristics were different among NSABP-B27, GeparTrio and our study. There were more patients with advanced disease in our study. When there was no nodal involvement, only patients with primary tumor ≥ 3 cm in diameter were eligible. More than 80% of patients had biopsy proved nodal disease. The NSABP-27 trial included 14% patients with tumors ≤ 2 cm and 70% of node negative disease.6 The GeparTrio trial included patients with T1 disease and 47% of the patients had no nodal involvement (N0)4. This study had a slightly lower percentage of hormone receptor positive patients and less HER2+ patients (Table 3). In NSABP-27 and GeparTrio trial, no patients received trastuzumab therapy. At the time when this trial was designed and implemented, neoadjuvant trastuzumab therapy was not standard of care. All HER2+ patients then received one-year adjuvant trastuzumab treatment. The anti-HER2 therapy was given postoperatively, it thus might improve RFS and OS but should not affect pCR rate. The lower proportion of HER2+ patients in this study should not contribute to a higher pCR rate. Conversely, patients with HER2+ tumors are often accompanied with topoisomerase-II amplification and are more sensitive to docetaxel-based 7 and anthracycline-based therapy.8,9 Two studies have found that the overexpression of HER2 is associated with a higher pCR rate.10,11 Taken together, even our study had more patients with advanced disease, a comparable pCR rate was obtained. This supports that TEC regimen is a very effective neoadjuvant chemotherapy regimen.\n\nThe total planned dose of chemotherapy in this study is slightly higher than of NSABP-B27 and GeparTrio (Table 4). Nevertheless, a high completion rate was achieved. Only one patient did not complete the full course of treatment. In NSABP-B27 trial, 5.5% of patients did not start docetaxel and in total, 21.2% of patients did not complete the full four course of AC and four course of docetaxel. In our study, 99.2% of chemotherapy was actually administered compared to that of 92.2% in GeparTrio trial. It is worthwhile to note that there were more elderly patients in our study. The percentage of patients who are 60 years of age was 30% in our study, compared to 9.5% in GeparTrio4 and 13.9% in NSABP-B27.6 The main grade 3-4 toxicity of TEC regimen was neutropenia. Its incidence was slightly lower than that in GeparTrio trial, 35% vs. 42.1%4 but higher than that of 8.6% in NSABP-B27 study.4,6 The incidence of febrile neutropenia in our study was, however higher than GeparTrio trial, 15% vs. 7.4%.4 In NSABP-B27 study, 7.3% of patients had febrile neutropenia while receiving AC but 21.2% patients developed febrile neutropenia while receiving docetaxel.6 (Table 4) There were more grade 3 peripheral neuropathy in our study than GeparTrio and NSABP-B27 study, 15% vs. 1.3%4 vs. 2.3%.4,6 Therefore the TEC regimen should be used cautiously for patients with preexisting peripheral neuropathy or patients with high risk to develop neuropathy, such as those with long-term diabetes.\n\nIn summary, our single-institution phase II study demonstrated that TEC regimen is an efficacious and well-tolerated neoadjuvant regimen for patients with locally advanced breast cancer. Future research interest in neoadjuvant chemotherapy in locally advanced breast cancer should be the focus of using genetic profiling such as Oncotype Dx in selecting patients to receive neoadjuvant chemotherapy treatment.\n\nFigure 1 Relapse-Free Survival\n\nFigure 2 Overall survival\n\nTable 1 Baseline clinical characteristics of the study population (N=20)\n\nCharacteristic\tNo.\t\nAge, years\t\t\nMean\t51\t\nrange\t29-70\t\nMenopausal status\t\t\npremenopausal\t8\t\npostmenopausal\t12\t\nClinical stage\t\t\nT2\t12\t\nT3\t7\t\nT4\t1\t\nClinical nodal status\t\t\nN0\t4\t\nN1\t13\t\nN2\t3\t\nScarf-Bloom-Richardson tumor grade\t\t\nI\t3\t\nII\t9\t\nIII\t8\t\nTumor hormone receptor status\t\t\nPositive\t10\t\nnegative\t10\t\nTumor HER2 receptor status\t\t\npositive\t4\t\nnegative\t16\t\nTable 2 Selected Adverse Events on 119 Cycles of Chemotherapy (%, any grade 3/4 or >3 events for grade 1/2)\n\nEvents\tGrade 1/2\tGrade 3\tGrade 4\t\nnausea/vomiting\t70\t\t\t\nconstipation\t55\t\t\t\ndiarrhea\t40\t10\t\t\nmucositis\t35\t\t\t\nanorexia\t30\t\t\t\nabdominal pain\t30\t\t\t\ndyspepsia\t30\t\t\t\nfatigue\t85\t\t\t\nmylgia\t25\t5\t\t\nBone pain\t30\t\t\t\nChest pain\t5\t5\t\t\nHot flash\t45\t5\t\t\nPort insertion site reaction\t15\t5\t\t\nalopecia\t60\t\t\t\nCutaneous reaction\t40\t\t\t\nsyncope\t\t15\t\t\ndizziness\t20\t\t\t\nheadache\t20\t5\t\t\nPeripheral neuropathy\t15\t15\t\t\nEye irritation\t35\t\t\t\nTaste change\t20\t\t\t\nRunny nose\t35\t\t\t\ninsomnia\t35\t\t\t\nMood change\t15\t10\t\t\nYeast infection\t30\t\t\t\nSinusitis/URI\t35\t\t\t\nUTI\t20\t\t\t\ngastroenteritis\t\t10\t\t\ndehydration\t\t10\t\t\nhyperglycemia\t10\t5\t\t\nedema\t20\t\t\t\nneutropenia\t10\t10\t25\t\nlymphopenia\t5\t10\t5\t\nFebrile neutropenia\t\t15\t\t\nanemia\t70\t\t\t\nTable 3 Comparison of patient characteristics, design and pCR rate among NSABP-B27, GeparTrio and our study TEC\n\nTrial\tNode positive \tHormone receptor negative\tHER2 receptor positive\tPlaned chemotherapy\tReported pCR\tCorrected pCR*\t\nNSABP-B27\t30.3%\t38.4%**\tunknown\tAll patients were given 8 cycles\t26%\t26%\t\nGepar Trio\t53%\t40.1%\t38.1%\tOnly those with tumor size >50% reduction had 6 cycles\t21%\t30.6%\t\nTEC\t80%\t50%\t20%\tAll patients were given 6 cycles\t25%\t30%\t\npCR: pathological complete response\n\n* NSABP-B27 pCR criteria: no invasive disease in the primary tumor was used in all three studies for a comparison.\n\n** 61.8% of patients have unknown hormone receptor status. For the patients with hormone receptor examined, 38.4% have negative hormone receptors.\n\nTable 4 Comparison of total planned chemotherapy dosage, completion rate, neutropenia among NSABP-B27, GeparTrio and our study TEC\n\n\tTotal chemotherapy dosage (mg)\tCompletion rate\tGrade 3-4 neutropenia\tFebrile neutropenia\t\nTrial\tDocetaxel\tAnthracycline\tCyclophosphamide\t\t\t\t\nNSABP-B27\t400\tDoxorubicin 240\t2,400\tunknown\t8.6%\tAC 7.3%\nT 21.2%\t\nGepar Trio\t450\tDoxorubicin 300\t3,000\t92.2%\t42.1%\t7.4%\t\nTEC\t450\tEpirubicin 450\t3,600\t99.2%\t35%\t15%\n==== Refs\n1 von Minckwitz G Kummel S Vogel P Neoadjuvant vinorelbine-capecitabine versus docetaxel-doxorubicin-cyclophosphamide in early nonresponsive breast cancer: phase III randomized GeparTrio trial J Natl Cancer Inst 2008 100 542 551 18398097 \n2 Rastogi P Anderson SJ Bear HD Preoperative chemotherapy: updates of National Surgical Adjuvant Breast and Bowel Project Protocols B-18 and B-27 J Clin Oncol 2008 26 778 785 18258986 \n3 Green MC Buzdar AU Smith T Weekly paclitaxel improves pathologic complete remission in operable breast cancer when compared with paclitaxel once every 3 weeks J Clin Oncol 2005 23 5983 5992 16087943 \n4 von Minckwitz G Kummel S Vogel P Intensified neoadjuvant chemotherapy in early-responding breast cancer: phase III randomized GeparTrio study J Natl Cancer Inst 2008 100 552 562 18398094 \n5 Vogt UKD Brandt B Bosse U Bonk U Assen AVD Muhs HJ Schlotter CM Semi-quantitative gene expression profiling for therapy prediction in a breast cancer neoadjuvant therpay applying docetaxel/epirubicin/cyclophosphamide ASCO Annual Meeting Proceedings 2007 25 18S 21144 \n6 Bear HD Anderson S Brown A The effect on tumor response of adding sequential preoperative docetaxel to preoperative doxorubicin and cyclophosphamide: preliminary results from National Surgical Adjuvant Breast and Bowel Project Protocol B-27 J Clin Oncol 2003 21 4165 4174 14559892 \n7 Martin M Pienkowski T Mackey J Adjuvant docetaxel for node-positive breast cancer N Engl J Med 2005 352 2302 2313 15930421 \n8 Buzdar AU Topoisomerase IIalpha gene amplification and response to anthracycline-containing adjuvant chemotherapy in breast cancer J Clin Oncol 2006 24 2409 2411 16682721 \n9 Di Leo A Isola J Topoisomerase II alpha as a marker predicting the efficacy of anthracyclines in breast cancer: are we at the end of the beginning? Clin Breast Cancer 2003 4 179 186 14499010 \n10 Toi M Nakamura S Kuroi K Phase II study of preoperative sequential FEC and docetaxel predicts of pathological response and disease free survival Breast Cancer Res Treat 2008 110 531 539 17879158 \n11 Rody A Karn T Gatje R Gene expression profiling of breast cancer patients treated with docetaxel, doxorubicin, and cyclophosphamide within the GEPARTRIO trial: HER-2, but not topoisomerase II alpha and microtubule-associated protein tau, is highly predictive of tumor response Breast 2007 16 86 93 17010609\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "1837-9664", "issue": "3()", "journal": "Journal of Cancer", "keywords": "Breast Cancer; Cyclophosphamide; Docetaxel; Epirubicin; Locally Advanced; Neoadjuvant Chemotherapy", "medline_ta": "J Cancer", "mesh_terms": null, "nlm_unique_id": "101535920", "other_id": null, "pages": "145-51", "pmc": null, "pmid": "22481980", "pubdate": "2012", "publication_types": "D016428:Journal Article", "references": "15930421;17879158;16087943;18398097;14559892;18258986;18398094;14499010;17010609;16682721", "title": "A Phase II Study of Concurrent Docetaxel, Epirubicin and Cyclophosphamide as a Neoadjuvant Chemotherapy Regimen in Patients with Locally Advanced Breast Cancer.", "title_normalized": "a phase ii study of concurrent docetaxel epirubicin and cyclophosphamide as a neoadjuvant chemotherapy regimen in patients with locally advanced breast cancer" }
[ { "companynumb": "US-AMGEN-USASP2020163022", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "PEGFILGRASTIM" }, "drugadditional": null, ...
{ "abstract": "Mycophenolate mofetil (MMF) is a widely used immunosuppressive agent. MMF hepatotoxicity has been reported in non-transplant and renal transplant patients with minimal histologic description. This is the first study describing detailed histology and ultrastructure of MMF hepatotoxicity.\n\n\n\nFour liver-transplant recipients (Cases 1-4) were suspected to have MMF hepatotoxicity. Cases 1-3 (two females and one male; 4-17 years) had multiple biopsies for liver function test (LFT) abnormalities. Case 4 (female; 16 years) had a surveillance biopsy. Electron-microscopic examination (EM) was requested on Cases 1-3 for unexplained, persistent LFT elevation and histologic abnormalities despite therapy and Case 4 for unexplained histologic abnormalities despite a stable clinical course. To confirm the pathologic changes in the human allografts, livers from MMF-treated and untreated mice were also reviewed.\n\n\n\nWhile the allograft biopsies showed nonspecific histologic changes, EM revealed unequivocal mitochondrial abnormalities similar to those seen in primary and secondary mitochondrial disorders. In Cases 1 and 2, LFTs improved after stopping and reducing MMF, respectively. In Case 3, pre- and post-MMF treatment biopsies were performed and only the post-MMF biopsy demonstrated mitochondrial abnormalities. Mitochondrial abnormality in Case 4 was subclinical. The mouse study confirmed that MMF caused various stress changes in the mitochondria; number of mitochondria/cell (mean ± standard deviation; untreated group: 58.25 ± 8.426; MMF-treated group: 76.37 ± 18.66), number of lipid droplets/cell (untreated: 0.9691 ± 1.150; MMF-treated: 3.649 ± 4.143) and sizes of mitochondria (μm, untreated: 0.8550 ± 0.3409; MMF-treated: 0.9598 ± 0.5312) were significantly increased in hepatocytes in the MMF-treated mice compared with the untreated mice (P < 0.0001).\n\n\n\nAlthough MMF is safe for the majority of patients, MMF can cause mitochondrial stress, which may trigger more severe mitochondrial abnormalities in a small subset. MMF hepatotoxicity should be considered for MMF-treated patients with unexplained, persistent LFT abnormalities and nonspecific histologic findings. EM should be requested for these cases.", "affiliations": "Department of Pathology and Laboratory Medicine.;Division of Gastroenterology, and Nutrition, Children's Hospital Los Angeles, University of Southern California Keck School of Medicine, Los Angeles, CA.;Division of Gastroenterology, and Nutrition, Children's Hospital Los Angeles, University of Southern California Keck School of Medicine, Los Angeles, CA.;Division of Hematology and Oncology, Department of Internal Medicine, University of Cincinnati College of Medicine, Cincinnati, OH.;Division of Hematology and Oncology, Department of Internal Medicine, University of Cincinnati College of Medicine, Cincinnati, OH.;Division of Gastroenterology, and Nutrition, Children's Hospital Los Angeles, University of Southern California Keck School of Medicine, Los Angeles, CA.", "authors": "Warren|Mikako|M|;Mitsinikos|Tania|T|;Yanni|George|G|;Sasaki|Mika|M|;Sasaki|Atsuo T|AT|;Thomas|Dan|D|", "chemical_list": "D007166:Immunosuppressive Agents; D009173:Mycophenolic Acid", "country": "United States", "delete": false, "doi": "10.1097/MPG.0000000000003171", "fulltext": null, "fulltext_license": null, "issn_linking": "0277-2116", "issue": "73(4)", "journal": "Journal of pediatric gastroenterology and nutrition", "keywords": null, "medline_ta": "J Pediatr Gastroenterol Nutr", "mesh_terms": "D000818:Animals; D056486:Chemical and Drug Induced Liver Injury; D005260:Female; D006084:Graft Rejection; D006801:Humans; D007166:Immunosuppressive Agents; D016031:Liver Transplantation; D008297:Male; D051379:Mice; D008928:Mitochondria; D009173:Mycophenolic Acid", "nlm_unique_id": "8211545", "other_id": null, "pages": "463-470", "pmc": null, "pmid": "34016874", "pubdate": "2021-10-01", "publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural", "references": null, "title": "Mycophenolate Mofetil Hepatotoxicity Associated With Mitochondrial Abnormality in Liver Transplant Recipients and Mice.", "title_normalized": "mycophenolate mofetil hepatotoxicity associated with mitochondrial abnormality in liver transplant recipients and mice" }
[ { "companynumb": "US-ACCORD-227237", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "MYCOPHENOLIC ACID" }, "drugadditional": "1", ...
{ "abstract": "Genomes of metastatic pancreatic cancers frequently contain intrachromosomal aberrations, indicating a DNA repair deficiency associated with sensitivity to DNA damaging agents, such as platinum.\nTo determine response rate following treatment with nab-paclitaxel plus gemcitabine plus platinum-based cisplatin for patients with metastatic pancreatic ductal adenocarcinoma (PDA).\nThis was a single-arm, open-label, phase 1b/2 clinical trial of nab-paclitaxel plus gemcitabine plus cisplatin treatment in which 25 patients with previously untreated metastatic PDA were enrolled. The trial was conducted from December 2013 to July 2016 at 3 US sites, with the last patient receiving study treatment at the end of October 2016, and the study closing January 2018.\nPatients were treated with nab-paclitaxel plus gemcitabine plus various doses of cisplatin, 25 mg/m2, 37.5 mg/m2, and 50 mg/m2, on days 1 and 8 of a 21-day cycle.\nPrimary end point was complete response rate as assessed by Response Evaluation Criteria in Solid Tumors, version 1.1 (RECIST), and levels of carbohydrate antigen 19-9 (or in nonexpressers, carbohydrate antigen 125 or carcinoembryonic antigen). Efficacy analysis included evaluable patients (those who received at least 1 dose of study treatment and had at least 1 postbaseline tumor assessment).\nOf 25 patients enrolled in the study, the median (range) age was 65.0 (47.0-79.0) years, 14 (56%) were men, and most (24) were white (96%). The maximum tolerable dose of cisplatin was 25 mg/m2. The most common treatment-related adverse events grade 3 or higher were thrombocytopenia (17 patients [68%]), anemia (8 patients [32%]), and neutropenia (6 patients [24%]). Fatal events occurred for 3 patients (12%); 2 were related to study participation. A median (range) of 8 (1-15) cycles was completed. The RECIST responses in 24 evaluable patients included 2 complete responses (8%), which was below the primary end point of 25%, 15 partial responses (62%), 4 stable disease (17%), and 3 progressive disease (12%), with median overall survival of 16.4 (95% CI, 10.2-25.3) months; 16 patients (64%) were alive at 1 year, 10 (40%) at 2 years, 4 (16%) at 3 years, and 1 (4%) at 4 plus years. Overall survival ranged from 36 to 59 months. Median progression-free survival was 10.1 (95% CI, 6.0-12.5) months. Thus, the overall response rate was 71%, and the disease control rate was 88%.\nThis triple drug regimen showed substantial clinical activity in this small study. Although the primary end point was not reached, the high overall response rate, disease control rate, and median survival time among patients with advanced PDA treated with this combination are encouraging. The regimen is being studied in patients with PDA in the neoadjuvant setting and in patients with advanced biliary cancers.\nClinicalTrials.gov identifier: NCT01893801.", "affiliations": "HonorHealth Research Institute, Scottsdale, Arizona.;HonorHealth Research Institute, Scottsdale, Arizona.;Translational Genomics Research Institute, an Affiliate of City of Hope, Phoenix, Arizona.;Rutgers Cancer Institute of New Jersey, New Brunswick.;Vita Medical Associates, Bethlehem, Pennsylvania.;HonorHealth Research Institute, Scottsdale, Arizona.;Mayo Clinic, Scottsdale, Arizona.;Cancer Research And Biostatistics, Seattle, Washington.;Cancer Research And Biostatistics, Seattle, Washington.;Cancer Research And Biostatistics, Seattle, Washington.;Cancer Research And Biostatistics, Seattle, Washington.;Imaging Endpoints, Scottsdale, Arizona.;HonorHealth Research Institute, Scottsdale, Arizona.;HonorHealth Research Institute, Scottsdale, Arizona.;Mayo Clinic, Scottsdale, Arizona.;HonorHealth Research Institute, Scottsdale, Arizona.", "authors": "Jameson|Gayle S|GS|;Borazanci|Erkut|E|;Babiker|Hani M|HM|;Poplin|Elizabeth|E|;Niewiarowska|Anna A|AA|;Gordon|Michael S|MS|;Barrett|Michael T|MT|;Rosenthal|Adam|A|;Stoll-D'Astice|Amy|A|;Crowley|John|J|;Shemanski|Lynn|L|;Korn|Ron L|RL|;Ansaldo|Karen|K|;Lebron|Leticia|L|;Ramanathan|Ramesh K|RK|;Von Hoff|Daniel D|DD|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1001/jamaoncol.2019.3394", "fulltext": null, "fulltext_license": null, "issn_linking": "2374-2437", "issue": null, "journal": "JAMA oncology", "keywords": null, "medline_ta": "JAMA Oncol", "mesh_terms": null, "nlm_unique_id": "101652861", "other_id": null, "pages": null, "pmc": null, "pmid": "31580386", "pubdate": "2019-10-03", "publication_types": "D016428:Journal Article", "references": "19097774;21969517;30998813;29313949;21561347;25719666;26802160;23071490;24141714;27404453;24131140;30220407;28720843", "title": "Response Rate Following Albumin-Bound Paclitaxel Plus Gemcitabine Plus Cisplatin Treatment Among Patients With Advanced Pancreatic Cancer: A Phase 1b/2 Pilot Clinical Trial.", "title_normalized": "response rate following albumin bound paclitaxel plus gemcitabine plus cisplatin treatment among patients with advanced pancreatic cancer a phase 1b 2 pilot clinical trial" }
[ { "companynumb": "US-MYLANLABS-2020M1026698", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "CISPLATIN" }, "drugadditional": null, ...
{ "abstract": "Background: In the era of precision medicine, cancer treatment is increasingly tailored according to tumor-specific genomic alterations. The analysis of tumor-derived circulating nucleic acids in cerebrospinal fluid (CSF) by next generation sequencing (NGS) may facilitate precision medicine in the field of CNS cancer. We therefore evaluated whether NGS from CSF of neuro-oncologic patients reliably detects tumor-specific genomic alterations and whether this may help to guide the management of patients with CNS cancer in clinical practice. Patient and methods: CSF samples from 27 patients with various primary and secondary CNS malignancies were collected and evaluated by NGS using a targeted, amplicon-based NGS-panel (Oncomine Focus Assay). All cases were discussed within the framework of a molecular tumor board at the Comprehensive Cancer Center Munich. Results: NGS was technically successful in 23/27 patients (85%). Genomic alterations were detectable in 20/27 patients (74%), 11/27 (40%) of which were potentially actionable. After discussion in the MTB, a change of therapeutic management was recommended in 7/27 (26%) of the cases. However, due to rapid clinical progression, only 4/27 (15%) of the patients were treated according to the recommendation. In a subset of patients (6/27, 22%), a high number of mutations of unknown significance suggestive of a high tumor mutational burden (TMB) were detected. Conclusions: NGS from cerebrospinal fluid is feasible in routine clinical practice and yields therapeutically relevant alterations in a large subset of patients. Integration of this approach into a precision cancer medicine program might help to improve therapeutic options for patients with CNS cancer.", "affiliations": "Department of Neurology, LMU Munich, Munich, Germany.;Institute of Pathology, LMU Munich, Munich, Germany.;Institute of Pathology, LMU Munich, Munich, Germany.;German Cancer Consortium (DKTK), Heidelberg, Germany.;Department of Medicine III, University Hospital, LMU Munich, Munich, Germany.;Institute of Pathology, LMU Munich, Munich, Germany.;German Cancer Consortium (DKTK), Heidelberg, Germany.;German Cancer Consortium (DKTK), Heidelberg, Germany.;German Cancer Consortium (DKTK), Heidelberg, Germany.;German Cancer Consortium (DKTK), Heidelberg, Germany.;Department of Neurology, LMU Munich, Munich, Germany.;German Cancer Consortium (DKTK), Heidelberg, Germany.;German Cancer Consortium (DKTK), Heidelberg, Germany.;Institute of Pathology, LMU Munich, Munich, Germany.;German Cancer Consortium (DKTK), Heidelberg, Germany.", "authors": "von Baumgarten|Louisa|L|;Kumbrink|Jörg|J|;Jung|Andreas|A|;Reischer|Anna|A|;Flach|Madeleine|M|;Liebmann|Sibylle|S|;Metzeler|Klaus H|KH|;Holch|Julian W|JW|;Niyazi|Maximilian|M|;Thon|Niklas|N|;Straube|Andreas|A|;von Bergwelt-Baildon|Michael|M|;Heinemann|Volker|V|;Kirchner|Thomas|T|;Westphalen|Christoph Benedikt|CB|", "chemical_list": "D014408:Biomarkers, Tumor", "country": "Australia", "delete": false, "doi": "10.7150/thno.36884", "fulltext": "\n==== Front\nTheranosticsTheranosticsthnoTheranostics1838-7640Ivyspring International Publisher Sydney 10.7150/thno.36884thnov10p0856Research PaperTherapeutic management of neuro-oncologic patients - potential relevance of CSF liquid biopsy von Baumgarten Louisa 1✉Kumbrink Jörg 23Jung Andreas 23Reischer Anna 34Flach Madeleine 456Liebmann Sibylle 2Metzeler Klaus H. 345Holch Julian W. 345Niyazi Maximilian 35Thon Niklas 36Straube Andreas 1von Bergwelt-Baildon Michael 345Heinemann Volker 345Kirchner Thomas 23Westphalen Christoph Benedikt 345✉1 Department of Neurology, LMU Munich, Munich, Germany;2 Institute of Pathology, LMU Munich, Munich, Germany;3 German Cancer Consortium (DKTK), Heidelberg, Germany;4 Department of Medicine III, University Hospital, LMU Munich, Munich, Germany;5 Comprehensive Cancer Center Munich, University Hospital, LMU Munich, Munich, Germany;6 Department of Radiation Oncology, University Hospital, LMU Munich, Munich, Germany;7 Department of Neurosurgery, LMU Munich, Munich, Germany.✉ Corresponding author: Dr. C. Benedikt Westphalen, Klinikum der Universität München, Medizinische Klinik III, Marchioninistrasse 15, 81377 München, Germany Email: christoph_benedikt.westphalen@med.uni-muenchen.de; PD Dr. Louisa von Baumgarten, Klinikum der Universität München, Neurologische Klinik, Marchioninistrasse 15, 81377 München, Germany Email: louisa.vonBaumgarten@med.uni-muenchen.deCompeting Interests: LB, JK, AJ, AR, MF, SL, KHM, JWH, MN, NT, AS, MVB, TK, VH and CBW report no conflict of interest.\n\n2020 1 1 2020 10 2 856 866 21 5 2019 8 9 2019 © The author(s)2020This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions.Background: In the era of precision medicine, cancer treatment is increasingly tailored according to tumor-specific genomic alterations. The analysis of tumor-derived circulating nucleic acids in cerebrospinal fluid (CSF) by next generation sequencing (NGS) may facilitate precision medicine in the field of CNS cancer. We therefore evaluated whether NGS from CSF of neuro-oncologic patients reliably detects tumor-specific genomic alterations and whether this may help to guide the management of patients with CNS cancer in clinical practice.\n\nPatient and methods: CSF samples from 27 patients with various primary and secondary CNS malignancies were collected and evaluated by NGS using a targeted, amplicon-based NGS-panel (Oncomine Focus Assay). All cases were discussed within the framework of a molecular tumor board at the Comprehensive Cancer Center Munich.\n\nResults: NGS was technically successful in 23/27 patients (85%). Genomic alterations were detectable in 20/27 patients (74%), 11/27 (40%) of which were potentially actionable. After discussion in the MTB, a change of therapeutic management was recommended in 7/27 (26%) of the cases. However, due to rapid clinical progression, only 4/27 (15%) of the patients were treated according to the recommendation. In a subset of patients (6/27, 22%), a high number of mutations of unknown significance suggestive of a high tumor mutational burden (TMB) were detected.\n\nConclusions: NGS from cerebrospinal fluid is feasible in routine clinical practice and yields therapeutically relevant alterations in a large subset of patients. Integration of this approach into a precision cancer medicine program might help to improve therapeutic options for patients with CNS cancer.\n\nNext Generation Sequencing (NGS)CNS CancerCSFcfDNAliquid biopsy.\n==== Body\nIntroduction\nPrimary and secondary brain tumors still have a dismal prognosis. Due to the blood brain barrier, systemic chemotherapy is thought to have limited CNS penetration. Thus, therapeutic interventions often have to include surgical and radiotherapeutic approaches or, in the case of leptomeningeal tumor spread, the intrathecal delivery of cytotoxic agents1-3. Precision medicine and the use of targeted therapies, which are tailored to match individual tumor-driving mutations, have led to relevant changes of standard clinical care in patients with systemic cancer and have significantly improved outcomes for patients with different types of cancer such as melanoma4 and lung carcinoma 5.\n\nNumerous clinical trials have shown that targeted therapies and immunotherapeutic agents can penetrate the blood-brain barrier and produce clinically meaningful intracranial response rates. Examples include EGFR and ALK inhibitors in non-small cell lung cancer, BRAF inhibitors in melanoma, HER2-targeting agents in breast cancer, and immune checkpoint inhibitors of CTLA4 or PDL1 in melanoma or non-small cell lung cancer 6-10. Therefore, the ability to analyze tumor genomics and monitor tumor evolution in patients with CNS malignancies has the potential to improve outcomes in patients with CNS cancer as well.\n\nSo far, molecular information of CNS cancer is usually obtained from tissue samples harvested by open resection or minimally invasive stereotactic biopsies. These invasive procedures may bear a considerable risk (e.g. due to tumor location in highly eloquent locations). Furthermore, repetitive tumor sampling over time may not be feasible.\n\nAn alternative is NGS (next generation sequencing) based analysis of cell-free total nucleic acids (cfTNA) in “liquid biopsies”. cfTNA comprises nucleic acid (NA) fragments (DNA and RNA) released from cells into the peripheral blood during apoptosis and necrosis. Within the cfTNA a small fraction of tumor-derived cfTNA, called circulating tumor TNA (ctTNA), shed from tumor cells is present, which can be analyzed for genetic alterations.\n\n“Liquid biopsy” or the mutational analysis of ctTNA in accessible body fluids by targeted next generation sequencing (NGS) is commonly applied in patients with systemic cancer and the resulting comprehensive genomic information can give patients access to targeted therapies 11. ctTNA can also be detected in the peripheral blood of a fraction of patients with primary and secondary CNS malignancies12, 13. However, its detection rate is relatively low compared to that in patients with systemic cancer 14-17. The paucity of ctTNA in the peripheral circulation in CNS cancer is most likely related to the blood-brain barrier, which prevents the efflux of cfTNA from the CNS. Therefore, CSF is a potentially attractive sampling source. Several smaller studies collected CSF and identified cfDNA of primary and metastatic brain tumors using different techniques 18-20. cfTNA could be detected in an NGS approach in the CSF of up to 50-74% of the patients with primary brain tumors18, 21 and in 63% of the patients with CNS metastasis, but not in patients without CNS involvement by cancer19. In line with this, peripheral ctDNA levels in patients with cerebral metastasis of solid tumors were lower than those detected in the CSF, except for patients with significant systemic disease burden. Furthermore, CSF cfTNA better represents the genomic alterations found in brain metastasis than plasma ctTNA20. Therefore, in the context of CNS-related cancers, cfDNA analysis from CSF may represent a powerful tool leading to more promising diagnostic yield than from peripheral blood.\n\nIn our study, we investigated the feasibility of analyzing the ctDNA and ctRNA within the CSF of patients with CNS cancer. Therefore, an amplicon-based NGS assay was applied that targets not only point mutations and deletions but also therapeutically relevant amplifications and gene fusions to facilitate access to targeted therapies within the framework of an interdisciplinary molecular tumor board.\n\nMaterial and Methods\nCSF collection and sample processing\nBetween December 2016 and May 2018, we collected CSF samples from 27 patients with cancer who underwent lumbar puncture as part of their routine clinical management. All patients signed informed consent for the analysis of their clinical data within a broad prospective registry conducted at Clinical Cancer Center of the Ludwig Maximilian University Munich (“The informative patient”), which was approved by the local ethics committee according to the Declaration of Helsinki. All patients were discussed in an interdisciplinary tumor board before and after molecular testing, had a clinical indication for molecular testing, and were informed about the purpose of the molecular analysis by the treating physician. CSF samples were collected in 10-ml Cell-Free DNA BCT blood collection tubes (Streck, La Vista, NE, USA) to prevent the release of genomic DNA from cells within the sample and the absorption of cell-free (CF) nucleic acids (NA).\n\nCell-free nucleic acid isolation\nCSF nucleic acids were isolated from 1.5-6 ml CSF (median 3 ml) using the QIAmp Circulating Nucleic Acid Kit (Qiagen, Valencia, CA, USA) according to manufacturer's instructions and quantified with a Qubit 3TM Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA).\n\nPanel sequencing\nGenomic profiling of samples by targeted NGS was performed by using a commercially available assay (Oncomine™ Focus Assay, Thermo Fisher Scientific) covering 30 kb of coding DNA on an Ion Torrent Personal Genome MachineTM (PGM), as described previously22. Briefly, the OncomineTM Focus Assay (OFA) is a multi-biomarker NGS system that enables the detection of variants in 52 key solid tumor genes (see Supplementary Table 1). These genes are well-characterized in the published literature and can partly be therapeutically addressed by targeted FDA approved agents, part of National Comprehensive Cancer Network (NCCN) guidelines, or in clinical trials. The OFA allows concurrent analysis of DNA and RNA to simultaneously detect single nucleotide variants (SNVs) and insertions/deletions (indels) in mutation hotspots as well as copy number variations (CNVs) and gene fusions 22.\n\ncDNA synthesis, library preparation, equalizer PCR, usage of the IonChef™ pipetting station, and Ion PGMTM Chip loading was performed according to the manufacturer's instructions. Briefly, the Invitrogen™ SuperScript™ VILO™ cDNA Synthesis Kit (Thermo Fisher Scientific) was used for reverse transcription prior to library preparation for the RNA panel. 20 ng DNA and 100 ng RNA were used for library generation utilizing the OFA, Select Library kit (Thermo Fisher Scientific). The Ion AmpliSeq™ Sample ID Panel (Thermo Fisher Scientific) was added to the library-generating PCR reaction for proper sample identification. The libraries were equalized with the Ion Library Equalizer™ Kit. Next, a maximum of 6 libraries (6 DNA and 6 RNA) were transferred to the IonChef™ pipetting station for library enrichment and subsequent Ion-318™ Chip loading (Ion PGM™ Hi-Q™ View Chef Kit, Thermo Fisher Scientific). Prepared chips were loaded into the IonTorrent PGM™.\n\nData analysis was performed with the dedicated software provided by the manufacturer, the Integrated Genomics Viewer (IGV, Broad Institute), and a proprietary database calling tool for the identification of single nucleotide polymorphisms (SNPs) and the tumor genetic evaluation of the identified alterations (Supplementary Fig. S1). Sequencing data were aligned to the human reference genome hg19 using Torrent Suite™ (ver. 5.2). Analysis, filtering, and annotation of variants were carried out with Ion Reporter™ (ver. 5.2). An automatic workflow (Oncomine Focus v2.1) with preconfigured parameter settings (Oncomine Variants 3% CI SCNV ploidy ≥ gain of 2 over normal) was used. The following sequencing quality metrics were used to determine the success of the analysis: 1) DNA: average base coverage depth ≥1000; 2) DNA: amplicons having at least 100 reads: ≥90%; 3) RNA (gene fusions): total Mapped Fusion Panel Reads ≥10000 4) RNA: all 5 expression controls were expressed. DNA alterations with a total coverage ≥200 reads and allelic frequencies >3% or gene fusions detected by RNA analysis ≥20 reads were considered positive. All candidate mutations were further reviewed using the IGV.\n\nOne sample (#6, Ewing sarcoma) was additionally analyzed with the Archer® FusionPlex® Sarcoma system (ArcherDX, Inc., Boulder, CO, USA) on an Ion Torrent PGMTM platform for sarcoma-specific gene fusions not present in the OFA panel. The Archer Sarcoma kit is a targeted sequencing assay to simultaneously detect and identify fusions of 26 genes associated with soft tissue cancers (Supplementary Table 1). The library preparation was executed as described in the vendor's manual using 250 ng RNA. The final library concentration was measured with an ExperionTM bioanalyzer (Biorad, Hercules, CA, USA). The analysis was performed with the Archer Analysis 5.1 site using Archer Comprehensive Targets v1.1, FusionPlex Sarcoma AK0032 v1.0 and the default quality metrics recommended by the manufacturer. CSF of three lung cancer patients (#1, #4 and #27) whose cancer progressed under tyrosine kinase inhibitor (TKI) treatment were analyzed for TKI resistance mutations in the EGFR gene (T790M mutation). Therefore, the smaller AmpliSeq Colon and Lung Cancer v2 DNA only panel (Thermo Fisher Scientific) containing 22 NSCLC related oncogenes and tumor suppressor genes (AKT1, ALK, BRAF, CTNNB1, DDR2, EGFR, ERBB2, ERBB4, FBX7, FGFR1, FGFR2, FGFR3, KRAS, MAP2K1, MET, NOTCH1, NRAS, PIK3CA, PTEN, SMAD4, STK11, TP53) was used in this situation.\n\nPotential actionability and molecular tumor board\nAn actionable alteration was defined as a characterized alteration that was either the direct target or a pathway component that could potentially be targeted by at least one FDA- and/or EMA-approved drug (in the same or another indication) or by an investigational drug in a clinical trial. Potential actionability was crosschecked by at least two investigators and mining of literature of actionable mutations and their clinical relevance was performed for each case (KHM, CBW, AJ, TK). All patients were discussed, and individual therapeutic recommendations were made within the framework of an interdisciplinary molecular tumor board, which is part of the “Molecular Diagnostics and Therapy” program at the Clinical Cancer Center of the Ludwig Maximilian University Munich.\n\nData extraction and analysis\nDemographic information, such as gender and age, as well as the clinical symptoms, laboratory testing, and results of neuroimaging, if available, were analyzed by review of the electronic medical chart. Furthermore, dates of sample collection, test results, list of actionable alterations data, and the result of the molecular tumor board were analyzed.\n\nData availability\nAnonymized data will be shared on request from any qualified investigator.\n\nResults\nPatient characteristics\nOverall, we included 27 patients in our analysis (Table 1). The median age was 58 years (range 22-82 years) and 16 patients were female. 23 patients had brain metastases from solid tumors. The most common primary tumors were breast (10/27, 37%) and non-small cell lung cancer (NSCLC) (8/27, 30%). Other tumor entities included colorectal cancer (CRC, 1/27), Ewing sarcoma (1/27), cholangiocellular carcinoma (CCC, 1/27), melanoma (1/27), and gastric cancer (1/27). Four patients suffered from primary brain tumors like glioblastoma (GBM, 2/27) and primary CNS lymphoma (PCNSL, 2/27).\n\nCytology revealed malignant cells in the CSF of 52% of the patients (14/27). MRI of the brain was indicative of leptomeningeal metastasis (LM) in 59% (16/27) and MRI of the spine in 44% (12/27) of the patients. Overall, 70% (19/27) of the patients had CSF and/or MRI positive for LM. 81% of the patients (22/27) had radiographic evidence for a parenchymal tumor manifestation in the brain or the spine.\n\n\nSequencing metrics\nWe isolated nucleic acids from 1.5-6 ml CSF (median: 3 ml). cfDNA and cfRNA could be isolated in all cases. cfDNA was used for the analysis of point mutations, insertions/deletions, and copy number variations. cfRNA was applied for the detection of gene fusions. NGS was successful in 23/27 (85.2%) of the patients. In 4 patients with low cfDNA content (median 0.5 ng/µl, range 0.4-2.5 ng/µl), the sequencing metrics (target base coverage at 100 reads: median: 75%, range: 71-78%) did not meet our quality standards and were excluded due to our strict quality thresholds. Sequencing metrics are summarized in Table 2 and Table 3.\n\nActionable genomic alterations detected in the cfTNA of CSF samples\nIn our patient cohort, somatic alterations were detected in 74% of the patients (20/27). Among patients with somatic alterations, we observed a median number of 3 (range 1-47) mutations in the Oncomine panel. 40% (11/27) of the patients carried potentially clinically actionable alterations which can principally be targeted by drugs already approved or currently in clinical trials. We found targetable alterations in the EGFR, BRAF, NTRK1, PIK3CA, MET, ROS1, and MTOR genes. cfTNA with somatic mutations was detected in 62% (5/8) of the patients with CNS cancer who had negative findings for LM in CSF cytology and MRI (Table 4).\n\nTherapeutic recommendation of the molecular tumor board (MTB) and clinical patient management\nAlthough 11/27 (40%) CSF-samples yielded potentially clinically actionable alterations, a change in the therapeutic management was recommended by the interdisciplinary MTB in 7/27 (26%) patients (Figure 2 and Table 4). In 4/27 patients (#22, #24, #25, #27) no targeted therapy was recommended although an actionable mutation was discovered: In one patient, several mutations were identified in overlapping pathways, potentially indicating resistance to respective targeted approaches (#22). In another patient (#24), tumor control and clinical stabilization after whole brain radiotherapy (WBRT) was achieved and an initially suspected LM could be ruled out. Therefore, targeted therapy was postponed until progression. One patient showed rapid and unforeseen clinical deterioration (#25) and, due to the relatively low allele frequency of the alterations found, the clinical benefit of a possible targeted approach for the tumor entity was deemed unlikely. One patient (#27) progressed on afatinib, suggesting an EGFR resistance mutation. NGS from CSF revealed the previously detected primary EGFR-mutation; however, neither the targetable T790M resistance mutation nor another relevant actionable mutation was detected. Furthermore, the patient showed rapid clinical deterioration and therefore received best supportive care.\n\nIn 7/27 patients with a recommended change of the therapeutic regimen, however only 4/27 (15%) of the patients could be treated according to the recommendations, as two patients showed unexpected clinical deterioration (#3, #7) and were treated with best supportive care and one patient (#17) refused further therapy.\n\nIn the following paragraph, we briefly summarize the therapeutic recommendations of the molecular tumor board.\n\nA 45-year-old male patient was referred to our hospital with headache and progressive cranial nerve palsy. Three weeks earlier, the patient had been diagnosed with non-small cell lung cancer (NSCLC) (adenocarcinoma of the lung, UICC stage IV, cT1, cN2, cM1b) with lymph node and bone metastases by tissue biopsy in an external hospital. Based on this diagnosis, one cycle of palliative platinum-based chemotherapy was initiated by the external physicians. Information on the molecular profile of the tumor was lacking. Lumbar puncture and MRI of brain and spine revealed LM and targeted NGS sequencing from the CSF identified an activating EGFR mutation (Exon 21) (see also #1, Table 4), which was later confirmed in the primary tumor biopsy by PCR as well. Systemic chemotherapy was discontinued and the treatment regimen was changed to erlotinib p.o. and intrathecal methotrexate. Under treatment, MRI revealed regression of the adherent LM. Cranial nerve palsy subsided. The systemic tumor load and non-adherent LM had been stable for 25 months when this manuscript was written (Figure 2).\n\nSimilarly, in a 58-year-old female patient (#4, Table 4) with newly diagnosed NSCLC (adenocarcinoma, UICC stage IV, cT2b, cN0, cM1c) with pulmonary, bone, brain, and leptomeningeal metastasis, systemic chemotherapy was switched to in-label afatinib in addition to intrathecal methotrexate injections after activating EGFR mutations (Exon 18, p.G719C; exon 20, p.S768I) were diagnosed by liquid CSF biopsy. Furthermore, she received whole brain radiotherapy (WBRT, 30 Gy, 3 Gy per fraction) due to a high cerebral metastatic burden. Further analysis revealed that the activating EGFR mutations were confirmed in the bone metastasis. However, the primary tumor did not contain EGFR exon 18 and 20 mutations but an activating EGFR exon 19 mutation (p.P753Q) which was observed in neither the CSF liquid biopsy nor in the bone metastasis. Under therapy, the patient showed a partial systemic and intracranial response for 5 months. Then she underwent stereotactic re-irradiation due to isolated intracranial progression. The systemic tumor load was stable and afatinib was continued. Eleven months after diagnosis, she showed a rapid systemic progression. After one cycle of pemetrexed the therapy was not continued due to her clinical deterioration and she succumbed to her disease under best supportive care 12 months after the initial diagnosis.\n\nA 66-year-old male patient with systemically controlled NSCLC was diagnosed with two progressing cortical cerebral metastases after WBRT (#15). NGS from CSF revealed an EZR/ROS1 fusion as well as an MTOR mutation. Due to the EZR/ROS1 fusion, an in-label therapy with a CNS-penetrating ROS-inhibitor (ceritinib, crizotinib) was recommended by the molecular tumor board. At the time of manuscript preparation the patient had received crizotinib for 6 months and had stable systemic and cerebral disease.\n\nA 62-year-old female patient with systemically controlled, metastasized (bone and lymph node), hormone receptor positive breast carcinoma was diagnosed with new cerebral metastases and adherent as well as non-adherent LM (#23). NGS from CSF revealed an amplification of the FGFR1 gene as well as an amplification of the MYC gene.\n\nDysregulation of FGFR signaling can lead to downstream activation of mitogen activated protein kinase (MAPK) and phosphoinositide-3-kinase (PI3K)/AKT pathways 23 and it has been shown, that patients with FGFR amplifications profit from PIK3CA/AKT directed therapy with everolimus 24. Furthermore, FGFR amplification may confer resistance to CDK4/6 inhibitors 25.\n\nThe molecular tumor board recommended an in-label therapy with everolimus in addition to systemic exemestane. Furthermore, the patient received WBRT (30 Gy) and intrathecal injections of methotrexate until CSF was cleared of atypical cells. Under the subsequent treatment with everolimus and exemestane the patient had been stable for 6 months when this manuscript was written.\n\nHowever, three patients did not receive the treatment that was recommended by the molecular tumor board (Figure 2).\n\nIn a 71-year-old male patient with peritoneal and abdominal metastasis of a cholangiocellular carcinoma (CCC) MRI revealed adherent spinal and cranial leptomeningeal metastasis. NGS from CSF detected a targetable BRAF mutation (p.V600E) as well as an activating ERBB2-mutation (#3, Table 4). The current literature (one basket study including one patient with CCC 26 as well as different case reports 27-29) corroborates the efficacy of BRAF-inhibiting monotherapy with vemurafenib and a combined BRAF- and MEK-inhibition in patients with CCC. In view of the additional ERBB2 mutation, which affects the RAS/RAF/MEK/ERK pathway 30, the tumor board recommended an off-label therapy with combined BRAF- and MEK-inhibition together with the intrathecal application of methotrexate. However, due to a rapid clinical deterioration, the patient refused further therapy and best supportive care was initiated.\n\nA 69-year-old female patient with bilateral hormone receptor positive breast carcinoma with bone metastasis of the skull and cutaneous tumor infiltration was diagnosed with non-adherent and adherent LM and novel brain metastasis (#7, Table 4). WBRI was refused by the patient but she was willing to undergo chemotherapy. NGS from CSF revealed a TPM3-NTRK1 fusion. Patients with NTRK-rearranged tumors have achieved robust and durable responses to treatment with TRK inhibitors in clinical trials 11, 30. Therefore, in addition to the intrathecal application of methotrexate, the molecular tumor board recommended treatment with entrectinib, preferentially within a clinical trial (NCT02568267: Basket Study of Entrectinib (RXDX-101) for the treatment of patients with solid tumors harboring NTRK1/2/3, ROS1 or ALK Rearrangements (Fusions), STARTRK-2). However, due to rapid clinical deterioration, the patient could not be included in the clinical trial.\n\nA 67-year-old female patient (#17 Table 4) with breast carcinoma was referred to our clinic with headache and acute, progressive paraparesis. CSF cytology was negative for atypical cells, but a PIK3CA mutation was found in the NGS analysis. MRI of the spine revealed contrast enhancement of the caudal spinal cord. cMRI was not possible due to a cochlea implant. The molecular tumor board recommended a therapy with everolimus. However, repetitive CSF punctures over the course of 8 weeks did not confirm LM and the symptoms did not progress further but instead improved slightly. Therefore, therapy was not initiated by the treating physician, which was in accordance with the patient's refusal to undergo further therapy. The patient was re-evaluated twice over a 9-month period without any evidence of clinical or radiological (MRI of the spine) progression.\n\nBesides known actionable mutations somatic alterations with unclear therapeutical/clinical significance (VUS, variant of unknown significance) were discovered in 22% (6/27) of the patients (Supplementary table 3). A high number of somatic alterations/VUS were found in 3 patients with breast carcinoma (#5, #9, #17), 2 patients with cerebral lymphoma (#16, #21), and 1 patient with melanoma (#22) (see Table 4 and Supplementary Table 3). The number of somatic alterations in these cases ranged from 7 to 47 (median: 11 variants). This increased number of mutations in comparison to other cases suggests a high tumor mutational burden (TMB high) which has been associated in recent studies with response to immune checkpoint inhibition in various cancers12, 31, 32. The quantification of TMB requires a sequencing assay that covers a territory of at least 0.8 megabases (Mb) ,while the Oncomine Focus assay covers only about 0.03 Mb and is thus not applicable for TMB measurements. Therefore, further diagnostic workup with a suitable panel to confirm TMBhigh was recommended by the molecular tumor board.\n\nDiscussion\nOur study demonstrates the feasibility of detecting clinically relevant somatic alterations in the CSF of patients with CNS cancer. Importantly, this study was conducted using an amplicon-based, commercially available NGS panel. We show here, that CSF samples from patients with and without leptomeningeal involvement of CNS cancer contain cfTNA and that a targeted standardized amplicon-based NGS assay generates clinically relevant data. All patients were discussed in an interdisciplinary molecular tumor board and targeted therapy was recommended with respect to the individual clinical history and molecular results obtained by NGS. A therapeutic recommendation was made for more than one quarter of all patients. However, due to rapid clinical deterioration and patient refusal, only 15% (4/27) actually received the therapy recommended by the molecular tumor board. This shows that leptomeningeal disease still has a poor prognosis and that patients' samples are often subjected to extend molecular testing at rather late stages of their disease. It has been suggested that patients with late-stage disease often have only limited benefit from precision cancer medicine 33.\n\nIn our studies, it was possible to successfully analyze samples with a low content of CSF nucleic acids using both the DNA and RNA panel of a commercially available NGS solution. This is in line with previous publications that demonstrate the ability to sequence low concentrations of cfDNA in the CSF 18-21, 34-36. So far, the fraction of tumor-derived DNA has been considered to be higher in the CSF than in the plasma due to the relative absence of non-tumor derived DNA, thus offering the possibility to detect somatic alterations with low allelic frequencies18, 20.\n\nWe identified somatic alterations in 74% of the (20/27) patients with a median of 3 (range 1-47) mutations per case. However, 11% of the samples (3/27) did not show any detectable alteration. In these cases we cannot exclude the possibility that 1) genomic alterations are not covered by the small NGS panel used (~30 kb) and thus were not detectable and 2) that, although a high average coverage of approximately 15000 reads was achieved, the sensitivity was still too low to detect the varying and usually low amounts of ctTNA within the cfTNA (“needle in a haystack”). However, compared to larger targeted NGS assays or whole genome sequencing, we were able to increase the coverage depth and thus sensitivity by 5 to 10 fold in comparison to our routine tissue analyses. Furthermore, it represents a cost-effective solution for clinical practice 22. In addition, cfTNA levels may be limiting the capacity to perform more extensive NGS testing in the CSF in some patients.\n\nWe identified targetable alterations in 40% (11/27) of the patients. However, after discussion in our interdisciplinary molecular tumor board, therapeutic recommendations could only be provided for 26% (7/27) of the patients. This highlights the fact that personalized medicine, relying on the genetic characterization of CNS malignancies, with its inherent potential pitfalls and difficulties in interpretation should be pursued within the framework of an interdisciplinary molecular tumor board to avoid unnecessary and potential harmful therapeutic interventions.\n\nIn one breast cancer patient with radiologically and clinically suspected LM, cfDNA showed a targetable PIK3CA mutation. However, no treatment was initiated due to clinical stabilization and patient refusal. For 11 months, the patient showed no clinical or radiological progression and sequential CSF punctures were negative for malignant cells. Overall, LM seems unlikely and it cannot be ruled out that the positive NGS result reflects blood derived cfDNA. However, unfortunately no matching blood sample was analyzed to support this hypothesis.\n\nIn this study we found a high number of somatic alterations (median 11, range 7-47 in 30 kB coding DNA screened) in a significant fraction of CSF samples (22%, 6/27). These high numbers of mutations point to an increased tumor mutational burden (TMB). TMB is quantified as a number of somatic mutations within an exonic territory of at least 0.8 Mb as mutations per megabase (mut/Mb). This requirement is a potential drawback of the NGS panel used in this study as it covers only 0.03 Mb and thus cannot be utilized for the quantification of TMB. However, determining TMB from liquid biopsies (blood/liquor-based TMB) is very expensive because 1) a huge territory needs to be sequenced 2) at a high coverage to overcome the sensitivity problem (ctDNA accounts usually for less than 5% of the total cfDNA 31).Therefore, liquid-based TMB analysis cannot be performed on smaller sequencing machines such as the Ion PGM used in this study.\n\nTMB metrics can be used to classify tumors into classes with low, medium, and high mutational burden. A high TMB (defined according to various cut-offs ranging from ≥10 to ≥20 mutations per Mb) might increase the number of distinct neoepitopes presented on the surface of tumor cells and hence lead to greater tumor immunogenicity. It has been validated as a predictive biomarker of efficacy of checkpoint inhibitors in several tumor types 27, 32. TMB was initially calculated using whole-exome sequencing (WES) of up to 60 Mb of the genome. Alternatively, sequencing of a reduced set of relevant genes with a higher sensitivity has been validated to determine TMB 27. The fact that we found a significant fraction of samples with a comparatively high amount of genomic alterations is an argument, especially in terms of a potential therapeutic alternative, to recommend TMB measurement with a validated TMB panel.\n\nOur study has other limitations. We analyzed a comparatively small patient cohort with multiple different types of CNS cancer, and no long-term follow up is available to determine the actual clinical benefit for the majority of patients. Although our results show that NGS from CSF can help to guide therapeutic recommendations, further larger prospective studies are needed to clarify whether individualized targeted therapeutic approaches based on CSF NGS results indeed translate into a clinical benefit for the patient.\n\nFurthermore, it would be of great interest to systematically compare the sequencing results of CSF, blood, brain parenchymal metastasis, and primary cancers, which was beyond the scope of our study.\n\nCancer cells continuously acquire new mutations due to genomic instability and/or selective pressure from the tissue microenvironment and clinical treatment. Recent data indicate that CNS manifestations of systemic cancer often carry genetic alterations that can differ from those observed in primary tumors and systemic metastasis 19, 37-40. In this respect, CNS metastases seem to harbor more clinically actionable mutations than the primary tumor and might thus better respond to targeted therapies. In a series of 86 paired cases of primary tumors and brain metastases, 53% of the brain metastases had one or more actionable mutation not found in the primary tumor 38. Similarly, CSF cfDNA was shown to harbor drug resistance mutations not present in the primary tumor 19. This heterogeneity is very relevant, as the majority of patients with CNS metastasis do not undergo surgery or biopsy for brain metastases and therefore, potential clinically actionable mutations or mechanisms of resistance in the CNS might not be identified. However, especially for primary brain tumors, cfDNA analysis from the blood may represent a less invasive alternative to CSF analysis requiring a lumbar puncture, which, under some circumstances (elevated intracranial pressure) may even be contraindicated. It will therefore be relevant to evaluate how far cfDNA analysis from the blood in this situation qualitatively represents the brain tumor lesion.\n\nFurthermore, several studies have pointed out, that the absolute amount of cfDNA in the CSF might represent a predictor for therapeutic response 20, 26, 34. Furthermore, serial analysis of cfDNA in the CSF by NGS can unravel potential resistance mechanisms towards targeted therapies 19.\n\nIn the future, it will therefore be relevant to further evaluate the utility of cfDNA analysis as marker of therapeutic success. For this purpose, larger prospective studies need to be conducted enrolling patients to monitor cfDNA samples from CSF prior to, repeatedly during, and after therapeutic interventions.\n\nIn conclusion, our study highlights that the collection and genomic profiling of CSF using a commercially available, amplicon-based NGS approach is technically feasible and identifies targetable genetic alterations in a substantial subset of patients. In the framework of a molecular tumor board it proved helpful to identify patients for novel targeted therapeutic approaches in a real-life scenario. Future larger prospective trials should solidify the clinical benefit of patients with CNS cancer receiving targeted therapies according to NGS-based CSF analysis. Additionally, the value of genomic profiling as a marker of clinical response to therapy, analogous to plasma cfDNA, should be analyzed.\n\nSupplementary Material\nSupplementary figures and tables.\n\nClick here for additional data file.\n\n We thank Katie Göttlinger for revising the manuscript for grammar and style.\n\nFunding\nLB- Bavarian foundation for gender equality, LMU Munich, Germany\n\nAuthorship\nCBW and LB designed the study; JK, AJ, SL and TK performed the experiments; LB, MF, JK, AJ and CBW analyzed the data; LB, CBW, JK, MN, NT, AJ, KWM, AS, MB, JWH and TK interpreted the data. All authors have been involved in the writing of the manuscript at draft and revision stages, and have read and approved the final version.\n\nFigure 1 NGS-Results NGS-Analysis from CSF is technically feasible and yields tumor genetic mutations in the majority of patients analyzed. VUS: variants of unknown significance, *2 patients had both: actionable mutations and VUS.\n\nFigure 2 Therapeutic management Flow Chart indicating the yield of actionable mutations in 27 patients, respective recommendations of the Molecular Tumor Board (MTB) and actual treatment\n\nFigure 3 Illustrative patient example 45-year-old male patient (#1) with newly diagnosed metastatic (leptomeningeal, bone, lymph nodes, pulmonary) NSCLC with actionable mutation (EGFR Exon 21) diagnosed by NGS from CSF. A: Note the exceptional clinical course under treatment with oral erlotinib and intrathecal MTX with regression of preexisting contrast enhancing metastatic lesions (green arrows) and stable pulmonary disease over 24 months. B: Non-adherent LM was diagnosed by cytology and could not be eradicated; however, the percentage of atypical cells in the CSF remained low for the whole treatment period.\n\nTable 1 Patient characteristics.\n\nMedian age (range)\t58 (22-82)\t\nGender women %, (N)\t59 (16/27)\t\nSecondary brain tumors %, (N)\t85 (23/27)\t\nBreast\t37 (10/27)\t\nLung\t30 (8/27)\t\nothers\t19 (5/27)\t\nPrimary brain tumors %, (N)\t15 (4/27)\t\nGBM\t7 (2/27)\t\nPCNSL\t7 (2/27)\t\nCSF cytology %, (N)\t\t\nPositive\t52 (14/27)\t\nNegative\t48 (13/27)\t\nMRI brain %, (N)\t\t\nPositive for LM\t59(16/27)\t\nNegative for LM\t41(11/27)\t\nNot performed\t4 (1/27)\t\nMRI spine %, (N)\t\t\nPositive for LM\t44 (12/27)\t\nNegative for LM\t41 (5/27)\t\nNot performed\t37 (10/27)\t\nMRI and/or CSF %, (N)\n\t\t\nPositive for LM\t70 (19/27)\t\nNegative for LM\t30 (8/27)\t\nParenchymal tumor manifestation %, (N)\t\t\nPositive\t81 (22/27)\t\nNegative\t19 (5/27)\t\nTable 2 RNA Sequencing metrics.\n\nRNA Sequencing\tTotal/avg\tThreshold\tMinimum observed*\tMaximum observed*\t\nRNA isolated (ng/µl)\t4.21 (median: 1)\tna\t0.3\t40.6\t\nSamples tested (n)\t24\tna\tna\tna\t\nSuccessfully analyzed (%)\t83.33\tna\tna\tna\t\nMapped fusion reads (n)\t282742.50\t10000\t42322\t832118\t\nFusion reads (n)\t4\tna\t0\t1\t\nna, not applicable. * per patient sample\n\nTable 3 DNA Sequencing metrics.\n\nDNA Sequencing\tTotal/avg\tThreshold\tMinimum observed*\tMaximum observed*\t\nDNA isolated (ng/µl)\t8.44 (median: 1)\tna\t0.1\t110\t\nSamples tested (n)\t27\tna\tna\tna\t\nSuccessfully analyzed (%)\t85.2\tna\tna\tna\t\nAverage base coverage depth\t14679.30\t4000\t4167\t20717\t\nTarget base coverage at 100x (%)\t98.78\t90\t92.87\t100\t\nUniformity of coverage (%)\t89.74\t70\t74.67\t99.99\t\nMutation reads (n)\t112\tna\t0\t40\t\nMutation allele frequency (%)\tna\t3\t3\t66.55\t\nAmplification detection (n)\t3\tna\t0\t2\t\nna, not applicable.* per patient sample\n\nTable 4 NGS results and clinical significance.\n\n#\tTumor\tLM\tPM\tGene\tAlteration\tExon\tAF (%)\tRecommendation\t\n1\tNSCLC\t+\t-\tEGFR\tc.2573T>G,p.Leu858Arg\t21\t8.7\tErlotinib\t\n2\tNSCLC\t+\t+\tJAK3\tc.1477A>T, p.Ser493Cys\t11\t8.0\tpStat3 testing (if positive Tocatinib)\t\n3\tCCC\t+\t+\tBRAF\tc.1799T>A p.Val600Glu\t15\t15.8\tCombinded BRAF- and MEK- nhibition\t\nERBB2\tc.2033G>A p.Arg678Gln\t17\t5.5\t\n4\tNSCLC\t+\t+\tEGFR\tc.2155G>T, p.Gly719Cys\t18\t64.1\tAfatinib\t\nEGFR\tc.2303G>T, p.Ser768Ile\t20\t66.6\t\n5\tBreast\t+\t+\tERG4\tTMPRSS2(1) - ERG4(4) fusion,\nchr21:42880007 - chr21:39817544\n*Probably TMB high\t\t\tTMB testing, if TMB high checkpoint inhibition\t\n6\tEwing Sarcoma\t+\t+\tFUS\tFUS(16) - DHX57(2) fusion,\nchr16: 31196264, chr2:39095397\t\t\tnot actionable\t\n7\tBreast\t+\t+\tNTRK1\tTPM3(7) - NTRK1(10) fusion,\nchr1:154142875 - chr1:156844362\t\t\tScreening for clinical trial (Entrectinib, XDX-101)\t\n8\tBreast\t+\t-\t\tno mutation\t\t\tnot actionable\t\n9\tBreast\t+\t+\tAR\tc.2630T>C, p.Phe877Ser\t8\t7.6\tTMB testing, if TMB high checkpoint inhibition\t\nCTNNB1\tc97T>C; pSer33Pro\nProbably TMB high\t3\t6.9\t\n10\tCRC\t+\t+\t\tnot successful\t\t\t\t\n11\tBreast\t+\t+\t\tno mutation\t\t\tnot actionable\t\n12\tGBM\t+\t+\t\tno mutation\t\t\tnot actionable\t\n13\tNSCLC\t-\t+\t\tnot successful\t\t\t\t\n14\tGBM\t-\t+\t\tno mutation\t\t\tnot actionable\t\n15\tNSCLC\t-\t+\tROS1\tEZR(10) - ROS1(34) fusion, chr6:159191795 - chr6:117645578\t\t\tCrizotinib or Ceritinib\t\nMTOR\tc.6604T>C, p.Phe2202Leu\t47\t7.7\t\n16\tPCNSL\t-\t+\t\t*Probably TMB high\t\t\tTMB testing, if TMB high checkpoint inhibition\t\n17\tBreast\t-\t-\tPIK3CA\tc.326A>G, p.Glu109Gly\n*Probably TMB high\t2\t5.8\tEverolimus,\nTMB-testing, if TMB high checkpoint inhibition\t\n18\tBreast\t+\t-\t\tnot successful\t\t\t\t\n19\tBreast\t+\t+\tMYC\tMYC amplification chr8:128748884, CNV 5.47\t\t\tnot actionable\t\n20\tGastric\t+\t-\t\tno mutation\t\t\tnot actionable\t\n21\tPCNSL\t+\t+\tALK\tc.3574C>T, p.Arg1192Trp\t23\t6.9\tTMB-testing, if TMB high checkpoint inhibition.\t\nERBB3\tc.706T>C, p.Ser236Pro, c.2053C>T,\t6\t6.9\t\nFGFR4\tp.Leu685Phe c.1700A>G,\t16\t7.5\t\nJAK3\tp.Glu567Gly,\t12\t6.6\t\nMED12\tc.3674A>G, p.Lys1225Arg,\t26\t5.8\t\nPDGFRA\tc.1975A>G, p.Asn659Asp,\t14\t35.2\t\nRAF1\tc.1282A>G, p.Ser428Gly,\nProbably TMB high\t12\t10.9\t\n22\tMelanoma\t+\t+\tAPC\tc.1579A>G, p.Arg527Gly\t13\t8.2\t6 potentially actionable mutations however, several mutation in multiple pathways, indicating resistance.\nProbably TMB-high, continue current treatment with checkpoint inhibitor.\t\nBRCA1\tc.362A>G, p.Glu121Gly\t6\t5\t\nFGFR1\tc.2221T>C, p.Phe741Leu\t17\t5.6\t\nFGFR2\tc.1940T>C, p.Leu647Pro\t14\t20.6\t\nMAP2K2\tc.193G>A, p.Gly65Ser\t2\t13.9\t\nMET\tc.3814A>G, p.Ser1272Gly\t19\t16.5\t\nNRAS\tc.35G>A ,p.Gly12Asp\t2\t5.2\t\nSMO\tc.1553A>G, p.Glu518Gly\nProbably TMB high\t9\t11.9\t\n23\tBreast\t+\t+\tFGFR1\tFGFR1 amplification, chr8:38271444, CNV 8.52\t\t\tEverolimus\t\nMYC\tMYC amplification, chr8:128748884, CNV 8.9\t\t\t\n24\tNSCLC\t-\t+\tBRAF\tc.1424A>G, p.Lys475Arg c.65A>G,\t11\t5\tActionable mutation (BRAF), however no change in management as the patient was clinically stable, no LM was detected and cerebral metastasis was controlled after stereotactic radiation. Re-evaluation in case of clinical deterioration\t\nCDK4\tp.Lys22Arg c.172A>G,p.Thr58Ala\t2\t3.9\t\nKRAS\t\t3\t4.8\t\n25\tBreast\t-\t+\tEGFR\tc.1473A>G, p.Ile491\t12\t7.3\tActionable mutation (MET, FGFR4), however, because of low allele frequency and clinical deterioration no change in management\t\nFGFR4\tc.2008A>G, p.Ser670Gly\t15\t6.5\t\nMET\tc.1120T>C, p.Phe374Leu\t2\t7.5\t\nRET\tc.2660A>G, p.Lys887Arg\t15\t7.7\t\n26\tNSCLC\t-\t+\t\tnot successful\t\t\t\t\n27\tNSCLC\t+\t+\tEGFR\tc.2155G>T , p.Gly719Cys\t18\t17.5\tPatient progressed on Afatinib. Best supportive care due to unexpected clinical deterioration.\t\nEGFR\tc.2156G>A p.Gly719Asp\t18\t3.8\t\nEGFR\tc.2303G>T, p.Ser768Ile\t20\t28.5\t\nNRAS\tc.35G>A, p.Gly12Asp\t2\t3\t\nPTEN\tc.1004G>A, p.Arg335Gln\t8\t5.9\t\nTP53\tc.527G>T, p.Cys176Phe\t5\t30.6\t\n*CSF and/or MRI suggestive of LM; Abbreviations: LM - leptomeningeal metastasis, PM -parenchymal tumor manifestation, AF - allele frequency, NSCLS - non small cell lung cancer, CCC -cholangiocellular carcinoma, CRC - colorectal carcinoma, GBM - glioblastoma, PCNSL - primary CNS lymphoma.\n==== Refs\n1 Beauchesne P Intrathecal chemotherapy for treatment of leptomeningeal dissemination of metastatic tumours The Lancet Oncology 2010 11 871 9 20598636 \n2 Inno A Di Noia V D'Argento E Modena A Gori S State of the art of chemotherapy for the treatment of central nervous system metastases from non-small cell lung cancer Transl Lung Cancer Res 2016 5 599 609 28149755 \n3 Mack F Baumert BG Schafer N Hattingen E Scheffler B Herrlinger U Therapy of leptomeningeal metastasis in solid tumors Cancer Treat Rev 2016 43 83 91 26827696 \n4 Larkin J Hodi FS Wolchok JD Combined Nivolumab and Ipilimumab or Monotherapy in Untreated Melanoma N Engl J Med 2015 373 1270 1 \n5 Pan Z Yang G He H Zhao G Yuan T Li Y Concurrent radiotherapy and intrathecal methotrexate for treating leptomeningeal metastasis from solid tumors with adverse prognostic factors: A prospective and single-arm study International journal of cancer 2016 139 1864 72 27243238 \n6 Dagogo-Jack I Gill CM Cahill DP Santagata S Brastianos PK Treatment of brain metastases in the modern genomic era Pharmacol Ther 2017 170 64 72 27773784 \n7 Di Giacomo AM Valente M Covre A Danielli R Maio M Immunotherapy targeting immune check-point(s) in brain metastases Cytokine Growth Factor Rev 2017 36 33 8 28736183 \n8 Wong A The Emerging Role of Targeted Therapy and Immunotherapy in the Management of Brain Metastases in Non-Small Cell Lung Cancer Front Oncol 2017 7 33 28424757 \n9 Shonka N Venur VA Ahluwalia MS Targeted Treatment of Brain Metastases Current neurology and neuroscience reports 2017 17 37 28326470 \n10 Mendez JS Ostrom QT Gittleman H Kruchko C DeAngelis LM Barnholtz-Sloan JS The elderly left behind-changes in survival trends of primary central nervous system lymphoma over the past 4 decades Neuro Oncol 2018 20 687 94 29036697 \n11 Drilon A Laetsch TW Kummar S DuBois SG Lassen UN Demetri GD Efficacy of Larotrectinib in TRK Fusion-Positive Cancers in Adults and Children The New England journal of medicine 2018 378 731 9 29466156 \n12 Samstein RM Lee CH Shoushtari AN Hellmann MD Shen R Janjigian YY Tumor mutational load predicts survival after immunotherapy across multiple cancer types Nature genetics 2019 \n13 Balana C Ramirez JL Taron M Roussos Y Ariza A Ballester R O6-methyl-guanine-DNA methyltransferase methylation in serum and tumor DNA predicts response to 1,3-bis(2-chloroethyl)-1-nitrosourea but not to temozolamide plus cisplatin in glioblastoma multiforme Clin Cancer Res 2003 9 1461 8 12684420 \n14 Bettegowda C Sausen M Leary RJ Kinde I Wang Y Agrawal N Detection of circulating tumor DNA in early- and late-stage human malignancies Sci Transl Med 2014 6 224ra24 \n15 Lavon I Refael M Zelikovitch B Shalom E Siegal T Serum DNA can define tumor-specific genetic and epigenetic markers in gliomas of various grades Neuro-oncology 2010 12 173 80 20150384 \n16 Shi W Lv C Qi J Zhao W Wu X Jing R Prognostic value of free DNA quantification in serum and cerebrospinal fluid in glioma patients J Mol Neurosci 2012 46 470 5 21881830 \n17 Piccioni DE Achrol AS Kiedrowski LA Banks KC Boucher N Barkhoudarian G Analysis of cell-free circulating tumor DNA in 419 patients with glioblastoma and other primary brain tumors CNS Oncol 2019 \n18 Wang Y Springer S Zhang M McMahon KW Kinde I Dobbyn L Detection of tumor-derived DNA in cerebrospinal fluid of patients with primary tumors of the brain and spinal cord Proceedings of the National Academy of Sciences of the United States of America 2015 112 9704 9 26195750 \n19 Pentsova EI Shah RH Tang J Boire A You D Briggs S Evaluating Cancer of the Central Nervous System Through Next-Generation Sequencing of Cerebrospinal Fluid Journal of clinical oncology: official journal of the American Society of Clinical Oncology 2016 34 2404 15 27161972 \n20 De Mattos-Arruda L Mayor R Ng CK Weigelt B Martinez-Ricarte F Torrejon D Cerebrospinal fluid-derived circulating tumour DNA better represents the genomic alterations of brain tumours than plasma Nature communications 2015 6 8839 \n21 Huang TY Piunti A Lulla RR Qi J Horbinski CM Tomita T Detection of Histone H3 mutations in cerebrospinal fluid-derived tumor DNA from children with diffuse midline glioma Acta neuropathologica communications 2017 5 28 28416018 \n22 Paasinen-Sohns A Koelzer VH Frank A Schafroth J Gisler A Sachs M Single-Center Experience with a Targeted Next Generation Sequencing Assay for Assessment of Relevant Somatic Alterations in Solid Tumors Neoplasia 2017 19 196 206 28161563 \n23 Tenhagen M van Diest PJ Ivanova IA van der Wall E van der Groep P Fibroblast growth factor receptors in breast cancer: expression, downstream effects, and possible drug targets Endocr Relat Cancer 2012 19 R115 29 22508544 \n24 Hortobagyi GN Chen D Piccart M Rugo HS Burris HA 3rd Pritchard KI Correlative Analysis of Genetic Alterations and Everolimus Benefit in Hormone Receptor-Positive, Human Epidermal Growth Factor Receptor 2-Negative Advanced Breast Cancer: Results From BOLERO-2 Journal of clinical oncology: official journal of the American Society of Clinical Oncology 2016 34 419 26 26503204 \n25 Formisano L Lu Y Servetto A Hanker AB Jansen VM Bauer JA Aberrant FGFR signaling mediates resistance to CDK4/6 inhibitors in ER+ breast cancer Nat Commun 2019 10 1373 30914635 \n26 Li Y Pan W Connolly ID Reddy S Nagpal S Quake S Tumor DNA in cerebral spinal fluid reflects clinical course in a patient with melanoma leptomeningeal brain metastases J Neurooncol 2016 128 93 100 26961773 \n27 Cabel L Proudhon C Romano E Girard N Lantz O Stern MH Clinical potential of circulating tumour DNA in patients receiving anticancer immunotherapy Nature reviews Clinical oncology 2018 \n28 Cabel L Riva F Servois V Livartowski A Daniel C Rampanou A Circulating tumor DNA changes for early monitoring of anti-PD1 immunotherapy: a proof-of-concept study Annals of oncology: official journal of the European Society for Medical Oncology 2017 28 1996 2001 28459943 \n29 Santini FC Rizvi H Plodkowski AJ Ni A Lacouture ME Gambarin-Gelwan M Safety and Efficacy of Re-treating with Immunotherapy after Immune-Related Adverse Events in Patients with NSCLC Cancer immunology research 2018 6 1093 9 29991499 \n30 Lin NU Winer EP Brain metastases: the HER2 paradigm Clinical cancer research: an official journal of the American Association for Cancer Research 2007 13 1648 55 17363517 \n31 Jung A Kirchner T Liquid Biopsy in Tumor Genetic Diagnosis Dtsch Arztebl Int 2018 115 169 74 29587961 \n32 Yarchoan M Hopkins A Jaffee EM Tumor Mutational Burden and Response Rate to PD-1 Inhibition N Engl J Med 2017 377 2500 1 29262275 \n33 Le Tourneau C Delord J-P Gonçalves A Gavoille C Dubot C Isambert N Molecularly targeted therapy based on tumour molecular profiling versus conventional therapy for advanced cancer (SHIVA): a multicentre, open-label, proof-of-concept, randomised, controlled phase 2 trial Lancet Oncol 2015 p. 1324-34 \n34 Momtaz P Pentsova E Abdel-Wahab O Diamond E Hyman D Merghoub T Quantification of tumor-derived cell free DNA(cfDNA) by digital PCR (DigPCR) in cerebrospinal fluid of patients with BRAFV600 mutated malignancies Oncotarget 2016 7 85430 6 27863426 \n35 Schwaederle M Chattopadhyay R Kato S Fanta PT Banks KC Choi IS Genomic Alterations in Circulating Tumor DNA from Diverse Cancer Patients Identified by Next-Generation Sequencing Cancer Res 2017 77 5419 27 28807936 \n36 Wang Z Jiang W Wang Y Guo Y Cong Z Du F MGMT promoter methylation in serum and cerebrospinal fluid as a tumor-specific biomarker of glioma Biomedical reports 2015 3 543 8 26171163 \n37 De Mattos-Arruda L Ng CKY Piscuoglio S Gonzalez-Cao M Lim RS De Filippo MR Genetic heterogeneity and actionable mutations in HER2-positive primary breast cancers and their brain metastases Oncotarget 2018 9 20617 30 29755676 \n38 Brastianos PK Carter SL Santagata S Cahill DP Taylor-Weiner A Jones RT Genomic Characterization of Brain Metastases Reveals Branched Evolution and Potential Therapeutic Targets Cancer Discov 2015 5 1164 77 26410082 \n39 Yang H Cai L Zhang Y Tan H Deng Q Zhao M Sensitive detection of EGFR mutations in cerebrospinal fluid from lung adenocarcinoma patients with brain metastases J Mol Diagn 2014 16 558 63 24994671 \n40 Li YS Jiang BY Yang JJ Zhang XC Zhang Z Ye JY Unique genetic profiles from cerebrospinal fluid cell-free DNA in leptomeningeal metastases of EGFR-mutant non-small-cell lung cancer: a new medium of liquid biopsy Ann Oncol 2018 29 945 52 29346604\n\n", "fulltext_license": "CC BY", "issn_linking": "1838-7640", "issue": "10(2)", "journal": "Theranostics", "keywords": "CNS Cancer; CSF; Next Generation Sequencing (NGS); cfDNA; liquid biopsy.", "medline_ta": "Theranostics", "mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D014408:Biomarkers, Tumor; D016543:Central Nervous System Neoplasms; D002555:Cerebrospinal Fluid; D005260:Female; D059014:High-Throughput Nucleotide Sequencing; D006801:Humans; D000073890:Liquid Biopsy; D008297:Male; D008875:Middle Aged; D058990:Molecular Targeted Therapy; D057285:Precision Medicine; D011379:Prognosis; D055815:Young Adult", "nlm_unique_id": "101552395", "other_id": null, "pages": "856-866", "pmc": null, "pmid": "31903155", "pubdate": "2020", "publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": "28326470;26503204;12684420;30914635;29755676;27773784;24994671;26398076;29346604;26827696;28416018;20150384;26554728;26342236;26410082;28807936;30855176;30050094;26171163;28459943;29036697;28424757;28736183;29587961;29466156;27863426;20598636;21881830;24553385;26195750;17363517;29262275;22508544;28149755;28161563;27161972;30643254;29991499;27243238;26961773", "title": "Therapeutic management of neuro-oncologic patients - potential relevance of CSF liquid biopsy.", "title_normalized": "therapeutic management of neuro oncologic patients potential relevance of csf liquid biopsy" }
[ { "companynumb": "DE-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2020-BI-004287", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "AFATINIB" }, "dr...
{ "abstract": "To identify potential pharmacokinetic interactions between the pharmaceutical formulation of cannabidiol (CBD; Epidiolex) and the commonly used antiepileptic drugs (AEDs) through an open-label safety study. Serum levels were monitored to identify interactions between CBD and AEDs.\n\n\n\nIn 39 adults and 42 children, CBD dose was started at 5 mg/kg/day and increased every 2 weeks by 5 mg/kg/day up to a maximum of 50 mg/kg/day. Serum AED levels were obtained at baseline prior to CBD initiation and at most study visits. AED doses were adjusted if it was determined that a clinical symptom or laboratory result was related to a potential interaction. The Mixed Procedure was used to determine if there was a significant change in the serum level of each of the 19 AEDs with increasing CBD dose. AEDs with interactions seen in initial analysis were plotted for mean change in serum level over time. Subanalyses were performed to determine if the frequency of sedation in participants was related to the mean serum N-desmethylclobazam level, and if aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels were different in participants taking concomitant valproate.\n\n\n\nIncreases in topiramate, rufinamide, and N-desmethylclobazam and decrease in clobazam (all p < 0.01) serum levels were seen with increasing CBD dose. Increases in serum levels of zonisamide (p = 0.02) and eslicarbazepine (p = 0.04) with increasing CBD dose were seen in adults. Except for clobazam and desmethylclobazam, all noted mean level changes were within the accepted therapeutic range. Sedation was more frequent with higher N-desmethylclobazam levels in adults (p = 0.02), and AST/ALT levels were significantly higher in participants taking concomitant valproate (p < 0.01).\n\n\n\nSignificantly changed serum levels of clobazam, rufinamide, topiramate, zonisamide, and eslicarbazepine were seen. Abnormal liver function test results were noted in participants taking concomitant valproate. This study emphasizes the importance of monitoring serum AED levels and LFTs during treatment with CBD.", "affiliations": "Division of Epilepsy, Department of Neurology, University of Alabama at Birmingham, Birmingham, Alabama, U.S.A.;Division of Epilepsy, Department of Neurology, University of Alabama at Birmingham, Birmingham, Alabama, U.S.A.;Department of Biostatistics, University of Alabama at Birmingham School of Public Health, Birmingham, Alabama, U.S.A.;Department of Biostatistics, University of Alabama at Birmingham School of Public Health, Birmingham, Alabama, U.S.A.;Division of Epilepsy, Department of Neurology, University of Alabama at Birmingham, Birmingham, Alabama, U.S.A.", "authors": "Gaston|Tyler E|TE|0000-0002-6525-789X;Bebin|E Martina|EM|;Cutter|Gary R|GR|;Liu|Yuliang|Y|;Szaflarski|Jerzy P|JP|;|||", "chemical_list": "D000927:Anticonvulsants; D014230:Triazoles; D000077236:Topiramate; D001569:Benzodiazepines; D002185:Cannabidiol; D000078306:Clobazam; D005632:Fructose; C024581:N-desmethylclobazam; C079703:rufinamide", "country": "United States", "delete": false, "doi": "10.1111/epi.13852", "fulltext": null, "fulltext_license": null, "issn_linking": "0013-9580", "issue": "58(9)", "journal": "Epilepsia", "keywords": "AEDs; Cannabidiol; Clobazam; Interactions; Valproate", "medline_ta": "Epilepsia", "mesh_terms": "D000293:Adolescent; D000328:Adult; D000367:Age Factors; D000927:Anticonvulsants; D001569:Benzodiazepines; D002185:Cannabidiol; D002648:Child; D002675:Child, Preschool; D000078306:Clobazam; D004305:Dose-Response Relationship, Drug; D004347:Drug Interactions; D004827:Epilepsy; D005260:Female; D005632:Fructose; D006801:Humans; D008297:Male; D008875:Middle Aged; D000077236:Topiramate; D014230:Triazoles; D055815:Young Adult", "nlm_unique_id": "2983306R", "other_id": null, "pages": "1586-1592", "pmc": null, "pmid": "28782097", "pubdate": "2017-09", "publication_types": "D016428:Journal Article", "references": null, "title": "Interactions between cannabidiol and commonly used antiepileptic drugs.", "title_normalized": "interactions between cannabidiol and commonly used antiepileptic drugs" }
[ { "companynumb": "US-LUNDBECK-DKLU2037055", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CANNABIDIOL" }, "drugadditional": "3", ...
{ "abstract": "OBJECTIVE\nTo evaluate oral tofacitinib versus placebo for treatment of active rheumatoid arthritis in Japanese patients with inadequate response to disease-modifying antirheumatic drugs.\n\n\nMETHODS\nIn this double-blind, placebo-controlled, randomized, parallel-group, 12-week, phase 2 study (clinicaltrials.gov NCT00687193), 317 patients received tofacitinib: 1, 3, 5, 10, or 15 mg as monotherapy or placebo twice daily (BID).\n\n\nMETHODS\nresponse rate by American College of Rheumatology (ACR) ≥ 20% improvement criteria (ACR20) at week 12.\n\n\nRESULTS\nACR20 response rates: 37.7% (20/53), 67.9% (36/53), 73.1% (38/52), 84.9% (45/53), and 90.7% (49/54) with tofacitinib: 1, 3, 5, 10, and 15 mg BID, respectively, versus 15.4% (8/52) with placebo (p < 0.01; all doses). Dose-dependent ACR20 responses with tofacitinib versus placebo occurred from week 2 onward (p < 0.05). Changes from baseline in 28-joint disease activity score using erythrocyte sedimentation rate improved with tofacitinib versus placebo from week 4 (p < 0.01; all doses). Six tofacitinib patients experienced treatment-related serious adverse events (AEs). Most common treatment-emergent AEs: nasopharyngitis (10% vs 12%) and hyperlipidemia (5% vs 0%). Serum creatinine, hemoglobin, and total-, low-, and high-density lipoprotein-cholesterol levels increased with tofacitinib.\n\n\nCONCLUSIONS\nTofacitinib produced dose-dependent ACR20 responses and reduced disease activity. The safety profile was consistent with that reported from global monotherapy trials.", "affiliations": "The First Department of Internal Medicine, School of Medicine, University of Occupational and Environmental Health , Kitakyushu, Fukuoka , Japan.", "authors": "Tanaka|Yoshiya|Y|;Takeuchi|Tsutomu|T|;Yamanaka|Hisashi|H|;Nakamura|Hiroyuki|H|;Toyoizumi|Shigeyuki|S|;Zwillich|Samuel|S|", "chemical_list": "D018501:Antirheumatic Agents; D010880:Piperidines; D047428:Protein Kinase Inhibitors; D011743:Pyrimidines; D011758:Pyrroles; C479163:tofacitinib; D053616:Janus Kinase 3", "country": "England", "delete": false, "doi": "10.3109/14397595.2014.995875", "fulltext": "\n==== Front\nMod RheumatolMod RheumatolIMORimor20Modern Rheumatology1439-75951439-7609Taylor & Francis 10.3109/14397595.2014.995875995875Original ArticlesEfficacy and safety of tofacitinib as monotherapy in Japanese patients with active rheumatoid arthritis: a 12-week, randomized, phase 2 study Tanaka Yoshiya \na\n\n*\nTakeuchi Tsutomu \nb\nYamanaka Hisashi \nc\nNakamura Hiroyuki \nd\nToyoizumi Shigeyuki \nd\nZwillich Samuel \ne\na The First Department of Internal Medicine, School of Medicine, University of Occupational and Environmental Health, Kitakyushu, Fukuoka, Japanb Keio University, Tokyo, Japanc Tokyo Women's Medical University, Tokyo, Japand Pfizer Japan Inc, Tokyo, Japane Pfizer Inc, Groton, CT, USACorrespondence to: Yoshiya Tanaka, MD, PhD, The First Department of Internal Medicine, School of Medicine, University of Occupational and Environmental Health, Japan, 1-1 Iseigaoka, Yahata-nishi, Kitakyushu, Fukuoka 807-8555, Japan. Tel: 81-93-691-7249. Fax: 81-93-691-9934. E-mail: tanaka@med.uoeh-u.ac.jp22 6 2015 10 7 2015 25 4 514 521 26 9 2014 30 11 2014 © 2015 Japan College of Rheumatology2015Japan College of RheumatologyThis is an open-access article distributed under the terms of the CC-BY-NC-ND 3.0 License which permits users to download and share the article for non-commercial purposes, so long as the article is reproduced in the whole without changes, and provided the original source is credited.Abstract\n\nObjectives. To evaluate oral tofacitinib versus placebo for treatment of active rheumatoid arthritis in Japanese patients with inadequate response to disease-modifying antirheumatic drugs.\n\n\nMethods. In this double-blind, placebo-controlled, randomized, parallel-group, 12-week, phase 2 study (clinicaltrials.gov NCT00687193), 317 patients received tofacitinib: 1, 3, 5, 10, or 15 mg as monotherapy or placebo twice daily (BID). Primary endpoint: response rate by American College of Rheumatology (ACR) ≥ 20% improvement criteria (ACR20) at week 12.\n\n\nResults. ACR20 response rates: 37.7% (20/53), 67.9% (36/53), 73.1% (38/52), 84.9% (45/53), and 90.7% (49/54) with tofacitinib: 1, 3, 5, 10, and 15 mg BID, respectively, versus 15.4% (8/52) with placebo (p < 0.01; all doses). Dose-dependent ACR20 responses with tofacitinib versus placebo occurred from week 2 onward (p < 0.05). Changes from baseline in 28-joint disease activity score using erythrocyte sedimentation rate improved with tofacitinib versus placebo from week 4 (p < 0.01; all doses). Six tofacitinib patients experienced treatment-related serious adverse events (AEs). Most common treatment-emergent AEs: nasopharyngitis (10% vs 12%) and hyperlipidemia (5% vs 0%). Serum creatinine, hemoglobin, and total-, low-, and high-density lipoprotein-cholesterol levels increased with tofacitinib.\n\n\nConclusions. Tofacitinib produced dose-dependent ACR20 responses and reduced disease activity. The safety profile was consistent with that reported from global monotherapy trials.\n\nKeywords\nJapanMonotherapyRandomized controlled trialRheumatoid arthritisTofacitinib\n==== Body\nIntroduction\nRheumatoid arthritis (RA) is a chronic, debilitating disease that negatively impacts on patient quality of life. Treatment options are based on disease-modifying antirheumatic drugs (DMARDs), typically starting with methotrexate [1–3]. Biologic DMARDs, such as tumor necrosis factor inhibitors (TNFis), are often used in patients with inadequate response to methotrexate (or other synthetic DMARDs). In Japan, the biologic DMARDs, infliximab, etanercept, adalimumab, golimumab, certolizumab pegol (TNFi), tocilizumab and abatacept, have been approved for use in patients with active RA and an inadequate response to existing therapies [4–6]. However, not all patients achieve an adequate response with available synthetic or biologic DMARDs [7–11]. Therefore, there remains an unmet need for additional therapeutic options with alternative mechanisms of action.\n\nTofacitinib is an oral Janus kinase (JAK) inhibitor for the treatment of RA [12,13]. Tofacitinib preferentially inhibits signaling by heterodimeric receptors associated with JAK3 and/or JAK1 with functional selectivity over receptors that signal via pairs of JAK2, blocking signaling for several cytokines, including interleukin (IL)-2, -4, -7, -9, -15, and -21 [14]. These cytokines are integral to lymphocyte activation and function, and inhibition of their signaling may modulate multiple aspects of the immune response [15].\n\nTofacitinib has demonstrated efficacy as monotherapy or in combination with DMARDs (mostly methotrexate) for the treatment of active RA in 6 phase 3 randomized controlled trials (RCTs) in various patient populations [16–21]. Furthermore, a phase 2 RCT in Japanese patients who had an inadequate response to methotrexate reported tofacitinib efficacy and safety in combination with stably dosed methotrexate [22]. Here, we evaluated multiple doses of tofacitinib monotherapy versus placebo for the treatment of RA in Japanese patients who have had an inadequate response to synthetic or biologic DMARDs.\n\nMaterials and methods\nPatients\nKey inclusion criteria included a diagnosis of RA based on the American College of Rheumatology (ACR) 1987 revised criteria [23]. Patients were required to have an active disease defined as ≥ 6 tender/painful joints and ≥ 6 swollen joints, and either erythrocyte sedimentation rate (ESR) above upper limit of normal (ULN) or C-reactive protein (CRP) > 7 mg/L. Patients were also required to have had an inadequate response to at least one synthetic or biologic DMARD, which had washed out ≥ 4 weeks prior to the first dose.\n\nKey exclusion criteria included: cytopenias; estimated glomerular filtration rate < 50 mL/min (Cockcroft–Gault calculation); total bilirubin, aspartate transaminase (AST), or alanine transaminase (ALT) > 2 × ULN; and evidence of active infection, including latent tuberculosis.\n\nStudy design and treatment\nThis was a 12-week, randomized, double-blind, placebo-controlled, parallel-group phase 2 study conducted at 47 centers in Japan from March 2009 to July 2010 (clinicaltrials.gov NCT00687193; Pfizer protocol A3921040). The study was performed in compliance with the 2008 update of the Declaration of Helsinki and the International Conference on Harmonisation's Good Clinical Practice Guidelines, and approved by the Institutional Review Boards at each study center. All patients provided written informed consent.\n\nBased on a randomization table pre-prepared by the study sponsor's Global Clinical Data Service Department, patients were randomized (1:1:1:1:1:1) to tofacitinib: 1, 3, 5, 10, or 15 mg, or placebo, given orally twice daily (BID) for 12 weeks. The study sponsor, investigators, and patients were blinded to the identity of study medications.\n\nConcomitant medications\nNo DMARDs were permitted as concomitant therapy during the study. Cytochrome P450 (CYP) 3A inducers and CYP3A4, 5, and 7 inhibitors were not permitted due to the potential for drug interactions, as tofacitinib metabolism is primarily mediated by CYP3A4 [24]. Stable doses of non-steroidal anti-inflammatory drugs, selective cyclo-oxygenase-2 inhibitors, or glucocorticoids (≤ 10 mg/day prednisone or equivalent) were permitted, provided they were stably dosed for ≥ 4 weeks before the first study drug dose.\n\nStudy assessments\nThe primary objective was to evaluate the dose–response relationship of the 5 tofacitinib doses compared with placebo; the primary efficacy endpoint was the response rate according to the ACR 20% improvement criteria (ACR20) compared with placebo at week 12. Secondary efficacy endpoints included ACR20 at all other timepoints, ACR50 and ACR70 response rates, change from baseline in 28-joint disease activity score using ESR (DAS28-4[ESR]), and proportions of patients achieving DAS-defined remission (DAS28-4[ESR] < 2.6) [25]. Other secondary efficacy endpoints included selected patient-reported outcomes, namely the Health Assessment Questionnaire-Disability Index (HAQ-DI) [26], Medical Outcomes Study Short-Form (36-item) Health Survey (SF-36), and the Functional Assessment of Chronic Illness Therapy-Fatigue (FACIT-F) scale [27]. ACR, DAS, and HAQ-DI assessments were performed at screening, baseline, and weeks 2, 4, 8, and 12. SF-36 was assessed at baseline and week 12, or early termination. FACIT-F was assessed at baseline, week 2, and week 12, or early termination.\n\nSafety endpoints included the incidence and severity of adverse events (AEs), serious AEs, laboratory tests, and vital sign assessments. AEs were recorded at every visit from the first dose through the last visit, and mapped to preferred terms according to the Medical Dictionary for Regulatory Activities (version 13.0). Laboratory parameters were measured at a central laboratory, except ESR, which was measured locally. Hematologic, lipid, hepatic, and renal function tests were performed at baseline, weeks 2, 4, 8, and 12, or early termination.\n\nStatistical analysis\nThe planned sample size of 50 patients per group (6 groups; total 300) had ≥ 80% power, with a significance level of 5%, to detect a 30% difference from placebo in the ACR20 response rate, assuming the placebo response rate was 35%.\n\nThe primary analysis population and the safety analysis set for this study was the full analysis set (FAS; all patients who were randomized to the study and received ≥ 1 dose of study medication).\n\nFor the primary endpoint, pairwise comparisons of the tofacitinib doses versus placebo were conducted using a chi-squared test with two-sided significance level of 0.05. The type I error rate for the pairwise comparisons was protected using a step-down procedure. When the pairwise comparison of the higher tofacitinib dose group versus placebo was statistically significant, the step-down procedure continued to the next lower tofacitinib dose group versus placebo comparison.\n\nFor the secondary endpoints, response rates from binary endpoints were analyzed using the normal approximation to the binomial, comparing each dose of study treatment with placebo. For continuous measures, a longitudinal, mixed-effect, repeated-measures model was employed. Treatment, week, and treatment-by-week interaction were included as fixed effects, along with patients as a random effect. Estimates of mean and mean difference from placebo were derived from the model and contrasts with placebo were formed.\n\nTo address missing data, 3 types of imputation were employed: baseline observation carried forward, also known as non-responder imputation (NRI); last observation carried forward (LOCF); and data as is (no imputation). LOCF was used for the ACR20 primary analysis at week 12; additional analyses were performed as a measure of robustness of the results.\n\nPost-hoc exploratory subanalyses were performed on the primary endpoint, ACR20 at week 12, and DAS28-4(ESR) remission rates, with respect to patient age, baseline DAS28-4(ESR), and RA disease duration.\n\nResults\nPatients\nOf 383 patients screened, 318 were randomized; 317 patients received ≥ 1 dose of study medication and 299 patients (94.0%) completed the study (Figure 1). The patient demographics and disease characteristics at baseline were similar across treatment groups (Table 1).\n\nFigure 1. Patient disposition. AEs were categorized according to whether they were considered related to study drug or not. AE adverse event, BID twice daily.\nTable 1. Patient baseline demographics and disease characteristics.\nCharacteristic, Mean\tTofacitinib\t\n1 mg BID (n = 53)\t3 mg BID (n = 53)\t5 mg BID (n = 52)\t10 mg BID (n = 53)\t15 mg BID (n = 54)\tPlacebo (n = 52)\t\nAge, years (SD)\t53.3 (9.9)\t52.8 (11.6)\t52.6 (10.9)\t54.7 (10.8)\t53.6 (12.5)\t53.3 (11.4)\t\nMale, n (%)\t11 (20.8)\t6 (11.3)\t8 (15.4)\t9 (17.0)\t10 (18.5)\t9 (17.3)\t\nWeight, kg (SD)\t52.9 (9.4)\t54.1 (10.2)\t54.2 (6.6)\t54.1 (10.0)\t53.8 (9.9)\t57.4 (11.7)\t\nBMI, kg/m2 (SD)\t21.5 (3.2)\t21.9 (3.8)\t22.2 (2.9)\t21.9 (3.9)\t22.1 (3.2)\t22.8 (3.8)\t\nDuration of RA, years (range)\t8.1 (0.5–39.0)\t6.8 (0.6–28.0)\t11.0 (0.4–34.0)\t7.3 (0.5–45.0)\t7.4 (0.5–38.3)\t6.4 (0.5–38.0)\t\nTender joint count (SD)\t13.55 (7.98)\t17.26 (11.44)\t18.58 (13.02)\t17.13 (10.27)\t17.35 (8.96)\t15.10 (8.76)\t\nSwollen joint count (SD)\t11.30 (6.49)\t14.64 (10.09)\t15.31 (10.83)\t13.77 (7.66)\t14.48 (8.99)\t11.96 (5.69)\t\nPGA, mm (SD)\t60.30 (22.40)\t60.28 (19.92)\t68.77 (22.28)\t64.91 (21.25)\t68.33 (18.79)\t58.13 (25.27)\t\nPtGA, mm (SD)\t60.62 (22.19)\t59.57 (18.83)\t70.44 (19.85)\t64.53 (22.51)\t67.00 (19.97)\t58.38 (21.83)\t\nPatient pain assessment, mm (SD)\t61.57 (17.37)\t62.13 (18.09)\t71.13 (17.54)\t69.85 (15.21)\t66.93 (17.60)\t61.08 (16.79)\t\nHAQ-DI (SD)\t1.25 (0.59)\t1.19 (0.64)\t1.50 (0.69)\t1.20 (0.65)\t1.20 (0.69)\t1.21 (0.69)\t\nCRP, mg/L (SD)\t30.21 (28.40)\t25.65 (24.54)\t35.61 (34.15)\t26.88 (27.81)\t27.37 (35.69)\t24.01 (23.01)\t\nDAS28-4(ESR) (SD)\t6.04 (0.89)\t6.08 (1.04)\t6.41 (1.05)\t6.06 (0.92)\t6.20 (1.02)\t5.83 (0.93)\t\n\nBID twice daily, BMI body mass index, CRP C-reactive protein, DAS28-4(ESR) 28-joint disease activity score using erythrocyte sedimentation rate, HAQ-DI health assessment questionnaire-disability index, PGA physician global assessment, PtGA patient global assessment, RA rheumatoid arthritis, SD standard deviation.\n\nEfficacy\nThe ACR20 response rates (FAS, LOCF) at week 12 (primary endpoint) were 20/53 (37.7%), 36/53 (67.9%), 38/52 (73.1%), 45/53 (84.9%), and 49/54 (90.7%) patients receiving tofacitinib: 1, 3, 5, 10, and 15 mg BID, respectively, and 8/52 (15.4%) patients receiving placebo (p < 0.0001 vs placebo for all doses of tofacitinib except 1 mg BID, where p < 0.01). The 12-week ACR response rates were similar when NRI was applied (Supplementary Table 1 to be found online at http://informahealthcare.com/doi/abs/10.3109/14397595.2014.995875).\n\nDose-dependent and statistically significant ACR20 responses were observed in all tofacitinib groups versus placebo from week 2, and were maintained throughout the 12-week period (p < 0.05; Figure 2a). A dose-dependent relationship was also observed for ACR50 response rates over the course of 12 weeks, with significant improvements versus placebo for tofacitinib doses of ≥ 3 mg BID at all timepoints (p < 0.05; Supplementary Figure 1a to be found online at http://informahealthcare.com/doi/abs/10.3109/14397595.2014.995875). In addition, a dose-dependent relationship was seen for ACR70 response rates, with significant improvements versus placebo for tofacitinib doses of ≥ 5 mg BID at all timepoints, except at week 2 with tofacitinib: 5 mg BID; significant improvements in ACR70 were observed with tofacitinib: 3 mg BID at weeks 8 and 12 (Supplementary Figure 1b to be found online at http://informahealthcare.com/doi/abs/10.3109/14397595.2014.995875). For the 1-mg BID dose, significant improvement versus placebo was only seen for ACR 50 response at week 8.\n\nFigure 2. Response rates for patients receiving tofacitinib monotherapy or placebo over time. (a) ACR20 response (± SE), FAS, LOCF. (b) DAS28-4(ESR) < 2.6 (remission), 2.6–3.2 (LDA), > 3.2–< 5.1 (MDA), and ≥ 5.1 (HDA), FAS, no imputation. (c) DAS28-4(ESR) < 2.6 (remission) (± SE), FAS, no imputation. (d) Mean HAQ-DI (± SE) change from baseline, FAS. *p < 0.05 versus placebo. ACR20 American College of Rheumatology 20% improvement criteria, BID twice daily, DAS28-4(ESR) 28-joint disease activity score using erythrocyte sedimentation rate, FAS full analysis set, HAQ-DI Health Assessment Questionnaire-Disability Index, HDA high disease activity, LDA low disease activity, LOCF last observation carried forward, MDA medium disease activity, SE standard error.\nDisease activity decreased in a dose-dependent manner over the 12 weeks of treatment (Figure 2b). Mean changes from baseline in DAS28-4(ESR) and ESR showed significant improvement versus placebo from week 2 for all tofacitinib doses (p < 0.01), except 1 mg BID, which showed a statistical difference from placebo at week 4 for DAS28-4(ESR) and week 8 for ESR (p < 0.01; Supplementary Figures 2a and b to be found online at http://informahealthcare.com/doi/abs/10.3109/14397595.2014.995875). The proportion of patients achieving DAS28-defined remission, DAS28-4(ESR) < 2.6, was significantly greater for patients receiving tofacitinib: ≥ 5 mg BID compared with placebo at weeks 8 and 12 (p < 0.05; Figure 2c). The proportion of patients achieving low disease activity, defined as DAS28-4(ESR) ≤ 3.2, was significantly greater than placebo at weeks 4, 8, and 12 for those receiving tofacitinib: ≥ 5 mg BID (p < 0.05).\n\nHAQ-DI values significantly improved from baseline compared with placebo from week 2 onward with tofacitinib doses of ≥ 3 mg BID (p < 0.05), and from week 8 onward with tofacitinib: 1 mg BID (p < 0.0001; Figure 2d). At week 12, a dose-dependent response was seen in the percentage of patients achieving a clinically meaningful decrease (≥ 0.22 units) in HAQ-DI from baseline (p < 0.01 vs placebo; Supplementary Table 2 to be found online at http://informahealthcare.com/doi/abs/10.3109/14397595.2014.995875).\n\nTable 2. Summary of safety data; all-causality TEAEs.\n \tTofacitinib\t\n1 mg BID (n = 53)\t3 mg BID (n = 53)\t5 mg BID (n = 52)\t10 mg BID (n = 53)\t15 mg BID (n = 54)\tPlacebo (n = 52)\t\nTEAEs, n\t37\t31\t42\t62\t50\t41\t\nPatients with ≥ 1 TEAE, n (%)\t21 (39.6)\t23 (43.4)\t29 (55.8)\t32 (60.4)\t28 (51.9)\t23 (44.2)\t\nPatients with ≥ 1 TESAE, n (%)\t0\t3 (5.7)\t2 (3.8)\t2 (3.8)\t1 (1.9)\t1 (1.9)\t\nDiscontinuations due to AEs, n (%)\t0\t1 (1.9)\t2 (3.8)\t3 (5.7)\t0\t2 (3.8)\t\nDeaths\t0\t0\t0\t0\t0\t0\t\n\nAE adverse event, BID twice daily, TEAE treatment-emergent adverse event, TESAE treatment-emergent serious adverse event.\n\nSF-36 scores were significantly improved in patients receiving tofacitinib versus those receiving placebo. The mean change in SF-36 domain scores for physical function, role physical, bodily pain, and role-emotional were significantly higher for all tofacitinib doses versus placebo (p < 0.05). Mean changes in general health, vitality, social function, and mental health domain scores were significantly higher with tofacitinib: ≥ 3 mg BID versus placebo (p < 0.05). The proportion of patients achieving a clinically meaningful increase (≥ 2.5 points) from baseline was higher with all tofacitinib doses versus placebo in the SF-36 physical component score (p < 0.001), and was higher with ≥ 3 mg of tofacitinib BID versus placebo in the SF-36 mental component score (p < 0.05; Supplementary Table 2 to be found online at http://informahealthcare.com/doi/abs/10.3109/14397595.2014.995875).\n\nChange in FACIT-F scores from baseline to week 12 were significantly greater (improved) in all tofacitinib groups versus placebo; mean score change (standard error): 2.51 (0.97), 5.44 (1.00), 7.52 (1.00), 8.51 (1.00), and 8.03 (0.97), with tofacitinib: 1, 3, 5, 10, and 15 mg BID, respectively, versus placebo –1.39 (1.01) (p < 0.01 for all tofacitinib doses vs placebo).\n\nExploratory subanalyses revealed significantly greater ACR20 response rates in patients receiving tofacitinib: ≥ 3 mg BID versus placebo at week 12 regardless of patient's age (18–44, 45–64, and ≥ 65 years), baseline DAS28-4(ESR) (score ≤ 5.1, > 5.1), and RA disease duration (< 2, ≥ 2 to < 7, ≥ 7 years). However, owing to low patient numbers in these subgroups, results must be interpreted with caution.\n\nSafety\nThe incidence of treatment-emergent AEs was similar across treatment groups, with a slight trend toward higher incidence with increasing tofacitinib dose (Table 2). Eight patients discontinued due to AEs. There were no deaths in the study.\n\nThe most common all-causality AEs (in ≥ 10% of patients) were nasopharyngitis and abnormalities in laboratory tests including hyperlipidemia and increased low-density lipoprotein cholesterol (LDL-C); most AEs (Table 3) were mild in severity. In 4 patients, 6 severe AEs were reported: gastric ulcer perforation and rheumatoid vasculitis in the tofacitinib: 3 mg BID group (1 patient each); a fall and fracture of fibula and tibia in 1 patient receiving tofacitinib: 5 mg BID; herpes zoster in 1 patient receiving tofacitinib: 10 mg BID (the multidermatomal rash was widespread and was recorded as a serious AE, see below). No opportunistic infections were reported, including tuberculosis. Nine patients had serious AEs, of whom six had serious events considered treatment-related. The serious AEs were elevated creatine kinase, AST, and ALT levels leading to hospitalization for evaluation (3 mg BID); gastric ulcer perforation (3 mg BID); rheumatoid vasculitis (3 mg BID); and herpes zoster and post-herpetic nerve paralysis considered by the investigator to be attributed to the herpes zoster (5 mg BID), herpes zoster (10 mg BID), and herpes zoster oticus/Ramsay Hunt syndrome (15 mg BID). All patients with serious AEs were withdrawn from the study, and all serious AEs resolved, apart from the herpes zoster oticus and rheumatoid vasculitis; both patients were still recovering at the last follow-up date (98 days and 163 days after study withdrawal, respectively; Supplementary Text to be found online at http://informahealthcare.com/doi/abs/10.3109/14397595.2014.995875).\n\nTable 3. Most common all-causality treatment-emergent AEs occurring in ≥ 2% patients in any of the treatment groups.\nAE, n (%)*\tTofacitinib\t\n1 mg BID (n = 53)\t3 mg BID (n = 53)\t5 mg BID (n = 52)\t10 mg BID (n = 53)\t15 mg BID (n = 54)\tPlacebo (n = 52)\t\nNasopharyngitis\t6 (11.3)\t4 (7.5)\t6 (11.5)\t3 (5.7)\t8 (14.8)\t6 (11.5)\t\nHyperlipidemia\t1 (1.9)\t0\t2 (3.8)\t6 (11.3)\t3 (5.6)\t0\t\nHeadache\t1 (1.9)\t3 (5.7)\t2 (3.8)\t1 (1.9)\t0\t1 (1.9)\t\nLDL-C increased\t0\t1 (1.9)\t0\t1 (1.9)\t6 (11.1)\t0\t\nALT increased\t0\t2 (3.8)\t0\t1 (1.9)\t1 (1.9)\t3 (5.8)\t\nConstipation\t1 (1.9)\t0\t1 (1.9)\t0\t3 (5.6)\t2 (3.8)\t\nPharyngitis\t0\t0\t0\t3 (5.7)\t2 (3.7)\t1 (1.9)\t\nStomatitis\t1 (1.9)\t1 (1.9)\t2 (3.8)\t1 (1.9)\t0\t1 (1.9)\t\nAbdominal discomfort\t2 (3.8)\t1 (1.9)\t0\t1 (1.9)\t0\t1 (1.9)\t\nAST increased\t0\t1 (1.9)\t0\t1 (1.9)\t0\t3 (5.8)\t\nBlood cholesterol increased\t0\t1 (1.9)\t1 (1.9)\t1 (1.9)\t2 (3.7)\t0\t\nFall\t3 (5.7)\t0\t1 (1.9)\t1 (1.9)\t0\t0\t\nHerpes zoster\t0\t0\t1 (1.9)\t3 (5.7)\t1 (1.9)\t0\t\nHypercholesterolemia\t0\t2 (3.8)\t0\t3 (5.7)\t0\t0\t\nBronchitis\t1 (1.9)\t1 (1.9)\t0\t2 (3.8)\t0\t0\t\nContusion\t2 (3.8)\t1 (1.9)\t0\t0\t1 (1.9)\t0\t\nDental caries\t0\t0\t2 (3.8)\t1 (1.9)\t0\t1 (1.9)\t\nGingivitis\t0\t1 (1.9)\t0\t0\t2 (3.7)\t1 (1.9)\t\nHypertension\t0\t0\t3 (5.8)\t1 (1.9)\t0\t0\t\nUpper respiratory tract infection\t0\t0\t1 (1.9)\t3 (5.7)\t0\t0\t\nDiarrhea\t1 (1.9)\t0\t0\t0\t0\t2 (3.8)\t\nGastritis\t0\t1 (1.9)\t0\t0\t2 (3.7)\t0\t\nRA\t0\t0\t0\t0\t0\t2 (3.8)\t\nUpper respiratory tract inflammation\t0\t0\t0\t0\t0\t2 (3.8)\t\n\nAE adverse event, ALT alanine transaminase, AST aspartate transaminase, BID twice daily, LDL-C low-density lipoprotein cholesterol.\n\n\n*Preferred terms according to Medical Dictionary for Regulatory Activities version 13.0.\n\nSignificant dose-dependent mean decreases in neutrophil and platelet counts, dose-dependent mean increases in LDL-C, high-density lipoprotein cholesterol (HDLC), and total cholesterol (TC) levels, and mean increases in hemoglobin and serum creatinine levels were observed with tofacitinib versus placebo (Table 4; Supplementary Figure 3 to be found online at http://informahealthcare.com/doi/abs/10.3109/14397595.2014.995875). Moderate-to-severe neutropenia (absolute neutrophil count [ANC] 500–1500/mm3) occurred in 2 patients receiving tofacitinib: 3 mg BID and 5 patients receiving 15 mg BID. None of the patients had potentially life-threatening neutropenia (ANC < 500/mm3). None of the patients had a platelet count < 75000/mm3. Across all groups, 74 patients (23.3%) had their absolute lymphocyte counts decrease to < 1000/mm3 (Table 4). Three patients in the 10 mg BID group had more severe reductions (< 500/mm3; Table 4); none of these patients experienced severe infections, and all three had low lymphocyte counts at baseline. One patient receiving tofacitinib: 1 mg BID had mild iron deficiency anemia that was deemed to be treatment-related. The patient receiving tofacitinib: 3 mg BID who had a gastric ulcer perforation was first discontinued from the study due to a decrease of > 30% from baseline in hematocrit level. The hemoglobin level recorded for this patient at discontinuation was 7.4 g/dL. No trends were seen in changes to hepatic enzymes. ALT or AST levels > 3 × ULN were observed in 3 patients receiving tofacitinib and 2 patients receiving placebo (Table 4). None of the patients were neutropenic at the last study date (Supplementary Text to be found online at http://informahealthcare.com/doi/abs/10.3109/14397595.2014.995875).\n\nTable 4. Mean changes in laboratory parameters from baseline at week 12.\nParameter Mean change\tTofacitinib\t\n1 mg BID\t3 mg BID\t5 mg BID\t10 mg BID\t15 mg BID\tPlacebo\t\nn = 51\tn = 49\tn = 50\tn = 49\tn = 52\tn = 48\t\nNeutrophils, × 103/mm3\t0.06\t–0.98‡\t–1.44‡§\t–2.10‡\t–1.66‡\t0.47\t\nHDL-C, mg/dL\t5.04†\t10.81‡\t17.73‡\t21.94‡\t21.11‡\t–0.94\t\nLDL-C, mg/dL\t3.21\t11.77†\t16.43‡\t21.45‡\t24.69‡\t–0.24\t\nTC, mg/dL\t11.52†\t25.44‡\t35.83‡\t50.35‡\t51.31‡\t–0.96\t\nHemoglobin, g/dL\t0.15*\t0.25†\t0.48‡§\t0.56‡\t0.19*\t–0.15\t\nSerum creatinine, mg/dL\t0.01\t0.02*\t0.04‡\t0.05‡\t0.06‡\t–0.01\t\nNo. of patients (%)\tn = 53\tn = 53\tn = 52\tn = 53\tn = 54\tn = 52\t\nLymphocytes, < 1000/mm3\t11 (20.8)\t6 (11.3)\t11 (21.2)\t12 (22.6)\t16 (29.6)\t18 (34.6)\t\nLymphocytes, < 500/mm3\t0\t0\t0\t3 (5.7)\t0\t0\t\nNeutrophils, < 500/mm3\t0\t0\t0\t0\t0\t0\t\nHemoglobin, decrease of 2–3 g/dL from baseline or hemoglobin < 8 g/dL\t0\t0\t0\t0\t0\t0\t\nAST or ALT > 3 × ULN\t1 (1.9)\t1 (1.9)\t0\t0\t1 (1.9)\t2 (3.8)\t\n\nALT alanine transaminase, AST aspartate transaminase, BID twice daily, HDL-C high-density lipoprotein cholesterol, LDL-C low-density lipoprotein cholesterol, TC total cholesterol, ULN upper limit of normal.\n\n*p < 0.05; †\np < 0.01; ‡\np < 0.001 versus placebo. §\nn = 49.\n\nDiscussion\nIn Japanese patients with active RA, of mean duration: 6.4–11.0 years across groups, and inadequate response to DMARDs, tofacitinib doses from 1 to 15 mg BID for 12 weeks demonstrated significant improvement in signs and symptoms of RA compared with placebo. Dose-related efficacy was demonstrated for all tofacitinib doses versus placebo by statistically significantly greater rates of patients achieving ACR20, ACR50, ACR70 (at tofacitinib: ≥ 5 mg BID), and DAS28-defined remission (at tofacitinib: ≥ 5 mg BID). Moreover, significant improvements in physical function and other patient-reported outcomes, such as HAQ-DI, SF-36 physical component scores, and FACIT-F scores, represent improvements in function and quality of life measures among patients receiving tofacitinib at all doses.\n\nThe incidence of patients experiencing treatment-emergent AEs was similar between treatment groups, with a trend toward higher incidence with increasing tofacitinib dose. Dose-dependent mean changes in laboratory parameters, including decreases in ANC and increases in hemoglobin, cholesterol, and serum creatinine, were also observed with tofacitinib. There were 3 serious AEs of herpes zoster/herpes zoster oticus, and 1 serious AE of rheumatoid vasculitis. Some of the cytokines that are inhibited by tofacitinib play an important role in lymphocyte development and function [28], which suggests that immunosurveillance may be negatively impacted by tofacitinib; however, in most patients no decrease in lymphocyte levels was seen and none of the patients were neutropenic.\n\nThe efficacy of tofacitinib monotherapy was similar to a previously published clinical trial of tofacitinib with background methotrexate in 136 Japanese patients with active RA [22], in which 12-week ACR20 response rates (NRI) were 60.7–88.9% with 1–10 mg BID versus 14.3% with placebo (p < 0.0001 for all doses). Similar to the present study, nasopharyngitis was the most common AE. In that study, increases in serum creatinine were reported with tofacitinib versus placebo; the serum creatinine increases in the Tanaka et al.'s study and the present study were not considered clinically meaningful. That study also reported elevated levels of AST and ALT in all groups (including placebo), suggesting that the background methotrexate may have contributed to the elevated transaminase levels.\n\nTofacitinib efficacy was also similar to previously published RCTs of tofacitinib in global studies of patients with RA [29–31]. The global phase 2b study of tofacitinib monotherapy in 384 treated patients reported significantly greater 12-week ACR20 response rates of 39.2–71.9% (NRI) with doses of 315 mg BID versus 22.0% with placebo [29]. In addition, a global phase 3 study of tofacitinib monotherapy in 610 treated patients reported significantly greater 3-month ACR20 response rates of 59.8% and 65.7% with tofacitinib: 5 mg BID and 10 mg BID, respectively, versus 26.7% with placebo [16]. The above studies reported similar AEs to the present study, including headache, diarrhea, nausea, nasopharyngitis, upper respiratory tract infection, and urinary tract infection. One case of disseminated herpes zoster was reported in the global phase 3 study [16]. A similar percentage of patients in the global monotherapy studies discontinued due to an AE (0–10.8%) [16,29] compared with the present study (0–5.7%). The studies above also reported elevated lipid levels and a slight increase in mean serum creatinine levels with tofacitinib, similar to the present study.\n\nIn this study, tofacitinib was associated with increased levels of LDL-C, HDL-C, and TC. IL-6 signaling is implicated in the regulation of cholesterol levels, and an anti-IL-6 receptor monoclonal antibody, tocilizumab, has also been associated with elevated lipid levels in patients with RA [32–34]. As the mode of action of tofacitinib includes inhibition of IL-6 signaling [28], the changes in cholesterol levels in response to tofacitinib in patients with RA may involve a degree of IL-6 inhibition; however, further studies will be required to confirm the mechanism behind these lipid changes.\n\nThis study was limited by the 12-week study period; a long-term extension study including patients from the present study has recently been completed to evaluate longer-term safety and efficacy of tofacitinib in Japanese patients (NCT00661661). In addition, this study did not assess radiographic progression, which could have provided further insight into the effect of treatment on the disease process.\n\nIn conclusion, tofacitinib produced dose-dependent improvements in signs and symptoms, and disease activity in Japanese patients with RA. The safety profile was consistent with that reported from global monotherapy trials and other studies in Japanese patients.\n\nSupplementary Material\nClick here for additional data file.\n\n Acknowledgments\nThis study was sponsored by Pfizer Inc. The authors would like to thank the patients who were involved in this study, and the A3921040 investigators and study team. The authors would like to acknowledge Makoto Suzuki and Keiko Yazawa for their valuable contribution to the study, and So Miyoshi who supported design-operating characteristics work on this study. Medical writing support was provided by Jonny Miller and Kate Silverthorne at Complete Medical Communications and was funded by Pfizer Inc.\n\nAppendix\nPrincipal study investigators\nRyutaro Matsumura, Shigeto Tohma, Masato Matsushita, Yoshiya Tanaka, Hisashi Yamanaka, Nobuyuki Miyasaka, Kouichi Amano, Hajime Yamagata, Shunsuke Mori, Eiichi Suematsu, Yasuhiko Munakata, Hide Yoshida, Katsumi Chiba, Yasushi Nawata, Akihiro Yamaguchi, Shigeru Honjyo, Yuji Yamanishi, Yoshinobu Koyama, Eisuke Shono, Tomomi Tsuru, Kiyoshi Migita, Yukitaka Ueki, Motohiro Oribe, Takao Sugiyama, Yojiro Kawabe, Shigenori Tamaki, Masakazu Kondo, Masaya Mukai, Atsushi Kaneko, Naoki Ishiguro, Tatsuya Atsumi, Kazuhide Tanimura, Kou Katayama, Takayuki Sumida, Mitchishi Tsukano, Mitsuru Sakaguchi, Seizo Yamana, Daisuke Kawabata, Atsushi Kawakami, Hajime Sano, Hiroshi Inoue, Tatsuo Hirose, Junji Chiba, Kenshi Higami, Teruaki Nakano, Yasuhiko Hirabayashi, Masato Yagita, Yutaka Kawahito, Takuya Sawabe.\n\n\nDisclosure: Data from this study were reported at congresses:\n\nACR 2011, Chicago, IL, USA, November 9, 2011: Tanaka Y, Takeuchi T, Yamanaka H, Suzuki M, Nakamura H, Toyoizumi S, et al. Tofacitinib (CP-690,550), an oral Janus kinase inhibitor, as monotherapy in Japanese patients with active rheumatoid arthritis: A 12-week phase 2b study. [abstract]. Arthritis Rheum 2011;63(Suppl 10):2192.\n\n55th Annual Meeting of the Japan College of Rheumatology, Kobe, Japan, July 19, 2011: Tanaka Y, Yamanaka H, Nakamura H, Takeuchi T. Study results of oral Jak inhibitor tasocitinib in pat\n\nConflict of interest\nY Tanaka has received consultancy fees, speaking fees, and honoraria from Abbvie, Chugai, Astellas, Takeda, Santen, MitsubishiTanabe, Pfizer, Janssen, Eisai, Daiichi-Sankyo, UCB Japan, GlaxoSmithKline, and Bristol-Myers-Squib.\n\nT Takeuchi has received consultancy fees, speaking fees, and honoraria from Abbott Japan, AbbVie, Asahi Kasei Medical, Astellas Pharma, AstraZeneca, Bristol-Myers Squibb, Chugai, Daiichi-Sankyo, Eisai, Eli Lilly Japan, Janssen Pharma, Mitsubishi Tanabe Pharma Corporation, Novartis, Pfizer, Symbio, Takeda, and UCB Japan.\n\nH Yamanaka has received consultancy fees, speaking fees, and honoraria from AbbVie, AstraZeneca, Bristol-Myers Squibb, Chugai, Daiichi-Sankyo, Eisai, Janssen Pharma, Mitsubishi Tanabe Pharma Corporation, Pfizer, and Takeda.\n\nH Nakamura and S. Toyoizumi are employees of Pfizer Japan Inc, Tokyo, Japan.\n\nS Zwillich is an employee of Pfizer Inc, Groton, USA.\n\nSupplementary material available online\n\nSupplementary Tables 1–2, Figures 1–3 and Supplementary Text.\n==== Refs\nReferences\nSmolen JS Aletaha D Bijlsma JW Breedveld FC Boumpas D Burmester G et al Treating rheumatoid arthritis to target: recommendations of an international task force Ann Rheum Dis 2010 69 (4) 631 7 20215140 \nSaag KG Teng GG Patkar NM Anuntiyo J Finney C Curtis JR et al American College of Rheumatology 2008 recommendations for the use of nonbiologic and biologic disease-modifying antirheumatic drugs in rheumatoid arthritis Arthritis Rheum 2008 59 (6) 762 84 18512708 \nStrand V Singh JA Improved health-related quality of life with effective disease-modifying antirheumatic drugs: evidence from randomized controlled trials Am J Manag Care 2007 13 (Suppl 9) S237 51 18095787 \nKoike R Harigai M Atsumi T Amano K Kawai S Saito K et al Japan College of Rheumatology 2009 guidelines for the use of tocilizumab, a humanized anti-interleukin-6 receptor monoclonal antibody, in rheumatoid arthritis Mod Rheumatol 2009 19 (4) 351 7 19590933 \nKoike R Takeuchi T Eguchi K Miyasaka N Update on the Japanese guidelines for the use of infliximab and etanercept in rheumatoid arthritis Mod Rheumatol 2007 17 (6) 451 8 18084695 \nMiyasaka N Takeuchi T Eguchi K Guidelines for the proper use of etanercept in Japan Mod Rheumatol 2006 16 (2) 63 7 16633923 \nLipsky PE van der Heijde DM St Clair EW Furst DE Breedveld FC Kalden JR et al Infliximab and methotrexate in the treatment of rheumatoid arthritis. Anti-tumor necrosis factor trial in rheumatoid arthritis with concomitant therapy study group N Engl J Med 2000 343 (22) 1594 602 11096166 \nWeinblatt ME Kremer JM Bankhurst AD Bulpitt KJ Fleischmann RM Fox RI et al A trial of etanercept, a recombinant tumor necrosis factor receptor: Fc fusion protein, in patients with rheumatoid arthritis receiving methotrexate N Engl J Med 1999 340 (4) 253 9 9920948 \nWeinblatt ME Keystone EC Furst DE Moreland LW Weisman MH Birbara CA et al Adalimumab, a fully human anti-tumor necrosis factor alpha monoclonal antibody, for the treatment of rheumatoid arthritis in patients taking concomitant methotrexate: the ARMADA trial Arthritis Rheum 2003 48 (1) 35 45 12528101 \nFinckh A Simard JF Gabay C Guerne PA Evidence for differential acquired drug resistance to anti-tumour necrosis factor agents in rheumatoid arthritis Ann Rheum Dis 2006 65 (6) 746 52 16339288 \nYamanaka H Seto Y Tanaka E Furuya T Nakajima A Ikari K et al Management of rheumatoid arthritis: the 2012 perspective Mod Rheumatol 2013 23 (1) 1 7 22772460 \nTanaka Y Yamaoka K JAK inhibitor tofacitinib for treating rheumatoid arthritis: from basic to clinical Mod Rheumatol 2012 23 415 24 23212593 \nTanaka Y Maeshima K Yamaoka K In vitro and in vivo analysis of a JAK inhibitor in rheumatoid arthritis Ann Rheum Dis 2012 71 (Suppl 2) i70 4 22460142 \nMeyer DM Jesson MI Li X Elrick MM Funckes-Shippy CL Warner JD et al Anti-inflammatory activity and neutrophil reductions mediated by the JAK1/JAK3 inhibitor, CP-690,550, in rat adjuvant-induced arthritis J Inflamm (Lond) 2010 7 (1) 41 20701804 \nRochman Y Spolski R Leonard WJ New insights into the regulation of T cells by γc family cytokines Nat Immunol Rev 2009 9 (7) 480 90 \nFleischmann R Kremer J Cush J Schulze-Koops H Connell CA Bradley JD et al Placebo-controlled trial of tofacitinib monotherapy in rheumatoid arthritis N Engl J Med 2012 367 (6) 495 507 22873530 \nKremer JM Li ZG Hall S Fleischmann R Genovese M Martin-Mola E et al Tofacitinib (CP-690,550), an oral JAK inhibitor, in combination with traditional DMARDS: Phase 3 study in patients with active rheumatoid arthritis with inadequate response to DMARDs Ann Rheum Dis 2011 70 (Suppl 3) 170 \nLee EB Fleischmann RM Hall S van Vollenhoven RF Bradley J Gruben D et al Radiographic, clinical and functional comparison of tofacitinib monotherapy versus methotrexate in methotrexate-nave patients with rheumatoid arthritis Arthritis Rheum 2012 64 (Suppl 10) S1049 \nBurmester GR Blanco R Charles-Schoeman C Wollenhaupt J Zerbini C Benda B et al Tofacitinib (CP-690,550) in combination with methotrexate in patients with active rheumatoid arthritis with an inadequate response to tumour necrosis factor inhibitors: a randomised phase 3 trial Lancet 2013 381 (9865) 451 60 23294500 \nvan Vollenhoven RF Fleischmann R Cohen S Lee EB García Meijide JA Wagner S et al Tofacitinib or adalimumab versus placebo in rheumatoid arthritis N Engl J Med 2012 367 (6) 508 19 22873531 \nvan der Heijde D Tanaka Y Fleischmann R Keystone E Kremer J Zerbini C et al Tofacitinib (CP-690,550) in patients with rheumatoid arthritis receiving methotrexate: twelve-month data from a twenty-four-month phase III randomized radiographic study Arthritis Rheum 2013 65 (3) 559 70 23348607 \nTanaka Y Suzuki M Nakamura H Toyoizumi S Zwillich SH Phase II study of tofacitinib (CP-690,550) combined with methotrexate in patients with rheumatoid arthritis and an inadequate response to methotrexate Arthritis Care Res (Hoboken) 2011 63 (8) 1150 8 21584942 \nArnett FC Edworthy SM Bloch DA McShane DJ Fries JF Cooper NS et al The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis Arthritis Rheum 1988 31 (3) 315 24 3358796 \nGupta P Alvey C Wang R Dowty ME Fahmi OA Walsky RL et al Lack of effect of tofacitinib (CP-690,550) on the pharmacokinetics of the CYP3A4 substrate midazolam in healthy volunteers: confirmation of in vitro data Br J Clin Pharmacol 2012 74 (1) 109 15 22233204 \nRadboud University Nijmegen Medical Centre DAS-score.nl: Disease activity score in rheumatoid arthritis http://www.das-score.nl \nFries JF Spitz PW Young DY The dimensions of health outcomes: the health assessment questionnaire, disability and pain scales J Rheumatol 1982 9 (5) 789 93 7175852 \nCella D Yount S Sorensen M Chartash E Sengupta N Grober J Validation of the functional assessment of chronic illness therapy fatigue scale relative to other instrumentation in patients with rheumatoid arthritis J Rheumatol 2005 32 (5) 811 9 15868614 \nGhoreschi K Jesson MI Li X Lee JL Ghosh S Alsup JW et al Modulation of innate and adaptive immune responses by tofacitinib (CP-690,550) J Immunol 2011 186 (7) 4234 43 21383241 \nFleischmann R Cutolo M Genovese MC Lee EB Kanik KS Sadis S et al Phase IIb dose-ranging study of the oral JAK inhibitor tofacitinib (CP-690,550) or adalimumab monotherapy versus placebo in patients with active rheumatoid arthritis with an inadequate response to disease-modifying antirheumatic drugs Arthritis Rheum 2012 64 (3) 617 29 21952978 \nKremer JM Cohen S Wilkinson BE Connell CA French JL Gomez-Reino J et al A phase IIb dose-ranging study of the oral JAK inhibitor tofacitinib (CP-690,550) versus placebo in combination with background methotrexate in patients with active rheumatoid arthritis and an inadequate response to methotrexate alone Arthritis Rheum 2012 64 (4) 970 81 22006202 \nKremer JM Bloom BJ Breedveld FC Coombs JH Fletcher MP Gruben D et al The safety and efficacy of a JAK inhibitor in patients with active rheumatoid arthritis: results of a double-blind, placebo-controlled phase IIa trial of three dosage levels of CP-690,550 versus placebo Arthritis Rheum 2009 60 (7) 1895 905 19565475 \nKawashiri SY Kawakami A Yamasaki S Imazato T Iwamoto N Fujikawa K et al Effects of the anti-interleukin-6 receptor antibody, tocilizumab, on serum lipid levels in patients with rheumatoid arthritis Rheumatol Int 2011 31 (4) 451 6 20024554 \nKoike T Harigai M Inokuma S Ishiguro N Ryu J Takeuchi T et al Postmarketing surveillance of tocilizumab for rheumatoid arthritis in Japan: interim analysis of 3881 patients Ann Rheum Dis 2011 70 (12) 2148 51 21852254 \nNishimoto N Miyasaka N Yamamoto K Kawai S Takeuchi T Azuma J Kishimoto T Study of active controlled tocilizumab monotherapy for rheumatoid arthritis patients with an inadequate response to methotrexate (SATORI): significant reduction in disease activity and serum vascular endothelial growth factor by IL-6 receptor inhibition therapy Mod Rheumatol 2009 19 (1) 12 19 18979150\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "1439-7595", "issue": "25(4)", "journal": "Modern rheumatology", "keywords": "Japan; Monotherapy; Randomized controlled trial; Rheumatoid arthritis; Tofacitinib", "medline_ta": "Mod Rheumatol", "mesh_terms": "D000328:Adult; D000368:Aged; D018501:Antirheumatic Agents; D001172:Arthritis, Rheumatoid; D004311:Double-Blind Method; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D053616:Janus Kinase 3; D007564:Japan; D008297:Male; D008875:Middle Aged; D010880:Piperidines; D047428:Protein Kinase Inhibitors; D011743:Pyrimidines; D011758:Pyrroles; D013997:Time Factors; D016896:Treatment Outcome", "nlm_unique_id": "100959226", "other_id": null, "pages": "514-21", "pmc": null, "pmid": "25496464", "pubdate": "2015-07", "publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't", "references": "18095787;18979150;15868614;20024554;22772460;22873531;7175852;23212593;19565475;18084695;12528101;21584942;23294500;11096166;18512708;16339288;16633923;20701804;21852254;22460142;21383241;20215140;22006202;21952978;19590933;23348607;9920948;3358796;19543225;22233204;22873530", "title": "Efficacy and safety of tofacitinib as monotherapy in Japanese patients with active rheumatoid arthritis: a 12-week, randomized, phase 2 study.", "title_normalized": "efficacy and safety of tofacitinib as monotherapy in japanese patients with active rheumatoid arthritis a 12 week randomized phase 2 study" }
[ { "companynumb": "JP-PFIZER INC-2009280258", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "TOFACITINIB CITRATE" }, "drugadditional": null...
{ "abstract": "Mucopolysaccharidoses (MPS) types I, II and VI are associated with deficiencies in alpha-L-iduronidase, iduronate-2-sulfatase and N-acetylgalactosamine-4-sulfatase, respectively, and generally involve progressive and multi-systemic clinical manifestations. Enzyme replacement therapy (ERT) appears to be reasonably well tolerated. The aim of this study was to examine clinical and diagnostic findings of a series of pediatric and adult MPS patients, and assess the safety and efficacy of ERT in children and adults with MPS type I, II and VI. Pediatric and adult patients were treated weekly with 1 mg/kg recombinant human N-acetylgalactosamine-4-sulphatase (rhASB), 0.45 mg/kg alpha-L-iduronidase, or 0.5 mg/kg iduronate-2-sulfatase. Clinical and biochemical parameters with ERT were evaluated for a mean duration of 5 years. Mantel-Haenszel risk ratios and associated 95% confidence intervals (CIs) were calculated for rates of death among different types of enzyme replacement therapies (ERTs). Twenty-seven patients (mean ages ‒ pediatric: 6.8 years; adult: 29 years) were included. ERT was found to be consistently well tolerated and effective in attenuating symptoms, but did not prevent the progression of the disease or reduce mortality rates. Our findings demonstrated that early diagnosis and initiation of ERT are critical for improvements in patient-important outcomes and quality of life, although disease progression and mortality rates remain high.", "affiliations": "Pediatric Department, Catholic University - PUC, Campinas, Brazil.;Institute of Science and Technology, Department of Biosciences and Oral Diagnosis, Unesp - Univ Estadual Paulista, São José dos Campos, Brazil.;Department of Health Research Methods, Evidence, and Impact, McMaster University, Hamilton, Ontario, Canada.;Genetics Unit of the Pediatrics Department, Children's Institute, University of São Paulo, SP, Brazil.;Institute of Science and Technology, Department of Biosciences and Oral Diagnosis, Unesp - Univ Estadual Paulista, São José dos Campos, Brazil.;Genetics Unit of the Pediatrics Department, Children's Institute, University of São Paulo, SP, Brazil.;Genetics Unit of the Pediatrics Department, Children's Institute, University of São Paulo, SP, Brazil.", "authors": "Franco|José Francisco da Silva|JFDS|;El Dib|Regina|R|;Agarwal|Arnav|A|;Soares|Diogo|D|;Milhan|Noala Vicensoto Moreira|NVM|;Albano|Lilian Maria José|LMJ|;Kim|Chong Ae|CA|", "chemical_list": null, "country": "Japan", "delete": false, "doi": "10.5582/irdr.2017.01036", "fulltext": null, "fulltext_license": null, "issn_linking": "2186-3644", "issue": "6(3)", "journal": "Intractable & rare diseases research", "keywords": "Lysosomal storage disorders; glycosaminoglycans; prognosis; treatment", "medline_ta": "Intractable Rare Dis Res", "mesh_terms": null, "nlm_unique_id": "101586847", "other_id": null, "pages": "183-190", "pmc": null, "pmid": "28944140", "pubdate": "2017-08", "publication_types": "D016428:Journal Article", "references": "24688287;20385007;17458871;24388732;17671068;20676532;25834948;27033167;17336562;21233716;15126990;17606547;25231261;24675674;17391447;15126981;22127392;3140740;8111411;15126989;26943923;12559846", "title": "Mucopolysaccharidosis type I, II and VI and response to enzyme replacement therapy: Results from a single-center case series study.", "title_normalized": "mucopolysaccharidosis type i ii and vi and response to enzyme replacement therapy results from a single center case series study" }
[ { "companynumb": "BR-BIOMARINAP-BR-2017-115528", "fulfillexpeditecriteria": "1", "occurcountry": "BR", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "GALSULFASE" }, "drugadditional": null, ...
{ "abstract": "Chest wall involvement from lung malignancy presents technical challenges for a minimally invasive surgical approach. Recently, new thoracoscopic rib cutting instrumentation has been developed and may offer a safe and efficient resection. Compared with thoracotomy, thoracoscopic lung and chest wall resection may potentially lower the morbidity associated with chest wall resection by thoracotomy. We present a case of thoracoscopic lobectomy with an en bloc chest wall resection.", "affiliations": "From the Department of Thoracic Surgery, Roswell Park Cancer Institute, Buffalo, NY.", "authors": "Yendamuri|Sai|S|;Nwogu|Chukwumere E|CE|;Demmy|Todd L|TL|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1097/IMI.0b013e3181987ae8", "fulltext": null, "fulltext_license": null, "issn_linking": "1556-9845", "issue": "4(1)", "journal": "Innovations (Philadelphia, Pa.)", "keywords": null, "medline_ta": "Innovations (Phila)", "mesh_terms": null, "nlm_unique_id": "101257528", "other_id": null, "pages": "36-8", "pmc": null, "pmid": "22436902", "pubdate": "2009-01", "publication_types": "D016428:Journal Article", "references": null, "title": "Thoracoscopic lobectomy with chest wall resection after neoadjuvant therapy.", "title_normalized": "thoracoscopic lobectomy with chest wall resection after neoadjuvant therapy" }
[ { "companynumb": "US-PFIZER INC-202200733708", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "HEPARIN SODIUM" }, "drugadditional": "3", ...
{ "abstract": "A 79-year-old man with underlying alcoholic liver cirrhosis presented with complaints of a fever, abdominal pain, and difficulty walking. A diagnostic work-up revealed liver atrophy and chylous ascites, and spontaneous bacterial peritonitis (SBP) was diagnosed based on the cell and neutrophil counts. The Burkholderia cepacia complex (Bcc) was detected on blood and ascitic fluid cultures. Although broad-spectrum antibiotic therapy was initiated, the infection was difficult to control, and the patient died of multiple organ failure. Bcc is often multidrug-resistant and difficult to treat. SBP caused by Bcc has been rarely reported and may have a serious course, thus necessitating caution.", "affiliations": "Department of Gastroenterology, Tokyo-Kita Medical Center, Japan.;Department of Gastroenterology, Tokyo-Kita Medical Center, Japan.;Department of Gastroenterology, Tokyo-Kita Medical Center, Japan.;Department of Gastroenterology, Tokyo-Kita Medical Center, Japan.;Department of Gastroenterology, Tokyo-Kita Medical Center, Japan.;Department of Gastroenterology, Tokyo-Kita Medical Center, Japan.;Department of Gastroenterology, Tokyo-Kita Medical Center, Japan.;Department of Gastroenterology, Tokyo-Kita Medical Center, Japan.;Department of Gastroenterology, Tokyo-Kita Medical Center, Japan.;Department of Gastroenterology, Tokyo-Kita Medical Center, Japan.;Department of Gastroenterology, Tokyo-Kita Medical Center, Japan.;Department of Gastroenterology, Tokyo-Kita Medical Center, Japan.", "authors": "Hamahata|Arisa|A|;Mitsusada|Seiya|S|;Iwata|Tomoyuki|T|;Nakajima|Ken|K|;Ogawa|Yuki|Y|;Miyazaki|Akira|A|;Kobayashi|Marina|M|;Fujiwara|Yushi|Y|;Asano|Yu|Y|;Mabuchi|Kazuhisa|K|;Yoshida|Miki|M|;Misawa|Ayako|A|", "chemical_list": null, "country": "Japan", "delete": false, "doi": "10.2169/internalmedicine.7170-21", "fulltext": "\n==== Front\nIntern Med\nIntern Med\nInternal Medicine\n0918-2918\n1349-7235\nThe Japanese Society of Internal Medicine\n\n33994438\n10.2169/internalmedicine.7170-21\nCase Report\nLiver Cirrhosis Complicated by Spontaneous Bacterial Peritonitis Caused by the Burkholderia cepacia Complex\nHamahata Arisa 1\nMitsusada Seiya 1\nIwata Tomoyuki 1\nNakajima Ken 1\nOgawa Yuki 1\nMiyazaki Akira 1\nKobayashi Marina 1\nFujiwara Yushi 1\nAsano Yu 1\nMabuchi Kazuhisa 1\nYoshida Miki 1\nMisawa Ayako 1\n1 Department of Gastroenterology, Tokyo-Kita Medical Center, Japan\nCorrespondence to Dr. Seiya Mitsusada, seiyami@jadecom.com\n\n14 5 2021\n1 11 2021\n60 21 34353440\n26 1 2021\n23 3 2021\nCopyright © 2021 by The Japanese Society of Internal Medicine\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ The Internal Medicine is an Open Access journal distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).\nA 79-year-old man with underlying alcoholic liver cirrhosis presented with complaints of a fever, abdominal pain, and difficulty walking. A diagnostic work-up revealed liver atrophy and chylous ascites, and spontaneous bacterial peritonitis (SBP) was diagnosed based on the cell and neutrophil counts. The Burkholderia cepacia complex (Bcc) was detected on blood and ascitic fluid cultures. Although broad-spectrum antibiotic therapy was initiated, the infection was difficult to control, and the patient died of multiple organ failure. Bcc is often multidrug-resistant and difficult to treat. SBP caused by Bcc has been rarely reported and may have a serious course, thus necessitating caution.\n\nBurkholderia cepacia complex\nmultidrug-resistant bacteria\nspontaneous bacterial peritonitis (SBP)\nliver cirrhosis\n==== Body\npmcIntroduction\n\nThe Burkholderia cepacia complex (Bcc) is a collective term for a group of ≥20 Gram-negative bacilli found in the natural environment. This bacterial group causes fatal respiratory infections particularly in patients with cystic fibrosis (CF) and is often implicated in opportunistic infections (1). It has rarely been detected as a pathogen for spontaneous bacterial peritonitis (SBP) complicating liver cirrhosis (2). Of note, Bcc is intrinsically resistant to many antibiotics, and its infection follows a serious course characterized by septic shock and renal failure (3).\n\nWe herein report a case of SBP caused by a bacterial species requiring attention.\n\nCase Report\n\nPatient: A 79-year-old man.\n\nChief complaint: A fever, abdominal pain, and difficulty walking\n\nMedical history: Alcoholic liver cirrhosis, diabetes mellitus, hypertension, and atrial fibrillation\n\nLife history: Alcohol drinker (43 g/day)\n\nHistory of present illness: In addition to the above complaints, the patient had also developed anorexia, abdominal pain, and generalized pain five days before admission. The patient had a fever and gradually became unable to take food orally, with walking also proving difficult. He was subsequently transferred to our hospital by ambulance.\n\nState of illness at admission: The patient's height and body weight were 159 cm and 51.7 kg, respectively. The level of consciousness was Japan Coma Scale-0. His blood pressure was 125/67 mmHg. The pulse rate was 146 beats/min and regular. His body temperature was 38.5℃. There was no pallor in the palpebral conjunctiva, although icterus was detected in the bulbar conjunctiva. The cardiac and respiratory sounds were normal. Superficial lymph nodes were not palpable. The abdomen was flat and hard, and there was tenderness throughout the abdomen from the upper right abdomen to the midline as the strongest point. The liver was not palpable. No pedal edema was noted.\n\nRegarding the hematological findings on admission (Table 1), although there was no clear elevation in the white blood cell count, the C-reactive protein (CRP) level was 22.3 mg/dL, revealing an elevated inflammatory response. Renal dysfunction was noted with a creatinine level of 2.76 mg/dL, urea nitrogen level of 60.3 mg/dL, and estimated glomerular filtration rate of 18.2 mL/min/1.73 m2. The albumin level was 2.2 g/dL. The total bilirubin level was 4.4 mg/dL. The prothrombin time was 34% (international normalized ratio: 1.67). The platelet count was 57,000/μL.\n\nTable 1. Blood Test Results on Admission.\n\nWBC\t\t3,090\t/μL\t\tBUN\t\t60.3\tmg/dL\t\nLymph\t\t2.0\t%\t\tCre\t\t2.76\tmg/dL\t\nStab\t\t26.0\t%\t\tCRP\t\t22.5\tmg/dL\t\nSeg\t\t48.0\t%\t\tFBS\t\t29\tmg/dL\t\nMyelo\t\t2.0\t%\t\tHbA1c\t\t7.6\t%\t\nMeta\t\t9.0\t%\t\t\t\t\t\t\nAtypi-Ly\t\t2.0\t%\t\tNa\t\t137\tmmol/L\t\nHb\t\t7.7\tg/dL\t\tK\t\t3.8\tmmol/L\t\nPlt\t\t5.7×104\t/μL\t\tCl\t\t99\tmmol/L\t\n\t\t\t\t\tCa\t\t8.6\tmmol/L\t\nAlb\t\t2.2\tg/dL\t\t\t\t\t\t\nLDH\t\t237\tU/L\t\tPT-sec\t\t18.9\tSec\t\nAST\t\t105\tU/L\t\tPT%\t\t34\t%\t\nALT\t\t127\tU/L\t\tPT-INR\t\t1.67\t\t\nALP\t\t138\tU/L\t\tAPTT\t\t46.6\tsec\t\nγGTP\t\t168\tU/L\t\tFib\t\t291\tmg/dL\t\nT-Bil\t\t4.4\tmg/dL\t\tDdimer\t\t10,4\tμg/mL\t\nThe hemoglobin level and platelet counts were decreased. The hepatobiliary deviation enzyme levels were elevated. Renal dysfunction was detected. Elevated inflammatory responses, abnormal coagulation test values, and an elevated lactate level were also noted.\n\nWBC: white blood cell, lymph: lymphocyte, stab: stab cell, seg: segmented cell, Myelo: myelocyte, Meta: metamyelocyte, Atypi-Ly: atypical, lymphocyte, Hb: hemoglobin, Plt: platelet, Alb: albumin, LDH: lactate, dehydrogenase, AST: aspartate aminotransferase, ALT: alanine aminotransferase, ALP: alkaline phosphatase, γGTP: γ-Glutamyl TransPeptidase, T-Bil: total bilirubin, BUN: blood urea nitrogen, Cre: creatine, CRP: C-reactive protein, FBS: fasting blood sugar, HbA1c: hemoglobin A1c, PT-sec: prothrombin time-second, PT%: prothrombin time %, PT-INR: prothrombin time-international normalized ratio, APTT: activated partial thromboplastin time, Fib: Fibrinogen\n\nOn abdominal plain computed tomography, the liver was found to be cirrhotic and atrophied with an irregular surface. Ascites and mild splenomegaly were noted. Neither abscess formation nor free air was noted (Fig. 1). The hepatic reserve was classified as Child-Pugh category C (13 points). The Model for End-Stage Liver Disease (MELD) score was 22.\n\nFigure 1. CT findings at the time of admission. There was fluid around the liver and spleen (ascites), and liver atrophy was noted. Neither free air nor abscess formation was noted.\n\nParacentesis was performed for ascites, and the ascitic fluid was found to be yellow and purulent with a cell count of 68,195/μL, comprising 80.9% neutrophils (Table 2), and the serum to ascites albumin gradient was 1.26, suggesting leaky ascites. Furthermore, bacterial bodies were confirmed by Gram staining (Fig. 2).\n\nTable 2. Ascites Test Results.\n\nAlbmin\t\t0.94\tg/dL\t\tCell count\t\t68,195\tμL\t\nLDH\t\t1,769\tIU/L\t\tNeut\t\t80.9\t%\t\nTotal cholesterol\t\t33\tmg/dL\t\tLymph\t\t2.0\t%\t\nSugar determination\t\t49\tmg/dL\t\tMono\t\t13.8\t%\t\nProtein quantification\t\t1.95\tg/dL\t\tEos\t\t3.3\t%\t\nSpecific gravity\t\t1.025\t\t\tpH\t\t7.2\t\t\nRivalta\t\t(+)\t\t\t\t\t\t\t\nWhite blood cells in the ascites were increased. This result suggests SBP.\n\nLDH: lactate dehydrogenase, Neut: neutrophil, Lymph: lymphocyte, Mono: monocyte, Eos: eosinophil\n\nFigure 2. Hematoxylin and Eosin staining of ascites sample. The arrows indicate the Burkholderia cepacia complex.\n\nClinical course after admission: Based on the above results, SBP was diagnosed, and ceftriaxone (CTRX 2 g once daily) and human serum albumin 25% were initiated. However, the fever persisted, and the white blood cell count increased. On hospital day 3, Bcc was detected by blood culture. The antibiotic was switched to meropenem (MEPM 0.5 g twice daily) (Table 3). However, the white blood cell count remained elevated. On hospital day 6, because the drug sensitivity test of the ascitic fluid suggested that the bacteria might be resistant to MEPM, trimethoprim-sulfamethoxazole (ST 160 mg every 8 h) combination was added (Table 4). The patient still poorly responded to treatment; thus, MEPM was switched to levofloxacin (250 mg once daily) on hospital day 8.\n\nTable 3. Results of the Sensitivity Test of Burkholderia Cepacia (Blood Culture).\n\nDrug\t\tMIC* (μg/mL)\t\tResult\t\tDrug\t\tMIC* (μg/mL)\t\tResult\t\nampicillin\t\t4\t\tR\t\tmeropenem\t\t≤0.25\t\tS\t\npiperacillin\t\t64\t\tR\t\taztreonam\t\t16\t\tI\t\nSBT/ABPC**\t\t≤2\t\tR\t\tgentamaicin\t\t8\t\tI\t\nTAZ/PIPC***\t\t≤4\t\tR\t\tamikacin\t\t16\t\tS\t\ncefazolin\t\t≥64\t\tR\t\tminomaicin\t\t≤1\t\tS\t\ncefmetazole\t\t≥64\t\tR\t\tlevofloxacin\t\t1\t\tS\t\nceftriaxone\t\t≤1\t\tR\t\tciprofloxacin\t\t1\t\tS\t\nceftazidime\t\t≤1\t\tR\t\tST****\t\t\t\tS\t\ncefepine\t\t≤1\t\tR\t\t\t\t\t\t\t\n*MIC: minimum inhibitory concentration. **SBT/ABPC: sulbactam/ampicillin.\n\n***TAZ/PIPC: poperacillin/tazobactam. ****ST: sulfamethoxazole/trimethoprim.\n\nTable 4. Results of the Sensitivity Test of Burkholderia Cepacia (Ascitic Fluid).\n\nDrug\t\tMIC* (μg/mL)\t\tResult\t\tDrug\t\tMIC* (μg/mL)\t\tResult\t\nampicillin\t\t≥32\t\tR\t\tmeropenem\t\t8\t\tI\t\npiperacillin\t\t≥128\t\tR\t\taztreonam\t\t≥64\t\tR\t\nSBT/ABPC**\t\t≥32\t\tR\t\tgentamaicin\t\t8\t\tI\t\nTAZ/PIPC***\t\t≥128\t\tR\t\tamikacin\t\t16\t\tS\t\ncefazolin\t\t≥64\t\tR\t\tminomaicin\t\t≤1\t\tS\t\ncefmetazole\t\t≥64\t\tR\t\tlevofloxacin\t\t1\t\tS\t\nceftriaxone\t\t≥64\t\tR\t\tciprofloxacin\t\t1\t\tS\t\nceftazidime\t\t16\t\tI\t\tST****\t\t\t\tS\t\ncefepine\t\t32\t\tR\t\t\t\t\t\t\t\n*MIC: minimum inhibitory concentration. **SBT/ABPC: sulbactam/ampicillin.\n\n***TAZ/PIPC: poperacillin/tazobactam. ****ST: sulfamethoxazole/trimethoprim.\n\nAlthough the fever and abdominal pain started to improve, abdominal distension owing to ascites worsened, and while the CRP levels decreased, the white blood cell count remained elevated (Fig. 3). During progress, the blood sugar passed in 200-300 mg/dL. Since renal dysfunction also progressed with time, dialysis was considered on hospital day 11. However, the patient was placed on observation without dialysis because of his poor general condition and at the request of his family. He ultimately died on hospital day 12. MEPM, ST, Levofloxacin, and albumin were continued until death (Fig. 3).\n\nFigure 3. Progress chart during hospitalization. Despite using broad-spectrum antibacterial drugs, although the CRP levels decreased, the white blood cell count remained elevated. CRP: C-reactive protein, WBC: white blood cell, BT: body temperature\n\nInformed consent was obtained by allowing opt-out on our website.\n\nDiscussion\n\nBcc was first reported in 1950 by Burkholde as a phytopathogenic bacterium causing onion to rot and was referred to as Pseudomonas cepacia (4). In 1992, it was classified under the Burkholderia genus based on 16S ribosomal RNA sequencing, DNA-DNA homology values, composition of cytoplasmic lipid and fatty acid, and phenotypic characteristics (5). In recent years, further genetic analyses have divided Bcc into at least 21 species (6). Because the applications of Bcc in the agricultural field are numerous, research on its pathogenicity and safety is continuously being conducted for each class and species based on genetic information.\n\nBcc is a group of glucose-nonfermenting aerobic Gram-negative bacilli that exist in moist natural environments, such as water, sewage, vegetables, and fruits. In the medical field, Bcc is an important pathogen in patients with CF, bronchiectasis, and a history of lung transplantation; it is also responsible for nosocomial infections through contaminated medical devices, such as catheters and disinfectant solutions (1,7,8). Generally, this bacterial group is rarely reported except in immunocompromised patients and those with CF (9). The present patient had diabetes mellitus, but a blood test by a previous doctor 2 months before admission showed an HbA1c of 7.0% and occasional glycemic level of 150 mg/dL, so his glycemic control was not bad.\n\nA previous study reported that Bcc was detected by positive ascitic fluid culture in 11 of 252 patients with SBP (4.3%) (3). However, commonly identified pathogens for SBP are Gram-negative bacilli (i.e. Escherichia coli and Klebsiella) and Gram-positive cocci (mainly streptococci and enterococci) (10). Bcc is often drug-resistant and intrinsically resistant to antibiotics, including aminoglycosides, first- and second-generation cephalosporins, synthetic penicillin, and polymyxins (11), as Bcc bacteria have a gene inducing β-lactamase that confers resistance to β-lactam antibiotics by altering penicillin-binding proteins and efflux pumps (3). The sensitivity and treatment of Bcc have been reported in immunocompromised patients and others in real-world clinical practice. In a report of patients infected with Bcc during the treatment of hematologic conditions, Bcc was found to be sensitive to imipenem in all patients, and their blood culture results became negative within 3 days of treatment with cefoperazone-sulbactam or piperacillin-tazobactam (12). In a cohort study that followed up non-CF patients positive for Bcc for 17 years, 94% and 88% of Bcc isolates were sensitive to trimethoprim-sulfamethoxazole and fluoroquinolones, respectively, whereas approximately 70% of the isolates were sensitive to ceftazidime and MEPM. The most frequently used antimicrobial agents in that cohort study were quinolone antimicrobial agents, followed by carbapenem antibiotics, ST combination, and ceftazidime. The study concluded that there was no marked difference in the prognosis, regardless of the antimicrobial agents, as long as an effective antimicrobial agent was selected (in vitro) (9).\n\nAlthough there have been a few reports of Bcc isolated from patients with SBP, a report of 11 cases indicated that Bcc was sensitive to cotrimoxazole and MEPM and resistant to CTRX, ceftazidime, cefepime, cefotaxime, and colistin (3). Another case report showed that patients survived after two weeks of treatment with MEPM (13). In general, the early use of antibiotics is recommended because the SBP prognosis is poor even with culture results being unknown. Third-generation cephalosporins are the first choice (14). In recent years, however, the spread of multidrug-resistant bacterial infections has reduced the efficacy of commonly used antibiotics, including third-generation cephalosporins (15). The selection of initial antibiotics should be adjusted according to the presence of risk factors for multidrug-resistant bacterial infection and the severity of infection, and regional epidemiology should also be considered. In a population at high risk for multidrug-resistant bacterial infections, empirical treatment requires the use of broad-spectrum antibiotics (carbapenem or tigecycline) and drugs with known activity against resistant bacteria. An early de-escalation strategy is recommended (16). Based on the above findings, infection with Bcc should be treated with carbapenem, ST combination, quinolones, tetracycline, and chloramphenicol.\n\nAccording to a systematic review, the mortality rate of SBP patients is 31.5% at 1 month and 66.2% at 12 months, and the mortality rate of patients with bacteremia is 42.2% (17). Factors determining the prognosis of patients with SBP include renal dysfunction, the MELD score, refractoriness to treatment, immunologic suppressor factors, and nosocomial SBP (18). Patients with liver cirrhosis who develop SBP are at risk of developing renal failure (19). However, renal failure, which occurs even after treatment with appropriate antibiotics, may be caused by excessive inflammatory responses of the host or hemodynamic changes associated with sepsis, instead of tissue damage directly caused by the bacteria (20). In a study including the largest number of patients with SBP caused by Bcc, 10 of 11 patients developed acute kidney injury, and 8 of 11 patients died of sepsis or multiple organ failure (3). This suggests that infection with Bcc is likely to be complicated by fatal conditions, such as renal failure, and multidrug resistance of Bcc is not the only issue to be considered. Thus, Bcc may be a bacterial group that is likely to cause sepsis associated with excessive inflammatory responses and hemodynamic changes in the host.\n\nIn the present case, the Cre value of 1.16 mg/dL (blood test at the previous doctor) increased sharply to 2.7 mg/dL within 2 months before admission. In addition, the patient was in septic shock at the time of admission. These findings suggest that the main cause of renal dysfunction at the time of admission in this patient was multiple organ failure associated with infectious disease. Furthermore, we cannot rule out the potential involvement of type 1 hepato-renal syndrome secondary to SBP in the exacerbation of the renal function after hospitalization.\n\nIn patients with liver cirrhosis, SBP is considered to be caused by enterobacterial proliferation and changes in the intestinal barrier owing to portal hypertension in addition to reticuloendothelial system dysfunction (21). Although many aspects of the association between intestinal microflora and Bcc in liver cirrhosis are unknown, they seem to be inter-related to an extent. Because Bcc cannot be killed by disinfectant solutions such as chlorhexidine (22), the possibility of infection from disinfectant solutions by multiple punctures has also been mentioned (13). In the present case, although the patient had been admitted to a previous hospital for treatment multiple times, we were unable to confirm whether or not ascites paracentesis had been performed at the previous hospital. In addition, this patient was unemployed at the time of admission (although he almost never went out), and we had no information on his previous occupation. Therefore, the route of infection was unknown.\n\nConclusion\n\nBecause Bcc is multidrug-resistant, its infection is likely to become serious and difficult to treat. Although reports of SBP caused by Bcc are rare, many describe SBP complicated by acute kidney injury. The first-choice drug for SBP is a third-generation cephem antibiotic. However, Bcc can be resistant to this drug, causing multiple organ failure and resulting in a high mortality rate. Our patient also had a serious clinical course. In clinical practice, caution should be exercised.\n\nThe authors state that they have no Conflict of Interest (COI).\n\nAcknowledgement\n\nWe thank Miyuki Isonishi, Department of Clinical Laboratory, Tokyo-Kita Medical Center, for providing expertise in the diagnosis.\n==== Refs\n1. Devanga Ragupathi NK , Veeraraghavan B . Accurate identification and epidemiological characterization of Burkholderia cepacia complex: an update. Annals Clin Microbiol Antimicrob 18 : 7, 2019.\n2. Fiore M , Maraolo AE , Gentile I , et al . Nosocomial spontaneous bacterial peritonitis antibiotic treatment in the era of multi-drug resistance pathogens: a systematic review. World J Gastroenterol 23 : 4654-4660, 2017.28740354\n3. Taneja S , Kumar P , Gautam V , et al . Spontaneous bacterial peritonitis by Burkholderia cepacia complex: a rare, difficult to treat infection in decompensated cirrhotic patients. J Clin Exp Hepatol 7 : 102-106, 2017.28663673\n4. WH B . Sour skin, a bacterial rot of onion bulbs. Phytopathology 40 : 115-117, 1950.\n5. Yabuuchi E , Kosako Y , Oyaizu H , et al . Proposal of Burkholderia gen. nov. and transfer of seven species of the genus Pseudomonas homology group II to the new genus, with the type species Burkholderia cepacia (Palleroni and Holmes 1981) comb. nov. Microbiol Immunol 36 : 1251-1275, 1992.1283774\n6. Furlan JPR , Pitondo-Silva A , Braz VS , Gallo IFL , Stehling EG . Evaluation of different molecular and phenotypic methods for identification of environmental Burkholderia cepacia complex. World J Microbiol Biotechnol 35 : 39, 2019.30739255\n7. Lipuma JJ . Update on the Burkholderia cepacia complex. Curr Opin Pulm Med 11 : 528-533, 2005.16217180\n8. Vandamme P , Dawyndt P . Classification and identification of the Burkholderia cepacia complex: past, present and future. Syst Appl Microbiol 34 : 87-95, 2011.21257278\n9. El Chakhtoura NG , Saade E , Wilson BM , Perez F , Papp-Wallace KM , Bonomo RA . A 17-year nationwide study of Burkholderia cepacia complex bloodstream infections among patients in the United States Veterans Health Administration. Clin Infect Dis 65 : 1253-1259, 2017.\n10. EASL clinical practice guidelines on the management of ascites, spontaneous bacterial peritonitis, and hepatorenal syndrome in cirrhosis. J Hepatol 53 : 397-417, 2010.20633946\n11. Sfeir MM . Burkholderia cepacia complex infections: More complex than the bacterium name suggest. J Infect 77 : 166-170, 2018.30012345\n12. Baul SN , De R , Mandal PK , Roy S , Dolai TK , Chakrabarti P . Outbreak of Burkholderia cepacia infection: a systematic study in a Hematolooncology unit of a tertiary care hospital from eastern India. Mediterr J Hematol Infectious Dis 10 : e2018051, 2018.30210744\n13. Mukhopadhyay C , Bhargava A , Ayyagari A . Two novel clinical presentations of Burkholderia cepacia infection. J Clin Microbiol 42 : 3904-3905, 2004.15297563\n14. Dever JB , Sheikh MY . Review article: spontaneous bacterial peritonitis-bacteriology, diagnosis, treatment, risk factors and prevention. Aliment Pharmacol Ther 41 : 1116-1131, 2015.25819304\n15. Piano S , Brocca A , Mareso S , Angeli P . Infections complicating cirrhosis. Liver Int 38 Suppl 1 : 126-133, 2018.\n16. Fernández J , Acevedo J . New antibiotic strategies in patients with cirrhosis and bacterial infection. Expert Rev Gastroenterol Hepatol 9 : 1495-1500, 2015.26465070\n17. Arvaniti V , D'Amico G , Fede G , et al . Infections in patients with cirrhosis increase mortality four-fold and should be used in determining prognosis. Gastroenterology 139 : 1246-1256, 1256.e1241, 2010.20558165\n18. Tandon P , Garcia-Tsao G . Renal dysfunction is the most important independent predictor of mortality in cirrhotic patients with spontaneous bacterial peritonitis. Clin Gastroenterol Hepatol 9 : 260-265, 2011.21145427\n19. Navasa M , Follo A , Filella X , et al . Tumor necrosis factor and interleukin-6 in spontaneous bacterial peritonitis in cirrhosis: relationship with the development of renal impairment and mortality. Hepatology 27 : 1227-1232, 1998.9581675\n20. Sort P , Navasa M , Arroyo V , et al . Effect of intravenous albumin on renal impairment and mortality in patients with cirrhosis and spontaneous bacterial peritonitis. N Engl J Med 341 : 403-409, 1999.10432325\n21. Ascione T , Di Flumeri G , Boccia G , De Caro F . Infections in patients affected by liver cirrhosis: an update. Infez Med 25 : 91-97, 2017.28603226\n22. Sobel JD , Hashman N , Reinherz G , Merzbach D . Nosocomial Pseudomonas cepacia infection associated with chlorhexidine contamination. Am J Med 73 : 183-186, 1982.7114074\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "0918-2918", "issue": "60(21)", "journal": "Internal medicine (Tokyo, Japan)", "keywords": "Burkholderia cepacia complex; liver cirrhosis; multidrug-resistant bacteria; spontaneous bacterial peritonitis (SBP)", "medline_ta": "Intern Med", "mesh_terms": "D000368:Aged; D001201:Ascites; D001202:Ascitic Fluid; D001424:Bacterial Infections; D042602:Burkholderia cepacia complex; D006801:Humans; D008103:Liver Cirrhosis; D008104:Liver Cirrhosis, Alcoholic; D008297:Male; D010538:Peritonitis", "nlm_unique_id": "9204241", "other_id": null, "pages": "3435-3440", "pmc": null, "pmid": "33994438", "pubdate": "2021-11-01", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "21145427;15297563;29017247;29427501;7114074;20633946;30012345;28603226;30739255;20558165;1283774;21257278;28663673;16217180;10432325;30210744;26465070;25819304;28740354;30717798;9581675", "title": "Liver Cirrhosis Complicated by Spontaneous Bacterial Peritonitis Caused by the Burkholderia cepacia Complex.", "title_normalized": "liver cirrhosis complicated by spontaneous bacterial peritonitis caused by the burkholderia cepacia complex" }
[ { "companynumb": "JP-PFIZER INC-PV202200003940", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "CEFTRIAXONE SODIUM" }, "drugadditional": "...