article dict | reports listlengths 1 3.97k |
|---|---|
{
"abstract": "BACKGROUND\nStevens-Johnson syndrome and toxic epidermal necrolysis are two serious immune diseases within the context of bullous mucocutaneous syndrome. These have varying degrees of involvement of the skin and usually at least two mucous membranes.\n\n\nMETHODS\nThree clinical cases are presented, two of them with significant ophthalmological sequelae, who had received drug treatment as a possible trigger, and another milder clinical case caused by Mycoplasma pneumoniae.\n\n\nCONCLUSIONS\nThe ophthalmologist plays a crucial role in the outcome and eye care of the patient in order to try to avoid the appearance of sequelae and subsequent loss of vision.",
"affiliations": "Servicio de Oftalmología, Hospital Infantil Universitario Niño Jesús, Madrid, España. Electronic address: Nataliablancocalvo@gmail.com.;Servicio de Oftalmología, Hospital Infantil Universitario Niño Jesús, Madrid, España.;Servicio de Oftalmología, Hospital Infantil Universitario Niño Jesús, Madrid, España.;Servicio de Oftalmología, Hospital Infantil Universitario Niño Jesús, Madrid, España.;Servicio de Oftalmología, Hospital Infantil Universitario Niño Jesús, Madrid, España.;Servicio de Oftalmología, Hospital Infantil Universitario Niño Jesús, Madrid, España.;Servicio de Dermatología, Hospital Infantil Universitario Niño Jesús, Madrid, España.;Servicio de Dermatología, Hospital Infantil Universitario Niño Jesús, Madrid, España.",
"authors": "Blanco|N|N|;Gutiérrez|B|B|;Valls|I|I|;Puertas|D|D|;Martín|C|C|;Rivera|M|M|;Hernández|Á|Á|;Torrelo|A|A|",
"chemical_list": "D000305:Adrenal Cortex Hormones; D000900:Anti-Bacterial Agents; D016756:Immunoglobulins, Intravenous; D007052:Ibuprofen",
"country": "Spain",
"delete": false,
"doi": "10.1016/j.oftal.2016.10.003",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0365-6691",
"issue": "92(5)",
"journal": "Archivos de la Sociedad Espanola de Oftalmologia",
"keywords": "Bullous mucocutaneous syndrome; Membranas mucosas; Mucous membranes; Mycoplasma pneumonia; Mycoplasma pneumoniae; Necrólisis epidérmica tóxica; Stevens Johnson syndrome; Síndrome Stevens Johnson; Síndrome mucocutáneo ampolloso; Toxic epidermal necrolysis",
"medline_ta": "Arch Soc Esp Oftalmol",
"mesh_terms": "D000305:Adrenal Cortex Hormones; D000900:Anti-Bacterial Agents; D001684:Biological Dressings; D002648:Child; D003131:Combined Modality Therapy; D003231:Conjunctivitis; D003318:Corneal Opacity; D003320:Corneal Ulcer; D015352:Dry Eye Syndromes; D004483:Ectropion; D015353:Eye Enucleation; D005260:Female; D006801:Humans; D007052:Ibuprofen; D016756:Immunoglobulins, Intravenous; D008297:Male; D011019:Pneumonia, Mycoplasma; D013262:Stevens-Johnson Syndrome",
"nlm_unique_id": "1304603",
"other_id": null,
"pages": "241-244",
"pmc": null,
"pmid": "27899204",
"pubdate": "2017-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Stevens-Johnson syndrome in childhood.",
"title_normalized": "stevens johnson syndrome in childhood"
} | [
{
"companynumb": "ES-JNJFOC-20180600645",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "IBUPROFEN"
},
"drugadditional": "3",
"d... |
{
"abstract": "For patients with attention deficit hyperactivity disorder and comorbid conduct-dissocial disorder, a combination therapy of the psychostimulant methylphenidate and the antipsychotic risperidone may be prescribed. Case reports describe the occurrence of movement disorders under this combination therapy, but clinical trials had limited power to detect these events. This study aimed (1) to summarise published case reports and (2) to analyse pharmacovigilance data consisting of adverse drug event reports to elucidate these reactions. PubMed, Embase, and APA PsycInfo were used to retrieve case reports. For the pharmacovigilance data, aggregated information on individual case safety reports (ICSRs) within the database of suspected adverse drug events by the WHO were analysed. ICSRs were assessed for disproportionality in reporting. Thirteen published case reports (62% male) on movement disorders were identified, with ages between 5 and 15 years. Seven reports (54%) described incidents when risperidone was tapered down or switched to methylphenidate. From the WHO, we identified 25,556 ICSRs (16,118 for methylphenidate, 8,614 for risperidone, and 824 for both). Of these, 953 (5.9%), 1356 (15.7%), and 159 (19.3%) ICSRs reported movement disorders in association with methylphenidate, risperidone or both, respectively. The analyses on disproportionality showed an increased number of ICSRs with movement disorders when the two drugs were coded in combination. The potential of movement disorders as adverse effects might be amplified when methylphenidate and risperidone are used in combination. The results from the literature underline the necessity of caution and patient monitoring when risperidone dosing is modified during methylphenidate therapy.",
"affiliations": "Pharmacoepidemiology, Department of Chemistry and Applied Biosciences, Institute of Pharmaceutical Sciences, ETH Zurich, Vladimir-Prelog-Weg 4, 8093, Zurich, Switzerland. dominik.staempfli@pharma.ethz.ch.;Pharmacoepidemiology, Department of Chemistry and Applied Biosciences, Institute of Pharmaceutical Sciences, ETH Zurich, Vladimir-Prelog-Weg 4, 8093, Zurich, Switzerland.;Pharmacoepidemiology, Department of Chemistry and Applied Biosciences, Institute of Pharmaceutical Sciences, ETH Zurich, Vladimir-Prelog-Weg 4, 8093, Zurich, Switzerland.",
"authors": "Stämpfli|Dominik|D|http://orcid.org/0000-0001-5293-134X;Weiler|Stefan|S|http://orcid.org/0000-0003-1087-7597;Burden|Andrea M|AM|http://orcid.org/0000-0001-7082-8530",
"chemical_list": "D008774:Methylphenidate; D018967:Risperidone",
"country": "Germany",
"delete": false,
"doi": "10.1007/s00787-020-01589-2",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1018-8827",
"issue": "30(7)",
"journal": "European child & adolescent psychiatry",
"keywords": "Attention deficit hyperactivity disorder; Conduct-dissocial disorder; Dyskinesia; Methylphenidate; Movement disorder; Risperidone",
"medline_ta": "Eur Child Adolesc Psychiatry",
"mesh_terms": "D001289:Attention Deficit Disorder with Hyperactivity; D003131:Combined Modality Therapy; D015897:Comorbidity; D019955:Conduct Disorder; D016208:Databases, Factual; D006801:Humans; D008774:Methylphenidate; D009069:Movement Disorders; D060735:Pharmacovigilance; D018967:Risperidone; D014944:World Health Organization",
"nlm_unique_id": "9212296",
"other_id": null,
"pages": "1047-1058",
"pmc": null,
"pmid": "32621088",
"pubdate": "2021-07",
"publication_types": "D016428:Journal Article; D016454:Review",
"references": "22946905;14659983;20622942;24839998;29768038;23539465;15319021;11998548;15317031;17513979;15908830;26871198;17903675;25920038;25912546;11869410;8936904;7531353;23303075;7888935;25052742;21670395;18990122;19622511",
"title": "Movement disorders and use of risperidone and methylphenidate: a review of case reports and an analysis of the WHO database in pharmacovigilance.",
"title_normalized": "movement disorders and use of risperidone and methylphenidate a review of case reports and an analysis of the who database in pharmacovigilance"
} | [
{
"companynumb": "CH-KVK-TECH, INC-20210800108",
"fulfillexpeditecriteria": "1",
"occurcountry": "CH",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHYLPHENIDATE HYDROCHLORIDE"
},
"drugadd... |
{
"abstract": "Tocilizumab is a humanized antibody against the membrane and soluble receptors for interleukin-6. Tocilizumab is among the disease-modifying antirheumatic drugs (DMARDs) used to treat moderate-to-severe active rheumatoid arthritis (RA) refractory to conventional DMARDs. We report a case of macrophage activation syndrome that complicated acute hepatitis E and started within 24hours after the fourth tocilizumab infusion in a patient with RA.",
"affiliations": "Service de rhumatologie, hôpital Sud, CHU de Rennes, 16, boulevard de Bulgarie, BP90347, 35203 Rennes cedex 2, France.;Service de rhumatologie, hôpital Sud, CHU de Rennes, 16, boulevard de Bulgarie, BP90347, 35203 Rennes cedex 2, France. Electronic address: guillaume.coiffier@chu-rennes.fr.;Service de virologie, hôpital Pontchaillou, CHU de Rennes, 2, rue Henri-le-Guilloux, 35000 Rennes, France.;Service de pharmacologie et toxicologie, hôpital Pontchaillou, CHU de Rennes, 2, rue Henri-le-Guilloux, 35000 Rennes, France.;Service de rhumatologie, hôpital Sud, CHU de Rennes, 16, boulevard de Bulgarie, BP90347, 35203 Rennes cedex 2, France.;Service de rhumatologie, hôpital Sud, CHU de Rennes, 16, boulevard de Bulgarie, BP90347, 35203 Rennes cedex 2, France.",
"authors": "Leroy|Marie|M|;Coiffier|Guillaume|G|;Pronier|Charlotte|C|;Triquet|Louise|L|;Perdriger|Aleth|A|;Guggenbuhl|Pascal|P|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; C502936:tocilizumab",
"country": "France",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1297-319X",
"issue": "82(4)",
"journal": "Joint bone spine",
"keywords": "Acute hepatitis E; Macrophage activation syndrome; Rheumatoid arthritis; Tocilizumab",
"medline_ta": "Joint Bone Spine",
"mesh_terms": "D000208:Acute Disease; D000328:Adult; D061067:Antibodies, Monoclonal, Humanized; D001172:Arthritis, Rheumatoid; D005260:Female; D016751:Hepatitis E; D006801:Humans; D007262:Infusions, Intravenous; D055501:Macrophage Activation Syndrome; D012720:Severity of Illness Index",
"nlm_unique_id": "100938016",
"other_id": null,
"pages": "278-9",
"pmc": null,
"pmid": "25791259",
"pubdate": "2015-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Macrophage activation syndrome with acute hepatitis E during tocilizumab treatment for rheumatoid arthritis.",
"title_normalized": "macrophage activation syndrome with acute hepatitis e during tocilizumab treatment for rheumatoid arthritis"
} | [
{
"companynumb": "FR-ROCHE-1523196",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ETANERCEPT"
},
"drugadditional": null,
"dru... |
{
"abstract": "Recently, percutaneous microbiopsy needles have been used as a less invasive alternative to the Bergstrom needle for obtaining human skeletal muscle biopsy to assess changes in protein content, gene expression, and enzymatic activities. Unlike the Bergstrom muscle biopsy procedure, potential complications associated with microbiopsies of human skeletal muscle have not been documented. Therefore, the present case report follows a young male's recovery from a muscle biopsy-induced hemorrhage/hematoma of the right vastus lateralis with the specific aims of (1) informing future participants, researchers, and clinicians on expected time course of recovery and (2) informing methods to minimize future participant adverse event risk during and after the percutaneous microbiopsy procedure. The present case report demonstrates that the inadvertent hemorrhaging of a neighboring vessel by percutaneous microbiopsy procedure can be debilitating. To minimize the risk of muscle biopsy-induced hemorrhage/hematoma, we advise post-biopsy compression for up to 15 min and post-biopsy follow-up should be completed for up to 72 h. When there is indication of hematoma development, compression should be applied, and the participant should avoid exercise and physical activity.",
"affiliations": "School of Kinesiology and Health Studies, Queen's University, Kingston, Ontario, Canada.;School of Kinesiology and Health Studies, Queen's University, Kingston, Ontario, Canada.;School of Medicine, Queen's University, Kingston, Ontario, Canada.;School of Kinesiology and Health Studies, Queen's University, Kingston, Ontario, Canada.",
"authors": "Drouin|Patrick J|PJ|https://orcid.org/0000-0001-7966-1319;Islam|Hashim|H|https://orcid.org/0000-0002-7145-0522;Simpson|Craig A|CA|;Gurd|Brendon J|BJ|https://orcid.org/0000-0002-4008-7927",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.14814/phy2.15038",
"fulltext": "\n==== Front\nPhysiol Rep\nPhysiol Rep\n10.1002/(ISSN)2051-817X\nPHY2\nphysreports\nPhysiological Reports\n2051-817X\nJohn Wiley and Sons Inc. Hoboken\n\n10.14814/phy2.15038\nPHY215038\nCase Report\nCase Report\nIntramuscular hematoma of the vastus lateralis following percutaneous skeletal muscle microbiopsy: a case report\nDROUIN et al.\nDrouin Patrick J. https://orcid.org/0000-0001-7966-1319\n1\nIslam Hashim https://orcid.org/0000-0002-7145-0522\n1\nSimpson Craig A. 2\nGurd Brendon J. https://orcid.org/0000-0002-4008-7927\n1 gurdb@queensu.ca\n\n1 School of Kinesiology and Health Studies Queen’s University Kingston Ontario Canada\n2 School of Medicine Queen’s University Kingston Ontario Canada\n* Correspondence\nBrendon J. Gurd, School of Kinesiology and Health Studies, Queen’s University, Kingston, ON, K7L 3N6, Canada.\nEmail: gurdb@queensu.ca\n\n11 10 2021\n10 2021\n9 19 10.1002/phy2.v9.19 e1503823 8 2021\n31 5 2021\n24 8 2021\n© 2021 The Authors. Physiological Reports published by Wiley Periodicals LLC on behalf of The Physiological Society and the American Physiological Society.\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.\n\nAbstract\n\nRecently, percutaneous microbiopsy needles have been used as a less invasive alternative to the Bergstrom needle for obtaining human skeletal muscle biopsy to assess changes in protein content, gene expression, and enzymatic activities. Unlike the Bergstrom muscle biopsy procedure, potential complications associated with microbiopsies of human skeletal muscle have not been documented. Therefore, the present case report follows a young male's recovery from a muscle biopsy‐induced hemorrhage/hematoma of the right vastus lateralis with the specific aims of (1) informing future participants, researchers, and clinicians on expected time course of recovery and (2) informing methods to minimize future participant adverse event risk during and after the percutaneous microbiopsy procedure. The present case report demonstrates that the inadvertent hemorrhaging of a neighboring vessel by percutaneous microbiopsy procedure can be debilitating. To minimize the risk of muscle biopsy‐induced hemorrhage/hematoma, we advise post‐biopsy compression for up to 15 min and post‐biopsy follow‐up should be completed for up to 72 h. When there is indication of hematoma development, compression should be applied, and the participant should avoid exercise and physical activity.\n\nThe present case report demonstrates that the inadvertent hemorrhaging of a neighboring vessel by percutaneous microbiopsy procedure can be debilitating. To minimize the risk of muscle biopsy‐induced hemorrhage/hematoma, post biopsy compression is recommended for up to 15 min and post biopsy follow‐up should be completed for up to 72 h.\n\ncase report\nhemorrhage\nintramuscular hematoma\nrecovery\nrisk mitigation\nskeletal muscle biopsy\nNatural Sciences and Engineering Research Council of Canada 10.13039/501100000038 402635 NSERC Alexander Graham Bell CGS Doctoral ScholarshipNSERC PGS‐D source-schema-version-number2.0\ncover-dateOctober 2021\ndetails-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.0.8 mode:remove_FC converted:11.10.2021\nDrouin, P. J. , Islam, H. , Simpson, C. A. , & Gurd, B. J. (2021). Intramuscular hematoma of the vastus lateralis following percutaneous skeletal muscle microbiopsy: a case report. Physiological Reports, 9 , e15038. 10.14814/phy2.15038\n\nFunding information\n\nThis project was supported by a discovery grant by the Natural Sciences and Engineering Research Council of Canada (NSERC) awarded to B.J.G (grant number: 402 635). P.J.D was funded by an NSERC Alexander Graham Bell CGS Doctoral Scholarship. H.I was funded by an NSERC PGS‐D.\n==== Body\npmc1 INTRODUCTION\n\nSkeletal muscle biopsies are commonly completed to assess changes in protein content (Egan et al., 2013; Little et al., 2010), gene expression (Islam et al., 2019; Mahoney et al., 2005), and enzymatic activities (Carter et al., 2001; MacDougall et al., 1998) in response to exercise. The procedure is typically performed using the Bergstrom needle biopsy technique (Ekblom, 2017; Shanely et al., 2014), which is relatively less invasive compared to the open biopsy method and has a minimal complication rate (see Tarnopolsky et al. (2011) for detailed statistics). Recently, percutaneous microbiopsy needles have been used as an alternative to the Bergstrom needle for obtaining human skeletal muscle biopsy (Hughes et al., 2015). Although the microbiopsy technique results in the extraction of a smaller piece of muscle tissue than the Bergstrom needle, it does not require a pre‐biopsy incision of the skin, involves a lower gauge needle and is perceived as being less invasive and painful than the Bergstrom technique (Bonafiglia et al., 2020; Hughes et al., 2015).\n\nUnlike the Bergstrom muscle biopsy procedure, potential complications associated with microbiopsies of human skeletal muscle have not been documented. Further, due to the infrequency of complications associated with Bergstrom needle muscle biopsies (Tarnopolsky et al., 2011) there is a deficiency of information regarding the development and progression of complications as well as the lived experiences of affected individuals. Therefore, the present case report follows a young male's recovery from a percutaneous muscle biopsy‐induced hemorrhage/hematoma of the right vastus lateralis with the specific aims of (1) informing future participants, researchers, and clinicians on expected time course of recovery and (2) informing methods to minimize future participant adverse event risk during and after the microbiopsy procedure.\n\n2 METHODS\n\n2.1 Participant characteristics\n\nA 23‐year‐old healthy, non‐medicated, non‐smoking, and active Caucasian male (height: 187 cm; weight: 75.4 kg) undertaking ~3 h of moderate‐to‐vigorous physical activity per week.\n\n2.2 Muscle biopsy procedure\n\nA single muscle biopsy was obtained from the lateral portion of the right vastus lateralis at the midpoint between the anterior spina iliaca superior and the patella via the percutaneous microbiopsy technique (Hughes et al., 2015) using a 14‐gauge Medax Biofeather microbiopsy disposable needle. The skin was punctured under local anesthesia (2% xylocaine with epinephrine) perpendicular to horizontal using a 12‐gauge cannula inserted 4 cm deep into the muscle to guide the biopsy needle to a final depth of 8 cm. Three cuts (~10–20 mg each) were made with a ~90° rotation applied to the needle between each cut over a ~30 s period. Each piece of muscle was removed from the needle using a sterile disposable surgical blade before a subsequent cut was made.\n\n2.3 Pain measurement\n\nPain was characterized using the short‐form McGill pain questionnaire (SF‐MPQ) completed 5, 6, 7, 8, 12, 13, and 19 days following the muscle biopsy (Melzack, 1987). Overall pain intensity was quantified using the present pain inventory (PPI) and a visual analog scale (VAS), included in the SF‐MPQ.\n\n2.4 Hematoma imaging\n\nA PhD candidate with ultrasound expertise recorded transverse ultrasound images of the affected site using a linear echo ultrasound probe operating at 13‐MHz in 2D mode (Vivid‐I GE Medical Systems).\n\n3 CASE PRESENTATION\n\n3.1 Unconfirmed pulsatile period\n\nDay 0. The muscle biopsy was performed on the participants right leg at 08:30 on Day 0. Immediately post‐biopsy, the participant experienced stiffness and favored his right leg. In the afternoon, the participant experienced pain while flexing his leg and had difficulty jumping while playing volleyball.\n\nDay 1. The following day leg pain did not improve and the participant demonstrated an antalgic gait pattern. At 20:00 of the same evening, after having been seated for approximately 2 h, the participant stood up and experienced immediate severe sharp, shooting, and throbbing pain. Visual inspection of the limb revealed slight bleeding, swelling, and warmth in the area surrounding the biopsy site. The participant contacted the primary investigator and was prescribed rest, ice, compression, and elevation. Before bed, the participant took 800 mg ibuprofen—severe sharp pain persisted making sleep difficult.\n\nDay 2–4. Pain in the participant's right leg was reduced to moderate. The participant maintained an antalgic gait pattern and reported moderate shooting pain throughout the entire length of his right leg upon transition from sitting to standing. On day 4 the participant assisted with moving furniture for ~4‐h. Severity of pain remained moderate throughout day 4, and in the evening tightness of the leg had increased.\n\n3.2 Confirmed pulsatile period\n\nDay 5. On day 5 the participant reported a recurrence of the severe sharp, shooting, and throbbing pain experienced on day 1. The participant could not walk or bend his leg without severe pain. The participant was driven to the School of Kinesiology and Health Studies where an ultrasound of the anterolateral aspect of the right thigh was completed. Although a pulsatile image was not saved, the ultrasound revealed a heterogeneous mass with arterial inflow in the deeper aspect of the right vastus lateralis, below the site of incision (Figure 1a). The participant rested, began compression, iced his leg and took 800 mg ibuprofen. The participant was not instructed to abstain from strenuous exercise, though the participant reported that he was unable to complete even low‐moderate exercise.\n\nFIGURE 1 Transverse ultrasound images of right vastus lateralis showing the intramuscular hematoma five (a), six (b), eight (c), nine (d), twelve (e), and nineteen (f) days after percutaneous microbiopsy. Color in (b) reflects arterial flow in the heterogeneous mass. Y‐scale is measured in cm\n\nDay 6–8. On day 6, ultrasonography confirmed pulsatile flow of the heterogeneous mass in the right vastus lateralis (Figure 1b). The same day, the participant was referred to athletic therapy—a thorough assessment was completed but, due to severe tenderness at the site of injury, manipulation was deemed unfeasible. The athletic therapist recommended passive stretching, compression, and ice. By day 8, pulsatile flow ceased, and the heterogeneous mass became stagnant (Figure 1c). Along with the absence of pulsatile flow, reported pain also decreased (Figure 2). Despite the reduced pain, the participant maintained an antalgic gait pattern and was unable to participate in any physical activity more intense than walking.\n\nFIGURE 2 Present pain inventory (PPI; a) and intensity of pain (b) assessed using a visual analog scale (VAS) as part of the short‐form McGill Pain Questionnaire. 0% = no pain, 100% = worst possible pain\n\n3.3 Nonpulsatile period\n\nDay 12–19. On day 12 and 13 pain was further reduced (Figure 2 and Table 1), however, the site of incision remained tender, achy and the participant reported throbbing pain. The participant's antalgic gait pattern was now reduced, though still present, and he remained unable to participate in athletic activities. On day 19, pain remained unchanged (Figure 2, Table 1), however, the participant attempted to participate in beach volleyball where he reported tolerable pain while running.\n\nTABLE 1 Type and severity of pain experienced over the course of recovery from muscle biopsy‐induced artery hemorrhage\n\n\t\tDay post‐biopsy\t\nPulsatile Period\tNonpulsatile Period\t\nDay 5\tDay 6\tDay 7\tDay 8\tDay 12\tDay 13\tDay 19\t\nDescriptor\tThrobbing\t3\t2\t2\t2\t1\t\t1\t\nShooting\t3\t1\t1\t1\t\t\t\t\nStabbing\t3\t\t\t\t\t\t\t\nSharp\t3\t1\t1\t2\t\t\t\t\nCramping\t2\t\t\t1\t\t\t\t\nGnawing\t\t\t\t1\t\t\t\t\nHot‐Burning\t\t\t1\t\t\t\t\t\nAching\t3\t2\t2\t2\t1\t1\t1\t\nTender\t3\t2\t3\t2\t1\t1\t1\t\nRatings: 0 (empty cell) = none, 1 = mild, 2 = moderate, 3 = severe.\n\nJohn Wiley & Sons, Ltd\n\nDay 28–29. On day 28, the participant had a referral to a clinical ultrasound at 08:30 and met with the orthopaedic surgeon on day 29. The radiologist, reported a heterogeneous mass within the deeper aspect of the right vastus lateralis measuring 3.1 × 4.3 × 1 cm. This same ultrasound demonstrated a vessel extending around the periphery of the heterogenous mass. The orthopaedic surgeon saw no threat to the heterogenous mass and recommended no action. At this time, the participant reported no pain. The participant had recommenced participation in all athletic activities.\n\n4 CASE INTERPRETATION\n\nWe interpret the data to suggest that the participant suffered from a muscle biopsy‐induced hemorrhage of an artery in the right vastus lateralis—pulsatile flow in the heterogenous mass supports this interpretation (Figure 1b). Following day 8 the hemorrhage closed thereby inhibiting further arterial inflow. Consequently, outflow was also inhibited thereby trapping blood intramuscularly leading to an intramuscular hematoma which persisted for another 20+ days.\n\n5 DISCUSSION\n\nMuscle biopsy adverse advents are infrequent and unpredictable (Tarnopolsky et al., 2011). Although utmost care is taken to avoid major vessels and nerves of the lower limb, it is difficult to always avoid smaller vessels or nerves. In the event a smaller vessel or nerve is hit, there are negative consequences for the participant. Unfortunately, to date, there is limited information about (1) the recovery period following muscle biopsy adverse events and (2) possible methods to minimize risk of percutaneous muscle biopsy adverse events. To help shed some light on one of the possible muscle biopsy adverse events, we have followed the time course of recovery for an individual living with a percutaneous muscle biopsy‐induced hemorrhage/hematoma.\n\n5.1 Pain\n\nThe discomfort associated with the muscle biopsy‐induced hemorrhage/hematoma was most severe for the participant while the heterogeneous mass was pulsatile (Table 1). During the pulsatile period (Day 0–8), pain was described most as throbbing, aching, and tender with periods of sharp and shooting pain (see Table 1). Following the pulsatile period (nonpulsatile period = Day 9+) pain dropped (Figure 2) and was described as throbbing, aching, and tender. Sharp and shooting pain was absent during the nonpulsatile period (Table 1). Despite a recommendation of 400 mg q4h prn (i.e., every 4 h when required), the participant took 800 mg ibuprofen following both instances of severe, sharp, and shooting pain. The anti‐coagulant effect of the high ibuprofen dose may have contributed to the continued bleeding—this could not be confirmed.\n\n5.2 Physical activity\n\nDuring the pulsatile phase, any physical activity requiring the lower limb was severely limited—the participant was limited to walking on flat surfaces. Despite the reduced pain during the nonpulsatile period, physical activity remained challenging for 20 days post‐cessation of the pulsatile flow. It is likely that the hematoma led to increased intramuscular pressure, making leg flexion more difficult and uncomfortable.\n\n5.3 No chronic consequences\n\nTwenty‐eight days after the muscle biopsy‐induced hemorrhage/hematoma the participant was back to his normal routine. A 1 year follow‐up was conducted—the participant reported no noticeable limitations and the hematoma was no longer noticeable via ultrasonography. Therefore, there appears to be no chronic consequences of this muscle biopsy.\n\n5.4 Muscle biopsy adverse event risk mitigation\n\nThe prevalence of muscle biopsy‐induced hematoma via the Bergstrom technique is low at 1 in 6813 (Tarnopolsky et al., 2011). We have completed <300 percutaneous muscle biopsies and here we report a muscle biopsy‐induced hematoma via the percutaneous technique—raising concern over the use of the percutaneous biopsy technique. Furthermore, considering the small muscle biopsy sample—when compared to the Bergstrom technique—the percutaneous biopsy technique is not useful for comprehensive histological and molecular assessment. Despite being perceived as less painful compared to the Bergstrom technique (Bonafiglia et al., 2020), continued use of the percutaneous muscle biopsy technique should be met with caution.\n\nTo help mitigate muscle biopsy‐mediated adverse events, we recommend that compression of the biopsy site be completed for up to 15 min (Thore et al., 2001) immediately post‐biopsy needle removal—minimizing bleeding and hematoma development. Participants should be monitored for up to 72 h, paying close attention for swelling, increased pain, extension of tenderness from the biopsy site, and prolonged restricted range of motion (Smith et al., 2006). These symptoms would indicate the development of a hematoma—exercise should be discouraged until the participant can move their limb while respecting their pain (Smith et al., 2006). Additionally, while the mass is pulsatile, compression should be applied to minimize the size of the developed hematoma (Thore et al., 2001).\n\n6 CONCLUSION AND KEY CLINICAL MESSAGES\n\nAlthough the microbiopsy technique makes smaller cuts in the muscle compared to the Bergstrom technique, there remains a risk of unintentional damage to neighboring vessels or nerves. The present case report demonstrates that the inadvertent hemorrhaging of a neighboring vessel can be debilitating. The recovery of the hemorrhaged vessel can be rapid, though the recovery from the remaining intramuscular hematoma can take much longer. Although chronic consequences do not appear to be evident, the acute consequences were severe for this individual and therefore risk minimization for future participants is warranted. To minimize the risk of muscle biopsy‐induced hemorrhage/hematoma, we advise post‐biopsy compression for up to 15 min and careful post‐biopsy follow‐up should be completed for up to 72 h—paying attention for swelling, increased pain, extension of tenderness from the biopsy site, and prolonged restricted range of motion (Smith et al., 2006). When any of these symptoms are evident, the participant should avoid exercise and compression should be applied while the mass is pulsatile—minimizing the size of the developed hematoma.\n\nCONFLICTS OF INTEREST\n\nNo conflicts of interest, financial or otherwise, are declared by the authors.\n\nAUTHORS’ CONTRIBUTIONS\n\nP.J.D, H.I, C.A.S, and B.J.G, Conceived and designed research, P.J.D completed patient interview, P.J.D and H.I collected self‐reported pain questionnaires, P.J.D, H.I, C.A.S, and.J.G interpreted the case P.J.D synthesized all data, P.J.D prepared figures drafted manuscript, P.J.D, H.I, C.A.S, and B.J.G edited and revised manuscript, P.J.D, H.I, C.S, and B.J.G approved final version of manuscript.\n\nCONSENT FOR PUBLICATION\n\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images.\n\nETHICS APPROVAL AND CONSENT TO PARTICIPATE\n\nExperimental procedures for both the original study the participant enrolled in and the current report were approved by the Health Sciences Human Research Ethics Board at Queen's University in accordance with the Declaration of Helsinki. The participant was provided with verbal and written explanation of experimental procedures and associated risks prior to giving written informed consent.\n\nDATA AVAILABILITY STATEMENT\n\nThe datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.\n==== Refs\nREFERENCES\n\nBonafiglia, J. T. , Islam, H. , Preobrazenski, N. , Drouin, P. , Ma, A. , Gerhart, A. , Quadrilatero, J. , Tschakovsky, M. E. , Tripp, D. A. , Perry, C. G. R. , Simpson, C. A. , & Gurd, B. J. (2020). A comparison of pain responses, hemodynamic reactivity and fibre type composition between Bergström and microbiopsy skeletal muscle biopsies. Current Research in Physiology, 3 , 1–10. 10.1016/j.crphys.2020.05.001\nCarter, S. L. , Rennie, C. D. , Hamilton, S. J. , & Tarnopolsky, M. A. (2001). Changes in skeletal muscle in males and females following endurance training. Canadian Journal of Physiology and Pharmacology, 79 (5 ), 386–392. 10.1139/y01-008 11405241\nEgan, B. , O'Connor, P. L. , Zierath, J. R. , & O'Gorman, D. J. (2013). Time course analysis reveals gene‐specific transcript and protein kinetics of adaptation to short‐term aerobic exercise training in human skeletal muscle. PLoS One, 8 (9 ), e74098. 10.1371/journal.pone.0074098 24069271\nEkblom, B. (2017). The muscle biopsy technique. Historical and methodological considerations. Scandinavian Journal of Medicine and Science in Sports, 27 (5 ), 458–461. 10.1111/sms.12808 28033689\nHughes, M. C. , Ramos, S. V. , Turnbull, P. C. , Nejatbakhsh, A. , Baechler, B. L. , Tahmasebi, H. , Laham, R. , Gurd, B. J. , Quadrilatero, J. , Kane, D. A. , & Perry, C. G. R. (2015). Mitochondrial bioenergetics and fiber type assessments in microbiopsy vs. Bergstrom percutaneous sampling of human skeletal muscle. Frontiers in Physiology, 6 , 360. 10.3389/fphys.2015.00360 26733870\nIslam, H. , Edgett, B. A. , Bonafiglia, J. T. , Shulman, T. , Ma, A. , Quadrilatero, J. , Simpson, C. A. , & Gurd, B. J. (2019). Repeatability of exercise‐induced changes in mRNA expression and technical considerations for qPCR analysis in human skeletal muscle. Experimental Physiology, 104 (3 ), 407–420. 10.1113/EP087401 30657617\nLittle, J. P. , Safdar, A. , Wilkin, G. P. , Tarnopolsky, M. A. , & Gibala, M. J. (2010). A practical model of low‐volume high‐intensity interval training induces mitochondrial biogenesis in human skeletal muscle: Potential mechanisms. Journal of Physiology, 588 (Pt 6 ), 1011–1022. 10.1113/jphysiol.2009.181743\nMacDougall, J. D. , Hicks, A. L. , MacDonald, J. R. , McKelvie, R. S. , Green, H. J. , & Smith, K. M. (1998). Muscle performance and enzymatic adaptations to sprint interval training. Journal of Applied Physiology, 84 (6 ), 2138–2142. 10.1152/jappl.1998.84.6.2138 9609810\nMahoney, D. J. , Parise, G. , Melov, S. , Safdar, A. , & Tarnopolsky, M. A. (2005). Analysis of global mRNA expression in human skeletal muscle during recovery from endurance exercise. The FASEB Journal, 19 (11 ), 1498–1500. 10.1096/fj.04-3149fje 15985525\nMelzack, R. (1987). The short‐form McGill Pain questionnaire. Pain, 30 (2 ), 191–197. 10.1016/0304-3959(87)91074-8 3670870\nShanely, R. A. , Zwetsloot, K. A. , Triplett, N. T. , Meaney, M. P. , Farris, G. E. , & Nieman, D. C. (2014). Human skeletal muscle biopsy procedures using the modified Bergstrom technique. Journal of Visualized Experiments, (91 ), 51812. 10.3791/51812 25285722\nSmith, T. O. , Hunt, N. J. , & Wood, S. J. (2006). The physiotherapy management of muscle haematomas. Physical Therapy in Sport, 7 (4 ), 201–209. 10.1016/j.ptsp.2006.06.001 21663833\nTarnopolsky, M. A. , Pearce, E. , Smith, K. , & Lach, B. (2011). Suction‐modified Bergström muscle biopsy technique: Experience with 13,500 procedures. Muscle and Nerve, 43 (5 ), 717–725. 10.1002/mus.21945 21462204\nThore, V. , Berder, V. , Houplon, P. , Preiss, J. P. , Selton‐Suty, C. , & Juilliere, Y. (2001). Role of manual compression time and bed rest duration on the occurrence of femoral bleeding complications after sheath retrieval following 4Fr left‐sided cardiac catheterization. Journal of Interventional Cardiology, 14 (1 ), 7–10. 10.1111/j.1540-8183.2001.tb00703.x 12053331\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2051-817X",
"issue": "9(19)",
"journal": "Physiological reports",
"keywords": "case report; hemorrhage; intramuscular hematoma; recovery; risk mitigation; skeletal muscle biopsy",
"medline_ta": "Physiol Rep",
"mesh_terms": null,
"nlm_unique_id": "101607800",
"other_id": null,
"pages": "e15038",
"pmc": null,
"pmid": "34633155",
"pubdate": "2021-10",
"publication_types": "D016428:Journal Article",
"references": "9609810;30657617;21462204;3670870;24069271;26733870;28033689;21663833;25285722;11405241;12053331;15985525;20100740",
"title": "Intramuscular hematoma of the vastus lateralis following percutaneous skeletal muscle microbiopsy: a case report.",
"title_normalized": "intramuscular hematoma of the vastus lateralis following percutaneous skeletal muscle microbiopsy a case report"
} | [
{
"companynumb": "CA-TEVA-2021-CA-1989768",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "IBUPROFEN"
},
"drugadditional": "3",
... |
{
"abstract": "Treatment with convalescent plasma has been shown to be safe in coronavirus disease in 2019 (COVID-19) infection, although efficacy reported in immunocompetent patients varies. Nevertheless, neutralizing antibodies are a key requisite in the fight against viral infections. Patients depleted of antibody-producing B cells, such as those treated with rituximab (anti-CD20) for hematological malignancies, lack a fundamental part of their adaptive immunity. Treatment with convalescent plasma appears to be of general benefit in this particularly vulnerable cohort. We analyzed clinical course and inflammation markers of three B-cell-depleted patients suffering from COVID-19 who were treated with convalescent plasma. In addition, we measured serum antibody levels as well as peripheral blood CD38/HLA-DR-positive T-cells ex vivo and CD137-positive T-cells after in vitro stimulation with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)-derived peptides in these patients. We observed that therapy with convalescent plasma was effective in all three patients and analysis of CD137-positive T-cells after stimulation with SARS-CoV-2 peptides showed an increase in peptide-specific T-cells after application of convalescent plasma. In conclusion, we here demonstrate efficacy of convalescent plasma therapy in three B-cell-depleted patients and present data that suggest that while application of convalescent plasma elevates systemic antibody levels only transiently, it may also boost specific T-cell responses.",
"affiliations": "Department of Gastroenterology and Hepatology, University Hospital Zürich, Zürich, Switzerland.;Department of Internal Medicine 5, Hematology and Oncology, University Hospital Erlangen and Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Department of Internal Medicine 4, Nephrology and Hypertension, University Hospital Erlangen and Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Department of Internal Medicine 5, Hematology and Oncology, University Hospital Erlangen and Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Department of Internal Medicine 5, Hematology and Oncology, University Hospital Erlangen and Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Department of Transfusion Medicine and Haemostaseology, University Hospital Erlangen and Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Department of Internal Medicine 5, Hematology and Oncology, University Hospital Erlangen and Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Department of Internal Medicine 5, Hematology and Oncology, University Hospital Erlangen and Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Department of Internal Medicine 5, Hematology and Oncology, University Hospital Erlangen and Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Institute of Virology, University Hospital Erlangen, Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Institute of Virology, University Hospital Erlangen, Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Institute of Virology, University Hospital Erlangen, Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Department of Internal Medicine 5, Hematology and Oncology, University Hospital Erlangen and Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Department of Internal Medicine 5, Hematology and Oncology, University Hospital Erlangen and Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Department of Internal Medicine 1, Gastroenterology, Pneumology and Endocrinology, University Hospital Erlangen and Friedrich-Alexander-University of Erlangen-Nürnberg, Erlangen, Germany.;Department of Internal Medicine 1, Gastroenterology, Pneumology and Endocrinology, University Hospital Erlangen and Friedrich-Alexander-University of Erlangen-Nürnberg, Erlangen, Germany.;Institute of Virology, University Hospital Erlangen, Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Department of Internal Medicine 1, Gastroenterology, Pneumology and Endocrinology, University Hospital Erlangen and Friedrich-Alexander-University of Erlangen-Nürnberg, Erlangen, Germany.;Department of Internal Medicine 5, Hematology and Oncology, University Hospital Erlangen and Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Department of Internal Medicine 4, Nephrology and Hypertension, University Hospital Erlangen and Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.;Department of Transfusion Medicine and Haemostaseology, University Hospital Erlangen and Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany.",
"authors": "Kremer|Andreas E|AE|;Kremer|Anita N|AN|;Willam|Carsten|C|;Völkl|Simon|S|;Verhagen|Johan|J|;Achenbach|Susanne|S|;van der Meijden|Edith D|ED|;Lang|Vanessa|V|;Aigner|Michael|M|;Maier|Clara|C|;Tenbusch|Matthias|M|;Korn|Klaus|K|;Lutzny-Geier|Gloria|G|;Spoerl|Silvia|S|;Strauß|Richard|R|;Vetter|Marcel|M|;Überla|Klaus|K|;Neurath|Markus F|MF|;Mackensen|Andreas|A|;Schiffer|Mario|M|;Hackstein|Holger|H|",
"chemical_list": "D057134:Antibodies, Neutralizing; D000914:Antibodies, Viral; D053261:Tumor Necrosis Factor Receptor Superfamily, Member 9; D000069283:Rituximab",
"country": "Germany",
"delete": false,
"doi": "10.1002/eji.202149277",
"fulltext": "\n==== Front\nEur J Immunol\nEur J Immunol\n10.1002/(ISSN)1521-4141\nEJI\nEuropean Journal of Immunology\n0014-2980\n1521-4141\nJohn Wiley and Sons Inc. Hoboken\n\n34350584\n10.1002/eji.202149277\nEJI5153\nShort Communication|Clinical\nImmunity to infection\nShort Communication\nClinical\nSuccessful treatment of COVID‐19 infection with convalescent plasma in B‐cell‐depleted patients may promote cellular immunity\nAndreas E. Kremer et al.\nKremer Andreas E. 1 2 # andreas.kremer@usz.ch\n\nKremer Anita N. 3 #\nWillam Carsten 4 #\nVölkl Simon 3\nVerhagen Johan 3\nAchenbach Susanne 5\nvan der Meijden Edith D. 3\nLang Vanessa 3\nAigner Michael 3\nMaier Clara 6\nTenbusch Matthias 6\nKorn Klaus 6\nLutzny‐Geier Gloria 3\nSpoerl Silvia 3\nStrauß Richard 2\nVetter Marcel 2\nÜberla Klaus 6\nNeurath Markus F. 2\nMackensen Andreas 3\nSchiffer Mario 4 #\nHackstein Holger 5 #\n1 Department of Gastroenterology and Hepatology University Hospital Zürich Zürich Switzerland\n2 Department of Internal Medicine 1 Gastroenterology, Pneumology and Endocrinology University Hospital Erlangen and Friedrich‐Alexander‐University of Erlangen‐Nürnberg Erlangen Germany\n3 Department of Internal Medicine 5 Hematology and Oncology University Hospital Erlangen and Friedrich‐Alexander‐University Erlangen‐Nürnberg Erlangen Germany\n4 Department of Internal Medicine 4 Nephrology and Hypertension University Hospital Erlangen and Friedrich‐Alexander‐University Erlangen‐Nürnberg Erlangen Germany\n5 Department of Transfusion Medicine and Haemostaseology University Hospital Erlangen and Friedrich‐Alexander‐University Erlangen‐Nürnberg Erlangen Germany\n6 Institute of Virology University Hospital Erlangen, Friedrich‐Alexander‐University Erlangen‐Nürnberg Erlangen Germany\n* Full correspondence: Prof. Andreas E. Kremer, Department of Gastroenterology and Hepatology, University Hospital Zürich, Rämistrasse 100, CH‐8091 Zürich, Switzerland.\ne‐mail: andreas.kremer@usz.ch\n\n# These authors contributed equally to this work.\n\n03 9 2021\n03 9 2021\n10.1002/eji.20214927722 6 2021\n25 3 2021\n28 7 2021\n© 2021 The Authors. European Journal of Immunology published by Wiley‐VCH GmbH\nhttps://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by-nc/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.\n\nAbstract\n\nTreatment with convalescent plasma has been shown to be safe in coronavirus disease in 2019 (COVID‐19) infection, although efficacy reported in immunocompetent patients varies. Nevertheless, neutralizing antibodies are a key requisite in the fight against viral infections. Patients depleted of antibody‐producing B cells, such as those treated with rituximab (anti‐CD20) for hematological malignancies, lack a fundamental part of their adaptive immunity. Treatment with convalescent plasma appears to be of general benefit in this particularly vulnerable cohort. We analyzed clinical course and inflammation markers of three B‐cell‐depleted patients suffering from COVID‐19 who were treated with convalescent plasma. In addition, we measured serum antibody levels as well as peripheral blood CD38/HLA‐DR‐positive T‐cells ex vivo and CD137‐positive T‐cells after in vitro stimulation with severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2)‐derived peptides in these patients. We observed that therapy with convalescent plasma was effective in all three patients and analysis of CD137‐positive T‐cells after stimulation with SARS‐CoV‐2 peptides showed an increase in peptide‐specific T‐cells after application of convalescent plasma.\n\nIn conclusion, we here demonstrate efficacy of convalescent plasma therapy in three B‐cell‐depleted patients and present data that suggest that while application of convalescent plasma elevates systemic antibody levels only transiently, it may also boost specific T‐cell responses.\n\nTreatment of B‐cell depleted patients suffering from COVID‐19 with convalescent plasma led to viral clearance and was followed by an increase in peptide‐specific CD4+ T‐cells suggesting that transient antibody titers promoted specific cellular immunity in these patients.\n\nB‐cell deficiency\nconvalescent plasma\nCOVID‐19\nSARS‐CoV‐2\nT‐cell immunity\nWilhelm Sander Foundation 10.13039/100008672 2020.045.1 source-schema-version-number2.0\nedited-statecorrected-proof\ndetails-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.0.7 mode:remove_FC converted:06.09.2021\n==== Body\npmcIntroduction\n\nCoronavirus disease in 2019 (COVID‐19), caused by severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2), has led to a pandemic with currently more than 175 million infected people worldwide and nearly 4 million deaths (status: June 2021; https://coronavirus.jhu.edu/map.html). In particular, older people and patients with immune defects are likely of high risk to develop a severe course of disease. So far, no specific antiviral medications are available. The use of antibody‐containing plasma from recently recovered patients is a potential therapeutic option, which was first tested experimentally in diphtheria‐infected animals in 1880 [1] and was later given clinically, for example, in the Spanish influenza pandemic in 1918, for MERS‐CoV and H1N1 influenza and recently in the Ebola outbreak in West Africa [2, 3]. Convalescent plasma therapy (CPT) for B‐cell‐competent patients suffering from COVID‐19 has achieved varying levels of success and seems to be most effective when using plasma with very high antibody titers in mild to moderate disease [4, 5, 6]. Reports of efficacy in B‐cell‐deficient patients have been more universally encouraging [7, 8, 9]. It remains unclear, however, whether the effect of CPT relies solely on the short‐lived virus‐neutralizing effect of antibodies or may have a more enduring effect on the immune response. Although Hueso et al. [7] reported functional T‐cell responses prior to CPT of B‐cell‐depleted COVID‐19 patients, they did not monitor changes in the magnitude of the T‐cell response during and after treatment.\n\nWe here report three cases of B‐cell‐depleted patients with COVID‐19 who successfully received CPT and monitor the effect on antigen‐specific T cells.\n\nResults and discussion\n\nClinical course of B‐cell‐depleted patients treated with convalescent plasma\n\nWe treated and analyzed three patients with SARS‐CoV‐2 immune plasma. All patients were completely B‐cell‐depleted due to prior treatment with rituximab for hematological malignancies and were in complete remission (Table 1). Patient 1 is an 18‐year‐old male diagnosed with progenitor B‐cell acute lymphoblastic leukemia in June 2019 and treated with poly‐chemotherapy plus rituximab. The last administration of rituximab had been on January 31, 2020. On March 19, 2020, he was admitted in complete leuco‐ and lymphopenia with fever and respiratory symptoms about 1 week after administration of consolidation therapy with cyclophosphamide/cytarabine. SARS‐CoV‐2 infection was confirmed by RT‐PCR. Due to the increased risk of the lymphopenic patient, a therapy with hydroxychloroquine was started. Two weeks later, the patient presented in reduced condition, still lymphopenic and inflammatory markers (C‐reactive protein [CRP], ferritin) increased further. On April 16 and 17, a total of three units (900 mL) of convalescent plasma were administered. This was repeated on May 5 and 6. Thereafter, viral loads dropped and have remained negative since (Fig. 1A). Patient 2 is a 70‐year‐old male with relapsed mantle cell lymphoma after allogeneic stem cell transplantation in 2015. The relapse was treated with ibrutinib before therapy was switched to rituximab and bendamustin and complete remission could be achieved. For consolidation therapy, the patient was treated with donor lymphocyte infusion and rituximab maintenance therapy until November 2019. On April 6, 2020, the patient was admitted to a local hospital with increasing dyspnoea and confirmed SARS‐CoV‐2 and influenza A infection (nasopharyngeal swab from April 1, 2020). First onset of symptoms was already on March 27 with headache, throat pain, cough, and fever. Influenza therapy with oseltamivir was initiated. On April 21, he was admitted to our intensive care unit. The patient was treated with broad‐spectrum antibiotics, hydroxychloroquine and intravenous immunoglobulin (IVIG), due to secondary antibody deficiency. We administered three units of convalescent plasma on April 23 and 24, which was repeated on May 15 and 16. The patient tested negative for SARS‐CoV‐2 on May 22 and has remained negative since. Patient 3 is a 49‐year‐old male who was first diagnosed with pancytopenia and splenomegaly in May 2020. Bone marrow puncture revealed infiltration with indolent B‐cell lymphoma. A computed tomography (CT)scan showed no further manifestation. Immuno‐chemotherapy with rituximab/bendamustin was initiated and the patient achieved complete remission after three cycles. On September 17 and 18, 2020, the patient received the fourth cycle of rituximab/bendamustin. Ten days later, the patient presented at our emergency room with 1‐day history of fever and cough and tested SARS‐CoV‐2 positive. Due to neutropenia after chemotherapy, treatment with G‐CSF and antibiotics were initiated. A chest CT scan showed bilateral infiltrates. As the patient had no need for oxygen substitution, no further treatment such as dexamethasone or remdesivir was administered. On October 2 and 3 and 6 and 7, a total of six units of convalescent plasma were administered. On October 10, fever subsided and CRP levels declined.\n\nTable 1 Characteristics of B‐cell‐deficient patients with COVID‐19 infection\n\nPatient ID\tAge\tSex\tUnderlying disease\tRemission status\tLast dose of rituximab\tFirst positive SARS‐CoV‐2 PCR\tCirculating B cells at time of infection (% of PBMC)\tCOVID‐19 severity score\tOutcome\t\n1\t18\tM\tProgenitor B‐ALL\tComplete\tJanuary 2020\tMarch 19, 2020\t0\t5\tVirus cleared\t\n2\t70\tM\tMantle cell lymphoma\tComplete\tNovember 2019\tApril 01, 2020\t0\t2\tVirus cleared\t\n3\t49\tM\tIndolent B‐cell lymphoma\tComplete\tSeptember 2020\tSeptember 27, 2020\t0\t5\tVirus cleared\t\nALL, acute lymphoblastic leukemia.\n\nJohn Wiley & Sons, Ltd.\n\nFigure 1 Clinical parameters of B‐cell‐depleted patients suffering from COVID‐19. (A) IgG/IgM serum levels during the course of disease (left y‐axis) and SARS‐CoV‐2 viral load (right y‐axis) for each of the three patients and measured by CLIA and qPCR, respectively. (B) C‐reactive protein (CRP) levels during course of disease and time periods of inpatient treatment and measured by ELISA. Administration of three units of immune plasma via intravenous infusion over 2 days is indicated by the black arrows and SARS‐CoV‐2‐specific antibody titers in the plasma products are indicated. Each data point corresponds to single measurements in the individual patient.\n\nAfter administration of three units of immune plasma, patients 1 and 2 reached anti‐SARS‐CoV‐2 antibody titers above the level of positivity (>10 AU/mL). Patient 3, whose first CPT had a lower specific antibody titer of 51 AU/mL compared to 61 and 81 AU/mL for patients 1 and 2, respectively, required a second application to reach this threshold. Importantly, in all patients seropositivity waned within 10–15 days (Fig. 1A). Despite the transient presence of the specific antibodies, all patients cleared the virus successfully. In all cases, application of the immune plasma was well tolerated and did not cause any adverse events. Shortly after administration, all patients improved in terms of clinical status and CRP values (Fig. 1B).\n\nSpecific T‐cell activation and expansion after application of convalescent plasma\n\nIn patient 3 in particular, the reduction in viral load continued gradually for weeks after serum antibody levels had dropped to below the 10 AU/mL threshold. This raised the question whether antigen‐specific T‐cell responses, known to contribute to recovery from SARS‐CoV‐2 infection in B‐cell‐competent individuals, were affected by CPT. We, therefore, studied the presence of activated CD38+HLA‐DR+ T cells ex vivo in available peripheral blood samples, retrospectively. Moreover, we looked at the expression of the activation marker CD137 on CD4+ and CD8+ T cells after overnight restimulation in vitro with peptides that together span the lengths of SARS‐CoV‐2 S and N proteins. We previously found CD137 to be a good marker for T cells that recognize SARS‐CoV‐2 epitopes with high affinity [10]. In patient 1, CD38+HLA‐DR+ CD4+ and CD8+ T cells showed a remarkable increase after the first plasma administration but remained stable after the second dose (Fig. 2A). A similar increase was seen in patient 3 after both the first and second CPT. The second dose of plasma, with a higher SARS‐CoV‐2‐specific antibody titer, had a greater effect than the first dose. In concordance with the ex vivo result, the number of CD137+ CD4+ and CD8+ T cells after in vitro restimulation peaked shortly after the first plasma dose in patient 1. For patient 2, unfortunately there were no samples available for FACS analysis from before the first plasma dose, so we could not confirm that this patient too showed a similar response. However, we could detect a marked increase in absolute lymphocytes numbers after the first plasma dose, as also seen in patient 1 (Fig. 2A).\n\nFigure 2 T‐cell responses after convalescent plasma therapy. (A) Percentage (left y‐axis) of CD38+HLA‐DR+, activated CD4+ and CD8+ T cells in peripheral blood ex vivo (circles), as well as percentage of CD137+ CD4+ and CD8+ T cells after overnight in vitro stimulation with overlapping peptides that together span the full length of SARS‐CoV‐2 S and N proteins (triangles) and measured by flow cytometry. Additionally, the absolute number of lymphocytes in peripheral blood is depicted (right y‐axis). Each data point corresponds to single measurements in the individual patient. Intravenous administration of three units of immune plasma over 2 days is indicated by the black arrows. (B and C) CD137 expression on CD4+ and CD8+ T cells after overnight in vitro stimulation with overlapping peptides that together span the full length of SARS‐CoV‐2 S and N proteins and measured by flow cytometry. Three B‐cell‐competent convalescent plasma donors and B‐cell‐depleted COVID‐19 patients 1 and 2, 6 months after the first detection of SARS‐CoV‐2 infection. Individual values as well as mean ± SEM are shown. n.s. = not significant, Mann–Whitney test.\n\nAs longevity of SARS‐CoV‐2 specific antibody responses is under debate even in B‐cell‐competent individuals [11, 12], we were interested in the persistence of SARS‐CoV‐2‐specific CD4+ and CD8+ T cells in our B‐cell‐depleted patients after infection. Restimulation of PBMCs from patients 1 and 2 with SARS‐CoV‐2 S and N proteins 6 months after infection demonstrated the retained presence of antigen‐specific T cells, as evidenced by the upregulation of the activation marker CD137 on CD4+ (Fig. 2B) and CD8+ (Fig. 2C) T cells. We could not acquire a 6 months postinfection sample from patient 3. The incidence of antigen‐specific T cells in B‐cell‐depleted donors was not lower than in the B‐cell‐competent plasma donors [6, 7].\n\nThere are several reports on patients with B‐cell‐deficiencies suffering from COVID‐19, with diverse outcomes. While most reports are either on patients with agammaglobulinemia or with rituximab treatment for autoimmune diseases [13, 14, 15, 16, 17], there are fewer reports on COVID‐19 in patients with rituximab treatment for hematological malignancies [18]. Patients with agammaglobulinemia generally seem to have a rather mild course of disease or can at least spontaneously recover from infection, indicating that the presence of B cells is not strictly required to overcome disease and supporting the notion of compensatory effects of other immune mechanisms. In contrast, patients with hematological malignancies, where rituximab therapy is routinely combined with chemotherapy, have been reported to suffer from persisting SARS‐CoV‐2 infection with fatal outcome [19]. The worse outcome could be speculated to be due to the role of T cells in the antiviral response as in these patients T‐cell counts and function are often disturbed. Our limited data hint at a potential increase in the number of activated, antigen‐specific T cells after CPT. This would be in line with reports from other infectious diseases like influenza and Ebola that administration of specific antibodies induces formation of antigen‐antibody complexes, which enhance cellular immune responses [2, 3, 19]. This mechanism has been described to involve an increased uptake by APCs through the Fc receptor, a FcR‐dependent enhancement of MHC class I‐restricted cross‐presentation, a shift in presentation of class II‐restricted determinant, and changes in cytokine expression by APCs and T cells [19]. More extensive data would be required to confirm a similar mechanism at play after CPT in B‐cell‐depleted COVID‐19 patients. Additionally, it remains currently unclear if the increase in antigen‐specific T cells following CPT is unique to B‐cell‐depleted individuals. Nonetheless, if our results can be confirmed in larger studies, this could have major implications for long‐term protection against reinfection in these patients.\n\nConcluding remarks\n\nIn conclusion, our data demonstrate efficacy of treatment with convalescent plasma in three B‐cell‐depleted patients with COVID‐19. Although transferred antibody levels were only short‐lived, our data suggest promotion of specific cellular immunity by application of convalescent plasma.\n\nMaterials and methods\n\nAll patients and donors provided written informed consent according to the Declaration of Helsinki.\n\nDetection of viral load\n\nSARS‐CoV‐2 viral loads were determined by RT‐PCR on nasopharyngeal swabs or, when patients were on mechanical ventilation, tracheal secretion. COVID‐19 disease severity scores were based on the NIH ordinal scale [20].\n\nFlowcytometric analysis\n\nPeripheral blood mononuclear cells (PBMCs) were isolated at several time points for each donor, cryopreserved, and stored in liquid nitrogen. All samples from one donor were analyzed at the same time for consistency. Unstimulated PBMCs of the patients were stained with antibodies to CD3 (clone HIT3α), CD4 (SK3), CD8 (RPA‐T8), CD38 (HB7), and HLA‐DR (L243) plus 7AAD (all from BD Bioscience) to detect activated T cells, ex vivo. To determine SARS‐CoV‐2 specific T‐cell responses, PBMCs of the patients or donors were incubated with 1 μg/mL of overlapping peptides covering the whole nucleocapsid (N) and spike (S) proteins of SARS‐CoV‐2 (JPT). After overnight incubation, antigen‐specific CD137+ T cells were detected using antibodies against CD3 (HIT3α), CD4 (RPA‐T4), CD8 (SK1), and CD137 (4B4‐1) as well as 7AAD (BD Bioscience) or Zombie Green viability dye (Biolegend). Upregulation of CD137 expression after antigen stimulation versus a DMSO‐only control was confirmed for two samples for each donor. Background CD137 expression remained very low and stable between donors and samples (not shown). Data are displayed as total CD137 expression. Samples were run on a BD Canto II flow cytometer and analyzed with Kaluza Analysis 2.1 (Beckman Coulter) or FlowJo 10.5.3 (BD Life Sciences) software. Gating strategy and representative CD137 expression versus controls are depicted in Supporting Information Figure S1.\n\nManufacturing of convalescent plasma\n\nCOVID‐19 convalescent plasma was produced according to EU guidelines after approval by local authorities (“Regierung von Oberfranken”; Nr: ROF‐SG55‐2‐2678 3‐6‐26‐29) and informed, written consent from donors. Donors were tested positive for anti‐S IgG SARS‐CoV‐2 antibodies by two independent assays, an anti‐S IgG ELISA (Euroimmune) and anti‐S1/S2 IgG CLIA (DiaSorin). Additionally, S‐ and N‐specific IgG level in the patient sera were measured by a fully automated CLIA (Shenzhen Yhlo Biotech). Finally, the neutralizing capacity of the donors’ plasma were determined in an immunofluorescence focus assay and the NT50 were confirmed to be higher than 160.\n\nConflict of interest\n\nThe authors have no financial or commercial conflict of interests.\n\nAuthor contributions\n\nA.E.K., A.N.K., and J.V. wrote the manuscript; A.N.K., S.V., A.E.K., and J.V. prepared the figures; M.A., C.M., M.T., G.L.‐G., K.K., and S.V. performed experiments; and C.W., S.A., R.S., M.V., M.F.N., A.M., H.H., and M.S. contributed to samples acquisition and patient care. All authors reviewed and approved the manuscript.\n\nEthics approval\n\nAll patients and donors provided written informed consent according to the Declaration of Helsinki. Ethics approval for plasma manufacturing was given by the “Regierung von Oberfranken”; Nr: ROF‐SG55‐2‐2678 3‐6‐26‐29 and for collection of blood specimen by the local ethics committee; Nr: 174_20B.\n\nPeer review\n\nThe peer review history for this article is available at https://publons.com/publon/10.1002/eji.202149277.\n\nAbbreviations\n\nCOVID‐19 coronavirus disease in 2019\n\nCPT convalescent plasma therapy\n\nCRP C‐reactive protein\n\nSARS‐CoV‐2 severe acute respiratory syndrome coronavirus 2\n\nSupporting information\n\nSupporting information\n\nClick here for additional data file.\n\nAcknowledgements\n\nThe authors thank the patients for their participation in this study and their colleagues for collaboration on the care of the patient. This work was supported by the “Bavarian Ministry of Art and Science” to A.N.K., M.A. and S.V. and A.E.K. and the Wilhelm Sander Foundation project number 2020.045.1 to M.A., A.N.K. and S.V.\n\nData availability statement\n\nThe data that support the findings of this study are available from the corresponding author upon reasonable request.\n==== Refs\nReferences\n\n1 Shahani, L., Singh, S. and Khardori, N. M., Immunotherapy in clinical medicine: historical perspective and current status. Med. Clin. North Am. 2012. 96 (3 ): 421–431, ix.22703849\n2 Marano, G., Vaglio, S., Pupella, S., Facco, G., Catalano, L., Liumbruno, G. M., Liumbruno, G. M. et al., Convalescent plasma: new evidence for an old therapeutic tool? Blood Transfus. 2016. 14 (2 ): 152–157.26674811\n3 Garraud, O. and Tissot, J. D., Blood components: are they drugs or special medicines? Transfus. Clin. Biol. 2016. 23 (3 ): 127–131.27424282\n4 Libster, R., Perez Marc, G., Wappner, D., Coviello, S., Bianchi, A., Braem, V., Esteban, I. et al., Early high‐titer plasma therapy to prevent severe Covid‐19 in older adults. N. Engl. J. Med. 2021. 384 (7 ): 610–618.33406353\n5 Joyner, M. J., Carter, R. E., Senefeld, J. W., Klassen, S. A., Mills, J. R., Johnson, P. W., Theel, E. S. et al., Convalescent plasma antibody levels and the risk of death from Covid‐19. N. Engl. J. Med. 2021. 384 (11 ): 1015–1027.33523609\n6 Simonovich, V. A., Burgos Pratx, L. D., Scibona, P., Beruto, M. V., Vallone, M. G., Vázquez, C., Savoy, N. et al., A randomized trial of convalescent plasma in Covid‐19 severe pneumonia. N. Engl. J. Med. 2021. 384 (7 ): 619–629.33232588\n7 Hueso, T., Pouderoux, C., Péré, H., Beaumont, A. L., Raillon, L. A., Ader, F., Chatenoud, L. et al., Convalescent plasma therapy for B‐cell‐depleted patients with protracted COVID‐19. Blood 2020. 136 (20 ): 2290–2295.32959052\n8 Betrains, A., Godinas, L., Woei, A. J. F., Rosseels, W., Van Herck, Y., Lorent, N., Dierickx, D. et al., Convalescent plasma treatment of persistent severe acute respiratory syndrome coronavirus‐2 (SARS‐CoV‐2) infection in patients with lymphoma with impaired humoral immunity and lack of neutralising antibodies. Br. J. Haematol. 2021. 192 (6 ): 1100–1105.33314018\n9 Kenig, A., Ishay, Y., Kharouf, F. and Rubin, L., Treatment of B‐cell depleted COVID‐19 patients with convalescent plasma and plasma‐based products. Clin. Immunol. 2021. 227 : 108723.33838340\n10 Verhagen, J., Van der Meijden, E. D., Lang, V., Kremer, A. E., Völkl, S., Mackensen, A., Aigner, M. et al., Human CD4+ T cells specific for dominant epitopes of SARS‐CoV‐2 spike and nucleocapsid proteins with therapeutic potential. Clin. Exp. Immunol. 2021. 10.1111/cei.13627\n11 Iyer, A. S., Jones, F. K., Nodoushani, A., Kelly, M., Becker, M., Slater, D., Mills, R. et al., Persistence and decay of human antibody responses to the receptor binding domain of SARS‐CoV‐2 spike protein in COVID‐19 patients. Sci. Immunol. 2020. 5 (52 ): eabe0367.33033172\n12 Wajnberg, A., Amanat, F., Firpo, A., Altman, D. R., Bailey, M. J., Mansour, M., McMahon, M. et al., Robust neutralizing antibodies to SARS‐CoV‐2 infection persist for months. Science. 2020. 370 (6521 ): 1227–1230.33115920\n13 Quinti, I., Lougaris, V., Milito, C., Cinetto, F., Pecoraro, A., Mezzaroma, I., Mastroianni, C. M. et al., A possible role for B cells in COVID‐19? Lesson from patients with agammaglobulinemia. J. Allergy Clin. Immunol. 2020. 146 (1 ): 211–213 e4.32333914\n14 Creed, M. A., Ballesteros, E., Greenfield, JrL. J. and Imitola, J., Mild COVID‐19 infection despite chronic B cell depletion in a patient with aquaporin‐4‐positive neuromyelitis optica spectrum disorder. Mult. Scler. Relat. Disord. 2020. 44 : 102199.32554285\n15 Safavi, F., Nourbakhsh, B. and Azimi, A. R., B‐cell depleting therapies may affect susceptibility to acute respiratory illness among patients with multiple sclerosis during the early COVID‐19 epidemic in Iran. Mult. Scler. Relat. Disord. 2020. 43 : 102195.32460086\n16 Avouac, J., Airo, P., Carlier, N., Matucci‐Cerinic, M. and Allanore, Y., Severe COVID‐19‐associated pneumonia in 3 patients with systemic sclerosis treated with rituximab. Ann. Rheum. Dis. 2020. 10.1136/annrheumdis-2020-217864\n17 Soresina, A., Moratto, D., Chiarini, M., Paolillo, C., Baresi, G., Foca, E., Bezzi, M. et al., Two X‐linked agammaglobulinemia patients develop pneumonia as COVID‐19 manifestation but recover. Pediatr. Allergy Immunol. 2020. 31 (5 ): 565–569.32319118\n18 Tepasse, P. R., Hafezi, W., Lutz, M., Kuhn, J., Wilms, C., Wiewrodt, R., Sackarnd, J. et al., Persisting SARS‐CoV‐2 viraemia after rituximab therapy: two cases with fatal outcome and a review of the literature. Br. J. Haematol. 2020. 190 (2 ): 185–188.32557623\n19 Brady, L. J. Antibody‐mediated immunomodulation: a strategy to improve host responses against microbial antigens. Infect. Immun. 2005. 73 : 671–678.15664904\n20 Mathew, D., Giles, J. R., Baxter, A. E., Oldridge, D. A., Greenplate, A. R., Wu, J. E., Alanio, C. et al., Deep immune profiling of COVID‐19 patients reveals distinct immunotypes with therapeutic implications. Science 2020. 369 (6508 ): eabc8511.32669297\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "0014-2980",
"issue": "51(10)",
"journal": "European journal of immunology",
"keywords": "B-cell deficiency; COVID-19; SARS-CoV-2; T-cell immunity; convalescent plasma",
"medline_ta": "Eur J Immunol",
"mesh_terms": "D000293:Adolescent; D000368:Aged; D057134:Antibodies, Neutralizing; D000914:Antibodies, Viral; D001402:B-Lymphocytes; D000086382:COVID-19; D006801:Humans; D007111:Immunity, Cellular; D007116:Immunization, Passive; D018655:Lymphocyte Count; D008212:Lymphocyte Depletion; D016393:Lymphoma, B-Cell; D020522:Lymphoma, Mantle-Cell; D008297:Male; D008875:Middle Aged; D054198:Precursor Cell Lymphoblastic Leukemia-Lymphoma; D000069283:Rituximab; D000086402:SARS-CoV-2; D013601:T-Lymphocytes; D016896:Treatment Outcome; D053261:Tumor Necrosis Factor Receptor Superfamily, Member 9",
"nlm_unique_id": "1273201",
"other_id": null,
"pages": "2478-2484",
"pmc": null,
"pmid": "34350584",
"pubdate": "2021-10",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Successful treatment of COVID-19 infection with convalescent plasma in B-cell-depleted patients may promote cellular immunity.",
"title_normalized": "successful treatment of covid 19 infection with convalescent plasma in b cell depleted patients may promote cellular immunity"
} | [
{
"companynumb": "CH-Appco Pharma LLC-2126785",
"fulfillexpeditecriteria": "1",
"occurcountry": "CH",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HYDROXYCHLOROQUINE SULFATE"
},
"drugadditio... |
{
"abstract": "Pneumocystis pneumonia (PCP) outbreaks may occur in solid organ transplant (SOT) patients. Transmissibility of Pneumocystis jirovecii among SOT and non-SOT patients has not been investigated. Ten SOT (ie, 4 heart, 4 kidney, 2 liver allograft recipients) and 11 non-SOT (ie, 7 HIV-infected, 3 hematologic malignancies, and 1 stem cell transplant) patients with PCP were admitted to London Health Sciences Center (LHSC) from October 2014 to August 2016. We investigated the course of illness and outcome of PCP in SOT and non-SOT patients. Post-transplant PCP was frequently an acute-onset disease (90% vs. 18.2%, p = .01) requiring ICU admission (70% vs. 20%, p = .03) and hemodialysis (60% vs. 0, p = .003). Mortality was more frequent in SOT patients (40% vs. 18.1%, p = .36). Multilocus sequence typing (MLST) demonstrated circulation of a single genotype of P. jirovecii among SOT patients. However, 8 different genotypes were detected from non-SOT patients. Reinstitution of prophylaxis successfully controlled post-transplant cluster until end of observation period in October 2019. No transmission was detected from non-SOT patients to SOT recipients. Detection of a single P. jirovecii genotype from all SOT recipients highlights the likelihood of nosocomial transmission. No source control method is recommended by current guidelines. Improvement of preventive strategies is required.",
"affiliations": "Transplant Infectious Diseases Program, Division of Infectious Diseases, Department of Medicine, University Health Network, University of Toronto, Toronto, ON, Canada.;Laboratoire de Santé Publique du Québec, Institut National de Santé Publique du Québec, Ste-Anne-de-Bellevue, QC, Canada.;Multiorgan Transplant Program, London Health Sciences Center, Western University, London, ON, Canada.;Laboratoire de Santé Publique du Québec, Institut National de Santé Publique du Québec, Ste-Anne-de-Bellevue, QC, Canada.;Multiorgan Transplant Program, London Health Sciences Center, Western University, London, ON, Canada.;Transplant Infectious Diseases Program, Division of Infectious Diseases, Department of Medicine, University Health Network, University of Toronto, Toronto, ON, Canada.;Transplant Infectious Diseases Program, Division of Infectious Diseases, Department of Medicine, University Health Network, University of Toronto, Toronto, ON, Canada.;Multiorgan Transplant Program, London Health Sciences Center, Western University, London, ON, Canada.",
"authors": "Hosseini-Moghaddam|Seyed M|SM|0000-0001-7979-2458;Dufresne|Philippe J|PJ|;Hunter Gutierrez|Elaine|E|;Dufresne|Simon F|SF|;House|Andrew A|AA|;Humar|Atul|A|;Kumar|Deepali|D|0000-0003-1961-0477;Jevnikar|Anthony M|AM|",
"chemical_list": null,
"country": "Denmark",
"delete": false,
"doi": "10.1111/ctr.14108",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0902-0063",
"issue": "34(12)",
"journal": "Clinical transplantation",
"keywords": "\nPneumocystis jirovecii\n; pneumocystis pneumonia; solid organ transplantation",
"medline_ta": "Clin Transplant",
"mesh_terms": "D064591:Allografts; D003428:Cross Infection; D005838:Genotype; D000077299:Healthcare-Associated Pneumonia; D006801:Humans; D058885:Multilocus Sequence Typing; D045363:Pneumocystis carinii; D011020:Pneumonia, Pneumocystis",
"nlm_unique_id": "8710240",
"other_id": null,
"pages": "e14108",
"pmc": null,
"pmid": "33048378",
"pubdate": "2020-12",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Long-lasting cluster of nosocomial pneumonia with a single Pneumocystis jirovecii genotype involving different organ allograft recipients.",
"title_normalized": "long lasting cluster of nosocomial pneumonia with a single pneumocystis jirovecii genotype involving different organ allograft recipients"
} | [
{
"companynumb": "CA-TEVA-2021-CA-1874788",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "3",
... |
{
"abstract": "To report a case of presumed furosemide-associated bilateral angle-closure glaucoma.\n\n\n\nRetrospective case report with spectral domain anterior segment optical coherence tomography imaging.\n\n\n\nA 21-year-old African American woman in her 17th week of pregnancy presented with acute angle-closure glaucoma in both eyes after being started on furosemide in her first trimester for fluid overload. Intraocular pressures were elevated in the low 40s mm Hg bilateral (OU) and anterior chambers were shallow with narrow grade 1 angles on gonioscopy (Schaffer classification). Medical history included type 1 diabetes mellitus, chronic kidney disease, and 2 prior failed pregnancies complicated by fluid overload. She was started on 60 mg of prednisone daily along with topical brimonidine in both eyes twice daily. After 3 days, her intraocular pressures normalized. At 1 week, slit-lamp examination showed deepened anterior chambers and gonioscopy confirmed widened angles. Oral prednisone was titrated down slowly for the remainder of her uneventful pregnancy. On follow-up 1 month after delivery, intraocular pressures and best-corrected visual acuities reached preterm baseline values of 15 mm Hg OU and 20/30 OU.\n\n\n\nThis is the first reported case of furosemide-associated bilateral angle-closure glaucoma. Similar idiosyncratic reactions following exposure to other sulphonamide-containing drugs have been described. We propose discontinuation of the offending agent and treatment with oral prednisone in similar clinical settings.",
"affiliations": "Summa Health System, Akron, OH.",
"authors": "Boundaoui|Oussama N|ON|;Woodruff|Todd E|TE|",
"chemical_list": "D004232:Diuretics; D005665:Furosemide",
"country": "United States",
"delete": false,
"doi": "10.1097/IJG.0000000000000430",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1057-0829",
"issue": "25(8)",
"journal": "Journal of glaucoma",
"keywords": null,
"medline_ta": "J Glaucoma",
"mesh_terms": "D000208:Acute Disease; D000869:Anterior Eye Segment; D003937:Diagnosis, Differential; D004232:Diuretics; D005260:Female; D005665:Furosemide; D015812:Glaucoma, Angle-Closure; D006068:Gonioscopy; D006801:Humans; D007429:Intraocular Pressure; D011247:Pregnancy; D011248:Pregnancy Complications; D011256:Pregnancy Outcome; D000072776:Slit Lamp Microscopy; D041623:Tomography, Optical Coherence; D014792:Visual Acuity; D055815:Young Adult",
"nlm_unique_id": "9300903",
"other_id": null,
"pages": "e748-50",
"pmc": null,
"pmid": "27479245",
"pubdate": "2016-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Presumed Furosemide-associated Bilateral Angle-Closure Glaucoma.",
"title_normalized": "presumed furosemide associated bilateral angle closure glaucoma"
} | [
{
"companynumb": "US-PFIZER INC-2016404510",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FUROSEMIDE"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nContinuous use of anabolic androgenic steroid in high-doses is associated with substantial health risks, including hepatocellular adenoma. Malignant transformation from hepatocellular adenoma to hepatocellular carcinoma after anabolic androgenic steroid abuse has been rarely reported. The morphological distinction of adenoma from well-differentiated hepatocellular carcinoma is challenging and requires elaborated imaging techniques and histology.\n\n\nMETHODS\nWe report about a 29-year old male professional bodybuilder who presented with mid-epigastric pain at the emergency unit. Ultrasound showed a severe hepatomegaly with multiple lesions. Contrast-enhanced ultrasound revealed a heterogeneous pattern with signs of hepatocellular carcinoma. CT scan of the abdomen confirmed multiple hypervascular lesions and central areas of necrosis without contrast enhancement. Subsequent diagnostics included fine needle aspiration (FNA) of suspicious lesions and mini-laparoscopy to establish the diagnosis of a β-catenin and testosterone-receptor positive hepatocellular carcinoma embedded in multiple adenomas. The patient was subsequently treated by liver transplantation and remains tumor-free 27 month after surgery.\n\n\nCONCLUSIONS\nHepatocellular carcinoma occurring in association with anabolic androgenic steroid abuse should sensitize physicians and especially professional bodybuilders for the harmful use of high doses of steroids.",
"affiliations": "Department of Gastroenterology, Hepatology and Endocrinology, Medizinische Hochschule, OE 6810 Carl-Neuberg-Str. 1, 30625, Hannover, Germany. solbach.philipp@mh-hannover.de.;Department of Gastroenterology, Hepatology and Endocrinology, Medizinische Hochschule, OE 6810 Carl-Neuberg-Str. 1, 30625, Hannover, Germany. potthoff.andrej@mh-hannover.de.;Department of Diagnostic and Interventional Radiology, Medizinische Hochschule Hannover, Hannover, Germany. raatschen.hans-juergen@mh-hannover.de.;Department of Pathology, Medizinische Hochschule Hannover, Hannover, Germany. soudah.bisharah@mh-hannover.de.;Department of Pathology, Medizinische Hochschule Hannover, Hannover, Germany. lehmann.ulrich@mh-hannover.de.;Department of Gastroenterology, Hepatology and Endocrinology, Medizinische Hochschule, OE 6810 Carl-Neuberg-Str. 1, 30625, Hannover, Germany. schneider.s.andrea@gmx.de.;Department of Gastroenterology, Hepatology and Endocrinology, Medizinische Hochschule, OE 6810 Carl-Neuberg-Str. 1, 30625, Hannover, Germany. gebel.michael@mh-hannover.de.;Department of Gastroenterology, Hepatology and Endocrinology, Medizinische Hochschule, OE 6810 Carl-Neuberg-Str. 1, 30625, Hannover, Germany. manns.michael@mh-hannover.de.;Department of Gastroenterology, Hepatology and Endocrinology, Medizinische Hochschule, OE 6810 Carl-Neuberg-Str. 1, 30625, Hannover, Germany. vogel.arndt@mh-hannover.de.",
"authors": "Solbach|Philipp|P|;Potthoff|Andrej|A|;Raatschen|Hans-Jürgen|HJ|;Soudah|Bisharah|B|;Lehmann|Ulrich|U|;Schneider|Andrea|A|;Gebel|Michael J|MJ|;Manns|Michael P|MP|;Vogel|Arndt|A|",
"chemical_list": "D045930:Anabolic Agents; D000728:Androgens; D014408:Biomarkers, Tumor; D058573:Performance-Enhancing Substances; D011944:Receptors, Androgen; D013256:Steroids",
"country": "England",
"delete": false,
"doi": "10.1186/s12876-015-0288-0",
"fulltext": "\n==== Front\nBMC GastroenterolBMC GastroenterolBMC Gastroenterology1471-230XBioMed Central London 2598606728810.1186/s12876-015-0288-0Case ReportTestosterone-receptor positive hepatocellular carcinoma in a 29-year old bodybuilder with a history of anabolic androgenic steroid abuse: a case report Solbach Philipp solbach.philipp@mh-hannover.de 1Potthoff Andrej potthoff.andrej@mh-hannover.de 1Raatschen Hans-Jürgen raatschen.hans-juergen@mh-hannover.de 2Soudah Bisharah soudah.bisharah@mh-hannover.de 3Lehmann Ulrich lehmann.ulrich@mh-hannover.de 3Schneider Andrea schneider.s.andrea@gmx.de 1Gebel Michael J. gebel.michael@mh-hannover.de 1Manns Michael P. manns.michael@mh-hannover.de 1Vogel Arndt vogel.arndt@mh-hannover.de 11 Department of Gastroenterology, Hepatology and Endocrinology, Medizinische Hochschule, OE 6810 Carl-Neuberg-Str. 1, 30625 Hannover, Germany 2 Department of Diagnostic and Interventional Radiology, Medizinische Hochschule Hannover, Hannover, Germany 3 Department of Pathology, Medizinische Hochschule Hannover, Hannover, Germany 20 5 2015 20 5 2015 2015 15 6027 1 2015 8 5 2015 © Solbach et al. 2015This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nContinuous use of anabolic androgenic steroid in high-doses is associated with substantial health risks, including hepatocellular adenoma. Malignant transformation from hepatocellular adenoma to hepatocellular carcinoma after anabolic androgenic steroid abuse has been rarely reported. The morphological distinction of adenoma from well-differentiated hepatocellular carcinoma is challenging and requires elaborated imaging techniques and histology.\n\nCase presentation\nWe report about a 29-year old male professional bodybuilder who presented with mid-epigastric pain at the emergency unit. Ultrasound showed a severe hepatomegaly with multiple lesions. Contrast-enhanced ultrasound revealed a heterogeneous pattern with signs of hepatocellular carcinoma. CT scan of the abdomen confirmed multiple hypervascular lesions and central areas of necrosis without contrast enhancement. Subsequent diagnostics included fine needle aspiration (FNA) of suspicious lesions and mini-laparoscopy to establish the diagnosis of a β-catenin and testosterone-receptor positive hepatocellular carcinoma embedded in multiple adenomas. The patient was subsequently treated by liver transplantation and remains tumor-free 27 month after surgery.\n\nConclusion\nHepatocellular carcinoma occurring in association with anabolic androgenic steroid abuse should sensitize physicians and especially professional bodybuilders for the harmful use of high doses of steroids.\n\nKeywords\nAnabolic androgenic steroidsHormonal treatmentHepatocellular carcinomaHepatic adenomaissue-copyright-statement© The Author(s) 2015\n==== Body\nBackground\nOne of the major risk factors of developing hepatocellular adenoma (HCA) is the use of oral contraceptives, which stimulate liver expressed estrogen and androgen receptors, predominantly in women between 15 and 45 years of age [1, 2]. Accordingly, 90 % of HCA are diagnosed in women [3]. Other risk factors include glycogen storage disease I and III and treatment with anabolic steroids in patients with Fanconi’s anemia [4–6]. A few reports indicate that anabolic androgenic steroids (AAS) may also lead to the formation of HCA [7–9]. Relevant complications of HCA include hemorrhage and malignant transformation into hepatocellular carcinoma (HCC) depending on size and β-catenin activation.\n\nIn the literature are more reports of patients with Fanconi’s anemia, which received medical treatment with AAS and subsequently developed HCCs [4, 6]. Furthermore a few cases are described from bodybuilders with AAS abuse that subsequently developed HCC [7, 9, 10]. These patients require close surveillance to detect possible malignant transformation from HCA into HCC or lesions that are at risk of bleeding or rupture [8].\n\nHere, we report a case of a testosterone-receptor positive HCC arising from multiple HCAs in a professional bodybuilder after 6 years of AAS abuse and the difficulties of diagnostics and therapeutical options.\n\nCase presentation\nClinical history\nWe describe a case of a 29-year old male professional bodybuilder who presented at the emergency unit with midepigastric-pain. He had been taking anabolic androgenic steroids (AAS; see below) and underwent strict nutritional diets to increase muscle mass prior to competitions over the last 6 years. He self-administered the following AAS from 2011 to 2012 in cycles of 4 weeks with rest periods of several weeks between the cycles: nandrolone decanoate (400 mg/week), sustanon (750 mg/week), methandienone (280–350 mg/week), stanozolol (50 mg/day for 1 month) and human growth hormone (4 IE/day for 3 month). Additionally 3 days before competitions he self-administered the diuretics aldosterone (50 mg/day) and thiazide (25 mg/day) to reduce extracellular and subcutaneous tissue volume and to achieve a better muscle shaping. Furthermore insulin injections and tamoxifen were administered. The frequency of self-administration was varying in each cycle.\n\nAt presentation, the patient had not taken any AAS for 5 weeks. Previous history was a childhood near a nuclear power plant until the age of fifteen. Allergic coryza and nasal spray use since the age of seven were reported. Moreover no abuse of ethanol or smoking was given. The patient’s father died supposedly as the result of kidney cancer, his grandfather died from bronchial cancer. His mother and younger siblings are healthy. On examination, the patient showed a three-fold amplified liver extending into lesser pelvis with painful palpation. No other clinical abnormalities were detectable (Fig. 1).Fig. 1 Clinical examination showed a muscular body, height 186 cm, weight 120 kg. The lung showed a sonorous percussion, vesicular breath sounds, no noise. Heart: regular rhythm, 55 bpm, RR 134/67 mmHg, first heart sound and second heart sound not flashy, no heart murmurs. No pathological examination findings for head, neck, lymph node status, pulse status. No scleral icterus. Abdominal examination showed a large abdomen, vascular abdominal markings, yellow colouring, liver palpable to lesser pelvis right, superficial palpation was painful, spleen not palpable, no kidney pain or back pain (a lateral view; b ventral view)\n\n\n\nLaboratory findings\nLaboratory evaluation revealed severe hepatic inflammation and an impaired liver function (ALT 1653 IU/l; AST 1437 IU/l; alkaline phosphatase 372 IU/l; GGT 463 IU/l; CHE 1.29 kU/I; LDH 695 U/I; total bilirubin 41 μmol/l; direct bilirubin 38 μmol/l). Hematology showed an anemia and slightly increased white blood cell count (leucocytes 12.500/ μl; hemoglobin 8.5 g/dl; INR 1.04; reticulocytes 104/nl). Inflammation parameters were increased (CRP 81 mg/l, PCT 4.8 μg/l, Ferritin 1672 μg/l). The renal function was almost normal (creatinine 123 μmol/l, but cystatine c 0.76 mg/l and MDRD > 60 ml/min).\n\nCoagulation tests were normal, as well as hepatitis virus markers, including hepatitis A, B and C and also human deficiency virus markers were negative. Serum levels of sex hypophyseal hormones (LH <0.07 U/I, FSH <0.3 U/I, androgens (T + DHT) 0.037 ng/ml, free-testosterone 4.94 pg/ml) and thyroid gland markers (fT3, fT4) were below the lower limit of normal. This constellation of sex hormones reflects anabolic steroids induced hypogonadism (ASIH).\n\nImaging\nAbdominal ultrasound (US) showed a marked hepatomegaly with 25.6 cm in the midclavicular line and 30.1 cm in the median with evidence of fatty liver. In B-mode sonography multiple lesions were detected in both liver lobes (left liver lobe: various isoecogenic, inhomogeneous lesions with a maximum size of 92 mm × 92 mm; right liver lobe: various isoecogenic, polycyclic inhomogeneous lesions with a maximum size of 222 mm × 162 mm) (Fig. 2a). Moreover, the hepatic segment of the inferior vena cava (IVC) was compressed by the hepatic tumors, which consecutively led to a partial Budd Chiari syndrome. This was diagnosed in the doppler sonography through the retrograde flow pattern in the right hepatic vein with an evidence of subcapsular venous collaterals.Fig. 2 a B-mode ultrasonography: The hepatic tumors were polycyclic, isoechoic and inhomogeneous. Doppler sonography showed a compression in the IVC hepatic segment by the liver tumors with consecutive development of partial Budd Chiari syndrome diagnosed by the retrograde flow pattern in the right hepatic vein and the presence of subcapsular venous collaterals. b Contrast enhanced ultrasonography (CEUS): CEUS was performed using a bolus injection of 1.5 mL SonoVue® (Bracco SpA, Milan, Italy). The largest lesion showed a large, avascular center with hypervascular margin in the arterial phase. In the late venous phase parts of the center and the margin showed wash-out\n\n\n\nIn contrast-enhanced ultrasound (CEUS) the hepatic lesions showed a heterogeneous pattern (Fig. 2b). Some lesions exhibited arterial enhancement, initially at the periphery with subsequent very rapid centripetal filling and without wash-out in the portal venous or late phase. Other lesions showed arterial enhancement, with a chaotic vascular pattern and avascular areas in different parts of each tumor. In the portal venous phase, these tumors showed wash-out, especially in liver segment 6, in which a tumor biopsy was performed. The small lesions (diameter <12 mm) seen in B-mode sonography showed neither arterial hypervascularisation nor wash-out in the portal venous or late phase. The contrast-enhanced CT scan of the abdomen revealed a distinctive hepatomegaly with multiple hypervascular lesions without substantial wash-out in portal venous phase. In the largest lesions, central areas of necrosis without contrast enhancement were present (16 × 13 cm) (Fig. 3). There was no evidence of metastasis in the abdomen and chest.Fig. 3 Contrast enhanced computed tomography in arterial (a,c) and portalvenous phase (b,d): Highly enlarged liver with curved borders secondary to multiple parenchymatous lesions throughout all liver segments, with arterial enhancement and no substantial wash-out during portalvenous phase. The large lesion in right lobe up to 16 cm appeared inhomogeneous with peripheral enhancement and non-enhancing, necrotic areas in the center. Intrahepatic vena cava and right liver vein were completely compressed by nodular tumors in the caudate lobe and the large lesion in the right lobe\n\n\n\nPathology\nCytology of liver-segment six was performed by fine needle aspiration (FNA) of one lesion with signs of hepatocellular carcinoma in contrast-enhanced ultrasound. The cytological samples did not reveal malignancy and showed no clearly signs for hepatocellular carcinoma or hepatoblastoma. Further molecular cytogenetic and pathological-anatomical diagnostics showed atypical HCA.\n\nTo confirm the diagnosis of hepatocellular carcinoma in suspicious lesions, a diagnostic laparoscopy was performed. The liver was enormously enlarged and there was almost no veritable parenchyma visible between the tumor nodules. The largest tumors bulged out of the liver’s surface with yellow to bluish discoloration and strong tumor vascular markings. Biopsy of the liver in the right lobe from three tumors and one tumor of the left lobe was performed. The synopsis of morphology and immunohistochemistry now clearly confirmed the diagnosis of a hepatocellular carcinoma (Fig. 4d; β-catenin 20% nuclear positive (Fig. 4a), glutamine synthetase cytoplasmic positive (Fig. 4b), androgen-receptor nuclear positive (Fig. 4c) and focal CD34 positive). Sequence analysis of exon 3 of the β-catenin gene was performed by PCR and subsequent Sanger sequencing as described in reference eleven and showed a hotspot mutation in codon 32 (p.D32G) [11].Fig. 4 Liver biopsy: Small solid and glandular associations of hepatocytes without bile duct epithelia. Reticulin fiber network focally obtained. The hepatocytes had markedly enlarged nuclei with large nucleoli with coarse structure of chromatin. Iron and rhodanine negative. Immunohistochemistry: Beta-catenin 20 % nuclear positive (a; 80:1) and glutamine synthetase cytoplasmic positive (b; 160:1), hepatocytes with nuclear positivity for androgen-receptors (c; 140:1). Molecular Cytogenetics: Aneuploidy of chromosome 1 (CEP1) and 8 (CEP). Diagnosis: The results of conventional histology, molecular biology and immunohistochemistry recommended HCC G1 (d; HE stain 140:1). Comment: Simply by Cytology (FNP) a detection of HCC G1 is quite difficult. There were no bridges or cell atypia, on the other hand, histology showed more criteria for HCC G1\n\n\n\nTreatment\nDue to the size and number of the lesions, there was no option for surgical resection. The distinction of all tumor nodules into HCAs and hepatocellular carcinomas was impossible, but overall HCC burden was considered to be out of the Milan criteria [12]. The multidisciplinary tumor board at Medical School Hannover initially recommended chemoembolization, which was however declined by the patient. He therefore returned home, where subsequently a liver transplantation was performed without any complications. The explanted liver showed a mass of 8 kg. 27 months after transplantation he is in excellent condition without any signs of metastasis or local recurrence. He is not taking AAS anymore.\n\nDiscussion\nWe report a case of a young professional bodybuilder with self-administration of high-doses of anabolic androgenic steroids (AAS) for at least 6 years who developed a hepatocellular carcinoma (HCC) without metastasis or alpha-fetoprotein elevation. In this case, the hepatocellular carcinoma was embedded in multiple hepatocellular adenomas (HCA).\n\nAAS such as testosterone and its derivates are favored in endurance and strength sports as well as in bodybuilding, often in combination with other medication like diuretics and insulin. The most popular oral products especially stanozolol, methandrostenolone and nandrolone have a high first-pass in the liver and have been reported to induce significant toxicity including intrahepatic structural changes with cholestasis and benign and malignant tumors.\n\nIt has been reported, that steroids induce HCA with potential malignant transformation into carcinoma. As described for colorectal-carcinoma, there could be an adenoma-carcinoma sequence [13]. In our case, it is difficult to distinguish whether the HCC developed de novo or within the multiple HCAs. Several biopsies from multiple tumor nodules were required to ascertain the diagnosis of HCC. The morphological distinction of HCA, focal nodular hyperplasia (FNH), macroregenerative nodules from well-differentiated HCC can be challenging [14].\n\nMalignant transformation of HCA may occur in about 4.5–9 % of cases [14–17]. Exome sequencing has identified recurrent somatic activating mutations in several genes including FRK, JAK1, gp130, and β-catenin. Moreover, integrative analysis of HCAs transformed to hepatocellular carcinoma revealed that β-catenin mutation occurs as an early alteration, whereas TERT promoter mutations are associated with the last step of the adenoma-carcinoma transition [18]. HCAs with ß-catenin mutations frequently show an overexpression of β-catenin (nuclear and cytoplasmic) and glutamine synthetase as in our patient. Although HCA shows an increased prevalence in women, beta-catenin activation is more prevalent in men with consequently an increased prevalence of HCC [19, 20]. In our case genetic analysis for β-catenin mutations showed a hotspot mutation in codon 32 of exon 3 (p.D32G).\n\nAs has been described previously, HCA showed highly variable appearance on computed tomography (CT), magnetic resonance imaging (MRI), and contrast-enhanced ultrasound (CEUS) scans. This is reflected by the differences in the histological features [21–25]. In the CEUS, typical HCA shows an arterial hypervascularisation in the early arterial phase with a centripetal filling pattern. However this arterial enhancement pattern can also be encountered in HCC and is not pathognomonic of HCA [26]. MRI seems to be superior to other imaging modalities for the diagnosis of HCA. One study performed by Laumonier and coworkers revealed that in hepatocyte nuclear factor 1 alpha (HNF1A) -mutated and inflammatory HCAs characteristic MRI patterns exist, which reach a specificity of 100 % and a sensitivity of 86.7 % [27]. Histology is the ultimate gold standard for the diagnosis and risk stratification of HCAs [28].\n\nImmunochemistry analysis revealed the presence of testosterone-receptors on the hepatocellular carcinoma, which might be of prognostic significance. In one study, none of the patients with androgen receptor (AR) positive HCC survived 5 years [29]. Other studies supported these findings by suggesting a negative impact of AR positivity on tumor recurrence [30]. Various clinical trials have evaluated the role of anti-androgens for the treatment of liver cancer with controversial outcome. In a systematic review, Di Maio et al. concluded that hormonal treatment should not be a part of the current management of HCC patients [31, 32].\n\nThere are different therapeutic strategies for HCC without metastasis. First of all local ablative therapies like percutaneous ethanol injection (PEI), radiofrequency ablation (RFA), transarterial chemoembolization (TACE) and radiation therapy (RT) but effectiveness depends on the number and size of the tumors. Due to the tumor burden of our patient local ablative therapies such as RFA or surgery were not possible. TACE for bridging was recommended by the tumorboard, although a clear differentiation between HCA and carcinoma was not given. This minimally- invasive method can treat multiple tumors, can be easily repeated and is well established in the treatment algorithm for patients with advanced HCC [33]. Embolization of HCA has been rarely reported, but appears to be a feasible therapeutic option [34]. Our patient refused to take this option.\n\nIn general liver transplantation is the therapy of choice for selected patients with HCC without the possibility of resection and extrahepatic metastasis [35]. It is known, that patients exceeding Milan criteria for liver transplantation had a higher recurrence rate and lower survival rate than complying them. But also beyond the Milan criteria but within extended University of California, San Francisco (UCSF) criteria (single tumor <6.5 cm, maximum of three total tumors with none >4.5 cm, and cumulative tumor size <8 cm) a prolonged survival can be achieved. Survival rates beyond UCSF criteria were less than 50 % at 5 years [36]. Following liver transplantation, our patient is still without any signs of tumor recurrence or metastasis.\n\nConclusion\nIn this case, 6 years of chronic anabolic androgenic steroid abuse lead to HCA and HCC development with almost no normal liver tissue left. Not only bodybuilders but also trainers and physicians should be aware of the HCC risk when using or prescribing AAS.\n\nConsent\nWritten informed consent was obtained from the patient for publication of this Case report and any accompanying images. A copy of the written consent is available for review by the Editor of this journal.\n\nAbbreviations\nAASAnabolic androgenic steroids\n\nALTAlanine transaminase\n\nARAndrogen receptor\n\nASTAspartate transaminase\n\nAFPAlfa-fetoprotein\n\nCEUSContrast-enhanced ultrasonography\n\nCHECholinesterase\n\nCRPC-reactive protein\n\nCTComputer tomography\n\nFNAFine needle aspiration\n\nFSHFollicle stimulating hormone\n\nGGTGamma-glutamyl transferase\n\nHCAHepatocellular adenoma\n\nHCCHepatocellular carcinoma\n\nINRInternational normalized ratio\n\nIVCInferior vena cava\n\nLDHLactate dehydrogenase\n\nLHLuteinising hormone\n\nMDRDModification of diet in renal disease\n\nMRIMagnet resonance imaging\n\nPCTProcalcitonin\n\nPEIPercutaneous ethanol injection\n\nRFARadiofrequency ablation\n\nRTRadiation therapy\n\nTACETransarterial chemoembolization\n\nCompeting interests\n\nAll authors listed have contributed sufficiently to the project to be included as authors, and all those who are qualified to be authors are listed in the author byline. To the best of our knowledge, no conflict of interest, financial or other, exists.\n\nAuthors’ contributions\n\nPS carried out the concept and design of the case report, responsible for the acquisition, analysis and interpretation of data and drafted the manuscript. AP was responsible for the acquisition, sonography and for the revision of the manuscript for content. HJR was responsible for the acquisition, computed tomography and for the revision of the manuscript for content. BS was responsible for the acquisition, analysis and interpretation of data, technical support and for the revision of the manuscript for content. UL was responsible for the gene mutation analysis of ß-catenin and for the revision of the manuscript for content. AS was responsible for the acquisition, technical support and for the revision of the manuscript for content. MG was responsible for the acquisition, analysis and interpretation of data, sonography and for the revision of the manuscript for content. MM was responsible for the acquisition, analysis and interpretation of data, technical support and for the revision of the manuscript for content and study supervision. AV carried out the concept and design of the case report and was responsible for the acquisition, analysis and interpretation of data, technical support and for the final revision of the manuscript for content. All authors read and approved the final manuscript.\n==== Refs\nReferences\n1. Rooks JB Ory HW Ishak KG Strauss LT Greenspan JR Hill AP Epidemiology of hepatocellular adenoma. The role of oral contraceptive use JAMA 1979 242 7 644 8 10.1001/jama.1979.03300070040020 221698 \n2. Nagasue N Ito A Yukaya H Ogawa Y Androgen receptors in hepatocellular carcinoma and surrounding parenchyma Gastroenterology 1985 89 3 643 7 10.1016/0016-5085(85)90463-9 2991072 \n3. Farges O Ferreira N Dokmak S Belghiti J Bedossa P Paradis V Changing trends in malignant transformation of hepatocellular adenoma Gut 2011 60 1 85 9 10.1136/gut.2010.222109 21148580 \n4. Johnson FL Lerner KG Siegel M Feagler JR Majerus PW Hartmann JR Association of androgenic-anabolic steroid therapy with development of hepatocellular carcinoma Lancet 1972 2 7790 1273 6 10.1016/S0140-6736(72)92649-9 4117807 \n5. Labrune P Trioche P Duvaltier I Chevalier P Odievre M Hepatocellular adenomas in glycogen storage disease type I and III: a series of 43 patients and review of the literature J Pediatr Gastroenterol Nutr 1997 24 3 276 9 10.1097/00005176-199703000-00008 9138172 \n6. Velazquez I Alter BP Androgens and liver tumors: Fanconi’s anemia and non-Fanconi’s conditions Am J Hematol 2004 77 3 257 67 10.1002/ajh.20183 15495253 \n7. Gorayski P Thompson CH Subhash HS Thomas AC Hepatocellular carcinoma associated with recreational anabolic steroid use Br J Sports Med 2008 42 1 74 5 10.1136/bjsm.2007.03932 18178686 \n8. Hernandez-Nieto L Bruguera M Bombi J Camacho L Rozman C Benign liver-cell adenoma associated with long-term administration of an androgenic-anabolic steroid (methandienone) Cancer 1977 40 4 1761 4 10.1002/1097-0142(197710)40:4<1761::AID-CNCR2820400454>3.0.CO;2-C 198105 \n9. Socas L Zumbado M Perez-Luzardo O Ramos A Perez C Hernandez JR Hepatocellular adenomas associated with anabolic androgenic steroid abuse in bodybuilders: a report of two cases and a review of the literature Br J Sports Med 2005 39 5 e27 10.1136/bjsm.2004.013599 15849280 \n10. Hardt A Stippel D Odenthal M Holscher AH Dienes HP Drebber U Development of hepatocellular carcinoma associated with anabolic androgenic steroid abuse in a young bodybuilder: a case report Case Reports Pathol 2012 2012 195607 10.1155/2012/195607 \n11. Huss S Nehles J Binot E Wardelmann E Mittler J Kleine MA beta-catenin (CTNNB1) mutations and clinicopathological features of mesenteric desmoid-type fibromatosis Histopathology 2013 62 2 294 304 10.1111/j.1365-2559.2012.04355.x 23020601 \n12. Mazzaferro V Regalia E Doci R Andreola S Pulvirenti A Bozzetti F Liver transplantation for the treatment of small hepatocellular carcinomas in patients with cirrhosis N Engl J Med 1996 334 11 693 9 10.1056/NEJM199603143341104 8594428 \n13. Dombrowski F Flaschka C Klotz L von Netzer B Schulz C Lehnert H Hepatocellular neoplasms after intrahepatic transplantation of ovarian fragments into ovariectomized rats Hepatology 2006 43 4 857 67 10.1002/hep.21124 16557532 \n14. Fischer SE. Hepatocellular carcinoma arising in hepatic adenoma: diagnostic and management implications. Diagn Histopathology. 2014;20(6):257–61.\n15. Kim DH Kim SU Nam DH Choi YJ Park SM Lee CK A case of hepatocellular carcinoma within hepatocellular adenoma in a non-cirrhotic male Korean J Intern Med 2009 24 2 147 52 10.3904/kjim.2009.24.2.147 19543495 \n16. Ronald M Woodfield J McCall J Koea J Hepatic adenomas in male patients HPB (Oxford) 2004 6 1 25 7 10.1080/13651820310020846 18333041 \n17. Stoot JH Coelen RJ De Jong MC Dejong CH Malignant transformation of hepatocellular adenomas into hepatocellular carcinomas: a systematic review including more than 1600 adenoma cases HPB (Oxford) 2010 12 8 509 22 10.1111/j.1477-2574.2010.00222.x 20887318 \n18. Pilati C Letouze E Nault JC Imbeaud S Boulai A Calderaro J Genomic profiling of hepatocellular adenomas reveals recurrent FRK-activating mutations and the mechanisms of malignant transformation Cancer Cell 2014 25 4 428 41 10.1016/j.ccr.2014.03.005 24735922 \n19. Bioulac-Sage P Rebouissou S Thomas C Blanc JF Saric J Sa Cunha A Hepatocellular adenoma subtype classification using molecular markers and immunohistochemistry Hepatology 2007 46 3 740 8 10.1002/hep.21743 17663417 \n20. Zucman-Rossi J Jeannot E Nhieu JT Scoazec JY Guettier C Rebouissou S Genotype-phenotype correlation in hepatocellular adenoma: new classification and relationship with HCC Hepatology 2006 43 3 515 24 10.1002/hep.21068 16496320 \n21. Arrive L Flejou JF Vilgrain V Belghiti J Najmark D Zins M Hepatic adenoma: MR findings in 51 pathologically proved lesions Radiology 1994 193 2 507 12 10.1148/radiology.193.2.7972769 7972769 \n22. Grazioli L Federle MP Ichikawa T Balzano E Nalesnik M Madariaga J Liver adenomatosis: clinical, histopathologic, and imaging findings in 15 patients Radiology 2000 216 2 395 402 10.1148/radiology.216.2.r00jl38395 10924560 \n23. Hussain SM van den Bos IC Dwarkasing RS Kuiper JW den Hollander J Hepatocellular adenoma: findings at state-of-the-art magnetic resonance imaging, ultrasound, computed tomography and pathologic analysis Eur Radiol 2006 16 9 1873 86 10.1007/s00330-006-0292-4 16708218 \n24. Kim TK Jang HJ Burns PN Murphy-Lavallee J Wilson SR Focal nodular hyperplasia and hepatic adenoma: differentiation with low-mechanical-index contrast-enhanced sonography AJR Am J Roentgenol 2008 190 1 58 66 10.2214/AJR.07.2493 18094294 \n25. Psatha EA Semelka RC Armao D Woosley JT Firat Z Schneider G Hepatocellular adenomas in men: MRI findings in four patients J Magn Reson Imaging 2005 22 2 258 64 10.1002/jmri.20375 16028257 \n26. Claudon M Dietrich CF Choi BI Cosgrove DO Kudo M Nolsoe CP Guidelines and good clinical practice recommendations for Contrast Enhanced Ultrasound (CEUS) in the liver - update 2012: A WFUMB-EFSUMB initiative in cooperation with representatives of AFSUMB, AIUM, ASUM, FLAUS and ICUS Ultrasound Med Biol 2013 39 2 187 210 10.1016/j.ultrasmedbio.2012.09.002 23137926 \n27. Laumonier H Bioulac-Sage P Laurent C Zucman-Rossi J Balabaud C Trillaud H Hepatocellular adenomas: magnetic resonance imaging features as a function of molecular pathological classification Hepatology 2008 48 3 808 18 10.1002/hep.22417 18688875 \n28. Khalili K Kim TK Jang HJ Haider MA Khan L Guindi M Optimization of imaging diagnosis of 1–2 cm hepatocellular carcinoma: an analysis of diagnostic performance and resource utilization J Hepatol 2011 54 4 723 8 10.1016/j.jhep.2010.07.025 21156219 \n29. Nagasue N Chang YC Hayashi T Galizia G Kohno H Nakamura T Androgen receptor in hepatocellular carcinoma as a prognostic factor after hepatic resection Ann Surg 1989 209 4 424 7 10.1097/00000658-198904000-00006 2539062 \n30. Boix L Castells A Bruix J Sole M Bru C Fuster J Androgen receptors in hepatocellular carcinoma and surrounding liver: relationship with tumor size and recurrence rate after surgical resection J Hepatol 1995 22 6 616 22 10.1016/0168-8278(95)80217-7 7560855 \n31. Di Maio M Daniele B Pignata S Gallo C De Maio E Morabito A Is human hepatocellular carcinoma a hormone-responsive tumor? World J Gastroenterol 2008 14 11 1682 9 10.3748/wjg.14.1682 18350599 \n32. Di Maio M De Maio E Morabito A D’Aniello R De Feo G Gallo C Hormonal treatment of human hepatocellular carcinoma Ann N Y Acad Sci 2006 1089 252 61 10.1196/annals.1386.007 17261772 \n33. Llovet JM Real MI Montana X Planas R Coll S Aponte J Arterial embolisation or chemoembolisation versus symptomatic treatment in patients with unresectable hepatocellular carcinoma: a randomised controlled trial Lancet 2002 359 9319 1734 9 10.1016/S0140-6736(02)08649-X 12049862 \n34. Kim YI Chung JW Park JH Feasibility of transcatheter arterial chemoembolization for hepatic adenoma J Vasc Interv Radiol 2007 18 7 862 7 10.1016/j.jvir.2007.04.014 17609445 \n35. Murray KF Carithers RL Jr Aasld: AASLD practice guidelines: evaluation of the patient for liver transplantation Hepatology 2005 41 6 1407 32 10.1002/hep.20704 15880505 \n36. Duffy JP Vardanian A Benjamin E Watson M Farmer DG Ghobrial RM Liver transplantation criteria for hepatocellular carcinoma should be expanded: a 22-year experience with 467 patients at UCLA Ann Surg 2007 246 3 502 9 10.1097/SLA.0b013e318148c704 17717454\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-230X",
"issue": "15()",
"journal": "BMC gastroenterology",
"keywords": null,
"medline_ta": "BMC Gastroenterol",
"mesh_terms": "D000328:Adult; D045930:Anabolic Agents; D000728:Androgens; D014408:Biomarkers, Tumor; D006528:Carcinoma, Hepatocellular; D004300:Doping in Sports; D006801:Humans; D008113:Liver Neoplasms; D008297:Male; D058573:Performance-Enhancing Substances; D011944:Receptors, Androgen; D013256:Steroids; D014891:Weight Lifting",
"nlm_unique_id": "100968547",
"other_id": null,
"pages": "60",
"pmc": null,
"pmid": "25986067",
"pubdate": "2015-05-20",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "15495253;17717454;16028257;2539062;19543495;7560855;4117807;15849280;18178686;7972769;15880505;23137926;9138172;22934212;16557532;18350599;18333041;10924560;21156219;18094294;17261772;21148580;20887318;17663417;18688875;221698;2991072;8594428;198105;16708218;12049862;23020601;16496320;17609445;24735922",
"title": "Testosterone-receptor positive hepatocellular carcinoma in a 29-year old bodybuilder with a history of anabolic androgenic steroid abuse: a case report.",
"title_normalized": "testosterone receptor positive hepatocellular carcinoma in a 29 year old bodybuilder with a history of anabolic androgenic steroid abuse a case report"
} | [
{
"companynumb": "DE-ROCHE-1629996",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "STANOZOLOL"
},
"drugadditional": null,
"drug... |
{
"abstract": "Right atrial and vena cava thrombus is a challenging clinical problem with limited treatment options for percutaneous extraction. We describe the use of a novel AngioVac venous extracorporeal bypass system (AngioDynamics) to remove a part of large right atrial tumor and thrombus in a patient with recurrent pulmonary embolism from hepatocellular carcinoma infiltrating into the inferior vena cava and the right atrium.",
"affiliations": "MetroHealth Campus, Case Western Reserve University, Cleveland, OH 44109 USA. sgandhi@metrohealth.org.",
"authors": "Sengodan|Prasanna|P|;Grewal|Harpreet|H|;Gandhi|Sanjay|S|",
"chemical_list": "D000925:Anticoagulants; D000970:Antineoplastic Agents; D017984:Enoxaparin; D010671:Phenylurea Compounds; D009536:Niacinamide; D000077157:Sorafenib",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1042-3931",
"issue": "26(7)",
"journal": "The Journal of invasive cardiology",
"keywords": null,
"medline_ta": "J Invasive Cardiol",
"mesh_terms": "D000328:Adult; D000792:Angiography; D000925:Anticoagulants; D000970:Antineoplastic Agents; D006528:Carcinoma, Hepatocellular; D017984:Enoxaparin; D017809:Fatal Outcome; D006325:Heart Atria; D006801:Humans; D008113:Liver Neoplasms; D008297:Male; D009361:Neoplasm Invasiveness; D009536:Niacinamide; D010671:Phenylurea Compounds; D011655:Pulmonary Embolism; D000077157:Sorafenib; D013396:Suction; D017131:Thrombectomy; D014682:Vena Cava, Inferior",
"nlm_unique_id": "8917477",
"other_id": null,
"pages": "E100-3",
"pmc": null,
"pmid": "24993994",
"pubdate": "2014-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Invasive hepatocellular carcinoma with recurrent pulmonary embolism: use of AngioVac cannula thrombectomy device for mechanical aspiration.",
"title_normalized": "invasive hepatocellular carcinoma with recurrent pulmonary embolism use of angiovac cannula thrombectomy device for mechanical aspiration"
} | [
{
"companynumb": "US-BAYER-2016-032792",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ENOXAPARIN"
},
"drugadditional": null,
... |
{
"abstract": "A human immunodeficiency virus (HIV) infection has long been associated with kidney disease. The pathogenesis of renal complications may be directly related to the presence of HIV viral particles or may occur secondary to an immune response against the virus. A number of HIV medications have been associated with the development of acute and chronic kidney disease. It has been estimated that approximately 60 percent of patients suffering from HIV/acquired immunodeficiency syndrome (AIDS) will, at some point, manifest clinically significant renal sequelae.The most common kidney disease affecting HIV patients is HIV-associated nephropathy (HIVAN) or focal segmental glomerulonephritis (FSGS). A very small subset of patients suffering from HIV/AIDS does go on to develop membranous glomerulonephritis. We present a case of a 55-year old Caucasian male who presented to the hospital after two weeks of weakness and falling when attempting to stand. The patient had a history of HIV, diagnosed in 1996. The latest cluster differentiation 4 (CD4) count was 245 cells/uL and the HIV-ribonucleic acid (RNA) viral load was reported as less than 75 copies/ml. The physical exam at presentation was insignificant. The laboratory examination revealed elevated creatinine. Potential nephrotoxic home medications, including Atripla and lisinopril, were held. After a brief inpatient stay, he was discharged but was ultimately readmitted for worsening renal function and nephrotic syndrome was diagnosed. Renal biopsy was performed, and membranous glomerulonephritis was confirmed. To this point, there are no associated cases reported of membranous glomerulonephritis after initiation of therapy with Atripla. We present a case of a rare etiology of membranous nephropathy in an HIV patient. Physicians should be judicious in detecting the etiology of renal dysfunction in HIV patients.",
"affiliations": "Internal Medicine, Charleston Area Medical Center, Charleston, USA.;Neurosurgery, University Hospitals Cleveland Medical Center, Cleveland, USA.;Pathology, Louisiana State University, Shreveport, USA.;Internal Medicine, Duke University, Raleigh, USA.;Internal Medicine, Charleston Area Medical Center, Charleston, USA.",
"authors": "Rawala|Muhammad Shabbir|MS|;Wright|James|J|;King|Judy|J|;Howell|David|D|;Martin|Shelda|S|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.7759/cureus.3932",
"fulltext": "\n==== Front\nCureusCureus2168-8184Cureus2168-8184Cureus Palo Alto (CA) 10.7759/cureus.3932Infectious DiseaseNephrologyMembranous Nephropathy in a Patient with Human Immunodeficiency Virus Shortly After Initiation of HAART with Atripla Muacevic Alexander Adler John R Rawala Muhammad Shabbir 1Wright James 2King Judy 3Howell David 4Martin Shelda 1\n1 \nInternal Medicine, Charleston Area Medical Center, Charleston, USA \n2 \nNeurosurgery, University Hospitals Cleveland Medical Center, Cleveland, USA \n3 \nPathology, Louisiana State University, Shreveport, USA \n4 \nInternal Medicine, Duke University, Raleigh, USA \nMuhammad Shabbir Rawala muhammad_rawala@hotmail.com21 1 2019 1 2019 11 1 e39329 1 2019 21 1 2019 Copyright © 2019, Rawala et al.2019Rawala et al.This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.This article is available from https://www.cureus.com/articles/17174-membranous-nephropathy-in-a-patient-with-human-immunodeficiency-virus-shortly-after-initiation-of-haart-with-atriplaA human immunodeficiency virus (HIV) infection has long been associated with kidney disease. The pathogenesis of renal complications may be directly related to the presence of HIV viral particles or may occur secondary to an immune response against the virus. A number of HIV medications have been associated with the development of acute and chronic kidney disease. It has been estimated that approximately 60 percent of patients suffering from HIV/acquired immunodeficiency syndrome (AIDS) will, at some point, manifest clinically significant renal sequelae.The most common kidney disease affecting HIV patients is HIV-associated nephropathy (HIVAN) or focal segmental glomerulonephritis (FSGS). A very small subset of patients suffering from HIV/AIDS does go on to develop membranous glomerulonephritis.\nWe present a case of a 55-year old Caucasian male who presented to the hospital after two weeks of weakness and falling when attempting to stand. The patient had a history of HIV, diagnosed in 1996. The latest cluster differentiation 4 (CD4) count was 245 cells/uL and the HIV-ribonucleic acid (RNA) viral load was reported as less than 75 copies/ml. The physical exam at presentation was insignificant. The laboratory examination revealed elevated creatinine. Potential nephrotoxic home medications, including Atripla and lisinopril, were held. After a brief inpatient stay, he was discharged but was ultimately readmitted for worsening renal function and nephrotic syndrome was diagnosed. Renal biopsy was performed, and membranous glomerulonephritis was confirmed. To this point, there are no associated cases reported of membranous glomerulonephritis after initiation of therapy with Atripla.\n\nWe present a case of a rare etiology of membranous nephropathy in an HIV patient. Physicians should be judicious in detecting the etiology of renal dysfunction in HIV patients.\n\nnephritistenofoviratriplahivThe content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.\n==== Body\nIntroduction\nA human immunodeficiency virus (HIV) infection has long been associated with kidney disease [1-5].Kidney disease may be directly related to the presence of HIV particles or occur secondary to an immune response against these particles [2].A number of HIV medications have also been shown to cause renal abnormalities. It has been estimated that approximately 60% of patients with AIDS will manifest a clinically significant kidney disease [4].The most common kidney diseases affecting HIV patients include HIV-associated nephropathy (HIVAN) or focal segmental glomerulosclerosis (FSGS) [1,4,6].Membranous glomerulonephritis (MN) is only rarely seen concomitantly with an HIV infection; however, it is a common cause of nephrotic syndrome in Caucasians [2,5,7]. MN is characterized microscopically by glomerular basement membrane (GBM) thickening without hypercellularity and subepithelial immune complex deposits [8].\n\nCase presentation\nA 55-year-old Caucasian male with a history of HIV diagnosed in 1996, whose cluster differentiation 4 (CD4) count was 245 cells per microliter and HIV-ribonucleic acid (RNA) was less than 75 copies per milliliter, presented to the emergency department with the primary complaint of two weeks of weakness and multiple falls. The patient’s comorbid conditions were significant for hypertension (HTN), hyperlipidemia (HLD), anemia, hypogonadism, pancreatitis, peripheral neuropathy, and chronic pain (managed with opiate medication and not with any nonsteroidal anti-inflammatory drugs (NSAIDs)). He denied any other complaints. The physical examination was significant for facial ecchymoses. The laboratory examination yielded an elevated creatinine at 2.8 mg/dL. The patient had no history of previous kidney disease and had been followed regularly by his primary care physician. Potential nephrotoxic home medications, including Atripla and lisinopril, were stopped at the time of presentation and the patient underwent full workup for new acute kidney injury (AKI). Of note, the patient had been on lisinopril for a number of years; however, he had begun therapy with Atripla approximately 170 days prior to this presentation. The initial workup yielded no results. The patient was discharged home but returned multiple times with sequelae of worsening creatinine and ultimately developed the nephrotic syndrome. Further workup of Fanconi syndrome also proved negative. Ultimately, a renal biopsy was performed, which helped in establishing the patient’s diagnosis as MN (Figures 1-4). The patient was managed conservatively with steroids only, to which his renal function responded minimally but stabilized. The patient was further followed up as an outpatient with a nephrologist.\n\nFigure 1 PAS stain showing thickened glomerular capillaries (arrow) signifying membranous nephropathy\nPeriodic acid–Schiff (PAS)\n\nFigure 2 IgG immunofluorescence indicating IgG deposits in renal glomeruli\nImmunoglobulin G (IgG)\n\nFigure 3 Complement C3 immunofluorescence indicating C3 deposits in renal glomeruli\nFigure 4 Electron microscopy indicating the presence of sub-epithelial deposits\nDiscussion\nMostly, HIV patients develop focal segmental glomerulosclerosis (FSGS) as a cause of nephrotic syndrome. Membranous glomerulonephritis (MGN) is very infrequently seen in patients with HIV. MN can be idiopathic or secondary to any other etiology, however, the idiopathic type is more common [8]. Secondary causes of MN has been associated with drugs, malignancies, autoimmune diseases, and chronic infections. The management of secondary MN focuses on the treatment of the underlying cause.\n\nThe most common cause of nephrotic syndrome in adult Caucasians is membranous glomerulonephritis. The disease is characterized by subepithelial immune complex deposits of immunoglobulin G (IgG) and complement (C3) in the glomerulus, along with a thickening of the capillary walls visualized by light microscopy [7]. This thickening is a result of glomerular inflammation via the membrane attack complex C5b-9, which ultimately leads to a loss of protein and nephrotic range proteinuria (>3.5 g/24hr). The goals of management primarily in HIV positive patients typically target the suppression of viral load and the reduction of the advancement of renal disease with medications such as angiotensin-converting enzyme (ACE) inhibitors for symptomatic therapy and alternating cytotoxic agents and corticosteroids [1-2].\n\nPatients with HIV are at a four-fold higher risk for developing chronic kidney disease (CKD) or end-stage renal disease (ESRD) due not only to the inherently increased risk from HIV but also due to several frequently seen co-morbidities, including co-infection with hepatitis C virus (HCV), HTN, diabetes mellitus, age, low CD4 count, and high HIV viral load [3-4]. Studies have shown HIV-associated nephropathy (HIVAN) to be a result of HIV viral replication in renal epithelial cells, which corresponds with findings that highly active antiretroviral therapy (HAART) can improve HIVAN [3]. However, studies have shown that in patients with renal disease other than HIVAN, antiretroviral therapy did not result in an improvement in renal function [5].\n\nA number of medications commonly used for HAART therapy may attribute to renal dysfunction and disease. The patient presented herein was taking the combination drug tenofovir, efavirenz, emtricitabine (Atripla). Of these three medications, only tenofovir has been previously associated with nephrotoxicity [6]. The most common presentation of tenofovir-associated renal toxicity is acute renal failure, nephrogenic diabetes insipidus, and Fanconi syndrome, characterized by renal tubular acidosis, glycosuria with normoglycemia, aminoaciduria, hypophosphatemia, hypouricemia, and tubular proteinemia [4,9-10]. Existing data suggest that the mechanism of damage is due to decreased molecular transportation into the mitochondria of the renal proximal tubule cells [10].\n\nUpon a review of the literature, no causal association between membranous nephropathy and HIV has been identified, although a few case reports have been published in the past, which indicate that some association may exist [5]. However, no known association exists between tenofovir, or the combination drug Atripla, and the development of membranous glomerulonephritis.\n\nConclusions\nThis case is significant given the widespread use of tenofovir for the treatment of HIV. Further studies are necessary on the development of membranous glomerulonephritis in patients with HIV and to elucidate any possible role that tenofovir, or the combination drug Atripla, may play in the development of this disease. In addition, individuals being treated with single agents, such as efavirenz or emtricitabine, may also need to be followed up for development of MGN.\n\nThe authors have declared that no competing interests exist.\n\nHuman Ethics\nConsent was obtained by all participants in this study\n==== Refs\nReferences\n1 Immunosuppression for membranous nephropathy: a systematic review and meta-analysis of 36 clinical trials Clin J Am Soc Nephrol Chen Y Schieppati A Cai G 787 796 8 2013 23449768 \n2 The HIV-associated renal diseases: current insight into pathogenesis and treatment Kidney Int Weiner NJ Goodman JW Kimmel PL 1618 1631 63 2003 https://www.sciencedirect.com/science/article/pii/S0085253815490519 12675837 \n3 How to manage HIV-infected patients with chronic kidney disease in the HAART era Clin Exp Nephrol Ando M Tsuchiya K Nitta K 363 372 16 2012 22294158 \n4 Renal disease associated with antiretroviral therapy in the treatment of HIV Nephron Clin Pract Cooper RD Tonelli M 262 268 118 2011 \n5 The clinical epidemiology and course of the spectrum of renal diseases associated with HIV infection Kidney Int Szczech LA Gupta SK Habash R 1145 1152 66 2004 https://www.ncbi.nlm.nih.gov/pubmed/15327410 15327410 \n6 Association of tenofovir exposure with kidney disease risk in HIV infection Aids Scherzer R Estrella M Li Y Choi AI Deeks SG Grunfeld C Shlipak MG 867 875 26 2012 22313955 \n7 Membranous nephropathy J Nephrol Ponticelli C 268 287 20 2007 https://www.researchgate.net/profile/Claudio_Ponticelli/publication/6280147_Membranous_nephropathy/links/02bfe50dca6e61d245000000/Membranous-nephropathy.pdf 17557260 \n8 Glomerular diseases: membranous nephropathy—a modern view Clin J Am Soc Nephrol Ponticelli C Glassock RJ 609 616 9 2014 23813556 \n9 \"One pill, once daily\": what clinicians need to know about Atripla(TM) Ther Clin Risk Manag Clay PG Taylor TA Glaros AG McRae M Williams C McCandless D Oelklaus M 291 302 4 2008 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2504066/ 18728842 \n10 Tenofovir nephrotoxicity: 2011 update AIDS Res Treat Fernandez-Fernandez B Montoya-Ferrer A Sanz AB 354908 2011 2011 21716719\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2168-8184",
"issue": "11(1)",
"journal": "Cureus",
"keywords": "atripla; hiv; nephritis; tenofovir",
"medline_ta": "Cureus",
"mesh_terms": null,
"nlm_unique_id": "101596737",
"other_id": null,
"pages": "e3932",
"pmc": null,
"pmid": "30931200",
"pubdate": "2019-01-21",
"publication_types": "D002363:Case Reports",
"references": "12675837;15327410;17557260;18728842;21212689;21716719;22294158;22313955;23449768;23813556",
"title": "Membranous Nephropathy in a Patient with Human Immunodeficiency Virus Shortly After Initiation of HAART with Atripla.",
"title_normalized": "membranous nephropathy in a patient with human immunodeficiency virus shortly after initiation of haart with atripla"
} | [
{
"companynumb": "US-GILEAD-2019-0401253",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "EFAVIRENZ\\EMTRICITABINE\\TENOFOVIR DISOPROXIL FUMARATE"
}... |
{
"abstract": "Orolingual angioedema is a rare adverse effect of tissue plasminogen activator (tPA), with an incidence of 1% to 5%. There are currently no published reports describing resolution of tPA-induced orolingual angioedema with complement inhibitor therapy. A 72-year-old man receiving home angiotensin-converting enzyme inhibitor therapy presented to the emergency department with newly developed orolingual angioedema after treatment with tPA for acute ischemic stroke. Therapy was initiated with intravenous methylprednisolone 125 mg, famotidine 20 mg, and diphenhydramine 50 mg, without significant improvement. Because of increased concern for airway protection, plasma-derived C1 esterase inhibitor was administered. Concerns about progressive and airway-threatening orolingual angioedema subsided 2 hours after administration, and invasive airway maneuvers were avoided. Orolingual angioedema is an infrequent, severe adverse effect of tPA for treatment of acute ischemic stroke. Complement inhibitors may be an additional therapeutic option for patients presenting with orolingual angioedema with potential airway compromise that is refractory to standard anaphylactic therapies.",
"affiliations": "University of Cincinnati Medical Center, Cincinnati, OH. Electronic address: lpahs@hotmail.com.;University of Cincinnati Medical Center, Cincinnati, OH.;St. John Medical Center, Tulsa, OK.;University of Cincinnati Medical Center, Cincinnati, OH.",
"authors": "Pahs|Lesley|L|;Droege|Chris|C|;Kneale|Hilary|H|;Pancioli|Arthur|A|",
"chemical_list": "D000893:Anti-Inflammatory Agents; D006634:Histamine H1 Antagonists; D006635:Histamine H2 Antagonists; D015738:Famotidine; D004155:Diphenhydramine; D010959:Tissue Plasminogen Activator; D008775:Methylprednisolone",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0196-0644",
"issue": "68(3)",
"journal": "Annals of emergency medicine",
"keywords": null,
"medline_ta": "Ann Emerg Med",
"mesh_terms": "D000368:Aged; D000799:Angioedema; D000893:Anti-Inflammatory Agents; D004155:Diphenhydramine; D004359:Drug Therapy, Combination; D015738:Famotidine; D006634:Histamine H1 Antagonists; D006635:Histamine H2 Antagonists; D006801:Humans; D007275:Injections, Intravenous; D008297:Male; D008775:Methylprednisolone; D009059:Mouth Diseases; D010959:Tissue Plasminogen Activator; D014060:Tongue Diseases",
"nlm_unique_id": "8002646",
"other_id": null,
"pages": "345-8",
"pmc": null,
"pmid": "27174372",
"pubdate": "2016-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "A Novel Approach to the Treatment of Orolingual Angioedema After Tissue Plasminogen Activator Administration.",
"title_normalized": "a novel approach to the treatment of orolingual angioedema after tissue plasminogen activator administration"
} | [
{
"companynumb": "US-MYLANLABS-2016M1056860",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ATENOLOL"
},
"drugadditional": null,
... |
{
"abstract": "Aging individuals can develop generalized, exquisitely-pruritic, eczematous eruptions of uncertain etiology that can be therapeutically-refractory and life-altering. Limited information exists in the literature to guide clinicians in the diagnosis and management of such patients. It is suggested that in approximately 40% of such patients a known cause for their chronic pruritic eruptions cannot be identified. In this report we will refer to this subgroup of patients as having idiopathic chronic eczematous eruption of aging (CEEA). Idiopathic CEEA must be distinguished from other established eczematous dermatoses. Idiopathic CEEA patients often require long-term systemic immunosuppressive drugs to make living bearable. Elder-onset atopic dermatitis is the most difficult of the known dermatoses to distinguish from idiopathic CEEA. Because of their clinical similarities we questioned whether dupilumab (Dupixent®), the first FDA-approved biologic for atopic dermatitis, might be valuable in the management of idiopathic CEEA. We report the case of an elderly man with idiopathic CEEA of four-years' duration who had a complete clinical response to the initiation of treatment with dupilumab. This case is presented to stimulate more discussion and systematic study of a possible role for dupilumab in otherwise-refractory idiopathic CEEA patients. We also propose a set of diagnostic criteria for idiopathic CEEA.",
"affiliations": "University of Utah School of Medicine, Salt Lake City, Utah. richard.sontheimer@hsc.utah.edu.",
"authors": "Brummer|Grace C|GC|;Wang|Lawrence T|LT|;Sontheimer|Richard D|RD|",
"chemical_list": "D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; D015847:Interleukin-4; C582203:dupilumab",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1087-2108",
"issue": "24(2)",
"journal": "Dermatology online journal",
"keywords": null,
"medline_ta": "Dermatol Online J",
"mesh_terms": "D000368:Aged; D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; D002908:Chronic Disease; D003937:Diagnosis, Differential; D004485:Eczema; D006801:Humans; D007279:Injections, Subcutaneous; D015847:Interleukin-4; D008297:Male",
"nlm_unique_id": "9610776",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "29630150",
"pubdate": "2018-02-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "A possible role for dupilumab (Dupixent) in the management of idiopathic chronic eczematous eruption of aging.",
"title_normalized": "a possible role for dupilumab dupixent in the management of idiopathic chronic eczematous eruption of aging"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/18/0097660",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CIPROFLOXACIN"
},
"drugadditional": "3",... |
{
"abstract": "An 83-year-old man with a previous right coronary artery (RCA) stent presented to the emergency department with syncope, dynamic lateral ST depression, and a serum troponin of 6148 ng/L (< 17). Coronary angiography revealed a patent proximal RCA stent and significant left-sided disease. The procedure was complicated by inferior ST elevation, urticaria, hypotension, and acute proximal RCA occlusion. This required stenting, which acted as a scaffold to ameliorate subsequent vasospasm that responded to intracoronary glyceryl trinitrate. Serum tryptase postprocedure was markedly elevated at 81.7 μg/L (≤ 11.4) and subsequently normalized. This confirmed a rare presentation of intraprocedural type II Kounis syndrome likely due to radioiodine contrast.",
"affiliations": "Department of Cardiology, Westmead Hospital, New South Wales, Australia. Electronic address: ashwin.b50@gmail.com.;Department of Cardiology, Westmead Hospital, New South Wales, Australia.;Department of Cardiology, Westmead Hospital, New South Wales, Australia.",
"authors": "Bhaskaran|Ashwin|A|;Deshmukh|Tejas|T|;Sivagangabalan|Gopal|G|",
"chemical_list": "D007457:Iodine Radioisotopes; D053802:Tryptases",
"country": "England",
"delete": false,
"doi": "10.1016/j.cjca.2018.08.029",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0828-282X",
"issue": "34(12)",
"journal": "The Canadian journal of cardiology",
"keywords": null,
"medline_ta": "Can J Cardiol",
"mesh_terms": "D000369:Aged, 80 and over; D017023:Coronary Angiography; D006801:Humans; D007457:Iodine Radioisotopes; D000074962:Kounis Syndrome; D008297:Male; D053802:Tryptases",
"nlm_unique_id": "8510280",
"other_id": null,
"pages": "1688.e1-1688.e3",
"pmc": null,
"pmid": "30527164",
"pubdate": "2018-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Intraprocedure Type II Kounis Syndrome Secondary to Radioiodine Contrast During Coronary Angiography.",
"title_normalized": "intraprocedure type ii kounis syndrome secondary to radioiodine contrast during coronary angiography"
} | [
{
"companynumb": "AU-GE HEALTHCARE LIFE SCIENCES-2018CSU005235",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "IOHEXOL"
},
"drugadditiona... |
{
"abstract": "Vilazodone is a selective serotonin reuptake inhibitor (SSRI) that was introduced to the market in 2011. It has a novel mechanism combining serotonin reuptake and partial agonism of 5HT-1 receptors. It has gained popularity in treating first generation SSRI-resistant depression. There has been little description in the literature of adult overdose. We are describing a 21-year-old female with an intentional overdose of 400 mg of vilazodone. This patient progressively developed worsening serotonin syndrome, which was resistant to aggressive benzodiazepine administration. The patient required sedation with propofol and phenobarbital to control serotonin syndrome. Patient required continued sedation for 36 h post-ingestion, with subsequent extubation and return to normal mental status. We detail an atypical case of a novel SSRI overdose with the treatment regimen used.",
"affiliations": "Department of Emergency Medicine, University of Iowa, Iowa City, IA, United States of America. Electronic address: james-clevenger@uiowa.edu.;Department of Emergency Medicine, University of Iowa, Iowa City, IA, United States of America.",
"authors": "Clevenger|James|J|;McCabe|Daniel|D|",
"chemical_list": "D017367:Serotonin Uptake Inhibitors; D001569:Benzodiazepines; D000069503:Vilazodone Hydrochloride",
"country": "United States",
"delete": false,
"doi": "10.1016/j.ajem.2019.12.029",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0735-6757",
"issue": "38(5)",
"journal": "The American journal of emergency medicine",
"keywords": "Novel SSRI; Serotonin syndrome; Toxicology; VIIBRYD; Vilazodone",
"medline_ta": "Am J Emerg Med",
"mesh_terms": "D001569:Benzodiazepines; D062787:Drug Overdose; D005260:Female; D006801:Humans; D020230:Serotonin Syndrome; D017367:Serotonin Uptake Inhibitors; D000069503:Vilazodone Hydrochloride; D055815:Young Adult",
"nlm_unique_id": "8309942",
"other_id": null,
"pages": "1045.e1-1045.e2",
"pmc": null,
"pmid": "31902699",
"pubdate": "2020-05",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Development of severe serotonin syndrome from acute ingestion of vilazodone without co-ingestion.",
"title_normalized": "development of severe serotonin syndrome from acute ingestion of vilazodone without co ingestion"
} | [
{
"companynumb": "US-MYLANLABS-2020M1075505",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PROPOFOL"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nAvelumab is a programmed death ligand 1-blocking monoclonal antibody used for the treatment of Merkel cell carcinoma (MCC), urothelial carcinoma, and other solid tumors. It acts as an immune checkpoint inhibitor and prolongs survival of MCC patients. Immune-mediated neurological adverse effects are rare and usually respond well to specific therapy.\n\n\nRESULTS\nA case of a 70-year-old man with metastatic MCC is described in this study. The patient developed diplopia after the fourth dose of avelumab, which was then discontinued. Seven months later, therapy was reinitiated and followed by a new adverse neurological event: severe demyelinating polyneuropathy combined with ophthalmoplegia refractory to a plethora of immune suppressive/modulatory treatment regimes.\n\n\nCONCLUSIONS\nThis report of severe demyelinating polyneuropathy and cranial neuropathy associated with an anti-programmed death ligand 1 drug refractory to immune suppressive/modulatory treatments sheds a new light to evolving spectrum of immune checkpoint inhibitor immune-related neurological adverse events.",
"affiliations": "Department of Neurology, Clinical Hospital Centre Zagreb.;Department of Neurology, Clinical Hospital Centre Zagreb.;Department of Neurology, Clinical Hospital Centre Zagreb.;Department of Oncology, Clinical Hospital Centre Zagreb, Zagreb, Croatia.",
"authors": "Bilić|Hrvoje|H|;Sitaš|Barbara|B|;Hančević|Mirea|M|;Habek|Mario|M|;Simetić|Luka|L|;Bilić|Ervina|E|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; C000609138:avelumab",
"country": "United States",
"delete": false,
"doi": "10.1097/WNF.0000000000000464",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0362-5664",
"issue": "44(5)",
"journal": "Clinical neuropharmacology",
"keywords": null,
"medline_ta": "Clin Neuropharmacol",
"mesh_terms": "D000368:Aged; D061067:Antibodies, Monoclonal, Humanized; D015266:Carcinoma, Merkel Cell; D002295:Carcinoma, Transitional Cell; D003389:Cranial Nerve Diseases; D006801:Humans; D008297:Male; D011115:Polyneuropathies; D012878:Skin Neoplasms; D001749:Urinary Bladder Neoplasms",
"nlm_unique_id": "7607910",
"other_id": null,
"pages": "193-195",
"pmc": null,
"pmid": "34238783",
"pubdate": "2021",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Severe Demyelinating Polyneuropathy and Cranial Neuropathy During Avelumab Treatment of Metastatic Merkel Cell Carcinoma.",
"title_normalized": "severe demyelinating polyneuropathy and cranial neuropathy during avelumab treatment of metastatic merkel cell carcinoma"
} | [
{
"companynumb": "HR-EMD SERONO-9044063",
"fulfillexpeditecriteria": "1",
"occurcountry": "HR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "AVELUMAB"
},
"drugadditional": "3",
"dr... |
{
"abstract": "OBJECTIVE\nPost-transplant lymphoproliferative disorder (PTLD) is a major complication of lung transplantation (LTx). However, few studies on PTLD in Asian populations have been reported. We explored the characteristics of Japanese PTLD cases after LTx.\n\n\nMETHODS\nWe retrospectively reviewed 195 cases of LTx at our institute. We summarized the clinical experiences of 7 PTLD cases and analyzed the patient characteristics and survival outcomes of patients with (n = 7) and without (n = 188) PTLD.\n\n\nRESULTS\nAll PTLD patients were taking corticosteroids preoperatively (p = 0.0030), and the duration of preoperative corticosteroid therapy was significantly longer in the PTLD group (p = 0.0064) than in the non-PTLD group. The overall survival after LTx was significantly worse in the PTLD group (p = 0.027) than in the non-PLTD group. Among the three patients who died within 1 year after the PTLD onset, two died of opportunistic infections without residual PTLD lesions. Chronic lung allograft dysfunction (CLAD) or bronchiolitis obliterans at an autopsy were diagnosed after PTLD treatment in four cases.\n\n\nCONCLUSIONS\nLong-term preoperative corticosteroid therapy may be a risk factor for PTLD after LTx. Opportunistic infections are lethal complications of PTLD, regardless of the effectiveness of PTLD treatment. CLAD occurs at a high rate after PTLD treatment, and close monitoring is required.",
"affiliations": "Department of General Thoracic Surgery, Organ Transplant Center, Okayama University Hospital, 2-5-1 Shikata-cho Kitaku, Okayama, 700-8558, Japan.;Department of General Thoracic Surgery, Organ Transplant Center, Okayama University Hospital, 2-5-1 Shikata-cho Kitaku, Okayama, 700-8558, Japan. otani.shinji.iz@ehime-u.ac.jp.;Department of General Thoracic Surgery, Organ Transplant Center, Okayama University Hospital, 2-5-1 Shikata-cho Kitaku, Okayama, 700-8558, Japan.;Department of General Thoracic Surgery, Organ Transplant Center, Okayama University Hospital, 2-5-1 Shikata-cho Kitaku, Okayama, 700-8558, Japan.;Department of General Thoracic Surgery, Organ Transplant Center, Okayama University Hospital, 2-5-1 Shikata-cho Kitaku, Okayama, 700-8558, Japan.;Department of General Thoracic Surgery, Organ Transplant Center, Okayama University Hospital, 2-5-1 Shikata-cho Kitaku, Okayama, 700-8558, Japan.;Department of General Thoracic Surgery, Organ Transplant Center, Okayama University Hospital, 2-5-1 Shikata-cho Kitaku, Okayama, 700-8558, Japan.;Department of General Thoracic Surgery, Organ Transplant Center, Okayama University Hospital, 2-5-1 Shikata-cho Kitaku, Okayama, 700-8558, Japan.;Department of General Thoracic Surgery, Organ Transplant Center, Okayama University Hospital, 2-5-1 Shikata-cho Kitaku, Okayama, 700-8558, Japan.;Department of General Thoracic Surgery, Organ Transplant Center, Okayama University Hospital, 2-5-1 Shikata-cho Kitaku, Okayama, 700-8558, Japan.",
"authors": "Shimizu|Dai|D|http://orcid.org/0000-0002-7565-6640;Otani|Shinji|S|;Sugimoto|Seiichiro|S|;Yamamoto|Haruchika|H|;Tomioka|Yasuaki|Y|;Shiotani|Toshio|T|;Miyoshi|Kentaroh|K|;Okazaki|Mikio|M|;Yamane|Masaomi|M|;Toyooka|Shinichi|S|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": "10.1007/s00595-021-02390-7",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0941-1291",
"issue": null,
"journal": "Surgery today",
"keywords": "Chronic lung allograft rejection; Corticosteroids; Epstein-Barr virus; Lung transplant; Post-transplant lymphoproliferative disorder",
"medline_ta": "Surg Today",
"mesh_terms": null,
"nlm_unique_id": "9204360",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34694493",
"pubdate": "2021-10-25",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Effect of preoperative long-term use of corticosteroids on the development of post-transplant lymphoproliferative disorders after lung transplantation: a single-center experience in Japan.",
"title_normalized": "effect of preoperative long term use of corticosteroids on the development of post transplant lymphoproliferative disorders after lung transplantation a single center experience in japan"
} | [
{
"companynumb": "JP-SUN PHARMACEUTICAL INDUSTRIES LTD-2022R1-336054",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drug... |
{
"abstract": "Bloodstream infection is the leading cause of mortality in left ventricular assist device. Bloodstream infection is a risk factor for intracranial hemorrhage. We report three left ventricular assist device recipients who presented with bloodstream infection and developed subarachnoid hemorrhage. Case 1, a 37-year-old male with non-ischemic cardiomyopathy with HeartMate II, presented with confusion and found to have serratia bloodstream infection and left frontal lobe subarachnoid hemorrhage. Cerebral angiogram showed a right M3/M4 branch infectious intracranial aneurysm. He was treated with coil embolization and underwent device exchange. Case 2, a 41-year-old male with non-ischemic cardiomyopathy with HeartMate II presented with confusion and found to have methicillin-resistant staphylococcus aureus bloodstream infection and bilateral frontal convexity subarachnoid hemorrhage. Cerebral angiogram showed left M3 and left A3 infectious intracranial aneurysms, which were treated with antibiotics alone. Case 3, a 58-year-old female with ischemic cardiomyopathy with HeartMate II presented with fever, found to have candida albicans bloodstream infection and a parieto-occipital enhancing lesion concerning for cerebral abscess. Repeat computed tomography brain a week later showed a new right frontal subarachnoid hemorrhage. Cerebral angiogram showed a M4/M5 junction infectious intracranial aneurysm; patient was not a surgical candidate and was transitioned to hospice. This case series emphasizes that left ventricular assist device-associated subarachnoid hemorrhage may be caused by infectious intracranial aneurysms when acute bloodstream infections are present.",
"affiliations": "Department of Neurology, Neurological Institute, Cleveland Clinic, Cleveland, OH, USA.;Department of Neurology, Neurological Institute, Cleveland Clinic, Cleveland, OH, USA.;Department of Neurology, Neurological Institute, Cleveland Clinic, Cleveland, OH, USA.;Department of Neurology, Neurological Institute, Cleveland Clinic, Cleveland, OH, USA.",
"authors": "Lee|Tiffany|T|;Buletko|Andrew B|AB|;Matthew|Jason|J|;Cho|Sung-Min|SM|0000-0002-5132-0958",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1177/0267659119858853",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0267-6591",
"issue": "35(2)",
"journal": "Perfusion",
"keywords": "infectious intracranial aneurysm; left ventricular assist device; subarachnoid hemorrhage",
"medline_ta": "Perfusion",
"mesh_terms": "D000328:Adult; D006352:Heart Ventricles; D006353:Heart-Assist Devices; D006801:Humans; D002532:Intracranial Aneurysm; D008297:Male; D008875:Middle Aged; D012307:Risk Factors; D018805:Sepsis; D013345:Subarachnoid Hemorrhage",
"nlm_unique_id": "8700166",
"other_id": null,
"pages": "117-120",
"pmc": null,
"pmid": "31339450",
"pubdate": "2020-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Bloodstream infection is associated with subarachnoid hemorrhage and infectious intracranial aneurysm in left ventricular assist device.",
"title_normalized": "bloodstream infection is associated with subarachnoid hemorrhage and infectious intracranial aneurysm in left ventricular assist device"
} | [
{
"companynumb": "US-BAYER-2020-040635",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": null,
"drugadditional": null,
"drugadministrationroute": null,
"drugauthoriza... |
{
"abstract": "A 34-year-old man who previously underwent a craniotomy due to oligodendroglioma was admitted with a diagnosis of recurrent brain tumor. An awake craniotomy was planned. Approximately 15 minutes after completing the scalp nerve block, his upper torso suddenly moved and trembled for 10 seconds, suggesting a generalized clonic seizure. He recovered gradually and fully in 55 minutes without any neurological sequelae. The emergency computed tomography scan revealed a localized fluid collection and small intracerebral hemorrhage nearby in the temporoparietal cortex beneath the skull defect. He underwent surgery under general anesthesia at 8 hours after the seizure and was discharged from the hospital after 10 days. This report documents the first case of generalized seizure that was caused by the accidental intracerebral injection of local anesthetics. Although the patient recovered completely, the clinical implications regarding the scalp infiltration technique in a patient with skull defects are discussed.",
"affiliations": "Department of Anesthesiology and Pain Medicine, Anesthesia and Pain Research Institute, Yonsei University College of Medicine, Seoul, Korea.;Department of Anesthesiology and Pain Medicine, Inha University College of Medicine, Incheon, Korea.;Department of Anesthesiology and Pain Medicine, Anesthesia and Pain Research Institute, Yonsei University College of Medicine, Seoul, Korea.;Department of Anesthesiology and Pain Medicine, Anesthesia and Pain Research Institute, Yonsei University College of Medicine, Seoul, Korea.;Department of Anesthesiology and Pain Medicine, Anesthesia and Pain Research Institute, Yonsei University College of Medicine, Seoul, Korea.",
"authors": "Lee|Woo Kyung|WK|;Kim|Hyunzu|H|;Bae|Myung-Il|MI|;Choi|Seung Ho|SH|;Min|Kyeong Tae|KT|",
"chemical_list": "D000779:Anesthetics, Local; D008012:Lidocaine",
"country": "Korea (South)",
"delete": false,
"doi": "10.4097/kja.d.17.00069",
"fulltext": "\n==== Front\nKorean J AnesthesiolKorean J AnesthesiolKJAEKorean Journal of Anesthesiology2005-64192005-7563Korean Society of Anesthesiologists 10.4097/kja.d.17.00069kja-d-17-00069Case ReportAccidental intracerebral injection and seizure during scalp nerve blocks for awake craniotomy in a previously craniotomized patient -a case report- http://orcid.org/0000-0003-4326-6944Lee Woo Kyung 1http://orcid.org/0000-0002-0625-6942Kim Hyunzu 2http://orcid.org/0000-0002-2363-4212Bae Myung-Il 1http://orcid.org/0000-0001-8442-4406Choi Seung Ho 1http://orcid.org/0000-0002-3299-4500Min Kyeong Tae 1\n1 Department of Anesthesiology and Pain Medicine, Anesthesia and Pain Research Institute, Yonsei University College of Medicine, Seoul, Korea\n2 Department of Anesthesiology and Pain Medicine, Inha University College of Medicine, Incheon, KoreaCorresponding author: Kyeong Tae Min, M.D., Ph.D. Department of Anesthesiology and Medicine, Yonsei University College of Medicine, 50-1, Yonsei-ro, Seodaemun-gu, Seoul 03722, Korea Tel: 82-2-2227-4161, Fax: 82-2-2227-7897 Email: ktmin501@yuhs.ac12 2018 9 5 2018 71 6 483 485 20 11 2017 1 1 2018 3 1 2018 Copyright © The Korean Society of Anesthesiologists, 20182018This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.A 34-year-old man who previously underwent a craniotomy due to oligodendroglioma was admitted with a diagnosis of recurrent brain tumor. An awake craniotomy was planned. Approximately 15 minutes after completing the scalp nerve block, his upper torso suddenly moved and trembled for 10 seconds, suggesting a generalized clonic seizure. He recovered gradually and fully in 55 minutes without any neurological sequelae. The emergency computed tomography scan revealed a localized fluid collection and small intracerebral hemorrhage nearby in the temporoparietal cortex beneath the skull defect. He underwent surgery under general anesthesia at 8 hours after the seizure and was discharged from the hospital after 10 days. This report documents the first case of generalized seizure that was caused by the accidental intracerebral injection of local anesthetics. Although the patient recovered completely, the clinical implications regarding the scalp infiltration technique in a patient with skull defects are discussed.\n\nAccidental intracerebral injectionAwake craniotomyPrevious craniotomyScalp nerve blocksSeizure\n==== Body\nIncreasing numbers of patients with skull defects are expected to get scalp infiltrations. This report presents the case of an accidental intracerebral injection of local anesthetics during scalp nerve blocks in awake craniotomy in a previously craniotomized patient. The clinical pattern of seizure and recommendations for scalp infiltration in patients with skull defects are briefly discussed.\n\nCase Report\nA 34-year-old man (weight: 79 kg, height: 180 cm), who underwent removal of an oligodendroglioma in the left temporal lobe 4 years ago, was admitted for the removal of the recurrent tumor. An awake craniotomy was planned. Preoperative routine laboratory tests did not indicate any abnormal findings. The patient had no problems with cognition or communication but complained of intermittent headaches with a visual analog score of 3–5. During the preoperative assessment, he was fully cooperative and understood the surgical and anesthetic (asleepawake-asleep technique) procedures. Magnetic resonance imaging showed a hyperintense lesion in the left temporal pole and insula, suggesting the progression of a recurrent tumor. Computer tomography (CT) scans of the brain and skull radiography showed a bony cleft that was 2 mm wide in the left half of the skull (Fig. 1). Two hours prior to surgery, 1.5 g 5-aminolevulinic acid hydrochloride was ingested on neurosurgeon’s instructions. Upon entering the operating room, pulse oximetry, non-invasive blood pressure monitoring, and electrocardiogram monitoring were applied. An arterial catheter was inserted under local anesthesia for direct blood pressure measurements. The blood pressure and pulse rate were 124/62 mmHg and 57 beats/min, respectively. Following the intravenous administration of 50 μg fentanyl, the scalp nerve block and a ring block in the left hemisphere were performed over 30 minutes using a 25-gauge × 40 mm needle at the supraorbital, supratrochlear, zygomaticotemporal, auriculotemporal, greater occipital, and lesser occipital nerves. A local anesthetic mixture of 60 ml (20 ml 2% lidocaine, 20 ml 0.75% ropivacaine, and 20 ml normal saline with 1 : 200,000 epinephrine) was used. The patient tolerated the scalp nerve block with no evidence of intravascular injection.\n\nApproximately 15 minutes after block completion, the seizure occurred initially with a sudden move up his trunk, followed by trembling of both extremities for 10 seconds. His mentality became stupor with dilated (7–8 mm) pupils without light reflex. The blood pressure and heart rate were 167/81 mmHg and 78 beats/min, respectively, with sinus rhythm and an oxygen saturation of 100%. Although the seizure subsided spontaneously, the patient remained in a stupor with dilated and fixed pupils (right: 7 mm; left: 8 mm) with no light reflex. The operation was postponed, as it was decided that proceeding with the awake craniotomy would not be feasible, and emergency CT was conducted in order to investigate the cause of the seizures. When the scan was completed after 15 minutes, the patient remained drowsy but could respond briskly to verbal commands. His pupils were anisocoric (right: 4 mm; left: 8 mm) with light reflex. The CT scan showed a localized fluid collection and small intracerebral hemorrhage (ICH) near the temporoparietal cortex beneath the skull defect (Figs. 2 and 3). At 30 minutes after the seizure, he continued to remain drowsy but could respond to verbal commands. Pupils were asymmetric but responded well to light. At 55 minutes after the seizure, he fully recovered without neurological sequelae but could not recall the incident. He had a muscle power of 5/5 in his upper and lower extremities and a Glasgow coma scale score of 15. His pupils were isocoric (2 mm) with prompt light reflex. Prior to this, the patient had not complained of nausea, dizziness, or perioral numbness.\n\nAfter being closely monitored for 1 hour and 20 minutes in the postanesthetic care unit, the patient was transferred to the neurosurgical care unit (NCU) for 6 hours and 40 minutes. Since no hemodynamic or neurological deterioration was observed, the patient was moved to an operating room, where he underwent the surgery for 7 hours and 30 minutes under general anesthesia. The lungs were extubated in the NCU 1.5 hours after the operation. He was transferred to the general ward on post-operative day 2 and released from the hospital on post-operative day 10.\n\nDiscussion\nTo our knowledge, this is the first report of a seizure caused by the direct injection of local anesthetics into brain tissue. This extremely rare complication occurred after scalp nerve blocks were given during awake craniotomy in a previously craniotomized patient.\n\nWe have performed awake craniotomies using the asleepawake-asleep technique [1,2]. The cause of the seizure may be related to the localized accumulation of the anesthetic mixture and/or ICH, as shown in the left brain CT scan (Fig. 2). The temporal cortex was beneath the skull defect and compatible with the zygomaticotemporal nerve block site in the deep temporalis fascia. The clinical pattern of the seizure was as described above in the text. In brief, contrary to the seizure caused by systemic toxicity of local anesthetic, the generalized clonic seizure was mild and transient and was accompanied with anisocoria. The size of fluid collection in the brain parenchyma was ~1.3 cm, which corresponded to 1.15 ml, assuming the fluid accumulated spherically. Regarding mechanisms of local anesthetic-induced seizure within the brain parenchyma, vascular absorption-related systemic toxicity would be excluded, because vascular assessments were frequently conducted, and the clinical manifestation here was different from that of systemic toxicities induced by plasma concentrations of > 10 μg/ml lidocaine [3] or > 2.2 μg/ml ropivacaine [4]. The mechanism behind this clinical manifestation, including the occurrence of generalized clonic movements in both extremities despite remaining local anesthetics in the parenchyma, asymmetrical pupillary response, and amnesia, could not be established. In experimental rats, the intracerebral injection of tetrodotoxin induced a similar pupillary response [5]. Okuda et al. [6] reported a case of seizure caused by an incidental subarachnoid space injection. Unlike our case, the patient experienced general discomfort and nausea as well as loss of consciousness immediately after a lesser occipital nerve block, using 0.5 ml 1% mepivacaine. The patient’s saturation was maintained at over 97% despite hypoventilation. After 2 h, the patient recovered completely without any neurological sequelae.\n\nIncreasing numbers of patients with skull defects are expected to get scalp infiltrations. To prevent complications, we recommend drawing an imaginary bony defect line from the previous craniotomy site or marking the site of the burr hole prior to performing scalp nerve blocks. The block should infiltrate as far as the imaginary line or marks. The angle of needle entry should be low around any bony defects. Scalp nerve blocks may also be performed under a C-Arm.\n\nFig. 1. Simple lateral skull X-ray shows the bony cleft due to the previous craniotomy.\n\nFig. 2. Brain CT scan taken after the occurrence of seizure shows minimal intracerebral hematoma and fluid collection (arrow) in the left side.\n\nFig. 3. Brain CT slice caudal to Fig. 2, bony cleft is visible (arrow).\n==== Refs\nReferences\n1 Ha SH Park IH Lee MH Shin SK Min KT Use of dexmedetomidine for awake crainiotomy Korean J Anesthesiol 2011 61 346 7 22110892 \n2 Osborn I Sebeo J \"Scalp block\" during craniotomy: a classic technique revisited J Neurosurg Anesthesiol 2010 22 187 94 20479675 \n3 Becker DE Reed KL Local anesthetics: review of pharmacological considerations Anesth Prog 2012 59 90 101 22822998 \n4 Costello TG Cormack JR Hoy C Wyss A Braniff V Martin K Plasma ropivacaine levels following scalp block for awake craniotomy J Neurosurg Anesthesiol 2004 16 147 50 15021284 \n5 Zhuravin IA Bures J Extent of the tetrodotoxin induced blockade examined by pupillary paralysis elicited by intracerebral injection of the drug Exp Brain Res 1991 83 687 90 2026211 \n6 Okuda Y Matsumoto T Shinohara M Kitajima T Kim P Sudden unconsciousness during a lesser occipital nerve block in a patient with the occipital bone defect Eur J Anaesthesiol 2001 18 829 32 11737183\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2005-6419",
"issue": "71(6)",
"journal": "Korean journal of anesthesiology",
"keywords": "Accidental intracerebral injection; Awake craniotomy; Previous craniotomy; Scalp nerve blocks; Seizure",
"medline_ta": "Korean J Anesthesiol",
"mesh_terms": "D000328:Adult; D000779:Anesthetics, Local; D001921:Brain; D003399:Craniotomy; D006801:Humans; D007267:Injections; D008012:Lidocaine; D008297:Male; D008508:Medication Errors; D009407:Nerve Block; D012535:Scalp; D012640:Seizures; D014851:Wakefulness",
"nlm_unique_id": "101502451",
"other_id": null,
"pages": "483-485",
"pmc": null,
"pmid": "29739181",
"pubdate": "2018-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "22822998;15021284;22110892;2026211;11737183;20479675",
"title": "Accidental intracerebral injection and seizure during scalp nerve blocks for awake craniotomy in a previously craniotomized patient -a case report.",
"title_normalized": "accidental intracerebral injection and seizure during scalp nerve blocks for awake craniotomy in a previously craniotomized patient a case report"
} | [
{
"companynumb": "KR-SA-2019SA014708",
"fulfillexpeditecriteria": "1",
"occurcountry": "KR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ROPIVACAINE HYDROCHLORIDE"
},
"drugadditional": null... |
{
"abstract": "Single-agent carboplatin is often proposed instead of a conventional carboplatin-paclitaxel doublet in vulnerable older patients with ovarian cancer. Such an approach could have a detrimental effect on outcomes for these patients.\nTo compare the feasibility, efficacy, and safety of single-agent carboplatin every 3 weeks, weekly carboplatin-paclitaxel, or conventional every-3-weeks carboplatin-paclitaxel in vulnerable older patients with ovarian cancer.\nThis international, open-label, 3-arm randomized clinical trial screened 447 women 70 years and older with newly diagnosed stage III/IV ovarian cancer by determining their Geriatric Vulnerability Score; 120 patients with a Geriatric Vulnerability Score of 3 or higher were stratified by country and surgical outcome. Enrollment took place at 48 academic centers in France, Italy, Finland, Denmark, Sweden, and Canada from December 11, 2013, to April 26, 2017. Final analysis database lock April 2019. Data analysis was performed from February 1 to December 31, 2019.\nPatients were randomized to receive 6 cycles of (1) carboplatin, area under the curve (AUC) 5 mg/mL·min, plus paclitaxel, 175 mg/m2, every 3 weeks; (2) single-agent carboplatin, AUC 5 mg/mL·min or AUC 6 mg/mL·min, every 3 weeks; or (3) weekly carboplatin, AUC 2 mg/mL·min, plus paclitaxel, 60 mg/m2, on days 1, 8, and 15 every 4 weeks.\nThe primary outcome was treatment feasibility, defined as the ability to complete 6 chemotherapy cycles without disease progression, premature toxic effects-related treatment discontinuation, or death.\nA total of 120 women were randomized. The mean and median age was 80 (interquartile range, 76-83; range, 70-94) years; 43 (36%) had a Geriatric Vulnerability Score of 4 and 13 (11%) had a Geriatric Vulnerability Score of 5; 40 (33%) had stage IV disease. During its third meeting, the independent data monitoring committee's recommendation led to the termination of the trial because single-agent carboplatin was associated with significantly worse survival. Six cycles were completed in 26 of 40 (65%), 19 of 40 (48%), and 24 of 40 (60%) patients in the every-3-weeks combination, single-agent carboplatin, and weekly combination groups, respectively. Treatment-related adverse events were less common with the standard every-3-weeks combination (17 of 40 [43%]) than single-agent carboplatin or weekly combination therapy (both 23 of 40 [58%]). Treatment-related deaths occurred in 4 patients (2 of 40 [5%] in each combination group).\nThis randomized clinical trial shows that compared with every-3-weeks or weekly carboplatin-paclitaxel regimens, single-agent carboplatin was less active with significantly worse survival outcomes in vulnerable older patients with ovarian cancer.\nClinicalTrials.gov Identifier: NCT02001272.",
"affiliations": "Groupe d'Investigateurs Nationaux pour l'Étude des Cancers de l'Ovaire et du sein (GINECO), Laboratoire CarMEN, INSERM U1060/INRA U1397, Université Lyon 1, INSA de Lyon, and Centre Hospitalier Lyon-Sud, Hospices Civils de Lyon, Pierre-Bénite, France.;GINECO and Institut Paoli Calmettes, Marseille, France.;GINECO and Centre Jean Perrin, Clermont-Ferrand, France.;GINECO and Institut de Cancérologie de la Loire, St Priest en Jarez, France.;Multicentre Italian Trials in Ovarian cancer (MITO) and Fondazione Istituto di Ricerca e Cura a Carattere Scientifico (IRCCS) Istituto Nazionale dei Tumori, Milan, and Fondazione Policlinico Universitario A Gemelli IRCCS, Rome, Italy.;Nordic Society of Gynecologic Oncology (NSGO), Odense University Hospital, Odense, and Zealand University Hospital, Roskilde, Denmark.;GINECO and Institut Jean Godinot, Reims, France.;GINECO and Centre Hospitalier Annecy Genevois, Pringy, France.;GINECO and Institut de Cancérologie de l'Ouest René Gauducheau, Saint Herblain, France.;GINECO and Groupe Hospitalier Paris Saint Joseph, Paris, France.;GINECO and Institut du Cancer de Montpellier, Montpellier, France.;GINECO and Hôpital Privé du Confluent, Nantes, France.;GINECO and Centre François Baclesse, Caen, France.;GINECO and Centre Hospitalier de Cholet, Cholet, France.;GINECO and Centre Hospitalier Intercommunal de Créteil, Créteil, France.;GINECO and Centre Hospitalier Universitaire Dupuytren, Limoges, France.;GINECO and Centre Léon Bérard, Lyon, France.;GINECO and Institut Claudius Regaud, Toulouse, France.;GINECO, Paris, France.;GINECO and Centre Hospitalier Lyon-Sud, Lyon, France.",
"authors": "Falandry|Claire|C|;Rousseau|Frédérique|F|;Mouret-Reynier|Marie-Ange|MA|;Tinquaut|Fabien|F|;Lorusso|Domenica|D|;Herrstedt|Jørn|J|;Savoye|Aude-Marie|AM|;Stefani|Laetitia|L|;Bourbouloux|Emmanuelle|E|;Sverdlin|Robert|R|;D'Hondt|Veronique|V|;Lortholary|Alain|A|;Brachet|Pierre-Emmanuel|PE|;Zannetti|Alain|A|;Malaurie|Emmanuelle|E|;Venat-Bouvet|Laurence|L|;Trédan|Olivier|O|;Mourey|Loïc|L|;Pujade-Lauraine|Eric|E|;Freyer|Gilles|G|;|||",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1001/jamaoncol.2021.0696",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2374-2437",
"issue": "7(6)",
"journal": "JAMA oncology",
"keywords": null,
"medline_ta": "JAMA Oncol",
"mesh_terms": null,
"nlm_unique_id": "101652861",
"other_id": null,
"pages": "853-861",
"pmc": null,
"pmid": "33885718",
"pubdate": "2021-06-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Efficacy and Safety of First-line Single-Agent Carboplatin vs Carboplatin Plus Paclitaxel for Vulnerable Older Adult Women With Ovarian Cancer: A GINECO/GCIG Randomized Clinical Trial.",
"title_normalized": "efficacy and safety of first line single agent carboplatin vs carboplatin plus paclitaxel for vulnerable older adult women with ovarian cancer a gineco gcig randomized clinical trial"
} | [
{
"companynumb": "FR-MYLANLABS-2021M1059741",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugadditional": null,
... |
{
"abstract": "Introduction and Importance: Tuberculosis is one of the leading infectious causes of mortality worldwide. In the United States, foreign-born persons account for 70% of tuberculosis (TB) diagnoses. Comparatively, testicular cancer is much less common. However, metastatic disease may present similarly. Diagnosis is supported by elevated tumor markers and radical orchiectomy with specimen biopsy confirms the diagnosis and tumor type. Following resection, adjuvant treatment for metastatic disease includes chemotherapy. Case Presentation: This case describes a 22-year-old male immigrant with shortness of breath as the presenting symptom. Chest imaging showed a cavitary lung lesion encroaching the bronchus and left atrium. The patient was placed on airborne precautions and a complex hospital course ensued which resulted in the diagnosis of metastatic nonseminomatous germ cell tumor. The patient's 8 cm testicular tumor was treated with radical orchiectomy followed by chemotherapy. His condition deteriorated quickly, and he passed away in the hospital. Clinical Discussion: Metastatic testicular cancer is relatively rare compared to tuberculosis, especially in the immigrant population. Differentiating extrapulmonary TB from metastatic disease can pose a diagnostic challenge due to similar presentations. Complete physical exam including the genitalia is paramount in discerning a diagnosis of testicular cancer. Conclusion: Incidence of metastatic testicular cancer is much less common than extrapulmonary tuberculosis but must always be included on the differential for a young male.",
"affiliations": "Creighton University School of Medicine Department of Urology, 7710, Mercy Road, Suite 501, USA.;Creighton University School of Medicine Department of Urology, 7710, Mercy Road, Suite 501, USA.;Creighton University School of Medicine Department of Urology, 7710, Mercy Road, Suite 501, USA.;Creighton University School of Medicine Department of Urology, 7710, Mercy Road, Suite 501, USA.",
"authors": "Najdawi|Faris|F|;Means|Matthew|M|;Didde|Ryan|R|;Feloney|Michael|M|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1016/j.amsu.2021.102975",
"fulltext": "\n==== Front\nAnn Med Surg (Lond)\nAnn Med Surg (Lond)\nAnnals of Medicine and Surgery\n2049-0801\nElsevier\n\nS2049-0801(21)00925-0\n10.1016/j.amsu.2021.102975\n102975\nCase Report\nTesticular cancer presenting as disseminated tuberculosis: A case report\nNajdawi Faris ab\nMeans Matthew a\nDidde Ryan kelleysanders@creighton.edu\na∗\nFeloney Michael a\na Creighton University School of Medicine Department of Urology, 7710, Mercy Road, Suite 501, USA\nb Des Moines University, 3200 Grand Ave, Des Moines, IA, 50312, USA\n∗ Corresponding author. kelleysanders@creighton.edu\n11 11 2021\n12 2021\n11 11 2021\n72 10297527 8 2021\n19 10 2021\n28 10 2021\n© 2021 Published by Elsevier Ltd on behalf of IJS Publishing Group Ltd.\n2021\n\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).\nIntroduction and Importance: Tuberculosis is one of the leading infectious causes of mortality worldwide. In the United States, foreign-born persons account for 70% of tuberculosis (TB) diagnoses. Comparatively, testicular cancer is much less common. However, metastatic disease may present similarly. Diagnosis is supported by elevated tumor markers and radical orchiectomy with specimen biopsy confirms the diagnosis and tumor type. Following resection, adjuvant treatment for metastatic disease includes chemotherapy.\n\nCase Presentation: This case describes a 22-year-old male immigrant with shortness of breath as the presenting symptom. Chest imaging showed a cavitary lung lesion encroaching the bronchus and left atrium. The patient was placed on airborne precautions and a complex hospital course ensued which resulted in the diagnosis of metastatic nonseminomatous germ cell tumor. The patient's 8 cm testicular tumor was treated with radical orchiectomy followed by chemotherapy. His condition deteriorated quickly, and he passed away in the hospital.\n\nClinical Discussion: Metastatic testicular cancer is relatively rare compared to tuberculosis, especially in the immigrant population. Differentiating extrapulmonary TB from metastatic disease can pose a diagnostic challenge due to similar presentations. Complete physical exam including the genitalia is paramount in discerning a diagnosis of testicular cancer.\n\nConclusion: Incidence of metastatic testicular cancer is much less common than extrapulmonary tuberculosis but must always be included on the differential for a young male.\n\nHighlights\n\n• Though relatively rare, testicular cancer is the most common malignancy among men 20–40 years old in the United States.\n\n• In any young man with a persistent cough, metastatic testicular cancer must be evaluated and excluded.\n\n• Complete physical exam, including genitalia, is vital following discovery of a lung lesion, especially in a young male.\n\n• Delay in diagnosis of testicular cancer may delay treatment resulting in worse patient outcomes.\n\nNSGCT, Nonseminomatous germ cell tumor\nKeywords\n\nNSGCT\nCase report\nGerm cell tumor\nTuberculosis\nTuberculous epididymo-orchitis\n==== Body\npmc1 Introduction\n\nTuberculosis (TB) is a leading infectious cause of mortality worldwide with an estimated 10 million cases in 2020 [1]. In the United States, TB has an incidence of 26 per 100,000 persons with foreign-born persons accounting for 70% of TB diagnoses in 2019 [2]. The disease most commonly infects the lungs (pulmonary TB) but can also affect other organs (extrapulmonary TB). The combination of fevers, night sweats, and hemoptysis is a classic presentation of pulmonary TB, and a scrotal mass may be present in tuberculous epididymo-orchitis. In contrast, testicular cancers are relatively rare with an incidence of 1.7 per 100,000 persons and have a higher incidence in non-Hispanic whites compared to Hispanic persons [3,4]. In this study, we report a unique presentation of a metastatic mixed nonseminomatous germ cell tumor (NSGCT) mimicking disseminated tuberculosis in a young adult male early in the year 2021.\n\nThis work has been reported in line with the SCARE 2020 criteria [5].\n\n2 Presentation of case\n\nA 22-year-old Guatemalan male presented to the emergency department (ED) with left-sided chest pain and shortness of breath. He reported his symptoms began four months prior and progressively worsened. He also described intermittent hemoptysis, fevers, night sweats, and a 20 lbs weight loss over those four months. The patient had no past medical history, no history of surgeries, no known genetic abnormalities, and no family history of cancer. He had no history of drug use or allergies but had smoked cigarettes for two years before recently quitting. He had been working in construction since his arrival to the United States 18 months prior.\n\nOn the initial exam, the patient was tachycardic and tachypneic. A chest X-ray revealed a right upper lobe consolidation with moderate bilateral pleural fluid. Computed tomography angiogram (CTa), conducted using LightSpeed VCT 64-slice CT system, showed large mass-like consolidation in the right perihilar region measuring 12 × 6 cm and involving the mediastinum, an area of cavitation transecting the right mainstem bronchus, and mediastinal lymphadenopathy (see Fig. 1). An addendum to the radiology report later raised the concern of a large mass extending into the left atrium, warranting immediate thoracic surgery consult. Initial laboratory workup in the ED revealed a white blood cell count of 21.8 with 84% neutrophils, hemoglobin 9.7, platelets 489, lactic acid 1.7, C-reactive protein 304, and negative troponins. Urinalysis revealed urobilinogen without blood or pyuria. Laboratory tests for COVID-19, influenza, RSV, and HIV were all negative. At the time of initial ED presentation, the patient met institutional criteria for sepsis and was started on broad-spectrum antibiotics.Fig. 1 Very large area of opacification in the right perihilar region measuring 12 × 6 cm shape (a) and right lung base involving mediastinum and transecting right bronchus (b).\n\nFig. 1\n\nQuantiFERON-TB gold testing, acid-fast bacteria sputum cultures, and blood cultures were taken. Transthoracic echocardiogram (TTE) and bronchial biopsies were recommended before surgical intervention for the lung mass invading the left atrium. TTE revealed a 3.4 cm × 2.1 cm left atrial mass. Bronchoscopy showed an endobronchial mass occluding the middle and lower lobes and needle biopsies were taken. Reevaluation of the patient revealed an enlarged, nonpainful testicle. On further questioning, the patient noted the mass had been there for several months, at which point urology was consulted.\n\nScrotal ultrasound using grey scale and color doppler revealed an 8.5 cm × 4.1 cm x 4.7 cm complex right testicular mass and a normal left testicle (see Fig. 2). Alpha-fetoprotein serum concentration was found to be elevated at 3519.1 ng/mL, beta-human chorionic gonadotropin at 217 mIU/mL, and lactate dehydrogenase at 866 U/L. Due to imaging and laboratory concerns for testicular cancer, radical orchiectomy was performed on hospital day four. The procedure was performed by a professor of urology with over 20 years of surgical experience at an academic hospital. Histopathology of the endobronchial mass revealed germ cell tumor (GCT) consistent with metastasis of primary testicular yolk sac tumor, while the testicular specimen was found to be 80% yolk sac tumor and 20% embryonal carcinoma with lymphovascular invasion. Repeat CT abdomen/pelvis showed a known left atrial filling defect, no retroperitoneal lymphadenopathy, and a 2 cm right renal mass concerning for metastasis, confirming a diagnosis of stage IIIc NSGCT.Fig. 2 Long axis of right testicle showing complex solid mass measuring 8.5 × 4.1 × 4.7 cm (a), extending beyond tunica albuginea (b). Initial CTa on 1/5/21.\n\nFig. 2\n\nThe patient was started on a 5-day course of bleomycin, etoposide, and cisplatin (BEP) without further surgical intervention at that time due to the large tumor burden and cardiac involvement.\n\nThe patient tolerated the treatment poorly, developing hypoxia, acute kidney failure, and neutropenia. Following completion of his 5-day BEP, a post-chemotherapy transesophageal echocardiogram and CT scan showed a significant decrease in tumor size. Despite this, the patient's condition deteriorated. Adjuvant external beam radiation was contraindicated at this time due to the patient's critical condition. He developed acute respiratory distress syndrome necessitating ECMO, then acute renal failure warranting continuous renal replacement therapy. The patient ultimately experienced acute hepatic failure and expired. An autopsy request was declined by the family. His body was transported to Guatemala for burial shortly after his passing.\n\n3 Discussion\n\nThis case is unique as it presents a diagnostic dilemma for the treatment team regarding an infectious versus neoplastic etiology. Given the patient's recent immigration from a TB-endemic country, infectious etiologies must be ruled out in the differential diagnosis. The patient's productive cough with intermittent hemoptysis, imaging finding of cavitary upper lobe lung lesions, and lack of enlarged retroperitoneal lymph nodes all support tuberculosis as a potential diagnosis. Reasons against possible disseminated tuberculosis include an immunocompetent state (HIV-negative) and no recent sick contacts.\n\nWhile TB has an incidence of 20.7 per 100,000 in Guatemala, testicular germ cell tumors are relatively rare, with rates per 100,000 of 0.6 in Guatemala and 3.9 among US Hispanics [6,7]. However, GCTs are the most diagnosed malignancy in US males between 15 and 44 years old [3]. Comprising 95% of testicular tumors, GCTs consist of multiple subtypes, the most common being seminoma. Mixed germ cell, the second most common subtype, was seen in this patient and may consist of various proportions of embryonal, choriocarcinoma, teratoma, and yolk sac types [8]. Staging is critical in evaluating the prognosis and treatment modalities of testicular cancer. Primary lymphatic sites of metastatic testicular disease are inter-aortocaval lymph nodes, and CT scans detect between 70 and 80% of positive nodes [[9], [10], [11]]. This case report is perplexing because it does not follow the usual pathway for metastatic disease. After radical orchiectomy, adjuvant treatment for metastatic NSGCTs consists of BEP chemotherapy which is highly effective in lower-stage malignancies. Patients with metastatic disease are classified according to the International Germ Cell Cancer Collaborative Group as Good, Intermediate, or Poor Risk with a 5-year survival of 92%, 72%, and 48%, respectively [12]. At the time of the patient's diagnosis, distant metastases were present, and his condition was classified as Poor Risk, a stratification present in only 16% of NSGCTs [13].\n\nThough testicular cancer metastasis to the mediastinum is well documented, it is imperative to keep in mind extragonadal GCT without primary testicular involvement occurs in 2–5% of cases [14,15]. These neoplasms typically have worse prognoses with a 5-year survival rate of 45% [15].\n\nThe SCARE 2020 paper was used in the development of this paper [4].\n\n4 Conclusion\n\nSymptoms of TB can cause other disease processes, such as metastatic testicular cancer, to be overlooked, posing a diagnostic challenge. Diagnosis of testicular cancer is based on a thorough history and pathologic examination. Incidence of metastatic disease is much less common than tuberculosis but must always be included in the differential for a young male. An initial more thorough examination, especially of genitalia, could have expedited the correct diagnosis and initiation of treatment, possibly saving his life.\n\nPatient perspective\n\nContinuing to educate young men on testicular self-examination through community outreach programs may help raise awareness for this disease.\n\nProvenance and peer review\n\nNot commissioned, externally peer-reviewed.\n\nDeclaration of competing interest\n\nWritten informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal on request.\n\nEthical approval\n\nNo ethical approval necessary.\n\nSources of funding\n\nThe author(s) received no financial support for the research, authorship and/or publication of this article.\n\nConsent\n\nWritten informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal on request.\n\nAuthor contribution\n\nFaris Najdawi; Matthew Means: Writing, reviewing, and editing of manuscript. Ryan Didde: Contributed for diagnose and treatment of the patient; review and editing of manuscript. Michael Feloney: Review, supervision, and surgeon of the patient.\n\nRegistration of research studies\n\nName of the registry: None.\n\nUnique Identifying number or registration ID: None.\n\nHyperlink to your specific registration (must be publicly accessible and will be checked): None.\n\nGuarantor\n\nMichael Feloney.\n\nAppendix A Supplementary data\n\nThe following are the Supplementary data to this article:Multimedia component 1\n\nMultimedia component 1\n\nMultimedia component 2\n\nMultimedia component 2\n\nAppendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.amsu.2021.102975.\n==== Refs\nReferences\n\n1 Global Tuberculosis Report 2020 World Health Organization Geneva, Switzerland\n2 Centers for Disease Control and Prevention (CDC) Reported Tuberculosis in the United States, 2015 2016 US Department of Health and Human Services Atlanta, GA\n3 Trabert B. Chen J. Devesa S.S. Bray F. McGlynn K.A. International patterns and trends in testicular cancer incidence, overall and by histologic subtype, 1973–2007 Andrology 3 2015 4 12 10.1111/andr.293 25331326\n4 Ghazarian A.A. Kelly S.P. Altekruse S.F. Rosenberg P.S. McGlynn K.A. Future of testicular germ cell tumor incidence in the United States: forecast through 2026 Cancer 123 12 2017 2320 2328 10.1002/cncr.30597 28241106\n5 Agha R.A. Franchi T. Sohrabi C. Mathew G. for the SCARE Group The SCARE 2020 guideline: updating consensus surgical CAse REport (SCARE) guidelines Int. J. Surg. 84 2020 226 230 33181358\n6 reportTuberculosis in the Americas, 2019 Regional Report. Washington, D.C.: Pan American Health Organization.\n7 Ghazarian A. Kelly S. Altekruse S. Rosenberg P. McGlynn K. Future of testicular germ cell tumor incidence in the United States: forecast through 2026 Cancer 123 12 2017 2320 2328 28241106\n8 Howitt B. Berney D. Tumors of the testis: morphologic features and molecular alterations Surgical Pathology Clinics 8 4 2015 687 716 26612222\n9 Sohaib S.A. Koh D.M. Husband J.E. The role of imaging in the diagnosis, staging, and management of testicular cancer AJR Am. J. Roentgenol. 191 2008 387 395 10.2214/AJR.07.2758 18647907\n10 Hudolin T. Kastelan Z. Knezevic N. Correlation between retroperitoneal lymph node size and presence of metastases in nonseminomatous germ cell tumors Int. J. Surg. Pathol. 20 2012 15 18 10.1177/1066896911431452 22180527\n11 Leibovitch L. Foster R.S. Kopecky K.K. Improved accuracy of computerized tomography based clinical staging in low stage nonseminomatous germ cell cancer using size criteria of retroperitoneal lymph nodes J. Urol. 154 1995 1759 1763 10.1016/S0022-5347(01)66778-8 7563341\n12 Albers P. Guidelines on testicular cancer: 2015 update Eur. Urol. 68 6 2016 1054 1068\n13 SEER Cancer Stat Facts: Testicular Cancer, Stage Distribution of SEER Incidence Cases, 2008-2017 2021 National Cancer Institute Bethesda, MD Available online: https://seer.cancer.gov/statfacts/html/testis.html\n14 Lin G.Y. Kerr K.M. Li J. Cough and dyspnea. Thinking beyond pneumonia Ann Am Thorac Soc 10 6 2013 693 696 10.1513/AnnalsATS.201307-225CR 24364775\n15 Bokemeyer C. Nichols C.R. Droz J.P. Extragonadal germ cell tumors of the mediastinum and retroperitoneum: results from an international analysis J. Clin. Oncol. 20 7 2002 1864 1873 10.1200/JCO.2002.07.062 11919246\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2049-0801",
"issue": "72()",
"journal": "Annals of medicine and surgery (2012)",
"keywords": "Case report; Germ cell tumor; NSGCT; NSGCT, Nonseminomatous germ cell tumor; Tuberculosis; Tuberculous epididymo-orchitis",
"medline_ta": "Ann Med Surg (Lond)",
"mesh_terms": null,
"nlm_unique_id": "101616869",
"other_id": null,
"pages": "102975",
"pmc": null,
"pmid": "34820117",
"pubdate": "2021-12",
"publication_types": "D002363:Case Reports",
"references": "24364775;7563341;18647907;26612222;25331326;28241106;11919246;22180527;26297604;33181358",
"title": "Testicular cancer presenting as disseminated tuberculosis: A case report.",
"title_normalized": "testicular cancer presenting as disseminated tuberculosis a case report"
} | [
{
"companynumb": "US-TEVA-2021-US-1993047",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "BLEOMYCIN SULFATE"
},
"drugadditional": "4",
... |
{
"abstract": "BACKGROUND\nRelapsing polychondritis (RP) is a rare autoimmune disorder, and myelodysplastic syndrome (MDS) is accompanied by RP at variable rates. Herein, we report a case with RP and MDS who responded dramatically to 5-azacitidine for MDS.\n\n\nMETHODS\nWith conventional immunosuppressive treatment, our patient had several episodes of different side effects, including infections. With the diagnosis of MDS and initiation of azacitidine treatment, all the manifestations of RP disappeared, and remission was achieved for MDS. Although he had relapses of either RP or MDS after several years of azacitidine treatment, all relapses were controlled well with the initiation of azacitidine treatment every time.\n\n\nCONCLUSIONS\nAzacitidine should be kept in mind as a treatment option for RP patients with MDS.",
"affiliations": "Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Rheumatology, Ankara, Turkey.;Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Rheumatology, Ankara, Turkey.;Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Rheumatology, Ankara, Turkey.;Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Rheumatology, Ankara, Turkey.;Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Rheumatology, Ankara, Turkey.;Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey.;Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Rheumatology, Ankara, Turkey.",
"authors": "Erden|Abdulsamet|A|;Bilgin|Emre|E|http://orcid.org/0000-0002-2260-4660;Kılıç|Levent|L|;Sarı|Alper|A|;Armağan|Berkan|B|;Büyükaşık|Yahya|Y|;Kalyoncu|Umut|U|",
"chemical_list": "D007166:Immunosuppressive Agents; D001374:Azacitidine",
"country": "Germany",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2363-8915",
"issue": "33(2)",
"journal": "Drug metabolism and personalized therapy",
"keywords": "azacitidine; myelodysplastic syndrome; relapsing polychondritis",
"medline_ta": "Drug Metab Pers Ther",
"mesh_terms": "D000328:Adult; D001374:Azacitidine; D006801:Humans; D007166:Immunosuppressive Agents; D008297:Male; D009190:Myelodysplastic Syndromes; D011081:Polychondritis, Relapsing; D012074:Remission Induction; D013997:Time Factors; D016896:Treatment Outcome",
"nlm_unique_id": "101653409",
"other_id": null,
"pages": "105-108",
"pmc": null,
"pmid": "29715182",
"pubdate": "2018-06-27",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Remission of relapsing polychondritis after successful treatment of myelodysplastic syndrome with azacitidine: a case and review of the literature.",
"title_normalized": "remission of relapsing polychondritis after successful treatment of myelodysplastic syndrome with azacitidine a case and review of the literature"
} | [
{
"companynumb": "TR-TEVA-2018-TR-929608",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": "3",
... |
{
"abstract": "Severe acute respiratory syndrome coronavirus 2 can lead to life-threatening coronavirus disease 2019 (COVID-19) infections in patients with hematologic malignancies, particularly among hematopoietic cell transplant (HCT) recipients. We describe two patients with COVID-19 during the pre-engraftment period after HCT and review previous reports of COVID-19 in HCT recipients. Because of significant mortality from COVID-19, primarily after allogeneic HCT, early, preemptive, and optimal directed therapy may improve outcomes and reduce the mortality rate but still needs to be established in clinical trials.",
"affiliations": "Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.",
"authors": "Malek|Alexandre E|AE|https://orcid.org/0000-0002-7867-4502;Adachi|Javier A|JA|;Mulanovich|Victor E|VE|;Sassine|Joseph|J|;Raad|Issam I|II|;McConn|Kelly|K|;Seiler|Garret T|GT|;Dhal|Udit|U|;Khawaja|Fareed|F|;Chemaly|Roy F|RF|",
"chemical_list": null,
"country": "Denmark",
"delete": false,
"doi": "10.1111/tid.13606",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1398-2273",
"issue": "23(4)",
"journal": "Transplant infectious disease : an official journal of the Transplantation Society",
"keywords": "COVID-19; hematopoietic cell transplantation; outcomes; pre-engraftment; stem cell therapy",
"medline_ta": "Transpl Infect Dis",
"mesh_terms": "D000086382:COVID-19; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D000074243:Immune Reconstitution; D000086402:SARS-CoV-2; D066027:Transplant Recipients",
"nlm_unique_id": "100883688",
"other_id": null,
"pages": "e13606",
"pmc": null,
"pmid": "33755273",
"pubdate": "2021-08",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Immune reconstitution and severity of COVID-19 among hematopoietic cell transplant recipients.",
"title_normalized": "immune reconstitution and severity of covid 19 among hematopoietic cell transplant recipients"
} | [
{
"companynumb": "NVSC2021US080665",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ANAKINRA"
},
"drugadditional": null,
"drugad... |
{
"abstract": "Cryptococcus neoformans is a common fungus found throughout the environment that causes opportunistic disease in immunocompromised individuals. Infection of humans with C neoformans usually manifests as lung disease through inhalation of spores or meningoencephalitis by involvement of the central nervous system. Rarely, dissemination in the form of cutaneous lesions can occur in individuals with long term immunosuppression. We present a patient with C. neoformans manifesting as cellulitis with focal segmental glomerulosclerosis treated with corticosteroids. Because of the mortality associated with disseminated cryptococcosis, early identification, especially of atypical cutaneous presentations is critical from a dermatological perspective.",
"affiliations": "Departments of Dermatology University of Southern California Keck School of Medicine, Los Angeles, California. genekim@usc.edu.",
"authors": "Zhu|Tian Hao|TH|;Rodriguez|Paola G|PG|;Behan|James W|JW|;Declerck|Brittney|B|;Kim|Gene H|GH|",
"chemical_list": "D000935:Antifungal Agents; D007166:Immunosuppressive Agents; D000666:Amphotericin B; D016572:Cyclosporine; D015725:Fluconazole; D005437:Flucytosine; D011241:Prednisone",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1087-2108",
"issue": "22(6)",
"journal": "Dermatology online journal",
"keywords": null,
"medline_ta": "Dermatol Online J",
"mesh_terms": "D000666:Amphotericin B; D000935:Antifungal Agents; D002481:Cellulitis; D003453:Cryptococcosis; D003455:Cryptococcus neoformans; D016572:Cyclosporine; D015725:Fluconazole; D005437:Flucytosine; D016469:Fungemia; D005923:Glomerulosclerosis, Focal Segmental; D006801:Humans; D016867:Immunocompromised Host; D007166:Immunosuppressive Agents; D007868:Leg Dermatoses; D008297:Male; D008875:Middle Aged; D011241:Prednisone; D012867:Skin",
"nlm_unique_id": "9610776",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "27617599",
"pubdate": "2016-06-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Cryptococcal cellulitis on the shin of an immunosuppressed patient.",
"title_normalized": "cryptococcal cellulitis on the shin of an immunosuppressed patient"
} | [
{
"companynumb": "US-HORIZON-PRE-0250-2016",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": null,
... |
{
"abstract": "Metformin-associated lactic acidosis (MALA) is a rare complication among patients who are diabetic, commonly presenting with non-specific findings, and developing mostly among those with other risk factors for lactic acidosis. We report the development of MALA in a 67-year-old man with diabetes who presented with progressive abdominal pain and bloody diarrhoea. On presentation the patient was in shock, with signs suggestive of peritonitis, and with severe lactic acidosis, renal failure and non-specific findings on abdominal CT. Neither the patient nor family could provide details of his home pharmaceuticals. Circulatory resuscitation with intravenous crystalloids and vasopressors was commenced, along with empiric broad-spectrum antibiotics. Emergent laparotomy did not show pathological findings. Emergent haemodialysis, initiated postoperatively, resulted in rapid resolution of shock and lactic acidosis. A list of patient's medications, provided afterwards by the family, included metformin. Microbiological studies remained negative and renal function normalised by the time of patient's hospital discharge after 9 days.",
"affiliations": "Internal Medicine Department, Texas Tech University Health Sciences Center at Permian Basin Campus, Odessa, Texas, USA.;Internal Medicine Department, Texas Tech University Health Sciences Center at Permian Basin Campus, Odessa, Texas, USA.;Internal Medicine Department, Texas Tech University Health Sciences Center at Permian Basin Campus, Odessa, Texas, USA.;Internal Medicine Department, Texas Tech University Health Sciences Center at Permian Basin Campus, Odessa, Texas, USA.;Internal Medicine Department, Texas Tech University Health Sciences Center at Permian Basin Campus, Odessa, Texas, USA.",
"authors": "Ali|Sajjad|S|;Labuschagne|Heloise|H|;Azarov|Nickolay|N|;Hindi|Zakaria|Z|http://orcid.org/0000-0003-0222-2312;Oud|Lavi|L|",
"chemical_list": "D007004:Hypoglycemic Agents; D008687:Metformin",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2017-221686",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2018()",
"journal": "BMJ case reports",
"keywords": "drugs: endocrine system; metabolic disorders",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D015746:Abdominal Pain; D000140:Acidosis, Lactic; D000368:Aged; D003920:Diabetes Mellitus; D003937:Diagnosis, Differential; D004632:Emergency Medical Services; D005243:Feces; D006471:Gastrointestinal Hemorrhage; D017583:Hemodiafiltration; D006801:Humans; D007004:Hypoglycemic Agents; D008297:Male; D008687:Metformin; D051437:Renal Insufficiency; D012769:Shock; D016896:Treatment Outcome",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "29391354",
"pubdate": "2018-02-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "14746555;10372243;10220200;24884658;22365024;26773926;14991192;11472468",
"title": "Metformin-associated lactic acidosis mimicking ischaemic bowel.",
"title_normalized": "metformin associated lactic acidosis mimicking ischaemic bowel"
} | [
{
"companynumb": "US-EPIC PHARMA LLC-2018EPC00160",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "LEVOTHYROXINE"
},
"drugadditional": nu... |
{
"abstract": "Two recent trials concluded that the use of oral contraceptives (OC) did not induce flares in lupus patients. We record our experience with OC in patients with stable lupus. Eight patients were enrolled in an open trial. Six received a combined contraceptive pill and two were allocated to the control arm. During a 12 month follow-up, 3 patients in the active arm experienced 4 major flares. One patient died as a result of uncontrolled disease complicated by sepsis. At this point, we abandoned the trial. The 2 patients in the control arm experienced no disease exacerbation during the 7 months of observation. We would urge that patients who are placed on OC be closely monitored.",
"affiliations": "Division of Rheumatology, Tygerberg Hospital, P.O. Box 19063, 7505, Tygerberg, Western Cape, South Africa. dwhit@sun.ac.za.;Division of Dermatology, Groote Schuur Hospital, Cape Town, South Africa.",
"authors": "Whitelaw|D A|DA|;Jessop|S J|SJ|",
"chemical_list": "D003276:Contraceptives, Oral",
"country": "Germany",
"delete": false,
"doi": "10.1007/s10067-007-0641-y",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0770-3198",
"issue": "26(12)",
"journal": "Clinical rheumatology",
"keywords": null,
"medline_ta": "Clin Rheumatol",
"mesh_terms": "D000328:Adult; D003276:Contraceptives, Oral; D005260:Female; D005500:Follow-Up Studies; D019584:Hot Flashes; D006801:Humans; D008180:Lupus Erythematosus, Systemic; D008875:Middle Aged; D011379:Prognosis; D012189:Retrospective Studies; D012307:Risk Factors",
"nlm_unique_id": "8211469",
"other_id": null,
"pages": "2163-2165",
"pmc": null,
"pmid": "17487447",
"pubdate": "2007-12",
"publication_types": "D016428:Journal Article",
"references": "1859487;11999880;7092961;16354890;7728402;16354891;1599520;14994382;1771400;11958584;16354897;15968009;11526727;15829269;3511372",
"title": "Major flares in women with SLE on combined oral contraception.",
"title_normalized": "major flares in women with sle on combined oral contraception"
} | [
{
"companynumb": "ZA-PFIZER INC-2015320982",
"fulfillexpeditecriteria": "1",
"occurcountry": "ZA",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ETHINYL ESTRADIOL\\LEVONORGESTREL"
},
"drugad... |
{
"abstract": "A 47-year-old man suffering from a bipolar disorder and intermittent myoglobinuria presented with acute rhabdomyolysis with renal failure after starting therapy with valproic acid. On morphological examination, skeletal muscle revealed increased lipid storage. Biochemically, decreased enzyme activity of carnitine palmitoyltransferase (CPT) type II with carnitine levels in the lower limit was found. Genetic analysis detected the common Ser113Leu substitution on one allele of the CPT2 gene. We conclude that valproic acid should be avoided in patients with CPT type II deficiency.",
"affiliations": "Department of Neurology, University of Freiburg, 79106 Freiburg, Germany. kottlors@nz11.ukl.uni-freiburg.de",
"authors": "Kottlors|M|M|;Jaksch|M|M|;Ketelsen|U P|UP|;Weiner|S|S|;Glocker|F X|FX|;Lücking|C H|CH|",
"chemical_list": "D018692:Antimanic Agents; D014635:Valproic Acid; D000108:Acetylcarnitine; D002334:Carnitine O-Palmitoyltransferase",
"country": "England",
"delete": false,
"doi": "10.1016/s0960-8966(01)00228-0",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0960-8966",
"issue": "11(8)",
"journal": "Neuromuscular disorders : NMD",
"keywords": null,
"medline_ta": "Neuromuscul Disord",
"mesh_terms": "D000108:Acetylcarnitine; D000208:Acute Disease; D018692:Antimanic Agents; D001714:Bipolar Disorder; D002334:Carnitine O-Palmitoyltransferase; D006801:Humans; D008052:Lipid Metabolism, Inborn Errors; D008297:Male; D008875:Middle Aged; D028361:Mitochondrial Diseases; D018482:Muscle, Skeletal; D009154:Mutation; D009212:Myoglobinuria; D012206:Rhabdomyolysis; D014635:Valproic Acid",
"nlm_unique_id": "9111470",
"other_id": null,
"pages": "757-9",
"pmc": null,
"pmid": "11595519",
"pubdate": "2001-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Valproic acid triggers acute rhabdomyolysis in a patient with carnitine palmitoyltransferase type II deficiency.",
"title_normalized": "valproic acid triggers acute rhabdomyolysis in a patient with carnitine palmitoyltransferase type ii deficiency"
} | [
{
"companynumb": "DE-VISTAPHARM, INC.-VER201712-001413",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "VALPROIC ACID"
},
"drugadditional"... |
{
"abstract": "To describe a case of unilateral retinal arteriolar occlusion following multiple intravitreal brolucizumab injections for neovascular age-related macular degeneration (nAMD).\nA 92-year-old Caucasian woman presented with blurry vision in her left eye (OS) after receiving the third dose of intravitreal brolucizumab. At the time of presentation, visual acuity (VA) was 20/40 in her right eye (OD) and had decreased from 20/150 to count finger (CF) at 1-foot OS. On examination, there was no evidence of active inflammation in the anterior chamber OU. Dilated fundus examination showed no vitritis in OD and 1+ vitreous cells OS, flame-shaped hemorrhage at the superior optic disc margin, and retinal whitening surrounding the proximal portion of the supero-temporal branch of the central retinal artery. There were drusen in OS and retinal pigment epithelial (RPE) changes in the maculae of OU. Intra-arteriolar greyish deposits were seen OS. Fluorescein angiography (FA) showed hyper-fluorescence in the maculae corresponding to fibrovascular pigment epithelial detachments (PED) OU. No peri-vascular leakage was noted OU. Delayed filling of multiple arterioles in early and late phases OS was observed on FA. The patient was diagnosed with retinal arteriolar occlusion associated with repeated intravitreal brolucizumab administrations.\nRetinal arteriolar occlusion with severe vision loss, possibly secondary to inflammatory responses, can occur after subsequent intravitreal brolucizumab injections, even if no inflammation occurred after initial administrations. Vaso-occlusive disease should be considered as a potential ocular complication, with acute as well as delayed onset, following intravitreal brolucizumab therapy.",
"affiliations": "Retina Consultants of San Diego, Poway, CA, USA.;Spencer Center for Vision Research, Byers Eye Institute, Stanford University, Palo Alto, CA, USA.;Spencer Center for Vision Research, Byers Eye Institute, Stanford University, Palo Alto, CA, USA.;Spencer Center for Vision Research, Byers Eye Institute, Stanford University, Palo Alto, CA, USA.;Spencer Center for Vision Research, Byers Eye Institute, Stanford University, Palo Alto, CA, USA.;Spencer Center for Vision Research, Byers Eye Institute, Stanford University, Palo Alto, CA, USA.;Spencer Center for Vision Research, Byers Eye Institute, Stanford University, Palo Alto, CA, USA.;Sierra Eye Associates, Reno, NV, USA.;Spencer Center for Vision Research, Byers Eye Institute, Stanford University, Palo Alto, CA, USA.;Spencer Center for Vision Research, Byers Eye Institute, Stanford University, Palo Alto, CA, USA.",
"authors": "Jain|Atul|A|;Chea|Sophaktra|S|;Matsumiya|Wataru|W|;Halim|M Sohail|MS|;Yaşar|Çigdem|Ç|;Kuang|Guoping|G|;Sepah|Yasir J|YJ|;Khanani|Arshad M|AM|;Do|Diana V|DV|;Nguyen|Quan Dong|QD|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.ajoc.2020.100687",
"fulltext": "\n==== Front\nAm J Ophthalmol Case Rep\nAm J Ophthalmol Case Rep\nAmerican Journal of Ophthalmology Case Reports\n2451-9936 Elsevier \n\nS2451-9936(20)30058-X\n10.1016/j.ajoc.2020.100687\n100687\nCase Report\nSevere vision loss secondary to retinal arteriolar occlusions after multiple intravitreal brolucizumab administrations\nJain Atul light123@msn.coma∗ Chea Sophaktra b Matsumiya Wataru b Halim M. Sohail bc Yaşar Çigdem b Kuang Guoping b Sepah Yasir J. bc Khanani Arshad M. de Do Diana V. b Nguyen Quan Dong b a Retina Consultants of San Diego, Poway, CA, USA\nb Spencer Center for Vision Research, Byers Eye Institute, Stanford University, Palo Alto, CA, USA\nc Ocular Imaging Research and Reading Center (OIRRC), Sunnyvale, CA, USA\nd Sierra Eye Associates, Reno, NV, USA\ne University of Nevada, Reno, NV, USA\n∗ Corresponding author. Retina Consultants of San Diego, 12630 Monte Vista Road, Suite 104, Poway, CA, 92064, USA. light123@msn.com\n02 4 2020 \n6 2020 \n02 4 2020 \n18 10068727 3 2020 31 3 2020 31 3 2020 © 2020 Published by Elsevier Inc.2020This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Purpose\nTo describe a case of unilateral retinal arteriolar occlusion following multiple intravitreal brolucizumab injections for neovascular age-related macular degeneration (nAMD).\n\nObservations\nA 92-year-old Caucasian woman presented with blurry vision in her left eye (OS) after receiving the third dose of intravitreal brolucizumab. At the time of presentation, visual acuity (VA) was 20/40 in her right eye (OD) and had decreased from 20/150 to count finger (CF) at 1-foot OS. On examination, there was no evidence of active inflammation in the anterior chamber OU. Dilated fundus examination showed no vitritis in OD and 1+ vitreous cells OS, flame-shaped hemorrhage at the superior optic disc margin, and retinal whitening surrounding the proximal portion of the supero-temporal branch of the central retinal artery. There were drusen in OS and retinal pigment epithelial (RPE) changes in the maculae of OU. Intra-arteriolar greyish deposits were seen OS. Fluorescein angiography (FA) showed hyper-fluorescence in the maculae corresponding to fibrovascular pigment epithelial detachments (PED) OU. No peri-vascular leakage was noted OU. Delayed filling of multiple arterioles in early and late phases OS was observed on FA. The patient was diagnosed with retinal arteriolar occlusion associated with repeated intravitreal brolucizumab administrations.\n\nConclusion\nRetinal arteriolar occlusion with severe vision loss, possibly secondary to inflammatory responses, can occur after subsequent intravitreal brolucizumab injections, even if no inflammation occurred after initial administrations. Vaso-occlusive disease should be considered as a potential ocular complication, with acute as well as delayed onset, following intravitreal brolucizumab therapy.\n\nKeywords\nAge-related macular degenerationBrolucizumabIntravitrealNeovascularRetinal vasculitisVaso-occlusionRetinal occlusive vasculitis\n==== Body\n1 Introduction\nIntravitreal vascular endothelial growth factor (VEGF) inhibitors are currently the preferred treatment for choroidal neovascularization (CNV) secondary to neovascular age-related macular degeneration (nAMD), which is a major cause of vision loss in the elderly in developed countries.1, 2, 3 Ranibizumab, approved by Food and Drug Administration (FDA) in 2004, and aflibercept, approved by FDA in 2011 in the United States, have been well established as effective and safe anti-VEGF therapies for nAMD. In addition, bevacizumab, is an “off-label” VEGF inhibitor widely used in nAMD.\n\nBrolucizumab is a rabbit derived humanized, single-chain variable fragment (scFv) antibody with a molecular mass of ~26kDa that inhibits VEGF-A. The phase 3 clinical trials, HAWK and HARRIER4,5 demonstrated non-inferiority in BCVA with brolucizumab (dosed every 8 or 12 weeks) compared to aflibercept (dosed every 8 weeks). In addition, brolucizumab treated eyes had greater reductions in retinal thickness compared to aflibercept treated eyes. HAWK and HARRIER reported that potentially serious adverse events associated with brolucizumab include hypersensitivity, endophthalmitis and retinal detachments, increased intraocular pressure, and systemic arterial thromboembolic events.6 While uveitis was noted as ocular adverse events (AEs) of interest in these studies, these AEs occurred at an incidence of 2.2% and 0.8% for brolucizumab 6 mg versus 0.3% and 0% for aflibercept, respectively, in HAWK and HARRIER. Approximately 90% of the uveitis cases were described and considered mild to moderate and were treated with a course of topical corticosteroids and/or topical antibiotics.5 In addition, there were 3 cases of either retinal artery “embolism, occlusion, or thrombosis” with 6 mg brolucizumab in the two studies versus 1 case with aflibercept.5 Based on the efficacy and safety outcomes from the pivotal clinical trials, on October 7, 2019, the United State Food and Drug Administration (FDA) approved brolucizumab for the treatment of nAMD.\n\nOn February 23, 2020, the American Society of Retinal Specialists (ASRS) alerted members to reported cases of ocular inflammation after brolucizumab treatment. In the statement, the ASRS indicated that “it has received reports of inflammation which included more than a dozen cases of vasculitis, of which greater than two-third were designated as occlusive retinal vasculitis by the reporting providers.”7\n\nWe herein describe a case of multiple retinal arteriolar occlusions associated with intravitreal brolucizumab injection that led to severe loss of vision in a patient with nAMD.\n\n1.1 Case report\nA 92-year-old Caucasian woman with nAMD in both eyes (OU) returned to the retina clinic because of significantly decreased vision in the left eye (OS). The patient's underlying systemic diseases included hypertension, arthritis, and hyperlipidemia.\n\nThe patient had been treated with different types of anti-VEGF therapy for her nAMD. In OD, the patient had received multiple intravitreal injections of bevacizumab with an incomplete response to treatment and persistent intraretinal fluid which resolved when treatment was switched to intravitreal aflibercept and remained as such when patient was transitioned back to bevacizumab. In OS, there was persistent CNV activity despite multiple injections of bevacizumab, ranibizumab, and aflibercept. There was no evidence of inflammation in OD or OS after intravitreal bevacizumab, ranibizumab, and aflibercept administrations. Because of the persistent nAMD activity in OS, intravitreal brolucizumab (6 mg) was recommended. After her first intravitreal brolucizumab injection, complete resolution of retinal fluid was noted, but there was no change in visual acuity (VA). No evidence of intraocular inflammation was noted after the first and second intravitreal brolucizumab injections. At the time of the third administration of intravitreal brolucizumab OS (February 13, 2020), the VA was 20/30 OD and 20/150 OS. No treatment was rendered OD at that visit. On February 29, 2020, the patient developed sudden blurry vision and noted floaters without eye pain or redness OS. However, she did not communicate the symptoms with the physician or the office until her follow-up appointment.\n\nThe patient returned to the clinic on March 5, 2020 with no changes in symptoms since onset five days prior. On ophthalmic examination, VA had decreased to count fingers (CF) at 1-foot OS and was stable OD. Intraocular pressure (IOP) was normal OU and slit-lamp examination did not reveal any cell or flare in either eye. Dilated fundus examination of OD showed no vitreous cells, disc with normal borders, and RPE changes in the macula. In OS, there was 1+ vitreous cells/debris. A flame-shape hemorrhage was noted at the superior disc border along with retinal whitening in the supero-nasal macula following the course of a retinal arteriole as well as whitening in the papillo-macular bundle adjacent to the optic nerve (Fig. 1E). In addition, there were intra-arteriolar greyish deposits (Fig. 1E) in multiple arterioles. Spectral-domain optical coherence tomography (SD-OCT) showed pigment epithelial detachments (PED) OU with no intraretinal or subretinal fluid (Fig. 2). The patient was given another intravitreal injection of bevacizumab OD and started on topical 1% prednisolone acetate four times daily OS.Fig. 1 Fundus photograph (FP) of both eyes. FP of the right eye before (1A) and after (1B–1C) bevacizumab injection are within normal limits. Left eye before (1D) the third intravitreal brolucizumab injection showing drusen (yellow arrow); three weeks post-third intravitreal brolucizumab injection (1E) showing drusen (yellow arrow), whitish lesions near the disc (red arrow), small intra-arteriolar greyish depositions (black arrow); and four weeks post-third intravitreal brolucizumab injection (1F) showing whitish lesions near disc (red arrow), small intra-arteriolar greyish depositions (black arrow). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)\n\nFig. 1Fig. 2 Optical coherence tomography (Spectralis, Heidelberg Engineering, Heidelberg, Germany) of the right (OD) and left (OS) eyes. OCT of OD after multiple intravitreal bevacizumab injections (2A, 2C, 2E). Before the third intravitreal brolucizumab injection in OS (2B), three weeks post-third intravitreal brolucizumab injection (2D) and four weeks post-third intravitreal brolucizumab injection (2F). Pigmented epithelial detachment can be seen at all visits in both OD and OS (red arrow). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)\n\nFig. 2\n\nThe patient returned to the clinic on March 12, 2020. VA remained CF at 1-foot OS. Slit-lamp examination revealed no cells or flare in the anterior chamber OU. Dilated fundus examination revealed RPE changes OU. SD-OCT remained unchanged from the previous visit on March 5, 2020 (Fig. 2E–F). Fluorescein angiography (FA) was performed and demonstrated hyper-fluorescence in the maculae corresponding to fibrovascular PED OU (Fig. 3). In addition, OS demonstrated segmental peri-vascular staining (less likely leakage) of an arteriole. In addition, there was delayed filling of multiple arterioles in the early phase demonstrating arteriolar occlusion (Fig. 3D) as well as areas of focal choroidal infarcts OS (not shown). There was staining of the disc border but no disc leakage OU.Fig. 3 Fluorescein angiography of right eye (OD) post-bevacizumab injection (top row) and post-third intravitreal brolucizumab injection (bottom row) in left eye (OS). No leakage of optic nerve and peri-vasculature can be seen in OD (3A-3C). Hyper-fluorescence in the peri-foveal region with no active leakage can be seen OU (white arrows). Delayed arteriolar filling in early phase (yellow arrow) can be seen in early phase FA in OS (3D). Hyper-fluorescence of the superior retinal arteriole near the optic disc (red arrows) can be seen without leakage in mid to late FA in OS (3E-3F). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)\n\nFig. 3\n\nBecause of the ocular inflammation and multiple arteriolar occlusions OS, laboratory evaluations (CBC with differential, erythrocyte sedimentation rate, and C-reactive protein) along with a thorough history and review of systems were obtained, both were negative for giant cell arteritis (GCA). Evaluation for autoimmune/inflammatory diseases were also normal or negative.\n\nBased on the negative laboratory testing, we suspected that the patient had multiple retinal arteriolar occlusions secondary to ocular inflammation attributed to brolucizumab OS. Given the presentation, the time of events post intravitreal administration of pharmacologic agents, clinical and angiographic findings, and the negative laboratory evaluation for associated systemic diseases, a diagnosis of multiple retinal arteriolar occlusions secondary to brolucizumab appears logical, especially in light of other cases reported by the ASRS. As the vision has decreased to CF, and there was no evidence of active inflammation on FA, we have decided to observe the patient rather than initiating any therapy such as corticosteroid.\n\n2 Discussion\nWe have presented a case of retinal arteriolar occlusions in an eye with nAMD treated with brolucizumab that has led to severe loss of vison. The left eye in the index patient has been treated previously with multiple other anti-VEGF agents (bevacizumab, ranibizumab, and aflibercept) without incidents. Although previous therapies did not lead to complete resolution of active nAMD, no ocular inflammation was previously detected by the retina specialist. Improvement in retinal fluid was noted after two intravitreal injections of brolucizumab without an associated improvement in VA. Unfortunately, delayed vitreous cells and retinal occlusions occurred in OS after the third administration of brolucizumab, leading to significant loss of vision. The index case is among the first published reports in the literature to describe in detail retinal arteriolar occlusions that occur after brolucizumab.\n\nBrolucizumab (~26 kDa) is the smallest of the anti-VEGF antibodies, significantly smaller than bevacizumab (149 kDa), aflibercept (97–115 kDa), and ranibizumab (48 kDa). Therefore, higher concentrations of brolucizumab molecules can be delivered in the same volume, resulting in an anti-VEGF binding capacity 11-times greater than aflibercept and 22-times than ranibizumab.8\n\nOcular and non-ocular AEs of the two phase 3 studies were comparable between the patients treated with brolucizumab and aflibercept. Ocular AEs reported in more than 5% of the study patients included conjunctival hemorrhage, eye pain, vitreous floaters, and reduced VA.2 Intraocular inflammation was reported to be higher in brolucizumab 6 mg versus aflibercept at week 48 in HAWK and HARRIER.5\n\nAt the 43rd Annual Meeting of the Macula Society in San Diego, February 19–22, 2020, additional safety data of brolucizumab in the HAWK and HARRIER studies were presented.9 There were six (6) cases of retinal artery occlusion (including terms of retinal artery thrombosis, retinal artery occlusion, and retinal artery embolism) in the brolucizumab 6 mg patients in the HAWK and HARRIER studies based on the assessment by an independent Safety Review Committee (SRC). The SRC examined the clinical and imaging data of all cases of inflammation in the HAWK and HARRIER studies. These findings were different than the published Phase 3 data of the HAWK and HARRIER studies which reported only 3 cases of retinal artery occlusion/thrombosis based on the data reported by the investigators. Subsequently, on February 23, 2020, the American Society of Retina Specialists (ASRS) announced to its members that it has received reports of 14 cases of vasculitis following commercially available brolucizumab administration. Of these, 11 cases were designated as occlusive retinal vasculitis by the reporting providers. On March 30, 2020, the ASRS updated the number that it had received to be 25 cases of vasculopathy following intravitreal injections of brolucizumab, with 21 cases being occlusive.7 Recent publication has also provided additional information about retinal vaso-occlusion that occurs after brolucizumab administration.10\n\nIn our index case, the patient developed 1+ vitreous cells/debris and multiple retinal arteriolar occlusions after her 3rd brolucizumab injection OS. The fundus photograph before the administration of the third dose of brolucizumab demonstrated RPE changes but no signs of retinal vasculitis or arteriolar occlusion. However, subsequent funduscopic examination and photographs demonstrated the presence of intra-arteriolar greyish substances, which most likely contributed to the occlusive process. It could be theorized that the observed adverse event is attributed to the more potent VEGF blockade, owing to the properties of the brolucizumab molecule. However, studies using various anti-VEGF pharmacologic agents in the past have not reported similar events which could be attributed to hi-dose VEGF antagonists and VEGF blockade. In both the HARBOR Study for nAMD and the READ-3 Study for diabetic macular edema, ranibizumab 2.0 mg, which is at least quadrupled of the current approved standards, was evaluated.11,12 There were no reported cases of retinal arterial or venous occlusion. Additionally, numerous phase 2 and phase 3 clinical trials, with thousands of enrolled subjects, conducted to assess the safety and efficacy of ranibizumab and aflibercept for treatment of diabetic macular edema and nAMD also did not report such a finding.12, 13, 14, 15, 16, 17 As of March 2020, retinal arterial occlusion or retinal vasculitis has been reported at a rate of less than 1 out of every 6 million intravitreal injections of aflibercept, and such cases have appeared in association with culture positive infectious endophthalmitis.18 In the index patient, the retinal arteriolar occlusions were observed without any underlying ocular inflammation or infection. As of March 13, 2020, more than 65,000 vials of brolucizumab for intravitreal injection have been shipped to prescribing physicians in the US; the incidence of adverse events reported to Novartis as retinal artery occlusion, vasculitis or severe vision loss is 10 per 10,000 injections.19\n\nPossibly, a type IV hypersensitivity reaction after intravitreal brolucizumab for the treatment of nAMD in the left eye has occurred, leading to an inflammatory response inside the vessels (such as accumulation of immune complexes) along the vessel wall where the plasma is in contact with the foreign protein (brolucizumab) and subsequent vascular occlusion. The presence of intra-arteriolar greyish material OS (Fig. 1E) suggests that there may indeed be intravascular immune complexes.\n\nShould local, including sustained-release devices, or systemic corticosteroids have been initiated to control the inflammation? Careful consideration was made regarding therapy to salvage the vision. However, the FA showed near-complete vascular occlusion and the vision OS had already decreased to CF. In addition, the lack of leakage of the optic disc or peri-vasculature on FA did not support active inflammation. Furthermore, an afferent pupillary defect was present. The acute inflammatory process likely has already occurred and passed, and the sequelae of such inflammation were seen. Given the age of patient, the prognosis of visual recovery, and the risks and benefits of corticosteroid therapy (or other anti-inflammatory therapy), local or systemic, were considered and discussed with the patient. Close observation was recommended and agreed upon.\n\n3 Conclusion\nWe reported a case of retinal arteriolar occlusions that are postulated to result from intra-arteriolar deposition of immune complexes and retinal vasculitis, leading to severe visual loss following multiple intravitreal brolucizumab injections. Such a significant adverse event did not occur after the first intravitreal brolucizumab administration, as presented in some cases, but rather after the third. Therefore, unfortunately, it is not always possible to guarantee safety even if the patient has tolerated previous brolucizumab treatments without incidents. We suggest that ophthalmologists and retina specialists discuss thoroughly with patients the potential risks and benefits of therapy with brolucizumab and other anti-VEGF therapies. Patients treated with brolucizumab and other anti-VEGF therapy should be examined carefully and monitored closely for signs of inflammatory reaction in their anterior as well as posterior segments. Such reactions to the agent can occur not just after the first but also after subsequent intravitreal administrations of brolucizumab. Anti-inflammatory therapy may be considered depending on the presence or absence of active inflammation, the visual prognosis, and the overall status of and risks and benefits for the patient.\n\nPatient consent\nConsent has been obtained from the patient.\n\nFunding\nA Research to Prevent Blindness Department Challenge Award, a National Eye Institute of the National Institutes of Health P30 Award (EY026877), and an unrestricted educational grant from the Ocular Imaging Research and Reading Center (OIRRC), among others, have been awarded to the Byers Eye Institute at Stanford University.\n\nAuthorship\nAll authors attest that they met the current ICMJE criteria.\n\nDeclaration of competing interest\nThe authors declare that there are no conflicts of interest related to this manuscript.\n==== Refs\nReferences\n1 Hernandez-Pastor L.J. Ortega A. Garcia-Layana A. Giraldez J. Ranibizumab for neovascular age-related macular degeneration Am J Health Syst Pharm: Offc J Am Soc Health Sys Pharama 65 2008 1805 1814 \n2 Morris B. Imrie F. Armbrecht A.M. Dhillon B. Age-related macular degeneration and recent developments: new hope for old eyes? Postgrad Med 83 2007 301 307 \n3 Wong W.L. Su X. Li X. Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: a systematic review and meta-analysis Lancet Glob health 2 2014 e106 e116 25104651 \n4 Dugel P.U. Jaffe G.J. Sallstig P. Brolucizumab versus aflibercept in participants with neovascular age-related macular degeneration: a randomized trial Ophthalmology 124 2017 1296 1304 28551167 \n5 Dugel P.U. Koh A. Ogura Y. HAWK and HARRIER: phase 3, multicenter, randomized, double-masked trials of brolucizumab for neovascular age-related macular degeneration Ophthalmology 127 2020 72 84 30986442 \n6 Markham A. Brolucizumab: first approval Drugs 79 2019 1997 2000 31768932 \n7 American Society of Retina Specialists Beovu update for ASRS members https://www.asrs.org/clinical/clinical-updates Published February 23, 2020 and March 30, 2020 \n8 Holz F.G. Dugel P.U. Weissgerber G. Single-chain antibody fragment VEGF inhibitor RTH258 for neovascular age-related macular degeneration: a randomized controlled study Ophthalmology 123 2016 1080 1089 26906165 \n9 Dugel P.U. Expanded week 96 safety outcomes: analysis of pooled data from HAWK & HARRIER studies. Presented at the 2020 Meeting of the Macula Society, March 19 to 22, San Diego, California.\n10 Nguyen Q.D. Das A. Do D.V. Brolucizumab: evolution through preclinical and clinical studies and the implications for the management of neovascular age-related macular degeneration Ophthalmology 2020 [Epub ahead of print] \n11 Busbee B.G. Ho A.C. Brown D.M. Twelve-month efficacy and safety of 0.5 mg or 2.0 mg ranibizumab in patients with subfoveal neovascular age-related macular degeneration Ophthalmology 120 2013 1046 1056 23352196 \n12 Sepah Y.J. Sadiq M.A. Boyer D. Twenty-four-month outcomes of the ranibizumab for edema of the macula in diabetes - protocol 3 with high dose (READ-3) study Ophthalmology 123 2016 2581 2587 27707550 \n13 Heier J.S. Korobelnik J.F. Brown D.M. Intravitreal aflibercept for diabetic macular edema: 148-week results from the VISTA and VIVID studies Ophthalmology 123 2016 2376 2385 27651226 \n14 Kaiser P.K. Brown D.M. Zhang K. Ranibizumab for predominantly classic neovascular age-related macular degeneration: subgroup analysis of first-year ANCHOR results Am J Ophthalmol 144 2007 850 857 17949673 \n15 Mitchell P. McAllister I. Larsen M. Evaluating the impact of intravitreal aflibercept on diabetic retinopathy progression in the VIVID-DME and VISTA-DME studies Ophthalmol Retina 2 2018 988 996 31047501 \n16 Nguyen Q.D. Brown D.M. Marcus D.M. Ranibizumab for diabetic macular edema: results from 2 phase III randomized trials: RISE and RIDE Ophthalmology 119 2012 789 801 22330964 \n17 Heier J.S. Brown D.M. Chong V. Intravitreal aflibercept (VEGF trap-eye) in wet age-related macular degeneration Ophthalmology 119 2012 2537 2548 23084240 \n18 Data on File. Regeneron Pharmaceuticals, Inc. Tarrytown, NY 10591.\n19 Data on File. Internal Sales Data March 2020 Novartis Pharmaceuticals Corporation https://www.novartis.com\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2451-9936",
"issue": "18()",
"journal": "American journal of ophthalmology case reports",
"keywords": "Age-related macular degeneration; Brolucizumab; Intravitreal; Neovascular; Retinal occlusive vasculitis; Retinal vasculitis; Vaso-occlusion",
"medline_ta": "Am J Ophthalmol Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101679941",
"other_id": null,
"pages": "100687",
"pmc": null,
"pmid": "32280811",
"pubdate": "2020-06",
"publication_types": "D002363:Case Reports",
"references": "18796421;17488857;23352196;26906165;27651226;22330964;23084240;30986442;31047501;17949673;31768932;27707550;32107066;28551167;25104651",
"title": "Severe vision loss secondary to retinal arteriolar occlusions after multiple intravitreal brolucizumab administrations.",
"title_normalized": "severe vision loss secondary to retinal arteriolar occlusions after multiple intravitreal brolucizumab administrations"
} | [
{
"companynumb": "US-ROCHE-2640051",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "BEVACIZUMAB"
},
"drugadditional": null,
"dru... |
{
"abstract": "Posttransplant malignancy is one of the most important complications of organ transplantation. Immunosuppressive drugs, viral infections such as human herpes virus 8 or Epstein-Barr virus, exposure to carcinogenic factors such as sun, and host factors can be etiologic factors in the development of malignant disease. In this paper we report 2 cases of late posttransplant lymphoproliferative disorder with malign behavior.\n\n\nBACKGROUND\nNone declared.",
"affiliations": "Çukurova University Faculty of Medicine, Department of Nephrology, Adana, Turkey.;Çukurova University Faculty of Medicine, Department of Hematology, Adana, Turkey.;Çukurova University Faculty of Medicine, Department of Oncology, Adana, Turkey.;Çukurova University Faculty of Medicine, Department of Pathology, Adana, Turkey.;Çukurova University Faculty of Medicine, Department of Pathology, Adana, Turkey.;Çukurova University Faculty of Medicine, Department of Hematology, Adana, Turkey.;Çukurova University Faculty of Medicine, Department of Hematology, Adana, Turkey.",
"authors": "Paydaş|Saime|S|;Paydaş|Semra|S|;Balal|Mustafa|M|;Açıkalın|Arbil|A|;Ergin|Melek|M|;Gürkan|Emel|E|;Başlamışlı|Fikri|F|",
"chemical_list": null,
"country": "Turkey",
"delete": false,
"doi": "10.4274/Tjh.2012.0017",
"fulltext": "\n==== Front\nTurk J HaematolTurk J HaematolTJHTurkish Journal of Hematology1300-77771308-5263Galenos Publishing 10.4274/Tjh.2012.00171081Case ReportLate Onset Epstein Barr Virus Seropositive Posttransplant Lymphoproliferative Disorder in Two Renal Transplant Receivers Böbrek Nakli Alıcısı İki Hastada Geç Dönemde Gelişen Epstein Barr Virüs Seropozitif Lenfoproliferatif Hastalık Paydaş Saime 1*Paydaş Semra 3Balal Mustafa 2Açıkalın Arbil 4Ergin Melek 4Gürkan Emel 3Başlamışlı Fikri 31 \nÇukurova University Faculty of Medicine, Department of Nephrology, Adana, Turkey\n2 \nÇukurova University Faculty of Medicine, Department of Oncology, Adana, Turkey\n3 \nÇukurova University Faculty of Medicine, Department of Hematology, Adana, Turkey\n4 \nÇukurova University Faculty of Medicine, Department of Pathology, Adana, Turkey\n* Address for Correspondence: Çukurova University Faculty of Medicine, Department of Nephrology, 01330 Adana, Turkey Phone: +90 322 338 73 20 E-mail: serkupeli@yahoo.com9 2013 5 9 2013 30 3 315 320 5 2 2012 19 9 2012 © Turkish Journal of Hematology, Published by Galenos Publishing.\n\n2014This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Posttransplant malignancy is one of the most important complications of organ transplantation. Immunosuppressive drugs, viral infections such as human herpes virus 8 or Epstein-Barr virus, exposure to carcinogenic factors such as sun, and host factors can be etiologic factors in the development of malignant disease. In this paper we report 2 cases of late posttransplant lymphoproliferative disorder with malign behavior.\n\nConflict of interest:None declared.\n\nNakil sonrası dönemde malign hastalık gelişmesi organ naklinin en önemli komplikasyonlarından biridir. Malign hastalık gelişmesinde; immünsüpressif ilaçlar, human herpes virüs 8, Ebstein Barr virüs gibi viral enfeksiyonlar, güneşe maruz kalma ve kişiye ait özellikler etyolojik faktörler olarak sayılabilir. Burada nakil sonrası geç dönemde gelişen ve malign gidiş gösteren lenfoproliferatif hastalıklı iki olgu rapor edilmişti\n\nRenal transplantationLymphoproliferative disorderBurkitt lymphoma\n==== Body\nINTRODUCTION\nAfter cardiovascular complications and infections, malignancy is the third most common cause of death in renal transplant receivers (RTRs) [1,2,3]. Malignant disorders account for the 20% of deaths in RTRs every year and this rate increases to 30% in cases followed for more than 20 years [4]. Increase in some cytokines such as transforming growth factor beta, interleukin-10 and vascular endothelial growth factor; immunodeficiency against viral infections; and DNA injury are etiologic factors in the development of posttransplant malignancy [5]. In transplant patients, Kaposi sarcoma, non-melanoma skin cancers, and non-Hodgkin lymphoma are the most common cancers, and the risk of these cancers has been found to be increased by 20-fold as compared with the normal population. The risk of renal cancer is reported to be increased 15-fold and a 5-fold increase risk has been found for melanoma, leukemia, and hepatobiliary, cervical, and vulvovaginal cancer. Two-to 3-fold increases have been reported for testicular, bladder, colorectal, lung, prostate, stomach, esophagus, pancreas, ovarian, and breast cancers [5].\n\nCASE REPORT\nCase 1\n\nRenal transplantation after a short course of hemodialysis (HD) had been performed in a 22-year-old woman from her father in 1997. There was no severe complication in the early posttransplant period and she did not receive anti-thymocyte globulin (ATG) or high-dose corticosteroids. She had no hypertension and/or proteinuria and other complications. Drugs used in this case and the clinical outcome are summarized in Table 1. Calcineurin inhibitors (cyclosporin A [CysA] for 51 months and tacrolimus for 85 months), azathioprine at 100 mg/day, and corticosteroid at 4 mg daily for 4 years were used in the follow-up period. Corticosteroid administration was ceased when she was found to be positive for hepatitis C virus (HCV). At that time, her serum creatinine was 1.8 mg/dL and cyclosporine and azathioprine were substituted with tacrolimus and mycophenolate mofetil (MMF). In 2008 she wished to become pregnant and MMF was replaced by azathioprine. In the last year, she was receiving tacrolimus, and azathioprine. In December 2009, she was hospitalized due to fever, anemia, and thrombocytopenia. At this time, physical exam was negative except for the forearm cellulitis. Chest X-ray, abdominal ultrasonography and blood–urine cultures were found to be negative. Serologic tests for Salmonella, Brucella, human immunodeficiency virus, and cytomegalovirus (CMV) were found to be negative. Epstein-Barr virus (EBV) IgM was negative and EBV IgG was positive and HCV polymerase chain reaction was found to be positive. Piperacillin-tazobactam plus linezolid were prescribed but the fever continued. Bone marrow aspiration showed dysplastic changes and periodic acid Schiff (PAS)-negative blasts, which were compatible with acute lymphoblastic leukemia L3 or Burkitt cells. Histopathological bone marrow biopsy revealed post-transplant lymphoproliferative disease (PTLD), monomorphic PTLD, and Burkitt lymphoma (Figures 1a and 1b). There was diffuse infiltration of the bone marrow by monotonous, medium-sized cells with multiple nucleoli, basophilic cytoplasm, and numerous mitoses. Starry sky appearance was present. Immunohistochemically, Pax-5 was positive while terminal deoxynucleotidyl transferase (Tdt), CD3, and myeloperoxidase (MPO) were negative in tumor cells. Immunosuppressive drugs were ceased. Abdominopelvic magnetic resonance imaging (MRI) showed pelvic fluid and retroperitoneal lymph nodes. Unconsciousness developed and there was no evidence of nuchal rigidity, papillary stasis or lateralized neurologic findings. Cerebral MRI showed diffuse thickening and contrast uptake in the meningeal structures. Cytology of the lumbar puncture showed blastic infiltration. CODOX-M including cyclophosphamide, doxorubicin, vincristine, methotrexate, calcium folinate, granulocyte colony-stimulating factor, Ara-C and rituximab was prescribed, but uremia developed and HD was performed. Nevertheless, fever and hypotension developed and she died.\n\nCase 2 \n\nA 17-year-old male was admitted to our unit with end-stage renal failure. He had history of atrophic kidneysince he was 7 years old. The patient received renal transplantation from his father after 2 years of HD in 1997. There was no severe complication in the early post-transplant period and neither ATG nor high-dose corticosteroid was used. During follow-up he received prednisolone and CysA plus azathioprine. At the end of 2 years, there was increase in blood urea nitrogen (BUN) and creatinine levels, and edema developed. Renal biopsy showed vascular rejection. Prednisolone was given 500 mg/day for 5 days, but renal function did not improve and HD was initiated again. The transplanted kidney was removed due to abscess formation 5 years after transplantation and renal biopsy showed chronic rejection. He developed pneumonia and imaging revealed ascites, cardiomegaly, pericardial effusion and pulmonary interstitial infiltrations. There was evidence of left ventricular hypertrophy, mitral annular calcification, and left atrial dilatation at echocardiography. Peritoneal biopsy showed active chronic inflammation and mesothelial cell hyperplasia. Upper endoscopy showed gastroesophageal reflux disease, hiatal hernia and Barrett’s metaplasia. In 2005 the patient was hospitalized due to abdominal pain, nausea and vomiting. Paraaortic multiple conglomerate lymph nodes and splenomegaly were detected upon abdominopelvic CT. Biopsy taken by laparotomy was compatible with non-Hodgkin lymphoma–diffuse large B cell lymphoma. Diffuse proliferation of large lymphoid cells with vesicular nuclei containing fine chromatin and nucleoli were found. Some tumor cells had multilobated nuclei. Immunohistochemically, leukocyte common antigen and CD20 were found to be positive while CD30 and CD3 were negative. EBV-encoded ribonucleic acid (EBER) was negative by in situ hybridization (ISH); see Figures 2a, 2b, and 2c. Six cycles of rituximab-doxorubicin-cyclophosphamide-vincristine-prednisone (R-CHOP) were administered. After chemotherapy, complete remission was achieved. In 2006, chemotherapy was completed. In the follow-up period, CT examination was negative for lymphoma (Table 2). In 2009, cadaveric renal transplantation was performed. Low-dose ATG (1 mg/kg daily) was given for 5 days and then maintenance sirolimus (target level: 3-12) and MMF (2 g daily) plus prednisolone were prescribed. In the last visit in 2010, BUN was 18 mg/dL, creatinine 0.7 mg/dL, hemoglobin 16.2 g/dL, hematocrit 49.2%, white blood cell count 7.7x10.9/L, and daily proteinuria 30 mg/day. EBV IgG was positive and IgM was negative.\n\nDISCUSSION\nPTLD is 20-fold more common in patients receiving organ transplantation as compared with normal populations [5]. PTLD is related to viral infections, especially EBV [6]. EBV has a central role in the pathogenesis of PTLD [7,8,9], although not all PTLD is EBV-related. The most clearly defined risk factor for PTLD is primary EBV infection, which increases the risk for PTLD by 10- to 76-fold [10,11]. However, EBV positivity is not the rule. EBV-related viral disease and EBV-related malignant disease may develop with direct and indirect effects of the virus [12]. Fever, neutropenia, pneumonia, enteritis, meningitis, or encephalitis may develop secondary to the direct effects of the virus. Indirect effects of the immunomodulatory effect of the virus may cause increased risk of immune suppression and opportunistic infections via the secretion of cytokines, chemokines, or growth factors. Additionally, viral infections may change the surface antigen expression (for example, human leukocyte antigen) and provoke rejection reaction and/or contribute to oncogenesis with dysregulated cellular proliferation. Infection with one virus may stimulate the replication of other viruses (like CMV+HCV) or immunosuppression [13,14,15,16,17]. EBV positivity was present in both of our cases and HCV was present in one of them. The spectrum of disease ranges from benign polyclonal B cell infectious mononucleosis-like disease to malignant monoclonal lymphoma. The majority is of B cell origin, although T cell, NK-cell, and null cell tumors have been described. T cell PTLD has been demonstrated in 10% to 15% of cases, especially in the late transplant period; within allografts, it can be confused with graft rejection or other viral infections. Lymphomas comprise up to 15% of tumors among adult transplant recipients (51% in children), with mortality of up to 40% to 60%. Many deaths are associated with allograft failure after withdrawal of immune suppression during treatment of malignancy. Compared with lymphoma in the general population, PTLD has increased extranodal involvement, bad response to conventional therapies, and poorer outcomes. \n\nThe use of muromonab-CD3 or antithymocyte globulin seems to be associated with an increased risk of PTLD, especially in the first year [18,19]. In RTRs belatacept was associated with an increased incidence of PTLD [20]. Tacrolimus is commonly associated with an increased risk of malignancy compared to cyclosporine [18,19]. mTOR inhibitors might protect against the development of PTLD.\n\nPTLD includes a wide range of histopathology. Histopathological findings are important both for estimating the prognosis and treatment decision, and they have been classified in different ways. There are 4 groups [21]:\n\n1) Early lesions: reactive and plasmacytic hyperplasia, infectious mononucleosis-like.\n\n2) PTLD polymorphic: polyclonal (rare), monoclonal.\n\n3) PTLD monomorphic: B cell lymphoma (diffuse large B cell lymphoma, Burkitt/Burkitt-like lymphoma), plasma cell myeloma, T cell lymphoma (peripheral T cell lymphoma and other types). \n\n4) Other types (rare): Hodgkin disease-like lesions (associated with methotrexate therapy), plasmacytoma-like lesions.\n\nAccording to this classification, cases 1 and 2 were compatible with the third group.\n\nThe cessation or decreasing of the dose of immunosuppressive drug is efficient in two-thirds of cases of EBV-related PTLD. This possibility is low in cases with EBV-related conditions and develops in more than 1 year after transplantation. In these cases, there is a tendency for more malignant behavior. However, some cases may respond to the decreasing of immunosuppressive drug dosages, which should be considered in these cases [21]. \n\nIn our first case, B cell lymphoma developed 12 years after transplantation and the patient presented with anemia and thrombocytopenia. Bone marrow aspiration/biopsy and cerebrospinal fluid were found to be positive for malignant cells. HCV and EBV IgG positivity were present in this case and there was no evidence of HCV-related liver disease. Two viral infections may be responsible as the risk factor for both the rejection and the development of malignant disease. In our second case, Burkitt lymphoma was localized in the abdomen and serum EBV IgG was found to be positive. Tumor specimen was negative for EBER by ISH. In the first case, ISH for EBER was not done due to the acid exposure of the bone marrow specimen.\n\n The case 1 of the current study patient both tacrolimus and CysA and the second case received only CysA. Additionally, our first patient was receiving immunosuppressives while the lymphoma developed, while in our second case lymphoma was detected 5 years after the cessation of immunosuppressive drugs. Azathioprine was used in both cases and MMF was used in the first case during the pre-lymphoma period. MMF was found to be relatively safe for development of PTLD in early and late periods [18,19].\n\nIn both of our cases, lymphoma developed in the post-transplant later period. For this reason, prognosis was poor and it was necessary to use anti-neoplastic drugs for the treatment of lymphoma. In the first case, lymphoma developed while the patient was receiving immunosuppressives, and in second case, PTLD developed 5 years after the cessation of immunosuppressive drugs. The first patient was treated with immunosuppressives for 12 years, but the second patient received them for almost 2 years. In case 1, chemotherapy was started, but the patient died with complications. Patient 2 was treated by R-CHOP. After 2 years, complete remission was achieved and a second renal transplantation was performed. Calcineurin inhibitor was not used, while mTOR+MMF was given without any adverse event. In general, the longer the cancer-free interval before transplantation, the smaller the recurrence risk. For most malignant neoplasms, a period of 2 to 5 years is recommended [22]. Informed consent was obtained.\n\nIn conclusion, although ATG is the main drug accused in the development of PTLD, both of our 2 patients had not been treated with ATG. Lymphoma develops generally while patients are receiving immunosuppressive drug(s) and regression of PTLD has been reported with the cessation of immunosuppressives. However, high-grade lymphoma developed in both of our patients and they were treated with aggressive combination chemotherapy. \n\nCONFLICT OF INTEREST STATEMENT\nThe authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. \n\nTable 1 Clinical and laboratory findings of the first patient\nTable 2 Clinical outcome and therapy of the second patient\nFigure 1 Diffuse infiltration of the bone marrow bymonotonous, medium-sized cells with multiple nucleoli,basophilic cytoplasm, and numerous mitoses. Starry skyappearance is present. Immunohistochemically, Pax-5 waspositive; Tdt, CD3, and MPO were negative in tumor cells.a) Burkitt lymphoma tumor cells with numerous mitoses(hematoxylin, 400×); b) monotonous, medium-sized cellsdiffusely infiltrating bone marrow with starry sky appearance(hematoxylin, 100×).\nFigure 2 Diffuse large B cell lymphoma showingatypical large lymphoid cells with multilobated nuclei:a) hematoxylin–eosin, 100x; b) hematoxylin–eosin, 400x;c) tumor specimen CD20 positivity (immunohistochemistry400x).\n==== Refs\nReferences\n1 Howard RJ Patton PR Reed AI Hemming AW Pfaff WW Srinivas TR Scornik JC The changing causes of graft loss and death after kidney transplantation Transplantation 2002 73 1923 1928 12131689 \n2 Briggs JD Causes of death after renal transplantation Nephrol Dial Transplant 2001 16 1545 1549 11477152 \n3 Collins AJ Kasiske B Herzog C Chen SC Everson S Constantini E Grimm R McBean M Xue J Chavers B Matas A Manning W Louis T Pan W Liu J Li S Roberts T Dalleska F Snyder J Ebben J Frazier E Sheets D Johnson R Li S Dunning S Berrini D Guo H Solid C Arko C Daniels F Wang X Forrest B Gilbertson D St Peter W Frederick P Eggers P Agodoa L Excerpts from the United States Renal Data System 2003 Annual Data Report: atlas of end-stage renal disease in the United States Am J Kidney Dis 2003 42( Suppl 5) 1 230 \n4 Mahony JF Caterson RJ Coulshed S Stewart JH Sheil AG Twenty and 25 years survival after cadaveric renal transplantation Transplant Proc 1995 27 2154 2155 7792917 \n5 Wimmer CD Rentsch M Crispin A Illner WD Arbogast H Graeb C Jauch KW Guba M The janus face of immunosuppression - de novo malignancy after renal transplantation: the experience of the Transplantation Center Munich Kidney Int 2007 71 1271 1278 17332737 \n6 Liebowitz D Epstein-Barr virus and a cellular signaling pathway in lymphomas from immunosuppressed patients N Engl J Med 1998 338 1413 1421 9580648 \n7 Opelz G Henderson R Incidence of non-Hodgkin lymphoma in kidney and heart transplant recipients Lancet 1993 342 1514 1516 7902900 \n8 aya CV Fung JJ Nalesnik MA Kieff E Green M Gores G Habermann TM Wiesner PH Swinnen JL Woodle ES Bromberg JS Epstein-Barr virus-induced posttransplant lymphoproliferative disorders. ASTS/ASTP EBV-PTLD Task Force and The Mayo Clinic Organized International Consensus Development Meeting. Transplantation 1999 68 1517 1525 10589949 \n9 Preiksaitis JK Keay S Diagnosis and management of posttransplant lymphoproliferative disorder in solid-organ transplant recipients Clin Infect Dis 2001 33(Suppl 1) 38 46 \n10 Walker RC Marshall WF Strickler JG Wiesner RH Velosa JA Habermann TM McGregor CG Paya CV Pretransplantation assessment of the risk of lymphoproliferative disorder Clin Infect Dis 1995 20 1346 1353 7620022 \n11 Walker RC Paya CV Marshall WF Strickler JG Wiesner RH Velosa JA Habermann TM Daly RC McGregor CG Pretransplantation seronegative Epstein-Barr virus status is the primary risk factor for posttransplantation lymphoproliferative disorder in adult heart, lung, and other solid organ transplantations J Heart Lung Transplant 1995 14 214 221 7779838 \n12 Kotton CN Fishman JA Viral infection in the renal transplant recipient J Am Soc Nephrol 2005 16 1758 1774 15829710 \n13 Rubin RH The direct and indirect effects of infection in liver transplantation: pathogenesis, impact, and clinical management Curr Clin Top Infect Dis 2002 22 125 154 12520651 \n14 Ljungman P Beta-herpesvirus challenges in the transplant recipient J Infect Dis 2002 186(Suppl1) 99 109 \n15 Boeckh M Nichols WG Immunosuppressive effects of beta-herpesviruses Herpes 2003 10 12 16 12749798 \n16 Reinke P Prösch S Kern F Volk HD Mechanisms of human cytomegalovirus (HCMV) (re)activation and its impact on organ transplant patients Transpl Infect Dis 1999 1 157 164 11428986 \n17 Dockrell DH Paya CV Human herpesvirus-6 and -7 in transplantation Rev Med Virol 2001 11 23 36 11241800 \n18 Opelz G Döhler B Lymphomas after solid organ transplantation: a collaborative transplant study report Am J Transplant 2004 4 222 230 14974943 \n19 Robson R Cecka JM Opelz G Budde M Sacks S Prospective registry-based observational cohort study of the long-term risk of malignancies in renal transplant patients treated with mycophenolate mofetil Am J Transplant 2005 5 2954 2960 16303010 \n20 Durrbach A Pestana JM Pearson T Vincenti F Garcia VD Campistol J Rial Mdel C Florman S Block A Russo G Di Xing J Garg P Grinyó J A phase III study of belatacept versus cyclosporine in kidney transplants from extended criteria donors (BENEFIT-EXT study) Am J Transplant 2010 10 547 557 20415898 \n21 Kidney Disease: Improving Global Outcomes (KDIGO) Transplant Work Group KDIGO clinical practice guideline for the care of kidney transplant recipients Am J Transplant 2009 9(Suppl 3) 1 155 19133925 \n22 Knoll G Cockfield S Blydt-Hansen T Baran D Kiberd B Landsberg D Rush D Cole E Kidney Transplant Working Group of the Canadian Society of Transplantation Canadian Society of Transplantation consensus guidelines on eligibility for kidney transplantation CMAJ 2005 173 1181 1184 16275969\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1300-7777",
"issue": "30(3)",
"journal": "Turkish journal of haematology : official journal of Turkish Society of Haematology",
"keywords": "Burkitt lymphoma; Lymphoproliferative disorder; Renal transplantation",
"medline_ta": "Turk J Haematol",
"mesh_terms": null,
"nlm_unique_id": "9606065",
"other_id": null,
"pages": "315-20",
"pmc": null,
"pmid": "24385813",
"pubdate": "2013-09",
"publication_types": "D016428:Journal Article",
"references": "14655179;9580648;11428986;12520651;11477152;7902900;11241800;11389521;12353194;19845597;20415898;12749798;16275969;17332737;7792917;12131689;15829710;16303010;7779838;7620022;14974943;10589949",
"title": "Late onset epstein barr virus seropositive posttransplant lymphoproliferative disorder in two renal transplant receivers.",
"title_normalized": "late onset epstein barr virus seropositive posttransplant lymphoproliferative disorder in two renal transplant receivers"
} | [
{
"companynumb": "NVSC2019TR080162",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": "3",
"dru... |
{
"abstract": "Lithium can suppress sinus node function, especially when it is used concomitantly with carbamazepine. We describe a 42-year-old woman who took lithium and carbamazepine for manic-depressive psychosis and seizure disorders, and developed marked sinus node dysfunction. Drug screening showed a toxic serum lithium level of 3.38 mmol/L and a normal serum carbamazepine level of 22.1 mumol/L. An electrophysiologic study showed prolongation of the corrected sinus node recovery time (CSNRT) of up to 9,708 msec. After three sessions of hemodialysis, normal sinus rhythm was resumed. The serum lithium level was 0.1 mmol/L 2 weeks later, and the CSNRT shortened to 309 msec. Because the combination of lithium and carbamazepine in psychiatric patients is not uncommon, recognition of the potential complication of severe bradyarrhythmia is essential in the emergency care of such patients.",
"affiliations": "Department of Emergency Medicine, National Taiwan University Hospital, Taipei, Taiwan.",
"authors": "Lai|C L|CL|;Chen|W J|WJ|;Huang|C H|CH|;Lin|F Y|FY|;Lee|Y T|YT|",
"chemical_list": "D002220:Carbamazepine; D008094:Lithium",
"country": "Singapore",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0929-6646",
"issue": "99(1)",
"journal": "Journal of the Formosan Medical Association = Taiwan yi zhi",
"keywords": null,
"medline_ta": "J Formos Med Assoc",
"mesh_terms": "D000328:Adult; D002220:Carbamazepine; D005260:Female; D006801:Humans; D008094:Lithium; D012849:Sinoatrial Node",
"nlm_unique_id": "9214933",
"other_id": null,
"pages": "66-8",
"pmc": null,
"pmid": "10743351",
"pubdate": "2000-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Sinus node dysfunction in a patient with lithium intoxication.",
"title_normalized": "sinus node dysfunction in a patient with lithium intoxication"
} | [
{
"companynumb": "PHBS2000TW08141",
"fulfillexpeditecriteria": "1",
"occurcountry": "TW",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BETHANECHOL CHLORIDE"
},
"drugadditional": null,
... |
{
"abstract": "5-Flourouracil (5-FU) is an S-phase specific, synthetic pyrimidine antimetabolite. It is a frequently administered chemotherapeutic agent for a variety of malignant lesions, either singly or in multidrug regimens. Its adverse side effects involving bone marrow, skin, mucous membranes, GIT and CNS are well known, whereas its cardiotoxicity is relatively uncommon and occurs in 1.2-18%.",
"affiliations": "Sher-I Kashmir Institute of Medical Sciences, Srinagar, Kashmir.",
"authors": "Bhat|G M|GM|;Mir|M H|MH|;Showkat|H I|HI|;Kasanna|B|B|;Bagdadi|F|F|;Sarmast|A H|AH|;Qadri|S|S|",
"chemical_list": "D000964:Antimetabolites, Antineoplastic; D005472:Fluorouracil",
"country": "Kuwait",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2078-2101",
"issue": null,
"journal": "The Gulf journal of oncology",
"keywords": null,
"medline_ta": "Gulf J Oncolog",
"mesh_terms": "D000328:Adult; D000368:Aged; D000964:Antimetabolites, Antineoplastic; D005472:Fluorouracil; D006331:Heart Diseases; D006801:Humans; D008297:Male; D008875:Middle Aged",
"nlm_unique_id": "101500911",
"other_id": null,
"pages": "70-2",
"pmc": null,
"pmid": "22773220",
"pubdate": "2012-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "5-Flourouracil cardiotoxicity - an elusive cardiopathy: case report.",
"title_normalized": "5 flourouracil cardiotoxicity an elusive cardiopathy case report"
} | [
{
"companynumb": "PHHY2013IN113784",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FLUOROURACIL"
},
"drugadditional": null,
"dr... |
{
"abstract": "BACKGROUND\nParvovirus B19 (PVB19) infection has been implicated in allograft failure or dysfunction in solid organ transplantation (SOT) and allogeneic hematopoietic stem cell transplantation (allo-HSCT), but the literature is limited.\n\n\nMETHODS\nTwo pediatric patients were diagnosed with PVB19 infection around the time of allo-HSCT graft failure. Both cases were secondary graft failure and required second allo-HSCT.\n\n\nCONCLUSIONS\nThere are many risk factors and potential confounders in determining the exact etiology of graft failure after allo-HSCT. These two cases highlight the importance of including PVB19 in the diagnostic evaluation for graft failure. PVB19 infection may be an important risk factor for allo-HSCT graft failure.",
"affiliations": "Pediatric Blood and Marrow Transplantation Program, Texas Transplant Institute, Methodist Children's Hospital, San Antonio, Texas, USA.;Pediatric Blood and Marrow Transplantation Program, Texas Transplant Institute, Methodist Children's Hospital, San Antonio, Texas, USA.;Pediatric Blood and Marrow Transplantation Program, Texas Transplant Institute, Methodist Children's Hospital, San Antonio, Texas, USA.;Pediatric Blood and Marrow Transplantation Program, Texas Transplant Institute, Methodist Children's Hospital, San Antonio, Texas, USA.;Pediatric Blood and Marrow Transplantation Program, Texas Transplant Institute, Methodist Children's Hospital, San Antonio, Texas, USA.",
"authors": "Rattani|Nabila|N|;Matheny|Christina|C|;Eckrich|Michael J|MJ|;Madden|Lisa M|LM|;Quigg|Troy C|TC|https://orcid.org/0000-0002-5268-7938",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1002/cnr2.1403",
"fulltext": "\n==== Front\nCancer Rep (Hoboken)\nCancer Rep (Hoboken)\n10.1002/(ISSN)2573-8348\nCNR2\nCancer Reports\n2573-8348\nJohn Wiley and Sons Inc. Hoboken\n\n33932151\n10.1002/cnr2.1403\nCNR21403\nCase Report\nCase Report\nParvovirus B19‐associated graft failure after allogeneic hematopoietic stem cell transplantation\nRattani et al.\nRattani Nabila 1\nMatheny Christina 1\nEckrich Michael J. 1\nMadden Lisa M. 1\nQuigg Troy C. https://orcid.org/0000-0002-5268-7938\n1 2 troy.quigg@spectrumhealth.org\n\n1 Pediatric Blood and Marrow Transplantation Program Texas Transplant Institute, Methodist Children's Hospital San Antonio Texas USA\n2 Present address: Pediatric Blood and Marrow Transplantation Program, Helen DeVos Children's Hospital, 10th Floor MC185, 100 Michigan St. NE Grand Rapids Michigan MI 49503. USA\n* Correspondence\nTroy C. Quigg, Pediatric Blood and Marrow Transplantation Program, Texas Transplant Institute, Methodist Physician Practices, 4410 Medical Drive, Suite 410, San Antonio, TX 78229.\nEmail: Troy.Quigg@spectrumhealth.org\n\n01 5 2021\n1 2022\n5 1 10.1002/cnr2.v5.1 e140325 2 2021\n18 11 2020\n30 3 2021\n© 2021 The Authors. Cancer Reports published by Wiley Periodicals LLC.\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.\n\nAbstract\n\nBackground\n\nParvovirus B19 (PVB19) infection has been implicated in allograft failure or dysfunction in solid organ transplantation (SOT) and allogeneic hematopoietic stem cell transplantation (allo‐HSCT), but the literature is limited.\n\nCase\n\nTwo pediatric patients were diagnosed with PVB19 infection around the time of allo‐HSCT graft failure. Both cases were secondary graft failure and required second allo‐HSCT.\n\nConclusion\n\nThere are many risk factors and potential confounders in determining the exact etiology of graft failure after allo‐HSCT. These two cases highlight the importance of including PVB19 in the diagnostic evaluation for graft failure. PVB19 infection may be an important risk factor for allo‐HSCT graft failure.\n\nallogeneic hematopoietic stem cell transplantation\ngraft failure\nparvovirus B19 infection\nsource-schema-version-number2.0\ncover-dateJanuary 2022\ndetails-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.1.0 mode:remove_FC converted:25.01.2022\nRattani N , Matheny C , Eckrich MJ , Madden LM , Quigg TC . Parvovirus B19‐associated graft failure after allogeneic hematopoietic stem cell transplantation. Cancer Reports. 2022;5 :e1403. 10.1002/cnr2.1403\n\nParvovirus B19‐Associated Graft Failure after Allogeneic Hematopoietic Stem Cell Transplantation, 2020 TCT Tandem Meetings (ASTCT/CIBMTR), Orlando, Florida (Poster Session, 02/22/20) Biology of Blood and Marrow Transplantation, Volume 26, Issue 3, Supplement, S344, March 01, 2020.\n==== Body\npmc1 INTRODUCTION\n\nParvovirus B19 (PVB19) is a single‐stranded DNA virus that commonly infects young children and is self‐limited in immunocompetent individuals with symptoms ranging from characteristic “slapped cheek” rash, viral exanthem, flu‐like symptoms, arthralgias, and occasional pure red cell aplasia. 1 , 2 PVB19 has a predilection for erythroid progenitor cells which can result in pure red cell aplasia, but PVB19 has also been associated with transient aplastic crisis. 2 , 3 , 4 The exact mechanism of PVB19‐associated bone marrow failure is not fully understood. Literature suggests that PVB19 has ability to replicate more efficiently in the relatively more hypoxic bone marrow microenvironment, leading to viral‐induced bone marrow suppression. 3 While mild infection occurs in normal hosts, PVB19 infection in immunocompromised hosts has been associated with hepatitis, pneumonitis, myocarditis, chronic pure red cell aplasia, and allograft dysfunction after solid organ transplant (SOT) and allogeneic hematopoietic stem cell transplantation (allo‐HSCT). 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15\n\nPVB19‐associated bone marrow graft failure has been rarely reported after allo‐HSCT. 5 , 12 , 13 There are many risk factors and potential confounders in determining the exact etiology of graft failure after allo‐HSCT. Thorough evaluation for the etiology of graft failure is critical to optimize treatment and outcomes for patients. We describe two pediatric cases of PVB19‐associated graft failure after allo‐HSCT, adding to the limited existing literature and highlighting the importance of inclusion of PVB19 in the diagnostic evaluation of graft failure.\n\n2 CASE\n\n2.1 Patient 1\n\nA 1‐year‐old male with leukocyte adhesion deficiency (LAD) received reduced intensity conditioning followed by an HLA‐matched sibling bone marrow graft (Table 1). He achieved neutrophil and platelet engraftment by days +23 and +25, respectively. Day +29 chimerism was 100% donor unseparated (whole blood by STR analysis). The first signs of allograft dysfunction were at day +60 with reduction in percent donor engraftment (71% donor unseparated, 72% donor CD15+ myeloid, and 97% donor CD3+ lymphoid). He developed biopsy‐proven acute gastrointestinal graft‐versus‐host disease (GVHD) at day +77, responsive to systemic steroids. Evaluation for unexplained and persistent transfusion‐dependent normocytic normochromic anemia at day +88 revealed PVB19 by blood PCR (3900 copies/mL). In retrospect, he had history of intermittent and unexplained, non‐palpable, non‐specific blanching erythematous rash associated with crying (perceived pain) during the early post‐engraftment period. We suspect that the indolent rash and pain he experienced were likely early manifestations of PVB19 infection, which would have preceded the decrease in day +60 donor chimerism studies.\n\nTABLE 1 Summary of patient characteristics\n\n\tPatient 1\tPatient 2\t\nAge at allo‐HSCT (years)\t1\t13\t\nSex\tMale\tMale\t\nDiagnosis\tLeukocyte adhesion deficiency, Type 1\tAML CR1 (MRD negative)\t\nConditioning a\tReduced intensity\tMyeloablative\t\nConditioning regimen a\tAlemtuzumab\n\nFludarabine\n\nThiotepa\n\nMelphalan\n\n\tFludarabine\n\nBusulfan\n\n\t\nGraft source\tHLA‐Matched Sibling\n\nBone Marrow\n\n\tHaploidentical Sibling\n\nBone Marrow\n\n\t\nABO compatible\tYes\tYes\t\nGraft cell dosesa\t4.85 × 108 TNC/kg\n\n9.74 × 106 CD34+/kg\n\n\t3.6 × 108 TNC/kg\n\n4.51 × 106 CD34+/kg\n\n\t\nGVHD prophylaxis a\tTacrolimus\n\nMethotrexate\n\n\tPost‐transplant cyclophosphamide\n\nTacrolimus\n\nMycophenolate mofetil\n\n\t\nPVB19 blood PCR at diagnosis (copies/mL)\t3900 (Day +88)\t<500 (Day +40)\t\nPVB19 bone marrow PCR\tNot Done\tDetected\t\nGVHD and treatment a\tAcute GI GVHD\n\nMethylprednisolone\n\n\tAcute GI GVHD\n\nMethylprednisolone\n\n\t\nTransfusion‐dependent anemia at time of PVB19 diagnosis\tYes\tYes\t\nLowest Hgb level, (mg/dL)\t6.7\t6.5\t\nLeukopenia at time of PVB19 diagnosis\tNo (Autologous Recovery)\tYes (Aplastic)\t\nLowest WBC count at time of PVB19 diagnosis (×109 cells/L)\t5.5\t<0.1\t\nThrombocytopenia at time of PVB19 diagnosis\tYes\tYes\t\nNote: Allo‐HSCT, allogeneic hematopoietic stem cell transplantation; AML, acute myeloid leukemia; CR1, first complete remission; GI, gastrointestinal; GVHD, graft‐versus‐host disease; Hgb, hemoglobin; HLA, Human Leukocyte Antigen; MRD, minimal residual disease; PCR, polymerase chain reaction; PVB19, parvovirus B19; TNC, total nucleated cells; WBC, white blood cell.\n\na First allo‐HSCT descriptions or events.\n\nThe patient received intravenous immunoglobulin (IVIG) replacement at 0.5 g/kg monthly for IgG levels <400 mg/dL per routine post‐HSCT monitoring and care concurrent with detection of the PVB19 viremia (two doses administered). His IVIG replacement therapy overlapped the same time period that the PVB19 infection was recognized and subsequently cleared. Follow‐up PVB19 blood PCR was negative at day +102. At day +105, repeat blood chimerism studies decreased to 9% unseparated and 5% myeloid donor engraftment. Flow cytometry revealed repopulation of original LAD phenotype, confirming secondary graft failure. The patient had autologous immune recovery and his blood PVB19 PCRs remained negative. He received a second allo‐HSCT using myeloablative busulfan and cyclophosphamide followed by G‐CSF mobilized peripheral blood stem cells from the same donor at day +225 from his first allo‐HSCT. At the time of this report, Patient 1 is 23 months status post his second allo‐HSCT with no evidence of GVHD or underlying LAD. He remains 100% donor by unseparated, myeloid, and lymphoid chimerism. He has had no recurrence of PVB19 viremia following his second allo‐HSCT.\n\n2.2 Patient 2\n\nA 13‐year‐old male with high‐risk acute myeloid leukemia (AML) received myeloablative conditioning followed by a haploidentical sibling bone marrow graft (Table 1). He achieved neutrophil engraftment by day +16, but never achieved platelet engraftment. Patient 2 had a non‐specific blanching rash with bone pain during the peri‐engraftment period. He developed cytomegalovirus (CMV) viremia and was treated and resolved with ganciclovir and valganciclovir early post‐HSCT. Day +26 chimerism was 89% donor unseparated and 100% donor myeloid. Bone marrow exam on day +40 showed mixed chimerism, no recurrent AML, but detectable PVB19 by qualitative PCR. Blood PVB19 PCR on day +40 was positive (<500 copies/mL). IVIG 1 g/kg was administered for empiric treatment on day +43. The patient was diagnosed with secondary graft failure with persistent severe transfusion‐dependent pancytopenia. Repeat blood PVB19 PCRs remained positive at days +52 and +61 (312 and 384 copies/mL, respectively). IVIG 1 g/kg was repeated on day +61. Given the severity of his pancytopenia and associated high risk for other opportunistic infections, we rapidly proceeded with a second allo‐HSCT. Blood PVB19 PCR at day +69 (day prior to second allo‐HSCT) remained positive (322 copies/mL).\n\nHe received a rescue allo‐HSCT from the same donor with G‐CSF mobilized peripheral blood stem cells following nonmyeloablative conditioning with fludarabine, cyclophosphamide and 400 cGy TBI. Patient 2 achieved neutrophil and platelet engraftment after second allo‐HSCT at days +15 and + 33, respectively, with 100% donor engraftment by unseparated and lineage‐specific chimerism analysis. His second allo‐HSCT course was complicated by acute gastrointestinal GVHD that resolved with low dose systemic steroids (0.5 mg/kg/day) and extracorporeal photopheresis (ECP), as steroid‐sparing therapy. PVB19 blood PCRs remained positive at low levels until a single negative PCR resulted at day +54 after second allo‐HSCT. At day +68, his blood PVB19 PCR was again detected (<199 copies/mL) and persisted at this level until day +166 when viral loads began to increase (96 400 copies/mL). By day +174 after second allo‐HSCT, he was readmitted with unexplained fever and found to have a PVB19 PCR viral load of 1.38 × 1010 copies/mL. He was given IVIG 1 g/kg daily × 3 consecutive days, fevers resolved, and was discharged home. PVB19 viral loads began to decline the week following IVIG treatment (2.4 million copies/mL) and the patient was maintained on monthly IVIG 0.5 g/kg until he had evidence of T‐ and B‐cell immune reconstitution 8 months later. Over a course of 12 months, his blood PVB19 PCRs declined to a low level of detection (<199 copies/mL) but were never negative. With documented immune recovery, response to vaccinations, and no evidence of residual cytopenias or graft dysfunction, blood PVB19 PCR surveillance was stopped. At the time of this report, Patient 2 is 26 months status post his second allo‐HSCT, without evidence of recurrent AML or chronic GVHD, and remains 100% donor across all chimerism studies.\n\n3 DISCUSSION\n\nPVB19 infection is a rarely reported complication following SOT or allo‐HSCT. Cases of allograft loss or dysfunction have been reported following SOT and allo‐HSCT, but the literature is limited. The two cases described in this case report add to existing rare reports of PVB19‐associated graft failure after allo‐HSCT. 5 , 12 , 13\n\nThe first report of PVB19 infection after renal transplantation was published in 1986. 7 PVB19 infection was implicated in a series reporting five pediatric SOT recipients who developed anemia and reticulocytopenia. 11 Significantly, PVB19 infection has been associated with allograft loss or dysfunction after SOT. 5 , 8 , 9 , 10 , 11 , 12 , 13 , 14\n\nRare cases of PVB19 infection during allo‐HSCT have been reported in the literature. One case described a 14‐year‐old girl with acute promyelocytic leukemia who had abrupt onset pure red cell aplasia induced by PVB19 after an HLA‐matched bone marrow transplant. 12 In another case report, a 38‐year‐old male was admitted with severe pancytopenia and multi‐organ failure with PVB19 infection that occurred 1 year post T‐cell depleted bone marrow transplantation from a matched unrelated donor for refractory chronic lymphocytic leukemia. 13 Such cases demonstrate that PVB19 infection can lead to more severe disease in allo‐HSCT recipients.\n\nAllograft loss or dysfunction can be a devastating and life‐threatening complication of SOT or allo‐HSCT. In a systematic review of the literature summarizing cases of PVB19 infection after SOT (n = 74) and allo‐HSCT (n = 24), allograft loss or dysfunction occurred in 10.4% of patients. 5 The majority of PVB19 (70%) occurred in the first 6 months after transplantation. Co‐infection with CMV and human herpesvirus 6 were found in 1% of cases, respectively. While the authors confirmed that serological tests are insufficient for diagnosis of PVB19 infection in immunocompromised patients (29% were negative), 96% were positive by PCR.\n\nWe report two cases of diagnosed PVB19 infection and secondary graft failure after allo‐HSCT. Recognition of PVB19 infection as a possible risk factor for graft failure is important for diagnostic consideration. Anemia in the early post‐HSCT period is expected and unless other symptoms or complications develop, PVB19 is rarely considered. Allo‐HSCT patients may not manifest with typical rash and joint pain due to an inadequate immune response or when symptoms are present, those symptoms are often attributed to donor cell engraftment. One report described two cases of erythematous rash in two PVB19 positive immunocompromised patients early after allo‐HSCT. 15 Both patients described in this case report had similar histories of non‐specific rash and pain in the post‐engraftment period that may have been indolent manifestations of PVB19 infection. Persistent hypoproliferative transfusion‐dependent anemia led to PVB19 evaluation and diagnosis in patient 1 and preceded secondary graft failure. Patient 1's clinical course led our team to test for PVB19 infection in patient 2 who suffered earlier and life‐threatening secondary graft failure with resultant aplastic anemia.\n\nRecipients of SOT and allo‐HSCT are at risk for PVB19 infection due to poor immune globulin production and T‐cell function during the post‐transplant period and while on immune‐suppressing therapies. Intravenous immune globulin (IVIG) is considered the only treatment option for PVB19 infection. IVIG treatment targets associated anemia, not fulminant graft failure or dysfunction, and there is significant risk for relapse of anemia. 5 , 11 , 13 High‐dose IVIG is a source of neutralizing autoantibodies as the majority of the adult population has anti‐B19 antibodies and the treatment effects are evidenced by rise in reticulocyte count and corresponding rise in the hemoglobin level. 4 IVIG has also been utilized to treat chronic pure red cell aplasia caused by persistent PVB19 infection in HIV‐infected patients. 16 , 17 Both patients described in this report received IVIG around the time of initial PVB19 infections. Patient 1 was receiving replacement IVIG (0.5 g/kg) for acquired hypogammaglobulinemia concurrent with the timeline of his PVB19 infection. The secondary graft failure ensued in Patient 1, but the patient had autologous blood count and immune recovery. IVIG was administered at higher doses earlier in the diagnosis of graft failure in Patient 2, but there was no appreciable improvement in his pancytopenia leading to urgent rescue allo‐HSCT. When PVB19 viremia recurred after Patient 2's second allo‐HSCT, we administered high‐dose IVIG comparable to reports in HIV‐treated patients. 16 , 17 As discussed, fevers resolved, viral loads improved, and there were no concerns for graft loss. Based on the observations in this report, we hypothesize that primary PVB19 infection at earlier timepoints after allo‐HSCT may be more impactful on graft failure or dysfunction than reactivations or infections that occur later in the post‐HSCT period. However, additional data are needed to elucidate the mechanisms and associated kinetics of PVB19‐associated graft failure after allo‐HSCT.\n\nThere are many potential risk factors and confounders for graft failure after allo‐HSCT such as underlying disease, type of conditioning, graft source and infused cell doses, infections (pre‐ and post‐allo‐HSCT), and drug toxicities. These potential confounders could limit the association of PVB19 infection and graft failure. Patient 1 in our report received reduced intensity conditioning but had no other identifiable risk factors for graft failure. Patient 2 received a haploidentical graft, had low level CMV viremia, and received ganciclovir and valganciclovir in the early post‐engraftment period; all potential contributors to graft failure. Although we cannot exclude the potential impact of CMV viremia and drug‐induced toxicity in Patient 2 on graft failure, he received his second allo‐HSCT from the same sibling haploidentical donor and engrafted without incident. The only unifying feature of graft failure between our two cases was PVB19 infection occurring early after first allo‐HSCT.\n\nIn this report, we describe two cases of PBV19 infection associated with secondary graft failure after allo‐HSCT. These cases add to the limited existing literature and highlight the importance of including PVB19 infection in the diagnostic evaluation for graft failure after allo‐HSCT. Quantitative PCR for PVB19 should be incorporated into comprehensive infectious and immunological testing to evaluate etiology of graft failure after allo‐HSCT. IVIG may be beneficial in the management of patients with PVB19 infection after allo‐HSCT but is unlikely to reverse fulminant graft failure occurring early after allo‐HSCT.\n\nCONFLICT OF INTEREST\n\nThe authors have stated explicitly that there are no conflicts of interest in connection with this article.\n\nAUTHOR CONTRIBUTIONS\n\nNabila Rattani: Conceptualization; writing‐original draft; writing‐review & editing. Christina Matheny: Conceptualization; writing‐original draft; writing‐review & editing. Michael Eckrich: Conceptualization; writing‐original draft; writing‐review & editing. Lisa Madden: Conceptualization; writing‐original draft; writing‐review & editing. Troy Quigg: Conceptualization; supervision; writing‐original draft; writing‐review & editing.\n\nETHICAL STATEMENT\n\nNo institutional review board approval was required as retrospective review of two patient cases for publication is not considered human subjects' research consistent with US Federal Policy for the Protection of Human Subjects. Therefore, no patient consent was required.\n\nACKNOWLEDGEMENTS\n\nThe cases were submitted as an abstract and accepted for poster presentation at the CIBMTR/ASTCT 2020 Meeting in Orlando, Florida. Erica Garcia‐Frausto, DNP participated in the care of the patients reported and contributed to the original abstract that was accepted for poster presentation but did not contribute to the manuscript.\n\nDATA AVAILABILITY STATEMENT\n\nThe data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.\n==== Refs\nREFERENCES\n\n1 Brown KE , Young NS . Parvoviruses and bone marrow failure. Stem Cells. 1996;14 (2 ):151‐163.8991535\n2 Young NS , Brown KE . Parvovirus B19. N Engl J Med. 2004;350 (6 ):586‐597.14762186\n3 Chen AY , Kleiboeker S , Qiu J . Productive parvovirus B19 infection of primary human erythroid progenitor cells at hypoxia is regulated by STAT5A and MEK signaling but not HIFα. PLoS Pathog. 2011;7 (6 ):e1002088.21698228\n4 Wąsak‐Szulkowska E , Grabarczyk P , Rzepecki P . Pure red cell aplasia due to parvovirus B19 infection transmitted probably through hematopoietic stem cell transplantation. Transpl Infect Dis. 2008;10 (3 ):201‐205.17631000\n5 Eid AJ , Brown RA , Patel R , Razonable RR . Parvovirus B19 infection after transplantation: a review of 98 cases. Clin Infect Dis. 2006;43 (1 ):40‐48.16758416\n6 Schleuning M , Jäger G , Holler E , et al. Human parvovirus B19‐associated disease in bone marrow transplantation. Infection. 1999;27 (2 ):114‐117.10219641\n7 Neild G , Anderson M , Hawes S , Colvin BT . Parvovirus infection after renal transplant. Lancet. 1986;328 (8517 ):1226‐1227.\n8 Broliden K . Parvovirus B19 infection in pediatric solid‐organ and bone marrow transplantation. Pediatr Transplant. 2001;5 (5 ):320‐330.11560750\n9 Eid AJ , Posfay‐Barbe KM . Parvovirus B19 in solid organ transplant recipients. Am J Transplant. 2009;9 (s4 ):S147‐50.20070674\n10 Geetha D , Zachary JB , Baldado HM , Kronz JD , Kraus ES . Pure red cell aplasia caused by parvovirus B19 infection in solid organ transplant recipients: a case report and review of literature. Clin Transplant. 2000;14 (6 ):586‐591.11127313\n11 Bakr Nour MG , Michaels M , Reyes J , et al. Parvovirus B19 infection in pediatric transplant patients. Transplantation. 1993;56 (4 ):835.8212203\n12 Niitsu H , Takatsu H , Miura I , et al. Pure red cell aplasia induced by B19 parvovirus during allogeneic bone marrow transplantation. [Rinsho Ketsueki] Jpn J Clin Hematol. 1990;31 (9 ):1566‐1571.\n13 Klümpen HJ , Petersen EJ , Verdonck LF . Severe multiorgan failure after parvovirus B19 infection in an allogeneic stem cell transplant recipient. Bone Marrow Transplant. 2004;34 (5 ):469‐470.15258560\n14 Yango A Jr , Morrissey P , Gohh R , Wahbeh A , Monaco A . Donor‐transmitted parvovirus infection in a kidney transplant recipient presenting as pancytopenia and allograft dysfunction. Transplant Infect Dis. 2002;4 (3 ):163‐166.\n15 Muetherig A , Christopeit M , Müller LP , et al. Human parvovirus B19 infection with GvHD‐like erythema in two allogeneic stem cell transplant recipients. Bone Marrow Transplant. 2007;39 (5 ):315‐316.17311086\n16 Frickhofen N , Abkowitz JL , Safford M , et al. Persistent B19 parvovirus infection in patients infected with human immunodeficiency virus type 1 (HIV‐1): a treatable cause of anemia in AIDS. Ann Intern Med. 1990;113 (12 ):926‐933.2173460\n17 Koduri PR , Kumapley R , Valladares J , Teter C . Chronic pure red cell aplasia caused by parvovirus B19 in AIDS: use of intravenous immunoglobulin—a report of eight patients. Am J Hematol. 1999;61 (1 ):16‐20.10331506\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2573-8348",
"issue": null,
"journal": "Cancer reports (Hoboken, N.J.)",
"keywords": "allogeneic hematopoietic stem cell transplantation; graft failure; parvovirus B19 infection",
"medline_ta": "Cancer Rep (Hoboken)",
"mesh_terms": null,
"nlm_unique_id": "101747728",
"other_id": null,
"pages": "e1403",
"pmc": null,
"pmid": "33932151",
"pubdate": "2021-05-01",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Parvovirus B19-associated graft failure after allogeneic hematopoietic stem cell transplantation.",
"title_normalized": "parvovirus b19 associated graft failure after allogeneic hematopoietic stem cell transplantation"
} | [
{
"companynumb": "US-OTSUKA-2020_003004",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BUSULFAN"
},
"drugadditional": "3",
"dr... |
{
"abstract": "Prenatal diagnosis of placenta increta and percreta is essential to avoid potentially life-threatening hemorrhage by optimizing peripartal management. Invasive placentation presents significant challenges at cesarean section even for highly skilled surgeons. In the four cases of placenta increta/percreta presented here we tried to avoid hysterectomy by leaving the placenta behind and tried to accelerate regression of placental tissue by administering methotrexate. The outcome in each of the four women was different, but no major bleeding occurred in any of the cases. Close follow-up for many weeks is mandatory.",
"affiliations": "Department of Obstetrics and Gynecology, Innsbruck Medical University, Innsbruck, Austria. angela.ramoni@uki.at",
"authors": "Ramoni|Angela|A|;Strobl|Eva-Maria|EM|;Tiechl|Johanna|J|;Ritter|Magdalena|M|;Marth|Christian|C|",
"chemical_list": "D008727:Methotrexate",
"country": "United States",
"delete": false,
"doi": "10.1111/aogs.12079",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0001-6349",
"issue": "92(4)",
"journal": "Acta obstetricia et gynecologica Scandinavica",
"keywords": null,
"medline_ta": "Acta Obstet Gynecol Scand",
"mesh_terms": "D000328:Adult; D002585:Cesarean Section; D003131:Combined Modality Therapy; D004621:Embolization, Therapeutic; D005260:Female; D006801:Humans; D008727:Methotrexate; D010920:Placenta; D010921:Placenta Accreta; D006473:Postpartum Hemorrhage; D011247:Pregnancy; D016896:Treatment Outcome; D055815:Young Adult",
"nlm_unique_id": "0370343",
"other_id": null,
"pages": "468-71",
"pmc": null,
"pmid": "23330969",
"pubdate": "2013-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Conservative management of abnormally invasive placenta: four case reports.",
"title_normalized": "conservative management of abnormally invasive placenta four case reports"
} | [
{
"companynumb": "AT-PFIZER INC-2016585581",
"fulfillexpeditecriteria": "1",
"occurcountry": "AT",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "AMOXICILLIN\\CLAVULANIC ACID"
},
"drugadditio... |
{
"abstract": "BACKGROUND Associated Liver Partition and Portal vein ligation with Staged hepatectomy (ALPPS) leads to rapid hepatic hypertrophy and decreases incidence of post-hepatectomy liver failure in patients with a marginal future liver remnant. Various procedural ALPPS modifications were previously described. Here, we present the first case of a new ALPPS modification, carrying out a left hepatic trisectionectomy with segment 1. CASE REPORT We present the case of a 36-year-old woman with locally advanced sigmoid adeno-carcinoma and extensive left liver metastases extending to segment V and VIII, who received state-of-the-art systemic conversion chemotherapy. Preoperative CT volumetric scan demonstrated a FLR/TLV (Future Liver Remnant/Total Liver Volume) of 22%. A left hepatic trisectionectomy procedure was conducted using our new ALPPS modification. Sufficient hepatic hypertrophy of FLR was reached with a volume increase of 100%. The period between the 2 stages was 7 days. The patient underwent left trisectionectomy and left colectomy with tumor-free margins. All dissected lymph nodes were tumor-negative. The surgical intra- and postoperative course was uneventful. Medically, the patient acquired an Acinetobacter infection, with severe sepsis and acute renal injury. After 3 dialysis sessions, the renal function recovered completely. Afterwards, the patient recovered slowly, and reintroduction ambulation and oral feeding was prolonged. Later on, the patient received Xeloda 1500 mg twice daily as adjuvant chemotherapy. CONCLUSIONS The new ALPPS modification leads to a sufficient hypertrophy of FRL within 1 week, allowing left hepatic trisectionectomy with tumor-free FRL. Despite the challenging complications, the new ALPPS modification might represent an alternative procedure for use when the classic ALPPS procedure is not applicable. Further studies are required.",
"affiliations": "Department of Hepatobiliary and Transplant Surgery, Jordan Hospital, Amman, Jordan.;Department of Hepatology, Gastroenterology and Hepatobiliary/Transplant Unit, Jordan Hospital, Amman, Jordan.;Department of Surgery, Jordan Hospital, Amman, Jordan.",
"authors": "Obed|Aiman|A|;Jarrad|Anwar|A|;Bashir|Abdalla|A|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.12659/ajcr.901265",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1941-5923",
"issue": "17()",
"journal": "The American journal of case reports",
"keywords": null,
"medline_ta": "Am J Case Rep",
"mesh_terms": "D000230:Adenocarcinoma; D000328:Adult; D000792:Angiography; D005260:Female; D005500:Follow-Up Studies; D006498:Hepatectomy; D006801:Humans; D008026:Ligation; D008113:Liver Neoplasms; D008279:Magnetic Resonance Imaging; D009367:Neoplasm Staging; D011169:Portal Vein; D014057:Tomography, X-Ray Computed; D014656:Vascular Surgical Procedures",
"nlm_unique_id": "101489566",
"other_id": null,
"pages": "759-765",
"pmc": null,
"pmid": "27756893",
"pubdate": "2016-10-19",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "26056475;25712199;7882785;22330038;26417845;24383035;24947768;23690242;25515978;26630386;27030243;25072445;22895352;24866543;24420797;23468045;27311006;22895353;26561404;25387325;25350653;23188224;22842130",
"title": "First Left Hepatic Trisectionectomy Including Segment One with New Associated Liver Partition and Portal Vein Ligation with Staged Hepatectomy (ALPPS) Modification: How To Do It?",
"title_normalized": "first left hepatic trisectionectomy including segment one with new associated liver partition and portal vein ligation with staged hepatectomy alpps modification how to do it"
} | [
{
"companynumb": "PHHY2016JO174689",
"fulfillexpeditecriteria": "1",
"occurcountry": "JO",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEUCOVORIN CALCIUM"
},
"drugadditional": "3",
... |
{
"abstract": "Cardiovascular dysfunction is the main manifestation of β-blocker intoxication; however, respiratory manifestations have rarely been reported.\nA 41-year-old man, who had ingested 300 mg carvedilol in a suicide attempt, was transferred to our emergency department. The patient had wheezing on arrival; however, he had no known history of bronchial asthma. In the absence of signs of heart failure, we gave the patient inhaled procaterol, a short-acting β2 agonist. The wheezing disappeared approximately 60 h after carvedilol ingestion and did not recur thereafter.\nWe report a case of wheezing caused by carvedilol intoxication. Although rare, clinicians should recognize that wheezing or bronchospasm can develop following β-blocker intoxication, for which a short-acting β2 agonist could be indicated.",
"affiliations": "Emergency and Critical Care Center Kurashiki Central Hospital Okayama Japan.;Emergency and Critical Care Center Kurashiki Central Hospital Okayama Japan.;Emergency and Critical Care Center Kurashiki Central Hospital Okayama Japan.",
"authors": "Nakanishi|Misuzu|M|;Kuriyama|Akira|A|https://orcid.org/0000-0001-5738-4031;Onodera|Mutsuo|M|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1002/ams2.475",
"fulltext": "\n==== Front\nAcute Med SurgAcute Med Surg10.1002/(ISSN)2052-8817AMS2Acute Medicine & Surgery2052-8817John Wiley and Sons Inc. Hoboken 10.1002/ams2.475AMS2475Case ReportCase ReportsPersistent wheezing caused by carvedilol overdose in a non‐asthmatic man Wheeze caused by carvedilol overdoseM. Nakanishi et al.Nakanishi Misuzu \n1\nKuriyama Akira https://orcid.org/0000-0001-5738-4031\n1\nak13568@kchnet.or.jp Onodera Mutsuo \n1\n\n1 \nEmergency and Critical Care Center\nKurashiki Central Hospital\nOkayama\nJapan\n* Corresponding: Akira Kuriyama, MD, MPH, Emergency and Critical Care Center, Kurashiki Central Hospital, 1‐1‐1 Miwa Kurahsiki Okayama 710‐8602, Japan. E‐mail: ak13568@kchnet.or.jp.\n14 12 2019 Jan-Dec 2020 7 1 10.1002/ams2.v7.1e47513 9 2019 04 11 2019 16 11 2019 © 2019 The Authors. Acute Medicine & Surgery published by John Wiley & Sons Australia, Ltd on behalf of Japanese Association for Acute Medicine.This is an open access article under the terms of the http://creativecommons.org/licenses/by-nc/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.Background\nCardiovascular dysfunction is the main manifestation of β‐blocker intoxication; however, respiratory manifestations have rarely been reported.\n\nCase Presentation\nA 41‐year‐old man, who had ingested 300 mg carvedilol in a suicide attempt, was transferred to our emergency department. The patient had wheezing on arrival; however, he had no known history of bronchial asthma. In the absence of signs of heart failure, we gave the patient inhaled procaterol, a short‐acting β2 agonist. The wheezing disappeared approximately 60 h after carvedilol ingestion and did not recur thereafter.\n\nConclusion\nWe report a case of wheezing caused by carvedilol intoxication. Although rare, clinicians should recognize that wheezing or bronchospasm can develop following β‐blocker intoxication, for which a short‐acting β2 agonist could be indicated.\n\nWe report a case of wheezing caused by carvedilol intoxication. Although rare, clinicians need to recognize that wheezing or bronchospasm can develop following β‐blocker intoxication, for which a short‐acting β2 agonist could be indicated.\n\n\nβ‐blockerbronchospasmcarvedilolprocaterolwheezing source-schema-version-number2.0cover-dateJanuary/December 2020details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:5.7.5 mode:remove_FC converted:21.01.2020\nFunding information\n\n\nNo funding information provided.\n==== Body\nIntroduction\nCarvedilol is a non‐selective β‐adrenergic blocker with an α‐adrenergic‐receptor blocking effect. It is widely used to treat ischemic heart disease, atrial fibrillation, and chronic heart failure.1 Intoxication of β‐blockers mainly manifests as cardiovascular dysfunction, but respiratory manifestations have rarely been reported. Here, we report a case of a 41‐year‐old man who ingested 300 mg carvedilol in a suicide attempt and developed wheezing that persisted for approximately 60 h. He was treated with a short‐acting β2 agonist (SABA).\n\nCase Presentation\nA 41‐year‐old man was transferred to our emergency department (ED) with a deteriorated level of consciousness. The patient had a cardiac resynchronization therapy defibrillator implanted for dilated cardiomyopathy 8 years prior and was treated with paroxetine for major depression. He did not have underlying bronchial asthma or episodes of acute exacerbation of cardiac failure. The patient’s family reported that he had ingested 300 mg carvedilol and 7 mg lorazepam, which were his usual medications, along with alcohol, in a suicide attempt after a quarrel with his mother 8 h before arriving at the hospital.\n\nThe patient’s vital signs on arrival to the ED were as follows: blood pressure, 72/44 mmHg; pulse, 90 b.p.m.; respiratory rate, 26 breaths/min; oxygen saturation, 80% on ambient air; and Glasgow Coma Scale score 13 (E3V4M6). On physical examination, the wheezing was audible with normal cardiac sounds. Arterial blood gas analysis under 5‐L facial mask oxygen showed mild respiratory acidosis (pH 7.32; PaO2, 92.1 mmHg; PaCO2, 52.0 mmHg; and HCO3, 26.2 mmol/L). The level of B‐type natriuretic peptide was 9.3 pg/mL and other laboratory examinations were within the normal limits. Chest X‐ray showed no infiltrate or cardiac enlargement (Fig. 1). The electrocardiogram showed sinus rhythm followed by ventricular pacing (Fig. 2). We suspected that the hypotension was due to hypovolemia, because ultrasonography showed a collapsed inferior vena cava and the blood pressure increased to 90 mmHg following administration of 500 mL fluid.\n\nFigure 1 Chest X‐ray showing no cardiac enlargement or pulmonary edema in a 41‐year‐old man with persistent wheezing caused by carvedilol overdose.\n\nFigure 2 Electrocardiogram of a 41‐year‐old man with persistent wheezing caused by carvedilol overdose, showing sinus rhythm followed by ventricular pacing.\n\nThe wheezing and hypoxia persisted, requiring oxygen supplementation. The patient was admitted to our intensive care unit for continued monitoring of respiratory status. Cardiac ultrasonography showed reasonable left ventricular contraction (ejection fraction rate of 45–50%) and respiratory collapse of the inferior vena cava, indicating a hypovolemic status. In the absence of a known diagnosis of bronchial asthma, we suspected that the wheezing or bronchospastic reaction was triggered by carvedilol. The patient was treated with inhaled procaterol hydrochloride hydrate on demand in addition to activated charcoal. The patient’s mental status normalized on day 2. The wheezing and hypoxia gradually improved and disappeared by the morning of day 3. The course of the hospital stay was uneventful without bradycardia or hypotension, and the patient was discharged on day 5. Because there has been no recurrence of wheezing for 2 years, a diagnosis of wheezing caused by carvedilol intoxication was supported.\n\nDiscussion\nCarvedilol is a non‐selective beta‐adrenergic (β1, β2) blocker with an alpha (α1) adrenergic receptor blocking effect that is used to treat hypertension, ischemic heart disease, atrial fibrillation, and chronic heart failure.1, 2 Carvedilol is lipophilic, and approximately 25–35% of the oral dose is bioavailable; its half‐life ranges from 7 to 10 h following oral administration.2\n\n\nTheoretically, β‐blockers could induce bronchial smooth muscle contraction or bronchospasm and might thereby exacerbate bronchial asthma. Non‐selective β‐blockers might induce bronchospasm, reduced airway conductance, and forced expiratory volume within a second, which can exacerbate bronchial asthma and chronic obstructive lung disease.3, 4 However, to the best of our knowledge, there is no evidence suggesting that β‐blockers induce bronchospasm or bronchial asthma in non‐asthmatic individuals.\n\nThe primary manifestations of β‐blocker intoxication include cardiovascular dysfunctions such as bradycardia, hypotension, and cardiac arrest, and miscellaneous symptoms such as vomiting, seizures, change in mental status, hypokalemia, and hypoglycemia.5, 6 In the present case, the patient had an altered mental status, hypotension, and wheezing. The deteriorated level of consciousness could be attributed to the co‐ingestion of alcohol and benzodiazepines. The hypotension was attributed to the hypovolemic status or dehydration secondary to alcohol intake, as it immediately resolved following fluid administration. The patient did not develop bradycardia or it was masked by the paced rhythm generated by his cardiac resynchronization therapy defibrillator, given that the baseline rhythm was consistently sinus rhythm. A noteworthy symptom in this patient was wheezing. As stated previously, this patient had no episodes of bronchial asthma or exacerbation of heart failure. The wheezing persisted until the morning of day 3 (approximately 60 h after carvedilol ingestion) and improved following SABA treatment. No recurrence of wheezing supported the fact that it was caused by carvedilol. Weinstein et al. reported the case of a 22‐year‐old woman who experienced wheezing 15 min after ingesting 1,000 mg atenolol7, which also improved with SABA given within 2 h. To the best of our knowledge, this is the only reported case of wheezing caused by a β‐blocker overdose, which makes the present case noteworthy.\n\nThis patient had significant wheezing without cardiovascular dysfunction. Although the patient denied a history of bronchial asthma, he might have had a subclinical asthmatic component.\n\nEvidence‐based consensus suggests that the lowest toxic oral dose of carvedilol for adults is 1,050 mg. The maximum single therapeutic dose is typically recommended at 50 mg.6 The present patient had ingested 300 mg carvedilol, which is lower than the reported toxic dose. However, knowledge regarding carvedilol intoxication vis‐à‐vis propranolol intoxication is scarce.8 Furthermore, the main symptom in this case of wheezing was significant relative to the carvedilol dose, which is reasonable given that the blood concentration of a β‐blocker was previously shown to have no association with the severity of β‐blocker intoxication.5 However, the time for which the wheezing and hypoxia persisted (maximum 60 h) was reasonable given the half‐life of the drug. Thus, any patient who has ingested a supratherapeutic dose of carvedilol should be cautiously monitored for complications such as wheezing.\n\nThere are some proposed treatment options for β‐blocker intoxication.9 Pharmacological therapies include glucagon and catecholamines given i.v.9 Glucagon exerts positive inotropic and chronotropic effects on the myocardium by stimulating adenyl cyclase, similar to catecholamines. Cardiovascular symptoms are the main reported indications of glucagon. Because it was unclear as to how the wheezing would respond to glucagon in the present case, we gave only inhaled procaterol to our patient. Activated charcoal could also be used for intoxication in general. Non‐pharmacologic therapies include cardiac pacing to maintain the heart rate; in addition, extracorporeal circulatory support and an aortic balloon pump could be considered for a prolonged and refractory cardiovascular compromise.9, 10 The present case suggests that the repeated use of SABA might be effective while wheezing persists. There is some evidence indicating that non‐invasive positive pressure ventilation could lead to clinical improvement of acute asthma.11 Given that β‐blocker intoxication is theoretically reversible, non‐invasive positive pressure ventilation can be an option for managing bronchospasm caused by β‐blocker intoxication that is refractory to SABA.\n\nConclusion\nWe report a case of wheezing caused by carvedilol intoxication, which was successfully treated with SABA. Although the reported manifestations of β‐blocker intoxication are mostly cardiac dysfunctions, clinicians should also recognize that wheezing or bronchospasm can develop following β‐blocker intoxication, for which SABA could be indicated.\n\nDisclosure\nApproval of the research protocol: N/A.\n\nInformed consent: Informed consent was obtained from the patient.\n\nRegistry and registration no. of the study/trial: N/A.\n\nAnimal studies: N/A.\n\nConflict of interest: None.\n\nAcknowledgments\nNone.\n==== Refs\nReferences\n1 \n\nDiNicolantonio \nJJ \n, \nHackam \nDG \n. Carvedilol: a third‐generation beta‐blocker should be a first‐choice beta‐blocker . Expert Rev. Cardiovasc. Ther. \n2012 ; 10 : 13 –25 .22149523 \n2 \n\nStafylas \nPC \n, \nSarafidis \nPA \n. Carvedilol in hypertension treatment . Vasc. Health Risk Manag. \n2008 ; 4 : 23 –30 .18629377 \n3 \n\nLoth \nDW \n, \nBrusselle \nGG \n, \nLahousse \nL \n, \nHofman \nA \n, \nLeufkens \nHG \n, \nStricker \nBH \n. beta‐Adrenoceptor blockers and pulmonary function in the general population: the Rotterdam Study . Br. J. Clin. Pharmacol. \n2014 ; 77 : 190 –200 .23772842 \n4 \n\nMorales \nDR \n, \nJackson \nC \n, \nLipworth \nBJ \n, \nDonnan \nPT \n, \nGuthrie \nB \n. Adverse respiratory effect of acute beta‐blocker exposure in asthma: a systematic review and meta‐analysis of randomized controlled trials . Chest \n2014 ; 145 : 779 –86 .24202435 \n5 \n\nFrishman \nW \n, \nJacob \nH \n, \nEisenberg \nE \n, \nRibner \nH \n. Clinical pharmacology of the new beta‐adrenergic blocking drugs. Part 8. Self‐poisoning with beta‐adrenoceptor blocking agents: recognition and management . Am. Heart J. \n1979 ; 98 : 798 –811 .40429 \n6 \n\nWax \nPM \n, \nErdman \nAR \n, \nChyka \nPA \n\net al\nbeta‐blocker ingestion: an evidence‐based consensus guideline for out‐of‐hospital management . Clin. Toxicol. (Phila) \n2005 ; 43 : 131 –46 .15906457 \n7 \n\nWeinstein \nRS \n, \nCole \nS \n, \nKnaster \nHB \n, \nDahlbert \nT \n. Beta blocker overdose with propranolol and with atenolol . Ann. Emerg. Med. \n1985 ; 14 : 161 –3 .2857542 \n8 \n\nBouchard \nNC \n, \nForde \nJ \n, \nHoffman \nRS \n. Carvedilol overdose with quantitative confirmation . Basic Clin. Pharmacol. Toxicol. \n2008 ; 103 : 102 –3 .18598302 \n9 \n\nKerns \nW \n2nd\n. Management of beta‐adrenergic blocker and calcium channel antagonist toxicity . Emerg. Med. Clin. North Am. \n2007 ; 25 : 309 –31 ; abstract viii.17482022 \n10 \n\nKoschny \nR \n, \nLutz \nM \n, \nSeckinger \nJ \n, \nSchwenger \nV \n, \nStremmel \nW \n, \nEisenbach \nC \n. Extracorporeal life support and plasmapheresis in a case of severe polyintoxication . J. Emerg. Med. \n2014 ; 47 : 527 –31 .25220022 \n11 \n\nSoma \nT \n, \nHino \nM \n, \nKida \nK \n, \nKudoh \nS \n. A prospective and randomized study for improvement of acute asthma by non‐invasive positive pressure ventilation (NPPV) . Intern. Med. \n2008 ; 47 : 493 –501 .18344635\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2052-8817",
"issue": "7(1)",
"journal": "Acute medicine & surgery",
"keywords": "bronchospasm; carvedilol; procaterol; wheezing; β‐blocker",
"medline_ta": "Acute Med Surg",
"mesh_terms": null,
"nlm_unique_id": "101635464",
"other_id": null,
"pages": "e475",
"pmc": null,
"pmid": "31988787",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "2857542;40429;17482022;24202435;18598302;22149523;23772842;15906457;18344635;25220022;18629377",
"title": "Persistent wheezing caused by carvedilol overdose in a non-asthmatic man.",
"title_normalized": "persistent wheezing caused by carvedilol overdose in a non asthmatic man"
} | [
{
"companynumb": "JP-PFIZER INC-2020008841",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LORAZEPAM"
},
"drugadditional": "3",
... |
{
"abstract": "The recreational use of new psychoactive substances (NPS) is increasing worldwide. Among them, the arylcyclohexylamine family including phencyclidine (PCP) and ketamine derivatives is increasing. We report a non-fatal intoxication mainly due to arylcyclohexylamine compounds illustrated by molecular networking (MN).\nA 37-year-old man with a history of drug abuse was discovered with several bags labeled as research chemicals around him and traces of powder on his nose. He was rehydrated, intubated, and admitted to the intensive care unit (ICU). Urine and drug were analyzed by liquid chromatography-mass spectrometry for NPS identification. Several NPS were quantified in urine: 3-OH-PCP at 12,085 mg/L, 3-MeO-PCP at 1100 mg/L, 2F-DCK at 147 mg/L, N-ethylhexedrone at 165 mg/L and CMC at 48 mg/L. Using a bioinformatic approach, a molecular network was built to confirm the consumption of powders contained in the bags by comparison with patient's urine.\nThis case illustrates the interest of MN to (i) perform sample-to-sample comparison, (ii) target quantification methods, and (iii) allow proper management to confirm the relevance of the treatment.",
"affiliations": "Forensic and Clinical toxicology laboratory, CHU Rennes, Rennes, France.;Institut NuMeCan (Nutrition, Metabolisms and Cancer), Univ Rennes, INSERM, INRAE, CHU Rennes, Rennes, France.;Department of Emergency Medicine, Pontchaillou, CHU Rennes, Rennes, France.;Forensic and Clinical toxicology laboratory, CHU Rennes, Rennes, France.;Institut NuMeCan (Nutrition, Metabolisms and Cancer), Univ Rennes, INSERM, INRAE, CHU Rennes, Rennes, France.;Forensic and Clinical toxicology laboratory, CHU Rennes, Rennes, France.;Forensic and Clinical toxicology laboratory, CHU Rennes, Rennes, France.",
"authors": "Pelletier|Romain|R|https://orcid.org/0000-0002-3848-507X;Le Daré|Brendan|B|https://orcid.org/0000-0002-5907-2450;Grandin|Loic|L|;Couette|Aurélien|A|;Ferron|Pierre-Jean|PJ|https://orcid.org/0000-0002-7417-4690;Morel|Isabelle|I|https://orcid.org/0000-0001-7160-968X;Gicquel|Thomas|T|https://orcid.org/0000-0001-7448-9732",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1080/15563650.2021.1931693",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1556-3650",
"issue": null,
"journal": "Clinical toxicology (Philadelphia, Pa.)",
"keywords": "New psychoactive substances; intensive care; intoxication; ketamine derivatives; molecular networking",
"medline_ta": "Clin Toxicol (Phila)",
"mesh_terms": null,
"nlm_unique_id": "101241654",
"other_id": null,
"pages": "1-4",
"pmc": null,
"pmid": "34085577",
"pubdate": "2021-06-04",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "New psychoactive substance cocktail in an intensive care intoxication case elucidated by molecular networking.",
"title_normalized": "new psychoactive substance cocktail in an intensive care intoxication case elucidated by molecular networking"
} | [
{
"companynumb": "FR-LUNDBECK-DKLU3047778",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CITALOPRAM HYDROBROMIDE"
},
"drugadditional": "... |
{
"abstract": "Raoultella planticola is a gram-negative, encapsulated, aerobic bacterium within the Enterobacteriaceae family. It has been primarily described as pathogen in cases with pneumonia and gastrointestinal infections. Here we describe a case of severe pelvic cellulitis in a patient with neutropenia following induction therapy for myeloid sarcoma. The patient experienced a septic shock and was treated successfully with antibiotic therapy. A literature review is provided to put this case in context with previous reports on R. planticola. This report highlights that awareness for uncommon pathogens is crucial in the clinical management of infections in neutropenic patients.",
"affiliations": "Department I of Internal Medicine, University Hospital of Cologne, Cologne, Germany; Department I of Internal Medicine, Critical Care Medicine, University Hospital of Cologne, Cologne, Germany.;Department I of Internal Medicine, University Hospital of Cologne, Cologne, Germany; Department I of Internal Medicine, Critical Care Medicine, University Hospital of Cologne, Cologne, Germany.;Department I of Internal Medicine, Division of Infectious Diseases, University Hospital of Cologne, Cologne, Germany; German Centre for Infection Research (DZIF), Partner Site Bonn - Cologne, Cologne, Germany.;Institute for Medical Microbiology, Immunology and Hygiene, University Hospital of Cologne, Cologne, Germany.;Department I of Internal Medicine, Division of Infectious Diseases, University Hospital of Cologne, Cologne, Germany; German Centre for Infection Research (DZIF), Partner Site Bonn - Cologne, Cologne, Germany.;Department I of Internal Medicine, Critical Care Medicine, University Hospital of Cologne, Cologne, Germany.;Department I of Internal Medicine, Critical Care Medicine, University Hospital of Cologne, Cologne, Germany.;Department I of Internal Medicine, Critical Care Medicine, University Hospital of Cologne, Cologne, Germany. Electronic address: boris.boell@uk-koeln.de.",
"authors": "Al-Sawaf|O|O|;Garcia-Borrega|J|J|;Vehreschild|J J|JJ|;Thelen|P|P|;Fätkenheuer|G|G|;Shimabukuro-Vornhagen|A|A|;Kochanek|M|M|;Böll|B|B|",
"chemical_list": "D000900:Anti-Bacterial Agents",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.jiac.2018.09.013",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1341-321X",
"issue": "25(4)",
"journal": "Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy",
"keywords": "Acute myeloid leukaemia; Cellulitis; Myeloid sarcoma; Neutropenia; Raoultella planticola",
"medline_ta": "J Infect Chemother",
"mesh_terms": "D000328:Adult; D000900:Anti-Bacterial Agents; D000971:Antineoplastic Combined Chemotherapy Protocols; D002481:Cellulitis; D064146:Chemotherapy-Induced Febrile Neutropenia; D004755:Enterobacteriaceae; D004756:Enterobacteriaceae Infections; D006801:Humans; D008279:Magnetic Resonance Imaging; D008297:Male; D010388:Pelvis; D023981:Sarcoma, Myeloid; D016896:Treatment Outcome",
"nlm_unique_id": "9608375",
"other_id": null,
"pages": "298-301",
"pmc": null,
"pmid": "30482700",
"pubdate": "2019-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Pelvic cellulitis caused by Raoultella planticola in a neutropenic patient.",
"title_normalized": "pelvic cellulitis caused by raoultella planticola in a neutropenic patient"
} | [
{
"companynumb": "DE-PFIZER INC-2019355699",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CYTARABINE"
},
"drugadditional": "3",
... |
{
"abstract": "Metronidazole can cause adverse effects both in the central and peripheral nervous system. We report a 34-year-old female who presented a reversible cerebellar syndrome and peripheral neuropathy as an adverse effect associated with the use of metronidazole. Brain magnetic resonance imaging (MRI) showed hyperintense T2 and FLAIR bilateral symmetrical cerebellar lesions, without contrast enhancement or mass effect, isointense in diffusion-weighted imaging and hypointense in apparent diffusion coefficient sequences. Also, electrophysiological evaluation was consistent with axonal polyneuropathy. She had received metronidazole for a liver abscess during 49 days. After discontinuation of metronidazole, she had rapid regression of cerebellar symptoms and normalization of MRI, with subsequent disappearance of peripheral symptoms. The brain MRI, electromyography and nerve conduction studies performed at 35 months later showed complete resolution of the lesions. Although metronidazole neurotoxicity is a rare event, it must be borne in mind because the prognosis is usually favorable after stopping the drug.",
"affiliations": null,
"authors": "Retamal-Riquelme|Eva|E|;Soto-San Martín|Hernán|H|;Vallejos-Castro|José|J|;Galdames-Poblete|Daniel|D|",
"chemical_list": "D000981:Antiprotozoal Agents; D008795:Metronidazole",
"country": "Chile",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0034-9887",
"issue": "142(3)",
"journal": "Revista medica de Chile",
"keywords": null,
"medline_ta": "Rev Med Chil",
"mesh_terms": "D000328:Adult; D000981:Antiprotozoal Agents; D002526:Cerebellar Diseases; D005260:Female; D006801:Humans; D008100:Liver Abscess; D008279:Magnetic Resonance Imaging; D008795:Metronidazole; D010523:Peripheral Nervous System Diseases",
"nlm_unique_id": "0404312",
"other_id": null,
"pages": "386-90",
"pmc": null,
"pmid": "25052278",
"pubdate": "2014-03",
"publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "Reversible neurotoxicity secondary to metronidazole: report of one case.",
"title_normalized": "reversible neurotoxicity secondary to metronidazole report of one case"
} | [
{
"companynumb": "CL-WATSON-2015-09252",
"fulfillexpeditecriteria": "1",
"occurcountry": "CL",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "BISMUTH SUBSALICYLATE\\METRONIDAZOLE\\TETRACYCLINE HYDROCHLORIDE"
... |
{
"abstract": "Immune-mediated drug reactions are a potentially life-threatening complication of antiseizure medications. Drug hypersensitivity syndrome (DHS) is the best recognised of these, presenting with fever, eosinophilia, rash and internal organ involvement. Isolated lymphadenopathy is a less recognized immune-mediated reaction to antiseizure drugs such as lamotrigine. We describe the case of a 24-year-old woman who developed lamotrigine-related bilateral cervical lymphadenopathy (pseudolymphoma) fifteen months following therapy initiation. This is the second such case reported in the medical literature.",
"affiliations": "Department of Neurology, Auckland City Hospital, 2 Park Road, Auckland, New Zealand.;Department of Neurology, Auckland City Hospital, 2 Park Road, Auckland, New Zealand.",
"authors": "Mulroy|Eoin|E|;Walker|Elizabeth|E|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.ebcr.2016.12.004",
"fulltext": "\n==== Front\nEpilepsy Behav Case RepEpilepsy Behav Case RepEpilepsy & Behavior Case Reports2213-3232Elsevier S2213-3232(16)30076-710.1016/j.ebcr.2016.12.004Case ReportLamotrigine-related pseudolymphoma presenting as cervical lymphadenopathy Mulroy Eoin EoinM@adhb.govt.nz⁎Walker Elizabeth Department of Neurology, Auckland City Hospital, 2 Park Road, Auckland, New Zealand⁎ Corresponding author. EoinM@adhb.govt.nz18 1 2017 2017 18 1 2017 7 40 41 3 10 2016 23 11 2016 9 12 2016 © 2017 The Authors2017This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Immune-mediated drug reactions are a potentially life-threatening complication of antiseizure medications. Drug hypersensitivity syndrome (DHS) is the best recognised of these, presenting with fever, eosinophilia, rash and internal organ involvement. Isolated lymphadenopathy is a less recognized immune-mediated reaction to antiseizure drugs such as lamotrigine. We describe the case of a 24-year-old woman who developed lamotrigine-related bilateral cervical lymphadenopathy (pseudolymphoma) fifteen months following therapy initiation. This is the second such case reported in the medical literature.\n\nHighlights\n• Localised lymphadenopathy, especially cervical, is a potential complication of antiseizure therapy\n\n• Drug-induced pseudolymphoma is a distinct entity from, and occurs without other features of drug hypersensitivity syndrome\n\n• Eosinophilia in a patient with lymphadenopathy should prompt the clinician to consider a diagnosis of a drug reaction\n\n• Discontinuation of the offending drug in cases of medication-induced lymphadenopathy often leads to clinical improvement\n\n\n\nKeywords\nAnticonvulsantsDrug hypersensitivity syndromePseudolymphomaEosinophilia\n==== Body\n1 Introduction\nLamotrigine is a triazine-derived antiseizure drug which acts to stabilize neuronal membranes through inhibition of voltage-sensitive sodium and calcium channel opening. Drug reactions are an important consideration when prescribing this medication. Skin rashes are a worrisome side-effect, as they may signal the development of Stevens–Johnson syndrome, toxic epidermal necrolysis, or drug hypersensitivity syndrome (DHS). A less common, and less recognised reaction to lamotrigine is the development of localized lymphadenopathy (pseudolymphoma) without systemic features or rash. In contrast to DHS and severe cutaneous adverse reactions, which happen within weeks of therapy initiation, drug-induced pseudolymphoma often occurs months after initiation. In patients taking lamotrigine and other antiseizure drugs, clinicians should consider drug reactions in the differential diagnosis of isolated lymphadenopathy, especially in the setting of peripheral blood eosinophilia.\n\n2 Case report\nA 24-year-old Sri Lankan woman with drug resistant focal dyscognitive seizures experienced daily seizures despite treatment with carbamazepine 800 mg twice daily and clonazepam 2 mg twice daily. She was on no other medication and otherwise well. Lamotrigine was started with the aim of improving seizure control and slowly titrated to a dose of 150 mg in the morning and 200 mg in the evening over a period of 6 months. Her seizure frequency reduced.\n\nFifteen months after initiation of lamotrigine, she complained of productive cough with yellow sputum. She was afebrile. Chest examination was normal. Lymphadenopathy was detected in the right cervical chain. Other lymph nodes, tonsillar tissue and spleen were of normal size. Spirometry was within normal limits. High resolution CT chest and neck showed extensive bilateral cervical lymphadenopathy and patchy ground-glass nodules in multiple lobes but no intrathoracic adenopathy. Full blood count, serum chemistries, as well as testing for rheumatoid factor, anti-citric citrullinated peptide antibodies, antinuclear antibodies, human immunodeficiency virus, Epstein–Barr virus, cytomegalovirus, toxoplasma and tuberculosis were all normal or negative. Erythrocyte sedimentation rate and c-reactive protein were elevated at 95 mm/h (normal < 23 mm/h) and 16 mg/L (normal < 5 mg/L) respectively. Histology of an excisional lymph node biopsy showed reactive follicular hyperplasia with capsular thickening without malignancy or granuloma. A review of prior blood testing revealed intermittent low-grade eosinophilia since introduction of lamotrigine (see Table 1). A diagnosis of lamotrigine-related pseudolymphoma was made. Lamotrigine was gradually withdrawn and her lymphadenopathy and pulmonary findings (which also likely represented a medication toxicity) have resolved.Table 1 Eosinophil count plotted against time showing intermittent eosinophilia during the period of treatment with lamotrigine.\n\nTable 1\n\n3 Discussion\nLamotrigine is an antiseizure drug which acts through voltage-sensitive sodium and calcium channels to reduce the release of excitatory neurotransmitters. Cutaneous adverse reactions are the most feared complication of therapy, because the presence of a rash can herald the development of devastating complications such as Stevens–Johnson syndrome, toxic-epidermal necrolysis or a drug-hypersensitivity syndrome (DHS). Localised lymphadenopathy without systemic symptoms (pseudolymphoma) is a much less appreciated complication of therapy.\n\nBoth drug-induced pseudolymphoma and DHS represent immune reactions to medications, but differ greatly in their time-course, clinical manifestations and treatment [1]. The most commonly implicated medications are antiseizure drugs such as phenytoin, carbamazepine and lamotrigine, but also allopurinol, antidepressants and some antihypertensive medications [2].\n\nPseudolymphoma may present with isolated lymphadenopathy, cutaneous lesions or both [1], [3]. The presence of systemic features and internal organ dysfunction is unusual and onset is generally weeks to months following therapy initiation [1], [3]. Localised lymphadenopathy secondary to lamotrigine has been reported once previously [3]. In this case, as in ours, the cervical nodes were involved. The pathogenesis of this reactive ‘pseudolymphoma’, which can be B-cell, T-cell or mixed-type is incompletely understood. As in this case, medication withdrawal is generally all that is necessary to treat the condition [1], [3].\n\nIn contrast, DHS (also known as drug reaction with eosinophilia and systemic symptoms [DRESS]), a well-recognised complication of antiseizure drug treatment, is characterised by a maculopapular rash, fever, leukocytosis and internal organ involvement [4]. Onset is more acute than pseudolymphoma, beginning in the first few weeks following therapy initiation. Treatment with immunosuppressive drugs, intravenous immunoglobulin and/or plasma exchange is often necessary, especially in severe cases.\n\nClinicians should consider drug reactions when assessing patients with localised lymphadenopathy. Drug initiation may have taken place weeks to month prior to the onset of symptoms. In our case, lamotrigine was likely the offending medication, though in both reported cases of lamotrigine-related pseudolymphoma (ours and one other previous case), patients were concurrently taking carbamazepine, a medication whose effective plasma concentration may be increased by lamotrigine [3], [5]. Intermittent or low-grade eosinophilia may be a clue to the diagnosis. Discontinuation of the offending drug (e.g. lamotrigine) in these cases can lead to resolution of clinical symptoms.\n==== Refs\nReferences\n1 Callot V. Roujeau J.C. Bagot M. Drug-induced pseudolymphoma and hypersensitivity syndrome. Two different clinical entities Arch Dermatol 132 11 1996 Nov 1315 1321 8915309 \n2 Albrecht J. Fine L.A. Piette W. Drug-associated lymphoma and pseudolymphoma: recognition and management Dermatol Clin 25 2 2007 Apr 233 244 [vii] 17430760 \n3 Pathak P. McLachlan R.S. Drug-induced pseudolymphoma secondary to lamotrigine Neurology 50 5 1998 May 1509 1510 9596028 \n4 Gaeta F. Alonzi C. Valluzzi R.L. Hypersensitivity to lamotrigine and nonaromatic anticonvulsant drugs: a review Curr Pharm Des 14 27 2008 2874 2882 18991705 \n5 Warner T. Patsalos P.N. Prevett M. Lamotrigine-induced carbamazepine toxicity: an interaction with carbamazepine-10,11-epoxide Epilepsy Res 11 2 Apr 1992 147 150 1618180\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2213-3232",
"issue": "7()",
"journal": "Epilepsy & behavior case reports",
"keywords": "Anticonvulsants; Drug hypersensitivity syndrome; Eosinophilia; Pseudolymphoma",
"medline_ta": "Epilepsy Behav Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101614202",
"other_id": null,
"pages": "40-41",
"pmc": null,
"pmid": "28348962",
"pubdate": "2017",
"publication_types": "D002363:Case Reports",
"references": "17430760;9596028;1618180;8915309;18991705",
"title": "Lamotrigine-related pseudolymphoma presenting as cervical lymphadenopathy.",
"title_normalized": "lamotrigine related pseudolymphoma presenting as cervical lymphadenopathy"
} | [
{
"companynumb": "NZ-JUBILANT CADISTA PHARMACEUTICALS-2017JUB00139",
"fulfillexpeditecriteria": "1",
"occurcountry": "NZ",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CLONAZEPAM"
},
"druga... |
{
"abstract": "Catatonia is a rare medical condition that can be fatal in paediatric patients if left untreated. It is often misdiagnosed or underdiagnosed. There are no published cases of catatonia in traumatised children living in long-term psychiatric care. However, there is some evidence that childhood maltreatment in its variant forms may be a risk for the development of catatonia in children and adolescents. In this case, a 10-year-old boy with intrauterine exposure to alcohol and multiple drugs and early childhood deprivation, developed neuroleptic-induced catatonia in an intensive psychiatric residential treatment centre approximately 24 hours after receiving a first-time intramuscular injection of haloperidol 5 mg for acute agitation. He had no known predisposing factors for catatonia such as psychosis, autism, neurological or general medical problems. This 10-year-old child's early childhood trauma should be considered as a predisposing factor for catatonia.",
"affiliations": "Psychiatry and Behavioral Medicine, The University of Alabama at Birmingham School of Medicine Tuscaloosa, Tuscaloosa, Alabama, USA magiggie@ua.edu.",
"authors": "Giggie|Marisa A|MA|",
"chemical_list": "D014150:Antipsychotic Agents; D006220:Haloperidol",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2020-239596",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "14(2)",
"journal": "BMJ case reports",
"keywords": "child abuse; child and adolescent psychiatry (paediatrics); drugs: psychiatry",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000293:Adolescent; D014150:Antipsychotic Agents; D002389:Catatonia; D002648:Child; D002675:Child, Preschool; D006220:Haloperidol; D006801:Humans; D008297:Male; D000066553:Problem Behavior; D012114:Residential Treatment",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33602769",
"pubdate": "2021-02-18",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Catatonia in a 10-year-old boy with early childhood neglect and disruptive behaviours in psychiatric residential treatment.",
"title_normalized": "catatonia in a 10 year old boy with early childhood neglect and disruptive behaviours in psychiatric residential treatment"
} | [
{
"companynumb": "US-MYLANLABS-2021M1017090",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HYDROXYZINE HYDROCHLORIDE"
},
"drugadditional... |
{
"abstract": "METHODS\nGiant cell myocarditis (GCM) is a rare and a rapidly progressive disorder with fatal outcomes such that patients often require heart transplantation. We present a case of recurrent GCM in a transplanted patient with a history of Crohn disease requiring a novel therapeutic approach.\nAfter the orthotopic heart transplantation, GCM recurred on aggressive immunosuppression over the months, which included corticosteroids, basiliximab, tacrolimus, antithymocyte globulin, and rituximab. Although combination immunosuppressive therapy containing cyclosporine and 2-4 additional drugs including corticosteroids, azathioprine, mycophenolate mofetil, muromonab, gammaglobulin, or methotrexate have shown to prolong the transplant-free survival by keeping the disease under control, its role in preventing and treating recurrence posttransplantation is unclear.\n\n\nMETHODS\nWe added sirolimus, a macrolide antibiotic, with properties of T- and B-lymphocyte proliferation inhibition on the above immunosuppressive treatment postrecurrence of GCM. After sirolimus initiation and continuation, the patient has remained disease free.",
"affiliations": "Department of Cardiovascular Medicine, University of Nebraska Medical Center, Omaha, NE.;Department of Cardiovascular Medicine, University of Nebraska Medical Center, Omaha, NE.;Department of Cardiovascular Medicine, University of Nebraska Medical Center, Omaha, NE.;Department of Pathology and Microbiology, University of Nebraska Medical Center, Omaha, NE.;Department of Cardiovascular Medicine, University of Nebraska Medical Center, Omaha, NE.;Department of Cardiovascular Medicine, University of Nebraska Medical Center, Omaha, NE.",
"authors": "Patel|Apurva D|AD|;Lowes|Brian|B|;Chamsi-Pasha|Mohammed A|MA|;Radio|Stanley J|SJ|;Hyden|Marshall|M|;Zolty|Ronald|R|",
"chemical_list": "D007166:Immunosuppressive Agents; D020123:Sirolimus",
"country": "United States",
"delete": false,
"doi": "10.1097/MJT.0000000000000796",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1075-2765",
"issue": "26(5)",
"journal": "American journal of therapeutics",
"keywords": null,
"medline_ta": "Am J Ther",
"mesh_terms": "D064591:Allografts; D004359:Drug Therapy, Combination; D004452:Echocardiography; D015726:Giant Cells; D006084:Graft Rejection; D006321:Heart; D016027:Heart Transplantation; D006801:Humans; D007166:Immunosuppressive Agents; D008279:Magnetic Resonance Imaging; D008297:Male; D008875:Middle Aged; D009205:Myocarditis; D009206:Myocardium; D012008:Recurrence; D020123:Sirolimus; D016896:Treatment Outcome",
"nlm_unique_id": "9441347",
"other_id": null,
"pages": "600-603",
"pmc": null,
"pmid": "29889677",
"pubdate": "2019",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Sirolimus for Recurrent Giant Cell Myocarditis After Heart Transplantation: A Unique Therapeutic Strategy.",
"title_normalized": "sirolimus for recurrent giant cell myocarditis after heart transplantation a unique therapeutic strategy"
} | [
{
"companynumb": "US-PBT-000056",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RITUXIMAB"
},
"drugadditional": "3",
"drugadmin... |
{
"abstract": "BACKGROUND\nThe benefit of decompressive hemicraniectomy in patients with malignant acute ischemic stroke is well established, however its role in supratentorial intracerebral hemorrhages is unclear and evolving. Prior studies combined cortical and subcortical hemorrhages in their analysis despite their different natural history. Subcortical hematoma is associated with worse outcomes due to mechanical compression of subcortical structures. We describe outcomes of a matched comparison of patients with spontaneous subcortical hemorrhage managed with hemicraniectomy versus medical management alone.\n\n\nMETHODS\nUsing our \"Get-with-the-guideline stroke\" database, patients with spontaneous subcortical hematoma managed with hemicraniectomy were identified. Using age, gender, and hematoma volume (categorized as 0-30, 30-60, >60ml), patients managed with hemicraniectomy were matched with medical management alone. Outcomes included hospital length of stay, discharge disposition, and Glasgow outcome score.\n\n\nRESULTS\nEight patients with subcortical hematoma managed with hemicraniectomy were matched with 22 medically managed patients. Other than use of antithrombotics, clinical characteristics did not differ between groups. On comparing outcomes, hospital length of stay in the hemicraniectomy group (26.5 vs 12.5 days p = 0.006) was significantly longer. Discharge disposition did not differ between groups (75% vs 36.4% p = 0.101). Despite a higher frequency of Glasgow outcome score ≥ 3 at 90 days amongst hemicraniectomy cases, there was no significant difference between groups (71.3% vs 54.5% p = 0.535).\n\n\nCONCLUSIONS\nHemicraniectomy for subcortical hematoma was associated with a prolonged hospital stay. Despite improving survival and favorable discharge disposition, there was no statistically significant difference between groups. Further studies on the benefit of hemicraniectomy in subcortical hematoma are needed.",
"affiliations": "Department of Neurocritical Care, Ochsner Clinical School, University of Queensland, Ochsner Medical Center, New Orleans, LA, USA.;Department of Neurosurgery, Ochsner Clinical School, University of Queensland, Ochsner Medical Center, New Orleans, LA, USA.;Ochsner Clinical School, University of Queensland, Ochsner Medical Center, New Orleans, LA, USA.;Department of Neurocritical Care, Ochsner Clinical School, University of Queensland, Ochsner Medical Center, New Orleans, LA, USA.;Ochsner Clinical School, University of Queensland, Ochsner Medical Center, New Orleans, LA, USA.;Department of Neurocritical Care, Ochsner Clinical School, University of Queensland, Ochsner Medical Center, New Orleans, LA, USA.;Department of Neurosurgery, Ochsner Clinical School, University of Queensland, Ochsner Medical Center, New Orleans, LA, USA.;Institute of Translational Medicine, Ochsner Medical Center, New Orleans, LA, USA.;Institute of Translational Medicine, Ochsner Medical Center, New Orleans, LA, USA.",
"authors": "Iwuchukwu|Ifeanyi|I|https://orcid.org/0000-0001-7790-7725;Bui|Cuoung|C|;Hsieh|Billie|B|;Sabharwal|Vivek|V|;Mohammed|Alaa|A|;McGrade|Harold|H|;Biro|Erin|E|;Nguyen|Doan|D|;Sulaiman|Olawale|O|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1080/00207454.2020.1713773",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0020-7454",
"issue": "130(10)",
"journal": "The International journal of neuroscience",
"keywords": " intracerebral hemorrhage; Acute care; hemicraniectomy; outcome",
"medline_ta": "Int J Neurosci",
"mesh_terms": "D000328:Adult; D000368:Aged; D002543:Cerebral Hemorrhage; D056424:Decompressive Craniectomy; D005260:Female; D023261:Glasgow Outcome Scale; D006801:Humans; D007902:Length of Stay; D008297:Male; D008875:Middle Aged; D017063:Outcome Assessment, Health Care",
"nlm_unique_id": "0270707",
"other_id": null,
"pages": "965-971",
"pmc": null,
"pmid": "31914353",
"pubdate": "2020-10",
"publication_types": "D003160:Comparative Study; D016428:Journal Article",
"references": null,
"title": "Decompressive hemicraniectomy in the management of subcortical spontaneous intracerebral hemorrhage.",
"title_normalized": "decompressive hemicraniectomy in the management of subcortical spontaneous intracerebral hemorrhage"
} | [
{
"companynumb": "US-BRISTOL-MYERS SQUIBB COMPANY-BMS-2020-087882",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "WARFARIN SODIUM"
},
"dr... |
{
"abstract": "Abrupt cessation of STN-DBS is an under-recognized cause of life-threatening akinetic crisis in Parkinson's disease (PD) and can present as a movement disorder emergency. We report on 2 patients who survived severe and prolonged akinetic crisis after abrupt cessation of STN stimulation for PD (malignant STN-DBS withdrawal syndrome). We discuss the clinical similarities and possible differences in pathophysiology from the akinetic crisis in medically-treated PD. Although early implantable pulse generator (IPG) replacement is the definitive treatment, medical and economic considerations may preclude early surgery and strategies for medical management assume importance. We reflect upon the socioeconomic concerns surrounding DBS in countries lacking health care coverage and the need for user-independent monitors and indicators of low IPG battery status.",
"affiliations": "Comprehensive Care Center for Movement Disorders Sree Chitra Tirunal Institute for Medical Sciences and Technology Kerala India.;Comprehensive Care Center for Movement Disorders Sree Chitra Tirunal Institute for Medical Sciences and Technology Kerala India.;Comprehensive Care Center for Movement Disorders Sree Chitra Tirunal Institute for Medical Sciences and Technology Kerala India.;Comprehensive Care Center for Movement Disorders Sree Chitra Tirunal Institute for Medical Sciences and Technology Kerala India.",
"authors": "Rajan|Roopa|R|;Krishnan|Syam|S|;Kesavapisharady|Krishna Kumar|KK|;Kishore|Asha|A|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1002/mdc3.12271",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2330-1619",
"issue": "3(3)",
"journal": "Movement disorders clinical practice",
"keywords": "Parkinson's disease; akinetic crisis; implantable pulse generator depletion; malignant STN‐DBS withdrawal syndrome; parkinsonism‐hyperpyrexia syndrome",
"medline_ta": "Mov Disord Clin Pract",
"mesh_terms": null,
"nlm_unique_id": "101630279",
"other_id": null,
"pages": "288-291",
"pmc": null,
"pmid": "30363553",
"pubdate": "2016",
"publication_types": "D002363:Case Reports",
"references": "12518299;23868498;24471704;25566059;26184453;24697701;20623765;23465352;12735911;21449010;20082998;23857820;15824341;22986363;18446306;19056273;11215582;12735915;25837755",
"title": "Malignant Subthalamic Nucleus-Deep Brain Stimulation Withdrawal Syndrome in Parkinson's Disease.",
"title_normalized": "malignant subthalamic nucleus deep brain stimulation withdrawal syndrome in parkinson s disease"
} | [
{
"companynumb": "PHHY2016IN084707",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "PRAMIPEXOLE"
},
"drugadditional": null,
"dru... |
{
"abstract": "BACKGROUND\nSodium valproate is a commonly used anticonvulsant. It is widely recognized that valproate can cause hyperammonemia, particularly in people with underlying liver disease. Patients with urea cycle disorders are genetically predisposed to this adverse event and can develop severe hyperammonemia if given valproate. This can occur even if liver functions tests and plasma concentration of valproate are normal, highlighting the importance of checking ammonia levels in any patient presenting with encephalopathy. Specific treatment for hyperammonemia must be implemented promptly.\n\n\nMETHODS\nA 22-year-old white British man with a history of epilepsy post head trauma presented with subacute encephalopathy 4 weeks after the introduction of sodium valproate. His ammonia levels were not checked until 48 hours into his presentation and were found to be elevated. He initially responded to treatment of his hyperammonemia and the raised levels were attributed to sodium valproate. However, as his ammonia levels continued to rise, further investigation led to a diagnosis of ornithine transcarbamylase deficiency.\n\n\nCONCLUSIONS\nOrnithine transcarbamylase deficiency is the most common of the urea cycle disorders. This case highlights both the importance of checking ammonia levels early and considering the diagnosis of this X-linked disorder in patients with raised ammonia, as these have implications both for the patient's acute and further management, and for family screening.",
"affiliations": "General Practice, King's College London, London, UK. shaine.mehta@kcl.ac.uk.;University College London Hospital, London, UK.;Metabolic Medicine, Charles Dent Metabolic Unit, National Hospital for Neurology and Neurosurgery, London, UK.",
"authors": "Mehta|Shaine|S|;Tayabali|Sarrah|S|;Lachmann|Robin|R|",
"chemical_list": "D000927:Anticonvulsants; D004044:Dietary Proteins; D014635:Valproic Acid",
"country": "England",
"delete": false,
"doi": "10.1186/s13256-018-1666-3",
"fulltext": "\n==== Front\nJ Med Case RepJ Med Case RepJournal of Medical Case Reports1752-1947BioMed Central London 166610.1186/s13256-018-1666-3Case ReportValproate-induced hyperammonemia - uncovering an underlying inherited metabolic disorder: a case report Mehta Shaine shaine.mehta@kcl.ac.uk 1Tayabali Sarrah sarrah.t@doctors.org.uk 2Lachmann Robin robin.lachmann@uclh.nhs.uk 31 0000 0001 2322 6764grid.13097.3cGeneral Practice, King’s College London, London, UK 2 0000 0004 0612 2754grid.439749.4University College London Hospital, London, UK 3 0000 0004 0612 2631grid.436283.8Metabolic Medicine, Charles Dent Metabolic Unit, National Hospital for Neurology and Neurosurgery, London, UK 17 5 2018 17 5 2018 2018 12 13430 6 2017 20 3 2018 © The Author(s). 2018Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nSodium valproate is a commonly used anticonvulsant. It is widely recognized that valproate can cause hyperammonemia, particularly in people with underlying liver disease. Patients with urea cycle disorders are genetically predisposed to this adverse event and can develop severe hyperammonemia if given valproate.\n\nThis can occur even if liver functions tests and plasma concentration of valproate are normal, highlighting the importance of checking ammonia levels in any patient presenting with encephalopathy. Specific treatment for hyperammonemia must be implemented promptly.\n\nCase presentation\nA 22-year-old white British man with a history of epilepsy post head trauma presented with subacute encephalopathy 4 weeks after the introduction of sodium valproate. His ammonia levels were not checked until 48 hours into his presentation and were found to be elevated. He initially responded to treatment of his hyperammonemia and the raised levels were attributed to sodium valproate. However, as his ammonia levels continued to rise, further investigation led to a diagnosis of ornithine transcarbamylase deficiency.\n\nConclusions\nOrnithine transcarbamylase deficiency is the most common of the urea cycle disorders. This case highlights both the importance of checking ammonia levels early and considering the diagnosis of this X-linked disorder in patients with raised ammonia, as these have implications both for the patient’s acute and further management, and for family screening.\n\nKeywords\nSodium valproateEncephalopathyLiver diseaseOTCissue-copyright-statement© The Author(s) 2018\n==== Body\nBackground\nSodium valproate is a commonly used anticonvulsant. It is widely recognized that valproate can cause hyperammonemia, particularly in people with underlying liver disease. Valproate does this by modulating the levels of substrates of the urea cycle [1, 2]. This means that patients with urea cycle disorders are genetically predisposed to this adverse event and can develop severe hyperammonemia if given valproate.\n\nPatients with valproate-induced hyperammonemia and encephalopathy may present with increased seizure frequency, lethargy, altered behavior or impaired consciousness. This can occur even if liver functions tests and plasma concentration of valproate are normal, highlighting the importance of checking ammonia levels in any patient presenting with encephalopathy.\n\nNormally, valproate-induced hyperammonemia is transient and resolves if the drug is withdrawn. Not all patients with valproate-induced hyperammonemia are symptomatic. Withdrawal of the drug may not be warranted in asymptomatic cases, although close monitoring is advised. However, in patients with an underlying urea cycle disorder the effects of sodium valproate can be catastrophic, resulting in metabolic decompensation and progressive cerebral edema. Specific treatment for hyperammonemia must be implemented promptly.\n\nOrnithine trancarbamylase (OTC) deficiency is the most common inherited cause of hyperammonemia. Most male hemizygotes will present in the neonatal period but in female heterozygotes and males with milder mutations presentation can be delayed. Presentation in adulthood is often missed as symptoms are nonspecific and hyperammonemia is seldom considered. Metabolic decompensation can be triggered by the introduction of drugs such as valproate, by high protein intake or by catabolic states such as intercurrent infection, fasting or during the post-partum period [2]. The concentration of ammonia may rise gradually and patients can present with subacute encephalopathy.\n\nCase presentation\nA 22-year-old white British man with a background of epilepsy presented with a 2-week history of worsening nausea, vomiting, confusion, and aggressive behavior. On admission, he was encephalopathic and confused with a Glasgow Coma Scale of 14. In view of his deteriorating condition, he was admitted to the acute admissions unit for further investigation.\n\nThere was no history of significant illness in infancy or childhood. At the age of 18 while working as a lifeguard, he had a fall and hit his head, following this injury he had a grand mal seizure and was started on anticonvulsant medication. He had previously tried lamotrigine and levetiracetam but was unable to tolerate the non-neurological side effects. He did not report altered mental state on these medications. He had been started on sodium valproate 1 month prior to presentation.\n\nInitial laboratory findings showed his alanine transaminase was elevated at 74 iU/L and his white cell count was 12 × 109 /L. C-reactive protein and all other blood tests were within normal ranges. His ammonia level was measured 2 days later and was 120 umol/L (normal range: 12–47 umol/L). Despite weaning down and stopping sodium valproate, his ammonia level continued to rise, reaching 230 umol/L. At this time, specific therapy for his hyperammonemia was started.\n\nPlasma amino acids showed a raised glutamine of 1160 umol/L (515–75), consistent with a chronic hyperammonemia and a low citrulline level of 13 umol/L (20–55), consistent with OTC deficiency. Urine organic acids showed a large peak of orotic acid, confirming the diagnosis.\n\nInitially, it was thought that his encephalopathy was secondary to sepsis. It took 48 hours for the ammonia to be checked. The hyperammonemia was initially considered to be simply due to valproate therapy and the drug was stopped. When the ammonia continued to rise, an underlying metabolic disorder was considered.\n\nTo reduce the plasma ammonia levels, he was treated with sodium benzoate, sodium phenylbutrate, and L-arginine intravenously. He was also put on a zero protein diet and given intravenous 10% dextrose to prevent catabolism. Once his ammonia levels declined to below 100 umol/L, dietary protein was gradually reintroduced and sodium benzoate, sodium phenylbutrate, and L-arginine were continued orally. He commenced clobazam for his epilepsy.\n\nHe made a full recovery, with no neurological abnormality detected on examination at outpatient follow-up 2 months later. He cut down on his consumption of meat but otherwise follows a normal diet. Ammonia was normal at 35umol/L (12–47) at 2 months.\n\nFollowing this presentation, he was referred to a specialist metabolic unit for further testing. He was found to have a genetic mutation associated with late presentation of OTC deficiency and continues to take reducing doses of medications for hyperammonemia with the aim to eventually stop them all together and get him back onto a normal diet in the long term.\n\nHe would be at risk of decompensation in the future if exposed to metabolic stresses such as prolonged fasting or severe gastroenteritis. He has been given an emergency dietary regime, consisting of high carbohydrate and low protein intake to follow in such circumstances. He has also been advised to obtain a MedicAlert bracelet.\n\nAs this is an X-linked condition, other family members have been recommended to attend for genetic screening.\n\nDiscussion and conclusions\nOTC is one of the five hepatic enzymes in the urea cycle which converts ammonia to urea, allowing renal excretion. Any disruption to this pathway can potentially lead to hyperammonemia and clinical encephalopathy [3]. More than 300 mutations causing OTC deficiency have been identified with most patients presenting in childhood, however, some mutations cause later presentation [4, 5]. Hyperammonemia in this latter group may be exacerbated by environmental factors such as the introduction of sodium valproate in this case. Males with milder forms may present with subtle behavioral changes and symptoms may be difficult to distinguish from psychiatric illness or drug abuse. Thus, urea cycle disorders must be considered at any age in a patient who presents with hyperammonemia.\n\nTreatment of hyperammonemia is similar to the treatment of hepatic encephalopathy and should be started immediately. The aim is to reduce ammonia production by stopping catabolism. Ammonia is produced from the breakdown of dietary proteins and in catabolic states, endogenous protein. Treatment aims to stop protein intake and stop catabolism by providing calories as carbohydrates using intravenous glucose and lipids. Ammonia can be removed, using the alternative pathway scavengers used in this case (sodium benzoate and sodium phenylbutyrate) [6]. In proximal urea cycle disorder, L-arginine is also used as it stimulates protein synthesis. In severe hyperammonemia hemodialysis or hemofiltration may be required. Dietary protein is normally reintroduced after 48 hours to avoid essential amino acid deficiency, as this would increase endogenous protein catabolism. Reintroduction of protein requires specialist dietetic guidance. Early discussion with a metabolic team is important and the patient is likely to need referral to a specialist center after the acute episode.\n\nWith any inherited genetic disorder there are implications for family screening. Other urea cycle disorders have an autosomal recessive pattern of inheritance, however OTC is X-linked, which has specific implications. Affected men are advised that while their sons will be unaffected, their daughters will become carriers of the gene. The daughters should be advised that they have a 50% chance of passing the gene onto their offspring, and that both female offspring and male offspring may present with late-onset disease. In this case, as the mutation resulted in late-presenting disease, affected male offspring are unlikely to present with severe disease in the neonatal period. While female carriers are less likely to be affected, skewed X-inactivation in the liver can lead to the development of hyperammonemia.\n\nIn the long term, patients who have a hyperammonemic episode need advice about the possible need for dietary modification, avoiding dehydration, fasting and other triggering events, and the use of emergency regimes at times of metabolic stress. Not all of these patients may need to take long-term nitrogen scavengers, however, this may be considered later in life as the disease can get more brittle with age. Decisions also need to be made regarding the care of asymptomatic individuals with OTC mutations. Periodic follow-up in a specialist center is recommended.\n\nKey learning points:Ammonia levels should be checked in all encephalopathic patients.\n\nRemember that sodium valproate can cause hyperammonemia.\n\nUrea cycle disorders may present in adulthood.\n\nPrompt diagnosis can facilitate rapid treatment, with appropriate input from a metabolic consultant.\n\nThe diagnosis of a genetically inherited disease has implications for other family members. Adequate counseling of family members is essential.\n\n\n\nAbbreviations\nOTCOrnithine trancarbamylase (OTC)\n\nAcknowledgements\nOpen access for this article was funded by King’s College London (Open Scholarship Fund).\n\nAuthors’ contributions\nSM analyzed and interpreted patient data regarding OTC deficiency and hyperammonemia. ST was a major contributor drafting the manuscript. RL reviewed the report guiding revisions to intellectual content. All authors read and approved the final manuscript.\n\nEthics approval and consent to participate\nThe patient consents to use of his health information for research, education and training, including publication of anonymized information.\n\nConsent for publication\nInformed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent statement is available for review by the Editor-in-Chief of this journal.\n\nCompeting interests\nRobin Lachmann is a Consultant in Metabolic Medicine at UCLH National Hospital of Neurology and Neurosurgery.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Tarafdar S, Slee M, Ameer F, et al. A case of valproate induced hyperammonaemic encephalopathy. Case Rep Med. 2011;(2):969505.\n2. Oechsner M Steen C Sturenburg HJ Hyperammonaemic encephalopathy after initiation of valproate therapy in unrecognised ornithine transcarbamylase deficiency J Neurol Neurosurg Psychiatry 1998 64 680 682 10.1136/jnnp.64.5.680 9598692 \n3. Choi DA Lee KW Shin YT Na KR Hyperammonemia in a patient with late-onset ornithine carbamoyltransferase deficiency J Korean Med Sci 2012 27 556 559 10.3346/jkms.2012.27.5.556 22563224 \n4. Tuchman M Morizono H Rajagopal BS The biochemical and molecular spectrum of ornithine transcarbamylase deficiency J Inherit Metab Dis 1998 21 40 58 10.1023/A:1005353407220 9686344 \n5. Klein OD Kostiner DR Weisiger K Acute fatal presentation of ornithine transcarbamylase deficiency in a previously healthy male Hepatol Int 2008 2 390 394 10.1007/s12072-008-9078-x 19669271 \n6. British Inherited Metabolic Disease Group. Emergency guidelines. Urea cycle defects - adult emergency management. 2015. http://www.bimdg.org.uk/store/guidelines/ADULT_UCD-rev_2015_422170_09012016.pdf. Accessed 3 Jan 2018.\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1752-1947",
"issue": "12(1)",
"journal": "Journal of medical case reports",
"keywords": "Encephalopathy; Liver disease; OTC; Sodium valproate",
"medline_ta": "J Med Case Rep",
"mesh_terms": "D000927:Anticonvulsants; D016638:Critical Illness; D004044:Dietary Proteins; D006801:Humans; D022124:Hyperammonemia; D008297:Male; D020163:Ornithine Carbamoyltransferase Deficiency Disease; D014635:Valproic Acid; D055815:Young Adult",
"nlm_unique_id": "101293382",
"other_id": null,
"pages": "134",
"pmc": null,
"pmid": "29769109",
"pubdate": "2018-05-17",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "9686344;21629819;9598692;22563224;19669271",
"title": "Valproate-induced hyperammonemia - uncovering an underlying inherited metabolic disorder: a case report.",
"title_normalized": "valproate induced hyperammonemia uncovering an underlying inherited metabolic disorder a case report"
} | [
{
"companynumb": "GB-SUN PHARMACEUTICAL INDUSTRIES LTD-2019RR-211377",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LAMOTRIGINE"
},
"dru... |
{
"abstract": "BACKGROUND\nHemophagocytic lymphohistiocytosis (HLH) is a rare, life-threatening clinical syndrome. HLH can be classified into 2 major forms: primary and secondary. Viral infections are frequently implicated in the onset of active HLH episodes. Allogeneic hematopoietic stem cell transplantation (allo-HSCT) is the only curative treatment for primary HLH and refractory/relapsed HLH after proper chemoimmunotherapy, although following immunosuppressive therapy may lead to infectious complications, including viral infections.\n\n\nMETHODS\nWe report a case of a 6-year-old boy with Epstein-Barr virus (EBV)-induced hemophagocytic lymphohistiocytosis. The patient underwent an allo-HSCT from a 10/10 HLA-matched unrelated donor. Because he received myeloablative and immunosuppressive treatment, another EBV reactivation occurred, as well as cytomegalovirus (CMV) reactivation. After antiviral therapy, on day +27, elimination of EBV and CMV was achieved. Repeated chimerism tests evaluated decreasing donor chimerism; graft-versus-host disease prophylaxis was reduced from day +32 and eventually withdrawn. Later on, the patient developed acute graft-versus-host disease (skin rush, gastrointestinal dysfunction). Immunosuppressive agents (methylprednisolone, cyclosporine) were applied once again, which led to an increase of CMV viremia and polyomavirus (BK virus) primary infection.\n\n\nCONCLUSIONS\nVirus infection can induct a severe disorder, such as HLH, and recur after its treatment. We believe our case represents dynamic changes in immunologic reaction to viral infection, which depend on modifications in treatment after allo-HSCT. These observations underscore the importance and difficulty of balancing immunosuppressive therapy and infection control.",
"affiliations": "Department of Pediatric Hematology, Oncology, and Transplantology, Children's University Hospital, Lublin, Poland. Electronic address: ania1589@gmail.com.;Department of Pediatric Hematology, Oncology, and Transplantology, Children's University Hospital, Lublin, Poland.;Department of Pediatric Hematology, Oncology, and Transplantology, Children's University Hospital, Lublin, Poland; Medical University of Lublin, Lublin, Poland.",
"authors": "Fałkowska|Anna|A|;Prądzyńska|Katarzyna|K|;Drabko|Katarzyna|K|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.transproceed.2021.03.044",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-1345",
"issue": "53(6)",
"journal": "Transplantation proceedings",
"keywords": null,
"medline_ta": "Transplant Proc",
"mesh_terms": "D002648:Child; D020031:Epstein-Barr Virus Infections; D018380:Hematopoietic Stem Cell Transplantation; D004854:Herpesvirus 4, Human; D006801:Humans; D051359:Lymphohistiocytosis, Hemophagocytic; D008297:Male; D012008:Recurrence; D019172:Transplantation Conditioning",
"nlm_unique_id": "0243532",
"other_id": null,
"pages": "2035-2039",
"pmc": null,
"pmid": "33933286",
"pubdate": "2021",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Difficult Balance Between EBV Treatment and Posttransplant Immunosuppression: A Successful Transplant in a Child With Recurrent Epstein-Barr Virus-Induced Hemophagocytic Lymphohistiocytosis.",
"title_normalized": "difficult balance between ebv treatment and posttransplant immunosuppression a successful transplant in a child with recurrent epstein barr virus induced hemophagocytic lymphohistiocytosis"
} | [
{
"companynumb": "PL-PFIZER INC-2021519411",
"fulfillexpeditecriteria": "1",
"occurcountry": "PL",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE"
},
"drugadditional": "1",
... |
{
"abstract": "Atypical fractures of the diaphyseal femoral shaft have been reported in the literature at an increasing rate over the past few years. They have been observed mostly in patients who have been on prolonged courses of bisphosphonates, with no reported cases of atypical femoral fractures in those treated with other anti-resorptive medications. A 59 year old woman sustained an atypical fracture of her right femur in March 2013. She had a past medical history of rheumatoid arthritis and osteoporosis. She had been on alendronate but it was discontinued after five years in 1999. She received denosumab by subcutaneous injection in December 2012. At follow up, she complained of pain in her left femur and a radiograph revealed atypical appearances. She was admitted in June 2013 for prophylactic nailing of the left femur. To our knowledge, this is the first reported case of bilateral atypical femoral changes in a patient prescribed denosumab. Given that denosumab has been on the market for a short time period, we expect that the number of these cases will increase with time. We emphasise previous guidance that patients who present with new onset hip or thigh pain should be screened for atypical femoral fractures.",
"affiliations": "Fracture Unit, Royal Victoria Hospital, Grosvenor Road, Belfast, BT12 6BA, UK. Electronic address: robin@robinthompson.org.;Fracture Unit, Royal Victoria Hospital, Grosvenor Road, Belfast, BT12 6BA, UK.;Fracture Unit, Royal Victoria Hospital, Grosvenor Road, Belfast, BT12 6BA, UK.",
"authors": "Thompson|Robin N|RN|;Armstrong|Ciara L|CL|;Heyburn|Gary|G|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D050071:Bone Density Conservation Agents; D000069448:Denosumab; D019386:Alendronate",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1873-2763",
"issue": "61()",
"journal": "Bone",
"keywords": "Atypical femoral fracture; Denosumab; Prophylactic nailing; Rheumatoid arthritis",
"medline_ta": "Bone",
"mesh_terms": "D019386:Alendronate; D061067:Antibodies, Monoclonal, Humanized; D001172:Arthritis, Rheumatoid; D050071:Bone Density Conservation Agents; D000069448:Denosumab; D005260:Female; D005264:Femoral Fractures; D006801:Humans; D008875:Middle Aged; D010024:Osteoporosis",
"nlm_unique_id": "8504048",
"other_id": null,
"pages": "44-7",
"pmc": null,
"pmid": "24389366",
"pubdate": "2014-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Bilateral atypical femoral fractures in a patient prescribed denosumab - a case report.",
"title_normalized": "bilateral atypical femoral fractures in a patient prescribed denosumab a case report"
} | [
{
"companynumb": "PHHY2014GB145299",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ALENDRONATE SODIUM"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nBullous pemphigoid (BP) is an autoimmune skin disorder characterized by the production of autoantibodies. Several recent reports have described the occurrence of BP in diabetic patients treated with dipeptidyl peptidase-4 (DPP-4) inhibitors. However, the clinical features of BP in diabetic patients, particularly in those treated with DPP-4 inhibitors, have not yet been examined. The aim of this study was to clarify clinical characteristics of BP in elderly type 2 diabetic patients.\n\n\nMETHODS\nWe found cases of BP in 15 elderly type 2 diabetic patients (11 men, 4 women) and 20 non-diabetic patients (8 men, 12 women) from September, 2012 to September, 2016. These patients had all been treated with corticosteroid therapy. We investigated the participants' basic clinical characteristics and the course of BP treatment. The differences in variables between the two groups were analyzed using Wilcoxon's test and the chi-square test.\n\n\nRESULTS\nThe mean age of type 2 diabetes patients with BP was 81.1±5.5 years. The mean HbA1c was 7.3±1.6%. A total of 87% of diabetic patients had been treated with DPP-4 inhibitors for 11.7 months prior to the BP onset. The diabetic patients had a lower prevalence of neurogenerative disease, severe ADL disabilities, and dementia than the non-diabetic patients. Furthermore, the diabetic patients with BP tended to be younger and more frequently male than those without diabetes. After stopping the DPP-4 inhibitors, the skin lesions were successfully treated with systemic corticosteroid therapy, and glycemic control was achieved using intensive insulin therapy. DPP-4 inhibitors were used in all cases where the aniti-BP180NC16a antibody showed negative conversion.\n\n\nCONCLUSIONS\nBP in patients with type 2 diabetes had different clinical features from that in non-diabetic patients, suggesting an association between BP and the use of DPP-4 inhibitors.",
"affiliations": "Department of Diabetes, Metabolism, and Endocrinology, Tokyo Metropolitan Geriatric Hospital.;Department of Diabetes, Metabolism, and Endocrinology, Tokyo Metropolitan Geriatric Hospital.;Department of Diabetes, Metabolism, and Endocrinology, Tokyo Metropolitan Geriatric Hospital.;Department of Dermatology, Tokyo Metropolitan Geriatric Hospital.;Department of Dermatology, Tokyo Metropolitan Geriatric Hospital.;Department of Diabetes, Metabolism, and Endocrinology, Tokyo Metropolitan Geriatric Hospital.;Department of Diabetes, Metabolism, and Endocrinology, Tokyo Metropolitan Geriatric Hospital.;Department of Diabetes, Metabolism, and Endocrinology, Tokyo Metropolitan Geriatric Hospital.",
"authors": "Kodera|Remi|R|;Chiba|Yuko|Y|;Tamura|Yoshiaki|Y|;Miyazawa|Rieko|R|;Tanei|Ryoji|R|;Mori|Seijiro|S|;Ito|Hideki|H|;Araki|Atsushi|A|",
"chemical_list": "D054873:Dipeptidyl-Peptidase IV Inhibitors",
"country": "Japan",
"delete": false,
"doi": "10.3143/geriatrics.56.43",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0300-9173",
"issue": "56(1)",
"journal": "Nihon Ronen Igakkai zasshi. Japanese journal of geriatrics",
"keywords": "Bullous pemphigoid; Dipeptidyl peptidase-4 inhibitors; Elderly patients; Type 2 diabetes",
"medline_ta": "Nihon Ronen Igakkai Zasshi",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D003924:Diabetes Mellitus, Type 2; D054873:Dipeptidyl-Peptidase IV Inhibitors; D005260:Female; D006801:Humans; D008297:Male; D010391:Pemphigoid, Bullous; D016896:Treatment Outcome",
"nlm_unique_id": "7507332",
"other_id": null,
"pages": "43-50",
"pmc": null,
"pmid": "30760682",
"pubdate": "2019",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Clinical characteristics of bullous pemphigoid in elderly patients with type 2 diabetes mellitus: The association with the use of dipeptidyl peptidase-4 inhibitors.",
"title_normalized": "clinical characteristics of bullous pemphigoid in elderly patients with type 2 diabetes mellitus the association with the use of dipeptidyl peptidase 4 inhibitors"
} | [
{
"companynumb": "JP-TAKEDA-2019TJP010438",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ALOGLIPTIN"
},
"drugadditional": "1",
... |
{
"abstract": "We report on a case of metastatic urothelial bladder carcinoma (mUBC) treated with anlotinib combined with sintilimab. A 69-year-old male was diagnosed with non-muscle invasive bladder cancer (NMIBC). He received transurethral resection of bladder tumor (TURBT) and intravesical gemcitabine chemotherapy. After the patients' cancer progressed to mUBC, cisplatin-based chemotherapy (gemcitabine combined with cisplatin, GC) was performed to this patient as first line therapy for four cycles. However, the disease progressed again within 6 months. Local radiotherapy was performed on the metastatic lesions, and after radiotherapy, the patient received anti-PD-1 antibody (sintilimab 200 mg, q3w)combined with Albumin-bound (Nab)-paclitaxel (100 mg, qw) as the second-line therapy, but the patient's cancer was still observed to be progressing. Molecular characterization confirmed the presence of FGFR3 mutations in the patient. Anlotinib was recommended to this patient. After the patient was fully informed and he was aware of off-label use of the drug, then, Nab-paclitaxel was replaced by anlotinib (10 mg D1-14, q3w) and sintilimab infusions were maintained for every 3 weeks. Partial response (PR) was observed through imaging examinations and stable disease (SD) was observed for more than 11 months; the patient's quality of life also improved. This case suggested that anlotinib combined with sintilimab may be a safe and effective choice in the treatment of mUBC in patients with FGFR3 mutations.",
"affiliations": "Medical School, Ningbo University, Ningbo, China.;Department of Medical Oncology, Mingzhou Hospital, Ningbo, China.;Medical School, Ningbo University, Ningbo, China.;Department of Pathology, People's Hospital, The Affiliated Hospital of Ningbo University, Ningbo, China.;Department of Urology, Ningbo First Hospital, The Affiliated Hospital of Ningbo University, Ningbo, China.;Comprehensive Urogenital Cancer Center, Ningbo First Hospital, The Affiliated Hospital of Ningbo University, Ningbo, China.",
"authors": "Cao|Jian-Zhou|JZ|;Wu|Wei|W|;Pan|Jin-Feng|JF|;Wang|Hong-Wei|HW|;Jiang|Jun-Hui|JH|;Ma|Qi|Q|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3389/fonc.2021.643413",
"fulltext": "\n==== Front\nFront Oncol\nFront Oncol\nFront. Oncol.\nFrontiers in Oncology\n2234-943X\nFrontiers Media S.A.\n\n10.3389/fonc.2021.643413\nOncology\nCase Report\nCase Report: Anlotinib Combined With Sintilimab as Third-Line Treatment in a Metastatic Urothelial Bladder Carcinoma Patient With FGFR3 Mutation\nCao Jian-zhou 1 2\n\nWu Wei 3\nPan Jin-feng 1 2\n\nWang Hong-wei 4\nJiang Jun-hui 5 6 *\nMa Qi 2 5 6 7 *\n1 Medical School, Ningbo University, Ningbo, China\n2 Comprehensive Urogenital Cancer Center, Ningbo First Hospital, The Affiliated Hospital of Ningbo University, Ningbo, China\n3 Department of Medical Oncology, Mingzhou Hospital, Ningbo, China\n4 Department of Pathology, People’s Hospital, The Affiliated Hospital of Ningbo University, Ningbo, China\n5 Department of Urology, Ningbo First Hospital, The Affiliated Hospital of Ningbo University, Ningbo, China\n6 Ningbo Clinical Research Center for Urological Disease, Ningbo, China\n7 Translational Research Laboratory for Urology, The Key Laboratory of Ningbo City, Ningbo First Hospital, The Affiliated Hospital of Ningbo University, Ningbo, China\nEdited by: Jennifer H. Gunter, Queensland University of Technology, Australia\n\nReviewed by: Luca Afferi, Luzerner Kantonsspital, Switzerland; Georges Mjaess, Free University of Brussels, Belgium\n\n*Correspondence: Jun-hui Jiang, Jiangjh200509@126.com; Qi Ma, dr.qm@qq.com\nThis article was submitted to Genitourinary Oncology, a section of the journal Frontiers in Oncology\n\n24 5 2021\n2021\n11 64341318 12 2020\n26 4 2021\nCopyright © 2021 Cao, Wu, Pan, Wang, Jiang and Ma\n2021\nCao, Wu, Pan, Wang, Jiang and Ma\nhttps://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.\nWe report on a case of metastatic urothelial bladder carcinoma (mUBC) treated with anlotinib combined with sintilimab. A 69-year-old male was diagnosed with non-muscle invasive bladder cancer (NMIBC). He received transurethral resection of bladder tumor (TURBT) and intravesical gemcitabine chemotherapy. After the patients’ cancer progressed to mUBC, cisplatin-based chemotherapy (gemcitabine combined with cisplatin, GC) was performed to this patient as first line therapy for four cycles. However, the disease progressed again within 6 months. Local radiotherapy was performed on the metastatic lesions, and after radiotherapy, the patient received anti-PD-1 antibody (sintilimab 200 mg, q3w)combined with Albumin-bound (Nab)-paclitaxel (100 mg, qw) as the second-line therapy, but the patient’s cancer was still observed to be progressing. Molecular characterization confirmed the presence of FGFR3 mutations in the patient. Anlotinib was recommended to this patient. After the patient was fully informed and he was aware of off-label use of the drug, then, Nab-paclitaxel was replaced by anlotinib (10 mg D1–14, q3w) and sintilimab infusions were maintained for every 3 weeks. Partial response (PR) was observed through imaging examinations and stable disease (SD) was observed for more than 11 months; the patient’s quality of life also improved. This case suggested that anlotinib combined with sintilimab may be a safe and effective choice in the treatment of mUBC in patients with FGFR3 mutations.\n\nanlotinib\nsintilimab\nimmunotherapy\ntargeted therapy\nmetastatic urothelial bladder carcinoma\nScience and Technology Department of Zhejiang Province10.13039/501100008990LY20H050002 Ningbo Municipal Bureau of Science and Technology10.13039/501100007928Ningbo Municipal Human Resources and Social Security Bureau10.13039/501100017533\n==== Body\nBackground\n\nThe prognosis of patients with mUBC is very poor if the disease progresses after platinum-based chemotherapy (1). The immune checkpoint inhibitors programmed cell death ligand-1 (PD-L1)/programmed death-1 (PD-1) are clinically active reagents for mUBC. Both of them are FDA-approved as second-line treatments (2). However, the objective response rate (ORR) was achieved in only 17% to 24% of these patients (3–7).\n\nFibroblast growth factor receptors (FGFRs) induce signaling through networks that regulate cell proliferation, survival, migration, and differentiation (8). FGFR3 is one of the most frequently mutated genes and is a promising target in urothelial carcinoma (UC) (9). FGFR3 is altered in 50% to 80% of low-grade and low-stage UC, particularly in the luminal I subtype. Conversely, FGFR3 mutations are less common (20%) in mUC (9, 10). FGFR inhibitors such as erdafitinib, when used to treat patients who had locally advanced or unresectable mUC with FGFR alterations, were shown to have an objective tumor response of 40% (11). The FDA has approved the use of erdafitinib for patients with locally advanced or mUC that has progressed during or after platinum-based chemotherapy and whose tumors have susceptible FGFR3 or FGFR2 genetic alterations (12).\n\nAnlotinib is a novel multitarget tyrosine kinase inhibitor. It was originally designed to inhibit VEGFR2/3, FGFR1–4 with high affinity (13, 14). Clinical trials have indicated that anlotinib significantly prolongs the progression-free survival (PFS) of patients with non-small cell lung cancer (NSCLC) (13, 15, 16). medullary thyroid carcinoma (MTC) (13) and metastatic renal cell carcinoma (mRCC) (17). Sintilimab is an IgG4 monoclonal PD-1 antibody that was derived from humans, and it blocks the binding of PD-1 to PD-L1 or PD-L2 (18). It has been shown excellent clinical benefits in the treatment of relapsed or refractory Hodgkin’s lymphoma (19, 20) and NSCLC (21, 22).\n\nHere we report on a 69-year-old male mUBC patient who had the FGFR3 mutations and was successfully treated with sintilimab combined with anlotinib as the third-line treatment, following the progression of cancer after first-line platinum-based chemotherapy and second-line Nab-paclitaxel plus sintilimab treatment.\n\nCase Presentation\n\nA 67-year-old man with no family and psychosocial history presented with hematuria in 2016 and was diagnosed with bladder carcinoma using cystoscopy. TURBT pathology indicated that the patient has stage-TaG1 UBC ( Figure 1A ). Single-dose intravesical gemcitabine chemotherapy within 24 hours after receiving TURBT was recommended for the patient. However, 2 months after TURBT was performed, cystoscopy revealed bladder carcinoma recurrence. Between July 2016 and May 2018, TURBT was repeated five times due to cancer recurrence and progression ( Figures 1B–F ). After the fifth TURBT was performed, abdominal computed tomography (CT) ( Figure 2 -1) revealed bladder carcinoma recurrence and pelvic metastasis. Further evaluation of the pelvis using magnetic resonance imaging (MRI) suggested multiple metastatic foci of the pelvic muscle 、bone and lymph nodes. Pelvic bone metastases were also found using emission computed tomography (ECT). The patient was diagnosed as mUBC on December 13, 2018. At that time, the ECOG score of this patient was 0 and the glomerular filtration rate (GFR) was 69 ml/min. He was treated with first-line cisplatin-based chemotherapy (gemcitabine combined with cisplatin, GC) for four cycles. The disease obtained an objective response and was stable for 6 months, after which imaging suggested that the disease progressed again. As the patient responded to GC chemotherapy previously, the patient received another two cycles of GC chemotherapy. Unexpectedly, the patient experienced severe pain and could not tolerate the toxicity of chemotherapy. Next, the patient received radiotherapy to the metastatic lesions from July to August 2019, with a total dose of 55 Gy, 2.2 Gy daily, up to 25 fractions to control pain and improve local cancer control. Then, anti-PD-1 antibody (sintilimab 200 mg, q3w) combined with Nab-paclitaxel (100mg, qw) was given to this patient as the second-line therapy on November 28, 2019. Unfortunately, after four cycles treatment, the patient’s abdominal CT ( Figure 2 –6) showed that the treatment had failed and the patients’ condition continued to deteriorate. He experienced severe bladder irritation due to tumor progression and radiation cystitis, the patient required 120 mg of Morphine Sulfate sustained-release tablets to control local pain.\n\nFigure 1 Six pathological reports of TURBT. (A) 2016-07-07, Papillary urothelial carcinoma, low-grade; (B) 2016-09-27, Necrotic tissue; (C) 2017-06-15, Chronic inflammation of the bladder mucosa with atypical hyperlasia; (D) 2017-12-14, Chronic inflammation of the bladder mucosa with atypical hyperlasia; (E) 2018-05-10, Papillary urothelial carcinoma, low-grade; (F) 2018-11-23, Papillary urothelial carcinoma, high-grade.\n\nFigure 2 Imaging manifestations of treatment.\n\nTo provide further treatment to this patient, we performed genetic sequencing and molecular characterization confirmed the presence of FGFR3, PIK3CA, and TP53 mutations in the patient ( Figure 3 ). Both erdafitinib and rogaratinib have been tested in clinical trial for FGFR mutated mUBC (23), however, both drugs are not affordable in China. We encouraged the patient to enrollment a clinical trial (NCT03390504) sponsored by Johnson & Johnson (24), which treated mUBC patients with FGFR mutation by erdafitinib. However, the patient did not have strong intention to enroll into this trial.\n\nFigure 3 The molecular characterization.\n\nThus, after careful consideration, anlotinib, a multitarget tyrosine kinase inhibitor designed to inhibit VEGFR2/3, FGFR1–4 with high affinity, was recommended to this patient. The patient was fully informed and he was aware of off-label use of the drug. With the patient’s consent, Nab-paclitaxel was changed to anlotinib (10 mg D1-14 q3w) on March 9, 2020, and the infusion of sintilimab was maintained. After treatment with sintilimab combined with anlotinib, the patient’s symptoms improved within 2 weeks and the dose of Morphine Sulfate sustained-release tablets was decreased and eventually stopped. After three cycles, the disease was evaluated by abdominal CT ( Figure 2 ) and PR was observed. Currently, the cancer has been stable for over 11 months and the patient is still being followed up. Except for a mild Hand-foot syndrome, no serious adverse events(AE) occurred while receiving sintilimab combined with anlotinib. The patient has not significant decreased in quality of life during treatment and he is quite satisfied with the outcome. The timeline of the patients’ treatment is described in Figure 4 .\n\nFigure 4 The timeline of treatment.\n\nDiscussion\n\nPlatinum-based chemotherapy can prolong overall survival (OS) in patients with mUBC, but cancer progression is almost inevitable (25). Nab-paclitaxel as a second-line treatment has demonstrated some positive preliminary activity in patients with mUBC (26). Yoo-Joung Ko reported on a single-group phase II trial which investigated the activity of Nab-paclitaxel 260 mg/m2 every 3 weeks as a second-line therapy for mUBC (26, 27). The results suggested that Nab-paclitaxel was well tolerated, but the clinical effect of Nab-paclitaxel monotherapy was limited (27). Recently, PD-1/PD-L1 inhibitors have been demonstrated to be relatively safe and have shown positive clinical activity in patients with mUBC (2, 6, 28), however, the ORR of single PD1/PD-L1 treatment was only 17% to 24% (3–7). To further improve PD1/PD-L1 treatment efficacy, PD-1 was combined with Nab-paclitaxel as a second-line therapy for mUBC. The open-label, single-arm, phase II PEANUT study found that the Pembrolizumab and Nab-paclitaxel salvage therapy for platinum-treated failed mUBC had a favorable safety profile, the PFS was 5 months, and the clinical ORR was 44.4% (29). Thus, when the patient was found that the disease progressed quickly after first line GC therapy, we tried to combine Nab-paclitaxel and PD-1/PD-L1 to control the disease.\n\nAlthough five kinds of PD-1/PD-L1 are FDA approved for second-line treatments of mUBC (12), only Pembrolizumab and Nivolumab were available in China when the patient decided to receive PD-1/PD-L1 therapy. However, both Pembrolizumab and Nivolumab did not get formal permission for indication of mUBC treatment in China. Moreover, both drugs were too expensive to use. Thus, after careful discussion with the patient, we decided to choose another cheaper PD-1 antibody to substitute Pembrolizumab or Nivolumab.\n\nAccording to the pre-clinical data, sintilimab binds to human PD-1 with a greater affinity than nivolumab and pembrolizumab (18). The high binding affinity and unique PD-1 epitopes bound by sintilimab might be responsible for its superior clinical effectiveness (18). Sintilimab has shown excellent clinical benefits in the treatment of relapsed or refractory Hodgkin’s lymphoma (19, 20) and NSCLC (21, 22). Theoretically, sintilimab combined with Nab-paclitaxel may produce favorable results for this patient, however, in this case, the combination was unsuccessful.\n\nGenetic testing confirmed the presence of FGFR3, PIK3CA, and TP53 mutations in the patient. FGFR3 mutations are associated with a lower response to platinum-based chemotherapy and a shorter recurrence time in patients with mUBC (30, 31), which was consistent with this patient who received six cycles of platinum-based chemotherapy. Erdafitinib, a pan-FGFR inhibitor, has been granted accelerated approval by the FDA for platinum-pretreated mUBC with susceptible to FGFR3 or FGFR2 genetic alterations (32), but Erdafitinib is unaffordable in China.\n\nAnlotinib was originally designed to inhibit VEGFR2/3, FGFR1–4 with high affinity (13, 14). Anlotinib also suppresses the activity of PDGFRα/β, c-Kit, Ret, Aurora-B, c-FMS, proving that it has broad inhibitory effects on tumor proliferation, vasculature, and tumor microenvironment (13, 14). In clinical trials, anlotinib showed broad antitumor activity against a variety of tumors. In advanced refractory solid tumors, anlotinib displayed manageable toxicity, and broad-spectrum antitumor potential (13). In locally advanced or metastatic MTC, 56.9% of patients experienced a PR after anlotinib treatment. PFS rate at 48 weeks was 85.5% (33). In a phase II trial on 166 patients with refractory metastatic soft-tissue sarcoma, the median progression-free survival and OS were 5.6 and 12 months, respectively (14). Similarly, in advanced NSCLC, Anlotinib appeared to lead to prolonged OS and PFS. OS was significantly longer in the anlotinib group than the placebo group (9.6 months vs 6.3 months) (16). Furthermore, anlotinib demonstrated that it had a better prognosis compared to sunitinib as the first-line treatment for patients with mRCC in a randomized phase II trial (17). In this trial, Anlotinib’s safety profile was excellent, especially in terms of hematological toxicities (17).\n\nIn addition to anti-tumor efficacy, anlotinib has the potential to modulate the tumor microenvironment and improve immunotherapy. A lung cancer mouse model showed that anlotinib could increase infiltration of innate immune cells such as natural killer (NK) cells and antigen-presenting cells (APC) into tumor microenvironment (15). Subsequently, when combined with PD-1/PD-L1 blockade, anlotinib provided significantly synergistic therapeutic benefits (15). A retrospective study further demonstrated the efficacy and safety of anlotinib with immunotherapy in advanced NSCLS as a third-line therapy (34). Based on these studies, we attempted to treat this patient by anlotinib combined with sintilimab, and favorable results were obtained.\n\nTo our knowledge, this is the first report that used anlotinib combined with sintilimab as the third-line treatment in an mUBC patient with FGFR3 mutation, who obtained a PR and was stable for more than 11 months. This case indicates that mUBC patients with FGFR3 mutations whose disease progresses after platinum-based chemotherapy may be able to use anlotinib combined with sintilimab as a new potential treatment choice, but we have only one case and further studies should be conducted to evaluate the efficacy and safety of this combination.\n\nData Availability Statement\n\nThe original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding authors.\n\nEthics Statement\n\nThe studies involving human participants were reviewed and approved by the ethical review committee of Ningbo First Hospital. The patients/participants provided their written informed consent to participate in this study.\n\nAuthor Contributions\n\nConception/design: QM. Provision of study materials or patients: QM, WW, and J-HJ. Collection and/or assembly of data: QM, J-ZC, J-FP, WW, and H-WW. Data analysis and interpretation: QM and J-ZC. Manuscript writing: J-ZC and QM. Final approval of manuscript: All authors. All authors contributed to the article and approved the submitted version.\n\nFunding\n\nThis study was supported by Zhejiang Natural Science Fund (grant no. LY20H050002 to QM, grant no. LY18H05000 to J-HJ), Ningbo Natural Science Fund (grant no. 2018A610297 to QM), Ningbo Social Development Fund (grant no. 202002N3192 to QM), and the Fund of Ningbo Clinical Research Center for Urological Disease (2019A21001).\n\nConflict of Interest\n\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n\nAcknowledgments\n\nThe authors wish to thank Dr. Maria Haleem and Dr. Derry Minyao Ng (School of medicine, Ningbo University) for their assistance in English editing.\n==== Refs\nReferences\n\n1 Apolo AB Ellerton JA Infante JR Agrawal M Gordon MS Aljumaily R . Avelumab as Second-Line Therapy for Metastatic, Platinum-Treated Urothelial Carcinoma in the Phase Ib Javelin Solid Tumor Study: 2-Year Updated Efficacy and Safety Analysis. J Immunother Cancer (2020) 8 (2 ):e001246. 10.1136/jitc-2020-001246 33037118\n2 Balar AV Galsky MD Rosenberg JE Powles T Petrylak DP Bellmunt J . Atezolizumab as First-Line Treatment in Cisplatin-Ineligible Patients With Locally Advanced and Metastatic Urothelial Carcinoma: A Single-Arm, Multicentre, Phase 2 Trial. Lancet (London England) (2017) 389 (10064 ):67–76. 10.1016/s0140-6736(16)32455-2\n3 Bellmunt J de Wit R Vaughn DJ Fradet Y Lee JL Fong L . Pembrolizumab as Second-Line Therapy for Advanced Urothelial Carcinoma. New Engl J Med (2017) 376 (11 ):1015–26. 10.1056/NEJMoa1613683\n4 Powles T Durán I van der Heijden MS Loriot Y Vogelzang NJ De Giorgi U . Atezolizumab Versus Chemotherapy in Patients With Platinum-Treated Locally Advanced or Metastatic Urothelial Carcinoma (Imvigor211): A Multicentre, Open-Label, Phase 3 Randomised Controlled Trial. Lancet (London England) (2018) 391 (10122 ):748–57. 10.1016/s0140-6736(17)33297-x\n5 Sharma P Retz M Siefker-Radtke A Baron A Necchi A Bedke J . Nivolumab in Metastatic Urothelial Carcinoma After Platinum Therapy (Checkmate 275): A Multicentre, Single-Arm, Phase 2 Trial. Lancet Oncol (2017) 18 (3 ):312–22. 10.1016/s1470-2045(17)30065-7\n6 Massard C Gordon MS Sharma S Rafii S Wainberg ZA Luke J . Safety and Efficacy of Durvalumab (medi4736), an Anti-Programmed Cell Death Ligand-1 Immune Checkpoint Inhibitor, in Patients With Advanced Urothelial Bladder Cancer. J Clin Oncol Off J Am Soc Clin Oncol (2016) 34 (26 ):3119–25. 10.1200/jco.2016.67.9761\n7 Apolo AB Infante JR Balmanoukian A Patel MR Wang D Kelly K . Avelumab, an Anti-Programmed Death-Ligand 1 Antibody, in Patients With Refractory Metastatic Urothelial Carcinoma: Results From a Multicenter, Phase Ib Study. J Clin Oncol Off J Am Soc Clin Oncol (2017) 35 (19 ):2117–24. 10.1200/jco.2016.71.6795\n8 Haugsten EM Wiedlocha A Olsnes S Wesche J . Roles of Fibroblast Growth Factor Receptors in Carcinogenesis. Mol Cancer Res MCR (2010) 8 (11 ):1439–52. 10.1158/1541-7786.Mcr-10-0168\n9 Van Rhijn BWG Mertens LS Mayr R Bostrom PJ Zuiverloon TCM . FGFR3 Mutation Status and FGFR3 Expression in a Large Bladder Cancer Cohort Treated by Radical Cystectomy: Implications for Anti-FGFR3 Treatment? Eur Urol (2020) 78 (5 ):682–7. 10.1016/j.eururo.2020.07.002\n10 Sung JY Sun JM Chang Jeong B Il Seo S Soo Jeon S Moo Lee H . Fgfr3 Overexpression is Prognostic of Adverse Outcome for Muscle-Invasive Bladder Carcinoma Treated With Adjuvant Chemotherapy. Urol Oncol (2014) 32 (1 ):49. 10.1016/j.urolonc.2013.07.015\n11 Loriot Y Necchi A Park SH Garcia-Donas J Huddart R Burgess E . Erdafitinib in Locally Advanced or Metastatic Urothelial Carcinoma. New Engl J Med (2019) 381 (4 ):338–48. 10.1056/NEJMoa1817323\n12 Flaig TW Spiess PE Agarwal N Bangs R Boorjian SA Buyyounouski MK . Bladder Cancer, Version 3.2020, nccn Clinical Practice Guidelines in Oncology. J Natl Compr Cancer Network JNCCN (2020) 18 (3 ):329–54. 10.6004/jnccn.2020.0011\n13 Sun Y Niu W Du F Du C Li S Wang J . Safety, Pharmacokinetics, and Antitumor Properties of Anlotinib, an Oral Multi-Target Tyrosine Kinase Inhibitor, in Patients With Advanced Refractory Solid Tumors. J Hematol Oncol (2016) 9 (1 ):105. 10.1186/s13045-016-0332-8 27716285\n14 Chi Y Fang Z Hong X Yao Y Sun P Wang G . Safety and Efficacy of Anlotinib, a Multikinase Angiogenesis Inhibitor, in Patients With Refractory Metastatic Soft-Tissue Sarcoma. Clin Cancer Res (2018) 24 (21 ):5233–8. 10.1158/1078-0432.Ccr-17-3766\n15 Yang Y Li L Jiang Z Wang B Pan Z . Anlotinib Optimizes Anti-Tumor Innate Immunity to Potentiate the Therapeutic Effect of Pd-1 Blockade in Lung Cancer. Cancer Immunol Immunother CII (2020) 69 (12 ):2523–32. 10.1007/s00262-020-02641-5\n16 Han B Li K Wang Q Zhang L Shi J Wang Z . Effect of Anlotinib as a Third-Line or Further Treatment on Overall Survival of Patients With Advanced non-Small Cell Lung Cancer: The Alter 0303 Phase 3 Randomized Clinical Trial. JAMA Oncol (2018) 4 (11 ):1569–75. 10.1001/jamaoncol.2018.3039\n17 Zhou AP Bai Y Song Y Luo H Ren XB Wang X . Anlotinib Versus Sunitinib as First-Line Treatment for Metastatic Renal Cell Carcinoma: A Randomized Phase Ii Clinical Trial. Oncologist (2019) 24 (8 ):e702–8. 10.1634/theoncologist.2018-0839\n18 Wang J Fei K Jing H Wu Z Wu W Zhou S . Durable Blockade of Pd-1 Signaling Links Preclinical Efficacy of Sintilimab to its Clinical Benefit. mAbs (2019) 11 (8 ):1443–51. 10.1080/19420862.2019.1654303\n19 Armand P Engert A Younes A . Nivolumab for Relapsed/Refractory Classic Hodgkin Lymphoma After Failure of Autologous Hematopoietic Cell Transplantation: Extended Follow-Up of the Multicohort Single-Arm Phase II Checkmate 205 Trial. J Clin Oncol (2018) 36 (14 ):1428–39. 10.1200/JCO.2017.76.0793\n20 Chen R Zinzani PL Fanale MA Armand P Johnson NA Brice P . Phase II Study of the Efficacy and Safety of Pembrolizumab for Relapsed/Refractory Classic Hodgkin Lymphoma. J Clin Oncol (2017) 35 (19 ):2125–32. 10.1200/JCO.2016.72.1316\n21 Yang Y Wang Z Fang J Yu Q Han B Cang S . Efficacy and Safety of Sintilimab Plus Pemetrexed and Platinum as First-Line Treatment for Locally Advanced or Metastatic Nonsquamous Nsclc: A Randomized, Double-Blind, Phase 3 Study (Oncology Program by Innovent Anti-Pd-1-11). J Thorac Oncol (2020) 15 (10 ):1636–46. 10.1016/j.jtho.2020.07.014\n22 Shi Y Su H Song Y Jiang W Sun X Qian W . Safety and Activity of Sintilimab in Patients With Relapsed or Refractory Classical Hodgkin Lymphoma (Orient-1): A Multicentre, Single-Arm, Phase 2 Trial. Lancet Haematol (2019) 6 (1 ):e12–9. 10.1016/s2352-3026(18)30192-3\n23 Casadei C Dizman N Schepisi G Cursano MC Basso U Santini D . Targeted Therapies for Advanced Bladder Cancer: New Strategies With Fgfr Inhibitors. Ther Adv Med Oncol (2019) 11 :1758835919890285. 10.1177/1758835919890285 31803255\n24 . Available at: https://clinicaltrials.gov/show/.\n25 Bellmunt J Orsola A Leow JJ Wiegel T De Santis M Horwich A . Bladder Cancer: Esmo Practice Guidelines for Diagnosis, Treatment and Follow-Up. Ann Oncol (2014) 25 Suppl 3 :iii40–48. 10.1093/annonc/mdu223\n26 Sonpavde G Galsky MD Bellmunt J . A New Approach to Second-Line Therapy for Urothelial Cancer? Lancet Oncol (2013) 14 (8 ):682–4. 10.1016/s1470-2045(13)70175-x\n27 Ko YJ Canil CM Mukherjee SD Winquist E Elser C Eisen A . Nanoparticle Albumin-Bound Paclitaxel for Second-Line Treatment of Metastatic Urothelial Carcinoma: A Single Group, Multicentre, Phase 2 Study. Lancet Oncol (2013) 14 (8 ):769–76. 10.1016/s1470-2045(13)70162-1\n28 Powles T Eder JP Fine GD Braiteh FS Loriot Y Cruz C . Mpdl3280a (anti-pd-l1) Treatment Leads to Clinical Activity in Metastatic Bladder Cancer. Nature (2014) 515 (7528 ):558–62. 10.1038/nature13904\n29 Giannatempo P Raggi D Marandino L Bandini M Farè E Calareso G . Pembrolizumab and Nab-Paclitaxel as Salvage Therapy for Platinum-Treated, Locally Advanced or Metastatic Urothelial Carcinoma: Interim Results of the Open-Label, Single-Arm, Phase Ii Peanut Study. Ann Oncol Off J Eur Soc Med Oncol (2020) 31 (12 ):1764–72. 10.1016/j.annonc.2020.09.012\n30 Robertson AG Kim J Al-Ahmadie H Bellmunt J Guo G Cherniack AD . Comprehensive Molecular Characterization of Muscle-Invasive Bladder Cancer. Cell (2017) 171 (3 ):540–556.e525. 10.1016/j.cell.2017.09.007 28988769\n31 Teo MY Mota JM Whiting KA Li HA Funt SA Lee CH . Fibroblast Growth Factor Receptor 3 Alteration Status is Associated With Differential Sensitivity to Platinum-Based Chemotherapy in Locally Advanced and Metastatic Urothelial Carcinoma. Eur Urol (2020) 78 (6 ):907–15. 10.1016/j.eururo.2020.07.018\n32 Nadal R Bellmunt J . Management of Metastatic Bladder Cancer. Cancer Treat Rev (2019) 76 :10–21. 10.1016/j.ctrv.2019.04.002 31030123\n33 Sun Y Du F Gao M Ji Q Li Z Zhang Y . Anlotinib for the Treatment of Patients With Locally Advanced or Metastatic Medullary Thyroid Cancer. Thyroid (2018) 28 (11 ):1455–61. 10.1089/thy.2018.0022\n34 Yang S Zhang W Chen Q Guo Q . Clinical Investigation of the Efficacy and Safety of Anlotinib With Immunotherapy in Advanced Non-Small Cell Lung Cancer as Third-Line Therapy: A Retrospective Study. Cancer Manage Res (2020) 12 :10333–40. 10.2147/cmar.S280096\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2234-943X",
"issue": "11()",
"journal": "Frontiers in oncology",
"keywords": "anlotinib; immunotherapy; metastatic urothelial bladder carcinoma; sintilimab; targeted therapy",
"medline_ta": "Front Oncol",
"mesh_terms": null,
"nlm_unique_id": "101568867",
"other_id": null,
"pages": "643413",
"pmc": null,
"pmid": "34109111",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "21047773;28131785;30902918;31340094;33037118;25096609;32135513;23706985;32979512;28441111;30142994;28375787;24360661;29584546;30098152;32781263;31803255;27269937;29268948;33116888;28988769;27716285;31402780;32577817;32682615;27939400;31030123;29895706;28212060;23706984;25428503;32753285;30612710",
"title": "Case Report: Anlotinib Combined With Sintilimab as Third-Line Treatment in a Metastatic Urothelial Bladder Carcinoma Patient With FGFR3 Mutation.",
"title_normalized": "case report anlotinib combined with sintilimab as third line treatment in a metastatic urothelial bladder carcinoma patient with fgfr3 mutation"
} | [
{
"companynumb": "CN-SUNPHARMA-2022R1-328417AA",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CISPLATIN"
},
"drugadditional": "3",
... |
{
"abstract": "Brugada electrocardiographic pattern, or Brugada phenocopy (BrP), can be found in conditions other than Brugada syndrome. We present the case of a 34-year-old woman who was found convulsing at home followed by ventricular tachycardia (VT) cardiac arrest upon arrival to the emergency department. Electrical direct cardioversion led to a return of spontaneous circulation, and she was started on intravenous amiodarone. The patient had four additional episodes of pulseless VT that returned to sinus rhythm with electrical cardioversion. A subsequent electrocardiogram taken in sinus rhythm revealed a right bundle branch block pattern with a coved ST segment elevation and inverted T waves in leads V1 and V2, suggestive of BrP type 1. Further inquiry revealed that an empty bottle of nortriptyline was found at her home. Nortriptyline intoxication was subsequently confirmed by a serum level of 1581 ng/mL. Treatments with intravenous sodium bicarbonate resolved the BrP, and she fully recovered with supportive care. Intoxication with drugs that inhibit cardiac sodium channels, such as nortriptyline, can trigger a BrP in otherwise normal individuals. Nortriptyline and other tricyclic antidepressants (TCAs) are used to treat chronic pain, depression, and other conditions but have dose-related side effects and can lead to fatal overdose. Intoxication by these TCAs should be on the differential when a BrP is observed.",
"affiliations": "ICAHN SCHOOL OF MEDICINE AT MOUNT SINAI HOSPITAL, NEW YORK, NEW YORK.;ICAHN SCHOOL OF MEDICINE AT MOUNT SINAI HOSPITAL, NEW YORK, NEW YORK.;ICAHN SCHOOL OF MEDICINE AT MOUNT SINAI HOSPITAL, NEW YORK, NEW YORK.",
"authors": "Otero|Diana|D|;Petrovic|Marija|M|;Liao|Steve Lin|SL|",
"chemical_list": "D000929:Antidepressive Agents, Tricyclic; D009661:Nortriptyline",
"country": "United States",
"delete": false,
"doi": "10.14797/mdcj-16-3-245",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1947-6108",
"issue": "16(3)",
"journal": "Methodist DeBakey cardiovascular journal",
"keywords": "Brugada phenocopy; nortriptyline overdose; ventricular tachycardia",
"medline_ta": "Methodist Debakey Cardiovasc J",
"mesh_terms": "D000328:Adult; D000929:Antidepressive Agents, Tricyclic; D053840:Brugada Syndrome; D003937:Diagnosis, Differential; D062787:Drug Overdose; D004562:Electrocardiography; D005260:Female; D006801:Humans; D009661:Nortriptyline; D011237:Predictive Value of Tests; D017180:Tachycardia, Ventricular",
"nlm_unique_id": "101508600",
"other_id": null,
"pages": "245-248",
"pmc": null,
"pmid": "33133362",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "3370662;31078108;20659475;17697824;3706169;30856002;1309182;24669289",
"title": "Brugada Phenocopy: A Case of Incessant Ventricular Tachycardia in a Patient with Tricyclic Antidepressant Overdose.",
"title_normalized": "brugada phenocopy a case of incessant ventricular tachycardia in a patient with tricyclic antidepressant overdose"
} | [
{
"companynumb": "US-SPECGX-T202002352",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "NORTRIPTYLINE HYDROCHLORIDE"
},
"drugadditional": ... |
{
"abstract": "To determine whether concurrent posttraumatic stress disorder (PTSD) should affect whether to augment or switch medications when major depressive disorder (MDD) has not responded to a prior antidepressant trial.\n\n\n\nPatients at 35 Veterans Health Administration medical centers from December 2012 to May 2015 with nonpsychotic MDD (N = 1,522) and a suboptimal response to adequate antidepressant treatment were randomly assigned to 3 \"next step\" treatments: switching to bupropion, augmenting the current antidepressant with bupropion, and augmenting with the antipsychotic aripiprazole. Blinded ratings with the 16-item Quick Inventory of Depressive Symptomatology-Clinician Rated (QIDS-C₁₆) determined remission and response by 12 weeks and relapse after remission. Survival analyses compared treatment effects in patients with concurrent PTSD diagnosed with the Mini-International Neuropsychiatric Interview (n = 717, 47.1%) and those without PTSD (n = 805, 52.9%).\n\n\n\nPatients diagnosed with PTSD showed more severe depressive symptoms at baseline and were less likely to achieve either remission or response by 12 weeks. Augmentation with aripiprazole was associated with greater likelihood of achieving response (68.4%) than switching to bupropion (57.7%) in patients with PTSD (relative risk [RR] = 1.26; 95% CI, 1.01-1.59) as well as in patients without PTSD (RR = 1.29; 95% CI, 1.05-1.97) (78.9% response with aripiprazole augmentation vs 66.9% with switching to bupropion). Treatment comparisons with the group receiving augmentation with bupropion were not significant. There was no significant interaction between treatment group and PTSD on remission (P = .70), response (P = .98), or relapse (P = .15).\n\n\n\nAlthough PTSD was associated with poorer overall outcomes, the presence of concurrent PTSD among Veterans in this trial did not affect the comparative effectiveness of medications on response, remission, or relapse after initial remission.\n\n\n\nClinicalTrials.gov identifier: NCT01421342.",
"affiliations": "VA Connecticut Healthcare System, 950 Campbell Ave, Mailstop (182), West Haven, CT 06516. somaia.mohamed@va.gov.;VA Connecticut Healthcare System, West Haven, Connecticut, USA.;VA Connecticut Healthcare System, West Haven, Connecticut, USA.;VA San Diego Healthcare System, San Diego, California, USA.;Baylor Scott and White Health, Temple, Texas, USA.;Louis Stokes Cleveland VA Medical Center, Cleveland, Ohio, USA.;VA San Diego Healthcare System, San Diego, California, USA.;Louis Stokes Cleveland VA Medical Center, Cleveland, Ohio, USA.;Tuscaloosa VA Medical Center, Tuscaloosa, Alabama, USA.;Tuscaloosa VA Medical Center, Tuscaloosa, Alabama, USA.;Tucson VA Medical Center, Tucson, Arizona, USA.;Salem VA Medical Center, Salem, Virginia, USA.;Salem VA Medical Center, Salem, Virginia, USA.;Cincinnati VA Medical Center, Cincinatti, Ohio, USA.;Charles George VA Medical Center, Asheville, North Carolina, USA.;Philadelphia VA Medical Center, Philadelphia, Pennsylvania, USA.;VA San Diego Healthcare System, San Diego, California, USA.;The names of all participants in the VAST-D Study are listed in Supplementary Appendix 1.",
"authors": "Mohamed|Somaia|S|;Johnson|Gary R|GR|;Sevilimedu|Varadan|V|;Rao|Sanjai D|SD|;Hicks|Paul B|PB|;Chen|Peijun|P|;Lauro|Kimberly|K|;Jurjus|George|G|;Pilkinton|Patricia|P|;Davis|Lori|L|;Wilcox|James A|JA|;Iranmanesh|Ali|A|;Sapra|Mamta|M|;Aslam|Muhammad|M|;Michalets|James|J|;Thase|Michael|M|;Zisook|Sidney|S|;|||",
"chemical_list": "D000928:Antidepressive Agents; D016642:Bupropion; D000068180:Aripiprazole",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0160-6689",
"issue": "81(4)",
"journal": "The Journal of clinical psychiatry",
"keywords": null,
"medline_ta": "J Clin Psychiatry",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000928:Antidepressive Agents; D000068180:Aripiprazole; D016642:Bupropion; D003865:Depressive Disorder, Major; D061218:Depressive Disorder, Treatment-Resistant; D004351:Drug Resistance; D004359:Drug Therapy, Combination; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D016037:Single-Blind Method; D013313:Stress Disorders, Post-Traumatic; D055815:Young Adult",
"nlm_unique_id": "7801243",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "32603560",
"pubdate": "2020-06-23",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D013486:Research Support, U.S. Gov't, Non-P.H.S.",
"references": null,
"title": "Impact of Concurrent Posttraumatic Stress Disorder on Outcomes of Antipsychotic Augmentation for Major Depressive Disorder With a Prior Failed Treatment: VAST-D Randomized Clinical Trial.",
"title_normalized": "impact of concurrent posttraumatic stress disorder on outcomes of antipsychotic augmentation for major depressive disorder with a prior failed treatment vast d randomized clinical trial"
} | [
{
"companynumb": "US-OTSUKA-2020_016939",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ARIPIPRAZOLE"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nDrug-induced liver enzyme abnormalities may indicate hepatic injury. Antipsychotic drugs also may cause increase in the liver enzymes and serum bilirubin levels. The present report evaluates the case of a patient with risperidone-associated hepatocellular damage.\n\n\nMETHODS\nA 19-year-old Caucasian man was admitted to the Department of Psychiatry with paranoid schizophrenia and risperidone was administered in a gradually increasing dose up to 8 mg/day. After 3 weeks of treatment, he experienced asthenia and weight loss. The level of aspartate aminotransferase was 283 IU/L (normal: <30 IU/L), and the alanine aminotransferase level was 778 IU/L (normal: <36 IU/L). Treatment with risperidone was immediately discontinued. Six days after drug withdrawal, the alanine aminotransferase level fell more than 50%, and a complete return to normalcy was seen within 2 months.\n\n\nRESULTS\nIn the present case, a possible causal association between risperidone and hepatocellular damage has been observed due to the temporal relationship between the administration of the drug and the onset of hepatic abnormalities, and a following rapid recovery after stopping the drug. As the hepatic damage could be related to the plasma concentration of risperidone which is highly influenced by the hepatic enzyme CYP2D6, the patient was genotyped for CYP2D6. He was classified as homozygous wild type for CYP2D6.\n\n\nCONCLUSIONS\nThe risk for developing hepatotoxicity during risperidone therapy cannot be supported by the patient CYP2D6 genotype. In clinical practice, it may be recommended to obtain baseline liver function tests before starting risperidone and regular screening for liver enzyme changes during therapy.",
"affiliations": null,
"authors": "López-Torres|Enrique|E|;Süveges|Agnes|A|;Peñas-LLedó|Eva M|EM|;Doña|Alvaro|A|;Dorado|Pedro|P|;LLerena|Adrián|A|;Berecz|Roland|R|",
"chemical_list": "D014150:Antipsychotic Agents; D019389:Cytochrome P-450 CYP2D6; D018967:Risperidone",
"country": "Germany",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0792-5077",
"issue": "29(2)",
"journal": "Drug metabolism and drug interactions",
"keywords": null,
"medline_ta": "Drug Metabol Drug Interact",
"mesh_terms": "D000328:Adult; D014150:Antipsychotic Agents; D056486:Chemical and Drug Induced Liver Injury; D019389:Cytochrome P-450 CYP2D6; D006720:Homozygote; D006801:Humans; D008111:Liver Function Tests; D008297:Male; D018967:Risperidone; D055815:Young Adult",
"nlm_unique_id": "8904736",
"other_id": null,
"pages": "123-6",
"pmc": null,
"pmid": "24598833",
"pubdate": "2014",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Liver enzyme abnormalities during antipsychotic treatment: a case report of risperidone-associated hepatotoxicity.",
"title_normalized": "liver enzyme abnormalities during antipsychotic treatment a case report of risperidone associated hepatotoxicity"
} | [
{
"companynumb": "ES-MYLAN-2014M1001419",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "RISPERIDONE"
},
"drugadditional": null,
... |
{
"abstract": "Ponatinib is effective in adults with Philadelphia chromosome-positive (Ph+) leukaemias, but scant data are available regarding the use of this tyrosine kinase inhibitor in children.\n\n\n\nThe aim of this study isto describe the tolerance and efficacy of compassionate use of ponatinib in a paediatric cohort of patients with Ph+ leukaemias.\n\n\n\nData from 11 children with chronic myeloid leukaemia (CML) registered to the international registry of childhood chronic myeloid leukaemia and from 3 children with Ph+ acute lymphoblastic leukaemia (Ph+ ALL) treated with ponatinib were collected retrospectively.\n\n\n\nIn 11 girls and 3 boys (median age 14 years), ponatinib was used as a second- to eighth-line treatment. Ponatinib was administered as single therapy (9 patients) or in combination with chemotherapy (8 patients). The status of the disease when ponatinib was started was as follows: CML in advanced phases (n = 8), CML in chronic phase without achievement of molecular response (n = 2) or presence of T315I mutation (n = 1) and Ph + ALL in molecular (n = 1) or marrow (n = 2) relapses. The median dose administered was 21.4 mg/m2 and median duration of ponatinib was 2.5 months. Ponatinib alone or in combination with chemotherapy administered on 16 occasions led to achievement of major molecular response in 50% of cases. Ponatinib was used as a bridge to transplant in 4 cases. Among the 9 patients treated with ponatinib alone, toxicity grade III-IV (2 patients) was exclusively haematologic. No vascular events related to ponatinib were observed.\n\n\n\nPonatinib may be a reasonable additional treatment option for children with Ph+ leukaemias who have failed several lines of therapy.",
"affiliations": "Inserm CIC 1402, University Hospital, Poitiers, France. Electronic address: f.millot@chu-poitiers.fr.;Medical Faculty, Pediatric Hemato-oncology, Technical University, Dresden, Germany.;Department of Pediatric Oncology/Hematology, Princess Maxima Center, Utrecht, Netherlands.;Department of Pediatric Hematology Oncology and Transplantation, Wroclaw Medical University, Wroclaw, Poland.;Department of Pediatric Hematology-oncology, University Hospital, Lille, France.;Department of Pediatric Hematology-oncology, University Hospital, Bordeaux, France.;Department of Pediatric Hematology, Institut d'Hématologie et d'Oncologie Pédiatrique, Lyon, France.;Department of Pediatric Hematology, Robert Debré Hospital, Paris, France.",
"authors": "Millot|Frédéric|F|;Suttorp|Meinolf|M|;Versluys|Anne B|AB|;Kalwak|Krzysztof|K|;Nelken|Brigitte|B|;Ducassou|Stephane|S|;Bertrand|Yves|Y|;Baruchel|André|A|",
"chemical_list": "D007093:Imidazoles; D011724:Pyridazines; C545373:ponatinib; D016044:Fusion Proteins, bcr-abl",
"country": "England",
"delete": false,
"doi": "10.1016/j.ejca.2020.05.020",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0959-8049",
"issue": "136()",
"journal": "European journal of cancer (Oxford, England : 1990)",
"keywords": "Children; Chronic myeloid leukaemia; Philadelphia chromosome–positive acute lymphoblastic leukaemia; Ponatinib",
"medline_ta": "Eur J Cancer",
"mesh_terms": "D000293:Adolescent; D017668:Age of Onset; D002648:Child; D002675:Child, Preschool; D005260:Female; D016044:Fusion Proteins, bcr-abl; D006801:Humans; D007093:Imidazoles; D007391:International Cooperation; D015464:Leukemia, Myelogenous, Chronic, BCR-ABL Positive; D008297:Male; D010677:Philadelphia Chromosome; D011724:Pyridazines; D012042:Registries; D012189:Retrospective Studies; D016019:Survival Analysis; D016896:Treatment Outcome",
"nlm_unique_id": "9005373",
"other_id": null,
"pages": "107-112",
"pmc": null,
"pmid": "32668374",
"pubdate": "2020-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Ponatinib in childhood Philadelphia chromosome-positive leukaemias: an international registry of childhood chronic myeloid leukaemia study.",
"title_normalized": "ponatinib in childhood philadelphia chromosome positive leukaemias an international registry of childhood chronic myeloid leukaemia study"
} | [
{
"companynumb": "FR-SHILPA MEDICARE LIMITED-SML-FR-2020-00256",
"fulfillexpeditecriteria": "2",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "IMATINIB"
},
"drugaddition... |
{
"abstract": "A 72-year-old man presented with tenosynovitis of the left hand's extensor tendons that had been present for several months. He was initially treated with corticosteroids, first by local injection then systemically, but with no effect. When re-evaluated, the patient had developed a rash, and the symptoms had spread locally to surrounding structures. At this point, the patient added to the medical history that he had been stung by a sculpin a month before the debut of symptoms. Based on this, the patient's involved area was biopsied, and subsequent microbiology findings proved consistent with Mycobacterium marinum infection. By the time of diagnosis, the patient had soft tissue involvement, arthritis and osteomyelitis with an overlying rash. This case emphasises the need for reassessment when treatment is not effective and for further investigations of the medical history to establish the correct diagnosis and treatment.",
"affiliations": "Department of Medicine, Vejle Hospital, University Hospital of Southern Denmark, Vejle, Denmark hplangkilde@hotmail.com.;Department of Orthopedic Surgery, Hand Surgery, University Hospital of Southern Denmark, Vejle, Denmark.;Department of Internal Medicine, Odense University Hospital - Svendborg, Denmark, Svendborg, Denmark.",
"authors": "Langkilde|Henrik Zachar|HZ|;Nesten|Kim|K|http://orcid.org/0000-0002-4525-3680;Morillon|Melanie Birger|MB|http://orcid.org/0000-0001-5083-663X",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2020-234417",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "14(5)",
"journal": "BMJ case reports",
"keywords": "bone and joint infections; orthopaedic and trauma surgery; rheumatology",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000368:Aged; D001706:Biopsy; D006801:Humans; D008297:Male; D009165:Mycobacterium Infections, Nontuberculous; D019910:Mycobacterium marinum; D010019:Osteomyelitis; D013717:Tenosynovitis",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33980549",
"pubdate": "2021-05-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Rare case of Mycobacterium marinum in a patient presenting with tenosynovitis.",
"title_normalized": "rare case of mycobacterium marinum in a patient presenting with tenosynovitis"
} | [
{
"companynumb": "DK-LUPIN PHARMACEUTICALS INC.-2021-22191",
"fulfillexpeditecriteria": "2",
"occurcountry": "DK",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RIFAMPIN"
},
"drugadditional":... |
{
"abstract": "Ergotamine toxicity has become a rare condition which can be caused by, among others, drug-drug interaction. In this work we report a case with vasospastic ischemia induced by the wrongful combination of ergotamine with recently started Antiretroviral Therapy. Clinicians were not aware that patient was self-medicating for years with medication containing ergotamine and caffeine for migraines. This diagnosis was established after evaluating the evolving 'and spreading' ischemia and CT scans and thoroughly interviewing patient's family. Treatment was started with intravenous nimodipine and intra-arterial sodium nitroprusside on the affected limbs. The patient developed severe limb ischemia, cerebral ischemia, and metabolic encephalopathy. Unfortunately no improvements were noticeable and due to evolving cerebral edema as a result of the ischemia, the patient developed brain herniation and died shortly after.",
"affiliations": "Université Catholique de Louvain, Place de l'Université 1, 1348 Louvain-la-Neuve, Belgium.;ZNA Stuivenberg, Lange Beeldekensstraat 267, 2060 Antwerpen, Belgium.;Université Catholique de Louvain, Place de l'Université 1, 1348 Louvain-la-Neuve, Belgium.;Université Catholique de Louvain, Place de l'Université 1, 1348 Louvain-la-Neuve, Belgium.",
"authors": "Petit|Elisabeth|E|0000-0002-3458-8629;Schoonheydt|Karen|K|;Meert|Philippe|P|;Van Laer|Marie|M|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2018/4107450",
"fulltext": "\n==== Front\nCase Rep Emerg MedCase Rep Emerg MedCRIEMCase Reports in Emergency Medicine2090-648X2090-6498Hindawi 10.1155/2018/4107450Case ReportDrug-Drug Interaction of Ergotamine with a Combination of Darunavir, Abacavir, and Lamivudine Causing a Fatal Vasospastic Ischemia http://orcid.org/0000-0002-3458-8629Petit Elisabeth elisabeth.petit@mil.be\n1\nSchoonheydt Karen \n2\nMeert Philippe \n1\nVan Laer Marie \n1\n\n1Université Catholique de Louvain, Place de l'Université 1, 1348 Louvain-la-Neuve, Belgium\n2ZNA Stuivenberg, Lange Beeldekensstraat 267, 2060 Antwerpen, BelgiumAcademic Editor: Vasileios Papadopoulos\n\n2018 19 12 2018 2018 41074509 9 2018 6 11 2018 13 11 2018 Copyright © 2018 Elisabeth Petit et al.2018This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Ergotamine toxicity has become a rare condition which can be caused by, among others, drug-drug interaction. In this work we report a case with vasospastic ischemia induced by the wrongful combination of ergotamine with recently started Antiretroviral Therapy. Clinicians were not aware that patient was self-medicating for years with medication containing ergotamine and caffeine for migraines. This diagnosis was established after evaluating the evolving ‘and spreading' ischemia and CT scans and thoroughly interviewing patient's family. Treatment was started with intravenous nimodipine and intra-arterial sodium nitroprusside on the affected limbs. The patient developed severe limb ischemia, cerebral ischemia, and metabolic encephalopathy. Unfortunately no improvements were noticeable and due to evolving cerebral edema as a result of the ischemia, the patient developed brain herniation and died shortly after.\n==== Body\n1. Introduction\nErgotism or ergotamine toxicity, denoted as ET, is an important and nowadays rare condition [1, 2]. Ergotamine mimics the neurotransmitters norepinephrine, serotonin, and dopamine and can result in smaller and bigger vessels vasospasm and vasoconstriction [3]. Symptoms of ET can be nausea, vomiting, abdominal pain, agitation, hallucinations, lethargy, confusion, painful spasms, seizures, feeble peripheral pulses and cyanotic limbs, loss of peripheral sensation, edema, and gangrene of affected tissues [4]. In some cases vasospasm can also occur in the blood vessels of the brain, kidney, eye, heart, and intestines [2]. If toxicity is left untreated or diagnosed late, it can eventually cause necrotising limbs leading to amputations [5], irreversible coma [6], or even possible dead [7].\n\nThe cause of ET is often ascribed to the ingestion of specific alkaloids (e.g., ergotamine and dihydroergotamine) produced by the Claviceps purpurea fungus as result of consumption of grain infested by fungi [2, 3, 8]. Furthermore it can also be induced after the administration of medication containing ergotamine [4, 7, 9]. Even in therapeutic doses it can cause ET in susceptible individuals, for example, those with peripheral vascular disease, coronary artery disease, infection, or renal/hepatic impairment [1, 2, 5]. Moreover ET can be caused by accidental overdosing (> 0.25mg/kg) or by drug-drug interactions [4] including macrolide antibiotics [10], azole antifungals, HIV protease inhibitors, and some antidepressants [1, 6, 11].\n\nWhen faced with symptoms compatible with vasospasm or nonocclusive arterial ischemia and in absence of any thrombophilic pathology or arteritides, thorough interview and physical examination are important to find clues to this rare disorder. In addition, it is crucial to differentiate with more common causes of limb ischemia with the use of CT angiography.\n\nTo emphasis the importance of ET as a result of drug-drug interaction, this report describes the case of a middle-aged woman who died of ET by recently started Antiretroviral Therapy (ART) and Cafergot® (medication containing of ergotamine and caffeine used in the treatment of migraine). This relatively rare disease is difficult to recognize and treatment is sometimes ambiguous.\n\n2. Case Report\n2.1. Description Patient\nWe report a case of a 50-year-old woman, normal weight and length (49 kg, 164 cm), known to have HIV for the previous 6 years and who was recently started on ART (2 weeks ago). No report was found of the patient taking any HIV therapy in the past. The ART started was abacavir-lamivudine, respectively, 600mg and 300 mg once daily in combination with darunavir 400mg twice daily. Further medical history consists of depression and anxiety, migraines, gastroesophageal reflux disease, and no known use of illicit drugs. She was admitted in the Intensive Care Unit (ICU) after being apathetic, lethargic, and having a painful cold cyanotic right hand for 4 days. The day of hospitalization she was found very drowsy on the floor by her partner who called the health emergency services immediately. Earlier that week a general practitioner was consulted concerning the painful hand. He suggested this was due to lateral epicondylitis and treated her with NSAID's.\n\n2.2. Clinical Examination\nIn hospital on admission physical examination revealed a woman with a Glasgow Coma Scale of 13/15, conscious but sleepy, oriented, slow speech, and grossly intact cranial nerves. On examination she had cyanotic cold toes on the right foot and a cyanotic right hand extending to the wrist and no pulsations were felt on all 4 limbs (no sign of edema). The patient had a blood pressure of 140/70 mmHg on the left arm and heart rate of 80 beats/min. On auscultation no irregularities were found and the SpO2 indicated 99%. Examination revealed no abdominal abnormalities, but auscultation showed hyperactive bowel sounds. There were no signs of a fever and the urine output was normal. On admission the SAPS score was 40, APACHE-II score 12, MODScore 6, and SOFA score 4; thus the mortality prediction by the SAPS-II score was 24.7%.\n\n2.3. Investigations\nA central venous catheter was inserted at the Emergency Department due to failed attempts of placing a peripheral canula. Complete blood cell count showed a white blood count of 11.5 x 109/L and no further abnormalities (see supplementary information nr 1). The serum biochemistry showed a CRP of 24 mg/dl, CK 2285U/L, normal renal function with a of sodium of 121 mEq/L and chloride 87 mEq/L. Lactate was 0.7 mmol/L and troponins were negative with two consecutive blood samples. Toxicology screening, including ethanol, were also negative. Coagulation showed normal PT and APTT but D-dimers were raised to 2.2 mg/L (reference normally < 0.5). HIV viral load showed 42 copies/mL and CD4 count was 380 cells per cubic millimeter of blood.\n\nBecause of the altered consciousness and lethargy a CT scan of the head was done. This showed no acute intracranial abnormality. During the following days the patient deteriorated and showed increasing unconsciousness and ischemic limbs. Platelet and coagulation disorders were excluded and the lumbar puncture showed no abnormalities. On the 3th day of admission, due to quickly lowering Glasgow coma scale, the patient needed intubation. At the same day a CT angiography of the aorta and lower limbs was done to find a cause for the increasingly cyanotic limbs. Findings included (i) multiple renal infarctions, (ii) narrowing of the external iliac arteries, and (iii) bilateral narrowed femoral-popliteal arteries with multitudinous stenosis or occlusions. The radiologists had difficulties to differentiate between thrombogenic pathology, medically induced arterial spasms, hypovolemia, or congenital hypotrophic arteries.\n\nTwo days after intubation, when sedation was stopped, clinical examination showed no improvement of consciousness and fixed pupils were noticed. A CT angiography of the head (Figure 1(a)) showed important supratentorial hydrocephalus with narrowing of cortical sulci and cerebral edema. A normal intracranial perfusion, caliber, and patency of the vertebral arteries and the carotid arteries were seen.\n\nOn the 6th day, a head MRI (Figure 1(b)) showed extensive recent ischemia in the cerebellum and hemispheres, more pronounced on the right side than the left side. An obstructive dilatation of the third and fourth ventricle with clear signs of edema in the posterior fossa and pontocerebellar cisterna could be noticed. In addition, beginning herniation of the cerebral tonsils in the foramen magnum was visible. The MRI showed flow void in the basilar arteria and internal carotid arteria. Blood results had shown a slow decline in red blood cell count to 2.74 x 1012/L with a hemoglobin of 8.2 g/dl and a rise in white blood cell count up to 17.8 x 109/L with CRP of 27 mg/dl on the day she passed away. Liver function tests and renal function were slightly elevated.\n\n2.4. Treatment\nAfter seeing the evolving ischemia with several CT's that could not clearly differentiate between nonocclusive vasospasms or multitudinous stenosis and no sign of underlying peripheral artery disease, the medical history of the patient was re-examined. This revealed a document 10 years prior to the current hospitalisation suggesting former use of ergotamine containing medication (Cafergot®). Current use of ergotamine prior to hospitalization for a severe migraine attack was also confirmed by the partner. All this information in combination with the clinical presentation led to the diagnosis of ET.\n\nTreatment was promptly started (3 days after admission), with IV nimodipine, intra-arterial sodium nitroprusside, and nitroglycerin transdermal patches on affected limbs (both legs and right arm). In addition, an epidural catheter was placed for infusion of bupivacaine. The HIV medication was discontinued and to prevent secondary thrombosis anticoagulation with low-molecular-weight heparin was started. However, no improvement was noticeable.\n\n2.5. Outcome\nTwo days after stopping sedation, the patient did not wake up and pupils were fixed. MRI of the head (Figure 1(b)) showed beginning herniation of the cerebral tonsils in the foramen magnum. Neurosurgeons believed that the brain damage due to hydrocephalus was irreversible and that there would be no improvement with external ventricular drainage. Due to the evolving symptomatology and poor prognosis, in agreement with family futile life sustaining therapies were limited and supportive therapy for comfort was started. Patient died 7 days after being admitted at the ICU.\n\n3. Discussion\nToxicity with ergotamine can be caused by (i) grain infested fungi, (ii) ergotamine containing medication or (iii) drug-drug interaction. Drugs that inhibit CYP3A4 [1, 6, 7, 11, 12], among them darunavir and other protease inhibitors, can raise the ergotamine concentration to toxic levels, even when ergotamine is administered at low doses [2, 6] (in this case patient was not taking any other medication which could interact with CYP3A4). The clinical presentation of ET depends upon underlying comorbidities and the time course of ergotamine administration. The latter is difficult to identify due to wide variety in symptomatology and broad differential diagnosis for ischemic limbs. In this case the patient was self-medicating with ergotamine and caffeine in normal therapeutic doses for migraine in combination with recently started darunavir as part of ART when she started to show symptoms of ergotism.\n\nFirst-line treatment of ET is to discontinue the causative agent or medication (half-life of 2-2.5 hours) [13]. In most cases, findings will generally be seen to improve [1, 5, 11, 12]. Nevertheless, pharmacological vasodilation therapy is often necessary to improve the symptomatology of the patient. However, to the best of our knowledge, there is no consensus in how to treat patients with ET as it is a rare disease and no extensive studies have been carried out [1, 2]. Treatment methods are mainly based on other vasospastic illnesses and case reports [7, 11, 12]. Some literature describes invasive treatments such as epidural spinal cord stimulation and balloon angioplasty but caution must be exercised as they risk damaging otherwise normal arteries [1, 2, 5, 10]. Prophylaxis to prevent vasospasm-induced stasis and thrombosis is widely accepted and used in ET. In this case, medical treatment was ineffective due to late presentation of the patient in the hospital, the severity of presented ischemia, and toxicity having been diagnosed only 3 days after patient was hospitalized and continued to deteriorate.\n\nRey et al. [6] reported a similar case with use of ritonavir where medical treatment was ineffective. It was reported that the patient stayed in an irreversible coma. Another case report [7] shows the death of a young female after taking ergotamine in combination with indinavir (in this case not many details about the case are known and clinical presentation was described as hypoxia and shock). To our knowledge these two cases are the only ones which prescribe a deadly outcome after drug-drug interaction of protease inhibitors and ergotamine though many case reports are described with better outcomes. Avihingsanon et al. reported [7] 23 cases of clinical ergotism associated with use of HIV-protease inhibitors. In 78.3 % of patients full recovery was seen, but in the remaining 21.7 % of patients amputation, gangrene, and 1 death occurred. Orrapin et al. [12] reported 4 cases; 2 of them showed full recovery, 1 patient had a Chopart amputation and the last had dry gangrene of distal phalanx, resulting in the autoamputation of both upper and lower extremities. Fröhlich et al. [11] identified 11 similar cases after searching Pubmed between 1997 and 2010; 8 patients showed full recovery, with one patient being the case of Rey et al. [6], a second patient suffering from right-sided central peroneal nerve paresis, and the 3th hjaving a transmetatarsal amputation.\n\nDeadly outcome or severe sequelae resulting from drug-drug interaction of protease inhibitors and ergotamine could be avoided if patients and healthcare professionals were to be better informed about possible drug-drug interactions especially when using ART. Avihingsanon et al. [7] suggested that patients do not always inform their pharmacist and health care workers about using HIV treatment due to potential stigma. Automated surveillance systems or online platforms for prescribed medication or purchased over-the-counter medication, could help pharmacists alerting patients. Several authors highlight the importance of thoroughly interviewing patients about their medication, self-administered medication and use of over-the-counter medication, especially when being confronted with medication that is known for having severe drug-drug interactions [5, 9–12].\n\nUnfortunately, in some countries medication containing ergotamine is still available over-the-counter. The worldwide use of ergotamine is in decline as sumatriptan and other triptans became the golden standard to stop a migraine attack as NSAID's also proved to be effective [9, 14].\n\n4. Conclusion\nThis work reports a case of an adult woman, hospitalized for lethargy and an ischemic limb. Initially no diagnosis was made. Nevertheless after looking further into her medical history use of ergotamine containing medication (Cafergot®) for migraines was noticed. This, in combination with ART which only started 2 weeks prior to this hospitalization, is known to cause severe forms of ergotism. Unfortunately, no improvement was observed after treatment and, five days after being admitted, the patient developed cerebral edema and brain herniation. Due to poor prognosis, treatment was changed to comfort therapy and the patient died a few days later. To avoid similar cases in the future, medical personal should always take into account that patients could use over-the-counter medication or could have been using medication over a period of years without informing their healthcare professional. When being started on antiretroviral medication patients should be informed about potentially harmful drug-drug interactions.\n\nConflicts of Interest\nThe authors declare that there are no conflicts of interest regarding the publication of this paper.\n\nSupplementary Materials\nSupplementary Materials The supplementary information consists out of 2 tables. (1) Supplementary information nr. 1 (Table 1) contains the blood results at the time the patient was admitted to the Emergency Department and afterwards at the ICU. In addition, supplementary nr. 1 also gives an overview of the day-to-day results for hematology and biochemistry to show the evolution of different blood results while the patient was at ICU. (2) Supplementary information nr. 2 (Table 2) contains the additional urine results taken at the first day of admission.\n\nClick here for additional data file.\n\n Figure 1 (a) CT angiography of the head showing important supratentorial hydrocephalus with narrowing of cortical sulci and cerebral edema. (b) MRI-scan of the head showing extensive recent ischemia in the cerebellum and dilatation of the third and fourth ventricle.\n==== Refs\n1 Ayarragaray J. E. F. Ergotism: A change of persepective Annals of Vascular Surgery 2014 28 1 265 268 2-s2.0-84890556607 10.1016/j.avsg.2013.02.005 23992606 \n2 Zavaleta E. G. Fernandez B. B. Grove M. K. Kaye M. D. St. Anthony's fire (ergotamine induced leg ischemia): A case report and review of the literature Angiology 2001 52 5 349 356 2-s2.0-0034999636 10.1177/000331970105200509 11386387 \n3 Meggs W. J. Epidemics of mold poisoning past and present Toxicology & Industrial Health 2009 25 10 571 576 2-s2.0-70350517314 10.1177/0748233709348277 19808743 \n4 Toxbase https://www.toxbase.org/ \n5 Adam G. Kurt T. Çinar C. Ergotamine-induced vasospastic ischemia mimicking arterial embolism: Unusual case Ulusal Travma ve Acil Cerrahi Dergisi 2014 20 4 291 294 2-s2.0-84906734243 10.5505/tjtes.2014.43433 25135025 \n6 Rey C. P. Yebra M. Borrallo M. Vega A. Ramos A. Montero M. C. Irreversible coma, ergotamine, and ritonavir Clinical Infectious Diseases 2003 37 5 e72 73 2-s2.0-0141669025 10.1086/376636 12942422 \n7 Avihingsanon A. Ergotism in Thailand caused by increased access to antiretroviral drugs: a global warning Top Antivir Med Journal 2014 21 5 165 168 \n8 Belser-Ehrlich S. Harper A. Hussey J. Hallock R. Human and cattle ergotism since 1900: Symptoms, outbreaks, and regulations Toxicology & Industrial Health 2013 29 4 307 316 2-s2.0-84876587598 10.1177/0748233711432570 22903169 \n9 Roberto G. Raschi E. Piccinni C. Adverse cardiovascular events associated with triptans and ergotamines for treatment of migraine: Systematic review of observational studies Cephalalgia 2015 35 2 118 131 2-s2.0-84927749398 10.1177/0333102414550416 25246519 \n10 Demir Ş. Akin Ş. Tercan F. Ariboğan A. Oğuzkurt L. Ergotamine-induced lower extremity arterial vasospasm presenting as acute limb ischemia Diagnostic and Interventional Radiology 2010 16 2 165 167 2-s2.0-77954873960 10.4261/1305-3825.DIR.1931-08.2 19821256 \n11 Fröhlich G. Kaplan V. Amann-Vesti B. Holy fire in an HIV-positive man: A case of 21st-century ergotism Canadian Medical Association Journal 2010 182 4 378 380 2-s2.0-77953318416 10.1503/cmaj.091362 20048008 \n12 Orrapin S. Reanpang T. Orrapin S. Case series of HIV infection–associated arteriopathy: diagnosis, management, and outcome over a 5-year period at Maharaj Nakorn Chiang Mai Hospital, Chiang Mai University The International Journal of Lower Extremity Wounds 2015 14 3 251 261 10.1177/1534734615598226 2-s2.0-84944048582 26264875 \n13 Perrin V. L. Clinical Pharmacokinetics of Ergotamine in Migraine and Cluster Headache Clinical Pharmacokinetics 1985 10 4 334 352 2-s2.0-0021856419 10.2165/00003088-198510040-00004 3899452 \n14 Rapoport A. M. What happens to the old headache medicines? Headache: The Journal of Head and Face Pain 2012 52 4 701 706 2-s2.0-84859698754 10.1111/j.1526-4610.2012.02123.x 22486742\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-6498",
"issue": "2018()",
"journal": "Case reports in emergency medicine",
"keywords": null,
"medline_ta": "Case Rep Emerg Med",
"mesh_terms": null,
"nlm_unique_id": "101591814",
"other_id": null,
"pages": "4107450",
"pmc": null,
"pmid": "30662776",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "11386387;12942422;19808743;19821256;20048008;22486742;22903169;23992606;24531557;25135025;25246519;26264875;3899452",
"title": "Drug-Drug Interaction of Ergotamine with a Combination of Darunavir, Abacavir, and Lamivudine Causing a Fatal Vasospastic Ischemia.",
"title_normalized": "drug drug interaction of ergotamine with a combination of darunavir abacavir and lamivudine causing a fatal vasospastic ischemia"
} | [
{
"companynumb": "BE-STRIDES ARCOLAB LIMITED-2019SP012266",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "DARUNAVIR"
},
"drugadditional"... |
{
"abstract": "Cytopenias are typical of patients with connective tissue disease (CTD) and are usually related to autoimmune phenomena. In some cases, cytopenia may be the result of treatment with cytotoxic agents. Although multi-drug therapy is known to produce myelodysplastic syndromes (MDS) and acute myeloid leukemia (AML) in patients with CTD, treatment with single-agent therapy, particularly methotrexate, has rarely been associated with secondary MDS or AML. Blood and marrow samples were studied from 3 men and 5 women with rheumatoid arthritis (5 cases), Behcet's disease (2 cases), and systemic lupus erythematosus (1 case) developing MDS or AML after methotrexate (5 cases), chlorambucil (2 cases), and cytoxan (1 case). The durations of CTD ranged from less than 6 months to more than 10 years. Five patients (63%) presented with MDS including refractory anemia (RA), refractory thrombocytopenia (RT), refractory anemia with excess blasts (RAEB), chronic myelomonocytic leukemia (CMML), and RAEB in transformation. Patients with RT, CMML, and RAEB in transformation developed AML. Of six patients presenting with or developing AML, four had AML with differentiation (FAB M2), one acute myelomonocytic leukemia (FAB M4), and one M4Eo. Inv 16 was seen in the M4Eo and t(8;21) in one case of M2. Four of six patients are alive up to 6 years after diagnosis of AML. One of three patients with MDS is alive 6 months after diagnosis of MDS. Cytopenias in patients with CTD may be due to therapy-related MDS or AML occurring in a setting of single-agent chemotherapy, including methotrexate.",
"affiliations": "University Hospitals of Cleveland, Institute of Pathology, Case Western Reserve University, Ohio 44106-5077, USA.",
"authors": "Rosenthal|N S|NS|;Farhi|D C|DC|",
"chemical_list": "D015703:Antigens, CD; D018501:Antirheumatic Agents; D002699:Chlorambucil; D003520:Cyclophosphamide; D008727:Methotrexate",
"country": "England",
"delete": false,
"doi": "10.1093/ajcp/106.5.676",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0002-9173",
"issue": "106(5)",
"journal": "American journal of clinical pathology",
"keywords": null,
"medline_ta": "Am J Clin Pathol",
"mesh_terms": "D000208:Acute Disease; D000328:Adult; D000368:Aged; D015703:Antigens, CD; D018501:Antirheumatic Agents; D002699:Chlorambucil; D003240:Connective Tissue Diseases; D003520:Cyclophosphamide; D003582:Cytogenetics; D005260:Female; D006801:Humans; D007951:Leukemia, Myeloid; D007970:Leukopenia; D008297:Male; D008727:Methotrexate; D008875:Middle Aged; D009190:Myelodysplastic Syndromes",
"nlm_unique_id": "0370470",
"other_id": null,
"pages": "676-9",
"pmc": null,
"pmid": "8929481",
"pubdate": "1996-11",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Myelodysplastic syndromes and acute myeloid leukemia in connective tissue disease after single-agent chemotherapy.",
"title_normalized": "myelodysplastic syndromes and acute myeloid leukemia in connective tissue disease after single agent chemotherapy"
} | [
{
"companynumb": "US-PFIZER INC-8-97076-002S",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHOTREXATE SODIUM"
},
"drugadditional": "3... |
{
"abstract": "We describe the presentation, diagnosis, management, and treatment of a 62-year-old woman with a medical history of gout who presented with a maculopapular rash, facial and tongue edema. Her initial presentation, coupled with a history of recent allopurinol use for systematic relief, led to the diagnosis of allopurinol-induced drug rash with eosinophilia and systemic symptoms (DRESS) syndrome, further confirmed by the RegiSCAR scoring criteria including a skin biopsy. The patient was initially treated conservatively but required systemic corticosteroid therapy as she developed severe multi-organ dysfunction. This article will highlight the challenges involved in diagnosing DRESS syndrome from other adverse cutaneous drug reactions, delayed systemic complications, and the need for evidence-based treatment modalities and regimens using the most recent published literature and analysis of case reports. Among treatment modalities, pulsed parenteral steroids show promise in a few case reports. We also discuss the newer alternative gout therapies since the mainstay of gout treatment, allopurinol, is potentially associated with morbidity and mortality risks as manifested in our patient with DRESS.",
"affiliations": "Departments of 1Medicine and 2Cardiovascular Diseases,St Luke's Roosevelt Hospital Center, Columbia University College of Physicians and Surgeons, New York, NY.",
"authors": "Thankachen|Jincy|J|;Agarwal|Vikram|V|",
"chemical_list": "D006074:Gout Suppressants; D000493:Allopurinol",
"country": "United States",
"delete": false,
"doi": "10.1097/MJT.0000000000000037",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1075-2765",
"issue": "22(3)",
"journal": "American journal of therapeutics",
"keywords": null,
"medline_ta": "Am J Ther",
"mesh_terms": "D000493:Allopurinol; D063926:Drug Hypersensitivity Syndrome; D005260:Female; D006074:Gout Suppressants; D006801:Humans; D008875:Middle Aged",
"nlm_unique_id": "9441347",
"other_id": null,
"pages": "e77-83",
"pmc": null,
"pmid": "24451301",
"pubdate": "2015",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Challenges in Diagnosis, Management, and Treatment of Allopurinol-Induced DRESS Syndrome: Case Report and Literature Review.",
"title_normalized": "challenges in diagnosis management and treatment of allopurinol induced dress syndrome case report and literature review"
} | [
{
"companynumb": "US-MYLANLABS-2015M1020312",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ALLOPURINOL"
},
"drugadditional": null,
... |
{
"abstract": "Infection of a maternal urachal cyst during pregnancy is rare; Sonography is an important diagnostic tool that can help minimize maternal and fetal complications. We describe the case of a 35-year-old multiparous woman presenting in the third trimester with 2 weeks of fever, abdominal pain, and urinary symptoms. Imaging showed a 5-cm complex anterior midline mass, found intraoperatively to be eroding into the uterus. Sonographic imaging aided in the diagnosis and management of the urachal cyst, and antepartum sonographic measurements of the lower uterine segment helped to counsel regarding a trial of labor. Following treatment, the patient stabilized and had an uncomplicated vaginal delivery.",
"affiliations": "Division of Maternal-Fetal Medicine, Oregon Health & Science University, Portland, Oregon.;Diagnostic Radiology, Oregon Health & Science University, Portland, Oregon.;Department of OBGYN, Division of Maternal Fetal Medicine, Kaiser Permanente San Diego Medical Center, San Diego, California.",
"authors": "Sargent|James|J|http://orcid.org/0000-0002-9895-8561;Sohaey|Roya|R|;Trivedi|Neha|N|",
"chemical_list": "D000900:Anti-Bacterial Agents; D000890:Anti-Infective Agents; D000894:Anti-Inflammatory Agents, Non-Steroidal; D065093:beta-Lactamase Inhibitors; D008795:Metronidazole; D019980:Amoxicillin-Potassium Clavulanate Combination; D002443:Ceftriaxone; D007213:Indomethacin",
"country": "United States",
"delete": false,
"doi": "10.1002/jcu.22540",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0091-2751",
"issue": "46(5)",
"journal": "Journal of clinical ultrasound : JCU",
"keywords": "pregnancy; ultrasonography; urachal cyst",
"medline_ta": "J Clin Ultrasound",
"mesh_terms": "D000328:Adult; D019980:Amoxicillin-Potassium Clavulanate Combination; D000900:Anti-Bacterial Agents; D000890:Anti-Infective Agents; D000894:Anti-Inflammatory Agents, Non-Steroidal; D016866:Bacteroidaceae Infections; D001706:Biopsy; D002443:Ceftriaxone; D005260:Female; D006801:Humans; D007213:Indomethacin; D008795:Metronidazole; D009035:Mothers; D011247:Pregnancy; D011251:Pregnancy Complications, Infectious; D018720:Prevotella; D016216:Ultrasonography, Prenatal; D014496:Urachal Cyst; D014497:Urachus; D065093:beta-Lactamase Inhibitors",
"nlm_unique_id": "0401663",
"other_id": null,
"pages": "355-357",
"pmc": null,
"pmid": "28980334",
"pubdate": "2018-06",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Sonographic detection of an infected maternal urachal cyst during pregnancy.",
"title_normalized": "sonographic detection of an infected maternal urachal cyst during pregnancy"
} | [
{
"companynumb": "US-TEVA-2018-US-980520",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "NITROFURANTOIN"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nThe use of direct oral anticoagulants (DOACs) in patients undergoing elective direct current (DC) cardioversion of non-acute atrial fibrillation (AF) can potentially shorten the time from initiation of anticoagulation treatment to cardioversion, compared with warfarin. The safety of this strategy needs to be investigated. Data from subgroup analysis from clinical trials with DOAC do not clarify whether 4-week treatment with DOAC is sufficient to prevent thromboembolism (TE) after cardioversion. The aim of this retrospective study was to assess the incidence of TE in anticoagulant naive patients converted after one month's pre-treatment with dabigatran.\n\n\nRESULTS\nWe scrutinized the medical records of 631 patients where dabigatran had been used prior to elective DC cardioversion. Transoesophageal echocardiography was rarely performed. Thromboembolism within 30 days of cardioversion was the primary endpoint. A total of 570 patients were naive to OAC when dabigatran was initiated. The mean age in this group was 64.2 ± 11 years and 31.7% were women. The mean CHA2DS2-VASc score was 2.0 ± 1.5. The dose of dabigatran was 150 mg b.i.d. in 94% of the patients. The median time from initiation of dabigatran to cardioversion was 32.0 ± 15 days. In 91% cardioversion resulted in sinus rhythm. During the 30-day follow-up, three TE occurred for an incidence of 0.53% (0.18-1.54).\n\n\nCONCLUSIONS\nIn this retrospective study from clinical material, we found a low incidence of TE when dabigatran was used as TE prophylaxis in association with elective cardioversion. These results indicate that dabigatran is a safe alternative strategy to warfarin during cardioversion in patients with AF.",
"affiliations": "Department of Clinical Sciences and Education, Södersjukhuset, Karolinska Institutet, 118 83 Stockholm, Sweden anna-karin.e.johansson@sodersjukhuset.se annakarin.ee.johansson@gmail.com.;Department of Cardiology, Skåne University Hospital, Malmö, Sweden.;Department of Medicine, Halland Hospital, Halmstad, Sweden.;Department of Cardiology, Karolinska University Hospital, Stockholm, Sweden.;Department of Clinical Science, Danderyd University Hospital, Karolinska Institutet, Stockholm, Sweden.;Department of Cardiology, Varberg County Hospital, Varberg, Sweden.;Department of Cardiology, Köping County Hospital, Köping, Sweden.;Department of Cardiology, Västerås Central Hospital, Västerås, Sweden.;Department of Clinical Sciences and Education, Södersjukhuset, Karolinska Institutet, 118 83 Stockholm, Sweden.;Department of Clinical Science, Danderyd University Hospital, Karolinska Institutet, Stockholm, Sweden.;Department of Clinical Sciences and Education, Södersjukhuset, Karolinska Institutet, 118 83 Stockholm, Sweden.",
"authors": "Johansson|Anna-Karin|AK|;Juhlin|Tord|T|;Engdahl|Johan|J|;Lind|Stefan|S|;Hagwall|Kristina|K|;Rorsman|Cecilia|C|;Fodor|Emöke|E|;Alenholt|Anna|A|;Paul Nordin|Astrid|A|;Rosenqvist|Mårten|M|;Frick|Mats|M|",
"chemical_list": "D000925:Anticoagulants; D014859:Warfarin; D000069604:Dabigatran",
"country": "England",
"delete": false,
"doi": "10.1093/europace/euv123",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1099-5129",
"issue": "17(10)",
"journal": "Europace : European pacing, arrhythmias, and cardiac electrophysiology : journal of the working groups on cardiac pacing, arrhythmias, and cardiac cellular electrophysiology of the European Society of Cardiology",
"keywords": "Anticoagulation; Apixaban; Atrial fibrillation; Cardioversion; Dabigatran; Rivaroxaban; Stroke; Thromboembolism; Warfarin",
"medline_ta": "Europace",
"mesh_terms": "D000368:Aged; D000925:Anticoagulants; D001281:Atrial Fibrillation; D000069604:Dabigatran; D004554:Electric Countershock; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D012189:Retrospective Studies; D012307:Risk Factors; D013923:Thromboembolism; D014859:Warfarin",
"nlm_unique_id": "100883649",
"other_id": null,
"pages": "1514-7",
"pmc": null,
"pmid": "26017466",
"pubdate": "2015-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Is one month treatment with dabigatran before cardioversion of atrial fibrillation sufficient to prevent thromboembolism?",
"title_normalized": "is one month treatment with dabigatran before cardioversion of atrial fibrillation sufficient to prevent thromboembolism"
} | [
{
"companynumb": "SE-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2015-BI-30652GD",
"fulfillexpeditecriteria": "1",
"occurcountry": "SE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DABIGATRAN ETEXILATE MESYLATE"
... |
{
"abstract": "Evidence has not been established to support that combination chemotherapy with cyclophosphamide, vincristine, and dacarbazine (CVD) improves survival in patients with malignant pheochromocytoma and paraganglioma (M-PPGL). To investigate the efficacy of CVD for this disease, we retrospectively analyzed data of 23 patients with metastatic and unresectable M-PPGL (mean age, 41.7 ± 15.4 years) who received at least 2 cycles of this regimen. The follow-up period after initiation of CVD ranged from 0.3 to 13.7 years, with a median of 3.3 years. CVD therapy achieved a complete tumor response (CR) in 1 patient (4%), a partial response (PR) in 5 (22%), stable disease (SD) in 5 (22%), and progressive disease (PD) in 13 (52%), respectively. All of the responders (CR and PR) but 6% of the non-responders (SD and PD) showed substantial biochemical improvement. The progression-free survival period in the responders was significantly longer than in the non-responders (p < 0.01). Although the overall survival and survival after the diagnosis of M-PPGL were longer in the responders than the non-responders, the difference was not statistically significant (p = 0.08). The progression-free and overall survival period were significantly longer in the non-progression group (CR, PR, and SD) than in the progression group (PD) (1.7 ± 3.3 vs. 0.3 ± 0.3 years, p < 0.01, and 4.6 ± 3.6 vs. 2.0 ± 3.7 years, p = 0.01, respectively). It is therefore suggested that CVD chemotherapy could be useful in controlling tumor progression and improving survival in patients with metastatic and progressive M-PPGL.",
"affiliations": "Division of Metabolism and Endocrinology, Department of Internal Medicine, St. Marianna University School of Medicine Yokohama City Seibu Hospital, 1197-1, Yasashicho, Asahi-ku, Yokohama, Kanagawa, 241-0811, Japan.;Division of Metabolism and Endocrinology, Department of Internal Medicine, St. Marianna University School of Medicine Yokohama City Seibu Hospital, 1197-1, Yasashicho, Asahi-ku, Yokohama, Kanagawa, 241-0811, Japan. t2kataba@marianna-u.ac.jp.;Division of Endocrinology and Metabolism, National Hospital Organization Kyoto Medical Center, 1-1, Mukaihatacho, Fukakusa, Fushimi-ku, Kyoto, 612-8555, Japan.;Division of Metabolism and Endocrinology, Department of Internal Medicine, St. Marianna University School of Medicine, 2-16-1 Sugao, Miyamae-ku, Kawasaki, Kanagawa, 216-8511, Japan.;Division of Endocrinology, Metabolism and Hypertension, Clinical Research Institute, National Hospital Organization Kyoto Medical Center, 1-1, Mukaihatacho, Fukakusa, Fushimi-ku, Kyoto, 612-8555, Japan.",
"authors": "Asai|Shiko|S|;Katabami|Takuyuki|T|;Tsuiki|Mika|M|;Tanaka|Yasushi|Y|;Naruse|Mitsuhide|M|",
"chemical_list": "D014750:Vincristine; D003606:Dacarbazine; D003520:Cyclophosphamide",
"country": "United States",
"delete": false,
"doi": "10.1007/s12672-017-0284-7",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1868-8497",
"issue": "8(2)",
"journal": "Hormones & cancer",
"keywords": "Antineoplastic combined chemotherapy; CVD therapy; Malignant pheochromocytoma; Myelodysplastic syndromes; Paraganglioma; Survival time",
"medline_ta": "Horm Cancer",
"mesh_terms": "D000310:Adrenal Gland Neoplasms; D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D003520:Cyclophosphamide; D003606:Dacarbazine; D018572:Disease-Free Survival; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D009362:Neoplasm Metastasis; D010235:Paraganglioma; D010673:Pheochromocytoma; D012189:Retrospective Studies; D016019:Survival Analysis; D016896:Treatment Outcome; D014750:Vincristine; D055815:Young Adult",
"nlm_unique_id": "101518427",
"other_id": null,
"pages": "108-118",
"pmc": null,
"pmid": "28108930",
"pubdate": "2017-04",
"publication_types": "D016428:Journal Article",
"references": "26464058;22314389;23361939;25041164;12623843;3997232;17652212;3395037;15369446;22006217;24891137;23884775;17914089;19097774;4823849;6801796;25143180;18780317;24118038;17237836",
"title": "Controlling Tumor Progression with Cyclophosphamide, Vincristine, and Dacarbazine Treatment Improves Survival in Patients with Metastatic and Unresectable Malignant Pheochromocytomas/Paragangliomas.",
"title_normalized": "controlling tumor progression with cyclophosphamide vincristine and dacarbazine treatment improves survival in patients with metastatic and unresectable malignant pheochromocytomas paragangliomas"
} | [
{
"companynumb": "JP-FRESENIUS KABI-FK201704729",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "VINCRISTINE"
},
"drugadditional": null,
... |
{
"abstract": "As only sparse data are available, we aimed to investigate whether needs for activated vitamin D and calcium supplements change in women with hypoparathyroidism during pregnancy and lactation and risk of pregnancy-related complications.\n\n\n\nRetrospective review of medical records.\n\n\n\nTwelve Danish and Canadian patients with chronic hypoparathyroidism who completed 17 pregnancies.\n\n\n\nData were extracted on plasma levels of ionized calcium (P-Ca2+ ) and doses of active vitamin D and calcium supplements during pregnancy (N = 14) and breastfeeding (N = 10). Data on pregnancy complications were available from all 17 pregnancies.\n\n\n\nAlthough average doses of active vitamin D (P = .91) and calcium supplements (P = .43) did not change during pregnancies, a more than 20% increase or decrease in dose of active vitamin D was needed in more than half of the pregnancies in order to maintain normocalcemia. Five women (36%) developed hypercalcaemia by the end of pregnancy or start of lactation. Median levels of P-Ca2+ increased from 1.20 mmol/L in third trimester to 1.32 mmol/L in the post-partum period (P < .03). Accordingly, the average dose of active vitamin D was significantly reduced (P = .01) during lactation compared to 3rd trimester. One woman developed severe pre-eclampsia (6%). Further four pregnancies (24%) were complicated by polyhydramnios, dystocia and/or perinatal hypoxia. Ten pregnancies required caesarean delivery (59%) with four (24%) being performed as an emergency.\n\n\n\nIn chronic hypoparathyroidism, close medical monitoring of the mother with frequent adjustments in the dose of calcium and active vitamin D is required during pregnancy and lactation in order to maintain normocalcemia. Patients should be offered close obstetric care to handle potential perinatal complications. We recommend evaluating the neonate immediately after birth and notifying the paediatrician of the risks of hypocalcaemia as well as hypercalcaemia in the neonate.",
"affiliations": "Department of Endocrinology and Internal Medicine, Aarhus University Hospital, Aarhus, Denmark.;Medicine, Divisions of Endocrinology and Metabolism and Geriatric Medicine, McMaster University, Oakville, ON, Canada.;Department of Endocrinology and Internal Medicine, Aarhus University Hospital, Aarhus, Denmark.;Department of Endocrinology and Internal Medicine, Aarhus University Hospital, Aarhus, Denmark.;Medicine, Divisions of Endocrinology and Metabolism and Geriatric Medicine, McMaster University, Oakville, ON, Canada.;Department of Endocrinology and Internal Medicine, Aarhus University Hospital, Aarhus, Denmark.",
"authors": "Hartogsohn|Etki A R|EAR|0000-0002-5752-5372;Khan|Aliya A|AA|;Kjaersulf|Line Underbjerg|LU|;Sikjaer|Tanja|T|;Hussain|Sharjil|S|;Rejnmark|Lars|L|",
"chemical_list": "D014807:Vitamin D; D002118:Calcium",
"country": "England",
"delete": false,
"doi": "10.1111/cen.14212",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0300-0664",
"issue": "93(3)",
"journal": "Clinical endocrinology",
"keywords": "calcitriol; calcium; hypercalcaemia; hypoparathyroidism; lactation; pregnancy; pregnancy complications",
"medline_ta": "Clin Endocrinol (Oxf)",
"mesh_terms": "D001942:Breast Feeding; D002118:Calcium; D002170:Canada; D005260:Female; D006801:Humans; D007011:Hypoparathyroidism; D007231:Infant, Newborn; D007774:Lactation; D011247:Pregnancy; D012189:Retrospective Studies; D014807:Vitamin D",
"nlm_unique_id": "0346653",
"other_id": null,
"pages": "261-268",
"pmc": null,
"pmid": "32350890",
"pubdate": "2020-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Changes in treatment needs of hypoparathyroidism during pregnancy and lactation: A case series.",
"title_normalized": "changes in treatment needs of hypoparathyroidism during pregnancy and lactation a case series"
} | [
{
"companynumb": "DK-STRIDES ARCOLAB LIMITED-2020SP013503",
"fulfillexpeditecriteria": "1",
"occurcountry": "DK",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CALCITRIOL"
},
"drugadditional"... |
{
"abstract": "BACKGROUND\nIn the era of more efficacious prevention of mother-to-child transmission (PMTCT) regimens, documenting the profile of drug resistance in HIV-infected infants and young children is critical to our efforts to improve care and treatment for children.\n\n\nMETHODS\nHIV drug resistance mutations in plasma virus were ascertained using population sequencing among 230 newly diagnosed HIV-infected children under 2 years of age recruited in Johannesburg, South Africa, during 2011. By this time, more effective PMTCT regimens, including combination antiretroviral therapy for pregnant women, were being implemented.\n\n\nRESULTS\nTwo-thirds (67.4%) of HIV-infected children had been exposed to some form of maternal (89%) and/or infant (97%) PMTCT. Among PMTCT-exposed, 56.8% had nonnucleoside reverse transcriptase inhibitor (NNRTI), 14.8% nucleoside reverse transcriptase inhibitor (NRTI), and 1.3% protease inhibitor mutations. NNRTI mutations were strongly related to younger age. The remaining third (32.6%) had no reported or recorded PMTCT exposures, but resistance to NNRTI was detected in 24.0%, NRTI in 10.7%, and protease inhibitor in 1.3%.\n\n\nCONCLUSIONS\nThe new PMTCT strategies dramatically reduce the number of children who acquire infection, but among those who do become infected, NNRTI resistance prevalence is high. In this South African setting with high PMTCT coverage, almost a quarter of children with no reported or recorded PMTCT also have drug resistance mutations. PMTCT history is an inadequate means of ruling out pretreatment drug resistance. Our results support the use of protease inhibitor-based first-line regimens in HIV-infected infants and young children regardless of PMTCT history.",
"affiliations": "aGertrude H. Sergievsky Center, College of Physicians and Surgeons, and Department of Epidemiology, Mailman School of Public Health, Columbia University, New York, New York, USA bNational Institute for Communicable Diseases of the National Health Laboratory Services cFaculty of Health Sciences, Empilweni Services and Research Unit, Department of Paediatrics & Child Health, Rahima Moosa Mother and Child Hospital, University of the Witwatersrand, Johannesburg, South Africa dMRC Clinical Trial Unit, University College London, London, UK eHIV Department, World Health Organization, Geneva, Switzerland fHIV Center for Clinical and Behavioral Studies in the Division of Gender Sexuality and Health, Department of Psychiatry, Columbia University and the New York State Psychiatric Institute, New York, New York, USA gFaculty of Health Sciences, Wits Reproductive Health and HIV Institute, University of Witwatersrand, Johannesburg, South Africa hICAP, Mailman School of Public Health, and Department of Pediatrics, College of Physicians & Surgeons, Columbia University, New York, New York, USA.",
"authors": "Kuhn|Louise|L|;Hunt|Gillian|G|;Technau|Karl-Günter|KG|;Coovadia|Ashraf|A|;Ledwaba|Johanna|J|;Pickerill|Sam|S|;Penazzato|Martina|M|;Bertagnolio|Silvia|S|;Mellins|Claude A|CA|;Black|Vivian|V|;Morris|Lynn|L|;Abrams|Elaine J|EJ|",
"chemical_list": "D019380:Anti-HIV Agents; D012367:RNA, Viral",
"country": "England",
"delete": false,
"doi": "10.1097/QAD.0000000000000261",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0269-9370",
"issue": "28(11)",
"journal": "AIDS (London, England)",
"keywords": null,
"medline_ta": "AIDS",
"mesh_terms": "D019380:Anti-HIV Agents; D018890:Chemoprevention; D024882:Drug Resistance, Viral; D005260:Female; D006678:HIV; D015658:HIV Infections; D006801:Humans; D007223:Infant; D007231:Infant, Newborn; D008297:Male; D009154:Mutation; D010949:Plasma; D011247:Pregnancy; D015995:Prevalence; D012367:RNA, Viral; D013019:South Africa",
"nlm_unique_id": "8710219",
"other_id": null,
"pages": "1673-8",
"pmc": null,
"pmid": "24785949",
"pubdate": "2014-07-17",
"publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't",
"references": "22544199;17117145;16603851;24442233;22424722;23432488;23687295;19287298;22544184;21633285;22716976;20942667;22132237;20554983;18575198",
"title": "Drug resistance among newly diagnosed HIV-infected children in the era of more efficacious antiretroviral prophylaxis.",
"title_normalized": "drug resistance among newly diagnosed hiv infected children in the era of more efficacious antiretroviral prophylaxis"
} | [
{
"companynumb": "ZA-GILEAD-2014-0112339",
"fulfillexpeditecriteria": "1",
"occurcountry": "ZA",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "TENOFOVIR DISOPROXIL FUMARATE"
},
"drugaddition... |
{
"abstract": "Autoimmune encephalitis is a rare spectrum of disease that can be a complication of chronic immunosuppression. Diagnosis often requires the presence of antineuronal antibodies, but many causative antibodies have not yet been identified. Antibody-negative autoimmune encephalitis (AbNAE) is especially difficult to diagnose and must rely largely on exclusion of other causes. In chronically immune-suppressed transplant recipients, the differential is broad, likely resulting in underdiagnosis and worse outcomes. Here, we present a 58-year-old liver transplant recipient taking tacrolimus for prevention of chronic rejection who presented with 5 days of confusion, lethargy and lightheadedness. He was diagnosed with AbNAE after an extensive workup and recovered fully after high-dose corticosteroids. Our case highlights the importance of recognising the association between chronic immunosuppression and autoimmune encephalitis. Autoimmune encephalitis, even in the absence of characterised antibodies, should be considered when transplant recipients present with central neurologic symptoms.",
"affiliations": "Internal Medicine, University of Louisville, Louisville, Kentucky, USA jeffrey.spindel@louisville.edu.;Internal Medicine, University of Louisville, Louisville, Kentucky, USA.;Gastroenterology, Hepatology, and Nutrition, University of Louisville, Louisville, Kentucky, USA.",
"authors": "Spindel|Jeffrey|J|http://orcid.org/0000-0001-5143-1431;Heckroth|Matthew|M|;Marsano|Luis|L|",
"chemical_list": "D000906:Antibodies; D007166:Immunosuppressive Agents; D016559:Tacrolimus",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2020-235777",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "13(9)",
"journal": "BMJ case reports",
"keywords": "gastroenterology; immunology; neurooncology; unwanted effects / adverse reactions",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000906:Antibodies; D004660:Encephalitis; D050031:Hashimoto Disease; D006801:Humans; D007165:Immunosuppression Therapy; D007166:Immunosuppressive Agents; D016031:Liver Transplantation; D008297:Male; D008875:Middle Aged; D011183:Postoperative Complications; D016559:Tacrolimus; D013997:Time Factors",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "32933909",
"pubdate": "2020-09-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Antibody-negative autoimmune encephalitis as a complication of long-term immune-suppression for liver transplantation.",
"title_normalized": "antibody negative autoimmune encephalitis as a complication of long term immune suppression for liver transplantation"
} | [
{
"companynumb": "US-ASTELLAS-2020US034644",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": null,
... |
{
"abstract": "A case report of a ciprofloxacin and simvastatin interaction is presented. The addition of ciprofloxacin to chronic simvastatin therapy led to the development of rhabdomyolysis. As ciprofloxacin is a weak inhibitor of CYP3A4, it is very likely that other mechanisms involving the ATP-binding cassette drug efflux transporter family played a role in this drug interaction.",
"affiliations": "The Queen Elizabeth Hospital, Department of Medicine, Kings Lynn, UK. drrahulsawant@hotmail.com",
"authors": "Sawant|R D|RD|",
"chemical_list": "D018528:ATP-Binding Cassette Transporters; D000890:Anti-Infective Agents; D065692:Cytochrome P-450 CYP3A Inhibitors; D004791:Enzyme Inhibitors; D000960:Hypolipidemic Agents; D002939:Ciprofloxacin; D019821:Simvastatin; D051544:Cytochrome P-450 CYP3A; C510163:CYP3A4 protein, human",
"country": "Canada",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1198-581X",
"issue": "16(1)",
"journal": "The Canadian journal of clinical pharmacology = Journal canadien de pharmacologie clinique",
"keywords": null,
"medline_ta": "Can J Clin Pharmacol",
"mesh_terms": "D018528:ATP-Binding Cassette Transporters; D000368:Aged; D000890:Anti-Infective Agents; D002939:Ciprofloxacin; D051544:Cytochrome P-450 CYP3A; D065692:Cytochrome P-450 CYP3A Inhibitors; D004347:Drug Interactions; D004791:Enzyme Inhibitors; D005260:Female; D006801:Humans; D000960:Hypolipidemic Agents; D012206:Rhabdomyolysis; D019821:Simvastatin",
"nlm_unique_id": "9804162",
"other_id": null,
"pages": "e78-9",
"pmc": null,
"pmid": "19151423",
"pubdate": "2009",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Rhabdomyolysis due to an uncommon interaction of ciprofloxacin with simvastatin.",
"title_normalized": "rhabdomyolysis due to an uncommon interaction of ciprofloxacin with simvastatin"
} | [
{
"companynumb": "UK-ACCORD-001810",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CIPROFLOXACIN"
},
"drugadditional": null,
"d... |
{
"abstract": "Pineoblastoma is an extremely rare intracranial neoplasm, with increased risk of craniospinal metastasis. There is only one case reported in the literature who presented during pregnancy. Described here is a woman who presented at five months of gestation with recurrence of pineoblastoma, who had previously defaulted adjuvant therapy following surgical decompression. The challenges in the diagnosis and treatment of pineoblastoma and its effects on pregnancy are also discussed.",
"affiliations": "Department of Obstetrics & Gynaecology, Jawaharlal Institute of Post-graduate Medical Education & Research (JIPMER), Puducherry, India.;Department of Obstetrics & Gynaecology, Jawaharlal Institute of Post-graduate Medical Education & Research (JIPMER), Puducherry, India.;Department of Neurosurgery, Jawaharlal Institute of Post-graduate Medical Education & Research (JIPMER), Puducherry, India.;Department of Radiation Oncology, Jawaharlal Institute of Post-graduate Medical Education & Research (JIPMER), Puducherry, India.;Department of Medical Oncology, Jawaharlal Institute of Post-graduate Medical Education & Research (JIPMER), Puducherry, India.;Department of Radiology, Jawaharlal Institute of Post-graduate Medical Education & Research (JIPMER), Puducherry, India.;Department of Neonatology, Jawaharlal Institute of Post-graduate Medical Education & Research (JIPMER), Puducherry, India.;Department of Obstetrics & Gynaecology, Jawaharlal Institute of Post-graduate Medical Education & Research (JIPMER), Puducherry, India.",
"authors": "Garg|Sonal|S|;Maurya|Dilip K|DK|;Sasidharan|Gopalakrishnan M|GM|;Prem|Shyama S|SS|;Ganesan|Prasanth|P|;Govindarajalou|Ramkumar|R|;Plakkal|Nishad|N|;Keepanasseril|Anish|A|https://orcid.org/0000-0002-4881-0382",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1177/1753495X20958339",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1753-495X",
"issue": "14(3)",
"journal": "Obstetric medicine",
"keywords": "Pineoblastoma; neoplastic; pregnancy complications",
"medline_ta": "Obstet Med",
"mesh_terms": null,
"nlm_unique_id": "101464191",
"other_id": null,
"pages": "181-186",
"pmc": null,
"pmid": "34646348",
"pubdate": "2021-09",
"publication_types": "D002363:Case Reports",
"references": "7501100;28937575;23813932;26490154;23060985;23321787;19745695;31092461;434490;20015593;29066161;10705018;88244;26287970;18559459;12590695;9256138;21717450;15863381;26508017;11827871;16172830;21184689;20846067;25210636;15782004;24636876;4751919;20041106;15725854;19934562",
"title": "Management dilemmas in pineoblastoma recurrence diagnosed during pregnancy.",
"title_normalized": "management dilemmas in pineoblastoma recurrence diagnosed during pregnancy"
} | [
{
"companynumb": "IN-MYLANLABS-2021M1090877",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": "4",
... |
{
"abstract": "The purpose of the current study was to compare the efficacy and safety of edoxaban versus vitamin K antagonist (VKA) therapy among a cohort of elderly patients (ie, those aged ≥75 years) with atrial fibrillation (AF) in a real-life setting.\n\n\n\nA propensity score-matched cohort observational study was performed comparing the safety and efficacy of edoxaban versus VKA therapy among a cohort of elderly (aged ≥75 years) patients with AF in a real-life setting. Follow-up data were obtained through outpatient visits at 1, 3, and every 6 months. The primary safety outcome was major bleeding. The primary efficacy outcome was the composite of stroke, transient ischemic attack, and systemic embolism.\n\n\n\nA total of 130 patients receiving edoxaban 60 mg (EDO) treatment were compared with the same number of VKA recipients. The mean follow-up was 16 (2.6) months. The cumulative incidence of thromboembolic events in the EDO and VKA groups was 1.5% (2 of 130) and 2.3% (3 of 130), respectively (P < 0.6). The cumulative incidence of major bleeding events was 1.5% (2 of 130) in the EDO group and 3.1% (4 of 130) in the VKA group (P < 0.4). The total anticoagulant therapy discontinuation rate was 2.3% (3 of 130) in the EDO group and 4.6% (6 of 130) in the VKA group (P < 0.3). A nonsignificant trend in improved adherence was observed between the EDO and VKA groups (81% vs 78%; P = 0.6).\n\n\n\nEdoxaban therapy showed a good real-life performance among elderly patients (aged ≥75 years) with AF.",
"affiliations": "Chair of Cardiology, Department of Translational Medical Sciences, University of Campania \"Luigi Vanvitelli\", Monaldi Hospital, Naples, Italy. Electronic address: v.p.russo@libero.it.;Cardiology Unit, Roccadaspide Hospital, Roccadaspide, SA, Italy.;Cardiovascular Centre, Health Authority 1, Trieste, Italy.;Chair of Cardiology, Department of Translational Medical Sciences, University of Campania \"Luigi Vanvitelli\", Monaldi Hospital, Naples, Italy.;Chair of Cardiology, Department of Translational Medical Sciences, University of Campania \"Luigi Vanvitelli\", Monaldi Hospital, Naples, Italy.;Department of Cardiology, San Giovanni di Dio e Ruggi d'Aragona Hospital, Salerno, Italy.;Cardiology Unit, San Francesco d' Assisi Hospital, Oliveta Citra, SA, Italy.;Department of Translational Medical Sciences, University of Naples Federico II, Naples, Italy.;Cardiology Unit, Roccadaspide Hospital, Roccadaspide, SA, Italy.;Chair of Cardiology, Department of Translational Medical Sciences, University of Campania \"Luigi Vanvitelli\", Monaldi Hospital, Naples, Italy.;Departmental Unit of Electrophysiology, Evaluation and Treatment of Arrhythmias, Monaldi Hospital, Naples, Italy.",
"authors": "Russo|Vincenzo|V|;Attena|Emilio|E|;Mazzone|Carmine|C|;Melillo|Enrico|E|;Rago|Anna|A|;Galasso|Gennaro|G|;Riegler|Lucia|L|;Parisi|Valentina|V|;Rotunno|Raffaele|R|;Nigro|Gerardo|G|;D'Onofrio|Antonio|A|",
"chemical_list": "D065427:Factor Xa Inhibitors; D011725:Pyridines; D013844:Thiazoles; D014812:Vitamin K; C552171:edoxaban",
"country": "United States",
"delete": false,
"doi": "10.1016/j.clinthera.2019.04.041",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0149-2918",
"issue": "41(8)",
"journal": "Clinical therapeutics",
"keywords": "Atrial fibrillation; Edoxaban; Efficacy; Real life; Safety; Vitamin K antagonists",
"medline_ta": "Clin Ther",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D001281:Atrial Fibrillation; D015331:Cohort Studies; D065427:Factor Xa Inhibitors; D005260:Female; D006470:Hemorrhage; D006801:Humans; D002546:Ischemic Attack, Transient; D008297:Male; D057216:Propensity Score; D011725:Pyridines; D020521:Stroke; D013844:Thiazoles; D013923:Thromboembolism; D016896:Treatment Outcome; D014812:Vitamin K",
"nlm_unique_id": "7706726",
"other_id": null,
"pages": "1598-1604",
"pmc": null,
"pmid": "31151813",
"pubdate": "2019-08",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study; D064888:Observational Study",
"references": null,
"title": "Real-life Performance of Edoxaban in Elderly Patients With Atrial Fibrillation: a Multicenter Propensity Score-Matched Cohort Study.",
"title_normalized": "real life performance of edoxaban in elderly patients with atrial fibrillation a multicenter propensity score matched cohort study"
} | [
{
"companynumb": "IT-DSJP-DSE-2019-138922",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "EDOXABAN TOSYLATE"
},
"drugadditional": "3",
... |
{
"abstract": "OBJECTIVE\nWe examined a cohort of Australian patients with statin exposure who developed a necrotizing autoimmune myopathy (NAM) associated with a novel autoantibody against 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR) and describe the clinical and therapeutic challenges of managing these patients and an optimal therapeutic strategy.\n\n\nMETHODS\nClinical, laboratory, EMG, and histopathologic results and response to immunomodulation are reported in 6 Australian patients with previous statin exposure and antibodies targeting HMGCR.\n\n\nRESULTS\nAll patients presented with painless proximal weakness following statin therapy, which persisted after statin cessation. Serum creatine kinase (CK) levels ranged from 2,700 to 16,200 IU/L. EMG was consistent with a myopathic picture. Muscle biopsies revealed a pauci-immune necrotizing myopathy. Detailed graphical representation of the clinical course of these patients showed a close association with rising CK and an increase in clinical weakness signifying relapses, particularly upon weaning or ceasing steroids. All 6 patients were responsive to initial steroid therapy, with 5 relapsing upon attempts to wean steroids. Both CK and clinical strength improved with the reinstitution of immunotherapy, in particular steroids and IV immunoglobulin (IVIg). All patients required treatment with varying multiagent immunosuppressive regimens to achieve clinical remission, including prednisone (n = 6), IVIg (n = 5), plasmapheresis (n = 2), and additional therapy including methotrexate (n = 6), cyclophosphamide (n = 2), rituximab (n = 2), azathioprine (n = 1), and cyclosporine (n = 1).\n\n\nCONCLUSIONS\nRecognition of HMGCR antibody-associated NAM is important because these patients are responsive to immunosuppression, and early multiagent therapy and a slow and cautious approach to withdrawing steroids may improve outcomes.",
"affiliations": "Department of Neurology (S.R., T.A.H., N.G., S.W.R.), Concord Repatriation General Hospital, Sydney, New South Wales, Australia; Neuroimmunology Group (S.R., R.C.D.), Institute for Neuroscience and Muscle Research, The Kids Research Institute at the Children's Hospital at Westmead, Sydney Medical School, University of Sydney, New South Wales, Australia; Department of Neurology (S.R.), Westmead Hospital, Sydney, New South Wales, Australia; Sullivan Nicolaides Pathology (D.L.), Brisbane, Queensland, Australia; Concord Clinical School (T.A.H., S.W.R.), University of Sydney, New South Wales, Australia; Clinical Immunology (C.B.), PathWest, QEII Medical Center, Nedlands, Western Australia, Australia; School of Pathology and Laboratory Medicine (C.B.), University of Western Australia, Nedlands, Western Australia, Australia; Australian Neuro-Muscular Research Institute (ANRI) and Centre for Neuromuscular and Neurological Disorders (CNND) (A.R.-U.), University of Western Australia, QEII Medical Centre, Nedlands, Western Australia, Australia; Pathology Queensland (T.R.), Royal Brisbane & Women's Hospital, Brisbane, Queensland, Australia; and National Institute of Arthritis and Musculoskeletal and Skin Diseases (A.L.M.), National Institutes of Health, Bethesda, MD.;Department of Neurology (S.R., T.A.H., N.G., S.W.R.), Concord Repatriation General Hospital, Sydney, New South Wales, Australia; Neuroimmunology Group (S.R., R.C.D.), Institute for Neuroscience and Muscle Research, The Kids Research Institute at the Children's Hospital at Westmead, Sydney Medical School, University of Sydney, New South Wales, Australia; Department of Neurology (S.R.), Westmead Hospital, Sydney, New South Wales, Australia; Sullivan Nicolaides Pathology (D.L.), Brisbane, Queensland, Australia; Concord Clinical School (T.A.H., S.W.R.), University of Sydney, New South Wales, Australia; Clinical Immunology (C.B.), PathWest, QEII Medical Center, Nedlands, Western Australia, Australia; School of Pathology and Laboratory Medicine (C.B.), University of Western Australia, Nedlands, Western Australia, Australia; Australian Neuro-Muscular Research Institute (ANRI) and Centre for Neuromuscular and Neurological Disorders (CNND) (A.R.-U.), University of Western Australia, QEII Medical Centre, Nedlands, Western Australia, Australia; Pathology Queensland (T.R.), Royal Brisbane & Women's Hospital, Brisbane, Queensland, Australia; and National Institute of Arthritis and Musculoskeletal and Skin Diseases (A.L.M.), National Institutes of Health, Bethesda, MD.;Department of Neurology (S.R., T.A.H., N.G., S.W.R.), Concord Repatriation General Hospital, Sydney, New South Wales, Australia; Neuroimmunology Group (S.R., R.C.D.), Institute for Neuroscience and Muscle Research, The Kids Research Institute at the Children's Hospital at Westmead, Sydney Medical School, University of Sydney, New South Wales, Australia; Department of Neurology (S.R.), Westmead Hospital, Sydney, New South Wales, Australia; Sullivan Nicolaides Pathology (D.L.), Brisbane, Queensland, Australia; Concord Clinical School (T.A.H., S.W.R.), University of Sydney, New South Wales, Australia; Clinical Immunology (C.B.), PathWest, QEII Medical Center, Nedlands, Western Australia, Australia; School of Pathology and Laboratory Medicine (C.B.), University of Western Australia, Nedlands, Western Australia, Australia; Australian Neuro-Muscular Research Institute (ANRI) and Centre for Neuromuscular and Neurological Disorders (CNND) (A.R.-U.), University of Western Australia, QEII Medical Centre, Nedlands, Western Australia, Australia; Pathology Queensland (T.R.), Royal Brisbane & Women's Hospital, Brisbane, Queensland, Australia; and National Institute of Arthritis and Musculoskeletal and Skin Diseases (A.L.M.), National Institutes of Health, Bethesda, MD.;Department of Neurology (S.R., T.A.H., N.G., S.W.R.), Concord Repatriation General Hospital, Sydney, New South Wales, Australia; Neuroimmunology Group (S.R., R.C.D.), Institute for Neuroscience and Muscle Research, The Kids Research Institute at the Children's Hospital at Westmead, Sydney Medical School, University of Sydney, New South Wales, Australia; Department of Neurology (S.R.), Westmead Hospital, Sydney, New South Wales, Australia; Sullivan Nicolaides Pathology (D.L.), Brisbane, Queensland, Australia; Concord Clinical School (T.A.H., S.W.R.), University of Sydney, New South Wales, Australia; Clinical Immunology (C.B.), PathWest, QEII Medical Center, Nedlands, Western Australia, Australia; School of Pathology and Laboratory Medicine (C.B.), University of Western Australia, Nedlands, Western Australia, Australia; Australian Neuro-Muscular Research Institute (ANRI) and Centre for Neuromuscular and Neurological Disorders (CNND) (A.R.-U.), University of Western Australia, QEII Medical Centre, Nedlands, Western Australia, Australia; Pathology Queensland (T.R.), Royal Brisbane & Women's Hospital, Brisbane, Queensland, Australia; and National Institute of Arthritis and Musculoskeletal and Skin Diseases (A.L.M.), National Institutes of Health, Bethesda, MD.;Department of Neurology (S.R., T.A.H., N.G., S.W.R.), Concord Repatriation General Hospital, Sydney, New South Wales, Australia; Neuroimmunology Group (S.R., R.C.D.), Institute for Neuroscience and Muscle Research, The Kids Research Institute at the Children's Hospital at Westmead, Sydney Medical School, University of Sydney, New South Wales, Australia; Department of Neurology (S.R.), Westmead Hospital, Sydney, New South Wales, Australia; Sullivan Nicolaides Pathology (D.L.), Brisbane, Queensland, Australia; Concord Clinical School (T.A.H., S.W.R.), University of Sydney, New South Wales, Australia; Clinical Immunology (C.B.), PathWest, QEII Medical Center, Nedlands, Western Australia, Australia; School of Pathology and Laboratory Medicine (C.B.), University of Western Australia, Nedlands, Western Australia, Australia; Australian Neuro-Muscular Research Institute (ANRI) and Centre for Neuromuscular and Neurological Disorders (CNND) (A.R.-U.), University of Western Australia, QEII Medical Centre, Nedlands, Western Australia, Australia; Pathology Queensland (T.R.), Royal Brisbane & Women's Hospital, Brisbane, Queensland, Australia; and National Institute of Arthritis and Musculoskeletal and Skin Diseases (A.L.M.), National Institutes of Health, Bethesda, MD.;Department of Neurology (S.R., T.A.H., N.G., S.W.R.), Concord Repatriation General Hospital, Sydney, New South Wales, Australia; Neuroimmunology Group (S.R., R.C.D.), Institute for Neuroscience and Muscle Research, The Kids Research Institute at the Children's Hospital at Westmead, Sydney Medical School, University of Sydney, New South Wales, Australia; Department of Neurology (S.R.), Westmead Hospital, Sydney, New South Wales, Australia; Sullivan Nicolaides Pathology (D.L.), Brisbane, Queensland, Australia; Concord Clinical School (T.A.H., S.W.R.), University of Sydney, New South Wales, Australia; Clinical Immunology (C.B.), PathWest, QEII Medical Center, Nedlands, Western Australia, Australia; School of Pathology and Laboratory Medicine (C.B.), University of Western Australia, Nedlands, Western Australia, Australia; Australian Neuro-Muscular Research Institute (ANRI) and Centre for Neuromuscular and Neurological Disorders (CNND) (A.R.-U.), University of Western Australia, QEII Medical Centre, Nedlands, Western Australia, Australia; Pathology Queensland (T.R.), Royal Brisbane & Women's Hospital, Brisbane, Queensland, Australia; and National Institute of Arthritis and Musculoskeletal and Skin Diseases (A.L.M.), National Institutes of Health, Bethesda, MD.;Department of Neurology (S.R., T.A.H., N.G., S.W.R.), Concord Repatriation General Hospital, Sydney, New South Wales, Australia; Neuroimmunology Group (S.R., R.C.D.), Institute for Neuroscience and Muscle Research, The Kids Research Institute at the Children's Hospital at Westmead, Sydney Medical School, University of Sydney, New South Wales, Australia; Department of Neurology (S.R.), Westmead Hospital, Sydney, New South Wales, Australia; Sullivan Nicolaides Pathology (D.L.), Brisbane, Queensland, Australia; Concord Clinical School (T.A.H., S.W.R.), University of Sydney, New South Wales, Australia; Clinical Immunology (C.B.), PathWest, QEII Medical Center, Nedlands, Western Australia, Australia; School of Pathology and Laboratory Medicine (C.B.), University of Western Australia, Nedlands, Western Australia, Australia; Australian Neuro-Muscular Research Institute (ANRI) and Centre for Neuromuscular and Neurological Disorders (CNND) (A.R.-U.), University of Western Australia, QEII Medical Centre, Nedlands, Western Australia, Australia; Pathology Queensland (T.R.), Royal Brisbane & Women's Hospital, Brisbane, Queensland, Australia; and National Institute of Arthritis and Musculoskeletal and Skin Diseases (A.L.M.), National Institutes of Health, Bethesda, MD.;Department of Neurology (S.R., T.A.H., N.G., S.W.R.), Concord Repatriation General Hospital, Sydney, New South Wales, Australia; Neuroimmunology Group (S.R., R.C.D.), Institute for Neuroscience and Muscle Research, The Kids Research Institute at the Children's Hospital at Westmead, Sydney Medical School, University of Sydney, New South Wales, Australia; Department of Neurology (S.R.), Westmead Hospital, Sydney, New South Wales, Australia; Sullivan Nicolaides Pathology (D.L.), Brisbane, Queensland, Australia; Concord Clinical School (T.A.H., S.W.R.), University of Sydney, New South Wales, Australia; Clinical Immunology (C.B.), PathWest, QEII Medical Center, Nedlands, Western Australia, Australia; School of Pathology and Laboratory Medicine (C.B.), University of Western Australia, Nedlands, Western Australia, Australia; Australian Neuro-Muscular Research Institute (ANRI) and Centre for Neuromuscular and Neurological Disorders (CNND) (A.R.-U.), University of Western Australia, QEII Medical Centre, Nedlands, Western Australia, Australia; Pathology Queensland (T.R.), Royal Brisbane & Women's Hospital, Brisbane, Queensland, Australia; and National Institute of Arthritis and Musculoskeletal and Skin Diseases (A.L.M.), National Institutes of Health, Bethesda, MD.;Department of Neurology (S.R., T.A.H., N.G., S.W.R.), Concord Repatriation General Hospital, Sydney, New South Wales, Australia; Neuroimmunology Group (S.R., R.C.D.), Institute for Neuroscience and Muscle Research, The Kids Research Institute at the Children's Hospital at Westmead, Sydney Medical School, University of Sydney, New South Wales, Australia; Department of Neurology (S.R.), Westmead Hospital, Sydney, New South Wales, Australia; Sullivan Nicolaides Pathology (D.L.), Brisbane, Queensland, Australia; Concord Clinical School (T.A.H., S.W.R.), University of Sydney, New South Wales, Australia; Clinical Immunology (C.B.), PathWest, QEII Medical Center, Nedlands, Western Australia, Australia; School of Pathology and Laboratory Medicine (C.B.), University of Western Australia, Nedlands, Western Australia, Australia; Australian Neuro-Muscular Research Institute (ANRI) and Centre for Neuromuscular and Neurological Disorders (CNND) (A.R.-U.), University of Western Australia, QEII Medical Centre, Nedlands, Western Australia, Australia; Pathology Queensland (T.R.), Royal Brisbane & Women's Hospital, Brisbane, Queensland, Australia; and National Institute of Arthritis and Musculoskeletal and Skin Diseases (A.L.M.), National Institutes of Health, Bethesda, MD.;Department of Neurology (S.R., T.A.H., N.G., S.W.R.), Concord Repatriation General Hospital, Sydney, New South Wales, Australia; Neuroimmunology Group (S.R., R.C.D.), Institute for Neuroscience and Muscle Research, The Kids Research Institute at the Children's Hospital at Westmead, Sydney Medical School, University of Sydney, New South Wales, Australia; Department of Neurology (S.R.), Westmead Hospital, Sydney, New South Wales, Australia; Sullivan Nicolaides Pathology (D.L.), Brisbane, Queensland, Australia; Concord Clinical School (T.A.H., S.W.R.), University of Sydney, New South Wales, Australia; Clinical Immunology (C.B.), PathWest, QEII Medical Center, Nedlands, Western Australia, Australia; School of Pathology and Laboratory Medicine (C.B.), University of Western Australia, Nedlands, Western Australia, Australia; Australian Neuro-Muscular Research Institute (ANRI) and Centre for Neuromuscular and Neurological Disorders (CNND) (A.R.-U.), University of Western Australia, QEII Medical Centre, Nedlands, Western Australia, Australia; Pathology Queensland (T.R.), Royal Brisbane & Women's Hospital, Brisbane, Queensland, Australia; and National Institute of Arthritis and Musculoskeletal and Skin Diseases (A.L.M.), National Institutes of Health, Bethesda, MD.",
"authors": "Ramanathan|Sudarshini|S|;Langguth|Daman|D|;Hardy|Todd A|TA|;Garg|Nidhi|N|;Bundell|Chris|C|;Rojana-Udomsart|Arada|A|;Dale|Russell C|RC|;Robertson|Thomas|T|;Mammen|Andrew L|AL|;Reddel|Stephen W|SW|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1212/NXI.0000000000000096",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2332-7812",
"issue": "2(3)",
"journal": "Neurology(R) neuroimmunology & neuroinflammation",
"keywords": null,
"medline_ta": "Neurol Neuroimmunol Neuroinflamm",
"mesh_terms": null,
"nlm_unique_id": "101636388",
"other_id": null,
"pages": "e96",
"pmc": null,
"pmid": "25866831",
"pubdate": "2015-06",
"publication_types": "D016428:Journal Article",
"references": "21623698;21972203;21654717;22933019;19428962;21885975;18367041;22422616;21360500;22866966;19813188;21093064;24797170;20496415",
"title": "Clinical course and treatment of anti-HMGCR antibody-associated necrotizing autoimmune myopathy.",
"title_normalized": "clinical course and treatment of anti hmgcr antibody associated necrotizing autoimmune myopathy"
} | [
{
"companynumb": "AU-PFIZER INC-2016474122",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ATORVASTATIN CALCIUM"
},
"drugadditional": "1"... |
{
"abstract": "Heparin-induced thrombocytopenia (HIT) is a serious complication in patients exposed to heparin, leading to thrombocytopenia and, potentially, thrombosis. This disorder is challenging in cardiac surgery when anticoagulation for cardiopulmonary bypass is required. Herein a patient with HIT who had active thrombosis and successfully underwent urgent left ventricular assist device implantation managed with plasma exchange, intravenous immunoglobulin, and protamine infusion is described. These therapies reduce the immune response to heparin and minimize thrombosis when heparin reexposure is planned. These approaches to perioperative management of HIT represent an attractive alternative to the use of non-heparin anticoagulants in the cardiac and vascular surgical population.",
"affiliations": "Department of Anesthesiology and Perioperative Medicine, Mayo Clinic, Rochester, MN. Electronic address: Liu.Victor@mayo.edu.;Department of Anesthesiology and Perioperative Medicine, Mayo Clinic, Rochester, MN.;Department of Cardiovascular Surgery, Mayo Clinic College of Medicine and Sciences, Rochester, MN.;Department of Anesthesiology and Perioperative Medicine, Mayo Clinic, Rochester, MN.",
"authors": "Liu|Victor C|VC|;Klompas|Allan M|AM|;Stulak|John M|JM|;Yalamuri|Suraj M|SM|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1053/j.jvca.2021.03.037",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1053-0770",
"issue": null,
"journal": "Journal of cardiothoracic and vascular anesthesia",
"keywords": "HIT; antiplatelet factor 4 antibodies; cardiopulmonary bypass; heparin-induced thrombocytopenia; intravenous immunoglobulin; plasma exchange",
"medline_ta": "J Cardiothorac Vasc Anesth",
"mesh_terms": null,
"nlm_unique_id": "9110208",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33933367",
"pubdate": "2021-03-30",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "The Triple HIT: Perioperative Management of Heparin-Induced Thrombocytopenia Using Plasma Exchange, Intravenous Immunoglobulin, and Protamine Infusion for Left Ventricular Assist Device Implantation.",
"title_normalized": "the triple hit perioperative management of heparin induced thrombocytopenia using plasma exchange intravenous immunoglobulin and protamine infusion for left ventricular assist device implantation"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/21/0136397",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HEPARIN SODIUM"
},
"drugadditional": "3"... |
{
"abstract": "OBJECTIVE\nIn Taiwan, the overall incidence of acute respiratory distress syndrome (ARDS) is 15.74 per 100,000 person-years, the mortality rate is 57.8%, and its overall prevalence in the intensive care unit (ICU) is 10.4%. Women who are pregnant and have ARDS have a high risk of fetal death and fetal asphyxia.\n\n\nMETHODS\nA 26-1/7-week pregnant woman presented with upper respiratory infection symptoms progressing to ARDS. While receiving ventilation, maintaining a prone position is an option for pregnant patients with severe ARDS. This case demonstrated a supplementary approach for pregnant women with ARDS.\n\n\nCONCLUSIONS\nProne position ventilation is indicated for pregnant women, as for any patient with ARDS. The Proning Severe ARDS Patients trial showed no difference in the complication between pregnant patients and other groups.",
"affiliations": "Department of Obstetrics and Gynecology, Tri-Service General Hospital, National Defense Medical Center, Taipei, Taiwan.;Department of Radiology, Tri-Service General Hospital, National Defense Medical Center, Taipei, Taiwan; Department of Radiology, Hualien Armed Forces General Hospital, Hualien, Taiwan.;Department of Obstetrics and Gynecology, Tri-Service General Hospital, National Defense Medical Center, Taipei, Taiwan. Electronic address: kung568@gmail.com.",
"authors": "Huang|Chuang-Yen|CY|;Tsai|Yi-Ling|YL|;Lin|Chi-Kang|CK|",
"chemical_list": null,
"country": "China (Republic : 1949- )",
"delete": false,
"doi": "10.1016/j.tjog.2021.03.036",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1028-4559",
"issue": "60(3)",
"journal": "Taiwanese journal of obstetrics & gynecology",
"keywords": null,
"medline_ta": "Taiwan J Obstet Gynecol",
"mesh_terms": "D000208:Acute Disease; D000328:Adult; D005260:Female; D006801:Humans; D056888:Patient Positioning; D011247:Pregnancy; D011251:Pregnancy Complications, Infectious; D016684:Prone Position; D012121:Respiration, Artificial; D012128:Respiratory Distress Syndrome; D012141:Respiratory Tract Infections; D013624:Taiwan",
"nlm_unique_id": "101213819",
"other_id": null,
"pages": "574-576",
"pmc": null,
"pmid": "33966753",
"pubdate": "2021-05",
"publication_types": "D002363:Case Reports",
"references": "29466596;9849838;26512593;24927376;23688302;27512467",
"title": "The prone position ventilation (PPV) as an approach in pregnancy with acute respiratory distress syndrome (ARDS).",
"title_normalized": "the prone position ventilation ppv as an approach in pregnancy with acute respiratory distress syndrome ards"
} | [
{
"companynumb": "TW-ROCHE-2844615",
"fulfillexpeditecriteria": "1",
"occurcountry": "TW",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "OSELTAMIVIR PHOSPHATE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nVarious cutaneous side-effects, including, exanthema, pruritus, urticaria and Lyell or Stevens-Johnson syndrome, have been reported with meropenem (carbapenem), a rarely-prescribed antibiotic. Levofloxacin (fluoroquinolone), a more frequently prescribed antibiotic, has similar cutaneous side-effects, as well as photosensitivity. We report a case of cutaneous hyperpigmentation induced by meropenem and levofloxacin.\n\n\nMETHODS\nA 67-year-old male was treated with meropenem (1g×4 daily), levofloxacin (500mg twice daily) and amikacin (500mg daily) for 2 weeks, followed by meropenem, levofloxacin and rifampicin (600mg twice daily) for 4 weeks for osteitis of the fifth metatarsal. Three weeks after initiation of antibiotic therapy, dark hyperpigmentation appeared on the lower limbs, predominantly on the anterior aspects of the legs. Histology revealed dark, perivascular and interstitial deposits throughout the dermis, which stained with both Fontana-Masson and Perls stains. Infrared microspectroscopy revealed meropenem in the dermis of involved skin. After withdrawal of the antibiotics, the pigmentation subsided slowly.\n\n\nCONCLUSIONS\nSimilar cases of cutaneous hyperpigmentation have been reported after use of minocycline. In these cases, histological examination also showed iron and/or melanin deposits within the dermis, but the nature of the causative pigment remains unclear. In our case, infrared spectroscopy enabled us to identify meropenem in the dermis. Two cases of cutaneous hyperpigmentation have been reported following use of levofloxacin, and the results of histological examination were similar. This is the first case of cutaneous hyperpigmentation induced by meropenem.",
"affiliations": "Service de dermatologie, hôpital Robert-Debré, CHU de Reims, avenue du Général-Kœnig, 51092 Reims cedex, France. Electronic address: egarval@chu-reims.fr.;Laboratoire de biophotonique, CNRS UMR 7369, URCA, 51100 Reims, France; Laboratoire de biopathologie, hôpital Maison-Blanche, CHU de Reims, 45, rue Cognacq-Jay, 51092 Reims cedex, France.;Laboratoire de biopathologie, hôpital Maison-Blanche, CHU de Reims, 45, rue Cognacq-Jay, 51092 Reims cedex, France.;Service de dermatologie, hôpital Robert-Debré, CHU de Reims, avenue du Général-Kœnig, 51092 Reims cedex, France.;Service de dermatologie, hôpital Robert-Debré, CHU de Reims, avenue du Général-Kœnig, 51092 Reims cedex, France.;Service de dermatologie, hôpital Robert-Debré, CHU de Reims, avenue du Général-Kœnig, 51092 Reims cedex, France.",
"authors": "Garval|E|E|;Vuiblet|V|V|;Durlach|A|A|;Perceau|G|G|;Anuset|D|D|;Bernard|P|P|",
"chemical_list": "D000900:Anti-Bacterial Agents; D064704:Levofloxacin; D000583:Amikacin; D000077731:Meropenem; D012293:Rifampin",
"country": "France",
"delete": false,
"doi": "10.1016/j.annder.2017.05.017",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0151-9638",
"issue": "144(12)",
"journal": "Annales de dermatologie et de venereologie",
"keywords": "Levofloxacin; Lévofloxacine; Meropenem; Méropénème; Pigmentation cutanée; Skin pigmentation",
"medline_ta": "Ann Dermatol Venereol",
"mesh_terms": "D000368:Aged; D000583:Amikacin; D000900:Anti-Bacterial Agents; D004359:Drug Therapy, Combination; D006801:Humans; D017495:Hyperpigmentation; D064704:Levofloxacin; D008297:Male; D000077731:Meropenem; D008684:Metatarsus; D010000:Osteitis; D012293:Rifampin",
"nlm_unique_id": "7702013",
"other_id": null,
"pages": "793-798",
"pmc": null,
"pmid": "29031417",
"pubdate": "2017-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Skin pigmentation induced by meropenem and levofloxacin.",
"title_normalized": "skin pigmentation induced by meropenem and levofloxacin"
} | [
{
"companynumb": "FR-B. BRAUN MEDICAL INC.-2036168",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "MEROPENEM\\SODIUM CHLORIDE"
},
"druga... |
{
"abstract": "Given the promising response of immune checkpoint inhibitors (ICPIs) in treating advanced malignancies, their use in clinical practice is on the rise. ICPIs are associated with a wide spectrum of immune-related adverse events (irAEs). The reported side effects of therapy can be severe enough to require interruption or withdrawal. We are presenting a case of a checkpoint inhibitor-induced acute pancreatitis and colitis, treated with high-dose steroids. This case highlights the need for all physicians to be aware of the different presentations of irAEs from checkpoint inhibitors to provide the correct diagnosis and management.",
"affiliations": "Internal Medicine, University of South Florida Morsani College of Medicine, Tampa, USA.;Internal Medicine, University of South Florida, Tampa, USA.;Internal Medicine, University of South Florida Morsani College of Medicine, Tampa, USA.;Internal Medicine, University of South Florida Morsani College of Medicine, Tampa, USA.;Gastroenterology, James A. Haley Veterans Affairs Hospital, Tampa, USA.",
"authors": "Pagan|Andrea|A|;Arroyo-Martinez|Yadis M|YM|;Tandon|Ankita|A|;Bertran-Rodriguez|Carlos|C|;Gill|Jeffrey|J|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.7759/cureus.8613",
"fulltext": "\n==== Front\nCureus\nCureus\n2168-8184\nCureus\n2168-8184 Cureus Palo Alto (CA) \n\n10.7759/cureus.8613\nInternal Medicine\nGastroenterology\nOncology\nImmune Checkpoint Inhibitor-Induced Acute Pancreatitis and Colitis\nMuacevic Alexander Adler John R Pagan Andrea 1 Arroyo-Martinez Yadis M 2 Tandon Ankita 1 Bertran-Rodriguez Carlos 1 Gill Jeffrey 3 \n1 \nInternal Medicine, University of South Florida Morsani College of Medicine, Tampa, USA \n\n2 \nInternal Medicine, University of South Florida, Tampa, USA \n\n3 \nGastroenterology, James A. Haley Veterans Affairs Hospital, Tampa, USA \n\nAndrea Pagan paganbol@usf.edu\n14 6 2020 \n6 2020 \n12 6 e861319 5 2020 13 6 2020 Copyright © 2020, Pagan et al.2020Pagan et al.This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.This article is available from https://www.cureus.com/articles/33727-immune-checkpoint-inhibitor-induced-acute-pancreatitis-and-colitisGiven the promising response of immune checkpoint inhibitors (ICPIs) in treating advanced malignancies, their use in clinical practice is on the rise. ICPIs are associated with a wide spectrum of immune-related adverse events (irAEs). The reported side effects of therapy can be severe enough to require interruption or withdrawal. We are presenting a case of a checkpoint inhibitor-induced acute pancreatitis and colitis, treated with high-dose steroids. This case highlights the need for all physicians to be aware of the different presentations of irAEs from checkpoint inhibitors to provide the correct diagnosis and management.\n\nimmune checkpoint inhibitorspancreatitisautoimmune colitisdiarrheaThe content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.\n==== Body\nIntroduction\nImmune checkpoint inhibitors (ICPIs) are an effective treatment for advanced malignancies. They work by releasing the brake that has been placed on the immune system, allowing the patients’ immune system to attack cancer cells, but also certain healthy tissues [1-3]. The primary targets for checkpoint inhibition include programmed cell death receptor 1 (PD1), programmed cell death ligand 1 (PD-L1), and cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4). Antibodies inhibiting PD-1 (pembrolizumab, nivolumab) and PD-L1 (atezolizumab, avelumab, durvalumab) have been approved for treatment in several types of cancer, including melanoma of the skin, non-small cell lung cancer, kidney cancer, bladder cancer, head and neck cancers, and Hodgkin lymphoma [1-3]. As their use increases, their side effects have become more prevalent. These adverse events can be severe enough to require interruption or withdrawal of immune checkpoint blockade therapy [4]. The most common side effects involve skin rashes (46%-62%), autoimmune colitis (22%-48%), autoimmune hepatitis (7%-33%), endocrinopathies (thyroiditis, hypophysitis, adrenalitis, and diabetes mellitus; 12%-34%) [5]. We present a case of a checkpoint inhibitor-induced acute pancreatitis and colitis.\n\nThe abstract of this article has been presented at the American College of Gastroenterology Conference in October 2019 [6].\n\nCase presentation\nA 76-year-old male with medical comorbidities pertinent for controlled hypertension, and stage IV oligometastatic clear cell renal carcinoma that was being treated with pembrolizumab, presented to the emergency department (ED) with two days of abdominal pain, nausea, and vomiting. On physical examination, he was tachycardic, normotensive, and afebrile, with epigastric tenderness to deep palpation. Laboratory work revealed elevated creatinine of 1.5 mg/dL (0.84-1.21 mg/dL) and lipase of 436 U/L (0-160 U/L). Abdominal computed tomography showed edematous pancreas with loss of pancreatic lobulation. Other causes of pancreatitis were ruled out. The patient was diagnosed with autoimmune-mediated acute pancreatitis and was treated with high-dose steroids. Infusions of pembrolizumab were held until the steroid taper was over. Once infusions were restored, he began having non-bloody diarrhea, up to six stools per day. Physical examination and laboratory data were normal on the second presentation. His infectious and inflammatory workup for diarrhea was negative. He underwent a colonoscopy with endoscopic findings showing colitis in the sigmoid colon (Figure 1).\n\nFigure 1 Colitis in the sigmoid colon and diverticulosis.\nRandom biopsies were obtained. Histological examination on the sigmoid colon showed chronic active colitis with crypt abscesses diagnosing the patient with checkpoint inhibitor-induced colitis (Figure 2).\n\nHe was restarted on high-dose steroids with improvement of his symptoms. Immunotherapy was placed on hold indefinitely.\n\nFigure 2 Active colitis with cryptitis and crypt abscesses (arrow) and chronic architectural alterations.\nDiscussion\nGastrointestinal toxicities are one of the most common causes of immune-related adverse effects of checkpoint blockade. Presentations include diarrhea and hepatotoxicity resulting in transaminitis and acute pancreatitis with the lowest incidence. Most immune-related adverse events appear within one to two months after the start of the checkpoint inhibitor [7]. Here we discuss the details of grading and managing ICPI-induced diarrhea as a reference for clinicians. Immune-mediated colitis and diarrhea is graded depending on the presentation. Grade 1 is defined as less than four stools per day above baseline. Grade 2 is defined as four to six stools per day and/or abdominal pain, mucus, or blood in the stool. Grade 3 is defined as seven or more stools per day and/or the presence of peritoneal signs with ileus and fever consistent with bowel perforation. Grade 4 consists of life-threatening consequences, such as hemodynamic collapse, perforation, ischemia, necrosis, bleeding, and toxic megacolon. Grade 5 consists of death [8]. Diagnosis is made by clinical history, laboratory workup, radiological imaging, sigmoidoscopy/colonoscopy, and histologic findings. Laboratory workup should be performed first to rule out any other cause of diarrhea or colitis, such as infectious. Abdominal computed tomography is useful to evaluate for obstruction, toxic megacolon, and inflamed areas due to ICPIs. Endoscopic and pathological findings are necessary to confirm ICPI-induced colitis and to rule out other causes of colitis, such as infectious, ischemic, other drug-induced, or diverticular colitis [9]. Endoscopic findings of immune-related diarrhea and colitis often show exudates, loss of vascular pattern, granular or edematous mucosa, patchy or diffuse erythema, aphtha, and ulcerations. The pathological evaluations most commonly show findings of active colitis, such as expansion of the lamina propria by lymphoplasmacytic infiltrate and later progressing to an increase in intraepithelial neutrophils and neutrophilic crypt abscess [9,10]. Treatment for colitis and diarrhea will depend on the grading. For grade 1, treatment consists of changes in diet, adding anti-motility agents, and continuation of ICPI therapy, once no infectious causes are identified. For grade 2, if immune-mediated colitis is identified on pathology and infectious workup is negative, treatment will consist of high-dose systemic steroids, 1-2 mg/kg/day, followed by a taper off corticosteroid therapy and ICPI treatment must be withheld until symptoms resolve [11]. For grade 3-4, hospital admission is recommended, and treatment includes intravenous high-dose corticosteroids, followed by a taper. Checkpoint inhibitor therapy must be discontinued permanently [12]. Early recognition of these toxicities is crucial in minimizing the impact of these complications on planned antineoplastic therapy.\n\nConclusions\nGastrointestinal toxicities are among the leading causes of immune-related adverse effects of checkpoint inhibitors. Patients on treatment with ICPIs presenting with diarrhea and abdominal pain, ICPI-induced diarrhea, and colitis should be high on the differential. Other causes of diarrhea should be ruled out as part of the workup and endoscopic evaluation is usually required for it. Treatment for ICPI-induced diarrhea and colitis includes high-dose steroids, and it depends on the grade discontinuation of the offending agent. In order to provide the correct diagnosis and management, physicians should be aware of the different presentations of the side effects of the ICPIs.\n\nThe authors have declared that no competing interests exist.\n\nHuman Ethics\nConsent was obtained by all participants in this study\n==== Refs\nReferences\n1 Fundamental mechanisms of immune checkpoint blockade therapy Cancer Discov Wei SC Duffy CR Allison JP 1069 1086 8 2018 30115704 \n2 A review of serious adverse effects under treatment with checkpoint inhibitors Curr Opin Oncol Heinzerling L Goldinger SM 136 144 29 2017 28059853 \n3 Immune-related adverse events of checkpoint inhibitors: Insights into immunological dysregulation Clin Immunol Yang H Yao Z Zhou X Zhang W Zhang X Zhang F 108377 213 2020 32135278 \n4 Fatal toxic effects associated with immune checkpoint inhibitors: a systematic review and meta-analysis JAMA Oncol Wang DY Salem JE Cohen JV 1721 1728 4 2018 30242316 \n5 Checkpoint inhibitors Dtsch Arztebl Int Heinzerling L de Toni EN Schett G Hundorfean G Zimmer L 119 126 116 2019 30940340 \n6 Immune checkpoint inhibitor-induced acute pancreatitis and colitis Am J Gastroenterol Pagan A Gill J Arroyo Y Bertran-Rodriguez C 0 114 2019 \n7 Patterns of onset and resolution of immune-related adverse events of special interest with ipilimumab: detailed safety analysis from a phase 3 trial in patients with advanced melanoma Cancer Weber JS Dummer R de Pril V Lebbe C Hodi FS MDX010-20 Investigators 1675 1682 119 2013 23400564 \n8 Immune checkpoint inhibitor-induced colitis: a comprehensive review World J Clin Cases Som A Mandaliya R Alsaadi D 405 418 7 2019 30842952 \n9 Immune checkpoint inhibitor-induced diarrhea/colitis: endoscopic and pathologic findings World J Gastrointest Pathophysiol Nishida T Iijima H Adachi S 17 28 10 2019 31559106 \n10 Autoimmune diseases induced by biological agents. A review of 12,731 cases (BIOGEAS Registry) Expert Opin Drug Saf Perez-De-Lis M Retamozo S Flores-Chavez A 1255 1271 16 2017 28854831 \n11 Management of immune-related adverse events associated with immune checkpoint inhibitor therapy: a minireview of current clinical guidelines Asia Pac J Oncol Nurs Trinh S Le A Gowani S La-Beck NM 154 160 6 2019 30931360 \n12 Workup and management of immune-mediated colitis in patients treated with immune checkpoint inhibitors Oncologist Singh BP Marshall JL He AR 197 202 25 2020 32162824\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2168-8184",
"issue": "12(6)",
"journal": "Cureus",
"keywords": "autoimmune colitis; diarrhea; immune checkpoint inhibitors; pancreatitis",
"medline_ta": "Cureus",
"mesh_terms": null,
"nlm_unique_id": "101596737",
"other_id": null,
"pages": "e8613",
"pmc": null,
"pmid": "32550093",
"pubdate": "2020-06-14",
"publication_types": "D002363:Case Reports",
"references": "28059853;30940340;28854831;30842952;30931360;30115704;23400564;31559106;30242316;32135278;32162824",
"title": "Immune Checkpoint Inhibitor-Induced Acute Pancreatitis and Colitis.",
"title_normalized": "immune checkpoint inhibitor induced acute pancreatitis and colitis"
} | [
{
"companynumb": "US-009507513-2002USA008166",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PEMBROLIZUMAB"
},
"drugadditional": null,
... |
{
"abstract": "Hashimoto's encephalopathy (HE) is a presumed autoimmune disorder associated with anti-thyroid autoantibodies and signs and symptoms of encephalopathy. A sub-type of HE is associated with cerebellar dysfunction and ataxia. Immunosuppressive therapy, particularly corticosteroid treatment, is utilized in the majority of cases. Short-term apheresis has been reported with variable patient responses. Here we report the case of a 72 year-old female with an ∼15 year history of cerebellar type HE that had profound improvement in symptoms after long-term apheresis treatment over an ∼2 year period. Following an induction phase, twice-weekly maintenance apheresis of 1 plasma volume reversed long-standing severe gait ataxia that had required a walker, as well as mild cognitive symptoms. This paralleled reductions in anti-thyroid antibody levels. Holidays from apheresis lasting several weeks and/or reductions in maintenance apheresis frequency to once per-week resulted in re-expression of ataxia and cognitive impairments along with a rise in anti-thyroid antibody levels. An apheresis dose-effect was observed whereby parallel rise and fall in both symptomatology and antibody levels would mirror duration between apheresis intervals. To our knowledge, this is the first report of profound therapeutic benefit and a dose-response relationship to long-term apheresis in cerebellar-type HE. This case suggests that maintenance apheresis be considered in responsive patients, particularly in those with contraindications to medical immunosuppression.",
"affiliations": "Department of Pathology and Laboratory Medicine, UC Irvine Health School of Medicine, United States; Department of Internal Medicine, UC Irvine Health School of Medicine, United States.;Department of Pathology and Laboratory Medicine, UC Irvine Health School of Medicine, United States.;Department of Neurology, UC Irvine Health School of Medicine, United States.;Department of Pathology and Laboratory Medicine, UC Irvine Health School of Medicine, United States.;Department of Neurology, UC Irvine Health School of Medicine, United States. Electronic address: mdemetri@uci.edu.",
"authors": "Tran|Minh-Ha|MH|;Mkhikian|Haik|H|;Sy|Michael|M|;Perez-Alvarez|Ingrid|I|;Demetriou|Michael|M|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1016/j.transci.2018.05.027",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1473-0502",
"issue": "57(3)",
"journal": "Transfusion and apheresis science : official journal of the World Apheresis Association : official journal of the European Society for Haemapheresis",
"keywords": "Apheresis access; Autoimmune Encephalitis; Cerebellar-type Hashimoto’s Encephalitis; Hashimoto’s Encephalitis; Plasma Exchange; Plasmapheresis; Therapeutic Apheresis; long-term apheresis",
"medline_ta": "Transfus Apher Sci",
"mesh_terms": "D000368:Aged; D004660:Encephalitis; D005260:Female; D050031:Hashimoto Disease; D006801:Humans; D010951:Plasma Exchange; D010956:Plasmapheresis",
"nlm_unique_id": "101095653",
"other_id": null,
"pages": "418-420",
"pmc": null,
"pmid": "29891220",
"pubdate": "2018-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Long-term plasma exchange as maintenance therapy for cerebellar-type Hashimoto's encephalopathy, a case report.",
"title_normalized": "long term plasma exchange as maintenance therapy for cerebellar type hashimoto s encephalopathy a case report"
} | [
{
"companynumb": "US-TEVA-2018-US-948461",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "IRON"
},
"drugadditional": "3",
"druga... |
{
"abstract": "Fungi are an important and common cause of cutaneous infections affecting solid organ transplant recipients. These infections can represent a primary site of infection with the potential for dissemination, or a manifestation of metastatic infection. The high morbidity and mortality associated with these infections necessitates urgent therapy with antifungal drugs; however, the interaction between these drugs and immunosuppressive therapies can be a major limitation because of drug toxicity. A case of soft tissue infection of the toe caused by Fusarium chlamydosporum and Candida guilliermondii in a liver transplant patient on sirolimus, who was successfully treated with the new antifungal agent posaconazole, is described. The pharmacokinetic interactions of sirolimus and the new triazoles, and their impact on treatment choices are briefly discussed.",
"affiliations": "Department of Internal Medicine, McMaster University;",
"authors": "Dahlan|Randah|R|;Patel|Ameen|A|;Haider|Shariq|S|",
"chemical_list": null,
"country": "Egypt",
"delete": false,
"doi": "10.1155/2012/272197",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1712-9532",
"issue": "23(2)",
"journal": "The Canadian journal of infectious diseases & medical microbiology = Journal canadien des maladies infectieuses et de la microbiologie medicale",
"keywords": "Cutaneous fungal infections; Liver transplantation; Posaconazole; Sirolimus",
"medline_ta": "Can J Infect Dis Med Microbiol",
"mesh_terms": null,
"nlm_unique_id": "101226876",
"other_id": null,
"pages": "e44-7",
"pmc": null,
"pmid": "23730320",
"pubdate": "2012",
"publication_types": "D002363:Case Reports",
"references": "20130026;15328123;19196220;17934079;17125435;17542765;16635790;12355377;11897586;18035188;18063600;16772406;14527380;18503400;15686733;20304202;8507760",
"title": "Successful use of posaconazole to treat invasive cutaneous fungal infection in a liver transplant patient on sirolimus.",
"title_normalized": "successful use of posaconazole to treat invasive cutaneous fungal infection in a liver transplant patient on sirolimus"
} | [
{
"companynumb": "CA-SUN PHARMACEUTICAL INDUSTRIES LTD-2021R1-283082",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SIROLIMUS"
},
"druga... |
{
"abstract": "Primary ovarian squamous cell carcinoma is uncommon, and the optimal treatment strategy for this disease has not yet been established. A 71-year-old woman diagnosed with FIGO stage IIb pure ovarian squamous cell carcinoma underwent cytoreductive surgery followed by combination chemotherapy with paclitaxel and carboplatin. After the second treatment course, a recurrent mass grew rapidly, and serum tumor maker levels increased. Monotherapy with weekly irinotecan was then instituted. This second-line chemotherapy was remarkably effective, and the patient subsequently underwent complete interval debulking surgery with a pathological complete response after the third treatment course. Weekly irinotecan is an effective choice for primary ovarian squamous cell carcinoma resistant to combination chemotherapy with paclitaxel and carboplatin.",
"affiliations": "Department of Gynecology, Yamaguchi Grand Medical Center, Yamaguchi, Japan.",
"authors": "Nakamura|Yasuhiko|Y|;Kamei|Toshiaki|T|;Shinagawa|Masahiro|M|;Sakamoto|Yuka|Y|;Miwa|Ichiro|I|",
"chemical_list": "D000970:Antineoplastic Agents; D000077146:Irinotecan; D016190:Carboplatin; D017239:Paclitaxel; D002166:Camptothecin",
"country": "Australia",
"delete": false,
"doi": "10.1111/jog.12631",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1341-8076",
"issue": "41(5)",
"journal": "The journal of obstetrics and gynaecology research",
"keywords": "carboplatin; irinotecan; ovarian cancer; paclitaxel; squamous cell carcinoma",
"medline_ta": "J Obstet Gynaecol Res",
"mesh_terms": "D000368:Aged; D000970:Antineoplastic Agents; D000971:Antineoplastic Combined Chemotherapy Protocols; D002166:Camptothecin; D016190:Carboplatin; D002294:Carcinoma, Squamous Cell; D019008:Drug Resistance, Neoplasm; D005260:Female; D006801:Humans; D000077146:Irinotecan; D010051:Ovarian Neoplasms; D017239:Paclitaxel; D019233:Retreatment; D016896:Treatment Outcome",
"nlm_unique_id": "9612761",
"other_id": null,
"pages": "809-12",
"pmc": null,
"pmid": "25511544",
"pubdate": "2015-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Case of pure ovarian squamous cell carcinoma resistant to combination chemotherapy with paclitaxel and carboplatin but responsive to monotherapy with weekly irinotecan.",
"title_normalized": "case of pure ovarian squamous cell carcinoma resistant to combination chemotherapy with paclitaxel and carboplatin but responsive to monotherapy with weekly irinotecan"
} | [
{
"companynumb": "JP-CIPLA LTD.-2015JP04467",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugadditional": "1",
... |
{
"abstract": "BACKGROUND\nInguinal hernia surgery is one of the most common surgical procedures performed worldwide. Some studies demonstrated clear advantages of laparoscopic approach in terms of chronic pain, recurrence rate and daily life activities Aim of this study was to compare short and long-terms outcome of tacks and fibrin glue used during laparoscopic transabdominal hernioplasty (TAPP).\n\n\nMETHODS\nThis is a retrospective study conducted by our division of General Surgery. From May 2008 to May 2013 we performed 116 hernioplasty with TAPP technique. We compared two groups of patients: a group of 59 patients treated with fibrin glue and a group of 57 patients treated with conventional tacks and the two subgroups of patients over 65 years old. We evaluated: perioperative outcomes, early and late complications.\n\n\nRESULTS\nThere were no significative difference about length of postoperative stay, time to return to work, recurrence rate and complications.\n\n\nCONCLUSIONS\nThis study demonstrates that fibrin glue are same tolerated than tacks by patients and that the glues lead to the same good results during initial follow-up and in long term data also in the elderly. Meticulous preparation of the groin with preservation of spermatic sheet is in our opinion necessary to provide effective pain reduction and a good result in every TAPP procedure.",
"affiliations": "University of Turin, Department of Oncology, School of Medicine, Teaching Hospital \"San Luigi Gonzaga\", Section of General Surgery, Orbassano, Turin, Italy. Electronic address: alessiaferrarese.md@gmail.com.;University of Turin, Department of Oncology, School of Medicine, Teaching Hospital \"San Luigi Gonzaga\", Section of General Surgery, Orbassano, Turin, Italy. Electronic address: silvia.marola@gmail.com.;University of Turin, Department of Oncology, School of Medicine, Teaching Hospital \"San Luigi Gonzaga\", Section of General Surgery, Orbassano, Turin, Italy. Electronic address: alessandra.sur@gmail.com.;University of Turin, Department of Oncology, School of Medicine, Teaching Hospital \"San Luigi Gonzaga\", Section of General Surgery, Orbassano, Turin, Italy. Electronic address: alexbori@libero.it.;University of Turin, Department of Oncology, School of Medicine, Teaching Hospital \"San Luigi Gonzaga\", Section of General Surgery, Orbassano, Turin, Italy. Electronic address: m4rk1018@gmail.com.;University of Turin, Department of Oncology, School of Medicine, Teaching Hospital \"San Luigi Gonzaga\", Section of General Surgery, Orbassano, Turin, Italy. Electronic address: jacopo.cumbo@gmail.com.;University of Turin, Department of Oncology, School of Medicine, Teaching Hospital \"San Luigi Gonzaga\", Section of General Surgery, Orbassano, Turin, Italy. Electronic address: mariosolej@gmail.com.;University of Turin, Department of Oncology, School of Medicine, Teaching Hospital \"San Luigi Gonzaga\", Section of General Surgery, Orbassano, Turin, Italy. Electronic address: stefano_e@libero.it.;University of Turin, Department of Oncology, School of Medicine, Teaching Hospital \"San Luigi Gonzaga\", Section of General Surgery, Orbassano, Turin, Italy. Electronic address: mario.nano@unito.it.;University of Turin, Department of Oncology, School of Medicine, Teaching Hospital \"San Luigi Gonzaga\", Section of General Surgery, Orbassano, Turin, Italy. Electronic address: valtermartino.md@gmail.com.",
"authors": "Ferrarese|Alessia|A|;Marola|Silvia|S|;Surace|Alessandra|A|;Borello|Alessandro|A|;Bindi|Marco|M|;Cumbo|Jacopo|J|;Solej|Mario|M|;Enrico|Stefano|S|;Nano|Mario|M|;Martino|Valter|V|",
"chemical_list": "D015718:Fibrin Tissue Adhesive; D014014:Tissue Adhesives",
"country": "England",
"delete": false,
"doi": "10.1016/j.ijsu.2014.08.371",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1743-9159",
"issue": "12 Suppl 2()",
"journal": "International journal of surgery (London, England)",
"keywords": "Elderly; Inguinal hernia repair; Laparoscopic hernioplasty; Laparoscopy; TAPP",
"medline_ta": "Int J Surg",
"mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D005260:Female; D015718:Fibrin Tissue Adhesive; D006552:Hernia, Inguinal; D059685:Herniorrhaphy; D006801:Humans; D010535:Laparoscopy; D007902:Length of Stay; D008297:Male; D008875:Middle Aged; D012008:Recurrence; D012189:Retrospective Studies; D017792:Surgical Stapling; D014014:Tissue Adhesives; D016896:Treatment Outcome; D058106:Wound Closure Techniques",
"nlm_unique_id": "101228232",
"other_id": null,
"pages": "S94-S98",
"pmc": null,
"pmid": "25183643",
"pubdate": "2014",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Fibrin glue versus stapler fixation in laparoscopic transabdominal inguinal hernia repair: a single center 5-year experience and analysis of the results in the elderly.",
"title_normalized": "fibrin glue versus stapler fixation in laparoscopic transabdominal inguinal hernia repair a single center 5 year experience and analysis of the results in the elderly"
} | [
{
"companynumb": "IT-JNJFOC-20141016223",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "FIBRINOGEN HUMAN\\THROMBIN HUMAN"
},
"drugadditi... |
{
"abstract": "OBJECTIVE\nOral anti-epileptic drugs (AED) represent possible add-on options in refractory status epilepticus (SE). We report our experience in using topiramate (TPM) to treat SE unresponsive to sequential trials of multiple agents.\n\n\nMETHODS\nOver 57 months, we identified 11 SE patients treated with TPM in our hospital, all of them suffered from SE refractory to at least two treatments, and six had generalized SE. Nine patients were managed in the ICU and required intubation.\n\n\nRESULTS\nWe found a definite electro-clinical response in 2/11 patients, already evident after 12-96 h after TPM introduction, and a possible response in 2/11 patients (concomitantly with other AEDs); 7/11 did not respond. Partial-complex SE appeared to better respond than generalized-convulsive SE. One patient developed a severe nephrolithiasis.\n\n\nCONCLUSIONS\nAs compared to previous small series describing only patients responding to TPM, this unselected observation underscores the difficulty of treating refractory SE, regardless of the agent.",
"affiliations": "Department of Clinical Neuroscience, Centre Hospitalier Universitaire Vaudois, Lausanne, Switzerland.",
"authors": "Stojanova|V|V|;Rossetti|A O|AO|",
"chemical_list": "D000927:Anticonvulsants; D000077236:Topiramate; D005632:Fructose",
"country": "Denmark",
"delete": false,
"doi": "10.1111/j.1600-0404.2011.01562.x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0001-6314",
"issue": "125(2)",
"journal": "Acta neurologica Scandinavica",
"keywords": null,
"medline_ta": "Acta Neurol Scand",
"mesh_terms": "D000284:Administration, Oral; D000293:Adolescent; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000927:Anticonvulsants; D004359:Drug Therapy, Combination; D005260:Female; D005632:Fructose; D006801:Humans; D008297:Male; D008875:Middle Aged; D011446:Prospective Studies; D013226:Status Epilepticus; D000077236:Topiramate; D016896:Treatment Outcome; D055815:Young Adult",
"nlm_unique_id": "0370336",
"other_id": null,
"pages": "e7-e11",
"pmc": null,
"pmid": "21711264",
"pubdate": "2012-02",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Oral topiramate as an add-on treatment for refractory status epilepticus.",
"title_normalized": "oral topiramate as an add on treatment for refractory status epilepticus"
} | [
{
"companynumb": "CH-UNICHEM PHARMACEUTICALS (USA) INC-UCM201912-000833",
"fulfillexpeditecriteria": "1",
"occurcountry": "CH",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CLONAZEPAM"
},
"... |
{
"abstract": "Skin necrosis and priapism are unusual complications of warfarin therapy. We report a teenager with warfarin-associated skin necrosis and priapism who was subsequently found to be a compound heterozygote for protein C deficiency and a heterozygote for the factor V Leiden mutation.",
"affiliations": "Department of Pediatrics, University of Colorado Health Sciences Center, Aurora, Colorado 80045-0507, USA.",
"authors": "Zimbelman|J|J|;Lefkowitz|J|J|;Schaeffer|C|C|;Hays|T|T|;Manco-Johnson|M|M|;Manhalter|C|C|;Nuss|R|R|",
"chemical_list": "D000925:Anticoagulants; D014859:Warfarin; D005165:Factor V",
"country": "United States",
"delete": false,
"doi": "10.1067/mpd.2000.107159",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0022-3476",
"issue": "137(2)",
"journal": "The Journal of pediatrics",
"keywords": null,
"medline_ta": "J Pediatr",
"mesh_terms": "D000293:Adolescent; D000925:Anticoagulants; D003875:Drug Eruptions; D005165:Factor V; D006801:Humans; D008297:Male; D009336:Necrosis; D011317:Priapism; D020151:Protein C Deficiency; D019851:Thrombophilia; D014859:Warfarin",
"nlm_unique_id": "0375410",
"other_id": null,
"pages": "266-8",
"pmc": null,
"pmid": "10931425",
"pubdate": "2000-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013487:Research Support, U.S. Gov't, P.H.S.",
"references": null,
"title": "Unusual complications of warfarin therapy: skin necrosis and priapism.",
"title_normalized": "unusual complications of warfarin therapy skin necrosis and priapism"
} | [
{
"companynumb": "US-PFIZER INC-2017126382",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HEPARIN SODIUM"
},
"drugadditional": "3",
... |
{
"abstract": "Vaginal carcinoma is rare, accounting for only 2% of all gynecological malignancies. Due to a lack of prospective randomized studies, the role of concurrent chemoradiotherapy in the treatment of primary vaginal carcinoma remains unclear. We report the first two cases of primary vaginal carcinoma successfully treated with a regimen involving concurrent weekly carboplatin plus paclitaxel, external beam radiotherapy and high-dose-rate interstitial brachytherapy. These cases strongly indicate that definitive chemoradiation involving carboplatin plus paclitaxel may be a reasonable treatment for primary vaginal carcinoma.",
"affiliations": "Department of Obstetrics and Gynecology, Osaka University Graduate School of Medicine, Suita, Osaka, Japan.",
"authors": "Mabuchi|Seiji|S|;Kawano|Mahiru|M|;Isohashi|Fumiaki|F|;Kuroda|Hiromasa|H|;Sasano|Tomoyuki|T|;Kimura|Tadashi|T|",
"chemical_list": "D000970:Antineoplastic Agents; D016190:Carboplatin; D017239:Paclitaxel",
"country": "Australia",
"delete": false,
"doi": "10.1111/jog.12492",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1341-8076",
"issue": "41(1)",
"journal": "The journal of obstetrics and gynaecology research",
"keywords": "carboplatin; concurrent chemoradiotherapy; paclitaxel; vaginal carcinoma",
"medline_ta": "J Obstet Gynaecol Res",
"mesh_terms": "D000328:Adult; D000970:Antineoplastic Agents; D001918:Brachytherapy; D016190:Carboplatin; D002277:Carcinoma; D005260:Female; D006801:Humans; D008875:Middle Aged; D017239:Paclitaxel; D014625:Vaginal Neoplasms",
"nlm_unique_id": "9612761",
"other_id": null,
"pages": "156-61",
"pmc": null,
"pmid": "25227150",
"pubdate": "2015-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "First two cases of primary carcinoma of the vagina successfully treated with concurrent weekly carboplatin plus paclitaxel, external beam radiotherapy and high-dose-rate interstitial brachytherapy: a case report and published work review.",
"title_normalized": "first two cases of primary carcinoma of the vagina successfully treated with concurrent weekly carboplatin plus paclitaxel external beam radiotherapy and high dose rate interstitial brachytherapy a case report and published work review"
} | [
{
"companynumb": "JP-MYLANLABS-2015M1003757",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PACLITAXEL"
},
"drugadditional": null,
... |
{
"abstract": "Metaplastic carcinoma is a rare type of breast carcinoma, which tends to be chemo-resistant. We report a case of metaplastic squamous cell carcinoma of the breast diagnosed after neoadjuvant chemotherapy(NAC). A 56-year-old woman was diagnosed as having right-sided breast cancer(invasive ductal carcinoma[IDC], triple negative), cT1cN1M0, stage II A. NAC with 5-fluorouracil, epirubicin, and cyclophosphamide(FEC)followed by docetaxel(DTX)was administered. Tumor progression occurred during both the FEC and DTX regimens. We discontinued NAC and performed breast conserving surgery with axillary lymph node dissection. Histological findings of the resected specimen showed mixed IDC and widely spread squamous metaplasia. Weekly paclitaxel and radiotherapy were administered and the patient is alive with no recurrence 3 years after surgery.",
"affiliations": "Dept. of Surgery, Kitakyushu Municipal Medical Center.",
"authors": "Ishikawa|Nami|N|;Saimura|Michiyo|M|;Koga|Kenichiro|K|;Anan|Keisei|K|;Mitsuyama|Shoshu|S|;Tamiya|Sadafumi|S|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0385-0684",
"issue": "45(7)",
"journal": "Gan to kagaku ryoho. Cancer & chemotherapy",
"keywords": null,
"medline_ta": "Gan To Kagaku Ryoho",
"mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D001943:Breast Neoplasms; D018270:Carcinoma, Ductal, Breast; D002294:Carcinoma, Squamous Cell; D005260:Female; D006801:Humans; D015412:Mastectomy, Segmental; D008875:Middle Aged; D020360:Neoadjuvant Therapy; D016896:Treatment Outcome",
"nlm_unique_id": "7810034",
"other_id": null,
"pages": "1101-1103",
"pmc": null,
"pmid": "30042281",
"pubdate": "2018-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "A Case of Metaplastic Squamous Cell Carcinoma of the Breast Diagnosed after Neoadjuvant Chemotherapy.",
"title_normalized": "a case of metaplastic squamous cell carcinoma of the breast diagnosed after neoadjuvant chemotherapy"
} | [
{
"companynumb": "JP-IMPAX LABORATORIES, INC-2018-IPXL-03089",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "EPIRUBICIN HYDROCHLORIDE"
},
... |
{
"abstract": "Multiple sclerosis (MS) is associated with a higher prevalence of mood and psychiatric disorders, such as bipolar disorder (BD). While mania is most often associated with BD, MS can also induce manic symptoms. However, it is crucial to distinguish which condition is causing mania since medical management is different based on its etiology. Herein, we report a case of a manic episode in a middle-aged female with a prolonged history of BD who received a recent diagnosis of MS 1 year ago.\nA 56-year-old female presented with an episode of mania and psychosis while receiving a phenobarbital taper for chronic lorazepam use. She had a prolonged history of bipolar type 1 disorder and depression. She showed optic neuritis and was diagnosed with MS a year prior.\nThe patient was diagnosed with BD-induced mania based on the absence of increased demyelination compared to previous MRI and lack of new focal or lateralizing neurologic findings of MS.\n\n\nMETHODS\nLithium was given for mood stabilization and decreased dosage of prior antidepressant medication. Risperidone was given for ongoing delusions.\n\n\nRESULTS\nAfter 8 days of hospitalization, patient's mania improved but demonstrated atypical features and ongoing delusions. She was discharged at her request to continue treatment in an outpatient setting.\nIn BD patients with an episode of mania, MS should be included in the differential, since both conditions can cause manic symptoms. The origin of mania should be delineated through a detailed neurological exam, neuroimaging, and thorough patient-family psychiatric history for appropriate clinical treatment.",
"affiliations": "University of Minnesota Medical School.;University of Minnesota Medical School.",
"authors": "Yang|Simon|S|;Wichser|Lora|L|",
"chemical_list": "D018692:Antimanic Agents; D014150:Antipsychotic Agents; D018020:Lithium Compounds; D018967:Risperidone",
"country": "United States",
"delete": false,
"doi": "10.1097/MD.0000000000022823",
"fulltext": "\n==== Front\nMedicine (Baltimore)\nMedicine (Baltimore)\nMEDI\nMedicine\n0025-7974 1536-5964 Lippincott Williams & Wilkins Hagerstown, MD \n\nMD-D-20-02381\n10.1097/MD.0000000000022823\n22823\n6500\nResearch Article\nClinical Case Report\nManic episode in patient with bipolar disorder and recent multiple sclerosis diagnosis\nA case reportYang Simon BS, MSa∗ Wichser Lora MDab Saranathan. Maya a University of Minnesota Medical School\nb Department of Psychiatry, University of Minnesota, Minneapolis, MN.\n∗ Correspondence: Simon Yang, University of Minnesota, 420 Delaware St. SE, Minneapolis MN 55455 (e-mail: yang6095@umn.edu).\n16 10 2020 \n16 10 2020 \n99 42 e2282328 3 2020 13 9 2020 21 9 2020 Copyright © 2020 the Author(s). Published by Wolters Kluwer Health, Inc.2020This is an open access article distributed under the Creative Commons Attribution License 4.0 (CCBY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. http://creativecommons.org/licenses/by/4.0Abstract\nIntroduction/Rationale:\nMultiple sclerosis (MS) is associated with a higher prevalence of mood and psychiatric disorders, such as bipolar disorder (BD). While mania is most often associated with BD, MS can also induce manic symptoms. However, it is crucial to distinguish which condition is causing mania since medical management is different based on its etiology. Herein, we report a case of a manic episode in a middle-aged female with a prolonged history of BD who received a recent diagnosis of MS 1 year ago.\n\nPatient Concerns:\nA 56-year-old female presented with an episode of mania and psychosis while receiving a phenobarbital taper for chronic lorazepam use. She had a prolonged history of bipolar type 1 disorder and depression. She showed optic neuritis and was diagnosed with MS a year prior.\n\nDiagnoses:\nThe patient was diagnosed with BD-induced mania based on the absence of increased demyelination compared to previous MRI and lack of new focal or lateralizing neurologic findings of MS.\n\nInterventions:\nLithium was given for mood stabilization and decreased dosage of prior antidepressant medication. Risperidone was given for ongoing delusions.\n\nOutcomes:\nAfter 8 days of hospitalization, patient's mania improved but demonstrated atypical features and ongoing delusions. She was discharged at her request to continue treatment in an outpatient setting.\n\nConclusion/Lesson:\nIn BD patients with an episode of mania, MS should be included in the differential, since both conditions can cause manic symptoms. The origin of mania should be delineated through a detailed neurological exam, neuroimaging, and thorough patient-family psychiatric history for appropriate clinical treatment.\n\nKeywords\nbipolar diseasemaniamultiple sclerosisneuroimagingmood disorderOPEN-ACCESSTRUE\n==== Body\n1 Introduction\nMultiple sclerosis (MS) is an inflammatory autoimmune disease that focally damages the white matter in the brain and spinal cord.[1] It affects 1 in 1000 people and is the most common central nervous system disease for young adults in the Western world.[2] Initially, neurological symptoms are transient due to remyelination, but repeated demyelination progressively leads to diffuse and chronic neurodegeneration. Furthermore, previous studies have shown increased psychiatric symptoms and higher prevalence of psychiatric and mood disorders.[3]\n\nBipolar disorder (BD) is a mood disorder characterized by extreme mood fluctuations with episodes of mania or hypomania and depression. Mania, a hallmark of BD, is when the patient is in a state of elevated mood and energy, during which the patient reports symptoms such as euphoria or irritable mood, racing thoughts, overactivity, and reduced need for sleep. BD affects more than 1 in 100 people worldwide.[4]\n\nThe prevalence of BD in MS patients has been reported to be twice than that of the general population.[5] For patients diagnosed with BD and MS, there is no clear method to distinguish whether mania was induced from BD or from a MS flare-up. However, it is important to discern the cause of manic episode since management is different for BD-induced mania vs MS-induced mania. Herein, we describe a patient diagnosed with BD that later developed MS who presented to us during a manic episode. Through this case, we aim to examine the BD versus MS origins of manic episodes and discuss relevant literature.\n\n2 Case Presentation\nThe patient was a 56-year-old female who came to us during an episode of mania and psychosis while receiving treatment at an addiction treatment center where she was taking a phenobarbital taper for chronic lorazepam use. She displayed symptoms of aggressive posturing, verbal abuse to staff, delayed response, and racing thoughts. She did not describe suicidal thoughts. She had 4 prior psychiatric hospitalizations. At age 33, she exhibited depression, anxiety, and paranoia that lead to her first hospitalization. At age 44, she attempted suicide via acetaminophen overdose. Her first reported manic episode was at age 45, during which bipolar type 1 disorder was considered as her differential and subsequently diagnosed. Her symptoms accompanied delusions during this episode, without suicidal ideation. Her most recent hospitalization was at age 49 for depression and paranoia with delusions of being wiretapped and people reading her mind. At age 55, the patient presented with optic neuritis and diagnosed with MS after a lumbar puncture showed oligoclonal bands.\n\nFamily history revealed depression in father and alcohol use disorder in mother. Past medical history described an acute onset dizziness when moving eyes left to right or vice versa and when standing up from a lying position.\n\nNeurology consult found no focal or lateralizing findings. MRI analysis showed greater than 15 foci of T2 hyperintensity within white matter where some lesions were within periventricular and juxtacortical white matter of both cerebral hemispheres, consistent with a demyelinating disease. A single focus of enhancement in the posterior corona radiata was suggestive of active demyelination. No demyelinating signs were seen in the thoracic spine. However, no significant difference was seen compared to previous MRI.\n\nDuring the present hospitalization, patient's prior bupropion was reduced due to concern for further mania activation. Lithium 600 mg twice a day was prescribed for mood stabilization. Risperidone 0.5 mg at bedtime was prescribed for ongoing delusions. Patient was not taking scheduled steroids prior to admission. After 8 days of hospitalization, patient's mania improved but demonstrated atypical features, such as absence of pressured speech, grandiosity, risk taking or sleep pattern changes. Per a family member's report, patient stated that she was in a movie and that everyone else was acting around her. Patient requested discharge to continue treatment in an outpatient setting.\n\n3 Discussion\nAlthough neurological symptoms of MS have been extensively studied, the psychiatric effects of MS are relatively less elucidated, despite the fact that the association of MS and psychiatric symptoms observed as early as 1872 by Jean-Martin Charcot.[6] In 1986, Schiffer et al suggested an association between BD and MS after identifying 10 patients with both BD and MS, out of more than 700,000 individuals, when epidemiologic data expected to find only 5.4 patients.[7] Co-occurrences of BD and MS have been reported infrequently through case studies. Recently, Carta et al conducted a case control study with 201 MS patients that examined the risk of BD in MS patients and reported OR of 44.4 for bipolar spectrum disorders. Specifically, bipolar type 2 diagnoses (7.5%) was more frequent than bipolar type 1 diagnoses (0.99%).[8]\n\nThe exact underlying mechanism and pathophysiology of BD and MS co-presentation is yet to be established. It is unknown whether BD is an early manifestation of MS or if both diseases share a common underlying cause presenting at similar timelines. More recent studies have shown genetic associations between BD and MS in human leukocyte antigen (HLA) DR2 gene and mitochondrial transcriptomes.[9,10] Further understanding of the etiology of this association may elucidate whether there are synergistic effects or crosstalk between MS and BD therapeutics.\n\nWhile mania is a hallmark symptom of BD, MS can also exhibit a range of psychiatric symptoms including mania, euphoria, depression, hallucinations, and episodes of pathologic laughing and weeping, which is coined as ‘pseudobulbar effects.’[11] Focal neuronal demyelination in MS patients may interfere with communication between frontal lobe brain regions responsible for emotion and manifests as emotional lability and exaggerated emotions, common symptoms in a manic or depressive episode.[12] Features of MS flare-up mania are no different than those of non-MS mania. However, the incidence of psychosis has been reported to be less common in MS.[13]\n\nDifferentiating the cause of the manic episode is of clinical significance as the treatment plan differs between a MS flare-up and a BD manic episode. For instance, while lithium and sodium valproate have been shown to be effective in treating mania in BD, no controlled trials of its efficacy in mania in MS patient has been published.[14] Additionally, manic episodes due to medications cannot be precluded. Steroid treatment in MS patient may often cause a moderate degree of mania.[15] Patients with a family history of alcohol use disorder or other affective disorder are more vulnerable to this cause.[15] Other medications, such as tizanidine, baclofen, and dantrolene, can also cause hypomania following their use.[16] Manic symptoms due to medications are often dose-dependent and manifest soon after initiating the medication.[16]\n\nDetailed neurologic tests or neuroimaging can often help differentiate the cause of a manic episode. MS flare-ups often manifest with increased focal neurological symptoms including visual loss, fatigue, urinary incontinence, and cognitive impairment, in addition to any of the afore-mentioned mood symptoms. Additionally, MS flare-ups may show an increased degree of demyelination on MRI compared to prior images.\n\nBoth MS and BD-onset mania have been reported to show white matter changes on MRI by Young et al.[17,18] Especially, MS patients with mania and psychotic symptoms were shown to have plaques located in the bilateral temporal horn areas.[14] Neuroimaging of BD patients without MS has been more complex. Several studies proposed increased white matter and periventricular hyperintensities in these patients.[19,20] McDonald et al reported increased subcortical hyperintensities in T2 weighted MRI in late-onset BD patients.[19,21] Dupont et al reported increased white matter hyperintensities in early-onset BD patients.[19,22] Altshuler et al reported no significant difference white matter hyperintensities, but increased periventricular hyperintensity in BD type 1 patients.[19,23]\n\nIn our case, the absence of aforementioned focal or lateralizing finding in MS during the neurological exam, absence of increased demyelination compared to previous MRI, and family history of psychiatric disorders decreased the likelihood of her current symptoms representing a MS flare-up and was more consistent with BD-induced mania. Additionally, patient was not taking mania-inducing medications such as steroids, tizanidine, baclofen, or dantrolene. Patient's symptoms improved with lithium treatment. The patient's MRI showed increased white matter and periventricular T2 hyperintensity. However, no plaques at bilateral temporal horn areas were identified. Considering that her symptom onset was during a phenobarbital taper for chronic benzodiazepine use, her mania may have been a BD manic episode triggered by her benzodiazepine withdrawal directly or exacerbated from withdrawal symptoms, such as poor sleep and increased anxiety.\n\nThe ages at which this patient's illnesses presented - BD type I onset at age 45 preceding MS onset at age 55, is of particular note in relation to previous case reports. Marangoni et al identified case reports of 26 patients who had BD onset clearly preceding MS, via a PubMed search from inception to 2014.[24] The study showed an average of 5 years difference between BD and MS onset. The majority of these patients were found to have BD type I, where 25 patients had BD type I and 1 patient had BD type II with rapid cycling. Three cases reported family history of MS and 6 cases reported psychiatric family history. The study also noticed increased white matter lesions in periventricular and subcortical white matter – which was consistent with our case - as well as in the centrum semiovale, frontal, parietal, and temporal lobes. However, it did not identify association between certain BD type to MS types nor association between certain BD types with patterns of white matter lesions.\n\nWhile the study had insufficient data to formulate a valid hypothesis, the study found that BD-preceded-MS had a higher age of both BD and MS onset compared to the age of onset of the combined pool of patients with BD and MS regardless of onset order. The study also suggested that later onset of MS may be associated with co-occurrence with BD. This case report, where the patient was diagnosed with BD and MS relatively later than the common age of onset of 20s or 30s, substantiates these trends found in previous case reports by Marangoni et al and speculates that late onset of BD or MS may be associated with BD-MS comorbidity. Past reports showed cases where acute psychotic symptoms led to MS diagnosis, which were coined as “inaugural manifestations” to MS.[25] Future research into the timing of onset can elucidate whether late diagnosis of mood or psychotic disorders can be early signs of comorbidity with MS.\n\n4 Conclusion\nIn patients with co-occurrence of BD and MS, there is currently no clear guideline to discern the origin of manic episodes. However, it is important to attempt to discern the predominant cause of the manic episode through detailed patient history, neurologic exam, and neuroimaging, as it can affect treatment plans. Additionally, the presented case, along with previous cases of BD-preceding-MS correlating with generally later age of onset of BD and MS, may be a future direction for further investigation.\n\nAuthor contributions\nConceptualization: Simon Yang.\n\nSupervision: Lora Wichser.\n\nWriting – original draft: Simon Yang.\n\nWriting – review & editing: Simon Yang, Lora Wichser.\n\nAbbreviations: BD = bipolar disorder, MS = multiple sclerosis.\n\nHow to cite this article: Yang S, Wichser L. Manic episode in patient with bipolar disorder and recent multiple sclerosis diagnosis: a case report. Medicine. 2020;99:42(e22823).\n\nPatient information was de-identified. Received written consent to use patient information as well.\n\nThe authors have no conflicts of interest to disclose.\n\nData sharing not applicable to this article as no datasets were generated or analyzed during the current study.\n==== Refs\nReferences\n[1] Compston A Coles A \nMultiple sclerosis\n. Lancet \n2008 ;372 :1502 –17\n.18970977 \n[2] Chwastiak LA Ehde DM \nPsychiatric issues in multiple sclerosis\n. Psychiatr Clin North Am \n2007 ;30 :803 –17\n.17938046 \n[3] Feinstein A Magalhaes S Richard JF \nThe link between multiple sclerosis and depression\n. Nat Rev Neurol Sep \n2014 ;10 :507 –17\n.\n[4] Belmaker RH \nBipolar disorder\n. N Engl J Med \n2004 ;351 :476 –86\n.15282355 \n[5] Fisk JD Morehouse SA Brown MG \nHospital-based psychiatric service utilization and morbidity in multiple sclerosis\n. Can J Neurol Sci Aug \n1998 ;25 :230 –5\n.\n[6] Charcot JM \nLecons sur les maladies du systeme nerveux faites a la Salpetriere. [French] Paris: Progres Medical, 1877:213-42 .\n[7] Schiffer RB Wineman NM Weitkamp LR \nAssociation between bipolar affective disorder and multiple sclerosis\n. Am J Psychiatry Jan \n1986 ;143 :94 –5\n.\n[8] Carta MG Moro MF Lorefice L \nThe risk of bipolar disorders in multiple sclerosis\n. J Affect Disord Feb 1 \n2014 ;155 :255 –60\n.\n[9] Bozikas VP Anagnostouli MC Petrikis P \nFamilial bipolar disorder and multiple sclerosis: a three-generation HLA family study\n. Prog Neuropsychopharmacol Biol Psychiatry \n2003 ;27 :835 –9\n.12921917 \n[10] Konradi C Sillivan SE Clay HB \nMitochondria, oligodendrocytes and inflammation in bipolar disorder: evidence from transcriptome studies points to intriguing parallels with multiple sclerosis\n. Neurobiol Dis \n2012 ;45 :37 –47\n.21310238 \n[11] Iacovides A Andreoulakis E \nBipolar disorder and resembling special psychopathological manifestations in multiple sclerosis: a review\n. Curr Opin Psychiatry \n2011 ;24 :336 –40\n.21546839 \n[12] Salem H Trieu-Keele C Teixeira AL \nMultiple sclerosis induced-mania: a clinical challenge\n. Neuropsychiatry \n2017 ;7 :271 –3\n.\n[13] Sahpolat M \nA multiple sclerosis case presenting mixed state bipolar affective disorder as initial sign\n. Ulutas Med J \n2016 ;2 :52 –4\n.\n[14] Feinstein A Du Boulay G Ron MA \nPsychotic illness in multiple sclerosis: a clinical and magnetic resonance imaging study\n. Br J Psychiatry Nov \n1992 ;161 :680 –5\n.\n[15] Jefferies K \nThe neuropsychiatry of multiple sclerosis\n. Adv Psychiatr Treat May \n2006 ;12 :214 –20\n.\n[16] Murphy R O’Donoghue S Counihan T \nNeuropsychiatric syndromes of multiple sclerosis\n. J Neurol Neurosurg Psychiatry Aug 1 \n2017 ;88 :697 –708\n.\n[17] Haussleiter IS Brüne M Juckel G \nPsychopathology in multiple sclerosis: diagnosis, prevalence and treatment\n. Ther Adv Neurol Disord Jan \n2009 ;2 :13 –29\n.\n[18] Young CR Weiss EL Bowers MB Jr \nThe differential diagnosis of multiple sclerosis and bipolar disorder\n. J Clin Psychiatry Mar \n1997 ;58 :123 .\n[19] Ybarra MI Moreira MA Araújo CR \nBipolar disorder and multiple sclerosis\n. Arq Neuropsiquiatr \n2007 ;65 (4B) :1177 –80\n.18345425 \n[20] Sheline YI \nNeuroimaging studies of mood disorder effects on the brain\n. Biol Psychiatry \n2003 ;54 :338 –52\n.12893109 \n[21] McDonald WM Krishnan KR Doraiswamy PM \nOccurrence of subcortical hyperintensities in elderly subjects with mania\n. Psychiatry Res Neuroimaging \n1991 ;40 :211 –20\n.\n[22] Dupont RM Jernigan TL Heindel H \nMagnetic resonance imaging and mood disorders: localization of white matter and other subcortical abnormalities\n. Arch Gen Psychiatry \n1995 ;52 :747 –55\n.7654126 \n[23] Altshuler LL Curran JG Hauser P \nT2 hyperintensities in bipolar disorder: magnetic resonance imaging comparison and literature meta-analysis\n. Am J Psychiatry \n1995 ;152 :1139 –44\n.7625460 \n[24] Marangoni C Nanni MG Grassi L \nBipolar disorder preceding the onset of multiple sclerosis\n. Neuroimmunol Neuroinflamm \n2015 ;2 :195 –9\n.\n[25] Blanc F Berna F Fleury M \nInaugural psychotic events in multiple sclerosis?\n\nRev Neurol (Paris) \n2010 ;166 :39 –48\n.19735928\n\n",
"fulltext_license": "CC BY",
"issn_linking": "0025-7974",
"issue": "99(42)",
"journal": "Medicine",
"keywords": null,
"medline_ta": "Medicine (Baltimore)",
"mesh_terms": "D018692:Antimanic Agents; D014150:Antipsychotic Agents; D001714:Bipolar Disorder; D005260:Female; D006801:Humans; D018020:Lithium Compounds; D008875:Middle Aged; D009103:Multiple Sclerosis; D018967:Risperidone",
"nlm_unique_id": "2985248R",
"other_id": null,
"pages": "e22823",
"pmc": null,
"pmid": "33080761",
"pubdate": "2020-10-16",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Manic episode in patient with bipolar disorder and recent multiple sclerosis diagnosis: A case report.",
"title_normalized": "manic episode in patient with bipolar disorder and recent multiple sclerosis diagnosis a case report"
} | [
{
"companynumb": "US-MYLANLABS-2020M1094534",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "LORAZEPAM"
},
"drugadditional": null,
... |
{
"abstract": "Vancomycin has been used for a long time to manage resistant gram-positive bacterial infections. Neutropenia is an uncommon and potentially serious adverse effect associated with vancomycin use. Herein we present a case of probable vancomycin induced neutropenia which resolved with discontinuation of the antibiotic. Since blood counts are monitored routinely these days in both outpatient and inpatient setting, due consideration needs to be given to vancomycin induced neutropenia in patients who are on long term antimicrobial therapy.",
"affiliations": "Internal Medicine, University of Missouri - Kansas City School of Medicine, Kansas City, USA.;Internal Medicine, University of Missouri - Kansas City School of Medicine, Kansas City, USA.;Hematology and Oncology, University of Cincinnati, Cincinnati, USA.;Hematology and Oncology, University of Missouri - Kansas City School of Medicine, Kansas City, USA.",
"authors": "Kaur|Anahat|A|;Khan|Ghazal|G|;Grover|Punita|P|;Moormeier|Jill|J|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.7759/cureus.5199",
"fulltext": "\n==== Front\nCureusCureus2168-8184Cureus2168-8184Cureus Palo Alto (CA) 10.7759/cureus.5199Internal MedicineInfectious DiseaseOncologyProbable Vancomycin Induced Neutropenia: A Case Report Muacevic Alexander Adler John R Kaur Anahat 1Khan Ghazal 1Grover Punita 2Moormeier Jill 3\n1 \nInternal Medicine, University of Missouri - Kansas City School of Medicine, Kansas City, USA \n2 \nHematology and Oncology, University of Cincinnati, Cincinnati, USA \n3 \nHematology and Oncology, University of Missouri - Kansas City School of Medicine, Kansas City, USA \nAnahat Kaur kauran@umkc.edu22 7 2019 7 2019 11 7 e51998 7 2019 22 7 2019 Copyright © 2019, Kaur et al.2019Kaur et al.This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.This article is available from https://www.cureus.com/articles/21516-probable-vancomycin-induced-neutropenia-a-case-reportVancomycin has been used for a long time to manage resistant gram-positive bacterial infections. Neutropenia is an uncommon and potentially serious adverse effect associated with vancomycin use. Herein we present a case of probable vancomycin induced neutropenia which resolved with discontinuation of the antibiotic. Since blood counts are monitored routinely these days in both outpatient and inpatient setting, due consideration needs to be given to vancomycin induced neutropenia in patients who are on long term antimicrobial therapy.\n\nvancomycinneutropeniaThe content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.\n==== Body\nIntroduction\nVancomycin has been used clinically for decades to treat gram-positive infections, particularly those caused by methicillin-resistant staphylococci and for patients with severe penicillin allergies. Adverse effects from vancomycin are rare and neutropenia with vancomycin therapy is uncommon.\n\nCase presentation\nWe present a case of a 64-year-old male who was admitted with a chief complaint of fever. The patient had recently been discharged from hospital one month ago after the inpatient stay for renal failure due to sepsis and had been started on hemodialysis (HD). On admission, the patient had a temperature of 102.7 F and was tachycardic. Initial labs revealed markedly decreased white blood cell (WBC) count of 500 cells/mm3 (differential with 0% neutrophils, 0% bands, 0% eosinophils, 97% lymphocytes, 2% monocytes and 1% basophils). Last known baseline of WBC count was 11,900 cells/mm3 two weeks ago at the time of last hospital discharge. Computerized tomography scan of the chest showed bilateral ground-glass opacities and he tested positive for influenza A.\n\nThe patient was admitted to the intensive care unit for leukopenia and fever. He was started on empiric antibiotic therapy with intravenous (IV) vancomycin, piperacillin-tazobactam, and levofloxacin. He was also started on oseltamivir for influenza. Legionella sputum culture collected due to the history of uncompleted Legionella treatment during prior hospitalization came back positive. On Day 2, the patient reported diarrhea and tested positive for Clostridium difficile so was started on oral vancomycin for C. difficile coverage. On this day, IV antibiotic regimen was de-escalated to levofloxacin (for Legionella) and vancomycin only. Piperacillin-tazobactam was discontinued due to known adverse reaction of granulocytopenia, however absolute neutrophil count (ANC) did not improve after this change and remained at zero. Peripheral smear showed normocytic normochromic anemia, severe neutropenia and rare circulating blast cells. Hematology service was consulted for neutropenic fever and recommended starting Granulocyte colony-stimulating factor (G-CSF). At this point cause of neutropenia was most likely thought to be medication or sepsis-induced however bone marrow biopsy was performed to rule out other etiologies. Biopsy results showed marrow cellularity at 20-30% with preserved megakaryopoiesis. Myeloid to erythroid ratio was 0.2:1. Myelopoiesis showed maturation with the relative increase in eosinophils, basophils and mast cells. Few neutrophils were identified. There was no evidence of malignancy. Autoimmune disease panel came back negative. Blood cultures did not show any growth so, IV vancomycin was also discontinued on Day 5. \n\nDespite these medication changes, the patient continued to remain neutropenic and developed intermittent fevers with negative blood and urine cultures throughout admit. There was a concern for vancomycin induced neutropenia at this point since the patient had been treated with vancomycin during prior admission for sepsis (last known exposure to vancomycin was 24 days before patient’s current presentation). Although the patient remained only on oral vancomycin for C. difficile at this time (which has poor bioavailability), this was also eventually discontinued on Day 12 due to the possibility of contribution to neutropenia. \n\nPatient's cell counts began to improve dramatically after completely stopping vancomycin therapy (Figure 1). G-CSF was discontinued on Day 19 when WBC count went up to 20,500 cells/mm3. His renal function improved throughout admit and he was able to come off dialysis. The patient was eventually discharged to a rehabilitation facility and was lost to follow up.\n\nFigure 1 Patient's WBC and ANC count throughout the course of hospitalization. Intravenous vancomycin was discontinued on Day 5 and oral vancomycin was discontinued on Day 12.\nWBC - White Blood Cell, ANC - Absolute Neutrophil Count\n\nDiscussion\nVancomycin is a glycopeptide antibiotic with reliable activity against many gram-positive pathogens and is frequently prescribed for patients with methicillin-resistant Staphylococcus aureus (MRSA) infections [1]. Its use is however associated with several adverse events, including allergic reactions, neutropenia, nephrotoxicity, ototoxicity and red man syndrome [2-6]. Neutropenia is commonly defined as ANC <1000 cells/mm3, severe neutropenia is defined as ANC <500 cells/mm3and leukopenia is defined as WBC count <3000 cells/mm3.\n\nPreviously reported incidence of vancomycin induced neutropenia has been between 2% to 12% [7]. Reports of vancomycin-induced neutropenia date back several decades but appear to be more common starting in the mid-1970s [8]. Incidence is similar across genders and age groups [9]. The underlying mechanism behind this remains unclear however isolation of anti-neutrophil antibodies suggests an immune-mediated event rather than direct destruction of the bone marrow [8, 10]. Examination of bone marrow biopsy specimens from patients with vancomycin-induced neutropenia has shown both hypoplasia and hyperplasia of the granulocyte series. Rapid recovery of granulocytes after stopping vancomycin therapy or administration of G-CSF suggests that myeloid precursors are likely intact [11]. The lack of a dose-dependent effect on WBC count argues against a direct toxic effect of vancomycin upon the bone marrow [9]. \n\nUsually, the development of neutropenia has been recognized after the first week of glycopeptide antibiotic therapy [7]. Nadir of the neutrophil count is observed 15-40 days after initiation of vancomycin and spontaneous recovery of neutrophils after cessation of antibiotics may take as long as one to 22 days with a median of six days [11, 12]. In our patient, neutropenia was present at the time of hospital admission and he was last known to have been exposed to vancomycin about 24 days ago during a prior hospitalization. Neutropenia generally does not correlate well with vancomycin dose or serum drug concentrations however compromised renal function in our patient could possibly have played a role in prolonged clearance of vancomycin [9]. Influenza and Legionella infections were believed to be unlikely causes of neutropenia in the setting of a normal platelet count. Other infectious causes of neutropenia were also felt to be less likely given the short duration of his illness and the fact that the patient clinically improved while his white count lagged behind. Hence, bone marrow biopsy was undertaken to rule out any potential malignancy which turned out to be unremarkable. Piperacillin-tazobactam was the first antibiotic to be discontinued as beta-lactams are also known to cause isolated profound granulocytopenia with rapid recovery within days once a drug is stopped, however, this did not improve ANC in our patient [13-16]. Eventual discontinuation of vancomycin had a profound effect on ANC. Based on the Naranjo adverse drug reaction probability scale, we suspect that this is a case of probable vancomycin induced neutropenia.\n\nThe first step in the management of suspected vancomycin induced neutropenia would include discontinuation of the drug. Teicoplanin, another glycopeptide antibiotic with somewhat different safety profile as compared to vancomycin, has been used as a substitute in some studies [17]. A meta-analysis of the combined results from 11 clinical trials indicated that teicoplanin was less likely to be associated with adverse effects than vancomycin [3]. Some case reports of cross-reactions to both vancomycin and teicoplanin, including neutropenia, have been published [18]. In a study conducted by Hung et al. four out of eight patients who experienced vancomycin induced neutropenia subsequently experienced teicoplanin induced neutropenia as well [7]. The use of teicoplanin in patients with vancomycin-related adverse effects is controversial [7, 18]. In situations where continuation of uninterrupted vancomycin therapy is imperative despite neutropenia (patients with penicillin allergy), another option would be to consider G-CSF administration [11]. The dose of G-CSF must be individualized specifically in patients requiring prolonged administration of vancomycin therapy, with a goal to maintain ANC between 1000-10,000/mm3. This would need intermittent dosing titrated to maintain an acceptable degree of response [11]. Re-challenge with vancomycin is generally not recommended given complications associated with neutropenia and the possibility of a more intense neutropenic reaction likely due to immune sensitization to the drug. Monitoring for vancomycin-induced neutropenia is important in patients receiving the drug for longer than two weeks duration [9].\n\nConclusions\nDue consideration needs to be given to vancomycin as a possible causative agent in setting of neutropenia of unclear etiology. Since complete blood count is now routinely monitored in both outpatient and inpatient setting, vancomycin-induced neutropenia is seen more often among patients who are receiving long-term antimicrobial therapy. Further management in this scenario would include discontinuation of vancomycin if considered appropriate or administration of G-CSF to maintain counts while patient completes antimicrobial therapy.\n\nThe authors have declared that no competing interests exist.\n\nHuman Ethics\nConsent was obtained by all participants in this study\n==== Refs\nReferences\n1 Staphylococcus aureus bloodstream infections: definitions and treatment Clin Infect Dis Corey GR 0 48 2009 \n2 Biopsy-proved acute tubulointerstitial nephritis and toxic epidermal necrolysis associated with vancomycin Pharmacotherapy Hsu SI 1233 1239 21 2001 11601669 \n3 The comparative efficacy and safety of teicoplanin and vancomycin J Antimicrob Chemother Wood MJ 209 222 37 1996 8707731 \n4 Vancomycin-induced toxic epidermal necrolysis South Med J Hannah BA Kimmel PL Dosa S Turner ML 720 722 83 1990 2356503 \n5 Antibiotic allergy N Engl J Med Gruchalla RS Pirmohamed M 601 609 354 2006 16467547 \n6 Vancomycin therapy of severe staphylococcal infections J Antimicrob Chemother Kirby WMM 73 78 14 1984 6394579 \n7 Tolerability of teicoplanin in 117 hospitalized adults with previous vancomycin-induced fever, rash, or neutropenia: a retrospective chart review Clin Ther Hung YP Lee NY Chang CM 1977 1986 31 2009 19843487 \n8 Vancomycin-induced neutropenia associated with fever: similarities between two immune-mediated drug reactions Pharmacotherapy Smith PF Taylor CT 240 244 19 1999 10030777 \n9 Probable vancomycin-induced neutropenia Ann Pharmacother Segarra-Newnham M Tagoff SS 1855 1859 38 2004 15466904 \n10 Vancomycin-induced neutropenia in a patient positive for an antineutrophil antibody Pharmacotherapy Schwartz MD 783 788 22 2002 12066971 \n11 Vancomycin-induced neutropenia treated with granulocyte colony- stimulating factor during home intravenous infusion therapy Clin Infect Dis Lai KK 844 845 23 1996 8909866 \n12 High incidence of vancomycin-associated leucopenia and neutropenia in a cardiothoracic surgical unit J Infect Morris A Ward C 217 223 22 1991 2071903 \n13 Piperacillin/tazobactam-induced neutropenia, thrombocytopenia, and fever during treatment of a diabetic foot infection Scand J Infect Dis Uzun G Önem Y Hatipoglu M Turhan V Mutluoglu M Ay H 73 76 45 2013 22746695 \n14 Leukocytopenia, thrombocytopenia and fever related to piperacillin/tazobactam treatment: A retrospective analysis in 38 children with cystic fibrosis Infection Reichardt P Handrick W Linke A Schille R Kiess W 355 356 27 1999 10624596 \n15 Piperacillin induced bone marrow suppression: a case report BMC Clin Pharmacol Kumar A Choudhuri G Aggarwal R 2 3 2003 12791166 \n16 Severe neutropenia secondary to piperacillin/tazobactam therapy Indian J Pharmacol Khan F 192 193 37 2009 \n17 Teicoplanin induced drug hypersensitivity syndrome BMJ Perrett CM McBride SR 1292 328 2004 15166065 \n18 Glycopeptide-induced neutropenia: cross-reactivity between vancomycin and teicoplanin Ann Pharmacother Hsiao SH Chang CM Tsai JC 891 894 41 2007 17426073\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2168-8184",
"issue": "11(7)",
"journal": "Cureus",
"keywords": "neutropenia; vancomycin",
"medline_ta": "Cureus",
"mesh_terms": null,
"nlm_unique_id": "101596737",
"other_id": null,
"pages": "e5199",
"pmc": null,
"pmid": "31565605",
"pubdate": "2019-07-22",
"publication_types": "D002363:Case Reports",
"references": "6394579;19843487;22746695;19374581;11601669;10624596;17426073;16467547;12791166;15166065;10030777;2356503;12066971;2071903;8707731;15466904;8909866",
"title": "Probable Vancomycin Induced Neutropenia: A Case Report.",
"title_normalized": "probable vancomycin induced neutropenia a case report"
} | [
{
"companynumb": "US-STRIDES ARCOLAB LIMITED-2019SP013283",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "LEVOFLOXACIN"
},
"drugaddition... |
{
"abstract": "Perforated ulcers of the gastric remnant and duodenum seem to be a rare complication after a Roux-en-Y gastric bypass. Diagnosis of this complication can be difficult given a vague presentation, however, early intervention is critical to prevent further morbidity. We present the case of a 38-year-old male with a perforated duodenal ulcer nearly a year after Roux-en-Y gastric bypass. Upon presentation, he complained of 8 hours of epigastric pain. His medical history was significant for chronic peptic ulcer disease and a negative history of H. pylori. Recently, he had been prescribed naproxen by his primary care physician for knee pain. His vital signs were normal with the exception of his systolic blood pressure which was 190 mmHg. He was diaphoretic and peritonitic on exam. He was taken emergently for a diagnostic laparoscopy and found to have a perforation of ∼5 mm of the anterior portion of his duodenum. This was repaired laparoscopically with an omental patch and the patient recovered without any further intervention required. While this is a rare complication reported in the literature, this or similar complications of the remnant stomach may be underrepresented in publications. The surgical intervention of this disease will either be resection of the remnant or an omental patch. However, controversy remains as to the proper post-operative medical treatment. For our patient, the inciting agent was likely the naproxen he was given and this was stopped immediately. Patient education and ownership should remain a cornerstone for patients that have undergone a Roux-en-y gastric bypass.",
"affiliations": "Department of Surgery, 3998Brooke Army Medical Center, Fort Sam Houston, TX, USA.;Department of Surgery, 19926Carl R Darnall Army Medical Center, Fort Hood, TX, USA.;Department of Surgery, 19926Carl R Darnall Army Medical Center, Fort Hood, TX, USA.;Department of Surgery, 19926Carl R Darnall Army Medical Center, Fort Hood, TX, USA.",
"authors": "Laverty|Robert B|RB|;Yoon|Brian S|BS|;Sokol|Kyle K|KK|;Sparkman|Brian K|BK|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/00031348211050582",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0003-1348",
"issue": null,
"journal": "The American surgeon",
"keywords": null,
"medline_ta": "Am Surg",
"mesh_terms": null,
"nlm_unique_id": "0370522",
"other_id": null,
"pages": "31348211050582",
"pmc": null,
"pmid": "34730448",
"pubdate": "2021-11-03",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Perforated Peptic Ulcer of the Duodenum After the Laparoscopic Roux-en-Y Gastric Bypass.",
"title_normalized": "perforated peptic ulcer of the duodenum after the laparoscopic roux en y gastric bypass"
} | [
{
"companynumb": "US-BION-010164",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "NAPROXEN SODIUM"
},
"drugadditional": "1",
"dr... |
{
"abstract": "Comprehensive genomic profiling identifying actionable molecular alterations aims to enable personalized treatment for cancer patients. The purpose of this analysis was to retrospectively assess the impact of personalized recommendations made by a multidisciplinary tumor board (MTB) on the outcome of patients with breast or gynecological cancers, who had progressed under standard treatment. Here, first experiences of our Comprehensive Cancer Center Molecular Tumor Board are reported.\n\n\n\nAll patients were part of a prospective local registry. 95 patients diagnosed with metastatic breast cancer or gynecological malignancies underwent extended molecular profiling. From May 2017 through March 2019, the MTB reviewed all clinical cases considering tumor profile and evaluated molecular alterations regarding further diagnostic and therapeutic recommendations.\n\n\n\n95 patients with metastatic breast or gynecological cancers were discussed in the MTB (68% breast cancer, 20% ovarian cancer, 5% cervical cancer, 3% endometrial cancer and 4% others). Genes with highest mutation rate were PIK3CA and ERBB2. Overall, 34 patients (36%) received a biomarker-based targeted therapy recommendation. Therapeutic recommendations were implemented in nine cases; four patients experienced clinical benefit with a partial response or disease stabilization lasting over 4 months.\n\n\n\nIn the setting of a multidisciplinary molecular tumor board, a small but clinically meaningful group of breast and gynecological cancer patients benefits from comprehensive genomic profiling. Broad and successful implementation of precision medicine is complicated by patient referral at late stage disease and limited access to targeted agents and early clinical trials.\n\n\n\n284-10 (03.05.2018).",
"affiliations": "Department of Obstetrics and Gynecology and CCC Munich LMU University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Department of Internal Medicine III and CCC Munich LMU, University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Institute of Pathology and CCC Munich LMU, University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Institute of Pathology and CCC Munich LMU, University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Institute of Pathology and CCC Munich LMU, University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Institute of Pathology and CCC Munich LMU, University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Institute of Pathology and CCC Munich LMU, University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Institute of Pathology and CCC Munich LMU, University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Department of Internal Medicine III and CCC Munich LMU, University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Department of Internal Medicine III and CCC Munich LMU, University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Department of Internal Medicine III and CCC Munich LMU, University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Department of Obstetrics and Gynecology and CCC Munich LMU University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Department of Obstetrics and Gynecology and CCC Munich LMU University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Department of Obstetrics and Gynecology and CCC Munich LMU University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Department of Obstetrics and Gynecology and CCC Munich LMU University Hospital, Ludwig Maximilians University (LMU), Munich, Germany.;Department of Obstetrics and Gynecology and CCC Munich LMU University Hospital, Ludwig Maximilians University (LMU), Munich, Germany. Rachel.Wuerstlein@med.uni-muenchen.de.",
"authors": "Sultova|Elena|E|;Westphalen|C Benedikt|CB|;Jung|Andreas|A|;Kumbrink|Joerg|J|;Kirchner|Thomas|T|;Mayr|Doris|D|;Rudelius|Martina|M|;Ormanns|Steffen|S|;Heinemann|Volker|V|;Metzeler|Klaus H|KH|;Greif|Philipp A|PA|;Burges|Alexander|A|;Trillsch|Fabian|F|;Mahner|Sven|S|;Harbeck|Nadia|N|;Wuerstlein|Rachel|R|http://orcid.org/0000-0001-7268-0840",
"chemical_list": null,
"country": "Germany",
"delete": false,
"doi": "10.1007/s00404-020-05881-z",
"fulltext": "\n==== Front\nArch Gynecol Obstet\nArch Gynecol Obstet\nArchives of Gynecology and Obstetrics\n0932-0067\n1432-0711\nSpringer Berlin Heidelberg Berlin/Heidelberg\n\n33277683\n5881\n10.1007/s00404-020-05881-z\nGynecologic Oncology\nNGS-guided precision oncology in metastatic breast and gynecological cancer: first experiences at the CCC Munich LMU\nSultova Elena 1\nWestphalen C. Benedikt 2\nJung Andreas 3\nKumbrink Joerg 3\nKirchner Thomas 3\nMayr Doris 3\nRudelius Martina 3\nOrmanns Steffen 3\nHeinemann Volker 2\nMetzeler Klaus H. 2\nGreif Philipp A. 2\nBurges Alexander 14\nTrillsch Fabian 14\nMahner Sven 14\nHarbeck Nadia 15\nhttp://orcid.org/0000-0001-7268-0840\nWuerstlein Rachel Rachel.Wuerstlein@med.uni-muenchen.de\n\n145\n1 grid.5252.0 0000 0004 1936 973X Department of Obstetrics and Gynecology and CCC Munich LMU University Hospital, Ludwig Maximilians University (LMU), Munich, Germany\n2 grid.5252.0 0000 0004 1936 973X Department of Internal Medicine III and CCC Munich LMU, University Hospital, Ludwig Maximilians University (LMU), Munich, Germany\n3 grid.5252.0 0000 0004 1936 973X Institute of Pathology and CCC Munich LMU, University Hospital, Ludwig Maximilians University (LMU), Munich, Germany\n4 grid.5252.0 0000 0004 1936 973X Gynecologic Oncology Center and CCC Munich LMU University Hospital, Ludwig Maximilians University (LMU), Munich, Germany\n5 grid.5252.0 0000 0004 1936 973X Breast Center and CCC Munich LMU University Hospital, Ludwig Maximilians University (LMU), Munich, Germany\n4 12 2020\n4 12 2020\n2021\n303 5 13311345\n14 8 2020\n4 11 2020\n© The Author(s) 2020\nhttps://creativecommons.org/licenses/by/4.0/ Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.\nPurpose\n\nComprehensive genomic profiling identifying actionable molecular alterations aims to enable personalized treatment for cancer patients. The purpose of this analysis was to retrospectively assess the impact of personalized recommendations made by a multidisciplinary tumor board (MTB) on the outcome of patients with breast or gynecological cancers, who had progressed under standard treatment. Here, first experiences of our Comprehensive Cancer Center Molecular Tumor Board are reported.\n\nMethods\n\nAll patients were part of a prospective local registry. 95 patients diagnosed with metastatic breast cancer or gynecological malignancies underwent extended molecular profiling. From May 2017 through March 2019, the MTB reviewed all clinical cases considering tumor profile and evaluated molecular alterations regarding further diagnostic and therapeutic recommendations.\n\nResults\n\n95 patients with metastatic breast or gynecological cancers were discussed in the MTB (68% breast cancer, 20% ovarian cancer, 5% cervical cancer, 3% endometrial cancer and 4% others). Genes with highest mutation rate were PIK3CA and ERBB2. Overall, 34 patients (36%) received a biomarker-based targeted therapy recommendation. Therapeutic recommendations were implemented in nine cases; four patients experienced clinical benefit with a partial response or disease stabilization lasting over 4 months.\n\nConclusion\n\nIn the setting of a multidisciplinary molecular tumor board, a small but clinically meaningful group of breast and gynecological cancer patients benefits from comprehensive genomic profiling. Broad and successful implementation of precision medicine is complicated by patient referral at late stage disease and limited access to targeted agents and early clinical trials.\n\nTrial registration number\n\n284-10 (03.05.2018).\n\nKeywords\n\nPersonalized medicine\nBreast cancer\nOvarian cancer\nBiomarker\nMolecular diagnostic\nMolecular tumor board\nUniversitätsklinik München (6933)Open Access funding enabled and organized by Projekt DEAL.\n\nissue-copyright-statement© Springer-Verlag GmbH Germany, part of Springer Nature 2021\n==== Body\nIntroduction\n\nIn women, metastatic breast cancer and gynecological malignancies are among the most frequent causes of cancer death. In 2018, there were an estimated 2,088,849 new cases of breast cancer and 626,679 deaths, 569,847 new cases of cervical cancer and 311 365 deaths, and 295,414 new cases of ovarian cancer and 184,799 deaths worldwide. [1] Despite rising overall incidence, mortality rate has steadily decreased owing to early detection and improvements in the therapeutic management of these patients. However, although the development of new drugs, vaccines, and systematic screening programs has improved patients’ outcomes, effective measures to successfully treat metastatic cancer are still missing.\n\nWith the advent of molecular diagnostics, cancer treatment entered a new era. New techniques of sequencing DNA such as comprehensive genomic profiling (CGP) and hotspot next generation sequencing (NGS) provide tools for deciphering complete genes and later entire genomes at unprecedented speed [2]. These new approaches led to the development of a novel cancer treatment movement, known as precision medicine. By selecting the most effective treatment based on the molecular characteristics of tumor tissues or some other biologic parameters of the malignant disease, precision medicine aims to offer personalized treatment concepts to cancer patients with limited standard of care options. Molecular therapeutic agents (MTA) targeting individual actionable molecular alterations have been successfully developed in the past few years, showing the positive impact of using molecular-based therapy on the cancer patients’ outcome [3–6]. These include the use of growth factor receptor 2 antibody trastuzumab in breast cancer, a tyrosine kinase inhibitor imatinib in myelogenous leukemia associated with the BCR-ABL fusion gene and EGFR tyrosine kinase inhibitors in lung carcinomas [7, 8].\n\nBreast and gynecological cancers constitute a heterogeneous group of malignant diseases associated with multiple genetic alterations [9–11]. In the past few years, a growing number of molecular markers in breast cancer, for example, have been investigated and some of them are now well-established as reliable predictors of prognosis and response to tumor therapy (Fig. 1a). Moreover, many different targeted therapies have been approved for use in breast cancer treatment (Fig. 1b). The recent approval of the PIK3CA specific inhibitor alpelisib has been the most recent example of targeted agents moving into routine care. [12] Treatment with alpelisib was shown to prolong PFS by more than 6 months compared to the control arm. [13]Fig. 1 Predictive factors (a) and treatment-relevant genetic alterations (b) in metastatic breast cancer, German Gynecological Oncology Group. In 2018, AGO was the first international guideline-commission to make recommendations regarding precision medicine in breast cancer. (http://www.ago-online.de) [14]\n\nIn gynecologic malignancies, MTAs have also been successfully implemented into clinical care. For example, early data from a clinical phase II trial focusing on BRCA-mutated ovarian cancer showed that olaparib as maintenance treatment significantly improved progression-free survival (PFS) in relapsed platinum-sensitive ovarian cancer [15]. In 2018, these data could be transferred to the first line setting when treatment effects of the SOLO1 trial were presented [16]. Due to an impressive PFS improvement and a 70% lower risk of disease progression or death with olaparib compared to placebo, this effect led to the incorporation of PARP inhibitors into the primary treatment of ovarian cancer in 2019 [17]. However, when it comes to other gynecologic malignancies such as endometrial cancer, the development of MTA is delayed in comparison to other malignancies.\n\nBy detecting potential actionable pathways using molecular diagnostics, it is also possible to assess and treat various cancer types. For example, the ERBB2/PIK3/AKT/mTOR pathway is known for its relevance in breast cancer, but recently a relevant actionable mutation from the same pathway, PIK3R1W624R was also identified in ovarian cancer [18]. Another study suggested that some subtypes of cervical cancers may also benefit from existing ERBB2/PIK3/AKT/mTOR targeted agents [19].\n\nWith the rising number of MTAs and considering the heterogeneous molecular profiles of breast cancer and gynecological malignancies, it is reasonable to expect that patients with these malignancies could potentially benefit from implementation of precision oncology based on comprehensive genomic profiling (CGP) into clinical care. Promising early data for such malignancies has been presented in multiple trials. In breast cancer, many reports of such driver alterations have emerged in the past few years, suggesting that patients could profit from precision medicine and targeted therapies [20]. For example, in the SAFIR01 multicenter prospective trial, data of precision medicine benefitting breast cancer patients were presented. 9 out of 43 patients (21%) responded to the recommended targeted therapy with a stable disease lasting over 16 weeks [21]. In ovarian cancer, multiplatform molecular profiling, conducted in a commercially available profiling center, led to a significantly longer post-profiling survival in patients, who were treated with profile-guided targeted agents, in comparison to the control group [22].\n\nWith the technical advances in molecular diagnostics and the continuous approval of many targeted therapies, the growing field of precision medicine is constantly expanding and requires optimization. Considering the complexity of precision medicine in oncology, it was reasonable to create a molecular tumor board (MTB) to leverage the knowledge of the many different disciplines involved in oncological treatment and to provide optimal treatment recommendations. In this manuscript, first experiences of the Comprehensive Cancer Center (CCC) LMU Munich Molecular Tumor Board are presented.\n\nThe aim of this project was to retrospectively measure the impact of MTB discussions and recommendations made by a multidisciplinary tumor board on outcome of patients with breast and gynecological cancers progressing under standard treatment. Detailed information including data on patient characteristics, diagnostic and treatment recommendations, implementation of the recommendations, and outcome of treated patients with breast and gynecological cancers (ovarian, endometrial, cervix, and other type of cancer) are presented.\n\nMaterials and methods\n\nAll patients reported here were discussed in the local MTB, which reviewed clinical cases and the respective tumor profiles with the associated actionable alterations. The final result of each MTB case discussion was a report, focused on NGS data and diagnostic and potential diagnostic, and therapeutic alternatives. Thereby, the MTB presented itself as a multidisciplinary team (MDT), which comprised clinical oncologists, pathologists, molecular pathologists, genetic counselors, bioinformaticians, and scientists with expertise in genetic and tumor profiling in diverse cancers. MTB-meetings were held every 2 weeks with the purpose of interpretation and/or translation of the molecular diagnostics’ results into diagnostic and/or treatment recommendations. All patients’ cases were first presented at organ-specific gynecology tumor boards by a team of experienced gyneco-oncologists, who reviewed all the clinical course of every individual patient and discussed if patients were eligible for a MTB discussion. Apart from recent tumor material, recent radiology images and other diagnostic tests were also required for the interdisciplinary setting of the MTB. All treatment recommendations were supported by levels of evidence by using the ESMO Scale for Clinical Actionability of molecular Targets (ESCAT). The process from enrolling the patient into the study till receiving a recommendation by the MTB is shown in Fig. 2.Fig. 2 MTB, from suggestion to conclusion\n\nPatients and patient informed consent\n\nAll patients discussed (n = 95) were included in the prospective single-center case study, “The informative Patient”, launched in March 2017 at the LMU University Hospital, Munich as a Munich-site part of the DKTK (German Cancer Consortium) program. All enrolled patients suffered from metastatic breast or gynecological cancer which had progressed after at least one line of prior standard treatment and who had no longer access to curative treatment. Prior to inclusion, all participants signed an informed consent that they were informed about potential and limitations that molecular diagnostics could offer for treatment selection and for analysis of their data, further discussion of their case by a multidisciplinary MTB, as well as for collecting follow-up data on the course of disease for research purpose (including requesting patient data from other physicians and institutions).\n\nThe intention-to-treat (ITT) population consisted of 100 patients. Eventually, five patients were excluded, because of death prior to a treatment recommendation or withdrawal of consent.\n\nThe data here are based on the results of an ITT population of 95 patients.\n\nMolecular pathology\n\nMolecular analyses were performed at the Institute of Pathology of the LMU. Appropriate tissue regions were selected histo-morphologically from formalin-fixed paraffin embedded (FFPE)- or fresh frozen tissue. Moreover, liquid biopsies (blood, liquor) were included. In only four patients, analysis had to be repeated due to material constraints. Targeted NGS was performed with the Oncomine Comprehensive Cancer v.3 Panels (Agilent) thereby screening for changes in 161 genes on DNA (SNV, MNV, small ins, del, indels, CNV) and RNA (gene fusions) level. DNA and RNA were isolated using Qiagen's GeneRead DNA FFPE- or RNeasy FFPE-kits, respectively. Nucleic acids (NA; DNA, and RNA) from liquid biopsies were prepared by utilization of the QIAamp Circulating Nucleic Acid Kit. Subsequently, library preparation as first step of NGS was generated by employing Ampliseq Library Plus-, Ampliseq cDNA synthesis-, Ampliseq CD index, Ampliseq Equalizer- together with Ampliseq Comprehensive v3-kits (all Illumina) or DNA- and RNA-Oncomine Comprehensive Panels v3 and Ion AmpliSeq Library-, IonXpress Barcode Adapter-, Ion Library Equalizer-kits together with Ion Chip kits (mostly 550) (all Thermo Fisher), following for each step the respective user manuals. Libraries were run on an Ion Torrent GeneStudio S5 Primer (Thermo Fisher) or Illumina 500 Next Seq (Illumina) NGS machine. Analysis of results was performed with either the Ion-Reporter System (Thermo Fisher) followed by further variant and quality interpretation with a self-made excel tool or annotating VCF-files using wAnnovar (http://wannovar.wglab.org/) [23] together with the self-made python-script PathoMine filtering for clinically relevant mutations. Mutations were judged as relevant on the basis of the key 'interpretation' given in ClinVar [24]. Alterations were confirmed with the Integrated Genomics Viewer (IGV, Broad Institute). The resulting molecular pathological dataset together with data from immunohistochemistry, fluorescence in situ hybridization (FISH), and histo-morphology became part of a comprehensive pathological report which was sent out to the MTB.\n\nData assessment\n\nFor this analysis, electronic medical records were reviewed for patient characteristics and follow-up. If needed, medical oncologists, gynecologists, and general practitioners were contacted in order to collect follow-up data on treatment course and patient status. Patient characteristics were summarized using descriptive statistics. Follow-up of clinical outcomes was performed to track tumor response to recommended therapies and analyzed by measuring progression-free survival (PFS) of patients, who received the recommended treatment. PFS was calculated from the first day of treatment with the recommended in- or off-label targeted drug until the date of disease progression or death, whichever occurred first, analogous to the Johns Hopkins MTB study and to the Von Hoff et al. study [25]. In order to evaluate the benefit of the treatment recommendation, we then calculated the PFS ratio (PFSr) by comparing the PFS of the recommended treatment and the PFS of the previous therapy of the patients. Cut-off date for data analysis was August 1st, 2019.\n\nResults\n\nPatient characteristics\n\nFrom March 2017 through March 2019, a total of 95 cases were submitted to the MTB. All patients (n = 95) were females, had an underlying malignant condition, suffered from metastatic disease, and had experienced disease progression under standard treatment. Patients with implemented therapy recommendations had received a median of five (range 2–6) prior therapies for metastatic cancer. The median age at time of the initial MTB presentation was 52 years (range 19–82 years).\n\nAs shown in Fig. 3, the most frequent tumor type was breast cancer (n = 64, 68%), followed by ovarian cancer (n = 19, 20%). The majority of patients with breast cancer had triple-negative (ER, PR and HER2 negative; n = 30; 46.9%), followed by estrogen receptor (ER) -positive and/or progesterone receptor (PR) -positive, human epidermal growth factor receptor 2 (HER2) -negative (luminal-like) (n = 28; 43.8%), or HER2 positive, ER-negative, PR-negative disease (n = 5; 7.8%) at the time of the MTB case discussion; one patient (1.6%) had triple-positive disease (ER positive and/or PR positive, HER2 positive).Fig. 3 Distribution of the cases discussed at the MTB meeting by tumor entity (n = 95)\n\nCharacteristics of patients with a molecular profile are reported in Table 1.Table 1 Patient characteristics\n\nCovariables\t\t\nMedian age at diagnosis\t47 years (range 12–80)\t\nAge at diagnosis\t\t\n < 30\t5 (5.3%)\t\n 30–39\t27 (28.4%)\t\n 40–49\t21 (22.1%)\t\n 50–59\t30 (31.6%)\t\n 60–69\t8 (8.4%)\t\n ≥ 70\t4 (4.2%)\t\nMedian age at MTB case presentation\t52 years (range 19–82)\t\n Age at MTB case presentation\t\t\n < 30\t2 (2.1%)\t\n 30–39\t19 (20.0%)\t\n 40–49\t20 (21.1%)\t\n 50–59\t28 (29.5%)\t\n 60–69\t18 (18.9%)\t\n ≥ 70\t8 (8.4%)\t\n\nMolecular profiling\n\nMolecular tests using NGS were performed for all 95 patients. Out of the set of mutations from the molecular pathological NGS-analysis, actionable mutations were defined as those matching or informing the use of available targeted agents.\n\nFour patients had tumor sequencing performed twice during the course of disease. 81 (85.3%) patients had suitable tissues for multimodal molecular profiling (NGS). All in all, 103 molecular alterations were identified in 55 cases (57.9%). The median number of alterations observed in each sample was one (range 0–6). Out of the 55 patients, 41 (43.2%) had an actionable mutation, which the board reviewed as a potentially targetable. No genomic alterations in the 161 investigated genes were found in 40 (42.1%) analyses, in 14 (14.7%) of which the molecular diagnostics test was technically not successful because of poor DNA quality or insufficient material quality. Although five (5.3%) patients had an actionable mutation, they did not receive a therapy recommendation because of co-morbidities, not meeting trial inclusion criteria, or other requirements for receiving a specific targeted therapy.\n\nWe discovered mutations in over 30 different genes. Among the patients tested, the most common alterations were as follows: PIK3CA mutation (13/95; 13.7%); ERBB2 mutation (10/95; 10.5%); KRAS mutation (9/95; 9.5%), and CCND1 mutation (9/95; 9.5%). Incidences of genomic alterations by gene and the distribution of molecular alterations by tumor type are shown in Fig. 4.Fig. 4 Frequency of genomic alterations for the different tumor entities (n = 95)\n\nRecommendations\n\nAmong the 55 (57.9%) patients with at least one molecular alteration identified, 41 patients (43.2%) had an actionable alteration, whereas 14 (14.7%) had only non-actionable variants. Eventually, this resulted in 15 diagnostic and 49 treatment recommendations for 45 patients (47.4%). Multiple recommendations were adjusted for 20 (21.1%) patients (multiple recommendation principle). Six patients received a conditional recommendation, which required specific further diagnostics, two of which resulted in a treatment recommendation.\n\nDiagnostic recommendations\n\nOut of 15 diagnostic recommendations, 10 were pursued. In seven (7.4%) cases, extended genetic analyses were recommended and eventually six (6.3%) of them were performed. Re-biopsies were recommended in 14 cases, when the initial diagnostic tests were technically not successful, which we did not include in the evaluation of the final results.\n\nTherapeutic recommendations\n\nAs shown in Fig. 5, 36 (37.9%) patients were given a therapy recommendation, 14 (14.7%) of whom received more than one treatment suggestion, as their tumor molecular profile revealed more than one actionable mutation. Two (2.1%) patients were excluded from the evaluation of the clinical outcome, as they received the recommended therapy in the period between NGS analysis and MTB treatment recommendation.Fig. 5 Treatment or diagnostic recommendations. Note, all numbers do not add up because some patients are counted in more than one category (e.g., had an actionable alteration for a treatment recommendation and also for diagnostic recommendation or received more than one treatment/ diagnostic recommendation). a Diagram representing the outcome of the molecular diagnostic testing (n = 95). b Breast cancer patients. c Gynecological cancer patients\n\nOverall, 9 of 34 therapeutic recommendations were pursued. Of note, in the present cohort, no patient pursued the recommended enrollment in a clinical trial. In-label therapy recommendations were implemented in five cases, whereas off-label recommendations were implemented in four patients. The most common reasons for non-administration of MTB-recommended therapy were deterioration of patients’ physical health condition, early death, no access to the recommended drug therapy, declined reimbursement applications by payer, or patient decision (see Table 2).Table 2 Recommendations (Note, some patients received more than one diagnostic and/or treatment recommendation.)\n\n\tBC\tGC\t\nPatients with min. 1 recommendation\tNo\tNo\t\n Diagnostic\t8\t7\t\n Therapeutic\t27\t7\t\n No treatment recommendation\t30\t20\t\n Conditional recommendation\t3\t3\t\n Referral to organ board\t\t1\t\nDiagnostic recommendations\t\t\t\n Extended genetic analysis\t3\t4\t\n PD-L1 Test\t2\t\t\n HR-Status\t1\t1\t\n Other\t5\t3\t\nPatients with diagnostic recommendations (n = 15)\t\t\t\n Implemented\t6\t4\t\n Non-implemented\t2\t3\t\nTreatment recommendations\t\t\t\n Targeted therapy\t32\t5\t\n Trial inclusion\t8\t2\t\n Checkpoint inhibition\t1\t1\t\nPatients with treatment recommendations (n = 36)\t\t\t\n Implemented\t7\t1\t\n Non-implemented\t22\t6\t\n\nClinical outcome\n\nAll patients were included in the registry after multiple standard of care treatments.\n\nOut of nine (9.5%) patients following therapy recommendation, 4 (4.2%) showed a state of partial remission or stabilization lasting more than 16 weeks, including two of them receiving off-label therapy recommendation. Comparing PFS of the recommended therapy with the PFS of the previously received systemic treatment, we estimated that four of nine responders receiving MTB-recommended therapies displayed a progression-free survival (PFS) ratio (PFS2/PFS1; PFSr) > 1.3, showing the relevance of the suggested therapies. Two patients responded with an ongoing PFSr. Figure 6 details the actual comparison of PFS on implemented recommended treatment versus PFS on the patient’s last prior treatment.Fig. 6 Comparison of PFS of previous line of therapy (PFS1) and implemented therapy recommendation (PFS2). PFS the period of time between the start of treatment till disease progression/ death\n\nMore information about the outcome of responding patients is shown in Table 3.Table 3 PFS ratio (PFSr) = ratio of patients’ PFS on the implemented recommended therapy (PFS2) (in this case the recommended in- or off-label targeted drug) to their PFS on the most recent previous line of therapy (standard of care) (PFS1)\n\n#\tTumor entity\tTreatment\tLabel\tPFS2 (weeks)\tPFS1 (weeks)\tPFSr\t\n1\tBreast\tEverolimus\tIn\t14\t81\t0.17\t\n2\tBreast\tEverolimus\tIn\t12\t55\t0.22\t\n3\tBreast\tExemestan + Everolimus + Trastuzumab\tOff\t4\t8\t0.50\t\n4\tBreast\tEverolimus\tIn\t13\t13\t1.00\t\n5\tBreast\tPazopanib\tOff\t12\t6\t2.00\t\n6\tBreast\tLapatinib\tIn\t18\t3\t6.00\t\n7\tBreast\tPalbociclib\tIn\t21\t13\t1.62\t\n8\tBreast\tPembrolizumab\tOff\t59\t5\t11.80\t\n9\tCervix\tTemsirolimus\tOff\t32\t38\t0.84\t\nPFSr PFS2/PFS1\n\nSee Appendix for details of identified actionable mutations and corresponded treatment recommendations made by the MTB.\n\nDiscussion\n\nWe evaluated the clinical consequences of actionable genetic alterations (by NGS) in 95 patients with metastatic breast cancer and gynecological malignancies, part of a pilot monocentric patient registry with the purpose of generating real-world data. Forty-one patients (43.2%) had at least one actionable molecular aberration. The total number of patients with a drug-targetable alteration was 34 (35.7%). Overall, 9 of 34 patients (9.5% of all) received the recommended drug treatment. In a small, but significant group of patients, four out of nine with implemented therapy recommendations (44.4%) experienced a clinical benefit (PFSr > 1.3) lasting over 16 months, a result similar to the one shown by Jameson et al. in cases of patients with metastatic breast cancer, who received personalized therapy recommendations based on multi-omic molecular profiling [26, 27].\n\nPrecision medicine offers not only personalized treatment concepts for patients, but also helps us optimize diagnostic and treatment options by identifying biomarkers that are linked to response and resistance to immunotherapy. For instance, in the past few years, the problem of resistance to endocrine therapy has been a point of research. Recently, the key role of the acquisition of ligand-independent ESR1 mutation in breast cancer as a common mechanism of resistance to hormonal therapy was discovered [28].\n\nSo far, the precision medicine movement is controversial and has sparked multiple debates. On the one hand, the SHIVA trial (2015), one of the first randomized investigation of precision therapy, was negative for its primary endpoint (progression-free survival [PFS]), as no statistically significant difference in PFS between patients receiving molecularly targeted agents and the control arm was demonstrated [29]. On the other hand, studies recruiting large number of patients, such as MOSCATO 01 (2017) and ProfiLER (2017), suggested that high-throughput genomic analyses (i.e. next-generation sequencing, comprehensive genomic profiling) improve clinical outcome in patients with advanced cancers. However, this approach has only been proven to be beneficial to a small subset of patients so far [30, 31]. As shown in Table 4, studies focusing on precision medicine show different, contradictory results. While in some studies more than 20% of the enrolled patients received the recommended according to molecular profiling treatment, in others the number of patients treated remains very low. These results suggest the need for large data collections in order to improve selection criteria and identify markers that discriminate patients that might benefit most from precision medicine.Table 4 Overview of studies focusing on molecular profiling\n\nAuthor/Study\tTumor entity\tEnrolled patients (n )\tMP patients\tActionable alterations\tImplemented therapies—n (% of enrolled)\tResults\t\nLe Tourneau et al. (SHIVA) [29]\tSolid tumors\t741\t496 (67%)\t293 (40%)\t96 (13%)\tNo significant difference in PFS (PFS: 2.3 vs 2.0 p = .41), hazard ratio for death or disease progression, 0.88 (95% CI 0.65–1.19)\t\nStockley et al. (IMPACT/COMPACT) [45]\tSolid tumors\t1893\t1640 (87%)\t187 (10%)\t84 (5%)\tORR: 19% in genotype-matched group vs 9% in unmatched group, p = 0.61\t\nMassard et al. (MOSCATO-01) [30]\tSolid tumors\t1035\t843 (81%)\t411 (40%)\t199 (24%)\tORR: 11%, SD 52%, PFSr > 1.3: 63/193 (33% of all treated patients or 7% of all enrolled patients)\t\nTrédan et al. (PROFILER) [31]\tSolid tumors\t2579\t1980 (77%)\t1032 (40%)\t163 (6%)\tORR: 0.9% of all patients\t\nRodon et al. (WINTHER) [46]\tSolid tumors\t303\t303 (100%)\t25 (89%)\t107 (35%)\tPFSr > 1.5: 22% of the patients with MP-based treatment\t\nHoefflin et al. [47]\tSolid tumors\t198\tn.a\t104 (53%)\t33 (17%)\tPR: 11/33 (33.3% of all treated patients or 5.5% of all enrolled patients)\n\nSD: 8/33 (24.2% of all treated patients or 4% of all enrolled patients)\n\n\t\nAndré et al. (SAFIR01/UNICANCER) [21]\tBreast cancer\t423\t299 (71%)\t195 (46%)\t55 (13%)\tORR:4 patients had a partial response and 9 had SD > 16 weeks (3% of all patients)\t\nParker et al. [27]\tBreast cancer\t43\t43 (100%)\t40 (93%)\t17 (40%)\t7 patients (41% of all treated patients or 16% of all enrolled patients) achieved SD or PR\t\nMP molecular profiled, PFS progression-free survival, ORR overall response rate, SD stable disease, PR disease progression, n.a. not available\n\nAlthough molecular targeted agents themselves are more precise than standard cytotoxic agents, clinical evidence for a significant better outcome associated with MTAs is still missing, as the access to targeted therapies remains limited, making collecting data regarding their efficacy difficult. In order to achieve their implementation in clinical care, a re-assessment of the standards of evidence sufficient to prove the benefit of precision cancer therapies is needed [32]. New evidence suggests that appropriately conducted real-world data studies have the potential to support regulatory decisions in the absence of RCT data [33].\n\nBased on initial results of the CCC LMU Munich, patients of various tumor entities benefit from extended molecular diagnostics and their implementation in clinical care [34]. Recently, many studies have described the positive effect of MTB case discussions for particular groups of patients with advanced solid cancers. However, there is not enough evidence for the utility of MTB decisions for patients with breast and gynecological malignancies.\n\nThe world of precision medicine is constantly evolving, and new targeted therapies are being developed and approved, enabling more and more patients (with up to this point of time not actionable mutation) to receive targeted therapies. For example, in spring 2019, the Food and Drug Administration of the USA (FDA) approved the PIK3CA inhibitor alpelisib in combination with endocrine therapy for patients with HR-positive, HER2-negative, PIK3CA-mutated, advanced or metastatic breast cancer. The availability of this drug after start of the Managed Access Program in our clinic could have resulted in five further therapy recommendations in our MTB cohort, showing the need of identifying such alterations in cancer patients.\n\nThe rising number of active targetable mutations affects the complexity of the results, making their interpretation a challenge for many oncologists. In 2014, Gray et al. conducted a study, which evaluated cancer physicians’ ability of using multiplex tumor genomic testing and showed that many physicians lack confidence in interpreting complex genomic test results as well as in incorporating them into practice [35]. Thus, we see great potential in establishing the combination of molecular diagnostic tests and a subsequent case discussion by a multidisciplinary molecular board team not only as a routine for cancer patients but also as a training platform and a knowledge-expanding approach for oncologists to help guide their decisions.\n\nHowever, precision oncology faces some challenges, which delay its widespread translation into clinical practice. Critics of the incorporation of NGS and similar methods into clinical practice express following concerns:\n\nFirst, the significant cost of molecular diagnostics and targeted drugs is still a great disadvantage. While prices of next-generation sequencing technologies are dropping from about $3 billion in the year 2000 and to $5000 today, the selection of molecular targeted agents is still enormously expensive [36]. As the price of precision medicine is still rather high for most patients, it is now crucial to also evaluate its cost-effectiveness in order to support its translation into clinical practice, for example in the setting of clinical trials and research programs [37].\n\nSecond, logistical problems causing limited access to targeted drugs and clinical trials for biomarker-positive patients represent another major problem. This is mainly due to the absence of reimbursement for drugs beyond their labelled indication. As a consequence, in order to receive the required, often off-label drug, patients need to be enrolled within active clinical trials or are required to cover the costs themselves or to file an application for reimbursement by the competent health insurance prior to treatment initiation. Clinical trials often have strict inclusion criteria and are, therefore, not easily accessible to many patients. As shown in the SAFIR01 trial, only a small number of patients benefit from personalized therapies mostly due to drug access problems. This problem could be solved by establishing a portfolio of early phase clinical basket trials or by early-access-programs [38]. Recent studies suggest that the implementation of a MTB improves access to targeted therapy [39]. As seen in our clinic, the early-access-program that we started in November 2019 enabled many patients with a PIK3CA mutation to derive benefit from the targeted drug alpelisib soon after its FDA approval in spring 2019 [40].\n\nThird, another major limitation is the testing of tumors from patients with late stage disease, which limits treatment options and hinders patients from receiving the recommended therapy or from enrolling in a clinical trial. As patients in an advanced cancer situation are often in an unstable health condition, obtaining biopsy material with a good quality of tissue is quite difficult. Our study had 14 (14.7%) technically unsuccessful molecular diagnostics. Moreover, the time between enrolling patients in the study, processing tumor samples, followed by the molecular diagnostics and the MTB case discussion is still rather lengthy in view of the fact that malignancies in late stages tend to evolve at unprecedented speed, while causing deterioration of the general condition and hindering patients from receiving particular therapies, one of the main reasons for the relative low number of implemented therapies (9 out of 34). In this study, molecular profiling and discussion were completed in a clinically reasonable time frame of approximately 4 weeks, which is comparable to the median turnaround times in other studies. Therefore, it is reasonable to expect that introducing molecular profiling at an earlier time point in a patient’s disease trajectory could improve the quality of molecular diagnostics and allow patients to benefit more from a multidisciplinary tailored MTB-based treatment advice.\n\nFourth, another concern is that the current trend of identifying single variables and matching it with an appropriate targeted therapy may be irrelevant for some patients because of the heterogeneous landscape of their cancer. Disease variability among individual tumors causes patients with tumors of similar histology to respond differently to targeted therapies [41–43]. For example, only 60% of lung cancer patients with the p.L858R mutation in the epidermal growth factor receptor gene (EGFR) respond to gefitinib, although all of them are carriers of the exact same mutation in the target gene, indicating that other, yet unknown genetic aberrations may influence the effect of targeted drugs and that the disease course is still unpredictable to a great extent [44].\n\nFifth, the common use of medicines outside the approved label is controversial. Off-label drug use may represent a danger for patient safety in some cases, but it is sometimes justified from a clinical point of view. Four out of nine (44%) of the implemented recommended therapies in the study “The informative Patient” included off-label drugs; two of these patients (50%) experienced a clinical benefit with a partial response or stabilization lasting over 4 months, while having progressed under last standard treatment.\n\nThere were several limitations to our study. First, despite a relatively high number of breast and gynecological cancer, the overall number of included patients remains low. Second, our patient cohort presented had a heterogeneous tumor type, making general conclusions relatively difficult. Third, the number of patients with implemented therapies is limited, due to deterioration of patients’ general condition or no access to the recommended targeted drug, as previously reported in other studies. Nevertheless, we do demonstrate feasibility of and patient benefit from a routine MTB at a large comprehensive cancer center.\n\nConclusion\n\nThe landscape of molecular alterations in breast and gynecological cancers is heterogeneous. Advances in the quality and availability of molecular diagnostics and the number of targeted therapies increase rapidly, offering patients with advanced cancer a variety of new treatment options. MTBs try to bridge the gap in between molecular alterations and matching drugs in a structured manner.\n\nThe primary objective of the present monocentric study was to estimate, in a real-world setting, the impact of interdisciplinary MTB case discussions for patients with breast and gynecological malignancies. Altogether, on the basis of individual molecular diagnostics, diagnostic and treatment recommendations were made for 45 patients (47.4% of all). Nine out of 34 patients received the recommended treatment. Four out of 9 patients responded with a PFSr > 1.3. Therefore, our results support the approach of matching specific drugs (in- and off-label) to particular genetic aberrations and demonstrate its relevance in breast and gynecological cancers for a small, but clinically relevant group of patients. By providing a multidisciplinary tailored-based treatment advice based on genetic tests, it is now possible for more patients with breast and gynecological malignancies to gain maximum clinical benefit and improve survival of patients with either advanced stage cancer or a rare tumor entity by applying personalized medicine.\n\nThe MTB strategy, however, needs to be standardized and optimized in order to eliminate major logistical problems such as limited access to targeted agents (often off-label) and clinical trials, as well as patient referral at stage disease that are too late for a beneficial therapeutic intervention.\n\nAppendix\n\nSee Table Table 5 Data supplement\n\n#\tMutation\tTumor entity\tTreatment recommended in MTB\tFollowed treatment / Line of therapy\tPFS (months) after start of treatment\t\n1\tFGFR1, androgen receptor and CCND1 amplifications\tBreast\t1. CDK4/6 Inhibitor\n\n2. Everolimus 3. androgen receptor blocker\n\n\t\t\t\n2\tCCND1 amplification\tBreast\t1. CDK4/6 Inhibitor\n\n2. Palbociclib + Fulvestrant\n\n3. Everolimus\n\n\tPalbociclib\t21\t\n3\tERBB2 mutation\tBreast\tAfatinib / Neratinib\t\t\t\n4\tPTEN deletion; MET mutation\tBreast\t1. NCT03337724 trial 2. Exemestan + Everolimus\t\t\t\n5\tPIK3CA mutation\tBreast\tEverolimus\t\t\t\n6\tMET Exon 14 mutation\tBreast\tCrizotinib\t\t\t\n7\tMYC, FGFR1 and CCND1 amplifications\tBreast\tEverolimus\tEverolimus\t13\t\n8\tandrogen receptor amplification\tBreast\t1. NCT01945775 / NCT02163694 trial\n\n2. Bicalutamide / Tamoxifen\n\n\t\t\t\n9\tPIK3CA mutation\tBreast\t1. SOLAR-1 / IPATunity130 trial 2. Everolimus\t\t\t\n10\tERBB2 amplification\tBreast\tLapatinib, Trastuzumab, Emtansine and Pertuzumab\t\t\t\n11\tARID1A and PIK3CA mutations, LMB (4,16 muts/MB)\tBreast\tEverolimus\tEverolimus\t12\t\n12\tESR1 mutation, CCND1 amplification\tBreast\tFulvestrant + \n\nEverolimus\n\n\t\t\t\n13\tTP53 and NOTCH1 mutations\tBreast\tCyclophosphamid\t\t\t\n14\tTPM3(7)—NTRK1(10) gene fusion\tBreast\tNCT02568267 trial\t\t\t\n15\tMET Exon 2 mutation\tBreast\tCabozantinib\t\t\t\n16\tKRAS and 2 PIK3CA mutations\tBreast\tlipos. Doxorubicin / Bevacizumab + Temsirolimus/ Everolimus\t\t\t\n17\tandrogen receptor mutation, PIK3CA mutation\tBreast\tEverolimus\t\t\t\n18\tFGFR1, CCND1, EGFR, PIK3CA and PDGFRA amplifications\tBreast\tPazopanib\t\t\t\n19\tESR1 and PIK3CA mutations\tBreast\t1. NCT03056755 trial\n\n2. Everolimus\n\n\t\t\t\n20\tp16 high expression and MYC mutation\tBreast\tCheckpoint inhibitor\tPembrolizumab\t59\t\n21\tandrogen receptor amplification\tBreast\tAndrogen receptor blocker\t\t\t\n22\tAKT mutation\tBreast\t1. AKT inhibitors\n\n2. IPATunity130 trial\n\n3. Everolimus\n\n\t\t\t\n23\tSLX4 and TP53 mutations; amplifications: FGFR1, CCND1, FGF19, FGFR3\tBreast\tPazopanib\tPazopanib\t12\t\n24\tESR1 mutation\tBreast\tFulvestrant + \n\nCDK4/6 Inhibitoren\n\n\t\t\t\n25\tCCND1 and FGFR1 amplifications\tBreast\t1. Everolimus + antihormonal therapy;\n\n2. Dovitinib\n\n\t\t\t\n26\tPIK3CA and ERBB2 mutations, high expression ERBB2\tBreast\t1. Pertuzumab/ Trastuzumab (+ Everolimus) 2. Neratinib\tLapatinib\t18\t\n27\tFGFR1 amplification\tBreast\tantihormonal therapy + Everolimus + Trastuzumab\tExemestan + Everolimus + Trastuzumab\t4\t\n28\tCCND1 amplification\tBreast\t1. Exemestan + Everolimus;\n\n2. NCT-MASTER / TOP-ART trial\n\n\t\t\t\n29\tCCND1 and FGFR1 amplifications\tBreast\t1. Everolimus + Exemestan 2. NCT03517956 trial\tEverolimus + Exemestan\t14\t\n30\tKRAS and ERBB2 mutations\tOvary\tNCT02703571 trial\t\t\t\n31\tERBB2, MYC, PIK3CA amplifications\tOvary\tEverolimus + Letrozol\t\t\t\n32\tPIK3CA alteration\tCervix\tTemsirolimus\tTemsirolimus\t32\t\n33\tPIK3CA and KRAS mutations, MET gene fusion\tCervix\t1. Crizotinib\n\n2. Everolimus\n\n\t\t\t\n34\tKRAS, SMAD4 and PTEN mutations\tEndometrium\tEverolimus\t\t\t\n35\tHTB (27 muts/MB)\tOther\t1. Checkpoint inhibitor\n\n2. NCT Master trial\n\n\t\t\t\n36\tEML4-ALK gene fusion\tOther\tALK inhibitor\t\t\t\n\n5.\n\nAuthor contributions\n\nES: Manuscript writing, Data management. BW: Project development, Data collection and management, Manuscript editing. AJ: Data collection, Manuscript editing. JK: Data collection, Manuscript editing. TK: Data collection, Manuscript editing. DM: Data collection, Manuscript editing. MR: Data collection, Manuscript editing. SO: Data collection, Manuscript editing. VH: Project development, Manuscript editing. KHM: Data collection, Manuscript editing. PAG: Data collection, Manuscript editing. AB: Data collection, Manuscript editing. FT: Data collection, Manuscript editing. SM: Manuscript editing, Manuscript editing. NH: Manuscript editing, Manuscript editing. RW: Project development, Data collection and management, Manuscript editing.\n\nFunding\n\nOpen Access funding enabled and organized by Projekt DEAL.\n\nCompliance with ethical standards\n\nConflict of interest statement\n\nCBW received personal and speakers’ fees, reimbursement for travel and accommodation and honoraria for participance in advisory boards from Bayer, Celgene, Ipsen, Rafael Pharmaceuticals, RedHill, Roche, Servier, Shire/Baxalta and Taiho and grant support by Roche. AJ received honoraria and reimbursement for travel and accommodation for participance in advisory boards and from speaker's bureau from Amgen, AstraZeneca, Biocartis, Bristo-Myers Squibb (BMS), Boehringer Ingelheim, Chinese Society for Pathology, German Society for Pathology, European Association for Cancer Research (EACR), International Association for Pathology (IAP), Merck-Serono, Merck-Sharp Dohme (MSD), Quality Initiative in Pathology (QuIP), Roche Pharma, Takeda; JK received honoraria and reimbursement for travel and accommodation for participance in advisory boards and from speaker's bureau from AstraZeneca, Novartis, Quality Initiative in Pathology (QuIP), Roche Pharma. TK received honoraria and reimbursement for travel and accommodation for participance in advisory boards from Amgen, AstraZeneca, Merck KGaA, MSD, Novartis, Pfizer, Roche; and from speaker's bureau from Merck and Astra Zeneca; from Merck and Roche research funding as well. KHM received honoraria from Celgene, Pfizer, Astellas, Daiichi Sankyo and Otsuka Pharma. AB received honoraria and reimbursement for travel and accommodation for participance in advisory boards from AstraZeneka, Roche and Tesaro. FT received research support, reimbursement for travel and accommodation for participance in advisory boards and from speaker's bureau from AstraZeneca, Clovis, Medac, PharmaMar, Roche, Tesaro/GSK. SM received research support, advisory board, honoraria and travel expenses from AbbVie, AstraZeneca, Clovis, Eisai, GlaxoSmithKline, Medac, MSD, Novartis, Olympus, PharmaMar, Pfizer, Roche, Sensor Kinesis, Teva, Tesaro. NH received honoraria for lectures and/or consulting from Agendia, Amgen, Astra Zeneca, BMS, Celgene, Daiichi-Sankyo, Genomic Health, Lilly, MSD, Novartis, Odonate, Pierre Fabre, Pfizer, Roche, Sandoz/Hexal, Seattle Genetics. RW received honoraria for lectures and/or consulting from Agendia, Amgen, Aristo, Astra Zeneca, Celgene, Clinsol, Daiichi-Sankyo, Eisai, Genomic Health, Glaxo Smith Kline, Hexal, Lilly, Medstrom Medical, MSD, Mundipharma, Nanostring, Novartis, Odonate, Paxman, Palleos, Pfizer, Pierre Fabre, PumaBiotechnolgogy, Riemser, Roche, Sandoz/Hexal, Seattle Genetics, Tesaro Bio, Teva.\n\nEthical approval\n\nThe study received approval of the local ethics committee (study number: 284–10) and was performed in accordance with the ethical standards as laid down in the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards.\n\nConsent to participate and publication:\n\nInformed consent was obtained from all individual participants included in the study.\n\nPublisher's Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. The Global Cancer Observatory, https://gco.iarc.fr Accessed 28 May 2020.\n2. Behjati S Tarpey PS What is next generation sequencing? Arch Dis Child Educ Pract Ed 2013 98 6 236 238 10.1136/archdischild-2013-304340 23986538\n3. Kaderbhai CG Bolidot R Beltjens F Use of dedicated gene panel sequencing using next generation sequencing to improve the personalized care of lung cancer Oncotarget 2016 7 17 24860 24870 10.18632/oncotarget.8391 27027238\n4. Von Hoff DD Stephenson JJ Jr Rosen P Pilot study using molecular profiling of patients’ tumors to find potential targets and select treatments for their refractory cancers J Clin Oncol 2010 28 33 4877 4883 10.1200/JCO.2009.26.5983 20921468\n5. Schwaederle M Zhao M Lee JJ Impact of precision medicine in diverse cancers: a meta-analysis of phase II clinical trials J Clin Oncol 2015 33 32 3817 3825 10.1200/JCO.2015.61.5997 26304871\n6. Haslem DS Chakravarty I Fulde G Precision oncology in advanced cancer patients improves overall survival with lower weekly healthcare costs Oncotarget. 2018 9 12316 12322 10.18632/oncotarget.24384 29552312\n7. Incorvati JA Shah S Mu Y Targeted therapy for HER2 positive breast cancer J Hematol Oncol 2013 6 38 10.1186/1756-8722-6-38 23731980\n8. Maekawa T Ashihara E Kimura S The Bcr-Abl tyrosine kinase inhibitor imatinib and promising new agents against Philadelphia chromosome-positive leukemias Int J Clin Oncol 2007 12 327 340 10.1007/s10147-007-0699-1 17929114\n9. Holman LL Lu KH Genetic risk and gynecologic cancers Hematol Oncol Clin North Am 2012 26 1 13 29 10.1016/j.hoc.2011.11.003 22244659\n10. Ellsworth RE Blackburn HL Shriver CD Molecular heterogeneity in breast cancer: state of the science and implications for patient care Semin Cell Dev Biol 2017 64 65 72 10.1016/j.semcdb.2016.08.025 27569190\n11. Salomon-Perzyński A Salomon-Perzyńska M Michalski B High-grade serous ovarian cancer: the clone wars Arch Gynecol Obstet 2017 295 3 569 576 10.1007/s00404-017-4292-1 28154920\n12. The Asco Post Staff (2019) Alpelisib plus Fulvestrant approved for PIK3CA mutated breast cancer. https://www.ascopost.com/issues/june-10-2019/alpelisib-plus-fulvestrant-approved-for-pik3ca-mutated-breast-cancer/. Accessed 16 Sep 2019\n13. André F Ciruelos E Rubovszky G Alpelisib for PIK3CA-mutated, hormone receptor-positive advanced breast cancer N Engl J Med 2019 380 1929 1940 10.1056/NEJMoa1813904 31091374\n14. AGO. Alle aktuelle Empfehllungen. https://www.ago-online.de/fileadmin/ago-online/downloads/_leitlinien/kommission_mamma/2020/Alle_aktuellen_Empfehlungen_2020.pdf. Accessed 24 April 2020.\n15. Ledermann J Harter P Gourley C Olaparib Maintenance Therapy in Platinum-Sensitive Relapsed Ovarian Cancer N Engl J Med 2012 366 1382 1392 10.1056/NEJMoa1105535 22452356\n16. Moore K Colombo N Scambia G (2018) Maintenance olaparib in patients with newly diagnosed advanced ovarian cancer N Engl J Med 2018 379 2495 2505 10.1056/NEJMoa1810858 30345884\n17. The Asco Post (2019). Olaparib improves outcomes in ovarian cancer. https://www.ascopost.com/issues/september-25-2019/olaparib-improves-outcomes-in-ovarian-cancer/. Accessed 29 Nov 2019\n18. D'Ambrosio C Erriquez J Arigoni M (2020) PIK3R1W624R Is an Actionable Mutation in High Grade Serous Ovarian Carcinoma Cells 2020 9 2 442 10.3390/cells9020442\n19. Zammataro L Lopez S Bellone S Whole-exome sequencing of cervical carcinomas identifies activating ERBB2 and PIK3CA mutations as targets for combination therapy Proc Natl Acad Sci U S A 2019 116 45 22730 22736 10.1073/pnas.191138511 31624127\n20. Campbell IG Russell SE Choong D Mutation of the PIK3CA gene in ovarian and breast cancer Cancer Res 2004 64 21 7678 7681 10.1158/0008-5472.CAN-04-2933 15520168\n21. André F Bachelot T Commo F Comparative genomic hybridisation array and DNA sequencing to direct treatment of metastatic breast cancer: A multicentre, prospective trial (SAFIR01/UNICANCER) Lancet Oncol 2014 15 3 267 274 10.1016/S1470-2045(13)70611-9 24508104\n22. Oliver KE Xiao N Spetzler D The impact of tumor molecular profile-directed treatment on survival in recurrent ovarian cancer J Clin Oncol 2014 10.1200/jco2014.32.15_suppl.5591 25225422\n23. Wang K Li M Hakonarson H ANNOVAR: Functional annotation of genetic variants from high throughput sequencing data Nucleic Acids Res 2010 38 16 e164 10.1093/nar/gkq603 20601685\n24. https://www.ncbi.nlm.nih.gov/clinvar/ Accessed 20 March 2020\n25. Dalton WB Forde PM Kang H Personalized medicine in the oncology clinic: implementation and outcomes of the Johns Hopkins Molecular Tumor Board JCO Precis Oncol 2017 10.1200/PO.16.00046 30003184\n26. Jameson GS Petricoin EF Sachdev J A pilot study utilizing multi-omic molecular profiling to find potential targets and select individualized treatments for patients with previously treated metastatic breast cancer Breast Cancer Res Treat 2014 147 3 579 588 10.1007/s10549-014-3117-1 25209003\n27. Parker BA Schwaederlé M Scur MD Breast cancer experience of the molecular tumor board at the University of California, San Diego Moores Cancer Center J Oncol Pract 2015 11 6 442 449 10.1200/JOP.2015.004127 26243651\n28. Dustin D Gu G Fuqua SAW ESR1 mutations in breast cancer Cancer 2019 125 3714 3728 10.1002/cncr.32345 31318440\n29. Tourneau CL Delord JP Gonçalves A Molecularly targeted therapy based on tumour molecular profiling versus conventional therapy for advanced cancer (SHIVA): a multicentre, open-label, proof-of-concept, randomised, controlled phase 2 trial Lancet Oncol 2015 16 13 1324 1334 10.1016/S1470-2045(15)00188-6 26342236\n30. Massard C Michiels S Ferté C High-throughput genomics and clinical outcome in hard-to-treat advanced cancers: results of the MOSCATO 01 Trial Cancer Discov 2017 7 6 586 595 10.1158/2159-8290.CD-16-1396 28365644\n31. The Asco Post (2017) ProfiLER trial: routine genomic testing feasible, but only a subset of patients may benefit. https://www.ascopost.com/News/55703. Accessed 27 July 2019\n32. Moscow JA Fojo T Schilsky RL The evidence framework for precision cancer medicine Nat Rev Clin Oncol 2018 15 3 183 192 10.1038/nrclinonc.2017.186 29255239\n33. Ramagopalan SV Simpson A Sammon (2020) Can real-world data really replace randomised clinical trials? BMC Med. 2020 18 1 13 10.1186/s12916-019-1481-8 31937304\n34. Heinrich K, Miller-Phillips L, von Bergwelt-Baildon M et al (2020) The CCC LMU Molecular Tumorboard: clinical and molecular characteristics of the first 450 patients, DKK 2020. https://dkk.conference2web.com/#!contentsessions/45052. Accessed 15 May 2020\n35. Gray SW Hicks-Courant K Cronin A Physicians' attitudes about multiplex tumor genomic testing J Clin Oncol 2014 32 13 1317 1323 10.1200/JCO.2013.52.4298 24663044\n36. Schwarze K Buchanan J Taylor JC Are whole-exome and whole-genome sequencing approaches cost-effective? A systematic review of the literature Genet Med 2018 20 1122 1130 10.1038/gim.2017.247 29446766\n37. Rody A Ettl J Marmé F Prat A Molecular tumor boards Breast Care (Basel) 2018 13 2 141 143 10.1159/000489138 29887793\n38. Hempel D Ebner F Garg A Real world data analysis of next generation sequencing and protein expression in metastatic breast cancer patients Sci Rep 2020 10 10459 10.1038/s41598-020-67393-9 32591580\n39. Bourien H Lespagnol A Campillo-Gimenez B Implementation of a molecular tumor board at a regional level to improve access to targeted therapy Int J Clin Oncol 2020 25 7 1234 1241 10.1007/s10147-020-01661-6 32215806\n40. Wuerstlein R, Harbeck N (2020) Präzisionsmedizin. Chancen für Forschung und Therapie. Individualisierte Diagnostik und Therapie des Mammakarzinoms: Hoffnung oder Realität? Frankfurter Forum für Gesellschafts- und Gesundheitspolitische Grundsatzfragen e.V. 40–49. http://frankfurterforum-diskurse.de/wp-content/uploads/2020/04/Heft_21_Vortrag_5.pdf. Accessed 28 April 2020.\n41. Seoane J De Mattos-Arruda L The challenge of intratumour heterogeneity in precision medicine J Intern Med 2014 10.1111/joim.12240 24661605\n42. Burrell RA McGranahan N Bartek J The causes and consequences of genetic heterogeneity in cancer evolu- tion Nature 2013 501 338 345 10.1038/nature12625 24048066\n43. Bedard PL Hansen AR Ratain MJ Tumour heterogeneity in the clinic Nature 2013 501 355 364 10.1038/nature12627 24048068\n44. Sim EH Yang IA Wood-Baker R (2018) Gefitinib for advanced non-small cell lung cancer Cochrane Database Syst Rev. 2018 1 1 CD006847 10.1002/14651858.CD006847.pub2 29336009\n45. Stockley TL Oza AM Berman HK Molecular profiling of advanced solid tumors and patient outcomes with genotype-matched clinical trials: the Princess Margaret IMPACT/COMPACT trial Genome Med 2016 8 1 109 10.1186/s13073-016-0364-2 27782854\n46. Rodon J Soria JC Berger R Genomic and transcriptomic profiling expands precision cancer medicine: the WINTHER trial Nat Med 2019 25 5 751 758 10.1038/s41591-019-0424-4 31011205\n47. Hoefflin R Geißler AL Fritsch R personalized clinical decision making through implementation of a molecular tumor board: a german single-center experience JCO Precis Oncol 2018 10.1200/PO.18.00105 32913998\n\n",
"fulltext_license": "CC BY",
"issn_linking": "0932-0067",
"issue": "303(5)",
"journal": "Archives of gynecology and obstetrics",
"keywords": "Biomarker; Breast cancer; Molecular diagnostic; Molecular tumor board; Ovarian cancer; Personalized medicine",
"medline_ta": "Arch Gynecol Obstet",
"mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D001943:Breast Neoplasms; D005260:Female; D005833:Genital Neoplasms, Female; D005858:Germany; D006801:Humans; D008875:Middle Aged; D009362:Neoplasm Metastasis; D057089:Pathology, Molecular; D057285:Precision Medicine; D055815:Young Adult",
"nlm_unique_id": "8710213",
"other_id": null,
"pages": "1331-1345",
"pmc": null,
"pmid": "33277683",
"pubdate": "2021-05",
"publication_types": "D016428:Journal Article",
"references": "23986538;27027238;26304871;29552312;23731980;17929114;22244659;27569190;28154920;31091374;22452356;30345884;31624127;15520168;24508104;25225422;20601685;30003184;25209003;26243651;31318440;26342236;28365644;29255239;31937304;24663044;29446766;32591580;32215806;24661605;24048066;24048068;29336009;27782854;31011205;32913998",
"title": "NGS-guided precision oncology in metastatic breast and gynecological cancer: first experiences at the CCC Munich LMU.",
"title_normalized": "ngs guided precision oncology in metastatic breast and gynecological cancer first experiences at the ccc munich lmu"
} | [
{
"companynumb": "DE-CELLTRION INC.-2021DE009988",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "EVEROLIMUS"
},
"drugadditional": "3",
... |
{
"abstract": "Gemcitabine, dexamethasone and cisplatin (GDP) is a well-established salvage regimen for relapsed and refractory lymphomas. In this study, we aimed to share our experience with the patients who received GDP/R-GDP (rituximab-gemcitabine, dexamethasone and cisplatin) for stem cell mobilization.\n\n\n\nData of 69 relapsed and refractory Hodgkin lymphoma (HL) and Non-Hodgkin lymphoma (NHL) patients who received GDP/R-GDP as salvage chemotherapy in our center between July 2014 and January 2020 were retrospectively evaluated. After the evaluation of response, 52 patients had a chemosensitive disease and underwent mobilization with GDP/R-GDP plus G–CSF (granulocyte colony-stimulating factor). Collected CD34+ stem cells and related parameters were compared in terms of diagnosis of HL and NHL, early and late stage, patients who did not receive RT and those who received RT, and patients aged under 60 and over 60.\n\n\n\nOn the 15th day on average (range 11–20), a median number of 8.7 × 106 /kg (4.1–41.5) CD34+ stem cells were collected in 51 (98%) of our 52 chemosensitive patients and 1 (2%) patients failed to mobilize. We observed acceptable hematological and nonhematological toxicity. The targeted amount of 2 × 106 /kg CD34+ stem cells was attained by 98% (n: 51) patients, and all of them underwent autologous stem cell transplantation. Moreover, low toxicity profiles provide outpatient utilization option clinics with close follow-up and adequate supportive care.\n\n\n\nWe suggest that GDP/R-GDP plus G-CSF can be used as an effective chemotherapy regimen for mobilizing CD34+ stem cells from peripheral blood in relapsed and refractory lymphoma patients due to low toxicity, effective tumor reduction, and successful stem cell mobilization. It can also be assumed that the GDP mobilization regimen may be more effective, especially in patients with early-stage disease and in HL patients.",
"affiliations": "Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Clinical Biochemistry, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey;Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara, Turkey",
"authors": "Batgi|Hikmettullah|H|0000-0002-5993-1403;Başcı|Semih|S|0000-0003-4304-9245;Dal|Mehmet Sinan|MS|0000-0002-5994-2735;Kızıl Çakar|Merih|M|0000-0003-0978-0923;Uncu Ulu|Bahar|B|0000-0002-6230-9519;Yiğenoğlu|Tuğçe Nur|TN|0000-0001-9962-8882;Özcan|Nurgül|N|0000-0001-8819-5153;Kılınç|Ali|A|0000-0002-2987-1171;Merdin|Alparslan|A|0000-0003-1689-630X;Yıldız|Jale|J|0000-0002-8235-1570;Bakırtaş|Mehmet|M|0000-0003-3216-482X;Şahin|Derya|D|0000-0002-0945-8398;Darçın|Tahir|T|0000-0001-5073-1790;İskender|Dicle|D|0000-0002-6062-6422;Baysal|Nuran Ahü|NA|0000-0002-2425-3374;Altuntaş|Fevzi|F|0000-0001-6872-3780",
"chemical_list": null,
"country": "Turkey",
"delete": false,
"doi": "10.3906/sag-2008-114",
"fulltext": "\n==== Front\nTurk J Med Sci\nTurk J Med Sci\nTurkish Journal of Medical Sciences\n1300-0144\n1303-6165\nThe Scientific and Technological Research Council of Turkey\n\n33237657\n10.3906/sag-2008-114\nArticle\nGemcitabine, dexamethasone and cisplatin (GDP) is an effective and well-tolerated mobilization regimen for relapsed and refractory lymphoma: a single center experience\nhttps://orcid.org/0000-0002-5993-1403\nBATGİ Hikmettullah 1\nhttps://orcid.org/0000-0003-4304-9245\nBAŞCI1 Semih *1\nhttps://orcid.org/0000-0002-5994-2735\nDAL1 Mehmet Sinan 1\nhttps://orcid.org/0000-0003-0978-0923\nKIZIL ÇAKAR Merih 1\nhttps://orcid.org/0000-0002-6230-9519\nUNCU ULU Bahar 1\nhttps://orcid.org/0000-0001-9962-8882\nYİĞENOĞLU Tuğçe Nur 1\nhttp://orcid.org/0000-0001-8819-5153\nÖZCAN Nurgül 2\nhttps://orcid.org/0000-0002-2987-1171\nKILINÇ Ali 1\nhttps://orcid.org/0000-0003-1689-630X\nMERDİN Alparslan 1\nhttps://orcid.org/0000-0002-8235-1570\nYILDIZ Jale 1\nhttps://orcid.org/0000-0003-3216-482X\nBAKIRTAŞ Mehmet 1\nhttps://orcid.org/0000-0002-0945-8398\nŞAHİN Derya 1\nhttps://orcid.org/0000-0001-5073-1790\nDARÇIN Tahir 1\nhttps://orcid.org/0000-0002-6062-6422\nİSKENDER Dicle 1\nhttps://orcid.org/0000-0002-2425-3374\nBAYSAL Nuran Ahu 1\nhttps://orcid.org/0000-0001-6872-3780\nALTUNTAŞ Fevzi 1\n1 1Department of Hematology and Bone Marrow Transplantation Center, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara Turkey\n2 Department of Clinical Biochemistry, Ankara Dr. Abdurrahman Yurtaslan Oncology Training and Research Hospital, University of Health Sciences, Ankara Turkey\n* To whom correspondence should be addressed. E-mail: dr.semihbasci@gmail.com\nCONFLICT OF INTEREST:\n\nThe authors declared that there is no conflict of interest in this study.\n\n2021\n30 4 2021\n51 2 685692\n14 8 2020\n21 11 2020\nCopyright © 2021 The Author(s)\n2021\nhttps://creativecommons.org/licenses/by/4.0/ This article is distributed under the terms of the Creative Commons Attribution License ( http://creativecommons.org/licenses/by/4.0/ ), which permits unrestricted use and redistribution provided that the original author and source are credited.\nBackground/aim\n\nGemcitabine, dexamethasone and cisplatin (GDP) is a well-established salvage regimen for relapsed and refractory lymphomas. In this study, we aimed to share our experience with the patients who received GDP/R-GDP (rituximab-gemcitabine, dexamethasone and cisplatin) for stem cell mobilization.\n\nMaterials and methods\n\nData of 69 relapsed and refractory Hodgkin lymphoma (HL) and Non-Hodgkin lymphoma (NHL) patients who received GDP/R-GDP as salvage chemotherapy in our center between July 2014 and January 2020 were retrospectively evaluated. After the evaluation of response, 52 patients had a chemosensitive disease and underwent mobilization with GDP/R-GDP plus G–CSF (granulocyte colony-stimulating factor). Collected CD34+ stem cells and related parameters were compared in terms of diagnosis of HL and NHL, early and late stage, patients who did not receive RT and those who received RT, and patients aged under 60 and over 60.\n\nResults\n\nOn the 15th day on average (range 11–20), a median number of 8.7 × 106 /kg (4.1–41.5) CD34+ stem cells were collected in 51 (98%) of our 52 chemosensitive patients and 1 (2%) patients failed to mobilize. We observed acceptable hematological and nonhematological toxicity. The targeted amount of 2 × 106 /kg CD34+ stem cells was attained by 98% (n: 51) patients, and all of them underwent autologous stem cell transplantation. Moreover, low toxicity profiles provide outpatient utilization option clinics with close follow-up and adequate supportive care.\n\nConclusion\n\nWe suggest that GDP/R-GDP plus G-CSF can be used as an effective chemotherapy regimen for mobilizing CD34+ stem cells from peripheral blood in relapsed and refractory lymphoma patients due to low toxicity, effective tumor reduction, and successful stem cell mobilization. It can also be assumed that the GDP mobilization regimen may be more effective, especially in patients with early-stage disease and in HL patients.\n\nGemcitabine\ndexamethasone\ncisplatin\nstem cell mobilization\nrelapsed and refractory lymphoma\n==== Body\n1. Introduction\n\nAutologous stem cell transplantation (ASCT), which is a highly therapeutic approach to the treatment of relapsed and refractory lymphoma, is extremely dependent on the mobilization and collection of hematopoietic stem cells (HSC) [1,2]. HSCs can be collected directly from the bone marrow or peripheral blood (PB) by apheresis. ASCTs are performed primarily with peripheral blood stem cells (PBSC). The release of HSCs to PB after granulocyte colony-stimulating factor (G-CSF) treatment and/or chemotherapy is known as mobilization. CD34+ cells do not exceed 0.05% of white blood cells (WBCs) under normal conditions in PB. After combining chemotherapy and G-CSF, the number of PBSC increases from 5 to 15 times [3–5].\n\nThe target quantity of HSC to be collected is dependent on the underlying disease (Non-Hodgkin lymphoma (NHL), Hodgkin lymphoma (HL), and the number of transplants. The minimum dose considered to be safe in case of ASCT is 2 × 106 CD34+ cells/kg per transplant; however, the aim of many centers is higher yields of 4–5 × 106 CD34+ cells/kg as it may allow faster neutrophil and platelet (PLT) recovery, reduced hospitalization, blood transfusions, and antibiotic therapy. The ideal dose required for successful transplantation was considered to be 5 × 106 CD34+ cells/kg [6–8]. The choice of a specific chemomobilization approach is based on the patient’s disease characteristics and local clinical practice guidelines. The applications that incorporate both the G-CSF and chemotherapy regimens were shown to mobilize more PBSCs than G-CSF alone [9,10].\n\nThe combination of G-CSF and chemotherapy is favored for stem cell mobilization and for tumor burden reduction and especially those who need to harvest a greater count of stem cells. It is an option to utilize mobilization not by splitting chemotherapy apart, however, through more precise, disease definite chemotherapy regimens such as; rituximab dexamethasone cytarabine cisplatin (R-DHAP) or rituximab, ifosfamide, carboplatin, and etoposide (R-ICE) for lymphoma patients [11]. After chemotherapy regimen employment, G-CSF daily dosage for mobilization was recommended as filgrastim 10 μg/kg and lenograstim 150 μg/m2. The G-CSF should be initiated following the fulfillment of chemotherapy instantly when leukocyte nadir is detected, and it should be continued till the ending of leukapheresis. Generally, it is recommended to begin G-CSF in 1–5 days following the completion of chemotherapy. Nonetheless, chemomobilization is not a panacea and has some detrimental aspects such as; therapy-associated toxicity, need for frequent hospitalization, harming bone marrow for forthcoming mobilizations and huge cost [11]. Also, it is known that repeated interventions for mobilization after failures constitute a burden for resource utilization and morbidity [12]. Considering all these factors together, determination of the most appropriate chemotherapy regimen for mobilization gains more importance [13].\n\nThe data regarding gemcitabine, dexamethasone, and cisplatin (GDP)/rituximab, gemcitabine, dexamethasone, and cisplatin (R-GDP) on stem cell mobilization are not widely investigated. This study is particularly designed to determine the results of GDP/R-GDP regimen plus G-CSF on mobilization as salvage therapy in patients with relapsed and refractory lymphoma.\n\n2. Materials and methods\n\nData of 69 relapsed and refractory HL and NHL patients who received GDP/R-GDP as salvage chemotherapy in our center between July 2014 and January 2020 were retrospectively evaluated. All the patients received GDP/R-GDP as salvage regimen (rituximab 375 mg/m2 on day 0, gemcitabine 1000 mg/m2 on days 1 and 8, cisplatin 75 mg/m2 on day 1, dexamethasone 40 mg/day on days 1, 2, 3 and 4: standard doses without dose modifications). Response assessment was based on imaging results from fluorodeoxyglucose–positron emission tomography-computed tomography (FDG/PET-CT) and computed tomography (CT) scans after treatments. The FDG/PET–CT and CT scans were evaluated by using Lugano criteria to assess FDG/PET–CT in lymphoma response criteria published in 2014 [14]. Fifty-two patients who received GDP/R-GDP had a chemosensitive disease. After GDP was given, it was the nadir for neutrophil to decrease and start to increase again, and G-CSF (2 × 5 g/kg/day) was started. Stem cell mobilization practice for lymphoma patients in our center was to start apheresis when the peripheral blood CD34+ count (PB CD34+) was > 10 cells/L, with a collection target of > 5 × 106 CD34+ cells/kg. Mobilization failure was defined as achieving a total CD34+ yield of < 2 × 106 cells/kg. Stem cell mobilization with GDP/R–GDP was compared in terms of diagnosis of HL and NHL, early and late stage, patients who did not receive RT and those who received RT, and patients under 60 and over 60 years of age.\n\n2.1. Statistical analysis\n\nThe SPSS version 21.0 (IBM Corporation, Armonk, NY, USA) was applied to analyses. The categorical variables were presented as frequency tables, and the numerical variables were presented as either mean ± standard deviations or median and minimum-maximum values, where appropriate. Distributions of continuous variables were assessed with graphics and Kolmogorov–Smirnov test. Mann–Whitney U test was implemented to compare the nonparametric continuous variables within the groups. A chi-square test was used to analyze apheresis count frequency between the groups. A P-value ≤ 0.05 was regarded as statistically significant.\n\n3. Results\n\nGDP/R–GDP was given to 69 relapsed and refractory HL and NHL patients as salvage chemotherapy. Of the patients, 42 (60.9%) were males, and 27 (39.1%) were females. 38 (55%) patients had the diagnosis of HL, and 31 (45%) patients had NHL. The mean age of the patients was 43.9 ± 15.2 years. The demographic and clinical characteristics of the patients are summarized in Tables 1 and 2. After the evaluation of response to GDP or R-GDP regimen, a mobilization with G-CSF was performed for 52 patients who had a chemosensitive disease. On the 15th day, on average (range 11–20), ____ CD34+ stem cells were collected. The G-CSF mean was performed for 5 days (range 3–11). Peripheral CD34+ stem cell count before collection (on the day of collection) was between 11 and 467 cells?/μL, and median number of peak CD34+ stem cells in peripheral blood was 55 cells?/μL. The CD34+ stem cells were collected in 51 of our 52 chemosensitive patients (≈ 98%), and 1 (≈ 2%) patients failed to mobilize. In 51 patients, > 2 × 106 CD34+ stem cells/kg (median 8.68 × 106, range 4.06–41.50) were successfully collected. They were collected with one leukapheresis procedure in 34 patients, with two leukapheresis procedures in 15 patients, and with three leukapheresis procedures in 2 patients. The results of PBPCs collection are summarized in Table 3.\n\nTable 1 Demographic and clinical characteristics of the patients.\n\nDiagnosis\tHL (n: 38); NHL (n: 31)\t\nAge\t17–77 years (range) (mean age: 43.9)\t\nSex\tMale (n:42); Female (n:27)\t\nDisease status\tRelapse (n:40); Refractory (n:29)\t\nRadiotherapy\tYes (n:14); no. (n:55)\t\nPrevious number of chemotherapies\t1 line (n: 60); 2 line (n: 7); 3 line (n: 1); 4line (n: 1)\t\nGDP/R-GDP\tGDP (n:42); R-GDP (n: 27)\t\nAnn Arbor stage before GDP/R-GDP treatment\tStage 1 (n: 4); Stage 2 (n: 13); Stage 3(n: 16); Stage 4 (n: 36)\t\nBone marrow involvement\t3/38 (8%); 8/31 (25.8%)\t\nGDP/R-GDP number of cycles\t2 (n: 36); 3 (n: 26); 4 (n: 7)\t\nGDP/R-GDP treatment response\tChemorefractory disease n: 17;Chemosensitive disease n: 52\t\nStem cell mobilization with GDP/R-GDP\tn: 52 (n: 51, 98% successful; n: 1, 2% unsuccessful)\t\n\nTable 2 Clinical characteristics of patients.\n\nClinical characteristics\tNumber of patients (n)\t\nLymphoma type\t69\t\nHodgkin’s lymphoma\t38\t\nNon-Hodgkin’s lymphoma\t31\t\nDiffuse large B-cell lymphoma\t24\t\nT-cell lymphoma\t4\t\nMantle cell lymphoma\t1\t\nFollicular lymphoma\t1\t\nMarginal zone lymphoma\t1\t\nPrevious chemotherapies\t\t\nHodgkin’s lymphoma\t\t\nABVD\t27\t\nABVD + radiotherapy\t11\t\nNon-Hodgkin’s lymphoma\t\t\nR-CHOP\t21\t\nR-CHOP + radiotherapy\t3\t\nCHOP\t4\t\nR-EPOCH\t2\t\nCHOEP\t1\t\n\nTable 3 Results of peripheral blood stem cells collection.\n\nVariable\tAll patients, n: 52\t\nMedian CD34+ cell count in peripheral blood (/μL) (range)\t55.04 (11.07–467.18)\t\nMedian apheresis days (range)\t15 (11–20)\t\nLeukapheresis procedure count (n)\t1 (n: 34); 2 (n: 15); 3 (n: 2)\t\nMedian total CD34+ cells collected (106/kg) (range)Out of target (< 2 × 106 CD34 + cells/kg) (%)\t8.68 (4.06–41.50)1 (2)\t\nAbove minimum target (> 2×106 CD34 + cells/kg) (%)\t51 (98)\t\nAbove optimal target (> 5×106 CD34 + cells/kg) (%)\t48 (92)\t\n\nDemographic and clinical characteristics of the patients with successful mobilization are summarized in Table 4. The mean age of the patients with successful mobilization (n: 51) was 44 ± 14.5 years. Twenty-nine (≈ 57%) were males and 22 (≈ 43%) were females. Twenty-four (≈ 47%) patients had the diagnosis of HL, and 27 (≈ 53%) patients had NHL. Of these, 22 were relapsed, 29 were refractory, and 15 had early stage and 36 had an advanced stage disease. The patient with unsuccessful mobilization was a 25-year-old female relapse Stage 3BX HL who had received one-line chemotherapy before and had a history of RT. Her response to GDP was a complete response. After nearly 3 weeks, CD34+ stem cells were collected with a G-CSF plus plerixafor.\n\nTable 4 Demographic and clinical characteristics of successfully mobilized patients.\n\nVariable\tAll patients, n: 51\t\nMedian age (range)\t44 (18–77)\t\nSex\tMale (n: 29); Female (n: 22)\t\nDiagnosis\tHL (n: 24); NHL (n: 27)\t\nDisease status\tRelapse (n: 22); Refractory (n: 29)\t\nStage 1–2, n\t15\t\nStage 3–4, n\t36\t\nPatients undergoing radiotherapy, n\t11\t\nMedian CD34 cell count in peripheral blood (cells?/μL)(range)\t55.04 (11.07–467.18)\t\nPrevious line of chemotherapy\t1 line (n: 45); 2 line (n: 4); 3 line (n: 1); 4 line (n: 1)\t\n\nBlood parameters at the collection date are shown in Table 5. The PLT count was below 150 × 109 /L in 42 (82%) of 51 patients and below 100 × 109 /L in 34 (67%) of 51 patients. 2 patients (4%) had neutropenia (< 1.500 × 109 /L).\n\nGrade 1–2 toxicity was approximately 5.9% (n: 3), which was ototoxicity, mucositis, and/or nephrotoxicity. Grade 3–4 toxicity was approximately 7.8% (n: 4), which was neutropenia (n: 2), febrile neutropenia (n: 1), infections requiring hospital admission (n: 2) and/or nephrotoxicity (n: 1).\n\nTable 5 Blood parameters at harvest.\n\nVariable\tMedian (range)\t\nLeukocyte count (×109/L)\t14 (2.44–53.6)\t\nHemoglobin level (g/dL)\t11.2 (7.57–13.4)\t\nPlatelet count (×109/L)\t62 (20–181)\t\nNeutrophil count (×109/L)\t8.7 (1.05–42.74)\t\n\nPatients under 60 years of age had a higher number of CD34+ stem cells collected on day 1 than those over 60 years of age (P: 0.03). However, there was no difference in total CD34+ collected. The amount of premobilization PLT, apheresis day PB CD34+, CD34+ on the first day, and CD34+ total in HL patients were higher than in the NHL patients (P: 0.02, P: 0.002, P: 0.006, P: 0.03, respectively). In the early-stage patients, total CD34+ amount, and apheresis day PB CD34+ was found higher than in the late-stage patients (P: 0.02 and P: 0.04, respectively). As shown in Tables 6 and 7, when patients who received RT were compared with those who did not receive RT, no statistically significant difference was found in terms of WBC, PLT, and premobilization PB CD34+ stem cell counts, total number of collected CD34+ stem cells, number of CD34+ stem cells collected on the 1st day, and apheresis procedures.\n\nTable 6 Relationship of mobilization and laboratory parameters with clinical variables.\n\nAge\tDiagnosis\t\nMedian (min-max)\tAged < 60 (n: 39)\tAged ≥ 60 (n: 12)\tP value\tHL (n: 24)\tNHL (n: 27)\tP value\t\nWBC\t13.7(2.4–53.6)\t14(6.6–34.1)\t0.85\t15.7(3.2–53.6)\t10.1(2.4–46.2)\t0.12\t\nPLT\t65.5(20–181)\t52(20–107)\t0.51\t73(30–134)\t46(20–181)\t0.02*\t\nPB CD34\t73.6(11.1–467.2)\t35.2(19.5–213)\t0.12\t119.3(19.5–467.2)\t35.2(11.1–173.8)\t0.002*\t\nCD34 (1st)\t6.5(2.3–41.5)\t3.6(1.7–20)\t0.03*\t11.5(2.2-34.3)\t4.3(1.7–41.5)\t0.006*\t\nCD34 (T)\t9.5(4.1–41.5)\t8.2(5.5–20)\t0.31\t12.4(4.7–34.3)\t8.3(4.1–41.5)\t0.03*\t\nApheresiscount\t1(1–3)\t2(1–3)\t0.12\t1(1–2)\t2(1–3)\t0.11\t\n\nTable 7 Relationship of mobilization and laboratory parameters with clinical variables.\n\nStage\tRT\t\nMedian(min-max)\tEarly(n: 15)\tLate(n: 36)\tP value\tRT(n:11)\tNon-RT(n:40)\tP value\t\nWBC\t17.6(3.2–53.6)\t12.5(2.4–46.2)\t0.19\t14.7(6.6–34.9)\t12.5(2.4–53.6)\t0.33\t\nPLT\t74(24–134)\t52(20–181)\t0.10\t97(36-123)\t55(20-181)\t0.15\t\nPB CD34\t106.7(33.1–337.6)\t36.8(11.1–467.2)\t0.02*\t132.5(29.3–399.1)\t50.68(11.1–467.2)\t0.90\t\nCD34 (1st)\t10.6(3.3–20)\t4.9(1.7–41.5)\t0.09\t6.5(2.0–13.3)\t5.95(1.7–41.5)\t0.98\t\nCD34 (T)\t12.5(4.1–20)\t8.3(4.7–41.5)\t0.04*\t9.5(4.7–17.1)\t9.14(4.1–41.5)\t0.92\t\nApheresis count\t1(1–2)\t1(1–3)\t0.33\t1(1–2)\t1(1–3)\t0.71\t\n\n4. Discussion\n\nCurrently, the number of 2 × 106 CD34+ cells/kg is generally considered to be the minimum stem cell count needed for a successful ASCT. Ideally, the optimum value is generally considered to be > 5 × 106 CD34+ cells/kg, and the sum of collected stem cells below < 2 × 106 CD34+ cells/kg is regarded as mobilization failure [6,7,8,15].\n\nVarious chemotherapeutic agents are used in conjunction with G-CSF for stem cell mobilization in ASCT. Chemotherapeutic agents should be both effective against the underlying disease and should also facilitate stem cell mobilization; thus, both cytoreduction and mobilization should be provided together. This is the reason why single agents such as cyclophosphamide, etoposide, cytarabine, etc. are used along with G-CSF for both pretransplant cytoreduction and stem cell mobilization; therefore, combined regimens such as GDP, cisplatin, cytosine arabinoside and dexamethasone (DHAP), doxorubicin, methylprednisolone, high-dose cytarabine and cisplatin (ASHAP), Vinorelbine, gemcitabine, procarbazine and prednisone (ViGePP) and ifosfamide, carboplatin, and etoposide phosphate (ICE) have been used as stem cell mobilizing regimens in hematology units [16–18]. By using salvage chemotherapy in patients with relapsed or refractory HL, failure of 3%, 18%, and 14% mobilization rates were reported for GDP, carmustine cytarabine etoposide melphalan (Mini-BEAM), and ICE, respectively [16,17].\n\nBozdağ et al. investigated the effect of chemotherapy regimens on mobilization in lymphoma patients [18]. Patients were given chemotherapy protocols such as cyclophosphamide (n: 15), ASHAP (n: 11), and ViGePP (n: 12) [18]. Although no difference was reported between the groups concerning the number of stem cells collected (P: 0.58), mobilization failure was 33% in the cyclophosphamide group (n: 5/15), 9% in the ASHAP group (n: 1/11) and 8% in the ViGePP group (n: 1/12) [18].\n\nBerber et al. evaluated the effectiveness of the DHAP regimen plus filgrastim for mobilization of stem cells in relapsed and/or refractory lymphoma patients [19]. Stem cells from 32 patients (94%) were collected on the 11th day on average and the median CD34+ cell count collected was 9.7 × 106 /kg (range 3.8–41.6) [19]. Mobilization failure in salvage treatments was reported as 10% in diffuse large B-cell lymphoma (DLBCL) (n: 197) patients given R-ICE, and it was 8% in DLBCL (n: 191) patients given R-DHAP [20]. Moccia et al. provided GDP salvage treatment to 235 relapsed and refractory HL and NHL patients in their study [21]. Autologous stem cell transplantation was applied to 126 patients (69 HL and 57 DLBCL) in total [21]. In addition, Moccia AA et al. also reported GDP as an effective out-patient salvage regimen for relapsed and refractory DLBCL and HL. However, in the study, the effectiveness of GDP on PBSC mobilization has not been adequately evaluated [21].\n\nIn the current study, we evaluated the efficacy of the GDP/R-GDP regimen plus G-CSF to mobilize PBSCs in relapsed and refractory lymphoma patients. Successful mobilization was achieved in 51 of chemosensitive patients and approximately 98% of patients had stem cells collected over 2 × 106 cells?/kg. Our mobilization failure was nearly 2%, and our mobilization failure seemed to be lower when compared to the reports of Mini-BEAM, ICE, cyclophosphamide, ASHAP, ViGePP, R-ICE, and R-DHAP regimens usage reported previously [15–18]. Besides, our study suggests that GDP mobilization regimen may be more effective in HL patients in comparison to NHL patients in terms of premobilization PLT levels, PB CD34+ stem cell counts, first-day collected stem cell amount of the mobilization, and the total number of CD34+ stem cells collected as shown in Tables 6 and 7.\n\nPlerixafor could be added to G-CSF at a dose of 24 µg/kg when there is a possibility of inadequate mobilization (defined as PB CD34+ stem cell number < 10 cells/L on the first apheresis day planned or target CD34+ stem cell yield on the first day of apheresis < 50%) [23,24]. Tang C et al. used 4% and 18% plerixafor in regimens (CE (cyclophosphamide/etoposide) + G-CSF and GDP + G-CSF), respectively [24]. Besides, they reported the mobilization failure as 1.2% [24]. In our study, mobilization failure was 2% and only 1 patient used G-CSF plus plerixafor. Eventually, GDP regimen seemed not to need very high rates of plerixafor usage.\n\nPatient and disease-related factors predicting mobilization failure are being over 60 years of age, having an underlying advanced disease, having previously received more than one-line chemotherapy, and having low CD34+ cells in peripheral blood before apheresis. However, the low PLT count before mobilization and previous treatments, including fludarabine, melphalan, or lenalidomide are controversial factors in terms of mobilization failure. It is generally accepted that the most influential predictive factor for mobilization failure is the number of CD34+ cells in preapheresis PB [6].\n\nFrom a total of 145 patients, 52% of whom were diagnosed with lymphoma, participated in a study conducted by Demiriz et al. [25]. The patients were divided into two groups according to successful and unsuccessful mobilization and the groups were compared in terms of the parameters affecting the mobilization success [25]. Among the factors of age, platelet count, LDH, ferritin, CRP, LDL, and triglyceride levels, it was only high platelet count that was shown to be effective in mobilization success in their study (P < 0.05) [25]. On the other hand, due to the high platelet count before mobilization, the number of stem cells collected in HL patients was found to be higher than in NHL patients in this study and it would be an indicator of bone marrow reserve.\n\nDogu MH et al. showed that age, the number of chemotherapy cycles taken before mobilization, and radiation therapy had no significant effect on the number of final CD34+ stem cell yield (P: 0.492, 0.746, and 0.078, respectively) [26]. On the contrary, in our study, the amounts of CD34+ stem cells collected on the 1st day in patients under 60 years of age and older than that were different; however, total amounts of collected CD34+ stem cells were similar. However, there was no difference in terms of the amount of collected total CD34+ between the patients who received RT and those who did not. In addition, when early stage patients were compared with late stage patients, the total number of collected CD34+ stem cells was found to be significantly higher in the early stage patients.\n\nTang C et al. examined the efficacy and safety of PBSC mobilization following CE + G-CSF versus GDP + G-CSF [24]. Patients mobilized with CE + G-CSF required fewer days of leukapheresis (median 1 vs. 2 days; P: 0.001) and achieved a higher total CD34+ stem cell yield than patients mobilized with GDP + G-CSF (8.5 × 106 vs. 7.1 × 106 CD34+ cells/kg; P: 0.001) [24]. Frequencies of febrile neutropenia and rates of CD34+ stem cell collection ≥ 5 × 106 CD34+ cells/kg were similar [24]. Furthermore, in our study, GDP/R-GDP regimens provided a median number of 8.68 × 106 cells?/kg of CD34+ stem cells (range 4.06–41.50) PBSCs. Total CD34+ stem cell yield was collected by one leukapheresis procedure in 34 (≈ 66.7%) patients, 2 leukapheresis procedures in 15 patients (≈ 29.4%), and 3 leukapheresis procedures in 2 (≈ 3.9%) patients.\n\nIn conclusion, we observed acceptable hematological and nonhematological toxicities with R-GDP/GDP salvage chemotherapies used in relapsed and refractory lymphoma patients. We also showed high rates of successful stem cell mobilization in relapsed and refractory lymphoma patients receiving GDP/R-GDP salvage chemotherapies. Therefore, GDP/R-GDP chemotherapy regimens should also be kept in mind as an alternative for salvage chemotherapy followed by peripheral stem cell mobilization in patients with relapsed and refractory lymphoma. It can also be assumed that a GDP mobilization regimen may be more effective, especially in patients with early-stage disease and also HL patients.\n\nEthical approval\n\nLocal ethics committee approval was obtained.\n==== Refs\nSchmitz N Pfistner B Sextro M Sieber M Carella AM 2002 Aggressive conventional chemotherapy compared with high-dose chemotherapy with autologous haemopoietic stem-cell transplantation for relapsed chemosensitive Hodgkin’s disease: a randomised trial The Lancet 359 2065 2071\nOzkan HA Bal C 2014 Chemomobilization with high-dose etoposide and G-CSF results in effective and safe stem cell collection in heavily pretreated lymphoma patients: report from a single institution study and review European Journal of Haematology 92 390 397 24400988\nBeyer J Schwella N Zingsem J Strohscheer I Schwaner I 1995 Hematopoietic rescue after high-dose chemotherapy using autologous peripheral-blood progenitor cells or bone marrow: a randomized comparison Journal of Clinical Oncology 13 1328 1335 7538556\nRichman CM Weiner RS Yankee RA 1976 Increase in circulating stem cells following chemotherapy in man Blood 47 1031 1039 1276467\nWeaver CH Schwartzberg LS Birch R Greco FA Rhinehart S 1997 Collection of peripheral blood progenitor cells after the administration of cyclophosphamide, etoposide, and granulocyte-colony-stimulating factor: an analysis of 497 patients Transfusion 37 896 903 9308634\nMohty M Hübel K Kröger N Aljurf M Apperley J 2014 Autologous haematopoietic stem cell mobilisation in multiple myeloma and lymphoma patients: a position statement from the European Group for Blood and Marrow Transplantation Bone Marrow Transplantation 49 865 872 24686988\nStiff PJ Micallef I Nademanee AP Stadtmauer EA Maziarz RT 2011 Transplanted CD34(+) cell dose is associated with long-term platelet count recovery following autologous peripheral blood stem cell transplant in patients with non-Hodgkin lymphoma or multiple myeloma Biology of Blood and Marrow Transplantation 17 1146 1153 21126595\nGiralt S Costa L Schriber J Dipersio J Maziarz R 2014 Optimizing autologous stem cell mobilization strategies to improve patient outcomes: consensus guidelines and recommendations Biology of Blood and Marrow Transplantation 20 295 308 24141007\nNakasone H Kanda Y Ueda T Matsumoto K Shimizu N 2009 Retrospective comparison of mobilization methods for autologous stem cell transplantation in multiple myeloma American Journal of Hematology 84 809 814 19862826\nPusic I Jiang SY Landua S Uy GL Rettig MP 2008 Impact of mobilization and remobilization strategies on achieving sufficient stem cell yields for autologous transplantation Biology of Blood and Marrow Transplantation 14 1045 1056 18721768\nHübel K. Carreras E Dufour C Mohty M 2019 Mobilization and collection of HSC The EBMT handbook 117 122\nTo LB Levesque JP Herbert KE 2011 How I treat patients who mobilize hematopoietic stem cells poorly Blood 118 4530 4540 21832280\nFord CD Green W Warenski S Petersen FB 2004 Effect of prior chemotherapy on hematopoietic stem cell mobilization Bone Marrow Transplantation 33 901 905 15004541\nVan Heertum RL Scarimbolo R Wolodzko JG Klencke B Messmann R 2017 Lugano 2014 criteria for assessing FDG-PET/CT in lymphoma: an operational approach for clinical trials Drug Design, Development and Therapy 13 1719 1728\nOlivieri A Marchetti M Lemoli R Tarella C Iacone A 2012 Proposed definition of ‘poor mobilizer’ in lymphoma and multiple myeloma: an analytic hierarchy process by ad hoc working group Gruppo ItalianoTrapianto di Midollo Osseo Bone Marrow Transplantation 47 342 351 21625224\nKuruvilla J Nagy T Pintilie M Tsang R Keating A 2006 Similar response rates and superior early progression-free survival with gemcitabine, dexamethasone, and cisplatin salvage therapy compared with carmustine, etoposide, cytarabine, and melphalan salvage therapy prior to autologous stem cell transplantation for recurrent or refractory Hodgkin lymphoma Cancer 106 353 360 16329112\nMoskowitz CH Nimer SD Zelenetz AD Trippett T Hedrick EE 2001 A 2-step comprehensive high-dose chemoradiotherapy second-line program for relapsed and refractory Hodgkin disease: analysis by intent to treat and development of a prognostic model Blood 1 616 623\nBozdağ SC Tekgündüz E Durgun G Sarıca A Demiriz IŞ 2013 Which regimen is better for stem cell mobilization of lymphoma patients? Transfusion and Apheresis Science 48 407 410 23643475\nBerber I Erkurt MA Kuku I Kaya E Bag HG 2016 DHAP plus filgrastim as an effective peripheral stem cell mobilization regimen for autologous stem-cell transplantation in patients with relapsed/refractory lymphoma: a single center experience Transfusion and Apheresis Science 54 48 52 26809684\nGisselbrecht C Glass B Mounier N Singh Gill D Linch DC 2010 Salvage regimens with autologous transplantation for relapsed large B-cell lymphoma in the rituximab era Journal of Clinical Oncology 20 4184 4190\nMoccia AA Hitz F Hoskins P Klasa R Power MM 2017 Gemcitabine, dexamethasone, and cisplatin (GDP) is an effective and well-tolerated salvage therapy for relapsed/refractory diffuse large B-cell lymphoma and Hodgkin lymphoma Leukemia & Lymphoma 58 324 332 27347845\nAbhyankar S DeJarnette S Aljitawi O Ganguly S Merkel D 2012 A risk-based approach to optimize autologous hematopoietic stem cell (HSC) collection with the use of plerixafor Bone Marrow Transplantation 47 483 487 21725372\nKouroukis CT Varela NP Bredeson C Kuruvilla J Xenocostas A 2016 Plerixafor for autologous stem-cell mobilization and transplantation for patients in Ontario Current Oncology 23 e409 e430 27536190\nTang C Espin-Garcia O Prica A Kurkreti V Kridel R 2020 Efficacy and safety of stem cell mobilization following gemcitabine, dexamethasone, cisplatin (GDP) salvage chemotherapy in patients with relapsed or refractory lymphoma Leukemia & Lymphoma 1 1 8\nDemiriz IŞ Bozdağ SC Tekgündüz E Uğur B Durgun G 2013 Predicting the successful peripheral blood stem cell harvesting Transfusion and Apheresis Science 48 411 414 23628357\nDogu MH Çagirgan S Ocakci S Kaya AH Ilkkilic K 2017 Autologous stem cell transplantation and stem cell mobilization kinetics in elderly patients with B cell non-Hodgkin lymphoma Transfusion and Apheresis Science 56 814 818 29153347\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1300-0144",
"issue": "51(2)",
"journal": "Turkish journal of medical sciences",
"keywords": "Gemcitabine; dexamethasone; cisplatin; stem cell mobilization; relapsed and refractory lymphoma",
"medline_ta": "Turk J Med Sci",
"mesh_terms": null,
"nlm_unique_id": "9441758",
"other_id": null,
"pages": "685-692",
"pmc": null,
"pmid": "33237657",
"pubdate": "2021-04-30",
"publication_types": "D016428:Journal Article",
"references": "23628357;27347845;21725372;21832280;23643475;12086759;24686988;19862826;24141007;1276467;15004541;18721768;11157476;21625224;32482114;21126595;16329112;29153347;20660832;26809684;9308634;27536190;28670108;24400988;7538556",
"title": "Gemcitabine, dexamethasone and cisplatin (GDP) is an effective and well-tolerated mobilization regimen for relapsed and refractory lymphoma: a single center experience",
"title_normalized": "gemcitabine dexamethasone and cisplatin gdp is an effective and well tolerated mobilization regimen for relapsed and refractory lymphoma a single center experience"
} | [
{
"companynumb": "TR-CELLTRION INC.-2020TR033257",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RITUXIMAB"
},
"drugadditional": "3",
... |
{
"abstract": "C-ros oncogene 1 receptor tyrosine kinase (ROS1) rearrangement forms a novel molecular subgroup of non-small cell lung cancer (NSCLC). The present study explored the clinicopathological features and clinical efficacy of crizotinib in patients with ROS1-positive NSCLC. A retrospective analysis of 2,617 cases of NSCLC diagnosed between January 2013 and December 2016 was performed. ROS1 fusion genes were detected by reverse transcription-quantitative polymerase chain reaction, fluorescence in situ hybridization or next-generation sequencing techniques, and patients positive for the ROS1 fusion gene received oral treatment with crizotinib. The ROS1 fusion was identified in 67 out of 2,617 cases (2.56%), including 21 cases that were male and 46 cases that were female. The median age was 68 years. Among these cases, 59 (88.06%) were adenocarcinoma and 8 were non-adenocarcinoma. According to Tumor-Node-Metastasis (TNM) staging, 4 cases were stage I-IIIa and 63 (94.02%) were stage IIIb-IV. The epidermal growth factor receptor (EGFR) gene status included 60 cases of wild-type, 1 case of co-mutation and 6 unknown cases. Statistically significant differences were identified for sex, TNM staging and EGFR gene status between ROS1 fusion gene-positive and -negative patients (P<0.001). A total of 23 patients received oral treatment with crizotinib, of which 13 (56.52%), 5 (21.74%) and 5 (21.74%) patients demonstrated a partial response, stable disease and progressive disease, respectively. The objective response rate was 56.52% and the disease control rate was 78.26%. Among all patients, the median progression-free survival (mPFS) time was 14.5 months. No differences were revealed in the mPFS time with regard to age, sex, smoking history, performance status score, histopathological type, TNM staging, tumor protein p53 gene status, EGFR gene status and first-line crizotinib treatment, whether by single or multiple factor analysis. The grade 3/4 treatment-associated adverse events included gastrointestinal disturbance, followed by increased transaminase concentration. In conclusion, the rate of ROS1 fusion in NSCLC among the patients is low, and crizotinib is an effective and safe drug for the treatment of ROS1-positive advanced NSCLC.",
"affiliations": "Department of Thoracic Disease Center, Zhejiang Rongjun Hospital, Jiaxing, Zhejiang 314000, P.R. China.;Department of Surgery, Zhejiang Rongjun Hospital, Jiaxing, Zhejiang 314000, P.R. China.;Department of Pathology, Jiaxing University College of Medicine, Jiaxing, Zhejiang 314000, P.R. China.;Department of Chemotherapy, Zhejiang Cancer Hospital, Hangzhou, Zhejiang 310022, P.R. China.;Department of Thoracic Disease Center, Zhejiang Rongjun Hospital, Jiaxing, Zhejiang 314000, P.R. China.;Department of Thoracic Disease Center, Zhejiang Rongjun Hospital, Jiaxing, Zhejiang 314000, P.R. China.;Department of Thoracic Disease Center, Zhejiang Rongjun Hospital, Jiaxing, Zhejiang 314000, P.R. China.;Department of Pathology, Fujian Provincial Cancer Hospital, Fujian Medical University Cancer Hospital, Fuzhou, Fujian 350014, P.R. China.;Department of Thoracic Disease Center, Zhejiang Rongjun Hospital, Jiaxing, Zhejiang 314000, P.R. China.",
"authors": "Zhu|You-Cai|YC|;Zhang|Xin-Gen|XG|;Lin|Xue-Ping|XP|;Wang|Wen-Xian|WX|;Li|Xiao-Feng|XF|;Wu|Li-Xin|LX|;Chen|Hua-Fei|HF|;Xu|Chun-Wei|CW|;Du|Kai-Qi|KQ|",
"chemical_list": null,
"country": "Greece",
"delete": false,
"doi": "10.3892/ol.2019.9949",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1792-1074",
"issue": "17(3)",
"journal": "Oncology letters",
"keywords": "clinicopathology; gene; lung neoplasms; treatment",
"medline_ta": "Oncol Lett",
"mesh_terms": null,
"nlm_unique_id": "101531236",
"other_id": null,
"pages": "3466-3474",
"pmc": null,
"pmid": "30867785",
"pubdate": "2019-03",
"publication_types": "D016428:Journal Article",
"references": "11846609;15118073;18083107;19097774;19692680;20573926;22215748;22327623;22661537;22919003;23514723;23552377;24380695;24419411;24857785;25079552;25157770;25264305;25399972;25667280;25688157;25721120;25851827;26273395;26840022;27100819;27237027;27486332;27738334;28461257;28532565;28818606;28971587;29251824;29268402;29596029",
"title": "Clinicopathological features and clinical efficacy of crizotinib in Chinese patients with ROS1-positive non-small cell lung cancer.",
"title_normalized": "clinicopathological features and clinical efficacy of crizotinib in chinese patients with ros1 positive non small cell lung cancer"
} | [
{
"companynumb": "CN-PFIZER INC-2020089707",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CRIZOTINIB"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nCesarean myomectomy (CM) allows to remove fibroids and to restore uterine anatomy during delivery combining two operations in one. It was opposed in the past due to surgical risks, although many reports showed that CM was not associated with increased morbidity The risk for admission to an intensive care unit (ICU) following CM - as an objective indicator of maternal morbidity potentially resulting in greater morbidity for patients, increased length of hospital stay and higher hospital costs - has been poorly evaluated in the literature. The aim of our investigation is to estimate risk factors for ICU admission after CM.\n\n\nMETHODS\nThe patients were subdivided into two groups: 57 women who were postoperatively admitted to the ICU (study group), and 45 women not treated in the ICU (control group). The p-value of <0.05 was considered as statistically significant.\n\n\nRESULTS\nData showed no statistically significant differences with regard to demographic factors, comorbidity and indications for cesarean section, as well as experience of the surgeon, number of hysterotomies, and incidence of emergency CS between the two groups. The most common reason for admission to the ICU was intraoperative hemorrhage (61.40%). As for the surgical characteristics, the study group showed significant increase in the rates of intraoperative transfusion (p=0.000) and intraoperative hemorrhage (p=0.000), as well as prolongation of surgical time (p=0.002). Myoma type and size were also significantly different between the groups (p=0.003 and p=0.000, respectively).\n\n\nCONCLUSIONS\nThe most important factor contributing to ICU admission after CM is intraoperative hemorrhage in case of bigger myomas and prolonged surgeries.",
"affiliations": null,
"authors": "Sparić|Radmila|R|;Guido|Marcello|M|;Tinelli|Andrea|A|",
"chemical_list": null,
"country": "Poland",
"delete": false,
"doi": "10.17772/gp/57828",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0017-0011",
"issue": "86(10)",
"journal": "Ginekologia polska",
"keywords": null,
"medline_ta": "Ginekol Pol",
"mesh_terms": "D000328:Adult; D002585:Cesarean Section; D004630:Emergencies; D005260:Female; D006801:Humans; D007362:Intensive Care Units; D007889:Leiomyoma; D010343:Patient Admission; D011247:Pregnancy; D011252:Pregnancy Complications, Neoplastic; D012189:Retrospective Studies; D016896:Treatment Outcome; D014592:Uterine Hemorrhage; D063186:Uterine Myomectomy; D014594:Uterine Neoplasms",
"nlm_unique_id": "0374641",
"other_id": null,
"pages": "731-6",
"pmc": null,
"pmid": "26677581",
"pubdate": "2015-10",
"publication_types": "D003160:Comparative Study; D016428:Journal Article",
"references": null,
"title": "Cesarean myomectomy and possible risk factors for admission to intensive care unit - a retrospective study.",
"title_normalized": "cesarean myomectomy and possible risk factors for admission to intensive care unit a retrospective study"
} | [
{
"companynumb": "RS-SUN PHARMACEUTICAL INDUSTRIES LTD-2016R1-112213",
"fulfillexpeditecriteria": "1",
"occurcountry": "RS",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CEFUROXIME"
},
"drug... |
{
"abstract": "This study compared the latency of pattern reversal visual evoked potentials (VEP) of 36-month old children exposed to opioid pharmacotherapy in utero to that of a group of non-exposed children. Pregnant women were enrolled as part of an open-label non-randomised flexible dosing longitudinal study. Participants were 21 children whose mothers were treated with buprenorphine- (n=11) or methadone-pharmacotherapy (n=10) during pregnancy, and 15 children not exposed to opioids in pregnancy. One-way between groups analyses of variance (ANOVA) were conducted to test the statistical significance of differences between the mean latencies of the peak response to two different sized checkerboard patterns (48' and 69' of retinal arc). Standard multiple regression analyses were conducted to determine whether there was a significant relationship between group status and VEP latencies after adjusting for the effect of covariates. VEP latencies ranged from 98 to 112 milliseconds (ms) for checks of 48' arc, and from 95 to 113ms for checks of 69' arc. Latencies were comparable across groups. After adjusting for covariates children prenatally exposed to methadone or buprenorphine did not differ significantly from non-opioid exposed children in their responses to either check size. Nor were there any significant differences in VEP latencies between children prenatally exposed to methadone and children prenatally exposed to buprenorphine. Head circumference (HC) was significantly associated with P100 latencies for both check sizes. Data from this controlled, non-randomised study suggest that neither buprenorphine nor methadone appear to have any long-term effects on visual maturity assessed at 36months of age.",
"affiliations": "Discipline of Paediatrics, School of Paediatrics and Reproductive Health, The University of Adelaide, South Australia 5005, Australia; Research and Evaluation Unit, Women's and Children's Health Network, 72 King William Rd, North Adelaide, South Australia 5006, Australia. Electronic address: justine.whitham@gmail.com.;Department of Paediatrics and Child Health, Flinders University, Bedford Park, South Australia 5042, Australia; Public Health Partnership Branch, Department for Health and Ageing, SA Health, Citicentre 11 Hindmarsh Square, Adelaide 5000, South Australia, Australia. Electronic address: nicola.spurrier@health.sa.gov.au.;Public Health Research Unit, Women's and Children's Health Network, 72 King William Rd, North Adelaide, South Australia 5006, Australia. Electronic address: peter.baghurst@adelaide.edu.au.;Department of Neurology, Women's and Children's Hospital, 72 King William Rd, North Adelaide, South Australia 5006, Australia. Electronic address: paul.weston@health.sa.gov.au.;Research and Evaluation Unit, Women's and Children's Health Network, 72 King William Rd, North Adelaide, South Australia 5006, Australia. Electronic address: michael.sawyer@health.sa.gov.au.",
"authors": "Whitham|Justine N|JN|;Spurrier|Nicola J|NJ|;Baghurst|Peter A|PA|;Weston|Paul|P|;Sawyer|Michael G|MG|",
"chemical_list": "D009294:Narcotics; D002047:Buprenorphine; D008691:Methadone",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0892-0362",
"issue": "52(Pt A)",
"journal": "Neurotoxicology and teratology",
"keywords": "Buprenorphine; Child development; Methadone; Opioids; Pregnancy; Prenatal exposure; VEP",
"medline_ta": "Neurotoxicol Teratol",
"mesh_terms": "D002047:Buprenorphine; D002540:Cerebral Cortex; D002675:Child, Preschool; D005074:Evoked Potentials, Visual; D005260:Female; D006801:Humans; D007223:Infant; D008137:Longitudinal Studies; D008297:Male; D008691:Methadone; D009294:Narcotics; D010775:Photic Stimulation; D011247:Pregnancy; D011297:Prenatal Exposure Delayed Effects",
"nlm_unique_id": "8709538",
"other_id": null,
"pages": "17-24",
"pmc": null,
"pmid": "26432025",
"pubdate": "2015",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Visual evoked potential latencies of three-year-old children prenatally exposed to buprenorphine or methadone compared with non-opioid exposed children: The results of a longitudinal study.",
"title_normalized": "visual evoked potential latencies of three year old children prenatally exposed to buprenorphine or methadone compared with non opioid exposed children the results of a longitudinal study"
} | [
{
"companynumb": "AU-INDIVIOR-INDV-085747-2015",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BUPRENORPHINE HYDROCHLORIDE"
},
"drugaddit... |
{
"abstract": "The t(3;21)(q26.2;q22) translocation is a rare chromosomal abnormality exhibited almost exclusively in therapy-related myelodysplastic syndrome/acute myeloid leukemia (t-MDS/AML) or in the blastic crisis phase of chronic myelogenous leukemia, which results in the fusion of the runt related transcription factor 1 (RUNX1, also called AML1) gene at 21q22 to the myelodysplasia syndrome 1 (MDS1)-ecotropic virus integration site 1 (EVI1) complex locus (MECOM) at 3q26.2, generating various fusion transcripts, including AML1/MDS1/EVI1 (AME). The present study examined the case of an 84-year-old Japanese woman who developed t-MDS/AML with t(3;21)(q26.2;q22) subsequent to receiving low-dose methotrexate (MTX) treatment for rheumatoid arthritis. Following treatment with MTX for 6 years, the patient developed anemia and neutropenia, and MTX was discontinued. A total of 3 years later, the patient was diagnosed with MDS with t(3;21)(q26.2;q22) and del (5q), which progressed rapidly to AML within 3 months. The patients was subsequently treated with azacitidine and cytarabine chemotherapy, but succumbed to the disease 6 months after diagnosis. Sequencing analysis of the nested reverse transcription-PCR products from the leukemic cells revealed the expression of two types of alternatively-spliced AME transcripts with or without RUNX1 exon 6 sequences. Western blot analysis of the leukemic cells of the patient additionally revealed that the corresponding AME fusion protein products were expressed at high levels, and that these cells also prominently expressed CCAAT/enhancer-binding protein α, the repression of which has been reported to be involved in leukemogenesis mediated by AME. To the best of our knowledge, the case discussed in the present study represents the first report of MDS/AML with t(3;21)(q26.2;q22) developing following low-dose MTX therapy for rheumatoid arthritis. Nonetheless, the clinical and molecular features of the patient in the present study were representative of those patients who typically develop this disease following exposure to chemotherapy or radiotherapy for primary malignancy, which implicates MTX in the pathogenesis of t-MDS/AML. Moreover, we confirmed the expression of two AME fusion proteins for the first time in primary leukemic cells and analyzed several cellular factors implicated in AME-mediated leukemogenesis to gain some insight into its molecular mechanisms.",
"affiliations": "Department of Hematology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo 113-8510, Japan.;Department of Hematology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo 113-8510, Japan.;Department of Hematology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo 113-8510, Japan.;Department of Hematology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo 113-8510, Japan.;Department of Hematology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo 113-8510, Japan.;Department of Hematology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo 113-8510, Japan.;Department of Hematology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo 113-8510, Japan.",
"authors": "Tanaka|Keisuke|K|;Oshikawa|Gaku|G|;Akiyama|Hiroki|H|;Ishida|Shinya|S|;Nagao|Toshikage|T|;Yamamoto|Masahide|M|;Miura|Osamu|O|",
"chemical_list": null,
"country": "Greece",
"delete": false,
"doi": "10.3892/ol.2017.6151",
"fulltext": "\n==== Front\nOncol LettOncol LettOLOncology Letters1792-10741792-1082D.A. Spandidos 10.3892/ol.2017.6151OL-0-0-6151ArticlesAcute myeloid leukemia with t(3;21)(q26.2;q22) developing following low-dose methotrexate therapy for rheumatoid arthritis and expressing two AML1/MDS1/EVI1 fusion proteins: A case report Tanaka Keisuke Oshikawa Gaku Akiyama Hiroki Ishida Shinya Nagao Toshikage Yamamoto Masahide Miura Osamu Department of Hematology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo 113-8510, JapanCorrespondence to: Professor Osamu Miura, Department of Hematology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8510, Japan, E-mail: miura.hema@tmd.ac.jp7 2017 10 5 2017 10 5 2017 14 1 97 102 12 4 2016 03 3 2017 Copyright: © Tanaka et al.2017This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.The t(3;21)(q26.2;q22) translocation is a rare chromosomal abnormality exhibited almost exclusively in therapy-related myelodysplastic syndrome/acute myeloid leukemia (t-MDS/AML) or in the blastic crisis phase of chronic myelogenous leukemia, which results in the fusion of the runt related transcription factor 1 (RUNX1, also called AML1) gene at 21q22 to the myelodysplasia syndrome 1 (MDS1)-ecotropic virus integration site 1 (EVI1) complex locus (MECOM) at 3q26.2, generating various fusion transcripts, including AML1/MDS1/EVI1 (AME). The present study examined the case of an 84-year-old Japanese woman who developed t-MDS/AML with t(3;21)(q26.2;q22) subsequent to receiving low-dose methotrexate (MTX) treatment for rheumatoid arthritis. Following treatment with MTX for 6 years, the patient developed anemia and neutropenia, and MTX was discontinued. A total of 3 years later, the patient was diagnosed with MDS with t(3;21)(q26.2;q22) and del (5q), which progressed rapidly to AML within 3 months. The patients was subsequently treated with azacitidine and cytarabine chemotherapy, but succumbed to the disease 6 months after diagnosis. Sequencing analysis of the nested reverse transcription-PCR products from the leukemic cells revealed the expression of two types of alternatively-spliced AME transcripts with or without RUNX1 exon 6 sequences. Western blot analysis of the leukemic cells of the patient additionally revealed that the corresponding AME fusion protein products were expressed at high levels, and that these cells also prominently expressed CCAAT/enhancer-binding protein α, the repression of which has been reported to be involved in leukemogenesis mediated by AME. To the best of our knowledge, the case discussed in the present study represents the first report of MDS/AML with t(3;21)(q26.2;q22) developing following low-dose MTX therapy for rheumatoid arthritis. Nonetheless, the clinical and molecular features of the patient in the present study were representative of those patients who typically develop this disease following exposure to chemotherapy or radiotherapy for primary malignancy, which implicates MTX in the pathogenesis of t-MDS/AML. Moreover, we confirmed the expression of two AME fusion proteins for the first time in primary leukemic cells and analyzed several cellular factors implicated in AME-mediated leukemogenesis to gain some insight into its molecular mechanisms.\n\nacute myeloid leukemiamyelodysplastic syndrometherapy-related myeloid neoplasmst(3;21)(q26.2;q22)runt related transcription factor 1ecotropic virus integration site 1 protein homologmethotrexaterheumatoid arthritis\n==== Body\nIntroduction\nA total of ~10% of acute myeloid leukemia (AML) develops following exposure to chemotherapy and/or radiation for a different primary malignancy and is categorized as therapy-related AML (t-AML) in the current World Health Organization (WHO) classification (1). The most common type of t-AML, which occurs subsequent to exposure to alkylating agents and/or radiation with a latency period of 5–10 years, is frequently preceded by therapy-related myelodysplastic syndrome (t-MDS) and is accompanied with an unbalanced loss of genetic material, often involving chromosome 5 and/or 7 (1). The less common type of t-AML, occurring following treatment with agents targeting topoisomerase II, exhibits a shorter latency period of 1–5 years without the preceding myelodysplastic phase and is often associated with balanced recurrent chromosomal translocations, frequently involving the mixed-lineage leukemia 1 (MLL) gene located at 11q23 or the runt related transcription factor 1 (RUNX1, or alternatively designated as AML1) gene at 21q22 (1). Although antimetabolites, including fludarabine, are also implicated in therapy-related hematological malignancies, it remains unknown if methotrexate (MTX), particularly when used at a low dose for the treatment of rheumatoid arthritis, serves a role in development of MDS/AML.\n\nThe t(3;21)(q26.2;q22) translocation is a rare chromosomal abnormality exhibited in <1% of AML/MDS, primarily t-MDS/AML or in the blastic crisis phase of chronic myelogenous leukemia (2–5). Chromosome 3q26.2 abnormalities typically activate the ecotropic virus integration site 1 (EVI1) gene, which has been implicated in the pathogenesis of AML and is associated with a poor prognosis (6–8). EVI1 is a nuclear transcription factor implicated in the regulation of proliferation and maintenance of hematopoietic stem cells. EVI1 also exists as the fusion protein MDS1/EVI1 (ME), which is generated by the alternative splicing of the third exon of MDS1 to the second exon of EVI1 with the two genes located nearby to form the MDS1-EVI1 complex locus (MECOM) on 3q26.2 (6,7). The most common types of 3q26.2 abnormalities are inv (3) (q21q26.2)/t(3;3)(q21;q26.2), which define a category of AML in the WHO classification and relocate a distal enhancer of the GATA binding protein 2 (GATA2) gene to a region between MDS1 and EVI1, which ectopically activates EVI1 (1,7,9,10). In contrast, t(3;21)(q26.2;q22) results in the translocation of a part of RUNX1 at 21q22 to MECOM and generates various fusion transcripts (2,4). Although these fusion transcripts, including AML1/MDS1/EVI1 (AME), have been analyzed in several cases of myeloid neoplasms associated with t(3;21)(q26.2;q22), the expression of the aberrant fusion protein products in primary leukemic cells has not previously been confirmed (3,11–16).\n\nThe present study examined a patient with MDS/AML with t(3;21)(q26.2;q22) that developed not with exposure to chemotherapy or radiotherapy for malignancy, but following treatment with low-dose MTX for rheumatoid arthritis. The fusion transcripts of RUNX1/MECOM were analyzed, and two alternatively-spliced AME transcripts with or without RUNX1 exon 6 sequences were identified. Additionally, the expression of the protein products of two of these fusion transcripts was confirmed, and the expression of CCAAT/enhancer-binding protein α (CEBPα) and other proteins implicated in AME-mediated leukemogenesis in leukemic cells from the patient was evaluated.\n\nCase report\n\nMaterials and methods\nEthics statement\nThe present study was approved by the Ethical Committee of Tokyo Medical and Dental University (Tokyo, Japan). Written informed consent was obtained from the patient in compliance with the Declaration of Helsinki.\n\nNested reverse transcription-polymerase chain reaction (RT-PCR) and sequencing analyses of the AME fusion transcripts\nThe peripheral blood mononuclear cells from the patient were obtained by Ficoll-Hypaque density gradient centrifugation (at 500 × g for 15 min at room temperature). RNA samples were prepared from the peripheral blood mononuclear cells of the patient or HL60 cells, used as a negative control, using the RNeasy® Mini kit (Qiagen GmbH, Hilden, Germany), according to the manufacturer's protocol, and subjected to RT-PCR using RUNX1 and EVI1 primers or primers for β-actin as a control. The RT-PCR for AME transcripts were performed as described previously (11) using the following primers: RUNX1 external forward, 5′-AAGTCGCCACCTACCACAGA-3′ and internal forward, 5′-GCCATCAAAATCACAGTGGA-3′; and EVI1 external reverse, 5′-CCGGCGCCATAGTTTCATGC-3′; and internal reverse, 5′-GGATAGTCTTCGCTCTTCAT-3′. The primers used for β-actin were: Forward, GGAGAAGCTGTGCTACGTCGCCC; and reverse, TACATGGTGGTGCCGCCAGACAG. The RT-PCR products were subjected to agarose gel electrophoresis and stained with ethidium bromide. For direct sequencing analysis of the AME fusion transcripts, two species of nested RT-PCR products were isolated from the gel using the MinElute® Gel Extraction kit (Qiagen GmbH), according to the manufacturer's protocol, and sequenced using the same internal primers.\n\nWestern blot analysis\nThe peripheral blood mononuclear cells from the patient and human leukemic HEL and MOLM-1 cells, obtained from the Fujisaki Cell Center (Okayama, Japan) and cultured in RPMI-1640 medium (Wako Pure Chemicals Industries, Ltd., Osaka, Japan) containing 10% fetal calf serum (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) at 37°C in a 5% CO2 incubator, were lysed and subjected to western blot analysis as described previously (17). Antibodies directed against RUNX1 (catalog no., CS4336), EVI1 (catalog no., CS2593) and calreticulin (catalog no., CS12238) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Antibodies directed against CEBPα (catalog no., SC61) and heat shock protein 90 (HSP90; catalog no., SC13119) were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). These first antibodies were used at 0.2 µg/ml at 4°C in overnight incubation, while the relevant secondary antibodies (HRP-linked anti-rabbit or -mouse IgG; NA934 or NA9310, respectively, from GE Healthcare Japan, Tokyo, Japan) were used at 0.2 µg/ml at room temperature for 1 h.\n\nCase results\nAn 84-year-old Japanese woman was referred to the Department of Hematology of the Graduate School of Medical and Dental Sciences at Tokyo Medical and Dental University (Tokyo, Japan) in September 2013 due to anemia and the appearance of blasts in the peripheral blood. The patient had been diagnosed with rheumatoid arthritis in 1997 and subsequently treated with bucillamine from 1997 until unidentified time, actarit between August 2001 and February 2002, salazosulfapyridine between February 2002 and September 2002 and penicillamine between September 2002 and June 2005, although clinical information on the dosages of these drugs was not available. In 2004, treatment with low-dose MTX (weekly doses of 6–10 mg, adjusted by clinical and laboratory findings, divided into 2 or 3 doses orally every 12 h) and prednisolone was started. In 2006, the patient was diagnosed with lung cancer and underwent radical surgery without any chemotherapy or radiotherapy. As the patient developed anemia and neutropenia in August 2010, MTX was discontinued and substituted for tacrolimus (daily doses of 1–2 mg, adjusted by clinical and laboratory findings, orally once a day). The duration of the MTX therapy was 75 months and the accumulated dose was 2,204 mg. Despite stopping MTX treatment, the patient's anemia gradually progressed, with the hemoglobin level decreasing to 6.6 g/dl (normal range, 12.0–15.0 g/dl) in September 2013, when myeloblasts and hypogranular neutrophils appeared in the peripheral blood.\n\nOn the patient's first visit to the Department of Hematology (Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University) the white blood cell count was 3.7×109/l (normal range, 3.6–9.3×109/l) with an appearance of 3% blasts, the hemoglobin level was 6.1 g/dl, and the platelet count was 155×109/l (normal range, 120–410×109/l). Bone marrow examination demonstrated slightly hypercellular marrow with 6.2% blast (normal range, 0.1–0.7%), pseudo-Pelger-Huet anomaly, hypogranular neutrophils, megaloblastoid changes, increased ringed sideroblasts (31%), and micromegakaryocytes (Fig. 1A). Flow cytometric analysis demonstrated that the blasts were positive for cluster of differentiation (CD)13 (82.2%), CD33 (43.2%, dimly expressed), and CD34 (41.7%), and partially positive for CD7 (18.5%). Cytogenetic analysis illustrated that the karyotype of the bone marrow cells was as follows: 46, XX, t(3;21)(q26.2;q22)[1]/46, idem, del(5)(q?) (16) (Fig. 1B). The position of deletion in 5q [(5)(q?)] could not be determined more precisely most likely because of the quality of metaphase samples obtained. Thus, t(3;21)(q26.2;q22) was observed in all the cells in metaphase (17) that were analyzed. In addition, the RT-PCR analysis using AML1 and EVI1 primers revealed two AME bands in gel electrophoresis (Fig. 2A). These RT-PCR products were isolated from the agarose gel and sequenced, which revealed two types of AML1/MDS1/EVI1 fusion transcripts, in which either exon 5 or 6 of RUNX1 was directly fused with exon 2 of MECOM, as demonstrated in Fig. 2B. Consistent with this, two AME fusion proteins with apparent molecular masses of 210 and 186 kDa were detected in bone marrow mononuclear cells by western blotting with antibodies directed against EVI1 and RUNX1 (Fig. 2C). EVI1 was detectable in HEL and MOLM-1 cells, but not in the patient's leukemic cells, which also expressed RUNX1, CEBPα and calreticulin at readily detectable levels.\n\nThe patient was diagnosed with MDS: Refractory anemia with excess blasts [international prognostic scoring system (IPSS) (18): Int-1; revised IPSS (19): High; WHO adapted prognostic scoring system (20): High). Although treatment with oral metenolone acetate (15 mg/day) was started in October 2013, the patient's anemia progressed and blasts in the peripheral blood increased. In December 2013, a bone marrow examination revealed 25.2% blasts, leading to the diagnosis of AML with myelodysplasia-related changes. In January 2014, treatment with azacitidine (75 mg/m2/day for 7 days) was started; however, the patient's cytopenia progressed (the white blood cell count, 2.2×109/l; platelet count, 43×109/l) and the bone marrow blasts increased. The patient was subsequently treated with low-dose cytarabine chemotherapy (10 mg/m2/day), but succumbed to the disease in July 2014.\n\nDiscussion\nThe present study described a case of AML with t(3;21)(q26.2;q22) that developed from MDS following treatment with low-dose MTX for rheumatoid arthritis. MDS/AML with t(3;21)(q26.2;q22) has been identified almost exclusively as t-MDS/AML. For instance, a large case series examined by the University of Texas MD Anderson Cancer Center (Houston, TX, USA) revealed that 16/17 cases (94.1%) of t(3;21)(q26.2;q22) -positive MDS/AML had previously received chemotherapy or radiotherapy (5). It is well established that other balanced recurrent chromosomal translocations in t-AML, including those involving RUNX1, are typically observed following treatment with topoisomerase II inhibitors without the antecedent MDS phase or myelodysplasia-related morphological changes, and are associated with a better prognosis compared with other types of t-AML (1). Notably, a previous study by the same group at the University of Texas MD Anderson Cancer Center implicated antimetabolites in the pathogenesis of t-MDS/AML with t(3;21)(q26.2;q22), as prior treatment with the pyrimidine analog 5-fluorouracil or the purine analog fludarabine was identified in 6/8 patients with this type of t-MDS/AML (3). However, the subsequent study revealed that a number of the 16 patients with t(3;21)(q26.2;q22)-positive t-MDS/AML also received alkylating agents and DNA topoisomerase II inhibitors for the treatment of their primary tumors (5). Thus, in contrast to t-AML associated with other balanced recurrent translocations, t-MDS/1-AML with t(3;21)(q26.2;q22) was observed subsequent to treatment with wide-ranging chemotherapeutics and demonstrated a very short overall survival rate (median, 4.7 months) (5). In the present study, the patient exhibited typical clinical and morphological features of MDS/AML with t(3;21)(q26.2;q22), and survived only 10 months following the diagnosis of MDS. However, to the best of our knowledge, t(3;21)(q26.2;q22)-positive MDS/AML following treatment with MTX has never been reported, and cannot be identified in the Mitelman Database of Chromosome Aberrations and Gene Fusion in Cancer (21).\n\nIt is well established that treatment with low-dose MTX for rheumatoid arthritis is associated with the development of lymphoproliferative disorders (LPDs), which are frequently associated with Epstein Barr virus infection and often regress spontaneously following the discontinuation of MTX (1,22). Thus, immunodeficiency caused by the MTX therapy is strongly implicated in the pathogenesis of LPDs. Conversely, it remains unknown whether MTX therapy for rheumatoid arthritis may serve a role in pathogenesis of MDS/AML. To the best of our knowledge, the cases of 13 patients with AML developing following low-dose MTX treatment for rheumatoid arthritis have previously been reported (Table I) (23–29). However, the clinical features, including latency periods, cumulative dosages of MTX and the presence or absence of antecedent MDS and myelodysplasia-related morphological changes have been heterogeneous among these patients. Cytogenetic changes observed in these patients have also been diverse; while complex karyotypic abnormalities were exhibited in one patient, t(8;21) was observed in two other cases (24,25,29). Conversely, the patient in the present study exhibited typical clinical and morphological features of MDS/AML associated with t(3;21)(q26.2;q22), which develops almost exclusively as t-MDS/AML (3,5). This indicates that low-dose MTX therapy is causally associated with the development of MDS/AML in the case reported in the present study, although it remains unknown whether the mechanism underlying this association involves DNA mutagenesis induced by MTX as an antimetabolite or the immunosuppressive effect of MTX. In this regard, it should be noted that rheumatoid arthritis itself has been associated with an elevated risk of AML [odds ratio (OR) 1.28, 95% confidence interval (CI) 1.11–1.47] and MDS (OR 1.52, 95% CI 1.27–1.81) (30). Additionally, rheumatoid arthritis is frequently treated with immunosuppressants in addition to MTX, as is the case for the patient in the present study who had received tacrolimus after stopping MTX. This suggests that patients with rheumatoid arthritis who are treated with MTX need to be carefully monitored for the development of MDS/AML. Further reports of patients with t-MDS/AML associated with MTX are required to clarify the etiological and clinical significance between MTX and t-MDS/AML.\n\nThe t(3;21)(q26.2;q22) translocation primarily generates the fusion gene transcript AME, although transcripts of RUNX1 fused directly with EVI1 or RPL22 near MECOM have also been identified (2,11,12,31). In the patient discussed in the present study, two AME fusion transcripts corresponding with RUNX1 fused at its 3′ end of exon 5 or 6 to the 5′ end of exon 2 of MECOM were detected. Thus, these fusion transcripts should encode the N-terminus of RUNX1 containing the DNA-binding Runt domain fused to the majority of the MDS1/EVI1 protein. These two different transcripts, presumably generated by alternative splicing, represent the two predominant forms of AME, which have previously been identified in the t(3;21)-carrying leukemic cell line SKH1 and in primary leukemic cells (3,11–16), with a few patients revealed to express both forms (14,16). However, the expression of the protein products of these fusion transcripts in primary leukemic cells has not yet been documented, to the best of our knowledge. In the present study, it was confirmed that the fusion products were expressed in present patient at a high level, comparable to that of EVI1 in human leukemic MOML-1 cells with inv(3) (q21.2;q26) (7,9) and HEL cells (32). The Runt domain maintained in AME is the DNA-binding domain of RUNX1, which is the DNA-binding subunit of the core-binding transcription factor that regulates the expression of genes essential for hematopoiesis. By recruiting histone deacetyltransferase and transcriptional co-repressors through the C-terminal domain of EVI1, AME represses the RUNX1-dependent promoters in a dominant-negative manner, thus serving an essential role in leukemogenesis (2,4). This is consistent with the observation of the present study that the leukemic cells of the patient did not express EVI1 despite the fact that wild-type RUNX1 was expressed at a readily detectable level, since EVI1 has been suggested to be a target gene of RUNX1 (32).\n\nAME has also been demonstrated to serve a role in leukemogenesis through the inhibition of CEBPα, a transcription factor that regulates the expression of genes associated with myeloid differentiation, including its own gene (2,4,31,33). Helbling et al (33) previously suggested that the conditional expression of AME in the myeloid leukemic cell line U937 suppressed the expression of CEBPα through the induction and activation of calreticulin, a putative inhibitor of CEBPα translation. The authors additionally demonstrated that leukemic cells from none of the 8 patients with t(3;21)-positive AML examined expressed CEBPα, although the expression of AME in these cells was not confirmed (33). By contrast, CEBPα was readily detectable in the leukemic cells from the patient in the present study. In addition, the expression of calreticulin was not distinctively enhanced in the present study, although the possible activation of calreticulin in the leukemic cells of the patient was not examined. Conversely, Tokita et al (31) revealed that AME inhibited CEBPα-mediated transcriptional activity in the murine hematopoietic progenitor cell line LG-3, although the mRNA levels of CEBPα, a target gene of CEBPα itself, and the expression level of calreticulin was not altered by the expression of AME in these cells. These observations suggest that the effects of AME on various cellular factors and events associated with leukemogenesis may depend on the cellular context. Thus, a detailed analysis of these factors, particularly at the protein level, in primary leukemic cells is warranted to generate more data in regards to the mechanism of AME-mediated leukemogenesis.\n\nAcknowledgements\nThe present study was supported by the Ministry of Education, Culture, Sports, Science and Technology of Japan (grant nos. 15K09467 and 24591384).\n\nFigure 1. Morphological and cytogenetic analyses of bone marrow cells at diagnosis of myelodysplastic syndrome. (A) Bone marrow smear illustrating i) a megakaryocyte with separated nuclei; ii and iii) dysplastic erythroblasts, increased blasts, pseudo-Pelger-Huet anomaly and degranulation of neutrophils and iv) ringed sideroblasts. (B) A Giemsa-banded karyogram demonstrating 46,XX,t(3;21)(q26.2;q22),del(5)(q?). Abnormal chromosomes are indicated by arrows.\n\nFigure 2. Analyses of AME fusion transcripts and proteins in the leukemic cells of the patient. (A) Reverse transcription (RT)-PCR analyses of the AME fusion transcripts. M, marker lane; 1, products from RUNX1 and EVI1 primers; 2, β-actin control. Sizes are given in bp. Pt., patient's bone marrow cells; Cont., HL60 cells; AME, AML/MDS1/EVI1. The positions of longer and shorter AME (AML/MDS1/EVI1) fusion transcripts, AME (L) and AME (S), as well as that of β-actin are also indicated. (B) Sequence analysis of the AME fusion transcripts obtained from RT-PCR. Arrows illustrate the boundaries of exons, with the nucleotide number for RUNX1 (NM_001001890.2) and MECOM (NM_004991.3) indicated. Vertical lines indicate the junctions of the chimeric transcripts. (C) Western blot analysis of the AME fusion proteins in patient's leukemic cells. Total cell lysates from HEL cells, MOLM-1 cells, or patient's bone marrow cells, as indicated, were subjected to Western blot analysis using antibodies against indicated proteins. Sizes are given in KDa. Positions of larger and smaller AME fusion proteins, AME (L) and AME (S), as well as those for EVI1, the smaller form of EVI1 lacking 324 amino acids (EVI1∆324), and RUNX1 are also indicated. HSP90 was used for a protein loading control.\n\nTable I. Identified cases of MDS/AML developing following low-dose MTX therapy for RA.\n\nAge/sex\tDuration of RA (y)\tTotal dose of MTX (mg)\tDiagnosis\tCytogenetic abnormality\t(Refs.)\t\n83/F\t33\t690\tAML\t46,XX\t(23)\t\n60/F\t23\t80\tAML-M2\tt(8;21)\t(24)\t\nNA\t0.6\tNA\tCMML to AML-M2\tNA\t(25)\t\nNA\t11\tNA\tMDS/AML-M2\tt(8;21)\t(25)\t\nNA\t10\tNA\tAML-M4\tNA\t(25)\t\n71/M\t16\t750\tAML-M1\t46,XY\t(26)\t\n72/F\t5\t1200\tAML-M4\tNA\t(26)\t\n52/M\t2\t1250\tAML-M0\t47,XY, +13\t(26)\t\n70/F\t9\t500\tAML-M5\t46,XX\t(26)\t\n68/F\t11\t1700\tAML-M6\t46,XX\t(27)\t\n73/F\t15\t5850\tAML with MRC\t46,XX\t(28)\t\n35/F\t3\t1170\tAML with MRC\t46,XX\t(28)\t\n78/F\t10\tNA\tMyeloid sarcoma\tComplex\t(29)\t\n84/F\t17\t2204\tMDS/AML\tt(3;21),del(5)(q?)\t*\t\nRA, rheumatoid arthritis; MTX, methotrexate; NA, not available; CMML, chronic myelomonocytic leukemia; MDS, myelodysplastic syndrome; AML, acute myeloid leukemia; AML-M0, undifferentiated AML; AML-M1, AML with minimal maturation; AML-M2, AML with maturation; AML-M4, acute myelomonocytic leukemia; AML-M5, acute monocytic leukemia; AML-M6, acute erythroid leukemia; MRC, myelodysplasia-related change; M, male; F, female; *, the present case.\n==== Refs\nReferences\n1 Swerdlow SH Campo E Harris NL Jaffe ES Pileri SA Stein H Thiele J Vardiman JW WHO classification of tumours of haematopoietic and lymphoid tissues 2 4th IARC 2008 \n2 Nucifora G Laricchia-Robbio L Senyuk V EVI1 and hematopoietic disorders: History and perspectives Gene 368 1 11 2006 10.1016/j.gene.2005.09.020 16314052 \n3 Yin CC Cortes J Barkoh B Hayes K Kantarjian H Jones D t(3;21)(q26;q22) in myeloid leukemia: An aggressive syndrome of blast transformation associated with hydroxyurea or antimetabolite therapy Cancer 106 1730 1738 2006 10.1002/cncr.21797 16532439 \n4 Maki K Yamagata T Mitani K Role of the RUNX1-EVI1 fusion gene in leukemogenesis Cancer Sci 99 1878 1883 2008 19016745 \n5 Li S Yin CC Medeiros LJ Bueso-Ramos C Lu G Lin P Myelodysplastic syndrome/acute myeloid leukemia with t(3;21)(q26.2;q22) is commonly a therapy-related disease associated with poor outcome Am J Clin Pathol 138 146 152 2012 10.1309/AJCPZRRL2DGC2ODA 22706870 \n6 Glass C Wilson M Gonzalez R Zhang Y Perkins AS The role of EVI1 in myeloid malignancies Blood Cell Mol Dis 53 67 76 2014 10.1016/j.bcmd.2014.01.002 \n7 Hinai AA Valk PJ Review: Aberrant EVI1 expression in acute myeloid leukaemia Br J Haematol 172 870 888 2016 10.1111/bjh.13898 26729571 \n8 Morishita K Parker DS Mucenski ML Jenkins NA Copeland NG Ihle JN Retroviral activation of a novel gene encoding a zinc finger protein in IL-3-dependent myeloid leukemia cell lines Cell 54 831 840 1988 10.1016/S0092-8674(88)91175-0 2842066 \n9 Gröschel S Sanders MA Hoogenboezem R De Wit E Bouwman BA Erpelinck C van der Velden VH Havermans M Avellino R van Lom K A single oncogenic enhancer rearrangement causes concomitant EVI1 and GATA2 deregulation in leukemia Cell 157 369 381 2014 10.1016/j.cell.2014.02.019 24703711 \n10 Yamazaki H Suzuki M Otsuki A Shimizu R Bresnick EH Engel JD Yamamoto M A remote GATA2 hematopoietic enhancer drives leukemogenesis in inv(3)(q21;q26) by activating EVI1 expression Cancer Cell 25 415 427 2014 10.1016/j.ccr.2014.02.008 24703906 \n11 Mitani K Ogawa S Tanaka T Miyoshi H Kurokawa M Mano H Yazaki Y Ohki M Hirai H Generation of the AML1-EVI-1 fusion gene in the t(3;21)(q26;q22) causes blastic crisis in chronic myelocytic leukemia EMBO J 13 504 510 1994 8313895 \n12 Nucifora G Begy CR Kobayashi H Roulston D Claxton D Pedersen-Bjergaard J Parganas E Ihle JN Rowley JD Consistent intergenic splicing and production of multiple transcripts between AML1 at 21q22 and unrelated genes at 3q26 in (3;21)(q26;q22) translocations Proc Natl Acad Sci USA 91 4004 4008 1994 10.1073/pnas.91.9.4004 8171026 \n13 Motomura S Fujisawa S Tsunooka S Fujimaki K Harano H Mohri H Okubo T Fujita H Maruta A Kodama F Translocation (3;21)(q26;q22) in de novo acute myelogenous leukemia Leukemia 11 172 173 1997 10.1038/sj.leu.2400533 9001437 \n14 Park TS Choi JR Yoon SH Song J Kim J Kim SJ Kwon O Min YH Acute promyelocytic leukemia relapsing as secondary acute myelogenous leukemia with translocation t(3;21)(q26;q22) and RUNX1-MDS1-EVI1 fusion transcript Cancer Genet Cytogenet 187 61 73 2008 10.1016/j.cancergencyto.2008.06.015 19027486 \n15 Yang JJ Cho SY Suh JT Lee HJ Lee WI Yoon HJ Baek SK Park TS Detection of RUNX1-MECOM fusion gene and t(3;21) in a very elderly patient having acute myeloid leukemia with myelodysplasia-related changes Ann Lab Med 32 362 365 2012 10.3343/alm.2012.32.5.362 22950073 \n16 Forghieri F Bigliardi S Morselli M Potenza L Fantuzzi V Faglioni L Nasillo V Messerotti A Paolini A Luppi M An unusual case of splenomegaly and increased lactate dehydrogenase heralding acute myeloid leukemia with eosinophilia and RUNX1-MECOM fusion transcripts Leuk Res Rep 3 83 85 2014 25379409 \n17 Nogami A Oshikawa G Okada K Fukutake S Umezawa Y Nagao T Kurosu T Miura O FLT3-ITD confers resistance to the PI3K/Akt pathway inhibitors by protecting the mTOR/4EBP1/Mcl-1 pathway through STAT5 activation in acute myeloid leukemia Oncotarget 6 9189 9205 2015 10.18632/oncotarget.3279 25826077 \n18 Greenberg P Cox C LeBeau MM Fenaux P Morel P Sanz G Sanz M Vallespi T Hamblin T Oscier D International scoring system for evaluating prognosis in myelodysplastic syndromes Blood 89 2079 2088 1997 9058730 \n19 Greenberg PL Tuechler H Schanz J Sanz G Garcia-Manero G Solé F Bennett JM Bowen D Fenaux P Dreyfus F Revised international prognostic scoring system for myelodysplastic syndromes Blood 120 2454 2465 2012 10.1182/blood-2012-03-420489 22740453 \n20 Malcovati L Porta MG Pascutto C Invernizzi R Boni M Travaglino E Passamonti F Arcaini L Maffioli M Bernasconi P Prognostic factors and life expectancy in myelodysplastic syndromes classified according to WHO criteria: A basis for clinical decision making J Clin Oncol 23 7594 7603 2005 10.1200/JCO.2005.01.7038 16186598 \n21 Mitelman F Johansson B Mertens FE Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer http://cgap ncinihgov/Chromosomes/Mitelman 2 16 2016 \n22 Ichikawa A Arakawa F Kiyasu J Sato K Miyoshi H Niino D Kimura Y Takeuchi M Yoshida M Ishibashi Y Methotrexate/iatrogenic lymphoproliferative disorders in rheumatoid arthritis: Histology, Epstein-Barr virus, and clonality are important predictors of disease progression and regression Eur J Haematol 91 20 28 2013 10.1111/ejh.12116 23560463 \n23 Pointud P Prudat M Peron JM Acute leukemia after low dose methotrexate therapy in a patient with rheumatoid arthritis J Rheumatol 20 1215 1216 1993 8371222 \n24 Kerr L Dubin Troy K Isola L Temporal association between the use of methotrexate and development of leukemia in 2 patients with rheumatoid arthritis J Rheumatol 22 2356 2358 1995 8835576 \n25 Rosenthal NS Farhi DC Myelodysplastic syndromes and acute myeloid leukemia in connective tissue disease after single-agent chemotherapy Am J Clin Pathol 106 676 679 1996 10.1093/ajcp/106.5.676 8929481 \n26 Kolte B Baer AN Sait SN O'Loughlin KL Stewart CC Barcos M Wetzler M Baer MR Acute myeloid leukemia in the setting of low dose weekly methotrexate therapy for rheumatoid arthritis Leuk Lymphoma 42 371 378 2001 10.3109/10428190109064593 11699401 \n27 Choi BR Ahn MJ Lee WS Kim TH Bae SC Jun JB Acute erythroleukemia in a rheumatoid arthritis patient during low-dose methotrexate therapy Rheumatol Int 25 311 313 2005 10.1007/s00296-004-0502-9 15338190 \n28 Al-Anazi KA Eltayeb KI Bakr M Al-Mohareb FI Methotrexate-induced acute leukemia: Report of three cases and review of the literature Clin Med Case Rep 2 43 49 2009 24179373 \n29 Sakai T Tamura S Miyoshi T Nesumi N Nagai K Oshima K Development of myeloid sarcoma after long-term methotrexate use for rheumatoid arthritis Int J Hematol 99 493 498 2014 10.1007/s12185-014-1506-1 24504437 \n30 Anderson LA Pfeiffer RM Landgren O Gadalla S Berndt SI Engels EA Risks of myeloid malignancies in patients with autoimmune conditions Br J Cancer 100 822 828 2009 10.1038/sj.bjc.6604935 19259097 \n31 Tokita K Maki K Mitani K RUNX1/EVI1, which blocks myeloid differentiation, inhibits CCAAT-enhancer binding protein alpha function Cancer Sci 98 1752 1757 2007 10.1111/j.1349-7006.2007.00597.x 17894555 \n32 Maicas M Vázquez I Vicente C García-Sánchez MA Marcotegui N Urquiza L Calasanz MJ Odero MD Functional characterization of the promoter region of the human EVI1 gene in acute myeloid leukemia: RUNX1 and ELK1 directly regulate its transcription Oncogene 32 2069 2078 2013 10.1038/onc.2012.222 22689058 \n33 Helbling D Mueller BU Timchenko NA Hagemeijer A Jotterand M Meyer-Monard S Lister A Rowley JD Huegli B Fey MF Pabst T The leukemic fusion gene AML1-MDS1-EVI1 suppresses CEBPA in acute myeloid leukemia by activation of Calreticulin Proc Natl Acad Sci USA 101 13312 13317 2004 10.1073/pnas.0404731101 15326310\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "1792-1074",
"issue": "14(1)",
"journal": "Oncology letters",
"keywords": "acute myeloid leukemia; ecotropic virus integration site 1 protein homolog; methotrexate; myelodysplastic syndrome; rheumatoid arthritis; runt related transcription factor 1; t(3;21)(q26.2;q22); therapy-related myeloid neoplasms",
"medline_ta": "Oncol Lett",
"mesh_terms": null,
"nlm_unique_id": "101531236",
"other_id": null,
"pages": "97-102",
"pmc": null,
"pmid": "28693140",
"pubdate": "2017-07",
"publication_types": "D016428:Journal Article",
"references": "8929481;16314052;15326310;8371222;22950073;22706870;23560463;25826077;15338190;24495476;16186598;9001437;2842066;19259097;24179373;17894555;8171026;22689058;25379409;22740453;16532439;9058730;19027486;8835576;24703906;24504437;24703711;26729571;19016745;8313895;11699401",
"title": "Acute myeloid leukemia with t(3;21)(q26.2;q22) developing following low-dose methotrexate therapy for rheumatoid arthritis and expressing two AML1/MDS1/EVI1 fusion proteins: A case report.",
"title_normalized": "acute myeloid leukemia with t 3 21 q26 2 q22 developing following low dose methotrexate therapy for rheumatoid arthritis and expressing two aml1 mds1 evi1 fusion proteins a case report"
} | [
{
"companynumb": "US-ENDO PHARMACEUTICALS INC-2017-003760",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHOTREXATE SODIUM"
},
"drugad... |
{
"abstract": "Cryoablation for pulmonary vein isolation in atrial fibrillation has been considered a relative contraindication in the presence of a septal occluder device. We describe the successful conduct of this technique with a multimodality imaging approach.",
"affiliations": "Cardiology Fellowship, Universidad de Antioquia, Medellín, Colombia.;Clínica Cardiovid, Medellín, Colombia.;Clínica Cardiovid, Medellín, Colombia.;Clínica Cardiovid, Medellín, Colombia.;Clínica Cardiovid, Medellín, Colombia.",
"authors": "Ramírez|Santiago Giraldo|SG|;Uribe|Juan Fernando Agudelo|JFA|;Barrera|Juan David Ramírez|JDR|;Velásquez|Rafael Correa|RC|;Jaramillo|Gloria Saenz|GS|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.19102/icrm.2021.120602",
"fulltext": "\n==== Front\nJ Innov Card Rhythm Manag\nJ Innov Card Rhythm Manag\nJICRM\nThe Journal of Innovations in Cardiac Rhythm Management\n2156-3977\n2156-3993\nMediaSphere Medical United States\n\nicrm.2021.120602\n10.19102/icrm.2021.120602\nCase Report\nPresence of a Septal Occluder Is No Longer an Obstacle for Pulmonary Vein Isolation by Cryoablation\nRamírez Santiago Giraldo MD 1\nUribe Juan Fernando Agudelo MD 2\nBarrera Juan David Ramírez MD 2\nVelásquez Rafael Correa MD 2\nJaramillo Gloria Saenz MD 2\n1Cardiology Fellowship, Universidad de Antioquia, Medellín, Colombia\n2Clínica Cardiovid, Medellín, Colombia\nAddress correspondence to: Santiago Giraldo Ramírez, Cardiology Fellowship, Universidad de Antioquia, Cl. 67 ##53-108, Medellín, Antioquia, Colombia. Email: santiago.giraldor@udea.edu.co.\nDr. Uribe is a speaker for Bayer outside the scope of the submitted work. The other authors report no conflicts of interest for the published content.\n\n15 6 2021\n6 2021\n12 6 45374540\n06 10 2020\n30 11 2020\nCopyright: © 2021 Innovations in Cardiac Rhythm Management\n2021\nhttps://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.\nCryoablation for pulmonary vein isolation in atrial fibrillation has been considered a relative contraindication in the presence of a septal occluder device. We describe the successful conduct of this technique with a multimodality imaging approach.\n\nAtrial fibrillation\ncryoablation therapy\npulmonary vein isolation\nseptal occluder device\ntransseptal puncture\n==== Body\nA 69-year-old man presented to our atrial fibrillation (AF) clinic due to the presence of paroxysmal AF diagnosed five years earlier. He complained of persistent palpitations despite the use of metoprolol succinate (100 mg once daily) and propafenone (150 mg twice daily), and he did not tolerate higher doses of antiarrhythmics due to gastrointestinal complaints. Echocardiography showed a preserved ejection fraction (0.55) and a normal atrial size. He was referred for pulmonary vein (PV) isolation with a cryoballoon due to refractory paroxysmal AF. The patient’s medical history included hypothyroidism and patent foramen ovale (PFO) closure for a cryptogenic stroke with a 25-mm Amplatzer® device (Abbott, Chicago, IL, USA) 15 years earlier. Medications included levothyroxine, apixaban, and statins.\n\nFollowing the exclusion of left atrial thrombus by transesophageal echocardiography, the patient was taken to the electrophysiology laboratory. Under general anesthesia, femoral vein access was gained. Quadripolar and decapolar catheters (Inquiry®; Abbott) were advanced to monitor His and coronary sinus signals, respectively. The His catheter was used as a reference to mark the most caudal aspect of the aorta and, in this way, to aid in the selection of the transseptal puncture (TSP) site. Intracardiac echocardiography (ICE) (ViewFlex®; Abbott) was used to guide the TSP and to monitor complications during the procedure (Figure 1).\n\nAs was described previously by Sang et al.,1 to indirectly localize the outflow tract and aortic root (as a white shadow), an inferior cava vein angiography was performed. A fixed-curve sheath (Swartz® Braided LAMP 90®; Abbott) was advanced into the right atrium, and 10 mL of contrast medium was injected with cineangiography film recording in the right anterior oblique (RAO) projection. Opacification of the right atrium, right ventricular outflow tract, and pulmonary artery creates an outline around the aortic root (a white shadow was seen). Thus, this structure can be referenced without the need to inject contrast directly through the aorta.\n\nTo enhance the precision and security of the procedure, a quadripolar catheter was positioned in the His area.2 The distance between the anterior edge of the Amplatzer® and the proximal pole of the His-located quadripolar catheter was 16 mm. A site between these reference points, inferior to the aortic shadow, was selected as the ideal location for transseptal atrial puncture (Figure 2). An anterior and inferior puncture site was selected to ease cryoballoon manipulation during right PV therapy (Figure 3).\n\nA 0.032-in guidewire and a transseptal introducer sheath (Swartz® Braided LAMP 90®) were advanced. Using a 71-cm transseptal needle (BRK®; Abbott) and under fluoroscopic imaging (in the RAO projection) and direct ICE vision, transseptal catheterization was performed. Afterward, the 0.032-in guidewire was exchanged for a 260-cm-long, high-support hydrophilic-coated guidewire (GLIDEWIRE ADVANTAGE® 0.035 in; Terumo Medical Corporation, Somerset, NJ, USA); then, a FlexCath Advance 15-F® steerable sheath (Medtronic, Minneapolis, MN, USA) was placed in the left atrium (Figure 2).\n\nGuided by ICE and fluoroscopy and taking the computed tomography imaging of the left atrium as an anatomic reference, the cryoballoon and a circular mapping Achieve® catheter (Medtronic) were advanced into the left atrium and subsequently into every PV ostium. Over the Achieve® catheter, the cryoballoon was advanced and insufflated. Iodinated contrast was injected through the distal tip of the catheter to test complete sealing of the PV in order to proceed with the cryoablation therapy for 240 seconds. Continuous phrenic stimulation was performed during right PV cryoablation to detect lesions of the phrenic nerve. At the end of the study, ICE ruled out pericardial effusion. The patient was in sinus rhythm the day after the procedure and was discharged without complications.\n\nDiscussion\n\nA increasing frequency of TSP use has been observed, mainly driven by the acceptance of PV ablation as a strategy for rhythm control in AF. The high success rate of the procedure (> 99%) and the low number of complications (< 1%) make this technique an essential tool for the electrophysiologist.3 On the other hand, the presence of a septal occluder device is now a common scenario in clinical practice as its placement is the procedure of choice for the closure of most atrial septal defects and its use has gained adoption for PFO closure since its approval for the management of patients with cryptogenic stroke by the United States Food and Drug Administration in 2016.4 Thus, it is not uncommon to find a patient with a septal occluder device and a clinical indication for PV isolation. However, the presence of an atrial septal occluder has classically been considered a relative contraindication for PV isolation.\n\nRadiofrequency catheter ablation was the first technique used for PV isolation in the classic report by Haïssaguerre et al.5 Since then, the evolution of both techniques and devices has made PV isolation a routine procedure in the area of electrophysiology. Meanwhile, cryoballoon ablation has emerged as an alternative to radiofrequency energy. The equivalent rate of sinus rhythm maintenance at one year in paroxysmal AF (60%–80%)6,7 and the shorter time required to complete the procedure have made cryoablation therapy an attractive option.\n\nPV isolation with radiofrequency catheter ablation is a well-described procedure in studies of a few patients with septal occluder devices.1,8 In these investigations, TSP had a 100% success rate, and the puncture could be achieved through the native septum in 70% to 90% of cases. In 10% to 30% of patients, the TSP was performed through the device without complications. In our case, due to the presence of paroxysmal AF and the normal atrial size, we chose the cryoballoon ablation technique over radiofrequency ablation, primarily to perform a single TSP.\n\nTo the best of our knowledge, there are only two previous reports of TSP for cryoballoon ablation in the presence of a septal occluder device.9,10 In both reports, left atrium access was gained through the native septum without the need to cross the device.9,10 In the report by Ströker et al.,9 TSP was conducted inferoposteriorly to the device, which could make cryoablation therapy for the right PV more difficult to complete due to the very acute angle created to access the right-side veins. Rind et al.10 described the use of an anteroinferior puncture site through the native septum without complications.\n\nIn our case, the use of ICE was of paramount importance to guide the procedure. Due to the larger sheath required during PV isolation with a cryoablation balloon, the procedure is technically more challenging in the presence of a septal occluder device. In this scenario, it is essential to gain anterior access through the septum as this puncture facilitates advancing the catheter and access into the right PVs.11 High anatomic resolution and real-time imaging with the use of ICE allowed us to gain access to the left atrium through the native septum. In this manner, ICE has a central role evaluating the anatomical variants of the interatrial septum, refining the puncture site selection for TSP, and improving the early detection of complications (eg, cardiac tamponade).12\n\nOne of the advantages of our approach is the use of a quadripolar catheter located in the His signal. Although this is a classic tool to demarcate the superior margin of the interatrial septum (which lies in juxtaposition to the noncoronary cusp of the aortic valve in its most inferior aspect),2 this additional point was very helpful because it allowed us to see a reference point during the fluoroscopic view and, hence, avoid an accidental puncture of the aortic root.\n\nConclusion\n\nThe presence of a septal occluder device in patients with an indication for PV isolation for AF is a situation that is expected to become increasingly common. PV isolation with a cryoablation balloon is a feasible procedure in this scenario. In the present case, the use of multimodal imaging with inferior cava vein angiography, ICE, and fluoroscopy led us to complete the procedure safely.\n\nFigure 1: ICE images taken during the procedure. A: Home view showing the Amplatzer® device and the His signal catheter. B: A point in the native septum was selected for left atrium access. C: ICE was used to guide septum puncture. D: Access to the left atrium. ICE: intracardiac echocardiography BRK: Brockenbrough; RV: right ventricle.\n\nFigure 2: A: Distance between the anteroinferior border of the Amplatzer® device and the His signal catheter. B: Inferior cava vein angiography. C: TSP with successful passage into the left atrium. D: Cryoablation therapy. PV: pulmonary vein; RA: right atrium; RV: right ventricle; RVOT: right ventricular outflow tract; TSP: transseptal puncture.\n\nFigure 3: Image showing the anatomical references relevant during the procedure. The Amplatzer® device lies in the interatrial septum. An inferior and anterior point through the native septum (marked as a red point) was chosen for TSP. TSP: transseptal puncture.\n==== Refs\nReferences\n\n1. Sang C-H Dong J-Z Long D-Y Transseptal puncture and catheter ablation of atrial fibrillation in patients with atrial septal occluder: initial experience of a single centre Europace 2018 20 9 1468 1474 [CrossRef][PubMed] 29106529\n2. Manolis AS Transseptal access to the left atrium: tips and tricks to keep it safe derived from single operator experience and review of the literature Curr Cardiol Rev 2017 13 4 305 318 [CrossRef][PubMed] 28969539\n3. De Ponti R Cappato R Curnis A Trans-septal catheterization in the electrophysiology laboratory: data from a multicenter survey spanning 12 years J Am Coll Cardiol 2006 47 5 1037 1042 [CrossRef][PubMed] 16516090\n4. Madhkour R Wahl A Praz F Meier B Amplatzer patent foramen ovale occluder: safety and efficacy Expert Rev Med Devices 2019 16 3 173 182 [CrossRef][PubMed] 30741039\n5. Haïssaguerre M Jaïs P Shah DC Spontaneous initiation of atrial fibrillation by ectopic beats originating in the pulmonary veins N Engl J Med 1998 339 10 659 666 [CrossRef][PubMed] 9725923\n6. Andrade JG Champagne J Dubuc M Cryoballoon or radiofrequency ablation for atrial fibrillation assessed by continuous monitoring: a randomized clinical trial Circulation 2019 140 22 1779 1788 [CrossRef][PubMed] 31630538\n7. Kuck K-H Brugada J Fürnkranz A Cryoballoon or radiofrequency ablation for paroxysmal atrial fibrillation N Engl J Med 2016 374 23 2235 2245 [CrossRef][PubMed] 27042964\n8. Santangeli P Di Biase L Burkhardt JD Transseptal access and atrial fibrillation ablation guided by intracardiac echocardiography in patients with atrial septal closure devices Heart Rhythm 2011 8 11 1669 1675 [CrossRef][PubMed] 21703215\n9. Ströker E de Asmundis C Chierchia G-B Cryoballoon ablation in the presence of a large occlutech device Acta Cardiol 2018 73 4 411 412 [CrossRef][PubMed] 28826333\n10. Rind JA Byl JL Samuel BP Vettukattil JJ Chalfoun NT Cryoballoon ablation for paroxysmal atrial fibrillation in the presence of an Amplatzer septal occluder device Indian Pacing Electrophysiol J 2016 16 5 169 171 10.1016/j.ipej.2016.11.004\n11. Alkhouli M Rihal CS Holmes DRJ Transseptal techniques for emerging structural heart interventions JACC Cardiovasc Interv 2016 9 24 2465 2480 [CrossRef][PubMed] 28007198\n12. Saliba W Thomas J Intracardiac echocardiography during catheter ablation of atrial fibrillation Europace 2008 10 Suppl 3 iii42 iii47 [CrossRef][PubMed] 18955398\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2156-3977",
"issue": "12(6)",
"journal": "The Journal of innovations in cardiac rhythm management",
"keywords": "Atrial fibrillation; cryoablation therapy; pulmonary vein isolation; septal occluder device; transseptal puncture",
"medline_ta": "J Innov Card Rhythm Manag",
"mesh_terms": null,
"nlm_unique_id": "101589872",
"other_id": null,
"pages": "4537-4540",
"pmc": null,
"pmid": "34234987",
"pubdate": "2021-06",
"publication_types": "D002363:Case Reports",
"references": "28007198;21703215;18955398;16516090;28826333;29106529;27042964;30741039;31630538;28969539;9725923",
"title": "Presence of a Septal Occluder Is No Longer an Obstacle for Pulmonary Vein Isolation by Cryoablation.",
"title_normalized": "presence of a septal occluder is no longer an obstacle for pulmonary vein isolation by cryoablation"
} | [
{
"companynumb": "CO-SUN PHARMACEUTICAL INDUSTRIES LTD-2021RR-311205",
"fulfillexpeditecriteria": "1",
"occurcountry": "CO",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PROPAFENONE"
},
"dru... |
{
"abstract": "Acinar cell carcinoma (ACC) of the pancreas is a rare exocrine tumour for which there is very limited information about chemotherapy regimens and prognosis. Even though there are clinical guidelines for management of ductal cell carcinoma, a definitive and specific regime has not yet been agreed for this type of pancreatic cancer. We report a case of metastatic ACC of pancreas who has been treated with a multimodal approach, including novel combinations of different targeted drugs with conventional chemotherapy, surgery and radiofrequency ablation since the last 11 years. This degree of long term survival has not been reported so far in such a case of metastatic ACC of the pancreas. This case highlights the importance of a personalised multidisciplinary therapeutic strategy, employing locoregional therapies along with combinations of established and novel systemic therapies to control the disease, and the importance of flexibility when instigating new treatment paradigms for progressive cancer. Also, this case demonstrates that complete tumour eradication may not be the sole purpose of surgical oncology.",
"affiliations": "Department of Surgery, The Royal Marsden, Fulham Road, London SW6 6JJ, UK. Electronic address: fcm.cananzi@hotmail.it.",
"authors": "Cananzi|Ferdinando C M|FC|;Jayanth|Akali|A|;Lorenzi|Bruno|B|;Belgaumkar|Ajay|A|;Mochlinski|Kazimiriez|K|;Sharma|Anand|A|;Mudan|Satvinder|S|;Cunningham|David|D|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1424-3903",
"issue": "13(5)",
"journal": "Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.]",
"keywords": "Acinar cell carcinoma; Long survival; Metastatic pancreatic cancer; Surgery; Targeted therapy",
"medline_ta": "Pancreatology",
"mesh_terms": "D018267:Carcinoma, Acinar Cell; D018450:Disease Progression; D006801:Humans; D008297:Male; D008875:Middle Aged; D010190:Pancreatic Neoplasms; D016896:Treatment Outcome",
"nlm_unique_id": "100966936",
"other_id": null,
"pages": "549-52",
"pmc": null,
"pmid": "24075523",
"pubdate": "2013",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "\"Chronic\" metastatic pancreatic acinar cell carcinoma.",
"title_normalized": "chronic metastatic pancreatic acinar cell carcinoma"
} | [
{
"companynumb": "GB-AMGEN-GBRSP2017072439",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PACLITAXEL"
},
"drugadditional": null,
... |
{
"abstract": "Immune-related adverse events associated with immune checkpoint therapy cause autoimmune disease-like symptoms. People who carry specific genotypes or haplotypes of human leucocyte antigen (HLA) are known to be predisposed to develop autoimmune diseases including narcolepsy. Immunotherapy could be a trigger to develop narcolepsy in predisposing HLA positive patients.\n\n\n\nA 66-year-old woman with stage IVB endometrial carcinosarcoma experienced daytime sleepiness and temporary muscle weakness 14 days after the administration of an immune checkpoint inhibitor, pembrolizumab. These were consistent with the main symptoms of narcolepsy with cataplexy. This patient carried a highly predisposing HLA haplotype for narcolepsy; HLA-DQB1*06:02, DRB1*15:01, DQA1*01:02 and DRB5*01:01:01. A hypocretin-1/orexin-A concentration in the patient's cerebrospinal fluid was low at 9.6 pg/mL in ELISA, and 155.5 pg/mL in radioimmunoassay that was below the normal level of 200 pg/mL. Therefore, she was diagnosed with narcolepsy tentatively according to the International Classification of Sleep Disorders, third edition diagnostic criteria for narcolepsy. The onset of narcolepsy in the 60s is very rare, and narcoleptic symptoms in our patient were likely to be caused by pembrolizumab.\n\n\n\nThis case suggests that treatment with immune checkpoint inhibitors potentially causes narcolepsy in genetically predisposed patients.",
"affiliations": "Department of Medical Oncology, Fukushima Medical University, Fukushima, Japan.;Department of Medical Oncology, Fukushima Medical University, Fukushima, Japan.;Department of Obstetrics and Gynecology, Fukushima Medical University, Fukushima, Japan.;Department of Obstetrics and Gynecology, Fukushima Medical University, Fukushima, Japan.;Department of Medical Oncology, Fukushima Medical University, Fukushima, Japan.;Department of Medical Oncology, Fukushima Medical University, Fukushima, Japan.;International Institute for Integrative Sleep Medicine (WPI-IIIS), University of Tsukuba, Tsukuba, Japan.;Department of Medical Oncology, Fukushima Medical University, Fukushima, Japan ss-saji@wa2.so-net.ne.jp.",
"authors": "Natori|Yutaka|Y|0000-0002-9535-5298;Sasaki|Eisaku|E|;Soeda|Shu|S|;Furukawa|Shigenori|S|;Azami|Yusuke|Y|;Tokuda|Emi|E|;Kanbayashi|Takashi|T|;Saji|Shigehira|S|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D000074322:Antineoplastic Agents, Immunological; C582435:pembrolizumab",
"country": "England",
"delete": false,
"doi": "10.1136/jitc-2020-001164",
"fulltext": "\n==== Front\nJ Immunother Cancer\nJ Immunother Cancer\njitc\njitc\nJournal for Immunotherapy of Cancer\n2051-1426 BMJ Publishing Group BMA House, Tavistock Square, London, WC1H 9JR \n\n33004543\njitc-2020-001164\n10.1136/jitc-2020-001164\nCase Report\n1506\n2518\n1619\nRisk of immunotherapy-related narcolepsy in genetically predisposed patients: a case report of narcolepsy after administration of pembrolizumab\nhttp://orcid.org/0000-0002-9535-5298Natori Yutaka 1 Sasaki Eisaku 1 Soeda Shu 2 Furukawa Shigenori 2 Azami Yusuke 1 Tokuda Emi 1 Kanbayashi Takashi 3 Saji Shigehira 1 \n1 \nDepartment of Medical Oncology, Fukushima Medical University, Fukushima, Japan\n\n\n2 \nDepartment of Obstetrics and Gynecology, Fukushima Medical University, Fukushima, Japan\n\n\n3 \nInternational Institute for Integrative Sleep Medicine (WPI-IIIS), University of Tsukuba, Tsukuba, Japan\n\nCorrespondence to Dr Shigehira Saji; ss-saji@wa2.so-net.ne.jp\n2020 \n1 10 2020 \n8 2 e00116423 8 2020 © Author(s) (or their employer(s)) 2020. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.2020http://creativecommons.org/licenses/by-nc/4.0/This is an open access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited, appropriate credit is given, any changes made indicated, and the use is non-commercial. See http://creativecommons.org/licenses/by-nc/4.0/.Background\nImmune-related adverse events associated with immune checkpoint therapy cause autoimmune disease-like symptoms. People who carry specific genotypes or haplotypes of human leucocyte antigen (HLA) are known to be predisposed to develop autoimmune diseases including narcolepsy. Immunotherapy could be a trigger to develop narcolepsy in predisposing HLA positive patients.\n\nCase presentation\nA 66-year-old woman with stage IVB endometrial carcinosarcoma experienced daytime sleepiness and temporary muscle weakness 14 days after the administration of an immune checkpoint inhibitor, pembrolizumab. These were consistent with the main symptoms of narcolepsy with cataplexy. This patient carried a highly predisposing HLA haplotype for narcolepsy; HLA-DQB1*06:02, DRB1*15:01, DQA1*01:02 and DRB5*01:01:01. A hypocretin-1/orexin-A concentration in the patient’s cerebrospinal fluid was low at 9.6 pg/mL in ELISA, and 155.5 pg/mL in radioimmunoassay that was below the normal level of 200 pg/mL. Therefore, she was diagnosed with narcolepsy tentatively according to the International Classification of Sleep Disorders, third edition diagnostic criteria for narcolepsy. The onset of narcolepsy in the 60s is very rare, and narcoleptic symptoms in our patient were likely to be caused by pembrolizumab.\n\nConclusions\nThis case suggests that treatment with immune checkpoint inhibitors potentially causes narcolepsy in genetically predisposed patients.\n\nautoimmunitycase reportsimmunotherapyprogrammed cell death 1 receptorhttp://dx.doi.org/10.13039/100009619Japan Agency for Medical Research and DevelopmentJP20dm0107162http://dx.doi.org/10.13039/501100003478Ministry of Health, Labour and Welfare201908033Ahttp://dx.doi.org/10.13039/501100001691Japan Society for the Promotion of ScienceJP19K08037JP19K09079special-featureunlocked\n==== Body\nIntroduction\nImmunotherapy using immune checkpoint inhibitors has recently been a promising new treatment showing remarkable benefit in a range of advanced cancers. The immune checkpoint inhibitors treat cancers by activating the human immune system that controls immune response toward cancer cells. Pembrolizumab, one of the immune checkpoint inhibitors blocks PD-1, an immune check point protein and demonstrated antitumor activity; objective response rate of 34.3% (95% CI 28.3% to 40.8%) in patients with cancer with microsatellite instability (MSI)-high.1 However, the activated human immune system also attacks healthy cells, causing ≥grade 3 adverse events in about half of treated patients with immune checkpoint inhibitors or any grade adverse events in about 100%.2 These adverse events are called immune-related adverse events (irAEs) and their symptoms are similar to those of autoimmune diseases (eg, ulcerative colitis, thyroiditis, interstitial pneumonia and type 1 diabetes mellitus).3 Some irAEs including colitis and pruritus were recently reported to be associated with specific genotypes of human leucocyte antigen (HLA).4 HLAs are polymorphic cell-surface proteins, and combination of HLAs is unique to each individual, serving as a landmark of self cells. Many autoimmune diseases are known to be associated with specific HLA genotypes or haplotypes; HLA-DRB1*04:05 for rheumatoid arthritis,5 DQA1*05:01 and DQB1*03:02 for type 1 diabetes,6 and HLA-DRB1*01:03 for ulcerative colitis. People carrying HLA B27 develop ankylosing spondylitis with a greater OR 171 compared with healthy controls.7 The genotype of HLA-DQB1*06:02 confers increased risk of developing narcolepsy with extraordinary OR 251.8\n\n\nNarcolepsy is a sleep disorder characterized by excessive daytime sleepiness, cataplexy, sleep paralysis and hypnagogic hallucination. The onset occurs mostly between the age of 10 and 50 years, especially teenage years.9 10 Narcolepsy had long been suspected as an autoimmune disease because of the association with the specific HLA genotypes and haplotypes. Epidemiological observation recently suggested Pandemrix H1N1 influenza vaccination is one of the triggers for narcolepsy.11 After Pandemrix H1N1 influenza vaccination, 96.8% of patients who developed narcolepsy were found to carry a haplotype in the HLA-DRB5*01:01:01, DRB1*15:01, DQA1*01:02, DQB1*06:02 compared with 28.0% of general population controls (p=6.17×10–16).12 For development of narcolepsy, in addition to genetic predisposition, environmental factors such as vaccination is likely required. In most patients, narcolepsy results from a loss of hypocretin neurons in the lateral hypothalamus. Hypocretin-1/orexin-A neuron specific CD4+ and CD8+T cells were found in the blood and cerebrospinal fluid (CSF) of patients with narcolepsy.13 14 These studies support the autoimmune hypothesis of narcolepsy, which develops on the background of genetic predisposition.\n\nAlthough there are many cases of irAEs resembling autoimmune diseases with defined specific HLA genotypes, there have been no case reports of irAE presenting symptoms of narcolepsy. Here, we report the first case of narcolepsy after the administration of pembrolizumab. The patient carried a highly predisposing HLA haplotype and had not developed narcolepsy before the immunotherapy. Therefore, the immunotherapy with pembrolizumab was highly suspected to have triggered the development of narcoleptic symptoms.\n\nMethods\nNarcolepsy diagnosis\nType 1 narcolepsy meaning narcolepsy with cataplexy was diagnosed with the following criteria in the International Classification of Sleep Disorders, third edition (ICSD-3).15 Both criteria (A) and (B) must be met for the diagnosis: (A) The patient has daily periods of irrepressible need to sleep or daytime lapses into sleep occurring for ≥3 months. (B) The presence of either one of the following: (1) The presence of cataplexy and a mean sleep latency of ≤8 min and two sleep-onset rapid eye movement periods on a multiple sleep latency test (MSLT). (2) CSF hypocretin-1/orexin-A concentration is either ≤110 pg/mL or <1/3 of mean values obtained in normal subjects with the same standardized assay. In addition to the ICSD-3 criteria, presence of accurate cataplexy was judged with the latest criteria of cataplexy by European experts.16\n\n\nHLA genotying\nHLA genotyping was performed at HLA Foundation Laboratory, Kyoto, Japan. DNA was purified from the patient’s blood with QIAamp DNA Blood Midi kit (QIAGEN). The DNA sample was sequenced by next-generation sequencing, Illumina MiSeq technology. The DNA sequence was genotyped by integrated genotyping system (Scisco Genetics). We performed the high-resolution HLA typing for HLA-A, -B, -C, -DRB1, -DRB3/4/5, -DQA1, -DQB1, -DPA1 and -DPB1.\n\nHypocretin-1/orexin-A assay\nCSF of the patient was collected by a lumbar puncture, 10 days after somnolence and 4 days after cataplexy. A concentration of hypocretin-1/orexin-A in the CSF was measured with orexin-A radioimmunoassay (RIA) kit (Phoenix Pharmaceuticals) as previously reported by International Institute for Integrative Sleep Medicine (WPI-IIIS) in the University of Tsukuba.17 We also measured a concentration of hypocretin-1/orexin-A in the CSF with orexin-A ELISA kit (WAKO).\n\nCase report\nA 66-year-old woman presented with abdominal pain and was found to have an intrapelvic tumor with lung and peritoneal metastasis. Biopsy was performed and she was diagnosed with stage IVB endometrial carcinosarcoma, and the international federation of gynecology and obstetrics IVB. The patient had a clinical complete response after adjuvant chemotherapy, followed by abdominal total hysterectomy, bilateral salpingo-oophorectomy and pelvic lymphadenectomy. However, the intrapelvic tumor relapsed and dysuria occurred. The patient received a total pelvic exenteration with ileal conduit as a salvage operation and was treated with standard chemotherapies for endometrial carcinosarcoma and carcinoma. Two episodes of febrile neutropenia occurred during the chemotherapies, which were treated with antibiotic therapy. The carcinosarcoma was classified as MSI high, and was eligible for treatment with an immune checkpoint inhibitor, pembrolizumab. Pembrolizumab at a dose of 200 mg/day was intravenously injected. The patient had the Eastern Cooperative Oncology Group Performance Status (PS) of 1 and did not have neurological symptoms, impaired consciousness or sleep-wake disorders. At 14 days postinjection, the patient developed a fever of 39°C (figure 1). CT showed an increase in the size of the pelvic tumor, but the cause of fever was not apparently identified. However, as bacteriuria was found, the cause of fever was suspected to be urinary tract infection, and the patient was treated with piperacillin/tazobactam in our hospital. At the same time, excessive daytime sleepiness and sleep attack occurred and persisted. The sleepiness was too intense to answer questions, causing disorientation or sleep even during conversation. The intensity of the sleepiness was temporarily weakened after naps or nocturnal sleep. No signs of paralysis or meningitis were observed. All electrolyte levels in the serum were normal. No medications that induce sleep were administered. Administration of vitamin B1 could not improve the somnolence. Delirium due to neoplastic fever was suspected, and dexamethasone 6.6 mg/day was administered at 23 days postinjection. The steroid reduced the fever, however, did not improve the somnolence. During pleasant conversations with her family at the hospital, temporary muscle weakness affecting the whole body including the face occurred, and lasted for a few seconds. The patient showed her muscle weakness despite being fully conscious. Brain CT and MRI demonstrated no brain metastasis, degenerative disease or infarction. The MRI image did not show hypothalamic inflammation (figure 1). Gadolinium-enhanced MRI was not performed. Surgical intervention that disrupts the blood-brain barrier had not been performed. A CSF examination showed clear fluid, normal pressure, negative oligoclonal bands, no cancer cells and no evidence of infection. The CSF revealed slightly elevated white blood cell count (10/mm3, lymphocytes 93.3%). Serum paraneoplastic antibodies were negative (AMPH, CV2, PNMA2/Ma2, Ri, Yo, Hu, recoverin, SOX1, titin, zic4, GAD65, Tr/DNER). Serum immunoglobulin G (IgG) was elevated from 1490 mg/dL at preinjection of pembrolizumab to 2091 mg/dL at postinjection, suggesting activated immune system. Autoimmune encephalitis as an irAE associated with pembrolizumab was suspected. Prednisolone 1 mg/kg was initiated and dexamethasone was discontinued at 35 days postinjection. However, the steroid treatment did not improve somnolence, disorientation or temporary muscle weakness. Pembrolizumab therapy was permanently discontinued due to the irAE, and the patient died by progression of carcinosarcoma at 72 days postinjection of pembrolizumab. Her family did not permit an autopsy.\n\nFigure 1 Clinical course, MRI and cerebrospinal fluid analysis in the patient. FLAIR, fluid-attenuated inversion recovery. RIA, radioimmunoassay.\n\nResults\nThe patient in the present case was initially diagnosed with an irAE encephalitis. In the clinical time course, onset of narcolepsy was suspected. Although she had no previous history of sleep-wake disorders, she repeated sleep attacks 2 weeks after administration of pembrolizumab. There were no structural disorders and no sleeping pills or opioids administered at the onset of somnolence. The latest cataplexy criteria were applied to diagnose cataplexy.16 Among the criteria, the patient met a criterion of cataplexy with pleasant surprise when meeting a familiar acquaintance. The patient’s consciousness was preserved when the loss of muscle tone of her whole body arose for a few seconds. Bilateral loss of muscle tone for a few seconds with preserved consciousness also met the cataplexy criteria. These sleep attack and cataplexy were consistent with the main symptoms of narcolepsy with cataplexy. Apparent hypnagogic hallucination and sleep paralysis were not found. The patient could not undergo polysomnography and MSLT for diagnosis of obstructive sleep apnea syndrome (OSAS) or narcolepsy due to physical weariness. Our patient did not notice snoring or apnea during sleep, we considered our case unlikely to have moderate or severe OSAS. A concentration of hypocretin-1/orexin-A in the CSF of the patient measured with RIA was 155.5 pg/mL, and that measured with ELISA was 9.6 pg/mL. This difference in the concentrations is considered to be within the range of error due to the measuring method.18 The 155.5 pg/mL measured with RIA does not meet the narcolepsy ICSD-3 criteria (≤110 pg/mL), but is below the normal level of 200 pg/mL. One of the ICSD-3 criteria describing daytime lapses into sleep lasting for 3 months could not be applied to the present case due to short survival time, indicating inappropriateness of the criterion for patients with poor prognosis. If she had lived longer, she would have met the criterion as she had daily daytime sleep attacks. High-resolution HLA genotyping demonstrated that the patient carried HLA-DQB1*06:02, DRB1*15:01, DQA1*01:02 and DRB5*01:01:01 (table 1). In a previous report, people carrying HLA-DQB1*06:02, DRB1*15:01, DQAl*01:02 and DRB5*01:01:01 developed narcolepsy with OR 6.75 after Pandemrix influenza vaccination.12 Almost all narcoleptic patients are known to carry HLA-DQB1*06:02, DRB1*15:01, and DQAl*01:02, regardless of race.8 19 In particular, 100% of Japanese narcoleptic patients are reported to carry DQB1*06:02 and DRB1*15:01.19 These results supported that the patient’s condition was similar etiology of narcolepsy with cataplexy.\n\nTable 1 HLA haplotype in the patient\n\nHLA-A\tHLA-B\tHLA-C\t\t\t\t\t\t\t\n01:01\t02:01\t37:01\t39:01\t06:02\t07:02\t\t\t\t\t\t\t\nHLA-DRB1\tHLA-DRB5\tHLA-DQA1\tHLA-DQB1\tHLA-DPA1\tHLA-DPB1\t\n10:01\t15:01\t01:01:01\t\n–\n\t01:02\t01:05\t05:01\t06:02\t01:03\t\n–\n\t02:01\t\n–\n\t\nHLA, human leucocyte antigen.\n\nDiscussion\nNarcolepsy had long been suspected of having an autoimmune origin, because narcolepsy patients carry the haplotype HLA-DQB1*06:02, DRB1*15 and DQA1*01:02 with significantly higher rates (54.3%–100%) compared with healthy controls (12.2%–23.3%) in any race.19 Pandemrix H1N1 influenza vaccination is epidemiologically confirmed to increase the incidence of narcolepsy.11 Hypocretin-1/orexin-A producing neuron specific CD4+ and CD8+T cells were found in the CSF of narcolepsy patients.13 14 These T cells are considered to attack the neurons and to be responsible for low concentration of hypocretin-1/orexin-A. An accumulation of studies revealed that narcolepsy is an autoimmune disease and a genetically predisposed disease. However, 25%–31% of genetically identical monozygotic twins are concordant for narcolepsy.20 This finding supports the hypothesis that in addition to the genetic predisposition, a non-genetic trigger is required for the onset of narcolepsy.\n\nWe experienced a case of narcolepsy after the initiation of a PD-1 inhibitor, pembrolizumab. The patient had a highly predisposing HLA haplotype for narcolepsy. Although the narcolepsy simultaneously developed with fever, the fever itself is not thought to be the trigger of this disorder. Two episodes of febrile neutropenia before the administration of pembrolizumab did not cause narcolepsy. There were no episodes that seemed to trigger narcolepsy other than the administration of pembrolizumab. Considering that the incidence of narcolepsy in the 60s is almost zero per cent,9 the immune checkpoint inhibitor, pembrolizumab is highly suspected to have induced narcolepsy in the 66-year-old patient in the current case. Since pembrolizumab causes irAEs similar to autoimmune diseases, pembrolizumab probably could cause an irAE similar to narcolepsy. Approximately 5.6% of the Japanese population carry predisposing HLA haplotypes for narcolepsy: HLA-DQB1*06:02, DRB1*15:01 and DQA1*01:02,21 while the prevalence of narcolepsy is about 0.16%–0.18%.20 This low prevalence of narcolepsy compared with the prevalence rate of predisposed HLA haplotype indicates the necessity of triggers to develop narcolepsy. Our case implies that inhibition of immune checkpoint could be a potential pathogenesis of narcolepsy. However, there have been no reports of narcolepsy as an irAE, despite the fact that many cancer patients have been treated with immune checkpoint inhibitors.22 There are some cases of encephalitis as an irAE, some of which presented with somnolence or sleepiness.23 Of these irAE encephalitis cases with somnolence, there may have been cases of undiagnosed narcolepsy. Anti-PNMA2/Ma2-associated encephalitis after initiation of immune checkpoint inhibitors has been reported with increased frequency.24 In those cases, serum anti-PNMA2/Ma2 antibody levels increased. However, there was no increase in anti-PNMA2/Ma2 antibody levels in serum of our patient, therefore we thought that anti-PNMA2/Ma2-associated encephalitis was unlikely. Although typical irAE encephalitis responds well to steroid treatment, followed by symptom improvement, our case did not.\n\nOur patient could not live a life that she had before the onset of narcolepsy due to severe somnolence. We should focus on the development of immunotherapy-related narcolepsy as that remarkably interferes with patients’ daily life. Some HLA genotypes or haplotypes associated with the development of irAEs have been reported.4 HLA haplotypes could be predictive markers for irAE narcolepsy.\n\nFinally, we note that our report did not prove a statistical association between immune checkpoint inhibitors and narcolepsy. Etiological or biological studies are needed. In addition, there still remains the question of different concentrations of hypocretin-1/orexin-A in different measuring methods. ELISA (WAKO) recognizes two epitopes of hypocretin-1/orexin-A, and likely detect intact hypocretin-1/orexin-A.18 However, RIA (Phoenix Pharmaceuticals) recognizes only a single epitope, and is known to detect the degradation product of hypocretin-1/orexin-A.25 Detection of metabolites of hypocretin-1/orexin-A may mask the possible decline in real hypocretin-1/orexin-A level. The value of 155.5 pg/mL measured with RIA was lower than 200 pg/mL of normal hypocretin-1/orexin-A cut-off level, which suggested that low concentrations of hypocretin-1/orexin-A may have affected the pathology of the patients. Usually, the diagnosis of narcolepsy often needs at least several months after the onset of symptoms. In this case, the timing of lumbar puncture was very close to the onset of somnolence (10 days) and cataplexy (4 days). Therefore, some possibility exists that hypocretin-1/orexin-A neurons were damaged, but hypocretin-1/orexin-A remained from the onset until the lumbar puncture. Current diagnostics for narcolepsy requiring long disease duration may be unsuitable to diagnose narcolepsy of irAE.\n\nWe reported the first case of narcolepsy as an irAE after the administration of an immune checkpoint inhibitor, pembrolizumab. Immune checkpoint inhibitors potentially cause irAE narcolepsy. Our patient carried a predisposing HLA haplotype for narcolepsy, indicating that we should carefully monitor patients genetically predisposed to narcolepsy when treating them with immunotherapy. The present case will hopefully alert the occurrence of irAE narcolepsy and help elucidating the mechanism of narcolepsy onset.\n\nAuthors appreciate International Institute for Integrative Sleep Medicine (WPI-IIIS), University of Tsukuba, Tsukuba, Japan, for the measurement of hypocretin-1/orexin-A with RIA.\n\nContributors: YN treated the case, performed experiments, and YN and SS wrote the manuscript. ES, SS and SF treated the case. All authors discussed the results, and read and approved the final manuscript.\n\nFunding: This work was supported by grant of Japan Society for the Promotion of Science KAKENHI, number JP19K09079, and supported by grant of Ministry of Health, Labor and Welfare, number 201 908 033A. This work was partially supported by AMED under grant number JP20dm0107162 and JSPS KAKENHI Grant-in-Aid for Scientific Research (C): 19K08037 for TK.\n\nCompeting interests: SS reports grants and personal fees (lecture fee) from Chugai, grants and personal fees from Kyowa Kirin, grants and personal fees from Eli lilly, grants and personal fees from Astra Zeneca, personal fees from Pfizer, personal fees from MSD, grants and personal fees from Novartis, grants and personal fees from Eisai, grants and personal fees from Takeda and grants from Taiho, outside the submitted work. ET reports grants from Eli lilly, personal fees from Chugai, personal fees from Pfizer, personal fees from Novartis, outside the submitted work.\n\nPatient consent for publication: Not required.\n\nEthics approval: This study was approved by the ethics committee of Fukushima Medical University.\n\nProvenance and peer review: Not commissioned; externally peer reviewed.\n==== Refs\nReferences\n1 \nMarabelle A , Le DT , Ascierto PA , et al \nEfficacy of pembrolizumab in patients with noncolorectal high microsatellite Instability/Mismatch repair-deficient cancer: results from the phase II KEYNOTE-158 study\n. J Clin Oncol \n2020 ;38 :1 –10\n. 10.1200/JCO.19.02105 \n31682550 \n2 \nLarkin J , Chiarion-Sileni V , Gonzalez R , et al \nCombined nivolumab and ipilimumab or monotherapy in untreated melanoma\n. N Engl J Med \n2015 ;373 :23 –34\n. 10.1056/NEJMoa1504030 \n26027431 \n3 \nPostow MA , Sidlow R , Hellmann MD \nImmune-related adverse events associated with immune checkpoint blockade\n. N Engl J Med \n2018 ;378 :158 –68\n. 10.1056/NEJMra1703481 \n29320654 \n4 \nHasan Ali O , Berner F , Bomze D , et al \nHuman leukocyte antigen variation is associated with adverse events of checkpoint inhibitors\n. Eur J Cancer \n2019 ;107 :8 –14\n. 10.1016/j.ejca.2018.11.009 \n30529903 \n5 \nTerao C , Yano K , Ikari K , et al \nBrief report: main contribution of DRB1*04:05 among the shared epitope alleles and involvement of Drb1 amino acid position 57 in association with joint destruction in anti-citrullinated protein antibody-positive rheumatoid arthritis\n. Arthritis Rheumatol \n2015 ;67 :1744 –50\n. 10.1002/art.39105 \n25777156 \n6 \nErlich H , Valdes AM , Noble J , et al \nHLA DR-DQ haplotypes and genotypes and type 1 diabetes risk\n. Diabetes \n2008 ;57 :1084 –92\n.18252895 \n7 \nBrown MA , Pile KD , Kennedy LG , et al \nHLA class I associations of ankylosing spondylitis in the white population in the United Kingdom\n. Ann Rheum Dis \n1996 ;55 :268 –70\n. 10.1136/ard.55.4.268 \n8733445 \n8 \nTafti M , Hor H , Dauvilliers Y , et al \nDQB1 locus alone explains most of the risk and protection in narcolepsy with cataplexy in Europe\n. Sleep \n2014 ;37 :19 –25\n. 10.5665/sleep.3300 \n24381371 \n9 \nDauvilliers Y , Arnulf I , Mignot E \nNarcolepsy with cataplexy\n. Lancet \n2007 ;369 :499 –511\n. 10.1016/S0140-6736(07)60237-2 \n17292770 \n10 \nBassetti CLA , Adamantidis A , Burdakov D , et al \nNarcolepsy - clinical spectrum, aetiopathophysiology, diagnosis and treatment\n. Nat Rev Neurol \n2019 ;15 :519 –39\n. 10.1038/s41582-019-0226-9 \n31324898 \n11 \nNohynek H , Jokinen J , Partinen M , et al \nAS03 adjuvanted AH1N1 vaccine associated with an abrupt increase in the incidence of childhood narcolepsy in Finland\n. PLoS One \n2012 ;7 :e33536. 10.1371/journal.pone.0033536 \n22470453 \n12 \nLind A , Akel O , Wallenius M , et al \nHLA high-resolution typing by next-generation sequencing in Pandemrix-induced narcolepsy\n. PLoS One \n2019 ;14 :e0222882. 10.1371/journal.pone.0222882 \n31577807 \n13 \nLatorre D , Kallweit U , Armentani E , et al \nT cells in patients with narcolepsy target self-antigens of hypocretin neurons\n. Nature \n2018 ;562 :63 –8\n. 10.1038/s41586-018-0540-1 \n30232458 \n14 \nLuo G , Ambati A , Lin L , et al \nAutoimmunity to hypocretin and molecular mimicry to flu in type 1 narcolepsy\n. Proc Natl Acad Sci U S A \n2018 ;115 :E12323 –32\n. 10.1073/pnas.1818150116 \n30541895 \n15 \nAmerican Academy of Sleep Medicine \nInternational classification of sleep disorders , 2014 .\n16 \nLammers GJ , Bassetti CLA , Dolenc-Groselj L , et al \nDiagnosis of central disorders of hypersomnolence: a reappraisal by European experts\n. Sleep Med Rev \n2020 ;52 :101306. 10.1016/j.smrv.2020.101306 \n32311642 \n17 \nNishino S , Ripley B , Overeem S , et al \nLow cerebrospinal fluid hypocretin (orexin) and altered energy homeostasis in human narcolepsy\n. Ann Neurol \n2001 ;50 :381 –8\n. 10.1002/ana.1130 \n11558795 \n18 \nOno T , Kanbayashi T , Yoshizawa K , et al \nMeasurement of cerebrospinal fluid orexin-A (hypocretin-1) by enzyme-linked immunosorbent assay: a comparison with radioimmunoassay\n. Psychiatry Clin Neurosci \n2018 ;72 :849 –50\n. 10.1111/pcn.12780 \n\n19 \nMignot E , Lin L , Rogers W , et al \nComplex HLA-DR and -DQ interactions confer risk of narcolepsy-cataplexy in three ethnic groups\n. Am J Hum Genet \n2001 ;68 :686 –99\n. 10.1086/318799 \n11179016 \n20 \nMignot E \nGenetic and familial aspects of narcolepsy\n. Neurology \n1998 ;50 :S16 –22\n. 10.1212/WNL.50.2_Suppl_1.S16 \n9484418 \n21 \nHashimoto M , Kinoshita T , Yamasaki M , et al \nGene frequencies and haplotypic associations within the HLA region in 916 unrelated Japanese individuals\n. Tissue Antigens \n1994 ;44 :166 –73\n. 10.1111/j.1399-0039.1994.tb02375.x \n7839349 \n22 \nYshii LM , Hohlfeld R , Liblau RS \nInflammatory CNS disease caused by immune checkpoint inhibitors: status and perspectives\n. Nat Rev Neurol \n2017 ;13 :755 –63\n. 10.1038/nrneurol.2017.144 \n29104289 \n23 \nFeng S , Coward J , McCaffrey E , et al \nPembrolizumab-Induced encephalopathy: a review of neurological toxicities with immune checkpoint inhibitors\n. J Thorac Oncol \n2017 ;12 :1626 –35\n. 10.1016/j.jtho.2017.08.007 \n28843363 \n24 \nVogrig A , Fouret M , Joubert B , et al \nIncreased frequency of anti-Ma2 encephalitis associated with immune checkpoint inhibitors\n. Neurol Neuroimmunol Neuroinflamm \n2019 ;6 :e604. 10.1212/NXI.0000000000000604 \n31454760 \n25 \nSakai N , Matsumura M , Lin L , et al \nHPLC analysis of CSF hypocretin-1 in type 1 and 2 narcolepsy\n. Sci Rep \n2019 ;9 :6 –11\n. 10.1038/s41598-018-36942-8 \n30626918\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2051-1426",
"issue": "8(2)",
"journal": "Journal for immunotherapy of cancer",
"keywords": "autoimmunity; case reports; immunotherapy; programmed cell death 1 receptor",
"medline_ta": "J Immunother Cancer",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D061067:Antibodies, Monoclonal, Humanized; D000074322:Antineoplastic Agents, Immunological; D002648:Child; D005260:Female; D020022:Genetic Predisposition to Disease; D006801:Humans; D008875:Middle Aged; D009290:Narcolepsy; D055815:Young Adult",
"nlm_unique_id": "101620585",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33004543",
"pubdate": "2020-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "30679597;22470453;17292770;7839349;9484418;8733445;29320654;18252895;29104289;30232458;31682550;31324898;31454760;28843363;30541895;26027431;30159979;11558795;25777156;30529903;32311642;24381371;31577807;11179016",
"title": "Risk of immunotherapy-related narcolepsy in genetically predisposed patients: a case report of narcolepsy after administration of pembrolizumab.",
"title_normalized": "risk of immunotherapy related narcolepsy in genetically predisposed patients a case report of narcolepsy after administration of pembrolizumab"
} | [
{
"companynumb": "JP-MYLANLABS-2021M1076274",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": "3",
... |
{
"abstract": "We describe a case of a 10 year-old boy who had fever, weakness, anorexia, weight loss and general malaise. No other remarkable symptoms were present. He had been treated with Aspirin and Ibuprofen. Deterioration of renal function, glucosuria, proteinuria, anemia and increased erythrocyte sedimentation rate were detected. After 7 days observation with no treatment, renal function worsened, glucosuria increased and fever persisted. A renal biopsy was performed and acute tubulointerstitial nephritis was diagnosed. The most common aetiologies of this entity were excluded. An ophthalmologic study revealed bilateral anterior uveitis, therefore the patient was diagnosed as having tubulointerstitial nephritis with uveitis. The child improved on corticosteroid therapy, but uveitis relapsed when treatment was stopped.",
"affiliations": "Department of Nephrology, Hospital Ramón y Cajal, Universidad de Alcalá de Henares, Madrid, Spain. ngallego@hrc.insalud.es",
"authors": "Gallego|N|N|;Estepa|R|R|;Mampaso|F|F|;García-S|F|F|;Reche|A|A|;Ortuño|J|J|",
"chemical_list": "D011241:Prednisone",
"country": "Italy",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1121-8428",
"issue": "13(5)",
"journal": "Journal of nephrology",
"keywords": null,
"medline_ta": "J Nephrol",
"mesh_terms": "D001707:Biopsy, Needle; D001774:Blood Chemical Analysis; D002648:Child; D005500:Follow-Up Studies; D006801:Humans; D007677:Kidney Function Tests; D008297:Male; D009395:Nephritis, Interstitial; D011241:Prednisone; D012720:Severity of Illness Index; D016896:Treatment Outcome; D016482:Urinalysis; D014605:Uveitis",
"nlm_unique_id": "9012268",
"other_id": null,
"pages": "373-6",
"pmc": null,
"pmid": "11063142",
"pubdate": "2000",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Tubulointerstitial nephritis and asymptomatic uveitis.",
"title_normalized": "tubulointerstitial nephritis and asymptomatic uveitis"
} | [
{
"companynumb": "ES-PFIZER INC-2017288322",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "IBUPROFEN"
},
"drugadditional": "3",
... |
{
"abstract": "Since nasal NK/T-cell lymphoma and NK/T-cell lymphoma nasal type are rare diseases, colonic involvement has seldom been seen. We report a case of a patient with a primary NK/T-cell lymphoma nasal type of the colon. The patient had no history of malignant diseases and was diagnosed after exhaustive study in the context of fever of unknown origin. The first therapeutic approach followed the DA-EPOCH-protocol: etoposide, prednisone, doxor-rubicin, vincristine and cyclophosphamide. The persistence of constitutional symptoms after the first treatment course motivated the switch to a second line following the SMILE-protocol: dexamethasone, metotrexate, ifosfamide, E.coli L-asparaginase, and etoposide. Despite intensive chemotherapy, the patient died 2 months after the diagnose of an extranodal NK/T-cell lymphoma of the colon and 4 months after the first symptomatic appearance of disease.",
"affiliations": "Hematology Service, Department of Internal Medicine;",
"authors": "Mahuad|Carolina Valeria|CV|;Bilbao|Erica Rojas|ER|;Garate|Gonzalo Martín|GM|;de Los Ángeles Vicente Repáraz|María|M|;Del Olmo|Mercedes|M|;Casali|Claudia Érica|CÉ|;Zerga|Marta Elisa|ME|;Chirife|Ana María|AM|;Cicco|Juan Alberto|JA|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.4081/rt.2013.e9",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2036-3605",
"issue": "5(1)",
"journal": "Rare tumors",
"keywords": "L-asparaginase; extranodal NK-T-cell; intestinal lymphoma.; lymphoma",
"medline_ta": "Rare Tumors",
"mesh_terms": null,
"nlm_unique_id": "101526926",
"other_id": null,
"pages": "e9",
"pmc": null,
"pmid": "23772308",
"pubdate": "2013-02-11",
"publication_types": "D002363:Case Reports",
"references": "22208442;21123825;8635042;16323259;21139937;20671118;18294294;21294123;18684695;19029440;18028433;18701429;21990393;15139996;12953813",
"title": "Primary NK/T cell lymphoma nasal type of the colon.",
"title_normalized": "primary nk t cell lymphoma nasal type of the colon"
} | [
{
"companynumb": "PHHY2014AR166449",
"fulfillexpeditecriteria": "1",
"occurcountry": "AR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": null,
"dru... |
{
"abstract": "Neutropenia is a significant adverse event after heart transplantation (HT) and increases infection risk. Granulocyte colony-stimulating factor (G-CSF) is commonly used in patients with neutropenia. In this work, we assessed the adverse effects of G-CSF treatment in the setting of a university hospital.\n\n\n\nData on HT patients from January 2008 to July 2016 were reviewed. Patients who received G-CSF were identified and compared with patients without a history of therapy. Baseline characteristics, rejection episodes, and outcomes were collected. Data were analyzed by incidence rates, time to rejection and survival were analyzed using Kaplan-Meier curves, and odds ratios were generated using logistic regression analysis.\n\n\n\nTwo hundred twenty-two HT patients were studied and 40 (18%) received G-CSF for a total of 85 total neutropenic events (0.79 event/patient year). There were no differences in baseline characteristics between the groups. In the 3 months after G-CSF, the incidence rate of rejection was 0.067 event/month. In all other time periods considered free of G-CSF effect, the incidence rate was 0.011 event/month. This rate was similar to the overall incidence rate in the non-GCSF group, which was 0.010 event/month. There was a significant difference between the incidence rates in the G-CSF group at 0 to 3 months after G-CSF administration and the non-GCSF group (p = 0.04), but not for the other time periods (p = 0.5). Freedom from rejection in the 3 months after G-CSF administration was 87.5% compared with 97.5% in the non-GCSF group (p = 0.006).\n\n\n\nG-CSF administration was found to be associated with significant short-term risk of rejection. This suggests the need for increased surveillance during this time period.",
"affiliations": "Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA. Electronic address: ann.nguyen2@uchospitals.edu.;Department of Pharmacy Services, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Surgery, Section of Cardiac and Thoracic Surgery, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA.;Department of Medicine, Section of Cardiology, The University of Chicago Medicine, Chicago, Illinois, USA.",
"authors": "Nguyen|Ann B|AB|;Lourenço|Laura|L|;Chung|Ben Bow|BB|;Imamura|Teruhiko|T|;Rodgers|Daniel|D|;Besser|Stephanie A|SA|;Murks|Catherine|C|;Riley|Tiana|T|;Powers|JoDel|J|;Raikhelkar|Jayant|J|;Kalantari|Sara|S|;Sarswat|Nitasha|N|;Jeevanandam|Valluvan|V|;Kim|Gene|G|;Sayer|Gabriel|G|;Uriel|Nir|N|",
"chemical_list": "D016179:Granulocyte Colony-Stimulating Factor",
"country": "United States",
"delete": false,
"doi": "10.1016/j.healun.2018.06.009",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1053-2498",
"issue": "37(11)",
"journal": "The Journal of heart and lung transplantation : the official publication of the International Society for Heart Transplantation",
"keywords": "G-CSF; acute rejection; heart transplantation; immunosuppression; infection prophylaxis; neutropenia",
"medline_ta": "J Heart Lung Transplant",
"mesh_terms": "D005260:Female; D006084:Graft Rejection; D016179:Granulocyte Colony-Stimulating Factor; D016027:Heart Transplantation; D006785:Hospitals, University; D006801:Humans; D008297:Male; D008875:Middle Aged; D009503:Neutropenia; D012306:Risk",
"nlm_unique_id": "9102703",
"other_id": null,
"pages": "1322-1328",
"pmc": null,
"pmid": "30174163",
"pubdate": "2018-11",
"publication_types": "D016428:Journal Article",
"references": "8108982;2479425;8539860;21258040;7940727;1314441;7539958;2469962;17164711;24384051;1703338;1375975;8623199;11429005;6990568;25274118;8643201;15596559;26000773;7022840;7022223;17425738;7854375;25443871;7506461;8652892;9187067;7690254;23953556;1376442;15611389",
"title": "Increase in short-term risk of rejection in heart transplant patients receiving granulocyte colony-stimulating factor.",
"title_normalized": "increase in short term risk of rejection in heart transplant patients receiving granulocyte colony stimulating factor"
} | [
{
"companynumb": "US-AMGEN-USASP2019213964",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "FILGRASTIM"
},
"drugadditional": null,
... |
{
"abstract": "A 63-year-old man with Bence Jones-κ multiple myeloma (MM) presented with renal impairment. First, we administered a bortezomib-containing regimen which is considered to be the first choice among therapeutic approaches for MM patients with renal failure. However, his condition was refractory to bortezomib, and the renal dysfunction worsened (creatinine 12.55mg/dl) necessitating the initiation of hemodialysis. Subsequently, we administered an adjusted dose of lenalidomide and dexamethasone. Dialysis could be discontinued after 3 cycles of lenalidomide therapy. After 4 cycles, he achieved a stringent complete response (sCR) with the creatinine level at 1.85mg/dl. This case suggests lenalidomide to be an effective drug for patients with multiple myeloma and renal impairment refractory to treatment with bortezomib.",
"affiliations": "Department of Hematology, Eiju General Hospital.",
"authors": "Uchida|Tomoyuki|T|;Inoue|Morihiro|M|;Hua|Jian|J|;Hagihara|Masao|M|",
"chemical_list": "D013792:Thalidomide; D003907:Dexamethasone; D000077269:Lenalidomide",
"country": "Japan",
"delete": false,
"doi": "10.11406/rinketsu.57.613",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0485-1439",
"issue": "57(5)",
"journal": "[Rinsho ketsueki] The Japanese journal of clinical hematology",
"keywords": null,
"medline_ta": "Rinsho Ketsueki",
"mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D003907:Dexamethasone; D006801:Humans; D000077269:Lenalidomide; D008297:Male; D008875:Middle Aged; D009101:Multiple Myeloma; D006435:Renal Dialysis; D051437:Renal Insufficiency; D013792:Thalidomide; D016896:Treatment Outcome",
"nlm_unique_id": "2984782R",
"other_id": null,
"pages": "613-7",
"pmc": null,
"pmid": "27263787",
"pubdate": "2016-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Achievement of hemodialysis discontinuation with lenalidomide and dexamethasone therapy in a refractory BJP-type multiple myeloma patient.",
"title_normalized": "achievement of hemodialysis discontinuation with lenalidomide and dexamethasone therapy in a refractory bjp type multiple myeloma patient"
} | [
{
"companynumb": "JP-SUN PHARMACEUTICAL INDUSTRIES LTD-2017R1-133571",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BORTEZOMIB"
},
"drug... |
{
"abstract": "We report a case of a non-secretory neuroendocrine tumor which transformed into an insulin secreting tumor after treatment with Sunitinib. To our knowledge, this has only been described in three other cases worldwide. Previously reported case series find transformation of non-secretory neuroendocrine cancers into secretory lesions occurs in 3.4-6.8% of cases. Sunitinib is known to have the potential to lower blood glucose and induce epigenetic changes in cells of various types. We hypothesize that the mechanism for Sunitinib-induced transformation in cancer phenotype is through epigenetic changes in DNA expression within the tumor cells.",
"affiliations": "1 Department of Medicine, Division of Hematology and Oncology, Medical College of Wisconsin, Milwaukee, USA.;1 Department of Medicine, Division of Hematology and Oncology, Medical College of Wisconsin, Milwaukee, USA.;1 Department of Medicine, Division of Hematology and Oncology, Medical College of Wisconsin, Milwaukee, USA.",
"authors": "Clover|Todd|T|;Abdelkader|Amrou|A|;Guru Murthy|Guru Subramanian|GS|",
"chemical_list": "D000970:Antineoplastic Agents; D000077210:Sunitinib",
"country": "England",
"delete": false,
"doi": "10.1177/1078155218791309",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1078-1552",
"issue": "25(6)",
"journal": "Journal of oncology pharmacy practice : official publication of the International Society of Oncology Pharmacy Practitioners",
"keywords": "Epigenetic; Sunitinib; insulinoma; neuroendocrine; transformation",
"medline_ta": "J Oncol Pharm Pract",
"mesh_terms": "D000970:Antineoplastic Agents; D002471:Cell Transformation, Neoplastic; D006801:Humans; D007340:Insulinoma; D008297:Male; D008875:Middle Aged; D018358:Neuroendocrine Tumors; D010190:Pancreatic Neoplasms; D000077210:Sunitinib",
"nlm_unique_id": "9511372",
"other_id": null,
"pages": "1516-1519",
"pmc": null,
"pmid": "30089432",
"pubdate": "2019-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Transformation of a non-secretory neuroendocrine tumor to insulinoma after treatment with Sunitinib: A case report and review of the literature.",
"title_normalized": "transformation of a non secretory neuroendocrine tumor to insulinoma after treatment with sunitinib a case report and review of the literature"
} | [
{
"companynumb": "US-PFIZER INC-2019202493",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "SUNITINIB MALATE"
},
"drugadditional": null,
... |
{
"abstract": "With advances in new cytotoxic drugs and molecular-targeted drugs, the prognosis of patients with metastatic colorectal cancer (mCRC) has improved. However, physicians often hesitate to administer intensive standard regimens to elderly patients with mCRC. Recently, first-line regimens that are effective in and well-tolerated by patients who are not eligible for intensive chemotherapy have been established. However, the therapeutic strategies to adopt after the failure of first-line treatment for patients who are not eligible for intensive chemotherapy remain unclear. We herein report two cases of long-term control of mCRC via FTD/TPI+bevacizumab (Bmab) as second- or third-line treatment in elderly patients without severe adverse events. In case 1, first-line treatment with Tegafur-Uracil, which is a prodrug of 5-FU, caused disease progression in a short period after the initiation of chemotherapy. In case 2, intensive first-line treatment caused severe adverse events, and treatment was discontinued. However, in both cases, disease control was obtained for a long time without severe adverse events by subsequent treatment with FTD/TPI+Bmab. The success in these present cases indicates that FTD/TPI+Bmab as a second- or third-line treatment is a therapeutic option for elderly patients with mCRC who are not eligible for intensive chemotherapy, even after failure of treatment with 5-FU.",
"affiliations": "Department of Surgical Oncology, Osaka City University Graduate School of Medicine, Osaka, Japan.;Department of Surgical Oncology, Osaka City University Graduate School of Medicine, Osaka, Japan.;Department of Surgical Oncology, Osaka City University Graduate School of Medicine, Osaka, Japan.;Department of Surgical Oncology, Osaka City University Graduate School of Medicine, Osaka, Japan.;Department of Surgical Oncology, Osaka City University Graduate School of Medicine, Osaka, Japan.;Department of Surgical Oncology, Osaka City University Graduate School of Medicine, Osaka, Japan.;Department of Surgical Oncology, Osaka City University Graduate School of Medicine, Osaka, Japan.;Department of Surgical Oncology, Osaka City University Graduate School of Medicine, Osaka, Japan.;Department of Surgical Oncology, Osaka City University Graduate School of Medicine, Osaka, Japan.",
"authors": "Shibutani|Masatsune|M|;Maeda|Kiyoshi|K|;Nagahara|Hisashi|H|;Fukuoka|Tatsunari|T|;Iseki|Yasuhito|Y|;Matsutani|Shinji|S|;Wang|En|E|;Hirakawa|Kosei|K|;Ohira|Masaichi|M|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.1159/000493849",
"fulltext": "\n==== Front\nCase Rep OncolCase Rep OncolCROCase Reports in Oncology1662-6575S. Karger AG Allschwilerstrasse 10, P.O. Box · Postfach · Case postale, CH-4009, Basel, Switzerland · Schweiz · Suisse, Phone: +41 61 306 11 11, Fax: +41 61 306 12 34, karger@karger.ch 10.1159/000493849cro-0011-0800Case ReportTwo Cases of Long-Term Control of Metastatic Colorectal Cancer via FTD/TPI plus Bevacizumab in Elderly Patients Shibutani Masatsune a*Maeda Kiyoshi abNagahara Hisashi aFukuoka Tatsunari aIseki Yasuhito aMatsutani Shinji aWang En aHirakawa Kosei aOhira Masaichi aaDepartment of Surgical Oncology, Osaka City University Graduate School of Medicine, Osaka, JapanbDepartment of Gastroenterological Surgery, Osaka City General Hospital, Osaka, Japan*Masatsune Shibutani, Osaka City University Graduate School of Medicine, Department of Surgical Oncology, 1-4-3 Asahi-machi Abeno-ku, Osaka City, Osaka Prefecture, 545-8585 (Japan), E-Mail fbxbj429@ybb.ne.jpSep-Dec 2018 29 11 2018 29 11 2018 11 3 800 805 13 9 2018 13 9 2018 Copyright © 2018 by S. Karger AG, Basel2018This article is licensed under the Creative Commons Attribution-NonCommercial-4.0 International License (CC BY-NC) (http://www.karger.com/Services/OpenAccessLicense). Usage and distribution for commercial purposes requires written permission.With advances in new cytotoxic drugs and molecular-targeted drugs, the prognosis of patients with metastatic colorectal cancer (mCRC) has improved. However, physicians often hesitate to administer intensive standard regimens to elderly patients with mCRC. Recently, first-line regimens that are effective in and well-tolerated by patients who are not eligible for intensive chemotherapy have been established. However, the therapeutic strategies to adopt after the failure of first-line treatment for patients who are not eligible for intensive chemotherapy remain unclear. We herein report two cases of long-term control of mCRC via FTD/TPI+bevacizumab (Bmab) as second- or third-line treatment in elderly patients without severe adverse events. In case 1, first-line treatment with Tegafur-Uracil, which is a prodrug of 5-FU, caused disease progression in a short period after the initiation of chemotherapy. In case 2, intensive first-line treatment caused severe adverse events, and treatment was discontinued. However, in both cases, disease control was obtained for a long time without severe adverse events by subsequent treatment with FTD/TPI+Bmab. The success in these present cases indicates that FTD/TPI+Bmab as a second- or third-line treatment is a therapeutic option for elderly patients with mCRC who are not eligible for intensive chemotherapy, even after failure of treatment with 5-FU.\n\nKeywords\nColorectal cancerChemotherapyFTD/TPI + bevacizumabElderly patient\n==== Body\nIntroduction\nOwing to the advances in new cytotoxic drugs and molecular-targeted drugs, the prognosis of patients with metastatic colorectal cancer (mCRC) has improved. However, physicians often hesitate to administer intensive standard regimens to elderly patients with mCRC, as elderly patients are often frail and have a deteriorated internal organ function. Recently, first-line regimens that are effective in and well-tolerated by patients who are not eligible for intensive chemotherapy, such as Capecitabine+Bevacizumab (Bmab) and Tefafur-Uracil (UFT)/Leucovorin(LV)+Bmab, have been established [1, 2]. However, the therapeutic strategies to adopt after the failure of first-line treatment for patients who are not eligible for intensive chemotherapy remain unclear. We herein report two cases of long-term control of mCRC via FTD/TPI+Bmab as second- or third-line treatment in elderly patients.\n\nCase Reports\nCase 1\nAn 85-year-old man who had undergone ileocecal resection and lymph node dissection for stage IIIC cecal cancer was found to have intraabdominal nodules, with fluorodeoxyglucose-positron emission tomography showing an abnormal uptake, 2 years after surgery (Fig. 1a, b). The patient was diagnosed with peritoneal dissemination. Given his advanced age, he was deemed ineligible for intensive chemotherapy. He received Tegafur-Uracil/Leucovorin+Bmab therapy. However, only three months later, the patient was judged as having progressive disease due to the increase in his intraabdominal nodules (Fig. 2a) and the appearance of new pulmonary nodules (Fig. 2b). After the failure of first-line treatment, the patient received FTD/TPI+Bmab as second-line treatment, as his RAS status was mutant-type. FTD/TPI+Bmab treatment was continued for six months without severe adverse events until disease progression.\n\nCase 2\nAn 84-year-old man who had undergone right hemi-colectomy and lymph node dissection for stage IIIB ascending colon cancer was diagnosed with multiple pulmonary metastases 4 years after surgery (Fig. 3a). Following nine cycles of mFOLFOX6+Bmab, a partial response was obtained (Fig. 3b). However, the treatment was discontinued due to severe gastrointestinal toxicity, and the patient needed hospitalization for one month. Although the general condition improved by hospitalization, CT showed an increase in pulmonary metastases (Fig. 3c). The patient received irinotecan+cetuximab as second-line treatment, as his RAS status was wild-type. However, second-line treatment resulted in a judgment of progressive disease after only two months, and the patient received FTD/TPI+Bmab as third-line treatment. Stable disease continued for more than one year with FTD/TPI+Bmab treatment without severe adverse events except for neutropenia, even though severe adverse events had occurred during the first-line treatment.\n\nDiscussion\nFTD/TPI is an oral anticancer agent containing trifluridine (FTD) and thymidine phosphorylase inhibitor (TPI). FTD exerts anticancer effects by being incorporated into DNA, and TPI maintains the serum concentration of FTD by preventing its rapid degradation [3, 4]. FTD/TPI has been reported to exert antitumor effects against 5-FU-resistant tumors [5], as FTD and FdUrd, a derivative of 5-FU, are incorporated into DNA with different efficiencies [6]. Therefore, FTD/TPI is a drug that can be expected to be effective even after the failure of the treatment with 5-FU. Indeed, in case 1, FTD/TPI+Bmab treatment was effective even after the failure of treatment with Tegafur-Uracil, which is a prodrug of 5-FU.\n\nIn the phase III RECOURSE trial, which included patients who had received at least two prior regimens of standard chemotherapies, the overall survival (OS) and the duration to worsening performance status were significantly better in patients with mCRC treated with FTD/TPI than in those treated with placebo (OS: 7.1 vs. 5.3 months; duration to worsening performance status: 5.7 versus 4.0 months) [7]. Furthermore, Bmab was found to improve outcomes when administered with FTD/TPI compared with FTD/TPI alone [8]. In addition, FTD/TPI is a drug that can be safely administered to elderly patients, because it was reported that there were no marked differences in terms of the incidence of adverse events between elderly patients and others [9]. In case 2, FTD/TPI+Bmab treatment has been continued for more than one year without severe adverse events, even though severe adverse events requiring hospitalization occurred during the first-line intensive standard treatment. Similarly, in case 1, FTD/TPI+Bmab treatment was continued without severe adverse events for six months until disease progression.\n\nWhen managing elderly patients, physicians should plan treatment strategies after the failure of the first-line treatment, taking into account the age-specific characteristics.\n\nIn the REGOTAS trial, which included patients with mCRC treated with late-line chemotherapy, no significant differences in the OS were noted between patients treated with FTD/TPI or regorafenib [10]. However, in the subgroup analyses according to age, FTD/TPI was reportedly more effective in prolonging the OS than regorafenib in patients ≥65 years of age [10]. Thus, FTD/TPI is thought to be more suitable than regorafenib for elderly patients in terms of efficacy, although the associated adverse events are different.\n\nAnti-EGFR antibodies are drugs that have excellent therapeutic outcomes and are used not only as front-line treatment but also for salvage-line treatment. As the objective response rate of anti-EGFR antibody monotherapy for patients with RAS wild-type mCRC was relatively high (approximately 20%) [11] in late-line treatment, it may be better to administer anti-EGFR antibody first, rather than FTD/TPI, for patients with RAS wild-type mCRC. However, the incidence of skin and subcutaneous tissue toxicities that diminish the quality of life, such as acne-like rush and paronychia, is very high (any grade: 86%-88%, Grade 3 or higher: 9.6%-12.4%) [11], leading to the discontinuation of the chemotherapy. Furthermore, the incidence of infusion reaction is not low [11]. Therefore, careful management is required for the use of anti-EGFR antibodies. In addition, it was recently reported that the efficacy of anti-EGFR antibody against right-sided colon cancer is poor [12].\n\nAlthough irinotecan is a key drug for the treatment of mCRC, the incidence of grade 3 or higher diarrhea is relatively high (15.7%) [13]. Furthermore, the incidence of grade 3 or higher diarrhea is even higher (38.6%) in patients ≥65 years of age [14]. Therefore, irinotecan is a somewhat hard-to-use drug for elderly patients.\n\nIn conclusion, the success in these present cases indicates that FTD/TPI+Bmab as a second- or third-line treatment is a therapeutic option for elderly patients with mCRC who are not eligible for intensive chemotherapy, even after failure of treatment with 5-FU.\n\nStatement of Ethics\nWritten ethical approval for the publication on the present case report was obtained from the patient.\n\nDisclosure Statement\nThe authors declare that they have no conflicts of interest to disclose.\n\nFig. 1 (a) Computed tomography showed small intraabdominal nodules. (b) Fluorodeoxyglucose-positron emission tomography showed an abnormal uptake in the intraabdominal nodules.\n\nFig. 2 Three months after the initiation of first-line treatment, computed tomography showed an increase in the intraabdominal nodules (a) and the appearance of new pulmonary nodules (b).\n\nFig. 3 (a) Computed tomography showed multiple pulmonary nodules. (b) Following nine cycles of mFOLFOX6+Bmab, computed tomography showed a decrease in the pulmonary nodules. (c) However, 10 months after the initiation of first-line treatment, computed tomography showed the regrowth of the pulmonary nodules.\n==== Refs\nReferences\n1 Cunningham D Lang I Marcuello E Lorusso V Ocvirk J Shin DB AVEX study investigators Bevacizumab plus capecitabine versus capecitabine alone in elderly patients with previously untreated metastatic colorectal cancer (AVEX): an open-label, randomised phase 3 trial Lancet Oncol 2013 10 14 (11) 1077 85 24028813 \n2 Nishina T Moriwaki T Shimada M Higashijima J Sakai Y Masuishi T Uracil-Tegafur and Oral Leucovorin Combined With Bevacizumab in Elderly Patients (Aged ≥ 75 Years) With Metastatic Colorectal Cancer: A Multicenter, Phase II Trial (Joint Study of Bevacizumab, Oral Leucovorin, and Uracil-Tegafur in Elderly Patients [J-BLUE] Study) Clin Colorectal Cancer 2016 9 15 (3) 236 42 26778644 \n3 Tanaka N Sakamoto K Okabe H Fujioka A Yamamura K Nakagawa F Repeated oral dosing of TAS-102 confers high trifluridine incorporation into DNA and sustained antitumor activity in mouse models Oncol Rep 2014 12 32 (6) 2319 26 25230742 \n4 Fukushima M Suzuki N Emura T Yano S Kazuno H Tada Y Structure and activity of specific inhibitors of thymidine phosphorylase to potentiate the function of antitumor 2′-deoxyribonucleosides Biochem Pharmacol 2000 5 59 (10) 1227 36 10736423 \n5 Emura T Suzuki N Yamaguchi M Ohshimo H Fukushima M A novel combination antimetabolite, TAS-102, exhibits antitumor activity in FU-resistant human cancer cells through a mechanism involving FTD incorporation in DNA Int J Oncol 2004 9 25 (3) 571 8 15289858 \n6 Sakamoto K Yokogawa T Ueno H Oguchi K Kazuno H Ishida K Crucial roles of thymidine kinase 1 and deoxyUTPase in incorporating the antineoplastic nucleosides trifluridine and 2′-deoxy-5-fluorouridine into DNA Int J Oncol 2015 46 (6) 2327 34 25901475 \n7 Mayer RJ Van Cutsem E Falcone A Yoshino T Garcia-Carbonero R Mizunuma N RECOURSE Study Group Randomized trial of TAS-102 for refractory metastatic colorectal cancer N Engl J Med 2015 5 372 (20) 1909 19 25970050 \n8 Kuboki Y Nishina T Shinozaki E Yamazaki K Shitara K Okamoto W TAS-102 plus bevacizumab for patients with metastatic colorectal cancer refractory to standard therapies (C-TASK FORCE): an investigator-initiated, open-label, single-arm, multicentre, phase 1/2 study Lancet Oncol 2017 9 18 (9) 1172 81 28760399 \n9 Van Cutsem E Benedetti FM Mizuguchi H Mayer RJ Falcone A Garcia-Carbonero R TAS-102 versus placebo (PBO) in patients (pts) ≥65 years (y) with metastatic colorectal cancer (mCRC): An age-based analysis of the recourse trial j clin oncol 2016 34 (suppl 4s) abstract 638 \n10 Moriwaki T Fukuoka S Taniguchi H Takashima A Kumekawa Y Kajiwara T Propensity Score Analysis of Regorafenib Versus Trifluridine/Tipiracil in Patients with Metastatic Colorectal Cancer Refractory to Standard Chemotherapy (REGOTAS): A Japanese Society for Cancer of the Colon and Rectum Multicenter Observational Study Oncologist 2018 1 23 (1) 7 15 28894015 \n11 Price TJ Peeters M Kim TW Li J Cascinu S Ruff P Panitumumab versus cetuximab in patients with chemotherapy-refractory wild-type KRAS exon 2 metastatic colorectal cancer (ASPECCT): a randomised, multicentre, open-label, non-inferiority phase 3 study Lancet Oncol 2014 5 15 (6) 569 79 24739896 \n12 Arnold D Lueza B Douillard JY Peeters M Lenz HJ Venook A Prognostic and predictive value of primary tumour side in patients with RAS wild-type metastatic colorectal cancer treated with chemotherapy and EGFR directed antibodies in six randomized trials Ann Oncol 2017 8 28 (8) 1713 29 28407110 \n13 Sobrero AF Maurel J Fehrenbacher L Scheithauer W Abubakr YA Lutz MP EPIC: phase III trial of cetuximab plus irinotecan after fluoropyrimidine and oxaliplatin failure in patients with metastatic colorectal cancer J Clin Oncol 2008 5 26 (14) 2311 9 18390971 \n14 Rothenberg ML Cox JV DeVore RF Hainsworth JD Pazdur R Rivkin SE A multicenter, phase II trial of weekly irinotecan (CPT-11) in patients with previously treated colorectal carcinoma Cancer 1999 2 85 (4) 786 95 10091755\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1662-6575",
"issue": "11(3)",
"journal": "Case reports in oncology",
"keywords": "Chemotherapy; Colorectal cancer; Elderly patient; FTD/TPI + bevacizumab",
"medline_ta": "Case Rep Oncol",
"mesh_terms": null,
"nlm_unique_id": "101517601",
"other_id": null,
"pages": "800-805",
"pmc": null,
"pmid": "30627095",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "10091755;10736423;15289858;18390971;24028813;24739896;25230742;25901475;25970050;26778644;28407110;28760399;28894015",
"title": "Two Cases of Long-Term Control of Metastatic Colorectal Cancer via FTD/TPI plus Bevacizumab in Elderly Patients.",
"title_normalized": "two cases of long term control of metastatic colorectal cancer via ftd tpi plus bevacizumab in elderly patients"
} | [
{
"companynumb": "JP-ACCORD-097783",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "LEUCOVORIN"
},
"drugadditional": "1",
"druga... |
{
"abstract": "METHODS\nA 73-year-old male presented with new onset dizziness and a 22-kg weight loss due to antibiotic-induced nausea/vomiting. Due to gaze-evoked nystagmus (GEN), thiamine deficiency was suspected. Within 12 h after replacement, his GEN decreased.\n\n\nCONCLUSIONS\nIn patients with nutritional deprivation, new onset GEN should prompt further diagnostics and immediate thiamine supplementation to avoid disease progression.",
"affiliations": "Infectiology, Department of Medicine, Cantonal Hospital of Baden, Baden, Switzerland.;Neurology, Department of Medicine, Cantonal Hospital of Baden, Baden, Switzerland.;Institute of Neuroradiology, Department of Radiology, Cantonal Hospital of Baden, Baden, Switzerland.;Neurology, Department of Medicine, Cantonal Hospital of Baden, Baden, Switzerland. alexander.tarnutzer@ksb.ch.",
"authors": "Wiggli|Benedikt|B|;Kapitza|Sandra|S|;Ahlhelm|Frank|F|;Tarnutzer|Alexander A|AA|http://orcid.org/0000-0002-6984-6958",
"chemical_list": "D000900:Anti-Bacterial Agents",
"country": "Germany",
"delete": false,
"doi": "10.1007/s15010-019-01363-w",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0300-8126",
"issue": "48(1)",
"journal": "Infection",
"keywords": "Antibiotics; Eye movements; Malnutrition; Vestibular; Wernicke’s disease",
"medline_ta": "Infection",
"mesh_terms": "D000368:Aged; D000900:Anti-Bacterial Agents; D006801:Humans; D008297:Male; D044342:Malnutrition; D009325:Nausea; D009759:Nystagmus, Pathologic; D013832:Thiamine Deficiency; D016896:Treatment Outcome",
"nlm_unique_id": "0365307",
"other_id": null,
"pages": "137-140",
"pmc": null,
"pmid": "31606875",
"pubdate": "2020-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "21576300;20642790;21996645;30107022;12695821;29593640;17434099;29143209;28365885;5162155",
"title": "Early recognition of thiamine deficiency: ocular motor deficits in a patient with nutritional deprivation due to persistent antibiotic-related nausea.",
"title_normalized": "early recognition of thiamine deficiency ocular motor deficits in a patient with nutritional deprivation due to persistent antibiotic related nausea"
} | [
{
"companynumb": "CH-TEVA-2020-CH-1213797",
"fulfillexpeditecriteria": "1",
"occurcountry": "CH",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CLINDAMYCIN"
},
"drugadditional": "1",
... |
{
"abstract": "OBJECTIVE\nOff-label prescribing of oral oncology agents has been explored in the treatment of soft tissue sarcoma. The time for a prior authorization approval or rejection for an off-label use can be lengthy. The purpose of this study is to capture this burden by comparing the time it takes for patients to receive off-label versus on-label treatment for their soft tissue sarcoma.\n\n\nMETHODS\nIn this retrospective chart review study, patients aged 18 and older who received a new prescription for an oral oncology agent for soft tissue sarcoma from one of three sarcoma providers at Oregon Health & Science University oncology clinics between March 2014 and February 2016 were included. Objectives included comparing the effect of off-label to on-label prescribing of oral oncology agents on time to receipt of medication and patient copays for a 30-day supply of oral chemotherapy agent(s).\n\n\nRESULTS\nThe time to receipt of medication (median (IQR)) for the off-label group (N = 26) was 12.5 (3.3 to 30.8) days compared to the on-label group (N = 29), which was 8.0 (4.0 to 15.0) days (p = 0.327). The patient cost was $0.00 ($0.00 to $20.00) for the off-label group (N = 18) compared to $3.00 ($0.00 to $68.80) for the on-label group (N = 18) (p = 0.467).\n\n\nCONCLUSIONS\nThere were no differences in the time to receipt of medication or patient cost between off-label and on-label prescriptions in soft tissue sarcoma patients. Despite lack of statistical significance, these results are meaningful to patient care and require further study to investigate these findings.",
"affiliations": "1 Legacy Health, Portland, OR, USA.;2 Biostatistics Shared Resource - Knight Cancer Institute, Oregon Health and Science University, Portland, OR, USA.;2 Biostatistics Shared Resource - Knight Cancer Institute, Oregon Health and Science University, Portland, OR, USA.",
"authors": "Tran|Victor|V|;Latour|Emile|E|;Palumbo|Alison|A|https://orcid.org/0000-0001-8635-9337",
"chemical_list": "D000970:Antineoplastic Agents",
"country": "England",
"delete": false,
"doi": "10.1177/1078155219830471",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1078-1552",
"issue": "25(6)",
"journal": "Journal of oncology pharmacy practice : official publication of the International Society of Oncology Pharmacy Practitioners",
"keywords": "Gastrointestinal stromal tumor; off-label; oral chemotherapy; soft tissue sarcoma",
"medline_ta": "J Oncol Pharm Pract",
"mesh_terms": "D000284:Administration, Oral; D000328:Adult; D000368:Aged; D000970:Antineoplastic Agents; D011307:Drug Prescriptions; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D056687:Off-Label Use; D000078482:Prior Authorization; D012189:Retrospective Studies; D012509:Sarcoma; D012983:Soft Tissue Neoplasms; D061665:Time-to-Treatment",
"nlm_unique_id": "9511372",
"other_id": null,
"pages": "1412-1418",
"pmc": null,
"pmid": "30760165",
"pubdate": "2019-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Off-label versus on-label prescribing of oral oncology agents on time to receipt of medication in patients with soft tissue sarcoma.",
"title_normalized": "off label versus on label prescribing of oral oncology agents on time to receipt of medication in patients with soft tissue sarcoma"
} | [
{
"companynumb": "US-009507513-1908USA003523",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "TEMOZOLOMIDE"
},
"drugadditional": null,
... |
{
"abstract": "Heparin is an anticoagulant, which is frequently used in hospitalized patients for prophylaxis of deep vein thrombosis (DVT). Subcutaneous administration of heparin may lead to complications such as bruising, hematoma, and pain at the injection site. Hematomas can develop without visible bruising, as in our case.",
"affiliations": "Division of Nephrology, Hypertension and Renal Transplantation University of Florida Gainesville Florida.;Division of Nephrology, Hypertension and Renal Transplantation University of Florida Gainesville Florida.",
"authors": "Koratala|Abhilash|A|0000-0001-5801-3574;Bhattacharya|Deepti|D|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1002/ccr3.1291",
"fulltext": "\n==== Front\nClin Case RepClin Case Rep10.1002/(ISSN)2050-0904CCR3Clinical Case Reports2050-0904John Wiley and Sons Inc. Hoboken 10.1002/ccr3.1291CCR31291Clinical ImageClinical ImagesSubcutaneous hematomas from prophylactic heparin use A. Koratala & D. BhattacharyaKoratala Abhilash http://orcid.org/0000-0001-5801-3574abhilash.koratala@medicine.ufl.edu \n1\nBhattacharya Deepti \n1\n\n1 \nDivision of Nephrology, Hypertension and Renal Transplantation\nUniversity of Florida\nGainesville\nFlorida\n* Correspondence\n\nAbhilash Koratala, Division of Nephrology, Hypertension and Renal Transplantation, University of Florida, P.O. Box 100224, Gainesville, 32610 FL; Tel: 352‐294‐8694; Fax: 352‐392‐3581; E‐mail: abhilash.koratala@medicine.ufl.edu\n24 11 2017 1 2018 6 1 10.1002/ccr3.2018.6.issue-1226 227 12 9 2017 17 10 2017 04 11 2017 © 2017 The Authors. Clinical Case Reports published by John Wiley & Sons Ltd.This is an open access article under the terms of the Creative Commons Attribution‐NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.Key Clinical Message\nHeparin is an anticoagulant, which is frequently used in hospitalized patients for prophylaxis of deep vein thrombosis (DVT). Subcutaneous administration of heparin may lead to complications such as bruising, hematoma, and pain at the injection site. Hematomas can develop without visible bruising, as in our case.\n\nHematomaheparinprophylaxis source-schema-version-number2.0component-idccr31291cover-dateJanuary 2018details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_NLMPMC version:version=5.3.1 mode:remove_FC converted:17.01.2018\n\nClinical Case Reports \n2018 ; 6 (1 ): 226 –227\n==== Body\nA 45‐year‐old White woman with a history of end‐stage renal disease (ESRD) on peritoneal dialysis, diabetes mellitus type 2, and essential hypertension was admitted to the hospital for the workup of new‐onset symptomatic hypotension. Hypotension persisted despite discontinuation of all her home antihypertensives, starting midodrine, and adjustment of peritoneal dialysis prescription. Extensive investigations were undertaken, and electromyography demonstrated severe axonal sensorimotor neuropathy with demyelinating changes. She was treated for possible chronic inflammatory demyelinating polyneuropathy‐related neurogenic hypotension with intravenous immunoglobulin and showed partial response. During the course of her prolonged hospital stay, she complained of right‐sided abdominal pain. Because of the concern for peritonitis in a peritoneal dialysis patient, an ultrasonogram was obtained which demonstrated multiple hypoechoic areas with a hyperechoic border suggestive of hematomas at the site of subcutaneous heparin injections, which she was receiving for DVT prophylaxis (Fig. 1). The coagulation panel was significant for a mildly elevated activated clotting time of 160 sec (ref: 94–120) and normal prothrombin time and international normalized ratio (10.7 sec and 1.0, respectively). Heparin is primarily metabolized in the liver and reticuloendothelial system, and at therapeutic doses, renal function is not known to affect elimination 1. Therefore, ESRD status of our patient is unlikely to be the cause here. Interestingly, there was no significant bruising on her abdomen. Pain improved with switching the injection site and with slow injections. Her peritoneal fluid cell count was not consistent with peritonitis. It has to be noted that current data on the effect of slow versus fast injection, local dry cold application on the development of bruising and hematoma formation at the site of subcutaneous heparin injection are limited and inconclusive 2. In addition to subcutaneous hematomas, clinicians need to be aware of prophylactic heparin‐induced rectus abdominis hematomas with inadvertent intramuscular injection, especially in thin patients and those with a tendency to paroxysmal cough. Injection at a 30°–45° angle from the skin surface or changing the injection site to thigh may be beneficial in such patients 3, 4.\n\nFigure 1 (A, B, C) Abdominal ultrasound demonstrating subcutaneous hematomas [hyperechoic areas with a fluid‐filled hypoechoic center]; (D) site of heparin injections with no significant bruising.\n\nInformed Consent\nInformed consent has been obtained for the publication of this clinical image.\n\nConflict of Interest\nThe authors have declared that no conflict of interest exists.\n\nAuthorship\nBoth the authors have made substantial contribution to the preparation of this manuscript. AK: acquired the images and drafted the manuscript; DB: performed literature search and revised the manuscript for critically important intellectual content.\n==== Refs\nReferences\n1 \n\nKandrotas , R. J. \n\n1992 \nHeparin pharmacokinetics and pharmacodynamics . Clin. Pharmacokinet. \n22 :359 –374 .1505142 \n2 \n\nAkbari Sari , A. \n, \nL. \nJanani \n, \nM. \nMohammady \n, and \nS. \nNedjat \n. 2014 \nSlow versus fast subcutaneous heparin injections for prevention of bruising and site‐pain intensity . Cochrane Database Syst. Rev. \n2017 :(11 ). Art. No.: CD008077.\n3 \n\nTsapatsaris , N. P. \n\n1991 \nLow‐dose heparin. A cause of hematoma of rectus abdominis . Arch. Intern. Med. \n151 :597 –599 .1845603 \n4 \n\nThomas , B. L. \n\n1992 \nHeparin‐induced hematomas . Arch. Intern. Med. \n152 :204 .\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2050-0904",
"issue": "6(1)",
"journal": "Clinical case reports",
"keywords": "Hematoma; heparin; prophylaxis",
"medline_ta": "Clin Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101620385",
"other_id": null,
"pages": "226-227",
"pmc": null,
"pmid": "29375872",
"pubdate": "2018-01",
"publication_types": "D016428:Journal Article",
"references": "29375872;1505142;25036897;1308651;1845603",
"title": "Subcutaneous hematomas from prophylactic heparin use.",
"title_normalized": "subcutaneous hematomas from prophylactic heparin use"
} | [
{
"companynumb": "US-MYLANLABS-2018M1011470",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "HEPARIN SODIUM"
},
"drugadditional": null,
... |
{
"abstract": "Oxaliplatin is a therapeutic platinum compound used for the treatment of colorectal cancer; however, it might induce hypersensitivity reactions, a critical situation that requires discontinuation of chemotherapies that contain oxaliplatin. Independent attempts of oxaliplatin desensitization have been reported, with mostly successful results. This letter reports a 53-year-old Japanese woman (weight, 70 kg) with chemorefractory metastatic rectal cancer who had undergone surgical intervention twice and received 3 treatment regimens. The patient developed grade 3 hypersensitivities to oxaliplatin during cumulative cycles of the FOLFOX (5-fluorouracil/leucovorin/oxaliplatin)-4 regimen. After the subsequent regimen failed, she was desensitized using a protocol of an 8-hour series of diluted-oxaliplatin infusions. Because, according to previously published desensitization reports, hypersensitivity reactions might recur during the final bag infusion of oxaliplatin despite intensive premedication, prophylactic antiemesis, corticosteroids, and antihistamines were administered twice (ie, before and during the oxaliplatin infusion). Allergic reactions were successfully and efficiently prevented with the 2 stages of intensive premedication in this patient who was able to receive oxaliplatin and had stabilized lung metastases. She was able to undergo desensitization for 5 cycles until acute development of obstructive pneumonia. In this report of a previously sensitized patient, a type I hypersensitivity reaction was successfully circumvented with 2-staged premedication for oxaliplatin desensitization. The optimum desensitization protocol for oxaliplatin administration in terms of efficacy and tolerability still needs to be defined.",
"affiliations": null,
"authors": "Nozawa|Hiroaki|H|;Muto|Yasuhiko|Y|;Yamada|Yoshinao|Y|",
"chemical_list": "D000970:Antineoplastic Agents; D009944:Organoplatinum Compounds; D000077150:Oxaliplatin; D002955:Leucovorin; D005472:Fluorouracil",
"country": "United States",
"delete": false,
"doi": "10.1016/j.clinthera.2008.06.007",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0149-2918",
"issue": "30(6)",
"journal": "Clinical therapeutics",
"keywords": null,
"medline_ta": "Clin Ther",
"mesh_terms": "D000970:Antineoplastic Agents; D000971:Antineoplastic Combined Chemotherapy Protocols; D003888:Desensitization, Immunologic; D004342:Drug Hypersensitivity; D005260:Female; D005472:Fluorouracil; D005500:Follow-Up Studies; D006801:Humans; D002955:Leucovorin; D008875:Middle Aged; D009362:Neoplasm Metastasis; D009944:Organoplatinum Compounds; D000077150:Oxaliplatin; D011292:Premedication; D012004:Rectal Neoplasms",
"nlm_unique_id": "7706726",
"other_id": null,
"pages": "1160-5",
"pmc": null,
"pmid": "18640472",
"pubdate": "2008-06",
"publication_types": "D002363:Case Reports; D016422:Letter",
"references": null,
"title": "Desensitization to oxaliplatin with two stages of premedication in a patient with metastatic rectal cancer.",
"title_normalized": "desensitization to oxaliplatin with two stages of premedication in a patient with metastatic rectal cancer"
} | [
{
"companynumb": "JP-SA-A01200809048",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "LEVOLEUCOVORIN CALCIUM"
},
"drugadditional": "1",
... |
{
"abstract": "Hyponatremia is a common electrolyte disorder occurring in patients with malignancy. Typically, it runs in the form of the syndrome of inappropriate antidiuretic hormone secretion (SIADH). Among malignant diseases it is often ascertained from small cell lung cancer. In the form of paraneoplastic syndrome it may precede clinical and radiological symptoms malignant disease. Hyponatremia requires special attention because of the neurological consequences and the risk of death. We present a case of a patient in whom the occurrence of hyponatremia preceded the appearance of clinical symptoms of lung cancer and has been the reason to start the diagnosis. The normalization of serum sodium was the first signal response to chemotherapy. In contrast, a statement confirmed the recurrence of hyponatremia progression of the disease in the form of metastases to the central nervous system. Speeches hyponatremia refractory symptomatic treatment should be a cause of further investigation into the neoplastic process. Recurrent hyponatremia during or after treatment may suggest its progression. Therefore, monitoring the sodium level is required not only during treatment, but also after the oncological treatment.",
"affiliations": null,
"authors": "Karczmarek-Borowska|Bozenna|B|;Zielińska|Kinga|K|;Bukała|Agnieszka|A|",
"chemical_list": "D014408:Biomarkers, Tumor; D012964:Sodium",
"country": "Poland",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1426-9686",
"issue": "37(217)",
"journal": "Polski merkuriusz lekarski : organ Polskiego Towarzystwa Lekarskiego",
"keywords": null,
"medline_ta": "Pol Merkur Lekarski",
"mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D014408:Biomarkers, Tumor; D059248:Chemoradiotherapy; D018450:Disease Progression; D017809:Fatal Outcome; D005260:Female; D006801:Humans; D007010:Hyponatremia; D008175:Lung Neoplasms; D008875:Middle Aged; D012008:Recurrence; D055752:Small Cell Lung Carcinoma; D012964:Sodium",
"nlm_unique_id": "9705469",
"other_id": null,
"pages": "49-52",
"pmc": null,
"pmid": "25154200",
"pubdate": "2014-07",
"publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "Hyponatremia in the course of small cell lung cancer--a case report.",
"title_normalized": "hyponatremia in the course of small cell lung cancer a case report"
} | [
{
"companynumb": "PL-BAXTER-2014BAX053184",
"fulfillexpeditecriteria": "1",
"occurcountry": "PL",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "SODIUM CHLORIDE"
},
"drugadditional": null,
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.