article dict | reports listlengths 1 3.97k |
|---|---|
{
"abstract": "BACKGROUND\nThe interferon-free antiviral regimen, sofosbuvir (SOF) and simeprevir (SIM) without ribavirin has been reported to achieve high sustained virologic response (SVR) rates with few adverse effects when treating patients with hepatitis C genotype 1 (HCV GT1) infection. However, there is scarcity of safety and efficacy data in this regimen after liver transplantation (LT).\n\n\nOBJECTIVE\nWe aim to report the safety, tolerability and efficacy of SOF + SIM to treat LT recipients with recurrent HCV GT1 in a multicenter cohort study.\n\n\nRESULTS\nEighty-one patients with HCV GT1 met criteria to be considered for treatment. Sixty-seven patients received SOF + SIM following LT to date: 69% male, 39% with HCV RNA >6 000 000 IU/mL, 22% advanced hepatic fibrosis (stage 3-4), 6% cholestatic recurrence. Fifty-eight percent previously failed or did not tolerate interferon-based treatments. Mean time from LT to treatment was 6.1 ± 5.2 yr. All patients had estimated GFR >30 mL/min. Tacrolimus was primary immunosuppression in 84% of patients and minimal immunosuppression dose adjustments were required during treatment. In intention-to-treat analysis, 90% achieved end-of-treatment virologic response and 88% achieved SVR.\n\n\nCONCLUSIONS\nSofosbuvir + SIM combination therapy without ribavirin is well tolerated and results in high virologic response rates in recurrent HCV GT1 infection after liver transplantation.",
"affiliations": "Department of Gastroenterology and Hepatology, Cleveland Clinic, Cleveland, OH, USA.;Department of Internal Medicine, Cleveland Clinic, Cleveland, OH, USA.;Department of Internal Medicine, Cleveland Clinic, Cleveland, OH, USA.;Department of Gastroenterology and Hepatology, Cleveland Clinic, Cleveland, OH, USA.;Department of Gastroenterology and Hepatology, Cleveland Clinic, Cleveland, OH, USA.;Department of Gastroenterology and Hepatology, Cleveland Clinic Florida, Weston, FL, USA.;Department of Gastroenterology and Hepatology, Cleveland Clinic, Cleveland, OH, USA.;Department of Gastroenterology and Hepatology, Cleveland Clinic, Cleveland, OH, USA.",
"authors": "Jackson|Whitney E|WE|;Hanouneh|Mohamad|M|;Apfel|Tehilla|T|;Alkhouri|Naim|N|;John|Binu V|BV|;Zervos|Xaralambos|X|;Zein|Nizar N|NN|;Hanouneh|Ibrahim A|IA|",
"chemical_list": "D000998:Antiviral Agents; D012254:Ribavirin; D000069616:Simeprevir; D000069474:Sofosbuvir",
"country": "Denmark",
"delete": false,
"doi": "10.1111/ctr.12738",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0902-0063",
"issue": "30(6)",
"journal": "Clinical transplantation",
"keywords": "hepatitis C virus; liver transplantation; simeprevir; sofosbuvir",
"medline_ta": "Clin Transplant",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000998:Antiviral Agents; D004359:Drug Therapy, Combination; D005260:Female; D005838:Genotype; D016174:Hepacivirus; D006526:Hepatitis C; D006801:Humans; D007165:Immunosuppression Therapy; D016031:Liver Transplantation; D008297:Male; D008875:Middle Aged; D011446:Prospective Studies; D012008:Recurrence; D012189:Retrospective Studies; D012254:Ribavirin; D000069616:Simeprevir; D000069474:Sofosbuvir; D016896:Treatment Outcome; D055815:Young Adult",
"nlm_unique_id": "8710240",
"other_id": null,
"pages": "709-13",
"pmc": null,
"pmid": "27019204",
"pubdate": "2016-06",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study",
"references": null,
"title": "Sofosbuvir and simeprevir without ribavirin effectively treat hepatitis C virus genotype 1 infection after liver transplantation in a two-center experience.",
"title_normalized": "sofosbuvir and simeprevir without ribavirin effectively treat hepatitis c virus genotype 1 infection after liver transplantation in a two center experience"
} | [
{
"companynumb": "US-GILEAD-2016-0219287",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "SIMEPREVIR"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nTramadol is an atypical analgesic with monoamine and modest mu opioid agonist activity. The purpose of this study was to evaluate: (1) the efficacy of extended-release (ER) tramadol in treating prescription opioid withdrawal and (2) whether cessation of ER tramadol produces opioid withdrawal.\n\n\nMETHODS\nPrescription opioid users with current opioid dependence and observed withdrawal participated in this inpatient, two-phase double blind, randomized placebo-controlled trial. In Phase 1 (days 1-7), participants were randomly assigned to matched oral placebo or ER tramadol (200 or 600 mg daily). In Phase 2 (days 8-13), all participants underwent double blind crossover to placebo. Breakthrough withdrawal medications were available for all subjects. Enrollment continued until 12 completers/group was achieved.\n\n\nRESULTS\nUse of breakthrough withdrawal medication differed significantly (p<0.05) among groups in both phases; the 200mg group received the least amount in Phase 1, and the 600 mg group received the most in both phases. In Phase 1, tramadol 200mg produced significantly lower peak ratings than placebo on ratings of insomnia, lacrimation, muscular tension, and sneezing. Only tramadol 600 mg produced miosis in Phase 1. In Phase 2, tramadol 600 mg produced higher peak ratings of rhinorrhea, irritable, depressed, heavy/sluggish, and hot/cold flashes than placebo. There were no serious adverse events and no signal of abuse liability for tramadol.\n\n\nCONCLUSIONS\nER tramadol 200mg modestly attenuated opioid withdrawal. Mild opioid withdrawal occurred after cessation of treatment with 600 mg tramadol. These data support the continued investigation of tramadol as a treatment for opioid withdrawal.",
"affiliations": "University of Kentucky (UK), Department of Psychiatry, Lexington, KY 40509, USA; UK, Department of Behavioral Science, Lexington, KY 40502, USA; UK, Center on Drug and Alcohol Research, Lexington, KY 40502, USA. Electronic address: michelle.lofwall@uky.edu.",
"authors": "Lofwall|Michelle R|MR|;Babalonis|Shanna|S|;Nuzzo|Paul A|PA|;Siegel|Anthony|A|;Campbell|Charles|C|;Walsh|Sharon L|SL|",
"chemical_list": "D000701:Analgesics, Opioid; D003692:Delayed-Action Preparations; D055553:Prescription Drugs; D014147:Tramadol",
"country": "Ireland",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0376-8716",
"issue": "133(1)",
"journal": "Drug and alcohol dependence",
"keywords": "Efficacy; Opioid withdrawal; Prescription opioid dependence; Randomized clinical trial; Tramadol; Treatment",
"medline_ta": "Drug Alcohol Depend",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000701:Analgesics, Opioid; D018592:Cross-Over Studies; D003692:Delayed-Action Preparations; D004305:Dose-Response Relationship, Drug; D004311:Double-Blind Method; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D009293:Opioid-Related Disorders; D055553:Prescription Drugs; D013375:Substance Withdrawal Syndrome; D014147:Tramadol",
"nlm_unique_id": "7513587",
"other_id": null,
"pages": "188-97",
"pmc": null,
"pmid": "23755929",
"pubdate": "2013-11-01",
"publication_types": "D016428:Journal Article; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": "15892169;1389934;14723474;1777741;1637252;11027901;20665209;10961373;1252693;2849950;4009158;11015800;16005162;7853176;9306048;12746360;16923666;14725960;17605004;2248123;16023304;22540433;17100415;6511949;21610203;23222095;15073888;16427041;10617309;10985875;1401384;1309873;1932883;23098678;8901078;17372805;3670870;16368820;10897546;14636971;8229760;16497429;17386981;19827010;17320313;8632309;9095564;16785220;2029860;20589494;14723475;3687892;15906019;8824687;22065255;15500597;22623016;8982709;12563592",
"title": "Efficacy of extended-release tramadol for treatment of prescription opioid withdrawal: a two-phase randomized controlled trial.",
"title_normalized": "efficacy of extended release tramadol for treatment of prescription opioid withdrawal a two phase randomized controlled trial"
} | [
{
"companynumb": "US-JNJFOC-20131214041",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TRAMADOL HYDROCHLORIDE"
},
"drugadditional": null... |
{
"abstract": "Focal cartilage defects in the knee are commonly found on MRI and arthroscopically. When these lesions are symptomatic and fail nonoperative management several surgical strategies are available. Common surgical techniques include reparative (ie, microfracture) and restorative procedures (ie, autologous chondrocyte implantation, particulated juvenile allograft cartilage, osteochondral autograft transfer, and osteochondral allograft). Each of these surgical procedures have shared and novel complications associated with their use. This article provides a detailed, case-based discussion of common complications encountered in surgical procedures for focal cartilage defects of the knee, highlighting causes, clinical recognition, and how to address and avoid these complications.",
"affiliations": "Department of Orthopedic Surgery - Sports Medicine, University of Colorado, CU Sports Medicine and Performance Center, 2150 Stadium Drive, Boulder, CO 80309, USA.;Department of Orthopedic Surgery, University of Colorado, 12631 E. 17th Avenue, Mailstop B202, Aurora, CO 80045, USA; Department of Orthopedic Surgery, University of Colorado, Anschutz Medical Campus, 13001 East 17th Place, AO1 Building - 4th Floor, Aurora, CO 80045, USA. Electronic address: Stephanie.Logterman@ucdenver.edu.;Department of Orthopedic Surgery - Sports Medicine, University of Colorado, CU Sports Medicine and Performance Center, 2150 Stadium Drive, Boulder, CO 80309, USA.;Department of Orthopedic Surgery - Sports Medicine, University of Colorado, 2150 Stadium Drive, Boulder, CO 80309, USA; Department of Orthopedic Surgery, CU Sports Medicine Center, 2000 South Colorado Boulevard, The Colorado Center Tower One, Suite 4500, Denver, CO 80222, USA.;Department of Orthopedic Surgery - Sports Medicine, University of Colorado, CU Sports Medicine and Performance Center, 2150 Stadium Drive, Boulder, CO 80309, USA.",
"authors": "Welton|Kristina Linnea|KL|;Logterman|Stephanie|S|;Bartley|Justin H|JH|;Vidal|Armando F|AF|;McCarty|Eric C|EC|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.csm.2017.12.008",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0278-5919",
"issue": "37(2)",
"journal": "Clinics in sports medicine",
"keywords": "Autologous chondrocyte implantation; Cartilage defects; Complications; Knee; Microfracture; Osteochondral allograft; Osteochondral autograft; Osteochondral defects",
"medline_ta": "Clin Sports Med",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D002358:Cartilage, Articular; D005260:Female; D006801:Humans; D007718:Knee Injuries; D007719:Knee Joint; D008297:Male; D008875:Middle Aged; D019637:Orthopedic Procedures; D011183:Postoperative Complications",
"nlm_unique_id": "8112473",
"other_id": null,
"pages": "307-330",
"pmc": null,
"pmid": "29525030",
"pubdate": "2018-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Knee Cartilage Repair and Restoration: Common Problems and Solutions.",
"title_normalized": "knee cartilage repair and restoration common problems and solutions"
} | [
{
"companynumb": "US-VERICEL CORPORATION-VCEL-2018-000047",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "AUTOLOGOUS CULTURED CHONDROCYTES"
},
... |
{
"abstract": "We present a case of pulmonary alveolar proteinosis (PAP) initially diagnosed 28 months after left single-lung transplantation for idiopathic pulmonary fibrosis. The diagnosis was based upon the presence of periodic acid-Schiff (PAS)-positive and surfactant immunostain-positive acellular lipoproteinaceous material within alveoli seen on transbronchial biopsy as well as in bronchoalveolar lavage fluid. The patient eventually also displayed a characteristic \"crazy paving\" pattern on radiographic imaging. Granulocyte macrophage-colony stimulating factor antibodies were negative, consistent with secondary PAP. PAP is a rare interstitial lung disease with only a few reported cases occurring after lung transplantation. The etiology is thought to be related to a defect in macrophage function caused by immunosuppression. Reduced immunosuppression has been associated with stabilization, but not reversal, of the condition in the case reported here. PAP is an exceptionally rare cause of dyspnea and radiographic infiltrates after lung transplantation and may be related to toxicity of immune-suppressive medications.",
"affiliations": "Division of Pulmonary and Critical Care Medicine, Department of Medicine, David Geffen School of Medicine at UCLA, Los Angeles, California 90095-1690, USA.",
"authors": "Albores|Jeffrey|J|;Seki|Atsuko|A|;Fishbein|Michael C|MC|;Abtin|Fereidoun|F|;Lynch|Joseph P|JP|;Wang|Tisha|T|;Weigt|S Samuel|SS|",
"chemical_list": "D007166:Immunosuppressive Agents",
"country": "United States",
"delete": false,
"doi": "10.1055/s-0033-1348472",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1069-3424",
"issue": "34(3)",
"journal": "Seminars in respiratory and critical care medicine",
"keywords": null,
"medline_ta": "Semin Respir Crit Care Med",
"mesh_terms": "D001706:Biopsy; D001992:Bronchoalveolar Lavage Fluid; D004417:Dyspnea; D005260:Female; D006801:Humans; D054990:Idiopathic Pulmonary Fibrosis; D007165:Immunosuppression Therapy; D007166:Immunosuppressive Agents; D016040:Lung Transplantation; D008875:Middle Aged; D011649:Pulmonary Alveolar Proteinosis",
"nlm_unique_id": "9431858",
"other_id": null,
"pages": "431-8",
"pmc": null,
"pmid": "23821516",
"pubdate": "2013-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "A rare occurrence of pulmonary alveolar proteinosis after lung transplantation.",
"title_normalized": "a rare occurrence of pulmonary alveolar proteinosis after lung transplantation"
} | [
{
"companynumb": "US-APOTEX-2015AP012748",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": null,
... |
{
"abstract": "This case highlights the importance of recognizing any new soft tissue abnormalities in cancer patients with an indwelling pleural catheter (IPC) or who has had an IPC. This report also describes the first case of catheter tract metastasis (CTM) due to renal cell carcinoma (RCC) and the second case of CTM post-IPC removal.",
"affiliations": "Pulmonary and Critical Care Mayo Clinic Arizona Phoenix AZ USA.;Pulmonary and Critical Care Mayo Clinic Arizona Phoenix AZ USA.",
"authors": "Low|See-Wei|SW|https://orcid.org/0000-0001-7523-7019;Sakata|Kenneth K|KK|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1002/rcr2.527",
"fulltext": "\n==== Front\nRespirol Case RepRespirol Case Rep10.1002/(ISSN)2051-3380RCR2Respirology Case Reports2051-3380John Wiley & Sons, Ltd Chichester, UK 10.1002/rcr2.527RCR2527Clinical ImageClinical ImageIndwelling pleural catheter tract metastasis from renal cell carcinoma Indwelling pleural catheter tract metastasisS.‐W. Low & K.K. SakataLow See‐Wei https://orcid.org/0000-0001-7523-7019\n1\nlow.see-wei@mayo.edu Sakata Kenneth K. \n1\n\n1 \nPulmonary and Critical Care\nMayo Clinic Arizona\nPhoenix\nAZ\nUSA\n* Correspondence\n\nSee‐Wei Low, Pulmonary and Critical Care, Mayo Clinic Arizona, 13400 E Shea Blvd, Scottsdale, Phoenix, AZ 85259 5499, USA. E‐mail: low.see-wei@mayo.edu\n03 2 2020 3 2020 8 2 10.1002/rcr2.v8.2e0052714 11 2019 12 12 2019 02 1 2020 © 2020 The Authors. Respirology Case Reports published by John Wiley & Sons Australia, Ltd on behalf of The Asian Pacific Society of RespirologyThis is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.This case highlights the importance of recognizing any new soft tissue abnormalities in cancer patients with an indwelling pleural catheter (IPC) or who has had an IPC. This report also describes the first case of catheter tract metastasis (CTM) due to renal cell carcinoma (RCC) and the second case of CTM post‐IPC removal.\n\nThe importance of recognizing new nodules or subcutaneous mass in patients who has had indwelling pleural catheter (IPC) or overlying the IPC site is highlighted. This report describes the first case of catheter tract metastasis (CTM) due to renal cell carcinoma (RCC) and the second case of CTM post‐IPC removal.\n\n\nCatheter tract metastasisindwelling pleural catheterrenal cell carcinoma source-schema-version-number2.0cover-dateMarch 2020details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:5.7.5 mode:remove_FC converted:03.02.2020\n\n\nLow , S‐W \n, \nSakata , KK \n. (2020 ) Indwelling pleural catheter tract metastasis from renal cell carcinoma . Respirology Case Reports , 8 (2 ), e00527\n10.1002/rcr2.527 \n\n\n\nAssociate Editor: John Wrightson\n==== Body\nClinical Image\nA 54‐year‐old female had a left indwelling pleural catheter (IPC) placed in March 2017 for a recurrent pleural effusion from renal cell carcinoma (RCC). She achieved spontaneous pleurodesis within two months and her IPC was removed. Her pleural effusion recurred four months later and a second IPC was placed at a separate site, posterior to her initial IPC placement. In January 2018, 10 months after her first IPC placement (eight months after her first IPC was removed), despite targeted treatment with lenvatinib and everolimus, she noticed an area of skin discolouration associated with pain along the previously tunneled tract of her first IPC (Fig. 1). A computed tomography (CT) of the chest showed presence of a left lateral chest wall mass (Fig. 2). An ultrasound‐guided biopsy of the chest wall mass revealed metastatic RCC (Fig. 3), confirming catheter tract metastasis (CTM). The patient received a total of 30 Gy in 15 fractions of external beam radiation to her left chest wall and back. Upon completion of therapy, repeat CT chest showed improvement of the left lateral chest wall mass and pleural metastases. CTM is a rare complication of IPCs. It often presents with a new and painful subcutaneous nodule/mass overlying the IPC insertion site or its tunneled subcutaneous tract. The diagnosis of CTM is made on clinical and radiological grounds with use of histological confirmation if needed. CTM often occurs late, at a median of 280 days post‐IPC placement.\n\nFigure 1 Skin discolouration along her previous tunneled tract 10 months after her first IPC placement (highlighted with red arrow).\n\nFigure 2 Computed tomography of the chest showing the presence of a soft tissue mass protruding out of the subcutaneous tissue through the skin on the left (highlighted with red oval).\n\nFigure 3 Histological confirmation of metastatic renal cell carcinoma from the biopsy of the left subcutaneous chest wall mass.\n\nDisclosure Statement\nAppropriate written informed consent was obtained for publication of this case report and accompanying images.\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2051-3380",
"issue": "8(2)",
"journal": "Respirology case reports",
"keywords": "Catheter tract metastasis; indwelling pleural catheter; renal cell carcinoma",
"medline_ta": "Respirol Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101631052",
"other_id": null,
"pages": "e00527",
"pmc": null,
"pmid": "32025307",
"pubdate": "2020-03",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Indwelling pleural catheter tract metastasis from renal cell carcinoma.",
"title_normalized": "indwelling pleural catheter tract metastasis from renal cell carcinoma"
} | [
{
"companynumb": "NVSC2020US080178",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "EVEROLIMUS"
},
"drugadditional": "3",
"druga... |
{
"abstract": "OBJECTIVE\nThere is an immediate need for more sustainable, effective therapies for treatment-resistant depression in patients who do not respond to traditional psychopharmacology. The aim of this study was to determine the efficacy and safety of intravenous ketamine infusions on the elderly population by using a case series of 6 geriatric patients with treatment-resistant depression.\n\n\nMETHODS\nEligible patients aged 65 to 82 were given a subanesthetic ketamine hydrochloride dose of 0.5 mg/kg delivered intravenously over 40 minutes twice weekly for an acute series. If patients reported a 50% decrease in depression symptoms after the acute series of 2 to 4 infusions, they would be moved to a maintenance series of infusions, which would occur every 2 to 6 weeks on an individual basis.\n\n\nRESULTS\nOf the 6 patients given ketamine, 1 failed to respond to the acute treatment phase, 4 responded to the acute infusion phase but failed to sustain a response after a range of 8 to 22 maintenance infusions, and 1 responded to the infusions but relapsed into alcohol use; therefore, treatment was discontinued.\n\n\nCONCLUSIONS\nThe relative safety of intravenous ketamine in the elderly was demonstrated by the mild, transient adverse effects seen by this patient group. The geriatric population is unable to maintain an antidepressant response to intravenous ketamine over time, signifying that ketamine has low efficacy for the elderly.",
"affiliations": "Center for Behavioral Health, Cleveland Clinic, Cleveland, OH.",
"authors": "Bryant|Kelly A|KA|;Altinay|Murat|M|;Finnegan|Nora|N|;Cromer|Kim|K|;Dale|Roman M|RM|",
"chemical_list": "D018691:Excitatory Amino Acid Antagonists; D007649:Ketamine",
"country": "United States",
"delete": false,
"doi": "10.1097/JCP.0000000000001006",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0271-0749",
"issue": "39(2)",
"journal": "Journal of clinical psychopharmacology",
"keywords": null,
"medline_ta": "J Clin Psychopharmacol",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D061218:Depressive Disorder, Treatment-Resistant; D018691:Excitatory Amino Acid Antagonists; D005260:Female; D006801:Humans; D007262:Infusions, Intravenous; D007649:Ketamine; D008297:Male; D016896:Treatment Outcome",
"nlm_unique_id": "8109496",
"other_id": null,
"pages": "158-161",
"pmc": null,
"pmid": "30742589",
"pubdate": "2019",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Effects of Repeated Intravenous Ketamine in Treatment-Resistant Geriatric Depression: A Case Series.",
"title_normalized": "effects of repeated intravenous ketamine in treatment resistant geriatric depression a case series"
} | [
{
"companynumb": "US-HIKMA PHARMACEUTICALS USA INC.-US-H14001-19-01809",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "KETAMINE"
},
"dru... |
{
"abstract": "Tuberculosis is common among solid-organ transplant recipients, including renal transplants. Tuberculosis of the thyroid gland is a rare diagnosis. We report on a renal transplant recipient with subacute fever associated with a neck mass diagnosed as thyroid tuberculosis. No prior publication has reported a case of posttransplant thyroid tuberculosis. This is an important diagnostic consideration, in addition to malignant transformation, in the posttransplant setting.",
"affiliations": "Department of Medicine, Division of Endocrinology, Diabetes, and Nutrition, University of Maryland School of Medicine, Baltimore, Maryland 21201.;Department of Medicine, Division of Endocrinology, Diabetes, and Nutrition, University of Maryland School of Medicine, Baltimore, Maryland 21201.;Department of Medicine, Division of Endocrinology, Diabetes, and Nutrition, University of Maryland School of Medicine, Baltimore, Maryland 21201.",
"authors": "Levitt|David L|DL|;Mesmar|Bayan|B|;Munir|Kashif M|KM|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1210/js.2016-1058",
"fulltext": "\n==== Front\nJ Endocr SocJ Endocr SocJSJSJournal of the Endocrine Society2472-1972Endocrine Society Washington, DC JS_2016105810.1210/js.2016-1058ImagesThyroidRenal Transplant–Associated Thyroid Tuberculosis Levitt David L. 1Mesmar Bayan 1Munir Kashif M. 11 Department of Medicine, Division of Endocrinology, Diabetes, and Nutrition, University of Maryland School of Medicine, Baltimore, Maryland 21201Address all correspondence to: Kashif M. Munir, MD, Assistant Professor of Medicine, University of Maryland School of Medicine, Division of Endocrinology, Diabetes, and Nutrition, 827 Linden Avenue, 2nd Floor, Baltimore, Maryland 21201. E-mail: kmunir@medicine.umaryland.edu.01 5 2017 13 4 2017 13 4 2017 1 5 553 559 21 11 2016 10 4 2017 Copyright © 2017 Endocrine SocietyThis article has been published under the terms of the Creative Commons Attribution Non-Commercial, No-Derivatives License (CC BY-NC-ND; https://creativecommons.org/licenses/by-nc-nd/4.0/).Tuberculosis is common among solid-organ transplant recipients, including renal transplants. Tuberculosis of the thyroid gland is a rare diagnosis. We report on a renal transplant recipient with subacute fever associated with a neck mass diagnosed as thyroid tuberculosis. No prior publication has reported a case of posttransplant thyroid tuberculosis. This is an important diagnostic consideration, in addition to malignant transformation, in the posttransplant setting.\n\nWe present a case of a renal transplant recipient with subacute fever and neck mass diagnosed as thyroid tuberculosis. Posttransplant thyroid tuberculosis has not been described previously.\n\nthyroidtuberculosistransplant\n==== Body\n1. Case\nA 61-year-old Pakistani female renal transplant recipient was admitted to the hospital with subacute fevers and chills 3 months after transplantation. Transplant immunosuppression included tacrolimus and mycophenolate mofetil, in addition to antimicrobial prophylaxis with valganciclovir and dapsone. Her medical history was also notable for type 2 diabetes mellitus and hypothyroidism, presumed Hashimoto’s thyroiditis. Over the preceding 3 weeks, she reported progressive neck swelling. During admission, she was febrile to 39°C. Initial diagnostic evaluation included white blood cells, 6.5 thousand/μL (4.5 to 11.0 thousand/μL); erythrocyte sedimentation rate, 48 mm/h (0 to 30 mm/h); C-reactive protein >15 mg/L (<3.0 mg/dL); thyrotropin, 0.14 mIU/L (0.47 to 4.68 mIU/L); free thyroxine, 2.2 ng/dL (0.6 to 2.5 ng/dL); negative bacterial blood and urine cultures; and a negative quantiferon Tb gold result (negative serum tuberculosis screen). Empiric broad-spectrum antibiotics did not lead to fever defervescence. Pan computed tomography scan noted a 4.5 × 3.4-cm hypodensity contiguous with the left thyroid lobe, extending into the superior mediastinum. Thyroid ultrasound demonstrated a complex, fluid-filled neck mass resulting in jugular vein thrombosis (Fig. 1). To evaluate for posttransplant malignant transformation, positron emission topography–computed tomography was conducted, showing left thyroid extreme fluorodeoxyglucose avidity (standardized uptake value = 16.0), in addition to several metabolically active foci within the scalp, skull, left cervical lymph node, right hilum, superior thoracic spine, right hepatic lobe, left wrist, and right thigh (Figs. 2 and 3). Fine needle aspiration (FNA) of the neck lesion drained 25 mL purulent fluid, with pathology noting acid-fast bacilli (AFB) (Fig. 4). Three sputum cultures, in addition to a blood culture, were positive for Mycobacterium tuberculosis complex. Within 1 day of initiating antituberculosis therapy, including rifabutin, isoniazid, pyrazinamide, and ethambutol, she was afebrile and subsequently discharged. Five months later, ultrasound did not reflect decreased abscess size, measured as a thick-walled 4.4 × 3.1 × 4.9-cm fluid collection, requiring ongoing antituberculosis treatment.\n\nFigure 1. Ultrasound image of large cystic and solid lesion contiguous with the left thyroid lobe, 4.8 × 3.0 × 4.8 cm. White arrow highlights normal thyroid parenchyma. Red arrows highlight abscess.\n\nFigure 2. Coronal section of positron emission topography–computed tomography, demonstrating diffusely increased metabolic activity in the left thyroid, skull, liver, and soft tissue. Arrows highlight regions of increased metabolic activity.\n\nFigure 3. Axial section of positron emission topography–computed tomography demonstrating a prominent left-sided thyroid lesion.\n\nFigure 4. AFB stain of FNA purulent fluid. Arrows indicate AFB.\n\n2. Discussion\nThe thyroid has antimicrobial properties, due to its colloid, vascularity, and iodine stores [1, 2]. The diagnosis of thyroid tuberculosis is rare: 0.1% of thyroidectomy surgical specimens have documented tuberculosis, albeit data was collected in 1932 [3]. More recently, 0.6% of thyroid FNA specimens diagnosed tuberculosis in data from India [4]. Initial presentation occurs in the context of either a neck mass, concurrent pulmonary tuberculosis, or without symptoms, as some cases are diagnosed only after thyroidectomy. Refer to Table 1 to review published thyroid tuberculosis cases. Laboratory evaluation in these cases typically displays normal thyroid function in addition to an elevated erythrocyte sedimentation rate reflecting inflammation. Imaging in these cases demonstrates solid, hypoechoic nodules that typically correlate with AFB-positive thyroid specimen (Table 1). It is of utmost importance to differentiate thyroid tuberculosis from cancer, to prevent unnecessary thyroidectomy in the setting of tuberculosis [5, 6]. Moreover, the differential diagnosis includes bacterial abscess and benign thyroid nodule, such as a fluid-filled cyst. In our case, we were concerned about infectious and malignant etiology, in the setting of fever and increased metabolic activity on positron emission tomography scan. The majority of thyroid tuberculosis cases are due to disseminated infection [7], with few cases associated with pulmonary tuberculosis [2]. FNA should be conducted as part of the diagnostic evaluation, albeit some lesions are not AFB positive and would warrant further histopathologic evaluation [8, 9]. FNA may yield thyroid tissue subjected to caseous necrosis, associated with epitheloid granulomas. Most thyroid tuberculosis cases are diagnosed postthyroidectomy or after autopsy [10]. Many of these cases have been diagnosed in young to middle-aged women, similar to our case [11]. Use of multiple antituberculous medications leads to eradication of disseminated infection. One percent of cases experience treatment failure, due to tubercular resistance [2, 12]. In our case, it is possible that posttreatment imaging does not reflect decreased residual disease due to difficulty treating an abscess medically. Although disappointed that our patient’s neck mass did not resolve with appropriate medical management, past cases have demonstrated resolution with antituberculosis therapy (Table 1). It is not known whether thyroidectomy as primary treatment is warranted for disseminated infection when thyroid tuberculosis is suspected. No prior publication has reported thyroid tuberculosis in the posttransplant setting, most likely due to the rarity of thyroid tuberculosis. With the use of immunosuppression, posttransplant thyroid tuberculosis activation and malignant transformation should be considered in the setting of occult fever. Our patient was at increased risk to develop tuberculosis due to mycophenolate mofetil administration, renal insufficiency, and diabetes mellitus and previously living in an indigenous tuberculosis region [13]. In our case, disseminated tuberculosis was diagnosed, associated with a tuberculous neck mass contiguous with the thyroid gland with some features similar to previously published cases [14–16].\n\nTable 1. Thyroid Tuberculosis Published Cases\n\nCitation\tCases\tClinical Details\tImaging\tLaboratory\tFNA\tSurgical Pathology\t\nRankin and Graham 1932\t104\t Miliary tuberculosis predominance\tNone reported\t21 cases suspicious for hyperthyroidism\tNot reported, as majority of cases were diagnosed postoperatively at this time\tTubercle and giant cell abundance detected in surgical cases\t\n 6 tuberculous abscesses\t\n 94 partial thyroidectomy cases\t\n 8 s/p incision and drainage\t\n Only 2 preoperative tuberculosis diagnoses reported\t\nLioté et al. 1987\t1\tPainless neck mass without generalized symptoms\t US: right thyroid hypoechoic nodule and 3 ipsilateral enlarged lymph nodes\t Thyroid function reported normal\tNot conducted\tAFB-positive surgical specimen\t\n Chest x-ray: enlarged paratracheal lymph nodes\t AFB-negative sputum samples\t\n Bronchial biopsy noted tuberculous granuloma with caseation, giant cells\t\nDas et al. 1992\t8\t Age ranged from 14 to 65 years old\tUS: 4 solitary nodules, 2 extra extrathyroidal lesions, 1 extrathyroidal vs cystic isthmic lesion, and 1 case Not imaged\tNone reported\t Of 1283 thyroid aspirates over 2 years, 8 (0.6%) diagnosed tuberculosis\tNone reported\t\n Six patients presented with clinically detected nodule\t Five AFB-positive aspirates\t\n Two patients presented with neck abscess\t\nKhan et al. 1993\t4\t Case 1: thyrotoxicosis\t Case 2: US notes right hypoechoic nodule\t Case 1: elevated T4\tCases 2–4: epitheloid granulomas\tCoalescing, caseating epitheloid granulomas, giant cells detected in surgical specimen\t\n Case 2: thyroid sinus tract\t Case 3: US notes multiple hypoechoic nodules\t Case 3: elevated ESR (115 mm/h)\t\n Case 3: dysphagia, fever\t\n Case 4: progressive thyroid enlargement\t\nMondal and Patra 1995\t18\t Age ranged from 36 to 52 years old\tIodine thyroid scan: all cases demonstrated solitary nodules\t Thyroid function reported normal in all cases\tOf 1565 thyroid aspirates over 9 years, 18 cases (1.15%) noted tuberculous thyroiditis\tAll cases demonstrated epitheloid granulomas with necrosis\t\n Three cases with cervical lymphadenopathy\t Elevated ESR in 4 cases\t\n Four cases with pulmonary tuberculosis\t\nPazaitou et al. 2002\t3\t 'One case presented with generalized symptoms (weight loss, diaphoresis)\tIodine thyroid scan: 2 cases demonstrating cold thyroid nodules\t Thyroid function reported normal in all cases\t One aspirate yielded white fluid, positive AFB stain\tEach thyroidectomy specimen was AFB positive\t\n One preoperative tuberculosis diagnosis\t ESR >100 mm/h in all cases\t One aspirate yielded lymphocytes\t\n Two postthyroidectomy tuberculosis diagnoses\t\nTas et al. 2005\t1\tReport of clinically apparent neck mass, dyspnea, dysphagia, and hoarseness for 6 days\tCT: right thyroid cystic mass with paraglottic extension\tThyroid function reported normal\tNot conducted\tPathology reported caseating tuberculosis\t\nGhosh et al. 2007\t1\tReport of clinically apparent neck mass for 2 years, with overlying abscess for the preceding 3 months\t US: 4.3 × 2.8 × 4.2 cm heterogeneous hypoechoic mass\t Thyroid function reported normal\tBlood-mixed aspirate with whitish material\tNo surgical intervention\t\n Iodine-131 thyroid scan: decreased uptake in the left lobe\t Elevated ESR (118 mm/h)\t\nModayil et al. 2009\t1\tReport of clinically apparent neck mass for 6 weeks, without generalized symptoms\t US: right lower thyroid 3.5 × 1.8-cm cyst, right level II lymphadenopathy\t Thyroid function reported normal\t 10 cc frank pus aspirated\tNo surgical intervention\t\n 'Posttreatment US: no lesion detected\t Elevated ESR (40 mm/h)\t Mycobacterium tuberculosis culture positive\t\nGupta et al. 2012\t1\tReport of clinically apparent neck mass for 8 days, without generalized symptoms\tUS: right thyroid thick-walled cyst with central fluid and echogenic debris\tThyroid function reported normal\t Purulent necrotic aspirate, inflammatory cells\tNo surgical intervention\t\nBahgat et al. 2012\t1\tReport of clinically apparent neck mass for 1 month, without generalized symptoms\tCT: thyroid cyst with irregular border, contrast enhancing\t Thyroid function reported normal\t Not reported\tIncision and drainage yielded epitheloid and Langhans’ giant cells\t\n Elevated ESR (50 mm/h)\t\nAbbreviations: US, ultrasound, ESR, erythrocyte sedimentation rate, s/p, status-post.\n\n3. Summary\nThe differential diagnosis of immunosuppressed posttransplant patients with fever and suspected neck abscess should include thyroid and disseminated tuberculosis, warranting FNA. The aspirate should be sent for AFB stain and culture for diagnostic evaluation.\n\nAbbreviations: AFBacid-fast bacilli\n\nFNAfine needle aspiration.\n\n\n\nAcknowledgments\nAuthor contributions: D.L.L. wrote the initial manuscript. B.M., D.L.L., and K.M.M. edited the manuscript. B.M., D.L.L., and K.M.M. edited the figures.\n\nDisclosure Summary: The authors have nothing to disclose.\n==== Refs\nReferences and Notes\n1. Khan EM , Haque I , Pandey R , Mishra SK , Sharma AK \nTuberculosis of the thyroid gland: a clinicopathological profile of four cases and review of the literature . Aust N Z J Surg . 1993 ;63 (10 ):807 –810 .8274125 \n2. Bulbuloglu E , Ciralik H , Okur E , Ozdemir G , Ezberci F , Cetinkaya A \nTuberculosis of the thyroid gland: review of the literature . World J Surg . 2006 ;30 (2 ):149 –155 .16425087 \n3. Rankin FW , Graham AS \nTuberculosis of the thyroid gland . Ann Surg . 1932 ;96 (4 ):625 –648 .17866857 \n4. Das DK , Pant CS , Chachra KL , Gupta AK \nFine needle aspiration cytology diagnosis of tuberculous thyroiditis: a report of eight cases . Acta Cytol . 1992 ;36 (4 ):517 –522 .1636345 \n5. Gupta V , Boombak E , Tanwar P , Yadav H , Sen R \nTuberculosis of thyroid gland presenting as abscess . J Cytol Histol . 2012 ;3 :154 .\n6. Talwar VK , Gupta H , Kumar A \nIsolated tuberculosis thyroiditis . JIACM . 2003 ;4 :238 –239 .\n7. Coller FA , Huggins CB \nTuberculosis of the thyroid gland: a review of the literature and report of five new cases . Ann Surg . 1926 ;84 (6 ):804 –820 .17865580 \n8. Pazaitou K , Chrisoulidou A , Ginikopoulou E , Angel J , Destouni C , Vainas I \nPrimary tuberculosis of the thyroid gland: report of three cases . Thyroid . 2002 ;12 (12 ):1137 –1140 .12593728 \n9. Modayil PC , Leslie A , Jacob A \nTuberculous infection of thyroid gland: a case report . Case Rep Med . 2009 ;2009 :416231 .20168986 \n10. Mondal A , Patra DK \nEfficacy of fine needle aspiration cytology in the diagnosis of tuberculosis of the thyroid gland: a study of 18 cases . J Laryngol Otol . 1995 ;109 (1 ):36 –38 .7876734 \n11. Ozekinci S , Mizrak B , Saruhan G , Senturk S \nHistopathologic diagnosis of thyroid tuberculosis . Thyroid . 2009 ;19 (9 ):983 –986 .19678750 \n12. Lioté HA , Spaulding C , Bazelly B , Milleron BJ , Akoun GM \nThyroid tuberculosis associated with mediastinal lymphadenitis . Tubercle . 1987 ;68 (3 ):229 –231 .3448799 \n13. Aguado JM , Torre-Cisneros J , Fortún J , Benito N , Meije Y , Doblas A , Muñoz P \nTuberculosis in solid-organ transplant recipients: consensus statement of the group for the study of infection in transplant recipients (GESITRA) of the Spanish Society of Infectious Diseases and Clinical Microbiology . Clin Infect Dis . 2009 ;48 (9 ):1276 –1284 .19320593 \n14. Bahgat M , Bahgat Y , Bahgat A , Aly S \nAcute tuberculous abscess of the thyroid gland . BMJ Case Rep . 2012 ;2012. pii: bcr2012006906.\n15. Ghosh A , Saha S , Bhattacharya B , Chattopadhay S \nPrimary tuberculosis of thyroid gland: a rare case report . Am J Otolaryngol . 2007 ;28 (4 ):267 –270 .17606045 \n16. Tas A , Yagiz R , Karasalihoglu AR \nThyroid gland tuberculosis with endolaryngeal extension: a case with laryngotracheal dyspnoea . J Laryngol Otol . 2005 ;119 (1 ):54 –56 .15807968\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2472-1972",
"issue": "1(5)",
"journal": "Journal of the Endocrine Society",
"keywords": "thyroid; transplant; tuberculosis",
"medline_ta": "J Endocr Soc",
"mesh_terms": null,
"nlm_unique_id": "101697997",
"other_id": null,
"pages": "553-559",
"pmc": null,
"pmid": "29264509",
"pubdate": "2017-05-01",
"publication_types": "D016428:Journal Article",
"references": "19320593;3448799;23010466;12593728;16425087;1636345;19678750;20168986;17865580;17606045;8274125;15807968;7876734;17866857",
"title": "Renal Transplant-Associated Thyroid Tuberculosis.",
"title_normalized": "renal transplant associated thyroid tuberculosis"
} | [
{
"companynumb": "PHHY2018US137030",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": "3",
"druga... |
{
"abstract": "The article describes a case of Goldenhar syndrome that had been diagnosed by an ophthalmologist in a medical consultation by school bullying due to a choristoma. A 15-year-old male patient, who had a nodular lesion with hair in the inferior temporal corneal-limbo-conjunctival of the left eye, was reported. He also had a facial asymmetry, with mild mandibular hypoplasia and malformation of the left external ear, where only an auricular appendage was formed. He denied similar family history and the history of genetic diseases, but revealed that his mother had used ibuprofen during the first 3 months of pregnancy and had gestational diabetes mellitus. Excisional biopsy of the eye lesion was performed and revealed a dermoid cyst. After the exegesis and with adequate multidisciplinary monitoring, the patient reported being very satisfied with the aesthetic result, returning with more confidence to his daily activities. That was a typical case of Goldenhar syndrome that has remained undiagnosed and untreated for more than a decade due to a lack of diagnosis despite its classic presentation. The delay in the approach resulted in social stigma and profound psychosocial damage. The importance of disseminating the correct knowledge of this pathology and of having an early multidisciplinary approach in these patients is emphasized, since the impact on the quality of life is significantly high.",
"affiliations": "Department of Ophthalmology, Instituto de Olhos Ciências Médicas, Belo Horizonte/ MG, Brazil.;Department of Ophthalmology, Instituto de Olhos Ciências Médicas, Belo Horizonte/ MG, Brazil.;Department of Ophthalmology, Instituto de Olhos Ciências Médicas, Belo Horizonte/ MG, Brazil.;Department of Ophthalmology, Instituto de Olhos Ciências Médicas, Belo Horizonte/ MG, Brazil.;Department of Ophthalmology, Instituto de Olhos Ciências Médicas, Belo Horizonte/ MG, Brazil.;Oculoplastics Department of Eye Plastic, Instituto de Olhos Ciências Médicas, Belo Horizonte/ MG, Brazil.",
"authors": "Malta|Pio Guilherme|PG|;Vilani|da Silva Rezende Aline|DSRA|;de Miranda|Cordeiro Frederico|CF|;Fouad|Ibrahim Larissa|IL|;Castro|Curi Cláudio|CC|;Borgatti|Moura Érica|MÉ|",
"chemical_list": null,
"country": "Romania",
"delete": false,
"doi": "10.22336/rjo.2020.68",
"fulltext": "\n==== Front\nRom J Ophthalmol\nRom J Ophthalmol\nRomJOphthalmol\nRomanian Journal of Ophthalmology\n2457-4325 2501-2533 Romanian Society of Ophthalmology Romania \n\nRomJOphthalmol-64-444\n10.22336/rjo.2020.68\nCase Reports\nGoldenhar syndrome: the importance of an ophthalmological approach\n\nMalta Pio Guilherme *** Vilani da Silva Rezende Aline * de Miranda Cordeiro Frederico **** Fouad Ibrahim Larissa * Castro Curi Cláudio * Borgatti Moura Érica **** \n* Department of Ophthalmology, Instituto de Olhos Ciências Médicas, Belo Horizonte/ MG, Brazil\n\n\n** Department of Ophthalmology, Núcleo Malta, Lagoa da Prata/ MG, Brazil\n\n\n*** Department of Ophthalmology, AME Excelência em Visão, Congonhas/ MG, Brazil\n\n\n**** Oculoplastics Department of Eye Plastic, Instituto de Olhos Ciências Médicas, Belo Horizonte/ MG, Brazil\n\nCorrespondence to: Guilherme Malta Pio, MD,\nDepartment of Ophthalmology, Instituto de Olhos Ciências Médicas, Belo Horizonte/ MG, \n163/ 303, Costa Sena Street, Padre Eustáquio, Belo Horizonte, Minas Gerais, Brazil, \nPhone: +5533 988 258 824, E-mail: guilherme@nucleomalta.com.br\n\nOct-Dec 2020 \n64 4 444 448\n©Romanian Society of Ophthalmology\n2020This is \nan open-access article distributed under the terms of the Creative \nCommons Attribution License, which permits unrestricted use,\ndistribution, and reproduction in any medium, provided the original work \nis properly cited.The article describes a case of Goldenhar syndrome that had been diagnosed by an ophthalmologist in a medical consultation by school bullying due to a choristoma. A 15-year-old male patient, who had a nodular lesion with hair in the inferior temporal corneal-limbo-conjunctival of the left eye, was reported. He also had a facial asymmetry, with mild mandibular hypoplasia and malformation of the left external ear, where only an auricular appendage was formed. He denied similar family history and the history of genetic diseases, but revealed that his mother had used ibuprofen during the first 3 months of pregnancy and had gestational diabetes mellitus. Excisional biopsy of the eye lesion was performed and revealed a dermoid cyst. After the exegesis and with adequate multidisciplinary monitoring, the patient reported being very satisfied with the aesthetic result, returning with more confidence to his daily activities. That was a typical case of Goldenhar syndrome that has remained undiagnosed and untreated for more than a decade due to a lack of diagnosis despite its classic presentation. The delay in the approach resulted in social stigma and profound psychosocial damage. The importance of disseminating the correct knowledge of this pathology and of having an early multidisciplinary approach in these patients is emphasized, since the impact on the quality of life is significantly high.\n\nchoristomacraniofacial microsomiadermoid cystGoldenhar syndrome\n==== Body\nIntroduction\nGoldenhar syndrome (GS) is a congenital disease that was first described in 1952 by the French ophthalmologist Maurice Goldenhar [1,2]. Its reported incidence ranges from 1:3,500 to 1:5,600 with a 3:2 ratio between men and women. The unilateral occurrence is about 85%, the right side being more affected than the left in a 3:2 proportion [1,3]. It has a multifactorial origin, but the etiopathogenesis of the disease is still n1*0.ot well known and probably involves genetic and environmental factors. It may present a pattern of autosomal dominant, recessive inheritance and sporadic forms. It is known that changes in embryonic development occur in the 1st and 2nd brachial arches, as well as occlusive vascular changes in the placental veins [1,2,4].\n\nClassified as a subtype of craniofacial microsomia, it is also known as oculo-auriculo-vertebral dysplasia [1,2,4-8]. It is characterized by the classic triad: mandibular hypoplasia with facial asymmetry, oculo-auricular malformations and vertebral abnormalities [1,2,4]. Among other changes, it is possible to observe choristomas, microphthalmia, strabismus, cataracts, coloboma of iris and retina, coloboma of upper eyelid, auricular appendage, asymmetry of the ears, atresia of the auditory external canal, hemifacial microsomia, facial asymmetry, mandibular and/ or maxillary hypoplasia, dental alterations such as supernumerary teeth, Fallot’s tetralogy, dextrocardia, transposition of the great vessels, atresia in the gastrointestinal tract, scoliosis, microcephaly, hydrocephalus, hypoplasia of the corpus callosum and several other alterations described [1,2,6]. Despite the variety of signs and symptoms, the diagnosis is based on clinical examination and complementary tests, such as radiological and blood tests [4,6].\n\nThis article describes a case of Goldenhar syndrome in a 15-year-old male patient without a family history of genetic alterations who, despite presenting characteristics of the syndrome’s ectoscopy, had not yet been diagnosed. Such diagnosis occurred from an ophthalmological care motivated by school bullying due to a choristoma. Given the rarity of this disease, the objective was to disseminate knowledge about this topic in order to facilitate its recognition and encourage early diagnosis and conduct, which can reduce possible negative impacts on the patient’s quality of life.\n\nCase report\nThe case of a 15-year-old male patient was reported in the eye plastic department, referenced by the psychologist due to frequent bullying at school motivated by left eye lesion, which made him depressed, introverted and caused successive school failures. The patient described that the lesion was congenital, with slow and progressive growth throughout life. He denied other ophthalmological complaints, ocular traumas, systemic comorbidities and the usage of usual systemic or topical medications. He also denied similar family history and the history of genetic diseases. He had an older brother without any syndromic condition. His gestational history revealed a full-term vaginal delivery, at 38 weeks and 6 days, with no complications. Parents did not have consanguineous marriage, but when asked, revealed that his mother used ibuprofen during the first 3 months of pregnancy and presented gestational diabetes mellitus.\n\nUpon ectoscopy, facial asymmetry was seen, with mild mandibular hypoplasia and malformation of the left external ear, where only an auricular appendage was formed. Eye examination revealed a corrected visual acuity of 1.0 in the right eye (RE) and 0.05 in the left eye (LE). Biomicroscopy of the RE presented without alterations and LE with a nodular, elevated, inferior temporal corneal-limbo-conjunctival lesion, deeply infiltrating the stroma, non-pigmented, with hair follicle in its surface, measuring approximately 5.7 x 5.7 mm (Fig. 1). Fundoscopy was normal bilaterally and intraocular pressure within normal limits.\n\nFig. 1 Ectoscopy. A) Facial asymmetry due to mandibular hypoplasia and left ear alteration. B) Absence of auditory pavilion and presence of auricular appendage. C) There is a corneal-limbo-conjunctival dermoid cyst in the left eye, where hair follicles can be noticed\n\n\nDue to the characteristics of left eye’s lesion, the diagnostic hypothesis of choristoma was suggested and excisional biopsy was performed, with repair using a conjunctival advancement flap of 10-0 silk suture. Complete excision of the lesion was not possible due to its adherence to the deep corneal stroma (Fig. 2). The material was sent for anatomopathological study.\n\nFig. 2 Excisional biopsy. The strong adhesion of the lesion to the deep tissues of the cornea is observed\n\n\nOn the seventh postoperative day, the left eye had mild ocular hyperemia, partial de-epithelialization, leukoma in the inferior temporal corneal area with the remains of the infiltrative lesion and intact sutures. On the 12th postoperative day, he showed improvement in the de-epithelialized area, staining only punctiform with fluorescein and the sutures were removed (Fig. 3). After 3 months of surgery, a calm eye with a small inferior temporal nubecula, local conjunctival covering and a fluoride-negative cornea, was observed. Final best corrected visual acuity remained the same as preoperative, 1.0 and 0.05 in the right and left eyes, respectively, which confirmed amblyopia on the left eye.\n\nFig. 3 Postoperative appearence. A) 7th day postoperative - 10-0 silk sutures can be observed. B) 12th day postoperative - corneal leukoma at the lesion excision site\n\n\nThe result of the anatomopathological study revealed: “fragments similar to the skin, presenting epidermis with orthokeratosis and good pigmentation in the basal layer keratinocytes. Moreover, the presence of multiple pilosebaceous follicles, being an atrophic follicle with light ectasia, was observed. Presence of a central follicle with discrete hyperplasia of the sebaceous glands showed a mature and well-differentiated aspect. The deep dermis showed groups of merocrine and apocrine sweat glands”.\n\nDental, otorhinolaryngological and orthopedic evaluations were requested, which showed abnormalities such as: mandibular dysgenesis, absence of the duct and auditory pavilion on left ear and vertebral hypoplasia.\n\nDue to the presence of a typical choristoma, as well as the presence of all the other clinical signs, Goldenhar syndrome clinical diagnosis was made. Genetic tests were requested for confirmation, but the present location did not have this service and the patient was not willing to pay for the exam on his own.\n\nThe patient was very satisfied with his final aesthetic result and was then referred for evaluation of plastic surgery in order to correct the other anatomical alterations. He returned to his daily activities and remained under psychosocial follow-up. The psychological representative sent a new report of his psychological evaluation describing an important improvement in his depression, introversion and lack of self-confidence.\n\nDiscussion\nGS is well known for its classic triad: mandibular hypoplasia with facial asymmetry, oculo-auricular malformations and vertebral abnormalities. The phenotype of each affected individual can vary greatly in severity, depending on the activation and degree of penetration of the defective gene. Among ocular manifestations, epibulbar choristoma is present in one third of the patients with SG, with the unilateral occurrence about 50% [3,5,6]. Other common manifestations such as microphthalmia, lipodermoids and coloboma, strabismus, cataracts, and epicanthic folds are also described together with anophthalmia, anomalies of the lacrimal drainage system, anomalies of the retina, optic nerve and glaucoma [2,3,5]. In addition to ocular changes, the association of Goldenhar syndrome with facial microsomia, maxillary and mandibular hypoplasia, malar flattening and the presence of ear tags occurrence, are common in about 80-90% of the cases [2,3]. \n\nOther alterations are also described, such as low auricular implantation, laryngomalacia, cleft lip or palate, anomalies of vertebrae such as hemivertebrae and scoliosis, congenital heart disease, such as ventricular septum and tetralogy of Fallot, renal and gastrointestinal changes, among others [1,3,4,7]. \n\nOur patient presented typical manifestations of the syndrome, including the classic triad, despite the less common involvement on the left side, as a mandibular hypoplasia with facial asymmetry, vertebral changes and ocular-auricular changes, such as choristoma and absence of formation of the outer and middle ear. However, despite the clinical diagnosis, the genetic study was not performed due to the impossibility of access by the patient.\n\nThe etiopathogenesis of the disease is still not well known and the hypothesis of a multifactorial etiology involving nutritional and environmental factors together with genetic dysregulation is accepted [2,3,7]. However, in most cases, the syndrome is sporadic [2,3,5]. \n\nA defect in the embryonic period with imbalance in cells during blastogenesis affects the derivatives of the first and second brachial arches explaining the manifestations of the syndrome [8]. Chromosomal aberrations such as 3del (5p), del (6q), del (8q) (161), del (18q), del (22q), recombinant chromosome 18, ring chromosome 21 and dup (22q), maternal and fetal hypoxia, hypertension, maternal diabetes, influenza or rubella viral infection, malnutrition, smoking, radio-diagnostic procedures between the 4th and the 6th week of pregnancy, exposure to drugs such as cocaine, tamoxifen, ibuprofen, retinoic acid and consanguineous marriage are possible predisposing factors [1,3,4,6,7]. \n\nReassessing the history of our patient, some risk factors for the occurrence of the syndrome were presented, such as the history of gestational diabetes mellitus and the use of ibuprofen during the first trimester of pregnancy. However, there was not any report of a history of genetic syndromes in the patient’s family. Therefore, it was believed that it was possibly a sporadic manifestation, our patient being the first case to occur in his family.\n\nConclusion\nThis article described a case of Goldenhar syndrome that remained more than a decade without investigation, diagnosis, treatment and adequate multidisciplinary follow-up, even causing significant permanent damage to the visual acuity of the left eye. Because its clinical characteristics were exuberant and easily visible at ectoscopy, GS was not a major diagnostic challenge.\n\nThe patient had serious psychosocial consequences due to the stigma caused by school bullying that resulted in social and educational damage. Early diagnosis could have helped prevent this social stigma in addition to early intervention trying to avoid amblyopia, depression, low self-esteem, school failures and social damage.\n\nThe importance of knowing the syndrome in its broad spectrum of changes was therefore emphasized. The extreme relevance of the multidisciplinary approach in these patients was also emphasized, since the impact on quality of life was significantly high.\n\nConflict of Interest\n\nNone. All authors have no conflict of interest in this work. All authors contributed equally to this work.\n\nInformed Consent\n\nThe authors certify that they have obtained all appropriate patient consent forms. The patient gave his consent for his images and other clinical information to be reported in the journal, in the signed form. The patient understood that his name and initials will not be published and due efforts will be made to conceal his identity, but anonymity cannot be guaranteed.\n\nAuthorization for the use of human subjects\n\nThe research related to human use complies with all the relevant national regulations, institutional policies, is in accordance with the tenets of the Helsinki Declaration, and has been approved by the Ethics Committee of the Eye Plastic Department of Instituto de Olhos Ciências Médicas.\n\nAcknowledgements\n\n None.\n\nSources of Funding\n\nNone.\n\nDisclosures\n\nNone.\n==== Refs\n1 Speranta S Miruna B Dana D Ioana Claudia P Goldenhar Syndrome - ophthalmologist´s perspective Rom J Ophthalmol 2018 62 2 96 104 30206552 \n2 Bogusiak K Puch A Arkuszewski P Goldenhar syndrome: current perspectives World J Pediatr 2017 13 5 405 415 28623555 \n3 Jahanimoghadam F Sharifi M Goldenhar Syndrome in a 6-year-old patient: a Case Report and Review of Literature J Dent 2019 20 4 298 303 \n4 Vong A Funamura J Multidisciplinary management of oculo-auriculo-vertebral spectrum Curr Opin Otolaryngol Head Neck Surg 2018 26 4 234 241 29847352 \n5 Rajabi MT Ramezani K Lipodermoid Cyst: A report of rare caruncular case Middle East Afr J Ophthalmol 2015 22 4 528 530 26692732 \n6 Hofmann E Detterbeck A Chepura T Kirschneck C Schmid M Hirschfelder U Oculoauriculovertebral spectrum and maxillary sinus volumes J Orofac Orthop 2018 79 4 259 266 29947815 \n7 Kushwaha RK Singh A Mohta A Jain SK Goldenhar syndrome: A report of two cases Indian Dermatol Online J 2019 10 6 719 720 31807458 \n8 Khong JJ Hardy TG McNab AA Prevalence of Oculo-auriculo-vertebral Spectrum in Dermolipoma Ophthalmology 2013 120 8 1529 1532 23683920\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2457-4325",
"issue": "64(4)",
"journal": "Romanian journal of ophthalmology",
"keywords": "Goldenhar syndrome; choristoma; craniofacial microsomia; dermoid cyst",
"medline_ta": "Rom J Ophthalmol",
"mesh_terms": "D000015:Abnormalities, Multiple; D000293:Adolescent; D005124:Eye Abnormalities; D006053:Goldenhar Syndrome; D006801:Humans; D008297:Male; D011788:Quality of Life",
"nlm_unique_id": "101677459",
"other_id": null,
"pages": "444-448",
"pmc": null,
"pmid": "33367184",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "23683920;30206552;29847352;31807458;29947815;28623555;26692732;31875178",
"title": "Goldenhar syndrome: the importance of an ophthalmological approach.",
"title_normalized": "goldenhar syndrome the importance of an ophthalmological approach"
} | [
{
"companynumb": "BR-SUN PHARMACEUTICAL INDUSTRIES LTD-2021R1-279981",
"fulfillexpeditecriteria": "1",
"occurcountry": "BR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "IBUPROFEN"
},
"druga... |
{
"abstract": "BACKGROUND\nDespite the many side effects solutions of kitchen salt are still being used as efficient and safe homemade emetics.\n\n\nMETHODS\nSaturated solutions of kitchen salt have been used by paramedics to provoke vomiting in two patients: a 50-years-old woman and a 44-years-old man. According to anamnesis patients received respectively around 330 and 500 g of dissolved kitchen salt. In both cases bloody emesis and bloody diarrhea, alteration of consciousness and low blood pressure were noted. Maximum blood sodium level was 177 and 173 mmol/l respectively. Due to signs of gastrointestinal bleeding gastric endoscopy was performed in both cases, which demonstrated widespread damage of gastric mucosa. Normalization of electrolyte disturbances and improvement of patients' status was achieved with intravenous infusion of 5% glucose. Both patients have been discharged to further outpatient treatment after 10-days hospitalization.\n\n\nCONCLUSIONS\n1. Use of salt kitchen solutions to induce emesis results in a high risk of life-threatening complications. 2. Particular emphasis must be put on training of paramedics in pre-hospital management of acute poisonings.",
"affiliations": "Zakład Toksykologii Klinicznej, Gdańskiego Uniwersytetu Medycznego.",
"authors": "Wiśniewski|Marek|M|;Waldman|Wojciech|W|;Sein Anand|Jacek|J|",
"chemical_list": "D012965:Sodium Chloride",
"country": "Poland",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0033-2240",
"issue": "68(8)",
"journal": "Przeglad lekarski",
"keywords": null,
"medline_ta": "Przegl Lek",
"mesh_terms": "D000328:Adult; D005260:Female; D005440:Fluid Therapy; D006471:Gastrointestinal Hemorrhage; D006801:Humans; D006955:Hypernatremia; D007022:Hypotension; D007049:Iatrogenic Disease; D008297:Male; D008875:Middle Aged; D012965:Sodium Chloride; D014474:Unconsciousness; D014839:Vomiting",
"nlm_unique_id": "19840720R",
"other_id": null,
"pages": "557-9",
"pmc": null,
"pmid": "22010467",
"pubdate": "2011",
"publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "Iatrogenic hypernatremia--report of two cases.",
"title_normalized": "iatrogenic hypernatremia report of two cases"
} | [
{
"companynumb": "PL-PFIZER INC-2015348387",
"fulfillexpeditecriteria": "1",
"occurcountry": "PL",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "AMLODIPINE BESYLATE"
},
"drugadditional": null... |
{
"abstract": "A 47-year-old woman with family history of autosomal-dominant polycystic kidney disease (ADPKD), who underwent living-donor kidney transplantation in 2000, presented with recurrent edema, hyperreninemia, and hyperaldosteronism. Since 2002, her antihypertensive therapy comprised ramipril and spironolactone. The post-transplantation kidney function was stable. Based on the clinical picture and reports of renin secretion by renal cysts in ADPKD, we performed a trial of aliskiren therapy (300 mg/day). The patient showed excellent blood pressure control and reduction of edema, with aldosterone levels normalizing within 2 months. This is a novel report of aliskiren therapy for treatment of edema, hyperreninemia, and hyperaldosteronism in ADPKD.",
"affiliations": "Department of Internal Medicine, University of Basel, Division of Nephrology, Kantonsspital, Liestal, Switzerland.",
"authors": "Amico|P|P|;Kalbermatter|S|S|;Kiss|D|D|",
"chemical_list": "D000577:Amides; D005650:Fumarates; C446481:aliskiren; D012083:Renin",
"country": "Germany",
"delete": false,
"doi": "10.5414/cnp72237",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0301-0430",
"issue": "72(3)",
"journal": "Clinical nephrology",
"keywords": null,
"medline_ta": "Clin Nephrol",
"mesh_terms": "D000577:Amides; D005260:Female; D005650:Fumarates; D006801:Humans; D006929:Hyperaldosteronism; D008875:Middle Aged; D016891:Polycystic Kidney, Autosomal Dominant; D012008:Recurrence; D012074:Remission Induction; D012083:Renin",
"nlm_unique_id": "0364441",
"other_id": null,
"pages": "237-9",
"pmc": null,
"pmid": "19761733",
"pubdate": "2009-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Aliskiren corrects recurrent hyperreninemia and hyperaldosteronism in autosomal dominant polycystic kidney disease.",
"title_normalized": "aliskiren corrects recurrent hyperreninemia and hyperaldosteronism in autosomal dominant polycystic kidney disease"
} | [
{
"companynumb": "CH-SUN PHARMACEUTICAL INDUSTRIES LTD-2021RR-280503",
"fulfillexpeditecriteria": "1",
"occurcountry": "CH",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SPIRONOLACTONE"
},
"... |
{
"abstract": "BACKGROUND\nImmune checkpoint inhibitors have transformed the field of oncology moving immuno-oncology to the forefront of cancer treatment. However, immune checkpoint inhibitors can result in serious immune-related adverse events. Hematologic toxicities are rare with incidence of neutropenia from nivolumab less than 1%.\n\n\nMETHODS\nWe present a case of refractory neutropenia in a 75-year-old woman with ulcerative colitis on adjuvant nivolumab for stage III melanoma.\nThe patient's neutropenia did not improve with high-dose intravenous steroids, filgrastim, mycophenolate mofetil, or intravenous immunoglobulin. She also developed significant neurological symptoms from nivolumab. She was transitioned to comfort measures given her persistent symptoms and poor functional status.\n\n\nCONCLUSIONS\nThough hematologic malignancies of immune checkpoint inhibitors are rare, they should be considered after other diagnoses are excluded. We discuss the serious immune-related adverse effects of immune checkpoint inhibitors in a patient with an underlying autoimmune disease and general treatment approaches.",
"affiliations": "Department of Medicine, Division of Hematology/Oncology, Tufts Medical Center, Boston, USA.;Department of Medicine, Division of Hematology/Oncology, Tufts Medical Center, Boston, USA.",
"authors": "Patel|Rima|R|https://orcid.org/0000-0003-3486-3085;Pai|Lori|L|",
"chemical_list": "D000077594:Nivolumab",
"country": "England",
"delete": false,
"doi": "10.1177/1078155219862341",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1078-1552",
"issue": "26(3)",
"journal": "Journal of oncology pharmacy practice : official publication of the International Society of Oncology Pharmacy Practitioners",
"keywords": "Immunotherapy; melanoma; neutropenia",
"medline_ta": "J Oncol Pharm Pract",
"mesh_terms": "D000368:Aged; D003093:Colitis, Ulcerative; D005260:Female; D006801:Humans; D007167:Immunotherapy; D008545:Melanoma; D009503:Neutropenia; D000077594:Nivolumab",
"nlm_unique_id": "9511372",
"other_id": null,
"pages": "730-734",
"pmc": null,
"pmid": "31315551",
"pubdate": "2020-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Immunotherapy-induced severe neutropenia with neurotoxicity: A case of a 75-year-old woman with ulcerative colitis diagnosed with melanoma.",
"title_normalized": "immunotherapy induced severe neutropenia with neurotoxicity a case of a 75 year old woman with ulcerative colitis diagnosed with melanoma"
} | [
{
"companynumb": "US-BEH-2019105879",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": null,
"... |
{
"abstract": "Neutropenia is an adverse effect of various pharmacological therapies, including antipsychotics. Among the second-generation antipsychotic (SGA) medications, clozapine is most notable for neutropenic adverse effect. Risperidone, another SGA drug, is linked mainly with metabolic adverse effects, but rarely, blood dyscrasia adverse reactions have been reported. Hence, we report the case of a 56-year-old African American woman who developed severe neutropenia following two weeks of oral risperidone treatment. Her neutrophil levels returned to normal limits following discontinuation of risperidone and switching to haloperidol.",
"affiliations": "Department of Psychiatry, Interfaith Medical Center, Brooklyn, NYC, NY, USA.;Department of Psychiatry, Interfaith Medical Center, Brooklyn, NYC, NY, USA.;Department of Psychiatry, Interfaith Medical Center, Brooklyn, NYC, NY, USA.;Department of Psychiatry, Interfaith Medical Center, Brooklyn, NYC, NY, USA.;Department of Psychiatry, Interfaith Medical Center, Brooklyn, NYC, NY, USA.;Department of Psychiatry, Interfaith Medical Center, Brooklyn, NYC, NY, USA.;Department of Psychiatry, Interfaith Medical Center, Brooklyn, NYC, NY, USA.",
"authors": "Atolagbe|Ayodele|A|;Nkemjika|Stanley|S|https://orcid.org/0000-0001-7592-5487;Popoola|Olusegun|O|;Oladeji|Oluwatoyin|O|;Kogan|Irina|I|;Saeed|Haroon|H|;Olupona|Tolulope|T|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2021/3980872",
"fulltext": "\n==== Front\nCase Rep Psychiatry\nCase Rep Psychiatry\nCRIPS\nCase Reports in Psychiatry\n2090-682X\n2090-6838\nHindawi\n\n10.1155/2021/3980872\nCase Report\nRisperidone-Induced Neutropenia in a Schizophrenic Patient: A Case Report and Literature Review\nAtolagbe Ayodele 1\nhttps://orcid.org/0000-0001-7592-5487\nNkemjika Stanley snkemjika@interfaithmedical.org\n1 2\nPopoola Olusegun 1\nOladeji Oluwatoyin 1\nKogan Irina 1\nSaeed Haroon 1\nOlupona Tolulope 1\n1Department of Psychiatry, Interfaith Medical Center, Brooklyn, NYC, NY, USA\n2Department of Population Health Sciences, School of Public Health, Georgia State University, Atlanta, GA, USA\nAcademic Editor: Erik J nsson\n\n2021\n17 8 2021\n2021 398087211 5 2021\n10 8 2021\nCopyright © 2021 Ayodele Atolagbe et al.\n2021\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.\nNeutropenia is an adverse effect of various pharmacological therapies, including antipsychotics. Among the second-generation antipsychotic (SGA) medications, clozapine is most notable for neutropenic adverse effect. Risperidone, another SGA drug, is linked mainly with metabolic adverse effects, but rarely, blood dyscrasia adverse reactions have been reported. Hence, we report the case of a 56-year-old African American woman who developed severe neutropenia following two weeks of oral risperidone treatment. Her neutrophil levels returned to normal limits following discontinuation of risperidone and switching to haloperidol.\n==== Body\n1. Introduction\n\nAntipsychotic-related hematologic abnormalities have been reported in the literature [1] but remain a rare complication of some second-generation antipsychotic (SGA) medications [2]. This complication may be life-threatening as it exposes patients to infectious susceptibility following bone marrow suppression. Neutropenia, defined as a consistently low (<1500/μL) absolute neutrophil count (ANC), can be due to reduced production or increased peripheral destruction [3]. The United States Food and Drug Administration (FDA) class warning on second generation antipsychotics reports possible adverse effect of blood dyscrasias, in the form of leukopenia, neutropenia, and agranulocytosis [4]. Hence, tricyclic antipsychotics such as the phenothiazines have been reported to cause neutropenia [5]. More notorious among the second-generation antipsychotic agents is clozapine, a dibenzodiazepine with a documented risk of agranulocytosis [6]. Though several antipsychotics might be related to leukopenia and neutropenia [7] risperidone, a benzisoxazole, has been reported to cause neutropenia in rare conditions [8]. It is noteworthy that the specific pathophysiology of these antipsychotic-induced neutropenias is still unclear [4, 9]. However, probable causes have been reported as stemming from the drug's effect on white blood cell (WBC) precursors, and as a result, protocols have been mandatory for regular monitoring of WBCs and ANCs included in computer-based registries of patients on clozapine treatment [6]. Though risperidone, olanzapine, and other antipsychotics do not have the same monitoring regulatory process as clozapine, neutropenia has been reported as a rare side effect of risperidone pharmacotherapy. Additionally, there is no evidence in the literature of risperidone-induced neutropenia in patients with past risperidone therapy exposure. Hence, we report a case of leukopenia and neutropenia occurring during treatment with risperidone in a chronic schizophrenic patient with comorbid hypertension and mild liver cirrhosis, which were resolved few days after the change of medication to a first-generation antipsychotic.\n\n2. Case Report\n\nA 48-year-old African American female was brought in by the emergency medical service on account of worsening agitation and aggressive behavior. The patient, who had a past history of hypertension and mild liver cirrhosis and a psychiatric history of schizophrenia, had been poorly compliant with her antipsychotic medications for the last two years. On presentation, the patient was very talkative; refused to follow safety instructions; exhibited poor frustration tolerance, poor impulse control, and poor reality testing; and appeared internally preoccupied. She endorsed auditory hallucinations and exhibited disorganized speech and behavior. A review of prior medication trial included mainly the first-generation antipsychotic (FGA) agents and risperidone therapy as the only second generation antipsychotic (SGA). She was subsequently admitted to the inpatient psychiatric unit and started on risperidone, with the plan of transitioning to a long acting injectable (LAI) paliperidone palmitate.\n\nHowever, the patient refused to take any medications for the first 14 days of admission and was given emergency intramuscular injection of haloperidol 5 mg and lorazepam 2 mg pro re nata (PRN) several times following aggressive behavior in the unit. By the 14th day of admission, the patient was commenced on treatment over objection court ruling management plan. The patient started taking risperidone orally disintegrating tablets 1 mg twice daily, which was gradually uptitrated to 3 mg twice daily by day 22 after admission. Following part of care management, patient's WBC count at presentation, on day 1, was 4,300/μL [reference interval: 4500-11,000/μL], ANC was 1800/μL [Ref: 2000-7900/μL], and platelet count was 258,000/μL [Ref: 130,000-400,000/μL]. On day 24, she was noted to have isolated neutropenia: WBC 2800/μL, ANC 514/μL. A repeated ANC on day 26 could not be estimated. During this time, the patient was only on risperidone. The patient was asymptomatic as she had normal vital signs, and there were no signs of extrapyramidal side effects. The patient's rapid plasma reagin (RPR) titer was within normal limit, SARS-COVID-19 polymerase chain reaction (PCR) test was not reactive, and hepatitis A and hepatitis B antibody titers were within normal limits. Her chest radio imaging and electrocardiogram reports were unremarkable. The patient's prothrombin time and international normalized ratio (INR) was 12.1 s [Ref: 9.8-13.4 s] and 1.04 [Ref: 0.85-1.15], respectively. Hemoglobin A1c (HbA1c) was 5.7% [Ref: 4.8-5.6%]. Her serum beta human chorionic gonadotropin (beta-hCG), serum electrolytes, blood urea nitrogen, creatinine, liver transaminases, and alkaline phosphatase were unremarkable. The patient's retroviral test was negative as well.\n\nRisperidone therapy was discontinued on day 24 of her inpatient stay. The patient was commenced on FGA haloperidol 2 mg by mouth twice daily following termination of risperidone. The haloperidol dose was titrated to 5 mg twice daily and subsequently 10 mg twice daily due to persistent psychotic symptoms. Following the discontinuation of risperidone, monitoring of ANC on day 39 showed a progressive increase to 1100/μL.\n\n3. Discussion\n\nRisperidone is a commonly used SGA in both the inpatient and outpatient psychiatric settings. Though there is documented evidence of adverse metabolic effects with risperidone pharmacotherapy, this was not evident in our patient. Instead, a neutropenia was evident, which resolved following termination of risperidone pharmacotherapy. Our patient did not have symptoms of acute viral illness and laboratory testing for other possible causes of neutropenia was negative. Cases of drug-induced neutropenia purely attributable to risperidone therapy are uncommon in the literature.\n\nWe conducted a review of the literature on the EMBASE, PSYCHINFO, and PubMed databases regarding the evidence on the adverse presentation of risperidone-induced leukopenia. The search results were suggestive that there is a gap in the literature on the topic as there are various reports on the relationship. Additionally, there are also synergistic and augmented pharmacologic effects on neutropenia. Evidence from literature shows that psychotropic drug-related neutropenia could be attributable to hereditary factors, commonly seen in the African American population and typically identified at an early age [10]. Other documented attributable factors are higher doses of neuroleptics, male gender, and neuroleptic naivety. Our case did not have the background attributable factors except for her racial origin. Based on these facts, this patient has been on risperidone treatment for multiple years without prior evident neutropenia; this suggests that the idea of race may not have been a probable cause of risperidone-induced neutropenia (RIN). Also, considering the chronicity of the patient's psychiatric condition with regard to her multiple hospitalizations, the concept of neuroleptic naivety does not apply to this case. Hence, an incidental finding of neutropenia a few days of commencement of risperidone therapy in the absence of any identifiable cause is exceptional.\n\nIn terms of pathophysiology, the documented body of evidence suggests that clozapine-induced neutropenia typically occurs within the first 18 weeks of treatment [11, 12], while RIN pathogenesis remains unknown and still needs further studies. Etiologically, using animal studies, it has been hypothesized that risperidone metabolites cause bone marrow suppression. Other postulated etiologies include decreased marrow neutrophil production, increased peripheral destruction of neutrophils by risperidone, and the role of the treated dendritic cell, which produced tumor necrosis factor-alpha- (TNF-α-) induced neutrophil death in vitro. Alternatively, this could also be attributable to immunomodulatory activities in genetically susceptible individuals, though this has not been fully explored in literature [13].\n\nAccording to [14], patients with drug-induced neutropenia can typically continue such treatment if neutropenia is mild (above 1000/μL) [14]. This guideline also applies to antipsychotic-related causes. Alternatively, medication dose tapering might be considered in benign neutropenia occurrence [14]. In this case report, considering the moderate to severe neutropenic state and the patient's comorbid medical problems—hypertension and mild liver cirrhosis, we switched from risperidone to a first-generation antipsychotic with a successful resolution. Other authors have reported successful resolution following a switch to another second-generation antipsychotic such as olanzapine [3, 15, 16]. Recombinant human granulocyte-cerebrospinal fluid therapy has been reported, and work up for other possible etiologies may be considered if neutropenia fails to resolve with other treatment modalities such as cessation of the causing agent [3, 15].\n\n4. Conclusion\n\nRisperidone-induced neutropenia is very unusual, and its incidence rate is unknown [3, 15–17]. Presently, there are no evidence-based alternative antipsychotic recommendations for incidental RIN. For the case presented here, we achieved a resolution of risperidone-induced severe neutropenia by changing to a haloperidol. Hence, a switch back to FGA medication could be an alternate treatment plan for such a scenario. Alternatively, olanzapine might also be a safe alternative in patients, who develop neutropenia on clozapine or risperidone. Additionally, olanzapine is ideal for adverse severe extrapyramidal symptoms from the first-generation neuroleptics [3, 15, 16].\n\nCurrently, there is no ANC monitoring requirement guideline for patients on risperidone treatment. Hence, we infer that routine monitoring of patients' ANC level on risperidone treatment irrespective of their hematological baseline might be good practice for all psychiatrists. We do recommend the extension of this practice to both the inpatient and outpatient service settings. Finally, clinicians should ensure routine hematologic evaluation for individuals with past or present histories of dyscrasias as part of the risperidone therapeutic management.\n\nConflicts of Interest\n\nThe authors declare that they have no conflicts of interest.\n==== Refs\n1 Hall R. L. Smith A. G. Edwards J. G. Haematological safety of antipsychotic drugs Expert opinion on drug safety 2003 2 4 395 399 10.1517/14740338.2.4.395 2-s2.0-0141818256 12904095\n2 Seeman M. V. Secondary effects of antipsychotics: women at greater risk than men Schizophrenia bulletin 2009 35 5 937 948 10.1093/schbul/sbn023 2-s2.0-69249118537 18400811\n3 Mahmood T. Silverstone T. Spittle B. Risperidone appears safe in patients with antipsychotic-induced blood dyscrasias International clinical psychopharmacology 1996 11 1 53 54 10.1097/00004850-199603000-00007 2-s2.0-0029940827 8732314\n4 Chokhawala K. Stevens L. Antipsychotic Medications 2020 Stat Pearls, Stat Pearls Publishing\n5 Correll C. U. Detraux J. De Lepeleire J. De Hert M. Effects of antipsychotics, antidepressants and mood stabilizers on risk for physical diseases in people with schizophrenia, depression and bipolar disorder World psychiatry: official journal of the World Psychiatric Association (WPA) 2015 14 2 119 136 10.1002/wps.20204 2-s2.0-84930444696 26043321\n6 Honigfeld G. Effects of the clozapine national registry system on incidence of deaths related to agranulocytosis Psychiatric services (Washington, D.C.) 1996 47 1 52 56 10.1176/ps.47.1.52 2-s2.0-0030046794\n7 Orsolini L. De Berardis D. Volpe U. Up-to-date expert opinion on the safety of recently developed antipsychotics Expert Opinion on Drug Safety 2020 19 8 981 998 10.1080/14740338.2020.1795126 32657173\n8 Meylan C. Reversible neutropenia during a cold: possible involvement of risperidone? A case report European neuropsychopharmacology: the journal of the European College of Neuropsychopharmacology 1995 5 1 1 2 10.1016/0924-977x(94)00125-u 2-s2.0-0029201338 7542050\n9 Flanagan R. J. Dunk L. Haematological toxicity of drugs used in psychiatry Human psychopharmacology 2008 23 Supplement 1 S27 S41 10.1002/hup.917 2-s2.0-38649101300\n10 Okhuijsen-Pfeifer C. Ayhan Y. Lin B. D. Genetic susceptibility to clozapine-induced agranulocytosis/neutropenia across ethnicities: results from a new cohort of Turkish and other Caucasian participants, and meta-analysis Schizophrenia Bulletin Open 2020 1 1 10.1093/schizbullopen/sgaa024\n11 De Berardis D. Rapini G. Olivieri L. Safety of antipsychotics for the treatment of schizophrenia: a focus on the adverse effects of clozapine Therapeutic advances in drug safety 2018 9 5 237 256 10.1177/2042098618756261 2-s2.0-85041658243 29796248\n12 Mijovic A. MacCabe J. H. Clozapine-induced agranulocytosis Annals of hematology 2020 99 11 2477 2482 10.1007/s00277-020-04215-y 32815018\n13 Drzyzga Ł. Obuchowicz E. Marcinowska A. Herman Z. S. Cytokines in schizophrenia and the effects of antipsychotic drugs Brain, behavior, and immunity 2006 20 6 532 545 10.1016/j.bbi.2006.02.002 2-s2.0-33749517666\n14 Newburger P. E. Dale D. C. Evaluation and management of patients with isolated neutropenia Seminars in hematology 2013 50 3 198 206 10.1053/j.seminhematol.2013.06.010 2-s2.0-84881588821 23953336\n15 Kailasam V. K. Chima V. Nnamdi U. Sharma K. Shah K. Risperidone-Induced Reversible Neutropenia Neuropsychiatric disease and treatment 2017 13 1975 1977 10.2147/NDT.S141472 2-s2.0-85026647905 28794632\n16 Tseng C. C. Neutropenia during risperidone treatment The Journal of neuropsychiatry and clinical neurosciences 2011 23 4, article E19 10.1176/jnp.23.4.jnpe19 22231329\n17 Biswas A. Risperidone induced cytopenias The Journal of the Association of Physicians of India 2000 48 11 1122 1123 11310398\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-6838",
"issue": "2021()",
"journal": "Case reports in psychiatry",
"keywords": null,
"medline_ta": "Case Rep Psychiatry",
"mesh_terms": null,
"nlm_unique_id": "101583308",
"other_id": null,
"pages": "3980872",
"pmc": null,
"pmid": "34447597",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "32815018;28794632;18400811;12904095;11310398;7542050;23953336;26043321;32657173;8925346;22231329;8732314;18098216;16580814;29796248",
"title": "Risperidone-Induced Neutropenia in a Schizophrenic Patient: A Case Report and Literature Review.",
"title_normalized": "risperidone induced neutropenia in a schizophrenic patient a case report and literature review"
} | [
{
"companynumb": "US-DRREDDYS-SPO/USA/21/0140182",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "RISPERIDONE"
},
"drugadditional": "1",
... |
{
"abstract": "OBJECTIVE\nTo evaluate the observed incidence of acute kidney injury (AKI) in adult patients receiving either piperacillin-tazobactam and vancomycin or cefepime-vancomycin for more than 48 hours.\n\n\nMETHODS\nRetrospective matched cohort.\n\n\nMETHODS\nLarge academic medical center.\n\n\nMETHODS\nAdult patients without preexisting renal dysfunction admitted over an 8-month time period who received either the combination of piperacillin-tazobactam and vancomycin or cefepime-vancomycin for more than 48 hours were evaluated for AKI, defined by the Acute Kidney Injury Network criteria.\n\n\nRESULTS\nA total of 224 patients receiving either antimicrobial combination were evaluated for AKI. The incidence of AKI was significantly higher in the piperacillin-tazobactam and vancomycin group (34.8%) compared with the cefepime-vancomycin group (12.5%) in the unmatched analysis (p<0.0001). After adjusting for potential sources of bias through propensity score matched pairs and conditional logistic regression, piperacillin-tazobactam and vancomycin combination therapy (p=0.003) was an independent predictor of AKI. There were no significant differences in time to AKI or hospital length of stay between groups.\n\n\nCONCLUSIONS\nThe results of this study suggest that there may be an association between piperacillin-tazobactam and vancomycin combination therapy and increased incidence of AKI.",
"affiliations": "UF Health Jacksonville, Jacksonville, Florida.",
"authors": "Gomes|Diane M|DM|;Smotherman|Carmen|C|;Birch|Amy|A|;Dupree|Lori|L|;Della Vecchia|Bethany J|BJ|;Kraemer|Dale F|DF|;Jankowski|Christopher A|CA|",
"chemical_list": "D000900:Anti-Bacterial Agents; D002511:Cephalosporins; D000077725:Piperacillin, Tazobactam Drug Combination; D014640:Vancomycin; D000077723:Cefepime; D010397:Penicillanic Acid; D010878:Piperacillin",
"country": "United States",
"delete": false,
"doi": "10.1002/phar.1428",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0277-0008",
"issue": "34(7)",
"journal": "Pharmacotherapy",
"keywords": "acute kidney injury; cefepime; nephrotoxicity; piperacillin-tazobactam; vancomycin",
"medline_ta": "Pharmacotherapy",
"mesh_terms": "D058186:Acute Kidney Injury; D000328:Adult; D000368:Aged; D000900:Anti-Bacterial Agents; D000077723:Cefepime; D002511:Cephalosporins; D015331:Cohort Studies; D004359:Drug Therapy, Combination; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D010397:Penicillanic Acid; D010878:Piperacillin; D000077725:Piperacillin, Tazobactam Drug Combination; D012189:Retrospective Studies; D016896:Treatment Outcome; D014640:Vancomycin",
"nlm_unique_id": "8111305",
"other_id": null,
"pages": "662-9",
"pmc": null,
"pmid": "24753221",
"pubdate": "2014-07",
"publication_types": "D003160:Comparative Study; D016428:Journal Article",
"references": null,
"title": "Comparison of acute kidney injury during treatment with vancomycin in combination with piperacillin-tazobactam or cefepime.",
"title_normalized": "comparison of acute kidney injury during treatment with vancomycin in combination with piperacillin tazobactam or cefepime"
} | [
{
"companynumb": "US-BAXTER-2014BAX045532",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "VANCOMYCIN"
},
"drugadditional": null,
... |
{
"abstract": "Myeloproliferative neoplasm (MPN)-associated myelofibrosis is a MPN characterized by bone marrow fibrosis, cytopenias, splenomegaly and constitutional symptoms. Pomalidomide, an immune-modifying drug, is reported to improve anaemia and thrombocytopenia in some patients with MPN-associated myelofibrosis. We designed a phase 2 study of pomalidomide in patients with MPN-associated myelofibrosis and anaemia and/or thrombocytopenia and/or neutropenia. Subjects received pomalidomide 2.0 mg/day in cohort 1 (n=38) or 0.5 mg/day in cohort 2 (n=58). Prednisolone was added if there was no response after 3 months in cohort 1 and based on up-front randomization in cohort 2 if there was no response at 3 or 6 months. Response rates were 39% (95% confidence interval (CI), 26-55%) in cohort 1 and 24% (95% CI, 15-37%) in cohort 2. In a multivariable logistic regression model pomalidomide at 2.0 mg/day (odds ratio (OR), 2.62; 95% CI, 1.00-6.87; P=0.05) and mutated TET2 (OR, 5.07; 95% CI, 1.16-22.17; P=0.03) were significantly associated with responses. Median duration of responses was 13.0 months (range 0.9-52.7). There was no significant difference in response rates or duration in subjects receiving or not receiving prednisolone. Clinical trial MPNSG 01-09 is registered at ClinicalTrials.gov (NCT00949364) and clinicaltrialsregister.eu (EudraCT Number: 2009-010738-23).",
"affiliations": "Department of Internal Medicine III, University Hospital of Ulm, Ulm, Germany.;Department of Internal Medicine III, University Hospital of Ulm, Ulm, Germany.;Hematology and Oncology, University Hospital Mannheim, Mannheim, Germany.;Department of Internal Medicine IV, University Hospital Aachen, Aachen, Germany.;Department of Hematology, Oncology and Clinical Immunology, University Hospital Düsseldorf, Düsseldorf, Germany.;Department of Hematology and Oncology, Stauferklinikum Mutlangen, Mutlangen, Germany.;Department of Internal Medicine I, University Hospital and Faculty of Medicine, University of Freiburg, Freiburg, Germany.;Internal Medicine II, Jena University Hospital, Jena, Germany.;Department of Internal Medicine I, University Hospital Dresden and GP Hematology and Oncology, Dresden, Germany.;Department of Internal Medicine II, University Hospital Hamburg, Hamburg, Germany.;Department of Hematology and Oncology, Charité, Campus Benjamin Franklin, Berlin, Germany.;Center of Outpatient Hematology and Oncology, Bonn, Germany.;Department of Hematology and Oncology, University Hospital Magdeburg, Magdeburg, Germany.;Department of Pathology, University of Freiburg, Freiburg, Germany.;Department of Pathology, Hannover Medical School, Hannover, Germany.;Department of Internal Medicine III, University Hospital of Ulm, Ulm, Germany.;Division of Biostatistics, German Cancer Research Center, Heidelberg, Germany.;Department of Internal Medicine III, University Hospital of Ulm, Ulm, Germany.;Department of Oncology, Klinikum Minden, Minden, Germany.;Department of Internal Medicine III, University Hospital of Ulm, Ulm, Germany.",
"authors": "Schlenk|R F|RF|;Stegelmann|F|F|;Reiter|A|A|;Jost|E|E|;Gattermann|N|N|;Hebart|H|H|;Waller|C|C|;Hochhaus|A|A|;Platzbecker|U|U|;Schafhausen|P|P|;Blau|I W|IW|;Verbeek|W|W|;Heidel|F H|FH|;Werner|M|M|;Kreipe|H|H|;Teleanu|V|V|;Benner|A|A|;Döhner|H|H|;Grießhammer|M|M|;Döhner|K|K|",
"chemical_list": "D015415:Biomarkers; D007155:Immunologic Factors; D013792:Thalidomide; D011239:Prednisolone; C467566:pomalidomide",
"country": "England",
"delete": false,
"doi": "10.1038/leu.2016.299",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0887-6924",
"issue": "31(4)",
"journal": "Leukemia",
"keywords": null,
"medline_ta": "Leukemia",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D000483:Alleles; D015415:Biomarkers; D002871:Chromosome Banding; D005260:Female; D006801:Humans; D007155:Immunologic Factors; D008297:Male; D008875:Middle Aged; D009154:Mutation; D009196:Myeloproliferative Disorders; D010641:Phenotype; D011239:Prednisolone; D055728:Primary Myelofibrosis; D013792:Thalidomide; D016896:Treatment Outcome",
"nlm_unique_id": "8704895",
"other_id": null,
"pages": "889-895",
"pmc": null,
"pmid": "27774990",
"pubdate": "2017-04",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't",
"references": "17728787;22186996;26287468;20567020;15057291;20052748;25047979;20008785;21537334;19652059;25596267;25499808;20651070;20560961;22430270;21052089;16675707;15781101;19009291;20944670;20601953;16834459;20692036;23890523;22431577;25897239",
"title": "Pomalidomide in myeloproliferative neoplasm-associated myelofibrosis.",
"title_normalized": "pomalidomide in myeloproliferative neoplasm associated myelofibrosis"
} | [
{
"companynumb": "DE-CELGENEUS-062-C4047-11031330",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": null,... |
{
"abstract": "Congenital adrenal hyperplasia (CAH) is characterized by adrenal steroid biosynthesis defect. Steroid replacement therapy should be performed regularly in these patients. Adrenal crisis may be present in acute stress due to increased cortisol requirements or in steroid deficiency due to stopping steroid medication abruptly. In patients with acute adrenal insufficiency, severe hypotension or hypovolemic shock occurs typically. Acute encephalopathy can be seen due to hypoxia, hypervolemia, or hypoglycemia. Diffusion restriction can be seen in cortical-subcortical regions of frontal and parieto-occipital lobes and in splenium of corpus callosum. In CAH patients with neurologic symptoms, Diffusion weighted images (DWI) is very important in the diagnosis and follow-up of acute encephalopathy.",
"affiliations": "Department of Radiology, Faculty of Medicine, Bezmialem Vakif University, Istanbul, Turkey.;Department of Radiology, Faculty of Medicine, Bezmialem Vakif University, Istanbul, Turkey.;Department of Pediatrics, Faculty of Medicine, Bezmialem Vakif University, Istanbul, Turkey.",
"authors": "Serter|Asli|A|;Alkan|Alpay|A|;Demirkol|Demet|D|",
"chemical_list": null,
"country": "India",
"delete": false,
"doi": "10.4103/0972-2327.152086",
"fulltext": "\n==== Front\nAnn Indian Acad NeurolAnn Indian Acad NeurolAIANAnnals of Indian Academy of Neurology0972-23271998-3549Medknow Publications & Media Pvt Ltd India AIAN-18-34210.4103/0972-2327.152086Case ReportDiffusion MRI features of acute encephalopathy due to stopping steroid medication abruptly in congenital adrenal hyperplasia Serter Asli Alkan Alpay Demirkol Demet 1Department of Radiology, Faculty of Medicine, Bezmialem Vakif University, Istanbul, Turkey1 Department of Pediatrics, Faculty of Medicine, Bezmialem Vakif University, Istanbul, TurkeyFor correspondence: Dr. Asli Serter, Department of Radiology, Faculty of Medicine, Bezmialem Vakif University, Istanbul, Turkey. E-mail: asli_serter@yahoo.comJul-Sep 2015 18 3 342 344 28 6 2014 05 9 2014 07 10 2014 Copyright: © Annals of Indian Academy of Neurology2015This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Congenital adrenal hyperplasia (CAH) is characterized by adrenal steroid biosynthesis defect. Steroid replacement therapy should be performed regularly in these patients. Adrenal crisis may be present in acute stress due to increased cortisol requirements or in steroid deficiency due to stopping steroid medication abruptly. In patients with acute adrenal insufficiency, severe hypotension or hypovolemic shock occurs typically. Acute encephalopathy can be seen due to hypoxia, hypervolemia, or hypoglycemia. Diffusion restriction can be seen in cortical-subcortical regions of frontal and parieto-occipital lobes and in splenium of corpus callosum. In CAH patients with neurologic symptoms, Diffusion weighted images (DWI) is very important in the diagnosis and follow-up of acute encephalopathy.\n\nCongenital adrenal hyperplasiaDWIencephalopathysteroid\n==== Body\nIntroduction\nCongenital adrenal hyperplasia (CAH) is characterized by adrenal steroid biosynthesis defect. Steroid replacement therapy should be performed regularly in these patients. Encephalopathy in CAH can depend on many different etiologic factors such as hypoxia, hypovolemia, hypoglycemia, infection, and hormonal causes.[1] Acute encephalopathy is commonly associated with hypoxia in newborn infants and infection in childhood.[2]\n\nTo our knowledge, there are a few reports about brain magnetic resonance imaging (MRI) features of adrenal crisis in children with CAH in the literature. We report diffusion MRI findings of a rare cause of acute encephalopathy, due to stopping steroid medication abruptly in a child with CAH.\n\nCase Report\nA 3-year-old boy was admitted to our emergency department because of convulsions and unconsciousness. He had been diagnosed as 21-hydroxylase deficiency at birth. He had been taking oral steroid (hydrocortisone) replacement therapy since then. His parents had stopped steroid therapy without the knowledge of the physician 3 days before the symptoms started. They were admitted to our hospital 6 hours after the onset of the symptoms. He was in coma and had seizures on admission. Laboratory tests were normal except for hypoglycemia. His plasma glucose level was 20 mg/dl and white blood cell (WBC) count was normal. No evidence of serum electrolyte abnormalities was detected. Specific infectious agents were not identified by comprehensive studies. Intravenous hydrocortisone treatment was initiated. Electroencephalography showed focal epileptic activity. Routine brain MRI was performed. Diffusion weighted images (DWI) and susceptibility weighted images (SWI) were also obtained in order to detect ischemia and hemorrhage. T2-weighted and fluid attenuated inversion recovery (FLAIR) images revealed increased signal intensities in the bilateral frontal and parietooccippital cortical-subcortical regions and a hyperintense lesion in the splenium of the corpus callosum [Figure 1]. Effacement of sulcal spaces was detected compatible with cerebral edema. Hyperintense cortical-subcortical signals and the lesion in the corpus callosum were hyperintense on DWI with reduced apparent diffusion coefficient (ADC) maps [Figure 2]. There were no signal changes suggesting microhemorrhages on SWI. MRI findings were consistent with cytotoxic cerebral edema in bilateral frontal and parieto-occiptal cortical-subcortical regions due to hypoxia and hypoglisemia. We obtained follow-up brain MRI on fifth, twelfth, and twentieth days once the treatment has started. DWI and FLAIR images on day 20 indicated partial resolution of the high intensity lesions. Hyperintense signal changes gradually decreased and completely disappeared in frontal lobes. However, ventricular dilatation, mild cerebral cortical atrophy, T2 and FLAIR hyperintense signal changes in bilateral occipital lobes were detected on the last MRI [Figure 3]. SWI was normal, and DWI showed restricted diffusion in bilateral occipital lobes. The patient exhibited epilepsy as neurological sequelae.\n\nFigure 1 (On admission): Axial T2 weighted (a) and FLAIR (b) images show increased signal intensities in the bilateral frontal and parieto-occippital cortical-subcortical regions with effacement of sulcal spaces and thickening of the gyri. There is a T2 hyperintense lesion in the splenium of the corpus callosum (c, arrow)\n\nFigure 2 (On admission): Cortical and subcortical regions in bilateral frontal and parietooccipital lobes and splenium of the corpus callosum (arrow) are hyperintense on DWI (a,b,c) with reduced ADC (d,e,f). Areas around the Sylvian fissure were spared (arrowheads), and there was more marked restricted diffusion in the lateral parts of the bilateral occipital lobes consistent with central sparing lesions\n\nFigure 3 (20 days after crisis): Axial T2-weighted image (a) shows sequelae ventricular dilatation and mild cerebral cortical atrophy. Hyperintense signal changes in bilateral occipital lobes are observed in FLAIR image (b). DWI (c) and ADC maps (d) demonstrate reduced diffusion in bilateral occipital lobes\n\nDiscussion\nCAH is a group of autosomal recessive diseases characterized by adrenal steroid biosynthesis defect. The most common enzyme insufficiency that causes CAH is 21-hydroxylase deficiency.[3] Typical presentation is ambiguous genitalia in females and/or salt-losing crisis in both genders at birth. The diagnosis is confirmed by elevated levels of serum 17-OH-progesterone and testosterone. Hyponatremia, hyperkalemia, and hypoglycemia can also be seen. Steroid replacement therapy should be performed regularly under close medical supervision in CAH. Adrenal crisis may be present in acute stress due to increased cortisol requirements or in steroid deficiency due to stopping steroid medication abruptly. In patients with acute adrenal insufficiency, severe hypotension or hypovolemic shock occurs typically.\n\nAcute encephalopathies are brain disorders caused by many different causes. Frequently acute encephalopathy caused by oxygen deficiency, infectious agents, toxic drugs, or metabolic disorders. Hypovolemia and hypoglycemia can also lead to encephalopathy. Acute encephalopathy is often characterized with neurological abnormalities. It can be reversible or irreversible depending on the reason of the encephalopathy, onset time of therapy, and the location of the brain involvement.[4]\n\nOkumura et al. categorized acute encephalopathy into two groups as diffuse and central-sparing lesions according to the distribution of brain lesions.[4] Cerebral cortex is susceptible to hypoxia. Global ischemia can cause bilateral and symmetric cerebral infarcts in the border zones between major arterial territories.[5] Hypoxic-ischemic encephalopathy is accompanied by cytotoxic cerebral edema. White matter can be involved rarely. In our case, the patient was in coma due to hypovolemic shock, hypoglycemia, and hypoxia, which were caused by steroid deficiency. MRI showed reduced diffusion in the bilateral frontal and parieto-occipital cortical-subcortical watershed border zones and effacement of sulcal spaces compatible with cytotoxic cerebral edema. There was also a transient lesion in the splenium of corpus callosum. Various reasons such as mild encephalopathy with a reversible splenial lesion (MERS), corticoid treatment, or hypoglycemia can cause transient lesions in the splenium.[67]\n\nOkumura et al. reported that clinical symptoms, laboratory data, and outcomes were markedly different between patients who had diffuse involvement and central sparing lesions.[4] They reported that in the presence of central sparing lesions, the areas around the Sylvian fissure did not show diffusion restriction and the lateral parts of the occipital lobes are affected more heavily than the medial parts.\n\nIn contrast to patients with central sparing lesions, the outcome for patients with diffuse lesions was very poor.[4] In our patient, areas around the Sylvian fissure were spared and there was more marked restricted diffusion in the lateral parts of the bilateral occipital lobes consistent with central sparing lesions. DWI obtained on the twentieth day demonstrated partial resolution of the lesions and patient showed epilepsy as neurological sequelae.\n\nLaminar cortical necrosis of a patient following an adrenal crisis was reported by Saito Y et al.[8] They described MRI findings in acute and chronic periods. In chronic period, progressive ventricular dilatation and linear high signal intensities on T1-weighted and FLAIR images were detected in the cerebral cortex with neurological sequelae. We did not detect laminar cortical necrosis in the first 20 days, however it may be seen in chronic follow-up images.\n\nAs a conclusion, acute adrenal insufficiency, which is characterized by hypotension or hypovolemic shock, may be present in acute stress due to increased corticoid requirements or in steroid deficiency due to stopping steroid medication abruptly. Acute encephalopathy can be seen due to hypoxia, hypervolemia, or hypoglycemia. Diffusion restriction can be seen in cortical-subcortical regions of frontal and parieto-occipital lobes and in splenium of corpus callosum. In CAH patients with neurologic symptoms, DWI is very important in the diagnosis and follow-up of acute encephalopathy.\n\nSource of Support: Nil\n\nConflicts of Interest: None declared.\n==== Refs\n1 Lee S Sanefuji M Watanabe K Uematsu A Torisu H Baba H Clinical and MRI characteristics of acute encephalopathy in congenital adrenal hyperplasia J Neurol Sci 2011 306 91 3 21496829 \n2 Mizuguchi M Yamanouchi H Ichiyama T Shiomi M Acute encephalopathy associated with influenza and other viral infections Acta Neurol Scand Suppl 2007 186 45 56 17784537 \n3 Hughes I Congenital adrenal hyperplasia Medicine 2009 37 423 5 \n4 Okumura A Kidokoro H Tsuji T Suzuki M Kubota T Kato T Differences of clinical manifestations according to the patterns of brain lesions in acute encephalopathy with reduced diffusion in the bilateral hemispheres AJNR Am J Neuroradiol 2009 30 825 30 19131408 \n5 Agamanolis DP Hypoxic- ischemic encephalopathy, General principles. Neuropathology Cerebral ischemia and stroke 2013 Ch. 2 \n6 Renard D Castelnovo G Campello C Bouly S Le Floch A Thouvenot E An MRI review of acquired corpus callosum lesions J Neurol Neurosurg Psychiatry 2014 85 1041 8 24563521 \n7 Aksu B Kurtcan S Alkan A Aralasmak A Oktem F Reversible corpus callosum splenial lesion due to steroid therapy J Neuroimaging 2014 \n8 Saito Y Ogawa T Nagaishi J Inoue T Maegaki Y Ohno K Laminar cortical necrosis in adrenal crisis: Sequential changes on MRI Brain Dev 2008 30 77 81 17590301\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "0972-2327",
"issue": "18(3)",
"journal": "Annals of Indian Academy of Neurology",
"keywords": "Congenital adrenal hyperplasia; DWI; encephalopathy; steroid",
"medline_ta": "Ann Indian Acad Neurol",
"mesh_terms": null,
"nlm_unique_id": "101273955",
"other_id": null,
"pages": "342-4",
"pmc": null,
"pmid": "26425016",
"pubdate": "2015",
"publication_types": "D002363:Case Reports",
"references": "19131408;24563521;21496829;17590301;24945326;17784537",
"title": "Diffusion MRI features of acute encephalopathy due to stopping steroid medication abruptly in congenital adrenal hyperplasia.",
"title_normalized": "diffusion mri features of acute encephalopathy due to stopping steroid medication abruptly in congenital adrenal hyperplasia"
} | [
{
"companynumb": "TR-SEBELA IRELAND LIMITED-2015SEB00081",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "HYDROCORTISONE"
},
"drugadditio... |
{
"abstract": "OBJECTIVE\nTo report 4-year outcomes following the switch to aflibercept in treatment-resistant neovascular age-related macular degeneration (nAMD).\n\n\nMETHODS\nIn this prospective, open-label, non-controlled, clinical trial, 49 patients with treatment-resistant nAMD received 2 mg intravitreal aflibercept as three loading doses every 4 weeks, followed by injections every 8 weeks for the first 48 weeks, then an individualized regimen for a further 36 months, following previous treatment with ranibizumab and/or bevacizumab. Outcome measures included best-corrected visual acuity (BCVA), central retinal thickness (CRT), pigment epithelial detachment (PED) height and geographic atrophy (GA) surface area.\n\n\nRESULTS\nOf the 49 patients who were initially recruited, data from 39 eyes of 39 patients were available at 48-month follow-up. Mean age was 76.7 ± 7.2 years. Over the 48 months, these eyes received a mean of 32.1 ± 5.6 injections. The mean BCVA improved significantly following 12 months of treatment (4.9 ± 9.0 ETDRS letters, p < 0.001); however, this was not maintained and was similar to baseline after 48 months (mean difference -0.4 ± 13.3 letters between baseline and 48 months, p < 0.001). The reduction in CRT from baseline was 170.3 ± 143.3 μm (p < 0.001) with absence of macular fluid in 56% of the 39 eyes at the end of month 48. PED height reduced by a mean 77.5 ± 20.0 μm, and geographic atrophy increased by a mean of 4.1 ± 3.4 mm2 (p < 0.01) over the 48 months.\n\n\nCONCLUSIONS\nAflibercept is an effective alternative therapy for treatment-resistant nAMD. Good anatomical and stable functional responses are achievable with continued therapy. The lack of continued visual improvement may be representative of GA progression, reflecting the progression of late-stage nAMD in these patients.",
"affiliations": "Sydney Retina Clinic & Day Surgery, Sydney, NSW, Australia.;Sydney Retina Clinic & Day Surgery, Sydney, NSW, Australia.;Sydney Retina Clinic & Day Surgery, Sydney, NSW, Australia.;Sydney Retina Clinic & Day Surgery, Sydney, NSW, Australia.;Sydney Retina Clinic & Day Surgery, Sydney, NSW, Australia.;Sydney Retina Clinic & Day Surgery, Sydney, NSW, Australia.;Sydney Retina Clinic & Day Surgery, Sydney, NSW, Australia.",
"authors": "Spooner|Kimberly|K|https://orcid.org/0000-0001-5096-3786;Hong|Thomas|T|;Nair|Rashmi|R|;Chow|Nicholas Chian Chiang|NCC|;Broadhead|Geoffrey K|GK|https://orcid.org/0000-0003-1351-4513;Wijeyakumar|Wijeyanthy|W|;Chang|Andrew A|AA|",
"chemical_list": "D020533:Angiogenesis Inhibitors; D011993:Recombinant Fusion Proteins; C533178:aflibercept; D000068258:Bevacizumab; D040262:Receptors, Vascular Endothelial Growth Factor; D000069579:Ranibizumab",
"country": "England",
"delete": false,
"doi": "10.1111/aos.14046",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1755-375X",
"issue": "97(5)",
"journal": "Acta ophthalmologica",
"keywords": "age-related macular degeneration; anti-VEGF; long-term; treatment resistance",
"medline_ta": "Acta Ophthalmol",
"mesh_terms": "D000368:Aged; D020533:Angiogenesis Inhibitors; D000068258:Bevacizumab; D004351:Drug Resistance; D057915:Drug Substitution; D005260:Female; D005451:Fluorescein Angiography; D005500:Follow-Up Studies; D005654:Fundus Oculi; D006801:Humans; D058449:Intravitreal Injections; D008266:Macula Lutea; D008297:Male; D011446:Prospective Studies; D000069579:Ranibizumab; D040262:Receptors, Vascular Endothelial Growth Factor; D011993:Recombinant Fusion Proteins; D013997:Time Factors; D041623:Tomography, Optical Coherence; D016896:Treatment Outcome; D057135:Wet Macular Degeneration",
"nlm_unique_id": "101468102",
"other_id": null,
"pages": "e706-e712",
"pmc": null,
"pmid": "30740921",
"pubdate": "2019-08",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article",
"references": null,
"title": "Long-term outcomes of switching to aflibercept for treatment-resistant neovascular age-related macular degeneration.",
"title_normalized": "long term outcomes of switching to aflibercept for treatment resistant neovascular age related macular degeneration"
} | [
{
"companynumb": "AU-ROCHE-2267518",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ALLOPURINOL"
},
"drugadditional": "3",
"drug... |
{
"abstract": "OBJECTIVE\nTherapies directed against multiple signaling pathways have been validated in the clinical setting as effective anticancer treatments. The combination of different agents is particularly helpful in patients with multiple cancer diagnoses, while data on cross-toxicity are frequently missing, as for imatinib and cetuximab plus platinum drugs.\n\n\nMETHODS\nWe present the case of a 76-year-old man with advanced laryngeal squamous cell carcinoma and chronic myeloid leukemia (CML). Combined treatment with imatinib mesylate and cetuximab plus carboplatin was well-tolerated by the patient, who did not develop neutropenia. By an interdisciplinary approach with hematology specialists, the anticipated neutropenia was managed by the temporary interruption of imatinib treatment when the white blood cell (WBC) count nadir was expected to occur.\n\n\nRESULTS\nAlthough treatment with imatinib, carboplatin, and cetuximab can be associated with hematologic toxicities, a combination regimen based on the concomitant administration of these 3 drugs and on the discontinuation of imatinib at the predicted nadir of WBC count was feasible and well-tolerated in a patient with concomitant CML and locally advanced laryngeal squamous cell carcinoma.\n\n\nCONCLUSIONS\nOur report indicates the feasibility of combination imatinib and cetuximab plus carboplatin in a case of multiple cancer diagnoses, provided that the treatment with imatinib is modulated according to the expected bone marrow depression.",
"affiliations": "Head and Neck Medical Oncology Department, Fondazione IRCCS Istituto Nazionale Tumori, Milan - Italy.;Head and Neck Medical Oncology Department, Fondazione IRCCS Istituto Nazionale Tumori, Milan - Italy.;Head and Neck Medical Oncology Department, Fondazione IRCCS Istituto Nazionale Tumori, Milan - Italy.;Head and Neck Medical Oncology Department, Fondazione IRCCS Istituto Nazionale Tumori, Milan - Italy.;Head and Neck Medical Oncology Department, Fondazione IRCCS Istituto Nazionale Tumori, Milan - Italy.;Head and Neck Medical Oncology Department, Fondazione IRCCS Istituto Nazionale Tumori, Milan - Italy.;Head and Neck Medical Oncology Department, Fondazione IRCCS Istituto Nazionale Tumori, Milan - Italy.;Head and Neck Medical Oncology Department, Fondazione IRCCS Istituto Nazionale Tumori, Milan - Italy.",
"authors": "Pala|Laura|L|;Bergamini|Cristiana|C|;Imbimbo|Martina|M|;Granata|Roberta|R|;Locati|Laura|L|;Alfieri|Salvatore|S|;Licitra|Lisa|L|;Bossi|Paolo|P|",
"chemical_list": "D000068877:Imatinib Mesylate; D016190:Carboplatin; D000068818:Cetuximab",
"country": "United States",
"delete": false,
"doi": "10.5301/tj.5000485",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0300-8916",
"issue": "102(Suppl. 2)",
"journal": "Tumori",
"keywords": null,
"medline_ta": "Tumori",
"mesh_terms": "D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D001706:Biopsy; D016190:Carboplatin; D002294:Carcinoma, Squamous Cell; D000068818:Cetuximab; D006801:Humans; D000068877:Imatinib Mesylate; D007822:Laryngeal Neoplasms; D015464:Leukemia, Myelogenous, Chronic, BCR-ABL Positive; D008279:Magnetic Resonance Imaging; D008297:Male; D009367:Neoplasm Staging; D009378:Neoplasms, Multiple Primary; D014057:Tomography, X-Ray Computed",
"nlm_unique_id": "0111356",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "26979243",
"pubdate": "2016-11-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Safety of combination treatment with imatinib mesylate, carboplatin, and cetuximab in a patient with multiple cancers: a case report.",
"title_normalized": "safety of combination treatment with imatinib mesylate carboplatin and cetuximab in a patient with multiple cancers a case report"
} | [
{
"companynumb": "IT-MYLANLABS-2016M1057962",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CETUXIMAB"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nTo our knowledge, no randomized study has shown whether zinc replacement therapy is effective for hyperammonemia in liver cirrhosis; therefore, we performed a double-blind, placebo-controlled trial to examine efficacy and safety of the zinc replacement therapy.\n\n\nMETHODS\nPatients with liver cirrhosis and hyperammonemia (at or above the institutional reference value) and hypozincemia (≤65 μg/dL) were enrolled in the outpatient units of the participating institutions and were randomly divided to receive placebo (P group) or zinc acetate preparation at a dose of 3 capsules/d for a total zinc content of 150 mg/d (Z group) by the envelope method. Of the 18 enrolled patients, 6 dropped out; thus, the analyses included 12 patients (5 in the P group and 7 in the Z group). Variations in blood concentrations of zinc and ammonia as well as liver function test results were compared.\n\n\nRESULTS\nBlood zinc levels significantly increased in the Z group (P = 0.0037; Friedman test) but not the P group. Blood ammonia levels significantly decreased in the Z group (P = 0.0114; Friedman test) but not the P group. The percent change in blood ammonia level also revealed significant reduction at the eighth week in the Z group (P = 0.0188: Mann-Whitney test). No serious adverse events attributable to the zinc preparation were noted.\n\n\nCONCLUSIONS\nAlthough this study is preliminary and includes a small sample, it is, to our knowledge, the first randomized controlled trial to show that zinc supplementation for 3 mo seems effective and safe for treating hyperammonemia in liver cirrhosis. Studies with a larger sample size are needed to confirm our findings.",
"affiliations": "Department of Hepatobiliary and Pancreatic Oncology, Osaka Medical Center of Cancer and Cardiovascular Diseases, Osaka, Japan. Electronic address: katayama-ka@mc.pref.osaka.jp.;Division of Hepatobiliary and Pancreatic Disease, Hyogo College of Medicine, Nishinomiya, Japan.;Division of Gastroenterology, Department of Medicine and Digestive Disease Information and Research, Kurume University School of Medicine, Kurume, Japan.;Division of Gastroenterology and Hepatology, Department of Internal Medicine, Iwate Medical University, Morioka, Japan.;Division of Gastroenterology and Hepatology, Department of Internal Medicine, Iwate Medical University, Morioka, Japan.;Division of Hepatobiliary and Pancreatic Disease, Hyogo College of Medicine, Nishinomiya, Japan.;Department of Internal Medicine, Morioka Municipal Hospital, Morioka, Japan.;Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Asahikawa, Japan.;Department of Gastroenterology and Hepatology, Dokkyo Medical University Koshigaya Hospital, Koshigaya, Japan.;Department of Gastroenterology and Hepatology, Graduate School of Medicine, Yamaguchi University, Ube, Japan.;Department of Gastroenterology, Yamagata University Faculty of Medicine, Yamagata, Japan.;Department of Nutritional Medicine, Osaka City University Graduate School of Human Life Science, Osaka, Japan.;Department of Internal Medicine, Osaka Koseinenkin Hospital, Osaka, Japan.;Department of Gastroenterology, Gifu University Graduate School of Medicine, Gifu, Japan.;Department of Nutritional Science, Morioka University, Morioka, Japan.",
"authors": "Katayama|Kazuhiro|K|;Saito|Masanori|M|;Kawaguchi|Takumi|T|;Endo|Ryujin|R|;Sawara|Kei|K|;Nishiguchi|Shuhei|S|;Kato|Akinobu|A|;Kohgo|Hiroshi|H|;Suzuki|Kazutomo|K|;Sakaida|Isao|I|;Ueno|Yoshiyuki|Y|;Habu|Daiki|D|;Ito|Toshifumi|T|;Moriwaki|Hisataka|H|;Suzuki|Kazuyuki|K|",
"chemical_list": "D014131:Trace Elements; D000641:Ammonia; D019345:Zinc Acetate; D015032:Zinc",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0899-9007",
"issue": "30(11-12)",
"journal": "Nutrition (Burbank, Los Angeles County, Calif.)",
"keywords": "Ammonia metabolism; Hepatic encephalopathy; Nutritional intervention; Trace element; Zinc acetate",
"medline_ta": "Nutrition",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D000641:Ammonia; D019587:Dietary Supplements; D004311:Double-Blind Method; D005260:Female; D006801:Humans; D022124:Hyperammonemia; D008103:Liver Cirrhosis; D008297:Male; D008875:Middle Aged; D014131:Trace Elements; D016896:Treatment Outcome; D015032:Zinc; D019345:Zinc Acetate",
"nlm_unique_id": "8802712",
"other_id": null,
"pages": "1409-14",
"pmc": null,
"pmid": "25280421",
"pubdate": "2014",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Effect of zinc on liver cirrhosis with hyperammonemia: a preliminary randomized, placebo-controlled double-blind trial.",
"title_normalized": "effect of zinc on liver cirrhosis with hyperammonemia a preliminary randomized placebo controlled double blind trial"
} | [
{
"companynumb": "JP-TEVA-518408USA",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ZINC\\ZINC CHLORIDE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nListeria monocytogenes is a facultative intracellular parasitic bacterium that is Gram positive, catalase positive, oxidase negative, and a facultative anaerobe. It is known to infect humans through food. It is a bacillus with low virulence, but can cause meningitis and sepsis in infants and immunocompromised patients.\n\n\nMETHODS\nA case of 75-year-old Japanese female with small cell carcinoma of the thymus and pleural dissemination is described. She was treated with carboplatin and etoposide and showed a partial response. However, the tumor recurred 6 months later. Therefore, we again administered carboplatin and etoposide. Though peritoneal dissemination was suspected based on abdominal computed tomography findings after two courses, the assessment was stable disease. She was occasionally treated for constipation. She developed chills, rigor, and diarrhea, necessitating admission on the 7th day of the third course of chemotherapy. We suspected intestinal infection, and cefepime was thus administered. However, her blood pressure dropped and neutropenia manifested on the 4th day of admission. We therefore switched the antibiotic from cefepime to meropenem and also administered granulocyte-colony stimulating factor. Listeria monocytogenes was detected by two blood cultures, and the antimicrobial medication was thus switched to ampicillin, in consideration of sensitivity. Her general condition improved and she was able to leave the hospital on the 19th day after admission.\n\n\nCONCLUSIONS\nDuring chemotherapy, factors such as impaired bowel movements, malnutrition, and myeloablation can contribute to the development of severe infections. It is necessary to comprehensively assess a patient's state and treat all aspects of illness.",
"affiliations": "Department of Cardiology, Respiratory Medicine and Nephrology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562, Japan. gacchi88@hotmail.com.;Department of Cardiology, Respiratory Medicine and Nephrology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562, Japan. y-asari@cc.hirosaki-u.ac.jp.;Department of Cardiology, Respiratory Medicine and Nephrology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562, Japan. moritaka@cc.hirosaki-u.ac.jp.;Department of Cardiology, Respiratory Medicine and Nephrology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562, Japan. taima0305@hotmail.com.;Department of Cardiology, Respiratory Medicine and Nephrology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562, Japan. kuni19780502@yahoo.co.jp.;Department of Cardiology, Respiratory Medicine and Nephrology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562, Japan. lapin2105@gmail.com.;Department of Cardiology, Respiratory Medicine and Nephrology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562, Japan. xyghx335@gmail.com.;Department of Cardiology, Respiratory Medicine and Nephrology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562, Japan. t-shingo@cc.hirosaki-u.ac.jp.;Department of Clinical Laboratory Medicine, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562, Japan. kayaba@cc.hirosaki-u.ac.jp.;Department of Cardiology, Respiratory Medicine and Nephrology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562, Japan. okumura@cc.hirosaki-u.ac.jp.",
"authors": "Itoga|Masamichi|M|;Asari|Yuko|Y|;Morimoto|Takeshi|T|;Taima|Kageaki|K|;Nakamura|Kunihiko|K|;Tanaka|Yoshihito|Y|;Tanaka|Hisashi|H|;Takanashi|Shingo|S|;Kayaba|Hiroyuki|H|;Okumura|Ken|K|",
"chemical_list": "D000900:Anti-Bacterial Agents; D000970:Antineoplastic Agents; D002511:Cephalosporins; D013845:Thienamycins; D016179:Granulocyte Colony-Stimulating Factor; D005047:Etoposide; D000667:Ampicillin; D000077723:Cefepime; D016190:Carboplatin; D000077731:Meropenem",
"country": "England",
"delete": false,
"doi": "10.1186/s13104-015-1230-9",
"fulltext": "\n==== Front\nBMC Res NotesBMC Res NotesBMC Research Notes1756-0500BioMed Central London 123010.1186/s13104-015-1230-9Case ReportSepsis caused by Listeria monocytogenes during chemotherapy for small cell carcinoma of the thymus Itoga Masamichi gacchi88@hotmail.com Asari Yuko y-asari@cc.hirosaki-u.ac.jp Morimoto Takeshi moritaka@cc.hirosaki-u.ac.jp Taima Kageaki taima0305@hotmail.com Nakamura Kunihiko kuni19780502@yahoo.co.jp Tanaka Yoshihito lapin2105@gmail.com Tanaka Hisashi xyghx335@gmail.com Takanashi Shingo t-shingo@cc.hirosaki-u.ac.jp Kayaba Hiroyuki kayaba@cc.hirosaki-u.ac.jp Okumura Ken okumura@cc.hirosaki-u.ac.jp Department of Cardiology, Respiratory Medicine and Nephrology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562 Japan Department of Clinical Laboratory Medicine, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562 Japan Department of Cardiology Medicine, Mutsu General Hospital, 1-2-8 Ogawa-cho, Mutsu, 035-8601 Japan Department of Anatomic Pathology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562 Japan Health Administration Center, Hirosaki University, 1 Bunkyo, Hirosaki, 036-8562 Japan 26 6 2015 26 6 2015 2015 8 2683 8 2014 14 6 2015 © Itoga et al. 2015\nOpen AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nListeria monocytogenes is a facultative intracellular parasitic bacterium that is Gram positive, catalase positive, oxidase negative, and a facultative anaerobe. It is known to infect humans through food. It is a bacillus with low virulence, but can cause meningitis and sepsis in infants and immunocompromised patients.\n\nCase presentation\nA case of 75-year-old Japanese female with small cell carcinoma of the thymus and pleural dissemination is described. She was treated with carboplatin and etoposide and showed a partial response. However, the tumor recurred 6 months later. Therefore, we again administered carboplatin and etoposide. Though peritoneal dissemination was suspected based on abdominal computed tomography findings after two courses, the assessment was stable disease. She was occasionally treated for constipation. She developed chills, rigor, and diarrhea, necessitating admission on the 7th day of the third course of chemotherapy. We suspected intestinal infection, and cefepime was thus administered. However, her blood pressure dropped and neutropenia manifested on the 4th day of admission. We therefore switched the antibiotic from cefepime to meropenem and also administered granulocyte-colony stimulating factor. Listeria monocytogenes was detected by two blood cultures, and the antimicrobial medication was thus switched to ampicillin, in consideration of sensitivity. Her general condition improved and she was able to leave the hospital on the 19th day after admission.\n\nConclusions\nDuring chemotherapy, factors such as impaired bowel movements, malnutrition, and myeloablation can contribute to the development of severe infections. It is necessary to comprehensively assess a patient’s state and treat all aspects of illness.\n\nKeywords\nBacterial translocationChemotherapyListeria monocytogenesissue-copyright-statement© The Author(s) 2015\n==== Body\nBackground\nListeria monocytogenes (L. monocytogenes) is a facultative intracellular bacterium that is Gram positive, catalase positive, oxidase negative, and a facultative anaerobe. L. monocytogenes is known to infect humans through food including cheese and fresh vegetables [1]. It is a bacillus with low virulence, and this infection is rare in adults without underlying diseases, but it can cause meningitis and sepsis in infants and the elderly, as well as in immunocompromised patients [2]. There are some reports of Listeriosis in Japan, in the compromised host during chemotherapy [3] and after surgery [4, 5]. In a Japanese review of listeriosis cases over for 23 years, it was reported that 76.4% of deaths in adult cases had underlying conditions [6].\n\nWe experienced a case of sepsis caused by L. monocytogenes during chemotherapy for small cell carcinoma of the thymus. This case is reported with a discussion of the relevant literature.\n\nCase presentation\nThe patient was a 75-year-old Japanese female who presented with chief complaints of fever and diarrhea. The past history, family history, and personal/occupational history were unremarkable. A diagnosis of small cell carcinoma of the thymus (cT4N2M1 stage IV) was made on January 19, 2010. Chemotherapy was started with carboplatin (CBDCA) + etoposide (VP-16) (Chemotherapy for small cell carcinoma of the thymus has not established. We performed the chemotherapy for small cell of the thymus using the regimen for small cell lung carcinoma as reference.) on the same day, and a total of four courses were administered. The tumor decreased in size following this treatment and the response was assessed as partial response (PR). Relapse of the tumor was detected in July, and chemotherapy with CBDCA + VP-16 was resumed due to sensitive relapse. Findings on chest-abdominal computed tomography (CT) performed for evaluation on October 12 after two courses of treatment suggested the possibility of peritoneal dissemination. However, the tumor response was assessed as stable disease (SD), and the treatment was continued. While receiving this treatment, the patient complained of constipation, which was dealt with symptomatically. On December 21 (the 7th day of the third course of chemotherapy), the patient developed chills, fever, and diarrhea, and was admitted on December 22 with a diagnosis of severe infection as an adverse event during chemotherapy. Vital signs were normal, except for a body temperature of 38.7°C. Chest auscultation revealed no abnormal findings. Examination of the abdomen also revealed no abnormalities, except for slight generalized tenderness. Laboratory examination revealed the following: hematology: pancytopenia (WBC 2,900/μL, RBC 335 × 104/μL, Hb 10.2 g/dL, Plt 10.1 × 104/μL); blood biochemistry: slight deterioration of liver function and electrolyte abnormalities (AST 37 U/L, ALT 30 U/L, LDH 250 U/L, ALP 454 U/L, γ-GTP 214 U/L, Na 132 mmol/L, Cl 95 mmol/L), and significant increase in serum CRP (CRP 32.76 mg/dL); blood coagulation profile: elevation of serum levels of FDP (FDP 22.5 μg/mL); serum tumor marker levels: within normal range. Arterial blood gas analysis revealed evidence of respiratory alkalosis (pH 7.532, pCO2 28.5 Torr, pO2 70.4 Torr, HCO3 23.8 mmol/L). Although Enterococcus faecalis was detected in the urine, urine microscopy revealed only 5-9 WBC/HPF, not suggestive of urinary tract infection (Table 1). Influenza test was negative. A chest X-ray revealed no abnormal findings (Figure 1). Chest CT showed an increase in the size of the small cell carcinoma tumor arising from the thymus in the anterior mediastinum (Figure 2a). Abdominal CT revealed mild ascites and prominent irregular granular shadows of the greater omentum and the mesentery (Figure 2b), suggestive of peritoneal dissemination.Table 1 Laboratory data at initial visitation\n\nCBC\tBlood chemistry\tTumor marker\t\n WBC\t2900/μL\t AST\t37 IU/L\t NSE\t8.4 ng/mL\t\n Neutro\t92.5 %\t ALT\t30 IU/L\t ProGRP\t43.7 pg/mL\t\n Mono\t0.3 %\t Y-GTP\t214 IU/L\tUrinalysis\t\n RBC\t335 × 104/μL\t LDH\t250 IU/L\t WBC\t5–9/HPF\t\n Hb\t10.2 g/dL\t ALP\t454 IU/L\t E. faecalis\n\t1 × 107\n\t\n Pit\t10.1 × 104/μL\t TP\t6.7 g/dL\tArterial blood gas analysis (room air)\t\nCoagulation\t\t Alb\t3.4 g/dL\t PH\t7.532\t\n PT-INR\t1.15\t CK\t21 IU/L\t pCO2\n\t28.5 Torr\t\n APTT\t33.4 s\t BUN\t18 mg/dL\t pO2\n\t70.4 Torr\t\n Fibrinogen\t352 mg/dL\t Cre\t0.66 mg/dL\t HCO3\n\t23.8 mmol/L\t\n FDP\t22.5 μg/mL\t Na\t132 mmol/L\t SaO2\n\t95.5 %\t\n AT-III\t85%\t K\t4.1 mmol/L\tBacteriological examination\t\n\t\t CI\t95 mmol/L\t Blood\t\nL. monocytogenes (+)\t\n\t\t Ca\t8.3 mmol/L\t\t\t\n\t\t CRP\t32.76 mg/dL\t\t\t\nFigure 1 Chest X-ray showed no abnormal findings.\n\nFigure 2 \na Chest computed tomography showed an increase in the size of the small cell carcinoma tumor arising from the thymus (red circle). b Abdominal computed tomography showed mild ascites (red arrow) and prominent irregular granular shadows of the greater omentum and the mesentery (red circle).\n\n\n\nThe focus of the infection was unclear, but since the patient was a compromised host, enteric bacterial infection was assumed and treatment was started empirically with cefepime (CFPM) 3 g/day. Samples were collected for two sets of blood culture at the time of admission. Because of a fall in blood pressure and neutropenia on December 25, the antimicrobial drug was switched to meropenem (MEPM) 1.5 g/day, and administration of granulocyte-colony stimulating factor (G-CSF) was started. On December 26, L. monocytogenes was identified in both sets of blood culture bottle, in BacT/ALERT blood cultures by direct inoculation into the Vitek 2 system (This serotype is not known.). On December 28, with recovery of the neutrophil count, the antibiotic was again changed to ampicillin (ABPC) 4 g/day in consideration of the bacterial sensitivity. The patient then recovered gradually and was discharged on January 10, 2011.\n\nDiscussion\nL. monocytogenes is widely distributed throughout the environment including soil, water, and decaying vegetation. L. monocytogenes exists in the feces of animals and putrescent tissues, showing a high osmotic pressure tolerance and the ability to proliferate in temperatures ranging from 1 to 45°C [2]. The gastrointestinal mucous membrane is considered to be the most common source of infection [1].\n\nL. monocytogenes has the ability to pass the intestinal barrier. The primary method of entry into endothelial cells is believed to be via a zipper-like mechanism [7]. Invasion proteins on the surface of the bacteria, like Internalin A, Internalin B, and P60, help the bacterium bind to host surface receptors [8]. This ability is thought to trigger bacterial translocation (BT).\n\nBT is considered to be the mechanism underlying sepsis due to L. monocytogenes. The phenomenon of enteral bacteria moving outside of the intestinal tract was described a century ago in animal experiments [9]. BT was defined as “the passage of viable bacteria from the gastrointestinal tract through the epithelial mucosa into the lamina propria and then to the mesenteric lymph nodes and possibly other organs” [10]. The intestinal tract then came to be thought of as a new source of infection. At present, microbial translocation, i.e., the concept of BT, is recognized as involving not only live bacteria but also components of dead bacteria and bacterial factors such as endotoxin [11]. L. monocytogenes is thought to invade intestinal epithelial cells and the mucous membrane lamina propria via various routes and to become an internalization of macrophages and lymphocytes, subsequently migrating to remote organs through lymphatic vessels [7].\n\nThe mechanisms of BT are considered to be (1) a change in enterobacterial flora, (2) failure of the intestinal tract barrier, and (3) diminished host immunity. The enterobacterial flora maintains an equilibrium allowing fungi and bacteria to coexist. When this enterobacterial flora balance is compromised by antimicrobials, antacids, ileus, or fecal impaction, pathogenic microbes and toxins proliferate abnormally in the intestinal tract, and this leads to contact with intestinal epithelia. The intestinal tract barrier is an epithelial structure that functions as a mechanical barrier and also provides a mucous membrane layer to protect the organism from excessive intestinal tract peristalsis and digestive juices such as gastric acid and bile acid. With the atrophy of intestinal tract disuse, ischemia may occur due to shock, malnutrition, hepatic cirrhosis, arterial clotting, inflammatory bowel disease, or radiation exposure, leading to barrier function failure, and pathogenic microbes can then come into contact with the intestinal mucosa. The intestinal mucosa then becomes hyper-permeable, facilitating invasion by pathogenic microbes. The intestinal tract has an immunologic barrier function and harbors local immune factors including neutrophils, macrophages, and gut-associated lymphoid tissue (GALT) of the terminal ileum. GALT is the most immunologically active tissue in the human body. Decreasing immune cells in GALT, due to nutritional management designed to avoid the gastrointestinal tract, reduces local immunity by causing IgA secretion disorders in the intestinal epithelia, compromised host immunity, and diminished host immuno-responsiveness to invasive pathogens from the intestinal tract. These alterations can all promote invasion by pathogens. It is thought that myeloablation with chemotherapy and the associated reduction in host immunity, direct damage to the intestinal mucosa by chemotherapy, intestinal tract obstruction by tumors with peritoneal dissemination, and constipation due to impaired bowel movements associated with disease states or treatment can lead to BT.\n\nNormalization of the aforementioned processes is necessary for the prevention and treatment of BT. In other words, for prevention of BT it is necessary to (1) control the enterobacterial flora, (2) maintain the intestinal tract barrier, (3) control immuno-responsiveness, and (4) maintain the intestinal tract blood supply. To achieve the prevention and treatment of BT, attention is being paid to the administration of probiotics and prebiotics [12, 13], glutamine [14], polyethylene glycol [15], and dobutamine [16]. In addition, to control immuno-responsiveness, endotoxin adsorption with blood adsorption therapy using a polymyxin B column was reported to be useful [17, 18].\n\nAs in our case, with the source of infection being unclear, the sepsis often progresses. BT is potentially involved in the infectious process by various mechanisms and must, in the intestinal tract, be regarded as an important source of infection. Thus, it is necessary to prevent BT as well as to implement infection control procedures.\n\nConclusion\nWe encountered a case with sepsis caused by L. monocytogenes during chemotherapy for small cell carcinoma of the thymus. We often experience unidentified sepsis during chemotherapy. Impaired bowel movements, malnutrition, and myeloablation by chemotherapy can easily cause bacterial translocation. We must not forget the possibility of serious sepsis caused by L. monocytogenes through bacterial translocation during chemotherapy. It is necessary to comprehensively assess a patient’s state and treat all aspects of illness.\n\nConsent\nWritten informed consent was obtained from the patient for publication of this Case Report and any accompanying images. A copy of the written consent is available for review by Editor-in-Chief of this journal.\n\nAbbreviations\nABPCampicillin\n\nBTbacterial translocation\n\nCBDCAcarboplatin\n\nCFPMcefepime\n\nCTcomputed tomography\n\nGALTgut-associated lymphoid tissue\n\nG-CSFgranulocyte-colony stimulating factor\n\nL. monocytogenesListeria monocytogenes\n\nMEPMmeropenem\n\nPRpartial response\n\nSDstable disease\n\nVP-16etoposide\n\nAuthors’ contributions\nMI, YA, TM, KT, KN, YT, HT, ST, and KO treated the patient. ST, HK, and KO helped to draft the manuscript. All authors read and approved the final manuscript.\n\nAcknowledgements\nThere is no source of funding for all authors.\n\nCompliance with ethical guidelines\nCompeting interests The authors declare that they have no competing interests.\n==== Refs\nReferences\n1. Riedo FX Pinner RW Tosca ML Cartter ML Graves LM Reeves MW A point-source foodborne listeriosis outbreak: documented incubation period and possible mild illness J Infect Dis 1994 170 693 696 10.1093/infdis/170.3.693 8077731 \n2. Schuchat A Swaminathan B Broome CV Epidemiology of human listeriosis Clin Microbiol Rev 1991 4 169 183 1906370 \n3. Ainoda Y Hirai Y Shoji T Totsuka K Listeriosis in non-Hodgkin’s lymphoma following outpatient R-CHOP therapy Kansenshogaku Zasshi J Jpn Assoc Infect Dis 2010 84 602 605 \n4. Kimura N Adachi H Adachi K Hashimoto M Yamaguchi A Ino T Chronic type A aortic dissection associated with Listeria monocytogenes infection Gen Thorac Cardiovasc Surg 2008 56 417 420 10.1007/s11748-008-0259-2 18696209 \n5. Yokoyama Y Suzuki T Yamashita Y Maeta H Listeria monocytogenes meningitis complicated after operation for thoracic aortic aneurysm Kyobu Geka Jpn J Thorac Surg 2006 59 131 136 \n6. Nagai T Human listeriosis in Japan (author’s transl) Rinsho Byori Jpn J Clin Pathol 1982 30 364 370 \n7. Cossart P Sansonetti PJ Bacterial invasion: the paradigms of enteroinvasive pathogens Science 2004 304 242 248 10.1126/science.1090124 15073367 \n8. Drevets DA Leenen PJ Greenfield RA Invasion of the central nervous system by intracellular bacteria Clin Microbiol Rev 2004 17 323 347 10.1128/CMR.17.2.323-347.2004 15084504 \n9. Lemaire LC van Lanschot JJ Stoutenbeek CP van Deventer SJ Wells CL Gouma DJ Bacterial translocation in multiple organ failure: cause or epiphenomenon still unproven Br J Surg 1997 84 1340 1350 10.1002/bjs.1800841005 9361586 \n10. Berg RD Garlington AW Translocation of certain indigenous bacteria from the gastrointestinal tract to the mesenteric lymph nodes and other organs in a gnotobiotic mouse model Infect Immun 1979 23 403 411 154474 \n11. Alexander JW Boyce ST Babcock GF Gianotti L Peck MD Dunn DL The process of microbial translocation Ann Surg 1990 212 496 510 10.1097/00000658-199010000-00012 2222015 \n12. Sugawara G Nagino M Nishio H Ebata T Takagi K Asahara T Perioperative synbiotic treatment to prevent postoperative infectious complications in biliary cancer surgery: a randomized controlled trial Ann Surg 2006 244 706 714 10.1097/01.sla.0000219039.20924.88 17060763 \n13. Rayes N Seehofer D Theruvath T Mogl M Langrehr JM Nussler NC Effect of enteral nutrition and synbiotics on bacterial infection rates after pylorus-preserving pancreatoduodenectomy: a randomized, double-blind trial Ann Surg 2007 246 36 41 10.1097/01.sla.0000259442.78947.19 17592288 \n14. Li J Kudsk KA Janu P Renegar KB Effect of glutamine-enriched total parenteral nutrition on small intestinal gut-associated lymphoid tissue and upper respiratory tract immunity Surgery 1997 121 542 549 10.1016/S0039-6060(97)90109-4 9142153 \n15. Wu L Zaborina O Zaborin A Chang EB Musch M Holbrook C High-molecular-weight polyethylene glycol prevents lethal sepsis due to intestinal Pseudomonas aeruginosa Gastroenterology 2004 126 488 498 10.1053/j.gastro.2003.11.011 14762786 \n16. Gatt M Reddy BS MacFie J Review article: bacterial translocation in the critically ill—evidence and methods of prevention Aliment Pharmacol Ther 2007 25 741 757 10.1111/j.1365-2036.2006.03174.x 17373913 \n17. Ono S Tsujimoto H Matsumoto A Ikuta S Kinoshita M Mochizuki H Modulation of human leukocyte antigen-DR on monocytes and CD16 on granulocytes in patients with septic shock using hemoperfusion with polymyxin B-immobilized fiber Am J Surg 2004 188 150 156 10.1016/j.amjsurg.2003.12.067 15249240 \n18. Sakamoto Y Mashiko K Matsumoto H Hara Y Kutsukata N Yamamoto Y Relationship between effect of polymyxin B-immobilized fiber and high-mobility group box-1 protein in septic shock patients ASAIO J 2007 53 324 328 10.1097/MAT.0b013e3180340301 17515723\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1756-0500",
"issue": "8()",
"journal": "BMC research notes",
"keywords": null,
"medline_ta": "BMC Res Notes",
"mesh_terms": "D000368:Aged; D000667:Ampicillin; D000900:Anti-Bacterial Agents; D000970:Antineoplastic Agents; D016190:Carboplatin; D018288:Carcinoma, Small Cell; D000077723:Cefepime; D002511:Cephalosporins; D005047:Etoposide; D005260:Female; D016179:Granulocyte Colony-Stimulating Factor; D006801:Humans; D008089:Listeria monocytogenes; D008088:Listeriosis; D000077731:Meropenem; D009364:Neoplasm Recurrence, Local; D018805:Sepsis; D013845:Thienamycins; D013950:Thymus Gland; D013953:Thymus Neoplasms; D016896:Treatment Outcome",
"nlm_unique_id": "101462768",
"other_id": null,
"pages": "268",
"pmc": null,
"pmid": "26111524",
"pubdate": "2015-06-26",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "17515723;15084504;17060763;16482907;9361586;9142153;8077731;1906370;2222015;7098070;154474;15249240;20960941;18696209;17592288;14762786;15073367;17373913",
"title": "Sepsis caused by Listeria monocytogenes during chemotherapy for small cell carcinoma of the thymus.",
"title_normalized": "sepsis caused by listeria monocytogenes during chemotherapy for small cell carcinoma of the thymus"
} | [
{
"companynumb": "JP-CORDEN PHARMA LATINA S.P.A.-JP-2016COR000078",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugad... |
{
"abstract": "Erlotinib has been FDA approved to be used in combination with gemcitabine as the first line treatment in advanced pancreatic cancer patients. Skin rash has been documented as one of the commonest adverse reactions in patients receiving erlotinib and other EGFR inhibitors. Draw back to this reaction leads to: 1) drug discontinuation or dose reduction; 2) impairs quality of life; and 3) Puts patients at risk of superinfection. Monitoring patients closely and initiating immediate skin care is recommended. However, patients forget how the rash started and when. No standard treatments exist secondary to the diversity of symptoms, variability and intermittent occurrence in relation to the cancer therapy. In addition, there is slow improvement with medical treatment. Also, patients need to make extra visits to doctor's office for skin management when in needed in addition to chemotherapy appointments. Late presentation for medical attention leading to complications, such as sepsis. We here experience a novel way of assessing and managing the skin rash using the electronic media. We suggest that electronic communication is of crucial importance to detect early, diagnose and treat anti-EGFR related skin rash in order to continue the benefit of anti-EGFR.",
"affiliations": "Section of Medical Oncology, Yale University School of Medicine, New Haven, CT 06520, USA. wasif.saif@yale.edu",
"authors": "Saif|Muhammad Wasif|MW|;Kaley|Kristin|K|;Lamb|Lynne|L|;Pecerillo|Jennifer|J|;Hotchkiss|Susan|S|;Steven|Lisa|L|;Brennan|Marianne|M|;Penney|Robin|R|;Gillespie|Carolyn|C|;Shaib|Walid|W|",
"chemical_list": "D047428:Protein Kinase Inhibitors; C512478:EGFR protein, human; D066246:ErbB Receptors",
"country": "Italy",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1590-8577",
"issue": "11(2)",
"journal": "JOP : Journal of the pancreas",
"keywords": null,
"medline_ta": "JOP",
"mesh_terms": "D016907:Adverse Drug Reaction Reporting Systems; D000465:Algorithms; D001296:Audiovisual Aids; D002277:Carcinoma; D003142:Communication; D003266:Continuity of Patient Care; D064420:Drug-Related Side Effects and Adverse Reactions; D004526:Efficiency; D034742:Electronic Mail; D066246:ErbB Receptors; D005770:Gastrointestinal Neoplasms; D006297:Health Services Accessibility; D006801:Humans; D010190:Pancreatic Neoplasms; D010349:Patient Compliance; D010817:Physician-Patient Relations; D047428:Protein Kinase Inhibitors; D012871:Skin Diseases; D013685:Telecommunications",
"nlm_unique_id": "101091810",
"other_id": null,
"pages": "176-82",
"pmc": null,
"pmid": "20208331",
"pubdate": "2010-03-05",
"publication_types": "D019531:Lecture",
"references": null,
"title": "Management of skin toxicities of anti-EGFR agents in patients with pancreatic cancer and other GI tumors by using electronic communication: effective and convenient.",
"title_normalized": "management of skin toxicities of anti egfr agents in patients with pancreatic cancer and other gi tumors by using electronic communication effective and convenient"
} | [
{
"companynumb": "US-ROCHE-698240",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ERLOTINIB"
},
"drugadditional": "3",
"drugadm... |
{
"abstract": "Optimal treatment strategies are lacking in relapsed/refractory (R/R) chronic lymphocytic leukemia (CLL). Gemcitabine has shown activity and acceptable safety profile in B-cell lymphomas. We present a retrospective case review of gemcitabine and alemtuzumab, every 21 d (for up to six courses) in 27 community-based patients with high-risk R/R CLL. Median age was 70 yr (44-83 yr), 55% patients had Binet stage C, deletion 17p (del(17p)) and/or deletion 11q (del(11q)) were found in 65% and 27%, bulky disease in 55.5%, and fludarabine-refractoriness in 48% of cases, respectively. Overall response rate was 63% (29.6% clinical CR and 33.4% PR). At a median follow-up of 31 months, median PFS and OS were 15.4 and 24 months. In multivariate analysis, median OS is influenced by prior lines of treatment = 3 and bulky disease. Combination of alemtuzumab and gemcitabine appears to be an active, easy to administrate treatment in routine practice, high-risk R/R CLL patients.",
"affiliations": "Department of Hematology, Purpan University Hospital, Toulouse cedex, France.",
"authors": "Oberic|Lucie|L|;Vaillant|Willy|W|;Hebraud|Benjamin|B|;Recher|Christian|C|;Suc|Etienne|E|;Houyau|Philippe|P|;Laurent|Guy|G|;Ysebaert|Loic|L|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D003841:Deoxycytidine; D000074323:Alemtuzumab; C056507:gemcitabine",
"country": "England",
"delete": false,
"doi": "10.1111/ejh.12391",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0902-4441",
"issue": "94(1)",
"journal": "European journal of haematology",
"keywords": "alemtuzumab; chronic lymphocytic leukemia; fludarabine-refractory; gemcitabine",
"medline_ta": "Eur J Haematol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000074323:Alemtuzumab; D061067:Antibodies, Monoclonal, Humanized; D000971:Antineoplastic Combined Chemotherapy Protocols; D003841:Deoxycytidine; D005260:Female; D006801:Humans; D015451:Leukemia, Lymphocytic, Chronic, B-Cell; D008297:Male; D008875:Middle Aged; D009367:Neoplasm Staging; D012008:Recurrence; D016896:Treatment Outcome",
"nlm_unique_id": "8703985",
"other_id": null,
"pages": "37-42",
"pmc": null,
"pmid": "24939411",
"pubdate": "2015-01",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Clinical activity of a new regimen combining gemcitabine and alemtuzumab in high-risk relapsed/refractory chronic lymphocytic leukemia patients.",
"title_normalized": "clinical activity of a new regimen combining gemcitabine and alemtuzumab in high risk relapsed refractory chronic lymphocytic leukemia patients"
} | [
{
"companynumb": "FR-ACCORD-033467",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "GEMCITABINE\\GEMCITABINE HYDROCHLORIDE"
},
"drugadditi... |
{
"abstract": "OBJECTIVE\nUrine cytology remains an essential diagnostic tool in the surveillance of patients with non-muscle invasive bladder cancer (NMIBC). The correlation of urine cytology with biopsy specimens to determine its accuracy following induction intravesical therapy has not been investigated.\n\n\nMETHODS\nA retrospective review was performed of patients who underwent intravesical therapy for biopsy-proven non-muscle invasive disease between 2013 and 2016 at our institution. All patients uniformly underwent cytology and systematic bladder biopsies in the operating room within 12 weeks following intravesical therapy. The accuracy of urinary cytology in predicting high-grade disease recurrence following intravesical therapy was confirmed by correlating cytology results to post-treatment systematic biopsies, regardless of endoscopic findings. Only patients with complete information regarding urine cytology and pathologic biopsy results, both pre- and post-intravesical therapy, were included.\n\n\nRESULTS\n90 cytology samples following intravesical therapy were analyzed from 76 patients who met inclusion criteria. 72 (80.0%) and 18 (20.0%) of the samples were collected from patients initially treated for high- and low-grade disease, respectively. Fifty-six (62.2%) specimens were obtained from patients following induction of bacillus Calmette-Guerin (BCG) therapy; the remainder were from patients treated with intravesical gemcitabine/docetaxel, mitomycin, or BCG/interferon. For patients treated with BCG, cytology was positive for high-grade disease in 8/15 patients with high-grade pathology on follow-up biopsy, thus demonstrating a sensitivity of 53% (95% CI 27-79%), specificity of 95% (95% CI 84-99%), positive predictive value of 80% (95% CI 44-98%), and negative predictive value of 85% (95% CI 71-94%). If cytologic interpretation was broadened to include high-grade and \"suspicious for high-grade\" findings, sensitivity increased to 67% (95% CI 38-88%) and specificity decreased to 88% (95% CI 74-96%).\n\n\nCONCLUSIONS\nWhile urinary cytology maintains a high specificity following intravesical therapy, it demonstrates a low sensitivity for potentially aggressive high-grade urothelial carcinoma. Further evaluation of more effective, clinic-based enhanced cystoscopy techniques and biomarkers is warranted to better identify patients at risk for disease recurrence following BCG therapy.",
"affiliations": "Department of Urology, James Buchanan Brady Urological Institute, Johns Hopkins Medical Institutions, The Johns Hopkins University School of Medicine, 600 North Wolfe Street, Park 224, Baltimore, MD, 21287, USA. mgupta16@jhmi.edu.;Department of Urology, James Buchanan Brady Urological Institute, Johns Hopkins Medical Institutions, The Johns Hopkins University School of Medicine, 600 North Wolfe Street, Park 224, Baltimore, MD, 21287, USA.;Department of Urology, James Buchanan Brady Urological Institute, Johns Hopkins Medical Institutions, The Johns Hopkins University School of Medicine, 600 North Wolfe Street, Park 224, Baltimore, MD, 21287, USA.;Department of Urology, James Buchanan Brady Urological Institute, Johns Hopkins Medical Institutions, The Johns Hopkins University School of Medicine, 600 North Wolfe Street, Park 224, Baltimore, MD, 21287, USA.;Department of Urology, James Buchanan Brady Urological Institute, Johns Hopkins Medical Institutions, The Johns Hopkins University School of Medicine, 600 North Wolfe Street, Park 224, Baltimore, MD, 21287, USA.;Department of Urology, James Buchanan Brady Urological Institute, Johns Hopkins Medical Institutions, The Johns Hopkins University School of Medicine, 600 North Wolfe Street, Park 224, Baltimore, MD, 21287, USA.;Department of Pathology and Oncology, Johns Hopkins Medical Institutions, Baltimore, MD, USA.;Department of Urology, James Buchanan Brady Urological Institute, Johns Hopkins Medical Institutions, The Johns Hopkins University School of Medicine, 600 North Wolfe Street, Park 224, Baltimore, MD, 21287, USA.",
"authors": "Gupta|Mohit|M|;Milbar|Niv|N|;Tema|Giorgia|G|;Pederzoli|Filippo|F|;Chappidi|Meera|M|;Kates|Max|M|;VandenBussche|Christopher J|CJ|;Bivalacqua|Trinity J|TJ|",
"chemical_list": "D000970:Antineoplastic Agents",
"country": "Germany",
"delete": false,
"doi": "10.1007/s00345-018-02624-3",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0724-4983",
"issue": "37(10)",
"journal": "World journal of urology",
"keywords": "Bacillus Calmette–Guerin; Urinary bladder neoplasms; Urine cytology; Urothelial carcinoma",
"medline_ta": "World J Urol",
"mesh_terms": "D000283:Administration, Intravesical; D000368:Aged; D000369:Aged, 80 and over; D000970:Antineoplastic Agents; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D009361:Neoplasm Invasiveness; D015203:Reproducibility of Results; D012189:Retrospective Studies; D001749:Urinary Bladder Neoplasms; D014556:Urine",
"nlm_unique_id": "8307716",
"other_id": null,
"pages": "2051-2058",
"pmc": null,
"pmid": "30671639",
"pubdate": "2019-10",
"publication_types": "D016428:Journal Article",
"references": "12559279;27324428;9850170;7615848;23906669;27317986;8465635;23602406;19520422;23540775;11025767;25037483;20019983;23192913;19230026;12796694;19494853;16442208;14665861;29575439;15713770;16399415;17499291;23192944;28272842;16093971;16542342;9307203;27221750;25001887",
"title": "Impact of intravesical therapy for non-muscle invasive bladder cancer on the accuracy of urine cytology.",
"title_normalized": "impact of intravesical therapy for non muscle invasive bladder cancer on the accuracy of urine cytology"
} | [
{
"companynumb": "US-009507513-2003USA002217",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "BACILLUS CALMETTE-GUERIN SUBSTRAIN TICE LIVE ANTIGEN"
... |
{
"abstract": "Cystic fibrosis (CF) is one of the most common genetic disorders. Mutations of the cystic fibrosis transmembrane regulator causes dysfunction of epithelial membranes within the gastrointestinal and respiratory system. Patients with CF are known to be at risk for gastrointestinal malignancies, and lung transplantation further increases this risk. We report a case series of three CF patients who developed adenocarcinoma of the gastrointestinal tract in the posttransplant setting. One of these case histories describes a gastric cancer, which is a novel and to date unreported observation. These data emphasise the importance of checking CF patients for the development of abdominal complications following lung transplantation.",
"affiliations": "Division of Pulmonology, University Hospital Zurich, Switzerland.;Division of Pulmonology, University Hospital Zurich, Switzerland.;Division of Pulmonology, University Hospital Zurich, Switzerland.;Division of Pulmonology, University Hospital Zurich, Switzerland.;Division of Pulmonology, University Hospital Zurich, Switzerland.",
"authors": "Murer|Christian|C|;Bürgi|Urs|U|;Kohler|Malcolm|M|;Benden|Christian|C|;Huber|Lars C|LC|",
"chemical_list": "D007166:Immunosuppressive Agents",
"country": "Switzerland",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0036-7672",
"issue": "145()",
"journal": "Swiss medical weekly",
"keywords": null,
"medline_ta": "Swiss Med Wkly",
"mesh_terms": "D000230:Adenocarcinoma; D000293:Adolescent; D000328:Adult; D003550:Cystic Fibrosis; D005260:Female; D005770:Gastrointestinal Neoplasms; D006801:Humans; D007166:Immunosuppressive Agents; D016040:Lung Transplantation; D008297:Male; D010190:Pancreatic Neoplasms",
"nlm_unique_id": "100970884",
"other_id": null,
"pages": "w14165",
"pmc": null,
"pmid": "26230186",
"pubdate": "2015",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Adenocarcinoma of the gastrointestinal tract in lung transplanted patients with cystic fibrosis: case series and review of the literature.",
"title_normalized": "adenocarcinoma of the gastrointestinal tract in lung transplanted patients with cystic fibrosis case series and review of the literature"
} | [
{
"companynumb": "PHHY2015CH093712",
"fulfillexpeditecriteria": "1",
"occurcountry": "CH",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "MYCOPHENOLATE MOFETIL"
},
"drugadditional": null,
... |
{
"abstract": "Interestingly, our case presenting with coronary AV fistula firstly reported in the literature with fetal valproate syndrome. Although differential diagnosis is sometimes difficult, it can be diagnosed with detailed history, physical examination and appropriate laboratory tests. Fetal valproate syndrome can be prevented by discontinue of the valproic acid especially during first trimester of pregnancy.",
"affiliations": "Erciyes University School of Medicine, Division of Pediatric Cardiology, Kayseri, Turkey.;Erciyes University School of Medicine, Division of Pediatric Cardiology, Kayseri, Turkey.;Erciyes University School of Medicine, Division of Pediatric Cardiology, Kayseri, Turkey.",
"authors": "Doğan|Alper|A|https://orcid.org/0000-0002-5735-9255;Baykan|Ali|A|;Vural|Cagdas|C|",
"chemical_list": "D014635:Valproic Acid",
"country": "England",
"delete": false,
"doi": "10.1017/S1047951120004904",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1047-9511",
"issue": "31(5)",
"journal": "Cardiology in the young",
"keywords": "coronary AV fistula; fetal valproate syndrome; teratogenes",
"medline_ta": "Cardiol Young",
"mesh_terms": "D000014:Abnormalities, Drug-Induced; D001164:Arteriovenous Fistula; D005260:Female; D006801:Humans; D011247:Pregnancy; D011261:Pregnancy Trimester, First; D014635:Valproic Acid",
"nlm_unique_id": "9200019",
"other_id": null,
"pages": "853-855",
"pmc": null,
"pmid": "33455599",
"pubdate": "2021-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Fetal valproate syndrome with coronary arteriovenous fistula: a case report.",
"title_normalized": "fetal valproate syndrome with coronary arteriovenous fistula a case report"
} | [
{
"companynumb": "TR-WOCKHARDT BIO AG-2021WBA000023",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "VALPROIC ACID"
},
"drugadditional": "... |
{
"abstract": "OBJECTIVE\nRare cases of azithromycin-induced hepatotoxicity have been reported, with variable clinical and histologic features. We characterized clinical features and outcomes of azithromycin-induced liver injury.\n\n\nMETHODS\nWe identified patients with azithromycin-induced liver injury from the Drug-Induced Liver Injury Network Prospective Study who had causality scores of definite, highly likely, or probable. Demographic, clinical, and laboratory data and 6-month outcomes were examined.\n\n\nRESULTS\nEighteen patients (72% female; mean age, 37 y) had causality scores of definite (n = 1), highly likely (n = 9), or probable (n = 8). Common presenting symptoms were jaundice, abdominal pain, nausea, and/or pruritus. For 16 patients, abnormal results from liver tests were first detected 14 days after azithromycin cessation (range, 9-20 d). The median duration of azithromycin treatment was 4 days (range, 2-7 d). The pattern of injury was hepatocellular in 10 patients, cholestatic in 6 patients, and mixed in 2 patients. The mean peak level of alanine aminotransferase was 2127 IU/L, of alkaline phosphatase was 481 IU/L, and of total bilirubin was 9.2 mg/dL. Liver histology showed ductopenia and veno-occlusive changes in a few patients. Two individuals had severe hypersensitivity cutaneous reactions. After 6 months, 8 patients had recovered, 4 patients had chronic injury, 1 patient died, and 1 patient underwent liver transplantation (outcomes were unavailable for 4 patients). Two of the patients who died or underwent liver transplantation had underlying chronic liver disease.\n\n\nCONCLUSIONS\nAzithromycin-induced liver injury occurs within 1 to 3 weeks after azithromycin initiation and predominantly is hepatocellular in nature. Although most patients recover fully, severe cutaneous reactions, chronic injury, and serious complications leading to death or liver transplantation can occur (ClinicalTrials.gov identifier, NCT00345930).",
"affiliations": "Division of Gastroenterology and Hepatology, Indiana University School of Medicine, Indianapolis, Indiana.;Division of Gastroenterology and Hepatology, Indiana University School of Medicine, Indianapolis, Indiana.;Department of Medicine, University of Michigan, Ann Arbor, Michigan.;Department of Medicine, University of Southern California, Los Angeles, California.;Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland.;Department of Medicine, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina.;Duke Clinical Research Institute, Durham, North Carolina.;Liver Disease Research Branch, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland.;Division of Gastroenterology and Hepatology, Indiana University School of Medicine, Indianapolis, Indiana. Electronic address: nchalasa@iupui.edu.",
"authors": "Martinez|Melissa A|MA|;Vuppalanchi|Raj|R|;Fontana|Robert J|RJ|;Stolz|Andrew|A|;Kleiner|David E|DE|;Hayashi|Paul H|PH|;Gu|Jiezhun|J|;Hoofnagle|Jay H|JH|;Chalasani|Naga|N|",
"chemical_list": "D000900:Anti-Bacterial Agents; D017963:Azithromycin",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1542-3565",
"issue": "13(2)",
"journal": "Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association",
"keywords": "Antibiotic; DILI; Liver Toxicity; Macrolide",
"medline_ta": "Clin Gastroenterol Hepatol",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000900:Anti-Bacterial Agents; D017963:Azithromycin; D056486:Chemical and Drug Induced Liver Injury; D002648:Child; D002675:Child, Preschool; D005260:Female; D006651:Histocytochemistry; D006801:Humans; D007223:Infant; D008099:Liver; D008297:Male; D008875:Middle Aged; D011446:Prospective Studies; D016019:Survival Analysis; D013997:Time Factors; D055815:Young Adult",
"nlm_unique_id": "101160775",
"other_id": null,
"pages": "369-376.e3",
"pmc": null,
"pmid": "25111234",
"pubdate": "2015-02",
"publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural",
"references": "14523675;11980521;3391880;11247598;11980528;19132805;24037963;19562705;1656742;12395890;22613850;18242505;23248414;19906050;23574140;9217574;20210729;8889721;15382161;12016551;10957862;20479103;20815829;20949552;4888905;22145749;18955056;22014021;8862966;20512999;629252;21586591",
"title": "Clinical and histologic features of azithromycin-induced liver injury.",
"title_normalized": "clinical and histologic features of azithromycin induced liver injury"
} | [
{
"companynumb": "US-LUPIN PHARMACEUTICALS INC.-2015-03726",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "AZITHROMYCIN ANHYDROUS"
},
"d... |
{
"abstract": "We present a case of root abscess with aorta to right atrium fistula due to vancomycin-intermediate Staphylococcus aureus (VISA) after limb amputation and cardiac surgery. Patient underwent redo aortic valve replacement, patch repair of aorta to right atrial fistula, and tricuspid valve repair with a ring. Fistula formation is a rare complication of prosthetic valve endocarditis (PVE). This is the first case to discuss aortocavitary fistula (ACF) formation due to VISA. Transesophageal echocardiogram (TEE) is the preferred imaging modality to diagnose ACF.",
"affiliations": "Department of Medicine, Division of Cardiovascular Medicine, University of Maryland School of Medicine, Baltimore, Maryland 21201, USA.;Department of Medicine, Division of Cardiovascular Medicine, University of Maryland School of Medicine, Baltimore, Maryland 21201, USA.;Department of Medicine, Division of Cardiovascular Medicine, University of Maryland School of Medicine, Baltimore, Maryland 21201, USA.",
"authors": "Hankinson|Stephen J|SJ|0000-0001-6108-1017;Sultanik|Elliot A|EA|0000-0002-0240-3482;Ramani|Gautam V|GV|0000-0002-2801-651X",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2019/3627063",
"fulltext": "\n==== Front\nCase Rep CardiolCase Rep CardiolCRICCase Reports in Cardiology2090-64042090-6412Hindawi 10.1155/2019/3627063Case ReportAortic Root Abscess with Aorta to Right Atrium Fistula due to Vancomycin-Intermediate Staphylococcus aureus (VISA) http://orcid.org/0000-0001-6108-1017Hankinson Stephen J. shankinson@som.umaryland.eduhttp://orcid.org/0000-0002-0240-3482Sultanik Elliot A. http://orcid.org/0000-0002-2801-651XRamani Gautam V. Department of Medicine, Division of Cardiovascular Medicine, University of Maryland School of Medicine, Baltimore, Maryland 21201, USAAcademic Editor: Antonio de Padua Mansur\n\n2019 29 5 2019 2019 36270632 3 2019 1 5 2019 7 5 2019 Copyright © 2019 Stephen J. Hankinson et al.2019This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.We present a case of root abscess with aorta to right atrium fistula due to vancomycin-intermediate Staphylococcus aureus (VISA) after limb amputation and cardiac surgery. Patient underwent redo aortic valve replacement, patch repair of aorta to right atrial fistula, and tricuspid valve repair with a ring. Fistula formation is a rare complication of prosthetic valve endocarditis (PVE). This is the first case to discuss aortocavitary fistula (ACF) formation due to VISA. Transesophageal echocardiogram (TEE) is the preferred imaging modality to diagnose ACF.\n==== Body\n1. Introduction\nThe emergence of multidrug-resistant (MDR) organisms makes the medical management of endocarditis increasingly difficult. TEE is the preferred imaging modality to diagnose ACF. Surgical repair continues to be the definitive treatment option for ACF.\n\n2. Case Presentation\nOur patient is a 74-year-old man with a history of rheumatoid arthritis (on prednisone), left below the knee amputation (BKA), coronary artery bypass graft (CABG) with a saphenous vein graft to the right coronary artery (SVG to RCA), aortic valve replacement (AVR) with a bioprosthetic valve, and mitral valve replacement (MVR) with a bioprosthetic valve who presented with fever, chills, and generalized weakness after a prolonged course of vancomycin for methicillin-resistant Staphylococcus aureus (MRSA) bacteremia.\n\nThe patient was previously admitted for left foot MRSA osteomyelitis. During that hospitalization, the patient had a myocardial infarction. Source control obtained with BKA of the left leg and five days later subsequently underwent CABG (SVG to RCA), AVR for severe aortic stenosis (AS), and MVR for severe mitral regurgitation (MR). The patient was discharged with a six-week course of vancomycin; however, vancomycin course was extended due to BKA wound that required skin graft surgery. Eighty-eight days after cardiac surgery, the patient was readmitted for MRSA bacteremia attributed to cellulitis of the BKA stump vs. endocarditis. Transthoracic echocardiogram (TTE) at that time was negative for PVE. Patient was treated with a six-week course of vancomycin, and BKA stump cellulitis subsequently resolved. Five days after completing antibiotics, the patient presented with MRSA bacteremia, which progressed to VISA bacteremia with a vancomycin minimum inhibitory concentration (MIC) of 4 μg/mL (Table 1). The patient was started on daptomycin, ceftaroline, and rifampin for VISA bacteremia. TEE showed aortic root thickening suggestive of abscess with associated structural defect, a mobile 2.4 cm × 1.9 cm echodensity projecting into the right atrium (RA) (Figure 1(a)), and left to right shunting (Figure 1(b)).\n\nThe patient subsequently underwent cardiac surgery for redo AVR with a bovine pericardial tissue valve, patch repair of aorta to right atrial fistula with a bovine pericardial patching material from both the left ventricular side and right atrial side, and tricuspid valve repair with a ring. Postsurgery TTE demonstrated a normal left ventricle size and systolic function, a normal right ventricle size and function, a bioprosthetic valve in aortic position (mean gradient 20 mmHg and peak gradient 45 mmHg) and no aortic regurgitation, and an annuloplasty ring indicative of tricuspid valve repair.\n\n3. Discussion\nThis case discusses ACF formation as a complication of cardiac surgery shortly after limb amputation. PVE is a devastating complication of valve replacement with the prevalence being 4.1% at 4 years after primary valve replacement with the greatest risk occurring 1 to 2 months after surgery [1].\n\nACF is a rare condition caused by congenital abnormalities, aortic dissection, valve replacement, and infective endocarditis (IE) [2]. The pathogenesis of ACF related to infection is caused by extension and infiltration of abscesses related to endocarditis. Annular infection affects contiguous tissue leading to pyogenesis and tissue necrosis, which causes formation of an abscess cavity. As a result, the weakened necrotic myocardium may expand and rupture which may create intracardiac fistulous communications or even pericardial shunts [3]. Echocardiography can be used to identify the location of the lesion while angiography is often used to demonstrate the course of the lesion and define the surgical approach. Anguera et al. demonstrated that the detection of ACF for TTE and TEE is 53% and 97%, respectively [4]. TEE is the superior imaging technique because the flow across the fistula is highly turbulent and Doppler mapping can easily detect pressure differences between the aorta and cardiac chambers even when the fistulous orifice is small; therefore, TEE allows for the detection of almost all fistulas and allows the optimal characterization of each fistula tract. Additionally, TEE is superior to TTE in assessing valve function and morphology as well as delineating intracardiac pathology such as complications of endocarditis, namely, root abscess and fistulas. Furthermore, TEE has a better signal to the noise ratio and proximity of the transducer to the heart leading to higher quality images with lesser attenuation [5].\n\nOur case is unique because it is the first case of ACF due to VISA. Our patient had extensive comorbidities prior to BKA including cardiac issues, sepsis, and steroid use, all of which have been shown to be predictors of increased mortality and postoperative complications within 30 days after BKA [6]. Given these comorbidities, perhaps a longer time course should have elapsed between the BKA in order to further optimize the patient prior to cardiac surgery. Overall, these comorbidities lead to a prolonged course of vancomycin, which resulted in the development of a MDR organism.\n\nVISA and vancomycin-resistant S. aureus (VRSA) are relatively rare infections that occur in the setting of heavy prior use of glycopeptide antibiotics [7]. The Clinical Laboratory Standards Institute (CLSI) defines VISA as a vancomycin MIC of 4-8 μg/mL and VRSA as a vancomycin MIC of ≥16 μg/mL [8]. Vancomycin MIC ≥ 4 μg/mL is associated with vancomycin treatment failures in MRSA IE, which is a novel concept for this cohort [9]. MRSA resistance to vancomycin occurs through a variety of mechanisms including cell wall thickening, decreased autolysis, reduced production of cell surface protein A, increased capsule expressions, increased D-alanylation of teichoic acids, and reduced agr activity [8]. Given the prolonged course of vancomycin prior to the discovery of the ACF, it is difficult to identify whether the valve annulus was seeded during implantation of the valve or BKA stump cellulitis lead to hematogenous seeding of the valve.\n\n4. Conclusion\nPresented above was a case of a patient with an ACF due to VISA. This case demonstrated that protracted use of vancomycin resulted in VISA IE. Clinicians should exercise caution in patients with high bacterial load infections after prolonged antibiotic use. Infectious disease specialist consultation, change in antibiotic regimen, and aggressive surgical management are appropriate for the management of VISA IE.\n\nConflicts of Interest\nThe authors declare that they have no conflicts of interest.\n\nSupplementary Materials\nSupplementary Materials “Color doppler video” (supplementary material 1) 2.4 cm × 1.9 cm mobile echodensity in the RA with a systolic left to right shunt.\n\nClick here for additional data file.\n\n Figure 1 TEE demonstrates mobile echodensity (red arrow) measuring 2.4 cm × 1.9 cm in the RA associated with the wall of the atrium at the site of the suspected defect (a). TEE demonstrates atrioventricular defect and a systolic left to right shunt suggestive of aortic root abscess and erosion into the RA (b).\n\nTable 1 Culture data during protracted use of vancomycin.\n\nType of culture\tDate\tOrganism\tVancomycin MIC (μg/mL)\t\nLeft foot wound\t11/10/2017\tMRSA\t≤0.5\t\nBlood\t2/27/2018\tMRSA\t1\t\nBlood\t4/16/2018\tMRSA\t2\t\nBlood\t4/26/2018\tMRSA\t4\n==== Refs\n1 Sabik J. F. Lytle B. W. Blackstone E. H. Marullo A. G. M. Pettersson G. B. Cosgrove D. M. Aortic root replacement with cryopreserved allograft for prosthetic valve endocarditis The Annals of Thoracic Surgery 2002 74 3 650 659 discussion 659 10.1016/S0003-4975(02)03779-7 2-s2.0-0036714224 12238819 \n2 Fierro E. A. Sikachi R. R. Agrawal A. Verma I. Ojrzanowski M. Sahni S. Aorto-atrial fistulas: a contemporary review Cardiology in Review 2018 26 3 137 144 10.1097/CRD.0000000000000182 2-s2.0-85053536583 29077586 \n3 Kang N. Wan S. Ng C. S. Underwood M. J. Periannular extension of infective endocarditis Annals of thoracic and cardiovascular surgery: official journal of the Association of Thoracic and Cardiovascular Surgeons of Asia 2009 15 2 74 81 19471219 \n4 Anguera I. Miro J. M. Vilacosta I. Aorto-cavitary fistulous tract formation in infective endocarditis: clinical and echocardiographic features of 76 cases and risk factors for mortality European Heart Journal 2005 26 3 288 297 10.1093/eurheartj/ehi034 2-s2.0-13544271776 15618052 \n5 Ananthasubramaniam K. Clinical and echocardiographic features of aorto-atrial fistulas Cardiovascular Ultrasound 2005 3 1 10.1186/1476-7120-3-1 2-s2.0-14544303178 \n6 Belmont P. J. Jr. Davey S. Orr J. D. Ochoa L. M. Bader J. O. Schoenfeld A. J. Risk factors for 30-day postoperative complications and mortality after below-knee amputation: a study of 2,911 patients from the national surgical quality improvement program Journal of the American College of Surgeons 2011 213 3 370 378 10.1016/j.jamcollsurg.2011.05.019 2-s2.0-80052960575 21723151 \n7 Chesi G. Colli A. Mestres C. A. Gambarati G. Boni F. Gherli T. Multiresistant-MRSA tricuspid valve infective endocarditis with ancient osteomyelitis locus BMC Infectious Diseases 2006 6 1 10.1186/1471-2334-6-124 2-s2.0-33747495217 \n8 Howden B. P. Davies J. K. Johnson P. D. Stinear T. P. Grayson M. L. Reduced vancomycin susceptibility in Staphylococcus aureus, including vancomycin-intermediate and heterogeneous vancomycin-intermediate strains: resistance mechanisms, laboratory detection, and clinical implications Clinical Microbiology Reviews 2010 23 1 99 139 10.1128/CMR.00042-09 2-s2.0-74249096623 20065327 \n9 Casapao A. M. Davis S. L. McRoberts J. P. Evaluation of vancomycin population susceptibility analysis profile as a predictor of outcomes for patients with infective endocarditis due to methicillin-resistant Staphylococcus aureus Antimicrobial Agents and Chemotherapy 2014 58 8 4636 4641 10.1128/AAC.02820-13 2-s2.0-84905389561 24890596\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-6404",
"issue": "2019()",
"journal": "Case reports in cardiology",
"keywords": null,
"medline_ta": "Case Rep Cardiol",
"mesh_terms": null,
"nlm_unique_id": "101576452",
"other_id": null,
"pages": "3627063",
"pmc": null,
"pmid": "31275664",
"pubdate": "2019",
"publication_types": "D002363:Case Reports",
"references": "12238819;15618052;15655075;16872491;19471219;20065327;21723151;24890596;29077586",
"title": "Aortic Root Abscess with Aorta to Right Atrium Fistula due to Vancomycin-Intermediate Staphylococcus aureus (VISA).",
"title_normalized": "aortic root abscess with aorta to right atrium fistula due to vancomycin intermediate staphylococcus aureus visa"
} | [
{
"companynumb": "NVSC2019US011734",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VANCOMYCIN"
},
"drugadditional": "3",
"druga... |
{
"abstract": "Small cell lung cancer (SCLC) transformation is a rare resistance mechanism to anaplastic lymphoma kinase-tyrosine kinase inhibitors (ALK-TKIs), for which cytotoxic chemotherapy is often initiated. However, no case has been reported so far in which the SCLC component disappeared after chemotherapy and the tumor responded to ALK-TKI treatment again. A 41-year-old, never-smoker man was diagnosed with multiple metastatic lung adenocarcinoma harboring ALK gene rearrangements. After tumor re-growth was treated with alectinib, histological analysis of re-biopsy of the primary lesion showed combined small cell carcinoma, and cytotoxic chemotherapy was administered. After resistance to chemotherapy developed, the third biopsy of the primary lesion showed the original ALK gene rearrangements without the SCLC component. Alectinib was re-administered, and partial response was obtained. Biopsy for ALK-positive lung cancer that progressed after chemotherapy for SCLC transformation might be useful for decision-making regarding the therapeutic strategy.",
"affiliations": "Department of Respiratory Medicine, Ohara Healthcare Foundation, Kurashiki Central Hospital, 1-1-1 Miwa, Kurashiki, Okayama, 710-8602, Japan.;Department of Respiratory Medicine, Ohara Healthcare Foundation, Kurashiki Central Hospital, 1-1-1 Miwa, Kurashiki, Okayama, 710-8602, Japan.;Department of Respiratory Medicine, Ohara Healthcare Foundation, Kurashiki Central Hospital, 1-1-1 Miwa, Kurashiki, Okayama, 710-8602, Japan.;Department of Respiratory Medicine, Ohara Healthcare Foundation, Kurashiki Central Hospital, 1-1-1 Miwa, Kurashiki, Okayama, 710-8602, Japan.",
"authors": "Yamagata|Akira|A|;Yokoyama|Toshihide|T|;Fukuda|Yasushi|Y|;Ishida|Tadashi|T|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1016/j.rmcr.2021.101440",
"fulltext": "\n==== Front\nRespir Med Case Rep\nRespir Med Case Rep\nRespiratory Medicine Case Reports\n2213-0071\nElsevier\n\nS2213-0071(21)00102-7\n10.1016/j.rmcr.2021.101440\n101440\nCase Report\nAlectinib re-challenge in small cell lung cancer transformation after chemotherapy failure in a patient with ALK-positive lung cancer: A case report\nYamagata Akira ayamagata@kuhp.kyoto-u.ac.jp\nab∗\nYokoyama Toshihide a\nFukuda Yasushi a\nIshida Tadashi a\na Department of Respiratory Medicine, Ohara Healthcare Foundation, Kurashiki Central Hospital, 1-1-1 Miwa, Kurashiki, Okayama, 710-8602, Japan\nb Department of Respiratory Medicine, Graduate School of Medicine, Kyoto University, 54 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto, 606-8507, Japan\n∗ Corresponding author. Department of Respiratory Medicine, Ohara Healthcare Foundation, Kurashiki Central Hospital, 1-1-1 Miwa, Kurashiki, Okayama, 710-8602, Japan. ayamagata@kuhp.kyoto-u.ac.jp\n01 6 2021\n2021\n01 6 2021\n33 10144028 1 2021\n24 3 2021\n27 5 2021\n© 2021 The Author(s)\n2021\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).\nSmall cell lung cancer (SCLC) transformation is a rare resistance mechanism to anaplastic lymphoma kinase-tyrosine kinase inhibitors (ALK-TKIs), for which cytotoxic chemotherapy is often initiated. However, no case has been reported so far in which the SCLC component disappeared after chemotherapy and the tumor responded to ALK-TKI treatment again. A 41-year-old, never-smoker man was diagnosed with multiple metastatic lung adenocarcinoma harboring ALK gene rearrangements. After tumor re-growth was treated with alectinib, histological analysis of re-biopsy of the primary lesion showed combined small cell carcinoma, and cytotoxic chemotherapy was administered. After resistance to chemotherapy developed, the third biopsy of the primary lesion showed the original ALK gene rearrangements without the SCLC component. Alectinib was re-administered, and partial response was obtained. Biopsy for ALK-positive lung cancer that progressed after chemotherapy for SCLC transformation might be useful for decision-making regarding the therapeutic strategy.\n\nKeywords\n\nNon-small cell lung cancer\nSmall cell transformation\nAlectinib\nAnaplastic lymphoma kinase\n==== Body\nAbbreviations\n\nALK anaplastic lymphoma kinase\n\nCEA carcinoembryonic antigen\n\nEGFR epidermal growth factor receptor\n\nFISH fluorescence in situ hybridization\n\nIHC immunohistochemistry\n\nNSCLC non-small cell lung cancer\n\nSCLC small cell lung cancer\n\nSLX sialyl-Lewis X-i antigen\n\nTKI tyrosine kinase inhibitor\n\n1 Introduction\n\nAnaplastic lymphoma kinase (ALK) gene rearrangements are present in 3–5% of patients with non-small cell lung cancer (NSCLC). In the past decade, various tyrosine kinase inhibitors (TKIs) showed a dramatic and durable clinical benefit against ALK-positive NSCLC. Nevertheless, drug resistance and recurrent disease still develop in the vast majority of initial responders. The resistance mechanisms in patients with ALK-positive NSCLC comprised ALK gene alterations, such as ALK point mutations and copy-number gains, bypass signaling activation through the activation of other oncogenes, and small cell lung cancer (SCLC) transformation [1,2]. Although standard therapeutic strategies have not yet been established for patients with SCLC transformed from ALK-positive adenocarcinoma, standard therapies for SCLC are recommended for patients with SCLC transformed from epidermal growth factor receptor (EGFR)-mutant adenocarcinoma [3]. However, whether subsequent re-challenge with TKI after chemotherapy provides clinical benefit is not known.\n\nA case of adenocarcinoma harboring ALK gene rearrangements that transformed to SCLC following alectinib treatment is reported. After resistance to cytotoxic chemotherapy developed, the third biopsy of the primary lesion showed the original ALK gene rearrangements without the SCLC component, and alectinib re-challenge showed partial response. This case report shows the importance of repeated biopsy for decision-making regarding therapeutic strategies in ALK-positive lung cancer with SCLC transformation.\n\n2 Case description\n\nIn March 2010, a 41-year old man with no history of smoking underwent a medical examination for epigastralgia. The echocardiogram showed a massive pericardial effusion, and an emergent pericardial puncture was performed. Multiple metastatic lung cancer (cT4N3M1c) was diagnosed by computed tomography and positron emission tomography (Fig. 1). Cytological examination of the pericardial effusion showed adenocarcinoma. The patient subsequently underwent 4 regimens of chemotherapy (cisplatin plus pemetrexed as the first-line treatment, S-1 as the second-line treatment, amrubicin as the third-line treatment, and docetaxel as the fourth-line treatment), but disease progression was observed.Fig. 1 Imaging findings at the time of initial diagnosis A, B) Chest computed tomography scan shows a primary lesion in the right upper lobe and a massive pericardial effusion. C, D) F18 fluorodeoxyglucose positron emission tomography scan shows uptake by the primary lesion, mediastinal lymph nodes, and pelvic bone.\n\nFig. 1\n\nIn January 2012, a biopsy of the primary lesion in the right upper lobe was performed, and both immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) showed adenocarcinoma with ALK rearrangement. The drug regimen was changed to 300 mg alectinib twice daily, which is the approved dosage in Japan. He eventually achieved a partial response. After 4 years of alectinib treatment, no metastases appeared, but the primary lesion progressed (Fig. 2A).Fig. 2 Computed tomography findings A) Progression of the primary lesion after 4 years of alectinib treatment. B) Partial response during cytotoxic chemotherapy for SCLC. C) Progression of the primary lesion after 2 years of cytotoxic chemotherapy for SCLC. D) Partial response after alectinib rechallenge.\n\nFig. 2\n\nHistological analysis based on re-biopsy showed combined small cell carcinoma, in which the SCLC components were CD56 (+), synaptophysin (+), TTF-1 (−), and ALK-1 (−), and the adenocarcinoma components were CD56 (−), synaptophysin (−), TTF-1 (+), and ALK-1 (+) (Fig. 3A). Two regimens of cytotoxic chemotherapy for SCLC (cisplatin plus irinotecan as the sixth-line treatment and amrubicin as the seventh-line treatment) showed a partial response (Fig. 2B), but serum tumor markers such as carcinoembryonic antigen (CEA) and sialyl-Lewis X-i antigen (SLX) increased gradually (Fig. 4). Imaging findings showed progression of the primary lesion and multiple brain metastases (Fig. 2C).Fig. 3 Pathological findings A) The second biopsy sample shows combined small cell carcinoma. SCLC components are positive for CD56 and synaptophysin, and adenocarcinoma components are positive for TTF-1 and ALK-1. B) The third biopsy sample shows only adenocarcinoma without SCLC components. Immunohistopathological analysis shows positive staining for TTF-1 and ALK-1, but negative staining for CD56 and synaptophysin.\n\nFig. 3\n\nFig. 4 Clinical course during the sequential treatment and tumor marker levels. CEA and SLX levels are re-elevated after disease progression during cytotoxic treatment for SCLC transformation. Alectinib is re-administered after the third biopsy, which results in a partial response and decreased CEA and SLX levels.\n\nFig. 4\n\nThe third biopsy of the primary lesion showed only adenocarcinoma, with CD56 (−), synaptophysin (−), TTF-1 (+), and ALK-1 (+), and disappearance of the SCLC component (Fig. 3B). Alectinib was re-administered, which resulted in a partial response and decreased CEA and SLX levels (Fig. 2, Fig. 4). The tumor response was maintained for 8 months after the rechallenge without cranial irradiation or surgery.\n\n3 Discussion\n\nSeveral cases of EGFR-mutant adenocarcinoma that transformed to SCLC and responded to TKIs again after development of resistance to chemotherapy have been reported [4,5]. To the best of our knowledge, however, this is the first case of successful re-challenge by ALK-TKI in an ALK-positive NSCLC in which the SCLC component disappeared after chemotherapy for SCLC transformation. After transformation, cytotoxic chemotherapy reduced the SCLC component, and the proportion of ALK rearrangement-positive cancer cells increased in the heterogeneous tumors. This may explain why alectinib re-challenge was effective again.\n\nSome reports have shown that the loss of tumor suppressor genes, such as RB1 and Tp53, plays an important role in transformation to SCLC during treatment with ALK-TKIs or EGFR-TKIs [[6], [7], [8]]. In the present case, comprehensive genomic profiling could not be performed due to poor biopsy samples, and the genetic background of SCLC transformation was unknown. However, the absence of a smoking history and tumor progression after long-term molecular targeted therapy suggested that the SCLC components were not originally present, but rather that SCLC transformation was caused by the selective pressure of alectinib treatment.\n\nSerum pro-gastrin-releasing peptide precursor (ProGRP) and neuron-specific enolase (NSE) have been reported to be useful predictive markers for SCLC transformation during the development of resistance to ALK-TKIs [9]. In the present case, there was no correlation between SCLC transformation and ProGRP. On the other hand, CEA and SLX levels were re-elevated after disease progression during cytotoxic treatment for SCLC transformation. No elevation of CEA or SLX was observed when transformation to SCLC was confirmed by the re-biopsy. Thus, these tumor markers may be useful for predicting the majority of the histological subtypes in heterogeneous lung cancers.\n\nIn conclusion, the present case is the first to show that re-challenge with ALK-TKIs is effective after chemotherapy failure for SCLC transformation. Repeat biopsy at progression might be useful for decision-making regarding the therapeutic strategy for ALK-positive lung cancer with SCLC transformation.\n\nFunding\n\nThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\n\nAuthor contributions\n\nAY drafted the manuscript. TY reviewed the manuscript. AY, TY, YF, and TY were responsible for final approval of the version to be submitted.\n\nDeclaration of competing interest\n\nNone.\n\nAcknowledgments\n\nNone.\n==== Refs\nReferences\n\n1 Gainor J.F. Dardaei L. Yoda S. Molecular mechanisms of resistance to first- and second-generation ALK inhibitors in ALK-rearranged lung cancer Canc. Discov. 6 2016 1118 1133\n2 Katayama R. Friboulet L. Koike S. Two novel ALK mutations mediate acquired resistance to the next-generation ALK inhibitor alectinib Clin. Canc. Res. 20 2014 5686 5696\n3 Marcoux N. Gettinger S.N. O'Kane G. EGFR-mutant adenocarcinomas that transform to small-cell lung cancer and other neuroendocrine carcinomas: clinical outcomes J. Clin. Oncol. 37 2018 278 285 30550363\n4 Lee S. Joo J. Kwak M. Role of chemotherapy with epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) rechallenge in small cell transformation after EGFR-TKI failure: a case report OncoTargets Ther. 11 2018 3943 3947\n5 Nishioka N. Yamada T. Harita S. Successful sequential treatment of refractory tumors caused by small cell carcinoma transformation and EGFR-T790M mutation diagnosed by repeated genetic testing in a patient with lung adenocarcinoma harboring epidermal growth factor receptor mutations: a case report Respir. Med. Case. Rep. 25 2018 261 263 30310765\n6 Levacq D. D'Haene N. Wind R. Histological transformation of ALK rearranged adenocarcinoma into small cell lung cancer: a new mechanism of resistance to ALK inhibitors Lung Canc. 102 2016 38 41\n7 Norkowski E. Ghigna M.R. Lacroix L. Small-cell carcinoma in the setting of pulmonary adenocarcinoma: new insights in the era of molecular pathology J. Thorac. Oncol. 8 2013 1265 1271 24457237\n8 Oser M.G. Niederst M.J. Sequist L.V. Transformation from non-small-cell lung cancer to small-cell lung cancer: molecular drivers and cells of origin Lancet Oncol. 16 2015 e165 e172 25846096\n9 Oya Y. Yoshida T. Uemura T. Serum ProGRP and NSE levels predicting small cell lung cancer transformation in a patient with ALK rearrangement-positive non-small cell lung cancer: a case report Oncology Letters 16 2018 4219 4222 30214557\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2213-0071",
"issue": "33()",
"journal": "Respiratory medicine case reports",
"keywords": "Alectinib; Anaplastic lymphoma kinase; Non-small cell lung cancer; Small cell transformation",
"medline_ta": "Respir Med Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101604463",
"other_id": null,
"pages": "101440",
"pmc": null,
"pmid": "34401280",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "30022837;30214557;30550363;24457237;30310765;25228534;27987586;27432227;25846096",
"title": "Alectinib re-challenge in small cell lung cancer transformation after chemotherapy failure in a patient with ALK-positive lung cancer: A case report.",
"title_normalized": "alectinib re challenge in small cell lung cancer transformation after chemotherapy failure in a patient with alk positive lung cancer a case report"
} | [
{
"companynumb": "JP-SUN PHARMACEUTICAL INDUSTRIES LTD-2022RR-326874",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PEMETREXED"
},
"drug... |
{
"abstract": "Fungal endocarditis (FE) is a rare complication in immunocompromised patients which is difficult to diagnose and has been characterized by excessive mortality (> 50%) and morbidity, regardless of treatment. The lack of clinical trials due to the small number of cases contributes further to a poor outcome. In our two cases of aspergilllus endocarditis we reviewed the clinical features, echocardiographic findings, microbiologic data, treatment, and outcome of these 2 cases and provide a current characterization of the syndrome. In this paper we have demonstrated the diversity of presentation of a critical fungal infection in immunocompromised but non neutropenic paediatric patients. The prompt diagnosis and initiation of treatment is crucial for a favourable outcome along with the use of double antifungal treatment with liposomal amphotericin and voriconazole initially which could be later switched to oral voriconazole with a good tissue penetration. Histological samples as well as radiological evidence and echocardiograms should be reviewed by experienced clinicians in order to aid diagnosis and promptly initiate treatment for these patients in order to achieve a favourable outcome.",
"affiliations": "Haematology department, Birmingham Childrens Hospital, United Kingdom.",
"authors": "Nikolousis|Emmanouil|E|;Velangi|Mark|M|",
"chemical_list": null,
"country": "Italy",
"delete": false,
"doi": "10.4081/hr.2011.e7",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2038-8322",
"issue": "3(1)",
"journal": "Hematology reports",
"keywords": "Aspergillus endocarditis; leukaemia; liposomal amphotericin; voriconazole.",
"medline_ta": "Hematol Rep",
"mesh_terms": null,
"nlm_unique_id": "101556723",
"other_id": null,
"pages": "e7",
"pmc": null,
"pmid": "22184529",
"pubdate": "2011-01-13",
"publication_types": "D002363:Case Reports",
"references": "1171349;15872225;15549616;17604438;12114375;12115356;10788811;17033406;17008238;16080100;9774591;9892534",
"title": "Two cases of aspergillus endocarditis in non neutropenic children on chemotherapy for acute lymphoblastic leukaemia.",
"title_normalized": "two cases of aspergillus endocarditis in non neutropenic children on chemotherapy for acute lymphoblastic leukaemia"
} | [
{
"companynumb": "GB-MYLANLABS-2022M1047912",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CLARITHROMYCIN"
},
"drugadditional": "3",
... |
{
"abstract": "The hemolysis, elevated liver enzymes, low platelet count (HELLP) syndrome is a serious complication in pregnancy occurring in 0.5-0.9% of all pregnancies and in 10-20% of cases with severe pre-eclampsia. Previous studies described HELLP syndrome without hemolysis without any further details.\nThis report represents the criteria for the diagnosis of Abdelazim and AbuFaza elevated liver enzymes, low platelet count (ELLP) syndrome as a variant of HELLP syndrome.\nA 39-year-old woman, pregnant 32 weeks' gestation, previous five cesarean sections, admitted with severe pre-eclampsia (blood pressure 160/110 mmHg, proteinuria +3, 700 mg proteins/24 h urine, and protein/creatinine ratio ≥0.9 in spot urine sample). Laboratory investigation showed elevated liver enzymes, low platelet (PLT) count, and no evidence of hemolysis. A 31-year-old woman, pregnant 33+4 weeks' gestation, previous one cesarean section, admitted with severe pre-eclampsia (blood pressure 170/120 mmHg, proteinuria +2, 1200 mg proteins/24 h urine, and protein/creatinine ratio 1.1 in spot urine sample). Laboratory investigations showed elevated liver enzymes, low PLT count, and no evidence of hemolysis. Both patients delivered by cesarean section after stabilization of their blood pressure and dexamethasone for induction of fetal lung maturity and MgSO4 for prevention of eclampsia. Both patients had uneventful intraoperative and postoperative stay in the hospital. The liver enzymes and the PLT count were completely normal on the 5th postoperative day, and they were discharged from the hospital in good general condition.\nAbdelazim and AbuFaza ELLP syndrome is variant of HELLP syndrome without hemolysis in women with severe pre-eclampsia. Abdelazim and AbuFaza ELLP syndrome diagnostic criteria are as follows: (1) Elevated liver enzymes; (2) Low PLT count; and (3) Absence of hemolysis (normal total and unconjugated bilirubin, absence of schizocytes, and polychromatic red cells in peripheral blood smear, and normal reticulocyte count).",
"affiliations": "Department of Obstetrics and Gynecology, Ahmadi Hospital, Kuwait Oil Company, Ahmadi, Kuwait.;Department of Obstetrics and Gynecology, Ahmadi Hospital, Kuwait Oil Company, Ahmadi, Kuwait.",
"authors": "Abdelazim|Ibrahim A|IA|;AbuFaza|Mohannad|M|",
"chemical_list": null,
"country": "India",
"delete": false,
"doi": "10.4103/jfmpc.jfmpc_381_18",
"fulltext": "\n==== Front\nJ Family Med Prim CareJ Family Med Prim CareJFMPCJournal of Family Medicine and Primary Care2249-48632278-7135Medknow Publications & Media Pvt Ltd India JFMPC-8-28010.4103/jfmpc.jfmpc_381_18Case ReportAbdelazim and AbuFaza ELLP syndrome as a variant of HELLP syndrome: Case reports Abdelazim Ibrahim A. 12AbuFaza Mohannad 11 Department of Obstetrics and Gynecology, Ahmadi Hospital, Kuwait Oil Company, Ahmadi, Kuwait2 Department of Obstetrics and Gynecology, Ain Shams University, Cairo, EgyptAddress for correspondence: Prof. Ibrahim A. Abdelazim, Department of Obstetrics and Gynecology, Ain Shams University, Cairo, Egypt and Ahmadi Kuwait Oil (KOC) Company Hospital, P.O. Box: 9758, Ahmadi - 61008, Kuwait. E-mail: dr.ibrahimanwar@gmail.com1 2019 8 1 280 284 Copyright: © 2019 Journal of Family Medicine and Primary Care2019This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.Background:\nThe hemolysis, elevated liver enzymes, low platelet count (HELLP) syndrome is a serious complication in pregnancy occurring in 0.5–0.9% of all pregnancies and in 10–20% of cases with severe pre-eclampsia. Previous studies described HELLP syndrome without hemolysis without any further details.\n\nObjectives:\nThis report represents the criteria for the diagnosis of Abdelazim and AbuFaza elevated liver enzymes, low platelet count (ELLP) syndrome as a variant of HELLP syndrome.\n\nCase Reports:\nA 39-year-old woman, pregnant 32 weeks’ gestation, previous five cesarean sections, admitted with severe pre-eclampsia (blood pressure 160/110 mmHg, proteinuria +3, 700 mg proteins/24 h urine, and protein/creatinine ratio ≥0.9 in spot urine sample). Laboratory investigation showed elevated liver enzymes, low platelet (PLT) count, and no evidence of hemolysis. A 31-year-old woman, pregnant 33+4 weeks’ gestation, previous one cesarean section, admitted with severe pre-eclampsia (blood pressure 170/120 mmHg, proteinuria +2, 1200 mg proteins/24 h urine, and protein/creatinine ratio 1.1 in spot urine sample). Laboratory investigations showed elevated liver enzymes, low PLT count, and no evidence of hemolysis. Both patients delivered by cesarean section after stabilization of their blood pressure and dexamethasone for induction of fetal lung maturity and MgSO4 for prevention of eclampsia. Both patients had uneventful intraoperative and postoperative stay in the hospital. The liver enzymes and the PLT count were completely normal on the 5th postoperative day, and they were discharged from the hospital in good general condition.\n\nConclusion:\nAbdelazim and AbuFaza ELLP syndrome is variant of HELLP syndrome without hemolysis in women with severe pre-eclampsia. Abdelazim and AbuFaza ELLP syndrome diagnostic criteria are as follows: (1) Elevated liver enzymes; (2) Low PLT count; and (3) Absence of hemolysis (normal total and unconjugated bilirubin, absence of schizocytes, and polychromatic red cells in peripheral blood smear, and normal reticulocyte count).\n\nAbdelazimAbuFazaELLPHELLPhemolysis\n==== Body\nIntroduction\nWeinstein in 1982 defined the HELLP syndrome (H = Hemolysis, EL = Elevated liver enzymes, and LP = Low platelets) syndrome.[1] HELLP syndrome considered a complication of severe pre-eclampsia.[2345] The diagnosis of HELLP syndrome requires the presence of the three major components of the syndrome, whereas partial or incomplete HELLP syndrome consists of only one or two elements of the triad (H or EL or LP).[6]\n\nHELLP syndrome is a serious condition in its complete form and associated with maternal and fetal risks.[78]\n\nHELLP syndrome occurs in about 0.5–0.9% of all pregnancies and in 10–20% of severe pre-eclampsia.[9] The majority of women with the HELLP syndrome have had hypertension and proteinuria, which may be absent in 10–20% of the cases.[5]\n\nWomen with partial HELLP syndrome have absent one or two elements of the HELLP triad (H or EL or LP). However, partial or incomplete HELLP syndrome may progress to complete form of the disorder.[4]\n\nThe three components of the HELLP syndrome are hemolysis, elevated liver enzymes, and thrombocytopenia. Hemolysis is one of the major component of the disorder and is due to a microangiopathic hemolytic anemia. Red cell fragmentation caused by high-velocity passage through damaged endothelium of the small vessels. The presence of fragmented schizocytes in the peripheral blood smear reflects the hemolytic process.[10] Polychromatic red cells in blood smears and increased reticulocyte count reflect the compensatory release of immature red cells from the bone marrow.[11]\n\nHemoglobin released from hemolysis of the red cells converted to unconjugated bilirubin in the spleen or may be bound in the plasma by haptoglobin. The hemoglobin-haptoglobin complex is cleared quickly by the liver, leading to low or undetectable haptoglobin levels in the blood.[11] Low haptoglobin concentration can be used to diagnose hemolysis and is the preferred marker of hemolysis.[121314] Thus, the diagnosis of hemolysis supported by high Lactate dehydrogenase (LDH) concentration and the presence of unconjugated bilirubin, but the low or undetectable haptoglobin concentration is more specific indicator of hemolysis.[121314]\n\nHemolysis contributes substantially to the elevated levels of LDH, whereas increased asparate aminotransferase (AST) and alanine aminotransferase (ALT) levels are mostly because of liver injury. Plasma glutathione S-transferase-A1 (GST-A1) is more sensitive indicator for acute liver damage than AST and ALT.[14]\n\nThrombocytopenia [platelets (PLTs) <150 × 103/mm3] in pregnancy may be caused by gestational thrombocytopenia, immune thrombocytopenic purpura (ITP), pre-eclampsia, and HELLP syndrome.[15] Decreased PLT count in the HELLP syndrome is due to increased PLT consumption.[10]\n\nAt present, there are two major definitions for diagnosing the HELLP syndrome. In the Tennessee Classification System, Sibai proposed strict criteria for “true” or “complete” HELLP syndrome, which includes PLTs ≤100 × 103/mm3, AST ≥70 IU/L, and LDH ≥600 IU/L.[5] Intravascular hemolysis diagnosed by abnormal peripheral blood smear, increased serum bilirubin (≥20.5 μmol/l or ≥ 1.2 mg/100 ml), and elevated LDH levels (>600 IU/l).[16]\n\nThe Mississippi-Triple Class System of HELLP syndrome depending on the low PLT count during the course of the syndrome.[4] Class 1 and Class 2 associated with hemolysis (LDH >600 IU/l) and elevated AST (≥70 IU/l), whereas Class 3 requires LDH >600 IU/l and AST ≥40 IU/l, in addition to the specific PLT count.[17] Class 3 HELLP syndrome considered as a clinical transition stage or a progression phase of the HELLP syndrome.[17]\n\nThe HELLP syndrome can be diagnosed simply on biochemical evidence.[181920] Some authors require the presence of severe pre-eclampsia together with the biochemical markers to diagnose HELLP.[20212223]\n\nCase Reports\nA 39-year-old woman, pregnant 32 weeks’ gestation, previous five cesarean sections, diabetic on oral hypoglycemic medications, admitted to Ahmadi hospital, Kuwait oil company (KOC) with severe pre-eclampsia (blood pressure 160/110 mmHg measured twice 6 h apart, lower limbs edema, headache, exaggerated ankle and knee reflexes, proteinuria +3 using urine dipsticks, 700 mg proteins/24 h urine, and protein/creatinine ratio ≥0.9 in spot urine sample).\n\nLaboratory investigation showed elevated liver enzymes (ALT 211 IU/l, AST 432 IU/l, and LDH 670 IU/l), low PLT count 67 × 103, and no evidence of hemolysis.\n\nUltrasound fetal assessment showed single intrauterine pregnancy matching with her dates and estimated fetal weight (EFW) 1.700 Kg.\n\nA 31-year-old woman, pregnant 33+4 weeks’ gestation, previous one cesarean section on oral thyroxine for treatment of hypothyroidism, admitted to Ahmadi hospital, KOC with severe pre-eclampsia (blood pressure 170/120 mmHg measured twice 6 h apart, lower limbs edema, headache, epigastric pain, proteinuria +2 using urine dipsticks, 1200 mg of proteins/24 h urine and protein/creatinine ratio 1.1 in spot urine sample).\n\nLaboratory investigations showed elevated liver enzymes (ALT 292 IU/l, AST 437 IU/l, and LDH 720 IU/l), low PLT count 56 × 103, and no evidence of hemolysis.\n\nUltrasound fetal assessment showed single intrauterine pregnancy matching with her dates with EFW 1.850 Kg.\n\nBoth patients delivered by cesarean section after stabilization of their blood pressure and dexamethasone for induction of fetal lung maturity[24] and MgSO4 for fetal neuroprotection and for prevention of eclampsia.[25] Both patients had uneventful intraoperative and postoperative stay in the hospital. The liver enzymes and the PLT count were completely normal on the 5th postoperative day, and they were discharged from the hospital in good general condition.\n\nDiscussion\nThe HELLP syndrome may be misdiagnosed as viral hepatitis, cholangitis, and other serious conditions such as idiopathic thrombocytopenic purpura (ITP), acute fatty liver of pregnancy (AFLP), hemolytic uremic syndrome (HUS), thrombotic thrombocytopenic purpura (TTP), and systemic lupus erythematosus (SLE).[16]\n\nAFLP typically occurs between the 30th and 38th gestational weeks with history of malaise, vomiting, epigastric or right upper abdominal pain, and jaundice, whereas hypertension and proteinuria are usually absent. AFLP usually associated with low grade disseminated intravascular coagulation (DIC), prolonged prothrombin time, and partial thromboplastin time, low fibrinogen, and anti-thrombin concentrations.[14]\n\nITP is a syndrome with thrombocytopenia, which may be manifested by bleeding disorder with purpura and petechiae. Pregnancy does not increase the incidence of ITP and even with a very low PLT count, most cases of ITP not associated with neither maternal nor fetal morbidity.[2627]\n\nHUS and TTP are thrombotic microangiopathies that share some characteristics of the HELLP syndrome such as endothelial injury, PLT aggregation, micro-thrombi, thrombocytopenia, and anemia.[28]\n\nThe microvascular injury in HUS affects mainly the kidneys with signs and symptoms of renal failure. However, most cases of HUS appear in children and adolescents and caused by specific enterotoxin produced by Escherichia coli O157:H7.[29]\n\nTTP is an extremely rare condition during pregnancy characterized by neurological dysfunction, abdominal pain, and bleeding. The spectrum of neurological abnormalities include headache, visual disturbances, transient paresis, and seizures.[30]\n\nSLE is an autoimmune disorder characterized by deposits of antigen-antibody complexes in capillaries of multiple organs (kidneys, lungs, heart, liver, and brain). The clinical and laboratory findings in lupus nephritis are similar to those of severe pre-eclampsia. Antiphospholipid antibodies (APA; lupus anticoagulant and/or anticardiolipin antibodies) are present in 30–40% of the cases, whereas thrombocytopenia occurs in 40–50% and hemolytic anemia in 14–23% of women with SLE. Cerebral symptoms may develop because of vasculitis and/or cerebro-vascular occlusion that might lead to seizures.[5] APA associated with recurrent thrombosis and pregnancy loss. Antiphospholipid syndrome may also occur as a primary disease unrelated to SLE.[31]\n\nClinical symptoms such as headache, visual changes, epigastric pain, and nausea-vomiting have been suggested to be better predictors of adverse maternal outcome in HELLP syndrome.[32]\n\nSpontaneous rupture of a sub-capsular liver hematoma in pregnancy is a rare, but life threatening complication that occurs in about 1% to < 2% of the cases with the HELLP syndrome.[33]\n\nAbruptio-placentae, DIC, and subsequent severe post-partum bleeding are more common serious maternal complications with HELLP syndrome.[5] Bilateral permanent visual loss associated with retinopathy is a rare ophthalmic complication of HELLP syndrome.[34] In the literature, there are several case reports of cerebral bleeding associated with the HELLP syndrome.[3536] Wound hematoma and infection are frequent complications in women with the HELLP syndrome undergoing cesarean delivery.[37]\n\nAbruptio-placentae associated with the HELLP syndrome increases the risk of DIC as well as the risk of renal failure and blood transfusion.[38] Cerebral hemorrhage or stroke found to be the primary cause of death in 26% of HELLP syndrome.[39] The perinatal mortality rate related to the HELLP syndrome is ranging from 7.4% to 34%.[39] According to Gul et al., the perinatal mortality was 34% before 32 weeks’ gestation and 8% after the 32nd week.[40] Prematurity, placental insufficiency, with or without intrauterine growth restriction, and abruptio-placentae are the main causes of neonatal death.\n\nThe studied women had severe pre-eclampsia diagnosed by (1) High blood pressure ≥160/110 mm Hg measured twice 6 h apart. (2) Significant proteinuria using urine dipsticks, ≥500 mg of proteins/24 h urine, and protein/creatinine ratio ≥0.9 in spot urine sample. (3) Symptoms in form of headache, epigastric pain, and/or exaggerated ankle and knee reflexes.\n\nLaboratory investigations of the studied women showed elevated liver enzymes (ALT, AST, and LDH) and low PLT count. The presence of hemolysis excluded by normal bilirubin (total and unconjugated) and absence of schizocytes, and polychromatic red cells in blood smear, and normal reticulocyte count.[10]\n\nChhabra et al., described the partial HEELP as a syndrome contains only one or two of the three components HELLP syndrome.[41] Roelofsen et al., described the ELLP syndrome as HELLP syndrome without hemolysis in a retrospective study investigating the maternal-fetal outcome after pregnancies complicated by (H) ELLP syndrome.[42]\n\nA number of studies have included women with HELLP syndrome without evidence of hemolysis without further details.[4344]\n\nAbdelazim and AbuFaza ELLP syndrome is variant of HELLP syndrome without hemolysis in women with severe pre-eclampsia. Abdelazim and AbuFaza ELLP syndrome diagnostic criteria are as follows: (1) Elevated liver enzymes; (2) Low PLT count; and (3) Absence of hemolysis (normal total and unconjugated bilirubin, absence of schizocytes, and polychromatic red cells in peripheral blood smear, and normal reticulocyte count).\n\nIn general, there are three major options for the management of women with severe pre-eclampsia and HELLP syndrome.[14]\n\nThese include (1) Immediate delivery if HELLP syndrome diagnosed at ≥34 weeks’ gestation; (2) Delivery after stabilization of the maternal condition within 48 h if HELLP syndrome diagnosed at 27–34 weeks’ gestation; and (3) Expectant (conservative) management for >48–72 h may be considered if HELLP syndrome diagnosed before 27 weeks’ gestation.[14]\n\nBoth studied women delivered by cesarean section after stabilization of their blood pressure and dexamethasone for induction of fetal lung maturity[24] and MgSO4 for fetal neuroprotection and for prevention of eclampsia.[25] Both patients had uneventful intraoperative and postoperative stay in the hospital. The liver enzymes and the PLT count were completely normal on the 5th postoperative day, and they were discharged from the hospital in good general condition.\n\nThis report represents the diagnostic criteria of Abdelazim and AbuFaza ELLP syndrome as a variant of HELLP syndrome without hemolysis, and large studies are going on to confirm the diagnostic criteria of the syndrome.\n\nConclusion\nAbdelazim and AbuFaza ELLP syndrome is variant of HELLP syndrome without hemolysis in women with severe pre-eclampsia. Abdelazim and AbuFaza ELLP syndrome diagnostic criteria are as follows: (1) Elevated liver enzymes; (2) Low PLT count; and (3) Absence of hemolysis (normal total and unconjugated bilirubin, absence of schizocytes, and polychromatic red cells in peripheral blood smear, and normal reticulocyte count).\n\nDeclaration of patient consent\nThe authors certify that they have obtained all appropriate patient consent forms. In the form the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.\n\nFinancial support and sponsorship\nNil.\n\nConflicts of interest\nThere are no conflicts of interest.\n\nAcknowledgments\nThe authors are grateful to the studied women for their agreement and consent to participate in this presentation [signed consent taken from the studied women].\n==== Refs\n1 Weinstein L Syndrome of hemolysis, elevated liver enzymes, and low platelet count: A severe consequence of hypertension in pregnancy.1982 Am J Obstet Gynecol 2005 193 859 16150287 \n2 Celik C Gezginc K Altintepe L Tonbul HZ Yaman ST Akyurek C Results of the pregnancies with HELLP syndrome Ren Fail 2003 25 613 8 12911166 \n3 Ertan AK Wagner S Hendrik HJ Tanriverdi HA Schmidt W Clinical and biophysical aspects of HELLP-syndrome J Perinat Med 2002 30 483 9 12530105 \n4 Martin JN Jr Rose CH Briery CM Understanding and managing HELLP syndrome: The integral role of aggressive glucocorticoids for mother and child Am J Obstet Gynecol 2006 195 914 34 16631593 \n5 Sibai BM Diagnosis, controversies, and management of the syndrome of hemolysis, elevated liver enzymes, and low platelet count Obstet Gynecol 2004 103 981 91 15121574 \n6 Barton JR Sibai BM Diagnosis and management of hemolysis, elevated liver enzymes, and low platelets syndrome Clin Perinatol 2004 31 807 33 15519429 \n7 Matsuda M Mitsuhashi S Watarai M Yamamoto K Hashimoto T Ikeda S Hemolysis, elevated liver enzymes and low platelet (HELLP) syndrome associated with systemic lupus erythematosus Intern Med 2003 42 1052 3 14606727 \n8 Murphy MA Ayazifar M Permanent visual deficits secondary to the HELLP syndrome J Neuroophthalmol 2005 25 122 7 15937436 \n9 Karumanchi SA Maynard SE Stillman IE Epstein FH Sukhatme VP Preeclampsia: A renal perspective Kidney Int 2005 67 2101 13 15882253 \n10 Baxter JK Weinstein L HELLP syndrome: The state of the art Obstet Gynecol Surv 2004 59 838 45 15572962 \n11 Wilke G Rath W Schutz E Armstrong VW Kuhn W Haptoglobin as a sensitive marker of hemolysis in HELLP-syndrome Int J Gynaecol Obstet 1992 39 29 34 1358701 \n12 Rath W Faridi A Dudenhausen JW HELLP syndrome J Perinat Med 2000 28 249 60 11031696 \n13 Deruelle P Coudoux E Ego A Houfflin-Debarge V Codaccioni X Subtil D Risk factors for post-partum complications occurring after preeclampsia and HELLP syndrome. A study in 453 consecutive pregnancies Eur J Obstet Gynecol Reprod Biol 2006 125 59 65 16118033 \n14 Haram K Svendsen E Abildgaard U The HELLP syndrome: Clinical issues and management. A Review BMC Pregnancy Childbirth 2009 9 8 19245695 \n15 Parnas M Sheiner E Shoham-Vardi I Burstein E Yermiahu T Levi I Moderate to severe thrombocytopenia during pregnancy Eur J Obstet Gynecol Reprod Biol 2006 128 163 8 16533554 \n16 Sibai BM Imitators of severe pre-eclampsia/eclampsia Clin Perinatol 2004 31 835 52 15519430 \n17 Martin JN Jr Rinehart BK May WL Magann EF Terrone DA Blake PG The spectrum of severe preeclampsia: Comparative analysis by HELLP (hemolysis, elevated liver enzyme levels, and low platelet count) syndrome classification Am J Obstet Gynecol 1999 180 1373 84 10368474 \n18 Osmanagaoglu MA Osmanagaoglu S Ulusoy H Bozkaya H Maternal outcome in HELLP syndrome requiring intensive care management in a Turkish hospital Sao Paulo Med J 2006 124 85 9 16878191 \n19 Svenningsen R Morken NH Kahn JA Corticosteroids in the treatment of HELLP-syndrome? Tidsskr Nor Laegeforen 2006 126 2253 6 16967063 \n20 Aldemir M Baç B Taçyildiz I Yağmur Y Keleş C Spontaneous liver hematoma and a hepatic rupture in HELLP syndrome: Report of two cases Surg Today 2002 32 450 3 12061700 \n21 Giannubilo SR Tranquilli AL Santolini C Prinicipi F Mancinelli R Littarru GP Placental CoQ10 levels in HELLP syndrome Biofactors 2005 25 159 63 16873941 \n22 Smulian J Shen-Schwarz S Scorza WE Kinzler WL Vintzileos AM A clinicohistopathological comparison between HELLP syndrome and severe preeclampsia J Matern Fetal Neonatal Med 2004 16 287 93 15621545 \n23 Tranquilli AL Giannubilo SR Tedeschi E Bezzeccheri V Suzuki H Menegazzi M Placental expression of nitric oxide synthase during HELLP syndrome: The correlation with maternal-fetal Doppler velocimetry Acta Obstet Gynecol Scand 2005 84 849 53 16097974 \n24 Abdelazim I Farghali MM Elbiaa AA Abdelrazak KM Hussain M Yehia AH Impact of antenatal oxytocin infusion on neonatal respiratory morbidity associated with elective cesarean section Arch Med Sci 2017 13 629 34 28507580 \n25 Abdelazim IA Shikanova S Kanshaiym S Karimova B Sarsembayev M Starchenko T Cesarean section scar dehiscence during pregnancy: Case reports J Family Med Prim Care 2018 7 1561 5 Doi: 10.4103/jfmpc.jfmpc_361_18. 30613559 \n26 Haram K Søfteland E Hervig T Pirhonen J Thrombocytopaenia in pregnancy Tidsskr Nor Laegeforen 2003 123 2250 2 14508545 \n27 Sukenik-Halevy R Ellis MH Fejgin MD Management of immune thrombocytopenic purpura in pregnancy Obstet Gynecol Surv 2008 63 182 8 18279544 \n28 Groot E de Groot PG Fijnheer R Lenting PJ The presence of active von Willebrand factor under various pathological conditions Curr Opin Hematol 2007 14 284 9 17414220 \n29 Franchini M Thrombotic microangiopathies: An update Hematology 2006 11 139 46 17325953 \n30 Mayer SA Aledort LM Thrombotic microangiopathy: Differential diagnosis, pathophysiology and therapeutic strategies Mt Sinai J Med 2005 72 166 75 15915311 \n31 Le Thi TD Tieulie N Costedoat N Andreu MR Wechsler B Vauthier-Brouzes D The HELLP syndrome in the antiphospholipid syndrome: Retrospective study of 16 cases in 15 women Ann Rheum Dis 2005 64 273 8 15647435 \n32 Cavkaytar S Ugurlu EN Karaer A Tapisiz OL Danisman N Are clinical symptoms more predictive than laboratory parameters for adverse maternal outcome in HELLP syndrome? Acta Obstet Gynecol Scand 2007 86 648 51 17520393 \n33 Wicke C Pereira PL Neeser E Flesch I Rodegerdts EA Becker HD Sub-capsular liver hematoma in HELLP syndrome: Evaluation of diagnostic and therapeutic options-a unicenter study Am J Obstet Gynecol 2004 190 106 12 14749644 \n34 Stewart MW Brazis PW Guier CP Thota SH Wilson SD Purtscher-like retinopathy in a patient with HELLP syndrome Am J Ophthalmol 2007 143 886 7 17452181 \n35 Altamura C Vasapollo B Tibuzzi F Novelli GP Valensise H Rossini PM Postpartum cerebellar infarction and haemolysis, elevated liver enzymes, low platelet (HELLP) syndrome Neurol Sci 2005 26 40 2 15877186 \n36 Zeidman LA Videnovic A Bernstein LP Pellar CA Lethal pontine hemorrhage in postpartum syndrome of hemolysis, elevated liver enzyme levels, and low platelet count Arch Neurol 2005 62 1150 3 16009775 \n37 Curtin WM Weinstein L A review of HELLP syndrome J Perinatol 1999 19 138 43 10642976 \n38 Drakeley AJ Le Roux PA Anthony J Penny J Acute renal failure complicating severe preeclampsia requiring admission to an obstetric intensive care unit Am J Obstet Gynecol 2002 186 253 6 11854645 \n39 Osmanağaoğlu MA Erdoğan I Zengin U Bozkaya H Comparison between HELLP syndrome, chronic hypertension, and superimposed preeclampsia on chronic hypertension without HELLP syndrome J Perinat Med 2004 32 481 5 15576268 \n40 Gul A Cebeci A Aslan H Polat I Ozdemir A Ceylan Y Perinatal outcomes in severe preeclampsia-eclampsia with and without HELLP syndrome Gynecol Obstet Invest 2005 59 113 8 15591806 \n41 Chhabra S Qureshi A Datta N Perinatal outcome with HELLP/partial HELLP complicating hypertensive disorders of pregnancy. An Indian rural experience J Obstet Gynaecol 2006 26 531 3 17000499 \n42 Roelofsen AC van Pampus MG Aarnoudse JG The HELLP-syndrome; maternal-fetal outcome and follow up of infants J Perinat Med 2003 31 201 8 12825475 \n43 Geary M The HELLP syndrome Br J Obstet Gynaecol 1997 104 887 91 9255078 \n44 Sibai BM Taslimi MM el-Nazer A Amon E Mabie BC Ryan GM Maternal-perinatal outcome associated with the syndrome of hemolysis, elevated liver enzymes, and low platelets in severe preeclampsia-eclampsia Am J Obstet Gynecol 1986 155 501 9 3529964\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "2249-4863",
"issue": "8(1)",
"journal": "Journal of family medicine and primary care",
"keywords": "Abdelazim; AbuFaza; ELLP; HELLP; hemolysis",
"medline_ta": "J Family Med Prim Care",
"mesh_terms": null,
"nlm_unique_id": "101610082",
"other_id": null,
"pages": "280-284",
"pmc": null,
"pmid": "30911521",
"pubdate": "2019-01",
"publication_types": "D002363:Case Reports",
"references": "10368474;10642976;11031696;11854645;12061700;12530105;12825475;12911166;1358701;14508545;14606727;14749644;15121574;15519429;15519430;15572962;15576268;15591806;15621545;15647435;15877186;15882253;15915311;15937436;16009775;16097974;16118033;16150287;16533554;16631593;16873941;16878191;16967063;17000499;17325953;17414220;17452181;17520393;18279544;19245695;28507580;30613559;3529964;9255078",
"title": "Abdelazim and AbuFaza ELLP syndrome as a variant of HELLP syndrome: Case reports.",
"title_normalized": "abdelazim and abufaza ellp syndrome as a variant of hellp syndrome case reports"
} | [
{
"companynumb": "KW-PFIZER INC-2019137038",
"fulfillexpeditecriteria": "1",
"occurcountry": "KW",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": "3",
... |
{
"abstract": "Capecitabine is an oral fluoropyrimidine which can prolong QT interval. However, there have been no reports that capecitabine induced ventricular fibrillation (VF) due to secondary QT prolongation in patients with no structural heart disease. A 39-year-old woman developed VF during the chemotherapy of capecitabine for colon cancer. At the administration, corrected QT interval (QTc) was prolonged to 559 ms despite no evidence of organic heart disease. Discontinuation of capecitabline normalized the QTc (414 ms). During the follow-up of eight years, neither the QTc prolongation nor the recurrent VF has been detected. We report the rare case of capecitabine-related VF without any organic heart disease. <Learning objective: Capecitabine is an oral fluoropyrimidine carbamate commonly used to treat colorectal and breast cancer. Capecitabine has been reported to be associated with VF due to vasospasm. However, capecitabine is also associated with QT elongation. This is the first report to describe VF due to capecitabine-related secondary long QT syndrome in a patient with no cardiac heart disease. Physicians must carefully follow up patients during capecitabine chemotherapy with serial electrocardiograms.>.",
"affiliations": "Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Center, Yokosuka Kyosai Hospital, Yokosuka, Japan.;Department of Cardiovascular Medicine, Tokyo Medical and Dental University, Tokyo, Japan.",
"authors": "Hayasaka|Kazuto|K|;Takigawa|Masateru|M|;Takahashi|Atsushi|A|;Kuwahara|Taishi|T|;Okubo|Kenji|K|;Tanaka|Yasuaki|Y|;Misawa|Toru|T|;Mizusawa|Masafumi|M|;Yamakami|Yosuke|Y|;Kojima|Keisuke|K|;Sagawa|Yuichiro|Y|;Hishikari|Keiichi|K|;Yamao|Kazuya|K|;Nakashima|Emiko|E|;Nakajima|Jun|J|;Kimura|Shigeki|S|;Takagi|Katsumasa|K|;Hikita|Hiroyuki|H|;Isobe|Mitsuaki|M|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": "10.1016/j.jccase.2017.03.009",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1878-5409",
"issue": "16(1)",
"journal": "Journal of cardiology cases",
"keywords": "Capecitabine; Secondary long QT syndrome; Ventricular fibrillation",
"medline_ta": "J Cardiol Cases",
"mesh_terms": null,
"nlm_unique_id": "101549579",
"other_id": null,
"pages": "26-29",
"pmc": null,
"pmid": "30279790",
"pubdate": "2017-07",
"publication_types": "D002363:Case Reports",
"references": "15231861;21997165;8391384;14759096;15978800;70620;26715165;23582737;9250550;21321041;20529041;22184401",
"title": "A case of ventricular fibrillation as a consequence of capecitabine-induced secondary QT prolongation: A case report.",
"title_normalized": "a case of ventricular fibrillation as a consequence of capecitabine induced secondary qt prolongation a case report"
} | [
{
"companynumb": "JP-MYLANLABS-2017M1047258",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CAPECITABINE"
},
"drugadditional": "1",
... |
{
"abstract": "Fluoroquinolones are avoided during pregnancy due to developmental toxicity in animals. The aim of this study was to assess the fetal risk after intrauterine fluoroquinolone exposure. We performed an observational study of a prospectively ascertained cohort of pregnant women exposed to a fluoroquinolone during the first trimester. Pregnancy outcomes were compared to those of a cohort exposed to neither fluoroquinolones nor teratogenic or fetotoxic drugs. The outcomes evaluated were major birth defects (structural abnormalities of medical, surgical, or cosmetic relevance), spontaneous abortion, and elective termination of pregnancy. Pregnancy outcomes of 949 women with fluoroquinolone treatment were compared with those of 3,796 nonexposed controls. Neither the rate of major birth defects (2.4%; adjusted odds ratio [OR(adj)], 0.91; 95% confidence interval [CI], 0.6 to 1.5) nor the risk of spontaneous abortion (adjusted hazard ratio [HR(adj)], 1.01; 95% CI, 0.8 to 1.3) was increased. However, there was a nonsignificant increase in major birth defects after exposure to moxifloxacin (6/93, 6.5%; crude odds ratio [OR(crude)], 2.40; 95% CI, 0.8 to 5.6). Neither a critical exposure time window within the first trimester nor a specific pattern of birth defects was demonstrated for any of the fluoroquinolones. The rate of electively terminated pregnancies was increased among the fluoroquinolone-exposed women (HR(adj), 1.32; 95% CI, 1.03 to 1.7). The gestational ages at delivery and birth weights did not differ between groups. Our study did not detect an increased risk of spontaneous abortion or major birth defects. These reassuring findings support the recommendation to allow fluoroquinolone use in early pregnancy in selected cases. After the use of moxifloxacin, a detailed fetal ultrasound examination should be considered.",
"affiliations": "Pharmakovigilanz- und Beratungszentrum für Embryonaltoxikologie (Institute for Clinical Teratology and Drug Risk Assessment in Pregnancy), Charité Universitätsmedizin Berlin, Berlin, Germany stephanie.padberg@charite.de.;Pharmakovigilanz- und Beratungszentrum für Embryonaltoxikologie (Institute for Clinical Teratology and Drug Risk Assessment in Pregnancy), Charité Universitätsmedizin Berlin, Berlin, Germany.;Department of Mathematics, Beuth Hochschule für Technik Berlin (University of Applied Sciences), Berlin, Germany.;Pharmakovigilanz- und Beratungszentrum für Embryonaltoxikologie (Institute for Clinical Teratology and Drug Risk Assessment in Pregnancy), Charité Universitätsmedizin Berlin, Berlin, Germany.;Pharmakovigilanz- und Beratungszentrum für Embryonaltoxikologie (Institute for Clinical Teratology and Drug Risk Assessment in Pregnancy), Charité Universitätsmedizin Berlin, Berlin, Germany.;Pharmakovigilanz- und Beratungszentrum für Embryonaltoxikologie (Institute for Clinical Teratology and Drug Risk Assessment in Pregnancy), Charité Universitätsmedizin Berlin, Berlin, Germany.;Pharmakovigilanz- und Beratungszentrum für Embryonaltoxikologie (Institute for Clinical Teratology and Drug Risk Assessment in Pregnancy), Charité Universitätsmedizin Berlin, Berlin, Germany.",
"authors": "Padberg|Stephanie|S|;Wacker|Evelin|E|;Meister|Reinhard|R|;Panse|Mary|M|;Weber-Schoendorfer|Corinna|C|;Oppermann|Marc|M|;Schaefer|Christof|C|",
"chemical_list": "D000900:Anti-Bacterial Agents; D024841:Fluoroquinolones; D000077266:Moxifloxacin",
"country": "United States",
"delete": false,
"doi": "10.1128/AAC.02413-14",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0066-4804",
"issue": "58(8)",
"journal": "Antimicrobial agents and chemotherapy",
"keywords": null,
"medline_ta": "Antimicrob Agents Chemother",
"mesh_terms": "D000014:Abnormalities, Drug-Induced; D000029:Abortion, Legal; D000022:Abortion, Spontaneous; D000328:Adult; D000900:Anti-Bacterial Agents; D001724:Birth Weight; D016022:Case-Control Studies; D005260:Female; D024841:Fluoroquinolones; D005865:Gestational Age; D006801:Humans; D000077266:Moxifloxacin; D016017:Odds Ratio; D011247:Pregnancy; D011256:Pregnancy Outcome; D011261:Pregnancy Trimester, First; D047928:Premature Birth; D011446:Prospective Studies",
"nlm_unique_id": "0315061",
"other_id": null,
"pages": "4392-8",
"pmc": null,
"pmid": "24841264",
"pubdate": "2014-08",
"publication_types": "D016428:Journal Article; D064888:Observational Study; D013485:Research Support, Non-U.S. Gov't",
"references": "20598025;9802183;18064739;16144758;3605158;12797461;2589381;15745724;18620043;9624471;8902438;19181435;16735418;20148386;15014927;2589384;8730972;21338666;1295072;21949152;8090389;16998965;14608641;16760444;18588969;15598095",
"title": "Observational cohort study of pregnancy outcome after first-trimester exposure to fluoroquinolones.",
"title_normalized": "observational cohort study of pregnancy outcome after first trimester exposure to fluoroquinolones"
} | [
{
"companynumb": "DE-ROXANE LABORATORIES, INC.-2014-RO-01618RO",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "MOXIFLOXACIN"
},
"drugadd... |
{
"abstract": "In recent years, intravenous lipid emulsion therapy (ILE) was used for lipophilic drug intoxications, and successful results were obtained. In the literature, there is a small number of reported cases about verapamil intoxication and ILE therapy in the pediatric age group. We used ILE therapy in a 14-year-old girl with verapamil intoxication in the 2nd h of the pediatric intensive care unit stay, before using traditional treatments such as glucagon and hyperinsulinemic euglycemia. She had resistant bradycardia and hypotension which was unresponsive to inotropic agents and a successful result was obtained after using ILE treatment. We believe our report may contribute to the early use of ILE therapy for toxicity with calcium channel blockers such as verapamil in pediatric patients.",
"affiliations": "Department of Pediatric Intensive Care, School of Medicine, Ankara University, Ankara, Turkey.;Department of Pediatric Intensive Care, School of Medicine, Ankara University, Ankara, Turkey.;Department of Pediatric Intensive Care, School of Medicine, Ankara University, Ankara, Turkey.;Department of Pediatric Cardiology, School of Medicine, Ankara University, Ankara, Turkey.;Department of Pediatric Intensive Care, School of Medicine, Ankara University, Ankara, Turkey.;Department of Pediatric Cardiology, School of Medicine, Ankara University, Ankara, Turkey.",
"authors": "Havan|Merve|M|0000-0003-3431-7906;Kendirli|Tanıl|T|0000-0001-9458-2803;Özcan|Serhan|S|0000-0003-4465-6063;Doğan|Melih Timuçin|MT|0000-0003-3565-8606;Yiğit|Ahmet Onur|AO|0000-0003-4373-7021;Uçar|Tayfun|T|0000-0003-1206-5103",
"chemical_list": null,
"country": "India",
"delete": false,
"doi": "10.4103/2452-2473.329626",
"fulltext": "\n==== Front\nTurk J Emerg Med\nTurk J Emerg Med\nTJEM\nTurkish Journal of Emergency Medicine\n2452-2473\nWolters Kluwer - Medknow India\n\nTJEM-21-217\n10.4103/2452-2473.329626\nCase Report\nA successful treatment with intravenous lipid emulsion therapy in a child with verapamil poisoning\nHavan Merve 1*http://orcid.org/0000-0003-3431-7906\n\nKendirli Tanıl 1http://orcid.org/0000-0001-9458-2803\n\nÖzcan Serhan 1http://orcid.org/0000-0003-4465-6063\n\nDoğan Melih Timuçin 2http://orcid.org/0000-0003-3565-8606\n\nYiğit Ahmet Onur 1http://orcid.org/0000-0003-4373-7021\n\nUçar Tayfun 2http://orcid.org/0000-0003-1206-5103\n\n1 Department of Pediatric Intensive Care, School of Medicine, Ankara University, Ankara, Turkey\n2 Department of Pediatric Cardiology, School of Medicine, Ankara University, Ankara, Turkey\nAddress for correspondence: Dr. Merve Havan, Division of Pediatric Critical Care Medicine, Ankara University Faculty of Medicine, Ankara, Turkey. E-mail: merve-havan@outlook.com\nAuthor contributions statement\n\nMerve Havan: Conceptualization (lead); writing – original draft (lead); Methodology (lead). Tanıl Kendirli: Supervision (lead); Visualization (lead). Serhan Özcan: Methodology (lead); Resources; Writing – original draft (supporting). Melih T. Doğan: Resources (supporting). Onur Yiğit: Resources Writing – original draft (supporting). Tayfun Uçar: Writing – review and editing (equal).\n\nOct-Dec 2021\n29 10 2021\n21 4 217220\n23 2 2021\n16 5 2021\n17 5 2021\nCopyright: © 2021 Turkish Journal of Emergency Medicine\n2021\nhttps://creativecommons.org/licenses/by-nc-sa/4.0/ This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.\nIn recent years, intravenous lipid emulsion therapy (ILE) was used for lipophilic drug intoxications, and successful results were obtained. In the literature, there is a small number of reported cases about verapamil intoxication and ILE therapy in the pediatric age group. We used ILE therapy in a 14-year-old girl with verapamil intoxication in the 2nd h of the pediatric intensive care unit stay, before using traditional treatments such as glucagon and hyperinsulinemic euglycemia. She had resistant bradycardia and hypotension which was unresponsive to inotropic agents and a successful result was obtained after using ILE treatment. We believe our report may contribute to the early use of ILE therapy for toxicity with calcium channel blockers such as verapamil in pediatric patients.\n\nChildren\nintoxication\nlipid emulsion therapy\nverapamil\n==== Body\npmcIntroduction\n\nIn recent years, intravenous lipid emulsion therapy (ILE) has been frequently used in the intoxications of anesthetic and lipophilic drugs after animal experiments. Initial studies were done in the late 1990s.[1] ILE therapy began to be used for therapeutic purposes in the systemic toxicity of local anesthetic drugs in 2006, and then it was used for lipophilic drug toxicity, and successful results have been reported in intoxications with calcium channel blockers (CCBs), beta-blockers, neuroleptics, antidepressants, and anticonvulsants.[23]\n\nHypotension and bradycardia are the most common symptoms in CCB intoxication. Metabolic acidosis and hyperglycemia are other common symptoms. In verapamil intoxication, there is no known antidote. Gastrointestinal decontamination is the first-line therapy. Intravenous calcium supplements, glucagon, hyperinsulinemic euglycemia (HIE) treatment, and in recent years, lipid emulsion therapy are recommended treatment methods in verapamil intoxication.[4]\n\nHere, we would like to report the early use of ILE therapy in verapamil intoxication in a 14-year-old girl who was followed with resistant hypotension and bradycardia in our pediatric intensive care unit (PICU).\n\nCase Report\n\nA 14-year-old girl was admitted to the pediatric emergency room with complaints of vomiting and dizziness. The patient stated that she had ingested 40 tablets verapamil (contains 120 mg verapamil hydrochloride in each tablet) 10 h before the emergency service admission. The patient underwent continuous cardiac monitoring. Her serial electrocardiography (ECGs) were obtained. On her physical examination, her body weight was 60 kg and her height was 157 cm. She was lethargic, her arterial blood pressure (BP), heart rate, respiration rate, and body temperature were measured as 57/32 mmHg, 50/min, 14/min, and 36.2°C, respectively. In the emergency department, gastric lavage and active charcoal treatment were not performed because she received the drug 10 h before the admission. 20 ml/kg 0.9% saline infusion has been given to the patient two times in the emergency department. The patient was taken to the PICU because her bradycardia and hypotension were resistant despite treatment. A central venous catheter was inserted quickly and 2500 ml/m2 hydration was started. In the laboratory analyses, complete blood count, renal function tests, serum electrolytes, and arterial blood gas analyses were taken, and all the results were within normal limits apart from elevated lactate levels (5.2 mml/L). Hyperglycemia was not found in the patient's blood glucose monitoring. In our follow-up, her general condition was poor and lethargic; bradycardia and ventricular extrasystoles were seen in the ECG [Figure 1]. She was in cardiogenic shock and dopamine infusion, at a rate of 10 mcg/kg/min was started, and calcium gluconate was given for CCB toxicity but her vital parameters did not change. Then, norepinephrine infusion therapy (0.1 mcg/kg/min) was started because she had peripheral vasodilatation symptoms and flushing. At the 2nd h of the patient's PICU hospitalization, we considered it appropriate to start ILE treatment, as the patient's hypotension and bradycardia continued, despite increased doses of inotropic drugs and calcium support. Intravenous lipid infusion (20% Intralipid) therapy was started at a rate of 1.5 ml/kg for 2 h. Half an hour after starting the ILE treatment, the patient's rhythm returned to the sinus rhythm, the ventricular extrasystoles disappeared on the patient's ECG and her arterial BP began to improve. The patient's BP was 79/52 mmHg when we started treatment. BPs were measured at 30 min, 1 h, and 2 h after the treatment had started, and the BPs were 84/56, 90/61, and 92/67 mmHg, respectively. Vital signs of the patient before and after ILE treatment are given in Table 1. After treatment, her inotropic drugs were gradually reduced within 8 h, and her consciousness began to recover very quickly. On the 2nd day of the intensive care stay, the patient was transferred to the cardiology service with complete neurological recovery and no organ failure. She was discharged from the hospital on the 4th day of admission. Detailed informed consent was obtained from the patient's parents in this case report.\n\nFigure 1 Sinus bradycardia and ventricular extrasystoles on electrocardiography of the patient before lipid emulsion therapy\n\nTable 1 The patient’s vital signs before and after intravenous lipid emulsion therapy\n\nVital signs\tEmergency service admission\tPICU admission\tBefore ILE therapy\tAfter ILE therapy (2nd h)\t\nBlood pressure (mmHg)\t57/32\t67/48\t79/57\t92/67\t\nHeart rate (/min)\t50\t51\t56\t64\t\nILE=Intravenous lipid emulsion, PICU=Pediatric intensive care unit\n\nDiscussion\n\nVerapamil is a nondhydropyridine CCB that is used in the treatment of arrhythmias, hypertension, and angina pectoris. Verapamil selectively blocks L-type calcium channels in the myocardium which are responsible for myocardial and vascular smooth muscle contractility.[5] Verapamil toxicity causes peripheral vasodilation, hypotension, bradycardia, metabolic acidosis, hyperglycemia, congestive heart failure, pulmonary edema, and cardiac arrest. There is no specific antidote for verapamil overdose, and extracorporeal removal by hemodialysis is not effective. Orogastric lavage is useful if performed in the first 2 h after taking the drug, but vagal stimulation may exacerbate CCB-induced bradycardia and hypotension. We did not perform gastric lavage on our patient because she came to the emergency room 10 h after taking the drug, and we thought that orogastric lavage would not be beneficial and could worsen the patient's symptoms with vagal system activation.\n\nIntravenous calcium supplements have been used for the treatment of cardiac side effects in verapamil toxicity. Glucagon has chronotropic and inotropic effects but is not effective in the recovery of bradycardia. HIE is a successful treatment for hypotension, hyperglycemia, and metabolic acidosis but has not been shown to have sufficient effect in the treatment of bradycardia, heart block, and intraventricular conduction delay.[6] Our patient was in hypotensive shock, and she had refractory bradycardia. Despite intravenous saline bolus treatment, calcium gluconate, and high doses of inotropic agents, the patient's bradycardia and hypotension did not improve. Due to the absence of hyperglycemia during her admission and the fact that her main symptoms are secondary to cardiac pathology, we did not give HIE treatment as a priority.\n\nIn recent years, ILE therapy has been used in the emergency department for life-threatening drug intoxications.[3] Although the effect of ILE therapy in the treatment of drug toxicity is still not fully known, two main mechanisms are emphasized in particular. First, the sweeping/portioning effect which is known as the lipid sink/shuttle phenomenon, and second, its direct cardiovascular effect since it acts on myocytes.[2] In an in vitro study, traditional treatments such as calcium supplements, glucagon, and insulin used in verapamil toxicity were shown to not affect L-type calcium channels, but ILE therapy directly affects L-type calcium channels, restoring myocyte contractility.[7] For this reason, we planned to give ILE treatment after calcium support and inotropic agents, as we thought we would see more benefits from ILE treatment than glucagon and HIE.\n\nIn the literature, there is no accurate information about when to start ILE treatment for lipophilic drug toxicity, what dose to apply, and whether bolus treatment or continuous infusion is more useful.[2] Previous publications on the use of ILE therapy in patients with verapamil poisoning are presented in detail in Table 2. There are only a few cases related to the use of ILE therapy in verapamil poisoning, and when these cases are examined, it has been reported that ILE therapy benefits some and does not provide the expected benefit in others [Table 2]. Furthermore, there are not enough publications on the use of ILE therapy in verapamil poisoning in pediatric patients. In a study that identified 14 cases, all patients were given different doses of bolus and/or continuous ILE therapy, and treatment doses were reported to vary according to the experience of clinicians.[14] In another study, blood verapamil levels were measured after poisoning, and the measured level was reported to be decreased after ILE treatment.[11] In our study, we were unable to measure blood verapamil levels. In the literature, there is no definitive data on the administration dose of ILE therapy in the pediatric age group. We administered 1.5 g/kg 20% lipid solution as an intravenous infusion for 2 h, avoiding giving a bolus dose, because our patient was a child, and we thought that lipid treatment at a bolus dose might have side effects.\n\nTable 2 Recent publications reporting the use of intravenous lipid emulsion therapy in verapamil poisoning\n\nPublication year (references)\tAge (years)/gender\tVerapamil overdose (mg)\tILE dose\tAdditional therapies\tResponse to ILE therapy\t\n2009[8]\t15/-\t4200\tNot obtained\tCalcium gluconate, HIE, ECMO, CVVH\tNo change\t\n2009[4]\t32/male\t13,440\t100 ml IV bolus\n0.5 ml/kg/h infusion\tNorepinephrine, calcium gluconate, glucagon\tResolution of hypotension\t\n2011[9]\t39/female\t4080\t100 ml IV bolus\n0.5 ml/kg/h infusion\tCalcium gluconate, glucagon, norepinephrine\tResolution of hypotension\t\n2011[10]\t41/female\t19,200\t100 ml IV bolus\n0.5 ml/kg/h infusion\tCalcium, dopamine, isoproterenol, norepinephrine, epinephrine, vasopressin, HIE, CVVH, nitric oxide\tResolution in multisystem function\t\n2011[11]\t47/male\t6300\t100 ml IV bolus\n150 ml IV/15 min\tAtropine, glucagon, calcium, HIE, norepinephrine, dopamine, vasopressin\tResolution of cardiac function\t\n2014[12]\t51/female\t9600\t100 ml IV bolus\n0.2 ml/kg/min infusion\tNorepinephrine, epinephrine, calcium gluconate, CVVH, ECMO\tResolution of ARDS\t\n2015[13]\t24/female\t7200\tIntraoseously, dose not obtained\tGlucagon, HIE, calcium gluconate, norepinephrine\tNo change, death\t\nARDS=Acute respiratory distress syndrome, CVVH=Continuous venovenous hemofiltration, ECMO=Extracorporeal membrane oxygenation, HİE=Hyperinsulinemic euglycemia, IV=Intravenous, ILE=Intravenous lipid emulsion\n\nILE treatment also can have serious side and adverse effects. In adults, hyperlipidemia, increased bleeding tendency, hypokalemia, hypophosphatemia, local thrombophlebitis, acute lung damage, hemolysis, and acute pancreatitis have been reported.[14] In our case, we did not see any complication about medication.\n\nILE treatment was stated to be beneficial in lipophilic drug poisoning. In the literature, it is recommended to use ILE therapy after standard treatment protocols (calcium support, glucagon, and HIE) for verapamil poisoning and to use extracorporeal treatment methods if the benefit is still not achieved. We applied ILE therapy to our case before applying much more invasive extracorporeal treatment methods such as hemoperfusion and extracorporeal membrane oxygenation. After starting ILE treatment, the patient's clinical manifestations quickly improved, and we began to reduce the infusion doses of inotropic agents, and the patient's consciousness quickly improved.\n\nConclusion\n\nThis case report may be useful to show that good results can be achieved using early-stage ILE therapy in pediatric patients with verapamil poisoning. As the number of studies on ILE use in children increases, this method of treatment will be used more often in lipophilic drug poisoning.\n\nAcknowledgment\n\nIn this case report everyone who contributed to this manuscript is listed as an author.\n\nConflicts of interest\n\nNone Declared.\n\nConsent to participate\n\nThe authors certify that they have obtained all appropriate patient consent forms. In the form, the parents have given their consent for images and other clinical information to be reported in the journal. The parents understand that names and initials will not be published, and due efforts will be made to conceal identity, but anonymity cannot be guaranteed.\n\nFinancial support and sponsorship\n\nNone.\n==== Refs\n1 Weinberg GL VadeBoncouer T Ramaraju GA Garcia-Amaro MF Cwik MJ Pretreatment or resuscitation with a lipid infusion shifts the dose-response to bupivacaine-induced asystole in rats Anesthesiology 1998 88 1071 5 9579517\n2 Robben JH Dijkman MA Lipid therapy for intoxications Vet Clin North Am Small Anim Pract 2017 47 435 50 28012788\n3 Jamaty C Bailey B Larocque A Notebaert E Sanogo K Chauny JM Lipid emulsions in the treatment of acute intoxication: A systematic review of human and animal studies Clin Toxicol 2010 48 1 27\n4 Young AC Velez LI Kleinschmidt KC Intravenous fat emulsion therapy for intentional sustained-release verapamil overdose Resuscitation 2009 80 591 3 19282085\n5 Hofer CA Smith JK Tenholder MF Verapamil intoxication: A literature review of overdoses and discussion of therapeutic options Am J Med 1993 95 431 8 8213877\n6 Shepherd G Klein-Schwartz W High-dose insulin therapy for calcium-channel blocker overdose Ann Pharmacother 2005 39 923 30 15811898\n7 Kryshtal DO Dawling S Seger D Knollmann BC In vitro studies indicate intravenous lipid emulsion acts as lipid sink in verapamil poisoning J Med Toxicol 2016 12 165 71 26553277\n8 Aaronson PM Wassil K Kunisaki TA Hyperinsulinemic euglycemia, continuous venovenous hemofiltration, and extracorporeal life support for severe verapamil poisoning: Case report Clin Toxicol 2009 47 742\n9 Franxman TJ Al-Nabhan M Cavallazzi RS Speak AJ Lipid emulsion therapy for verapamil overdose Ann Intern Med 2011 154 292 21320947\n10 Liang CW Diamond SJ Hagg DS Lipid rescue of massive verapamil overdose: A case report J Med Case Rep 2011 5 399 21854635\n11 French D Armenian P Ruan W Wong A Drasner K Olson KR Serum verapamil concentrations before and after Intralipid® therapy during treatment of an overdose Clin Toxicol (Phila) 2011 49 340 4 21563913\n12 Martin C Gonzalez H Ruiz S Ribes D Franchitto N Minville V Acute respiratory distress syndrome following verapamil overdose treated with intravenous lipid emulsion: A rare life-threatening complication Ann Fr Anesth Reanim 2014 33 e101 2 24972511\n13 Sampson CS Bedy SM Lipid emulsion therapy given intraosseously in massive verapamil overdose Am J Emerg Med 2015 33 1844.e1\n14 Presley JD Chyka PA Intravenous lipid emulsion to reverse acute drug toxicity in pediatric patients Ann Pharmacother 2013 47 735 43 23613099\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "2452-2473",
"issue": "21(4)",
"journal": "Turkish journal of emergency medicine",
"keywords": "Children; intoxication; lipid emulsion therapy; verapamil",
"medline_ta": "Turk J Emerg Med",
"mesh_terms": null,
"nlm_unique_id": "101681782",
"other_id": null,
"pages": "217-220",
"pmc": null,
"pmid": "34849436",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "20095812;21854635;26553277;15811898;21563913;23613099;19282085;28012788;26003744;24972511;8213877;21320947;9579517",
"title": "A successful treatment with intravenous lipid emulsion therapy in a child with verapamil poisoning.",
"title_normalized": "a successful treatment with intravenous lipid emulsion therapy in a child with verapamil poisoning"
} | [
{
"companynumb": "TR-RECRO GAINESVILLE LLC-REPH-2021-000018",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "VERAPAMIL HYDROCHLORIDE"
},
"... |
{
"abstract": "Isotretinoin, a synthetic vitamin A derivative, is primarily used in the management of severe nodulocystic acne. Since its introduction, isotretinoin has been linked with various psychiatric side effects. In particular, depression and suicidality have been extensively reported as side effects. This case report features a young male who developed a first psychotic episode within 3 months of starting isotretinoin therapy. The patient was hospitalized, and organic pathologies and use of psychoactive substances that could explain his presentation were ruled out. After stopping isotretinoin and starting olanzapine 10 mg, the psychotic symptoms remitted completely within 2 weeks. This case highlights the need for increased vigilance toward psychiatric manifestations of isotretinoin. In addition, it suggests that secondary psychosis should be considered as a differential diagnosis by clinicians, especially in patients with no past psychiatric history or family history of mental illness.",
"affiliations": "Mental Health Services-Consultation Liaison Psychiatry-Hamad Medical Corporation, Doha, Qatar.;Mental Health Services-Consultation Liaison Psychiatry-Hamad Medical Corporation, Doha, Qatar.;Mental Health Services-Consultation Liaison Psychiatry-Hamad Medical Corporation, Doha, Qatar.;Mental Health Services-Consultation Liaison Psychiatry-Hamad Medical Corporation, Doha, Qatar.;Mental Health Services-Consultation Liaison Psychiatry-Hamad Medical Corporation, Doha, Qatar.",
"authors": "Elhusein|Bushra|B|https://orcid.org/0000-0003-0803-1138;Elkhaled|Walid|W|https://orcid.org/0000-0002-3188-4545;Khoodoruth|Mohamed Adil Shah|MAS|https://orcid.org/0000-0003-3104-7525;Kumar|Rajeev|R|;Al Abdulla|Majid|M|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1177/2050313X20931342",
"fulltext": "\n==== Front\nSAGE Open Med Case Rep\nSAGE Open Med Case Rep\nSCO\nspsco\nSAGE Open Medical Case Reports\n2050-313X SAGE Publications Sage UK: London, England \n\n10.1177/2050313X20931342\n10.1177_2050313X20931342\nCase Report\nIsotretinoin-induced psychotic episode in a 17-year-old adolescent\nmale\nhttps://orcid.org/0000-0003-0803-1138Elhusein Bushra https://orcid.org/0000-0002-3188-4545Elkhaled Walid https://orcid.org/0000-0003-3104-7525Khoodoruth Mohamed Adil Shah Kumar Rajeev Al Abdulla Majid Mental Health Services-Consultation Liaison\nPsychiatry-Hamad Medical Corporation, Doha, Qatar\nWalid Elkhaled, Mental Health\nServices-Consultation Liaison Psychiatry-Hamad Medical Corporation, P.O. Box\n3050, Doha, Qatar. Email: w.elkhaled.92@gmail.com\n20 6 2020 \n2020 \n8 2050313X2093134227 11 2019 11 5 2020 © The Author(s) 20202020SAGE PublicationsThis article is distributed under the terms of the Creative Commons\nAttribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which\npermits non-commercial use, reproduction and distribution of the work\nwithout further permission provided the original work is attributed as\nspecified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).Isotretinoin, a synthetic vitamin A derivative, is primarily used in the\nmanagement of severe nodulocystic acne. Since its introduction, isotretinoin has\nbeen linked with various psychiatric side effects. In particular, depression and\nsuicidality have been extensively reported as side effects. This case report\nfeatures a young male who developed a first psychotic episode within 3 months of\nstarting isotretinoin therapy. The patient was hospitalized, and organic\npathologies and use of psychoactive substances that could explain his\npresentation were ruled out. After stopping isotretinoin and starting olanzapine\n10 mg, the psychotic symptoms remitted completely within 2 weeks. This case\nhighlights the need for increased vigilance toward psychiatric manifestations of\nisotretinoin. In addition, it suggests that secondary psychosis should be\nconsidered as a differential diagnosis by clinicians, especially in patients\nwith no past psychiatric history or family history of mental illness.\n\nAcneisotretinoinvitamin Apsychosisdrug-related side effectsadverse reactionscover-dateJanuary-December 2020typesetterts1\n==== Body\nIntroduction\nIsotretinoin (13-cis-retinoic acid) belongs to the retinoid family, which includes\nendogenous molecules derived from vitamin A (retinol) that are essential in\nregulating the cell cycle in multiple organ systems.1 Being the only anti-acne drug to affect all major pathologic factors\nimplicated in acne rendered isotretinoin superior to other conventional treatments;\nit prevents comedogenesis, decreases sebum production, inhibits\nPropionibacterium acnes growth, and reduces the inflammation\nassociated with acne.2\n\nFollowing the approval of isotretinoin by the US Food and Drug Administration (FDA)\nin 1982 to be used for severe and treatment-resistant nodulocystic acne, multiple\nstudies have denoted a possible link between the drug and psychiatric side effects,\nwhich were increasing in prevalence. This warranted the FDA in 2005 to place a black\nbox warning for suicide, depression, aggression, and psychosis as possible side\neffects associated with isotretinoin use.3\n\nDepression and suicidality have been extensively addressed in the literature, with\nsome studies suggesting a relationship with isotretinoin, whereas a link with\npsychosis is rarely reported in the literature.4 We report a case of an adolescent male with no previous psychiatric history\nwho presented with a psychotic episode while on isotretinoin therapy for acne\nvulgaris.\n\nCase presentation\nWe present a 17-year-old adolescent male (weight, 54 kg), pre-university student, who\npresented to the Accident and Emergency department with a 2-day history of decreased\nneed for sleep (sleeps for short hours and feels invigorated upon awakening), mood\nswings, and disorganized erratic behavior (dispatching laptop batteries, destroying\ncell phones, and foraging garbage bins). The patient’s mental status examination\nrevealed a young man who looked scared and suspicious, mood was irritable with\nlabile affect. He had irrelevant speech and disorganized thoughts with signs of\ndissociation. The patient experienced persecutory delusions (indicated that his room\nwas being filled by toxic gases) and third-person auditory hallucinations (He\nreported hearing voices of unseen people talking about him). He denied any episode\nof visual hallucinations and other abnormal perceptions. The patient denied\nexperiencing death wishes or suicidal ideation.\n\nOn admission, the patient lived with both parents, and was described by his mother as\n“the best student with the highest grades.” He had no psychiatric or medical\nhistory, no family history of psychiatric or medical illnesses, and did not take any\nmedications routinely, except isotretinoin (30 mg/day) for severe nodulocystic acne\non the forehead and cheeks, which was started 3 months before his psychiatric\npresentation.\n\nThe next day, the patient experienced an episode of seizure with convulsion of the\nwhole-body, including the head, whereas his eyes were open with a central gaze. The\nseizure lasted 10 min without postictal symptoms besides confusion, and one instance\nof fever (38.2°C). He was admitted under observation of the medical team;\nantibiotics were initiated and he was investigated thoroughly for systemic diseases\nbecause of the high suspicion of meningoencephalitis.\n\nPhysical examination was unremarkable; his seizures continued with a fluctuating\ncourse, and he developed a total of three episodes of seizure during his hospital\nstay. Eventually, these events were considered psychogenic non-epileptic seizures\n(PNES) based on the following characteristics: asynchronous motor movements with a\nwaxing and waning pattern, prolonged duration of seizures, no upward rolling of the\neyes, absence of urinary incontinence, and normal electroencephalogram (EEG) spikes\nwith unremarkable prolactin levels. The results of pertinent investigations,\nincluding head computed tomography (CT), magnetic resonance imaging (MRI), and\nlumbar puncture, were within normal limits; his vitamin A level was 1.746 µmol/L\n(normal: 1.047–2.094 µmol/L).\n\nThe patient continued to experience mood swings and psychotic symptoms; eventually,\nantibiotics were stopped, and isotretinoin was discontinued. A provisional diagnosis\nof drug-induced psychotic episode was made.\n\nOlanzapine (10 mg) was initiated on day 6 of admission by the psychiatry team.\nThereafter, the patient started showing progressive improvement in his mental\nstatus, and within 1 week, his psychotic symptoms were almost in complete remission.\nThe patient was followed up 1 week after discharge in the outpatient clinic; his\npsychotic symptoms were in complete remission and he was preparing for medical\nschool.\n\nDiscussion\nIsotretinoin is the only non-psychotropic drug that ranks among the list of top 10\ndrugs in the FDA’s database in terms of the number of reports on depression and\nsuicidal attempts, whereas psychosis, obsessive-compulsive disorder, and anxiety\nhave been rarely reported.5\n\nSome reports imply that isotretinoin is contraindicated in psychosis as it\ncomplicates the course of the disease. For example, Kępska et al.6 described worsening of positive symptoms in a 35-year-old lady with\nschizophrenia who was taking isotretinoin, and they have recommended close\ncooperation between dermatologists and psychiatrists in patients with schizophrenia\npresenting with dermatological concerns. In Table 1, we charted individual cases of\nisotretinoin-related psychosis reported in the literature.\n\nTable 1. Summary of data reported on isotretinoin-related psychosis.\n\nCase number\tAuthor(s)\tYear\tAge\tGender\tDosage\tRemarks\t\n1\tSegmiller et al.7\t2013\t25\tF\t20 mg/day for 3 weeks\tImproved within 10 days after discontinuation of isotretinoin,\nand quetiapine titrated up to 400 mg daily\t\n2\tRajagopal8\t2014\t27\tM\tNot reported\tPsychiatric symptoms started 5 days after starting isotretinoin.\nSymptoms resolved 3 days after discontinuation of isotretinoin,\nand risperidone 1 mg daily\t\n3\tLucca et al.9\t2016\t20\tF\t20 mg/day for 45 days, then increased to 60 mg/day for\n15 days\tManic and psychotic features resolved after 6 days of\ndiscontinuation of isotretinoin, and addition of quetiapine\n100 mg bedtime, oxcarbamazepine 300 mg daily, and risperidone\n2 mg bedtime\t\n4\tValderrama et al.10\t2017\t13\tM\t20 mg/day for 2 months\tComplete remission of symptoms after 2 weeks of stopping\nisotretinoin, and olanzapine 10 mg daily\t\nGoodman has put forward three lines of evidence proposing retinoid dysregulation as a\npossible cause of schizophrenia: (1) the similarity of symptomatology and clinical\nfeatures, for example, thought disorder, intellectual disability, enlarged\nventricles, microcephaly, and congenital malformations; (2) specific gene loci\nlinked to schizophrenia are also known gene loci within the retinoid signaling\nsystem, namely RAR and RXR; and (3) retinoid regulation targets schizophrenia genes,\nin particular, genes of dopamine and serotonin.11 More recently, isotretinoin treatment, schizophrenia, and depression have\neach been associated with elevated homocysteine levels, indicating the possibility\nthat isotretinoin-induced homocysteine elevation may contribute to psychiatric side effects.1\n\nFurthermore, a series of cases of manic psychosis that developed in 1 year (2003) in\nassociation with isotretinoin treatment and resulted in suicidality and progression\nto long-standing psychosis was reported; these cases were selected from among 500\nsoldiers who had been evaluated in a military specialist’s dermatology clinic for\nsevere acne.12 However, nearly all of them had either a personal psychiatric history or a\nfamily history of mental illness. In contrast, in the case we presented here, the\npatient had no predisposing personal or family psychiatric history.\n\nIn this case, we were looking to formulate the following research question: “Is there\nan association between the use of isotretinoin and the development of new emerging\npsychosis?” we conducted an extensive literature review using databases such as\nPubMed and Google scholar, where we evaluated similar cases using keywords such as\nacne, isotretinoin, vitamin A, psychosis, drug-related side effects, and adverse\nreactions. Eventually, we concluded that there is a lot of controversy regarding\nthis topic; however, in our case, with no previous psychiatric history and with the\ntemporal association between the appearance of psychosis and use of isotretinoin, we\ndeemed the association as non-coincidental; therefore our report may promote more\nawareness among clinicians regarding the possibility of the existence of such\nassociations.\n\nConclusion\nNumerous studies have reported psychiatric adverse events associated with\nisotretinoin use, and this should prompt clinicians to have a higher index of\nsuspicion for potential psychiatric events other than depression and suicidality\nrelated to isotretinoin use. Although no causal relationship has been established,\nthe increase in reported studies describing psychiatric events associated with\nisotretinoin indicates a link between the medication and psychopathology. This case\nserves as a reminder to psychiatrists that history-taking, including medication\nhistory, remains the pillar of a proper psychiatric assessment because it will\naffect the diagnosis, management, and subsequently, the long-term treatment\nplan.\n\nDeclaration of conflicting interests: The author(s) declared no potential conflicts of interest with respect to the\nresearch, authorship, and/or publication of this article.\n\nEthical approval: Ethical approval to report this case series was obtained from “ABHATH” (APPROVAL\nNUMBER/ID: MRC-04-19-471).\n\nFunding: The author(s) disclosed receipt of the following financial support for the\nresearch, authorship, and/or publication of this article: The publication of\nthis article was funded by the Qatar National Library.\n\nInformed consent: Written informed consent was obtained from a legally authorized representative(s)\nfor anonymized patient information to be published in this article. A\ngeneral consent form to publish patient information was obtained from the legal\nguardians (both parents).\n\nORCID iDs: Bushra Elhusein \nhttps://orcid.org/0000-0003-0803-1138\n\nWalid Elkhaled \nhttps://orcid.org/0000-0002-3188-4545\n\nMohamed Adil Shah Khoodoruth \nhttps://orcid.org/0000-0003-3104-7525\n==== Refs\nReferences\n1. \nSuuberg A \nPsychiatric and developmental effects of\nisotretinoin (Retinoid) treatment for acne vulgaris\n.\nCurr Ther Res \n2019 ; 90 :\n27 –31\n.30828405 \n2. \nLayton A \nThe use of isotretinoin in acne\n.\nDermatoendocrinol \n2009 ; 1 :\n162 –169\n.20436884 \n3. \nLudot M Mouchabac S Ferreri F \nInter-relationships between isotretinoin\ntreatment and psychiatric disorders: depression, bipolar disorder, anxiety,\npsychosis and suicide risks\n. World J\nPsychiatry \n2015 ; 5 :\n222 –227\n.26110123 \n4. \nBremner JD Shearer KD McCaffery PJ \nRetinoic acid and affective\ndisorders\n. J Clin Psychiatry \n2012 ; 73 :\n37 –50\n.\n5. \nWysowski DK Pitts M Beitz J \nDepression and suicide in patients treated with\nisotretinoin\n. N Engl J Med \n2001 ; 344 :\n460 –460\n.\n6. \nKępska A Majtyka M Kowman M , et al\nDermatitis artefacta as a\nsymptom of schizophrenia?\n\nAdv Dermatology Allergol \n2014 ; 4 :\n277 –279\n.\n7. \nSegmiller FM Rüther T Linhardt A , et al\nPsychosis during treatment\nwith isotretinoin\n. Ther Adv Psychopharmacol \n2013 ; 3 :\n244 –245\n.24167696 \n8. \nRajagopal S \nAcute psychosis induced by\nisotretinoin\n. Indian J Psychiatry \n2014 ; 56 :\n295 –297\n.25316943 \n9. \nLucca J Varghese N Ramesh M , et al\nA case report of\nisotretinoin-induced manic psychosis\n. Indian J\nDermatol \n2016 ; 61 : 120 .\n10. \nValderrama F Gomez A Restrepo D \nIsotretinoin therapy for acne vulgaris and first\nepisode psychosis in an adolescent patient\n. Rev\nColomb Psiquiatr \n2017 ; 46 (1 ):\n50 –54\n.28193374 \n11. \nGoodman AB \nChromosomal locations and modes of action of\ngenes of the retinoid (vitamin A) system support their involvement in the\netiology of schizophrenia\n. Am J Med Genet \n1995 ; 60 :\n335 –348\n.7485272 \n12. \nBarak Y Wohl Y Greenberg Y , et al\nAffective psychosis\nfollowing Accutane (isotretinoin) treatment\n. Int\nClin Psychopharmacol \n2005 ; 20 (1 ):\n39 –41\n.15602115\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2050-313X",
"issue": "8()",
"journal": "SAGE open medical case reports",
"keywords": "Acne; adverse reactions; drug-related side effects; isotretinoin; psychosis; vitamin A",
"medline_ta": "SAGE Open Med Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101638686",
"other_id": null,
"pages": "2050313X20931342",
"pmc": null,
"pmid": "32612830",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "24167696;21903028;25254016;20436884;26955128;7485272;30828405;26110123;11221610;28193374;15602115;25316943",
"title": "Isotretinoin-induced psychotic episode in a 17-year-old adolescent male.",
"title_normalized": "isotretinoin induced psychotic episode in a 17 year old adolescent male"
} | [
{
"companynumb": "QA-AKORN PHARMACEUTICALS-2020AKN00952",
"fulfillexpeditecriteria": "1",
"occurcountry": "QA",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ISOTRETINOIN"
},
"drugadditional"... |
{
"abstract": "The increasing reports of vancomycin-resistant enterococci (VRE) as a cause of neonatal septicemia are of recent interest. However, in majority of the cases, the source of VRE could not be located. As a consequence, the real importance of VRE and its control measures is undermined. Herein, we report a case of neonatal septicemia due to VRE (Enterococcus faecalis) of vanA genotype with VRE carriage in stool of the neonates as a possible source of sepsis. The report put forwards some lacunae in the infection control practices that are presently followed in the country.",
"affiliations": "Department of Microbiology, Institute of Medical Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh, India.;Department of Microbiology, Institute of Medical Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh, India.;Department of Microbiology, Institute of Medical Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh, India.;Department of Pediatrics, Institute of Medical Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh, India.",
"authors": "Kaushal|Satyendra|S|;Banerjee|Tuhina|T|;Anupurba|Shampa|S|;Kumar|Ashok|A|",
"chemical_list": "D001426:Bacterial Proteins; C071437:VanA ligase, Bacteria; D019729:Carbon-Oxygen Ligases",
"country": "India",
"delete": false,
"doi": "10.4103/0377-4929.191802",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0377-4929",
"issue": "59(4)",
"journal": "Indian journal of pathology & microbiology",
"keywords": null,
"medline_ta": "Indian J Pathol Microbiol",
"mesh_terms": "D001426:Bacterial Proteins; D019729:Carbon-Oxygen Ligases; D002353:Carrier State; D013293:Enterococcus faecalis; D005243:Feces; D016908:Gram-Positive Bacterial Infections; D006801:Humans; D007231:Infant, Newborn; D017053:Infection Control; D008297:Male; D000071074:Neonatal Sepsis; D065507:Vancomycin-Resistant Enterococci",
"nlm_unique_id": "7605904",
"other_id": null,
"pages": "548-550",
"pmc": null,
"pmid": "27721296",
"pubdate": "2016",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Vancomycin-resistant enterococci in neonatal stool as a cause of septicemia: Challenges for infection control practices.",
"title_normalized": "vancomycin resistant enterococci in neonatal stool as a cause of septicemia challenges for infection control practices"
} | [
{
"companynumb": "IN-AXELLIA-000997",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VANCOMYCIN"
},
"drugadditional": "3",
"drug... |
{
"abstract": "Patients with inflammatory bowel disease (IBD) on immunosuppression are at risk of developing lymphoma, particularly primary gastrointestinal (GI) tract non-Hodgkin lymphoma. Primary GI Hodgkin lymphoma (HL) in this setting, however, is rare and poorly defined. Here we review the available literature and also report a patient with Crohn's disease (CD) who developed GI HL. Our search yielded 12 single case studies and 7 case series involving 22 patients published between 1978-2016. Twenty-one (91%) patients had CD, and 2 had ulcerative colitis. The median age at lymphoma diagnosis was 39 years, and 18 (78%) patients were males. HL was diagnosed at a median of 8 years after IBD detection and 2 years after commencing immunosuppression. HL had a predilection (80%) to involve the inflamed GI site and the histological subtype was mixed cellularity in 65% of cases. In-situ hybridization for Epstein-Barr virus (EBV)-encoded RNA was positive in all documented cases. HL was diagnosed in stages I, II, IV in 35%, 20% and 45% of the patients, respectively. Notably, 66% of patients with advanced disease had liver involvement. Immunosuppression was stopped in most (69%) patients at HL diagnosis. Treatment used was either chemotherapy only, surgery followed by chemotherapy, or surgery alone in 50%, 33% and 16% of cases, respectively. Four patients had an IBD flare during HL remission. Patients with IBD who develop GI HL have distinct characteristics; male sex, predominance of CD, preference to develop in inflamed sites, mixed cellularity histology, EBV positivity, and a unique spread to the liver pattern.",
"affiliations": "Departments of Hematology, Tel Aviv Sourasky Medical Center, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel.;Department of Hematology, Hadassah University Hospital, Hebrew University Medical School, Jerusalem, Israel.;Departments of Hematology, Tel Aviv Sourasky Medical Center, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel.;Departments of Hematology, Tel Aviv Sourasky Medical Center, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel.;Departments of Hematology, Tel Aviv Sourasky Medical Center, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel.;Division of Medical Oncology and Hematology, Princess Margaret Hospital, Ontario, Canada.;Departments of Hematology, Tel Aviv Sourasky Medical Center, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel.;Departments of Hematology, Tel Aviv Sourasky Medical Center, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel. Electronic address: nadavsarid@gmail.com.",
"authors": "Barzilai|Merav|M|;Polliack|Aaron|A|;Avivi|Irit|I|;Herishanu|Yair|Y|;Ram|Ron|R|;Tang|Catherine|C|;Perry|Chava|C|;Sarid|Nadav|N|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1016/j.leukres.2018.06.008",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0145-2126",
"issue": "71()",
"journal": "Leukemia research",
"keywords": "Gastrointestinal; Hodgkin lymphoma; Inflammatory bowel disease",
"medline_ta": "Leuk Res",
"mesh_terms": "D000328:Adult; D000368:Aged; D020031:Epstein-Barr Virus Infections; D005260:Female; D005770:Gastrointestinal Neoplasms; D006689:Hodgkin Disease; D006801:Humans; D015212:Inflammatory Bowel Diseases; D008297:Male; D008875:Middle Aged; D055815:Young Adult",
"nlm_unique_id": "7706787",
"other_id": null,
"pages": "1-5",
"pmc": null,
"pmid": "29920411",
"pubdate": "2018-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Hodgkin lymphoma of the gastrointestinal tract in patients with inflammatory bowel disease: Portrait of a rare clinical entity.",
"title_normalized": "hodgkin lymphoma of the gastrointestinal tract in patients with inflammatory bowel disease portrait of a rare clinical entity"
} | [
{
"companynumb": "IL-MYLANLABS-2018M1054667",
"fulfillexpeditecriteria": "1",
"occurcountry": "IL",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "MERCAPTOPURINE"
},
"drugadditional": "1",
... |
{
"abstract": "Ruxolitinib, a small molecule JAK-1/2 inhibitor, was approved by the U.S. Food and Drug Administration (FDA) in November 2011, as the first therapeutic for the treatment of intermediate and high-risk myelofibrosis. The Janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway is one of the most well-studied intracellular signaling networks. Recent advances in our understanding of the complexities of signal activation and regulation of gene expression has provided opportunities for targeted therapeutic interventions. Although numerous inhibitors of the JAK/STAT pathway are currently being evaluated in clinical trials, ruxolitinib represents the first FDA approved in-class JAK inhibitor. We report a drug eruption associated with ruxolitinib.",
"affiliations": "Boston University School of Medicine/Roger Williams Medical Center. Johnbfournier@gmail.com.",
"authors": "Fournier|John Byrne|JB|;Cummings|Francis|F|;Cannella|Jonathan|J|;Breen|Catherine|C|;Zhou|Linda|L|;Iwamoto|Satori|S|",
"chemical_list": "D009570:Nitriles; D011720:Pyrazoles; D011743:Pyrimidines; C540383:ruxolitinib; D053612:Janus Kinases",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1087-2108",
"issue": "20(10)",
"journal": "Dermatology online journal",
"keywords": null,
"medline_ta": "Dermatol Online J",
"mesh_terms": "D003875:Drug Eruptions; D004890:Erythema; D006801:Humans; D053612:Janus Kinases; D008297:Male; D008875:Middle Aged; D009570:Nitriles; D055728:Primary Myelofibrosis; D011720:Pyrazoles; D011743:Pyrimidines",
"nlm_unique_id": "9610776",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "25526003",
"pubdate": "2014-10-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Drug-associated skin lesions in a patient with myelofibrosis receiving ruxolitinib.",
"title_normalized": "drug associated skin lesions in a patient with myelofibrosis receiving ruxolitinib"
} | [
{
"companynumb": "US-INCYTE CORPORATION-2013IN000469",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "LINAGLIPTIN"
},
"drugadditional": n... |
{
"abstract": "We describe a 49-year-old man with human immunodeficiency virus infection and stable chronic renal insufficiency who developed acute oliguric renal failure and severe lactic acidosis and who died several weeks after tenofovir was added to an antiretroviral regimen that included didanosine. Although the role of tenofovir in precipitating acute renal failure is unclear, progressive accumulation of the drug and pharmacologic interaction that caused increased levels of didanosine were the likely antecedents of increased mitochondrial toxicity that led to lactic acidosis.",
"affiliations": "Infectious Disease Section, Veterans Affairs Medical Center, and Oregon Health and Science University, Portland, Oregon 97201, USA. melissa.murphy@med.va.gov",
"authors": "Murphy|Melissa D|MD|;O'Hearn|Mary|M|;Chou|Sunwen|S|",
"chemical_list": "D019380:Anti-HIV Agents; D063065:Organophosphonates; D009943:Organophosphorus Compounds; D000068698:Tenofovir; D000225:Adenine; D016049:Didanosine",
"country": "United States",
"delete": false,
"doi": "10.1086/368313",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1058-4838",
"issue": "36(8)",
"journal": "Clinical infectious diseases : an official publication of the Infectious Diseases Society of America",
"keywords": null,
"medline_ta": "Clin Infect Dis",
"mesh_terms": "D000140:Acidosis, Lactic; D058186:Acute Kidney Injury; D000225:Adenine; D019380:Anti-HIV Agents; D023241:Antiretroviral Therapy, Highly Active; D016049:Didanosine; D004357:Drug Synergism; D017809:Fatal Outcome; D006801:Humans; D008297:Male; D008875:Middle Aged; D008928:Mitochondria; D063065:Organophosphonates; D009943:Organophosphorus Compounds; D000068698:Tenofovir",
"nlm_unique_id": "9203213",
"other_id": null,
"pages": "1082-5",
"pmc": null,
"pmid": "12684925",
"pubdate": "2003-04-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Fatal lactic acidosis and acute renal failure after addition of tenofovir to an antiretroviral regimen containing didanosine.",
"title_normalized": "fatal lactic acidosis and acute renal failure after addition of tenofovir to an antiretroviral regimen containing didanosine"
} | [
{
"companynumb": "US-MACLEODS PHARMACEUTICALS US LTD-MAC2021033676",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TENOFOVIR"
},
"drugadd... |
{
"abstract": "A 60-year-old Caucasian female presented with stage IIA (T2N0M0) estrogen- and progesterone-negative and HER2-positive breast cancer. She was started on an adjuvant chemotherapy regimen of docetaxel, carboplatin, and trastuzumab (TCH). She tolerated the first two cycles of the TCH regimen well. However, 3-4 days after the third and fourth cycles, she developed acute pancreatitis. Elevated pancreatic enzymes and abdominal computed tomography (CT) imaging findings confirmed the diagnosis of acute pancreatitis. Common causes of pancreatitis were ruled out. Given the time course it was assumed that the chemotherapy was the cause of pancreatitis in our patient. The patient did not receive any further docetaxel and carboplatin chemotherapy but continued on adjuvant trastuzumab alone for a planned duration of 1 year without any recurrence of acute pancreatitis.",
"affiliations": "Department of Neoplastic Diseases, Medical College of Wisconsin, 9200 W Wisconsin Ave, Milwaukee, WI, USA. vsingh@mcw.edu",
"authors": "Singh|Veerpal|V|;Devata|Sumana|S|;Cheng|Yee C|YC|",
"chemical_list": "D011960:Receptors, Estrogen; D011980:Receptors, Progesterone; D043823:Taxoids; D000077143:Docetaxel; D016190:Carboplatin; D018719:Receptor, ErbB-2; D002330:Carmustine",
"country": "Japan",
"delete": false,
"doi": "10.1007/s10147-010-0105-2",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1341-9625",
"issue": "15(6)",
"journal": "International journal of clinical oncology",
"keywords": null,
"medline_ta": "Int J Clin Oncol",
"mesh_terms": "D000208:Acute Disease; D000971:Antineoplastic Combined Chemotherapy Protocols; D001943:Breast Neoplasms; D016190:Carboplatin; D002330:Carmustine; D017024:Chemotherapy, Adjuvant; D000077143:Docetaxel; D005260:Female; D006801:Humans; D008875:Middle Aged; D009367:Neoplasm Staging; D010195:Pancreatitis; D011379:Prognosis; D018719:Receptor, ErbB-2; D011960:Receptors, Estrogen; D011980:Receptors, Progesterone; D043823:Taxoids; D014057:Tomography, X-Ray Computed",
"nlm_unique_id": "9616295",
"other_id": null,
"pages": "642-4",
"pmc": null,
"pmid": "20602134",
"pubdate": "2010-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "12602552;19088522;20227028",
"title": "Carboplatin and docetaxel-induced acute pancreatitis: brief report.",
"title_normalized": "carboplatin and docetaxel induced acute pancreatitis brief report"
} | [
{
"companynumb": "US-SUN PHARMACEUTICAL INDUSTRIES LTD-2016US-110320",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"dru... |
{
"abstract": "BACKGROUND\nDrug-induced pancreatitis (DIP) is a kind of acute pancreatitis with a relatively low incidence. There are many cases of acute pancreatitis (AP) caused by chemotherapeutic agents that have been reported. However, few reports focus on the combination of chemotherapeutic agents that induce acute pancreatitis. This article aims to retrospectively analyze a case of DIP and to explore the relationship between chemotherapeutic agents and acute pancreatitis.\nHere, we report a 35-year-old Chinese female patient who was diagnosed as acute myeloid leukemia with BCR/ABL expression. After induction chemotherapy of daunorubicin and cytarabine, bone marrow aspiration showed: Acute myeloid leukemia-not relieved (AML-NR). Then the regimen of homoharringtonine, cytarabine and dasatinib was started. The patient developed abdominal pain on the 14th day of chemotherapy. Laboratory tests showed elevated serum amylase (AMY) and lipase (LIPA). Computed tomography (CT) of the abdomen revealed a swollen pancreas with blurred edges and thickened left prerenal fascia.\n\n\nMETHODS\nThe patient was diagnosed as DIP by the symptoms of upper abdominal pain and the change of CT images. Other common causes of AP were excluded meanwhile.\n\n\nMETHODS\nThe chemotherapy was stopped immediately. And after fasting, fluid infusion and inhibiting the secretion of the pancreas, the symptoms were relieved.\n\n\nRESULTS\nDIP relapsed when the regimen of aclacinomycin + cytarabine + G-CSF + dasatinib regimen (G-CSF (400ug/day, day 1 to 15), cytarabine (30 mg/day, day 2 to 15), aclacinomycin (20 mg/day, day 2 to 5)and dasatinib (140 mg/day, continuously)) was given, and was recovered after treatment for AP was performed.\n\n\nCONCLUSIONS\nTo choose the best treatment plan for patients, clinicians should raise awareness of DIP, and should know that chemotherapeutic agents can induce pancreatitis and the combination of chemotherapeutic agents may increase the risk of drug-induced pancreatitis.",
"affiliations": "Department of Gastroenterology, The Second Affiliated Hospital of Kunming Medical University, Kunming, Yunnan Province, China.",
"authors": "Yang|Qiu-Jin|QJ|;Zheng|Jie|J|;Dang|Fu-Tao|FT|;Wan|Yue-Meng|YM|;Yang|Jing|J|",
"chemical_list": "D003561:Cytarabine; D000077863:Homoharringtonine; D000069439:Dasatinib; D003630:Daunorubicin",
"country": "United States",
"delete": false,
"doi": "10.1097/MD.0000000000021848",
"fulltext": "\n==== Front\nMedicine (Baltimore)\nMedicine (Baltimore)\nMEDI\nMedicine\n0025-7974 1536-5964 Lippincott Williams & Wilkins Hagerstown, MD \n\nMD-D-19-07884\n10.1097/MD.0000000000021848\n21848\n4500\nResearch Article\nClinical Case Report\nAcute pancreatitis induced by combination chemotherapy used for the treatment of acute myeloid leukemia\nA case reportYang Qiu-Jin MD Zheng Jie MD Dang Fu-Tao MD Wan Yue-Meng MD, PhD Yang Jing MD∗ Saranathan. Maya Department of Gastroenterology, The Second Affiliated Hospital of Kunming Medical University, Kunming, Yunnan Province, China.\n∗ Correspondence: Jing Yang, Department of Gastroenterology, The Second Affiliated Hospital of Kunming Medical University, Dianmian Road 374, Kunming 650101, Yunnan Province, China (e-mail: 727783704@qq.com).\n28 8 2020 \n28 8 2020 \n99 35 e2184810 10 2019 3 7 2020 21 7 2020 Copyright © 2020 the Author(s). Published by Wolters Kluwer Health, Inc.2020This is an open access article distributed under the Creative Commons Attribution License 4.0 (CCBY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. http://creativecommons.org/licenses/by/4.0Abstract\nRationale:\nDrug-induced pancreatitis (DIP) is a kind of acute pancreatitis with a relatively low incidence. There are many cases of acute pancreatitis (AP) caused by chemotherapeutic agents that have been reported. However, few reports focus on the combination of chemotherapeutic agents that induce acute pancreatitis. This article aims to retrospectively analyze a case of DIP and to explore the relationship between chemotherapeutic agents and acute pancreatitis.\n\nPatient concerns:\nHere, we report a 35-year-old Chinese female patient who was diagnosed as acute myeloid leukemia with BCR/ABL expression. After induction chemotherapy of daunorubicin and cytarabine, bone marrow aspiration showed: Acute myeloid leukemia-not relieved (AML-NR). Then the regimen of homoharringtonine, cytarabine and dasatinib was started. The patient developed abdominal pain on the 14th day of chemotherapy. Laboratory tests showed elevated serum amylase (AMY) and lipase (LIPA). Computed tomography (CT) of the abdomen revealed a swollen pancreas with blurred edges and thickened left prerenal fascia.\n\nDiagnosis:\nThe patient was diagnosed as DIP by the symptoms of upper abdominal pain and the change of CT images. Other common causes of AP were excluded meanwhile.\n\nInterventions:\nThe chemotherapy was stopped immediately. And after fasting, fluid infusion and inhibiting the secretion of the pancreas, the symptoms were relieved.\n\nOutcomes:\nDIP relapsed when the regimen of aclacinomycin + cytarabine + G-CSF + dasatinib regimen (G-CSF (400ug/day, day 1 to 15), cytarabine (30 mg/day, day 2 to 15), aclacinomycin (20 mg/day, day 2 to 5)and dasatinib (140 mg/day, continuously)) was given, and was recovered after treatment for AP was performed.\n\nLessons:\nTo choose the best treatment plan for patients, clinicians should raise awareness of DIP, and should know that chemotherapeutic agents can induce pancreatitis and the combination of chemotherapeutic agents may increase the risk of drug-induced pancreatitis.\n\nKeywords\nchemotherapeutic agentsdiagnosisdrug-induced pancreatitispathogenesisrisk factorstreatment principlesOPEN-ACCESSTRUE\n==== Body\n1 Introduction\nAcute pancreatitis is a kind of inflammatory injury including pancreatic edema, hemorrhage and necrosis caused by self-digestion of pancreatic tissue. And acute pancreatitis can be caused by various causes. The most common causes include: biliary tract disease, alcohol, pancreatic duct obstruction, disease of the descending duodenum, etc. Drug-induced pancreatitis is relatively rare. At present, there are few studies on drug-induced pancreatitis, mainly based on case reports.[1] However, as more and more drugs are used in clinical practice, the incidence of drug-induced pancreatitis is also relatively increased. Chemotherapeutic agents have been reported repeatedly to cause AP, and the mechanism is still unclear. Combination of chemotherapeutic agents may increase the incidence of DIP. DIP is a diagnosis of exclusion, and it is difficult to determine the causal relationship between the drug and pancreatitis without a rechallenge test.[2] The main point of the treatment for DIP is to stop suspicious drugs, and other therapies are the same as general pancreatitis.[3] Many of the reported cases of pancreatitis are caused by the clear use of a single drug, and few are caused by drug combination or interaction. Therefore, we retrospectively analyzed the course, laboratory examination and imaging changes of a case of acute pancreatitis caused by the combination of chemotherapeutic agents, to deepen the understanding of the risk factors, pathogenesis, diagnosis and treatment principles of DIP via reviewing the literature, and to help clinicians to choose medications. Written informed consent was obtained from the patient for publication of this case report and accompanying images.\n\n2 Case presentation\nA 35-year-old woman presented with swelling of the right upper gums, without gum pain, bleeding, fever, night sweats, bone pain, weight loss, etc. Blood test showed: white blood cell count (WBC) 13.74 × 109/L, neutrophile cell (NC) 0.82 × 109/L, hemoglobin (Hb) 105 g/L, platelet (PLT) 140 × 109/ L, the primitive cells account for 60%. Then she came to our hospital for further diagnosis and treatment. Bone marrow cytological diagnosis was: acute myeloid leukemia to be classified, with increased immature basophils. Bone marrow biopsy revealed: myeloid hyperplasia is extremely active (>90%), and cells in naive stage increase significantly. Immunohistochemically, BCR-ABL1 p190 was positive. Karyotype analysis of bone marrow showed the presence of 46, XX, t (9; 22) (q34; q11.2). The diagnosis of acute myeloid leukemia with BCR/ABL expression was established. Induced chemotherapy was given, including daunorubicin (90 mg/day, day 5 to 7) and cytarabine (200 mg/day, day 1 to 7) from March 13th to 19th. The patient developed myelosuppression after chemotherapy, including granulocyte deficiency, severe anemia and extremely low platelets, which were alleviated after administration of Granulocyte colony-stimulating factor (G-CSF) and blood transfusion. Bone marrow aspiration on April 4th showed: Acute myeloid leukemia-not relieved (AML-NR). On April 8th, the regimen of homoharringtonine, cytarabine and dasatinib was started: cytarabine (200 mg/day for 7 days), homoharringtonine (3 mg/day, day 1, day 3, day 5 and day 7) and dasatinib (140 mg/day, continuously). The patient developed abdominal pain on the 14th day of chemotherapy. The pancreatic function test was found to be: amylase (AMY) 111U/L (normal range 30–110U/L), lipase (LIPA) 568 U/L (normal range 23–300U/L). Computed tomography (CT) of the abdomen revealed a swollen pancreas with blurred edges and thickened left prerenal fascia (Fig. 1). Diagnosis of acute pancreatitis can be determined by the biochemical test and CT imaging. The use of Dasatinib was stopped immediately. After fasting, fluid infusion and inhibiting the secretion of the pancreas, the symptoms were relieved. The patient returned to our hospital because of fever on May 10th, 2019. After exclusion of the contraindications of chemotherapy, chemotherapeutic regimen of the aclacinomycin, cytarabine, G-CSF and dasatinib was given including G-CSF (400ug/day, day 1 to 15), cytarabine (30 mg/day, day 2 to 15), aclacinomycin (20 mg/day, day 2 to 5) and dasatinib (140 mg/day, continuously). The patient developed abdominal pain and fever on May 29th, 2019. Emergency pancreatic function test showed increased trypsin: AMY 134U/L (normal range 30-110U/L), LIPA 520U/L (normal range 23–300U/L). CT of the abdomen showed a swollen pancreas (Fig. 2). We considered it a relapse of pancreatitis. The use of dasatinib was stopped again and treatment for pancreatitis was given until the symptoms were relieved and pancreatic function returned to normal.\n\nFigure 1 CT of the abdomen revealed a swollen pancreas with blurred edges and thickened left prerenal fascia, which suggested the diagnosis of AP. CT = Computed tomography, AP = Acute pancreatitis.\n\nFigure 2 CT of the abdomen showed a swollen pancreas. CT = Computed tomography.\n\n3 Discuss\nDIP is a kind of acute pancreatitis with a relatively low incidence. At present, the incidence of DIP is mostly from random case reports, but not all case reports clearly describe the dose, frequency, and time course from drug delivery to onset, and some cases have not even strictly ruled out other causes of acute pancreatitis. Due to ethical issues, few cases can complete the rechallenge test. Nitsche et al[1] believe that the overall incidence of drug-induced pancreatitis may be between 0.1% and 2%. The incidence of drug-induced pancreatitis in the study of Vinklerová et al[2] is as high as 5.3% (9/170) however, which may be attributed to the small number of cases, or because most cases cannot be diagnosed by the rechallenge test and lead to over-diagnosis.\n\nThere are no unified diagnostic criteria for drug-induced pancreatitis at home and abroad so far. Jiaming Qian and Shujun Wang[3] proposed that the diagnostic criteria for DIP are:\n\n(1) meeting the diagnostic criteria for acute pancreatitis;\n\n(2) excluding other common causes of acute pancreatitis;\n\n(3) history of medication;\n\n(4) the time from drug delivery to onset is consistent with the latency reported in most literatures;\n\n(5) the improvement of pancreatitis symptoms and the decrease of pancreatic enzyme after withdrawal;\n\n(6) after re-medication clinical manifestations reappeared and pancreatic enzymes increased (rechallenge test positive).\n\nIt is worth noting that in the diagnosis of DIP, it is necessary to carefully ask and find out the history, to rule out common causes of acute pancreatitis such as cholelithiasis, heavy drinking, hyperlipidemia, autoimmune pancreatitis, pancreatic cancer, abdominal injury and the history of surgery, etc. If the condition allows and the patient's consent is obtained, the same drug can be used again if necessary. If clinical symptoms, pancreatic enzyme elevation increase and/or imaging changes occur again, suggesting that the rechallenge test is positive, which indicates the diagnosis of DIP.\n\nThe WHO database lists a total of 525 drugs that may cause acute pancreatitis. But there are currently only about 30 drugs that cause acute pancreatitis for certain. Drugs that are now clearly associated with pancreatitis are listed in Table 1.[4]\n\nTable 1 Drugs definitely associated with acute pancreatitis according to Ksiadzyna[4].\n\nThe pathogenesis of drug-induced pancreatitis is still unclear. Yanar et al[5] pointed out that the hypothesis of mechanism include immune-mediated inflammatory response, direct cytotoxicity, pancreatic duct stenosis, small arterial thrombosis and metabolic effects, etc. Studies by Badalov et al[6] have shown that drugs such as acetaminophen, erythromycin, and carbamazepine induce DIP through direct toxic damage to the pancreas by active metabolites, and this response is associated with overdose. Pancreatitis caused by most drugs is not related to the dose of the drug, so most drug-induced pancreatitis is caused by an idiosyncratic reaction instead, that is, an unpredictable reaction that occurs within the normal dose of the drug.[3] Some side effects of drugs can lead to hypercalcemia, hyperlipidemia or increased pancreatic juice viscosity, which is exactly the pathogenesis of acute pancreatitis.[3,7]\n\nCytarabine mainly acts on pyrimidine antimetabolites in the S proliferative phase of cells. It inhibits DNA synthesis and interferes with cell proliferation. It widely uses in leukemia, especially for acute myeloid leukemia. There have been reports of cases of cytarabine-associated pancreatitis, but few of them have accomplished the rechallenge test, and the pathogenesis is still not very clear. Dasatinib is a polytyrosine kinase inhibitor, mainly used in the treatment of adult patients with all stages of chronic myelogenous leukemia who is imatinib-resistant or imatinib-intolerable and the treatment of adult patients resistant or intolerant to other therapies with Philadelphia chromosome-positive acute lymphoblastic leukemia. Serpa et al[8] reported a case report of acute pancreatitis after the use of dasatinib, the mechanism of TKIs(tyrosine kinase inhibitors)-induced pancreatitis is still speculation, but the reason proposed by Plandari et al[9] may be the inhibition of c-ABL. This inhibition may interfere with the molecular mechanism that regulates apoptosis and leads to pancreatic damage. Or may be due to the indirect effects of drugs on the release of calcium ions from the intracellular acinar pool, thereby regulating pancreatic exocrine function and possibly increasing the deposition of intracellular fatty acids in pancreatic acinar cells, which interfere with the exocytosis process. However, reports of pancreatitis caused by TKIs are more common in imatinib and nilotinib, and dasatinib is relatively rare. Case reports of acute pancreatitis induced by homoharringtonine[10] and aclacinomycin[11] have also been published, but lack of relevant mechanisms.\n\nIn this case, the patient didn’t develop any sign of acute pancreatitis when she underwent the regimen of daunorubicin and cytarabine at the stage of induced chemotherapy (daunorubicin(90 mg/day, day 5 to 7) and cytarabine (200 mg/day, day 1 to day 7)). However, she suffered from acute pancreatitis on the 14th day when she underwent the chemotherapy regimen of homoharringtonine, cytarabine and dasatinib (cytarabine(200 mg/day for 7 days), homoharringtonine (3 mg/day, day 1, day 3, day 5 and day 7) and dasatinib(140 mg/day, continuously)). After her acute pancreatitis was cured, she developed acute pancreatitis again on the 15th day when she underwent the chemotherapy regimen of aclacinomycin, cytarabine, G-CSF and dasatinib (G-CSF (400ug/day, day 1 to 15), cytarabine (30 mg/day, day 2 to 15), aclacinomycin (20 mg/day, day 2 to 5) and dasatinib(140 mg/day, continuously)). Other common causes of acute pancreatitis such as cholelithiasis, alcohol, and hyperlipidemia have been ruled out by making a detailed inquiry of her medical history and relevant auxiliary examinations. Therefore, the diagnosis of DIP was established. And both episodes of pancreatitis were cured by symptomatic and supportive treatment for acute pancreatitis such as fasting, anti-infection, inhibition of gastric acid and inhibition of pancreatic enzyme secretion. Since all the four chemotherapeutic agents used in this patient have been reported to be with side effects causing acute pancreatitis, in consideration of the three chemotherapeutic regimens of the patient and the incubation period before acute pancreatitis, cytarabine is most likely the chief culprit in inducing her acute pancreatitis in this case. Cytarabine has been reported to cause acute pancreatitis for many time, in the Badalov 2007 classification criteria,[5] it belongs to class Ia (at least one case reported a positive rechallenge test, and ruled out other causes). McBride et al[12] have reported that cytarabine may cause acute pancreatitis for two reasons:\n\n(1) Time-dependent toxicity;\n\n(2) Combined with other chemotherapeutic agent.\n\nMcGrail[13] and others believe that acute pancreatitis induced by cytarabine has nothing to do with the time and dose. In this case, there was also no clear dose-dependent and time-dependent relationship between cytarabine and acute pancreatitis, and it is more likely to be attributed to the combination with other drugs.\n\nThere are relatively few reports of acute pancreatitis caused by dasatinib, homoharringtonine, and aclacinomycin. However, the possibility of pancreatitis caused by any other single drugs or the combination of them in this case cannot be completely ruled out. We figured that there was no aclacinomycin in the chemotherapeutic regimen of homoharringtonine, cytarabine and dasatinib at the first time when the patient developed acute pancreatitis, and there was no homoharringtonine in the regimen of the aclacinomycin, cytarabine, G-CSF and dasatinib at the second time, considering that the possibility of the acute pancreatitis induced by these two drugs was relatively low. There was no acute pancreatitis when the patient underwent high-dose cytarabine therapy at the stage of inducing chemotherapy, and since dasatinib was continuously used through the other two stages, it may be another potential cause of DIP. Therefore, it is difficult to clearly prove the causal relationship between any single drug and acute pancreatitis in this case.\n\nWe assume that cytarabine combined with some certain drugs may increase the risk of inducing acute pancreatitis, or several combinations of drugs that may cause pancreatitis will increase the incidence of drug-induced pancreatitis. The pathogenesis needs more further research. When selecting the appropriate chemotherapeutic regimen for a patient, the clinician should carefully consider the superposition of the same adverse reactions of the drugs and the interaction between the drugs to avoid using a combination of drugs that may increase the incidence of adverse reactions. At the same time, when clarifying the relationship between a single drug and acute pancreatitis, it is also necessary to consider the additional effects of multiple drugs in order to help clinicians to develop better treatment options.\n\nDue to the complexity of the diagnosis of drug-induced pancreatitis, it often leads to misdiagnosis or missed diagnosis. Tenner[14] pointed out that clinicians were overly dependent on case reports and ignored randomized clinical trials and large pharmacology-epidemiology investigations, leading to confusion about drug-induced acute pancreatitis and idiopathic pancreatitis. He believes that drug-induced pancreatitis may account for less than 1% of cases of pancreatitis, and may be extremely rare in patients who do not take significant medications. Nearly one-third of pancreatitis are described as idiopathic pancreatitis because of its unknown etiology. Therefore, it is a more appropriate choice to diagnose it as idiopathic pancreatitis when the diagnosis of drug-induced pancreatitis is not clear.[14]\n\nIn view of the idiopathic and susceptibility characteristics of drug-induced pancreatitis, we can prevent it by the following ways. First of all, we should fully understand the drugs that may cause pancreatitis. Secondly, we should recognize the susceptible population of drug-induced pancreatitis. Balani et al[15] pointed out that the risk factors of drug-induced pancreatitis include:\n\n(1) children\n\n(2) women\n\n(3) elderly patients taking multiple drugs\n\n(4) CD4+T-cells count for <200 cells/mm3 of advanced AIDS patients\n\n(5) inflammatory bowel disease (especially Crohn's disease)\n\n(6) patients who use tumor chemotherapeutic drugs.\n\nParticular attention should be paid to the possibility of developing drug-induced pancreatitis when using related drugs in these groups. For the treatment of drug-induced pancreatitis, the most important thing is to stop using suspicious drugs, and other therapies are the same as general pancreatitis.[3,7] To avoid re-use of the same drug as much as possible. If considering that the benefits for the patient are greater than the side effects (pancreatitis) when it is necessary to use a drug, we can use a possible alternative or change the dose and method to minimize the incidence of side effects.\n\n4 Summary\nWith the continuous development of new drugs, more and more drugs have been used in clinical practice, and drugs reported causing acute pancreatitis are also increasing. Among them, chemotherapeutic drugs can induce pancreatitis and the combination of chemotherapeutic drugs may increase the risk of drug-induced pancreatitis, which should cause enough attention of clinicians. The specific incidence of pancreatitis caused by chemotherapeutic drugs and the combination of chemotherapeutic agents that cause DIP needed further study at present.\n\nAcknowledgments\nThe authors thank to the contribution of their colleagues and institution.\n\nAuthor contributions\nConceptualization: Qiujin Yang, Jie Zheng.\n\nData curation: Qiujin Yang, Jie Zheng.\n\nInvestigation: Qiujin Yang, Jie Zheng, Fu-Tao Dang.\n\nMethodology: Qiujin Yang, Jie Zheng.\n\nProject administration: Jing Yang.\n\nResources: Fu-Tao Dang.\n\nSupervision: Jing Yang.\n\nValidation: Yue-Meng Wan, Jing Yang.\n\nVisualization: Yue-Meng Wan, Jing Yang.\n\nWriting – original draft: Qiujin Yang, Jie Zheng.\n\nWriting – review & editing: Qiujin Yang, Jie Zheng, Jing Yang.\n\nAbbreviations: AML = acute myeloid leukemia, AMY = amylase, AP = acute pancreatitis, CT = Computed tomography, DIP = drug-induced pancreatitis, Hb = hemoglobin, LIPA = lipase, NC = neutrophile cell, PLT = platelet, WBC = white blood cell.\n\nHow to cite this article: Yang QJ, Zheng J, Dang FT, Wan YM, Yang J. Acute pancreatitis induced by combination chemotherapy used for the treatment of acute myeloid leukemia: a case report. Medicine. 2020;99:35(e21848).\n\nQJY and JZ contributed to this work equally.\n\nThe authors report no conflicts of interest.\n\nThe patient has provided informed consent for publication of the case.\n\nThe datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.\n==== Refs\nReferences\n[1] Nitsche CJ Jamieson N Lerch MM \nDrug induced pancreatitis\n. Best Pract Res Clin Gastroenterol \n2010 ;24 :143 55\n.20227028 \n[2] Vinklerová I Procházka M Procházka V \nIncidence, severity, and etiology of drug-induced acute pancreatitis\n. Dig Dis Sci \n2010 ;55 :2977 81\n.20499176 \n[3] Jiaming Qian Shujun Wang \nDiagnosis and treatment of drug-induced pancreatitis\n. Lin Chuang Gan Dan Bing Za Zhi \n2014 ;30 :722 5\n.\n[4] Ksiadzyna D \nDrug-induced acute pancreatitis related to medications commonly used in gastroenterology\n. Eur J Intern Med \n2011 ;22 :20 5\n.21238888 \n[5] Yanar F Agcaoglu O Sarici IS \nClinical challenges in drug induced pancreatitis: Presentation of two cases and review of the literature\n. Int J Surg Case Rep \n2013 ;4 :708 10\n.23810919 \n[6] Badalov N Baradarian R Iswara K \nDrug-induced acute pancreatitis: an evidence-based review\n. Clin Gastroenterol Hepatol \n2007 ;5 :648 61\n. quiz 644 .17395548 \n[7] Chengliang Cao Bei Sun Gang Wang \nResearch progress in drug-induced pancreatitis\n. Zhongguo Shi Yong Wai Ke Za Zhi \n2016 ;36 :1345 7\n.\n[8] Serpa M Sanabani SS Bendit I \nEfficacy and tolerability after unusually low doses of dasatinib in chronic myeloid leukemia patients intolerant to standard-dose dasatinib therapy\n. Clin Med Insights Oncol \n2010 ;4 :155 62\n.21234296 \n[9] Palandri F Castagnetti F Soverini S \nPancreatic enzyme elevation in chronic myeloid leukemia patients treated with nilotinib after imatinib failure\n. Haematologica \n2009 ;94 :1758 61\n.19608673 \n[10] Tang J Liu Y Chen J \nHomoharringtonine as a backbone drug for the treatment of newly diagnosed pediatric acute myeloid leukemia: a report from a single institution in China\n. Int J Hematol \n2011 ;93 :610 7\n.21509439 \n[11] Adachi S Akiyama Y Takimoto T \nAclarubicin-related pancreatitis in a child with AML\n. Rinsho Ketsueki \n1988 ;29 :385 8\n.3165144 \n[12] McBride CE Yavorski RT Moses FM \nAcute pancreatitis associated with continuous infusion cytarabine therapy: a case report\n. Cancer \n1996 ;77 :2588 91\n.8640710 \n[13] McGrail LH Sehn LH Weiss RB \nPancreatitis during therapy of acute myeloid leukemia: cytarabine related?\n\nAnn Oncol \n1999 ;10 :1373 6\n.10631468 \n[14] Tenner S \nDrug induced acute pancreatitis: does it exist?\n\nWorld J Gastroenterol \n2014 ;20 :16529 34\n.25469020 \n[15] Balani AR Grendell JH \nDrug-induced pancreatitis: incidence, management and prevention\n. Drug Saf \n2008 ;31 :823 37\n.18759507\n\n",
"fulltext_license": "CC BY",
"issn_linking": "0025-7974",
"issue": "99(35)",
"journal": "Medicine",
"keywords": null,
"medline_ta": "Medicine (Baltimore)",
"mesh_terms": "D000328:Adult; D000971:Antineoplastic Combined Chemotherapy Protocols; D003561:Cytarabine; D000069439:Dasatinib; D003630:Daunorubicin; D005260:Female; D000077863:Homoharringtonine; D006801:Humans; D015470:Leukemia, Myeloid, Acute; D010195:Pancreatitis; D014057:Tomography, X-Ray Computed",
"nlm_unique_id": "2985248R",
"other_id": null,
"pages": "e21848",
"pmc": null,
"pmid": "32871908",
"pubdate": "2020-08-28",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Acute pancreatitis induced by combination chemotherapy used for the treatment of acute myeloid leukemia: A case report.",
"title_normalized": "acute pancreatitis induced by combination chemotherapy used for the treatment of acute myeloid leukemia a case report"
} | [
{
"companynumb": "CN-MEITHEAL PHARMACEUTICALS-2020MHL00062",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "DASATINIB"
},
"drugadditional"... |
{
"abstract": "Immune checkpoint inhibitors (ICIs) have revolutionized the treatment of advanced melanoma. Combination of ICI with ipilimumab cytotoxic T-lymphocyte antigen-4 and nivolumab [anti-programmed cell death-1 (PD-1)] improves tumoral response compared to anti-PD1 monotherapy in melanoma patients, but is associated with more severe and multiple immune-related adverse events. We report the first case of aseptic cystitis induced by ipilimumab and nivolumab combination in a 61-year-old melanoma patient. She described after two infusions, diarrhea, pollakiuria, intense bladder pain, urinary urgency, and nocturia. Repeated negative urine culture tests led to perform cystoscopy. Mucosal bladder biopsies showed lymphocytic T-cells infiltration in intraepithelial and in subepithelial connective tissue, which were consistent with the diagnosis of immune-related aseptic cystitis. Aseptic cystitis is a rare and poorly known side-effect related to ICI. Only four other cases with anti-PD1 monotherapy were found in literature, only in Japanese patients. It simulates bacterial cystitis with negative urinary tests, and is often associated with atypical symptoms like diarrhea, which may delay the diagnosis. Oral steroids appear to be the most efficient therapeutic options.",
"affiliations": "CHU de Bordeaux, Service de Dermatologie.;CHU de Bordeaux, Service de chirurgie urologique.;CHU de Bordeaux, Service de Pathologie.;CHU de Bordeaux, Service de Dermatologie.;CHU de Bordeaux, Service de Dermatologie.;CHU de Bordeaux, Service de Dermatologie.;CHU de Bordeaux, Service de Dermatologie.",
"authors": "Schneider|Sophie|S|;Alezra|Eric|E|;Yacoub|Mokrane|M|;Ducharme|Océane|O|;Gerard|Emilie|E|;Dutriaux|Caroline|C|;Prey|Sorilla|S|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1097/CMR.0000000000000765",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0960-8931",
"issue": "31(5)",
"journal": "Melanoma research",
"keywords": null,
"medline_ta": "Melanoma Res",
"mesh_terms": null,
"nlm_unique_id": "9109623",
"other_id": null,
"pages": "487-489",
"pmc": null,
"pmid": "34433197",
"pubdate": "2021-10-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Aseptic cystitis induced by nivolumab and ipilimumab combination for metastatic melanoma.",
"title_normalized": "aseptic cystitis induced by nivolumab and ipilimumab combination for metastatic melanoma"
} | [
{
"companynumb": "FR-BRISTOL-MYERS SQUIBB COMPANY-BMS-2021-099628",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "IPILIMUMAB"
},
"drugadd... |
{
"abstract": "Multiple studies and reports have suggested that coronavirus disease-19 (COVID-19) promotes arterial and venous thrombotic events in multiple organ systems, although the mechanism leading to a hypercoagulable state is still unknown. Few cases of splenic infarction associated with COVID-19 have been reported, of which half were found incidentally upon autopsy. This may be due to a clinically silent presentation or the symptoms being wrongfully attributed to pain caused by the effects of COVID-19. Due to the rarity of the condition and its lack of consistent symptomatology, splenic thromboembolism can be difficult to diagnose. Awareness of the condition and high clinical suspicion will help the clinician identify and manage the problem. Hemorrhage in patients with COVID-19 is uncommon in the hypercoagulable state that threatens thrombus formation in patients with COVID-19 infection. Despite prophylactic treatment with anticoagulation therapies, patients are more prone to developing clots. It is also well-known that therapeutic anticoagulation can place patients at a higher risk of bleeding. Thus, this unique population is at risk of developing both thrombotic and hemorrhagic events. We report a rare case of splenic infarction in a patient with confirmed COVID-19 infection despite prophylactic treatment with low-molecular-weight heparin which was found incidentally during workup for 2 other rare conditions: spontaneous rectus sheath hematoma and microhemorrhage or thrombus of the mesenteric vessels.",
"affiliations": "Medical College of Wisconsin, 1900 Westwood Center Blvd, Unit 3100, Wausau, WI, 54401 USA.;Medical College of Wisconsin, 1900 Westwood Center Blvd, Unit 3100, Wausau, WI, 54401 USA.;Medical College of Wisconsin, 1900 Westwood Center Blvd, Unit 3100, Wausau, WI, 54401 USA.;Medical College of Wisconsin, 1900 Westwood Center Blvd, Unit 3100, Wausau, WI, 54401 USA.;Ascension Saint Michael's Hospital, Stevens Point, WI.;Ascension Saint Michael's Hospital, Stevens Point, WI.",
"authors": "Dennison|Jennifer J|JJ|;Carlson|Samuel|S|;Faehling|Shannon|S|;Phelan|Hannah|H|;Tariq|Muhammad|M|;Mubarik|Ateeq|A|",
"chemical_list": null,
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.radcr.2021.02.016",
"fulltext": "\n==== Front\nRadiol Case Rep\nRadiol Case Rep\nRadiology Case Reports\n1930-0433\nElsevier\n\nS1930-0433(21)00080-7\n10.1016/j.radcr.2021.02.016\nCase Report\nSplenic infarction and spontaneous rectus sheath hematomas in COVID-19 patient\nDennison Jennifer J. BS jdennison@mcw.edu\na⁎\nCarlson Samuel BS a\nFaehling Shannon BS a\nPhelan Hannah BS a\nTariq Muhammad MD b\nMubarik Ateeq MD bc\na Medical College of Wisconsin, 1900 Westwood Center Blvd, Unit 3100, Wausau, WI, 54401 USA\nb Ascension Saint Michael's Hospital, Stevens Point, WI\nc Clinical Assistant Professor, Medical College of Wisconsin, 1900 Westwood Center Blvd, Unit 3100, Wausau, WI 54401 USA\n⁎ Corresponding author. jdennison@mcw.edu\n13 2 2021\n5 2021\n13 2 2021\n16 5 9991004\n3 2 2021\n7 2 2021\n© 2021 The Authors\n2021\nThis is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).\nMultiple studies and reports have suggested that coronavirus disease-19 (COVID-19) promotes arterial and venous thrombotic events in multiple organ systems, although the mechanism leading to a hypercoagulable state is still unknown. Few cases of splenic infarction associated with COVID-19 have been reported, of which half were found incidentally upon autopsy. This may be due to a clinically silent presentation or the symptoms being wrongfully attributed to pain caused by the effects of COVID-19. Due to the rarity of the condition and its lack of consistent symptomatology, splenic thromboembolism can be difficult to diagnose. Awareness of the condition and high clinical suspicion will help the clinician identify and manage the problem. Hemorrhage in patients with COVID-19 is uncommon in the hypercoagulable state that threatens thrombus formation in patients with COVID-19 infection. Despite prophylactic treatment with anticoagulation therapies, patients are more prone to developing clots. It is also well-known that therapeutic anticoagulation can place patients at a higher risk of bleeding. Thus, this unique population is at risk of developing both thrombotic and hemorrhagic events. We report a rare case of splenic infarction in a patient with confirmed COVID-19 infection despite prophylactic treatment with low-molecular-weight heparin which was found incidentally during workup for 2 other rare conditions: spontaneous rectus sheath hematoma and microhemorrhage or thrombus of the mesenteric vessels.\n\nKeywords\n\nCOVID-19\nCoronavirus\nSars-Cov-2\nSplenic infarction\nRectus sheath hematoma\n==== Body\nIntroduction\n\nIn December 2019, the first cases of COVID-19 caused by the novel severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) were reported in Wuhan, China. Since, there have been 95,612,831 confirmed cases of COVID-19, including 2,066,176 deaths, reported to the World Health Organization [1]. Multiple studies have been done to examine clinical and epidemiologic aspects of the disease [2], [3], [4], [5], [6], [7]. It is well established that COVID-19 has a myriad of presentations, ranging from asymptomatic to severe illness; the most severe cases being observed in the elderly and those with comorbid conditions [8,9]. COVID-19 predominantly attacks the pulmonary system, and causes acute lung injury and diffuse alveolar damage, but it also has been shown to affect multiple systems in patients with and without comorbidities. Literature suggests that infection with COVID-19 provokes arterial and venous thrombotic events [10], and could be contributing to the multisystem damage. In an autopsy study done by Falasca et al histopathological hallmarks of widespread vascular injury were found in the liver, kidney, bone marrow, and spleen [3]. The exact mechanism causing these findings is not yet understood, but it is theorized to be a distinct process unique to the Sars-Cov-2 virus [10]. The current postulations attribute the pathophysiological mechanisms of COVID-19-related hypercoagulopathy to systemic inflammatory response syndrome (SIRS) precipitated by cytokine storm or activation of the coagulation cascade due to cellular activation triggered by the virus, or both [11]. These pathologies are quantified by measurement of the D-dimer and fibrin degradation product levels which have been shown to correlate with the severity of disease and patient prognosis [7].\n\nInterestingly, the patient we present suffered one confirmed and one possible hemorrhagic event as a result of being anticoagulated to prevent further thrombus formation. 80 mg prophylactic LMWH was being administered twice daily, but the measured D-dimer remained markedly elevated. COVID-19-related hypercoagulopathy dictates that clinically-overt bleeding is uncommon in the setting of COVID-19 [12]. However, bleeding is a risk of therapeutic anticoagulation. Our patient spontaneously developed bilateral rectus sheath hematomas (RSH) as well as mesenteric vessel microhemorrhage. Rectus sheath hematoma is an uncommon cause of acute abdomen and can be benign, but in the setting of a patient receiving anticoagulation agents, can quickly progress to a life-threatening event. To date, there is only one other case reported of rectus sheath hematoma in a patient with COVID-19 [13]. Splenic infarct, mesenteric vessel infarct, and rectus sheath hematoma are rare in COVID-19 patients and providers should be aware of these potential complications. We present a case where all 3 are concurrently present in the same patient.\n\nNarrative\n\nA male in his 70s with a past medical history of hypertension, benign prostatic hypertrophy, gastroesophageal reflux disease, and depression presented to the emergency department with a chief complaint of worsening dyspnea. Seven days prior, the patient developed a dry cough with sore throat, and subsequently tested positive for COVID-19 which he had been managing at home on an outpatient basis. Since his COVID-19 diagnosis, his symptoms continued to worsen, and upon arrival to the emergency department he had dyspnea at rest, nonproductive cough, fevers, nausea, decreased appetite, and weakness. He was found to be in acute hypoxic respiratory failure with oxygen saturation (O2 SAT) of 68% on room air. His O2 SAT increased to 88%-92% on a 15% nonrebreather mask. He was also tachypneic at 22 breaths per minute and afebrile at 37.6 °C. Chest X-ray revealed new extensive patchy consolidative opacities about the lungs, favored to represent multifocal pneumonia. Laboratory evaluation was significant for elevated D-dimer, fibrinogen, and ferritin at 14.41 mg/L, 620 mg/dL and 1973 mg/mL, respectively. Additionally, lactic acid and white blood cell count were both elevated at 2.6 mmol/L and 14,900 cells/uL, respectively. Blood and urine cultures were negative. Treatment with enoxaparin, dexamethasone, and remdesivir was initiated as the patient was admitted to the intensive care unit for inpatient management of sepsis, viral pneumonia, severe COVID-19 infection, and acute hypoxic respiratory failure.\n\nOn hospital admission day 2, repeat D-dimer continued to be elevated at 5.56 ng/mL. A duplex ultrasound examination of the bilateral lower extremities was performed which revealed no evidence of intraluminal thrombus. Over the course of the next few days, the patient reported improved symptomatology and resolved dyspnea. His acute hypoxic respiratory failure was improving; he was reduced from 90% FiO2 on BiPAP to 45% FiO2, high-flow nasal cannula/BiPAP. His care was transferred from intensive care to intermediate care. His D-dimer continued to be elevated at 4.20, 3.78, and 4.58 ng/mL on hospital admission days 3, 4, and 5, respectively.\n\nOn the morning of hospital admission day 6, the patient continued to endorse improvement of symptoms, including no nausea, vomiting, fever, or chills, but he began to complain of constipation. To manage said constipation, the patient was given 30 mL oral lactulose for symptomatic relief.\n\nLater that evening, the patient had a large bowel movement. Subsequently, the patient experienced acute onset of severe left lower quadrant abdominal pain. CT scan of the abdomen and pelvis with intravenous contrast revealed several findings. A 4 cm well-demarcated area of nonenhancement within the anterior superior spleen (Fig. 1) consistent with acute infarct was seen. Additionally, there was inflammation within fat surrounding the mesenteric vessels in the left upper quadrant (Fig. 2) which was suspected to be microhemorrhage or thrombosis. There were also large hematomas within the bilateral rectus muscles (Fig. 3, Fig. 4, Fig. 5) beginning just above the umbilicus extending down to the pubis measuring 5.6 cm × 18 cm on the left (Fig. 4) and 7 cm × 4 cm × 10 cm on the right (Figs. 4 and 5). Contrast within the hematomas suggested active bleeding at the time of imaging (Fig. 3). Hemoglobin was tested and was found to have decreased from 13.7 g/dL at the time of admission to 10.7 g/dL shortly after the time of CT scan. The patient's full dose enoxaparin, which was initially started due to significantly elevated D-dimer, was subsequently discontinued due to the presence of actively bleeding hematomas, despite the presence of a splenic infarct. When measured earlier that morning, his D-dimer continued to be elevated at 3.90 mg/mL.Fig. 1 Axial CT image of the abdomen demonstrating a 4 cm well-demarcated area of nonenhancement within the spleen on abdominal CT with IV contrast.\n\nFig 1\n\nFig. 2 Coronal abdominal CT image of the abdomen/pelvis demonstrating edema and fat stranding surrounding the left upper quadrant mesenteric vessels (red oval). This was thought to be due to mesenteric vessel microthrombi or hemorrhage. A definitive diagnosis was never established.\n\nFig. 2\n\nFig. 3 Axial CT image of the abdomen/pelvis demonstrating large hematomas within the bilateral rectus muscles (red arrows). Contrast within the left hematoma (red arrowhead) suggests active bleeding at the time of imaging. Dense fluid within the pelvis and along intrapelvic fascial planes is consistent with hemorrhage.\n\nFig. 3\n\nFig. 4 Sagittal CT images of the abdomen/pelvis with length measurement of the right and left rectus sheath hematomas.\n\nFig 4\n\nFig. 5 Axial CT image of the abdomen/pelvis with diameter measurements of the right rectus sheath hematoma.\n\nFig 5\n\nAt this time, the decision was made to transfer the patient by helicopter to a tertiary care center for possible interventional radiology embolization as well as management of the large rectus hematomas. At this point, the patient had received 6 doses of IV remdesevir out of 10 as well as 6 days of IV dexamethasone. The patient was stable at the time of transfer.\n\nAfter 2 days of in-patient care at the tertiary center, it was determined that the active bleeding had stopped, and the hematomas remained stable. The patient's COVID-19 symptoms had also improved, and he was able to maintain adequate oxygenation levels while ambulating. The patient was discharged to complete his recovery at home. His recovery course has gone well without complications and as of 2 months following discharge he has been able to safely return to normal activity.\n\nDiscussion\n\nCOVID-19 infection is well known to cause hypercoagulability with pulmonary emboli being the most common presentation, splenic artery embolism and splenic infarction are rarely reported [14], [15], [16]. Splenic infarct is a rare cause of abdominal pain, often secondary to a hypercoagulable state [7]. COVID-19 hypercoagulability has been proposed to occur due to elevation of proinflammatory cytokines, including IL-6 [14], [15], [16]. Additionally, elevated D-dimer and fibrinogen degradation products are associated with poorer disease prognosis, potentially related to risk of disseminated intravascular coagulation [16]. Thus, treatment of the hypercoagulable state with antithrombotic agents is appropriate.\n\nIn a brief literature review, we identified 5 case studies consisting of 6 patients with involvement of splenic thromboembolism secondary to COVID-19 infection, including one case of atraumatic splenic rupture, and one case of hemoperitoneum [7,10,[17], [18], [19]. Additionally, multiple post-mortem autopsies have identified splenic involvement secondary to COVID-19 infection [2], [3], [4], [5], [6]. There have also been 2 cases of psoas hematoma [20,21]. As of yet, there has been only one prior report of rectus sheath hematoma secondary to COVID-19 coagulopathy [13].\n\nAbdominal scans are not routinely performed in COVID-19 patients as primary symptomatology involves the respiratory tract. Thus, only symptomatic splenic infarctions or those found incidentally on CT scans of the chest extending into the abdomen may be identified. Evidence of splenic involvement has been noted on autopsy in patients known to have had COVID-19 [2], [3], [4], [5], [6]. This suggests that the presence of splenic involvement due to COVID-19 hypercoagulability may be higher than reported. While most cases of splenic infarct may be asymptomatic, atraumatic splenic rupture can be a devastating complication and necessitates a high clinical index of suspicion for patients with abdominal pain and concurrent or prior COVID-19 infection.\n\nRectus sheath hematoma is an uncommon complication of anticoagulation therapy. Other risk factors include old age, female gender, history of abdominal surgery/trauma/injections, cancer, coagulopathies, and renal impairment [22]. We hypothesize that the development of RSH in our patient was due to shearing of the epigastric vessels caused by the combination of anticoagulation therapy and trauma caused by straining and/or coughing. Early diagnosis and intervention are key to improving patient mortality and morbidity. CT scan with IV contrast is considered the gold standard [22], for identification of bleeding and for differentiating between arterial and venous bleeds [13] In cases where conservative management is unsuccessful, or the patient presents with severe clinical criteria, CT angiography can be utilized to identify active bleeding and help in staging for interventional radiology treatment [23]. In patients who have contraindication to contrast, Doppler ultrasound and red cell scintigraphy can be used. The required treatment should be dictated by the severity of the RSH and status of the patient. Conservative therapy including a binder, rest and analgesics may be adequate in the stable patient, whereas patients with hemodynamic instability may require resuscitation using IV fluids and blood products. In patients who have been anticoagulated, intravascular coil embolization or rarely surgery to ligate the epigastric vessels, may be required to achieve adequate hemostatic control.\n\nConclusion\n\nSplenic infarction in COVID-19 infection is rarely reported and may go undetected if symptoms are vague or obscured by other ailments such as constipation, placing patients at risk of splenic rupture. Likewise, SRSH are also rare, a source for abdominal pain and a potentially serious condition especially in the anticoagulated patient, necessitating emergent treatment and the need to weigh the risks of hemorrhage versus thrombus when considering anticoagulation reversal. Despite their rarity, these conditions are treatable and should be considered in COVID-19 patients with abdominal pain and radiologists should monitor for thrombosis to aid in early diagnosis. Additionally, further research or reports on acute hemorrhage in COVID-19 patients receiving anticoagulation is recommended.\n\nLearning points\n\n• COVID-19 is well known to predispose patients for hypercoagulable events and complications, including thrombosis of unusual locations such as splenic artery branches.\n\n• Anticoagulant management of acute thrombotic events in COVID-19 is critical in prevention of morbidity and mortality.\n\n• Full anticoagulation predisposes patients to adverse effects related to bleeding and hemorrhage, including rectus sheath hematoma.\n\n• There are no clear guidelines on management of hemorrhagic events in patients on therapeutic anticoagulation as treatment of ischemia due to thrombus, the risks of hemorrhage versus thrombosis must be weighed.\n\n• Further research or reports on acute hemorrhage in COVID-19 patients receiving anticoagulation is recommended.\n\nPatient consent statement\n\nWe are using entirely anonymized images from CT scans. These do not contain any identifying marks and are not accompanied by text that might identify the individual concerned.\n\nCredit author statement\n\nJennifer Dennison: Writing-Original draft preparation and Editing, Investigation, Visualization: Samuel Carlson: Writing-Original draft preparation and Editing: Shannon Faehling: Writing-Original draft preparation and Editing: Hannah Phelan: Writing-Review and Editing: Muhammad Tariq: Writing-Review and Editing Ateeq Mubarik: Writing-Review and Editing, Supervision.\n\nInstitutional review board statement: Institutional Review Board approval was not necessary for our report.\n\nFunding: None. The authors did not receive grant or outside funding in support of their research or preparation of this manuscript. They did not receive payment or any benefits from commercial entities.Declaration of competing interest\n\nAll authors declare that they have no competing interests.\n==== Refs\nReferences\n\n1 WHO Coronavirus disease (COVID-19) Dashboard, World Health Organization Web site. https://covid19.who.int/. Published 2020. Accessed January 21, 2021.\n2 Bradley BT Maioli H Johnston R Chaudhry I Fink SL Xu H Histopathology and ultrastructural findings of fatal COVID-19 infections in Washington State: a case series Lancet North Am Ed 396 10247 2020 320 332 10.1093/infdis/jiaa578\n3 Falasca L Nardacci R Colombo D Lalle E Caro AD Nicastri E Postmortem findings in Italian patients with COVID-19: a descriptive full autopsy study of cases with and without comorbidities J Infect Dis 2020 https://www.thelancet.com/pdfs/journals/lancet/PIIS0140-6736(20)31305-2.pdf. Accessed January 10, 2021. doi: 10.1093/infdis/jiaa578\n4 Buja L.M. Wolf D.W. Zhao B. Akkanti B. McDonal M. Lelenwa L. The emerging spectrum of cardiopulmonary pathology of the coronavirus disease 2019 (COVID-19): report of 3 autopsies from Houston, Texas, and review of autopsy findings from other United States cities Cardiovasc Pathol 2020 10.1016/j.carpath.2020 https://www.sciencedirect.com/science/article/pii/S1054880720300375. Accessed January 10, 2021.\n5 Xu X Chang XN Pan HX Su H Huang B Yang M [Pathological changes of the spleen in ten patients with coronavirus disease 2019(COVID-19) by postmortem needle autopsy] Zhonghua Bing Li Xue Za Zhi 49 6 2020 576 582 10.3760/cma.j.cn112151-20200401-00278 Chinese. 2020 Jun 8 32340089\n6 Duarte-Neto A.N. de Almeida Monteiro R.A. da Silva L.F.F. Malheirosa D.M.C. de Oliveira E.P. Filho J.T. Pulmonary and systemic involvement of COVID-19 assessed by ultrasound-guided minimally invasive autopsy Histopathology 77 2 2020 186 197 10.1111/his.14160 Aug 32443177\n7 Agha OQ Berryman R. Acute splenic artery thrombosis and infarction associated with COVID-19 disease Case Rep Crit Care 2020 2020 1 4 10.1155/2020/8880143\n8 Chen N Zhou M Dong X Qu J Gong F Han Y Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study Lancet 395 2020 507 513 10.1016/S0140-6736(20)30211-7 32007143\n9 Chen G Wu D Guo W Cao Y Huang D Wang H Clinical and immunological features of severe and moderate coronavirus disease-2019 J Clin Invest 130 2020 2620 2629 32217835\n10 Pessoa M.S.L. Lima C.F.C. Pimentel A.C.F. Costa Júnior J.C.G. Holanda J.L.B Multisystemic infarctions in COVID-19: focus on the spleen Eur J Case Rep Intern Med 7 7 2020 10.12890/2020_001747 001747. https://europepmc.org/article/med/32665933. Accessed January 10, 2021. DOI:\n11 Oudkerk M Büller HR Kuijpers D van Es N Oudkerk SF McLoud TC Diagnosis, prevention, and treatment of thromboembolic complications in COVID-19: report of the National Institute for Public Health of the Netherlands Radiology 2020 10.1148/radiol.2020201629 https://www-ncbi-nlm-nih-gov.proxy.lib.mcw.edu/pmc/articles/PMC7233406/ Accessed January 10, 2021. DOI:\n12 Bikdeli B Madhavan MV Jimenez D Chuich T Dreyfus I Driggin E COVID-19 and thrombotic or thromboembolic disease: implications for prevention, antithrombotic therapy, and follow-up J Am Coll Cardiol 2020 10.1016/j.jacc.2020.04.031 Accessed January 10, 2021.\n13 Bakirov I. Bakirova G. Albalawi Y. Asiri A.Y. Faqihi F. Bairli I. Left Inferior epigastric artery injury in COVID-19 patient. Case report and literature review Int J Surg Case Rep 76 2020 415 420 DOI: 10.1016j.ijscr.2020.09.198 33042768\n14 Yin S. Huang M. Li D. Tang N. Difference of coagulation features between severe pneumonia induced by SARS-CoV2 and non-SARS-CoV2 J Thromb Thrombolysis 2020 3 6 10.1007/s11239-020-02105-8\n15 Ranucci M. Ballotta A. Di Dedda U. Bayshnikova E Dei Poli M Resta M The procoagulant pattern of patients with COVID-19 acute respiratory distress syndrome J Thromb Haemost 18 7 2020 1747 1751 10.1111/jth.14854 32302448\n16 Han H. Yang L. Liu R. Lui F Wu K Li J Prominent changes in blood coagulation of patients with SARS-CoV-2 infection Clin Chem Lab Med 58 7 2020 1116 1120 10.1515/cclm-2020-0188 32172226\n17 Shaukat I Khan R Diwakar L Kemp T Bodasing N. Atraumatic splenic rupture due to covid-19 infection Clin Infect Pract 2020 10.1016/j.clinpr.2020.100042 100042. https://pubmed.ncbi.nlm.nih.gov/32999997/. Accessed January 10, 2021. DOI:\n18 Hossri S. Shadi M. Hamarsha Z. Schneider R. El-Sayegh D. Clinically significant anticardiolipin antibodies associated with COVID-19 J Crit Care 2020 10.1016/j.jcrc.2020.05.017 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7256550/ Accessed January 10, 2021.\n19 Karki S. Rawal S.B. Malla S. Rayamajhi J. Thapa B.B. A case report on spontaneous hemoperitoneum in COVID-19 patient Int J Surg Case Rep 74 2020 211 213 10.1016/j.ijscr.2020.09.078\n20 Patel I. Akoluk A. Douedi S. Upadhyaya V. Mazahir U. Costanzo E. Life-threatening psoas hematoma due to retroperitoneal hemorrhage in a COVID-19 patient on enoxaparin treated with arterial embolization: a case report J Clin Med Res 12 7 2020 458 461 10.14740/jcomr4256 32655742\n21 Guo S.H. Zhu S.M. Yao Y.X. Giant retroperitoneal hematoma during extracorporeal membrane oxygenation in a patient with coronavirus disease-2019 pneumonia J Cardiothorac Vasc Anesth 34 10 Oct 2020 2839 2840 10.1053/j/jvca.2020.05.039 32600997\n22 Sheth HS Kumar R DiNella J Janov C Kaldas H Smith RE. Evaluation of risk factors for rectus sheath hematoma Clin Appl Thromb Hemost 22 3 Apr 2016 292 296 10.1177/1076029614553024 25294636\n23 Pierro A Cilla S Modugno P Centritto EM De Filippo CM Sallustio G. Spontaneous rectus sheath hematoma: the utility of CT angiography Radiol Case Rep 13 2 2018 328 332 10.1016/j.radcr.2018.01.016 29904466\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "1930-0433",
"issue": "16(5)",
"journal": "Radiology case reports",
"keywords": "COVID-19; Coronavirus; Rectus sheath hematoma; Sars-Cov-2; Splenic infarction",
"medline_ta": "Radiol Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101467888",
"other_id": null,
"pages": "999-1004",
"pmc": null,
"pmid": "33619439",
"pubdate": "2021-05",
"publication_types": "D002363:Case Reports",
"references": "32217835;32682491;29904466;32512349;32302448;32665933;25294636;32246317;32914853;32007143;33042768;32434133;32959008;32600997;32324101;32999997;32311448;32655742;32340089;32934849;32443177;32172226",
"title": "Splenic infarction and spontaneous rectus sheath hematomas in COVID-19 patient.",
"title_normalized": "splenic infarction and spontaneous rectus sheath hematomas in covid 19 patient"
} | [
{
"companynumb": "US-APOTEX-2021AP009850",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ENOXAPARIN"
},
"drugadditional": "1",
... |
{
"abstract": "BACKGROUND\nTreatment of HIV infection in adolescents is challenging due to long duration of therapy and poor adherence. Recently, the integrase strand transfer inhibitor dolutegravir (DTG) has been approved for the use in adolescents with HIV, but evidence in clinical practice is very limited.\n\n\nMETHODS\nWe describe six cases of HIV-infected children/adolescents successfully treated with DTG-based regimen. Data relative to children/adolescents managed at the Referral Center for Pediatric HIV/AIDS of the University of Naples were reviewed. Patients were tested before introduction of DTG, after 1 month and every 3 months in the first 2 years to assess virologic and immunological response, tolerance and development of side effects. Families were asked to report any suspected adverse events.\n\n\nRESULTS\nSix patients (2 male, median age 17 years, range 12-18) were started on DTG-based anti-retroviral regimen due to low adherence to anti-retroviral treatment (ART), multiple drug resistance mutations, or development of ART-related side effects. Within 4-8 weeks after DTG treatment onset, a complete viral suppression and a concomitant increase of CD4+ cell count was observed. Four patients showed a persistent suppression after 2 years of follow-up, and 2 patients at about 1 year. One month after the introduction of DTG, the patient enrolled because of severe dyslipidaemia and hyper-transaminasemia showed a complete normalization of laboratory values. During follow-up (median 24 months, range 9-24) no adverse events were reported and most patients demonstrated a good adherence to treatment.\n\n\nCONCLUSIONS\nDTG-based treatments demonstrated efficacy and good safety profile in adolescents. All patients demonstrated a rapid virologic and immunological response within 4-8 weeks, with good adherence and absence of side effects.",
"affiliations": "Department of Translational Medical Science - Section of Pediatrics, University of Naples Federico II, Naples, Italy.;Department of Translational Medical Science - Section of Pediatrics, University of Naples Federico II, Naples, Italy.;Department of Translational Medical Science - Section of Pediatrics, University of Naples Federico II, Naples, Italy.;Unit of Viral Diseases, including AIDS DH, AOU Federico II of Naples, Naples, Italy.;Unit of Viral Diseases, including AIDS DH, AOU Federico II of Naples, Naples, Italy.;Unit of Viral Diseases, including AIDS DH, AOU Federico II of Naples, Naples, Italy.;Department of Translational Medical Science - Section of Pediatrics, University of Naples Federico II, Naples, Italy. alfguari@unina.it.",
"authors": "Bruzzese|Eugenia|E|;Lo Vecchio|Andrea|A|;Smarrazzo|Andrea|A|;Tambaro|Orsola|O|;Palmiero|Giulia|G|;Bonadies|Giovanni|G|;Guarino|Alfredo|A|",
"chemical_list": "D004279:DNA, Viral; D019428:HIV Integrase Inhibitors; D006575:Heterocyclic Compounds, 3-Ring; D010078:Oxazines; D010879:Piperazines; D011728:Pyridones; C562325:dolutegravir",
"country": "England",
"delete": false,
"doi": "10.1186/s13052-018-0469-x",
"fulltext": "\n==== Front\nItal J PediatrItal J PediatrItalian Journal of Pediatrics1824-7288BioMed Central London 46910.1186/s13052-018-0469-xResearchDolutegravir-based anti-retroviral therapy is effective and safe in HIV–infected paediatric patients Bruzzese Eugenia eugbruzz@unina.it 1Lo Vecchio Andrea andrea.lovecchio@unina.it 1Smarrazzo Andrea and.smarrazzo@gmail.com 1Tambaro Orsola tamborso@libero.it 2Palmiero Giulia palmiero.giulia@virgilio.it 2Bonadies Giovanni gbonadies2@alice.it 2Guarino Alfredo 0039-081-7464232alfguari@unina.it 11 0000 0001 0790 385Xgrid.4691.aDepartment of Translational Medical Science - Section of Pediatrics, University of Naples Federico II, Naples, Italy 2 Unit of Viral Diseases, including AIDS DH, AOU Federico II of Naples, Naples, Italy 20 3 2018 20 3 2018 2018 44 3728 9 2017 23 2 2018 © The Author(s). 2018Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nTreatment of HIV infection in adolescents is challenging due to long duration of therapy and poor adherence. Recently, the integrase strand transfer inhibitor dolutegravir (DTG) has been approved for the use in adolescents with HIV, but evidence in clinical practice is very limited.\n\nMethods\nWe describe six cases of HIV-infected children/adolescents successfully treated with DTG-based regimen. Data relative to children/adolescents managed at the Referral Center for Pediatric HIV/AIDS of the University of Naples were reviewed. Patients were tested before introduction of DTG, after 1 month and every 3 months in the first 2 years to assess virologic and immunological response, tolerance and development of side effects. Families were asked to report any suspected adverse events.\n\nResults\nSix patients (2 male, median age 17 years, range 12–18) were started on DTG-based anti-retroviral regimen due to low adherence to anti-retroviral treatment (ART), multiple drug resistance mutations, or development of ART-related side effects. Within 4–8 weeks after DTG treatment onset, a complete viral suppression and a concomitant increase of CD4+ cell count was observed. Four patients showed a persistent suppression after 2 years of follow-up, and 2 patients at about 1 year. One month after the introduction of DTG, the patient enrolled because of severe dyslipidaemia and hyper-transaminasemia showed a complete normalization of laboratory values. During follow-up (median 24 months, range 9–24) no adverse events were reported and most patients demonstrated a good adherence to treatment.\n\nConclusions\nDTG-based treatments demonstrated efficacy and good safety profile in adolescents. All patients demonstrated a rapid virologic and immunological response within 4–8 weeks, with good adherence and absence of side effects.\n\nKeywords\nHIVDolutegravirIntegrase strand transfer inhibitorAdolescentChildrenComplianceSide effectsissue-copyright-statement© The Author(s) 2018\n==== Body\nBackground\nThe treatment of adolescents with vertically-acquired HIV infection is particularly challenging [1] due to social and clinical factors. Poor adherence to long-term anti-retroviral therapy (ART), and consequent treatment failure with multiple therapy shifts, have been reported in adolescents with HIV infection. This condition could be related to multiple factors, including: the development of side-effects, the discovery of sexuality and acceptance of HIV-related “stigma”, the limited awareness of infection state and a general misinformation about HIV infection, often associated with socio-economically deprived communities [2, 3].\n\nSeveral studies have identified both pill burden and lifestyle issues (i.e., not having medications on hand when away from home, changes in schedule) as major barriers to effective adherence. Choosing the simplest regimen possible, reducing dose frequency and pill number and selecting a regimen that fits well to daily patients and family activities, are important strategies to achieve.\n\nRecently, the integrase strand transfer inhibitors (INSTIs) have been approved as preferred regimens for treating children and adolescents with HIV infection [4, 5]. Dolutegravir (DTG) has interesting pharmacokinetic/pharmacodynamic features such as prolonged intracellular half-life, absence of negative interactions with other anti-retroviral drugs and a potent activity against HIV-1 strains that are resistant to other INSTIs [6]. Its use is currently approved for treatment of HIV-infected adolescents (> 12 years old and/or above 40 kg of weight) [4, 5]. The approval was supported by data from a study of 23 treatment-experienced but INSTI-naive children and adolescents [7]. The drug has a very favourable safety profile and can be administered once a day to INSTI-naive patients [8]. These characteristics made DTG highly suitable for adolescents infected with HIV strains resistant to other anti-retroviral drugs.\n\nRecently DTG, in combination with other anti-retroviral drugs, was effective in dramatically reducing viral replication without side effects in two patients, an adult [9] and a child [10], both with multidrug genetic resistance profile, and has been used to prevent mother-to-child HIV transmission [11].\n\nMethods\nWe performed a retrospective review of adolescents with HIV infection treated with DTG at the Regional Referral Center for Pediatric HIV of the University of Naples Federico II in collaboration with consultants from the Unit of Viral Diseases. Clinical and laboratory data were retrieved through manual chart reviewing. All patients aged ≤ 18 years old were tested before ART switch (T0), at 1 month (T1), and successively every 3 months after introduction of new ART regimen to assess virologic and immunological response and the potential development of side-effects.\n\nViral load was evaluated by using a real time-PCR (Abbott, with cut off sensitivity 40 copies/ml and dynamic range 40–1.000.000 copies/ml). Caregivers of children were required to report any suspect adverse event to the Reference Center after ART switch. Other potential side effects were specifically looked for during follow-up visits.\n\nDTG was prescribed according to recent guidelines for the management of HIV infection in children and adolescent [4, 5].\n\nNo ethical committee opinion was requested because the use of this drug in adolescents is suggested by international guidelines. All procedures performed in this study were in accordance with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. An informed consent for sharing anonymous patient data was obtained from families and/or caregivers. All drugs were provided by the University Hospital Pharmacy and paid by the National Health Care System according to Italian legislation. No direct contact with drug companies was taken.\n\nResults\nDolutegravir-based therapy onset\nSince January 2015 a DTG-based ART was prescribed to 6 paediatric patients (2 males, median age 17 years, range 12–18) due to previous treatment failure, development of side effects, presence of multiple viral resistance or low adherence to ART (Tables 1 and 2). An additional patient receiving a DTG-based regimen was excluded from the present study due to the lack of data after the first month of prescription (lost to follow-up).Table 1 Description of the patients involved in the study\n\nPatient\tGender\tAge\tCountry of origin\tCDC class\tPrevious ART\nregimen\tNew ART\nregimen\tReason for ART switch\tFollow-up\n(months)\t\n1\tF\t18\tItaly\t3\tLPV/r + TDF/FTC\tDTG +\nTDF/FTC\tSide effects\nLow adherence\t24\t\n2\tF\t17\tNigeria\t3\tLPV/r + TDF/FTC\tDTG +\nTDF/FTC\tSide effects\nLow adherence\t24\t\n3\tM\t12\tItaly\t3\tLPV/r +\nABC + 3TC\tDTG/ABC/3TC\tSide effects\t24\t\n4\tM\t16\tItaly\t1\tLPV/r + TDF/FTC\tDTG + TDF/FTC\tSide effects\nLow adherence\t24\t\n5\tF\t18\tNigeria\t3\tFPV + TDF/FTC + ATV + RTV\tDTG + TDF/FTC\tART simplification\t12\t\n6\tF\t17\tUkraine\t3\tEFV + FTC + TDF\tDTG/ABC/3TC\tSide effects\nLow adherence\t9\t\nTable 2 Mutations and resistance pattern\n\nPatient\tReverse transcriptase\tProtease\t\n\tMutations\tResistance\tMutations\tResistance\t\n1\tM41 L, V75IMV, F77 L, T215D, E44A/D, V118I, D67N, M184 V\t3TC (LR), ABC (IR), ZDV (HR), D4T (HR), DDI (HR), FTC (LR), TDF (IR), EFV (S), ETR (S), NVP (S), RPV (S)\tA71AV, N88DN, D30N\tLPV (S), ATV (LR), DRV (S), IDV (S), FPV (S), NFV (IR), SQV (LR), TPV (S)\t\n2\tK103 N, P225H, M184 V\t3TC (HR), ABC (LR), ZDV (S), D4T (S), DDI (LR), FTC (HR), TDF (S), EFV (HR), ETR (S), NVP (HR), RPV (S)\tK20I, A71AT, L89 V, M36I\tLPV (S), ATV (S), DRV (S), IDV (S), FPV (S), NFV (LR), SQV (S), TPV (S)\t\n3\tNot available\tNot available\tNot available\tNot available\t\n4\tM184 V, G190A\t3TC (HR), ABC (S), ZDV (S), D4T (S), DDI (S), FTC (HR), TDF (S), EFV (IR), NVP (HR)\tL10 V, L63P\tLPV (S), ATV (S), DRV (S), IDV (S), FPV (S), NFV (S), SQV (S), TPV (S)\t\n5\tD67N, K101P, K103 N/S, M184 V, G190A, T215Y\t3TC (HR), ABC (IR), ZDV (IR), D4T (IR), DDI (S), FTC (HR), TDF (S), EFV (HR), NVP (HR)\tL10F, I13V, K20I, M36I, M46I, Q58E, L63P, H69K, L76 V, I84V, L89I\tLPV (IR), ATV (HR), DRV (S), IDV (IR), FPV (HR), NFV (HR), SQV (IR), TPV (IR)\t\n6\tNot available\tNot available\tNot available\tNot available\t\n\n\nAll but one patients were classified as stage 3 according to the 2014 Center for Disease Control and Prevention (CDC) Classification for paediatric HIV/AIDS [12] and none of them presented AIDS-defining conditions.\n\nThe clinical management of patient 1 and patient 2, both female in stage 3, was complicated by missed medical visits, a sustained low compliance to ART and the development of multiple genetic resistance mutations. They received various anti-retroviral drugs combined in different regimens: zidovudine (ZDV), stavudine (D4T), lamivudine (3TC), efavirenz (EFV), nelfinavir (NFV), lopinavir/ritonavir (LPV/r), tenofovir (TDF), emtricitabine (FTC).\n\nThe last ART regimen was LPV/r and TDF/FTC, which was poorly tolerated due to persistent gastrointestinal side effects in both patients. Particularly, although other alternative regimens including PI were considered, patient 1 experienced severe and frequent side effects related to PI, with recurrent abdominal and epigastric pain, nausea, episodes of vomiting and anorexia. Because of the persistence of virologic failure associated with a decrease of CD4+ cells, on January 2015, a once-daily regimen with DTG and TDF/FTC was started with the aim of increasing compliance and immunological and virologic response.\n\nPatient 3 was a 12-year-old male admitted to our Department for acute pancreatitis whose mother died 8 years before due to AIDS-related meningitis, and he never underwent testing because of parental refusal. At the time of HIV diagnosis, he presented with 190 CD4+ cells/μl (8%) with a viral load of 19.800 copies/ml. Since the patient was naïve to anti-retroviral therapy, we started anti-retroviral treatment with LPV/r and ABC plus 3TC, according to Pediatric Guidelines for HIV infection [5]. After 4 weeks of treatment a good virologic response was obtained with a substantial reduction of HIV viral load (from 19.800 to 191 copies/ml, 2 logs in 4 weeks). However, after one month of LPV/r-based ART, the patient showed a sustained increase of total cholesterol (749 mg/dl), LDL cholesterol (513 mg/dl) and serum triglycerides (345 mg/dl), with concomitant reduction of HDL cholesterol (5 mg/dl). Dyslipidaemia was associated with hyper-transaminasemia (AST and ALT > 5 times normal values) and an increase in alkaline phosphatase (1774 mg/dl). Considering child age, the expected long duration of therapy and the elevated risk of persistent hypercholesterolemia and hyper-triglyceridemia associated to protease inhibitors-based regimens, the child was switched to a DTG-based regimen (DTG + ABC + 3TC) (Table 1).\n\nPatient 4 was a 16-year-old Italian male who was on LPV/r + TDF/FTC in the last 4 years of follow-up, and subsequently developed chronic (not infectious) diarrhoea as side effect of ART. This was responsible for a progressive decrease in treatment adherence and he was switched to DTG-based regimen.\n\nPatient 5 was an 18-year-old female treated with FPV + TDF/FTC + ATV + RTV due to a complex mutation profile. A DTG-based regimen was introduced in order to simplify the ART.\n\nPatient 6 was a 17-year-old female from Ukraine treated with EFV + FTC + TDF. In order to improve compliance, a DTG-based regimen was started.\n\nViro-immunological response\nPatients 1, 3 and 4 experienced full viral suppression (HIV viral load < 40 copies/ml) within the first 4 weeks. Patient 2 demonstrated a significative reduction (2 logs) after 4 weeks and a complete viral suppression after 8 weeks of treatment. Patients 5 and 6, who already had undetectable viral load under previous ART regimen, maintained a suppressed HIV load after treatment switch (Fig. 1 a).Fig. 1 a Effects of dolutegravir-based regimen on viral load after the introduction of DTG-based regimen in 7 HIV-infected adolescents. b Effects of dolutegravir-based regimen on CD4+ cell percentage after the introduction of DTG-based regimen in 7 HIV-infected adolescents\n\n\n\nDuring follow-up, two patients (1 and 2), discontinued ART and required unscheduled clinical visits that showed viral load peaks of 1779 copies/ml (patient 1) and 4100 copies/ml (patient 2). After discussions with both patients regarding the importance of adherence and the risks of acquiring further drug resistance mutations, we observed virologic suppression at subsequent visits, resulting from improved adherence to ART and rapid response to DTG-based ART.\n\nA progressive increase in CD4+ cells was observed in all but one patients (Fig. 1 b).\n\nPatient 3, who showed a major reduction in viral load during LPV/r-based regimen, demonstrated full viral suppression (HIV viral load < 40 copies/ml) and an increase in CD4+ cells after three weeks of DTG-based treatment (Fig. 1 a/b).\n\nPatient 5, who was started on DTG-based regimen with a high percentage of CD4+, had a slight reduction of CD4+ at first control (from 44% to 36% with no significant reduction in absolute CD4+ lymphocyte count) and then remained substantially stable.\n\nFollow-up and safety\nThe 6 patients were followed during the last two years with a median follow-up of 24 months (range 9–24 months). All patients are still in follow-up at our institution and DTG-based treatment is still ongoing. Neither side effects or treatment failure were observed during follow-up visits. Two patients reported a transient reduction in ART adherence.\n\nPatient 3, who received DTG-based regimen due to the presence of serious side effects, had a complete normalization of total (142 mg/dl) and LDL (80 mg/dl) cholesterol, triglycerides (74 mg/dl) concentrations and liver markers (AST 36 U/ml, ALT 36 U/ml, ALP 263 mg/dl) within one month after ART switch.\n\nDiscussion\nDespite excellent efficacy, safety and tolerability in adults, the effects of DTG in children and adolescents are poorly documented. DTG is approved for patients ≥ 12 years of age (recently anticipated at 6 years) and the IMPAACT study showed that 70% of adolescents (12 to < 18 years old) treated with DTG achieve a complete viral suppression [8]. Data from literature demonstrated that DTG is useful as a rescue drug in the setting of patients with multi-drug resistance [13].\n\nIn our experience, two patients who in the last five years never achieved a viral suppression with several ART regimens, showed a rapid and good response to DTG-based regimen. Both experienced a viral suppression and increase of CD4+ cells, although their adherence to ART was not optimal as demonstrated by a temporary viremia relapse. As reported in adult patients [14], due to its high genetic barrier, DTG may reduce the risk of developing viral resistance also in poorly compliant adolescents.\n\nPatient 3, the only one receiving DTG-based regimen for serious ART-related side effects, reached a complete normalization of dyslipidaemia and hyper-transaminasemia, in association with a complete viral suppression, as previously reported in a large adult population [15]. The dramatic response of both viral load and CD4+ count, in association with the normalization of lipid profile, suggests that DTG-base regimen is a good therapeutic option also in naïve HIV-infected adolescents.\n\nOne limitation of this study is that drug resistance profiles were available for 4 of 6 patients. In adult patients, DTG monotherapy is associated with an increased risk of virological failure and DTG resistance [16]. Further, while dual therapy with DTG + 3TC is promising among adults, this study only included patients who were virologically suppressed at the time of switch [17]. Finally, while DTG-based ART is superior to LPV/r-based ART as a second-line therapy in the DAWNING trial, patients in this cohort were required to have at least 1 fully active NRTI [18]. Thus, for children who have high viral loads at the time of switch in combination with extensive drug resistance, the efficacy of DTG-based ART remains unknown. In this cohort of children, 4 of 6 patients had high viral loads at switch and at least one (patient 1) did not have any fully susceptible NRTI (although in addition to TAMs, M184 V was present which increases susceptibility to TDF). Thus in applying these findings to other cohorts of children, one must carefully consider the baseline NRTI resistance profile, as this may impact the long-term success of this regimen.\n\nConclusions\nIn conclusion, this small size series indicates that children and adolescents may benefit from DTG- based regimen achieving a complete control of HIV infection with no side effects. The major advantages of DTG-based regimen are the possibility to reduce the pill burden to two pills once a day, the increasing treatment adherence and the low or absent risk of additional drug resistance mutations. Good safety profile was observed up to a maximum of 24 months in our patients.\n\nAbbreviation\n3TCLamivudine\n\nABCAbacavir\n\nAIDSAcquired immunodeficiency syndrome\n\nARTAnti-retroviral therapy\n\nATVAtazanavir\n\nCDCCenter for Disease Control and Prevention\n\nD4TStavudine\n\nDDIDidanosine\n\nDRVDarunavir\n\nDTGDolutegravir\n\nETREtravirine\n\nFPVFosamprenavir\n\nFTCEmtricitabine\n\nHIVHuman Immunodeficiency Virus\n\nHRHigh resistance\n\nIDVIndinavir\n\nINSTIsIntegrase strand transfer inhibitors\n\nIRIntermediate resistance\n\nLPVLopinavir\n\nLPV/rLopinavir/ritonavir\n\nLRLow resistance\n\nNFVNelfinavir\n\nNVPNevirapine\n\nRPVRilpivirine\n\nRTVRitonavir\n\nSSensible\n\nSQVSaquinavir\n\nTDFTenofovir\n\nEFV\n\nEfavirenz\n\nTPVTipranavir\n\nZDVZidovudine\n\nAcknowledgements\nThis paper is dedicated to the memory of prof. Bonadies, abruptly deceased before the final submission of this work.\n\nFunding\nNo funding has been received for this study; no honorarium, grant or other form of payment was given to anyone to produce the manuscript.\n\nAvailability of data and materials\nThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\n\nAuthors’ contributions\nEB, ALV, AG and GB contributed to the conception and design of the study and acquisition of data; AS, ALV, EB collected and analysed all the data and wrote the manuscript; GP and OT helped to draft and critically revised the manuscript. All authors have read and approved the final manuscript.\n\nEthics approval and consent to participate\nNo ethical committee opinion was requested because the use of this drug in adolescents is suggested by international guidelines. All procedures performed in this study were in accordance with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. An informed consent for the sharing of anonymous patient data was obtained from families and/or caregivers.\n\nConsent for publication\nnot applicable.\n\nCompeting interests\nThe authors declare that they have no competing interests to declare.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Garvie PA Wilkins ML Young JC Medication adherence in adolescents with behaviorally-acquired HIV: evidence for using a multimethod assessment protocol J Adolesc Health 2010 47 504 511 10.1016/j.jadohealth.2010.03.013 20970086 \n2. Giacomet V Albano F Starace F de Franciscis A Giaquinto C Gattinara GC Adherence to antiretroviral therapy and its determinants in children with human immunodeficiency virus infection: a multicentre, national study Acta Paediatr 2003 92 1398 1340 10.1111/j.1651-2227.2003.tb00822.x 14971789 \n3. Albano F Giacomet V De Marco G Bruzzese E Starace F Guarino A Adherence to antiretroviral therapy in children: a comparative evaluation of caregiver reports and physician judgement AIDS Care 2007 19 764 766 10.1080/09540120600909406 17573596 \n4. Guidelines for the use of antiretroviral agents in pediatric HIV infection (2016), http://aidsinfo.nih.gov/guidelines. Accessed 3 Mar 2017.\n5. Guidelines for the use of antiretroviral agents in HIV-1-infected adults and adolescents (2016), http://aidsinfo.nih.gov/guidelines. Accessed 3 Mar 2017.\n6. Rathbun RC Lockhart SM Miller MM Liedtke MD Dolutegravir, a second-generation integrase inhibitor for the treatment of HIV-1 infection Ann Pharmacother 2014 48 395 403 10.1177/1060028013513558 24259658 \n7. Viani RM Alvero C Fenton T Acosta EP Hazra R Townley E Safety, pharmacokinetics and efficacy of dolutegravir in treatment-experienced HIV-1 infected adolescents: 48-week results from IMPAACT P1093 Pediatr Infect Dis J 2015 34 11 1207 1213 10.1097/INF.0000000000000848 26244832 \n8. PL MC Dolutegravir: a review of its use in the management of HIV-1 infection in adolescents and adults Drugs 2014 74 1241 1252 10.1007/s40265-014-0256-y 25005775 \n9. Bonadies G Maraolo AE Tambaro O Palmiero G Di Filippo G Orlando R Dolutegravir: successful experience in a challenging patient AIDS 2015 29 1269 1271 10.1097/QAD.0000000000000696 26035327 \n10. Wagner N Wyler-Lazarevic CA Yerly S Samer C Peytavin G Posfay-Barbe KM Dolutegravir-based antiretroviral therapy in a severely overweight child with a multidrug-resistant human immunodeficiency virus infection. A case report and review New Microbes New Infect 2015 6 1 4 10.1016/j.nmni.2015.02.003 26082840 \n11. Pinnetti C Tintoni M Ammassari A Tamburrini E Bernardi S Liuzzi G Successful prevention of HIV mother-to-child transmission with dolutegravir-based combination antiretroviral therapy in a vertically infected pregnant woman with multiclass highly drug-resistant HIV-1 AIDS 2015 29 18 2534 2537 10.1097/QAD.0000000000000888 26372490 \n12. Centers for Disease Control and Prevention (CDC). Revised surveillance case definition for HIV infection — United States, vol. Vol. 63 / No. 3: MMWR 2014. Recommendations and reports; 2014.\n13. Castagna A Maggiolo F Penco G Wright D Mills A Grossberg R Viking-3 study group. Dolutegravir in antiretroviral experienced patients J Infect Dis 2014 210 354 362 10.1093/infdis/jiu051 24446523 \n14. Wainberg MA Mesple’de T, Raffi F. What if HIV were unable to develop resistance against a new therapeutic agent? BMC Med 2013 11 249 10.1186/1741-7015-11-249 24267867 \n15. Clotet B Feinberg J van Lunzen J Khuong-Josses MA Antinori A Dumitru I ING114915 study team. Once-daily dolutegravir versus darunavir plus ritonavir in antiretroviral-naive adults with HIV-1 infection (FLAMINGO): 48-week results from the randomised open-label phase 3b study Lancet 2014 383 2222 2231 10.1016/S0140-6736(14)60084-2 24698485 \n16. Wijting I Rokx C Boucher C van Kampen J Pas S de Vries-Sluijs T Dolutegravir as maintenance monotherapy for HIV (DOMONO): a phase 2, randomised non-inferiority trial Lancet HIV 2017 4 12 e547 e554 10.1016/S2352-3018(17)30152-2 29107562 \n17. Joly V, Burdet C, Landman R, Raffi F, Katlama C, Cabié A et al. Promising results of dolutegravir + lamivudine in ANRS 167 LAMIDOL trial. presented at: conference on retroviruses and opportunistic infections (CROI 2017); 13–16 February, 2017; Seattle, WA, USA. Abstract 458.\n18. M. Aboud, R. Kaplan, J. Lombaard, F. Zhang, J. Hidalgo, E. Mamedova et al. Superior efficacy of dolutegravir (DTG) plus 2 nucleoside reverse transcriptase inhibitors (NRTIs) compared with lopinavir/ritonavir (LPV/RTV) plus 2 NRTIs in second-line treatment: interim data from the DAWNING study. Presented at: 9th IAS Conference on HIV Science (IAS 2017); 23–26 July, 2017; Paris, France. Abstract TUAB0105LB.\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1720-8424",
"issue": "44(1)",
"journal": "Italian journal of pediatrics",
"keywords": "Adolescent; Children; Compliance; Dolutegravir; HIV; Integrase strand transfer inhibitor; Side effects",
"medline_ta": "Ital J Pediatr",
"mesh_terms": "D000293:Adolescent; D002648:Child; D004279:DNA, Viral; D005260:Female; D005500:Follow-Up Studies; D006678:HIV; D015658:HIV Infections; D019428:HIV Integrase Inhibitors; D006575:Heterocyclic Compounds, 3-Ring; D006801:Humans; D008297:Male; D010078:Oxazines; D010879:Piperazines; D011728:Pyridones; D060888:Real-Time Polymerase Chain Reaction; D012189:Retrospective Studies; D016896:Treatment Outcome; D019562:Viral Load",
"nlm_unique_id": "101510759",
"other_id": null,
"pages": "37",
"pmc": null,
"pmid": "29558972",
"pubdate": "2018-03-20",
"publication_types": "D016428:Journal Article",
"references": "25005775;17573596;24446523;14971789;26082840;24267867;24717910;29107562;26372490;24698485;24259658;26035327;20970086;26244832",
"title": "Dolutegravir-based anti-retroviral therapy is effective and safe in HIV-infected paediatric patients.",
"title_normalized": "dolutegravir based anti retroviral therapy is effective and safe in hiv infected paediatric patients"
} | [
{
"companynumb": "IT-GLAXOSMITHKLINE-IT2018054790",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ABACAVIR"
},
"drugadditional": "1",
... |
{
"abstract": "The authors report a case of a 58-year-old woman, ex-smoker, who was referred to the respiratory clinic with a presumed unresolving airspace shadowing in the right lung. Further evaluation of the shadowing with a CT thorax revealed rib lesions, a pancreatic lesion and multiple liver lesions, making the diagnosis of metastatic pancreatic carcinoma most likely. However, further blood investigations and imaging eventually revealed the cause for the shadowing to be multiple myeloma, since the unresolving shadowing was actually a rib lesion.",
"affiliations": "Department of Medicine, Mater Dei Hospital, Msida, Malta.;Department of Medicine, Mater Dei Hospital, Msida, Malta.;Respiratory Division, Department of Medicine, Mater Dei Hospital, Msida, Malta.;Department of Medical Imaging, Mater Dei Hospital, Msida, Malta.;Respiratory Division, Department of Medicine, Mater Dei Hospital, Msida, Malta.",
"authors": "Schembri|Emma Louise|EL|;Mifsud|Simon|S|;Gauci|Jonathan|J|;Mizzi|Adrian|A|;Fsadni|Peter|P|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2018-226412",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "11(1)",
"journal": "BMJ case reports",
"keywords": "haematology (incl blood transfusion); malignant and benign haematology; respiratory medicine",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000359:Aftercare; D000971:Antineoplastic Combined Chemotherapy Protocols; D005260:Female; D006801:Humans; D008168:Lung; D008875:Middle Aged; D009101:Multiple Myeloma; D010190:Pancreatic Neoplasms; D012272:Ribs; D014057:Tomography, X-Ray Computed",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "30567104",
"pubdate": "2018-11-28",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "16304401;25009837;27249749;24803933;26788357;21135286;20160366;21712927;15100901;12528874;9081205;646535",
"title": "An unusual presentation of multiple myeloma.",
"title_normalized": "an unusual presentation of multiple myeloma"
} | [
{
"companynumb": "IN-LUPIN PHARMACEUTICALS INC.-2022-03706",
"fulfillexpeditecriteria": "2",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ALBUTEROL"
},
"drugadditional"... |
{
"abstract": "The likelihood of a drug reaction with lamotrigine is increased by dose escalation that is too rapid or drug interactions that increase the concentration of lamotrigine. There is a well-documented interaction between valproic acid and lamotrigine in which lamotrigine levels are increased, subsequently increasing the risk of a drug reaction with eosinophilia and systemic symptoms (DRESS) syndrome. This syndrome is characterized by fever, lymphadenopathy, diffuse maculopapular rash, multivisceral involvement, eosinophilia, and atypical lymphocytes and has a mortality rate of 10-40%. We describe the first case, to our knowledge, of DRESS syndrome that was probably induced by a drug interaction between lamotrigine and ginseng. A 44-year-old white man presented to the emergency department after experiencing a possible seizure. His medical history included two other lifetime events concerning for seizures at ages 14 and 29 years old. After referral to the neurology clinic, he was diagnosed with generalized tonic-clonic seizure disorder, and lamotrigine was started with up-titration according to the drug's package insert to a goal dosage of 150 mg twice/day. The patient had also been taking deer antler velvet and ginseng that he continued during his lamotrigine therapy. On day 43 of therapy, the patient presented to the emergency department with a pruritic rash that had started on his extremities and spread to his torso. He was thought to have experienced a drug reaction to lamotrigine, and the drug was discontinued. Thirteen days later, the patient was admitted from the acute care clinic for inpatient observation due to laboratory abnormalities in the setting of continued rash, headache, and myalgias. His admission laboratory results on that day were remarkable for leukocytosis, with a white blood cell count up to 17.6 × 10(3) /mm(3) , with a prominent eosinophilia of 3.04 × 10(3) /mm(3) ; his liver enzyme levels were also elevated, with an aspartate aminotransferase level of 191 U/L, alanine aminotransferase level 473 U/L, alkaline phosphatase level 465 U/L, and total bilirubin level 1.4 mg/dl. Use of the Drug Interaction Probability Scale indicated that a drug interaction between lamotrigine and ginseng was the probable cause (score of 5). The proposed mechanism of the interaction is ginseng inhibition of the uridine diphosphate glucuronosyltransferase 2B7 enzyme, similar to the mechanism of the interaction with valproic acid. Clinicians should be aware of this probable drug interaction and avoid coadministration of ginseng and lamotrigine or use a more conservative dose titration of lamotrigine for patients who are also taking ginseng.",
"affiliations": "Department of Pharmaceutical Services, Vanderbilt University Medical Center, Nashville, Tennessee.",
"authors": "Myers|Amy P|AP|;Watson|Troy A|TA|;Strock|Steven B|SB|",
"chemical_list": "D000927:Anticonvulsants; D014227:Triazines; D000077213:Lamotrigine",
"country": "United States",
"delete": false,
"doi": "10.1002/phar.1550",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0277-0008",
"issue": "35(3)",
"journal": "Pharmacotherapy",
"keywords": "DRESS; drug interaction; ginseng; lamotrigine",
"medline_ta": "Pharmacotherapy",
"mesh_terms": "D000328:Adult; D000927:Anticonvulsants; D004305:Dose-Response Relationship, Drug; D063926:Drug Hypersensitivity Syndrome; D004802:Eosinophilia; D041743:Herb-Drug Interactions; D006801:Humans; D000077213:Lamotrigine; D008297:Male; D005894:Panax; D014227:Triazines",
"nlm_unique_id": "8111305",
"other_id": null,
"pages": "e9-e12",
"pmc": null,
"pmid": "25756365",
"pubdate": "2015-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Drug reaction with eosinophilia and systemic symptoms syndrome probably induced by a lamotrigine-ginseng drug interaction.",
"title_normalized": "drug reaction with eosinophilia and systemic symptoms syndrome probably induced by a lamotrigine ginseng drug interaction"
} | [
{
"companynumb": "US-MYLANLABS-2015M1012827",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "LAMOTRIGINE"
},
"drugadditional": "1",
... |
{
"abstract": "OBJECTIVE\nThe present study was designed to assess the efficacy and safety of IGNG that is a new liquid, saccharose and maltose-free highly purified ready-to-use 5% intravenous immunoglobulin (IVIg), in primary immune thrombocytopenic patients with severe thrombocytopenia.\n\n\nMETHODS\nNineteen adults with a platelet count ≤ 25 × 109/L received a single dose of IGNG (1 g/kg) on Day 1, with a second identical dose on Day 3 if needed. Patients were followed for 30 days. Primary endpoint was the response rate, defined as the proportion of patients with a platelet count ≥ 50 × 109/L within 96 hours after the first IGNG dose.\n\n\nRESULTS\nAll but one of the 17 evaluable patients for efficacy responded with an overall response rate of 94.1% (95% CI 71.3%-99.9%). Response was observed after only one infusion (1 g/kg boby weight) in 11 patients (59%) and the others required a second dose. Mean time to response was 2.2 days. Maximum platelet count was reached within 1 week after the first dose and lasted for approximately 2 weeks. Patients requiring a second dose had lower platelet counts at baseline than patients requiring a single dose. In the 19 evaluable patients for safety, IGNG demonstrated good safety, good hepatic and renal tolerance, and did not induce hemolysis. This trial was registered at the French Medical Agency (AFSSAPS) as #DI n°060735.",
"affiliations": "Department of Haematology, Henri Duffaut Hospital France.;Department of Internal Medicine, Jean Verdier Hospital France.;Department of Internal Medicine, Les Oudairies Hospital France.;Hematology Department, Carémeau Hospital France.;Department of Internal Medicine, Haut-Lévêque Hospital France.;Global Scientific Affairs Unit, LFB Biomedicaments France.;Global Scientific Affairs Unit, LFB Biomedicaments France.;Department of Internal Medicine, University Hospital Henri Mondor France.",
"authors": "Slama|Borhane|B|;Fain|Olivier|O|;Maisonneuve|Hervé|H|;Jourdan|Eric|E|;Viallard|Jean-François|JF|;Ouaja|Rabye|R|;Alfa-Cissé|Ousmane|O|;Godeau|Bertrand|B|;|||",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2160-1992",
"issue": "7(1)",
"journal": "American journal of blood research",
"keywords": "Intravenous immunoglobulin; efficacy; primary immune thrombocytopenia; safety",
"medline_ta": "Am J Blood Res",
"mesh_terms": null,
"nlm_unique_id": "101569577",
"other_id": null,
"pages": "1-9",
"pmc": null,
"pmid": "28203488",
"pubdate": "2017",
"publication_types": "D016428:Journal Article",
"references": "9324032;1984800;18211567;17317619;24319191;12588344;19245432;11809183;15941913;9331514;15312219;15951296;7138600;10847256;10487396;25305203;18217129;19846889;8704187",
"title": "Efficacy and safety of ClairYg®, a ready-to-use intravenous immunoglobulin, in adult patients with primary immune thrombocytopenia.",
"title_normalized": "efficacy and safety of clairyg a ready to use intravenous immunoglobulin in adult patients with primary immune thrombocytopenia"
} | [
{
"companynumb": "FR-TAKEDA-FR202034281",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HUMAN IMMUNOGLOBULIN G"
},
"drugadditional": "3",... |
{
"abstract": "Multiple myeloma (MM) is a neoplastic clonal plasma cell disorder. Approximately 30% of newly diagnosed MM present with baseline renal dysfunction adversely affecting prognosis and survival. But its outcome has improved with the advent of novel agents.\nWe undertook this clinicopathological study to assess the profile of renal involvement, evaluate hematological response, renal reversibility and renal response of 34 newly diagnosed cases of MM with renal impairment receiving 4-6 cycles of Bortezomib, Thalidomide and Dexamethasone (BTD).\nBone pain (67.64%) and pallor (88.23%) were the most common clinical symptom and sign respectively. Mean serum creatinine before and after treatment was 3.5 mg/dl and 1.59 mg/dl respectively. After treatment 15 cases achieved renal reversibility, 8 patients had improved renal function and 3 patients became dialysis independent. The median time to renal reversal was 22weeks (2-28 weeks) and overall myeloma response rate was 78.78%. All patients showed renal response. The median time to renal response was 2.4weeks. We found 38.23% pure cast nephropathy, 14.7% myeloma immunoglobulin deposition disease (MIDD), 5.88% amylodosis apart from other lesions.\nBTD is safe, effective in reversing renal impairment and improves survival in newly diagnosed cases of MM with renal impairment.",
"affiliations": "Postgraduate , Corresponding Author.;Professor, Post Graduate Department of Medicine.;Professor and Head, Department of Clinical Hematology.;Associate Professor, Department of Pathology.;Professor and Head, Department of Nephrology, S.C.B. Medical College and Hospital, Cuttack, Odisha.",
"authors": "Panda|Tribikram|T|;Das|Sidhartha|S|;Jena|Rabindra Kumar|RK|;Das|Bidyut Prava|BP|;Rout|Sashi Bhusan|SB|",
"chemical_list": "D013792:Thalidomide; D000069286:Bortezomib; D003907:Dexamethasone",
"country": "India",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0004-5772",
"issue": "67(7)",
"journal": "The Journal of the Association of Physicians of India",
"keywords": null,
"medline_ta": "J Assoc Physicians India",
"mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D000069286:Bortezomib; D003907:Dexamethasone; D006801:Humans; D009101:Multiple Myeloma; D013792:Thalidomide; D016896:Treatment Outcome",
"nlm_unique_id": "7505585",
"other_id": null,
"pages": "54-57",
"pmc": null,
"pmid": "31559769",
"pubdate": "2019-07",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Hematological, Biochemical and Renal Changes in Patients of Multiple Myeloma Treated with Bortezomib Based Triple Drug Chemotherapy.",
"title_normalized": "hematological biochemical and renal changes in patients of multiple myeloma treated with bortezomib based triple drug chemotherapy"
} | [
{
"companynumb": "IN-TAKEDA-2019TUS055185",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "THALIDOMIDE"
},
"drugadditional": "3",
... |
{
"abstract": "Natalizumab is among the most effective drugs for controlling multiple sclerosis (MS). The most important side effect of this drug is progressive multifocal leukoencephalopathy, although some other complications are increasingly reported in literature such as meningitis and encephalitis. Here, a patient with MS who has suffered from myocardial infarction (MI) after the injection of natalizumab is introduced.",
"affiliations": "MS Research Center, Neuroscience Institute, Tehran University of Medical Sciences, Tehran, Iran.;MS Research Center, Neuroscience Institute, Tehran University of Medical Sciences, Tehran, Iran.;Department of Cardiology, Sina Hospital, Tehran University of Medical Sciences, Tehran, Iran.;Department of Cardiology, Sina Hospital, Tehran University of Medical Sciences, Tehran, Iran. Electronic address: abdorrezamoghadasi@gmail.com.",
"authors": "Darki|Aala|A|;Masoumi|Peiman|P|;Soleimani|Abbas|A|;Naser Moghadasi|Abdorreza|A|",
"chemical_list": "D007155:Immunologic Factors; D000069442:Natalizumab",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.msard.2018.07.016",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2211-0348",
"issue": "25()",
"journal": "Multiple sclerosis and related disorders",
"keywords": "Multiple sclerosis; Myocardial infarction; Natalizumab",
"medline_ta": "Mult Scler Relat Disord",
"mesh_terms": "D017023:Coronary Angiography; D005260:Female; D006801:Humans; D007155:Immunologic Factors; D008875:Middle Aged; D009103:Multiple Sclerosis; D009203:Myocardial Infarction; D000069442:Natalizumab",
"nlm_unique_id": "101580247",
"other_id": null,
"pages": "26-28",
"pmc": null,
"pmid": "30025371",
"pubdate": "2018-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Myocardial infarction in a patient with multiple sclerosis after receiving natalizumab.",
"title_normalized": "myocardial infarction in a patient with multiple sclerosis after receiving natalizumab"
} | [
{
"companynumb": "IR-BIOGEN-2018BI00613685",
"fulfillexpeditecriteria": "1",
"occurcountry": "IR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ASPIRIN"
},
"drugadditional": null,
... |
{
"abstract": "To report a case of bilateral non-leaking cystoid macular degeneration induced by docetaxel, possibly potentiated by hydroxychloroquine.\nA 63-year-old female patient with a long-term history of rheumatoid arthritis controlled on hydroxychloroquine for 33 years with no evidence of retinopathy developed bilateral loss of vision after having been on docetaxel chemotherapy for breast cancer. Optical coherence tomography showed bilateral cystic maculopathy with no angiographic evidence of leakage on fluorescein angiography. The patient was treated conservatively with no further interventions. Marked improvement of the macular degeneration occurred over the subsequent 9 months, but without visual improvement, although a cataract likely confounded final visual acuity measurement.\nDocetaxel-induced maculopathy has been previously reported, but with only four case reports in literature, and most often in conjunction with concurrent therapies or conditions also known to cause macular edema. This is the first case report of docetaxel-induced maculopathy in a setting of hydroxychloroquine therapy which may possibly has potentiated the effect of docetaxel to induce maculopathy. Impaired transcellular retinal pigment epithelial transport might be the cause of non-leaking cystic maculopathy.",
"affiliations": "Department of Ophthalmology, Bascom Palmer Eye Institute, University of Miami Miller School of Medicine, 900 NW 17 Street, Miami, FL, 33136, USA.;Department of Ophthalmology, Bascom Palmer Eye Institute, University of Miami Miller School of Medicine, 900 NW 17 Street, Miami, FL, 33136, USA.;Department of Ophthalmology, Bascom Palmer Eye Institute, University of Miami Miller School of Medicine, 900 NW 17 Street, Miami, FL, 33136, USA.",
"authors": "Elhusseiny|Abdelrahman M|AM|;Relhan|Nidhi|N|;Smiddy|William E|WE|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.ajoc.2019.100560",
"fulltext": "\n==== Front\nAm J Ophthalmol Case RepAm J Ophthalmol Case RepAmerican Journal of Ophthalmology Case Reports2451-9936Elsevier S2451-9936(19)30103-310.1016/j.ajoc.2019.100560100560Case ReportDocetaxel-induced maculopathy possibly potentiated by concurrent hydroxychloroquine use Elhusseiny Abdelrahman M. abRelhan Nidhi aSmiddy William E. wsmiddy@med.miami.edua∗a Department of Ophthalmology, Bascom Palmer Eye Institute, University of Miami Miller School of Medicine, 900 NW 17 Street, Miami, FL, 33136, USAb Department of Ophthalmology, Kasr Al Ainy School of Medicine, Cairo University, Egypt∗ Corresponding author. 900 NW 17 Street, Miami, FL, 33136, USA. wsmiddy@med.miami.edu26 9 2019 12 2019 26 9 2019 16 10056023 2 2019 16 9 2019 24 9 2019 © 2019 The Authors2019This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Purpose\nTo report a case of bilateral non-leaking cystoid macular degeneration induced by docetaxel, possibly potentiated by hydroxychloroquine.\n\nObservations\nA 63-year-old female patient with a long-term history of rheumatoid arthritis controlled on hydroxychloroquine for 33 years with no evidence of retinopathy developed bilateral loss of vision after having been on docetaxel chemotherapy for breast cancer. Optical coherence tomography showed bilateral cystic maculopathy with no angiographic evidence of leakage on fluorescein angiography. The patient was treated conservatively with no further interventions. Marked improvement of the macular degeneration occurred over the subsequent 9 months, but without visual improvement, although a cataract likely confounded final visual acuity measurement.\n\nConclusions and importance\nDocetaxel-induced maculopathy has been previously reported, but with only four case reports in literature, and most often in conjunction with concurrent therapies or conditions also known to cause macular edema. This is the first case report of docetaxel-induced maculopathy in a setting of hydroxychloroquine therapy which may possibly has potentiated the effect of docetaxel to induce maculopathy. Impaired transcellular retinal pigment epithelial transport might be the cause of non-leaking cystic maculopathy.\n\nKeywords\nDocetaxelHydroxychloroquineNon-leaking cystoid macular degenerationRetinal pigment epithelium pump\n==== Body\n1 Introduction\nCystoid macular edema (CME) is characteristically recognized as a vision-threatening condition due to vascular leakage usually due to some degree of inflammation. It has classically been diagnosed, quantified, and monitored by the appearance of fluorescein extravasation and is exquisitely apparent even in mild degrees by optical coherence tomography (OCT). More recently, several drugs have been identified as causing non-leaking CME-cystoid spaces demonstrable by OCT, but not associated with fluorescein leakage which has come to be referred to as cystoid macular degeneration (CMD).1\n\nWe describe a case of bilateral, non-leaking cystic maculopathy likely induced by docetaxel chemotherapy, possibly potentiated by long-term hydroxychloroquine use, in patient treated for invasive breast cancer.\n\n2 Case report\nA 62-year-old female presented with a 2-month history of bilateral loss of vision. She had a past medical history rheumatoid arthritis for which she was receiving hydroxychloroquine (HCQ) 200mg/day for 33 years. During this long period of follow-up, no signs of HCQ-retinopathy were detected by annual macular Humphrey visual field testing and her best corrected visual acuity was 20/20 OU. Her medical history was also notable for a diagnosis of right invasive breast cancer treated by right partial mastectomy followed by a combination of both radiotherapy and chemotherapy including 4 cycles of cyclophosphamide (Endoxan®) docetaxel (Taxotere®) and corticosteroids. Shortly after completion of the chemotherapy regimen she noticed bilateral blurry vision.\n\nThe BCVA was 20/70 OD and 20/60 OS. The anterior segment, free extraocular motility, pupil, and intraocular pressure examinations were normal. The dilated fundus examination disclosed bilateral macular spaces without evidence of inflammation. The optical coherence tomography (OCT) showed intraretinal fluid spaces with multiple parafoveal cystic spaces (Fig. 1). Visual field showed bilateral central scotomas whereas the study from the previous year had been normal (Fig. 2). Fundus fluorescein angiography (FA) showed normal filling of choroidal and retinal vasculature without angiographic evidence of leakage (Fig. 3).Fig. 1 Optical coherence tomography (OCT) of (A–B) the left, (C–D) the right eye showing intraretinal fluid spaces with multiple parafoveal cystic spaces.\n\nFig. 1Fig. 2 Visual field of the A) left, and B) right eye showing bilateral central scotomas.\n\nFig. 2Fig. 3 Fluorescein angiography (FA) of (A) the left, (B) the right eye showing no evidence of vascular leakage with normal filling of retinal vasculature.\n\nFig. 3\n\nDocetaxel induced maculopathy was diagnosed, possibly potentiated by long term HCQ therapy. Since the patient had already completed her last cycle of therapy, no therapeutic intervention was recommended. Eight weeks later, the macular edema had improved markedly with reduction in the retinal thickness (Fig. 4). At the most recent follow-up examination, 9 months after onset, the BCVA was 20/80 OD and 20/60, but using the potential acuity meter the vision improved to 20/40 OU, consistent he presence of bilateral nuclear sclerotic cataracts.Fig. 4 OCT of (A–B) the left, (C–D) the right eye showing marked improvement of the macular spaces with reduction of the retinal thickness at 2 months follow-up.\n\nFig. 4\n\n3 Discussion\nTaxane-induced CME has been reported with 4 cases involving docetaxel,2, 3, 4, 5 but previous case reports have been clouded by the concurrent use of other agents (such as tamoxiphen) or conditions (retinitis pigmentosa or the fluid retention syndrome) also known to cause CME. This has led some to hypothesize that taxanes might potentiate the tendency towards CME in such settings.4,5 Generally, the CME resolved with cessation of the drug, although in some cases topical or oral acetazolamide was also used.2,6 We present this case as the first with docetaxel-induced CME possibly potentiated by long-term use of HCQ, and also one that was peculiar in that its onset seemed to occur after cessation of the docetaxel. Moreover, we hypothesize that RPE transcellular transport disruption is the site of this action.\n\nTaxanes comprise a group of chemotherapeutic agents commonly used in the management of various types of solid malignant tumors including breast carcinoma.7 These include paclitaxel (Taxol®, Bristol-Myers Squibb), docetaxel (Taxotere®, Rhone-Poulenc Rhorer) and cabazitaxel (Jevatana®, Sanofi-Aventis). Their mechanism of action is to disrupt the function of the microtubules by binding to beta-tubulin subunit stabilizing microtubules, inhibiting cell replication, and inducing apoptosis.8 Reported ocular adverse effects of docetaxel are rare but include canalicular stenosis, toxic optic neuropathy, conjunctivitis, and non-leaking cystoid macular degeneration.2, 3, 4, 5,9, 10, 11 One member of the taxane class of drugs, paclitaxel, is reported to be more toxic than docetaxel, possibly related to its more quickly achieving a cumulative dose needed to induce CME.6,12,13\n\nThe pathogenesis of taxane-induced CME is unclear, but several mechanisms have been suggested. One study suggested paclitaxel-induced dysfunction of Muller cells with subsequent fluid accumulation.13 This theory is consistent with Jampol's suggestion that the non-leaking nature of niacin-induced CME represented subclinical leakage or niacin-induced toxic effects on Muller cells leading to intracellular deregulation and fluid accumulation.14 Based on OCT-findings, Kuznetcova et al. proposed that paclitaxel's toxic effect on microtubules leads to arrest of microtubule-dependent fluid absorption across the RPE, intimating that nonleaking CME might be a consequence of dysfunctional RPE rather than vascular leakage.15 such a role has been postulated for microtubules in Sertoli cells where the seminiferous tubule secretion requires an intact microtubule transport system.16 The reported occurrence of taxane-induced CME in patients already treated with systemic bevacizumab, corroborates the theory that excessive permeability does not underlie the pathogenesis of non-leaking CME.17 Another pathogenic theory for non-leaking CME (by FA) proposes that the blood retinal barrier is only partially compromised (as Jampol hypothesized for niacin's effect) such that diffusion of small molecules but not larger ones such as fluorescein.18\n\nHydroxychloroquine (HCQ) is used to manage arthropathies associated with some autoimmune disorders, most commonly rheumatoid arthritis or systemic lupus erythematosis. Its mechanism of action is not completely established but may involve immune function suppression by disrupting antigen processing and presentation; its lysosomotrophic characteristics cause pH elevation which seems to affect this result. It is associated with various forms of retinopathy including photoreceptor damage, bull's eye maculopathy via RPE damage, and even diffuse retinal atrophy; these effects are related to dosage and duration of treatment.19,20 HCQ has also been reported to be associated with leaking21 as well as non-leaking22 CME with 12 cases reported. Although the mechanism of HCQ-induced CME is not well understood, it may be by inducing Increased RPE permeability subsequently causing partial loss of blood retinal barrier (BRB) but without affecting tight junction molecules expression.23 Accumulation of HCQ in the RPE may disrupt its pump function, resulting in intraretinal fluid accumulation. . In fact, the rationale for using carbonic anhydrase inhibitors is to enhance RPE pumping function.21,24,25 Whatever the exact mechanism, taxanes could potentiate the (non-leaking) CME effect of other agents (like tamoxifen5,12 or HCQ) at the level of the RPE pump as was suggested by Buffet et al.5 The occurrence of CME in a retinitis pigmentosa patient also supports the possibility of RPE dysfunction as a possible mechanism triggered or compounded by the taxane effect.4\n\n4 Conclusion\nWe can propose that the pathogenic site of the non-leaking CME caused by taxanes, hydroxychloroquine,and possibly tamoxifen is malfunctioning RPE rather than retinal vasculature, resulting in inhibition of transcellular fluid transport across the RPE to the choriocapillaris, and that such agents are cumulative or synergistic. This explains the absence of leakage pattern by FA in our case - and perhaps in other drug-induced,non-leaking CME. Following discontinuation of the drug(s) there is usually spontaneous resolution. This mechanism is consistent with reports that oral or topical carbonic anhydrase inhibitors may improve refractory edema since they enhance RPE cell transport.3 Taxane-induced maculopathy has been rarely reported in literature, but oncologists and ophthalmologists should be aware of its existence and response to non-interventional management.\n\nPatient consent\nNo consent was needed as we did not publish any identifying information.\n\nFunding\n“This study was supported by the NIH Center Core Grant P30EY014801 and an unrestricted grant to the University of Miami from the Research to Prevent Blindness.\"\n\nAuthorship\nAll authors attest that they meet the current ICMJE criteria for authorship.\n\nDeclaration of competing interest\nThe following authors have no financial disclosures:\n\nAcknowledgments\nNone.\n==== Refs\nReferences\n1 Makri O.E. Georgalas I. Georgakopoulos C.D. Drug-induced macular edema Drugs 73 2013 789 802 23640687 \n2 Teitelbaum B. Tresley A. Cystic maculopathy with normal capillary permeability secondary to docetaxel Optom Vis Sci 80 4 2003 277 279 12692483 \n3 Telander D. Sarraf D. Cystoid macular edema with docetaxel chemotherapy and the fluid retention syndrome Semin Ophthalmol 22 3 2007 151 153 17763235 \n4 Enzsoly A. Kammerer K. Nemeth J. Schneider M. Bilateral cystoid macular edema following docetaxel chemotherapy in a patient with retinitis pigmentosa: a case report BMC Ophthalmol 15 1 2015 \n5 Nghiem-Buffet S. Cohen S. Giocanti-Auregan A. Docetaxel retinopathy: a case report Case Rep Ophthalmol 8 1 2017 21 25 28203192 \n6 Bassi E. Loizzi V. Furino C. Cystoid macular edema secondary to paclitaxel therapy for ovarian cancer: a case report Mol Clin Oncol 7 2 2017 285 287 28781803 \n7 Nabholtz J. Gligorov J. The role of taxanes in the treatment of breast cancer Expert Opin Pharmacother 6 7 2005 1073 1094 15957963 \n8 Rowinsky E. The development and clinical utility of the taxane class of antimicrotubule chemotherapy agents Annu Rev Med 48 1 1997 353 374 9046968 \n9 Moloney T, Xu W, Rallah-Baker K, Oliveira N, Woodward N, Farrah J. Toxic optic neuropathy in the setting of docetaxel chemotherapy: a case report. BMC Ophthalmol. 201 ;Feb 24;14(1):18.\n10 Esmaeli B. Valero V. Ahmadi M.A. Booser D. Canalicular stenosis secondary to docetaxel (taxotere): a newly recognized side effect Ophthalmology 108 2001 994 995 11320034 \n11 Skolnick C. Doughman D. Erosive conjunctivitis and punctal stenosis secondary to docetaxel (taxotere) Eye Contact Lens 29 2 2003 134 135 12695719 \n12 Chung H. Kim D. Ahn S. Early detection of tamoxifen-induced maculopathy in patients with low cumulative doses of tamoxifen Ophthalmic Surg Lasers Imaging 2010 1 5 Mar 9 \n13 Joshi M.M. Garretson B.R. Paclitaxel maculopathy Arch Ophthalmol 125 2007 709 710 17502517 \n14 Jampol L.M. Niacin maculopathy Ophthalmology 95 1988 1704 1705 \n15 Kuznetcova T. Cech P. Herbort C. The mystery of angiographically silent macular oedema due to taxanes Int Ophthalmol 32 3 2012 299 304 22484725 \n16 Richburg J. Redenbach D. Boekelheide K. Seminiferous tubule fluid secretion is a sertoli cell microtubule-dependent process inhibited by 2,5-hexanedione exposure Toxicol Appl Pharmacol 128 2 1994 302 309 7940545 \n17 Yokoe T. Fukada I. Kobayashi K. Cystoid macular edema during treatment with paclitaxel and bevacizumab in a patient with metastatic breast cancer: a case report and literature review Case Rep Oncol 10 2 2017 605 612 28868019 \n18 Smith S. Cystoid macular edema secondary to albumin-bound paclitaxel therapy Arch Ophthalmol 126 11 2008 1605 19001234 \n19 Geamanu Panca A. Popa-Cherecheanu A. Marinescu B. Geamanu C.D. Voinea L.M. Retinal toxicity associated with chronic exposure to hydroxychloroquine and its ocular screening. review J Med Life 7 2014 322 326 25408748 \n20 Mackenzie A.H. Dose refinements in long-term therapy of rheumatoid arthritis with antimalarials Am J Med 75 1A 1983 40 45 \n21 Hong E. Ahn S. Lim H. Lee B. The effect of oral acetazolamide on cystoid macular edema in hydroxychloroquine retinopathy: a case report BMC Ophthalmol 17 1 2017 \n22 Parikh V. Modi Y. Au A. Nonleaking cystoid macular edema as a presentation of hydroxychloroquine retinal toxicity Ophthalmology 123 3 2016 664 666 26459999 \n23 Korthagen N. Bastiaans J. van Meurs J. van Bilsen K. van Hagen P. Dik W. Chloroquine and hydroxychloroquine increase retinal pigment epithelial layer permeability J Biochem Mol Toxicol 29 7 2015 299 304 25752684 \n24 Kim D.G. Yoon C.K. Kim H.W. Lee S.J. Effect of topical dorzolamide therapy on cystoid macular edema in hydroxychloroquine retinopathy Can J Ophthalmol 53 2018 e103 e107 29784170 \n25 Ahn S. Joung J. Lee S. Lee B. Intravitreal dexamethasone implant therapy for the treatment of cystoid macular oedema due to hydroxychloroquine retinopathy: a case report and literature review BMC Ophthalmol 18 1 2018\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2451-9936",
"issue": "16()",
"journal": "American journal of ophthalmology case reports",
"keywords": "Docetaxel; Hydroxychloroquine; Non-leaking cystoid macular degeneration; Retinal pigment epithelium pump",
"medline_ta": "Am J Ophthalmol Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101679941",
"other_id": null,
"pages": "100560",
"pmc": null,
"pmid": "31650088",
"pubdate": "2019-12",
"publication_types": "D002363:Case Reports",
"references": "17502517;23640687;7940545;6869410;20337363;3231439;28868019;29784170;9046968;25408748;24564293;25752684;12695719;28781803;26459999;11320034;30522457;22484725;28203192;15957963;28701214;17763235;19001234;12692483;25885440",
"title": "Docetaxel-induced maculopathy possibly potentiated by concurrent hydroxychloroquine use.",
"title_normalized": "docetaxel induced maculopathy possibly potentiated by concurrent hydroxychloroquine use"
} | [
{
"companynumb": "US-TEVA-2019-US-1128864",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HYDROXYCHLOROQUINE"
},
"drugadditional": "3",
... |
{
"abstract": "Patients who undergo chimeric antigen receptor T-cell therapy (CAR T-cell therapy) are immunosuppressed due to multiple factors. While adenovirus and BK virus are well-known pathogens in the context of hematopoietic stem cell transplant, there are no detailed reports of these infections in the setting of CAR T-cell therapy. We describe a 70-year-old male who recently underwent CAR T-cell therapy for diffuse large B-cell lymphoma. He presented with intractable gross hematuria and dysuria. Workup revealed adenovirus viremia and viruria and BK virus viruria. He was treated for adenovirus hemorrhagic cystitis with intravenous cidofovir 1 mg/kg/day, every three days for three weeks, with good clinical response. We also discuss the mechanisms of immunosuppression in CAR T-cell therapy as well as the principles of treatment of adenovirus and BK virus infections in the immunosuppressed patient.",
"affiliations": "Department of Internal Medicine, Albany Medical Center, Albany, NY, USA.;Department of Internal Medicine, Albany Medical Center, Albany, NY, USA.;Department of Internal Medicine, Albany Medical Center, Albany, NY, USA.;Department of Infectious Diseases, Albany Medical Center, Albany, NY, USA.;New York Oncology Hematology, Albany Medical Center, Albany, NY, USA.",
"authors": "Khan|Abdul Moiz|AM|https://orcid.org/0000-0002-0724-0766;Ajmal|Zainub|Z|https://orcid.org/0000-0002-3792-8975;Tuz Zahra|Fatima|F|https://orcid.org/0000-0001-5989-1117;Ramani|Ananthakrishnan|A|;Zackon|Ira|I|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2020/6621967",
"fulltext": "\n==== Front\nCase Rep Hematol\nCase Rep Hematol\nCRIHEM\nCase Reports in Hematology\n2090-6560 2090-6579 Hindawi \n\n10.1155/2020/6621967\nCase Report\nHemorrhagic Cystitis Secondary to Adenovirus and BK Virus Infection in a Diffuse Large B-Cell Lymphoma Patient with Recent CAR T-Cell Therapy\nhttps://orcid.org/0000-0002-0724-0766Khan Abdul Moiz khana13@amc.edu\n1\n https://orcid.org/0000-0002-3792-8975Ajmal Zainub \n1\n https://orcid.org/0000-0001-5989-1117Tuz Zahra Fatima \n1\n Ramani Ananthakrishnan \n2\n Zackon Ira \n3\n \n1Department of Internal Medicine, Albany Medical Center, Albany, NY, USA\n\n2Department of Infectious Diseases, Albany Medical Center, Albany, NY, USA\n\n3New York Oncology Hematology, Albany Medical Center, Albany, NY, USA\nAcademic Editor: Chihaya Imai\n\n\n2020 \n27 11 2020 \n2020 662196711 10 2020 11 11 2020 16 11 2020 Copyright © 2020 Abdul Moiz Khan et al.2020This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Patients who undergo chimeric antigen receptor T-cell therapy (CAR T-cell therapy) are immunosuppressed due to multiple factors. While adenovirus and BK virus are well-known pathogens in the context of hematopoietic stem cell transplant, there are no detailed reports of these infections in the setting of CAR T-cell therapy. We describe a 70-year-old male who recently underwent CAR T-cell therapy for diffuse large B-cell lymphoma. He presented with intractable gross hematuria and dysuria. Workup revealed adenovirus viremia and viruria and BK virus viruria. He was treated for adenovirus hemorrhagic cystitis with intravenous cidofovir 1 mg/kg/day, every three days for three weeks, with good clinical response. We also discuss the mechanisms of immunosuppression in CAR T-cell therapy as well as the principles of treatment of adenovirus and BK virus infections in the immunosuppressed patient.\n==== Body\n1. Introduction\nHemorrhagic cystitis (HC) is a diffuse inflammatory condition of the urinary bladder due to an infectious or noninfectious etiology resulting in bleeding from the bladder mucosa [1]. Infectious agents include bacteria, viruses (such as adenovirus and BK virus), fungi, or parasites. Noninfectious causes include medications such as cyclophosphamide, environmental toxins, and radiation [1, 2]. Prompt management of HC is vital especially in the context of immunosuppression. Chimeric antigen receptor T-cell therapy (CAR T-cell therapy) is an emerging type of immunotherapy for various hematological malignancies. Patients who undergo CAR T-cell therapy are generally immunosuppressed and prone to infections [3]. While adenovirus and BK virus are well-recognized pathogens in the context of hematopoietic stem cell transplant, only 2 cases of adenovirus viremia in CAR T-cell therapy patients have been reported by Chandorkar in a retrospective study [4]. Importantly, to the best of our literature review, there are no detailed accounts of concurrent infection with both these agents in the setting of CAR T-cell therapy.\n\nWe describe a case of HC secondary to adenovirus and BK virus in a patient with diffuse large B-cell lymphoma with recent CAR T-cell therapy. We discuss the mechanisms of immunosuppression in CAR T-cell therapy and the principles of treatment of adenovirus and BK virus infections in the immunocompromised patients.\n\n2. Case Presentation\nA 70-year-old male with diffuse large B-cell lymphoma presented with worsening dysuria, frequency, urgency, and gross hematuria along with mild suprapubic pain for 10 days. Hematuria was initially intermittent though it became persistent with infrequent passage of clots. The patient had failed an outpatient course of trimethoprim/sulfamethoxazole for a possible bacterial urinary tract infection. He denied fever, chills, flank pain, trauma, or weight loss. On our initial physical exam, he had a temperature of 37 C, blood pressure 120/55 mmHg, pulse 100 beats/min, respiratory rate 20/min, and oxygen saturation 98% on room air. He had prominent conjunctival pallor, a mildly distended abdomen with moderate tenderness in the suprapubic region. However, no flank or costovertebral angle tenderness, scrotal or penile swelling or tenderness, or cervical, axillary, or inguinal lymphadenopathy was noted.\n\nThe patient was diagnosed with diffuse large B-cell lymphoma in 2007 with multiple recurrences. Most recently, he had received lymphodepleting chemotherapy with fludarabine and cyclophosphamide followed by axicabtagene ciloleucel CAR T-cell therapy (2 × 106 cells/kg) two months before the presentation, in December 2019. He experienced grade 2 cytokine release syndrome during the treatment which warranted therapy with interleukin-6 inhibitor, tocilizumab. He had also received multiagent chemotherapeutic regimens between 2007 and 2018 for recurrences, including an autologous stem cell transplant in 2017. Additionally, he had a 60 pack-year smoking history which he quit 5 years ago. He denied any significant travel or occupational exposures.\n\nInitial workup revealed pancytopenia with a white blood cell count of 3.2 × 103 (normal level 4–9 x 103 cells/μL), absolute neutrophil count 2.5 × 103 (1.5–5.2 × 103 cells/μL), absolute lymphocyte count 0.3 × 103 (1.1–3.9 × 103 cells/μL), hemoglobin 8.9 (13.6–16.7 g/dl), hematocrit 26.3 (40–49%), and platelet count 17 × 103 (130–350 × 103 cells/μL). Creatinine was 1.60 (patient's baseline was 1 mg/dL) and estimated GFR 43 (normal >60 mL/min/1.73 m2). Urinalysis showed 1+ leukocyte esterase, negative nitrite, 3+ hemoglobin, 50–100/high power field (HPF) WBCs and too numerous to count RBCs. Urine gram stain and culture had 3+ polymorphonuclear cells but no bacterial or fungal growth. Two sets of aerobic and anaerobic blood cultures were negative. On imaging, computerized tomography (CT) scan of the abdomen and pelvis showed moderate right hydroureteronephrosis with surrounding fat stranding of the kidney and ureter along its entire course. Ureteral dilation was up to 1.1 cm and bladder wall thickening with surrounding fat stranding were seen. Adenovirus and BK virus PCR were ordered.\n\nWhile the results of adenovirus and BK virus PCR were awaited, supportive care was provided with intravenous fluids, phenazopyridine, and analgesics. Patient also received intravenous immunoglobulin (IVIG) for hypogammaglobulinemia. Antibiotics were held given the low likelihood of bacterial urinary tract infection. In order to rule out obstruction based on the findings of hydroureteronephrosis, rigid cystourethroscopy, bilateral retrograde pyelogram, right ureteroscopy, bladder biopsies, and fulguration were performed. Cystoscopy revealed diffuse gross cystitis with mucosal mounding. Bilateral retrograde pyelogram demonstrated poor drainage and calyceal blunting on the right-side, hence a ureteral stent was placed, whereas the left side was normal. Meanwhile, adenovirus was detected by PCR in urine as well as serum. BK virus DNA quantitation by real time PCR in urine showed 1,300,000 copies/ml (log copies 6.11), though BK viral DNA was not detected in serum. Hypogammaglobulinemia with IgG level 288.2 (667–1485 mg/dL), IgM <20 (46–216 mg/dl), and IgA 33 (63–391 mg/dL) was also seen. Bladder biopsy, urine cytology from the right kidney, and bladder washings ruled out malignancy and showed evidence of acute inflammation. Although the patient did not show any appreciable improvement in the symptoms, the renal function gradually improved to baseline.\n\nOnce the adenoviremia/viruria and BK viruria were confirmed, and the renal function improved, the patient was started on intravenous cidofovir for adenovirus HC at a dose of 1 mg/kg/day (90 mg), three times a week, for a total of three weeks. He also received probenecid and 500 ml of normal saline before and after the administration of cidofovir for renal protection. His renal function and blood counts were closely monitored and remained stable. The patient had resolution of hematuria and marked sustained improvement of lower urinary tract symptoms within 2 weeks of completion of therapy.\n\n3. Discussion\nHemorrhagic cystitis (HC) in the setting of immunosuppression can be secondary to infectious or noninfectious causes. While adenovirus viremia and viruria and BK viruria were consistent with viral HC in our case, cyclophosphamide induced HC was also considered. Early-onset HC within the first few days of cyclophosphamide administration is linked to acrolein, a urotoxic metabolite of cyclophosphamide. However, HC can develop weeks to months after treatment in patients who receive high dose of cyclophosphamide [5, 6]. Late HC is most often secondary to adenovirus and BK virus infections in the setting of immunosuppression from the cyclophosphamide rather than a direct toxic effect [6–8]. In our patient, onset of symptoms almost 2 months after cyclophosphamide administration and persistent lymphodepletion supports an indirect role of cyclophosphamide.\n\nPatients receiving CD 19 CAR T-cell therapy are immunosuppressed for multiple reasons. Effects of malignancy itself, prior cytotoxic treatments, and lymphodepleting chemotherapy, given immediately before CAR T-cell therapy, lead to cytopenias and may disrupt mucosal barriers. CAR T-cell therapy can be complicated by cytokine release syndrome (CRS) or neurotoxicity which may necessitate the use of immunosuppressive agents such as corticosteroids and tocilizumab. In addition, CD19 CAR T-cells cause depletion of normal CD19+ B-cells which may lead to hypogammaglobulinemia [3, 9]. Our patient had all these risk factors that may have compounded the risk of adenovirus and BK virus infection. However, the persistent lymphodepletion and suppressed cellular immunity from the chemotherapy given prior to the CAR T-cell therapy likely had the highest role in development of the infections.\n\nHuman adenovirus (AdV) is a nonenveloped, double-stranded, linear DNA virus that causes a wide array of diseases in both immunocompetent and immunocompromised patients, although fulminant manifestations such as HC are more common in immunocompromised population [10]. Disseminated disease carries a high mortality rate [11]. BK virus belongs to the Polyomaviridae family of nonenveloped, double-stranded DNA viruses. Unlike adenovirus, BK virus infections manifest through reactivation of latent virus in the setting of immunosuppression, and clinically significant infections are less frequent in immunocompetent hosts [12, 13]. In addition to the potential of causing HC by itself, BK virus may have an augmenting role since studies have shown that BK virus increases the risk of adenovirus co-infection and contributes to enhanced Adenovirus replication [14, 15].\n\nTreatment options for treating adenovirus HC are limited. Intravenous (IV) cidofovir appears to be the most promising drug for adenovirus infection. Close monitoring and preventive strategies are required for cidofovir-associated nephrotoxicity [11, 16]. European Conference on Infections in Leukemia (ECIL) guidelines (2011) support the treatment of human adenovirus disease with IV cidofovir along with renal protective measures such as hyperhydration and oral probenecid. The recommended dosage is 5 mg/kg/week for 2 weeks and 5 mg/kg every 2 weeks thereafter, given the lack of data on other dosage schedules [17]. However, Nagafuji described treating 16 patients with adenovirus HC following hematopoietic stem cell transplant (HSCT) with IV cidofovir (CDV) at 1 mg/kg/day, three times weekly for 3 weeks. CDV therapy cleared adenovirus from urine in 86% and led to clinical improvement in HC in 71% of the evaluated patients [18]. Yoshimura and Bordigoni have also reported encouraging results with IV cidofovir for treatment of adenovirus infections in patients with allogeneic HSCT [19, 20]. Given the acute kidney injury in our patient, a dose of 1 mg/kg/day, three times weekly for 3 weeks, was used with hyperhydration and probenecid. In addition, there are some reports of intravesical cidofovir, brincidofovir, ribavirin, and vidarabine used successfully for adenovirus infections, though further investigations are needed to establish their role [11, 21–24].\n\nECIL guidelines (2017) also provide a framework for the treatment of BK virus HC, which mostly relies on supportive measures such as hyperhydration, bladder irrigation, platelet transfusions as needed, and pain management. Some studies have reviewed intravenous cidofovir as an effective therapy, although there is no consensus on best dose schedule, and adverse effects mainly nephrotoxicity should be considered on a case-by-case basis [25, 26]. Overall, antiviral treatment with cidofovir remains controversial and of uncertain efficacy due to a lack of randomized controlled trials [26].\n\n4. Conclusions\nPatients undergoing CAR T-cell therapy are immunosuppressed and prone to pathogens including adenovirus and BK virus. Intravenous cidofovir has proven to be an effective treatment for adenovirus infections in the setting of immunosuppression. Renal function should be closely monitored and measures such as hyperhydration and probenecid should be employed to reduce the risk of cidofovir nephrotoxicity.\n\nData Availability\nNo data were used to support this study; relevant references are appropriately cited in the manuscript.\n\nDisclosure\nThe authors declare that this research did not receive any grant from funding agencies in the public, commercial, or not-for-profit sectors.\n\nConflicts of Interest\nIt is hereby declared that the authors of this case report carry no affiliations with or involvement in any organization or entity with any financial interest or nonfinancial interest.\n==== Refs\n1 Manikandan R. Kumar S. Dorairajan L. N. Hemorrhagic cystitis: a challenge to the urologist Journal of the Urological Society of India 2010 26 2 159 166 10.4103/0970-1591.65380 2-s2.0-77954995713 \n2 Haldar S. Dru C. Bhowmick N. A. Mechanisms of hemorrhagic cystitis American Journal of Clinical and Experimental Urology 2014 2 3 199 208 25374922 \n3 Hill J. A. Li D. Hay K. A. Infectious complications of CD19-targeted chimeric antigen receptor-modified T-cell immunotherapy Blood 2018 131 1 121 130 10.1182/blood-2017-07-793760 2-s2.0-85040089946 29038338 \n4 Riddell A. A. Anderson A. D. Morris M. I. Natori Y. Komanduri K. V. Camargo J. F. Viral kinetics and outcomes of adenovirus reactivation following allogeneic hematopoietic cell transplant or CAR-T cell therapy Biology of Blood and Marrow Transplantation 2020 26 3 p. S331 10.1016/j.bbmt.2019.12.357 \n5 Thompson A. Adamson A. Bahl A. Guidelines for the diagnosis, prevention and management of chemical- and radiation-induced cystitis Journal of Clinical Urology 2014 7 1 25 35 10.1177/2051415813512647 2-s2.0-84899537359 \n6 Huddart A. Jones R. J. Brodsky R. A. Cyclophosphamide and cancer: golden anniversary Nature Reviews Clinical Oncology 2009 6 11 638 647 10.1038/nrclinonc.2009.146 2-s2.0-70350786392 \n7 Apperley J. F. Rice S. J. Bishop J. A. Late-onset hemorrhagic cystitis associated with urinary excretion of polyoma viruses after bone marrow transplantation Transplantation 1987 43 1 108 112 10.1097/00007890-198701000-00024 2-s2.0-0023096916 3026070 \n8 Goldman R. R. Shah K. V. Baust S. J. Santos G. W. Saral R. Association of BK viruria with hemorrhagic cystitis in recipients of bone marrow transplants New England Journal of Medicine 1986 315 4 230 234 10.1056/nejm198607243150405 2-s2.0-0022622861 3014334 \n9 Brudno J. N. Kochenderfer J. N. Toxicities of chimeric antigen receptor T cells: recognition and management Blood 2016 127 26 3321 3330 10.1182/blood-2016-04-703751 2-s2.0-84977477922 27207799 \n10 Lion T. Adenovirus infections in immunocompetent and immunocompromised patients Clinical Microbiology Reviews 2014 27 3 441 462 10.1128/cmr.00116-13 2-s2.0-84903600989 24982316 \n11 Cesaro S. Berger M. Berger M. A survey on incidence and management of adenovirus infection after allogeneic HSCT Bone Marrow Transplantation 2019 54 8 1275 1280 10.1038/s41409-018-0421-0 2-s2.0-85058473535 30546071 \n12 Ljungman G. R. Francis R. S. Smyth M. J. Smith C. Khanna R. BK polyomavirus: clinical aspects, immune regulation, and emerging therapies Clinical Microbiology Reviews 2017 30 2 503 528 10.1128/cmr.00074-16 2-s2.0-85014031247 28298471 \n13 Reploeg M. D. Storch G. A. Clifford D. B. BK virus: a clinical review Clinical Infectious Diseases 2001 33 2 191 202 10.1086/321813 2-s2.0-0035879598 11418879 \n14 Bil-Lula I. Woźniak M. Co-infection with human polyomavirus BK enhances gene expression and replication of human adenovirus Archives of Virology 2018 163 7 1841 1849 10.1007/s00705-018-3810-1 2-s2.0-85044478440 29582163 \n15 Bil-Lula I. Ussowicz M. Rybka B. PCR diagnostics and monitoring of adenoviral infections in hematopoietic stem cell transplantation recipients Archives of Virology 2010 155 12 2007 2015 10.1007/s00705-010-0802-1 2-s2.0-78449298133 20848295 \n16 Kałwak C. A. Leen A. M. Boelens J. J. How I treat adenovirus in hematopoietic stem cell transplant recipients Blood 2010 116 25 5476 5485 10.1182/blood-2010-04-259291 2-s2.0-78650489175 20837781 \n17 Matthes-Martin S. Feuchtinger T. Shaw P. J. European guidelines for diagnosis and treatment of adenovirus infection in leukemia and stem cell transplantation: summary of ECIL-4 (2011) Transplant Infectious Disease 2012 14 6 555 563 10.1111/tid.12022 2-s2.0-84870975363 23146063 \n18 Ljungman K. Aoki K. Henzan H. Cidofovir for treating adenoviral hemorrhagic cystitis in hematopoietic stem cell transplant recipients Bone Marrow Transplantation 2004 34 10 909 914 10.1038/sj.bmt.1704682 2-s2.0-9444273521 15361907 \n19 Nagatoshi T. Nishimoto M. Nakane T. Cidofovir treatment for adenovirus-associated hemorrhagic cystitis in adult recipients of allogeneic hematopoietic stem cell transplantation: a retrospective comparative study Biology of Blood and Marrow Transplantation 2017 23 3 p. S202 10.1016/j.bbmt.2016.12.389 \n20 Nakamae P. Carret A.-S. Venard V. Witz F. Le Faou A. Treatment of adenovirus infections in patients undergoing allogeneic hematopoietic stem cell transplantation Clinical Infectious Diseases 2001 32 9 1290 1297 10.1086/319984 2-s2.0-0035341289 11303263 \n21 Miyamura K. Hamaguchi M. Taji H. Successful ribavirin therapy for severe adenovirus hemorrhagic cystitis after allogeneic marrow transplant from close HLA donors rather than distant donors Bone Marrow Transplantation 2000 25 5 545 548 10.1038/sj.bmt.1702195 2-s2.0-17044442190 10713633 \n22 Saito M. Ueda S. Maeda T. Vidarabine therapy for virus-associated cystitis after allogeneic bone marrow transplantation Bone Marrow Transplantation 1997 20 6 485 490 10.1038/sj.bmt.1700923 2-s2.0-0030768715 9313882 \n23 Nakamura M. Kondo T. Umeda M. Kawabata H. Yamashita K. Takaori-Kondo A. Successful treatment with intravesical cidofovir for virus-associated hemorrhagic cystitis after allogeneic hematopoietic stem cell transplantation: a case report and a review of the literature Journal of Infection and Chemotherapy 2016 22 7 495 500 10.1016/j.jiac.2016.01.013 2-s2.0-84974712796 26898668 \n24 Ramsay I. D. Attwood C. Irish D. Griffiths P. D. Kyriakou C. Lowe D. M. Disseminated adenovirus infection after allogeneic stem cell transplant and the potential role of brincidofovir-case series and 10 year experience of management in an adult transplant cohort Journal of Clinical Virology 2017 96 73 79 10.1016/j.jcv.2017.09.013 2-s2.0-85030687370 29017084 \n25 Philippe M. Ranchon F. Gilis L. Cidofovir in the treatment of BK virus-associated hemorrhagic cystitis after allogeneic hematopoietic stem cell transplantation Biology of Blood and Marrow Transplantation 2016 22 4 723 730 10.1016/j.bbmt.2015.12.009 2-s2.0-84960471296 26718666 \n26 Labussiere-Wallet S. Dalianis T. Hanssen Rinaldo C. ECIL guidelines for the prevention, diagnosis and treatment of BK polyomavirus-associated haemorrhagic cystitis in haematopoietic stem cell transplant recipients Journal of Antimicrobial Chemotherapy 2018 73 1 12 21 29190347\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-6579",
"issue": "2020()",
"journal": "Case reports in hematology",
"keywords": null,
"medline_ta": "Case Rep Hematol",
"mesh_terms": null,
"nlm_unique_id": "101576456",
"other_id": null,
"pages": "6621967",
"pmc": null,
"pmid": "33294236",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "19786984;10713633;15361907;29582163;24982316;11418879;29038338;25374922;23146063;3026070;26718666;26898668;27207799;29017084;3014334;9313882;28298471;30546071;20877590;11303263;29190347;20848295;20837781",
"title": "Hemorrhagic Cystitis Secondary to Adenovirus and BK Virus Infection in a Diffuse Large B-Cell Lymphoma Patient with Recent CAR T-Cell Therapy.",
"title_normalized": "hemorrhagic cystitis secondary to adenovirus and bk virus infection in a diffuse large b cell lymphoma patient with recent car t cell therapy"
} | [
{
"companynumb": "US-BAXTER-2021BAX006504",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CYCLOPHOSPHAMIDE"
},
"drugadditional": "3",
... |
{
"abstract": "A 68-year-old man develops acute hepatocellular injury during treatment with direct-acting antiviral agents (DAA) for hepatitis C. Medical history reveals the intake of tamoxifen as adjuvant treatment for breast cancer, currently in remission. After stopping tamoxifen, despite the continuation of the anti-HCV agents, a complete resolution of liver injury occurs. This interesting case illustrates tamoxifen hepatotoxicity induced by CYP3A4 interaction with direct anti-HCV agents. It stresses the importance of checking for interactions before starting treatment for hepatitis C.",
"affiliations": "Department of Hepatogastroenterology, Cliniques universitaires Saint-Luc, Université Catholique de Louvain, Brussels, Belgium.;Department of Hepatogastroenterology, Cliniques universitaires Saint-Luc, Université Catholique de Louvain, Brussels, Belgium.",
"authors": "Wyffels|Klara|K|https://orcid.org/0000-0003-2520-7692;Horsmans|Yves|Y|",
"chemical_list": "D000998:Antiviral Agents; D013629:Tamoxifen",
"country": "England",
"delete": false,
"doi": "10.1177/1078155218819742",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1078-1552",
"issue": "25(8)",
"journal": "Journal of oncology pharmacy practice : official publication of the International Society of Oncology Pharmacy Practitioners",
"keywords": "Hepatotoxicity; drug interaction; hepatitis C; tamoxifen",
"medline_ta": "J Oncol Pharm Pract",
"mesh_terms": "D000368:Aged; D000998:Antiviral Agents; D056486:Chemical and Drug Induced Liver Injury; D004347:Drug Interactions; D019698:Hepatitis C, Chronic; D006801:Humans; D008297:Male; D013629:Tamoxifen",
"nlm_unique_id": "9511372",
"other_id": null,
"pages": "2038-2040",
"pmc": null,
"pmid": "30563414",
"pubdate": "2019-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Tamoxifen-induced hepatotoxicity caused by drug interaction with direct-acting antiviral agents for hepatitis C.",
"title_normalized": "tamoxifen induced hepatotoxicity caused by drug interaction with direct acting antiviral agents for hepatitis c"
} | [
{
"companynumb": "BE-TEVA-2019-BE-1160153",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "OMBITASVIR\\PARITAPREVIR\\RITONAVIR"
},
"drugad... |
{
"abstract": "To the best of our knowledge, we report the first case of pre-transplant unrecognized disseminated Coxiella burnetii infection, unmasked in the post-transplant period leading to both heart and kidney allograft dysfunction. A 59 year old man with a history of simultaneous heart-kidney transplantation due to end stage heart failure from severe aortic regurgitation (AR) and cryoglobulinemic immune complex mediated concentric necrotizing glomerulonephritis (GN), presents with a history of intermittent fevers and fatigue. Prior to transplantation he was treated for multiple episodes of culture negative endocarditis requiring bio-prosthetic valve replacement. Evaluation of fever included a transesophageal echocardiogram (TEE) that revealed a large hyperechoic mass on the anterior mitral leaflet with perforation, severe mitral regurgitation and moderate AR. Blood cultures were negative at that time. Owing to development of allograft mitral and aortic valve insufficiency, he underwent allograft bio-prosthetic mitral valve (MV) replacement and aortic valvuloplasty 2 years following his transplantation. Pathologic examination of the allograft mitral valve demonstrated fibrinopurulent exudate with degenerating bacterial organisms, consistent with vegetation and myxoid degenerative changes. Due to a high suspicion for native heart C. burnetii prosthetic valve endocarditis prior to transplantation, we re-evaluated the native explanted heart histopathology, as well as the explanted allograft MV. Cardiac allograft and native MV were positive for C. burnetii by real-time PCR. C. burnetii serology was consistent with persistent infection as well.",
"affiliations": "Division of Infectious Diseases, Department of Internal Medicine, Mayo Clinic, Rochester, Minnesota.;Division of Infectious Diseases, Department of Internal Medicine, Mayo Clinic, Rochester, Minnesota.;Division of Infectious Diseases, Department of Internal Medicine, Mayo Clinic, Rochester, Minnesota.;Division of Infectious Diseases, Department of Internal Medicine, Mayo Clinic, Rochester, Minnesota.;Division of Infectious Diseases, Department of Internal Medicine, Mayo Clinic, Rochester, Minnesota.;Unité de Recherche sur les Maladies Infectieuses et Tropicales Emergentes, UMR MEPHI, IRD, Assistance Publique-Hôpitaux de Marseille, Institut Hospitalo-Universitaire Méditerranée-Infection, Aix-Marseille Université, Marseille, France.;Division of Infectious Diseases, Department of Internal Medicine, Mayo Clinic, Rochester, Minnesota.",
"authors": "Jandhyala|Deeksha|D|http://orcid.org/0000-0002-8361-0714;Farid|Saira|S|;Mahmood|Maryam|M|;Deziel|Paul|P|;Abu Saleh|Omar|O|;Raoult|Didier|D|;Beam|Elena|E|",
"chemical_list": null,
"country": "Denmark",
"delete": false,
"doi": "10.1111/tid.12962",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1398-2273",
"issue": "20(5)",
"journal": "Transplant infectious disease : an official journal of the Transplantation Society",
"keywords": "Coxiella burnetii endocarditis; Q fever endocarditis; disseminated Coxiella burnetii; heart transplantation; kidney transplantation; transplant infectious diseases",
"medline_ta": "Transpl Infect Dis",
"mesh_terms": "D064591:Allografts; D001021:Aortic Valve; D001705:Bioprosthesis; D000071997:Blood Culture; D016997:Coxiella burnetii; D004697:Endocarditis, Bacterial; D006321:Heart; D016027:Heart Transplantation; D006350:Heart Valve Prosthesis; D006801:Humans; D007668:Kidney; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D009206:Myocardium; D057234:Preoperative Period; D011778:Q Fever; D019737:Transplants",
"nlm_unique_id": "100883688",
"other_id": null,
"pages": "e12962",
"pmc": null,
"pmid": "29975810",
"pubdate": "2018-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Unrecognized pre-transplant disseminated Coxiella burnetti infection diagnosed in a post-transplant heart-kidney recipient.",
"title_normalized": "unrecognized pre transplant disseminated coxiella burnetti infection diagnosed in a post transplant heart kidney recipient"
} | [
{
"companynumb": "PHHY2018US141017",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "3",
"druga... |
{
"abstract": "BACKGROUND\nAgranulocytosis has been reported as a delayed-onset complication of rituximab treatment. However, the exact incidence and risk factors of this complication in patients with nephrotic syndrome remain unknown.\n\n\nMETHODS\nRecords of 213 rituximab treatments for 114 patients with refractory nephrotic syndrome between February 2006 and April 2013 were reviewed to identify episodes of agranulocytosis (defined as an absolute neutrophil count of <500 mm(3)).\n\n\nRESULTS\nEleven episodes of agranulocytosis were detected in 11 patients. Median time of onset of agranulocytosis was 66 days (range, 54-161 days) after rituximab treatment. Nine patients experienced acute infections and received antibiotics. All but one patient received granulocyte colony-stimulating factor. Agranulocytosis resolved in all cases within a median of 3 days. The incidence of agranulocytosis was 9.6% in total patients and 5.2% in all treatments. Median age of the 11 patients who developed agranulocytosis was 6.4 years at the first rituximab treatment, significantly younger than the median age of the 103 patients who did not (median, 12.5 years; P = 0.0009). Five patients received re-treatment with rituximab. No recurrence of agranulocytosis was observed in any patient.\n\n\nCONCLUSIONS\nIt is important to pay extra attention to this clinically serious delayed-onset complication as it may be accompanied by life-threatening infections such as sepsis. Further clinical studies are needed to clarify its pathogenesis.",
"affiliations": "Department of Nephrology and Rheumatology, National Center for Child Health and Development, Tokyo, Japan.;Department of Nephrology and Rheumatology, National Center for Child Health and Development, Tokyo, Japan.;Department of Nephrology and Rheumatology, National Center for Child Health and Development, Tokyo, Japan.;Department of Nephrology and Rheumatology, National Center for Child Health and Development, Tokyo, Japan.;Department of Nephrology and Rheumatology, National Center for Child Health and Development, Tokyo, Japan.;Department of Nephrology and Rheumatology, National Center for Child Health and Development, Tokyo, Japan.;Department of Nephrology and Rheumatology, National Center for Child Health and Development, Tokyo, Japan.;Department of Nephrology and Rheumatology, National Center for Child Health and Development, Tokyo, Japan.",
"authors": "Kamei|Koichi|K|;Takahashi|Masaki|M|;Fuyama|Masaki|M|;Saida|Ken|K|;Machida|Hiroyuki|H|;Sato|Mai|M|;Ogura|Masao|M|;Ito|Shuichi|S|",
"chemical_list": "D058846:Antibodies, Monoclonal, Murine-Derived; D000970:Antineoplastic Agents; D016179:Granulocyte Colony-Stimulating Factor; D000069283:Rituximab",
"country": "England",
"delete": false,
"doi": "10.1093/ndt/gfu258",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0931-0509",
"issue": "30(1)",
"journal": "Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association",
"keywords": "B cell; agranulocytosis; infection; nephrotic syndrome; rituximab",
"medline_ta": "Nephrol Dial Transplant",
"mesh_terms": "D000293:Adolescent; D000380:Agranulocytosis; D058846:Antibodies, Monoclonal, Murine-Derived; D000970:Antineoplastic Agents; D002648:Child; D002675:Child, Preschool; D005260:Female; D016179:Granulocyte Colony-Stimulating Factor; D006801:Humans; D007223:Infant; D008297:Male; D009404:Nephrotic Syndrome; D012008:Recurrence; D012196:Review Literature as Topic; D012307:Risk Factors; D000069283:Rituximab",
"nlm_unique_id": "8706402",
"other_id": null,
"pages": "91-6",
"pmc": null,
"pmid": "25085238",
"pubdate": "2015-01",
"publication_types": "D016428:Journal Article; D016454:Review",
"references": null,
"title": "Rituximab-associated agranulocytosis in children with refractory idiopathic nephrotic syndrome: case series and review of literature.",
"title_normalized": "rituximab associated agranulocytosis in children with refractory idiopathic nephrotic syndrome case series and review of literature"
} | [
{
"companynumb": "JP-MYLANLABS-2015M1025734",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": null,
... |
{
"abstract": "Renal dysfunction frequently occurs in liver transplant recipients and is associated with increased morbidity and mortality. BK virus is a human polyoma virus that reactivates during immunocompromised states and is a known cause of renal allograft dysfunction in renal transplant recipients. However, BK nephropathy of native kidneys is rare in non-renal transplant recipients. There is no published data linking BK virus and renal dysfunction in liver transplant recipients. We describe the first confirmed case of native polyomavirus BK nephropathy in a liver transplant recipient. BK nephropathy should be considered in the differential diagnosis of new renal failure in liver transplant recipients.",
"affiliations": "Division of Nephrology, University of British Columbia, Vancouver, BC, Canada.;Department of Pathology and Laboratory Medicine, University of British Columbia, Vancouver, BC, Canada.;Trana Hussaini Faculty of Pharmaceutical Sciences University of British Columbia, Vancouver, BC, Canada.;Division of Nephrology, University of British Columbia, Vancouver, BC, Canada.;Division of Gastroenterology. University of British Columbia, Vancouver, BC, Canada.;Division of Gastroenterology. University of British Columbia, Vancouver, BC, Canada.;Division of Gastroenterology. University of British Columbia, Vancouver, BC, Canada.",
"authors": "Zeng|Yangmin|Y|;Magil|Alex|A|;Hussaini|Trana|T|;Yeung|C Kit|CK|;Erb|Siegfried R|SR|;Marquez-Alazagara|Vladimir|V|;Yoshida|Eric M|EM|",
"chemical_list": "D007166:Immunosuppressive Agents",
"country": "Mexico",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1665-2681",
"issue": "14(1)",
"journal": "Annals of hepatology",
"keywords": null,
"medline_ta": "Ann Hepatol",
"mesh_terms": "D001739:BK Virus; D015209:Cholangitis, Sclerosing; D058625:End Stage Liver Disease; D006084:Graft Rejection; D006801:Humans; D016867:Immunocompromised Host; D007166:Immunosuppressive Agents; D007674:Kidney Diseases; D016031:Liver Transplantation; D008297:Male; D008875:Middle Aged; D027601:Polyomavirus Infections; D014412:Tumor Virus Infections",
"nlm_unique_id": "101155885",
"other_id": null,
"pages": "137-40",
"pmc": null,
"pmid": "25536653",
"pubdate": "2015",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "First confirmed case of native polyomavirus BK nephropathy in a liver transplant recipient seven years post-transplant.",
"title_normalized": "first confirmed case of native polyomavirus bk nephropathy in a liver transplant recipient seven years post transplant"
} | [
{
"companynumb": "CA-SUN PHARMACEUTICAL INDUSTRIES LTD-2015US-103709",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drug... |
{
"abstract": "Background. A 61-year-old woman who had undergone an ileostomy closure 10 days previously presented to a tertiary medical center with abdominal pain, vomiting, diarrhea, dehydration, and oliguria. The patient had undergone a staged total proctocolectomy with ileal-pouch-anal anastomosis and a loop ileostomy 8 months previously to treat her steroid-refractory ulcerative colitis.Investigations. Physical examination, abdominal and pelvic CT scan, blood laboratory tests, pouch endoscopy, and fecal testing for Clostridium difficle toxins A and B.Diagnosis. Fulminant C. difficile-associated pouchitis and enteritis, which led to Psuedomonas aeruginosa septicemia, intravascular coagulopathy, acute renal failure, hemorrhagic ascites and respiratory failure and eventual death.Management. Intravenous hydration, aggressive therapy with oral and intravenous antibiotics, supportive care, hemodialysis, and intubation.",
"affiliations": "Digestive Disease Institute, The Cleveland Clinic Foundation, Cleveland, OH, USA.",
"authors": "Shen|Bo|B|;Remzi|Feza H|FH|;Fazio|Victor W|VW|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1038/nrgastro.2009.105",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1759-5045",
"issue": "6(8)",
"journal": "Nature reviews. Gastroenterology & hepatology",
"keywords": null,
"medline_ta": "Nat Rev Gastroenterol Hepatol",
"mesh_terms": "D016360:Clostridioides difficile; D003093:Colitis, Ulcerative; D004761:Enterocolitis, Pseudomembranous; D017809:Fatal Outcome; D005260:Female; D006801:Humans; D007081:Ileostomy; D008875:Middle Aged; D019449:Pouchitis; D011552:Pseudomonas Infections",
"nlm_unique_id": "101500079",
"other_id": null,
"pages": "492-5",
"pmc": null,
"pmid": "19654602",
"pubdate": "2009-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": "6789993;16540624;15889354;12068199;7202942;2914643;17368234;12576902;16179431;17103037;10789757;18484669;15486751;18467184",
"title": "Fulminant Clostridium difficile-associated pouchitis with a fatal outcome.",
"title_normalized": "fulminant clostridium difficile associated pouchitis with a fatal outcome"
} | [
{
"companynumb": "US-PFIZER INC-2019260376",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "PIPERACILLIN SODIUM\\TAZOBACTAM SODIUM"
},
"dr... |
{
"abstract": "Intersphincteric resection (ISR) aims to preserve anal function in patients with very low rectal tumors. Here, we analyzed patients who underwent neoadjuvant imatinib therapy followed by ISR for low rectal gastrointestinal stromal tumors (GISTs).\n\n\n\nWe retrospectively analyzed patients with low rectal GISTs who underwent neoadjuvant imatinib therapy and ISR between January 2013 and December 2015 at the University of Tokyo hospital.\n\n\n\nThe study included 4 men and 1 woman, with a median age of 67 years (range=45-67). All patients received 400 mg of neoadjuvant imatinib once daily for the median duration of 4 months (range=3-12). Microscopically, R0 resection was performed in 4 patients, and R1, in 1 patient. There was 1 recurrence event during the median follow-up duration of 35 months.\n\n\n\nNeoadjuvant imatinib therapy and ISR for low rectal GISTs is a challenging, but promising, alternative to achieve complete resection margins and preserve anal function.",
"affiliations": "Department of Surgical Oncology, Faculty of Medicine, The University of Tokyo, Tokyo, Japan m.kaneko@fancy.ocn.ne.jp.;Department of Surgical Oncology, Faculty of Medicine, The University of Tokyo, Tokyo, Japan.;Department of Surgical Oncology, Faculty of Medicine, The University of Tokyo, Tokyo, Japan.;Department of Surgical Oncology, Faculty of Medicine, The University of Tokyo, Tokyo, Japan.;Department of Surgical Oncology, Faculty of Medicine, The University of Tokyo, Tokyo, Japan.;Department of Surgical Oncology, Faculty of Medicine, The University of Tokyo, Tokyo, Japan.;Department of Surgical Oncology, Faculty of Medicine, The University of Tokyo, Tokyo, Japan.;Department of Surgical Oncology, Faculty of Medicine, The University of Tokyo, Tokyo, Japan.;Department of Surgical Oncology, Faculty of Medicine, The University of Tokyo, Tokyo, Japan.;Department of Surgical Oncology, Faculty of Medicine, The University of Tokyo, Tokyo, Japan.;Department of Surgical Oncology, Faculty of Medicine, The University of Tokyo, Tokyo, Japan.;Department of Surgical Oncology, Faculty of Medicine, The University of Tokyo, Tokyo, Japan.",
"authors": "Kaneko|Manabu|M|;Nozawa|Hiroaki|H|;Emoto|Shigenobu|S|;Murono|Koji|K|;Sasaki|Kazuhito|K|;Otani|Kensuke|K|;Nishikawa|Takeshi|T|;Tanaka|Toshiaki|T|;Kiyomatsu|Tomomichi|T|;Hata|Keisuke|K|;Kawai|Kazushige|K|;Watanabe|Toshiaki|T|",
"chemical_list": "D000970:Antineoplastic Agents; D047428:Protein Kinase Inhibitors; D000068877:Imatinib Mesylate",
"country": "Greece",
"delete": false,
"doi": "10.21873/anticanres.11936",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0250-7005",
"issue": "37(9)",
"journal": "Anticancer research",
"keywords": "Gastrointestinal stromal tumor; imatinib; low rectum; neoadjuvant therapy",
"medline_ta": "Anticancer Res",
"mesh_terms": "D000368:Aged; D000970:Antineoplastic Agents; D003131:Combined Modality Therapy; D005260:Female; D046152:Gastrointestinal Stromal Tumors; D006801:Humans; D000068877:Imatinib Mesylate; D008297:Male; D008875:Middle Aged; D020360:Neoadjuvant Therapy; D047428:Protein Kinase Inhibitors; D012004:Rectal Neoplasms; D016896:Treatment Outcome; D047368:Tumor Burden",
"nlm_unique_id": "8102988",
"other_id": null,
"pages": "5155-5160",
"pmc": null,
"pmid": "28870948",
"pubdate": "2017-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Neoadjuvant Imatinib Therapy Followed by Intersphincteric Resection for Low Rectal Gastrointestinal Stromal Tumors.",
"title_normalized": "neoadjuvant imatinib therapy followed by intersphincteric resection for low rectal gastrointestinal stromal tumors"
} | [
{
"companynumb": "JP-SUN PHARMACEUTICAL INDUSTRIES LTD-2017RR-154127",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "IMATINIB"
},
"drugad... |
{
"abstract": "Progressive multifocal leucoencephalopathy is a serious side effect of natalizumab, a humanized monoclonal antibody approved for the treatment of multiple sclerosis. Here, we report a case of unexpected worsening of natalizumab-related progressive multifocal leucoencephalopathy following COVID-19. After natalizumab discontinuation, a slight neurological improvement was observed, but, two months later the patient was admitted to the hospital because of neurological deterioration and COVID-19 mild pneumonia. Except for SARS-CoV-2 infection, no other potential factors of neurological worsening were identified. Thus, we pose the hypothesis that SARS-CoV-2 was instrumental in the progressive multifocal leucoencephalopathy deterioration.",
"affiliations": "Department of Neurology, Brugmann University Hospital and Free University of Brussels (ULB), Brussels, Belgium. serena.borrelli.sb@gmail.com.;Department of Neurology, Brugmann University Hospital and Free University of Brussels (ULB), Brussels, Belgium.;Department of Neurology, Brugmann University Hospital and Free University of Brussels (ULB), Brussels, Belgium.;Service of Neurology, Department of Clinical Neurosciences, Lausanne University Hospital (CHUV) and University of Lausanne, Lausanne, Switzerland.",
"authors": "Borrelli|S|S|0000-0002-3186-1562;Dachy|B|B|;Gazagnes|M-D|MD|;Du Pasquier|R|R|",
"chemical_list": "D007155:Immunologic Factors; D000069442:Natalizumab",
"country": "United States",
"delete": false,
"doi": "10.1007/s13365-021-00980-2",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1355-0284",
"issue": "27(3)",
"journal": "Journal of neurovirology",
"keywords": "COVID-19; Multiple sclerosis; Natalizumab; Progressive multifocal leucoencephalopathy; SARS-CoV-2",
"medline_ta": "J Neurovirol",
"mesh_terms": "D000086382:COVID-19; D006801:Humans; D007155:Immunologic Factors; D007968:Leukoencephalopathy, Progressive Multifocal; D008297:Male; D008875:Middle Aged; D020529:Multiple Sclerosis, Relapsing-Remitting; D000069442:Natalizumab; D011014:Pneumonia; D000086402:SARS-CoV-2",
"nlm_unique_id": "9508123",
"other_id": null,
"pages": "510-513",
"pmc": null,
"pmid": "33876412",
"pubdate": "2021-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Unexpected worsening of progressive multifocal leucoencephalopathy following COVID-19 pneumonia.",
"title_normalized": "unexpected worsening of progressive multifocal leucoencephalopathy following covid 19 pneumonia"
} | [
{
"companynumb": "BE-BIOGEN-2020BI00849102",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "NATALIZUMAB"
},
"drugadditional": "3",
... |
{
"abstract": "Recently, cancer immunotherapy by immune checkpoint inhibitors has been considered one of the pillars for the treatment of cancer. Nivolumab is the first immune checkpoint inhibitor approved for lung cancer treatment in Japan. Although nivolumab has superior survival benefits and fewer adverse events than cytotoxic agents, it can generate dysimmune toxicities, known as immune-related adverse events. Although autoimmune manifestations are well-known immune-related adverse events, the development of infectious diseases is rare. Here, we report on a patient with advanced NSCLC in whom pulmonary tuberculosis developed rapidly during nivolumab treatment and discuss the potential mechanisms as well as what is known about infections during checkpoint inhibitor therapy.",
"affiliations": "Division of Respiratory Medicine, National Hospital Organization Kyoto Medical Center, Kyoto, Japan. Electronic address: kfujita-oka@umin.ac.jp.;Division of Clinical Pathology, National Hospital Organization Kyoto Medical Center, Kyoto, Japan.;Division of Respiratory Medicine, National Hospital Organization Kyoto Medical Center, Kyoto, Japan.",
"authors": "Fujita|Kohei|K|;Terashima|Tsuyoshi|T|;Mio|Tadashi|T|",
"chemical_list": "D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; C000594389:atezolizumab",
"country": "United States",
"delete": false,
"doi": "10.1016/j.jtho.2016.07.006",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1556-0864",
"issue": "11(12)",
"journal": "Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer",
"keywords": "Immune checkpoint inhibitor; Immunotherapy; Nivolumab; Opportunistic infection; Tuberculosis",
"medline_ta": "J Thorac Oncol",
"mesh_terms": "D000368:Aged; D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; D006801:Humans; D008297:Male; D016896:Treatment Outcome; D014397:Tuberculosis, Pulmonary",
"nlm_unique_id": "101274235",
"other_id": null,
"pages": "2238-2240",
"pmc": null,
"pmid": "27423391",
"pubdate": "2016-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Anti-PD1 Antibody Treatment and the Development of Acute Pulmonary Tuberculosis.",
"title_normalized": "anti pd1 antibody treatment and the development of acute pulmonary tuberculosis"
} | [
{
"companynumb": "JP-BRISTOL-MYERS SQUIBB COMPANY-BMS-2016-061270",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "NIVOLUMAB"
},
"drugaddi... |
{
"abstract": "BACKGROUND\nEven though remarkable progress for diagnostics of pulmonary TB has been made, it is still a challenge to establish a definitive diagnosis for extrapulmonary TB (EPTB) in clinical practice. Among all the presentations of EPTB, cold abscesses are unusual and deceptive, which are often reported in the chest wall and spine. Subcutaneous abscess in the connective tissue of limbs is extremely rare.\n\n\nMETHODS\nA 48-year-old man with dermatomyositis was hospitalized because of multiple subcutaneous tuberculous abscesses in his limbs, but without pulmonary tuberculosis. Particularly, one insidious abscess appeared during anti-TB treatment due to \"paradoxical reaction\". After routine anti-TB therapy, local puncture drainage and surgical resection, the patient was cured and discharged.\n\n\nCONCLUSIONS\nTuberculous infection should be kept in mind for the subcutaneous abscess of immunocompromised patients, even without previous TB history. Treatment strategy depends on the suppurating progress of abscess lesions. Meanwhile, complication of newly-developed insidious abscess during treatment should be vigilant.",
"affiliations": "Department of Tuberculosis, the second hospital of Nanjing, Nanjing University of Chinese Medicine, 1-1 Zhongfu Road, Gulou district, Nanjing, 210003, Jiangsu province, China.;Department of Tuberculosis, the second hospital of Nanjing, Nanjing University of Chinese Medicine, 1-1 Zhongfu Road, Gulou district, Nanjing, 210003, Jiangsu province, China. njyy002@njucm.edu.cn.;Clinical Research Center, the second hospital of Nanjing, Nanjing University of Chinese Medicine, 1-1 Zhongfu Road, Gulou district, Nanjing, 210003, Jiangsu province, China. weichennannan2017@163.com.",
"authors": "Gao|Weiwei|W|;Zeng|Yi|Y|;Chen|Wei|W|http://orcid.org/0000-0003-1526-4677",
"chemical_list": "D000995:Antitubercular Agents",
"country": "England",
"delete": false,
"doi": "10.1186/s12879-020-05137-w",
"fulltext": "\n==== Front\nBMC Infect Dis\nBMC Infect. Dis\nBMC Infectious Diseases\n1471-2334 BioMed Central London \n\n5137\n10.1186/s12879-020-05137-w\nCase Report\nMultiple subcutaneous tuberculous abscesses in a dermatomyositis patient without pulmonary tuberculosis: a case report and literature review\nGao Weiwei weiweigao1106@163.com 1 Zeng Yi njyy002@njucm.edu.cn 1 http://orcid.org/0000-0003-1526-4677Chen Wei weichennannan2017@163.com 2 1 grid.410745.30000 0004 1765 1045Department of Tuberculosis, the second hospital of Nanjing, Nanjing University of Chinese Medicine, 1-1 Zhongfu Road, Gulou district, Nanjing, 210003 Jiangsu province China \n2 grid.410745.30000 0004 1765 1045Clinical Research Center, the second hospital of Nanjing, Nanjing University of Chinese Medicine, 1-1 Zhongfu Road, Gulou district, Nanjing, 210003 Jiangsu province China \n12 6 2020 \n12 6 2020 \n2020 \n20 40925 2 2020 4 6 2020 © The Author(s) 2020Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.Background\nEven though remarkable progress for diagnostics of pulmonary TB has been made, it is still a challenge to establish a definitive diagnosis for extrapulmonary TB (EPTB) in clinical practice. Among all the presentations of EPTB, cold abscesses are unusual and deceptive, which are often reported in the chest wall and spine. Subcutaneous abscess in the connective tissue of limbs is extremely rare.\n\nCase presentation\nA 48-year-old man with dermatomyositis was hospitalized because of multiple subcutaneous tuberculous abscesses in his limbs, but without pulmonary tuberculosis. Particularly, one insidious abscess appeared during anti-TB treatment due to “paradoxical reaction”. After routine anti-TB therapy, local puncture drainage and surgical resection, the patient was cured and discharged.\n\nConclusions\nTuberculous infection should be kept in mind for the subcutaneous abscess of immunocompromised patients, even without previous TB history. Treatment strategy depends on the suppurating progress of abscess lesions. Meanwhile, complication of newly-developed insidious abscess during treatment should be vigilant.\n\nKeywords\nTuberculousAbscessSubcutaneousLimbDermatomyositishttp://dx.doi.org/10.13039/501100004608Natural Science Foundation of Jiangsu ProvinceBK20170133Chen Wei issue-copyright-statement© The Author(s) 2020\n==== Body\nBackground\nTuberculosis (TB) is still a major issue for public health in the developing countries even through tremendous efforts [1]. Its causative agent, Mycobacterium tuberculosis (MTB) mainly invades the lungs and causes pulmonary TB (PTB). Recently, the occurrence rate of extrapulmonary TB (EPTB) presents a significant rising trend, especially among people with immunocompromise [2, 3], and accounts for 15–30% of all the TB cases [4]. EPTB could originate from either endogenous or exogenous infection. The tricky point is, it is hard to establish a definitive diagnosis for EPTB, and prone to delay treatment, since the clinical symptoms and imaging characteristics are usually diverse and vague [5]. Among all the presentations of EPTB, cold abscesses are unusual and deceptive [6, 7]. Tuberculous abscess is often observed in the chest wall and spine [8–10]. Subcutaneous tuberculous abscess refers to MTB infection in the subcutaneous connective tissue and skeletal muscle, which is an extremely rare type of EPTB [11]. Only 5 cases are reported in limbs in PubMed database from 2000 to 2019. In this report, we presented a middle-aged man with dermatomyositis who suffered from multiple subcutaneous tuberculous abscesses in his limbs, but without PTB.\n\nCase presentation\nA 48-year-old man was admitted to our hospital because of tuberculous abscesses. The patient had been diagnosed as dermatomyositis in another hospital since one year ago and had taken low dose prednisolone (15 mg/d) continuously. One month before hospitalization, he unconsciously noticed two swellings in his limbs without pain and redness. The patient was suspected of TB infection in another hospital and transferred to our hospital, which is the designated hospital for infectious diseases in Nanjing district. At admission, the patient had no other symptoms, such as tenderness, redness, fever, cough or night sweats. In addition, his medical history showed that he had neither underlying disease, like diabetes, hypertension, or coronary heart disease, nor trauma and intramuscular injection recently. Neither he nor his family had previous history of TB ever.\n\nPhysical examinations revealed two soft tissue swellings on the left lower humeru and the tront of left femur, approximately 4.0 × 5.0 cm and 5.0 × 12.0 cm, respectively. The overlying skins presented with normal temperature, scars, rash or sinuses (Fig. 1A and B). A systematic laboratory examination of the patient did not find any abnormities for blood routine test, liver and renal function tests, common neoplasms, the cardiovascular and neurological functions. The level of NT-proBNP, neoplastic markers, anti-neutrophil cytoplasmic antibodies, C3, C4 and IgG4 were negative or normal. C-reactive protein was 12.9 mg/dL, and the erythrocyte sedimentation rate value was 80 mm/h. Computed tomography (CT) scans did not find any active TB lesion in the lung (Fig. 2). Magnetic resonance imaging (MRI) of the left humerus and the left femoral showed two different fluid collection extension along the path of subcutaneous connective tissue. The abscess on the left femoral penetrated the posterior abdominal wall musculature and formed a sinus tract (Fig. 3).\nFig. 1 Localization of three swellings in the limbs. One soft-tissue swelling on the tront of left femur (ca. 5.0 × 12.0 cm) (A), one soft-tissue swelling on the left lower humeru (ca. 4.0 × 5.0 cm) (B), and another mass on the right femur above the right armpit (ca.6.0 × 8.0 cm) (C). The sites of abscesses were defined by circles\n\nFig. 2 Chest CT scan showed interstitial change in both lower lungs under the pleur without active TB lesion\n\nFig. 3 MRI of subcutaneous abscesses in the limbs pre and post treatment. MRI of the left femoral showed two different fluid collections extended along the path of subcutaneous connective tissue (upper panel, A and B). There was a spot with slightly high signal at the lower end of the left humerus (middle panel, D). After the comprehensive treatment, the left femur and the left humerus abscesses faded away obviously (C and E). Another mass was on the right femur above the right popliteal fossa, without fluid fluctuation (lower panel, F and G). After surgical removal of the abscesses, the abscess lesion on the right humerus was restored (H)\n\n\n\nThe pus isolated from the subcutaneous abscesses by needle aspiration was positive for Ziehl-Neelsen staining (2+). qPCR confirmed the presence of MTB DNA. GeneXpert MTB/RIF assay showed that the MTB strain was susceptible to rifampicin. Drug susceptibility test further revealed that the cultured MTB strain was susceptible to all the first-line anti-TB drugs. Once upon confirming the tuberculous lesions, anti-TB regimen was initiated, including isoniazid (600 mg qd), rifampicin (600 mg qd), ethambutol (750 mg qd), pyrazinamide (1000 mg qd). Meanwhile, pus drainage was conducted once every other day. 50 ml and 200 ml of yellow pus were extracted per puncture from the abscess of the left humerus and the left femoral, respectively, followed by direct injection of 0.5 g and 1.0 g streptomycin. No complications occurred during the process of puncture, drainage and drug injection. After two months of treatment, the two abscesses faded obviously (Fig. 3).\n\nUnfortunately, another subcutaneous lump emerged at the back of the right thigh, 6.0 × 8.0 cm in size, without warm, redness or pain (Fig. 1C). Different from the previous two abscesses, there was no fluid fluctuation within this lump when touched. A needle aspiration only got little pus, which was remarkably MTB-positive. Since the hard lump did not suppurate, it was excised by surgical operation. Histopathological examinations of the lump tissue revealed caseous necrosis and tuberculous granulomas inflammation. One week after surgery, the patient with wound healing well was discharged and accepted postoperative anti-TB medication for 12 months. At one-year follow-up, MRI did not find any lump or abscess recurrence.\n\nDiscussion and conclusion\nWe performed a retrospective study of patients with tuberculous abscess in the PubMed database, with keywords “tuberculosis” and “abscess”. Only the articles in English were counted. From 2000 to 2019, 329 cases of tuberculous abscess are reported totally. The predominant site of tuberculous abscess is the thoracic and abdominal wall (39.2%), followed by paravertebral line (22.70%) and lymph node (9.81%) (Fig. 4). In these cases, there are only 5 cases (1.53%) occurring in the subcutaneous and muscle tissues of limbs, 2 males and 3 females, with average age of 50.2. Their clinical presentations are varied and non-specific, including chronic swelling with pain and cough or sputum. All of these patients have active PTB. 3 patients have underlying diseases, such as renal allograft and rheumatoid arthritis. Multiple big abscesses are observed for all of them and the most frequent sites are the thigh. The 2 patients without underlying diseases had single and small lesion. We noticed that the most frequent sites are the thigh. Luckily, like our patient, all the 5 patients have very good prognosis after treatment (summarized in Table S1).\nFig. 4 Distribution of different TB abscess lesions from 2000 to 2019\n\n\n\nHow are the subcutaneous tuberculous abscesses are caused? One of the high-risk factors is PTB, where the lung might be the primary infection site. MTB disseminated from the lung remains latent in the subcutaneous tissues until adverse conditions like immunosuppression or malnutrition [12]. However, in our case, the patient had no active or previous PTB, which excluded the possibility of pulmonary dissemination. On the other side, trauma, injury or local injection might cause subcutaneous and muscle tuberculous infection through direct introduction of mycobacteria [13]. In our case, the patient recently had neither trauma nor injection. It’s worthy to note that the patient had dermatomyositis, with long-term administration of hormones. He was at an immunocompromised condition and susceptible to variable infections. In addition, dermatomyositis mainly impairs the skin and muscle of the limb [14, 15]. Once infection, pathogens are difficult to be eliminated and prone to spread along the fascia and muscular tissues [16]. Therefore, we inferred that dermatomyositis promoted the development of subcutaneous tuberculous abscesses.\n\nAs for the third abscess at the back of the right thigh, it was very insidious and not perceived at the first physical examination. This abscess appeared after two-month anti-TB therapy, when another two foci showed obvious absorption. This was reminiscent of a similar case where a woman with miliary TB developed subcutaneous abscesses after 5 months of anti-TB treatment [17]. Actually, the phenomenon is defined as “paradoxical reaction”, which manifests as deterioration of pre-existing tuberculous lesions or development of new lesions during anti-TB treatment [18, 19]. Paradoxical tuberculous reaction is more common in the HIV-positive TB patients [20].\n\nThe management of TB subcutaneous tuberculous abscess includes pharmacological and surgical treatment, with drainage and surgical debridement. The challenge to treat tuberculous abscess only lies in anti-TB drugs, since it is difficult for them to penetrate the wall of a pyogenic abscess, leading to an unsatisfactory outcome. Pus puncture followed by drug injection enhances the efficacy of anti-TB therapy, reduces surgical trauma, and avoids postoperative complications, making it a safe and feasible treatment option for tuberculous abscesses [21, 22]. It’s reported that surgical treatment performed during the exudative phase of lumbar spine TB significantly increased the incidence of abscess recurrence, unhealed lesions, and sinus tract formation [23]. Hence, preoperative anti-TB therapy is necessary for patients with tuberculous abscesses. On the other hand, treatment strategy often depends on the progress of the abscess lesion. If the lesion is suppurated, puncture and local injection of anti-TB drugs are recommended. If the lesion is not suppurated or could not be extracted by puncture, surgical resection should be considered.\n\nIn conclusion, we described an extremely rare case about a dermatomyositis patient with multiple subcutaneous tuberculous abscesses in the limbs, but without PTB. Through pus puncture, surgical resection, and comprehensive anti-TB regimen, the patient was successfully cured and discharged. Tuberculous infection should be kept in mind when an unexplained swelling occurred in the limbs of immunocompromised patients, even though no previous TB history.\n\nSupplementary information\n\nAdditional file 1 Table 1 Clinical characteristics of patients with tuberculous abscess in limbs.\n\n \nAdditional file 2.\n\n\n \n\n\nAbbreviations\nTBTuberculosis\n\nPTBPulmonary tuberculosis\n\nEPTBExtrapulmonary tuberculosis\n\nMTBMycobacterium tuberculosis\n\n\nMRIMagnetic resonance imaging\n\nCTComputed tomography\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nSupplementary information\nSupplementary information accompanies this paper at 10.1186/s12879-020-05137-w.\n\nAcknowledgements\nNot applicable.\n\nConsent to publication\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor of this journal.\n\nAuthors’ contributions\nWWG conducted the literature review and wrote the draft. YZ and WC conceived the study and revised the manuscript. All authors have read and approved the manuscript.\n\nFunding\nThis work was supported by Natural Science Foundation of Jiangsu province (Grant No. BK20170133), which paid the article processing charge.\n\nAvailability of data and materials\nData relating to this study are contained and presented in this document. Other materials are available from the corresponding authors on reasonable request.\n\nEthics approval and consent to participate\nThis study was approved by the institutional review boards of the Second Hospital of Nanjing (2017-LY-kt011).\n\nCompeting interests\nThe authors declare that they have no competing interests.\n==== Refs\nReferences\n1. Global tuberculosis report 2019, Geneva: World Health Organization. 2019, Licence: CC BY-NC-SA 3.0 IGO.\n2. Gomes da Rocha Dias AP, von Amann B, Costeira J, Gomes C, Bárbara C: Extrapulmonary tuberculosis in HIV infected patients admitted to the hospital. European Respiratory Journal 2016, 48(suppl 60):PA2761.\n3. Sester M Leth Fv, Bruchfeld J, Bumbacea D, Cirillo DM, Dilektasli AG, Domínguez J, Duarte R, Ernst M, Eyuboglu FO et al: risk assessment of tuberculosis in Immunocompromised patients. A TBNET study Am J Respir Crit Care Med 2014 190 10 1168 1176 25303140 \n4. Rodriguez-Takeuchi SY Renjifo ME Medina FJ Extrapulmonary tuberculosis: pathophysiology and imaging findings RadioGraphics 2019 39 7 2023 2037 31697616 \n5. Ramirez-Lapausa M Menendez-Saldana A Noguerado-Asensio A Extrapulmonary tuberculosis: an overview Rev Esp Sanid Penit 2015 17 9 \n6. Brown S Thekkinkattil DK Tuberculous cold abscess of breast: an unusual presentation in a male patient Gland Surg 2016 5 3 361 365 27294045 \n7. Dv K, Gunasekaran K, Mishra AK, Iyyadurai R: Disseminated tuberculosis presenting as cold abscess of the thyroid gland—a case report. Oxford Medical Case Reports 2017, 2017(9).\n8. Hussain S Chest wall tuberculous ulcer: a rare complication of pulmonary tuberculosis Indian J Tuberc 2016 63 4 265 267 27998501 \n9. Hsu H-E, Chen C-Y: Tuberculous retropharyngeal abscess with Pott disease and tuberculous abscess of the chest wall: A case report. Medicine 2019, 98(27).\n10. Srivastava AK, Sardhara J, Godbole C, Behari S: Surgical Treatment of Spinal Tuberculosis Complicated with Extensive Abscess. In: Tuberculosis of the Central Nervous System. edn.: Springer; 2017: 447–459.\n11. Sezgin B Atilganoglu U Yigit O Ergün SS Cambaz N Demirkesen C Concomitant cutaneous metastatic tuberculous abscesses and multifocal skeletal tuberculosis Indian J Dermatol 2008 53 3 149 153 19882018 \n12. Pacheco C Silva E Miranda J Duarte R Cutaneous tuberculosis as metastatic tuberculous abscess J Bras Pneumol 2015 41 2 200 202 25972972 \n13. Kothavade R Dhurat R Mishra S Kothavade U Clinical and laboratory aspects of the diagnosis and management of cutaneous and subcutaneous infections caused by rapidly growing mycobacteria Eur J Clin Microbiol Infect Dis 2013 32 2 161 188 23139042 \n14. Hayeri MR Ziai P Shehata ML Teytelboym OM Huang BK Soft-tissue infections and their imaging mimics: from cellulitis to necrotizing fasciitis RadioGraphics 2016 36 6 1888 1910 27726741 \n15. Malik A Hayat G Kalia JS Guzman MA Idiopathic inflammatory myopathies: clinical approach and management Front Neurol 2016 7 64 27242652 \n16. Chen I-J Tsai W-P Wu Y-JJ Luo S-F Ho H-H Liou L-B Chen J-Y Kuo C-F Chang H-C Yang C-H Infections in polymyositis and dermatomyositis: analysis of 192 cases Rheumatology 2010 49 12 2429 2437 20837496 \n17. Mert A Bilir M Ozturk R Tabak F Ozaras R Tahan V Senturk H Aktuglu Y Tuberculous subcutaneous abscesses developing during miliary tuberculosis therapy Scand J Infect Dis 2000 32 1 37 40 10716075 \n18. Brown CS Smith CJ Breen RAM Ormerod LP Mittal R Fisk M Milburn HJ Price NM Bothamley GH Lipman MCI Determinants of treatment-related paradoxical reactions during anti-tuberculosis therapy: a case control study BMC Infect Dis 2016 16 1 479 27600661 \n19. Chen C-H Tsai J-J Shih J-F Perng R-P Tuberculous subcutaneous abscesses developing during chemotherapy for pulmonary tuberculosis Scand J Infect Dis 1993 25 1 149 152 8460341 \n20. Breen RAM Smith CJ Bettinson H Dart S Bannister B Johnson MA Lipman MCI Paradoxical reactions during tuberculosis treatment in patients with and without HIV co-infection Thorax 2004 59 8 704 707 15282393 \n21. Lai Z Shi S Fei J Han G Hu S A comparative study to evaluate the feasibility of preoperative percutaneous catheter drainage for the treatment of lumbar spinal tuberculosis with psoas abscess J Orthop Surg Res 2018 13 1 290 30454001 \n22. Ye F Zhou Q Feng D Comparison of the anteroposterior and posterior approaches for percutaneous catheter drainage of tuberculous psoas abscess Medical science monitor: international medical journal of experimental and clinical research 2017 23 5374 29127771 \n23. Kagimoto A Shibata S Resection of a Tuberculous abscess of the Thoracic Wall Kyobu geka The Japanese journal of thoracic surgery 2017 70 6 422 425 28595221\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2334",
"issue": "20(1)",
"journal": "BMC infectious diseases",
"keywords": "Abscess; Dermatomyositis; Limb; Subcutaneous; Tuberculous",
"medline_ta": "BMC Infect Dis",
"mesh_terms": "D000038:Abscess; D000995:Antitubercular Agents; D003882:Dermatomyositis; D004322:Drainage; D005121:Extremities; D006801:Humans; D008297:Male; D008875:Middle Aged; D016896:Treatment Outcome; D014382:Tuberculosis, Cutaneous",
"nlm_unique_id": "100968551",
"other_id": null,
"pages": "409",
"pmc": null,
"pmid": "32532200",
"pubdate": "2020-06-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": "29127771;10716075;23139042;25303140;27242652;27600661;27726741;8460341;27294045;25972972;19882018;30454001;20837496;31697616;28928976;15282393;31277156;27998501;28595221",
"title": "Multiple subcutaneous tuberculous abscesses in a dermatomyositis patient without pulmonary tuberculosis: a case report and literature review.",
"title_normalized": "multiple subcutaneous tuberculous abscesses in a dermatomyositis patient without pulmonary tuberculosis a case report and literature review"
} | [
{
"companynumb": "CN-FRESENIUS KABI-FK202007195",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ISONIAZID"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nNasopharyngeal carcinoma is endemic in Asia and angiogenesis is important for growth and progression. We hypothesized that pazopanib would have antiangiogenic activity in nasopharyngeal carcinoma.\n\n\nMETHODS\nA single arm monotherapy study of pazopanib in patients with WHO type II/III nasopharyngeal carcinoma who had metastatic/recurrent disease and failed at least one line of chemotherapy. A Simon's optimal 2-stage design was used. Patients with Eastern Cooperative Oncology Group (ECOG) 0-2 and adequate organ function were treated with pazopanib 800 mg daily on a 21-day cycle. The primary endpoint was clinical benefit rate (CR/PR/SD) achieved after 12 weeks of treatment. Secondary endpoints included toxicity and progression-free survival. Exploratory studies of dynamic-contrast enhanced computed tomography (DCE-CT) paired with pharmacokinetics (PK) of pazopanib was done.\n\n\nRESULTS\nThirty-three patients were accrued. Patients were ECOG 0-1 with median age of 50 years (range 36-68). There were 2 (6.1%) partial responses, 16 (48.5%) stable disease, 11 (33.3%) progressive disease, 4 (12.1%) were not evaluable for response. The clinical benefit rate was 54.5% (95% CI: 38.0-70.2). Ten patients (30.3%) received more than 6 cycles (4 months) of treatment and 7 (21.2%) had PR/SD that lasted at least 6 months. One patient each died from epistaxis and myocardial infarction. Common grade 3/4 toxicities included fatigue (15.2%), hand-foot syndrome (15.2%), anorexia (9.1%), diarrhea (6.1%), and vomiting (6.1%). Serial DCE-CT scans show significant reductions in tumor blood flow, permeability surface area product, and fractional intravascular blood volume.\n\n\nCONCLUSIONS\nPazopanib showed encouraging activity in heavily pretreated nasopharyngeal carcinoma with an acceptable toxicity profile.",
"affiliations": "Department of Medical Oncology, National Cancer Centre Singapore, Singapore. dmolwt@nccs.com.sg",
"authors": "Lim|Wan-Teck|WT|;Ng|Quan-Sing|QS|;Ivy|Percy|P|;Leong|Swan-Swan|SS|;Singh|Onkar|O|;Chowbay|Balram|B|;Gao|Fei|F|;Thng|Choon Hua|CH|;Goh|Boon-Cher|BC|;Tan|Daniel Shao-Weng|DS|;Koh|Tong San|TS|;Toh|Chee-Keong|CK|;Tan|Eng-Huat|EH|",
"chemical_list": "D020533:Angiogenesis Inhibitors; D007191:Indazoles; D011743:Pyrimidines; D013449:Sulfonamides; C516667:pazopanib",
"country": "United States",
"delete": false,
"doi": "10.1158/1078-0432.CCR-10-3409",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1078-0432",
"issue": "17(16)",
"journal": "Clinical cancer research : an official journal of the American Association for Cancer Research",
"keywords": null,
"medline_ta": "Clin Cancer Res",
"mesh_terms": "D000328:Adult; D000368:Aged; D020533:Angiogenesis Inhibitors; D000855:Anorexia; D044466:Asians; D002277:Carcinoma; D003967:Diarrhea; D004334:Drug Administration Schedule; D005221:Fatigue; D005260:Female; D006801:Humans; D007191:Indazoles; D053208:Kaplan-Meier Estimate; D008297:Male; D008875:Middle Aged; D000077274:Nasopharyngeal Carcinoma; D009303:Nasopharyngeal Neoplasms; D009362:Neoplasm Metastasis; D009364:Neoplasm Recurrence, Local; D009389:Neovascularization, Pathologic; D011743:Pyrimidines; D013449:Sulfonamides; D016896:Treatment Outcome; D014839:Vomiting",
"nlm_unique_id": "9502500",
"other_id": null,
"pages": "5481-9",
"pmc": null,
"pmid": "21712450",
"pubdate": "2011-08-15",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "A Phase II study of pazopanib in Asian patients with recurrent/metastatic nasopharyngeal carcinoma.",
"title_normalized": "a phase ii study of pazopanib in asian patients with recurrent metastatic nasopharyngeal carcinoma"
} | [
{
"companynumb": "PHHY2017SG119715",
"fulfillexpeditecriteria": "1",
"occurcountry": "SG",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "PAZOPANIB"
},
"drugadditional": null,
"druga... |
{
"abstract": "Pharmacogenetic analysis to explain or predict the response of a specific patient to drug therapy is increasingly used in clinical practice. This holds especially true for CYP genotyping in psychiatry. We present a patient with genetic polymorphisms in more than one CYP450 enzyme, resulting in reduced effectiveness of CYP enzymes, explaining the high drug serum trough levels of antipsychotics and antidepressants and difficulty in optimizing therapy and dosing. Mrs X was found to be a CYP1A2, CYP2D6, CYP3A4 intermediate and in addition a CYP2C19 poor metabolizer. For Mrs X, pharmacogenetic analysis has contributed to reconsider choice and use of medication. Prior knowledge of the genetic polymorphisms in this patient might have avoided treatment delay and discomfort.",
"affiliations": "Department of Pediatric Surgery and Intensive Care, Erasmus University Medical Center-Sophia Children's Hospital, Rotterdam, The Netherlands.;Department of Psychiatry, Brain Center Rudolf Magnus, University Medical Center Utrecht, Utrecht, The Netherlands.;Department of Clinical Chemistry & Hematology, University Medical Center Utrecht, Utrecht, The Netherlands.;Department of Psychiatry, Brain Center Rudolf Magnus, University Medical Center Utrecht, Utrecht, The Netherlands.;Department Hospital Pharmacy, University Medical Center Utrecht, Utrecht, The Netherlands.;Department of Clinical Chemistry & Hematology, University Medical Center Utrecht, Utrecht, The Netherlands.",
"authors": "Mian|Paola|P|;Somers|Metten|M|;Berg|Maarten Ten|MT|;Cahn|Winnie|W|;Wilting|Ingeborg|I|;Schaik|Ron van|RV|",
"chemical_list": "D000928:Antidepressive Agents; D014150:Antipsychotic Agents; D054316:Biomarkers, Pharmacological; D003577:Cytochrome P-450 Enzyme System; D019388:Cytochrome P-450 CYP1A2; D065731:Cytochrome P-450 CYP2C19; D019389:Cytochrome P-450 CYP2D6; D051544:Cytochrome P-450 CYP3A; D003024:Clozapine",
"country": "England",
"delete": false,
"doi": "10.2217/pgs-2019-0037",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1462-2416",
"issue": "20(8)",
"journal": "Pharmacogenomics",
"keywords": "antipsychotics; case report; cytochrome P450; pharmacogenetics; psychiatry",
"medline_ta": "Pharmacogenomics",
"mesh_terms": "D000928:Antidepressive Agents; D014150:Antipsychotic Agents; D054316:Biomarkers, Pharmacological; D003024:Clozapine; D019388:Cytochrome P-450 CYP1A2; D065731:Cytochrome P-450 CYP2C19; D019389:Cytochrome P-450 CYP2D6; D051544:Cytochrome P-450 CYP3A; D003577:Cytochrome P-450 Enzyme System; D004305:Dose-Response Relationship, Drug; D005260:Female; D005838:Genotype; D006801:Humans; D008875:Middle Aged; D010597:Pharmacogenetics; D011110:Polymorphism, Genetic; D011618:Psychotic Disorders",
"nlm_unique_id": "100897350",
"other_id": null,
"pages": "567-570",
"pmc": null,
"pmid": "31190622",
"pubdate": "2019-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "High levels of several antipsychotics and antidepressants due to a pharmacogenetic cause: a case report.",
"title_normalized": "high levels of several antipsychotics and antidepressants due to a pharmacogenetic cause a case report"
} | [
{
"companynumb": "NL-MYLANLABS-2019M1064785",
"fulfillexpeditecriteria": "1",
"occurcountry": "NL",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HALOPERIDOL"
},
"drugadditional": "3",
... |
{
"abstract": "Although liver injury after administration of the trimethoprim-sulfamethoxazole combination is rare, hepatocellular necrosis and cholestasis have developed in a few cases. We describe a patient who developed a severe, prolonged cholestatic reaction after trimethoprim-sulfamethoxazole administration. The findings from serial liver biopsy samples showed characteristic abnormalities of phospholipidosis that have not been previously described for trimethoprim-sulfamethoxazole-related hepatic injury. The most prominent finding on electron microscopic evaluation of the liver was the presence of prominent hepatocyte lysosomal inclusions characterized by concentric arrangements of membranous and lamellated structures. The patient improved after several courses of exchange plasmapheresis, which may have assisted in the removal of toxic drug-lipid complexes. The pathogenesis of this acquired secondary phospholipidosis is unknown. Possible mechanisms include generation of highly lipid-soluble metabolites and inhibition of the lysosomal enzyme phospholipase A1.",
"affiliations": "Department of Medicine, Jefferson Medical College, Philadelphia, Pennsylvania 19107.",
"authors": "Muñoz|S J|SJ|;Martinez-Hernandez|A|A|;Maddrey|W C|WC|",
"chemical_list": "D004338:Drug Combinations; D010743:Phospholipids; D014295:Trimethoprim; D013420:Sulfamethoxazole",
"country": "United States",
"delete": false,
"doi": "10.1002/hep.1840120223",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0270-9139",
"issue": "12(2)",
"journal": "Hepatology (Baltimore, Md.)",
"keywords": null,
"medline_ta": "Hepatology",
"mesh_terms": "D056486:Chemical and Drug Induced Liver Injury; D002780:Cholestasis, Intrahepatic; D004338:Drug Combinations; D005260:Female; D006801:Humans; D002479:Inclusion Bodies; D008099:Liver; D008107:Liver Diseases; D008247:Lysosomes; D008854:Microscopy, Electron; D008875:Middle Aged; D010743:Phospholipids; D010956:Plasmapheresis; D011537:Pruritus; D013420:Sulfamethoxazole; D014295:Trimethoprim; D014552:Urinary Tract Infections",
"nlm_unique_id": "8302946",
"other_id": null,
"pages": "342-7",
"pmc": null,
"pmid": "2167870",
"pubdate": "1990-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Intrahepatic cholestasis and phospholipidosis associated with the use of trimethoprim-sulfamethoxazole.",
"title_normalized": "intrahepatic cholestasis and phospholipidosis associated with the use of trimethoprim sulfamethoxazole"
} | [
{
"companynumb": "US-PFIZER INC-2019428094",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "LEVOTHYROXINE"
},
"drugadditional": null,
... |
{
"abstract": "To evaluate the impact of non-medical switch from rituximab originator (RTX-O) to biosimilar (RTX-B) in patients with RA.\n\n\n\nBetween October 2017 and October 2019, all patients on RTX-O in our centre requiring re-treatment were switched to RTX-B unless declined by the patient or specified by the treating clinician. Switch strategy effectiveness was assessed retrospectively using DAS28-CRP(3) and RTX retention, with patients remaining on RTX-O as a comparator group.\n\n\n\nThe number of patients switching to RTX-B was 255/337 (75.7%) while 82 (24.3%) remained on RTX-O. There was no difference in DAS28-CRP(3) 4 months post-RTX-B switch vs the same time point post-RTX-O previous cycle (paired data available in 60%). Eighteen-month retention estimates were 75.6% (95% CI: 69.4, 80.7%) for RTX-B group and 82.3% (95% CI: 70.4, 89.8%) for RTX-O [adjusted hazard ratio 1.52 (95% CI: 0.85, 2.73)]. The number of patients who discontinued RTX-B for loss of effectiveness (LOE) was 42/255 (16.5%), five (2.0%) for adverse effects (AEs). Risk of RTX-B discontinuation was associated with comorbidities and ≥2 previous biologic DMARDs. Risk of adverse outcome RTX cessation was associated with comorbidities, and reduced risk with number of previous RTX-O cycles and pre-switch cycle B cell depletion. The number of patients who switched back to RTX-O was 34/255 (13.3%) (LOE: 30, AEs: 4), while 13/255 (5.1%) started other biologic/targeted synthetic DMARDs. Of patients who switched back for LOE, 28/30 remained on RTX-O at a mean 7.7 months follow-up.\n\n\n\nNon-medical switch to RTX-B was largely effective. Factors associated with RTX-B discontinuation, including comorbidities, previous biologic DMARDs, and RTX-O treatment history, may inform switch decisions. Most patients who switched back to RTX-O for LOE remained on treatment at short-term follow-up.",
"affiliations": "Leeds Institute of Rheumatic and Musculoskeletal Medicine, University of Leeds, Chapel Allerton Hospital, Leeds, UK.;Leeds Institute of Rheumatic and Musculoskeletal Medicine, University of Leeds, Chapel Allerton Hospital, Leeds, UK.;Leeds Institute of Rheumatic and Musculoskeletal Medicine, University of Leeds, Chapel Allerton Hospital, Leeds, UK.;Leeds Institute of Rheumatic and Musculoskeletal Medicine, University of Leeds, Chapel Allerton Hospital, Leeds, UK.;Rheumatology Department, Leeds Teaching Hospitals NHS Trust, Leeds, UK.;Leeds Institute of Rheumatic and Musculoskeletal Medicine, University of Leeds, Chapel Allerton Hospital, Leeds, UK.;Leeds Institute of Rheumatic and Musculoskeletal Medicine, University of Leeds, Chapel Allerton Hospital, Leeds, UK.;Leeds Institute of Rheumatic and Musculoskeletal Medicine, University of Leeds, Chapel Allerton Hospital, Leeds, UK.;Rheumatology Department, Leeds Teaching Hospitals NHS Trust, Leeds, UK.",
"authors": "Melville|Andrew R|AR|0000-0002-2604-9123;Md Yusof|Md Yuzaiful|MY|0000-0003-3131-9121;Fitton|John|J|;Garcia-Montoya|Leticia|L|;Bailey|Lynda|L|;Dass|Shouvik|S|;Emery|Paul|P|0000-0002-7429-8482;Buch|Maya H|MH|;Saleem|Benazir|B|",
"chemical_list": "D018501:Antirheumatic Agents; D059451:Biosimilar Pharmaceuticals; D000069283:Rituximab",
"country": "England",
"delete": false,
"doi": "10.1093/rheumatology/keaa834",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1462-0324",
"issue": "60(8)",
"journal": "Rheumatology (Oxford, England)",
"keywords": "B cells; bDMARDs; biosimilars; rheumatoid arthritis; rituximab",
"medline_ta": "Rheumatology (Oxford)",
"mesh_terms": "D000368:Aged; D018501:Antirheumatic Agents; D001172:Arthritis, Rheumatoid; D059451:Biosimilar Pharmaceuticals; D057915:Drug Substitution; D005260:Female; D006801:Humans; D008297:Male; D055118:Medication Adherence; D008875:Middle Aged; D016016:Proportional Hazards Models; D012189:Retrospective Studies; D000069283:Rituximab; D016896:Treatment Outcome",
"nlm_unique_id": "100883501",
"other_id": null,
"pages": "3679-3688",
"pmc": null,
"pmid": "33432358",
"pubdate": "2021-08-02",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Real-world experience of effectiveness of non-medical switch from originator to biosimilar rituximab in rheumatoid arthritis.",
"title_normalized": "real world experience of effectiveness of non medical switch from originator to biosimilar rituximab in rheumatoid arthritis"
} | [
{
"companynumb": "GB-CELLTRION INC.-2021GB000649",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "RITUXIMAB-ABBS"
},
"drugadditional": nul... |
{
"abstract": "Tocilizumab (TCZ; Actemra/RoActemra) is an anti-interleukin (IL)-6 receptor antibody for the treatment of rheumatoid arthritis (RA) and other autoimmune diseases and cytokine storms. The present case is a 63-year-old female well-controlled RA patient, who presented with a progressive cognitive impairment after 34 months of TCZ administration. Brain magnetic resonance imaging (MRI) showed leukencephalopathy with a lactic acid peak in magnetic resonance spectroscopy (MRS), a decreased blood flow in single photon emission computed tomography (SPECT), and a decreased accumulation in fluorodeoxyglucose positron emission tomography (FDG-PET). The discontinuation of TCZ improved her cognitive function and brain MRI findings at 3 months after drug cessation. The present case suggests that TCZ may sometimes cause leukoencephalopathy after long-term administration, and thus the early discontinuation of TCZ is recommended to achieve a good prognosis.",
"affiliations": "Department of Neurology, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Japan.;Department of Neurology, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Japan.;Department of Neurology, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Japan.;Department of Neurology, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Japan.;Department of Neurology, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Japan.;Department of Neurology, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Japan.;Department of Neurology, Himeji Central Hospital, Japan.;Department of Neurology, Himeji Central Hospital, Japan.;Department of Neurology, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Japan.",
"authors": "Sasaki|Ryo|R|;Hishikawa|Nozomi|N|;Nomura|Emi|E|;Omote|Yoshio|Y|;Takemoto|Mami|M|;Yamashita|Toru|T|;Hatanaka|Noriko|N|;Higashi|Yasuto|Y|;Abe|Koji|K|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D016207:Cytokines; C502936:tocilizumab",
"country": "Japan",
"delete": false,
"doi": "10.2169/internalmedicine.5288-20",
"fulltext": "\n==== Front\nIntern Med\nIntern Med\nInternal Medicine\n0918-2918 1349-7235 The Japanese Society of Internal Medicine \n\n32999229\n10.2169/internalmedicine.5288-20\nCase Report\nTocilizumab-induced Leukoencephalopathy with a Reversible Clinical Course\nSasaki Ryo 1 Hishikawa Nozomi 1 Nomura Emi 1 Omote Yoshio 1 Takemoto Mami 1 Yamashita Toru 1 Hatanaka Noriko 2 Higashi Yasuto 2 Abe Koji 1 \n1 Department of Neurology, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Japan\n\n2 Department of Neurology, Himeji Central Hospital, Japan\nCorrespondence to Dr. Koji Abe, pwag680v@okayama-u.ac.jp\n\n\n30 9 2020 \n15 11 2020 \n59 22 2927 2930\n8 5 2020 4 6 2020 Copyright © 2020 by The Japanese Society of Internal MedicineThe Internal Medicine is an Open Access journal distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).Tocilizumab (TCZ; Actemra/RoActemra) is an anti-interleukin (IL)-6 receptor antibody for the treatment of rheumatoid arthritis (RA) and other autoimmune diseases and cytokine storms. The present case is a 63-year-old female well-controlled RA patient, who presented with a progressive cognitive impairment after 34 months of TCZ administration. Brain magnetic resonance imaging (MRI) showed leukencephalopathy with a lactic acid peak in magnetic resonance spectroscopy (MRS), a decreased blood flow in single photon emission computed tomography (SPECT), and a decreased accumulation in fluorodeoxyglucose positron emission tomography (FDG-PET). The discontinuation of TCZ improved her cognitive function and brain MRI findings at 3 months after drug cessation. The present case suggests that TCZ may sometimes cause leukoencephalopathy after long-term administration, and thus the early discontinuation of TCZ is recommended to achieve a good prognosis. \n\ntocilizumabTCZleukoencephalopathycognitive dysfunctionCOVID-19\n==== Body\nIntroduction\nTocilizumab (TCZ) is a humanized anti-interleukin (IL)-6 receptor monoclonal antibody for the treatment of moderate to severe active arthritis (RA) patients who are resistant to treatments with steroids, methotrexate (MTX), and tumor necrosis factor (TNF) inhibitors (1). TCZ has also been used for various diseases related to the autoimmune response. Recently, TCZ was reported to be one of the treatments for novel coronavirus disease (COVID-19) by suppressing cytokine storms (2).\n\nThe most common adverse events associated with TCZ are infection and abnormalities in laboratory tests including dyslipidemia, neutropenia, thrombocytopenia, and an abnormality of the liver enzymes (3). However, nervous adverse effects including leukoencephalopathy are significantly rare, and thus it is unclear how to prevent or treat such neurological events.\n\nWe herein report the first known case of leukoencephalopathy with a progressive cognitive impairment suspected to have been induced by TCZ, who demonstrated a recovery of her symptoms and magnetic resonance imaging (MRI) findings at 3 months after TCZ withdrawal.\n\nCase Report\nA 63-year-old woman was admitted to our hospital due to a gradually progressive cognitive impairment. She was previously diagnosed to have RA, and had thus started the administration of prednisolone (PSL) 10 mg/day followed by MTX 6 mg/week at age 58. At age 60, MTX administration was discontinued due to acute interstitial pneumonia, and TCZ 680 mg/month with tacrolimus 2 mg/day was started (Fig. 1). Since the disease activity of RA was controllable, the dose of TCZ was changed to 162 mg/week with tapering of PSL to 8 mg/day at age 62. At age 63, after 34 months from the initial TCZ administration, she developed forgetfulness in regard to taking her daily medicine and also in other daily life events, and therefore she visited to a local neurology clinic. She showed mild cognitive dysfunction with a score of 24/30 in a mini mental state examination (MMSE), 22/30 in Hasegawa dementia scale-revised (HDS-R), and 15/18 in a frontal assessment battery (Fig. 1, top). MRI showed high intensity lesions with edema in the bilateral temporal, frontal, and parietal lobes on fluid-attenuated inversion recovery images (Fig. 2A-C), where Gadolinium-enhanced T1-weighted MRI showed no enhancement (data not shown). She was therefore admitted to our hospital for further examination.\n\nFigure 1. Clinical course of the patient: At age 60, the administration of tocilizumab (TCZ) 680 mg/month with tacrolimus 2 mg/day was started. At age 62, the dose of TCZ was reduced to 162 mg/week with tapering of PSL to 8 mg/day. At age 63, after 34 months from the initial TCZ administration, she presented with progressive dementia which improved 3 months after TCZ discontinuation.\n\nFigure 2. A brain MRI showed leukencephalopathy in the bilateral temporal, frontal, and parietal lobes (A-C) with a lactic acid peak in MRS (D, arrowhead), a decreased blood flow in SPECT (E, arrowhead) and a decreased accumulation in FDG-PET (F, arrowhead). The brain MRI findings improved at 3 months after TCZ discontinuation (G-I, arrowheads).\n\nOn admission to our hospital, her blood pressure was 108/76 mmHg with a body temperature of 36.5 °C. Neurological examinations revealed hyperreflexia in all extremities with snout reflex. Her sensory, cerebellar, and autonomic systems were normal. Biochemical analyses showed elevated white blood cells (10,070 /μL, normal 3,300-8,600 /μl), normal C-reactive protein (0.02 mg/dL, normal 0.00-0.14 mg/dL), erythrocyte sedimentation rate (5 mm/hr), and elevated interleukin-6 (IL-6: 69 pg/mL, normal <4.0 pg/mL). Anti-glutamic acid decarboxylase, aquaporin 4, myelin oligodendrocyte glycoprotein, N-methyl-D-aspartate, human immunodeficiency virus, and Human T-cell leukemia virus type 1 antibodies were all negative. A cerebral spinal fluid study showed a normal pressure, slight pleocytosis (9 /μL, monocyte 100 %), and an elevated protein level (91 mg/dL, normal 10-40 mg/dL). The IgG index (5.63, normal <0.73) was elevated and an oligo clonal band was present. Bacterial, mycobacterium, and fungal cultures of cerebrospinal fluid (CSF) were negative. Polymerase chain reaction for JC virus DNA was negative. Whole body computed tomography showed no evident feature of malignancy. A follow-up brain MRI after 36 months from the initial TCZ administration showed no remarkable changes compared to the previous findings (data not shown). Magnetic resonance spectroscopy (MRS) revealed a lactic acid peak in the left temporal lobe (Fig. 2D, arrowhead) which was absent on the contralateral side. Radio isotope inspections showed a low accumulation in the left frontal lobe in brain single photon emission computed tomography [SPECT, using N-isopropyl-P-(123I) iodoamphetamine, and analyzed by the graph plot method] (Fig. 2E, arrowhead), and a decreased accumulation in the left frontal lobe lesion on 18F-fluoro-2-deoxyglucose positron emission tomography (FDG-PET) (Fig. 2F, arrowhead).\n\nBecause TCZ induced leukoencephalopathy was suspected, TCZ was stopped after 37 months from the initial administration. We continued PSL 7 mg/day and tacrolimus 2 mg/day, and newly started baricitinib 4 mg/day. After 3 months from starting the above therapy, the MMSE and HDS-R scores improved to 29/30 and 30/30 (Fig. 1), and the brain MRI findings also improved in the bilateral temporal, right frontal, and right parietal lobe lesions (Fig. 2G-I, arrowheads) without an exacerbation of the RA symptoms.\n\nDiscussion\nThe present case was a well-controlled RA patient who presented with a progressive cognitive impairment after 34 months of TCZ administration (Fig. 1). Brain MRI showed leukencephalopathy in the bilateral temporal, frontal, and parietal lobe (Fig. 2A-C) with a lactic acid peak in MRS (Fig. 2D, arrowhead), a decreased blood flow in SPECT (Fig. 2E, arrowhead) and a decreased accumulation in FDG-PET (Fig. 2F, arrowhead). We suspected her to have drug induced leukencephalopathy and therefore stopped TCZ administration. Three months later, both her dementia and the brain MRI findings improved (Fig. 2G-I, arrowheads).\n\nTCZ is an IgG1 class monoclonal antibody against IL-6 receptor, inhibiting the IL-6-mediated cascade of autoimmune cell differentiation and autoantibody production related to the inflammatory response (4). Conversely, IL-6 also works as a neurotrophic or tissue repair mediator regarding neuroprotection (5). Therefore, the inhibition of IL-6 potentially makes the central nervous system vulnerable to various types of damage resulting in leukoencephalopathy. In addition, the combination of tacrolimus administration may worsen the disruption of the blood brain barrier and thereby increase the toxic effect of TCZ (6). Prior MTX administration may be one of the potential causes of leukoencephalopathy, however, this is thought to be less likely because of the long range from discontinuation of MTX and the symptoms. TCZ induced leukoencephalopathy is rare (7, 8), and this is the first case report that showed an improvement of both the symptoms and in the MRI findings after TCZ withdrawal. Comparing the reported TCZ-induced leukoencephalopathy cases including ours, the common MRI findings may be the diffuse high intensity on fluid-attenuated inversion recovery (FLAIR) with the laterality of the lesions. However, it is unclear that the present case showed improvement of lesions only in the right frontal lobe. The accumulation of further cases, and more frequent MRI or neurological examinations are required to clarify the mechanisms of TCZ-induced leukoencephalopathy.\n\nTCZ has been used for RA (1) and Castleman disease (9), and also showed an efficacy in neuromyelitis optica (10). Recent reports revealed that TCZ could suppress cytokine storm in patients with COVID-19 (2, 11). Although the administration period of TCZ is shorter for COVID-19 patients than for RA patients, the potential adverse effect of TCZ for leukoencephalopathy should also be taken into account.\n\nThis is the first report of suspected TCZ induced leukoencephalopathy case who recovered at 3 months after TCZ withdrawal. The present case suggested that TCZ may cause leukoencephalopathy after long-term administration and the early discontinuation of TCZ is therefore recommended for to achieve a good prognosis.\n\n\nThe authors state that they have no Conflict of Interest (COI).\n\nFinancial Support\nThis work was partly supported by a Grant-in-Aid for Scientific Research (B) 17H0419611, (C) 15K0931607, 17H0975609, and 17K1082709, and by Grants-in-Aid from the Research Committees (Kaji R, Toba K, and Tsuji S) from the Japan Agency for Medical Research and Development 7211800049, 7211800130, and 7211700121.\n==== Refs\n1. \nBiggioggero M , Crotti C , Becciolini A , Favalli EG \nTocilizumab in the treatment of rheumatoid arthritis: an evidence-based review and patient selection\n. Drug Des Devel Ther \n13 : 57 -70\n, 2018 .\n2. \nLuo P , Liu Y , Qiu L , Liu X , Liu D , Li J \nTocilizumab treatment in COVID-19: a single center experience\n. J Med Virol \n10 : 1002 , 2020 .\n3. \nOgata A , Kato Y , Higa S , Yoshizaki K \nIL-6 inhibitor for the treatment of rheumatoid arthritis: a comprehensive review\n. Mod Rheumatol \n29 : 258 -267\n, 2019 .30427250 \n4. \nTanaka T , Narazaki M , Kishimoto T \nIL-6 in inflammation, immunity, and disease\n. Cold Spring Harb Perspect Biol \n6 : a016295 , 2014 .25190079 \n5. \nNarazaki M , Kishimoto T \nThe two-faced cytokine IL-6 in host defense and diseases\n. Int J Mol Sci \n19 : 3528 , 2018 .\n6. \nKochi S , Takanaga H , Matsuo H , Naito M , Tsuruo T , Sawada Y \nEffect of cyclosporin A or tacrolimus on the function of blood-brain barrier cells\n. Eur J Pharmacol \n372 : 287 -295\n, 1999 .10395024 \n7. \nKobayashi K , Okamoto Y , Inoue H , et al \nLeukoencephalopathy with cognitive impairment following tocilizumab for the treatment of rheumatoid arthritis (RA)\n. Intern Med \n48 : 1307 -1309\n, 2009 .19652436 \n8. \nYamaguchi Y , Furukawa K , Yamamoto T , Takahashi Y , Tanaka K , Takahashi M \nMultifocal encephalopathy and autoimmune-mediated limbic encephalitis following tocilizumab therapy\n. Intern Med \n53 : 879 -882\n, 2014 .24739610 \n9. \nNishimoto N , Sasai M , Shima Y , et al \nImprovement in Castleman's disease by humanized anti-interleukin-6 receptor antibody therapy\n. Blood \n95 : 56 -61\n, 2000 .10607684 \n10. \nAraki M , Matsuoka T , Miyamoto K , et al \nEfficacy of the anti-IL-6 receptor antibody tocilizumab in neuromyelitis optica: a pilot study\n. Neurology \n82 : 1302 -1306\n, 2014 .24634453 \n11. \nZhang C , Wu Z , Li JW , Zhao H , Wang GQ \nCytokine release syndrome (CRS) in severe COVID-19 and interleukin-6 receptor (IL-6R) antagonist tocilizumab may be the key to reduce the mortality\n. Int J Antimicrob Agents \n55 : 105954 , 2020 .32234467\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0918-2918",
"issue": "59(22)",
"journal": "Internal medicine (Tokyo, Japan)",
"keywords": "COVID-19; TCZ; cognitive dysfunction; leukoencephalopathy; tocilizumab",
"medline_ta": "Intern Med",
"mesh_terms": "D061067:Antibodies, Monoclonal, Humanized; D001172:Arthritis, Rheumatoid; D016207:Cytokines; D005260:Female; D006801:Humans; D056784:Leukoencephalopathies; D008279:Magnetic Resonance Imaging; D008875:Middle Aged; D049268:Positron-Emission Tomography",
"nlm_unique_id": "9204241",
"other_id": null,
"pages": "2927-2930",
"pmc": null,
"pmid": "32999229",
"pubdate": "2020-11-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "24634453;24739610;32234467;25190079;30423923;10607684;19652436;10395024;30587928;30427250",
"title": "Tocilizumab-induced Leukoencephalopathy with a Reversible Clinical Course.",
"title_normalized": "tocilizumab induced leukoencephalopathy with a reversible clinical course"
} | [
{
"companynumb": "JP-ACCORD-219721",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": "3",
"dru... |
{
"abstract": "Changes in estrogen receptor (ER) expression over the course of therapy may affect response to endocrine therapy. However, measuring temporal changes in ER expression requires serial biopsies, which are impractical and poorly tolerated by most patients. Functional ER imaging using (18)F-fluoroestradiol (FES)-PET provides a noninvasive measure of regional ER expression and is ideally suited to serial studies. Additionally, lack of measurable FES uptake in metastatic sites of disease predict tumor progression in patients with ER-positive primary tumors treated with endocrine therapy. This report presents a case of restored sensitivity to endocrine therapy in a patient with bone-dominant breast cancer who underwent serial observational FES-PET imaging over the course of several treatments at our center, demonstrating the temporal heterogeneity of regional ER expression. Although loss and restoration of endocrine sensitivity in patients who have undergone prior hormonal and cytotoxic treatments has been reported, this is, to our knowledge, the first time the accompanying changes in ER expression have been documented by molecular imaging.",
"affiliations": "University of Washington/Seattle Cancer Care Alliance, Seattle, Washington;University of Washington/Seattle Cancer Care Alliance, Seattle, Washington;University of Pennsylvania, Philadelphia, Pennsylvania;Oregon Health and Science University, Portland, Oregon;University of Washington/Seattle Cancer Care Alliance, Seattle, Washington;University of Arizona, Tucson, Arizona;University of Pennsylvania, Philadelphia, Pennsylvania;University of Washington/Seattle Cancer Care Alliance, Seattle, Washington",
"authors": "Currin|Erin|E|;Peterson|Lanell M|LM|;Schubert|Erin K|EK|;Link|Jeanne M|JM|;Krohn|Kenneth A|KA|;Livingston|Robert B|RB|;Mankoff|David A|DA|;Linden|Hannah M|HM|",
"chemical_list": "D019275:Radiopharmaceuticals; D011960:Receptors, Estrogen",
"country": "United States",
"delete": false,
"doi": "10.6004/jnccn.2016.0017",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1540-1405",
"issue": "14(2)",
"journal": "Journal of the National Comprehensive Cancer Network : JNCCN",
"keywords": null,
"medline_ta": "J Natl Compr Canc Netw",
"mesh_terms": "D001859:Bone Neoplasms; D001842:Bone and Bones; D001943:Breast Neoplasms; D005260:Female; D006801:Humans; D008875:Middle Aged; D057054:Molecular Imaging; D049268:Positron-Emission Tomography; D019275:Radiopharmaceuticals; D011960:Receptors, Estrogen",
"nlm_unique_id": "101162515",
"other_id": null,
"pages": "144-7",
"pmc": null,
"pmid": "26850484",
"pubdate": "2016-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural",
"references": "11519859;7001242;18327670;1757079;15639680;25380844;17438091;18287268;3262228;22149876;24079874;16682724",
"title": "Temporal Heterogeneity of Estrogen Receptor Expression in Bone-Dominant Breast Cancer: 18F-Fluoroestradiol PET Imaging Shows Return of ER Expression.",
"title_normalized": "temporal heterogeneity of estrogen receptor expression in bone dominant breast cancer 18f fluoroestradiol pet imaging shows return of er expression"
} | [
{
"companynumb": "US-SUN PHARMACEUTICAL INDUSTRIES LTD-2017US-144430",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "THIOTEPA"
},
"drugad... |
{
"abstract": "Whole-genome sequences for Stenotrophomonas maltophilia serial isolates from a bacteremic patient before and after development of levofloxacin resistance were assembled de novo and differed by one single-nucleotide variant in smeT, a repressor for multidrug efflux operon smeDEF. Along with sequenced isolates from five contemporaneous cases, they displayed considerable diversity compared against all published complete genomes. Whole-genome sequencing and complete assembly can conclusively identify resistance mechanisms emerging in S. maltophilia strains during clinical therapy.",
"affiliations": "Icahn Institute and Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Division of Infectious Diseases, Department of Medicine, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Icahn Institute and Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Icahn Institute and Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Department of Pathology, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Icahn Institute and Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Icahn Institute and Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Icahn Institute and Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Icahn Institute and Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Division of Infectious Diseases, Department of Medicine, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Division of Infectious Diseases, Department of Medicine, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Division of Infectious Diseases, Department of Medicine, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Icahn Institute and Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Division of Infectious Diseases, Department of Medicine, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Icahn Institute and Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Icahn Institute and Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York, USA andrew.kasarskis@mssm.edu.;Icahn Institute and Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York, USA.",
"authors": "Pak|Theodore R|TR|http://orcid.org/0000-0002-1676-2523;Altman|Deena R|DR|;Attie|Oliver|O|;Sebra|Robert|R|;Hamula|Camille L|CL|;Lewis|Martha|M|;Deikus|Gintaras|G|;Newman|Leah C|LC|;Fang|Gang|G|;Hand|Jonathan|J|;Patel|Gopi|G|;Wallach|Fran|F|;Schadt|Eric E|EE|;Huprikar|Shirish|S|;van Bakel|Harm|H|;Kasarskis|Andrew|A|;Bashir|Ali|A|",
"chemical_list": "D004269:DNA, Bacterial; D015363:Quinolones",
"country": "United States",
"delete": false,
"doi": "10.1128/AAC.01723-15",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0066-4804",
"issue": "59(11)",
"journal": "Antimicrobial agents and chemotherapy",
"keywords": null,
"medline_ta": "Antimicrob Agents Chemother",
"mesh_terms": "D004269:DNA, Bacterial; D024901:Drug Resistance, Multiple, Bacterial; D016680:Genome, Bacterial; D016905:Gram-Negative Bacterial Infections; D008826:Microbial Sensitivity Tests; D009154:Mutation; D015363:Quinolones; D020615:Stenotrophomonas maltophilia",
"nlm_unique_id": "0315061",
"other_id": null,
"pages": "7117-20",
"pmc": null,
"pmid": "26324280",
"pubdate": "2015-11",
"publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't",
"references": "15928010;15231754;9124855;9145884;18428693;11353642;11850246;12384340;19324881;18419807;20140025;21148543;22232370;23220575;23644548;24126583;24145530;24451623;25250641;25654114;15155232;14739147",
"title": "Whole-genome sequencing identifies emergence of a quinolone resistance mutation in a case of Stenotrophomonas maltophilia bacteremia.",
"title_normalized": "whole genome sequencing identifies emergence of a quinolone resistance mutation in a case of stenotrophomonas maltophilia bacteremia"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/15/0054854",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEVOFLOXACIN"
},
"drugadditional": "3",
... |
{
"abstract": "Numerous autoantibodies are implicated in the pathogenesis of autoimmune epilepsy. In the past decade, many case series reported the association of glutamic acid decarboxylase 65 (GAD 65) antibodies with epilepsy. Conjoint presence of GAD 65 antibodies with antinuclear, anti-thyroid, and anti-parietal cell antibodies has often been demonstrated. However, concomitant elevated levels of GAD 65 and P/Q voltage gated calcium channel (VGCC) antibodies is rare. We report a case of autoimmune epilepsy with conjoint GAD 65 and P/Q VGCC antibodies in the absence of malignancy. This report highlights a possible role of P/Q VGCC antibodies in the pathogenesis of autoimmune epilepsy.",
"affiliations": "Department of Neurosciences, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia.;Department of Neurosciences, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia.;Department of Neurosciences, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia.;Medical Intern, AlFaisal University, Riyadh, Saudi Arabia.",
"authors": "AlKhaja|Mohamed|M|;AlKawi|Ammar|A|;Abu-Ata|Mahmoud|M|;Mohammaddin|Asma|A|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.ebcr.2017.12.002",
"fulltext": "\n==== Front\nEpilepsy Behav Case RepEpilepsy Behav Case RepEpilepsy & Behavior Case Reports2213-3232Elsevier S2213-3232(17)30147-010.1016/j.ebcr.2017.12.002ArticleConjoint glutamic acid decarboxylase 65 and P/Q voltage gated calcium channel antibodies in autoimmune epilepsy: A case report AlKhaja Mohamed malkhaja70@kfshrc.edu.saa⁎AlKawi Ammar aAbu-Ata Mahmoud aMohammaddin Asma ba Department of Neurosciences, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabiab Medical Intern, AlFaisal University, Riyadh, Saudi Arabia⁎ Corresponding author. malkhaja70@kfshrc.edu.sa22 12 2017 2018 22 12 2017 9 26 28 5 11 2017 4 12 2017 13 12 2017 © 2017 The Authors2017This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Numerous autoantibodies are implicated in the pathogenesis of autoimmune epilepsy. In the past decade, many case series reported the association of glutamic acid decarboxylase 65 (GAD 65) antibodies with epilepsy. Conjoint presence of GAD 65 antibodies with antinuclear, anti-thyroid, and anti-parietal cell antibodies has often been demonstrated. However, concomitant elevated levels of GAD 65 and P/Q voltage gated calcium channel (VGCC) antibodies is rare. We report a case of autoimmune epilepsy with conjoint GAD 65 and P/Q VGCC antibodies in the absence of malignancy. This report highlights a possible role of P/Q VGCC antibodies in the pathogenesis of autoimmune epilepsy.\n==== Body\n1 Introduction\nAutoimmune epilepsy has become a fact in modern medicine. The new ILAE classification of the epilepsies recently added immune epilepsy as one of the etiological groups [1] Accumulating data support the presence an immune-mediated pathogenesis in drug-resistant epilepsy even in the absence of limbic encephalitis or malignancy. Examples of antibodies implicated in this disorder include N-methyl-d-aspartate receptor (NMDA) antibodies, voltage gated potassium channel complex (VGKCc) antibodies, collapsin response mediator protein 5 (CRMP-5) antibodies, ganglionic acetylcholine receptor antibodies, and GAD 65 antibodies [2]. Voltage gated calcium channel antibodies, on the other hand, have not yet been linked to autoimmune epilepsy.\n\n2 Case\nA 26-year-old right handed non-smoker female with history of type 1 diabetes mellitus (DM), hypothyroidism, hyperlipidemia, and asthma was referred to our clinic with a two year history of new onset recurrent seizures. She had no history of head trauma nor did she have a previous personal history of seizures. Moreover, there was no history of maternal illness during pregnancy. The patient was a product of spontaneous vaginal delivery and she cried immediately after birth. Her growth and development were normal. The patient describes two types of seizures. The first type started two years prior to her presentation, when she developed focal aware seizures in the form of a de ja vu which usually lasted for 10 to 15 s. The frequency of these seizures was twice every month, and they were not followed by convulsions. The patient visited a psychiatrist who diagnosed her with panic attacks and started her on escitalopram. Despite treatment with escitalopram, the patient continued to have recurrent focal aware seizures and developed a second type described as generalized tonic-clonic (GTC) convulsion without a preceding aura. Her diagnosis was revisited thereafter and she was started on levetiracetam which did not control her symptoms.\n\nBy the time she was referred to our clinic, the patient was already on levetiracetam 500 mg twice a day and lamotrigine 50 mg twice a day. Her cognitive (déjà vu) seizure frequency was once to twice per month, and she has already had multiple GTCs with a frequency of one every three months. The patient's examination was unremarkable upon presentation. EEG and MRI were ordered for further evaluation and her levetiracetam dose was increased. Her first EEG showed bilateral fronto-temporal intermittent slow activity with no epileptiform discharges. Her brain MRI was normal.\n\nThree months later, the patient came for a follow-up evaluation and reported that her seizures did not respond well to the levetiracetam dose increment, so her anti-seizure medications were further increased. A repeat EEG and a brain PET CT were ordered. Her second EEG demonstrated bilateral fronto-temporal epileptiform discharges in addition to intermittent slow activity in the bilateral fronto-temporal regions. The PET scan was reported normal.\n\nAfter coming for the third follow-up evaluation, the patient complained of experiencing a single episode of incomplete retrograde amnesia which lasted for one day. Her seizure frequency decreased this time. Her mental status and neurological exam were completely normal upon this visit. Anti-thyroid-peroxidase and anti-thyroglobulin antibodies were ordered and came back negative. A paraneoplastic panel was also ordered and showed elevated P/Q VGCC antibody levels of 0.05 nmol/L (normal: ≤ 0.02 nmol/L). Three months later, the same investigation was ordered and showed marginally elevated P/Q VGCC antibodies at a level of 0.05. To rule out malignancy, a CT of the chest, abdomen, and pelvis was done and reported normal.\n\nAt the next visit, the patient described suboptimal seizure control again; having 1–2 focal aware seizures per month and GTCs every three months despite reaching maximum doses of levetiracetam and lamotrigine. An epilepsy panel was ordered and the results showed elevated serum P/Q VGCC antibodies at a level of 0.06 nmol/L in addition to high GAD 65 antibody levels of 22.2 (normal: ≤ 0.02 nmol/L). Other antibodies including NMDA, VKGCc, and N-type VGCC were all negative. A lumbar puncture was performed to measure autoantibody levels in the CSF. White cell count, biochemistry, and cultures of CSF came out normal. Cerebrospinal fluid autoantibodies showed elevated GAD65 antibody levels of 0.27 nmol/L (normal: ≤ 0.02 nmol/L). Note that serum and CSF antibody levels were tested by Mayo clinic laboratories in Mayo Clinic (Rochester, Minnesota).\n\nGiven the absence of structural, infectious, and metabolic causes; in addition to the borderline positivity of antineuronal antibodies, the patient's diagnosis was presumed to be autoimmune epilepsy. She was given 1 g of intravenous methylprednisolone (IVMP) for 3 days followed by oral prednisone at a dose of 10 mg daily. Her anti-seizure drugs (ASDs) were kept at 1500 mg twice daily of levetiracetam and lamotrigine 150 mg twice daily. Her seizure frequency decreased to focal aware seizures (déjà vu) once every 3 months and had no further GTCs. Attempts of tapering oral prednisone and introducing azathioprine failed due to development of Azathioprine allergy and increased frequency of seizures on smaller doses of prednisone. A repeat MRI and EEG one year after starting steroid therapy was normal for both studies. This patient continues to be followed in the neurology and immunology clinics and was finally placed on mycophenolate mofetil 1 g BID in addition to her preexisting treatment regimen of prednisone and anti-seizure medications. By the time this report was written, the patient has completed 1 year of immunotherapy and steroids. Since then, she had only 4 focal aware seizures and no GTCs.\n\n3 Discussion\nGlutamic acid decarboxylase (GAD) is the major enzyme that catalyzes the conversion of glutamic acid to gamma aminobutyric acid (GABA). Two major types of GAD exist: GAD 65 and GAD67. GAD 65 is present in nerve terminals while GAD 67 is found all over the nerve cell. Antibodies directed against the GAD enzyme block the conversion of glutamic acid to GABA, therefore reducing GABA levels. Low levels of GABA, which is an inhibitory neurotransmitter, can cause seizures.\n\nSeveral neurological syndromes have been associated with anti-GAD antibodies including stiff person syndrome, cerebellar ataxia, epilepsy, limbic encephalitis, dancing eye syndrome, and Miller Fischer syndrome [3]. Aside from their well-known association with autoimmune disorders such as type 1 diabetes mellitus, presence of anti-GAD antibodies has been often found to be concomitant with other antibodies such as antithyroid, antinuclear, and antiparietal cell antibodies [4], [5]. However, conjoint presence of both anti-GAD 65 and anti-P/Q VGCC antibodies is very rare. As far as we know, this is the first reported case of autoimmune epilepsy with GAD 65 and P/Q VGCC antibodies.\n\nThe classical teaching about VGCC antibody positivity is its occurrence in Lambert Eaton myasthenic syndrome (LEMS) and lung cancer. Yet, its presence in many other oncological and neurological conditions has become recently known. Zalewski et al. reported positivity of VGCC antibodies in patients with variable neurological diagnoses such as autoimmune encephalopathy, degenerative dementia, cerebellar ataxia without demylination or stroke, multiple sclerosis, parkinsonism, and amyotrophic lateral sclerosis. Out of the 236 cases he included in his study, 24 had coexisting anti-VGCC (P/Q or N-type or both) and anti-GAD 65 antibodies. Nevertheless, the author did not elaborate on their presentations. Only 10 out of the 236 anti-VGCC antibody positive patients had seizures, 2 out of whom were attributed to autoimmune epilepsy. Interesting enough, 7 out of the 10 patients with seizures had low P/Q VGCC titers (0.03–0.09 nmol/L), 3 had moderate titers (0.1–0.99 nmol/L), and none had high titers [6].\n\nTiters of GAD 65 antibodies are usually 100–1000 times higher in neurological disorders than they are in patients with DM [7]. Titers that are ≤ 0.02 nmol/L are considered negative. 80% of patients with type 1 DM have mildly elevated titers (0.03–19.9 nmol/L). This is also true for 25% of patients with LEMS, myasthenia gravis, and other rarer autoimmune disorders [8], [9]. When GAD 65 antibody titers exceed 20 nmol/L and patients have neurological symptoms, an autoimmune etiology of the symptoms should highly be suspected. Neurological manifestations associated with such values include cerebellar ataxia, seizures with or without encephalitis, stiff man phenomena, and brainstem involvement (nystagmus, ophthalmoplegia, dysphagia, and vertigo) [10].\n\nThe association of GAD 65 antibodies with immune mediated temporal lobe epilepsy has become an established finding in literature. Errichello et al. reported 4 anti-GAD 65 positive TLE cases, M. Falip reported 5 cases, while Malter et al. looked at the treatment outcomes of 13 cases with the same condition [11], [12], [13]. Our case consolidates the current evidence about the association of GAD antibodies and temporal lobe epilepsy. It also raises a question about a possible role for anti P/Q VGCC antibodies in autoimmune temporal lobe epilepsy.\n\nMany controversies arise around the management of autoimmune epilepsy. Lack of response to pulse steroids has been considered a major feature in anti-GAD antibody positive encephalitis according to some literature [14]. On the contrary, a cohort of 13 patients with anti-GAD antibody positive TLE compared the following therapies with each other: corticosteroids, apheresis, intravenous immunoglobulin, natalizumab, and epilepsy surgery. All patients were placed on antiepileptics. The best therapeutic outcome was seen in the corticosteroid group which achieved a reduction of seizure frequency by more than 50% in 45% of the patients studied [12]. Our case showed a significant improvement with pulse and oral corticosteroids to further support possible benefits of steroids in anti-GAD antibody autoimmune epilepsy.\n\nLooking into the management of anti-P/Q VGCC positive epilepsy, we found two cases reported in literature. The first case had conjoint anti-GABA B and VGCC antibodies manifesting with a clinical picture of autoimmune limbic epilepsy. The patient received multiple ASDs, IV steroids, IVIG, plasmapheresis, and rituximab. Seizure frequency reduction was achieved during a 3 month follow-up period with the author suggesting that rituximab is a safe and efficacious treatment option in autoimmune limbic epilepsy [15]. The second case had positive voltage gated potassium channel complex (VGKCc) and P/Q VGCC antibodies in a patient with autoimmune encephalopathy and refractory seizures. Significant improvement was seen during a 1 month follow-up after treatment with IVMP and IVIG [16].\n\nIn our case, the possibility of immune-mediated epilepsy was only entertained after ruling out other causes. Although antineuronal antibodies were borderline positive, their clinical significance should not be ruled out. False positive results are also a possibility, however, GAD 65 antibodies were measured in serum and then measured in CSF three months later. Equally important, P/Q VGCC antibody levels were measured in serum at 3 separate clinic visits which were 3 months apart. Levels of GAD 65 antibodies in our patient were higher than what would be expected in type 1 DM. P/Q VGCC antibody levels, on the other hand, were mildly elevated similar to most cases with seizures reported by Zalewski et al. [6].\n\n4 Conclusion\nWe report a case of autoimmune epilepsy with conjoint GAD 65 and P/Q VGCC antibodies in the absence of malignancy. This report emphasizes the role of GAD 65 antibodies in the pathogenesis of autoimmune epilepsy. It also raises a question about the possible role of P/Q VGCC antibodies in the pathogenesis of this disease. Whether the presence of conjoint autoantibodies alters the pathogenesis and response to treatment in autoimmune epilepsy or not is difficult to determine from a single case. However, accumulating further cases in the future will help in answering this question. Given the increased coincidental presence of anti-VGCC antibodies with other antibodies that are well known to be associated with autoimmune epilepsy, we recommend further screening of this antibody in suspected cases of autoimmune epilepsy.\n\nFinancial disclosure\nNone.\n\nConflict of interest\nThere is no conflict of interest.\n==== Refs\nReferences\n1 Scheffer I.E. Berkovic S. Capovilla G. Connolly M.B. French J. Guilhoto L. ILAE classification of the epilepsies: Position paper of the ILAE commission for classification and terminology Epilepsia 58 4 Apr 2017 512 521 28276062 \n2 Quek A.M. Britton J.W. Mckeon A. So E. Lennon V.A. Shin C. Autoimmune epilepsy:clinical characteristics and respinse to immunotherapy Arch Neurol. 69 5 May 2012 582 22451162 \n3 Tohid H. Anti-glutamic acid decarboxylase antibody positive neurological syndromes Neurosciences (Riyadh) 21 3 Jul 2016 215 222 27356651 \n4 Fernandes M. Munhoz R.P. Carrilho P.E. Arruda W.O. Lorenzoni P.J. Scola R.H. Neurological disorders associated with glutamic acid decarboxylase antibodies: a Braziliancase series Arq Neuropsiquiatr 70 9 Sep 2012 657 661 22990719 \n5 Fauser S. Uttner I. Ariño H. Scherbaum W.A. Saiz A. Lewerenz J. Long latency between GAD antibody detection and development of limbic encephalitis - a casereport BMC Neurol 15 Sep 2015 177 26420440 \n6 Zalewski N.L. Lennon V.A. Lachance D.H. Klein C.J. Pittock S.J. Mckeon A. P/Q- and N-type calcium-channel antibodies: oncological, neurological, and serological accompaniments Muscle Nerve 54 2 Aug 2016 220 227 26789908 \n7 Graus F. Titulaer M.J. Balu R. Benseler S. Bien C.G. Cellucci T. A clinical approach to diagnosis of autoimmune encephalitis Lancet Neurol 15 4 Apr 2016 391 404 26906964 \n8 Mayo medical laboratories Glutamic acid decarboxylase (GAD65) antibody assay, serum Available from: https://www.mayomedicallaboratories.com/test-catalog/Clinical+and+Interpretive/81596 \n9 Walikonis J.E. Lennon VA. Radioimmunoassay for glutamic acid decarboxylase (GAD65) autoantibodies as a diagnostic aid for stiff-man syndrome and a correlate of susceptibility to type 1 diabetes mellitus Mayo Clin Proc 73 12 Dec 1998 1161 1166 9868413 \n10 Pittock S.J. Yoshikawa H. Ahlskog J.E. Tisch S.H. Benarroch E.E. Kryzer T.J. Glutamic acid decarboxylase autoimmunity with brainstem, extrapyramidal and spinal cord dysfunction Mayo Clin Proc 81 9 Sep 2006 1207 1214 16970217 \n11 Errichiello L. Perruolo G. Pascarella A. Formisano P. Minetti C. Striano S. Autoantibodies to glutamic acid decarboxylase (GAD) in focal and generalized epilepsy: a study on 233 patients J Neuroimmunol 211 1-2 Jun 25 2009 120 123 19428124 \n12 Falip M. Carreño M. Miró J. Saiz A. Villanueva V. Quílez A. Prevalence and immunological spectrum of temporal lobe epilepsy with glutamic acid decarboxylase antibodies Eur J Neurol 19 6 Jun 2012 827 833 22353320 \n13 Malter M.P. Frisch C. Zeitler H. Surges R. Urbach H. Helmstaedter C. Treatment of immune-mediated temporal lobe epilepsy with GAD antibodies Seizure 30 Aug 2015 57 63 26216686 \n14 Cikrikçili U. Ulusoy C. Turan S. Yildiz S. Bilgiç B. Hanagasi H. Non-convulsive status epilepticus associated with glutamic acid decarboxylase antibody Clin EEG Neurosci 44 3 Jul 2013 232 236 23820312 \n15 Dubey D. Konikkara J. Modur P.N. Agostini M. Gupta P. Shu F. Effectiveness of multimodality treatment for autoimmune limbic epilepsy Epileptic Disord 16 4 Dec 2014 494 499 25465439 \n16 Al-Ajlan F.S. Althobiti A. Baz S. Al-Attas A. Autoimmune encephalopathy and drug resistant seizures with the presence of two antibodies specific for the neuronal cell surface Epilepsy Behav Case Rep 2 Nov 2014 199 202 25667907\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2213-3232",
"issue": "9()",
"journal": "Epilepsy & behavior case reports",
"keywords": null,
"medline_ta": "Epilepsy Behav Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101614202",
"other_id": null,
"pages": "26-28",
"pmc": null,
"pmid": "29692966",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "27356651;26789908;9868413;25667907;26216686;22451162;28276062;19428124;22990719;22353320;26420440;25465439;23820312;16970217;26906964",
"title": "Conjoint glutamic acid decarboxylase 65 and P/Q voltage gated calcium channel antibodies in autoimmune epilepsy: A case report.",
"title_normalized": "conjoint glutamic acid decarboxylase 65 and p q voltage gated calcium channel antibodies in autoimmune epilepsy a case report"
} | [
{
"companynumb": "SA-ALLERGAN-1840447US",
"fulfillexpeditecriteria": "1",
"occurcountry": "SA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ESCITALOPRAM OXALATE"
},
"drugadditional": "3",
... |
{
"abstract": "WHAT THIS ARTICLE TELLS US THAT IS NEW: BACKGROUND:: The incidence of substance use disorders in the United States among residents in anesthesiology is between 1% and 2%. A recent study reported that the incidence of substance use disorders in U.S. anesthesiology residents has been increasing. There are no reports of effective methods to prevent substance use disorder in residents. A comprehensive drug testing program including a random component may reduce the incidence of substance use disorders.\n\n\n\nThe authors initiated a comprehensive urine drug screening program of residents, fellows, faculty physicians, and certified nurse anesthetists. The authors performed 3,190 tests over 13 yr. The authors determined the incidence of substance use disorders among residents in our large anesthesiology residency program during the decade before (January 1, 1994, to December 31, 2003) and for the 13 yr after (January 1, 2004 to December 31, 2016) instituting a random urine drug testing program. A total of 628 residents trained in the program over these 23 yr; they contributed a total of 1,721 resident years for analysis. Fewer faculty and certified nurse anesthetists were studied, so we do not include them in our analysis.\n\n\n\nThe incidence of substance use disorders among trainees in our department during the 10 yr before initiation of urine drug screening was four incidents in 719 resident years or 0.0056 incidents per resident-year. In the 13 yr after the introduction of urine drug screening, there have been zero incidents in 1,002 resident years in our residency program (P = 0.0305).\n\n\n\nThis single-center, comprehensive program including preplacement and random drug testing was associated with a reduction of the incidence of substance use disorders among our residents in anesthesiology. There were no instances of substance use disorders in our residents over the recent 13 yr. A large, multicenter trial of a more diverse sample of academic, government, and community institutions is needed to determine if such a program can predictably reduce the incidence of substance use disorders in a larger group of anesthesiology residents.",
"affiliations": "From the Department of Anesthesia, Critical Care, and Pain Medicine, Harvard Medical School, Massachusetts General Hospital, Boston, Massachusetts (M.G.F., K.B., E.L., W.M.Z.) Division of Cardiology, Department of Medicine (R.M.) Occupational Medicine (A.G.), Massachusetts General Hospital, Boston, Massachusetts.",
"authors": "Fitzsimons|Michael G|MG|;Baker|Keith|K|;Malhotra|Rajeev|R|;Gottlieb|Andrew|A|;Lowenstein|Edward|E|;Zapol|Warren M|WM|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1097/ALN.0000000000002348",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0003-3022",
"issue": "129(4)",
"journal": "Anesthesiology",
"keywords": null,
"medline_ta": "Anesthesiology",
"mesh_terms": "D000072080:Anesthesiologists; D000776:Anesthesiology; D006801:Humans; D015994:Incidence; D007396:Internship and Residency; D015813:Substance Abuse Detection; D019966:Substance-Related Disorders; D013997:Time Factors",
"nlm_unique_id": "1300217",
"other_id": null,
"pages": "821-828",
"pmc": null,
"pmid": "30020101",
"pubdate": "2018-10",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Reducing the Incidence of Substance Use Disorders in Anesthesiology Residents: 13 Years of Comprehensive Urine Drug Screening.",
"title_normalized": "reducing the incidence of substance use disorders in anesthesiology residents 13 years of comprehensive urine drug screening"
} | [
{
"companynumb": "US-JNJFOC-20190446092",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "MEPERIDINE"
},
"drugadditional": "3",
"... |
{
"abstract": "Haemophilia A is a rare inherited hematologic disorder characterized by a deficit of coagulation factor VIII. It is associated with frequent episodes of musculoskeletal bleedings that occur mainly inside joints and secondly inside muscles. The majority of intramuscular hematomas respond well to conservative protocols, based on rehabilitation techniques and appropriate haemostatic coverage; surgery is limited to refractory cases. This manuscript describes the management of an intramuscular bleeding in a young patient with severe haemophilia A and high-titre inhibitors. A multidisciplinary approach directed by a physiatrist and combining surgical intervention, use of bypassing agents and rehabilitation treatment allowed to successfully managing this case, leading to a complete functional recovery. Given the lack of consensus on the treatment of intramuscular bleedings in haemophiliac patients, this case report provides an example of successful management for such conditions, which require a multidisciplinary approach in which the physiatrist plays a key role.",
"affiliations": "Department of Medicine and Surgery, University of Parma, Parma, Italy. antonio.frizziero@unipr.it.;Department of Physical and Rehabilitation Medicine, University Hospital of Padua, Padua, Italy. finottipaolo89@libero.it.;Department of Medicine and Surgery, University of Parma, Parma, Italy. cosimo.costantino@unipr.it.;Hemophilia Center, University Hospital of Padua, Padua, Italy. sampasca27@gmail.com.;Hemophilia Center, University Hospital of Padua, Padua, Italy. zanezio61@gmail.com.",
"authors": "Frizziero|Antonio|A|;Finotti|Paolo|P|;Costantino|Cosimo|C|;Pasca|Samantha|S|;Zanon|Ezio|E|",
"chemical_list": null,
"country": "Italy",
"delete": false,
"doi": "10.23750/abm.v92iS1.10983",
"fulltext": "\n==== Front\nActa Biomed\nActa Biomed\nActa Bio Medica : Atenei Parmensis\n0392-4203\n2531-6745\nMattioli 1885 Italy\n\n33944815\nACTA-92-118\n10.23750/abm.v92iS1.10983\nCase Report\nRehabilitation management of a triceps surae muscle injury in a young male with haemophilia A and high-titre inhibitors\nFrizziero Antonio 1\nFinotti Paolo 2\nCostantino Cosimo 1\nPasca Samantha 3\nZanon Ezio 3\n1 Department of Medicine and Surgery, University of Parma, Parma, Italy\n2 Department of Physical and Rehabilitation Medicine, University Hospital of Padua, Padua, Italy\n3 Hemophilia Center, University Hospital of Padua, Padua, Italy\nCorrespondence: Antonio Frizziero, MD, PhD Department of Medicine and Surgery, University of Parma, Via Gramsci 14, 43126, Parma, Italy; Phone +39 3492202338; Email: antonio.frizziero@unipr.it\n2021\n30 4 2021\n92 Suppl 1 e202111819 11 2020\n19 11 2020\nCopyright: © 2020 ACTA BIO MEDICA SOCIETY OF MEDICINE AND NATURAL SCIENCES OF PARMA\n2020\nhttps://creativecommons.org/licenses/by-nc-sa/4.0/ This work is licensed under a Creative Commons Attribution 4.0 International License\nBackground:\n\nHaemophilia A is a rare inherited hematologic disorder characterized by a deficit of coagulation factor VIII. It is associated with frequent episodes of musculoskeletal bleedings that occur mainly inside joints and secondly inside muscles. The majority of intramuscular hematomas respond well to conservative protocols, based on rehabilitation techniques and appropriate haemostatic coverage; surgery is limited to refractory cases.\n\nMethods:\n\nThis manuscript describes the management of an intramuscular bleeding in a young patient with severe haemophilia A and high-titre inhibitors. A multidisciplinary approach directed by a physiatrist and combining surgical intervention, use of bypassing agents and rehabilitation treatment allowed to successfully manage this case, leading to a complete functional recovery.\n\nConclusions:\n\nGiven the lack of consensus on the treatment of intramuscular bleedings in haemophiliac patients, this case report provides an example of successful management for such conditions, which require a multidisciplinary approach in which the physiatrist plays a key role.\n\nhaemophilia\nintramuscular bleeding\nmanagement\nrehabilitation\n==== Body\nIntroduction\n\nHaemophilia A is a rare inherited hematologic disorder characterized by a deficit of coagulation FVIII. Haemophiliac patients, especially those with a severe form of pathology, suffer from frequent episodes of bleedings. Hematomas are mostly internal and can present spontaneously or after minimal trauma.\n\nAnti-FVIII antibodies develop in 20-30% of patients and make the management of bleedings more complicated, since drug effectiveness is lower in the presence of inhibitor (1).\n\nBetween 10 and 23% of musculoskeletal bleeding episodes occur inside muscles, with a high percentage of recurrences; triceps surae, iliopsoas and forearm muscles are the most common targets (2). If untreated, muscle bleedings can cause complications such as nerve injury, compartment syndrome, myositis ossificans, pseudo-tumour, and even infection (3).\n\nThe diagnosis is based on history and clinical examination, usually supported by imaging (ultrasound and magnetic resonance) (4).\n\nThe majority of these lesions respond well to conservative and rehabilitation protocols and surgery is limited to a small percentage of patients with severe lesions that fail conservative approaches (5).\n\nIn absence of specific guidelines about diagnosis and treatment of muscle injuries in haemophiliac patients, this case report provides an example of successful management for such conditions, in which the physiatrist plays a key role.\n\nCase Report\n\nThis manuscript describes the case of a 14-years-old male with severe haemophilia A (FVIII<1%) and high titre inhibitors, managed for an intramuscular bleeding that occurred following low-impact activities.\n\nIn absence of a family history for haemorrhagic diseases, diagnosis of haemophilia A was performed at the age of 9 months after an accidental fall causing a hematoma inside the iliopsoas muscle. At the age of 12 months, the child started a treatment with recombinant factor VIII concentrate (octocog-alpha, II generation). One year later, he developed high titre anti-bodies against FVIII. After inhibitors appearance, he presented several haemorrhagic events, both traumatic and spontaneous; therefore, a first immune tolerance induction (ITI) was started with the same recombinant factor VIII (rFVIII) previously used in prophylaxis. Unfortunately, the patient showed a partial response to treatment with an unsatisfactory reduction of the inhibitor titre. For this reason, the child was placed in prophylaxis with rFVIIa at dosage of 90 μg/kg/day for several months. In March 2013, an ITI-Rescue was started with moroctocog alfa at the initial dose of 100 IU/kg/day, subsequently reduced when the inhibitor titre started to decrease.\n\nIn July 2016, the subject experimented painless swelling in the right calf after a football friendly match. This episode was initially self-managed with rest, ice and clay wraps.\n\nA few days later, he underwent to clinical and ultrasound examination at the Haemophilia Centre. He was prescribed laser therapy and ITI treatment with rFVIIa. Such approach determined a clinical improvement without complete remission of symptoms.\n\nOne month after the first episode, the patient developed marked swelling in the right calf again after a short walk in the mountains. For this reason, he was prescribed a new cycle of laser therapy in association with rFVIIa. Even in that case, there was only a partial clinical improvement.\n\nTwenty days later, the boy experimented a third episode of swelling in the right calf during a walk, this time accompanied by pain. After ultrasound examination, the haematologist prescribed him rFVIIa and laser therapy again, with partial benefit.\n\nOnly more than two months after the first acute event, the patient finally arrived to physiatrist observation, without a precise diagnosis on his problem yet. At clinical evaluation, right calf appeared swollen and painful at superficial and deep palpation, without signs of peripheral vascular or nervous deficits. Ultrasound evaluation revealed massive swelling of probable blood origin with fibrous limbs at early stage in the contest of both medial and lateral gastrocnemii (Figure 1).\n\nFigure 1. Ultrasound images showing massive swelling in the contest of both medial (left) and lateral (right) gastrocnemii.\n\nTherefore, he was recommended to wear an elastic device for 10 days, to put ice on the right calf three times a day (each one for 20 minutes), to use an anti-oedema ointment and to walk with two Canadian crutches. Moreover, he was prescribed to perform right calf MRI, followed by an orthopaedic evaluation.\n\nAccording to ISMuLT classification of muscle injuries (6), MRI showed a massive type 4 lesion of the right medial gastrocnemius and a type 3b lesion of the right lateral gastrocnemius. Under the coordination of the physiatrist figure, a multidisciplinary team (also composed of a haematologist and an orthopaedic surgeon expert in the management of musculoskeletal problems in haemophiliac patients) discussed and managed the case. The collegial decision was to subject the patient to surgical evacuation of blood supply, followed by an early post-operative rehabilitation. Before surgery, the subject was educated to walk with crutches without weight loading on the right leg in the first post-operative period, waiting for the definition of a more detailed rehabilitative protocol.\n\nSurgical evacuation was performed under haemostatic coverage with rFVIIa; 15 mg of product (200 μg/kg) was administered immediately before intervention, followed by 7 mg (90 μg/kg) three hours later. 15 mg of rFVIIa every 8 hours were then infused for two days. Once discharged, the patient was treated with 15 mg of rFVIIa every 12 hours, in association with FVIII. No thromboembolic complications or adverse events were reported during this treatment.\n\nA few days after surgical intervention, the patient came back to rehabilitation department. At clinical evaluation, he exhibited swelling and oedema in the proximal third of the right calf. Right triceps surae muscle appeared contracted in the proximal region and partially shortened with foot in equine position and deficit of about 30° in ankle dorsiflexion. Moreover, right anterior tibial muscle was hypotonic and the patient referred paraesthesia in the posterior lateral area of the right foot and leg.\n\nA rehabilitation protocol based on clinical evaluation was established. It included right ankle joint mobilizations (especially in dorsiflexion) for complete articular recovery, accompanied by bland stretching of the right triceps surae muscle below pain threshold. Active mobilization exercises for the right ankle were also allowed. Draining massage of right foot and leg was performed avoiding for the first days the wounded area, where, instead, a disconnecting massage of the scar was performed. Anti-oedema pharmacologic treatment, right leg unloading, compressive device for right leg and contact US therapy in correspondence of the right calf completed the recommended post-operative treatment. Before any physiotherapy session, 90μg/kg of rFVIIa were administered. This treatment was effective in preventing bleedings during the whole physiotherapy pathway.\n\nTwo months after surgical intervention, the subject came back for physiatrist examination. Right calf appeared non-oedematous and non-painful at superficial and deep palpation. The superficial scar had deepened for a few millimetres and the movements of the right knee were allowed to the highest degrees, while the dorsiflexion of the right ankle was actively limited to the first degrees because of triceps surae retraction. At ultrasound evaluation (Figure 2), physiatrist observed a collection of likely serum-haematic content of a very small size compared to the previous control, bounded by thick fibrous tissue.\n\nFigure 2. Two months after surgical intervention, ultrasound images showed a collection of likely serum hematic content of a very small size compared to the previous evaluation and bounded by thick fibrous tissue.\n\nBasing on clinical and instrumental evaluation, the patient was recommended to continue with the previously established rehabilitative protocol, with the addition of massage therapy of the right calf, proprioceptive training and laser therapy in correspondence of the surgical wound.\n\nOne month and a half later, the clinical situation appeared very improved with good function and a complete recovery of the range of motion of the right ankle. Therefore, the patient was allowed to do sport like swimming, but avoiding any kind of articular overload and continuing the previously described rehabilitation program.\n\nMore than 7 months after surgical intervention, the patient showed no difficulties in walking or going on tips and heels with good tropism of right triceps surae muscle. Ultrasound examination only identified a massive fibrous scar in the context of the right medial gastrocnemius and in the contact area between medial and lateral gastrocnemius. The patient was recommended to perform hydrokinetic therapy and to continue avoiding overloads associated with running and jumping. However, he was allowed to swim and to ride a bike.\n\nDiscussion\n\nTogether with intra-articular ones, intra-muscular bleedings represent an important cause of disability in haemophiliac patients. Even in healthy subjects, the management of muscle injuries is often difficult; the complexity added by the haemophilic pathology helps to explain the poor literature data in this area, in particular regarding subjects with a severe form of haemophilia A and high titre inhibitor. Indeed, there is still no clear consensus about the management of muscle lesions in haemophiliac patients (2). For all patients prevention represents the best treatment, but once hematoma has verified, therapy must be based on rehabilitation techniques and haemostatic coverage through appropriate infusion of replacement clotting factor (7).\n\nDue to this lack of literature, the case management presented in this manuscript was based on the previous works concerning the diagnosis and the treatment of muscle injuries not only in haemophiliac patients but also in healthy subjects.\n\nIn particular, I.S.Mu.L.T. classification and guidelines were used as a reference (6), appropriately adapting them to the specific patient and the characteristics of his pathology.\n\nAs recommended by many authors, clinical examination was supported by imaging, represented by US as first level tool, followed by MRI investigation (4). Since a severe structural lesion was identified, the multidisciplinary team considered surgical intervention necessary.\n\nThe physiatrist directed preoperative, operative and postoperative management, always interfacing with the haematologist in order to ensure an adequate haemostatic coverage during all the treatment phases. Indeed, this aspect is crucial to avoid complications and to perform an effective rehabilitative protocol in safe conditions.\n\nAfter surgery, a precise rehabilitation program based on previous literature data was progressively defined. According to Sørensen et al., rehabilitation should be divided into different phases: control of bleeding (phase 1) through POLICE protocol; restoration of range of motion and strength (phase 2); functional rehabilitation and return to normal living activities (phase 3) and eventually recreational activities(8). As reported by Beeton K et al., rehabilitative strategies include postural correction, progressive mobilization, stretching, muscular strengthening, proprioceptive exercises, physical therapies, hydrokinetic therapy and occupational therapy (9).\n\nBasing on these literature data, in this case report a progressive rehabilitation program was defined and adapted to the clinical and instrumental features that were found at each medical check-up.\n\nIn the first post-operative phase, the control of bleeding, oedema and pain was obtained through cryotherapy, right leg unloading with crutches, compressive device for right leg, draining massage of right foot and leg and anti-oedema pharmacologic treatment. The recovery of ankle range of motion was performed through progressive passive and active joint mobilizations accompanied by stretching of the right triceps surae muscle. Subsequently, progressive exercises of muscle strengthening and proprioceptive training were added to the rehabilitative program, finally recommending the patient to perform hydrokinetic therapy and allowing him to do sport like swimming or riding a bike, but avoiding overloads associated with running and jumping.\n\nWithin the rehabilitation program, some physical therapies (contact ultrasound and laser therapy) were introduced as they have proven to be effective in reducing pain and promoting reparative processes and healing of the surgical wound (6).\n\nMoreover, a maintenance program is fundamental to obtain a complete recovery and prevent recurrences. The achievement of these objectives has a very important impact not only for the individual quality of life but also for the costs supported by the national health system for hemophilic patients. Indeed, many of the specific drugs for these subjects are extremely expensive and an adequate rehabilitation management for both therapeutic and preventive purposes can reduce their use. In this case, hydrokinetic therapy was recommended as it proved to be a valuable tool for muscle strengthening, tissue elasticity recovery, oedema resorption and muscle relaxation (8). In order to avoid complications or recurrences, all Authors also agree in limiting the spectrum of sports activities allowed to hemophilic subjects. Indeed, while sport represents a fundamental instrument of integration and psychophysical well-being, on the other hand high impact activities should be avoided for the risk of articular and muscular overload. Although there is no common agreement on permitted and avoided recreational activities, sports like rugby or basketball are generally discouraged, preferring activities such as swimming, yoga and biking instead (10).\n\nSurely, this case report exhibits some limitations. The follow-up period is relatively short and the final recommendations about sport activity and hydrokinetic therapy were not assessed and followed over time. Moreover, this is a unique case, and the conclusions cannot be extended to all hemophiliac subjects, given the great heterogeneity of the pathology and the different individual response to the proposed treatments.\n\nConclusions\n\nConsidering the lack of precise rehabilitative protocols for muscular lesions in haemophiliac patients, this case report provides an example of successful management for such conditions, emphasizing the key role of the physiatrist in coordinating the treatment plan.\n\nSurely, a prompt diagnosis, a multidisciplinary approach (including different figures such as haematologist, surgeon, physical therapist, etc.) and a timely specific rehabilitation protocol, combining patient education, pharmacological therapy, kinesiotherapy and physical therapies, can allow optimal results and prevent recurrences. However, future research is needed in order to improve current knowledge and define the most effective therapeutic approach.\n\nConflict of interest:\n\nEach Author declares that he or she has no commercial associations (e.g. consultancies, stock ownership, equity interest, patent/licensing arrangement etc.) that might pose a con-flict of interest in connection with the submitted article.\n==== Refs\nReferences\n\n1 Valentino LA Hakobyan N Enockson C Exploring the biological basis of haemophilic joint disease: experimental studies Haemophilia 2012 May 18 3 310 8 22044636\n2 Beyer R Ingerslev J Sørensen B Current practice in the management of muscle haematomas in patients with severe haemophilia Haemophilia 2010 Nov 16 926 31 20491963\n3 De la Corte-Rodriguez H Rodriguez-Merchan EC Treatment of muscle haematomas in haemophiliacs with special emphasis on percutaneous drainage Blood Coagul Fibrinolysis 2014 Dec 25 8 787 94 24914744\n4 Koh ES McNally EG Ultrasound of skeletal muscle injury Semin Musculoskelet Radiol 2007 Jun 11 2 162 73 18095248\n5 Rodriguez-Merchan EC Aspects of current management: orthopaedic surgery in haemophilia Haemophilia 2012 Jan 18 1 8 16\n6 Maffulli N Oliva F Frizziero A ISMuLT Guidelines for muscle injuries Muscles Ligaments Tendons J 2014 Feb 24 3 4 241 9 24596685\n7 Smith TO Hunt NJ Wood SJ The physiotherapy management of muscle haematomas Phys Ther Sport 2006 Nov 7 4 201 9 21663833\n8 Sørensen B Benson GM Bladen M Management of muscle haematomas in patients with severe haemophilia in an evidence-poor world Haemophilia 2012 Jul 18 4 598 606 22151135\n9 Beeton K Rodriguez-Merchan EC Alltree J Cornwall J Rehabilitation of muscle dysfunction in hemophilia 2012 Rev. ed World Federation of Hemophilia 12 Treatment of Hemophilia; No. 24\n10 Gomis M Querol F Gallach JE Gonzalez LM Aznar JA Exercise and sport in the treatment of haemophilic patients: a systematic review Haemophilia 2009 Jan 15 1 43 54 18721151\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "0392-4203",
"issue": "92(S1)",
"journal": "Acta bio-medica : Atenei Parmensis",
"keywords": null,
"medline_ta": "Acta Biomed",
"mesh_terms": "D006467:Hemophilia A; D006470:Hemorrhage; D006801:Humans; D007866:Leg; D008297:Male; D009132:Muscles",
"nlm_unique_id": "101295064",
"other_id": null,
"pages": "e2021118",
"pmc": null,
"pmid": "33944815",
"pubdate": "2021-04-30",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "24596685;24914744;22044636;22151135;18095248;21535324;21663833;18721151;20491963",
"title": "Rehabilitation management of a triceps surae muscle injury in a young male with haemophilia A and high-titre inhibitors.",
"title_normalized": "rehabilitation management of a triceps surae muscle injury in a young male with haemophilia a and high titre inhibitors"
} | [
{
"companynumb": "IT-TAKEDA-2021TUS045799",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ANTIHEMOPHILIC FACTOR, HUMAN RECOMBINANT"
},
"d... |
{
"abstract": "Chronic granulomatous disease (CGD) is a primary immunodeficiency syndrome that results in increased risk for bacterial and fungal infections, as well as inflammatory/autoimmune complications. While CGD historically has been associated with early death in childhood, the life expectancy and morbidity of patients with CGD have greatly improved. Many patients with CGD now survive well into adulthood, and data on adult cohorts of patients with CGD have been published. However, reports of pregnancy management, complications, and outcomes for patients with CGD are sparse. In addition, management of invasive fungal infections, including use of newer triazole antifungals, during pregnancy has not been well described. We report a case of fungal lung infection in a pregnant woman with CGD, diagnosed during her second trimester, which was treated with multiple antifungal agents, including more than 12 weeks of isavuconazole therapy, resulting in resolution of infection and delivery of a healthy newborn at term.",
"affiliations": "Division of Infectious Diseases, Brigham and Women's Hospital, Boston, Massachusetts, USA.;Department of Pharmacy, Brigham and Women's Hospital, Boston, Massachusetts, USA.;Department of Pharmacy, Brigham and Women's Hospital, Boston, Massachusetts, USA.;Department of Pharmacy, Brigham and Women's Hospital, Boston, Massachusetts, USA.;Division of Maternal Fetal Medicine, Department of Obstetrics and Gynecology, Brigham and Women's Hospital, Boston, Massachusetts, USA.;Division of Allergy and Clinical Immunology, Brigham and Women's Hospital, Boston, Massachusetts, USA.",
"authors": "Johnson|J A|JA|;Pearson|J C|JC|0000-0002-5276-1050;Kubiak|D W|DW|;Dionne|B|B|;Little|S E|SE|;Wesemann|D R|DR|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1093/ofid/ofaa447",
"fulltext": "\n==== Front\nOpen Forum Infect Dis\nOpen Forum Infect Dis\nofid\nOpen Forum Infectious Diseases\n2328-8957 Oxford University Press US \n\n10.1093/ofid/ofaa447\nofaa447\nNovel ID Cases\nAcademicSubjects/MED00290\nTreatment of Chronic Granulomatous Disease–Related Pulmonary Aspergillus Infection in Late Pregnancy\nJohnson J A 1 http://orcid.org/0000-0002-5276-1050Pearson J C 2 Kubiak D W 2 Dionne B 23 Little S E 4 Wesemann D R 5 1 \nDivision of Infectious Diseases, Brigham and Women’s Hospital, Boston, Massachusetts, USA\n2 \nDepartment of Pharmacy, Brigham and Women’s Hospital, Boston, Massachusetts, USA\n3 \nDepartment of Pharmacy and Health System Sciences, Northeastern University, Boston, Massachusetts, USA\n4 \nDivision of Maternal Fetal Medicine, Department of Obstetrics and Gynecology, Brigham and Women’s Hospital, Boston, Massachusetts, USA\n5 \nDivision of Allergy and Clinical Immunology, Brigham and Women’s Hospital, Boston, Massachusetts, USA\nCorrespondence: Jennifer A. Johnson, MD, Division of Infectious Diseases, Brigham and Women’s Hospital, 75 Francis Street, PBB-A4, Boston, MA 02115 (jjohnson30@bwh.harvard.edu).\n10 2020 \n26 9 2020 \n26 9 2020 \n7 10 ofaa44724 7 2020 17 9 2020 25 9 2020 24 10 2020 © The Author(s) 2020. Published by Oxford University Press on behalf of Infectious Diseases Society of America.2020This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs licence (http://creativecommons.org/licenses/by-nc-nd/4.0/), which permits non-commercial reproduction and distribution of the work, in any medium, provided the original work is not altered or transformed in any way, and that the work is properly cited. For commercial re-use, please contact journals.permissions@oup.comAbstract\nChronic granulomatous disease (CGD) is a primary immunodeficiency syndrome that results in increased risk for bacterial and fungal infections, as well as inflammatory/autoimmune complications. While CGD historically has been associated with early death in childhood, the life expectancy and morbidity of patients with CGD have greatly improved. Many patients with CGD now survive well into adulthood, and data on adult cohorts of patients with CGD have been published. However, reports of pregnancy management, complications, and outcomes for patients with CGD are sparse. In addition, management of invasive fungal infections, including use of newer triazole antifungals, during pregnancy has not been well described. We report a case of fungal lung infection in a pregnant woman with CGD, diagnosed during her second trimester, which was treated with multiple antifungal agents, including more than 12 weeks of isavuconazole therapy, resulting in resolution of infection and delivery of a healthy newborn at term.\n\nAspergillus fumigateschronic granulomatous disease (CGD)isavuconazolepregnancy\n==== Body\nCASE REPORT\nA 37-year-old woman with chronic granulomatous disease (CGD) was admitted to the hospital while pregnant at 21 weeks gestational age (GA) with 2 weeks of progressive cough and shortness of breath. She had been diagnosed with autosomal recessive NCF1 (p47phox)–deficient CGD at age 9 years. Prior testing indicated <1% neutrophil oxidative burst activity. At age 17 years, she was treated for Nocardia sp. pulmonary infection followed by interferon gamma (IFNγ) intermittently for 1 year and then chronic prophylaxis with trimethoprim-sulfamethoxazole (TMP/SMX). At age 23 years, she was treated for Aspergillus sp. pulmonary infection and then chronic prophylaxis with itraconazole. At age 31 years, TMP/SMX and itraconazole were held during pregnancy; she had an uncomplicated pregnancy and term delivery. She began prophylactic cefdinir 300 mg twice daily. Itraconazole was not restarted due to planning for subsequent pregnancy. At age 36 years, she suffered a spontaneous abortion at 8 weeks GA. She then became pregnant again and continued on cefdinir prophylaxis.\n\nShe reported cough and dyspnea during the first trimester, which were attributed to asthma. Her inhaler regimen was modified, eventually including fluticasone/salmeterol 500 mcg/50 mcg twice daily, budesonide 90 mcg twice daily, and albuterol 90 mcg as needed. At 19 weeks GA, she reported worsening dry cough, chest tightness, and dyspnea on exertion. She was treated with prednisone 40 mg daily for 5 days. She developed worsening sinus pressure, cough, and shortness of breath. She was treated with 7 days of amoxicillin-clavulanate and a 5-day course of prednisone 40 mg daily and developed low-grade fevers. A chest radiograph showed new opacities in the right lung, prompting referral to the emergency department (ED).\n\nIn the ED, her vital signs were temperature 36.8°C, blood pressure 99/63, heart rate 72, respiratory rate 18, and oxygen saturation 96% on room air. She had decreased breath sounds at the right lung base. Results of initial blood chemistries were normal, with the exception of decreased albumin 3.2 g/dL and increased globulin 4.8g/dL. Blood counts were within normal range: white blood cell count 9560/μL, hemoglobin 13.0 g/dL, platelets 159 000/μL. Nasopharyngeal swab tested negative for influenza A, influenza B, and respiratory syncytial virus by polymerase chain reaction (PCR). Blood cultures were obtained, which had no growth after 5 days. Serum (1,3)-beta-D-glucan was 64 pg/mL, and serum galactomannan (Aspergillus antigen) was 0.06. Chest computed tomography (CT) showed consolidative opacity with air bronchograms within the superior segment of the right lower lobe with additional smaller nodular opacities seen within the basilar segments of the right lower lobe (Figure 1A). The patient was triaged to urgent bronchoscopy. The bronchoalveolar lavage sample yielded positive results for influenza A by PCR, Pneumocystis jiroveci by methenamine silver stain, and Aspergillus fumigatus by fungal culture. Galactomannan from the bronchoalveolar lavage fluid was 0.14.\n\nFigure 1. A, Chest computed tomography (CT) at the time of presentation with infection at 21 weeks gestational age. B, Chest CT at 1 day postpartum.\n\nImmediately after bronchoscopy, treatment was initiated with intravenous cefepime 2 g every 8 hours, oral oseltamivir 75 mg twice daily, and intravenous TMP/SMX 15 mg/kg daily divided every 8 hours. Voriconazole was initiated at 6 mg/kg intravenously every 12 hours for 2 doses, followed by 300 mg (4 mg/kg) orally twice daily. Cefepime was discontinued after 48 hours. After 48 hours of voriconazole therapy, the patient reported severe visual and sleep disturbances. Voriconazole trough was 2.3 mcg/mL. Voriconazole was discontinued, and intravenous liposomal amphotericin 5 mg/kg once daily was initiated. The Aspergillus fumigatus isolate was sent to a reference lab (UT Health San Antonio, San Antonio, TX, USA), where antifungal minimal inhibitory concentrations (MICs) were fluconazole >64 mcg/mL, itraconazole 0.25 mcg/mL, posaconazole 0.06 mcg/mL, and voriconazole 0.5 mcg/mL. After 6 days of treatment, laboratory abnormalities developed: elevated serum creatinine (1.32 mg/dL), hyponatremia (130 mmol/L), and acidosis (carbon dioxide 20 mmol/L). TMP/SMX was transitioned to 320-mg twice-daily oral tablets, and laboratory abnormalities improved. She was discharged to home and continued to receive intravenous liposomal amphotericin B.\n\nAfter 16 days of liposomal amphotericin B, she was noted to have new thrombocytopenia, with platelets decreased from 181 000/μL to 64 000/μL. Liposomal amphotericin B was discontinued, and TMP/SMX dosing was further decreased to 160 mg once daily. At this point (24 weeks GA), therapy was initiated with isavuconazonium sulfate (prodrug of isavuconazole) 372 mg by mouth every 8 hours for 6 doses, and then continued 372 mg once daily. She tolerated isavuconazole without any adverse events. Isavuconazole trough level was measured twice: 1.5 mcg/mL and 1.9 mcg/mL. At 36 weeks GA, there were no signs of infection, and the patient expressed concern about continuing isavuconazole through planned breastfeeding. Isavuconazole was discontinued, completing 12 weeks of isavuconazole therapy and more than 14 weeks of antifungal therapy. At 39 weeks GA, she underwent planned cesarean section due to breech presentation, delivering a healthy infant without complications. Chest CT obtained after delivery documented complete resolution of the prior multifocal opacities (Figure 1b). In follow-up at 6 months postpartum, the patient and the infant were healthy.\n\nDISCUSSION\nCGD is an inherited immunodeficiency disorder that results in defective phagocyte killing, leading to recurrent bacterial and fungal infections. Historically CGD was associated with universal childhood mortality, but improvements in diagnostics and therapeutics for infectious and inflammatory complications have led to marked improvement in prognosis [1]. A retrospective analysis of adult patients with CGD diagnosed in childhood in France identified pulmonary as the most common infection site (31%), and the most common pathogens were Aspergillus sp. (17%) and Staphylococcus aureus (10.7%) [2]. Infections with gram-negative bacteria and mycobacteria were reported, but infections with Burkholderia sp. and Nocardia sp. were uncommon [2]. Only 38% of patients with infection presented with fever. Another analysis identified 155 patients with CGD, of whom 80 were diagnosed with invasive fungal infections (IFIs) [3]. Only 27% of cases of proven invasive aspergillosis had positive Aspergillus serologic testing (serum galactomannan). No infections with Pneumocystis sp. were reported in these cohort studies—in our case report, the patient may have been predisposed to Pneumocystis infection due to treatment with systemic and inhaled corticosteroids, as well as immune system alterations during pregnancy. It is not clear which of the concurrently diagnosed infections (influenza, Pneumocystis jiroveci, and Aspergillus fumigatus) in this case may have developed first, and to what degree 1 infection may have predisposed to the development of the other infections. Prior studies have documented benefit with TMP/SMX prophylaxis to prevent bacterial infections and itraconazole prophylaxis to prevent fungal infections in patients with CGD [1, 3, 4]. However, 54% of patients in 1 CGD cohort who developed IFI were receiving itraconazole prophylaxis at the time of infection diagnosis [3]. These cohort studies highlight the challenges and importance of efficient diagnosis and early effective treatment of pulmonary infections in CGD, which may otherwise be fatal. Use of empiric antimicrobial therapy is often insufficient due to the variety of atypical pathogens; however, routine diagnostic tests, such as sputum culture, often do not reveal the causative pathogen. Rapid triage to invasive diagnostics such as bronchoalveolar lavage or biopsy is crucial to achieve early microbiologic diagnosis and initiation of targeted, often life-saving, antibiotic therapy in CGD patients with pulmonary infections.\n\nThere are few published data on pregnancy in patients with CGD. A case report described an X-linked carrier of CGD who had serial episodes of chorioamnionitis resulting in early delivery in 3 pregnancies, 1 of which resulted in neonatal death due to sepsis [5]. Another report documented an uncomplicated pregnancy of a woman with CGD, but the patient developed Aspergillus fumigatus lumbosacral osteomyelitis in the early postpartum period [6]. At least 2 older case reports have described uneventful pregnancies in patients with CGD [5]. Hisano et al. described successful completion of pregnancy with term delivery in a woman with CGD who had been carefully monitored and treated with TMP/SMX 160/800 mg daily (with augmented folate supplementation) during conception and throughout pregnancy [7].\n\nWhen fungal infections develop in pregnancy, there are limited data to guide management. Amphotericin B deoxycholate is the antifungal agent with the most data on safety in pregnancy. Although teratogenicity has not been reported with this agent, there are frequent toxicities including azotemia, fever, nephrotoxicity, thrombophlebitis, electrolyte disorders, and anemia [8]. The safety of fluconazole and itraconazole during pregnancy was examined in a meta-analysis of cohort studies including more than 1 million women in total [9]. Itraconazole use in pregnancy was not associated with significant increased risk overall, but the incidence of fetal eye defects was slightly higher among itraconazole-exposed patients. There were no data on exposure to voriconazole, posaconazole, or isavuconazole in the meta-analysis. Fluconazole use in pregnancy was not associated with significant increased risk overall, but the incidence rates of congenital heart defects and limb defects were slightly higher among fluconazole-exposed patients. First trimester exposure to fluconazole was associated with increased risk of cleft lip and cleft palate and dextro-transposition of the great arteries. Another cohort study recently documented a small but significantly increased risk of musculoskeletal abnormalities at birth with low-dose fluconazole during early pregnancy, though no increased risk of oral cleft or contruncal abnormalities was noted [10]. A single case report documents use of voriconazole during pregnancy [11]. A 28-year-old pregnant woman developed invasive aspergillosis of the sinuses initially treated with surgery and liposomal amphotericin. Voriconazole was initiated at 19 weeks GA and continued for 5 months through infection resolution and delivery of a healthy infant at 35 weeks GA, without complications. The prescribing information for isavuconazonium states that it may cause fetal harm when used in pregnancy and describes increased skeletal abnormalities and perinatal mortality in the offspring of rats with pregnancy exposure, and systemic isavuconazole is transmitted to breastmilk [12].\n\nThis is a novel case report of an invasive fungal lung infection developing during pregnancy in a woman with CGD, treated with antifungal agents including isavuconazole, without adverse events, and with cessation of antifungal treatment before delivery and breastfeeding. The absence of high-grade fevers or severe symptoms and the negative serum fungal markers at the time of presentation in this case are typical among patients with CGD and highlight the importance of early triage to imaging and invasive diagnostics. As more patients with CGD survive into adulthood, improvements in preconception and perinatal counseling and management will be required to improve pregnancy outcomes. Further data are needed on the safety and efficacy of triazole antifungal agents during pregnancy, including isavuconazole.\n\nAcknowledgments\n\nPotential conflicts of interest. All authors: no reported conflicts of interest. All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of the manuscript have been disclosed.\n\n\nPatient consent. The patient in the reported case gave permission for her de-identified information to be included in this manuscript. All other cases referred to in the “Discussion” section of the manuscript are from previously published literature.\n==== Refs\nReferences\n1. \nHolland SM \nChronic granulomatous disease\n. Hematol Oncol Clin North Am 2013 ; 27 :89 –99, viii\n.23351990 \n2. \nDunogué B , Pilmis B , Mahlaoui N , et al. Chronic granulomatous disease in patients reaching adulthood: a nationwide study in France\n. Clin Infect Dis 2017 ; 64 :767 –75\n.28362954 \n3. \nBlumenthal S , Mouy R, Mahlaoui N, et al. Invasive mold infections in chronic granulomatous disease: a 25 year retrospective survey\n. Clin Infect Dis 2011 ; 53 :e159–69 .22080130 \n4. \nMargolis DM , Melnick DA , Alling DW , Gallin JI \nTrimethoprim-sulfamethoxazole prophylaxis in the management of chronic granulomatous disease\n. J Infect Dis 1990 ; 162 :723 –6\n.2117627 \n5. \nHaidar ZA , Malshe A , McKenna D \nChronic granulomatous disease carrier with recurrent poor obstetric outcome\n. Obstet Gynecol 2014 ; 123 :484 –6\n.24413246 \n6. \nSheikbahaei S , Sherkat R, Camacho-Ordonez N, et al. Pregnancy, child bearing and prevention of giving birth to the affected children in patients with primary immunodeficiency disease; a case-series\n. BMC Pregnancy Childbirth 2018 ; 18 :299 .29996795 \n7. \nHisano M , Kobayashi S , Arata N , et al. Successful completion of pregnancy in a woman with chronic granulomatous disease\n. Obstet Med 2011 ; 4 :174 –6\n.27579121 \n8. \nKing CT , Rogers PD , Cleary JD , Chapman SW \nAntifungal therapy during pregnancy\n. Clin Infect Dis 1998 ; 27 :1151 –60\n.9827262 \n9. \nLiu D , Zhang C , Wu L , et al. Fetal outcomes after maternal exposure to oral antifungal agents during pregnancy: a systematic review and meta-analysis\n. Int J Gynaecol Obstet 2020 ; 148 :6 –13\n.\n10. \nZhu Y , Bateman BT , Gray KJ , et al. Oral fluconazole use in the first trimester and risk of congenital malformations: population based cohort study\n. BMJ 2020 ; 369 :m1494 .32434758 \n11. \nShoai Tehrani M , Sicre de Fontbrune F , Roth P , et al. Case report of exposure to voriconazole in the second and third trimesters of pregnancy\n. Antimicrob Agents Chemother 2013 ; 57 :1094 –5\n.23165463 \n12. \nIsavuconazonium package insert \nAstellas Pharma Available at: https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/207500s005,207501s004lbl.pdf. Accessed 10 October 2020 .\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2328-8957",
"issue": "7(10)",
"journal": "Open forum infectious diseases",
"keywords": "Aspergillus fumigates; chronic granulomatous disease (CGD); isavuconazole; pregnancy",
"medline_ta": "Open Forum Infect Dis",
"mesh_terms": null,
"nlm_unique_id": "101637045",
"other_id": null,
"pages": "ofaa447",
"pmc": null,
"pmid": "33134418",
"pubdate": "2020-10",
"publication_types": "D002363:Case Reports",
"references": "31691277;22080130;27579121;29996795;23165463;23351990;9827262;28362954;2117627;32434758;24413246",
"title": "Treatment of Chronic Granulomatous Disease-Related Pulmonary Aspergillus Infection in Late Pregnancy.",
"title_normalized": "treatment of chronic granulomatous disease related pulmonary aspergillus infection in late pregnancy"
} | [
{
"companynumb": "US-CIPLA LTD.-2020US09236",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "VORICONAZOLE"
},
"drugadditional": "1",
... |
{
"abstract": "Fludarabine, a fluorinated analogue of adenine, was given to 11 patients with macroglobulinemic lymphoma, all but one having failed prior standard chemotherapy. Five patients (45%) responded with more than a 50% reduction of immunoglobulin M (IgM) tumor mass for a projected median duration of longer than 1 year. The onset of remission was usually slow, with a median tumor halving time of 5.2 months in responding patients, emphasizing the importance of repeated courses of treatment. Fludarabine is an important new agent effective against macroglobulinemic lymphoma, and should be evaluated further in combination with other active modalities.",
"affiliations": "Department of Hematology, University of Texas M.D. Anderson Cancer Center, Houston 77030.",
"authors": "Kantarjian|H M|HM|;Alexanian|R|R|;Koller|C A|CA|;Kurzrock|R|R|;Keating|M J|MJ|",
"chemical_list": "D000964:Antimetabolites, Antineoplastic; D001088:Arabinonucleotides; D008259:Macroglobulins; D001084:Vidarabine Phosphate; C042382:fludarabine phosphate",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0006-4971",
"issue": "75(10)",
"journal": "Blood",
"keywords": null,
"medline_ta": "Blood",
"mesh_terms": "D000328:Adult; D000368:Aged; D000964:Antimetabolites, Antineoplastic; D001088:Arabinonucleotides; D005260:Female; D006801:Humans; D007262:Infusions, Intravenous; D008223:Lymphoma; D008259:Macroglobulins; D008297:Male; D008875:Middle Aged; D001084:Vidarabine Phosphate; D008258:Waldenstrom Macroglobulinemia",
"nlm_unique_id": "7603509",
"other_id": null,
"pages": "1928-31",
"pmc": null,
"pmid": "1692487",
"pubdate": "1990-05-15",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Fludarabine therapy in macroglobulinemic lymphoma.",
"title_normalized": "fludarabine therapy in macroglobulinemic lymphoma"
} | [
{
"companynumb": "US-PFIZER INC-2021375430",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FLUDARABINE PHOSPHATE"
},
"drugadditional": "3... |
{
"abstract": "Early infantile epileptic encephalopathy has a grave outcome. Dravet syndrome (DS), characterized by early onset, refractory seizures, and intellectual deficit is one of the variants of the condition. SCN1B gene mutation is one of the lesser known variants of DS. Increased awareness of genetic analysis has increased the early diagnosis of DS for an early prognostication as well as genetic counselling of parents. We present the case of a 7-month old male child who started having recurrent febrile, and thereafter, afebrile seizures, following administration of a vaccination at 3 months. He developed global developmental delay, and is presently on multiple anticonvulsants. Genetic analysis was suggestive of SCN1B gene mutation associated with DS.",
"affiliations": "Department of Pediatric Medicine and Pediatric Neurology, Institute of Child Health, Kolkata, West Bengal, India.;Department of Pediatric Medicine and Pediatric Neurology, Institute of Child Health, Kolkata, West Bengal, India.;Department of Pediatric Medicine and Pediatric Neurology, Institute of Child Health, Kolkata, West Bengal, India.;Department of Pediatric Medicine and Pediatric Neurology, Institute of Child Health, Kolkata, West Bengal, India.",
"authors": "Mukherjee|Devdeep|D|;Mukherjee|Swapan|S|;Niyogi|Prabal|P|;Mahapatra|Manas|M|",
"chemical_list": "D000927:Anticonvulsants; C470379:SCN1B protein, human; D062547:Voltage-Gated Sodium Channel beta-1 Subunit",
"country": "India",
"delete": false,
"doi": "10.4103/neuroindia.NI_1115_15",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0028-3886",
"issue": "65(4)",
"journal": "Neurology India",
"keywords": null,
"medline_ta": "Neurol India",
"mesh_terms": "D000927:Anticonvulsants; D001921:Brain; D002658:Developmental Disabilities; D004831:Epilepsies, Myoclonic; D006801:Humans; D007223:Infant; D008279:Magnetic Resonance Imaging; D008297:Male; D009154:Mutation; D011379:Prognosis; D003294:Seizures, Febrile; D013226:Status Epilepticus; D062547:Voltage-Gated Sodium Channel beta-1 Subunit",
"nlm_unique_id": "0042005",
"other_id": null,
"pages": "801-803",
"pmc": null,
"pmid": "28681755",
"pubdate": "2017",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Dravet syndrome with SCN1B gene mutation: A rare entity.",
"title_normalized": "dravet syndrome with scn1b gene mutation a rare entity"
} | [
{
"companynumb": "IN-UCBSA-2017031902",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "TOPIRAMATE"
},
"drugadditional": null,
"d... |
{
"abstract": "BACKGROUND\nPancreatic cancer has become the third leading cause of cancer death with minimal improvements in outcome for over 40 years. Recent trials of therapies that target-defective DNA maintenance using poly (ADP-ribose) polymerase (PARP) inhibitors are showing promising results, yet invariably patients recur and succumb to disease. Mechanisms of resistance to platinum-based and PARP inhibitor therapy in other cancer types include secondary mutations, which restore the integrity of DNA repair through an increasing number of different mechanisms.\n\n\nMETHODS\nHere we present a case of a 63-year-old female patient with a germ line pathogenic BRCA2 mutation (6714 deletion) who developed pancreatic cancer and had an exceptional response to platinum and PARP inhibitor therapy. Through next-generation sequencing and clinical follow-up, we correlated tumour response and resistance to the BRCA2 mutational status in the tumour.\n\n\nRESULTS\nInitially, the patient had an exceptional response to platinum and PARP inhibitor therapy, most likely due to the BRCA2 mutation. However, the primary lesion recurred while on PARP inhibitor therapy and contained a secondary mutation in BRCA2, which mostly likely restored BRCA2 function in PARP inhibitor-resistant tumour cells.\n\n\nCONCLUSIONS\nTo our knowledge, this is the first report of a BRCA2 reversion mutation that conferred resistance to PARP inhibitor-based therapy in a pancreatic ductal adenocarcinoma patient. Future studies are needed to understand this important mechanism of resistance and how it may impact the choice of therapy for patients with pancreatic cancer.",
"affiliations": "Lombardi Comprehensive Cancer Center, Georgetown University Medical Center, Washington, DC, USA.;Wolfson Wohl Cancer Research Centre, Institute of Cancer Sciences, University of Glasgow, Garscube Estate, Switchback Road, Bearsden, Glasgow G61 1BD, UK.;Wolfson Wohl Cancer Research Centre, Institute of Cancer Sciences, University of Glasgow, Garscube Estate, Switchback Road, Bearsden, Glasgow G61 1BD, UK.;Wolfson Wohl Cancer Research Centre, Institute of Cancer Sciences, University of Glasgow, Garscube Estate, Switchback Road, Bearsden, Glasgow G61 1BD, UK.;Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University, Baltimore, MD, USA.;Department of Surgery, Johns Hopkins University, Baltimore, MD, USA.;Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, PA, USA.",
"authors": "Pishvaian|Michael J|MJ|;Biankin|Andrew V|AV|;Bailey|Peter|P|;Chang|David K|DK|;Laheru|Daniel|D|;Wolfgang|Christopher L|CL|;Brody|Jonathan R|JR|",
"chemical_list": "D024682:BRCA2 Protein; C551750:BRCA2 protein, human; D001562:Benzimidazoles; D009944:Organoplatinum Compounds; D000067856:Poly(ADP-ribose) Polymerase Inhibitors; C521013:veliparib; D000077150:Oxaliplatin; D011065:Poly(ADP-ribose) Polymerases; D005472:Fluorouracil",
"country": "England",
"delete": false,
"doi": "10.1038/bjc.2017.40",
"fulltext": "\n==== Front\nBr J CancerBr. J. CancerBritish Journal of Cancer0007-09201532-1827Nature Publishing Group bjc20174010.1038/bjc.2017.4028291774Clinical StudyBRCA2 secondary mutation-mediated resistance to platinum and PARP inhibitor-based therapy in pancreatic cancer Secondary BRCA2 mutation in pancreatic cancerPishvaian Michael J 1*Biankin Andrew V 234*Bailey Peter 2Chang David K 234Laheru Daniel 5Wolfgang Christopher L 6Brody Jonathan R 71 Lombardi Comprehensive Cancer Center, Georgetown University Medical Center, Washington, DC, USA2 Wolfson Wohl Cancer Research Centre, Institute of Cancer Sciences, University of Glasgow, Garscube Estate, Switchback Road, Bearsden, Glasgow G61 1BD, UK3 West of Scotland Pancreatic Unit, Glasgow Royal Infirmary, Glasgow G31 2ER, UK4 Faculty of Medicine, South Western Sydney Clinical School, University of NSW, Liverpool, New South Wales 2170, Australia5 Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University, Baltimore, MD, USA6 Department of Surgery, Johns Hopkins University, Baltimore, MD, USA7 Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, PA, USA* E-mail: pishvaim@georgetown.edu* E-mail: andrew.biankin@glasgow.ac.uk11 04 2017 14 03 2017 116 8 1021 1026 04 10 2016 29 11 2016 16 01 2017 Copyright © 2017 Cancer Research UK2017Cancer Research UKFrom twelve months after its original publication, this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 4.0 Unported License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/Background:\nPancreatic cancer has become the third leading cause of cancer death with minimal improvements in outcome for over 40 years. Recent trials of therapies that target-defective DNA maintenance using poly (ADP-ribose) polymerase (PARP) inhibitors are showing promising results, yet invariably patients recur and succumb to disease. Mechanisms of resistance to platinum-based and PARP inhibitor therapy in other cancer types include secondary mutations, which restore the integrity of DNA repair through an increasing number of different mechanisms.\n\nMethods:\nHere we present a case of a 63-year-old female patient with a germ line pathogenic BRCA2 mutation (6714 deletion) who developed pancreatic cancer and had an exceptional response to platinum and PARP inhibitor therapy. Through next-generation sequencing and clinical follow-up, we correlated tumour response and resistance to the BRCA2 mutational status in the tumour.\n\nResults:\nInitially, the patient had an exceptional response to platinum and PARP inhibitor therapy, most likely due to the BRCA2 mutation. However, the primary lesion recurred while on PARP inhibitor therapy and contained a secondary mutation in BRCA2, which mostly likely restored BRCA2 function in PARP inhibitor-resistant tumour cells.\n\nConclusions:\nTo our knowledge, this is the first report of a BRCA2 reversion mutation that conferred resistance to PARP inhibitor-based therapy in a pancreatic ductal adenocarcinoma patient. Future studies are needed to understand this important mechanism of resistance and how it may impact the choice of therapy for patients with pancreatic cancer.\n\nBRCAveliparibpancreatic canceroxaliplatin5-fluorouracilDNA damage response\n==== Body\nEmerging data suggest that the subgroup of pancreatic ductal adenocarcinoma (PDA) patients whose tumours harbour defects in genes involved in the homologous recombination pathway, most notably BRCA1 and BRCA2 mutations, may benefit significantly from poly (ADP-ribose) polymerase (PARP) inhibitor-based therapy (Lowery et al, 2011; Pishvaian et al, 2013; O'Reilly et al, 2014; Kaufman et al, 2015). From a personalised therapy perspective, this patient cohort is sizable as previous reports claim a conservative 5–7% of PDAs harbour mutations in the BRCA pathway, whereas more recent sophisticated interrogations of PDA genomes estimate that up to 20% of PDA have defects in DNA damage response, which may confer sensitivity to platinum therapy and drugs that specifically target these mechanisms (PARP, ATR, and Wee1 inhibitors; Waddell et al, 2015; Bailey et al, 2016). In fact, ongoing clinical trials have revealed that patients with BRCA-mutated PDAs are experiencing progression-free survival times of 12 months or more, with frank response rates of over 50%. Unfortunately these patients' tumours eventually develop resistance to PARP inhibitor-based therapy.\n\nPancreatic ductal adenocarcinoma cells altered in the DNA repair genes, BRCA2, FANCC, and G (labelled as ‘BRCA-deficient'), are all hypersensitive to inter-strand cross-linking agents and platinum-based drugs in in vitro and in vivo models (van der Heijden et al, 2005). Ashworth and colleagues showed that cells deficient in genes involved in homologous recombination repair pathway of double-stranded breaks (including BRCA1, BRCA2, RAD51, RAD54, DSS1, RPA1, NBS1, ATR, ATM, CHK1, CHK2, FANCD2, FANCA, or FANCC) are also hypersensitive to PARP inhibitors (Farmer et al, 2005; McCabe et al, 2006). Hence, PARP inhibitors are being investigated as a therapeutic option for various cancers disrupted in the BRCA pathway, and the PARP inhibitor olaparib (Lynparza, Astra Zeneca, Cambridge, UK) was recently approved for BRCA-mutated ovarian cancer.\n\nPoly (ADP-ribose) polymerase is a nuclear enzyme that plays a critical role in the repair of DNA damage (McCabe et al, 2006; Donawho et al, 2007; Kummar et al, 2009). Thus, PARP inhibition results in less efficient DNA repair following a cytotoxic insult. Consequently, PARP inhibitors act as sensitising agents for a variety of DNA-damaging chemotherapeutic agents and with radiotherapy. Veliparib (ABT-888, Abbvie Inc., Lake Bluff, IL, USA) is a PARP inhibitor that has proven in vivo activity (Kummar et al, 2009), and increases the sensitivity of tumour cells to chemotherapy, including cisplatin, irinotecan, and temozolomide, and to radiation (Curtin et al, 2004; DePinho and Polyak, 2004; Langelier et al, 2008; Sharpless and DePinho, 2004). Thus, there are currently dozens of ongoing clinical trials of PARP inhibitor-based combination therapies (Clinical trials.gov).\n\nSince the mid-2000s, PARP inhibitor-based therapies have shown promising results in patients with BRCA-mutated cancers (Audeh et al, 2010; Fong et al, 2010; Tutt et al, 2010; Gelmon et al, 2011; Lowery et al, 2011; Kaye et al, 2012; Ledermann et al, 2012; Sandhu et al, 2013; Kaufman et al, 2015; Mateo et al, 2015; Oza et al, 2015). For example, Audeh et al\n(2010) demonstrated that patients with BRCA-mutated recurrent ovarian cancer had a 33% response rate to single agent olaparib dosed at 400 mg twice daily. Similar results were published by Fong et al\n(2010), though in their cohort of BRCA-mutated ovarian cancer patients, the response rate in platinum-sensitive disease was 61%. Herein, we present a case report of a PDA patient with a germ line BRCA2 mutation who was selected for PARP inhibitor-based therapy.\n\nMethods and results\nOur patient is a 63-year-old female who was diagnosed with pancreatic cancer when she initially presented with nausea, vomiting, abdominal pain, and jaundice in April 2014. She had a strong family history of cancer, with her brother having had breast cancer, and her mother having breast cancer and uterine cancer, and her father having prostate cancer. The patient had previously chosen to undergo germ line testing (from a buccal swab) through Myriad on 22 April 2010, which demonstrated a deleterious 6714 deletion mutation in BRCA2. An MRI on 03 April 2014 revealed a 1.7 × 2.1 cm mass in the head of the pancreas, and the patient was referred to Johns Hopkins University Hospital for evaluation. A pancreas protocol CT scan obtained for staging revealed a localised tumour with no vessel involvement. She enroled in a pre-operative trial of a short course of vaccine (GVAX) therapy with 7 days of oral cyclophosphamide (50 mg daily) pre-operatively. Then on 01 May 2014, the patient underwent surgical exploration for an intended pancreaticoduodenectomy. Unfortunately, intra-operatively, she was found to have metastatic disease to the liver, which was proven on an intraoperative frozen section. The liver lesion was excised and sent to Foundation Medicine for next-generation sequencing of cancer-related genes (Foundation ONE test), the results of which revealed a pathogenic BRCA2 mutation (c.6486_6489delACAA p.K2162fs*5), a four base pair deletion that resulted in a premature STOP codon (Figure 1). Careful review of the BRCA2 mutation identified in the tumour specimen by Foundation Medicine (and discussion with Foundation Medicine) have confirmed that the specific mutation was the same as the patient's germ line BRCA2 mutation identified on the buccal swab. Of note, an assessment of the mutational allele frequency (MAF) revealed that the MAF of the BRCA2 mutation was 61% – thus a higher allele frequency than would be expected for a purely heterozygous state, and suggesting that there was loss of heterozygosity in a portion of the cancer cells. However, because the tested sample was not of isolated tumour cells, adjacent stromal cell contamination may have affected the MAF results, and the MAF purely in the tumour cells may actually have been higher than 61%. The tumour also exhibited a KRAS G12V and a TP53 mutation (P295fs*50) both typical for pancreatic adenocarcinomas.\n\nAfter recovery from surgery, the patient was seen at Georgetown University for enrolment in an IRB-approved Phase I/II trial of 5-FU, oxaliplatin, and veliparib (NCT01489865). Her pre-treatment CA 19-9 was 31.5, and her baseline imaging revealed a pancreatic head mass 1.7 cm × 1.7 cm, as well as a left lobe liver lesion, 2.3 cm × 2.0 cm (Figure 1A, baseline imaging). The treatment consisted of the standard modified FOLFOX6 regimen with oxaliplatin (85 mg m−2) Day 1, and continuous infusion 5-fluorouracil (2400 mg m−2) Days 1–3 but without the 5-fluorouracil bolus. She also received veliparib 200 mg orally twice a day for 7 days, and the cycles were repeated every 2 weeks. Our patient began therapy on 05 June 2014, and had a fair degree of nausea and vomiting, ultimately requiring the dose of veliparib to be reduced by 50%, to 100 mg twice a day. She also had to stop the oxaliplatin after Cycle 13 for neuropathy. Nevertheless, the patient stayed on therapy for 31 cycles, through 10 August 2015 (progression-free survival=15 months). While on study, she experienced a near complete response, with a virtual radiographic disappearance of the liver lesion and pancreatic head lesion by 23 March 2015 (Figure 1B, near complete response imaging). Then, starting 18 May 2015, her imaging revealed renewed progression of the pancreatic head mass. Interestingly, the re-growth, in retrospect, was eccentric, when compared to the primary pancreatic mass, visually suggesting growth of an independent, resistant clone on the periphery (Figure 1C and D, emerging resistance imaging).\n\nPer RECIST criteria, the patient had developed progressive disease by 10 August 2015, but her disease burden was still minimal, and there was no evidence of extrapancreatic disease. On the basis of the lack of development of additional liver lesions and the response to systemic therapy, the patient underwent surgical exploration on 10 September 2015 at the Johns Hopkins University Hospital with the intent of performing a pancreaticoduodenectomy. The only identifiable liver lesion was resected and found to be scar tissue on intraoperative frozen section. As a result of these intraoperative findings the patient underwent a margin-negative pancreaticoduodenectomy at that time. Final pathology revealed a primary pancreatic adenocarcinoma with 3 out of 24 local lymph nodes positive for disease. Final pathology confirmed only scar within the liver lesion. She had an unremarkable recovery from the operation.\n\nAfter resection, due to the patient's reluctance to have additional cytotoxic chemotherapy she initiated olaparib as a maintenance strategy in place of cytotoxic adjuvant therapy. She was treated at 400 mg orally twice a day, but quickly needed to reduce the dose to 200 mg twice a day due to nausea and fatigue. During this time, the resection specimen was re-sent to Foundation Medicine, which again reported the original mutations (including the identical KRAS and TP53 mutations), but also revealed a new somatic (secondary) BRCA2 mutation (c.6448_6473delAAAGTTTCTCCATATCTCTCTCAATT p.K2150fs*17). This somatic 26 base deletion in the BRCA2 gene was located 13 bases upstream of the germ line 4 base pair deletion of the same allele. This secondary somatic deletion restored the reading frame of the BRCA2 gene, which contained the four base deletion (Figure 2). Interestingly, the MAF of the secondary mutation from the pancreatic resection specimen was only 8%, whereas the MAF of the germ line BRCA2 mutation was reduced to 52%. These results suggest that only a relatively small portion of the mutated alleles harboured this secondary mutation. Clinically, immediately following the pancreaticoduodenectomy, there was no evidence of recurrent metastatic disease and the functional consequences of this secondary mutation in this context were not known. That is, although the reading frame was restored, there was no knowledge of whether this produced a fully, or even hypo-functional BRCA2. As a consequence, olaparib was continued. Unfortunately, by early January, 2016 the patient was clearly becoming symptomatic, and imaging revealed early peritoneal carcinomatosis, suggesting olaparib offered no control of her disease. Thus, she was taken off therapy, and was able to enrol in an immunotherapy trial of the combination of the CXCR2 antagonist, AZD5069, and durvalumab (NCT02499328). While on study, she developed suppurative cholecystitis, and passed away on 24 May 2016.\n\nConclusions\nMany PARP inhibitor resistance mechanisms have been proposed (Montoni et al, 2013), but Sakai et al\n(2008) and Edwards et al\n(2008) were the first to describe that BRCA2 reversion mutations could confer resistance to PARP inhibitor-based therapy (Ashworth, 2008). They demonstrated that the PDA cell line CAPAN1 that has lost one copy of the BRCA2 gene and harbours a c.6174delT mutation in the other, are exquisitely sensitive to potent PARP inhibitors (McCabe et al, 2005). In the cell line, this mutation was accompanied by a loss of the wild-type copy of the BRCA2 gene, yet made a truncated protein ∼2000 amino acids. This study, albeit in just one cell line, demonstrated that PARP inhibitors targeted this BRCA2 genetic lesion by showing that isogenic cells generated to become >1000-fold resistant harboured a secondary mutation, which restored the open reading frame of the BRCA2 sequence, and thus restoring the DNA repair function (i.e., RAD51 binding to the BRCA repeats; Ashworth, 2008).\n\nSubsequently, others also demonstrated the presence of secondary BRCA1/2 mutations that confer resistance to therapy in BRCA1/2-mutated ovarian cancer patients, whose tumours had become resistant to platinum-based therapies (Swisher et al, 2008; Norquist et al, 2011), and may occur through a variety of mechanisms that would not be detected using NGS for selected genes and may require whole-genome sequencing (Patch et al, 2015). Importantly, Sakai et al\n(2008) demonstrated that the platinum-resistant, BRCA2 functionally reverted ovarian cancer cell lines also demonstrate resistance to PARP inhibitor therapy. Additional studies in breast and ovarian cancer patients described the development of BRCA reversion and PARP inhibitor resistance (Barber et al, 2013). Of note, Ang et al\n(2013) assessed response to chemotherapy including platinum-based chemotherapy in patients with PARP inhibitor (olaparib)-resistant ovarian cancer. Surprisingly, these PARP inhibitor-resistant ovarian cancers retained sensitivity to chemotherapies including platinums. However, these observations were confounded by the fact that none of the PARP inhibitor-resistant ovarian cancers were found to have BRCA reversion events, thus providing evidence that other mechanisms may be at play such as defects in drug transport or drug metabolism.\n\nAs our patient received several therapies, including those that target similar mechanisms such as platinum and PARP inhibition, it is difficult to be definitive. Yet it is reasonable that either the platinum and/or the PARP inhibitor induced selection pressure on the tumour to restore defective DNA damage response mechanisms. To our knowledge, this is the first report of a BRCA2 reversion mutation, which conferred resistance to PARP inhibitor-based therapy in a PDA patient. Future studies are needed to understand this important mechanism of resistance and how it may impact the choice of therapy for patients with pancreatic cancer. Central to this approach is the assessment of tumour biopsies pre- and post treatment.\n\nWe wish to thank the Ruesch Center for the Cure of Gastrointestinal Cancers for support of the clinical trial; Abbvie Inc. for supplying the veliparib; and Foundation Medicine for providing detailed analyses of the tumour mutational testing. Also, the 2015 Pancreatic Cancer Action Network American Association for Cancer Research Acceleration Network Grant (15-90-25-BROD).\n\nThis work is published under the standard license to publish agreement. After 12 months the work will become freely available and the license terms will switch to a Creative Commons Attribution-NonCommercial-Share Alike 4.0 Unported License.\n\nThe authors declare no conflict of interest.\n\nFigure 1 Patient images.The baseline scans from 28 May 2014 revealed a liver lesion and pancreatic mass. These lesions slowly improved on veliparib, 5-FU, and oxaliplatin therapy, and by 23 March 2015, the liver lesion was not visible, and the pancreatic mass was barely visible. However, from May 2015 to August 2015, there was steady re-growth of what proved to be a resistant clone in the pancreas, eccentric from the original mass.\n\nFigure 2 Germ line and secondary BRCA2 mutations in pancreatic cancer.(A) Location of mutations in exon 11 – note proximity. (B) The germ line mutation with the deletion highlighted in yellow, with C showing the resultant transcript with a premature STOP codon. D shows the secondary somatic mutation in normal BRCA2 sequence, with E showing the secondary mutation in the context of the germ line deletion with restoration of the reading frame. The green box with arrow shows how the secondary mutation brings the coding region back into the correct reading frame. A full colour version of this figure is available at the British Journal of Cancer journal online\n==== Refs\nAng JE, Gourley C, Powell CB, High H, Shapira-Frommer R, Castonguay V, De Greve J, Atkinson T, Yap TA, Sandhu S, Banerjee S, Chen LM, Friedlander ML, Kaufman B, Oza AM, Matulonis U, Barber LJ, Kozarewa I, Fenwick K, Assiotis I, Campbell J, Chen L, de Bono JS, Gore ME, Lord CJ, Ashworth A, Kaye SB (2013 ) Efficacy of chemotherapy in BRCA1/2 mutation carrier ovarian cancer in the setting of PARP inhibitor resistance: a multi-institutional study . Clin Cancer Res \n19 (19): 5485 –5493.23922302 \nAshworth A (2008 ) Drug resistance caused by reversion mutation . Cancer Res \n68 (24): 10021 –10023.19074863 \nAudeh MW, Carmichael J, Penson RT, Friedlander M, Powell B, Bell-McGuinn KM, Scott C, Weitzel JN, Oaknin A, Loman N, Lu K, Schmutzler RK, Matulonis U, Wickens M, Tutt A (2010 ) Oral poly (ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and recurrent ovarian cancer: a proof-of-concept trial . Lancet \n376 (9737): 245 –251.20609468 \nBailey P, Chang DK, Nones K, Johns AL, Patch AM, Gingras MC, Miller DK, Christ AN, Bruxner TJ, Quinn MC, Nourse C, Murtaugh LC, Harliwong I, Idrisoglu S, Manning S, Nourbakhsh E, Wani S, Fink L, Holmes O, Chin V, Anderson MJ, Kazakoff S, Leonard C, Newell F, Waddell N, Wood S, Xu Q, Wilson PJ, Cloonan N, Kassahn KS, Taylor D, Quek K, Robertson A, Pantano L, Mincarelli L, Sanchez LN, Evers L, Wu J, Pinese M, Cowley MJ, Jones MD, Colvin EK, Nagrial AM, Humphrey ES, Chantrill LA, Mawson A, Humphris J, Chou A, Pajic M, Scarlett CJ, Pinho AV, Giry-Laterriere M, Rooman I, Samra JS, Kench JG, Lovell JA, Merrett ND, Toon CW, Epari K, Nguyen NQ, Barbour A, Zeps N, Moran-Jones K, Jamieson NB, Graham JS, Duthie F, Oien K, Hair J, Grutzmann R, Maitra A, Iacobuzio-Donahue CA, Wolfgang CL, Morgan RA, Lawlor RT, Corbo V, Bassi C, Rusev B, Capelli P, Salvia R, Tortora G, Mukhopadhyay D, Petersen GM Australian Pancreatic Cancer Genome IMunzy DM, Fisher WE, Karim SA, Eshleman JR, Hruban RH, Pilarsky C, Morton JP, Sansom OJ, Scarpa A, Musgrove EA, Bailey UM, Hofmann O, Sutherland RL, Wheeler DA, Gill AJ, Gibbs RA, Pearson JV, Waddell N, Biankin AV, Grimmond SM (2016 ) Genomic analyses identify molecular subtypes of pancreatic cancer . Nature \n531 (7592): 47 –52.26909576 \nBarber LJ, Sandhu S, Chen L, Campbell J, Kozarewa I, Fenwick K, Assiotis I, Rodrigues DN, Reis Filho JS, Moreno V, Mateo J, Molife LR, De Bono J, Kaye S, Lord CJ, Ashworth A (2013 ) Secondary mutations in BRCA2 associated with clinical resistance to a PARP inhibitor . J Pathol \n229 (3): 422 –429.23165508 \nCurtin NJ, Wang LZ, Yiakouvaki A, Kyle S, Arris CA, Canan-Koch S, Webber SE, Durkacz BW, Calvert HA, Hostomsky Z, Newell DR (2004 ) Novel poly (ADP-ribose) polymerase-1 inhibitor, AG14361, restores sensitivity to temozolomide in mismatch repair-deficient cells . Clin Cancer Res \n10 (3): 881 –889.14871963 \nDePinho RA, Polyak K (2004 ) Cancer chromosomes in crisis . Nat Genet \n36 (9): 932 –934.15340427 \nDonawho CK, Luo Y, Luo Y, Penning TD, Bauch JL, Bouska JJ, Bontcheva-Diaz VD, Cox BF, DeWeese TL, Dillehay LE, Ferguson DC, Ghoreishi-Haack NS, Grimm DR, Guan R, Han EK, Holley-Shanks RR, Hristov B, Idler KB, Jarvis K, Johnson EF, Kleinberg LR, Klinghofer V, Lasko LM, Liu X, Marsh KC, McGonigal TP, Meulbroek JA, Olson AM, Palma JP, Rodriguez LE, Shi Y, Stavropoulos JA, Tsurutani AC, Zhu GD, Rosenberg SH, Giranda VL, Frost DJ (2007 ) ABT-888, an orally active poly (ADP-ribose) polymerase inhibitor that potentiates DNA-damaging agents in preclinical tumor models . Clin Cancer Res \n13 (9): 2728 –2737.17473206 \nEdwards SL, Brough R, Lord CJ, Natrajan R, Vatcheva R, Levine DA, Boyd J, Reis-Filho JS, Ashworth A (2008 ) Resistance to therapy caused by intragenic deletion in BRCA2 . Nature \n451 (7182): 1111 –1115.18264088 \nFarmer H, McCabe N, Lord CJ, Tutt AN, Johnson DA, Richardson TB, Santarosa M, Dillon KJ, Hickson I, Knights C, Martin NM, Jackson SP, Smith GC, Ashworth A (2005 ) Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy . Nature \n434 (7035): 917 –921.15829967 \nFong PC, Yap TA, Boss DS, Carden CP, Mergui-Roelvink M, Gourley C, De Greve J, Lubinski J, Shanley S, Messiou C, A'Hern R, Tutt A, Ashworth A, Stone J, Carmichael J, Schellens JH, de Bono JS, Kaye SB (2010 ) Poly(ADP)-ribose polymerase inhibition: frequent durable responses in BRCA carrier ovarian cancer correlating with platinum-free interval . J Clin Oncol \n28 (15): 2512 –2519.20406929 \nGelmon KA, Tischkowitz M, Mackay H, Swenerton K, Robidoux A, Tonkin K, Hirte H, Huntsman D, Clemons M, Gilks B, Yerushalmi R, Macpherson E, Carmichael J, Oza A (2011 ) Olaparib in patients with recurrent high-grade serous or poorly differentiated ovarian carcinoma or triple-negative breast cancer: a phase 2, multicentre, open-label, non-randomised study . Lancet Oncol \n12 (9): 852 –861.21862407 \nKaufman B, Shapira-Frommer R, Schmutzler RK, Audeh MW, Friedlander M, Balmana J, Mitchell G, Fried G, Stemmer SM, Hubert A, Rosengarten O, Steiner M, Loman N, Bowen K, Fielding A, Domchek SM (2015 ) Olaparib monotherapy in patients with advanced cancer and a germline BRCA1/2 mutation . J Clin Oncol \n33 (3): 244 –250.25366685 \nKaye SB, Lubinski J, Matulonis U, Ang JE, Gourley C, Karlan BY, Amnon A, Bell-McGuinn KM, Chen LM, Friedlander M, Safra T, Vergote I, Wickens M, Lowe ES, Carmichael J, Kaufman B (2012 ) Phase II, open-label, randomized, multicenter study comparing the efficacy and safety of olaparib, a poly (ADP-ribose) polymerase inhibitor, and pegylated liposomal doxorubicin in patients with BRCA1 or BRCA2 mutations and recurrent ovarian cancer . J Clin Oncol \n30 (4): 372 –379.22203755 \nKummar S, Kinders R, Gutierrez ME, Rubinstein L, Parchment RE, Phillips LR, Ji J, Monks A, Low JA, Chen A, Murgo AJ, Collins J, Steinberg SM, Eliopoulos H, Giranda VL, Gordon G, Helman L, Wiltrout R, Tomaszewski JE, Doroshow JH (2009 ) Phase 0 clinical trial of the poly (ADP-ribose) polymerase inhibitor ABT-888 in patients with advanced malignancies . J Clin Oncol \n27 (16): 2705 –2711.19364967 \nLangelier MF, Servent KM, Rogers EE, Pascal JM (2008 ) A third zinc-binding domain of human poly (ADP-ribose) polymerase-1 coordinates DNA-dependent enzyme activation . J Biol Chem \n283 (7): 4105 –4114.18055453 \nLedermann J, Harter P, Gourley C, Friedlander M, Vergote I, Rustin G, Scott C, Meier W, Shapira-Frommer R, Safra T, Matei D, Macpherson E, Watkins C, Carmichael J, Matulonis U (2012 ) Olaparib maintenance therapy in platinum-sensitive relapsed ovarian cancer . N Engl J Med \n366 (15): 1382 –1392.22452356 \nLowery MA, Kelsen DP, Stadler ZK, Yu KH, Janjigian YY, Ludwig E, D'Adamo DR, Salo-Mullen E, Robson ME, Allen PJ, Kurtz RC, O'Reilly EM (2011 ) An emerging entity: pancreatic adenocarcinoma associated with a known BRCA mutation: clinical descriptors, treatment implications, and future directions . Oncologist \n16 (10): 1397 –1402.21934105 \nMateo J, Carreira S, Sandhu S, Miranda S, Mossop H, Perez-Lopez R, Nava Rodrigues D, Robinson D, Omlin A, Tunariu N, Boysen G, Porta N, Flohr P, Gillman A, Figueiredo I, Paulding C, Seed G, Jain S, Ralph C, Protheroe A, Hussain S, Jones R, Elliott T, McGovern U, Bianchini D, Goodall J, Zafeiriou Z, Williamson CT, Ferraldeschi R, Riisnaes R, Ebbs B, Fowler G, Roda D, Yuan W, Wu YM, Cao X, Brough R, Pemberton H, A'Hern R, Swain A, Kunju LP, Eeles R, Attard G, Lord CJ, Ashworth A, Rubin MA, Knudsen KE, Feng FY, Chinnaiyan AM, Hall E, de Bono JS (2015 ) DNA-repair defects and olaparib in metastatic prostate cancer . N Engl J Med \n373 (18): 1697 –1708.26510020 \nMcCabe N, Lord CJ, Tutt AN, Martin NM, Smith GC, Ashworth A (2005 ) BRCA2-deficient CAPAN-1 cells are extremely sensitive to the inhibition of poly (ADP-ribose) polymerase: an issue of potency . Cancer Biol Ther \n4 (9): 934 –936.16251802 \nMcCabe N, Turner NC, Lord CJ, Kluzek K, Bialkowska A, Swift S, Giavara S, O'Connor MJ, Tutt AN, Zdzienicka MZ, Smith GC, Ashworth A (2006 ) Deficiency in the repair of DNA damage by homologous recombination and sensitivity to poly (ADP-ribose) polymerase inhibition . Cancer Res \n66 (16): 8109 –8115.16912188 \nMontoni A, Robu M, Pouliot E, Shah GM (2013 ) Resistance to PARP-inhibitors in cancer therapy . Front Pharmacol \n4 : 18 .23450678 \nNorquist B, Wurz KA, Pennil CC, Garcia R, Gross J, Sakai W, Karlan BY, Taniguchi T, Swisher EM (2011 ) Secondary somatic mutations restoring BRCA1/2 predict chemotherapy resistance in hereditary ovarian carcinomas . J Clin Oncol \n29 (22): 3008 –3015.21709188 \nO'Reilly EM, Lowery MA, Segal MF, Smith SC, Moore MJ, Kindler HL, Golan T, Segal A, Salo-Mullen EE, Hollywood E, Epstein AS, Capanu M, Moynahan ME, Fusco A, Stadler ZK, Do RKG, Chen AP, Yu KH, Tang LH, Kelsen DP (2014 ) Phase IB trial of cisplatin (C), gemcitabine (G), and veliparib (V) in patients with known or potential BRCA or PALB2-mutated pancreas adenocarcinoma (PC) . J Clin Oncol \n32 (5s suppl): abstr 4023 .\nOza AM, Cibula D, Benzaquen AO, Poole C, Mathijssen RH, Sonke GS, Colombo N, Spacek J, Vuylsteke P, Hirte H, Mahner S, Plante M, Schmalfeldt B, Mackay H, Rowbottom J, Lowe ES, Dougherty B, Barrett JC, Friedlander M (2015 ) Olaparib combined with chemotherapy for recurrent platinum-sensitive ovarian cancer: a randomised phase 2 trial . Lancet Oncol \n16 (1): 87 –97.25481791 \nPatch AM, Christie EL, Etemadmoghadam D, Garsed DW, George J, Fereday S, Nones K, Cowin P, Alsop K, Bailey PJ, Kassahn KS, Newell F, Quinn MC, Kazakoff S, Quek K, Wilhelm-Benartzi C, Curry E, Leong HS Australian Ovarian Cancer Study GHamilton A, Mileshkin L, Au-Yeung G, Kennedy C, Hung J, Chiew YE, Harnett P, Friedlander M, Quinn M, Pyman J, Cordner S, O'Brien P, Leditschke J, Young G, Strachan K, Waring P, Azar W, Mitchell C, Traficante N, Hendley J, Thorne H, Shackleton M, Miller DK, Arnau GM, Tothill RW, Holloway TP, Semple T, Harliwong I, Nourse C, Nourbakhsh E, Manning S, Idrisoglu S, Bruxner TJ, Christ AN, Poudel B, Holmes O, Anderson M, Leonard C, Lonie A, Hall N, Wood S, Taylor DF, Xu Q, Fink JL, Waddell N, Drapkin R, Stronach E, Gabra H, Brown R, Jewell A, Nagaraj SH, Markham E, Wilson PJ, Ellul J, McNally O, Doyle MA, Vedururu R, Stewart C, Lengyel E, Pearson JV, Waddell N, deFazio A, Grimmond SM, Bowtell DD (2015 ) Whole-genome characterization of chemoresistant ovarian cancer . Nature \n521 (7553): 489 –494.26017449 \nPishvaian MJ, Wang H, Zhuang T, He AR, Hwang JJ, Hankin A, Ley L, White K, Littman SJ, Weiner LM, Marshall J, Brody JR (2013 ) A phase I/II study of ABT-888 in combination with 5-fluorouracil (5-FU) and oxaliplatin (Ox) in patients with metastatic pancreatic cancer (MPC) . J Clin Oncol \nsuppl 4 : abstr 147 .\nSakai W, Swisher EM, Karlan BY, Agarwal MK, Higgins J, Friedman C, Villegas E, Jacquemont C, Farrugia DJ, Couch FJ, Urban N, Taniguchi T (2008 ) Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers . Nature \n451 (7182): 1116 –1120.18264087 \nSandhu SK, Schelman WR, Wilding G, Moreno V, Baird RD, Miranda S, Hylands L, Riisnaes R, Forster M, Omlin A, Kreischer N, Thway K, Gevensleben H, Sun L, Loughney J, Chatterjee M, Toniatti C, Carpenter CL, Iannone R, Kaye SB, de Bono JS, Wenham RM (2013 ) The poly (ADP-ribose) polymerase inhibitor niraparib (MK4827) in BRCA mutation carriers and patients with sporadic cancer: a phase 1 dose-escalation trial . Lancet Oncol \n14 (9): 882 –892.23810788 \nSharpless NE, DePinho RA (2004 ) Telomeres, stem cells, senescence, and cancer . J Clin Invest \n113 (2): 160 –168.14722605 \nSwisher EM, Sakai W, Karlan BY, Wurz K, Urban N, Taniguchi T (2008 ) Secondary BRCA1 mutations in BRCA1-mutated ovarian carcinomas with platinum resistance . Cancer Res \n68 (8): 2581 –2586.18413725 \nTutt A, Robson M, Garber JE, Domchek SM, Audeh MW, Weitzel JN, Friedlander M, Arun B, Loman N, Schmutzler RK, Wardley A, Mitchell G, Earl H, Wickens M, Carmichael J (2010 ) Oral poly (ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and advanced breast cancer: a proof-of-concept trial . Lancet \n376 (9737): 235 –244.20609467 \nvan der Heijden MS, Brody JR, Dezentje DA, Gallmeier E, Cunningham SC, Swartz MJ, DeMarzo AM, Offerhaus GJ, Isacoff WH, Hruban RH, Kern SE (2005 ) In vivo therapeutic responses contingent on Fanconi anemia/BRCA2 status of the tumor . Clin Cancer Res \n11 (20): 7508 –7515.16243825 \nWaddell N, Pajic M, Patch AM, Chang DK, Kassahn KS, Bailey P, Johns AL, Miller D, Nones K, Quek K, Quinn MC, Robertson AJ, Fadlullah MZ, Bruxner TJ, Christ AN, Harliwong I, Idrisoglu S, Manning S, Nourse C, Nourbakhsh E, Wani S, Wilson PJ, Markham E, Cloonan N, Anderson MJ, Fink JL, Holmes O, Kazakoff SH, Leonard C, Newell F, Poudel B, Song S, Taylor D, Waddell N, Wood S, Xu Q, Wu J, Pinese M, Cowley MJ, Lee HC, Jones MD, Nagrial AM, Humphris J, Chantrill LA, Chin V, Steinmann AM, Mawson A, Humphrey ES, Colvin EK, Chou A, Scarlett CJ, Pinho AV, Giry-Laterriere M, Rooman I, Samra JS, Kench JG, Pettitt JA, Merrett ND, Toon C, Epari K, Nguyen NQ, Barbour A, Zeps N, Jamieson NB, Graham JS, Niclou SP, Bjerkvig R, Grutzmann R, Aust D, Hruban RH, Maitra A, Iacobuzio-Donahue CA, Wolfgang CL, Morgan RA, Lawlor RT, Corbo V, Bassi C, Falconi M, Zamboni G, Tortora G, Tempero MA Australian Pancreatic Cancer Genome IGill AJ, Eshleman JR, Pilarsky C, Scarpa A, Musgrove EA, Pearson JV, Biankin AV, Grimmond SM (2015 ) Whole genomes redefine the mutational landscape of pancreatic cancer . Nature \n518 (7540): 495 –501.25719666\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "0007-0920",
"issue": "116(8)",
"journal": "British journal of cancer",
"keywords": null,
"medline_ta": "Br J Cancer",
"mesh_terms": "D000230:Adenocarcinoma; D000971:Antineoplastic Combined Chemotherapy Protocols; D024682:BRCA2 Protein; D001562:Benzimidazoles; D021441:Carcinoma, Pancreatic Ductal; D019008:Drug Resistance, Neoplasm; D004359:Drug Therapy, Combination; D005260:Female; D005472:Fluorouracil; D006801:Humans; D008875:Middle Aged; D009154:Mutation; D009367:Neoplasm Staging; D009944:Organoplatinum Compounds; D000077150:Oxaliplatin; D010190:Pancreatic Neoplasms; D000067856:Poly(ADP-ribose) Polymerase Inhibitors; D011065:Poly(ADP-ribose) Polymerases; D011379:Prognosis",
"nlm_unique_id": "0370635",
"other_id": null,
"pages": "1021-1026",
"pmc": null,
"pmid": "28291774",
"pubdate": "2017-04-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "23165508;23450678;21709188;18413725;22203755;16912188;23810788;17473206;14871963;19364967;20609467;16251802;15340427;18264087;18055453;18264088;14722605;25366685;21862407;25481791;25719666;20406929;16243825;26510020;19074863;26017449;21934105;15829967;20609468;23922302;26909576;22452356",
"title": "BRCA2 secondary mutation-mediated resistance to platinum and PARP inhibitor-based therapy in pancreatic cancer.",
"title_normalized": "brca2 secondary mutation mediated resistance to platinum and parp inhibitor based therapy in pancreatic cancer"
} | [
{
"companynumb": "US-TEVA-783171USA",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "OLAPARIB"
},
"drugadditional": null,
"druga... |
{
"abstract": "We describe a rare case of drug-induced hepatitis due to the smoking cessation agent varenicline in a 46-year-old Asian woman. The liver injury progressed in two steps. First, the liver injury started in the absence of viral/autoimmune responses, and withdrawal of varenicline lowered the increase in the levels of liver enzymes immediately. Such findings suggested varenicline-induced liver injury. Second, hepatitis recurred in association with conversion of antinuclear antibody from negative to positive about 8 weeks after the initial episode. Histology upon recurrence of liver injury revealed interface hepatitis with lymphocytic and lymphoplasmacytic portal inflammatory infiltrates extending into lobules. Such findings suggested autoimmune hepatitis. Corticosteroid treatment was effective for recurrent hepatitis. The clinical course suggests that varenicline caused drug-induced liver injury and subsequent autoimmune hepatitis. Some autoimmune changes were probably involved in the mechanism of varenicline-induced liver injury.",
"affiliations": "Department of Hepatobiliary and Pancreatic Oncology, Osaka International Cancer Institute, 3-1-69 Otemae, Chuo-ku, Osaka, 541-8567, Japan. sakakibara-mi@mc.pref.osaka.jp.;Department of Hepatobiliary and Pancreatic Oncology, Osaka International Cancer Institute, 3-1-69 Otemae, Chuo-ku, Osaka, 541-8567, Japan.;Department of Hepatobiliary and Pancreatic Oncology, Osaka International Cancer Institute, 3-1-69 Otemae, Chuo-ku, Osaka, 541-8567, Japan.;Department of Hepatobiliary and Pancreatic Oncology, Osaka International Cancer Institute, 3-1-69 Otemae, Chuo-ku, Osaka, 541-8567, Japan.;Department of Hepatobiliary and Pancreatic Oncology, Osaka International Cancer Institute, 3-1-69 Otemae, Chuo-ku, Osaka, 541-8567, Japan.;Department of Hepatobiliary and Pancreatic Oncology, Osaka International Cancer Institute, 3-1-69 Otemae, Chuo-ku, Osaka, 541-8567, Japan.;Department of Hepatobiliary and Pancreatic Oncology, Osaka International Cancer Institute, 3-1-69 Otemae, Chuo-ku, Osaka, 541-8567, Japan.",
"authors": "Sakakibara|Mitsuru|M|http://orcid.org/0000-0003-4649-2082;Ohkawa|Kazuyoshi|K|;Nawa|Takatoshi|T|;Abe|Yutaro|Y|;Kusakabe|Akira|A|;Imai|Toshihiro|T|;Katayama|Kazuhiro|K|",
"chemical_list": "D018722:Nicotinic Agonists; D000068580:Varenicline",
"country": "Japan",
"delete": false,
"doi": "10.1007/s12328-018-0824-x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1865-7265",
"issue": "11(3)",
"journal": "Clinical journal of gastroenterology",
"keywords": "AIH; Autoimmune hepatitis; DILI; Drug-induced liver injury; Varenicline",
"medline_ta": "Clin J Gastroenterol",
"mesh_terms": "D056486:Chemical and Drug Induced Liver Injury; D018450:Disease Progression; D005260:Female; D019693:Hepatitis, Autoimmune; D006801:Humans; D008099:Liver; D008214:Lymphocytes; D008875:Middle Aged; D018722:Nicotinic Agonists; D012008:Recurrence; D016540:Smoking Cessation; D000068580:Varenicline; D028761:Withholding Treatment",
"nlm_unique_id": "101477246",
"other_id": null,
"pages": "184-187",
"pmc": null,
"pmid": "29383494",
"pubdate": "2018-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "28119269;19031437;10580593;22681894;21921356;14585395;25820383;20564754;12469151;19638471;27402321;21396413;15588780;17931212",
"title": "Two-step progression of varenicline-induced autoimmune hepatitis.",
"title_normalized": "two step progression of varenicline induced autoimmune hepatitis"
} | [
{
"companynumb": "JP-PFIZER INC-2018053594",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "VARENICLINE TARTRATE"
},
"drugadditional": "1"... |
{
"abstract": "There have been conflicting findings for severe mental illnesses and the risk for gestational diabetes mellitus (GDM). Outside of pregnancy, both severe mental illnesses and specific antipsychotic medications have been associated with an elevated risk for metabolic disorders, including type 2 diabetes mellitus.\n\n\n\nThis study examined the risk of developing GDM in relation to mental disorder, psychotropic treatment and comorbid risk factors.\n\n\n\nA retrospective study of 539 pregnant women with mental disorders was carried out. Measures included GDM diagnosis, mental health diagnosis, psychotropic medication, body mass index, age, smoking, alcohol and illicit substance use.\n\n\n\nThis study found that women with psychotic disorders had a significantly elevated risk for GDM (20.9%) compared with women with non-psychotic severe mental illnesses during pregnancy (P = 0.023), and nearly threefold the expected population rate (8.3%). Furthermore, women using specific antipsychotic agents - risperidone (P = 0.016), clozapine (P < 0.001) and higher-dose quetiapine (P = 0.029) - also had a higher risk of developing GDM. After adjusting for maternal age and body mass index, women taking these specific agents continued to have a fourfold risk of having GDM compared with women not taking these agents. Smoking, alcohol consumption and illicit drug use were not associated with elevated GDM rate in women with mental disorders.\n\n\n\nThese findings support the need for early screening and closer surveillance of metabolic risk in pregnancy for women with psychotic disorders and those taking specific atypical antipsychotic agents.",
"affiliations": "School of Psychology and Exercise Science, Murdoch University, Perth, Western Australia, Australia.;King Edward Memorial Hospital, Perth, Western Australia, Australia.;School of Psychology and Exercise Science, Murdoch University, Perth, Western Australia, Australia.;Neuropsychiatric Epidemiology Research Unit, School of Population and Global Health, The University of Western Australia, Perth, Western Australia, Australia.;Mercy Hospital for Women, Melbourne, Victoria, Australia.",
"authors": "Galbally|Megan|M|0000-0003-3909-1918;Frayne|Jacqueline|J|;Watson|Stuart J|SJ|;Morgan|Vera|V|;Snellen|Martien|M|",
"chemical_list": "D014150:Antipsychotic Agents",
"country": "Australia",
"delete": false,
"doi": "10.1111/ajo.12986",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0004-8666",
"issue": "60(1)",
"journal": "The Australian & New Zealand journal of obstetrics & gynaecology",
"keywords": "antipsychotics; bipolar disorder; gestational diabetes; schizophrenia; severe mental illness",
"medline_ta": "Aust N Z J Obstet Gynaecol",
"mesh_terms": "D000328:Adult; D014150:Antipsychotic Agents; D001315:Australia; D001714:Bipolar Disorder; D015897:Comorbidity; D016640:Diabetes, Gestational; D005260:Female; D006801:Humans; D001523:Mental Disorders; D011247:Pregnancy; D011248:Pregnancy Complications; D011618:Psychotic Disorders; D012189:Retrospective Studies",
"nlm_unique_id": "0001027",
"other_id": null,
"pages": "63-69",
"pmc": null,
"pmid": "31141172",
"pubdate": "2020-02",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study",
"references": null,
"title": "The association between gestational diabetes mellitus, antipsychotics and severe mental illness in pregnancy: A multicentre study.",
"title_normalized": "the association between gestational diabetes mellitus antipsychotics and severe mental illness in pregnancy a multicentre study"
} | [
{
"companynumb": "AU-OTSUKA-2020_006282",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ARIPIPRAZOLE"
},
"drugadditional": "3",
... |
{
"abstract": "Immunocompromised patients may have severe forms of infections. Since there is an increasing number of patients maintained under immunosuppressive therapy, we will be confronted with increasing frequency with these infectious problems. Effective treatments will be of great value. The case is described of a renal transplant with a giant orf lesion, which continued growing instead of regressing spontaneously as is observed usually. The treatment options in such patients are limited. It was decided to treat the patient with the antiviral drug cidofovir (HPMPC, Vistide. Topical cidofovir treatment resulted in complete regression of the lesion. This case is discussed in the context of the known literature on orf (ecthyma contagiosum).",
"affiliations": "Department of Dermatology, University Hospital, K.U. Leuven, Leuven, Belgium.",
"authors": "Geerinck|K|K|;Lukito|G|G|;Snoeck|R|R|;De Vos|R|R|;De Clercq|E|E|;Vanrenterghem|Y|Y|;Degreef|H|H|;Maes|B|B|",
"chemical_list": "D000998:Antiviral Agents; D063065:Organophosphonates; D009943:Organophosphorus Compounds; D003596:Cytosine; D000077404:Cidofovir",
"country": "United States",
"delete": false,
"doi": "10.1002/jmv.1084",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0146-6615",
"issue": "64(4)",
"journal": "Journal of medical virology",
"keywords": null,
"medline_ta": "J Med Virol",
"mesh_terms": "D000287:Administration, Topical; D000328:Adult; D000998:Antiviral Agents; D000077404:Cidofovir; D003596:Cytosine; D004474:Ecthyma, Contagious; D005260:Female; D006229:Hand Dermatoses; D006801:Humans; D016867:Immunocompromised Host; D009923:Orf virus; D063065:Organophosphonates; D009943:Organophosphorus Compounds; D016896:Treatment Outcome",
"nlm_unique_id": "7705876",
"other_id": null,
"pages": "543-9",
"pmc": null,
"pmid": "11468742",
"pubdate": "2001-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "A case of human orf in an immunocompromised patient treated successfully with cidofovir cream.",
"title_normalized": "a case of human orf in an immunocompromised patient treated successfully with cidofovir cream"
} | [
{
"companynumb": "US-ALKEM LABORATORIES LIMITED-US-ALKEM-2021-01305",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "MYCOPHENOLATE MOFETIL"
},
... |
{
"abstract": "METHODS\nA 26-year-old man with a history of longstanding treatment-resistant schizophrenia gained a substantial amount of weight while being treated with high-dose combination antipsychotic therapy with olanzapine and amisulpride. The patient was switched to combination therapy with olanzapine and aripiprazole to reverse a drug-induced hyperprolactinemia. The patient subsequently lost over 37 lb in weight over a period of 4 months despite no measurable changes in his dietary caloric intake or in his level of physical activity and without any identifiable medical cause on physical investigation.\n\n\nCONCLUSIONS\nThe timing of the weight loss following the addition of aripiprazole and the exclusion of a medical cause point toward a causal relationship between the change in the patient's medication and the dramatic change in his body weight. We propose that, in a subgroup of patients, the addition of aripiprazole to their antipsychotic regime (without stopping the offending antipsychotic in terms of weight gain) can result in very significant weight loss and even the reversal of antipsychotic-induced weight gain.",
"affiliations": "BOLAND and CHHABRA: West London Mental Health NHS Trust, London, UK.",
"authors": "Boland|Xavier|X|;Chhabra|Preeti|P|",
"chemical_list": "D014150:Antipsychotic Agents; D000068180:Aripiprazole; D000077152:Olanzapine",
"country": "United States",
"delete": false,
"doi": "10.1097/PRA.0000000000000372",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1527-4160",
"issue": "25(2)",
"journal": "Journal of psychiatric practice",
"keywords": null,
"medline_ta": "J Psychiatr Pract",
"mesh_terms": "D000328:Adult; D014150:Antipsychotic Agents; D000068180:Aripiprazole; D057915:Drug Substitution; D004359:Drug Therapy, Combination; D006801:Humans; D008297:Male; D000077152:Olanzapine; D012559:Schizophrenia; D015431:Weight Loss",
"nlm_unique_id": "100901141",
"other_id": null,
"pages": "135-138",
"pmc": null,
"pmid": "30849062",
"pubdate": "2019-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Dramatic Weight Loss Following Addition of Aripiprazole to Olanzapine in a Patient With Treatment-resistant Schizophrenia: A Case Report.",
"title_normalized": "dramatic weight loss following addition of aripiprazole to olanzapine in a patient with treatment resistant schizophrenia a case report"
} | [
{
"companynumb": "GB-PRINSTON PHARMACEUTICAL INC.-2019PRN00367",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "ARIPIPRAZOLE"
},
"drugaddi... |
{
"abstract": "Outcomes for triple-negative or hormone-refractory metastatic breast cancer (MBC) are poor and treatment options are limited. Described herein are cases of two women who developed MBC following adjuvant chemotherapy and endocrine therapy for human epidermal growth factor receptor 2 (HER2)-negative ductal carcinoma. Both underwent treatment with fulvestrant, followed by paclitaxel and letrozole or nab-paclitaxel. Following disease progression, both patients started single-agent eribulin mesylate (1.4 mg/m(2) on Days 1 and 8 of a 21-day cycle). The first patient is currently continuing on eribulin at full dose, despite interruption for hip surgery and the presence of grade 1 neuropathy in the hands and feet. The second patient had a partial response with eribulin, which was sustained for 4 months. She was able to tolerate the full dose of eribulin despite slight worsening of the neuropathy that was present at baseline. Eribulin may be a beneficial option for hormone-refractory MBC with extensive treatment experience.",
"affiliations": "US Oncology-Cancer Care Centers of South Texas, San Antonio, TX, USA.;Texas Oncology-Dallas Presbyterian Hospital, US Oncology, Dallas, TX, USA.",
"authors": "Wilks|Sharon|S|;McIntyre|Kristi|K|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.4137/CMO.S27962",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1179-5549",
"issue": "9()",
"journal": "Clinical Medicine Insights. Oncology",
"keywords": "breast cancer; eribulin; hormone refractory; metastatic",
"medline_ta": "Clin Med Insights Oncol",
"mesh_terms": null,
"nlm_unique_id": "101525771",
"other_id": null,
"pages": "81-5",
"pmc": null,
"pmid": "26508896",
"pubdate": "2015",
"publication_types": "D002363:Case Reports",
"references": "21376385;18561551;21161370;24350218;22997442;15106201;12065558;12586793;25605862",
"title": "Case Studies in the Management of Metastatic Breast Cancer with Eribulin.",
"title_normalized": "case studies in the management of metastatic breast cancer with eribulin"
} | [
{
"companynumb": "US-ACTAVIS-2015-25657",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "FULVESTRANT"
},
"drugadditional": null,
... |
{
"abstract": "Takotsubo cardiomyopathy is a condition characterized by transient left ventricular systolic and diastolic dysfunction, with a possible direct causal role of catecholamine in its pathophysiology. We present a case of a woman with shock and adrenal insufficiency in whom Takotsubo cardiomyopathy developed after treatment with norepinephrine. This case confirms the direct causal role of catecholamine in the pathophysiology of Takotsubo cardiomyopathy. An 82-year-old woman presented with asthenia, anorexia, nausea and abdominal pain. The patient had been on chronic corticosteroid therapy until 3 months before, when she underwent abdominal surgery and corticosteroids were stopped. She now presented with acute kidney injury, hyponatremia and hyperkalemia and shock. A norepinephrine continuous infusion was administered to maintain a mean arterial pressure over 65 mmHg. An echocardiogram showed severe hypokinesis in the apical segments and hyperdynamic basal segments, with an ejection fraction of 25%. Plasma cortisol level was 4.5 μg/dL (reference range 5-25). Corticosteroid therapy was begun and norepinephrine was tapered and stopped. A new echocardiogram showed normalization of cardiac wall motion and an ejection fraction of 70%. This case highlights the importance of the correction of the cause of shock, as well as the risks associated with the use of norepinephrine if hypotension is severe or if it persists despite fluid administration, as usually recommended. It also confirms the direct causal role of catecholamine in the pathophysiology of Takotsubo cardiomyopathy. To the best of our knowledge, this is the first report of stress-induced cardiomyopathy secondary to norepinephrine by continuous infusion for shock.\nTakotsubo cardiomyopathy is a condition characterized by transient left ventricular dysfunction of the apex and midventricle in the absence of attributable coronary artery disease.In patients with shock and adrenal insufficiency, who can be erroneously interpreted as septic shock, Takotsubo cardiomyopathy can develop after treatment with norepinephrine.In the management of shock, there are risks associated with recommending the use of norepinephrine if hypotension is severe or if it persists despite fluid administration, when the cause of shock is other than septic shock and is not corrected.There is a direct causal role of catecholamine in the pathophysiology of Takotsubo cardiomyopathy.",
"affiliations": "Intensive Care Unit, Hospital do Espírito Santo Évora EPE, Évora, Portugal.;Serviço de Medicina 1, Hospital do Espírito Santo Évora EPE, Évora, Portugal.;Serviço de Medicina 1, Hospital do Espírito Santo Évora EPE, Évora, Portugal.",
"authors": "Vieira|Alfredo|A|;Batista|Bárbara|B|;de Abreu|Tiago Tribolet|TT|",
"chemical_list": null,
"country": "Italy",
"delete": false,
"doi": "10.12890/2018_000894",
"fulltext": "\n==== Front\nEur J Case Rep Intern MedEur J Case Rep Intern MedEuropean Journal of Case Reports in Internal Medicine2284-2594SMC Media Srl 10.12890/2018_000894894-1-5492-1-10-20180427ArticlesIatrogenic Takotsubo Cardiomyopathy Secondary to Norepinephrine by Continuous Infusion for Shock Vieira Alfredo 1Batista Bárbara 2de Abreu Tiago Tribolet 2\n1 Intensive Care Unit, Hospital do Espírito Santo Évora EPE, Évora, Portugal\n2 Serviço de Medicina 1, Hospital do Espírito Santo Évora EPE, Évora, Portugal2018 26 7 2018 5 7 00089430 3 2018 13 4 2018 © EFIM 20182018This article is licensed under a Commons Attribution Non-Commercial 4.0 LicenseTakotsubo cardiomyopathy is a condition characterized by transient left ventricular systolic and diastolic dysfunction, with a possible direct causal role of catecholamine in its pathophysiology. We present a case of a woman with shock and adrenal insufficiency in whom Takotsubo cardiomyopathy developed after treatment with norepinephrine. This case confirms the direct causal role of catecholamine in the pathophysiology of Takotsubo cardiomyopathy. An 82-year-old woman presented with asthenia, anorexia, nausea and abdominal pain. The patient had been on chronic corticosteroid therapy until 3 months before, when she underwent abdominal surgery and corticosteroids were stopped. She now presented with acute kidney injury, hyponatremia and hyperkalemia and shock. A norepinephrine continuous infusion was administered to maintain a mean arterial pressure over 65 mmHg. An echocardiogram showed severe hypokinesis in the apical segments and hyperdynamic basal segments, with an ejection fraction of 25%. Plasma cortisol level was 4.5 μg/dL (reference range 5–25). Corticosteroid therapy was begun and norepinephrine was tapered and stopped. A new echocardiogram showed normalization of cardiac wall motion and an ejection fraction of 70%. This case highlights the importance of the correction of the cause of shock, as well as the risks associated with the use of norepinephrine if hypotension is severe or if it persists despite fluid administration, as usually recommended. It also confirms the direct causal role of catecholamine in the pathophysiology of Takotsubo cardiomyopathy. To the best of our knowledge, this is the first report of stress-induced cardiomyopathy secondary to norepinephrine by continuous infusion for shock.\n\nLEARNING POINTS\nTakotsubo cardiomyopathy is a condition characterized by transient left ventricular dysfunction of the apex and midventricle in the absence of attributable coronary artery disease.\n\nIn patients with shock and adrenal insufficiency, who can be erroneously interpreted as septic shock, Takotsubo cardiomyopathy can develop after treatment with norepinephrine.\n\nIn the management of shock, there are risks associated with recommending the use of norepinephrine if hypotension is severe or if it persists despite fluid administration, when the cause of shock is other than septic shock and is not corrected.\n\nThere is a direct causal role of catecholamine in the pathophysiology of Takotsubo cardiomyopathy.\n\nShockTakotsubo cardiomyopathyadrenal insufficiencynorepinephrinevasoconstrictor agentsvasoactive agents\n==== Body\nINTRODUCTION\nTakotsubo cardiomyopathy, also called apical ballooning syndrome or stress cardiomyopathy, is a condition characterized by transient left ventricular systolic and diastolic dysfunction of the apex and midventricle in the absence of attributable coronary artery disease. It typically occurs in postmenopausal women and may be preceded by a stressful or emotional event[1]. We report a case of Takotsubo cardiomyopathy induced by norepinephrine continuous infusion in a patient with shock caused by adrenal crisis, erroneously interpreted as septic shock.\n\nCASE REPORT\nAn 82-year-old woman presented with asthenia, anorexia, nausea and abdominal pain. Five years earlier, a diagnosis of systemic lupus erythematosus had been made[2] and therapy with daily prednisolone 17.5 mg and azathioprine 50 mg started.\n\nThree months before the present episode, the patient underwent emergency surgery for a small bowel obstruction, caused by a transmural necrosis of the colon adjacent to an ileocolic anastomosis (performed 20 years earlier for adenocarcinoma of the cecum). An ileocolic resection and an ileostomy were performed. The patient had an uneventful recovery and was discharged after 9 days. Two days after discharge, the patient was readmitted due to dehydration and acute kidney injury, as a result of an overactive ileostomy. No corticosteroids or other immunosuppressants were administered during both episodes.\n\nDuring the next month, there were no new medical events, until 24 hours before this admission, when asthenia, anorexia, nausea and abdominal pain occurred and the patient presented to the emergency department the next day. The patient had a history of hypertension, aortic stenosis, hypothyroidism, depression and osteoarthrosis of the hip and knee. Medications were enalapril, amiloride/hydrochlorothiazide, levothyroxine, sertraline, clopidogrel, and chondroitin.\n\nOn examination, her temperature was 35.6 °C; pulse 89 beats per minute; and blood pressure 90/59 mmHg. Oxygen saturation was 99% at room air and she had diffuse abdominal tenderness. The remainder of the examination was normal.\n\nLaboratory work was remarkable for thrombocytopenia (52,000/uL), leukocytosis and neutrophilia (13,100/uL and 11,300/uL, respectively) with an undetectable C-reactive protein (<0.5 mg/dL). There was acute kidney injury (creatinine 2.53 mg/dL) with hyponatremia (sodium 124 mmol/L) and hyperkalemia (potassium 5.9 mmol/L) and a serum lipase of 1185 U/L (normal range <300 U/L).\n\nArterial blood gas analysis, at room air, included a pH of 7.27 (reference range 7.35–7.45); a partial pressure of carbon dioxide of 20 mmHg (reference range 32–45); a partial pressure of oxygen of 108 mmHg (reference range 83–108); a bicarbonate level of 9 mmol/L (reference range 21–28); and a lactate of 2.2 mmol/L (reference range 0.5–1.6). An abdominal ultrasound showed multiple gallstones, without other sonographic criteria for acute cholecystitis, with no evidence of dilated intrahepatic ducts or the common hepatic duct; the pancreas was normal in appearance (partially visualized due to overlying bowel gas) with no ascites.\n\nFluid loading began with a balanced salt solution. The patient became prostrate, with a blood pressure of 87/52 mmHg and was admitted to the intensive care unit (ICU). In the ICU, the patient maintained a mean arterial pressure under 50 mmHg and a continuous infusion of norepinephrine was administered, with a rate of 0.8 μg/kg/min to obtain a mean arterial pressure over 65 mmHg. Plasma adrenocorticotropic hormone (ACTH) levels were 8 ng/L (reference range 6–76) and plasma cortisol levels were 4.5 μg/dL (reference range 5–25). Methylprednisolone was started 40 mg twice daily, and norepinephrine dose tapering was possible.\n\nA transthoracic echocardiogram (while on 0.5 μg/kg/min norepinephrine) showed severe hypokinesis in the apical segments and hyperdynamic basal segments, with an ejection fraction of 25% (Video 1, Fig. 1). There was a troponin-I peak of 1.72 ng/mL on day 3 of admission to ICU. Methylprednisolone was substituted for prednisolone 20 mg and norepinephrine tapering was continued, until it was stopped 48 hours after the echocardiogram was performed. Piperacillin/tazobactam was administered for 4 days, with a peak procalcitonin of 0.55 ng/mL. Blood and urine cultures were negative, and lipase levels became normal within 48 hours, with no abdominal pain. The patient was transferred to the general internal medicine ward on day 5 of admission to ICU, where a new echocardiogram showed normalization of cardiac wall motion and an ejection fraction of 70% (Video 2, Fig. 1). The patient was discharged on day 11 of admission.\n\nDISCUSSION\nWe present a case of a patient with shock and adrenal insufficiency, in whom Takotsubo cardiomyopathy developed after treatment with norepinephrine. Although some animal studies show Takotsubo cardiomyopathy induced by norepinephrine infusion[3,4], we found only a single case report in human patients with a Takotsubo cardiomyopathy secondary to iatrogenic norepinephrine injection[5]. In that article, Takotsubo cardiomyopathy was induced by a single 4 mg norepinephrine injection. Our case is more complex, not only because Takotsubo cardiomyopathy was induced by continuous infusion of norepinephrine, but also because adrenal insufficiency had to be corrected.\n\nAlternatively, this case might be interpreted as an acute pancreatitis with septic shock and multiple organ failure, including adrenal insufficiency. Nevertheless, this scenario would not explain the severe apical hypokinesis with hyperdynamic basal segments, as well as its normalization within a few days. The rapid recovery of the multiple organ failure, normalization of the elevated lipase (in 48 hours) and tapering off of the norepinephrine infusion (immediately after corticosteroid administration) also do not favor the diagnosis of acute pancreatitis with septic shock and multiple organ failure.\n\nBest practice in the management of shock recommends using norepinephrine if hypotension is severe or if it persists despite fluid administration[6]. It is also recommended that treatment should include correction of the cause of shock and hemodynamic stabilization, primarily through fluid infusion and administration of vasoactive agents. This case report highlights the importance of the former and the risks of the latter, and confirms the direct causal role of catecholamine in the pathophysiology of Takotsubo cardiomyopathy. To the best of our knowledge, it is the first report of stress-induced cardiomyopathy secondary to norepinephrine by continuous infusion for shock.\n\nCONCLUSIONS\nWhen managing patients in shock and before starting vasoactive agents, one should always think of possible causes of shock, including adrenal insufficiency, as inappropriate norepinephrine infusion might have a causal role in the development of a Takotsubo cardiomyopathy.-\n\nConflicts of Interests: The Authors declare that there are no competing interests.\n\nFigure 1 (a) First echocardiogram: diastole with norepinephrine. (b) First echocardiogram: systole with norepinephrine (ejection fraction 25%, velocity time integral (VTI) 13 cm). (c) Second echocardiogram: diastole without norepinephrine. (d) Second echocardiogram: systole without norepinephrine (ejection fraction 70%, VTI 20 cm).\n\nVideo 1 First echocardiogram: severe hypokinesis in the apical segments and hyperdynamic basal segments, with an ejection fraction of 25%. Click here to view the video: https://youtu.be/F9w-AYn5lQI\n\nVideo 2 Second echocardiogram: normalization of cardiac wall motion and an ejection fraction of 70%.\n\nClick here to view the video: https://youtu.be/Z5VgOfU2GMg\n==== Refs\nREFERENCES\n1 Maiti A Dhoble A Takotsubo cardiomyopathy N Engl J Med 2017 377 e24 29045209 \n2 Petri M Orbai AM Alarcón GS Derivation and validation of the Systemic Lupus International Collaborating Clinics classification criteria for systemic lupus erythematosus Arthritis Rheum 2012 64 2677 86 22553077 \n3 Ohanyan V Yin L Bardakjian R Kh-yata M Kolz CL Enrick M Catecholamine induced Takotsubo cardiomyopathy: the role of coronary metabolic blood flow regulation in apical ballooning FASEB J 2016 30 Suppl 948.9 26538555 \n4 Movahed A Reeves WC Mehta PM Gilliland MG Mozingo SL Jolly SR Norepinephrine-induced left ventricular dysfunction in anesthetized and conscious, sedated dogs Int J Cardiol 1994 45 23 33 7995660 \n5 Sherif K Sehli S Jenkins LA Takotsubo cardiomyopathy after administration of norepinephrine Proc (Bayl Univ Med Cent) 2016 29 166 7 27034556 \n6 Vincent JL De Backer D Circulatory shock N Engl J Med 2013 369 1726 34 24171518\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2284-2594",
"issue": "5(7)",
"journal": "European journal of case reports in internal medicine",
"keywords": "Shock; Takotsubo cardiomyopathy; adrenal insufficiency; norepinephrine; vasoactive agents; vasoconstrictor agents",
"medline_ta": "Eur J Case Rep Intern Med",
"mesh_terms": null,
"nlm_unique_id": "101648453",
"other_id": null,
"pages": "000894",
"pmc": null,
"pmid": "30756050",
"pubdate": "2018",
"publication_types": "D016428:Journal Article",
"references": "22553077;24171518;27034556;29045209;7995660",
"title": "Iatrogenic Takotsubo Cardiomyopathy Secondary to Norepinephrine by Continuous Infusion for Shock.",
"title_normalized": "iatrogenic takotsubo cardiomyopathy secondary to norepinephrine by continuous infusion for shock"
} | [
{
"companynumb": "PT-MYLANLABS-2018M1095893",
"fulfillexpeditecriteria": "1",
"occurcountry": "PT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ENALAPRIL"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nInformation on the course of SARS-CoV-2 infection in children with chronic kidney disease (CKD) is limited.\n\n\nMETHODS\nWe retrospectively reviewed the presentation and outcomes of SARS-CoV-2 infection in patients with CKD followed at any of the four pediatric nephrology centers in New Delhi from April 2020 to June 2021. Outcomes, including cardiopulmonary and renal complications, were reported in relation to underlying disease category and illness severity at presentation.\n\n\nRESULTS\nUnderlying illness in 88 patients included nephrotic syndrome (50%), other CKD stages 1-4 (18.2%), CKD 5D (17%), and CKD 5T (14.8%). Thirty-two of 61 patients with symptomatic COVID-19 and 9/27 asymptomatic patients were admitted for median 10 (interquartile range 7-15) days. Seventeen (19.3%) patients developed moderate or severe COVID-19. Systemic complications, observed in 30 (34.1%), included acute kidney injury (AKI, 34.2%), COVID-19 pneumonia (15.9%), unrelated pulmonary disease (2.3%), and shock (4.5%). Nineteen (21.6%) had severe complications (AKI stage 2-3, encephalopathy, respiratory failure, shock). Eight (11%) of twelve (16.4%) patients with severe AKI required dialysis. Three (3.4%) patients, two with steroid-resistant nephrotic syndrome in relapse and one with CKD 1-4, died due to respiratory failure. Univariate logistic regression indicated that patients presenting with nephrotic syndrome in relapse or moderate to severe COVID-19 were at risk of AKI (respective odds ratio, 95%CI: 3.62, 1.01-12.99; 4.58, 1.06-19.86) and/or severe complications (respective odds ratio, 95%CI: 5.92, 1.99-17.66; 61.2, 6.99-536.01).\n\n\nCONCLUSIONS\nChildren with CKD presenting with moderate-to-severe COVID-19 or in nephrotic syndrome relapse are at risk of severe complications, including severe AKI and mortality. A higher resolution version of the Graphical abstract is available as Supplementary information.",
"affiliations": "Division of Nephrology, Department of Pediatrics, All India Institute of Medical Sciences, New Delhi, 110029, India.;Department of Pediatrics, Maulana Azad Medical College and Lok Nayak Jai Prakash Hospital, New Delhi, India.;Department of Pediatrics, Chacha Nehru Bal Chikitsalaya, Delhi, India.;Department of Pediatrics, Vardhman Mahavir Medical College and Safdarjung Hospitals, New Delhi, India.;Department of Microbiology, All India Institute of Medical Sciences, New Delhi, India.;Department of Pediatrics, Chacha Nehru Bal Chikitsalaya, Delhi, India.;Department of Pediatrics, Vardhman Mahavir Medical College and Safdarjung Hospitals, New Delhi, India.;Department of Pediatrics, Maulana Azad Medical College and Lok Nayak Jai Prakash Hospital, New Delhi, India.;Department of Microbiology, Vardhman Mahavir Medical College and Safdarjung Hospitals, New Delhi, India.;Division of Nephrology, Department of Pediatrics, All India Institute of Medical Sciences, New Delhi, 110029, India.;Division of Nephrology, Department of Pediatrics, All India Institute of Medical Sciences, New Delhi, 110029, India.;Division of Nephrology, Department of Pediatrics, All India Institute of Medical Sciences, New Delhi, 110029, India. aditisinhaaiims@gmail.com.;Division of Nephrology, Department of Pediatrics, All India Institute of Medical Sciences, New Delhi, 110029, India.",
"authors": "Krishnasamy|Sudarsan|S|;Mantan|Mukta|M|;Mishra|Kirtisudha|K|;Kapoor|Kanika|K|;Brijwal|Megha|M|;Kumar|Manish|M|;Sharma|Shobha|S|;Swarnim|Swarnim|S|;Gaind|Rajni|R|;Khandelwal|Priyanka|P|;Hari|Pankaj|P|;Sinha|Aditi|A|http://orcid.org/0000-0002-9566-3370;Bagga|Arvind|A|http://orcid.org/0000-0002-7832-684X",
"chemical_list": null,
"country": "Germany",
"delete": false,
"doi": "10.1007/s00467-021-05218-1",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0931-041X",
"issue": null,
"journal": "Pediatric nephrology (Berlin, Germany)",
"keywords": "Acute kidney injury; COVID-19; Children; Kidney replacement therapy; Nephrotic syndrome",
"medline_ta": "Pediatr Nephrol",
"mesh_terms": null,
"nlm_unique_id": "8708728",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34519896",
"pubdate": "2021-09-14",
"publication_types": "D016428:Journal Article",
"references": "32643418;33251504;33318026;32727941;33246166;32555539;32312768;34152424;32435879;32709685;33344488;30035208;32202343;33127076;32720259;32512263;33372426;33051960;32883700;33419577;32671831;32411815;33355203;32718953;30693275;32335173;32064853;32191675;32270695;33400721;19158356;33501962;32360416;32593339",
"title": "SARS-CoV-2 infection in children with chronic kidney disease.",
"title_normalized": "sars cov 2 infection in children with chronic kidney disease"
} | [
{
"companynumb": "IN-ROCHE-3075209",
"fulfillexpeditecriteria": "1",
"occurcountry": null,
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RITUXIMAB"
},
"drugadditional": "3",
"drugad... |
{
"abstract": "BACKGROUND\nLife satisfaction (LS) in opioid-dependent individuals is lower than in the general population. This study aimed to explore changes in LS during short- and long-term treatment with extended-release naltrexone (XR-NTX).\n\n\nMETHODS\nThis open-label 12-week clinical trial randomized 159 participants to either monthly XR-NTX or daily buprenorphine-naloxone (BP-NLX). In a subsequent 36-week follow-up study on XR-NTX, participants either continued or switched to XR-NTX. The study collected data on the Temporary Satisfaction with Life (TSWL) and illicit opioid use every fourth week. The research team assessed changes in TSWL by a linear mixed model and growth mixture model. The study assessed relationship between opioid use and TSWL by a linear mixed model.\n\n\nRESULTS\nChange in LS differed significantly between the groups in both study periods. TSWL scores were significantly higher in the XR-NTX group at week 4 (p = 0.013) and week 8 (p = 0.002). In the follow-up period, the groups were significantly different only at week 16 (p = 0.031) and week 48 (p = 0.025), with the higher TSWL scores in the XR-NTX continued group. Increase in opioid use by one day was associated with a 0.12 point lower mean TSWL score. Both study periods identified groups with low and high LS levels. In the trial period, the TSWL scores exhibited a significant increase from baseline to week 12 in both groups, p < 0.001 and p = 0.011 in the low and high LS group, respectively. In the follow-up period, the TSWL scores exhibited a significant increase from week 16 to week 48 (p = 0.003) in the high LS group, while the low LS group showed persistently lower values throughout that period.\n\n\nCONCLUSIONS\nXR-NTX treatment given once monthly is associated with higher LS, as measured by TSWL, compared to daily use of BP-NLX. The majority of the participants had relatively low TSWL scores and did not report any change in TSWL during longer-term treatment. The study found a significant association between more frequent illicit opioid use and a low or decreased LS during follow-up.",
"affiliations": "Department of Addiction Medicine, Haukeland University Hospital, Østre Murallmenningen 7, 5012 Bergen, Norway; Department of Clinical Dentistry, University of Bergen, Årstadveien 19, 5009 Bergen, Norway. Electronic address: zhanna.gaulen@helse-bergen.no.;Institute of Clinical Medicine, Campus Ahus, University of Oslo, Blindern, Problemveien 7, 0315, Norway; Health Services Research Unit, Akershus University Hospital, Lørenskog, Sykehusveien 25, 1478 Nordbyhagen, Norway. Electronic address: j.s.benth@medisin.uio.no.;Department of Addiction Medicine, Haukeland University Hospital, Østre Murallmenningen 7, 5012 Bergen, Norway; Department of Global Public Health and Primary Care, University of Bergen, Årstadveien 17, 5009 Bergen, Norway. Electronic address: lars.fadnes@uib.no.;Department of Addiction Medicine, Haukeland University Hospital, Østre Murallmenningen 7, 5012 Bergen, Norway; Department of Psychology, University of Bergen, Christies gate 12, 5015 Bergen, Norway. Electronic address: ida.halvorsen.brenna@helse-bergen.no.;Department of Research and Development in Mental Health, Akershus University Hospital, Lørenskog, Sykehusveien 25, 1478 Nordbyhagen, Norway; Department of Health Science, Oslo Metropolitan University, Pilestredet 46, 0167 Oslo, Norway. Electronic address: Lars.Hakon.Reiestad.Tanum@ahus.no.",
"authors": "Gaulen|Zhanna|Z|;Šaltytė Benth|Jūratė|J|;Fadnes|Lars Thore|LT|;Brenna|Ida Halvorsen|IH|;Tanum|Lars|L|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.jsat.2021.108656",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0740-5472",
"issue": null,
"journal": "Journal of substance abuse treatment",
"keywords": "Buprenorphine-naloxone; Extended-release naltrexone; Life satisfaction; Opioid use disorder",
"medline_ta": "J Subst Abuse Treat",
"mesh_terms": null,
"nlm_unique_id": "8500909",
"other_id": null,
"pages": "108656",
"pmc": null,
"pmid": "34774396",
"pubdate": "2021-11-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Life satisfaction among individuals with opioid use disorder receiving extended-release naltrexone: A 12-week randomized controlled trial and a 36-week follow-up.",
"title_normalized": "life satisfaction among individuals with opioid use disorder receiving extended release naltrexone a 12 week randomized controlled trial and a 36 week follow up"
} | [
{
"companynumb": "NO-INDIVIOR US-INDV-131995-2021",
"fulfillexpeditecriteria": "1",
"occurcountry": "NO",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BUPRENORPHINE HYDROCHLORIDE\\NALOXONE HYDROCHLORIDE"
... |
{
"abstract": "OBJECTIVE\nTarget plasma level achievement has remained a challenge in neurosurgical intensive care unit patients receiving intravenous vancomycin. We evaluated continuous infusion (CI) and intermittent vancomycin dosing strategies in these patients.\n\n\nMETHODS\nThis retrospective cohort compared CI vancomycin (target random levels, 20-30 mg/L) to intermittent vancomycin (target troughs, 15-20 mg/L) in regards to achievement of target plasma levels, nephrotoxicity, pharmacodynamic target attainment, and cost savings in 130 patients.\n\n\nRESULTS\nContinuous infusion resulted in greater achievement of goal plasma concentrations at the first steady-state level (40 vs 21.5%, P = .02), more rapid achievement of goal plasma concentrations (2.04 vs 3.76 days, P < .0001), and increased time within therapeutic range (55% vs 34%, P < .0001) but no significant difference in nephrotoxicity (15.4% vs 21.5%, P = .5). Continuous infusion improved pharmacodynamic target attainment (92.3% vs 30.8%, P < .0001) and also reduced levels drawn (3.8 vs 5.7, P = .0007), dose adjustments (1.4 vs 2.4, P = .0006), days of therapy (10.4 vs 14.1, P = .01), and mean total daily dose requirements (33 vs 35.7 mg/kg, P < .0001) per patient.\n\n\nCONCLUSIONS\nContinuous infusion appears beneficial for improving attainment of target plasma concentrations, pharmacodynamic goals, and financial burden, without increasing risk of acute kidney injury.",
"affiliations": "Department of Pharmacy, University of Colorado Hospital, Aurora, CO, USA.;Department of Clinical Pharmacy, University of Colorado Skaggs School of Pharmacy and Pharmaceutical Sciences, Aurora, CO, USA.;Department of Pharmacy, University of Colorado Hospital, Aurora, CO, USA.;Department of Clinical Pharmacy, University of Colorado Skaggs School of Pharmacy and Pharmaceutical Sciences, Aurora, CO, USA.;Department of Pharmacy, University of Colorado Hospital, Aurora, CO, USA; Department of Clinical Pharmacy, University of Colorado Skaggs School of Pharmacy and Pharmaceutical Sciences, Aurora, CO, USA.;Department of Neurosurgery, University of Colorado Anschutz Medical Campus, Aurora, CO, USA.;Department of Neurosurgery, University of Colorado Anschutz Medical Campus, Aurora, CO, USA.;Department of Clinical Pharmacy, University of Colorado Skaggs School of Pharmacy and Pharmaceutical Sciences, Aurora, CO, USA. Electronic address: Ty.Kiser@ucdenver.edu.",
"authors": "Hong|Lisa T|LT|;Goolsby|Tiffany A|TA|;Sherman|Deborah S|DS|;Mueller|Scott W|SW|;Reynolds|Paul|P|;Cava|Luis|L|;Neumann|Robert|R|;Kiser|Tyree H|TH|",
"chemical_list": "D000900:Anti-Bacterial Agents; D014640:Vancomycin",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0883-9441",
"issue": "30(5)",
"journal": "Journal of critical care",
"keywords": "Continuous infusion; Neurosurgery; Parmacodynamic; Pharmacokinetic; Vancomycin",
"medline_ta": "J Crit Care",
"mesh_terms": "D058186:Acute Kidney Injury; D000293:Adolescent; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000900:Anti-Bacterial Agents; D003422:Critical Care; D005260:Female; D006801:Humans; D007262:Infusions, Intravenous; D007362:Intensive Care Units; D007674:Kidney Diseases; D008297:Male; D008875:Middle Aged; D012189:Retrospective Studies; D014640:Vancomycin; D055815:Young Adult",
"nlm_unique_id": "8610642",
"other_id": null,
"pages": "1153.e1-6",
"pmc": null,
"pmid": "26239323",
"pubdate": "2015-10",
"publication_types": "D003160:Comparative Study; D016428:Journal Article; D016449:Randomized Controlled Trial",
"references": null,
"title": "Continuous infusion vs intermittent vancomycin in neurosurgical intensive care unit patients.",
"title_normalized": "continuous infusion vs intermittent vancomycin in neurosurgical intensive care unit patients"
} | [
{
"companynumb": "US-BAXTER-2015BAX054759",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "VANCOMYCIN"
},
"drugadditional": null,
... |
{
"abstract": "Despite widespread use of unfractionated heparin (UFH) and low molecular weight heparin (LMWH), protamine sulfate remains the only reversal agent for UFH that is approved by the Food and Drug Administration within the US. Availability of new reversal agents for approved anticoagulants and those in development may improve patient safety and care. Delparantag (PMX-60056) is a novel small molecule that shows ability to neutralize the anticoagulation effects of UFH and LMWH in animals and humans. This study examined the 1-year utilization of protamine within an acute care hospital in order to determine the need for a novel reversing agent like delparantag. All patients having documented protamine administration within a 1-year period were included. Pharmacy automated dispensing machines and computerized medication management systems were queried for all doses of protamine withdrawn, billed for, or dispensed. Scanned medical records were reviewed and protamine and anticoagulant information was abstracted. Primary procedural group categorizations for protamine patients were coronary artery bypass graft, cardiac valve surgeries, abdominal aortic aneurysm and other open abdominal surgeries, fistula placement, non-cardiac vascular, cardiac catheter and electrophysiology lab, and \"other.\" Average doses of protamine administered were 439, 423, 126, 26, 46, 36, and 35 mg in these groups, respectively. Four major bleeds and one serious adverse event occurred over the year period. Protamine is used in a wide array of procedures. Evaluating protamine's current use may be beneficial in identifying roles for future UFH and LMWH reversal agent use.",
"affiliations": "Presbyterian Healthcare Services, University of New Mexico, 1100 Central Ave. SE, Albuquerque, NM, 87106, USA, chmahan@yahoo.com.",
"authors": "Mahan|Charles E|CE|",
"chemical_list": "D006494:Heparin Antagonists; D006495:Heparin, Low-Molecular-Weight; D011479:Protamines",
"country": "Netherlands",
"delete": false,
"doi": "10.1007/s11239-013-0927-7",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0929-5305",
"issue": "37(3)",
"journal": "Journal of thrombosis and thrombolysis",
"keywords": null,
"medline_ta": "J Thromb Thrombolysis",
"mesh_terms": "D000818:Animals; D002318:Cardiovascular Diseases; D006494:Heparin Antagonists; D006495:Heparin, Low-Molecular-Weight; D006801:Humans; D008297:Male; D008510:Medication Systems, Hospital; D011479:Protamines; D012189:Retrospective Studies",
"nlm_unique_id": "9502018",
"other_id": null,
"pages": "271-8",
"pmc": null,
"pmid": "23653171",
"pubdate": "2014-04",
"publication_types": "D016428:Journal Article",
"references": "20307530;20961243;8925592;22315266;17024282;20460347;22641771;16999654;15842354;18574269;12114345;22315258;18574264;22739656;18574270;18574267;21048158;21496885;23374371;10607857;22315264;17626254;19878532;12871413;20660806;18574272;19132240;22859796;21724623;11343485;22735179;10858037;14981611;15186641;20870279;21315207",
"title": "A 1-year drug utilization evaluation of protamine in hospitalized patients to identify possible future roles of heparin and low molecular weight heparin reversal agents.",
"title_normalized": "a 1 year drug utilization evaluation of protamine in hospitalized patients to identify possible future roles of heparin and low molecular weight heparin reversal agents"
} | [
{
"companynumb": "PHHY2014US119058",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HEPARIN SODIUM"
},
"drugadditional": null,
"... |
{
"abstract": "OBJECTIVE\nFor approximately 2 decades, vacuum-assisted closure (VAC) therapy has been widely used for the management of complex wounds and soft tissue defects on the external surface of the body. As yet, this technique has not been studied for intraoral wound management. Therefore, this study evaluated the feasibility, safety, and effectiveness of intraoral VAC therapy in patients with medication-related osteonecrosis of the jaw (MRONJ).\n\n\nMETHODS\nAfter successful construction of an intraoral device providing sufficient airtight sealing, individually manufactured appliances were used in a prospective clinical trial of 3 patients using the VAC therapy system.\n\n\nRESULTS\nIntraoral VAC therapy showed some success and did not produce serious side effects. Different positive effects, such as formation of new granulation tissue, cessation of pain, and pus suppuration, were found.\n\n\nCONCLUSIONS\nThis prospective proof-of-principle study showed that intraoral VAC therapy is feasible and safe. It could play a role in the management of MRONJ and other types of intraoral wounds (eg, osteoradionecrosis, postoperative wound dehiscence, etc).",
"affiliations": "Consultant, University Hospital for Craniomaxillofacial and Oral Surgery, Innsbruck, Austria.;Consultant, University Hospital for Craniomaxillofacial and Oral Surgery, Innsbruck, Austria.;Consultant, University Hospital for Craniomaxillofacial and Oral Surgery, Innsbruck, Austria.;Professor and Head, University Hospital for Craniomaxillofacial and Oral Surgery, Innsbruck, Austria.;Consultant, University Hospital for Plastic, Reconstructive, and Aesthetic Surgery, Innsbruck, Austria.;Consultant, University Hospital for Craniomaxillofacial and Oral Surgery, Innsbruck, Austria. Electronic address: office@bruckmoser.info.",
"authors": "Laimer|Johannes|J|;Steinmassl|Otto|O|;Hechenberger|Martin|M|;Rasse|Michael|M|;Pikula|Rajmond|R|;Bruckmoser|Emanuel|E|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.joms.2017.02.033",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0278-2391",
"issue": "75(10)",
"journal": "Journal of oral and maxillofacial surgery : official journal of the American Association of Oral and Maxillofacial Surgeons",
"keywords": null,
"medline_ta": "J Oral Maxillofac Surg",
"mesh_terms": "D000368:Aged; D059266:Bisphosphonate-Associated Osteonecrosis of the Jaw; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D054843:Negative-Pressure Wound Therapy; D010865:Pilot Projects; D011446:Prospective Studies",
"nlm_unique_id": "8206428",
"other_id": null,
"pages": "2154-2161",
"pmc": null,
"pmid": "28396234",
"pubdate": "2017-10",
"publication_types": "D002363:Case Reports; D016430:Clinical Trial; D016428:Journal Article",
"references": null,
"title": "Intraoral Vacuum-Assisted Closure Therapy-A Pilot Study in Medication-Related Osteonecrosis of the Jaw.",
"title_normalized": "intraoral vacuum assisted closure therapy a pilot study in medication related osteonecrosis of the jaw"
} | [
{
"companynumb": "AT-PFIZER INC-2018166600",
"fulfillexpeditecriteria": "1",
"occurcountry": "AT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ZOLEDRONIC ACID"
},
"drugadditional": "3",
... |
{
"abstract": "To report a case of oral candidiasis that developed in a 70-year-old white female both upon initiation and rechallenge of extended-release bupropion therapy.\nA 70-year-old female with a past medical history of osteoarthritis, degenerative joint disease, and polycythemia vera developed oral candidiasis on 2 occasions following initiation of extended-release bupropion for the treatment of recurrent depression. During both instances, the reaction occurred with an increased dose of the medication, suggesting the adverse event may have been dose-related. The patient had no risk factors for oral candidiasis aside from dry mouth at baseline that reportedly worsened on bupropion.\nThough there are no other reports to our knowledge describing the development of oral candidiasis with bupropion, the likelihood of this having been an adverse reaction in this patient is probable as indicated by a calculated score of 8 from the Naranjo Algorithm. The adverse event appeared following bupropion administration and improved over time following its discontinuation. The adverse event reappeared following readministration of the agent, and no alternative causes were able to be identified. Additionally, the reaction occurred following an increase in the dose on both occasions, with the lower dose having only resulted in worsening dry mouth.\nThis case demonstrates that an additional adverse event to screen for with bupropion treatment is the development of oral candidiasis. This adverse event may be more likely to occur in the older adult population.",
"affiliations": "(Corresponding author) Assistant Professor, The University of Arizona, College of Pharmacy Practice and Science, Tucson, Arizona, vadiei@pharmacy.arizona.edu.;Associate Professor, Dell Medical School at The University of Texas at Austin, Department of Psychiatry, Austin, Texas.;Assistant Professor, Dell Medical School at The University of Texas at Austin, Department of Psychiatry, Austin, Texas.",
"authors": "Vadiei|Nina|N|0000-0003-3984-0317;Smith|Tawny L|TL|0000-0002-7512-4919;Garcia-Pittman|Erica C|EC|0000-0002-6835-1910",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.9740/mhc.2018.07.188",
"fulltext": "\n==== Front\nMent Health ClinMent Health ClinmhclThe Mental Health Clinician2168-9709College of Psychiatric & Neurologic Pharmacists 10.9740/mhc.2018.07.188mhcl-08-03-04MHC-D-17-00050Case ReportsDevelopment of oral candidiasis following initiation and rechallenge of extended-release bupropion in a geriatric patient Vadiei Nina http://orcid.org/0000-0003-3984-0317PharmD1\n1 (Corresponding author) Assistant Professor, The University of Arizona, College of Pharmacy Practice and Science, Tucson, Arizona, vadiei@pharmacy.arizona.edu\nSmith Tawny L. http://orcid.org/0000-0002-7512-4919PharmD, BCPP2\n2 Associate Professor, Dell Medical School at The University of Texas at Austin, Department of Psychiatry, Austin, Texas\nGarcia-Pittman Erica C. http://orcid.org/0000-0002-6835-1910MD3\n3 Assistant Professor, Dell Medical School at The University of Texas at Austin, Department of Psychiatry, Austin, Texas\n7 2018 29 6 2018 8 4 188 190 © 2018 CPNP.2018This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial 3.0 License, which permits non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.Objective:\nTo report a case of oral candidiasis that developed in a 70-year-old white female both upon initiation and rechallenge of extended-release bupropion therapy.\n\nCase Summary:\nA 70-year-old female with a past medical history of osteoarthritis, degenerative joint disease, and polycythemia vera developed oral candidiasis on 2 occasions following initiation of extended-release bupropion for the treatment of recurrent depression. During both instances, the reaction occurred with an increased dose of the medication, suggesting the adverse event may have been dose-related. The patient had no risk factors for oral candidiasis aside from dry mouth at baseline that reportedly worsened on bupropion.\n\nDiscussion:\nThough there are no other reports to our knowledge describing the development of oral candidiasis with bupropion, the likelihood of this having been an adverse reaction in this patient is probable as indicated by a calculated score of 8 from the Naranjo Algorithm. The adverse event appeared following bupropion administration and improved over time following its discontinuation. The adverse event reappeared following readministration of the agent, and no alternative causes were able to be identified. Additionally, the reaction occurred following an increase in the dose on both occasions, with the lower dose having only resulted in worsening dry mouth.\n\nConclusion:\nThis case demonstrates that an additional adverse event to screen for with bupropion treatment is the development of oral candidiasis. This adverse event may be more likely to occur in the older adult population.\n\nKeywords\nbupropioncandidiasisthrushgeriatric\n==== Body\nBackground\nCandidiasis, also known as “thrush,” is caused by an imbalance in normal flora leading to an overgrowth of Candida albicans. Risk factors for the development of oral candidiasis include impaired salivary gland function, wearing dentures, oral cancer/leukoplakia, smoking, infection, nutritional deficiencies, and immunosuppressive conditions.1 Certain drugs have been implicated as well, including immunosuppressive drugs and certain broad spectrum antibiotics.1\n\nBupropion is an antidepressant with a distinct side effect profile.2 Initial studies3,4 comparing bupropion sustained release to placebo-treated patients reported that the most common adverse events were dry mouth, nausea, and insomnia, respectively. Though dry mouth is a commonly reported side effect,5-8 and this is a risk factor of oral candidiasis, we are unaware of any case reports describing this adverse event following bupropion use. We report a case of suspected bupropion-induced oral candidiasis in an older adult.\n\nCase Summary\nA 70-year-old white female with past medical history of osteoarthritis, osteoporosis, degenerative joint disease, and polycythemia vera, sought care in our clinic for unresolved depression. She had been referred to us by her nurse practitioner, who had initiated bupropion as an augmentation strategy with sertraline that the patient had previously been taking for 20 years. She was initiated on bupropion XL 150 mg daily, and 2 weeks later her dose was increased to 300 mg. One week following the dose increase, she developed oral candidiasis (thrush), for which her nurse practitioner prescribed nystatin suspension. The patient eventually self-discontinued the bupropion 1 week prior to presenting to our clinic due to the thrush worsening despite nystatin treatment.\n\nWhen presenting to our clinic for psychiatric evaluation, she expressed dissatisfaction with sertraline monotherapy, stating she preferred bupropion but believed it had caused the thrush to develop. At this time, she was taking sertraline 100 mg daily, aspirin delayed-release 81 mg daily, ibandronate 150 mg once a month, and the nystatin suspension 4 times daily (which she had been taking for 2 weeks). She denied wearing any mechanical dentation and stated a possible history of oral thrush following a course of antibiotics. At this time, it was decided to switch her to escitalopram.\n\nShe was seen 1 month after escitalopram initiation and reported the thrush had resolved. She remained on escitalopram for 3 months but had minimal improvement in her depressive symptoms. It was then decided to retry the bupropion with the hope that the thrush was unrelated to the previous trial. The patient was counselled on preventative measures for dry mouth and instructed to follow up with her ears, nose, and throat physician to further discuss preventative options.\n\nAfter a month of reinitiation on bupropion XL 150 mg daily, she reported no side effects aside from “slight worsening” of dry mouth. Two months later, she reportedly self-increased her dose to 300 mg daily in the context of worsening depression and shortly afterwards the thrush returned. She was instructed to decrease the dose to 150 mg daily, reinitiate escitalopram 5 mg, and schedule a follow-up appointment. Unfortunately, the patient did not return to clinic for follow-up.\n\nDiscussion\nTo our knowledge, this is the first report describing the development of oral candidiasis associated with bupropion. While there are no known published case reports describing this adverse event with bupropion use, there are case reports9,10 discussing the development of apthous ulcers. These reports however described the cases of a female adolescent and a 23-year-old, while ours describes the case of an elderly female. This is understandable given rates of C albicans carriage increases with older age,1 which is the underlying etiology of oral candidiasis development but not of apthous ulcer development.11\n\nIn our case, other than advanced age, there were no additional risk factors identified. Given the elderly are more vulnerable to accumulation of bupropion and its adverse effects,12,13 it is possible that her age may have put her at greater risk for dry mouth,14 which may have then led to subsequent oral candidiasis development. It should also be considered however that alterations in saliva production can occur in affective disorders during periods of stress/acute anxiety irrespective of the antidepressant.15 The patient did complain of dry mouth on the lower bupropion dose, which could be considered impaired salivary gland function (a stated risk factor of oral candidiasis). Given this finding, and that the oral candidiasis developed upon rechallenge at the same dose each time, it appears likely that this was in fact an adverse event from the bupropion. According to the Naranjo Adverse Drug Reaction Probability Scale, the likelihood of this having been an adverse drug reaction is “probable,” as indicated by a score of 8 (the adverse event appeared after bupropion administration +2; the adverse event improved upon bupropion discontinuation +1; the adverse event reappeared upon readministration +2; there were no alternative causes identified to have independently have caused the reaction +2; the reaction was more severe when the dose was increased +1).16\n\nIt is important to consider alternative potential risk factors. This patient did have a diagnosis of polycythemia vera, an autoimmune condition that causes erythrocytosis.17 While a risk factor for development of oral candidiasis is having an autoimmune condition, specific complications of polycythemia vera do not include disrupting the normal oral flora. She was diagnosed with polycythemia vera about a year before initiating bupropion, also suggesting this was not the underlying cause. If this had been an additional risk factor, it does not decrease the likelihood that the dose increase to bupropion 300 mg led to the oral candidiasis developing, given the clinical timeline of symptoms in relation to her dose increase. Per the package insert, dry mouth occurrence may be dose related, and the risk of development may be reduced by lowering the dose.18 This is supported by studies identifying the incidence of dry mouth being directly related to bupropion plasma concentrations.19 It is unfortunate that the patient was lost to follow-up following the dose decrease of bupropion to determine whether this may have been a dose-related adverse event.\n\nThe mechanism of dry mouth occurrence with bupropion is unknown, although a previous study evaluating side effects from bupropion, moclobemide, paroxetine, sertraline, and venlafaxine had dry mouth reported as a side effect in 35% or more patients across all 5 groups.20 These agents vary widely in receptor affinities, making it difficult to determine the underlying mechanism. Bupropion specifically lacks appreciable affinity for histamine or muscarinic acetylcholine receptors,2 which have been linked to xerostomia.13 It's suggested that antidepressants interfere with acinar and duct functions, which lead to alterations in blood flow of the salivary glands21; however, no literature was identified reporting the development of oral candidiasis with antidepressants.\n\nConclusion\nThis case demonstrates that oral candidiasis is a potential adverse event to screen for with bupropion. This adverse event may be more likely to occur in older adults, especially in those who report experiencing dry mouth. Clinicians should monitor older patients on bupropion for side effects such as dry mouth and be prepared to manage this side effect to reduce the risk of oral candidiasis development.\n\nDisclosures: The authors have no conflicts of interest to disclose related to financial or personal relationships for the subject matter of this manuscript.\n==== Refs\nReferences\n1 Singh A Verma R Murari A Agrawal A Oral candidiasis: An overview J Oral Maxillofac Pathol 2014 18 Suppl 1 S81 5 DOI: 10.4103/0973-029X.141325 PubMed PMID: 10.4103/0973-029X.141325 25364186 PubMed PMID: 25364186 25364186 \n2 Stahl SM Pradko JF Haight BR Modell JG Rockett CB Learned-Coughlin S A review of the neuropharmacology of bupropion, a dual norepinephrine and dopamine reuptake inhibitor Prim Care Companion J Clin Psychiatry 2004 6 4 159 66 PubMed PMID: 15361919 15361919 \n3 Settle EC Stahl SM Batey SR Andrew Johnston J, Ascher JA. Safety profile of sustained-release bupropion in depression: Results of three clinical trials Clin Ther 1999 21 3 454 63 10.1016/S0149-2918(00)88301-0 10321415 \n4 Wellbutrin [package insert] Greenville (NC) GlaxoSmithKline 2009 \n5 Fava M Rush AJ Thase ME Clayton A Stahl SM Pradko JF 15 years of clinical experience with bupropion HCl: from bupropion to bupropion SR to bupropion XL Prim Care Companion J Clin Psychiatry 2005 7 3 106 13 PubMed PMID: 16027765 16027765 \n6 Gadde KM Parker CB Maner LG Wagner HR Logue EJ Drezner MK Bupropion for weight loss: an investigation of efficacy and tolerability in overweight and obese women Obes Res 2001 9 9 544 51 DOI: 10.1038/oby.2001.71 PubMed PMID: 10.1038/oby.2001.71 11557835 PubMed PMID: 11557835 11557835 \n7 Fortner MR Brown K Varia IM Gersing KR O'Connor C Doraiswamy PM Effect of bupropion SR on the quality of life of elderly depressed patients with comorbid medical disorders Prim Care Companion J Clin Psychiatry 1999 1 6 174 9 PubMed PMID: 15014668 15014668 \n8 Weihs KL Settle EC Batey SR Houser TL Donahue RM Ascher JA Bupropion sustained release versus paroxetine for the treatment of depression in the elderly J Clin Psychiatry 2000 61 3 196 202 PubMed PMID: 10817105 10817105 \n9 Chiang CK Chou YH Chen YH Sha CB Liang CS Aphthous ulcers associated with bupropion in a female adolescent: a case verified by rechallenge Gen Hosp Psychiatry 2011 33 4 411.e1 2 DOI: 10.1016/j.genhosppsych.2011.01.010 PubMed PMID: 10.1016/j.genhosppsych.2011.01.010 21762840 PubMed PMID: 21762840 \n10 Kast RE Altschuler EL Bupropion and chronic aphthous ulceration Arch Dermatol 2005 141 9 1167 DOI: 10.1001/archderm.141.9.1167-a PubMed PMID: 10.1001/archderm.141.9.1167-a 16172322 PubMed PMID: 16172322 \n11 Slebioda Z Szponar E Kowalska A Recurrent aphthous stomatitis: genetic aspects of etiology Postepy Dermatol Alergol 2013 30 2 96 102 DOI: 10.5114/pdia.2013.34158 PubMed PMID: 10.5114/pdia.2013.34158 24278055 PubMed PMID: 24278055 24278055 \n12 Sweet RA Pollock BG Kirshner M Wright B Altieri LP DeVane CL Pharmacokinetics of single- and multiple-dose bupropion in elderly patients with depression J Clin Pharmacol 1995 35 9 876 84 PubMed PMID: 8786247 8786247 \n13 Howard WT Warnock JK The efficacy and toxicity of bupropion in the elderly Jefferson J Psychiatry 2000 15 1 174 9 \n14 Ben-Aryeh H Miron D Szargel R Gutman D Whole-saliva secretion rates in old and young healthy subjects J Dent Res 1984 63 6 1147 8 DOI: 10.1177/00220345840630091001 PubMed PMID: 10.1177/00220345840630091001 6589278 PubMed PMID: 6589278 6589278 \n15 Guggenheimer J Xerostomia Moore P J Am Dent Assoc 2003 134 1 61 9 10.14219/jada.archive.2003.0018 12555958 \n16 Naranjo CA Busto U Sellers EM Sandor P Ruiz I Roberts EA A method for estimating the probability of adverse drug reactions Clin Pharmacol Ther 1981 30 2 239 45 10.1038/clpt.1981.154 7249508 \n17 Spivak JL Polycythemia vera: myths, mechanisms, and management Blood 2002 100 13 4272 90 DOI: 10.1182/blood-2001-12-0349 PubMed PMID: 10.1182/blood-2001-12-0349 12393615 PubMed PMID: 12393615 12393615 \n18 Zyban [package insert] Research Triangle Park (NC) GlaxoSmithKline 2017 \n19 Johnston AJ Ascher J Leadbetter R Schmith VD Patel DK Durcan M Pharmacokinetic optimisation of sustained-release bupropion for smoking cessation Drugs 2002 62 Suppl 2 11 24 PubMed PMID: 12109932 \n20 Vanderkooy JD Kennedy SH Bagby RM Antidepressant side effects in depression patients treated in a naturalistic setting: a study of bupropion, moclobemide, paroxetine, sertraline, and venlafaxine Can J Psychiatry 2002 47 2 174 80 DOI: 10.1177/070674370204700208 PubMed PMID: 10.1177/070674370204700208 11926080 PubMed PMID: 11926080 11926080 \n21 Schubert MM Izutsu KT Iatrogenic causes of salivary gland dysfunction J Dent Res 1987 66 Spec No 680-8 DOI: 10.1177/00220345870660S213 PubMed PMID: 10.1177/00220345870660S213 3305644 PubMed PMID: 3305644 3305644\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2168-9709",
"issue": "8(4)",
"journal": "The mental health clinician",
"keywords": "bupropion; candidiasis; geriatric; thrush",
"medline_ta": "Ment Health Clin",
"mesh_terms": null,
"nlm_unique_id": "101728585",
"other_id": null,
"pages": "188-190",
"pmc": null,
"pmid": "30155394",
"pubdate": "2018-07",
"publication_types": "D002363:Case Reports",
"references": "16027765;12555958;12393615;15014668;10321415;6589278;24278055;11926080;8786247;12109932;10817105;3305644;11557835;7249508;21762840;16172322;15361919;25364186",
"title": "Development of oral candidiasis following initiation and rechallenge of extended-release bupropion in a geriatric patient.",
"title_normalized": "development of oral candidiasis following initiation and rechallenge of extended release bupropion in a geriatric patient"
} | [
{
"companynumb": "US-SLATE RUN PHARMACEUTICALS-SLTR-AE-18-16",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "BUPROPION HYDROCHLORIDE"
},
... |
{
"abstract": "The diagnosis of infiltrative basal cell carcinoma (BCC) can be delayed owing to its often subtle clinical findings. A 90-year-old woman presented with an asymptomatic annular pink plaque on her left shin that was clinically diagnosed as tinea corporis. After years of not responding to topical anti-fungal therapy, biopsies confirmed a diagnosis of infiltrative BCC. We discuss the differential diagnosis of the case, the difficulties in identifying infiltrative BCC, and the pathologic features of infiltrative BCC.",
"affiliations": "Department of Dermatology, Baylor College of Medicine, Houston, Texas. viraat.patel@bcm.edu.",
"authors": "Xu|Ann|A|;Patel|Viraat|V|;Sutton|Leigh|L|;Orengo|Ida|I|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1087-2108",
"issue": "24(3)",
"journal": "Dermatology online journal",
"keywords": null,
"medline_ta": "Dermatol Online J",
"mesh_terms": "D000369:Aged, 80 and over; D001706:Biopsy; D002280:Carcinoma, Basal Cell; D003937:Diagnosis, Differential; D005260:Female; D006801:Humans; D012867:Skin; D012878:Skin Neoplasms; D014005:Tinea",
"nlm_unique_id": "9610776",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "29634889",
"pubdate": "2018-03-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Infiltrative basal cell carcinoma mimicking tinea corporis.",
"title_normalized": "infiltrative basal cell carcinoma mimicking tinea corporis"
} | [
{
"companynumb": "US-BAUSCH-BL-2018-029678",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "NAFTIFINE HYDROCHLORIDE"
},
"drugadditional": ... |
{
"abstract": "OBJECTIVE\nTo assess the suitability of galantamine for the symptomatic treatment of post-traumatic oculomotor (III) and trochlear (IV) nerve palsy.\n\n\nMETHODS\nThe routine ophthalmic and strabological examination was performed in five patients (4 females and 1 male) at the age of 31 to 57 years (mean 40.7) with the post-traumatic ophthalmic complications. Due to the unilateral oculomotor and trochlear nerve palsy, which had not resolved within 2-6 (mean duration of 4 months) months following traffic accident, galantamine was used. Nivalin and Reminyl were administered in iontophoresis and orally, respectively, for 10-18 months (mean duration of 14 months). The ocular muscle motion exercises and prism correction were also used.\n\n\nRESULTS\nThe increased range of ocular motion (100%), reducing of the angle of strabismus horizontally (40%) and vertically (60%), statistically significant extension of palpebral fissure (60%), and regression of diplopia (80% total without correction) were observed. The binocular vision after treatment in the free- and instrument-space environment were also improved (100% simultaneous perception, fusion 80%, stereopsis 60%).\n\n\nCONCLUSIONS\nThe early galantamine administration in patient with n. III and n. IV post-traumatic palsy accelerates the resolution of post-traumatic ophthalmic symptoms. It is an effective treatment which offers the elimination of strabismus, diplopia and ptosis, at the same time improvings ocular movements and binocular vision. galantamine, post-traumatic nerve palsy, oculomotor and trochlear nerves.",
"affiliations": null,
"authors": "Tokarz-Sawińska|Ewa|E|;Lachowicz|Ewelina|E|;Gosławski|Wojciech|W|",
"chemical_list": "D010277:Parasympathomimetics; D005702:Galantamine",
"country": "Poland",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0023-2157",
"issue": "115(4)",
"journal": "Klinika oczna",
"keywords": null,
"medline_ta": "Klin Oczna",
"mesh_terms": "D000063:Accidents, Traffic; D000328:Adult; D001924:Brain Concussion; D001930:Brain Injuries; D003867:Depth Perception; D004172:Diplopia; D005260:Female; D005702:Galantamine; D006801:Humans; D008297:Male; D008875:Middle Aged; D015840:Oculomotor Nerve Diseases; D010277:Parasympathomimetics; D012189:Retrospective Studies; D013285:Strabismus; D020432:Trochlear Nerve Diseases; D015348:Vision, Binocular; D014796:Visual Perception",
"nlm_unique_id": "0376614",
"other_id": null,
"pages": "275-9",
"pmc": null,
"pmid": "24908916",
"pubdate": "2013",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "The use of galantamine in the treatment of post-traumatic oculomotor and trochlear nerve palsy.",
"title_normalized": "the use of galantamine in the treatment of post traumatic oculomotor and trochlear nerve palsy"
} | [
{
"companynumb": "US-JNJFOC-20140612044",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "GALANTAMINE"
},
"drugadditional": null,
... |
{
"abstract": "Cerebral vasculitis is an uncommon life-threatening complication of community-acquired bacterial meningitis.\nWe report the case of a 64-year-old woman with pneumococcal meningitis who developed parainfectious vasculitis causing ischaemic brain damage. Cerebral magnetic resonance imaging (MRI) confirmed the diagnosis. Clinical and radiological recovery after delayed addition of corticosteroid was achieved.\nThis report shows that the onset of neurological deficits following pneumococcal meningitis can be caused by cerebral vasculitis. Underdosing with antibiotics and delayed adjunctive dexamethasone seem to favour this complication. There are no guidelines for treatment but high doses of steroids led to resolution in this case.\nPneumococcal meningitis complicated by cerebral vasculitis can be treated with high-dose steroids.A repeat lumbar puncture is recommended to rule out relapsing or persistent infection in patients who deteriorate after 48 h of adequate antibiotic therapy.The cerebral vasculitis in our patient may have been caused by antibiotic underdosing and by delayed dexamethasone administration.",
"affiliations": "Medical Intensive Care Unit, Farhat Hached Hospital, Sousse, Tunisia.;Medical Intensive Care Unit, Farhat Hached Hospital, Sousse, Tunisia.;Infectious Diseases Department, Farhat Hached Hospital, Sousse, Tunisia.;Medical Intensive Care Unit, Farhat Hached Hospital, Sousse, Tunisia.;Infectious Diseases Department, Farhat Hached Hospital, Sousse, Tunisia.;Medical Intensive Care Unit, Farhat Hached Hospital, Sousse, Tunisia.",
"authors": "Khedher|Ahmed|A|;Sma|Nesrine|N|;Slama|Dorsaf|D|;Fraj|Nesrine|N|;Hachfi|Wissem|W|;Boussarsar|Mohamed|M|",
"chemical_list": null,
"country": "Italy",
"delete": false,
"doi": "10.12890/2018_000819",
"fulltext": "\n==== Front\nEur J Case Rep Intern MedEur J Case Rep Intern MedEuropean Journal of Case Reports in Internal Medicine2284-2594SMC Media Srl 10.12890/2018_000819819-1-5215-1-10-20180312ArticlesCerebral Vasculitis Complicating Pneumococcal Meningitis Khedher Ahmed 1Sma Nesrine 1Slama Dorsaf 2Fraj Nesrine 1Hachfi Wissem 2Boussarsar Mohamed 1\n1 Medical Intensive Care Unit, Farhat Hached Hospital, Sousse, Tunisia\n2 Infectious Diseases Department, Farhat Hached Hospital, Sousse, Tunisia2018 25 5 2018 5 5 00081914 12 2017 22 12 2017 © EFIM 20182018This article is licensed under a Commons Attribution Non-Commercial 4.0 LicenseIntroduction\nCerebral vasculitis is an uncommon life-threatening complication of community-acquired bacterial meningitis.\n\nPatient and methods\nWe report the case of a 64-year-old woman with pneumococcal meningitis who developed parainfectious vasculitis causing ischaemic brain damage. Cerebral magnetic resonance imaging (MRI) confirmed the diagnosis. Clinical and radiological recovery after delayed addition of corticosteroid was achieved.\n\nDiscussion\nThis report shows that the onset of neurological deficits following pneumococcal meningitis can be caused by cerebral vasculitis. Underdosing with antibiotics and delayed adjunctive dexamethasone seem to favour this complication. There are no guidelines for treatment but high doses of steroids led to resolution in this case.\n\nLEARNING POINTS\nPneumococcal meningitis complicated by cerebral vasculitis can be treated with high-dose steroids.\n\nA repeat lumbar puncture is recommended to rule out relapsing or persistent infection in patients who deteriorate after 48 h of adequate antibiotic therapy.\n\nThe cerebral vasculitis in our patient may have been caused by antibiotic underdosing and by delayed dexamethasone administration.\n\nCerebral vasculitispneumococcal meningitisstrokesteroids\n==== Body\nINTRODUCTION\nCerebral vasculitis is a rare life-threatening complication of community-acquired bacterial meningitis[1]. It is associated with a high mortality and a high incidence of neurological sequelae[2]. There is no standard treatment for this cerebrovascular complication but steroids are known to improve outcome[1].\n\nCASE REPORT\nA 64-year-old woman presented to a private hospital for headache and confusion after 1 week of neglected otalgia and fever. Physical examination showed neck stiffness, a Glasgow Coma Scale score of 14 and a temperature of 39°C. Lumbar puncture (LP) yielded cloudy cerebrospinal fluid (CSF): CSF white blood cells (WBC), 1,000/mm3; neutrophils, 76%; CSF protein, 1.95 g/l; CSF blood glucose ratio, 0.4. Gram staining revealed Gram-positive diplococci. The patient was diagnosed with pneumococcal meningitis. Treatment with cefotaxime 200 mg/kg/24 h was initiated within the first hour after initial medical contact with no associated dexamethasone. CSF culture isolated penicillin-resistant cefotaxime-susceptible Streptococcus pneumoniae. The minimal inhibitory concentrations were not available. Two hours later, the patient developed generalized seizures and acute respiratory failure managed with clonazepam and mechanical ventilation with sedation. A brain CT scan revealed no abnormalities.\n\nThree days later, the patient was referred to a tertiary intensive care unit (ICU) for persistent fever. On day 1 of ICU admission, she had recurrent generalized seizures. A second LP showed clear CSF: CSF WBC, <1/mm3; CSF protein, 0.5 g/l; CSF blood glucose ratio, 0.64. CSF culture was negative. Screening for other infections was negative. There were no signs of haemodynamic instability. The cefotaxime dose was increased to 300 mg/kg/24 h for a total of 14 days and adjunctive dexamethasone 10 mg four times daily for 4 days was initiated. By day 3 of this combination therapy, persistent apyrexia was obtained with no seizure recurrence. Consciousness was not affected after sedation was stopped, but neurological examination showed left proportional hemiplegia. Cerebral MRI showed multiple lesions with increased signal intensity in the right white matter of the parietal-insular and Rolandic areas (Fig. 1) and markedly restricted diffusion. These findings were consistent with infectious cerebral vasculitis. Methylprednisolone 1.5 mg/kg daily for 5 days was introduced and then replaced with oral prednisone 1 mg/kg daily for 2 months. The patient was discharged from the ICU on day 15. She remained in hospital and received physiotherapy until she recovered fully and left hospital on day 29. One month later, the patient had no complaints with complete regression of the neurological deficit. A follow-up cerebral MRI performed 2 months later showed subtotal regression of the subcortical parieto-insular right hypersignal (Fig. 2).\n\nMethods and Procedures\nWe searched PubMed using the keywords ‘cerebral vasculitis’, ‘pneumococcal meningitis’ and ‘treatment’. Our search retrieved seven articles, five of which were case reports published between 2007 and 2017, that described four adult patients and three children. Empirical intravenous antibiotics with adjunctive dexamethasone were administered in all patients. Three patients completely recovered in 1–36 months, two had one or two long-term sequelae and two died after a few days[1–4].\n\nDISCUSSION\nWe report one of the rare cases described in the literature of cerebral vasculitis following pneumococcal meningitis [1]. This cerebrovascular complication is not well understood and has a poor outcome with non-specific presentations; there are no guidelines for treatment. Diagnosis of our case relied on the combination of persistent fever, recurrent generalized seizures, new onset of hemiplegia, normalized CSF parameters in the repeat LP and a normal CT cerebral scan. However, a repeat LP is now recommended to rule out relapsing or persistent infection in patients who deteriorate after 48 h of adequate antibiotic therapy[5]. A small number of patients with repeat LP have been diagnosed with delayed cerebral thrombosis after clinical deterioration. In these patients, CSF WBC remained elevated in contrast to our case. CSF bacterial cultures are commonly negative[4].\n\nThe discrepancy between clinical findings and a normalized repeat LP should prompt physicians to perform emergent brain MRI to rule out cerebrovascular complications including cerebral vasculitis. MRI has a sensitivity of over 90% for identifying cerebral vasculitis based on detection of white matter lesions, ischaemic necrosis and arterial changes, especially in the posterior area[1]. In the present case, the MRI findings were ischaemic lesions in the right white matter of the parietal-insular and Rolandic areas, explaining the left hemiplegia.\n\nTwo pathophysiological mechanisms for this complication are suggested. The first is an immune response affecting cerebral blood vessels resulting in delayed cerebral thrombosis. All patients in one study were treated initially with adjunctive dexamethasone, suggesting a dexamethasone-associated effect[4]. The main suggested mechanism is mediated by vascular inflammation due to proinflammatory cytokines and chemokines disrupting the blood–brain barrier following antibiotic-induced autolysis. Prompt use of intravenous antibiotics is key for the treatment of bacterial meningitis. A dosing regimen of 100 mg/kg/day of ceftriaxone, or 300 mg/kg/day of cefotaxime in case of penicillin-resistant Streptococcus pneumoniae, is recommended[5]. Adjunctive steroid treatment has shown its efficacy and is now indicated very early in the course of bacterial meningitis, before or at the time of the first dose of antibiotics[6]. In the present case, cefotaxime was initiated at a dosing regimen of 200 mg/kg/day for the 3 days after the first medical contact. The dose was then increased to the optimal dose. Adjunctive dexamethasone was introduced 3 days after the first antibiotic infusion. There were no reasons to suggest the vasculitis was due to cefotaxime underdosing and/or delayed adjunctive dexamethasone.\n\nSeveral therapeutic schemes have been reported but data on the optimum duration of steroid administration are limited. In our patient, 2 mg/kg methylprednisolone for 5 days followed by tapering improved the deficit within 15 days[1]. High doses of steroids in other reports have been associated with immunosuppression. In the present case, 1.5 mg/kg methylprednisolone was initially used for 5 days, followed by 1 mg/kg prednisone for 2 months with progressive tapering leading to total resolution of the neurological deficit. The MRI findings had very nearly disappeared 2 months after the episode of meningitis.\n\nIn conclusion, this report shows that onset of neurological deficits following pneumococcal meningitis can be due to cerebral vasculitis, an uncommon but serious life-threatening complication. Inappropriate antibiotic dosing and delayed addition of dexamethasone seem to be risk factors for this complication. There are no guidelines for treatment, but high doses of steroids resulted in resolution of the neurological deficits in this case.\n\nConflicts of Interests: The Authors declare that there are no competing interests.\n\nFigure 1 Diffusion-weighted sequence shows markedly restricted diffusion, as evidenced by the high signal intensity of the lesions.\n\nFigure 2 Axial sequence T2 FLAIR shows regression of the abnormal subcortical parieto-insular right signal.\n==== Refs\nREFERENCES\n1 Regaieg K Baccouche N Souissi B Bahloul M Bouaziz M Vascularite cérébrale: une complication rare de la méningite à Streptococcus pneumoniae Med Mal Infect 2016 46 3 \n2 Klobassa DS Zoehrer B Paulke-Korinek M Gruber-Sedlmayr U Pfurtscheller K Strenger V The burden of pneumococcal meningitis in austrian children between 2001 and 2008 Eur J Pediatr 2014 173 871 878 24419336 \n3 Tavladaki T Spanaki AM llia S Geromarkaki E Raissaki M Briassoulis G Unusual exanthema combined with cerebral vasculitis in pneumococcal meningitis: a case report J Med Case Report 2011 5 410 \n4 Schut ES Brouwer MC de Gans J Florquin S Troost D van de Beek D Delayed cerebral thrombosis after initial good recovery from pneumococcal meningitis Neurology 2009 73 1988 1995 19890068 \n5 Société de Pathologie Infectieuse de Langue Française Management of acute community-acquired bacterial meningitides, except in newborn infants Rev Neurol (Paris) 2009 165 205 16 \n6 de Gans J van de Beek D Dexamethasone in adults with bacterial meningitis N Engl J Med 2002 347 1549 1556 12432041\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2284-2594",
"issue": "5(5)",
"journal": "European journal of case reports in internal medicine",
"keywords": "Cerebral vasculitis; pneumococcal meningitis; steroids; stroke",
"medline_ta": "Eur J Case Rep Intern Med",
"mesh_terms": null,
"nlm_unique_id": "101648453",
"other_id": null,
"pages": "000819",
"pmc": null,
"pmid": "30756030",
"pubdate": "2018",
"publication_types": "D016428:Journal Article",
"references": "12432041;19890068;20222183;21864329;24419336;26867663",
"title": "Cerebral Vasculitis Complicating Pneumococcal Meningitis.",
"title_normalized": "cerebral vasculitis complicating pneumococcal meningitis"
} | [
{
"companynumb": "TN-SANIK-2018SA339211AA",
"fulfillexpeditecriteria": "1",
"occurcountry": "TN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": "3",
... |
{
"abstract": "Bortezomib, a chemotherapeutic agent used in the treatment of hematologic malignancies, has been associated with multiple forms of lung injury including diffuse alveolar hemorrhage (DAH). We present the first reported case of bortezomib-induced DAH in a patient with plasma cell leukemia. This 59-year-old female developed hemoptysis, severe cough, and diffuse bilateral ground glass opacities on CT scan of the chest after receiving one dose of bortezomib, with DAH subsequently confirmed on bronchoalveolar lavage. Unlike most previously reported cases, she did not develop respiratory failure requiring high dose corticosteroids, and in fact did not require any supplemental oxygen. We also provide a comparative summary of all reports of bortezomib-induced DAH in the literature to date. This case provides additional insight into the spectrum of disease severity observed in DAH secondary to bortezomib therapy.",
"affiliations": "Division of Respirology, Critical Care, and Sleep Medicine, Department of Medicine, University of Saskatchewan, Saskatoon, Saskatchewan, Canada.;Division of Respirology, Critical Care, and Sleep Medicine, Department of Medicine, University of Saskatchewan, Saskatoon, Saskatchewan, Canada.",
"authors": "Wirth|Ingrid M|IM|;Peters|Gregory E|GE|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1016/j.rmcr.2020.101169",
"fulltext": "\n==== Front\nRespir Med Case Rep\nRespir Med Case Rep\nRespiratory Medicine Case Reports\n2213-0071\nElsevier\n\nS2213-0071(20)30382-8\n10.1016/j.rmcr.2020.101169\n101169\nCase Report\nBortezomib-induced diffuse alveolar hemorrhage in a patient with plasma cell leukemia\nWirth Ingrid M. ingrid.wirth@usask.ca\n∗\nPeters Gregory E. gep134@usask.ca\n\nDivision of Respirology, Critical Care, and Sleep Medicine, Department of Medicine, University of Saskatchewan, Saskatoon, Saskatchewan, Canada\n∗ Corresponding author. Division of Respirology, Critical Care, and Sleep Medicine, University of Saskatchewan, 5th Floor Ellis Hall, Royal University Hospital, 103 Hospital Drive, Saskatoon, SK, S7N 0W8, Canada. ingrid.wirth@usask.ca\n21 7 2020\n2020\n21 7 2020\n31 10116922 6 2020\n13 7 2020\n© 2020 The Author(s)\n2020\nThis is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).\nBortezomib, a chemotherapeutic agent used in the treatment of hematologic malignancies, has been associated with multiple forms of lung injury including diffuse alveolar hemorrhage (DAH). We present the first reported case of bortezomib-induced DAH in a patient with plasma cell leukemia. This 59-year-old female developed hemoptysis, severe cough, and diffuse bilateral ground glass opacities on CT scan of the chest after receiving one dose of bortezomib, with DAH subsequently confirmed on bronchoalveolar lavage. Unlike most previously reported cases, she did not develop respiratory failure requiring high dose corticosteroids, and in fact did not require any supplemental oxygen. We also provide a comparative summary of all reports of bortezomib-induced DAH in the literature to date. This case provides additional insight into the spectrum of disease severity observed in DAH secondary to bortezomib therapy.\n\nKeywords\n\nBortezomib\nDrug-induced lung injury\nDiffuse alveolar hemorrhage\nPulmonary hemorrhage\nPlasma cell leukemia\n==== Body\n1 Introduction\n\nBortezomib is a selective and reversible inhibitor of the 26S proteasome. The resulting intracellular protein accumulation leads to cell cycle dysfunction and apoptosis, and these antiproliferative effects have led to the incorporation of bortezomib into various chemotherapeutic regimens. While its use is most established in the treatment of multiple myeloma, bortezomib-based therapy has also been found to improve outcomes in multiple other hematologic malignancies, including plasma cell leukemia [[1], [2], [3]].\n\nAlong with adverse effects including peripheral neuropathy, cytopenias, and gastrointestinal complaints [[3], [4], [5], [6]], pulmonary complications associated with bortezomib use are being increasingly reported and characterized in the literature. In 2014, Yoshizawa et al. [7] described three patterns of bortezomib-induced lung disease (BILD) based on radiologic findings: interstitial pneumonia (including diffuse alveolar damage (DAD), hypersensitivity pneumonitis (HP), and non-DAD/non-HP), vascular hyperpermeability (noncardiogenic pulmonary edema), and hypoxia without significant radiological abnormalities. Additionally, bortezomib-induced diffuse alveolar hemorrhage (DAH) has emerged as a distinct clinical manifestation of BILD.\n\nIn this paper, we present a case of bortezomib-induced alveolar hemorrhage occurring after the first treatment dose in a patient with plasma cell leukemia, and provide a comparative summary of the seven previous cases of bortezomib-induced DAH reported in the literature to date.\n\n2 Case presentation\n\nA 59-year-old female presented to our institution with a four-week history of malaise, myalgia, chills, and unintentional weight loss. She also endorsed rhinorrhea and a non-productive cough over this time. She had no medical history or prescription medications, although she took daily supplements including Vitamin C, Vitamin D, zinc, garlic, and a multivitamin. She used marijuana intermittently but did not smoke tobacco or use any other substances. Upon presentation, she was afebrile with an oxygen saturation of 96% on room air and otherwise stable vital signs. Her respiratory, cardiac, and abdominal examinations were unremarkable.\n\nInitial investigations were notable for a peripheral lymphocyte count of 52.2 × 109/L and flow cytometry showing 70% involvement of an immunophenotypically abnormal monoclonal plasma cell population. A bone marrow biopsy performed on Day 4 of her hospital admission confirmed a diagnosis of plasma cell leukemia. Of note, CT chest performed upon admission to hospital did not demonstrate any airspace disease.\n\nOn Day 8, she began therapy with bortezomib 1.3 mg/m2 weekly, dexamethasone 40 mg weekly, and lenalidomide daily. She was afebrile and her oxygen saturation was 95% on room air. The next day, her cough worsened significantly from earlier in the admission, and the sputum contained small volumes of dark blood. The hemoptysis and severe cough persisted on Day 10; she remained afebrile with an oxygen saturation of 96% on room air. A CT scan of the chest demonstrated bilateral patchy ground glass opacities with regions of crazy paving and new small bilateral pleural effusions (Fig. 1).Fig. 1 Axial views of patient's chest CT scan at different points during her hospital admission. A: Six days prior to receiving bortezomib; B: Two days after receiving bortezomib; C: Nine days after receiving bortezomib.\n\nFig. 1\n\nBronchoscopy was performed on Day 11. Sequential bronchoalveolar lavage demonstrated increasingly hemorrhagic returns. Microbiologic testing for bacterial and fungal cultures, COVID-19, influenza, RSV, TB, PJP, and galactomannan was negative, and cytology did not demonstrate any malignant cells. A workup for alveolar hemorrhage was initiated. Anti-nuclear antibodies, rheumatoid factor, anti-cyclic citrullinated peptide (anti-CCP), extractable nuclear antigen (ENA) panel, anti-nuclear cytoplasmic antibodies (ANCA), anti-glomerular basement membrane antibodies (anti-GBM), complements C3 and C4, cryoglobulin, anti-cardiolipin antibodies, and lupus anticoagulant testing were all within normal limits. CRP was 82.1 mg/L (2.9 mg/L on admission).\n\nThe patient remained clinically stable on room air, with no further hemoptysis after Day 12 of her admission and with gradual improvement in her cough. Therefore, she was not immediately initiated on corticosteroids, aside from the 40 mg of weekly dexamethasone in her chemotherapeutic regimen. However, she became febrile on Day 13 and on Day 14, out of concern that the fevers may be a delayed manifestation of a bortezomib-related reaction, she was started on prednisone 70 mg daily. A septic workup was negative, and the fevers subsided.\n\nA repeat CT scan of the chest on Day 17 of her admission showed near complete resolution of the ground glass opacities, with some residual mosaicism in the upper lung zones, and a decrease in the size of the effusions. She was discharged home shortly afterward and continued therapy with lenalidomide and a tapering dose of steroids; our service advised that she not be rechallenged with bortezomib. She has not had any recurrence of her respiratory symptoms.\n\n3 Discussion\n\nTable 1 summarizes the cases of bortezomib-related DAH reported in the literature. All prior cases involved males with multiple myeloma between 51 and 82 years of age. Six out of seven patients developed respiratory failure (at least three of whom required mechanical ventilation), all were treated with high dose steroids, and three of the seven died. In addition to being the first reported case in a female patient and in a patient with plasma cell leukemia, our patient is unique in that she was not hypoxemic despite BAL findings of DAH and recovered without immediately receiving high-dose steroids.Table 1 Summary of BAL-confirmed cases of DAH secondary to bortezomib.\n\nTable 1Case report\tDemographics\tDiagnosis\tSCT prior to borte-zomib\tCorticosteroids administered with bortezomib cycle\tPulmonary findings while on bortezomib, prior to DAH diagnosis\tNumber of bortezomib doses prior to DAH diagnosis*\tClinical presentation at time of DAH diagnosis\tCT chest findings\tTreatment and outcome\t\nPitini et al., 2006 [8]\t51 M\nItalian\tMM\tYes\tUnknown\tNo\t9\tDyspnea, hypoxemia\tBilateral infiltrates\tMethylprednisolone\n1g daily\nSurvived\t\nWirk, 2012 [9]\t67 M\nAmerican, ethnicity not specified\tMM\tNo\tYes\tYes (bibasal consolidation with negative workup including BAL after 4th dose)\t8 (twice-weekly dosing)\tFever, hypoxemic respiratory failure requiring intubation and ventilation\tDiffuse bilateral GGO\tMethylprednisolone\n2mg/kg daily\nDied\t\nAyed et al., 2014 [10]\t67 M\nCaucasian\tMM\tUnknown\tUnknown\tYes (“respiratory symptoms” after 4th dose)\t8 (twice-weekly dosing)\tFever, dyspnea, hypoxemia, respiratory failure\tBilateral infiltrates and GGO, interlobular septal thickening\tHigh dose steroids\nDied\t\n72 M\nCaucasian\tMM\tUnknown\tUnknown\tNo\t2 (twice-weekly dosing)\tFever, cough, hypoxemia, respiratory failure\tBilateral infiltrates\tHigh dose steroids\nSurvived\t\n55 M\nCaucasian\tMM\tUnknown\tUnknown\tNo\t1 (1.5mg/m2)\tFever, hypoxemia, respiratory failure\tBilateral infiltrates\tHigh dose steroids\nDied\t\nSugita et al., 2015 [11]\t67 M\nJapanese\tMM\tNo\tYes\tNo, but had small patchy GGO prior to start of treatment\t1\tHemoptysis (also present prior to bortezomib), cough, hypoxemic respiratory failure requiring intubation and ventilation\tDiffuse bilateral GGO and consolidation\tMethylprednisolone\n1g daily with clinical\nimprovement\nRechallenged at a reduced dose with no recurrence\nSurvived\t\nDo and Dew, 2018 [12]\t82 M\nCaucasian\tMM\tNo\tYes\tYes (RLL infiltrates and effusions beginning Day 8, in the setting of sinus node dysfunction)\tUnknown (diagnosed 33 days after beginning bortezomib)\tRespiratory failure requiring intubation and ventilation\tGGO, bilateral pleural effusions\tMethyprednisolone\n1g daily\nSurvived\t\nCurrent report, 2020\t59 F\nCaucasian\tPCL\tNo\tYes\tNo\t1\tHemoptysis, cough, delayed fever\tBilateral patchy GGO, crazy paving, bilateral pleural effusions\tPrednisone 70 mg daily, 5 days after symptom onset\nSurvived\t\nBAL = bronchoalveolar lavage, DAH = diffuse alveolar hemorrhage, SCT = stem cell transplant, MM = multiple myeloma, PCL = plasma cell leukemia, GGO = ground glass opacities, RLL = right lower lobe. *Bortezomib dosing 1.3mg/m2 unless otherwise specified.\n\nIt is important to note that while some BILD patients in the literature did undergo bronchoscopy/BAL [13], most did not [7,14,15]. It is therefore possible that some cases with significant airspace disease on CT scan may have been unrecognized DAH since not all patients with DAH present with hemoptysis [16]. Accordingly, attempts to draw distinctions between BILD patients with DAH and those without, must be undertaken with caution.\n\nNevertheless, when comparing the cases of bortezomib-induced DAH to reports of BILD without demonstrated pulmonary hemorrhage, there is a noticeable difference in the ethnicity of the affected patients. While the majority of reported non-hemorrhagic BILD cases have occurred in Japanese patients [7,14,17], most reported cases of DAH involved Caucasians. The overall high rate of BILD seen in Japanese patients may simply reflect closer monitoring for pulmonary complications in Japan compared to other countries; however, Shimazaki et al. [18] proposed that the Japanese population may have a genetic predisposition toward developing interstitial pneumonitis. Future epidemiological studies involving patients of varying ethnic backgrounds would provide further clarification.\n\nThere are also similarities between BILD patients with known DAH and those without. Kharel et al. [15] reported a BILD mortality rate of 37.2% in the literature, which is consistent with the 37.5% mortality rate among bortezomib-induced DAH cases, as shown in Table 1. They [15] also reported a higher mortality risk among patients with a prior stem cell transplant; while our DAH data set (Table 1) is too small for such an analysis and is further limited by missing data, we note that the one DAH patient with a known prior stem cell transplant did survive. Additionally, the number of bortezomib doses received prior to the onset of DAH (ranging from 1 to 9 doses) does not differ significantly from those reported for BILD without alveolar hemorrhage [7,[13], [14], [15],[17], [18], [19]].\n\nThe mechanism by which bortezomib leads to BILD, including DAH, has not been fully elucidated but several hypotheses have been presented. This drug is known to modulate inflammation through the inhibition of NFκB, a proinflammatory transcription factor. Some authors have proposed that reactivation of NFκB following the withdrawal of bortezomib provokes a rebound inflammatory response in the lungs [13,14,18], while Wirk [9] suggested that the presence of bortezomib during the resolution of an inflammatory process (although the initial trigger for that inflammation is unclear) prolongs the inflammation. Alternatively, it has been proposed that metabolites of bortezomib may cause direct injury to the lung [[13], [14], [15]]. Further, Sugita et al. [11] hypothesized that the alveolar hemorrhage observed in their patient resulted from the rapid disintegration of multiple myeloma cells in the lung following the first dose of bortezomib, and Miyakoshi et al. [14] proposed the same mechanism in one of their patients. However, this mechanism is unlikely to be applicable in our case because, unlike Sugita et al.’s patient who had patchy ground glass opacities on CT prior to the initiation of treatment, our patient's initial CT scan had no abnormalities suggestive of leukemic infiltration of the lung parenchyma.\n\n4 Conclusion\n\nAlong with being the first case of bortezomib-induced DAH described in a female patient and in a patient with plasma cell leukemia, our case differs notably from most previously published reports in that our patient did not develop respiratory failure. As such, it provides additional insight into the spectrum of disease severity observed in DAH secondary to bortezomib therapy. Continued research is warranted to better characterize the varying forms of BILD, risk factors, and underlying mechanisms.\n\nFunding\n\nThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\n\nDeclaration of competing interest\n\nThe authors do not declare any conflicts of interest.\n==== Refs\nReferences\n\n1 Robak P. Robak T. Bortezomib for the treatment of hematologic malignancies: 15 years later Drugs R 19 2 2019 73 92 10.1007/s40268.019.0269.9\n2 Katodritou E. Terpos E. Delimpasi S. Kotsopoulou M. Michalis E. Vadikolia C. Kyrtsonis M.C. Symeonidis A. Giannakoulas N. Vadikolia C. Michael M. Kalpadakis C. Gougopoulou T. Prokopiou C. Kaiafa G. Christoulas D. Gavriatopoulou M. Giannopoulou E. Labropoulou V. Verrou E. Kastritis E. Konstantinidou P. Anagnostopoulos A. Dimopoulos M.A. Real-world data on prognosis and outcome of primary plasma cell leukemia in the era of novel agents: a multicenter national study by the Greek Myeloma Study group Blood Canc. J. 8 31 2018 1 8 10.1038/s41408-018-0059-6\n3 Katodritou E. Terpos E. Kelaidi C. Kotsopoulou M. Delimpasi S. Kyrtsonis M.C. Symeonidis A. Giannakoulas N. Stefanoudaki A. Christoulas D. Chatziaggelidou C. Gastari V. Spyridis N. Verrou E. Konstantinidou P. Zervas K. Dimopoulos M.A. Treatment with bortezomib-based regimens improves overall response and predicts for survival in patients with primary or secondary plasma cell leukemia: analysis of the Greek myeloma study group Am. J. Hematol. 89 2 2014 145 150 10.1002/ajh.23600 24123068\n4 Hu B. Zhou Q. Hu Y.Y. Zhuang L. Yi L.P. Cao J.X. Li T.Q. Wang J. Efficacy and safety of once-weekly versus twice-weekly bortezomib in patients with hematologic malignancies: a meta-analysis with trial sequential analysis Pharmacotherapy 39 6 2019 697 708 10.1002/phar.2267 30985015\n5 Sun C. Li J. Chu Z. Zhang L. Chen L. Hu Y. Efficacy and safety of bortezomib maintenance in patients with newly diagnosed multiple myeloma: a meta-analysis Biosci. Rep. 37 2017 1 8 10.1042/BSR20170304\n6 Aguiar P.M. Lima TdM. Colleoni G.W.B. Storpirtis S. Efficacy and safety of bortezomib, thalidomide, and lenalidomide in multiple myeloma: an overview of systematic reviews with meta-analyses Crit. Rev. Oncol. Hematol. 113 2017 195 212 10.1016/j.critrevonc.2017.03.014 28427509\n7 Yoshizawa K. Mukai H.Y. Miyazawa M. Miyao M. Ogawa Y. Ohyashiki K. Katoh T. Kusumoto M. Gemma A. Sakai F. Siguyama Y. Hatake K. Fukada Y. Kudoh S. Bortezomib therapy-related lung disease in Japanese patients with multiple myeloma: incidence, mortality and clinical characterization Canc. Sci. 105 2014 195 201 10.1111/cas.1233\n8 Pitini V. Arrigo C. Altavilla G. Naro C. Severe pulmonary complications after bortezomib treatment for multiple myeloma: an unrecognized pulmonary vasculitis? Leuk. Res. 31 2007 1027 1028 10.1016/j.leukres.2006.09.015 17134751\n9 Wirk B. Bortezomib-related diffuse alveolar hemorrhage J. Clin. Oncol. 30 36 2012 e379 381 10.1200/JCO.2012.43.6519 23150703\n10 Ayed A.O. Moreb J.S. Hsu J.W. Hiemenz J.W. Wingard J.R. Norkin M. Severe diffuse alveolar hemorrhage associated with bortezomib administration in patients with multiple myeloma Blood 124 21 2014 5761 10.1182/blood.V124.21.5761.5761\n11 Sugita Y. Ohwada C. Nagao Y. Kawajiri C. Shimizu R. Togasaki E. Yamazaki A. Muto T. Sakai S. Takeda Y. Mimura N. Takeuchi M. Sakaida E. Iseki T. Yokote K. Nakaseko C. Early-onset severe diffuse alveolar hemorrhage after bortezomib administration suggestive of pulmonary involvement of myeloma cells J. Clin. Exp. Hematop. 55 3 2015 163 168 10.3960/jslrt.55.163 26763365\n12 Do P. Dew A. Lightning strikes twice? Alveolar hemorrhage and sinus node dysfunction requiring pacemaker after initiating bortezomib for multiple myeloma. [abstract] Chest 154 4 2018 956A 10.1016/j.chest.2018.08.860\n13 Ohri A. Arena F.P. Severe pulmonary complications in African-American patient after bortezomib therapy Am. J. Therapeut. 13 6 2006 553 555 10.1097/01.mjt.0000245224.20913.0d\n14 Miyakoshi S. Kami M. Yuji K. Matsumura T. Takotoku M. Sasaki M. Narimatsu H. Fujii T. Kawabata M. Taniguchi S. Ozawa K. Oshimi K. Severe pulmonary complications in Japanese patients after bortezomib treatment for refractory multiple myeloma Blood 107 9 2006 3492 3494 10.1182/blood.2005.11.4541 16410442\n15 Kharel P. Uprety D. Chandra A.B. Hu Y. Belur A.A. Dhakal A. Bortezomib-induced pulmonary toxicity: a case report and review of literature Case Rep. Med. 2018 10.1155/2018/2913124\n16 Zamora M.R. Warner M.L. Tuder R. Schwarz M.I. Diffuse alveolar hemorrhage and systemic lupus erythematosus: clinical presentation, histology, survival, and outcome Medicine (Baltim.) 76 3 1997 192 202 10.1097/00005792.199705000.00005\n17 Gotoh A. Ohyashiki K. Oshimi K. Usui N. Hotta T. Dan K. Iked Y. Lung injury associated with bortezomib therapy in relapsed/refractory multiple myeloma in Japan :A questionnaire-based report from the “Lung Injury by Bortezomib” joint committee of the Japanese Society of Hematology and the Japanese Society of Clinical Hematology Int. J. Hematol. 84 2006 406 412 10.1532/IJH97.06142 17189220\n18 Shimazaki C. Kobayashi Y. Inaba T. Taniwaki M. Dexamethasone reduces the risk of bortezomib-induced pulmonary complications in Japanese myeloma patients Int. J. Hematol. 84 2006 90 91 10.1532/IJH97.06062 16867910\n19 Balsman E. Bortezomib therapy-related lung disease in a patient with light chain amyloidosis: a case report J. Oncol. Pharm. Pract. 23 7 2017 545 548 10.1177/1078155216657680 27357815\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2213-0071",
"issue": "31()",
"journal": "Respiratory medicine case reports",
"keywords": "Bortezomib; Diffuse alveolar hemorrhage; Drug-induced lung injury; Plasma cell leukemia; Pulmonary hemorrhage",
"medline_ta": "Respir Med Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101604463",
"other_id": null,
"pages": "101169",
"pmc": null,
"pmid": "32754424",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "17189220;30993606;16410442;24123068;26763365;9193454;27357815;29523783;17134751;30985015;24329927;23150703;16867910;28427509;17122539;28706008;30595697",
"title": "Bortezomib-induced diffuse alveolar hemorrhage in a patient with plasma cell leukemia.",
"title_normalized": "bortezomib induced diffuse alveolar hemorrhage in a patient with plasma cell leukemia"
} | [
{
"companynumb": "CA-DRREDDYS-USA/CAN/20/0126057",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": nul... |
{
"abstract": "Amantadine withdrawal syndrome (AWS) is a rare but recognized cause of severe and persistent altered mental status sometimes with co-occurring extrapyramidal symptoms. First described in a case series from 1987, its clinical manifestations have been characterized along a spectrum ranging from profound hypoactive delirium to hyperactive delirium with hallucinations. Risk factors for withdrawal include abrupt medication discontinuation, prolonged use, older age and underlying dementia. Herein we describe a case of a 52-year-old woman who presented with confusion, hallucinations, and coronavirus disease-2019 infection. She subsequently developed a prolonged hypoactive delirium after her amantadine was tapered and held. Her hypoactive delirium entirely resolved with resumption of amantadine confirming the diagnosis of AWS. This case illustrates the importance of slowly tapering dopaminergic medications and being aware of rare pharmacologic side effects.",
"affiliations": "Department of Hospital Medicine, University of Chicago, Chicago, IL, USA.;Clinical Pharmacist, University of Chicago, Chicago, IL, USA.",
"authors": "Murray|John P|JP|;Kerins|Angela|A|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1093/omcr/omaa133",
"fulltext": "\n==== Front\nOxf Med Case Reports\nOxf Med Case Reports\nomcr\nOxford Medical Case Reports\n2053-8855 Oxford University Press \n\n10.1093/omcr/omaa133\nomaa133\nCase Report\nAcademicSubjects/MED00010\nAmantadine withdrawal syndrome masquerading as COVID-19 encephalopathy: a case report and review of the literature\nMurray John P 1 Kerins Angela 2 1 \nDepartment of Hospital Medicine, University of Chicago, Chicago, IL, USA\n2 \nClinical Pharmacist, University of Chicago, Chicago, IL, USA\nCorrespondence address. Department of Hospital Medicine, University of Chicago, 5841 S Maryland Ave, Chicago, IL 60637, USA. Tel: 402-301-8695; Fax: 773-795-7398; E-mail: murrayjp8@medicine.bsd.uchicago.edu\n2 2021 \n15 2 2021 \n15 2 2021 \n2021 2 omaa13324 9 2020 11 11 2019 9 12 2020 © The Author(s) 2021. Published by Oxford University Press.2021This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.ABSTRACT\nAmantadine withdrawal syndrome (AWS) is a rare but recognized cause of severe and persistent altered mental status sometimes with co-occurring extrapyramidal symptoms. First described in a case series from 1987, its clinical manifestations have been characterized along a spectrum ranging from profound hypoactive delirium to hyperactive delirium with hallucinations. Risk factors for withdrawal include abrupt medication discontinuation, prolonged use, older age and underlying dementia.\n\nHerein we describe a case of a 52-year-old woman who presented with confusion, hallucinations, and coronavirus disease-2019 infection. She subsequently developed a prolonged hypoactive delirium after her amantadine was tapered and held. Her hypoactive delirium entirely resolved with resumption of amantadine confirming the diagnosis of AWS. This case illustrates the importance of slowly tapering dopaminergic medications and being aware of rare pharmacologic side effects.\n==== Body\nINTRODUCTION\nAmantadine hydrochloride, among the many happy accidents in medicine, was inadvertently discovered to alleviate the extrapyramidal symptoms of Parkinson’s disease (PD) in 1968. A woman with PD found her symptoms much improved while taking amantadine for flu prophylaxis. Later that year a large trial demonstrated both subjective and objective benefits when used to treat PD [1]. Since that time, amantadine has been used to treat PD alongside a number of other movement disorders.\n\nAlthough its mechanism is not fully understood, amantadine is thought to achieve its effect via N-methyl-D-aspartate receptor antagonism, direct and indirect effects on dopamine neurons, and by decreasing anticholinergic tone [2]. Amantadine can cause dopamine toxicity: paranoia, hallucinations and tachycardia. For this reason, the medication is initiated progressively. Inversely, if it is rapidly discontinued, patients may develop amantadine withdrawal syndrome (AWS), a severe and persistent delirium often with concurrent extrapyramidal symptoms.\n\nCASE REPORT\nA 52-year-old female with a past medical history of spinocerebellar ataxia, hyperthyroidism and depression presented to the hospital with 2–3 weeks of hallucinations. Admission labs were remarkable for a new acute kidney injury with blood urea nitrogen (76 mg/dl) and creatinine (1.6 mg/dl from baseline of 0.8 mg/dl). Additionally, she was found to be coronavirus disease-2019 (COVID-19) positive. Complete blood count, urinalysis, thyroid stimulating hormone (TSH), serum ethanol level and head computed tomography were unremarkable. Vital signs were notable for a heart rate of 104. On arrival she was alert and answering questions appropriately. The patient had been prescribed amantadine for 2.5 years prior to admission and was taking 300 mg daily.\n\nThe neurology service suspected her hallucinations were related to amantadine toxicity and recommended a 3-day taper, shortened to 2 days by the primary service. Serum amantadine level was ordered on admission and found to be 1505 ng/dl (therapeutic range 200–1000 ng/ml and toxicity >2000 ng/ml). The patient continued to have hallucinations with concurrent agitation, prompting an electroencephalogram (EEG) and lumbar puncture. All lumbar puncture studies were normal. EEG showed background slowing consistent with encephalopathy with no epileptiform activity.\n\nAfter 3 days, the patient was no longer having active hallucinations but became increasingly somnolent and disoriented. Five days into her course, she was no longer consistently speaking with providers. Two weeks into her hospitalization, she required assistance in feeding and was not reliably following commands. Given her persistent symptoms, the possibility of COVID-19 encephalopathy was raised and a repeat lumbar puncture considered for colony-stimulating factor polymerase chain reactiontesting. Prior to this, the patient was resumed on 200 mg of oral amantadine. Within 2 days she was alert, speaking in full sentences, and oriented to person, month and situation. Because the patient’s prolonged delirium resolved immediately after resuming amantadine, the diagnosis of AWS was made. The neurology service believed that the patient’s initial presentation was consistent with amantadine toxicity with the patient going into withdrawal in the subsequent days as the medication was tapered and held, thus explaining both her initial agitation and hallucinations and subsequent hypoactive delirium. She ultimately returned to her cognitive baseline and was discharged to subacute rehab.\n\nDISCUSSION\nSince 1987 there have been seven case reports describing instances of AWS including 15 patients. This is the first published since 2017 and is noteworthy in that it describes a patient without PD or underlying dementia. The first case series, published by Wilson in 1987, describes three older patients who experienced recrudescence of their PD motor symptoms after amantadine was held [3]. Only one of the three patients may have suffered from our more contemporary definition of AWS, an acute delirium following the discontinuation of the medication, whereas the other two patients experienced only movement symptoms.\n\nIn 1997 Factor published a case series describing three elderly patients who developed acute delirium with worsening motor function after amantadine was held [4]. All patients had underlying dementia and had been taking amantadine for more than 4 years. Symptoms quickly resolved after resuming the medication. Interestingly, all patients had their amantadine held due to hallucinations. Miyasaki republished a reply to the editor sharing two similar cases of patients with longstanding PD who developed AWS [5]. Factor responded with two further cases of elderly patients with characteristic PD and AWS. These cases were novel in that one patient did not have underlying dementia and both patients had been taking amantadine for less than 1 year. Again, symptoms entirely resolved with resumption of amantadine. Miyasaki hypothesized that pathogenesis of the delirium was related to the glutamatergic system. At this point some general risk factors for AWS were induced: old age, advanced PD, underlying dementia and duration of therapy. Factor agreed with Miyaski that AWS was unlikely related to dopaminergic pathways.\n\nIn 2009 Brantley published a case report of neuroleptic malignant syndrome (NMS) believed induced by amantadine withdrawal [6]. The authors hypothesized that more classic AWS exists on a spectrum which includes NMS. Marxreiter added an additional case of severe AWS in a patient with PD in 2017, helpfully noting the benefit of reintroducing amantadine early in instances of diagnostic uncertainty due to its rapid effects [7]. Finally, Fryml described three cases of AWS in a 2017 report which interestingly included the first patient without PD [8]. The authors noted the remarkable duration that AWS can persist: in one instance for weeks. Similar to Brantley, she describes AWS as a protean syndrome ranging from delirium to NMS, driven by dopaminergic derangements.\n\nOur case illustrates both characteristic and unusual features of AWS. Characteristically, this case was prolonged and refractory, included motor symptoms, and entirely resolved with amantadine reintroduction. Atypically, this case involved a patient without PD who experienced a hypoactive delirium, although this has been also reported. Intriguingly, this case of AWS likely occurred after a period of amantadine toxicity, as the patient initially presented with hallucinations and elevated serum amantadine levels. We hope this report highlights the importance of prolonged amantadine tapers in the setting of toxicity as symptoms of overdose and withdrawal can overlap, creating diagnostic confusion. Further questions which remain to be answered include the exact pathophysiology of the syndrome and if it includes NMS as part of its spectrum.\n\nACKNOWLEDGMENTS\nUniversity of Chicago COVID-19 unit. No funding was received for this report.\n\nCONFLICT OF INTEREST\nNone declared.\n\nETHICAL APPROVAL\nPatient information was deidentified and informed consent obtained.\n\nCONSENT\nWritten consent was obtained from the patient.\n\nGUARANTOR\nJohn P. Murray.\n==== Refs\nREFERENCES\n1. \n\nSchwab R , England A , Poskanzer D , Young R \nAmantadine in the treatment of Parkinson's disease\n. JAMA 1969 ;208 :1168 –70\n. doi: 10.1001/jama.1969.03160070046011 .5818715 \n2. \n\nBrantley E , Cohn J , Babu K \nCase files of the program in medical toxicology at Brown University: amantadine withdrawal and the neuroleptic malignant syndrome\n. J Med Toxicol 2009 ;5 :92 –8\n. doi: 10.1007/BF03161096 .19415596 \n3. \n\nWilson J , Farquhar D , Primrose W , Smith R \nLong term amantadine treatment the danger of withdrawal\n. Scott Med J 1987 ;32 :135 . doi: 10.1177/003693308703200503 .3441780 \n4. \n\nFactor S , Molho E , Brown D \nAcute delirium after withdrawal of amantadine in Parkinson's disease\n. Neurology 1998 ;50 :1456 –8\n. doi: 10.1212/WNL.50.5.1456 .9596005 \n5. \n\nMiyasaki J , Grimes D , Lang A \nAcute delirium after withdrawal of amantadine in Parkinson’s disease\n. Neurology 1999 ;52 :1717 . doi: 10.1212/wnl.50.5.1456 .\n6. \n\nBrantley E , Cohn J , Babu K \nCase files of the program in medical toxicology at Brown University: amantadine withdrawal and the neuroleptic malignant syndrome\n. J Med Toxicol 2009 ;5 :92 –8\n. doi: 10.1007/BF03161096 .19415596 \n7. \n\nMarxreiter F , Winkler J , Uhl M , Madžar D \nA case report of severe delirium after amantadine withdrawal\n. Case Rep Neurol 2017 ;9 :44 –8\n. doi: 10.1159/000460814 .28611642 \n8. \n\nFryml L , Williams K , Pelic C , Fox J , Sahlem G , Robert S et al. The role of amantadine withdrawal in 3 cases of treatment-refractory altered mental status\n. J Psychiatr Pract 2017 ;23 :191 –9\n. doi: 10.1097/PRA.0000000000000237 .28492457\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2053-8855",
"issue": "2021(2)",
"journal": "Oxford medical case reports",
"keywords": null,
"medline_ta": "Oxf Med Case Reports",
"mesh_terms": null,
"nlm_unique_id": "101642070",
"other_id": null,
"pages": "omaa133",
"pmc": null,
"pmid": "33614044",
"pubdate": "2021-02",
"publication_types": "D002363:Case Reports",
"references": "3441780;10331717;5818715;28611642;19415596;9596005;28492457",
"title": "Amantadine withdrawal syndrome masquerading as COVID-19 encephalopathy: a case report and review of the literature.",
"title_normalized": "amantadine withdrawal syndrome masquerading as covid 19 encephalopathy a case report and review of the literature"
} | [
{
"companynumb": "US-CIPLA LTD.-2021US05939",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "AMANTADINE HYDROCHLORIDE"
},
"drugadditional"... |
{
"abstract": "Although gamma heavy chain disease (γ-HCD) lesions occasionally morphologically resemble angioimmunoblastic T-cell lymphoma (AITL), no association has been described in detail due to the rarity of the disease. In this report, we present a rare manifestation of methotrexate (MTX)-associated lymphoproliferative disorders (LPDs) with AITL-like features accompanied by γ-HCD in a 75-year-old man with rheumatoid arthritis (RA). A biopsy specimen was evaluated using immunohistochemistry, clonal analyses of immunoglobulin VH and T-cell receptor γ gene rearrangements by polymerase chain reaction, and Sanger sequencing for confirmation of the structure of deleted γ-HCD clones. The histological features characterized by proliferation of CD4- and PD-1-positive medium-sized T cells and arborizing high endothelial venules together with numbers of small lymphocytes, eosinophils, plasma cells, and histiocytes in the background mimicked those of AITL, but did not completely fulfill the diagnostic criteria. Clonal analysis demonstrated that the specimen contained multiple LPDs of both B-cell and T-cell lineages. Sequence analysis confirmed the co-existence of a clone responsible for production of the abnormal heavy chain. This report provides new insights into the pathology of γ-HCD. Multiple host-derived factors (e.g., RA and/or use of MTX) may be responsible for the occurrence of LPDs of multiple lineages within a single lymph node.",
"affiliations": "Department of Hematology, Iizuka Hospital, Iizuka, Japan.;Department of Pathology, School of Medicine, Kurume University, Kurume, Japan.;Department of Hematology, Iizuka Hospital, Iizuka, Japan.;Department of Hematology, Iizuka Hospital, Iizuka, Japan.;Department of Hematology, Iizuka Hospital, Iizuka, Japan.;Department of Hematology, Iizuka Hospital, Iizuka, Japan.;Department of Hematology, Iizuka Hospital, Iizuka, Japan.;Department of Hematology, Iizuka Hospital, Iizuka, Japan.;Department of Hematology, Iizuka Hospital, Iizuka, Japan.;Department of Pathology, School of Medicine, Kurume University, Kurume, Japan.;Department of Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.;Department of Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.;Department of Pathology, School of Medicine, Kurume University, Kurume, Japan.;Department of Hematology, Iizuka Hospital, Iizuka, Japan.",
"authors": "Kiyasu|Junichi|J|;Arakawa|Fumiko|F|;Haji|Shojiro|S|;Tachikawa|Yoshimichi|Y|;Tsuda|Mariko|M|;Tsukamoto|Yasuhiro|Y|;Ikeda|Motohiko|M|;Muta|Hiroki|H|;Matsushima|Takamitsu|T|;Miyoshi|Hiroaki|H|;Shiratsuchi|Motoaki|M|;Ogawa|Yoshihiro|Y|;Ohshima|Kouichi|K|;Yufu|Yuji|Y|",
"chemical_list": null,
"country": "Australia",
"delete": false,
"doi": "10.1111/pin.12703",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1320-5463",
"issue": null,
"journal": "Pathology international",
"keywords": "arthritis; heavy chain disease; lymphoproliferative disorders; methotrexate; rheumatoid",
"medline_ta": "Pathol Int",
"mesh_terms": null,
"nlm_unique_id": "9431380",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "29987858",
"pubdate": "2018-07-10",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Methotrexate-associated lymphoproliferative disorders with angioimmunoblastic T-cell lymphoma-like features accompanied by gamma-heavy chain disease in a patient with rheumatoid arthritis.",
"title_normalized": "methotrexate associated lymphoproliferative disorders with angioimmunoblastic t cell lymphoma like features accompanied by gamma heavy chain disease in a patient with rheumatoid arthritis"
} | [
{
"companynumb": "JP-SUN PHARMACEUTICAL INDUSTRIES LTD-2018R1-183551",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"dr... |
{
"abstract": "Cardiac tamponade is a serious complication of catheter ablation for atrial fibrillation (AF). However, the outcomes of catheter ablation in patients of cardiac tamponade are unknown.\nWe performed catheter ablation in 2467 sessions of AF or a recurrence of AF between January 2007 and January 2016. Of these, 29 events in 27 patients (1.18%: 22 men; 64.5 ± 10.4 years; 17 with paroxysmal AF) of cardiac tamponade during or after the procedure were recorded. The clinical characteristics and outcomes of these 29 events were studied in detail.\nOf the 19 events where the ablation procedure was completed, seven events developed acute recurrence of AF (36.8%). Of the 10 events with an incomplete procedure, 10 exhibited AF recurrence (100.0%). Direct oral anticoagulants were used in seven events, and clinical outcomes were not significantly different compared to the remaining 21 events that were prescribed warfarin. Pericarditis occurred in 10 events (34.5%) after the procedure, and the incidence rate was lower in patients receiving prophylactic nonsteroidal anti-inflammatory drugs or steroids (2/15, 13.3% vs 8/14, 57.1%; P = 0.013). Repeated sessions were performed in 12 events (two with a complete initial procedure, 10 with an incomplete initial procedure). Freedom from atrial arrhythmias was observed in 27 events (93.1%, 9 with antiarrhythmic drugs) over midterm follow-up (3.1 ± 2.6 years).\nAlthough cardiac tamponade caused by catheter ablation led to a high rate of acute AF recurrence and pericarditis, the midterm recurrence rates of AF are unaffected if the procedure can be completed.",
"affiliations": "Cardiovascular Division Faculty of Medicine University of Tsukuba Tsukuba Japan.;Cardiovascular Division Faculty of Medicine University of Tsukuba Tsukuba Japan.;Cardiovascular Division Faculty of Medicine University of Tsukuba Tsukuba Japan.;Cardiovascular Division Faculty of Medicine University of Tsukuba Tsukuba Japan.;Cardiovascular Division Faculty of Medicine University of Tsukuba Tsukuba Japan.;Cardiovascular Division Faculty of Medicine University of Tsukuba Tsukuba Japan.;Cardiovascular Division Faculty of Medicine University of Tsukuba Tsukuba Japan.;Cardiovascular Division Faculty of Medicine University of Tsukuba Tsukuba Japan.;Cardiovascular Division Faculty of Medicine University of Tsukuba Tsukuba Japan.",
"authors": "Yui|Yoshiaki|Y|;Sekiguchi|Yukio|Y|0000-0003-3649-4025;Nogami|Akihiko|A|;Yamasaki|Hiro|H|;Machino|Takeshi|T|;Kuroki|Kenji|K|;Igarashi|Miyako|M|;Aonuma|Kazutaka|K|;Ieda|Masaki|M|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": "10.1002/joa3.12127",
"fulltext": "\n==== Front\nJ ArrhythmJ Arrhythm10.1002/(ISSN)1883-2148JOA3Journal of Arrhythmia1880-42761883-2148John Wiley and Sons Inc. Hoboken 10.1002/joa3.12127JOA312127Original ArticleOriginal ArticlesMidterm outcomes of catheter ablation for atrial fibrillation in patients with cardiac tamponade YUI et al.Yui Yoshiaki MD\n1\nSekiguchi Yukio MD, PhDhttp://orcid.org/0000-0003-3649-4025yseki@md.tsukuba.ac.jp \n1\nNogami Akihiko MD, PhD\n1\nYamasaki Hiro MD, PhD\n1\nMachino Takeshi MD, PhD\n1\nKuroki Kenji MD, PhD\n1\nIgarashi Miyako MD, PhD\n1\nAonuma Kazutaka MD, PhD\n1\nIeda Masaki MD, PhD\n1\n\n1 \nCardiovascular Division\nFaculty of Medicine\nUniversity of Tsukuba\nTsukuba\nJapan\n* Correspondence\n\nYukio Sekiguchi, Cardiovascular Division, Faculty of Medicine, University of Tsukuba, Tsukuba, Japan.\n\nEmail: yseki@md.tsukuba.ac.jp\n24 10 2018 2 2019 35 1 10.1002/joa3.2019.35.issue-1109 120 21 7 2018 28 8 2018 © 2018 The Authors. Journal of Arrhythmia published by John Wiley & Sons Australia, Ltd on behalf of the Japanese Heart Rhythm Society.This is an open access article under the terms of the http://creativecommons.org/licenses/by-nc/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.Abstract\nBackground\nCardiac tamponade is a serious complication of catheter ablation for atrial fibrillation (AF). However, the outcomes of catheter ablation in patients of cardiac tamponade are unknown.\n\nMethods\nWe performed catheter ablation in 2467 sessions of AF or a recurrence of AF between January 2007 and January 2016. Of these, 29 events in 27 patients (1.18%: 22 men; 64.5 ± 10.4 years; 17 with paroxysmal AF) of cardiac tamponade during or after the procedure were recorded. The clinical characteristics and outcomes of these 29 events were studied in detail.\n\nResults\nOf the 19 events where the ablation procedure was completed, seven events developed acute recurrence of AF (36.8%). Of the 10 events with an incomplete procedure, 10 exhibited AF recurrence (100.0%). Direct oral anticoagulants were used in seven events, and clinical outcomes were not significantly different compared to the remaining 21 events that were prescribed warfarin. Pericarditis occurred in 10 events (34.5%) after the procedure, and the incidence rate was lower in patients receiving prophylactic nonsteroidal anti‐inflammatory drugs or steroids (2/15, 13.3% vs 8/14, 57.1%; P = 0.013). Repeated sessions were performed in 12 events (two with a complete initial procedure, 10 with an incomplete initial procedure). Freedom from atrial arrhythmias was observed in 27 events (93.1%, 9 with antiarrhythmic drugs) over midterm follow‐up (3.1 ± 2.6 years).\n\nConclusion\nAlthough cardiac tamponade caused by catheter ablation led to a high rate of acute AF recurrence and pericarditis, the midterm recurrence rates of AF are unaffected if the procedure can be completed.\n\nanticoagulantsatrial fibrillationcardiac tamponadecatheter ablationpericarditis source-schema-version-number2.0component-idjoa312127cover-dateFebruary 2019details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_NLMPMC version:5.5.8 mode:remove_FC converted:13.02.2019\n\n\nYui \nY \n, \nSekiguchi \nY \n, \nNogami \nA \n, et al. Midterm outcomes of catheter ablation for atrial fibrillation in patients with cardiac tamponade . J Arrhythmia . 2019 ;35 :109 –120 . 10.1002/joa3.12127\n==== Body\n1 INTRODUCTION\nThe effectiveness of catheter ablation therapy for atrial fibrillation (AF) is well‐established. However, for maximum benefit, a reduction in acute procedure‐related complications is essential. In recent years, the number of AF ablation procedures has been increasing worldwide. Correspondingly, the incidence of cardiac tamponade, a serious complication of catheter ablation, is also increasing. However, there is little midterm follow‐up research on patients of cardiac tamponade. In a large study, major complications related to AF ablation occurred in 4.54%‐6% of patients.1, 2 The mortality rate associated with AF ablation was 0.15%,2 and cardiac tamponade was the most frequent cause of procedure‐related death.3, 4 The incidence rate of cardiac tamponade is approximately 1%‐1.31% but subsequent patient outcomes are not clear.1, 2, 5 Further, the use of direct oral anticoagulants (DOAC) has recently increased all over the world.6 The association between this change in anticoagulant therapy and cardiac tamponade is still unclear. In addition, although pericarditis sometimes occurs alongside cardiac tamponade, the relationship between them remains poorly understood. Distinctive cases of delayed cardiac tamponade after AF ablation have also been reported,7, 8, 9 with rupture of an epicardial hematoma or pericarditis as the postulated causes. The aim of this study was to clarify the clinical characteristics and midterm outcomes of patients with cardiac tamponade.\n\n2 METHODS\n2.1 Study participants\nA total of 2467 sessions in which patients with AF and atrial tachycardia (AT) related to AF ablation, treated with catheter ablation between January 2007 and January 2016, were retrospectively enrolled in this study. All arrhythmias were resistant to at least one antiarrhythmic drug. Of these patients, 29 events (22 males; age, 64.5 ± 10.4 year‐old; paroxysmal AF [PAF], 17; Table 1) exhibited cardiac tamponade during or after the procedure (29 events, 1.18% of total cohort). PAF was defined as AF lasting 7 or fewer days, and persistent atrial fibrillation (PerAF) as AF lasting >7 days. Long‐standing persistent atrial fibrillation (LSPerAF) was defined as AF persisting for >1 year. The recurrence blanking period was set at 3 months. The clinical characteristics of the 29 events, procedure‐related data, acute outcomes, and midterm outcomes were examined in detail. Ethical approval was granted by the institutional review board at Tsukuba University Hospital.\n\nTable 1 Clinical characteristics of 29 cardiac tamponade events\n\nEvent no\tPatient no\tAge (years)\tSex\tBMI (kg/m2)\tAF type\tLAD (mm)\tLV‐EF (%)\tDisease\tAnticoagulant drug\tAntiplatelet drug\tOnset situation\tPericardiocentesis\tDrainage blood type\tDrainage blood (mL)\t\n1\t1\t63\tM\t24.7\tPAF\t37\t72\t—\tWarfarin\t—\tLeft atrium\tDone\tVenous\t300\t\n2\t2\t73\tM\t21.4\tPAF\t41\t75\t—\tWarfarin\t—\tLeft atrium\tDone\tArterial\t160\t\n3\t3\t63\tM\t23.5\tPAF\t33\t60\t—\tWarfarin\t—\tLeft atrium\tDone\tArterial\t175\t\n4\t4\t74\tF\t20.5\tPAF\t39\t72\t—\tWarfarin\t—\tWard\tDone\tVenous\t160\t\n5\t5\t64\tM\t23.6\tPerAF\t41\t69\t—\tWarfarin\tAspirin\tLeft atrium\tDone\tVenous\t360\t\n6\t6\t62\tM\t25.9\tPAF\t42\t68\t—\tWarfarin\t—\tTrans septum\tNot performed\t—\t—\t\n7\t7\t75\tF\t22.5\tPAF\t40\t68\t—\tDabigatran\t—\tLeft atrium\tNot performed\t—\t—\t\n8\t8\t64\tM\t27.7\tPAF\t43\t72\t—\tWarfarin\t—\tLeft atrium\tNot performed\t—\t—\t\n9\t9\t68\tM\t27.6\tPAF\t34\t62\t—\tWarfarin\t—\tLeft atrium\tDone\tVenous\t500\t\n10\t10\t65\tM\t21.9\tLSPerAF\t49\t62\t—\tWarfarin\t—\tLeft atrium\tDone\tArterial\t150\t\n11\t10\t65\tM\t21.9\tLSPerAF\t49\t62\t—\tWarfarin\t—\tLeft atrium\tDone\tArterial\t250\t\n12\t11\t42\tM\t28.0\tPerAF\t36\t53\t—\tWarfarin\t—\tWard\tDone\t—\t—\t\n13\t12\t70\tM\t22.7\tPerAF\t42\t66\tASD post ope\tWarfarin\t—\tTrans septum\tDone\tArterial\t250\t\n14\t13\t59\tM\t16.4\tPerAF\t51\t73\t—\tWarfarin\t—\tLeft atrium\tDone\tVenous\t500\t\n15\t14\t67\tM\t24.4\tPAF\t41\t64\t—\tWarfarin\t—\tLeft atrium\tDone\tArterial\t160\t\n16\t15\t42\tM\t22.7\tPerAF\t43\t69\t—\tWarfarin\t—\tTrans septum\tNot performed\t—\t—\t\n17\t16\t76\tM\t24.0\tPerAF\t44\t68\tAR\tWarfarin\t—\tWard\tDone\tVenous\t200\t\n18\t17\t51\tF\t28.5\tPAF\t34\t66\t—\tWarfarin\t—\tWard\tNot performed\t—\t—\t\n19\t18\t49\tF\t26.9\tPerAF\t38\t71\tFunnel chest\tWarfarin\t—\tLeft atrium\tDone\tArterial\t1000\t\n20\t19\t65\tM\t24.5\tPerAF\t45\t63\t—\tWarfarin\t—\tAfter discharge\tDone\tVenous\t600\t\n21\t20\t61\tF\t30.2\tPAF\t39\t75\t—\tDabigatran\t—\tLeft atrium\tDone\tVenous\t100\t\n22\t21\t60\tM\t21.2\tPAF\t39\t72\tHOCM\tDabigatran\t—\tLeft atrium\tDone\tVenous\t350\t\n23\t22\t64\tM\t26.7\tLSPerAF\t49\t72\t—\tWarfarin\t—\tPost procedure\tNot performed\t—\t—\t\n24\t23\t73\tF\t19.1\tPAF\t37\t60\tHOCM\tApixaban\t—\tLeft atrium\tDone\tVenous\t250\t\n25\t24\t80\tF\t22.0\tPAF\t39\t68\t—\tNot use\t—\tLeft atrium\tDone\tNot mentioned\t1300\t\n26\t25\t70\tM\t28.8\tPAF\t48\t70\t—\tWarfarin\t—\tLeft atrium\tNot performed\t—\t—\t\n27\t26\t66\tM\t27.3\tLSPerAF\t42\t69\t—\tRivaroxaban\t—\tLeft atrium\tDone\tVenous\t300\t\n28\t27\t76\tM\t23.0\tPAF\t48\t77\tVSA\tRivaroxaban\tClopidogrel\tLeft atrium\tDone\tVenous\t1200\t\n29\t27\t76\tM\t23.0\tPAF\t48\t77\tVSA\tRivaroxaban\tClopidogrel\tAfter discharge\tDone\tNot mentioned\t300\t\nAF, atrial fibrillation; AR, aortic regurgitation; ASD post ope, atrial septal defect postsurgical operation; BMI, body mass index; Complete, procedure could be completely ended; F, female; HOCM, hypertrophic obstructive cardiomyopathy; M, male; LAD, left atrial diameter; LSPerAF, long‐standing persistent AF; LV‐EF, left ventricular‐ejection fraction; Not use, anticoagulant drug was not used before procedure; Onset, the time that cardiac tamponade occurred; PAF, paroxysmal AF; PerAF, persistent AF; VSA, vasospastic angina.\n\nJohn Wiley & Sons, Ltd2.2 Ablation procedure and anticoagulation\nAntiarrhythmic drugs were discontinued for at least five half‐lives before the procedure, with the exception of amiodarone. Atrial thrombi were checked by transesophageal echocardiography on the day of (or the day before) the procedure. Surface electrocardiography (ECG) and intracardiac electrograms were continuously displayed and stored on a computer‐based digital recording system using filter settings of 30‐500 Hz during the procedure (CardioLab System; Prucka Engineering, Houston, TX, USA). In conventional radiofrequency catheter ablation (RFCA) cases, through a single transseptal puncture, a 3.5 mm open‐irrigated deflectable catheter (ThermoCool; Biosense Webster, Diamond Bar, CA, USA) was used for mapping and ablation. The force‐sensing ablation catheter (Smarttouch; Biosense Webster) was used if it was possible in terms of insurance‐related concerns. Radiofrequency (RF) energy was delivered at a power of 20‐35 W, maximum irrigation rate of 30 mL/min, and maximum temperature of 42°C. The ipsilateral pulmonary vein (PV) was circumferentially ablated under 3D mapping system guidance (CARTO; Biosense Webster; or Ensite Navix; St Jude Medical, St. Paul, MN, USA). In cryoballoon cases, a steerable 15 F sheath (Flexcath®; Medtronic Inc., Minneapolis, MN, USA) was used and flushed continuously with heparinized saline. A mapping catheter (Achieve®; Medtronic Inc.) was advanced into each PV, and PV antrum occlusion was considered. Following angiography, a single 3 min application was performed using a second‐generation cryoballoon (28 mm Advance balloon; Medtronic Inc) in each targeted PV. In some cases of PerAF and LSPerAF, a left atrial roof line, superior vena cave isolation, and complex fractionated atrial electrogram ablation were added at the discretion of the operator. If AT occurred after intravenous injection of isoproterenol and/or programmed atrial stimulation and incremental burst pacing from the catheter at the top of the right atrium, it was treated accordingly.\n\nAnticoagulant therapy was prescribed before catheter ablation. The attending physician selected the appropriate anticoagulant drug depending on age and renal function. Anticoagulant drugs were chosen among warfarin or factor Xa inhibitors (apixaban, edoxaban, rivaroxaban) or direct oral thrombin inhibitors (dabigatran etexilate). In the case of warfarin, the target prothrombin time‐international normalized ratio (PT‐INR) was set to 2.0‐3.0 in patients younger than 70 years and 1.6‐2.6 in those older than 70 years.10 All patients underwent catheter ablation without interruption of warfarin or DOAC. Immediately following the transseptal puncture, 5000 units of intravenous heparin were given and heparinized saline was administered via sustained injection to maintain the activated clotting time at 300‐400 s. Atrial blood pressure was monitored continuously from the 4 Fr sheath positioned within the right femoral artery.\n\n2.3 Definition of arrhythmia, cardiac tamponade, and pericarditis\nAtrial arrhythmias were defined as supraventricular arrhythmias related to AF ablation, such as focal or macro‐reentrant tachycardia at the left atrium. Common atrial flutter in the right atrium was excluded from this definition in this study. AF or AT related to prior AF ablation was assumed to be sustained for more than 2 h. Cardiac tamponade was defined as an increase in pericardial effusion of >5 mm, a sign of collapse in the atrium or ventricle, and a decrease in systolic blood pressure to <80 mm Hg. Pericarditis was defined by both an increase in pericardial effusion of >5 mm at onset of cardiac tamponade and ST elevation >2 mm on >6 leads.\n\n2.4 Diagnosis and management of cardiac tamponade\nIf cardiac tamponade was suspected due to a decrease in blood pressure or unexpected catheter manipulation, the motion of the cardiac silhouette was checked in the left anterior oblique view. Pericardial effusion was confirmed by transthoracic or intracardiac echocardiography. When cardiac tamponade was confirmed, pericardiocentesis was performed under the guidance of fluoroscopy and ultrasonography from the left sternal, apical, or subxiphoid positions. Seven events immediately recovered from hypotensive episodes after transvenous injection of noradrenalin and extracellular fluid; therefore, observational therapy was selected. A pigtail catheter was introduced into the pericardial space and the pericardial fluid was drained. The drained blood was subjected to blood gas analysis to determine the presence of atrial or venous blood. The pericardial fluid was manually drained and connected to a closed drainage system. Heparin and warfarin were neutralized using protamine sulfate and vitamin K. The dabigatran neutralizer was not used in this study and the other DOAC do not have neutralizers, while all patients treated with warfarin received a vitamin K neutralizer. The patients were managed in the intensive care unit while the drainage catheter was within the pericardial space. After pericardial fluid flow stopped, the drainage catheter was removed and oral anticoagulant therapy was resumed.\n\n2.5 Definition of acute outcome, midterm outcome, AF/AT control, and follow‐up\n“Acute recurrence” was defined as AF/AT recurrence during the hospital stay for catheter ablation. “Midterm recurrence” was defined as AF/AT recurrence while the patient was being followed in the outpatient clinic or after any required repeat procedures. After discharge, patients were followed at 2 weeks, 1, 3, 6 months, and every 6 months thereafter at an outpatient clinic. Recurrences were investigated according to subjective symptoms, 12‐lead ECG, Holter ECG (DSC‐3300; Nihon Kohden, Tokyo, Japan), and an event recorder (HCG‐901; Omron, Kyoto, Japan). Antiarrhythmic drugs were discontinued after catheter ablation at the discretion of the attending physician with input from the patient. “AF/AT control” was defined as the maintenance of sinus rhythm with or without antiarrhythmic drugs.\n\n2.6 Statistical analyses\nContinuous variables are presented as means ± 1 standard deviation, and skewed variables are expressed as medians with interquartile ranges. Student's t test or the Mann‐Whitney U tests were performed for two‐group comparisons of continuous variables, as per the normality of the data distribution. The chi‐squared or Fisher's exact test was used for two‐group comparisons of categorical variables. Differences were reported as significant if P < 0.05. All statistical analyses were performed using SPSS (version 16.0; SPSS Inc., Chicago, IL, USA).\n\n3 RESULTS\n3.1 Patients’ characteristics\nThis study included 27 patients (29 events; 64.5 ± 10.4 years; 22 men; body mass index, 24.2 ± 3.2 kg/m2; Table 1) with cardiac tamponade related to AF ablation. The mean left atrial diameter was 41.6 ± 5.0 mm and the mean left ventricular‐ejection fraction was 68.1 ± 5.6%. Oral anticoagulant therapy was being administered for at least 1 month before catheter ablation in 26 patients. Structurally normal hearts were observed in 23 patients while one had undergone patch closure of an atrial septum defect, one was diagnosed with mild to moderate aortic regurgitation on echocardiography, and two exhibited hypertrophic obstructive cardiomyopathy (Table 1).\n\n3.2 Causes of cardiac tamponade\nCardiac tamponade was caused by intracardiac catheter manipulation in 25 events (25/29; 86.2%), atrial septum puncture in three (3/29; 10.3%), and postprocedural inflammation in two (2/29; 6.9%). Regarding the timing of cardiac tamponade occurrence, 23 events (23/29; 79.3%) occurred during ablation in the electrophysiology suite, four (4/29; 13.8%) during the ward stay after the procedure, and two events (2/29; 6.9%) at 10 and 33 days postprocedure. In 19 events (19/29, 65.5%) the ablation procedure was completed, and in 10 (10/29, 34.5%) it could not be completed on the first attempt. There were no instances of cardiac tamponade associated with steam pops.\n\n3.3 Management of cardiac tamponade\nPercutaneous pericardial puncture was performed in 21 events and seven events underwent conservative treatment without puncture. In one event, the puncture could not be performed because of anatomical difficulties (Event 12; Table 2). The average volume of initially drained blood was 408 ± 345 mL (21 events; range, 100‐1300 mL; Table 1) and the drain pigtail catheter was placed for an average of 2.5 ± 1.1 days (20 events; range, 0‐5 days; Table 2). In seven events (36.8%; 7/19), blood gas analysis showed atrial blood and 12 events (63.2%; 12/19) showed venous blood. The hospital stay was 11.6 ± 7.1 days (range, 4‐40 days). No patients died or required surgical repairs and all patients were discharged to their homes.\n\nTable 2 Clinical outcome of 29 cardiac tamponade events\n\nEvent no\tPatient no\tPericardiocentesis\tDrainage (days)\tHospital stay (days)\tComplete procedure\tProcedure\tContact force\tPreventive administration\tPericarditis\tAcute recurrence\tRedo\tMidterm AF/AT control\tAF type\tDrug\t\n1\t1\tDone\t2\t6\tYes\tPVI, SVC\tNo\tYes\tNo\tNo\tNo\tYes\tPAF\t—\t\n2\t2\tDone\t3\t12\tNo\tPVI\tYes\tYes\tNo\tYes\tYes\tYes\tPAF\tPropafenone\t\n3\t3\tDone\t2\t8\tYes\tPVI\tNo\tYes\tNo\tNo\tNo\tYes\tPAF\t—\t\n4\t4\tDone\t2\t13\tYes\tPVI, CTI\tNo\tYes\tNo\tYes\tNo\tYes\tPAF\tPropafenone\t\n5\t5\tDone\t2\t10\tYes\tPVI, roof\tNo\tYes\tNo\tNo\tNo\tYes\tPerAF\tBepridil\t\n6\t6\tNot performed\t—\t7\tNo\tC.T. occurred before PVI\tNo\tYes\tNo\tYes\tYes\tYes\tPAF\t—\t\n7\t7\tNot performed\t—\t10\tYes\tPVI\tYes\tYes\tNo\tNo\tNo\tYes\tPAF\t—\t\n8\t8\tNot performed\t—\t5\tNo\tC.T. occurred before PVI\tNo\tYes\tNo\tYes\tYes\tYes\tPAF\t—\t\n9\t9\tDone\t3\t13\tYes\tPVI, CTI\tNo\tNo\tNo\tNo\tNo\tYes\tPAF\t—\t\n10\t10\tDone\t2\t7\tNo\tPVI\tNo\tNo\tNo\tYes\tYes\tYes\tLSPerAF\tAmiodarone\t\n11\t10\tDone\t3\t4\tYes\tPVI\tNo\tNo\tNo\tNo\tNo\tYes\tLSPerAF\tAmiodarone\t\n12\t11\tDone\t0\t9\tNo\tPVI\tNo\tYes\tNo\tYes\tYes\tYes\tPerAF\t—\t\n13\t12\tDone\t3\t11\tYes\tPVI\tYes\tYes\tNo\tYes\tNo\tNo\tPerAF\tAmiodarone\t\n14\t13\tDone\t2\t40\tNo\tC.T. occurred before PVI\tNo\tNo\tNo\tYes\tYes\tNo\tPerAF\tAmiodarone\t\n15\t14\tDone\t2\t12\tNo\tC.T. occurred before PVI\tNo\tNo\tYes\tYes\tYes\tYes\tPAF\t—\t\n16\t15\tNot performed\t—\t15\tNo\tC.T. occurred before PVI\tNo\tNo\tYes\tYes\tYes\tYes\tPerAF\t—\t\n17\t16\tDone\t2\t14\tYes\tPVI, CTI\tNo\tNo\tYes\tYes\tNo\tYes\tPerAF\tAmiodarone\t\n18\t17\tNot performed\t—\t18\tYes\tPVI, SVC, CTI\tNo\tNo\tYes\tYes\tNo\tYes\tPAF\t—\t\n19\t18\tDone\t1\t14\tYes\tPVI\tYes\tNo\tYes\tNo\tNo\tYes\tPerAF\t—\t\n20\t19\tDone\t5\t10\tYes\tPVI, CFAE, roof, CTI\tYes\tNo\tYes\tNo\tNo\tYes\tPerAF\t—\t\n21\t20\tDone\t2\t6\tNo\tPVI, CTI\tYes\tNo\tNo\tYes\tYes\tYes\tPAF\t—\t\n22\t21\tDone\t3\t7\tYes\tPVI, CTI\tYes\tYes\tNo\tYes\tYes\tYes\tPAF\tAmiodarone\t\n23\t22\tNot performed\t—\t4\tYes\tPVI, roof, CTI\tYes\tNo\tNo\tYes\tYes\tYes\tLSPerAF\tAmiodarone\t\n24\t23\tDone\t0\t7\tYes\tCryoballon, CTI\tNo\tYes\tNo\tNo\tNo\tYes\tPAF\t—\t\n25\t24\tDone\t3\t22\tYes\tPVI\tYes\tYes\tYes\tYes\tNo\tYes\tPAF\t—\t\n26\t25\tNot performed\t—\t13\tNo\tC.T. occurred before PVI\tNo\tYes\tYes\tYes\tYes\tYes\tPAF\t—\t\n27\t26\tDone\t2\t6\tYes\tPVI, CTI\tYes\tNo\tYes\tNo\tNo\tYes\tLSPerAF\tAmiodarone\t\n28\t27\tDone\t4\t19\tYes\tCryoballon\tNo\tNo\tYes\tNo\tNo\tYes\tPAF\t—\t\n29\t27\tDone\t4\t14\tYes\tC.T. occurred before PVI\tNo\tYes\tNo\tNo\tNo\tYes\tPAF\t—\t\n\t\nAF, atrial fibrillation; AT, atrial tachycardia; CFAE, complex fractionated atrial electrogram; CTI, cavo tricuspid isthmus line ablation; C.T. occurred before PVI, cardiac tamponade occurred before pulmonary vein isolation; LSPerAF, long‐standing persistent atrial fibrillation; PAF, paroxysmal atrial fibrillation; PerAF, persistent atrial fibrillation; PVI, pulmonary vein isolation; roof, left atrium roof liner ablation; SVC, superior vena cava; Redo,redo AF/AT ablation session.\n\nJohn Wiley & Sons, Ltd3.4 Acute and midterm recurrence\nThe results of the acute and midterm recurrence of catheter ablation in patients with cardiac tamponade are shown in Figure 1. Among the 19 events of cardiac tamponade, in which catheter ablation was completed, seven events developed acute recurrence of AF or AT (7/19, 36.8%; Table 2). Repeat sessions were performed in the 10 events in which the procedure was not completed and in two in which there was AF/AT recurrence over blanking periods of 3 months. Optimal medical therapy was administered in 11 events (37.9%, 11/29; 3 PAF, 4 PerAF, 4 LSPerAF; Table 2) at the discretion of the attending physician in consultation with the patient. By midterm follow‐up (3.1 ± 2.6 years), 27 of 29 events were free from AF or AT (nine with medication). Other major complications such as death, congestive heart failure, or stroke were not observed during the follow‐up period.\n\nFigure 1 The results of the acute and midterm recurrence of catheter ablation in patients with cardiac tamponade. AAD, antiarrhythmic drug; AF, atrial fibrillation; AT, atrial tachycardia; Complete Ablation, procedure was completed; Incomplete Ablation, procedure could not be completed; No recur, AF and AT did not recur; Recur, AF or AT recurred; S.R., sinus rhythm\n\n3.5 Anticoagulant therapy\nAnticoagulant therapy was administered in 28 events (96.6%) before catheter ablation (Table 1). Among them, 21 events received warfarin, and seven events received factor Xa inhibitors (apixaban, edoxaban, rivaroxaban) or direct oral thrombin inhibitors (dabigatran etexilate). There was no significant difference in the clinical characteristics and outcomes between the warfarin and DOAC groups. No significant differences in drained blood volume (warfarin group, 340 ± 240 mL vs DOAC group, 417 ± 393 mL; P = 0.598) and hospital stay (warfarin group, 11.7 ± 7.53 days, vs DOAC group, 9.9 ± 4.95 days; P = 0.560) were observed. Only the rate of venous blood tamponade was significantly higher in the DOAC group [5/5 (100%) vs 7/14 (50.0%); P = 0.047; Table 3]. The acute and midterm recurrence rates of AF were not significantly different (Table 3).\n\nTable 3 Comparison of clinical characteristics between warfarin group and DOAC group\n\nDemographic variables\tAll events n = 28a\n\tWarfarin Group n = 21\tDOAC Group n = 7\t\nP\n\t\nAge (y ± SD)\t64.4 ± 9.30\t62.7 ± 9.44\t69.6 ± 7.10\t0.088\t\nMale, n\t22/28 (78.6%)\t18/21 (85.7%)\t4/7 (57.1%)\t0.111\t\nBMI (kg/m2)\t24.2 ± 3.22\t24.4 ± 3.10\t23.8 ± 3.76\t0.658\t\nPAF, n\t16/28 (57.1%)\t10/21 (47.6%)\t6/7 (85.7%)\t0.078\t\nLAD (mm)\t41.9 ± 5.08\t41.9 ± 5.37\t41.9 ± 4.45\t1.000\t\nLV‐EF (%)\t68.1 ± 5.74\t67.1 ± 5.39\t71.1 ± 6.10\t0.108\t\nOnset situations\t\nEP lab, n\t22/28 (78.6%)\t16/21 (76.2%)\t6/7 (85.7%)\t0.595\t\nWard, n\t4/28 (14.3%)\t4/21 (19.0%)\t0/7 (0.0%)\t0.212\t\nBlood typeb\n\t\nVenous blood, n\t12/19 (63.2%)\t7/14 (50.0%)\t5/5 (100%)\t0.047c\n\t\nAtrial blood, n\t7/19 (36.8%)\t7/14 (50.0%)\t0/5 (0.0%)\t0.047c\n\t\nPericardiocentesis, n\t22/28 (78.6%)\t16/21 (76.2%)\t6/7 (85.7%)\t0.595\t\nHospital stay (days)\t11.2 ± 6.94\t11.7 ± 7.53\t9.9 ± 4.95\t0.560\t\nDrainage blood (mL)\t363 ± 286 (n = 20)\t340 ± 240 (n = 14)\t417 ± 393 (n = 6)\t0.598\t\nComplete procedure, n\t18/28 (64.3%)\t12/21 (57.1%)\t6/7 (85.7%)\t0.172\t\nPreventive administration, n\t14/28 (50.0%)\t10/21 (47.6%)\t4/7 (57.1%)\t0.662\t\nPericarditis, n\t9/28 (32.1%)\t7/21 (33.3%)\t2/7 (28.6%)\t0.815\t\nAcute recurrence, n\t16/28 (57.1%)\t14/21 (66.7%)\t2/7 (28.6%)\t0.078\t\nMidterm recurrence, n\t2/28 (7.1%)\t2/21 (9.5%)\t0/7 (0.0%)\t0.397\t\nPre CRP (mg/dL)\t0.42 ± 1.69\t0.09 ± 0.12\t1.41 ± 3.35\t0.071\t\nMax CRP (mg/dL)\t6.71 ± 6.66\t6.24 ± 6.47\t8.11 ± 7.52\t0.530\t\nAcute recurrence, AF/AT recurrence in acute term; AF, atrial fibrillation; AT, atrial tachycardia; BMI, body mass index; Complete procedure, procedure could be completely ended; DOAC, direct oral anticoagulants; EP, electrophysiological; Hospital stay, the length of hospitalization; LAD, left atrial diameter; LV‐EF, left ventricular‐ejection fraction; Max CRP, the maximum value of serum C‐reactive protein; Midterm AF/AT control; AF/AT control in midterm; PAF, paroxysmal atrial fibrillation; Pre CRP, the preoperative serum C‐reactive protein; Preventive administration, preventive administration for pericarditis; SD, standard deviation.\n\na The number of the patients who took anticoagulant was 28, as one patient did not take it before catheter ablation.\n\nb The number of this event was 19 of 28, as the drainage was not performed in seven, and the drainage blood type could not be evaluated in the remaining two events.\n\nc \nP < 0.05.\n\nJohn Wiley & Sons, Ltd3.6 Pericarditis associated with cardiac tamponade\nAmong all 29 events, 10 (10/29; 34.5%) developed pericarditis. Most cases of pericarditis developed immediately after cardiac tamponade; however, one developed after discharge from the hospital (Table 2; Event 20). Patients with pericarditis exhibited more severe disease statuses than those without (Table 4). The maximum C‐reactive protein values were higher in the cardiac tamponade with pericarditis group than in the cardiac tamponade without pericarditis group (12.32 ± 7.8 vs 3.71 ± 3.0 mg/dL; P = 0.0002). The mean hospitalization was also longer in the pericarditis group (14.3 ± 4.6 vs 10.2 ± 7.8 days; P = 0.0048). In contrast, there was no statistically significant difference in midterm outcome between the two groups (with pericarditis, 0/10 events, 0.0%; without pericarditis group, 2/19 events, 10.5%; P = 0.288). Anti‐inflammatory drugs, such as nonsteroidal anti‐inflammatories (NSAIDs), or steroids were administered at the attending physician's discretion in 15 events to prevent pericarditis (Table 2). The amount of blood drained in the pericarditis group was higher than that in the nonpericarditis group (680 ± 485 mL vs 272 ± 124 mL; P = 0.071). The incidence rate of pericarditis was lower in the group that received prophylactic treatment than in the group that did not (2/15 events, 13.3% vs 8/14 events, 57.1%; P = 0.013; odds ratio, 0.115; 95% confidence intervals, 0.019‐0.717).\n\nTable 4 Comparison of clinical characteristics between pericarditis group and nonpericarditis group\n\nDemographic variables\tAll events n = 29\tPericarditis group n = 10\tNonpericarditis group n = 19\t\nP value\t\nAge (y ± SD)\t64.5 ± 10.4\t64.2 ± 12.8\t65.3 ± 7.8\t0.771\t\nMale, n\t22/29 (75.9%)\t7/10 (70.0%)\t15/19 (78.9%)\t0.593\t\nBMI (kg/m2)\t24.2 ± 3.2\t25.2 ± 2.5\t23.6 ± 3.4\t0.203\t\nPAF, n\t17/29 (58.6%)\t5/10 (50.0%)\t12/19 (63.2%)\t0.494\t\nLAD (mm)\t41.6 ± 5.0\t42.2 ± 4.4\t41.5 ± 5.4\t0.738\t\nLV‐EF (%)\t68.1 ± 5.6\t68.5 ± 3.9\t67.9 ± 6.5\t0.789\t\nAnticoagulant drugs\t\nWarfarin use, n\t21/29 (72.4%)\t7/10 (70.0%)\t14/19 (73.7%)\t0.833\t\nDOAC use, n\t7/29 (24.1%)\t2/10 (20.0%)\t5/19 (26.3%)\t0.766\t\nOnset situations\t\nEP lab, n\t23/29 (79.3%)\t7/10 (70.0%)\t16/19 (84.2%)\t0.369\t\nWard, n\t4/29 (13.8%)\t2/10 (20.0%)\t2/19 (10.5%)\t0.482\t\nBlood typea\n\t\nVenous blood, n\t12/19 (63.2%)\t4/6 (66.7%)\t8/13 (61.5%)\t0.829\t\nAtrial blood, n\t7/19 (36.8%)\t2/6 (33.3%)\t5/13 (38.5%)\t0.829\t\nPericardiocentesis, n\t22/29 (75.9%)\t7/10 (70.0%)\t15/19 (78.9%)\t0.593\t\nHospital stay (days)\t11.6 ± 7.1\t14.3 ± 4.6\t10.2 ± 7.8\t0.0048**\n\t\nDrainage blood (mL)\t408 ± 345 (n = 21)\t680 ± 485 (n = 7)\t272 ± 124 (n = 14)\t0.071\t\nComplete procedure, n\t19/29 (65.5%)\t7/10 (70.0%)\t12/19 (63.2%)\t0.713\t\nPreventive administration, n\t15/29 (51.7%)\t2/10 (20.0%)\t13/19 (68.4%)\t0.013*\n\t\nAcute recurrence, n\t17/29 (58.6%)\t6/10 (60.0%)\t11/19 (57.9%)\t0.913\t\nMidterm recurrence, n\t2/29 (6.9%)\t0/10 (0.0%)\t2/19 (10.5%)\t0.288\t\nPre CRP (mg/dL)\t0.41 ± 1.7\t0.11 ± 0.1\t0.56 ± 2.5\t0.498\t\nMax CRP (mg/dL)\t6.68 ± 6.5\t12.32 ± 7.8\t3.71 ± 3.0\t0.0002**\n\t\nAcute recurrence, AF/AT recurrence in acute term; AF, atrial fibrillation; AT, atrial tachycardia; BMI, body mass index; Complete procedure, procedure could be completely ended; DOAC, direct oral anticoagulants; EP, electrophysiological; Hospital stay, the length of hospitalization; LAD, left atrial diameter; LV‐EF, left ventricular‐ejection fraction; Max CRP, the maximum value of serum C‐reactive protein; Midterm AF/AT control; AF/AT control in midterm; PAF, paroxysmal atrial fibrillation; Pre CRP, the preoperative serum C‐reactive protein; Preventive administration, preventive administration for pericarditis; SD, standard deviation.\n\na The number of this event was 19 of 29, as the drainage was not performed in seven, and the drainage blood type could not be evaluated in the remaining three events.\n\n*P < 0.05; **P < 0.005.\n\nJohn Wiley & Sons, Ltd3.7 Delayed tamponade\nIn this study, only two events developed delayed tamponade (2/2467, 0.081%). In one event, the patient noticed chest discomfort 10 days after catheter ablation. He visited the emergency room after discharge and pericardial effusion was confirmed via echocardiography (Figure 2A). After pericardiocentesis, there was no reaccumulation of effusion. In another event, cardiac tamponade occurred immediately after PV isolation by cryoballoon and pericardiocentesis was performed at once. Pericarditis occurred 2 days after catheter ablation. NSAIDs and colchicine were prescribed, and after resolution of the pericarditis, the patient was discharged. However, 33 days after catheter ablation, he experienced new‐onset dyspnea and presented to the emergency department. We observed increased pericardial fluid and inflow blockage on the echocardiogram, diagnosed him with recurrent cardiac tamponade and performed a repeat pericardiocentesis. The ST elevation on ECG and increased serum C‐reactive protein levels supported the diagnosis of recurrent pericarditis.\n\nFigure 2 A, A case of delayed tamponade (event 20). This figure shows the transthoracic echocardiography (parasternal, long‐axis view) 10 days after catheter ablation. Moderate pericardial effusion (white arrow) was observed as a 12 mm thickness around the heart. B, An electrocardiogram (ECG) of pericarditis (event 16). In this patient, atrial fibrillation (AF) recurred with development of pericarditis\n\n4 DISCUSSION\n4.1 Main findings\nTo the best of our knowledge, this study describes the longest follow‐up period for patients with cardiac tamponade associated with ablation for AF. In addition, only a few reports have described pericarditis in patients with cardiac tamponade and the relationship between DOAC and cardiac tamponade. Among the patients with cardiac tamponade in our study, seven events (24.1%) were prescribed DOAC. The acute and midterm recurrence rate were not significantly different in the DOAC and warfarin groups. Pericarditis occurred in 10 events (34.5%) and 17 (58.6%) had an AF/AT recurrence during their respective hospital stays (An example of AF recurrence with pericarditis is shown in Figure 2B). None of the patients required surgical treatment. During midterm follow‐up (3.1 ± 2.6 years), 27 events were free from AF or AT (27/29; 93.1%, nine events with antiarrhythmic medication).\n\n4.2 Acute and midterm outcome in cardiac tamponade cases\nWhile previous studies have reported frequency of cardiac tamponade, midterm outcomes are lacking. In this study, the overall acute AF/AT recurrence rate was 58.6% (17/29). In 19 events that underwent complete ablation, the acute AF/AT rate was 36.8% (7/19). Conversely, patients in the incomplete ablation group had a higher AF/AT recurrence rate (100.0%). The results suggest that complete ablation can help reduce the acute recurrence rate. In addition, 2 of the 19 events in the complete ablation group and all 10 in the incomplete group required redo sessions after blanking periods of 3 months and most events maintained sinus rhythm at midterm follow‐up (27/29, 93.1%, with antiarrhythmic medication). This shows that even if tamponade occurs, proper diagnosis and treatment could prevent serious complications such as death or other unrecoverable states. If the patient survives the acute perioperative period and the repeat procedures are performed properly, sinus rhythm maintenance could be expected, similarly to normal patients. This result was similar with a previous study by Bunch et al11 (Table 5), which reported a high rate of sinus rhythm maintenance in midterm (7/9, 77.8%, 1 patient with antiarrhythmic drug, 1.5 ± 1.1 years follow‐up). However, it bears mentioning that these favorable results were achieved at a high volume center with expert electrophysiologists.\n\nTable 5 Comparison with previous literature on cardiac tamponade\n\n \tOur study 2018\tLatchamsetty et al13 2011\tBunch et al11 2005\t\nn = 29\tn = 40\tn = 15\t\nIncidence of cardiac tamponade\t29/2467 (1.18%)\tNot mentioned\t15/617 (2.4%)\t\nAge (years)\t64.5 ± 10.4\t61.1 ± 7.8\t54 ± 13\t\nMale\t22/29 (75.9%)\t20/40 (50.0%)\t10/15 (66.2%)\t\nPAF\t17/29 (58.6%)\t28/40 (70.0%)\t11/15 (73.3%)\t\nTamponade by atrial blood\t7/19a (36.8%)\tNot mentioned\t9/15 (60.0%)\t\nPericarditis\t10/29 (34.5%)\tNot mentioned\t8/15 (53.3%)\t\nHospital stay (days)\t11.6 ± 7.1\tNot mentioned\t6.8 ± 4.8\t\nSurgical operation\t0/29 (0.0%)\t0/40 (0.0%)\t0/15 (0.0%)\t\nDeath\t0/29 (0.0%)\t0/40 (0.0%)\t0/15 (0.0%)\t\nAnticoagulant drug\t\nWarfarin use\t21/29 (72.4%)\t40/40 (100.0%)\tNot mentioned\t\nDOAC use\t7/29 (24.1%)\t0/40 (0.0%)\tNot mentioned\t\nAblation procedure\t\nRFCA\t20/22b (91.0%)\t40/40 (100.0%)\t15/15 (100.0%)\t\nBalloon ablation\t2/22 (9.1%)\t0/40 (0.0%)\t0/15 (0.0%)\t\nAcute recurrence in hospital\t17/29 (58.6%)\t20/40 (50.0%)\t10/15 (66.7%)\t\nSinus rhythm maintenance in midterm F/U\t27/29 (93.1%) (9 events with AAD; 3.1 ± 2.6 years F/U)\tNot mentioned\t7/9 (77.8%) (1 patient with AAD; 1.5 ± 1.1 years F/U)\t\nAAD, antiarrhythmic drugs; DOAC, direct oral anticoagulants; F/U, follow‐up; Not mentioned, the variable was not mentioned in the study; PAF, paroxysmal atrial fibrillation; RFCA, radiofrequency catheter ablation; Sinus rhythm maintenance in midterm F/U, Sinus rhythm maintenance rate of patients with complete procedure in midterm follow‐up.\n\na The number of this event was 19 of 29, as the drainage was not performed in seven, and the drainage blood type could not be evaluated in the remaining three events.\n\nb The number of ablation procedure was 22, as cardiac tamponade occurred before ablation procedure in seven events.\n\nJohn Wiley & Sons, Ltd4.3 Causes of cardiac tamponade\nA previous paper had reported that steam pops can cause cardiac tamponade during ablation of ventricular arrhythmias, and that surgical repair was often needed.12 Although cardiac tamponade attributable to steam pop was also reported during AF ablation,4 no such incidents occurred in this study. This may be due to the magnitude of energy applied, which is limited to 35 W at our institution. Atrial bleeding could be caused by injury to the left atrial appendage, left atrial roof, or PVs. In contrast, venous bleeding occurs secondary to damage the right atrium, right ventricle, or coronary sinus. This indicates the importance of catheter manipulation in the right side of the heart as well as the left side during AF ablation in patients on anticoagulation.\n\n4.4 Anticoagulant therapy\nThe standard procedures for catheter ablation are changing and the number of patients requiring AF ablation continues to increase worldwide. It is common to perform AF ablation while continuing anticoagulant therapy. As long as the PT‐INR is maintained within the appropriate range, bleeding complications are rare, even with warfarin treatment.12 All our patients underwent catheter ablation while on anticoagulant therapy. This study is the first report to describe pericarditis and cardiac tamponade related to AF ablation in patients receiving anticoagulant therapy, including DOAC. Similar to past reports of warfarin use in11, 13 cardiac tamponade, DOAC may be fully manageable if proper supports are given.\n\n4.5 Pericarditis with cardiac tamponade\nA case of pericarditis complicated with cardiac tamponade was previously reported by Bunch et al11 in a study where 8 of 15 patients (53.3%) developed pericarditis (Table 5). In our study, 10 events (10/29, 34.5%) developed pericarditis after cardiac tamponade (Table 4). The events with pericarditis required longer hospital stays (14.3 ± 4.6 days). Subsequent pericarditis was less frequent in the group that received prophylactic treatment than in the group that did not (2/15, 13.3% vs 8/14, 57.1%; P = 0.013). The cause of pericarditis after cardiac tamponade is still unclear. The maximum value of serum C‐reactive protein was higher in the pericarditis group (12.32 ± 7.8 vs in nonpericarditis Group, 3.71 ± 3.0, P = 0.0002; Table 4), presumably caused by the pericarditis itself. Although there was no significant difference in the drainage volume between the two groups (680 ± 485 mL in pericarditis group vs 272 ± 124 mL in nonpericarditis group; P = 0.071), pericarditis tended to occurs when the volume exceeded 600 mL. In such circumstances, the administration of anti‐inflammatory drugs should be considered to prevent pericarditis.\n\n4.6 Delayed tamponade\nSimilarly to “Dressler syndrome” and “postcardiac injury syndrome,” late‐onset pericarditis after catheter ablation has been reported.14, 15, 16 The onset of these conditions can vary from within a few days to a few weeks after procedure. Although the pathogenesis is unclear, inflammation of the ablation region or rupture of a hematoma on the pericardial side are possible causes of this rarecomplication.7 In this study, only two events developed delayed tamponade (2/2467, 0.081%). Both patients had been checked for excess pericardial fluid before discharge; therefore, we suspect that the pericardial effusion increased during the postdischarge subacute phase. Even at several weeks after the procedure, it is necessary to pay attention to changes in the patient's physical condition as there is a possibility, albeit low, that delayed tamponade will occur.\n\n4.7 Limitations\nThe study has some limitations. First, we retrospectively examined a small (29) number of events from a single center. Second, the AF/AT recurrences were diagnosed based on the patient's symptoms and regular follow‐up 12‐lead ECGs, 24‐h Holter monitoring, or event recordings. Recurrence after ablation can be asymptomatic and we, therefore, may have missed some cases. Third, we used the contact force system in only 10 events because of insurance‐related concerns. The use of a contact force system may affect the occurrence of cardiac tamponade as its incidence may be decreased if excessive contact is avoided. Finally, the rate of occurrence of cardiac tamponade depends on the experience of both the operator and the institute. Thus, in a different setting, the results may differ.\n\n5 CONCLUSION\nCardiac tamponade is a serious complication of the catheter ablation procedure for AF, and acute AT/AF recurrence and pericarditis are quite common. If the ablation procedure can be completed before the occurrence of cardiac tamponade, or a repeat ablation procedure scheduled later, the midterm outcomes of AF ablation may be unaffected.\n\nCONFLICT OF INTEREST\nDr. Nogami, Dr. Aonuma, and Dr. Sekiguchi belong to the endowed department of Medtronic, Toray Industries, and Abbott, respectively. The other authors report no conflicts.\n==== Refs\nREFERENCES\n1 \n\nCappato \nR \n, \nCalkins \nH \n, \nChen \nSA \n, et al. Worldwide survey on the methods, efficacy, and safety of catheter ablation for human atrial fibrillation . Circulation . 2005 ;111 :1100 –5 .15723973 \n2 \n\nCappato \nR \n, \nCalkins \nH \n, \nChen \nSA \n, et al. Updated worldwide survey on the methods, efficacy, and safety of catheter ablation for human atrial fibrillation . Circ Arrhythm Electrophysiol . 2010 ;3 :32 –8 .19995881 \n3 \n\nCappato \nR \n, \nCalkins \nH \n, \nChen \nSA \n, et al. Prevalence and causes of fatal outcome in catheter ablation of atrial fibrillation . J Am Coll Cardiol . 2009 ;53 :1798 –803 .19422987 \n4 \n\nHsu \nLF \n, \nJaïs \nP \n, \nHocini \nM \n, et al. Incidence and prevention of cardiac tamponade complicating ablation for atrial fibrillation . Pacing Clin Electrophysiol . 2005 ;28 :106 –9 .\n5 \n\nFagundes \nRL \n, \nMantica \nM \n, \nDe Luca \nL \n, et al. Safety of single transseptal puncture for ablation of atrial fibrillation: Retrospective study from a large cohort of patients . J Cardiovasc Electrophysiol . 2007 ;18 :1277 –81 .17883403 \n6 \n\nSticherling \nC \n, \nMarin \nF \n, \nBirnie \nD \n, et al. Antithrombotic management in patients undergoing electrophysiological procedures: a European Heart Rhythm Association (EHRA) position document endorsed by the ESC Working Group Thrombosis, Heart Rhythm Society (HRS), and Asia Pacific Heart Rhythm Society (APHRS) . Europace . 2015 ;8 :1197 –214 .\n7 \n\nLambert \nT \n, \nSteinwender \nC \n, \nLeisch \nF \n, \nHofmann \nR \n. Cardiac tamponade following pericarditis 18 days after catheter ablation of atrial fibrillation . Clin Res Cardiol . 2010 ;99 :595 –7 .20454967 \n8 \n\nCappato \nR \n, \nCalkins \nH \n, \nChen \nSA \n, et al. Delayed cardiac tamponade after radiofrequency catheter ablation of atrial fibrillation: a worldwide report . J Am Coll Cardiol . 2011 ;58 :2696 –7 .22152959 \n9 \n\nKitamura \nT \n, \nFukamizu \nS \n, \nSakurada \nH \n, \nHiraoka \nM \n. Development of delayed cardiac tamponade 55 days after catheter ablation for atrial fibrillation with a new oral anticoagulant . J Interv Card Electrophysiol . 2014 ;41 :135 .25008254 \n10 \nGuidelines for indication and procedural techniques of catheter ablation (JCS: Japanese Circulation Society 2012) (in Japanese) . http://www.j-circ.or.jp/guideline/pdf/JCS2012_okumura_d.pdf.\n11 \n\nBunch \nTJ \n, \nAsirvatham \nSJ \n, \nFriedman \nPA \n, et al. Outcomes after cardiac perforation during radiofrequency ablation of the atrium . J Cardiovasc Electrophysiol . 2005 ;16 :1172 –9 .16302900 \n12 \n\nTokuda \nM \n, \nKojodjojo \nP \n, \nEpstein \nLM \n, et al. Outcomes of cardiac perforation complicating catheter ablation of ventricular arrhythmias . Circ Arrhythm Electrophysiol . 2011 ;4 :660 –6 .21753037 \n13 \n\nLatchamsetty \nR \n, \nGautam \nS \n, \nBhakta \nD \n, et al. Management and outcomes of cardiac tamponade during atrial fibrillation ablation in the presence of therapeutic anticoagulation with warfarin . Heart Rhythm . 2011 ;8 :805 –8 .21236362 \n14 \n\nRovang \nKS \n, \nHee \nTT \n, \nPagano \nTV \n, \nMohiuddin \nS \n. Dressler's syndrome complicating radiofrequency ablation of an accessory atrioventricular pathway . Pacing Clin Electrophysiol . 1993 ;16 :251 –3 .7680450 \n15 \n\nTuritto \nG \n, \nAbordo \nMG \nJr\n, \nMandawat \nMK \n, \nTogay \nVS \n, \nEl‐Sherif \nN \n. Radiofrequency ablation for cardiac arrhythmias causing post cardiac injury syndrome . Am J Cardiol . 1998 ;1 (81 ):369 –70 .\n16 \n\nLiu \nY \n, \nWang \nC \n, \nZhao \nR \n, et al. Incidence and clinical characteristics of post cardiac injury syndrome complicating cardiac perforation caused by radiofrequency catheter ablation for cardiac arrhythmias . Int J Cardiol . 2013 ;168 :3224 –9 .23642822\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1880-4276",
"issue": "35(1)",
"journal": "Journal of arrhythmia",
"keywords": "anticoagulants; atrial fibrillation; cardiac tamponade; catheter ablation; pericarditis",
"medline_ta": "J Arrhythm",
"mesh_terms": null,
"nlm_unique_id": "101263026",
"other_id": null,
"pages": "109-120",
"pmc": null,
"pmid": "30805051",
"pubdate": "2019-02",
"publication_types": "D016428:Journal Article",
"references": "15683473;15723973;16302900;17883403;19422987;19995881;20454967;21236362;21753037;22152959;23642822;25008254;26105732;7680450;9468089",
"title": "Midterm outcomes of catheter ablation for atrial fibrillation in patients with cardiac tamponade.",
"title_normalized": "midterm outcomes of catheter ablation for atrial fibrillation in patients with cardiac tamponade"
} | [
{
"companynumb": "JP-JNJFOC-20200335597",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HEPARIN SODIUM"
},
"drugadditional": "3",
... |
{
"abstract": "OBJECTIVE\nHepatitis B (HBV) is a common comorbidity among rheumatic patients. The prevalence of HBV infection and the rate of reactivation remain unclear. The literature data suggested a higher risk in chronic than in past infection. Currently, the literature data are mostly focused on anti-TNF and rituximab. This retrospective observational study aimed to analyse the prevalence of HBV infection and the risk of viral reactivation in a population of rheumatic patients undergoing anti-TNF and non-anti-TNF agents.\n\n\nMETHODS\nWe analysed 1216 rheumatic patients, treated with both csDMARDs and bDMARDs between 2006 and 2017. Serologic markers for HBV (HBsAg, anti-HBs, anti-HBc) were performed prior and during biologic treatment. Patients with chronic or resolved infection were monitored every 3 months.\n\n\nRESULTS\nThe prevalence of HBV in our cohort was 15.7% (chronic infection: 0.4%, resolved infection: 12.6%, anti-HBc positivity alone: 2.6%). 12 (6.2%) out of 191 HBV infected patients experienced a reactivation. All of them showed markers of past infection. One patient experienced HBV reactivation despite lamivudine. Only one patient experienced acute hepatitis, probably due to the interruption of immunosuppressors in anticipation of surgery, not preceded by any HBV prophylactic treatment.\n\n\nCONCLUSIONS\nHBV reactivation is a rare event in patients treated with a bDMARD and it can also occur while taking lamivudine, not only in chronic carriers (as per the literature data) but also in inactive ones. Regular screening followed by prompt treatment can prevent symptoms or complications. Due to the risk of hepatitis following the immune reconstitution, an antiviral therapy should be considered in the case of sudden discontinuation of csDMARDs or bDMARD.",
"affiliations": "Rheumatology Unit, Department of General and Specialistic Medicine, Azienda Ospedaliera Universitaria Città della Salute e della Scienza di Torino, and University of Padova, PhD Program in Clinical and Experimental Sciences, Padova, Italy.;Rheumatology Unit, Department of General and Specialistic Medicine, Azienda Ospedaliera Universitaria Città della Salute e della Scienza di Torino, Turin, Italy. simone.parisi@hotmail.it.;Rheumatology Unit, Department of Internal Medicine, San Gerardo Hospital, Monza, Italy.;Rheumatology Unit, Department of Clinical and Experimental Medicine, University of Messina, Azienda Ospedaliera Gaetano Martino, Messina, Italy.;Rheumatology Unit, Department of Internal Medicine, Ospedale di Circolo - Fondazione Macchi, ASST-Settelaghi, Varese, Italy.;Rheumatology Unit, University Hospital ASST-Fatebenefratelli-Sacco, Milan, Italy.;Rheumatology and Clinical Immunology Unit and Department of Clinical and Experimental Sciences, Spedali Civili and University of Brescia, Italy.;Rheumatology Unit, University Hospital ASST-Fatebenefratelli-Sacco, Milan, Italy.;Rheumatology Unit, Department of General and Specialistic Medicine, Azienda Ospedaliera Universitaria Città della Salute e della Scienza di Torino, Turin, Italy.;Rheumatology Unit, Department of General and Specialistic Medicine, Azienda Ospedaliera Universitaria Città della Salute e della Scienza di Torino, Turin, Italy.;Rheumatology Unit, University Hospital ASST-Fatebenefratelli-Sacco, Milan, Italy.",
"authors": "Ditto|Maria Chiara|MC|;Parisi|Simone|S|;Varisco|Valentina|V|;Talotta|Rossella|R|;Batticciotto|Alberto|A|;Antivalle|Marco|M|;Gerardi|Maria Chiara|MC|;Agosti|Michele|M|;Borrelli|Richard|R|;Fusaro|Enrico|E|;Sarzi-Puttini|Piercarlo|P|",
"chemical_list": "D000998:Antiviral Agents; D006510:Hepatitis B Antibodies; D006514:Hepatitis B Surface Antigens; D000079424:Tumor Necrosis Factor Inhibitors",
"country": "Italy",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0392-856X",
"issue": "39(3)",
"journal": "Clinical and experimental rheumatology",
"keywords": null,
"medline_ta": "Clin Exp Rheumatol",
"mesh_terms": "D000998:Antiviral Agents; D001172:Arthritis, Rheumatoid; D001691:Biological Therapy; D006509:Hepatitis B; D006510:Hepatitis B Antibodies; D006514:Hepatitis B Surface Antigens; D006515:Hepatitis B virus; D006801:Humans; D015995:Prevalence; D000079424:Tumor Necrosis Factor Inhibitors; D014775:Virus Activation",
"nlm_unique_id": "8308521",
"other_id": null,
"pages": "546-554",
"pmc": null,
"pmid": "32940216",
"pubdate": "2021",
"publication_types": "D016428:Journal Article; D064888:Observational Study",
"references": null,
"title": "Prevalence of hepatitis B virus infection and risk of reactivation in rheumatic population undergoing biological therapy.",
"title_normalized": "prevalence of hepatitis b virus infection and risk of reactivation in rheumatic population undergoing biological therapy"
} | [
{
"companynumb": "IT-TEVA-2021-IT-1935797",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nPediatric traumatic vascular injuries are rare. Given the paucity of data to guide anti-coagulation (AC) management of these injuries in children, who have a lower overall risk for thrombosis compared to their adult counterparts, we sought to examine and summarize our recent experience.\n\n\nMETHODS\nWe conducted a retrospective review of all patients (<18 years old) who sustained traumatic vascular injuries between 2010-2018 at a Level 1 and Level 2 Pediatric Trauma Center.\n\n\nRESULTS\nNinety-nine patients had traumatic vascular injuries. Eighty-four patients sustained a major arterial injury, 26 had a major venous injury, and 11 had both arterial and venous injuries. The arterial injury cohort had a median age of 13.3 years. Most of the arterial injury patients (65/84, 77%) required vascular repair. In-hospital AC management for the arterial injury patients consisted of a post-operative heparin drip (18%, 15/84), aspirin (39%, 26/84), enoxaparin (23%, 19/84), or none (42%, 43/84). Approximately one-half of the patients with arterial injuries (54%, 45/84) were discharged home on AC therapy, most commonly aspirin. Fifty-six patients (66%) followed up post-injury, of which 25% (14/56) had experienced complications.\n\n\nCONCLUSIONS\nPediatric traumatic arterial injuries that require surgical intervention other than ligation should be considered for discharge AC - most commonly aspirin - in the absence of contraindications. Pediatric patients with vascular injuries to the aorta, carotid artery, inferior vena cava, portal vein, or lower extremities that are managed non-operatively should also be considered for AC. The preferred AC for pediatric venous injuries is enoxaparin, in the absence of contraindications.\n\n\nMETHODS\nTreatment Study LEVEL OF EVIDENCE: IV.",
"affiliations": "Division of Pediatric Surgery, Children's Hospital Colorado, Aurora, CO, USA; Department of Surgery, University of Colorado School of Medicine, Aurora, CO, USA. Electronic address: niti.shahi@childrenscolorado.org.;Division of Pediatric Surgery, Children's Hospital Colorado, Aurora, CO, USA; Department of Surgery, University of Colorado School of Medicine, Aurora, CO, USA.;The Center for Research in Outcomes for Children's Surgery, University of Colorado School of Medicine, Aurora, CO, USA.;Department of Surgery, University of Colorado School of Medicine, Aurora, CO, USA.;Department of Surgery, University of Colorado School of Medicine, Aurora, CO, USA.;Division of Pediatric Surgery, Children's Hospital Colorado, Aurora, CO, USA.;Department of Surgery, University of Colorado School of Medicine, Aurora, CO, USA; Department of Surgery, Denver Health Medical Center, Denver, CO, USA.;Division of Pediatric Surgery, Children's Hospital Colorado, Aurora, CO, USA; Department of Surgery, University of Colorado School of Medicine, Aurora, CO, USA.",
"authors": "Shahi|Niti|N|;Phillips|Ryan|R|;Meier|Maxene|M|;Nehler|Mark|M|;Jacobs|Donald|D|;Recicar|John|J|;Bensard|Denis|D|;Moulton|Steven|S|",
"chemical_list": "D000925:Anticoagulants; D006493:Heparin; D001241:Aspirin",
"country": "United States",
"delete": false,
"doi": "10.1016/j.jpedsurg.2019.10.009",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0022-3468",
"issue": "55(2)",
"journal": "Journal of pediatric surgery",
"keywords": "Anti-coagulation; Antiplatelet therapy; Pediatric trauma; Vascular graft; Vascular injury",
"medline_ta": "J Pediatr Surg",
"mesh_terms": "D000293:Adolescent; D000925:Anticoagulants; D001241:Aspirin; D002648:Child; D006493:Heparin; D006801:Humans; D011182:Postoperative Care; D012189:Retrospective Studies; D057772:Vascular System Injuries",
"nlm_unique_id": "0052631",
"other_id": null,
"pages": "324-330",
"pmc": null,
"pmid": "31732119",
"pubdate": "2020-02",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Anti-coagulation management in pediatric traumatic vascular injuries.",
"title_normalized": "anti coagulation management in pediatric traumatic vascular injuries"
} | [
{
"companynumb": "US-PFIZER INC-2020072818",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "HEPARIN SODIUM"
},
"drugadditional": null,
... |
{
"abstract": "Vemurafenib is a newly licensed target-directed medication. It has been proven to improve the survival of patients with metastatic melanoma and the BRAF(V600E) mutation; however, adverse cutaneous reactions are frequent. Few cases of life-threatening severe cutaneous adverse reactions (SCARs) induced by vemurafenib have been reported. Dabrafenib, another selective BRAF inhibitor, has been licensed recently as an alternative drug with the same indications. From a molecular point of view, both vemurafenib and dabrafenib contain a sulfonamide group; cross-reactivity to sulfonamide compounds has been reported in allergic patients. We report on a patient with vemurafenib-induced toxic epidermal necrolysis (TEN). In vitro analysis of lymphocyte reactivity to vemurafenib showed positive results, confirming drug causality. In addition, lymphocytes from the patient reacted to dabrafenib and to the antibiotic sulfonamide drug sulfamethoxazole. Moreover, lymphocytes from two patients with cutaneous adverse reactions to sulfamethoxazole also reacted to vemurafenib and dabrafenib in vitro. These data strongly suggest that there might be clinical cross-reactivity between BRAF inhibitors and sulfonamides in some patients. Thus, precautions should be taken to avoid sulfonamide drugs as much as possible in patients showing serious hypersensitivity reactions to vemurafenib and vice versa.",
"affiliations": "Institute for Health Research, University Hospital La Paz-IdiPAZ, P° Castellana 261, 28046, Madrid, Spain.;Clinical Pharmacology Unit, Principe de Asturias University Hospital, Madrid, Spain.;Department of Dermatology, University Hospital of Getafe, Madrid, Spain.;Department of Dermatology, University Hospital of Getafe, Madrid, Spain.;Clinical Pharmacology Unit, Principe de Asturias University Hospital, Madrid, Spain.",
"authors": "Bellón|T|T|;Lerma|V|V|;González-Valle|O|O|;González Herrada|C|C|;de Abajo|F J|FJ|",
"chemical_list": "D000970:Antineoplastic Agents; D007093:Imidazoles; D007211:Indoles; D010091:Oximes; D047428:Protein Kinase Inhibitors; D011728:Pyridones; D011744:Pyrimidinones; D013449:Sulfonamides; D000077484:Vemurafenib; C560077:trametinib; D048493:Proto-Oncogene Proteins B-raf; C561627:dabrafenib",
"country": "England",
"delete": false,
"doi": "10.1111/bjd.14201",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0007-0963",
"issue": "174(3)",
"journal": "The British journal of dermatology",
"keywords": null,
"medline_ta": "Br J Dermatol",
"mesh_terms": "D000368:Aged; D000970:Antineoplastic Agents; D004347:Drug Interactions; D004359:Drug Therapy, Combination; D006801:Humans; D007093:Imidazoles; D007211:Indoles; D008297:Male; D008545:Melanoma; D010091:Oximes; D047428:Protein Kinase Inhibitors; D048493:Proto-Oncogene Proteins B-raf; D011728:Pyridones; D011744:Pyrimidinones; D012878:Skin Neoplasms; D013262:Stevens-Johnson Syndrome; D013449:Sulfonamides; D000077484:Vemurafenib",
"nlm_unique_id": "0004041",
"other_id": null,
"pages": "621-4",
"pmc": null,
"pmid": "26412570",
"pubdate": "2016-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Vemurafenib-induced toxic epidermal necrolysis: possible cross-reactivity with other sulfonamide compounds.",
"title_normalized": "vemurafenib induced toxic epidermal necrolysis possible cross reactivity with other sulfonamide compounds"
} | [
{
"companynumb": "ES-ROCHE-1600379",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "VEMURAFENIB"
},
"drugadditional": null,
"dru... |
{
"abstract": "This study (NCT01288573) investigated plerixafor's safety and efficacy in children with cancer. Stage 1 investigated the dosage, pharmacokinetics (PK), pharmacodynamics (PD), and safety of plerixafor + standard mobilization (G-CSF ± chemotherapy). The stage 2 primary endpoint was successful mobilization (doubling of peripheral blood CD34+ cell count in the 24 h prior to first apheresis) in patients treated with plerixafor + standard mobilization vs. standard mobilization alone. In stage 1, three patients per age group (2-<6, 6-<12, and 12-<18 years) were treated at each dose level (160, 240, and 320 µg/kg). Based on PK and PD data, the dose proposed for stage 2 was 240 µg/kg (patients 1-<18 years), in which 45 patients were enrolled (30 plerixafor arm, 15 standard arm). Patient demographics and characteristics were well balanced across treatment arms. More patients in the plerixafor arm (24/30, 80%) met the primary endpoint of successful mobilization than in the standard arm (4/14, 28.6%, p = 0.0019). Adverse events reported as related to study treatment were mild, and no new safety concerns were identified. Plerixafor + standard G-CSF ± chemotherapy mobilization was generally well tolerated and efficacious when used to mobilize CD34+ cells in pediatric cancer patients.",
"affiliations": "Birmingham Women's and Children's Hospital, Birmingham, UK. bruce.morland@nhs.net.;University Hospital Brno and ICRC/St. Anna University Hospital, Masaryk University, Brno, Czech Republic.;IRCCS Giannina Gaslini, Genova, Italy.;Hospital Infantil Universitario Niño Jesus, FIB HIUNJ, CIBERER, Madrid, Spain.;Royal Hospital for Children, Glasgow, UK.;Fondazione IRCCS Istituto Nazionale dei Tumori, Milan, Italy.;Schneider Children's Medical Center of Israel, Tel Aviv University, Petah Tikva, Israel.;Universitätsklinikum Frankfurt am Main, Frankfurt, Germany.;Division of Pediatric Hematology/Oncology, Department of Pediatrics, Inselspital, Bern University Hospital, University of Bern, Bern, Switzerland.;Department for Women's and Children's Health, University of Padua, Padua, Italy.;Hannover Medical School, Hannover, Germany.;University Children's Hospital, Tübingen, Germany.;Erasmus MC-Sophia Children's Hospital, Rotterdam, Netherlands.;Faculty Hospital Motol, Prague, Czech Republic.;United St Istvan and St Laszlo Hospital, Budapest, Hungary.;Sanofi Genzyme, Cambridge, MA, USA.;Sanofi Genzyme, Cambridge, MA, USA.;Sanofi US, Bridgewater, NJ, USA.;IRCCS Bambino Gesù Children's Hospital, Rome, Italy.",
"authors": "Morland|Bruce|B|;Kepak|Tomas|T|;Dallorso|Sandro|S|;Sevilla|Julian|J|;Murphy|Dermot|D|;Luksch|Roberto|R|;Yaniv|Isaac|I|;Bader|Peter|P|;Rößler|Jochen|J|;Bisogno|Gianni|G|http://orcid.org/0000-0003-4462-5523;Maecker-Kolhoff|Britta|B|;Lang|Peter|P|;Zwaan|C Michel|CM|;Sumerauer|David|D|;Kriván|Gergely|G|;Bernard|John|J|;Liu|Qianying|Q|;Doyle|Eileen|E|;Locatelli|Franco|F|",
"chemical_list": "D001596:Benzylamines; D000080027:Cyclams; D006571:Heterocyclic Compounds; C088327:plerixafor",
"country": "England",
"delete": false,
"doi": "10.1038/s41409-020-0836-2",
"fulltext": "\n==== Front\nBone Marrow Transplant\nBone Marrow Transplant\nBone Marrow Transplantation\n0268-3369 1476-5365 Nature Publishing Group UK London \n\n32127657\n836\n10.1038/s41409-020-0836-2\nArticle\nPlerixafor combined with standard regimens for hematopoietic stem cell mobilization in pediatric patients with solid tumors eligible for autologous transplants: two-arm phase I/II study (MOZAIC)\nMorland Bruce bruce.morland@nhs.net 1 Kepak Tomas 2 Dallorso Sandro 3 Sevilla Julian 4 Murphy Dermot 5 Luksch Roberto 6 Yaniv Isaac 78 Bader Peter 9 Rößler Jochen 10 http://orcid.org/0000-0003-4462-5523Bisogno Gianni 11 Maecker-Kolhoff Britta 12 Lang Peter 13 Zwaan C. Michel 1415 Sumerauer David 16 Kriván Gergely 17 Bernard John 1822 Liu Qianying 18 Doyle Eileen 19 Locatelli Franco 2021 1 grid.415246.00000 0004 0399 7272Birmingham Women’s and Children’s Hospital, Birmingham, UK \n2 grid.10267.320000 0001 2194 0956University Hospital Brno and ICRC/St. Anna University Hospital, Masaryk University, Brno, Czech Republic \n3 IRCCS Giannina Gaslini, Genova, Italy \n4 grid.411107.20000 0004 1767 5442Hospital Infantil Universitario Niño Jesus, FIB HIUNJ, CIBERER, Madrid, Spain \n5 grid.415571.30000 0004 4685 794XRoyal Hospital for Children, Glasgow, UK \n6 grid.417893.00000 0001 0807 2568Fondazione IRCCS Istituto Nazionale dei Tumori, Milan, Italy \n7 grid.12136.370000 0004 1937 0546Schneider Children’s Medical Center of Israel, Tel Aviv University, Petah Tikva, Israel \n8 grid.12136.370000 0004 1937 0546Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel \n9 grid.411088.40000 0004 0578 8220Universitätsklinikum Frankfurt am Main, Frankfurt, Germany \n10 grid.5734.50000 0001 0726 5157Division of Pediatric Hematology/Oncology, Department of Pediatrics, Inselspital, Bern University Hospital, University of Bern, Bern, Switzerland \n11 grid.5608.b0000 0004 1757 3470Department for Women’s and Children’s Health, University of Padua, Padua, Italy \n12 grid.10423.340000 0000 9529 9877Hannover Medical School, Hannover, Germany \n13 grid.488549.cUniversity Children’s Hospital, Tübingen, Germany \n14 grid.416135.4Erasmus MC-Sophia Children’s Hospital, Rotterdam, Netherlands \n15 grid.487647.ePrincess Máxima Center, Utrecht, Netherlands \n16 grid.411798.20000 0000 9100 9940Faculty Hospital Motol, Prague, Czech Republic \n17 grid.452768.aUnited St Istvan and St Laszlo Hospital, Budapest, Hungary \n18 Sanofi Genzyme, Cambridge, MA USA \n19 grid.417555.70000 0000 8814 392XSanofi US, Bridgewater, NJ USA \n20 grid.414125.70000 0001 0727 6809IRCCS Bambino Gesù Children’s Hospital, Rome, Italy \n21 grid.7841.aSapienza University of Rome, Rome, Italy \n22 Present Address: Mustang Bio Inc., Worcester, Massachusetts USA \n3 3 2020 \n3 3 2020 \n2020 \n55 9 1744 1753\n14 1 2020 3 2 2020 © The Author(s) 2020Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.This study (NCT01288573) investigated plerixafor’s safety and efficacy in children with cancer. Stage 1 investigated the dosage, pharmacokinetics (PK), pharmacodynamics (PD), and safety of plerixafor + standard mobilization (G-CSF ± chemotherapy). The stage 2 primary endpoint was successful mobilization (doubling of peripheral blood CD34+ cell count in the 24 h prior to first apheresis) in patients treated with plerixafor + standard mobilization vs. standard mobilization alone. In stage 1, three patients per age group (2–<6, 6–<12, and 12–<18 years) were treated at each dose level (160, 240, and 320 µg/kg). Based on PK and PD data, the dose proposed for stage 2 was 240 µg/kg (patients 1–<18 years), in which 45 patients were enrolled (30 plerixafor arm, 15 standard arm). Patient demographics and characteristics were well balanced across treatment arms. More patients in the plerixafor arm (24/30, 80%) met the primary endpoint of successful mobilization than in the standard arm (4/14, 28.6%, p = 0.0019). Adverse events reported as related to study treatment were mild, and no new safety concerns were identified. Plerixafor + standard G-CSF ± chemotherapy mobilization was generally well tolerated and efficacious when used to mobilize CD34+ cells in pediatric cancer patients.\n\nissue-copyright-statement© Springer Nature Limited 2020\n==== Body\nIntroduction\nPlerixafor (Mozobil®, Sanofi, Cambridge, MA, USA) is an antagonist of the 7 transmembrane G protein coupled chemokine (C-X-C motif) receptor 4 (CXCR4) that works by disrupting the interaction of CXCR4 with stromal cell-derived factor-1, resulting in the release of CD34+ stem cells into the circulation [1–4]. In the United States, plerixafor is licensed for use in combination with granulocyte colony stimulating factor (G-CSF) to mobilize hematopoietic stem cells (HSCs) into peripheral blood (PB) for collection and subsequent autologous HSC transplantation (HSCT) in adult patients with non-Hodgkin lymphoma or multiple myeloma (MM). In the European Union, plerixafor is indicated for use in combination with G-CSF to enhance mobilization of HSCs into PB and subsequent autologous HSCT in adults with lymphoma and MM, who are proven to be poor mobilizers.\n\nWhile the efficacy and safety of plerixafor is well established in adults, limited data for its use in children are available. This study investigated the appropriate dosing, safety, and efficacy of plerixafor when given in combination with G-CSF, in pediatric patients with different types of cancer.\n\nMethods\nThis was a phase I–II international, multicenter, randomized, parallel assignment, open-label study of plerixafor in pediatric cancer patients (ClinicalTrials.gov, NCT01288573; EudraCT, 2010-019340-40). The study was conducted in accordance with the Declaration of Helsinki and the International Conference on Harmonization Guidelines for Good Clinical Practice.\n\nIndependent ethics committees or institutional review boards at the participating sites approved the protocol and all amendments. All patients, and/or their legal guardians, provided written informed consent prior to enrollment. The study was conducted in two stages. Stage 1 (3 + 3 design) investigated the appropriate dose, safety, pharmacokinetics (PK) and pharmacodynamics (PD) of plerixafor in pediatric cancer patients when given in addition to standard mobilization (chemotherapy plus daily G-CSF or daily G-CSF alone). Stage 2 was an open-label, comparative study to evaluate the efficacy of plerixafor in addition to standard mobilization regimens of HSCs into PB, and subsequent collection by apheresis in pediatric patients with cancer (Fig. 1).Fig. 1 Stage 2 study design.\na At least 40 patients were to be enrolled into stage 2, which was open to patients with all malignant conditions leading to autologous transplant except leukemia, but with the intention of acquiring a minimum of five patients for each of the following diagnoses: Ewing’s sarcoma/soft tissue sarcoma, lymphoma, neuroblastoma, and brain tumors. b Randomization based on day when trigger point of ≥7 CD34+ cells/μL was reached. c Twenty-four months after the last planned transplant performed within 6 months or after last study apheresis if not transplanted.\n\n\n\nPatients\nPediatric patients with Ewing’s sarcoma/soft tissue sarcoma, neuroblastoma, brain tumors, and other malignancies scheduled to undergo high-dose chemotherapy followed by autologous HSCT were eligible for the study (Table 1). For stage 1, patients were aged between 2 and <18 years, and in stage 2, patients were aged 1–<18 years. Full exclusion criteria are provided in the Supplementary Materials.Table 1 Stage 1 patient baseline characteristics.\n\n\tAge 2–<6 years\n(n = 9)\tAge 6–<12 years\n(n = 9)\tAge 12–<18 years\n(n = 9)\t\nAge [years], mean ± SD\t3.1 ± (1.2)\t8.8 ± 1.7\t15.3 ± 1.1\t\nMale, n (%)\t2 (22)\t7 (78)\t3 (33)\t\nRace, n (%)\t\n White\t8 (89)\t9 (100)\t8 (89)\t\n Asian\t1 (11)\t0\t1(11)\t\nEthnicity, n (%)\t\n Hispanic or Latino\t0\t0\t0\t\n Not Hispanic or Latino\t7 (78)\t9 (100)\t8 (89)\t\n Not reported\t2 (22)\t0\t1 (11)\t\nTumor type, n (%)\t\n Ewing’s sarcoma\t0\t3 (33)\t3 (33)\t\n Hodgkin’s lymphoma\t0\t0\t3 (33)\t\n Medulloblastoma\t0\t0\t0\t\n Neuroblastoma\t7 (78)\t4 (44)\t2 (22)\t\n Non-Hodgkin’s lymphoma\t0\t1 (11)\t0\t\n Rhabdomyosarcoma\t1 (11)\t0\t1 (11)\t\n PNET\t1 (11)\t0\t0\t\n CNS tumor not germinomatous\t0\t1 (11)\t0\t\n\n\nStudy procedures\nIn stages 1 and 2, plerixafor was administered subcutaneously at a separate anatomical site from the patient’s standard mobilization treatment. All participating patients received a standard mobilization regimen (chemotherapy plus daily G-CSF or daily G-CSF alone) as per study site practice guidelines. In stage 1, all patients received plerixafor in addition to the standard mobilization regimen. In stage 2, 45 patients were randomized 2:1 to receive plerixafor plus standard mobilization or standard mobilization alone. In both stage 1 and stage 2, CD34+ cells were obtained from venous blood samples by both local and central laboratories for fluorescence-activated cell sorting (FACS) analysis. CD34+ cell counts were obtained at regular intervals to determine when the trigger point of seven CD34+ cells/µL was reached, at which time plerixafor administration was scheduled for the next day.\n\nIn stage 1, three dose levels of plerixafor (160, 240, and 320 µg/kg) were studied for each of the age groups 2–<6 years, 6–<12 years, and 12–<18 years, respectively, (based on the adult dose of 240 µg/kg). Blood samples were taken to determine plerixafor concentrations in the plasma, which were evaluated using liquid chromatography coupled with tandem mass spectrometry with a lower limit of quantification of 5 ng/mL. Venous blood samples were collected for CD34+ FACS analysis on the morning of the day preceding the first apheresis and on the morning of the apheresis day (prior to administration of the daily G-CSF dose). For each apheresis collection, apheresis product volume, absolute number of CD34+ cells per unit volume, and the patient’s weight were used to calculate the yield of CD34+ cells/kg. The total CD34+ cell yield was calculated as the sum of all apheresis collections.\n\nIn stage 2, all patients received standard mobilization with G-CSF, dosed at 10 µg/kg daily. In patients mobilizing poorly prior to randomization, the dose of G-CSF could be increased up to a maximum of 15 µg/kg (three (10%) patients in the plerixafor arm and one patient in the standard (6.6%) therapy arm) if this was in accordance with the study site standard practice. Patients were randomized when the trigger point of seven CD34+ cells/µL was reached (a threshold of seven CD34+ cells/µl was chosen as the lowest threshold to maximize the probability that patients could achieve apheresis following randomization).\n\nPlerixafor was dosed at 240 µg/kg (determined in stage 1) between 8 and 12 h before the planned apheresis as CD34+ cell counts peak ~9 h after plerixafor mobilization. A maximum of five apheresis sessions were permitted for each patient. On the morning of the day preceding the first apheresis and on the morning of the apheresis day itself (prior to administration of the daily G-CSF), venous blood samples were taken for PB CD34+ FACS analysis.\n\nThe primary stage 2 efficacy endpoint was successful mobilization, defined as at least a doubling of PB CD34+ cell count in the 24 h prior to first apheresis. Secondary stage 2 endpoints included safety, number of days of apheresis required to reach ≥2 × 106 CD34+ cells/kg, CD34+ yield per apheresis, total CD34+ cell yield, and percentage of patients proceeding to transplant, successfully engrafting, and the number of patients with durable engraftment at 3, 6, 12, and 24 months post transplant.\n\nExploratory endpoints included the CD34+ cell count that was transplanted, increase in CD34+ cell counts, total blood volume processed, time to neutrophil engraftment, and time to platelet engraftment.\n\nTreatment-emergent adverse events (TEAEs) were defined as any adverse event from the date of randomization until 30 days after the last dose of the patient’s study mobilization regimen, or until the first dose of their next anticancer therapy or pretransplant myeloablative therapy, whichever occurred first. Safety was assessed in stage 1 and stage 2 by monitoring TEAEs. All patients who underwent transplant within 6 months of their last study apheresis were evaluated up to 24 months after their last transplant. For patients who did not undergo transplant, safety was monitored up to 24 months after the last dose of study mobilization treatment.\n\nStatistical assessments\nA standard 3 + 3 dose parallel escalation strategy was used to determine dose per age cohort in stage 1. For each planned plerixafor dose (160, 240, and 320 µg/kg), 9 patients (3 per age group [2–<6 years, 6–<12 years, and 12–<18 years]) were to be included for a total of 27 patients. Further three patients would be enrolled in a cohort if a dose limiting toxicity occurred. Escalation would only occur if <2 patients exhibited unacceptable toxicities.\n\nFor stage 2, it was planned to enroll 40 patients; 27 patients in the plerixafor arm and 13 in the standard arm (2:1 ratio). The sample size has been determined by the ability to recruit patients to the study, based on known numbers of autologous transplants carried out in pediatric cancer patients, diagnoses to be included in this study, and limiting participation to larger sites that have capability to achieve sufficient patient numbers within a reasonable amount of time. No formal statistics-based on sample size calculations have been performed.\n\nThe full analysis set comprised all patients randomized in stage 2. Patients were analyzed according to the treatment arm allocated by randomization (intention-to-treat analysis). Continuous variables were summarized using either mean and standard deviation (SD), or median and range (minimum to maximum). Categorical and ordinal data were summarized using the number and percentage of patients in each treatment arm. All summaries and statistical analyses were generated using SAS software version 9.0 or higher. Test for statistical significance was performed only on the primary efficacy endpoint.\n\nResults\nStage 1\nTwenty-seven patients were included in three age groups (2–<6, 6–<12, and 12–<18 years) with three patients in each age group treated at each dose level (160, 240, and 320 µg/kg) (Table 1).\n\nPharmacokinetic parameters are summarized in Table 2. There was considerable variability in PK parameters within each age cohort due to low numbers of patients. As the dose of plerixafor was raised from 160 to 240 µg/kg, exposure (as assessed by Cmax) to plerixafor generally increased in all age cohorts; further increases between 240 and 320 µg/kg were observed in the youngest and oldest age cohorts. Mean AUC0–9 h values did not appear to increase between the 240 µg/kg and 320 µg/kg doses in the youngest and middle age groups, but were proportional between the 160 µg/kg and 320 µg/kg doses in the oldest group. There was a trend toward lower exposures in the youngest age categories; however, the trend was not clinically relevant, and exposure was sufficient for a response. In general, at all dose levels, CD34+ cells counts within the first hour after dosing lag behind the maximum plasma concentrations of plerixafor, although there was variation between individual patients (Supplementary Fig. 1a, b). The delayed increase in CD34+ cell count with rising plerixafor concentration is consistent with the PK/PD relationship observed in adults. In addition, the PD response regarding CD34+ cell count was comparable across all dose levels. Therefore, the dose proposed for stage 2 was 240 µg/kg to be given between 8 and 12 h before apheresis. Overall, three patients failed to reach 2 × 106 cells/kg (one patient in the 2–<6 years cohort and two in the 12–18 years cohort (Table 3).Table 2 Stage 1 mean ± SD (geometric mean) [CV%] pharmacokinetic parameters of plerixafor.\n\n\t2–<6 years\t6–<12 years\t12–<18 years\t\nPK parameter\t160 µg/kg (n = 3)\t240 µg/kg (n = 3)\t320 µg/kg (n = 3)\t160 µg/kg (n = 3)\t240 µg/kg (n = 3)\t320 µg/kg (n = 3)\t160 µg/kg (n = 3)\t240 µg/kg (n = 3)\t320 µg/kg (n = 3)\t\nCmax (ng/mL)\t153 ± 82.1 (137) [53.6]\t327 ± 244 (223) [74.6]\t465 ± 79.7 (460) [17.2]\t288 ± 61.5 (283) [21.4]\t625 ± 77.7 (621) [12.4]\t604 ± 70.9 (601) [11.7]\t496 ± 11.3 (496) [2.3]\t784 ± 275 (748) [35.1]\t1180 ± 205 (1170) [17.3]\t\ntmaxa (h)\t1.00 (0.87–1.02)\t1.00 (0.62–1.02)\t0.63 (0.50–0.67)\t1.02 (1.00–1.05)\t1.00 (1.00–1.00)\t1.02 (1.02–1.08)\t0.50 (0.25–0.58)\t0.25 (0.25–0.50)\t0.52 (0.25–0.52)\t\nT1/2Z (h)\t1.60, 1.88b (1.73)\t2.09, 2.78b (2.41)\t1.93 ± 0.468 (1.89) [24.2]\t2.35 ± 0.674 (2.29) [28.7]\t2.59 ± 0.690 (2.52) [26.7]\t2.10 ± 0.392 (2.08) [18.6]\t4.04 ± 1.57 (3.89) [39.0]\t3.05 ± 0.503 (3.02) [16.5]\t3.20 ± 0.598 (3.16) [18.7]\t\nAUC0–9 (ng × h/mL)\t655, 486b (564)\t1750, 1730b (1740)\t1520 ± 126 (1510) [8.3]\t953 ± 231 (934) [24.2]\t2270 ± 475 (2230) [20.9]\t2140 ± 401 (2110) [18.7]\t1800 ± 363 (1770) [20.2]\t2600 ± 556 (2550) [21.4]\t4120 ± 100 (4120) [2.4]\t\naMedian (min–max).\n\nbIndividual values (geometric mean) are reported when n = 2 due to poorly defined elimination phase in some patients.\n\nTable 3 Stage 1 efficacy analysis.\n\n\t2–<6 years\t6–<12 years\t12–<18 years\t\nParameter\t160 µg/kg (n = 3)\t240 µg/kg (n = 3)\t320 µg/kg (n = 3)\tOverall (n = 9)\t160 µg/kg (n = 3)\t240 µg/kg (n = 3)\t320 µg/kg (n = 3)\tOverall (n = 9)\t160 µg/kg (n = 3)\t240 µg/kg (n = 3)\t320 µg/kg (n = 3)\tOverall (n = 9)\t\nPB CD34+ cell count doubled, n (%)\t\n Yes\t2 (67)\t1 (33)\t3 (100)\t6 (67)\t2 (67)\t3 (100)\t3 (100)\t8 (89)\t3 (100)\t3 (100)\t3 (100)\t9 (100)\t\n No\t1 (33)\t1 (33)\t0\t2 (22)\t1 (33)\t0\t0\t1 (11)\t0\t0\t0\t0\t\n Missing\t0\t1 (33)\t0\t1 (11)\t0\t0\t0\t0\t0\t0\t0\t0\t\nPatients reaching at least 2 × 106 CD34+ cells/kg, n (%)\t\n Yes\t2 (67)\t3 (100)\t3 (100)\t8 (89)\t2 (67)\t3 (100)\t3 (100)\t8 (89)\t2 (67)\t3 (100)\t2 (67)\t7 (78)\t\n No\t1 (33)\t0\t0\t1 (11)\t0\t0\t0\t0\t1 (33)\t0\t1 (33)\t2 (22)\t\n Missing\t0\t0\t0\t0\t1 (33)\t0\t0\t1 (11)\t0\t0\t0\t0\t\nNumber of apheresis to reach 2 × 106 CD34+ cells/kg, n/n (%)\t\n 1\t1/2 (50)\t1/3 (33)\t2/3 (67)\t4/8 (50)\t1/2 (50)\t3/3 (100)\t1/3 (33)\t5/8 (63)\t2/2 (100)\t3/3 (100)\t1/2 (50)\t6/7 (86)\t\n 2\t1/2 (50)\t2/3 (67)\t1/3 (33)\t4/8 (50)\t1/2 (50)\t0\t2/3 (67)\t3/8 (38)\t0\t0\t1/2 (50)\t1/7 (14)\t\nTotal CD34+ yield, [cells/kg], median (min, max)\t54.63 (1.84, 106.07)\t9.62 (7.93, 62.21)\t16.54 (2.01, 19.93)\t16.54 (1.84, 106.07)\t5.84 (4.23, 7.44)\t8.85 (4.53, 13.72)\t12.72 (3.92, 146.36)\t8.15 (3.92, 146.36)\t8.94 (0.52, 19.08)\t4.95 (3.97, 16.28)\t15.14 (1.95, 42.73)\t8.94 (0.52, 42.73)\t\nCentral laboratory data used, however, when central laboratory value was missing, local laboratory values are used.\n\n\n\nNo dose limiting toxicities were observed in stage 1. TEAEs were experienced by 16 patients (59%); 9 patients (33%) experienced a serious TEAE. All serious TEAEs were attributed to the effects of mobilizing chemotherapy and not related to study treatment. Four deaths occurred after the 30-day period following the last plerixafor dose; three due to disease progression (none of these patients received HSCT) and one patient through a cerebral hemorrhage, of which treatment with heparin was likely the cause.\n\nStage 2\nForty-five patients were enrolled in stage 2 (30 plerixafor arm, 15 standard arm); 35 patients completed all study follow-up visits. Patient demographics and characteristics were well balanced across patient cohorts with little variation in diagnosis of underlying disease between age groups (Table 4). Baseline PB CD34+ cell count (last value recorded prior to randomization) was numerically higher in the standard arm than for the plerixafor arm (27.0 vs. 14.8 cells/μL, respectively; no statistical analysis was carried out on baseline parameters). More patients in the plerixafor arm had PB CD34+ cell counts of <20 cells/µL on the day before first apheresis than in the standard arm (Table 5). Ten patients discontinued the study (Table 6).Table 4 Stage 2 patient baseline characteristics.\n\n\tAge group 1–<6 years\tAge group 6–<12 years\tAge group 12–<18 years\t\nStandard arm (n = 10)\tPlerixafor arm (n = 16)\tStandard arm (n = 3)\tPlerixafor arm (n = 9)\tStandard arm (n = 2)\tPlerixafor arm (n = 5)\t\nAge [years], mean ± SD\t3.2 ± 1.3\t3.6 ± 1.2\t6.7 ± 0.8\t8.0 ± 1.6\t14.3 ± 2.7\t15.8 ± 1.5\t\nMale, n (%)\t4 (40)\t9 (56)\t2 (67)\t6 (67)\t1 (50)\t4 (80)\t\nRace, n (%)\t\n Caucasian\t9 (90)\t16 (100)\t3 (100)\t8 (89)\t2 (100)\t5 (100)\t\n Not reported\t1 (10)\t0\t0\t1 (11)\t0\t0\t\nEthnicity, n (%)\t\n Hispanic or Latino\t1 (10)\t1 (6)\t0\t1 (11)\t0\t2 (40)\t\n Not Hispanic or Latino\t8 (80)\t15 (94)\t3 (100)\t7 (78)\t2 (100)\t3 (60)\t\n Not reported\t1 (10)\t0\t0\t1 (11)\t0\t0\t\nTumor type, n (%)\t\n Lymphoma\t1 (10)\t0\t0\t0\t0\t2 (40)\t\n Neuroblastoma\t6 (60)\t12 (75)\t1 (33)\t2 (22)\t0\t0\t\n Sarcoma\t0\t0\t2 (67)\t6 (67)\t2 (100)\t2 (40)\t\n Medulloblastoma\t1 (10)\t2 (13)\t0\t1 (11)\t0\t0\t\n Wilms’ tumor\t1 (10)\t1 (6)\t0\t0\t0\t0\t\n Anaplastic ependymoma\t1 (10)\t0\t0\t0\t0\t0\t\n Malignant rhaboid tumor\t0\t1 (6)\t0\t0\t0\t0\t\n Intracranial germ cell tumor\t0\t0\t0\t0\t0\t1 (20)\t\nPatient percentages are a proportion of the treatment arm for all age groups combined (standard mobilization group or plerixafor + standard mobilization group).\n\nTable 5 Number (%) of patients with PB CD34+ cell count (cells/µL) less than 10, 15, or 20 on the day before first apheresis.\n\n\tStandard arm (N = 15)\tPlerixafor arm (N = 30)\t\nCentral laboratory measurement, n (%)\t\n <10 cells/µL\t3 (20)\t4 (13.3)\t\n <15 cells/µL\t4 (26.7)\t14 (46.7)\t\n <20 cells/µL\t4 (26.7)\t17 (56.7)\t\nTable 6 Summary of stage 2 efficacy endpointsa.\n\nPrimary endpoint\tStandard arm (N = 15)\tPlerixafor arm (N = 30)\t\nPrimary analysis\t\n Successful mobilizationb, n/N1(%), [95% CI]\t4/14 (28.6)\n\n[8.4%, 58.1%]\n\n\t24/30 (80.0)\n\n[61.4%, 92.3%]\n\n\t\nDifference of proportion of successful mobilizationc\t51.4\t\n 95% CL\t[18.5%, 84.3%]\t\n p valued\t0.0019\t\nSecondary and exploratory endpoints\tStandard arm (N = 15)\tPlerixafor arm (N = 30)\t\nNumber of days required to reach ≥2 × 106 cells/kg, median [95% CI]\t1 [NC, NC]\t1 [NC, NC]\t\nCumulative patients reaching ≥2 × 106 cells/kg, n (%)a\t\n Day 1\t15 (100)\t26 (89.7)\t\n Day 2\t15 (100)\t27 (94.4)\t\n Day 3\t15 (100)\t27 (94.4)\t\n Day 4\t15 (100)\t27 (94.4)\t\n Day 5\t15 (100)\t27 (94.4)\t\nPatients not reaching target of ≥2 × 106 cells/kg by apheresis day 5, n (%)\t1 (7.1)\t3 (10.3)\t\nTotal blood volume processed [L], median\t3.27\t3.00\t\nCumulative CD34+ cell collection (106 cells/kg)e\t\n Number\t14\t29\t\n Median\t10.2\t9.1\t\n Min:Max\t0.7:66.0\t0.1:200.4\t\nNumber of patients who received transplants\t10 (66.7)\t23 (76.7)\t\nNumber of CD34+ cells (106 cells/kg) infused on transplant day, median (min:max)\t4.55 (0.5:9.4)\t4.16 (0.1:12.0)\t\nPercentage of durable engraftment after transplant, n/n (%), [95% CI]f\t\n Month 3\t10/10 (100) [69.2, 100.0]\t21/23 (91.3) [72.0, 98.9]\t\n Month 6\t9/10 (90.0) [55.5, 99.7]\t20/23 (87.0) [64.4, 97.2]\t\n Month 12\t8/10 (80.0) [44.4, 97.5]\t20/23 (87.0) [64.4, 97.2]\t\n Month 24\t8/10 (80.0) [44.4, 97.5]\t19/23 (82.6) [61.2, 95.0]\t\nTime to neutrophil engraftment [days], Median (95% CI)g\t14 (11.0%, 15.0%)\t12 (11.0%, 13.0%)\t\nTime to platelet engraftment [days], Median (95% CI)g\t23 (11.0%, 31.0%)\t28 (18.0%, 37.0%)\t\nPeripheral Blood CD34+ cell count (cells/μL) summary, median (min:max)\t\n Day prior to first planned apheresis\t35.0 (5.0:300.00)\t15.0 (1.0:306.0)\t\n Day 1 first planned apheresis\t64.0 (11.00:510.00)\t77 (0.0:959.0)\t\n Day 1 increase in CD34+ counts from day prior\t12 (−17.0:362.0)\t53.0 (−45.0:653.0)\t\nReason for study discontinuation, n (%)\tStandard arm\n\n(N = 15)\n\n\tPlerixafor arm\n\n(N = 30)\n\n\t\nProgressive disease\t1 (6.7)\t0\t\nDeathh\t3 (20.0)\t3 (10.0)\t\nInvestigator’s choicei\t0\t1 (3.3)\t\nSubject/parent request\t1 (6.7)\t1 (3.3)\t\nCI confidence interval, n number of patients who successfully mobilized, N1 number of patients excluding patients missing both local and central laboratory records, NC not calculated.\n\naData for the primary analysis is from the central laboratory. In case of missing data from the central laboratory, the corresponding local laboratory result was used for primary analysis.\n\nbThe primary endpoint of successful mobilization is defined as at least a doubling of the peripheral blood (PB) CD34+ count from the morning of the day preceding the first planned apheresis day to the morning prior to apheresis. The 95% CIs are calculated using the exact method.\n\ncThe difference in the proportion of patients who met the primary endpoint is calculated relative to standard mobilization alone treatment arm. The CI of the difference is based on the Wald asymptotic CI with continuity correction method.\n\ndThe p value is based on the Fisher’s exact test comparing the proportion of successful mobilization between the two treatment arms.\n\neData from central laboratory.\n\nfCI is estimated using exact method. Percentages are based on N1.\n\ngCL estimated by Kaplan–Meier method using log–log transformation.\n\nhDeath due to progressive disease.\n\niInvestigator felt the patient needed more mobilization after first apheresis.\n\n\n\nEfficacy\nMore patients in the plerixafor arm (24/30, 80%) met the primary endpoint of doubling the PB CD34+ cell count in the 24 h prior to first apheresis than in the standard arm (4/14, 28.6%) (p = 0.0019; Table 6). Three patients in the plerixafor arm and one patient in the standard arm failed to reach 2 × 106 CD34+ cells/kg (Table 6). The median total CD34+ cell yield was numerically higher in the standard arm (Table 6).\n\nDuring the 6-month time period following mobilization 23/30 (76.7%) patients in the plerixafor arm and 10/15 (66.7%) patients in the standard arm proceeded to HSCT. All patients who received HSCT had successful engraftments. The median number of CD34+ cells infused at transplant was 4.55 × 106 cells/kg in the standard arm and 4.16 × 106 cells/kg in the plerixafor arm (Table 6). Rates of neutrophil, platelet, and sustained engraftment were comparable between treatment arms (Table 6).\n\nOn the day prior to the first planned apheresis median PB CD34+ cell counts were lower in the plerixafor arm than in the standard arm; by the day of apheresis median PB CD34+ cell counts were higher in the plerixafor arm than in the standard arm (Table 6). An ad hoc analysis demonstrated that patients in the plerixafor arm (n = 27) experienced a median PB CD34+ cell increase of 3.2-fold in the 24 h prior to first apheresis compared with a 1.39-fold increase for patients in the standard arm (n = 14).\n\nStage 2 safety results\nIn the plerixafor arm 76.7% of patients experienced a TEAE compared with 66.7% of patients in the standard arm (Table 7). The number of TEAEs grade 3 or higher were comparable between arms (43.3% plerixafor arm vs. 40.0% standard arm) (Table 7). No TEAEs grade 3 or higher or SAEs related to study treatment were observed. TEAEs assessed as related to the study treatment were reported for four patients (13.3%) in the plerixafor arm and no patients in the standard arm: injection site reactions (6.7%), hypokalemia (3.3%), blood bicarbonate increased (3.3%). No patient discontinued study treatment due to a TEAE or experienced a TEAE leading to death. The number of patients with myeloablative conditioning before transplantation are shown in Table 8 (stage 1 and stage 2). Six patients (three in each study arm) died during the study; all deaths were due to disease progression and occurred during the posttreatment follow-up period.Table 7 Overview of treatment-emergent adverse events during stage 2.\n\nParameter, n (%)\tStandard arm\n(N = 15)\tPlerixafor arm\n(N = 30)\t\nAny TEAE\t10 (66.7)\t23 (76.7)\t\nTEAE related to study procedure\t4 (26.7)\t12 (40.0)\t\nTEAE related to study treatmenta\t0\t4 (13.3)\t\n Injection site reactions\t\t2 (6.7)\t\n Hypokalemia\t\t1 (3.3)\t\n Blood bicarbonate increased\t\t1 (3.3)\t\nAny grade 3–4 TEAE\t6 (40.0)\t13 (43.3)\t\nAny grade 3–4 TEAE related to study procedure\t4 (26.7)\t9 (30)\t\nAny grade 3–4 TEAE related to study treatment\t0\t0\t\nAny serious TEAE\t4 (26.7)\t9 (30)\t\nSerious TEAE related to study procedure\t1 (6.7)\t3 (10)\t\nSerious TEAE related to study treatment\t0\t0\t\nTEAE treatment-emergent adverse event.\n\naAll were common terminology criteria for adverse events grade 1.\n\nTable 8 Patients with myeloablative conditioning before transplantation (a) stage 1 and (b) stage 2.\n\n(a) Stage 1\t\n\tAge 2–<6 years\n(n = 9)\tAge 6–<12 years\n(n = 9)\tAge 12–<18 years\n(n = 9)\t\nPatients, n (%)\t8 (88.9)\t6 (66.7)\t5 (55.6)\t\n(b) Stage 2\t\n\tAge group 1–<6 years\tAge group 6–<12 years\tAge group 12–<18 years\t\n\tStandard arm\n(n = 10)\tPlerixafor arm\n(n = 16)\tStandard arm\n(n = 3)\tPlerixafor arm\n(n = 9)\tStandard arm\n(n = 2)\tPlerixafor arm\n(n = 5)\t\nPatients, n (%)\t7 (70)\t13 (81)\t2 (67)\t8 (89)\t1 (50)\t3 (60)\t\n\n\nDiscussion\nThis study is the first to address the dose and timing of plerixafor in pediatric patients with cancer and allowed for efficacy and safety to be assessed in this patient population.\n\nStage 1 of this study was conducted to establish the PK of plerixafor in the pediatric population. No apparent dose-dependent effect of plerixafor on CD34+ cumulative cell yield or fold increases were observed observed and efficacy and safety of plerixafor in this study was similar to that observed in adults at all three doses explored. Therefore the recommended adult dose of 240 µg/kg, administered 8–12 h prior to apheresis, was recommended in pediatric patients.\n\nThe primary endpoint, defined as at least a doubling of PB CD34+ cell count in the 24 h prior to first apheresis (i.e., prior to first administration of plerixafor in the experimental arm), was significantly higher in the plerixafor arm than in the standard arm (p = 0.0019). The primary endpoint allowed for the measure of the role of plerixafor in addition to standard mobilization with G-CSF alone or in combination with chemotherapy in order to not modify the standard mobilization regimens currently used. Of note, on the day prior to the first planned apheresis, CD34+ cell counts were more than twofold higher in patients randomized to the standard arm than in the plerixafor arm. The added value of plerixafor treatment can be seen in the increase in CD34+ cell counts on day 1 of apheresis from the day prior to apheresis, with patients in the plerixafor arm experiencing a greater median fold change (3.2-fold vs. 1.39-fold) in CD34+ cell counts than those in the standard arm.\n\nIn adults, plerixafor has been observed to be advantageous in patients considered to be poor mobilizers using the current consensus threshold for poor mobilization in adults (<20 CD34+ cells/µL) [5–7]. However, the adult “consensus” threshold for poor mobilization may not be appropriate in the pediatric setting [8]. Few studies have been published exploring poor mobilization in pediatric patients and therefore there is no current consensus threshold for poor mobilization in this patient group. In a single retrospective study of pediatric patients, who received a mobilization regime consisting of G-CSF for 4 days, prior to collection of CD34+ cells, [8] no differences were observed in the numbers of patients reaching the target cell dose (2 × 106 cells/µL) for autologous PB progenitor cell transplantation in patients with baseline PB CD34+ cells counts of >20 cells/µL compared with those with baseline CD34+ cells counts of 11–20 cells/µL [8]. Of 26 pediatric patients with a PB CD34+ cell count of ≤10 cell/µL, 18 underwent hematopoietic progenitor cell collection, two reached the target CD34+ cell dose after one apheresis, and 16 failed to reach the target [8].\n\nData for use of plerixafor for mobilization of HSC in pediatric patients are sparse. Studies, with limited numbers of pediatric patients who had failed earlier mobilization with chemotherapy and G-CSF, or G-CSF alone, have demonstrated that plerixafor combined with G-CSF can result in successful mobilization [9–12]. In a more comprehensive study of 33 pediatric patients who had previously failed to mobilize using G-CSF mobilization regimes, 31 patients successfully mobilized CD34+ cells after treatment with plerixafor, with 27 patients meeting the target of 2 × 106 cell/kg after one apheresis procedure and 24 patients proceeded to transplant [13].\n\nIn the current study, more patients in the plerixafor arm than in the standard arm successfully mobilized cells it is important to note that both arms had high levels of successful mobilization, suggesting plerixafor may have a specific role in the population of patients who are poor mobilizers [14]. Again, it was noted that the plerixafor arm had a higher proportion of potential poor mobilizers (as defined using the current consensus threshold for poor mobilization in adults, <20 CD34+ cells/µL), than in the standard arm. The higher number of poor mobilizers in the plerixafor group may have contributed to a trend in slower platelet engraftment observed in the plerixafor group, median time to engraftment 28 days in the plerixafor arm compared with 23 days in the standard arm. However, in another study in children with malignant tumors, the median time to platelet engraftment with plerixafor was 16 days (range 9–30 days) [13], which is similar to the median time of 18–21 days for platelet engraftment observed for both plerixafor plus G-CSF and the G-CSF alone arms in adult patients with non-Hodgkin’s lymphoma and MM [15, 16]. It is known that there are differences in the cellular composition of apheresis products recovered from healthy adults who received either plerixafor plus G-CSF or G-CSF alone [17]. Nevertheless, there is no evidence from studies in adult lymphoma or MM patients that potential differences in apheresis product affects platelet engraftment [15, 16]. The results of the previous pediatric published literature, in which high levels of successful mobilization were observed in patients that had previously failed to mobilize on alternative mobilization regimes, provide further support for the use of plerixafor in HSC mobilization [9–13].\n\nAdverse events reported as related to study treatment in the current study were mild and consistent with the known safety profile of plerixafor. In addition, few AEs have been reported in other studies investigating the use of plerixafor in pediatric patients [9, 11, 12]. Maschan et al. [13] noted mild toxicity in 8 out of 33 patients including World Health Organization grade 1/2 diarrhea (n = 5), grade 2 nausea (n = 2), grade 1 bone pain (n = 1), and urticaria (n = 1). Hong et al. reported that two patients with medulloblastoma developed pneumomediastinum, with pathogenic findings consistent with diffuse alveolar damage [10].\n\nIn summary, this study has established the dose and timing of plerixafor in pediatric patients as 240 µg/kg to be administered between 6 and 11 h before apheresis. More patients in the plerixafor arm, than in the standard arm, met the primary endpoint of successful mobilization supporting the role of plerixafor on increasing the number of mobilized CD34+ cells in PB, especially in poor mobilizers. Adverse events reported as related to study treatment were mild, and no new safety concerns were identified in this study. Overall, plerixafor was generally well tolerated and efficacious when used to mobilize CD34+ cells in pediatric patients with a variety of different cancers.\n\nSupplementary information\nSupplementary Figures\n\n Supplementary Figures Legend\n\n Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nSupplementary information\nThe online version of this article (10.1038/s41409-020-0836-2) contains supplementary material, which is available to authorized users.\n\nAcknowledgements\nThis work was funded by Sanofi. The sponsor was involved in data collection, analysis, and interpretation, in collaboration with the authors. All authors had unrestricted access to the primary clinical trial data, vouch for completeness and accuracy of the data, and had final responsibility for the manuscript content and decision to submit. Editorial support, funded by Sanofi, was provided by Barrie J. Anthony, PhD, CMPP, and John Clarke, PhD, of Elevate Medical Affairs, funded by Sanofi.\n\nData availability\nQualified researchers may request access to patient-level data and related study documents including the clinical study report, study protocol with any amendments, blank case report form, statistical analysis plan, and dataset specifications. Patient-level data will be anonymized and study documents will be redacted to protect the privacy of trial participants. Further details on Sanofi’s data sharing criteria, eligible studies, and process for requesting access can be found at https://www.clinicalstudydatarequest.com.\n\nCompliance with ethical standards\nConflict of interest\nBM, TK, SD, DM, RL, IY, PB, GB, PL, DS, GK, and FL have nothing to disclose. CMZ reports fees for consultancy from Sanofi, outside the submitted work. JS reports payments to their institution from Sanofi, received for conducting this clinical trial, and reports financial support outside the submitted work for educational lectures by Novartis, Advisory board member for Rocket Pharmaceuticals, educational lectures for Miltenyi, and advisory board member for Novartis. JR reports grants from Pfizer, personal fees from Pierre Fabre, outside the submitted work. BM-K reports personal fees and nonfinancial support from Jazz Pharmaceuticals, outside the submitted work. QL is an employee of Sanofi. JB and ED were employees of Sanofi at the time of the study.\n==== Refs\nReferences\n1. DiPersio JF Uy GL Yasothan U Kirkpatrick P Plerixafor Nat Rev Drug Discov 2009 8 105 6 10.1038/nrd2819 19180104 \n2. Fricker SP Anastassov V Cox J Darkes MC Grujic O Idzan SR Characterization of the molecular pharmacology of AMD3100: a specific antagonist of the G-protein coupled chemokine receptor, CXCR4 Biochem Pharmacol. 2006 72 588 96 10.1016/j.bcp.2006.05.010 16815309 \n3. Hatse S Princen K Bridger G De Clercq E Schols D Chemokine receptor inhibition by AMD3100 is strictly confined to CXCR4 FEBS Lett 2002 527 255 62 10.1016/S0014-5793(02)03143-5 12220670 \n4. Uy GL Rettig MP Cashen AF Plerixafor, a CXCR4 antagonist for the mobilization of hematopoietic stem cells Expert Opin Biol Ther 2008 8 1797 804 10.1517/14712598.8.11.1797 18847313 \n5. Mohty M Azar N Chabannon C Le Gouill S Karlin L Farina L Plerixafor in poor mobilizers with non-Hodgkin’s lymphoma: a multi-center time-motion analysis Bone Marrow Transpl 2018 53 246 54 10.1038/s41409-017-0033-0 \n6. Maziarz RT Nademanee AP Micallef IN Stiff PJ Calandra G Angell J Plerixafor plus granulocyte colony-stimulating factor improves the mobilization of hematopoietic stem cells in patients with non-Hodgkin lymphoma and low circulating peripheral blood CD34+ cells Biol Blood Marrow Transpl 2013 19 670 5 10.1016/j.bbmt.2013.01.005 \n7. Nademanee AP DiPersio JF Maziarz RT Stadtmauer EA Micallef IN Stiff PJ Plerixafor plus granulocyte colony-stimulating factor versus placebo plus granulocyte colony-stimulating factor for mobilization of CD34(+) hematopoietic stem cells in patients with multiple myeloma and low peripheral blood CD34(+) cell count: results of a subset analysis of a randomized trial Biol Blood Marrow Transpl 2012 18 1564 72 10.1016/j.bbmt.2012.05.017 \n8. Sevilla J Guillen M Castillo A Prudencio M Gonzalez-Vicent M Lassaletta A Defining “poor mobilizer” in pediatric patients who need an autologous peripheral blood progenitor cell transplantation Cytotherapy. 2013 15 132 7 10.1016/j.jcyt.2012.10.004 23260093 \n9. Avramova BE Yordanova MN Konstantinov DN Bobev DG Successful mobilization of peripheral blood stem cells in children with cancer using plerixafor (Mozobil) and granulocyte-colony stimulating factor Drug Des Dev Ther 2011 5 407 9 10.2147/DDDT.S19157 \n10. Hong KT Kang HJ Kim NH Kim MS Lee JW Kim H Successful mobilization using a combination of plerixafor and G-CSF in pediatric patients who failed previous chemomobilization with G-CSF alone and possible complications of the treatment J Hematol Oncol 2012 5 14 10.1186/1756-8722-5-14 22458355 \n11. Sevilla J Schiavello E Madero L Pardeo M Guggiari E Baragano M Priming of hematopoietic progenitor cells by plerixafor and filgrastim in children with previous failure of mobilization with chemotherapy and/or cytokine treatment J Pediatr Hematol Oncol 2012 34 146 50 10.1097/MPH.0b013e31821c2cb8 22009006 \n12. Teusink A Pinkard S Davies S Mueller M Jodele S Plerixafor is safe and efficacious for mobilization of peripheral blood stem cells in pediatric patients Transfusion. 2016 56 1402 5 10.1111/trf.13599 27079854 \n13. Maschan AA Balashov DN Kurnikova EE Trakhtman PE Boyakova EV Skorobogatova EV Efficacy of plerixafor in children with malignant tumors failing to mobilize a sufficient number of hematopoietic progenitors with G-CSF Bone Marrow Transpl 2015 50 1089 91 10.1038/bmt.2015.71 \n14. European Medicines Agency. Mozobil. 2014. https://www.ema.europa.eu/en/medicines/human/EPAR/mozobil. Last accessed 18 February, 2020.\n15. DiPersio JF Stadtmauer EA Nademanee A Micallef IN Stiff PJ Kaufman JL Plerixafor and G-CSF versus placebo and G-CSF to mobilize hematopoietic stem cells for autologous stem cell transplantation in patients with multiple myeloma Blood. 2009 113 5720 6 10.1182/blood-2008-08-174946 19363221 \n16. Micallef IN Stiff PJ Stadtmauer EA Bolwell BJ Nademanee AP Maziarz RT Safety and efficacy of upfront plerixafor + G-CSF versus placebo + G-CSF for mobilization of CD34(+) hematopoietic progenitor cells in patients >/=60 and <60 years of age with non-Hodgkin’s lymphoma or multiple myeloma Am J Hematol 2013 88 1017 23 10.1002/ajh.23561 23907769 \n17. Teipel R Oelschlagel U Wetzko K Schmiedgen M Kramer M Rucker-Braun E Differences in cellular composition of peripheral blood stem cell grafts from healthy stem cell donors mobilized with either granulocyte colony-stimulating factor (G-CSF) alone or G-CSF and plerixafor Biol Blood Marrow Transpl 2018 24 2171 7 10.1016/j.bbmt.2018.06.023\n\n",
"fulltext_license": "CC BY",
"issn_linking": "0268-3369",
"issue": "55(9)",
"journal": "Bone marrow transplantation",
"keywords": null,
"medline_ta": "Bone Marrow Transplant",
"mesh_terms": "D000293:Adolescent; D064592:Autografts; D001596:Benzylamines; D002648:Child; D000080027:Cyclams; D019650:Hematopoietic Stem Cell Mobilization; D006571:Heterocyclic Compounds; D006801:Humans; D009369:Neoplasms",
"nlm_unique_id": "8702459",
"other_id": null,
"pages": "1744-1753",
"pmc": null,
"pmid": "32127657",
"pubdate": "2020-09",
"publication_types": "D017426:Clinical Trial, Phase I; D017427:Clinical Trial, Phase II; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Plerixafor combined with standard regimens for hematopoietic stem cell mobilization in pediatric patients with solid tumors eligible for autologous transplants: two-arm phase I/II study (MOZAIC).",
"title_normalized": "plerixafor combined with standard regimens for hematopoietic stem cell mobilization in pediatric patients with solid tumors eligible for autologous transplants two arm phase i ii study mozaic"
} | [
{
"companynumb": "GB-AMGEN-GBRSP2020170856",
"fulfillexpeditecriteria": "2",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "FILGRASTIM"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nA number of serious cardiovascular safety concerns related to the use of atypical antipsychotics, compared with no use, have emerged, but nearly all reports are from studies of older patients. We aimed to compare the risk of cardiovascular events between the three most commonly used atypical antipsychotics in young and middle-aged adults.\n\n\nMETHODS\nWe conducted a nationwide register-based cohort study in Denmark, 1997-2011, including adults aged 18-64 years, who started treatment with oral or intramuscular olanzapine (n = 15,774), oral quetiapine (n = 18,717), and oral or intramuscular risperidone (n = 14,134). The primary outcome was any major cardiovascular event (composite of cardiovascular mortality, acute coronary syndrome, or ischemic stroke) within 1 year following treatment initiation. Cox regression was used to estimate hazard ratios (HRs) while on current antipsychotic monotherapy in the outpatient setting, adjusting for an outcome-specific disease risk score.\n\n\nRESULTS\nThe crude rate of any major cardiovascular event was 5.3 per 1,000 person-years among olanzapine users, 3.4 in quetiapine users, and 5.2 in risperidone users. Compared with risperidone, the risk of any major cardiovascular event was not significantly different in olanzapine users (HR 0.90, 95 % confidence interval [CI] 0.53-1.52) and quetiapine users (HR 0.79, 95 % CI 0.45-1.39). The absolute risk difference per 1,000 person-years on treatment was -0.5 (95 % CI -2.4 to 2.7) events for olanzapine and -1.1 (95 % CI -2.9 to 2.0) events for quetiapine.\n\n\nCONCLUSIONS\nAmong young and middle-aged outpatients, the risk of acute major cardiovascular events was similar with use of olanzapine, quetiapine, and risperidone. Although moderate relative differences cannot be ruled out, any differences are small in absolute terms.",
"affiliations": "Department of Epidemiology Research, Statens Serum Institut, Artillerivej 5, 2300, Copenhagen S, Denmark, bjp@ssi.dk.",
"authors": "Pasternak|Björn|B|;Svanström|Henrik|H|;Ranthe|Mattis F|MF|;Melbye|Mads|M|;Hviid|Anders|A|",
"chemical_list": "D014150:Antipsychotic Agents; D003987:Dibenzothiazepines; D001569:Benzodiazepines; D000069348:Quetiapine Fumarate; D018967:Risperidone; D000077152:Olanzapine",
"country": "New Zealand",
"delete": false,
"doi": "10.1007/s40263-014-0176-0",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1172-7047",
"issue": "28(10)",
"journal": "CNS drugs",
"keywords": null,
"medline_ta": "CNS Drugs",
"mesh_terms": "D000284:Administration, Oral; D000293:Adolescent; D000328:Adult; D014150:Antipsychotic Agents; D001569:Benzodiazepines; D002318:Cardiovascular Diseases; D015331:Cohort Studies; D003718:Denmark; D003987:Dibenzothiazepines; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D007273:Injections, Intramuscular; D008297:Male; D008875:Middle Aged; D000077152:Olanzapine; D016016:Proportional Hazards Models; D000069348:Quetiapine Fumarate; D012042:Registries; D012306:Risk; D018967:Risperidone; D012680:Sensitivity and Specificity; D055815:Young Adult",
"nlm_unique_id": "9431220",
"other_id": null,
"pages": "963-73",
"pmc": null,
"pmid": "24895158",
"pubdate": "2014-10",
"publication_types": "D003160:Comparative Study; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "20384598;16172203;22009159;12654406;16234500;15840622;22249081;22450214;22362541;21679221;12063102;22442100;21576008;21254289;21954480;21775347;21775349;12823080;23172692;18755769;21041245;22329464;21775345;19144938;21775346;17548409;17898349;19595447",
"title": "Atypical antipsychotics olanzapine, quetiapine, and risperidone and risk of acute major cardiovascular events in young and middle-aged adults: a nationwide register-based cohort study in Denmark.",
"title_normalized": "atypical antipsychotics olanzapine quetiapine and risperidone and risk of acute major cardiovascular events in young and middle aged adults a nationwide register based cohort study in denmark"
} | [
{
"companynumb": "DK-JNJFOC-20141004972",
"fulfillexpeditecriteria": "1",
"occurcountry": "DK",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "RISPERIDONE"
},
"drugadditional": null,
... |
{
"abstract": "To evaluate whether intravenous immunoglobulin (IVIG) use in children with suspected Kawasaki disease (KD) was given according to local trust and the newly revised American Heart Association (AHA) guidelines.\nIn our tertiary hospital, any child with suspected KD given IVIG, over the past 3 years, was identified. Their electronic notes were then reviewed.\nTen patients were identified. Nine patients had a fever lasting 5 days or more. Four patients had either 5/5 or 4/5 of the diagnostic criteria for KD and were diagnosed with complete KD. The remaining six patients were suspected to have incomplete KD. 7/10 patients received IVIG within 10 days of onset of illness. Patients suspected to have incomplete KD experienced a mean delay in administration of IVIG of 5.3 days compared with those with complete KD. In four patients, an alternative diagnosis was established. Three patients had coronary artery abnormalities on first echocardiogram. From these patients, only one had a follow-up echocardiogram recorded in their notes. No patient had more than one follow-up echocardiogram (at both 2 and 6 weeks).\nIdentifying patients with incomplete KD is more difficult than identifying those with complete KD and any delay in giving IVIG could be due to this reason. This audit suggests that increasing awareness of incomplete KD and a clear guideline will aid prompter diagnosis and administration of IVIG. This audit also suggests that all patients with KD should receive more than one follow-up echocardiogram.",
"affiliations": "Paediatrics, Nottingham University Hospitals NHS Trust, Nottingham, UK.;University of Birmingham College of Medical and Dental Sciences, Birmingham, UK.;Paediatrics, Nottingham University Hospitals NHS Trust, Nottingham, UK.;Paediatrics, Nottingham University Hospitals NHS Trust, Nottingham, UK.",
"authors": "Pascall|Beth|B|0000-0003-2380-1786;Thakker|Arjuna|A|0000-0001-5256-7939;Foo|Ying|Y|;Thakker|Pradip|P|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1136/bmjpo-2019-000451",
"fulltext": "\n==== Front\nBMJ Paediatr OpenBMJ Paediatr OpenbmjpobmjpoBMJ Paediatrics Open2399-9772BMJ Publishing Group BMA House, Tavistock Square, London, WC1H 9JR bmjpo-2019-00045110.1136/bmjpo-2019-000451General Paediatrics1506Original articleImmunoglobulin for Kawasaki disease: a 3-year retrospective audit http://orcid.org/0000-0003-2380-1786Pascall Beth 1http://orcid.org/0000-0001-5256-7939Thakker Arjuna 2Foo Ying 1Thakker Pradip 1\n1 \nPaediatrics, Nottingham University Hospitals NHS Trust, Nottingham, UK\n\n2 \nUniversity of Birmingham College of Medical and Dental Sciences, Birmingham, UK\nCorrespondence to Dr Beth Pascall; elizabeth.pascall@nhs.net2019 6 9 2019 3 1 e00045105 4 2019 27 5 2019 01 6 2019 © Author(s) (or their employer(s)) 2019. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.2019This is an open access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited, appropriate credit is given, any changes made indicated, and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/.Aim\nTo evaluate whether intravenous immunoglobulin (IVIG) use in children with suspected Kawasaki disease (KD) was given according to local trust and the newly revised American Heart Association (AHA) guidelines.\n\nMethods\nIn our tertiary hospital, any child with suspected KD given IVIG, over the past 3 years, was identified. Their electronic notes were then reviewed.\n\nResults\nTen patients were identified. Nine patients had a fever lasting 5 days or more. Four patients had either 5/5 or 4/5 of the diagnostic criteria for KD and were diagnosed with complete KD. The remaining six patients were suspected to have incomplete KD. 7/10 patients received IVIG within 10 days of onset of illness. Patients suspected to have incomplete KD experienced a mean delay in administration of IVIG of 5.3 days compared with those with complete KD. In four patients, an alternative diagnosis was established. Three patients had coronary artery abnormalities on first echocardiogram. From these patients, only one had a follow-up echocardiogram recorded in their notes. No patient had more than one follow-up echocardiogram (at both 2 and 6 weeks).\n\nConclusion\nIdentifying patients with incomplete KD is more difficult than identifying those with complete KD and any delay in giving IVIG could be due to this reason. This audit suggests that increasing awareness of incomplete KD and a clear guideline will aid prompter diagnosis and administration of IVIG. This audit also suggests that all patients with KD should receive more than one follow-up echocardiogram.\n\nauditcardiologygeneral paediatricsimmunoglobulinsdelayed diagnosisspecial-featureunlocked\n==== Body\nWhat is known about this subject?\nFailure to recognise and treat Kawasaki disease promptly is associated with a higher risk of development of coronary artery aneurysms.\n\nPatients with incomplete Kawasaki disease (fever with fewer than four diagnostic features) may still develop coronary artery aneurysms.\n\nWhat this study adds?\nPatients with incomplete Kawasaki disease (KD) may experience a delay in intravenous immunoglobulin administration compared with those with complete KD.\n\nThe algorithm for incomplete KD should be considered when incomplete KD is suspected in any patient. In any uncertainty, a KD expert should be consulted.\n\nGuidelines must emphasise the importance of follow-up echocardiograms in all patients diagnosed with KD.\n\nIntroduction\nKawasaki disease (KD) is a vasculitis affecting small-sized and medium-sized arteries, predominantly affecting children under 5 years. It is characterised by a prolonged fever lasting 5 days or more and coronary artery aneurysms if left untreated.1 Timely administration of intravenous immunoglobulin (IVIG) has been shown to reduce the incidence of coronary artery aneurysms from anywhere between 5% and 26%.2\n\n\nThe diagnostic criteria for KD must include a fever lasting 5 days or more, followed by oral mucosal changes, bilateral non-exudative conjunctivitis, a polymorphous rash, cervical lymphadenopathy, erythema and oedema followed by desquamation of the extremities. Classic or ‘complete KD’ can be diagnosed with a fever lasting a minimum of 4 days and at least four out of the five mentioned clinical features. However, as this criterion cannot identify all children with KD, the diagnosis of ‘incomplete KD’ should be considered in children with prolonged unexplained fever associated with any of the principle clinical features of the disease. Incomplete KD is a challenging diagnosis to make, especially as fever is a very common presentation of children to hospital. Those under 6 months of age without conjunctivitis and mucosal changes are at particular risk of delayed diagnosis.3 15% to 20% of patients who do not meet the criteria for complete KD still develop aneurysms,4 and therefore urgent treatment and echocardiogram monitoring remain vital in this group.\n\nWhere incomplete KD is being considered, both AHA and local trust guidelines recommend using a diagnostic algorithm for treatment decisions (online supplementary figures 1 and 2). The algorithm used in the local trust guideline closely models the algorithm used in the gold standard AHA guidelines (there remain subtle differences). Despite the use of algorithms, IVIG prescription and administration is closely controlled within the trust and the decision to administer IVIG is taken by a consultant, whose decision is then screened by a panel of ‘experts’ including a microbiologist and senior pharmacist.\n\n10.1136/bmjpo-2019-000451.supp1Supplementary data \n\n\n\n In May 2016, a National Health Service Patient Safety Alert was published to increase awareness of the ‘risk of death and serious harm from failure to recognise acute coronary syndromes in patients with KD’.5 This was closely followed with the release of the American Heart Association (AHA) revised guideline6 in April 2017, providing updated recommendations on the diagnosis, treatment and long-term management of KD. In view of both the updated guidelines and a national pledge for early diagnosis of the disease, a 3-year audit of KD cases was performed, focusing on length of time from presentation to diagnosis and treatment.\n\nMethods\nThe audit was approved by the local trust. A list was obtained from the hospital pharmacy of all paediatric patients prescribed IVIG for KD from May 2014 to May 2017. Electronic notes were looked at by the authors and the following factors were reviewed: age at diagnosis, sex, ethnicity, weight, which diagnostic clinical features present, complete or incomplete KD diagnosis made, if incomplete, whether the AHA or the local trust guidelines was followed, duration of fever, fever peak, antibiotics given, length of hospital stay, laboratory investigations, time from onset of illness to IVIG, time from diagnosis/consideration of diagnosis to IVIG, whether correct dose of IVIG was given, time from IVIG to termination of fever, whether two doses IVIG or adjunct therapies were given, whether initial and maintenance aspirin doses given, time from diagnosis/consideration of diagnosis to first echocardiogram, timing of subsequent echocardiograms, length of follow-up and whether an alternative diagnosis was eventually established.\n\nPatient involvement\nPatients were not directly involved in the design of this study.\n\nResults\nEleven patients were identified from our 3-year retrospective search. One patient was excluded due to transfer to a cardiac centre following IVIG administration, meaning electronic notes were not available. 7 out of 10 patients were male. The mean age of the patients was 32 months with the youngest patient being 8 weeks and the oldest patient being 5 years of age. As some patients were transferred from other hospitals, the combined total hospital stay ranged from 3 to 14 days, with a mean of 7 days in hospit\n\n9 patients out of 10 were found to have a fever lasting 5 days or more. Only one patient had a fever lasting less than 5 days. The average length of time a patient had a fever was approximately 8 days. Five patients had a highest recorded temperature of more than 39°C.\n\nTwo patients satisfied all six diagnostic criteria for classic KD (fever+five clinical signs) set out in the AHA and trust guidelines. Two patients satisfied five, two satisfied four, two satisfied two and two satisfied one (table 1). The most common clinical feature, aside from fever, was extremity changes, present in seven patients. The least common clinical feature was cervical lymphadenopathy, present in three patients.\n\nTable 1 Clinical criteria for Kawasaki disease and patient population checklist for criteria met\n\nPatient\t1\t2\t3\t4\t5\t6\t7\t8\t9\t10\t\n≥5 days of fever\tYes\tYes\tYes\tYes\tNo\tYes\tYes\tYes\tYes\tYes\t\nMucous membrane involvement\tYes\tYes\tNo\tYes\tYes\tNo\tNo\tNo\tNo\tYes\t\nBilateral non-exudative conjunctivitis\tYes\tYes\tNo\tYes\tYes\tNo\tNo\tNo\tNo\tYes\t\nPolymorphous erythematous rash\tYes\tYes\tYes\tYes\tNo\tNo\tYes\tNo\tNo\tYes\t\nExtremity changes\tYes\tYes\tYes\tYes\tNo\tNo\tYes\tNo\tYes\tYes\t\nCervical lymphadenopthy >1.5 cm\tNo\tNo\tYes\tYes\tNo\tNo\tYes\tNo\tNo\tYes\t\nFour patients were diagnosed with complete KD at the time (table 2), meeting the diagnostic criteria of prolonged fever and at least four out of the five clinical signs needed to make the diagnosis. The remaining six patients were suspected to have incomplete KD at the time, with five out of six patients presenting with prolonged fever but fewer than four principal clinical signs (table 1).\n\nTable 2 Summary table for patient population\n\nPatient number\tSuspected diagnosis at the time (complete or incomplete Kawasaki)\tIf incomplete, was AHA algorithm criteria met?\tIf incomplete, was trust algorithm criteria met?\tAlternative diagnosis eventually established?\tTime to IVIG from onset of illness (days)\t\n1\tComplete\tNA\tNA\tNo\t6\t\n2\tComplete\tNA\tNA\tNo\t8\t\n3\tIncomplete\tYes\tYes\tNo\t10\t\n4\tComplete\tNA\tNA\tNo\t5\t\n5\tIncomplete\tNo\tNo\tRheumatological diagnosis\t5\t\n6\tIncomplete\tNo\tNo\tStill’s disease\tMany\t\n7\tIncomplete\tNo\tNo\tHaemophilus and rhinovirus pneumonia with effusion\t24\t\n8\tIncomplete\tNo\tNo\tPolyarteritis nodosa\t6\t\n9\tIncomplete\tNo\tNo\tNo\t14\t\n10\tComplete\tNA\tNA\tNo\t7\t\nOut of the six patients with suspected incomplete KD, only one satisfied both the AHA and trust algorithm. This was due to a positive echocardiogram result. The remaining five patients did not satisfy either algorithms due to a strict cut-off for laboratory findings (online supplementary figures 1 and 2).\n\nAn alternative diagnosis was eventually established in four patients (table 2). From these patients, all four were suspected to have incomplete KD at the time of presentation. These patients were prescribed IVIG even though they did not meet both the AHA and trust algorithm for incomplete KD.\n\nThe time taken from the onset of the initial illness to IVIG ranged from 5 to 24 days, with seven patients given IVIG within 10 days of illness. One patient received IVIG after 24 days due to a peeling rash and raised erythrocyte sedimentation rate (ESR). The other two patients received IVIG after 10 days either due to a raised C-reactive protein (CRP) or a raised ESR. The time taken from the initial diagnosis/consideration of KD to giving IVIG ranged from less than 24 hours to up to 4 days. One patient received a second dose of IVIG. Cases of incomplete KD experienced a mean delay in administration of IVIG of 5.3 days compared with those diagnosed with complete KD (online supplementary figure 1).\n\nSeven patients received aspirin at 50 mg/kg until their fever resolved. One patient was also treated with a combination of steroids and infliximab due to an ongoing fever and worsening left coronary artery dilation.\n\nThe mean time from diagnosis/consideration of KD to first echocardiogram was 50 hours, with the longest time being 96 hours for one patient. The first echocardiogram showed coronary artery abnormalities in three patients. After 1–2 weeks following the first echocardiogram, three patients had a repeat echocardiogram. Five patients had a repeat echocardiogram after 4–6 weeks following the first echocardiogram.\n\nFour patients still have active ongoing follow-up and two have been transferred to another centre for ongoing care.\n\nDiscussion\nDespite evidence showing that the incidence of KD is increasing,7 it still remains a rare condition in the UK, with an incidence of 9.1 per 100 000 in children under 5 years.8 In our hospital, an average of 3.3 patients per year were treated for suspected KD, with a mean age of 32 months and a typical age distribution.\n\nA summary of the audit standards and outcomes is shown in table 3. Fever for more than 5 days was the most common clinical feature and was present in nine patients. As fever is a common reason for paediatric presentation to hospital, this makes a diagnosis of KD extremely challenging. The least common clinical feature was cervical lymphadenopathy, which correlates with the literature findings of lymphadenopathy being present only in 52% of patients with KD.9 Patients presenting with both fever and cervical lymphadenopathy can often be misdiagnosed as having bacterial lymphadenitis. In our cohort, four patients were presented with fever and cervical lymphadenopathy. From these patients, two had definitive complete KD and two were suspected to have incomplete KD. It is therefore important to consider KD in any patient suspected of having bacterial lymphadenitis, especially in incomplete cases where clinical features of KD may be absent.10\n\n\nTable 3 Summary of standards set out by the 2017 American Heart Association guideline ‘diagnosis, treatment and long-term management of KD’ and the outcomes of the audit\n\nAudit criteria\tTarget\tExceptions\tOutcome\t\nThe diagnosis of KD should be made based on the listed diagnostic criteria or according to the AHA algorithm in cases of incomplete KD\t100%\tThis incomplete KD algorithm is not evidence based but represents the opinion of an expert committee; therefore, exceptions may arise following consultation with an expert\t50%\t\nEchocardiography should be performed when the diagnosis of KD is considered, and repeated within 1–2 weeks and 4–6 weeks in uncomplicated patients\t100%\tNone\t0%\t\nPatients with complete or incomplete KD should be treated with high dose IVIG (2 mg/kg) within 10 days of illness onset\t100%\tIf delayed presentation to hospital, IVIG should be given as soon as possible after diagnosis\t70%\t\nA second dose of IVIG should only be given to patients with persistent fever 36 hours after the initial dose\t100%\tNone\t100%\t\nIVIG, intravenous immunoglobulin; KD, Kawasaki disease.\n\nAll patients received the correct dose of IVIG. High dose IVIG (2 g/kg) has been conclusively shown to be more effective than other dose regimens used in the past, and as a result this dose is used consistently across the UK and USA, minimising potential for dosing errors. The AHA guideline states that IVIG should be given within 10 days of illness onset (ideally as soon as possible after diagnosis). We achieved this in seven of 10 patients. The reason for the delay in the remaining three patients was possibly due to uncertainty regarding the diagnosis. According to the AHA guidelines, it is reasonable to give IVIG after the 10th day of illness if the child has persistent fever or coronary artery abnormalities together with ongoing systemic inflammation manifested by elevated CRP or ESR. This was likely to be the case in all three patients who received IVIG after the 10th day of illness, despite only one of them having a documented reason in their electronic notes (online supplementary table 1).\n\nOur data clearly showed that those patients who fulfilled the diagnostic criteria for complete KD received IVIG earlier than those with incomplete KD. It is well recognised that patients with incomplete KD who have prolonged fever but fewer than four of the diagnostic clinical features may still develop cardiovascular complications. As was the case with one patient, who developed coronary artery dilation. Despite this happening to only one patient from six, this fits with the predicted incidence of cardiovascular complications in those with incomplete KD.11 Therefore, IVIG administration in incomplete KD cases remains as clinically urgent as for complete KD cases.\n\nIncomplete KD is more common in infants under 6 months4; however, in our group of patients, the mean age for those with presumed incomplete KD was approximately 2.5 years, with no patients under 6 months of age. An alternative diagnosis was eventually established in four of the six patients, which was not surprising, given that neither the AHA nor local trust algorithm was met in these patients. This also supports the robustness of the AHA and local trust algorithms and suggests we should be more stringent with its use.\n\nDespite the similarity between the AHA and local trust algorithms, the AHA guidelines further state that in any circumstance of uncertainty, a ‘KD expert’ should be consulted. The local guidelines, however, recommend referring to the consultant responsible for the patient. In most cases, this is likely to be paediatrician, and while most paediatricians are knowledgeable about KD, they are not KD specialists per se. Therefore, experts in KD should be preferably consulted in any uncertain cases of KD.\n\nPersistence or recurrence of fever at least 36 hours after the initial IVIG infusion occurs in approximately 11% of patients with KD12 and is termed IVIG resistance. The AHA guidelines recommend considering a second dose of IVIG after at least 36 hours in the case of IVIG resistance, although there is no strong evidence to support this. One of our patients received this second dose, which appeared to be in accordance with the AHA recommendations. One patient went on to receive methylprednisolone and infliximab due to ongoing fever and worsening coronary dilation. This was also appropriate and consistent with the AHA recommendations.\n\nThe AHA guidelines also state that echocardiograms should be performed at first presentation, 1–2 weeks and at 4–6 weeks as a minimum in uncomplicated patients. We did not achieve these follow-up goals in any of the 10 patients. All patients had an echocardiogram at presentation but either the 1–2 week or 4–6 week echocardiogram was missed, despite these targets also being clearly stated in the trust guideline. As of yet, there are no clinical repercussions from this, but further investigation is required to determine why this happened. Similarly, despite incomplete data, the serial echocardiograms are recommended by AHA in those patients with an abnormal initial echocardiogram; however, this was not adhered to. The AHA guidelines recommend at least twice weekly echocardiograms in these patients until luminal dimensions have stopped progressing, then weekly in the first 45 days of illness, then monthly until the third month after onset. The reason for this not being met could be that these standards are simply unrealistic given the limited resources in the UK. A detailed assessment of echocardiogram techniques and reporting, including the use of Z-scores to assess luminal dimensions of coronary arteries, was beyond the scope of this audit. However, it a potential area for future audit as clear guidelines are set out by the AHA.\n\nRecommendations\nThe most striking finding was the delay in administration of IVIG in patients with incomplete KD. This was most likely due to the difficulty in identifying patients with incomplete KD, as well as unawareness of the local trust algorithm. Increased awareness of this algorithm is therefore necessary, and the AHA algorithm should be used in the local guideline. Further, patients who do not meet the criteria set out in the algorithm, should not receive IVIG, unless there is either a clear alternative indication or a KD expert is consulted.\n\nSecond, all uncomplicated patients only received one follow-up echocardiogram, while complicated patients were not followed up closely enough. Although the reason for this requires further research, a strategy needs to be put in place to ensure this does not happen. This could mean specifying that all follow-up echocardiograms need to be booked by the responsible clinician before discharge.\n\nThe local Kawasaki guideline should be updated to reflect the above recommendations, followed by reaudit in 12–24 months.\n\nContributors: PT presented the idea of this audit and supervised the process. BP, FY and AT contributed to collecting the data and writing the manuscript.\n\nFunding: The authors have not declared a specific grant for this research from any funding agency in the public, commercial or not-for-profit sectors.\n\nCompeting interests: None declared.\n\nPatient consent for publication: Not required.\n\nData availability statement: All data relevant to the study are included in the article or uploaded as supplementary information.\n==== Refs\nReferences\n1. \nMcCrindle BW , Rowley AH , Newburger JW , et al \nDiagnosis, treatment, and long-term management of Kawasaki disease: a scientific statement for health professionals from the American heart association . Circulation \n2017 ;135 \n10.1161/CIR.0000000000000484 \n\n2. \nTerai M , Shulman ST , Minich LL \nPrevalence of coronary artery abnormalities in Kawasaki disease is highly dependent on gamma globulin dose but independent of salicylate dose . J Pediatr \n1997 ;131 :888 –93 . 10.1016/S0022-3476(97)70038-6 \n9427895 \n3. \nSleeper LA , Atz AM , McCrindle BW , et al \nDelayed diagnosis of Kawasaki disease: what are the risk factors? \nPediatrics \n2007 ;120 :e1434 –40 .18025079 \n4. \nRowley AH \nIncomplete (atypical) Kawasaki disease . Pediatr Infect Dis J \n2002 ;21 :563 –5 . 10.1097/00006454-200206000-00015 \n12182382 \n5. \nNHS Improvement \nPatient Safety Alert: Risk of death and serious harm from failure to recognise acute coronary syndromes in Kawasaki disease patients [Internet] , 2016 Available: https://improvement.nhs.uk/documents/92/Patient_Safety_Alert_Stage_1_Failure_to_recognise_coronary_syndromes_in_Kawasa_ivbyZC0.pdf [Accessed 14 Jun 2018 ].\n6. \nMcCrindle BW , Rowley AH , Newburger JW , et al \nDiagnosis, treatment, and long-term management of Kawasaki disease: a scientific statement for health professionals from the American heart association . Circulation \n2017 ;135 :e927 –99 . 10.1161/CIR.0000000000000484 \n28356445 \n7. \nHarnden A , Alves B , Sheikh A \nRising incidence of Kawasaki disease in England: analysis of hospital admission data . BMJ \n2002 ;324 :1424 –5 . 10.1136/bmj.324.7351.1424 \n12065266 \n8. \nHall GC , Tulloh LE , Tulloh RMR \nKawasaki disease incidence in children and adolescents: an observational study in primary care . Br J Gen Pract \n2016 ;66 :e271 –6 . 10.3399/bjgp16X684325 \n26906631 \n9. \nApril MM , Burns JC , Newburger JW , et al \nKawasaki disease and cervical adenopathy . Arch Otolaryngol Head Neck Surg \n1989 ;115 :512 –4 . 10.1001/archotol.1989.01860280110027 \n2923695 \n10. \nKubota M , Usami I , Yamakawa M , et al \nKawasaki disease with lymphadenopathy and fever as sole initial manifestations . J Paediatr Child Health \n2008 ;44 :359 –62 . 10.1111/j.1440-1754.2008.01310.x \n18476929 \n11. \nDuarte R , Cisneros S , Fernandez G , et al \nKawasaki disease: a review with emphasis on cardiovascular complications . Insights Imaging \n2010 ;1 :223 –31 . 10.1007/s13244-010-0035-6 \n22347918 \n12. \nDurongpisitkul K , Soongswang J , Laohaprasitiporn D , et al \nImmunoglobulin failure and retreatment in Kawasaki disease . Pediatr Cardiol \n2003 ;24 :145 –8 . 10.1007/s00246-002-0216-2 \n12457253\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2399-9772",
"issue": "3(1)",
"journal": "BMJ paediatrics open",
"keywords": "audit; cardiology; delayed diagnosis; general paediatrics; immunoglobulins",
"medline_ta": "BMJ Paediatr Open",
"mesh_terms": null,
"nlm_unique_id": "101715309",
"other_id": null,
"pages": "e000451",
"pmc": null,
"pmid": "31548996",
"pubdate": "2019",
"publication_types": "D016428:Journal Article",
"references": "12065266;12182382;12457253;18025079;18476929;22347918;26906631;28356445;2923695;9427895",
"title": "Immunoglobulin for Kawasaki disease: a 3-year retrospective audit.",
"title_normalized": "immunoglobulin for kawasaki disease a 3 year retrospective audit"
} | [
{
"companynumb": "GB-SHIRE-GB201935266",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HUMAN IMMUNOGLOBULIN G"
},
"drugadditional": "3",
... |
{
"abstract": "OBJECTIVE\nThe multicentre non-interventional AVANTI study assessed safety, effectiveness and patient-reported outcomes with approved first-line bevacizumab-containing regimens for HER2-negative locally recurrent/metastatic breast cancer (LR/MBC) in German routine oncology practice.\n\n\nMETHODS\nEligible patients had HER2-negative LR/MBC, no bevacizumab contraindications and no prior chemotherapy for LR/MBC. Chemotherapy schedule, diagnostics and follow-up were at physicians' discretion. Data were collected for 1 year after starting bevacizumab, then every 6 months for 1.5 years (maximum follow-up: 2.5 years). Patients and physicians rated treatment satisfaction. Subgroup analyses were prespecified in clinically relevant populations, including triple-negative breast cancer (TNBC).\n\n\nRESULTS\nBetween November 1, 2009 and April 30, 2016, 2065 eligible patients at 346 centres received bevacizumab with paclitaxel or capecitabine. Patients receiving bevacizumab-capecitabine were less likely to have de novo disease and more likely to have TNBC, age ≥60 years and prior anthracycline/taxane and/or endocrine therapy. Median PFS was 12.6 (95% CI 11.9-13.2) months (12.8 with bevacizumab-paclitaxel, 10.5 with bevacizumab-capecitabine); median OS was 23.9 (95% CI 22.2-25.1) months. Outcomes were worse in patients with TNBC, prior anthracycline/taxane or prior endocrine therapy. Grade ≥3 adverse events occurred in 27% of patients. Treatment was discontinued for adverse events in 15%. Treatment satisfaction was rated as good or better by 304/394 responding patients (77%) at week 54 and in 1393/2065 patients (67%) by physicians overall.\n\n\nCONCLUSIONS\nIn routine clinical practice, effectiveness and safety of first-line bevacizumab-containing therapy for LR/MBC were consistent with experience from phase III trials. Patient and physician treatment satisfaction showed high concordance.",
"affiliations": "Klinik und Poliklinik für Gynäkologie, Universitätsklinikum Hamburg-Eppendorf, Hamburg, Germany. Electronic address: v.mueller@uke.de.;Paracelsus-Klinik Osnabrück, Osnabrück, Germany. Electronic address: markus.ruhnke@helios-gesundheit.de.;Universitätsklinikum Essen, Westdeutsches Tumorzentrum Essen (WTZ), Comprehensive Cancer Center, Nationales Centrum für Tumorerkrankungen, Klinik für Frauenheilkunde und Geburtshilfe, Essen, Germany. Electronic address: oliver.hoffmann@uk-essen.de.;MVZ Nordhausen gGmbh, Praxis Dr Grafe/Brustzentrum der Frauenklinik, Südharz-Klinikum Nordhausen gGmbh, Nordhausen, Germany. Electronic address: andrea.grafe@shk-ndh.de.;St. Vincentius-Kliniken gAG, Karlsruhe, Germany. Electronic address: oliver.tome@vincentius-ka.de.;Onkologische Praxis, Wuppertal, Germany. Electronic address: fett-onkologe@t-online.de.;Schwerpunktpraxis Bonn, Bonn, Germany. Electronic address: DRHRBRUCH@t-online.de.;Roche Pharma AG, Grenzach-Wyhlen, Germany. Electronic address: ann-katrin.sommer@roche.com.;Nationales Centrum für Tumorerkrankungen, Universitätsklinikum und Deutsches Krebsforschungszentrum, Heidelberg, Germany. Electronic address: Andreas.Schneeweiss@med.uni-heidelberg.de.",
"authors": "Müller|Volkmar|V|;Ruhnke|Markus|M|;Hoffmann|Oliver|O|;Grafe|Andrea|A|;Tomé|Oliver|O|;Fett|Werner|W|;Bruch|Harald-Robert|HR|;Sommer-Joos|Ann-Katrin|AK|;Schneeweiss|Andreas|A|",
"chemical_list": null,
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.breast.2021.08.014",
"fulltext": "\n==== Front\nBreast\nBreast\nThe Breast : Official Journal of the European Society of Mastology\n0960-9776\n1532-3080\nElsevier\n\nS0960-9776(21)00444-6\n10.1016/j.breast.2021.08.014\nOriginal Article\nFirst-line bevacizumab-containing therapy for HER2-negative locally advanced/metastatic breast cancer: Real-world experience from >2000 patients treated in the multicentre AVANTI study☆\nMüller Volkmar v.mueller@uke.de\na∗\nRuhnke Markus markus.ruhnke@helios-gesundheit.de\nb1\nHoffmann Oliver oliver.hoffmann@uk-essen.de\nc\nGrafe Andrea andrea.grafe@shk-ndh.de\nd\nTomé Oliver oliver.tome@vincentius-ka.de\ne\nFett Werner fett-onkologe@t-online.de\nf\nBruch Harald-Robert DRHRBRUCH@t-online.de\ng\nSommer-Joos Ann-Katrin ann-katrin.sommer@roche.com\nh\nSchneeweiss Andreas Andreas.Schneeweiss@med.uni-heidelberg.de\ni\na Klinik und Poliklinik für Gynäkologie, Universitätsklinikum Hamburg-Eppendorf, Hamburg, Germany\nb Paracelsus-Klinik Osnabrück, Osnabrück, Germany\nc Universitätsklinikum Essen, Westdeutsches Tumorzentrum Essen (WTZ), Comprehensive Cancer Center, Nationales Centrum für Tumorerkrankungen, Klinik für Frauenheilkunde und Geburtshilfe, Essen, Germany\nd MVZ Nordhausen gGmbh, Praxis Dr Grafe/Brustzentrum der Frauenklinik, Südharz-Klinikum Nordhausen gGmbh, Nordhausen, Germany\ne St. Vincentius-Kliniken gAG, Karlsruhe, Germany\nf Onkologische Praxis, Wuppertal, Germany\ng Schwerpunktpraxis Bonn, Bonn, Germany\nh Roche Pharma AG, Grenzach-Wyhlen, Germany\ni Nationales Centrum für Tumorerkrankungen, Universitätsklinikum und Deutsches Krebsforschungszentrum, Heidelberg, Germany\n∗ Corresponding author. Klinik und Poliklinik für Gynäkologie, Universitätsklinikum Hamburg-Eppendorf, Martinistraße 52, 20246, Hamburg, Germany. v.mueller@uke.de\n1 Present address: Helios Klinikum Aue, Aue, Germany.\n\n27 8 2021\n12 2021\n27 8 2021\n60 7077\n20 5 2021\n23 8 2021\n24 8 2021\n© 2021 The Authors\n2021\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).\nAim\n\nThe multicentre non-interventional AVANTI study assessed safety, effectiveness and patient-reported outcomes with approved first-line bevacizumab-containing regimens for HER2-negative locally recurrent/metastatic breast cancer (LR/MBC) in German routine oncology practice.\n\nMethods\n\nEligible patients had HER2-negative LR/MBC, no bevacizumab contraindications and no prior chemotherapy for LR/MBC. Chemotherapy schedule, diagnostics and follow-up were at physicians’ discretion. Data were collected for 1 year after starting bevacizumab, then every 6 months for 1.5 years (maximum follow-up: 2.5 years). Patients and physicians rated treatment satisfaction. Subgroup analyses were prespecified in clinically relevant populations, including triple-negative breast cancer (TNBC).\n\nResults\n\nBetween November 1, 2009 and April 30, 2016, 2065 eligible patients at 346 centres received bevacizumab with paclitaxel or capecitabine. Patients receiving bevacizumab–capecitabine were less likely to have de novo disease and more likely to have TNBC, age ≥60 years and prior anthracycline/taxane and/or endocrine therapy. Median PFS was 12.6 (95% CI 11.9–13.2) months (12.8 with bevacizumab–paclitaxel, 10.5 with bevacizumab–capecitabine); median OS was 23.9 (95% CI 22.2–25.1) months. Outcomes were worse in patients with TNBC, prior anthracycline/taxane or prior endocrine therapy. Grade ≥3 adverse events occurred in 27% of patients. Treatment was discontinued for adverse events in 15%. Treatment satisfaction was rated as good or better by 304/394 responding patients (77%) at week 54 and in 1393/2065 patients (67%) by physicians overall.\n\nConclusions\n\nIn routine clinical practice, effectiveness and safety of first-line bevacizumab-containing therapy for LR/MBC were consistent with experience from phase III trials. Patient and physician treatment satisfaction showed high concordance.\n\nHighlights\n\n• AVANTI assessed 1st-line bevacizumab-based therapy for LR/MBC in routine practice.\n\n• Median progression-free and overall survival were 12.6 and 23.9 months respectively.\n\n• Treatment satisfaction was rated as good or better by 77% of patients at week 54.\n\n• Physician- and patient-rated treatment satisfaction showed high concordance.\n\n• Effectiveness and safety were consistent with experience from phase III trials.\n\nKeywords\n\nBevacizumab\nMetastatic breast cancer\nNon-interventional study\n==== Body\npmc1 Introduction\n\nFor many years, the standard first-line treatment for patients with HER2-negative metastatic breast cancer (MBC) has been chemotherapy, with or without the anti-angiogenic agent bevacizumab. In Europe, bevacizumab is approved in combination with either paclitaxel or capecitabine based on results from the randomised phase III E2100 [1] and RIBBON-1 [2] trials, respectively. Both demonstrated significantly improved progression-free survival (PFS) but not overall survival (OS) with the addition of bevacizumab to chemotherapy. The subsequent randomised phase III TURANDOT trial demonstrated non-inferior OS with bevacizumab plus capecitabine (BEV–CAP) versus bevacizumab plus paclitaxel (BEV–PAC) [3]. In clinical practice, the decision to use bevacizumab may depend on disease and patient characteristics, and many factors may influence the chemotherapy partner.\n\nIn Germany, bevacizumab is used routinely, based on European and German guidelines [[4], [5], [6], [7]]. We report final results from AVANTI, a non-interventional post-marketing surveillance study of bevacizumab combined with paclitaxel or capecitabine in patients with MBC.\n\n2 Patients and methods\n\nThe single-arm multicentre non-interventional AVANTI study was designed to assess treatment decision making, selection criteria, safety, effectiveness, patient-reported outcomes (PROs) and treatment satisfaction in patients receiving first-line bevacizumab-containing therapy for HER2-negative MBC in routine oncology practice in Germany.\n\nEligible patients were female, aged ≥18 years, and eligible for first-line BEV–PAC or BEV–CAP for locally recurrent or metastatic breast cancer (LR/MBC). Patients with contraindications for bevacizumab according to the approved indication in Europe [8] were excluded. Patients were enrolled by oncologists and gynaecologists in clinics or outpatient clinics and by office-based physicians specialising in oncology. All patients provided written informed consent before study documentation began. The treatment regimen and schedule were chosen by treating physicians; patients were not randomised between BEV–PAC and BEV–CAP.\n\nThere was no specific primary objective; however, predefined questions of particular importance included: treatment selection criteria; safety (especially in elderly patients); response and time-related endpoints overall and in clinically relevant subgroups; treatment impact on PROs; and patient and physician treatment satisfaction. Patients were assessed at baseline and underwent regular detailed documentation for the first 12 months, followed by 6-monthly follow-up documentation for 1.5 years thereafter (according to German regulations). Data were captured in an electronic case report form. Adverse events (AEs) were coded using the latest version of the Medical Dictionary for Regulatory Activities (MedDRA). Investigators assessed response according to standard local practice. PFS was defined as the interval between first bevacizumab dose and disease progression or death from any cause, censoring patients who were alive without progression at the date of last follow-up or start of subsequent anti-neoplastic therapy, whichever was earlier. OS was defined as the interval between first bevacizumab dose and death from any cause; patients not known to have died by the data cut-off were censored at the date they were last known to be alive. PROs were assessed using the European Organisation for Research and Treatment of Cancer Quality of Life Questionnaire Core 30 (EORTC QLQ-C30) at baseline and at weeks 9, 15, 33 and 54. Overall treatment satisfaction was evaluated by patients and physicians using a 5-point Likert-type questionnaire, completed at the same timepoints as PROs by patients and at the end of treatment by physicians. Patients also recorded their subjective experience of side effects at the end of the 12-month documentation period (or end of therapy if earlier) using a study-specific questionnaire.\n\nWhen the study was initially designed, the target sample size was 3000 patients based on detection of rare serious AEs with BEV–PAC or bevacizumab plus docetaxel, which was an approved regimen when the study began. The analysis population for efficacy and safety included all patients who had received at least one bevacizumab dose, providing at least the initial dose was in accordance with the approved indication. Those who received ‘off-label’ bevacizumab-containing regimens from the outset were excluded. The BEV–PAC subpopulation was defined as all patients qualifying for analysis who received at least one dose of paclitaxel with bevacizumab. The BEV–CAP subpopulation was defined as all patients qualifying for analysis who received at least one dose of capecitabine with bevacizumab. Patients switching between these regimens were analysed in both subpopulations in subgroup analyses (but were not double counted in analyses of the overall population). Kaplan–Meier estimates and Cox regression were used to estimate PFS and OS. Change from baseline was calculated at each timepoint for PROs. Descriptive statistics were used for all baseline parameters and safety analyses. Predefined analyses included subgroups according to hypertension (hypertensive vs normotensive), triple-negative breast cancer (TNBC; yes vs no), age (<60 vs ≥ 60 years), number of metastatic sites (<3 vs ≥ 3), previous anthracycline/taxane (yes vs no), previous endocrine therapy (yes vs no) and ‘urgency to treat’ (defined as fulfilling at least three of the following: ≥3 metastatic sites, liver metastasis, prior [neo]adjuvant anthracycline/taxane, TNBC). There was no adjustment for multiple testing.\n\n3 Results\n\n3.1 Patient population and treatment decision making\n\nBetween November 1, 2009 and April 30, 2016, 2065 eligible patients enrolled at 346 centres in Germany received at least one dose of bevacizumab-containing therapy: BEV–PAC in 1821 patients (88%) and BEV–CAP in 295 patients (14%; recruitment starting July 1, 2011). Fifty-one patients (2%) switched between regimens and are thus analysed in both subpopulations. Appendix Fig. A1 shows reasons for exclusion from the analysis population. Treatment documentation was completed in 1996 (97%) out of 2065 patients. The most common reasons for ending documentation were tumour progression (766 patients; 37%), end of the documentation period (505; 24%), physician decision (290; 14%), patient's wish (200; 10%), death (183; 9%) and tumour remission (103; 5%).\n\nTable 1 shows baseline characteristics overall and by selected chemotherapy. The BEV–CAP subpopulation included higher proportions of patients who were aged ≥60 years, had TNBC, and had received prior taxane/anthracycline and/or endocrine therapy, but a lower proportion with de novo MBC, emphasising the different patient populations enrolled in these two non-randomised groups. Treatment decisions were typically made by a tumour board (1294 patients; 63%) or an office-based oncologist (338 patients; 16%). The most commonly cited reasons for treatment choice were efficacy (65% overall, 67% for BEV–PAC vs 58% for BEV–CAP), guidelines (57% of patients overall; 58% vs 50% for BEV–PAC and BEV–CAP, respectively) and tolerability (41% overall and in both subpopulations). Previous therapy was more commonly cited as a reason for choosing BEV–CAP (40%) than BEV–PAC (30%).Table 1 Baseline characteristics overall and according to selected chemotherapy.\n\nTable 1Characteristic\tAll patients (n = 2065)\tBEV–PAC (n = 1821)\tBEV–CAP (n = 295)\t\nMedian age, years (range)\t60 (24–87)\t60 (24–86)\t61 (29–87)\t\nAge ≥60 years, n (%)\t1019 (49)\t891 (49)\t158 (54)\t\nTNBC, n (%)\t425 (21)\t363 (20)\t74 (25)\t\nDe novo metastatic breast cancer, n (%)\t609 (29)\t570 (31)\t48 (16)\t\n≥3 metastatic sites, n (%)\t414 (20)\t380 (21)\t47 (16)\t\nVisceral metastases\t1548 (75)\t1384 (76)\t211 (72)\t\nECOG performance status, n (%)\t\n0\t953 (46)\t840 (46)\t139 (47)\t\n1\t817 (40)\t725 (40)\t108 (37)\t\n2\t132 (6)\t124 (7)\t12 (4)\t\n3\t10 (<1)\t9 (<1)\t1 (<1)\t\n4\t4 (<1)\t2 (<1)\t2 (1)\t\nMissing\t149 (7)\t121 (7)\t33 (11)\t\nPrior (neo)adjuvant chemotherapy, n (%)\t1147 (56)\t976 (54)\t202 (68)\t\nTaxane\t671 (32)\t536 (29)\t147 (50)\t\nAnthracycline\t1008 (49)\t856 (47)\t179 (61)\t\nPrior endocrine therapy\t\nAdjuvant setting\t752 (36)\t649 (36)\t126 (43)\t\nMetastatic setting\t364 (18)\t312 (17)\t61 (21)\t\nBEV–CAP, bevacizumab plus capecitabine; BEV–PAC, bevacizumab plus paclitaxel; ECOG, Eastern Cooperative Oncology Group; TNBC, triple-negative breast cancer. Patients who received at least one dose of BEV–CAP and at least one dose of BEV–PAC (switched between regimens) were analysed in both subpopulations; consequently, the sum of these two subgroups is larger than the total number of patients.\n\n3.2 Treatment exposure\n\nAt the data cut-off (February 3, 2020), the median bevacizumab duration was 6.0 months (95% confidence interval [CI] 5.6–6.3 months) and the median chemotherapy duration was 4.2 months (95% CI 4.0–4.2 months). There was no difference in chemotherapy exposure according to chemotherapy partner; median bevacizumab duration was 6.2 months (95% CI 5.8–6.7 months) in the BEV–PAC subpopulation and 5.6 months (95% CI 5.1–6.6 months) in the BEV–CAP subpopulation. Some patients received maintenance therapy with bevacizumab (25%), capecitabine (10% of the BEV–CAP subpopulation, 2% of the BEV–PAC subpopulation) or endocrine therapy.\n\nThe most commonly administered second-line therapies following disease progression were eribulin (10%; 9% after BEV–PAC vs 14% after BEV–CAP), capecitabine (9%; 10% vs 4%, respectively), doxorubicin (9%) and vinorelbine (9%) (Appendix Fig. A2).\n\n3.3 Effectiveness\n\nThe overall response rate (ORR) was 49% (95% CI 47–51%) overall, including complete responses in 6% of patients. ORRs were 51% (95% CI 48–53%) with BEV–PAC and 39% (95% CI 34–45%) with BEV–CAP. At the data cut-off, PFS events had been recorded in 53% of patients (51% vs 65% in the BEV–PAC and BEV–CAP subpopulations, respectively). Median PFS was 12.6 (95% CI 11.9–13.2) months in the overall population, 12.8 months with BEV–PAC and 10.5 months with BEV–CAP (Fig. 1). Median OS after events in 48% of patients was 23.9 (95% CI 22.2–25.1) months overall, 24.5 months with BEV–PAC and 20.4 months with BEV–CAP (Fig. 2).Fig. 1 Progression-free survival in: (A) All patients; (B) BEV–PAC subpopulation; and (C) BEV–CAP subpopulation. BEV–CAP, bevacizumab plus capecitabine; BEV–PAC, bevacizumab plus paclitaxel; CI, confidence interval.\n\nFig. 1\n\nFig. 2 Overall survival in: (A) All patients; (B) BEV–PAC subpopulation; and (C) BEV–CAP subpopulation. BEV–CAP, bevacizumab plus capecitabine; BEV–PAC, bevacizumab plus paclitaxel; CI, confidence interval.\n\nFig. 2\n\nTable 2 summarises PFS and OS in clinically relevant subgroups. Generally, prognostic effects observed in the overall population were replicated in the BEV–PAC and BEV–CAP subpopulations. However, subgroup analyses according to age showed marked differences, with apparently more favourable outcomes in patients aged ≥60 than <60 years receiving BEV–CAP (Appendix Fig. A3). Conversely, the apparently worse prognosis among patients with versus without prior endocrine therapy was driven almost entirely by the BEV–PAC subpopulation (Appendix Fig. A3).Table 2 Overview of effectiveness by subgroup.\n\nTable 2Subgroup\t\tPFS\tOS\t\nMedian, months\tHazard ratio (95% CI)\tMedian, months\tHazard ratio (95% CI)\t\nBaseline hypertension\tHypertensivea vs normotensive\t13.6 vs 11.9\t0.88 (0.77–1.00)\t25.1 vs 23.2\t0.88 (0.76–1.01)\t\nTNBCb\tYes vs no\t10.3 vs 12.9\t1.44 (1.24–1.67)\t16.8 vs 25.2\t1.53 (1.30–1.80)\t\nAge, years\t≥60 vs < 60\t12.8 vs 12.3\t1.09 (0.96–1.23)\t21.9 vs 25.4\t1.26 (1.11–1.44)\t\nMetastatic sites\t≥3 vs < 3\t11.6 vs 12.8\t1.06 (0.88–1.28)\t19.3 vs 24.9\t1.15 (0.96–1.39)\t\nPrior anthracycline/taxane\tYes vs no\t11.5 vs 14.3\t1.32 (1.16–1.50)\t20.8 vs 27.4\t1.25 (1.09–1.43)\t\nPrior ET\tYes vs no\t10.7 vs 13.2\t1.56 (1.33–1.82)\t17.6 vs 25.1\t1.56 (1.33–1.82)\t\nUrgency to treatc\tYes vs no\t9.9 vs 12.9\t1.38 (1.09–1.74)\t14.8 vs 25.0\t1.38 (1.09–1.75)\t\nCI, confidence interval; ET, endocrine therapy; OS, overall survival; PFS, progression-free survival; TNBC, triple-negative breast cancer.\n\na Defined as: documented pre-existing arterial hypertension; documented blood pressure >150/100 mmHg at baseline; at least one anti-hypertensive drug with indication hypertension and documented start date before the first dose of bevacizumab; or documented ongoing hypertension in medical history screening with start date before the first date of bevacizumab.\n\nb Unknown in 127 patients.\n\nc Fulfilling at least three of the following: ≥3 metastatic sites, liver metastasis, prior [neo]adjuvant anthracycline/taxane therapy, TNBC.\n\n3.4 PROs and treatment satisfaction\n\nApproximately 90% of patients completed at least one question of QLQ-C30 at baseline. Mean global health status/quality of life (GHS/QoL) scores were higher (representing better GHS/QoL) at baseline in patients aged <60 than ≥60 years, irrespective of chemotherapy partner. Compliance with questionnaire completion diminished only slightly over time: among those who received a questionnaire at week 54, 74% completed at least one question. Mean change from baseline GHS/QoL showed no relevant change in the overall population, nor in subgroups according to chemotherapy or age (Fig. 3). Similar patterns were seen for functioning and symptom subscales, except for fatigue, which increased substantially from baseline to week 9, but decreased thereafter (data not shown).Fig. 3 Patient-reported global health status/quality of life (GHS/QoL) over time: (A) By chemotherapy partner and (B) By age. BEV–CAP, bevacizumab plus capecitabine; BEV–PAC, bevacizumab plus paclitaxel.\n\nFig. 3\n\nPatient-reported experience of side effects and interference with daily activities showed little difference according to chemotherapy partner or age. At week 54, most patients (78%) completing therapy reported “some impairment” to daily life overall but very few (4%) reported strong impairment (Appendix Fig. A4). A similar pattern was seen among those discontinuing treatment prematurely.\n\nMost patients reported treatment satisfaction as good or better. Physician-reported treatment satisfaction was similar or slightly lower than patient-reported treatment satisfaction (Fig. 4).Fig. 4 Treatment satisfaction reported by patients at week 54 (n = 394) and (for all 2065 patients) reported by physicians at end of treatment. BEV–CAP, bevacizumab plus capecitabine; BEV–PAC, bevacizumab plus paclitaxel.\n\nFig. 4\n\n3.5 Safety\n\nAEs of any grade were reported in 59% of patients (grade ≥3 in 27%, including grade 5 in 5%). Generally, incidences were slightly higher in older than younger patients, and with BEV–CAP (which included a higher proportion of older patients) versus BEV–PAC (Table 3). AEs recorded as fatal included a substantial proportion related to disease progression, and the 16 fatal AEs described by investigators as bevacizumab related included eight described as disease progression or comorbidities (Appendix Table A1).Table 3 Overview of safety overall and in subgroups according to selected chemotherapy and age.\n\nTable 3AE, n (%)\tAll patients (n = 2065)\tBEV–PAC (n = 1821)\tBEV–CAP (n = 295)\t<60 years (n = 1046)\t≥60 years (n = 1019)\t\nAny grade AE\t1214 (59)\t1055 (58)\t195 (66)\t585 (56)\t629 (62)\t\n Bevacizumab related\t625 (30)\t558 (31)\t92 (31)\t304 (29)\t321 (32)\t\nGrade ≥3 AE\t549 (27)\t480 (26)\t94 (32)\t247 (24)\t302 (30)\t\nFatal AEa\t111 (5)\t101 (6)\t12 (4)\t40 (4)\t71 (7)\t\n Bevacizumab relatedb\t16 (1)\t14 (1)\t2 (1)\t5 (<1)\t11 (1)\t\nAE leading to treatment discontinuation\t310 (15)\t272 (15)\t44 (15)\t132 (13)\t178 (17)\t\nAE, adverse event; BEV–CAP, bevacizumab plus capecitabine; BEV–PAC, bevacizumab plus paclitaxel. Patients who received at least one dose of BEV–CAP and at least one dose of BEV–PAC (switched between regimens) were analysed in both subpopulations; consequently, the sum of these two subgroups is larger than the total number of patients.\n\na Documented cause of death: disease progression (n = 62), unknown (n = 24), comorbidity (n = 5), treatment associated (n = 2), other (n = 11), missing (n = 7). Fatal AEs: including unexplained death (n = 27), general physical health deterioration (n = 23), disease progression/metastases (n = 22).\n\nb Documented cause of death: disease progression (n = 6), comorbidity (n = 2), treatment associated (n = 1), unknown (n = 2), other (n = 4), missing (n = 1). Further details provided in Appendix Table A1.\n\nConsistent with the known safety profile of bevacizumab, the most common all-grade AEs were hypertension, fatigue and polyneuropathy (Table 4). Proteinuria was reported in 2% of patients (grade 3 in eight patients [0.4%]; no grade 4). Palmar-plantar erythrodysaesthesia, diarrhoea and mucosal inflammation were more common with BEV–CAP, whereas fatigue, leucopenia and alopecia were less common. The only grade ≥3 AEs in ≥2% of patients were leucopenia, general physical health deterioration and hypertension (each in 2%). Prespecified subgroup analyses comparing hypertension in patients with versus without pre-existing hypertension at baseline showed marginally lower incidences in patients without pre-existing hypertension (132/1358 patients [10%] vs 109/707 patients [15%] with pre-existing hypertension). Within these subgroups, there were no differences in the incidence of hypertension according to age <60 versus ≥60 years or bevacizumab dose <2.5 versus 2.5–<5 versus ≥5 mg/kg/week. Similarly, there was no difference in the incidence of proteinuria according to age or bevacizumab dose.Table 4 Most common adverse events (any grade in ≥5% of any population; grade ≥3 in ≥1% of any population).\n\nTable 4Adverse event, n (%)\tAll patients (n = 2065)\tBEV–PAC (n = 1821)\tBEV–CAP (n = 295)\t\nAny grade\tGrade ≥3\tAny grade\tGrade ≥3\tAny grade\tGrade ≥3\t\nHypertension\t241 (12)\t43 (2)\t214 (12)\t39 (2)\t36 (12)\t9 (3)\t\nFatigue\t210 (10)\t13 (0.6)\t195 (11)\t13 (0.7)\t22 (7)\t1 (0.3)\t\nPolyneuropathy\t177 (9)\t15 (0.7)\t169 (9)\t15 (0.8)\t20 (7)\t2 (0.7)\t\nNausea\t145 (7)\t7 (0.3)\t120 (7)\t6 (0.3)\t29 (10)\t1 (0.3)\t\nLeucopenia\t138 (7)\t51 (2)\t129 (7)\t48 (3)\t10 (3)\t4 (1)\t\nDiarrhoea\t129 (6)\t14 (0.7)\t101 (6)\t11 (0.6)\t33 (11)\t3 (1)\t\nEpistaxis\t109 (5)\t3 (0.1)\t103 (6)\t3 (0.2)\t10 (3)\t0\t\nAlopecia\t95 (5)\t–\t94 (5)\t–\t5 (2)\t–\t\nPalmar-plantar erythrodysaesthesia\t91 (4)\t14 (0.7)\t30 (2)\t3 (0.2)\t68 (23)\t13 (4)\t\nMucosal inflammation\t83 (4)\t8 (0.4)\t63 (3)\t3 (0.2)\t25 (8)\t5 (2)\t\nAnaemia\t81 (4)\t19 (0.9)\t75 (4)\t16 (0.9)\t6 (2)\t3 (1)\t\nGeneral physical health deterioration\t67 (3)\t44 (2)\t60 (3)\t39 (2)\t8 (3)\t6 (2)\t\nNeutropenia\t38 (2)\t24 (1)\t36 (2)\t23 (1)\t2 (1)\t1 (0.3)\t\nUrinary tract infection\t36 (2)\t14 (0.7)\t30 (2)\t11 (0.6)\t8 (3)\t4 (1)\t\nPulmonary embolism\t34 (2)\t28 (1)\t31 (2)\t25 (1)\t5 (2)\t5 (2)\t\nBack pain\t32 (2)\t5 (0.2)\t28 (2)\t3 (0.2)\t5 (2)\t3 (1)\t\nMalignant neoplasm progression\t29 (1)\t29 (1)\t27 (1)\t27 (1)\t3 (1)\t3 (1)\t\nUnexplained deatha\t28 (1)\t24 (1)\t24 (1)\t21 (1)\t4 (1)\t3 (1)\t\nAspartate aminotransferase increased\t25 (1)\t9 (0.4)\t20 (1)\t6 (0.3)\t5 (2)\t3 (1)\t\nThrombocytopenia\t24 (1)\t8 (0.4)\t18 (1)\t6 (0.3)\t7 (2)\t3 (1)\t\nPleural effusion\t23 (1)\t10 (0.5)\t17 (0.9)\t8 (0.4)\t7 (2)\t3 (1)\t\nBEV–CAP, bevacizumab plus capecitabine; BEV–PAC, bevacizumab plus paclitaxel. Patients who received at least one dose of BEV–CAP and at least one dose of BEV–PAC (switched between regimens) were analysed in both subpopulations; consequently, the sum of these two subgroups is larger than the total number of patients.\n\na Grade missing in 3 patients in the BEV–PAC subpopulation and recorded as grade 2 in error in 1 patient in the BEV–CAP subpopulation; these patients are not counted as grade ≥3.\n\n4 Discussion\n\nIn this non-interventional study in routine oncology practice in Germany, PFS and OS are consistent with results from numerous phase III trials (E2100, MERiDiAN, TURANDOT, CALGB 40502/NCCTG N063H, RIBBON-1, CARIN), which consistently reported median PFS of 11.0–11.4 months with BEV–PAC [[8], [9], [10], [11]] and 8.1–8.8 months with BEV–CAP [2,10,12] and median OS of 26.5–29.5 months [3,8,11,13] and 25.1–29.0 months, respectively [3,12,14] (Appendix Table A2). OS in AVANTI is more difficult to interpret given the relatively short follow-up (maximum 2.5 years), which biases towards early deaths in higher-risk patients, and the varied subsequent therapy, with predictable imbalances in capecitabine and taxane use. However, the feasibility of a broad range of available treatment options following progression on first-line bevacizumab-containing therapy is noteworthy.\n\nAEs with both regimens were generally consistent with previous clinical trial experience, the well-established safety profile of bevacizumab-containing therapy for LR/MBC, and known paclitaxel and capecitabine side effects [[1], [2], [3],[8], [9], [10]]. Interestingly, patient-reported treatment satisfaction was at least as positive as physician-reported treatment satisfaction, although only a fraction of patients completed treatment satisfaction questionnaires, potentially leading to some bias.\n\nA limitation of the trial is its single-arm design and non-standardised response assessment (according to local practice rather than Response Evaluation Criteria in Solid Tumours), which could affect both PFS and ORR evaluation. Additionally, there was extensive censoring for PFS in the first 6 months. Comparing effectiveness of BEV–PAC and BEV–CAP is challenging because of the different characteristics of these two non-randomised subpopulations. Chemotherapy choice was at the treating physician's discretion, and prior therapy was a clear contributor to treatment selection. BEV–CAP was selected more often in patients previously treated with anthracycline/taxane or endocrine therapy, and less often in those with de novo MBC. Imbalances in the patient population may also contribute to somewhat counterintuitive findings with regard to prognostic factors. For example, among patients receiving BEV–PAC, those previously treated with endocrine therapy appeared to have worse PFS and OS than those without prior endocrine therapy. However, as PFS and OS are calculated from the first dose of bevacizumab, those in the prior endocrine therapy subgroup could have received multiple lines of prior endocrine therapy between diagnosis of LR/MBC and entry into the AVANTI study at the time of chemotherapy eligibility, whereas in endocrine therapy-naïve patients, PFS is essentially calculated from their first diagnosis of LR/MBC. Similarly, patient selection and physician bias may have contributed to the apparently more favourable outcomes in patients aged ≥60 versus <60 years in the BEV–CAP subpopulation. It is plausible that in the BEV–CAP subpopulation, only relatively fit older patients with more indolent disease or perhaps a preference for oral chemotherapy were enrolled, whereas younger patients treated with BEV–CAP were perhaps frailer and more heavily pretreated.\n\nAE reporting may represent another potential limitation. Non-interventional studies may be more susceptible to under-reporting of AEs, and reports that may be queried in more rigorously monitored prospective studies may not be queried in a non-interventional study. For example, a number of cases described as bevacizumab-related fatal AEs were also attributable to disease progression or comorbidities (Appendix Table A1), thus the true incidence of treatment-related fatal AEs may be <0.5%. As with the effectiveness comparisons, imbalances between the BEV–PAC and BEV–CAP populations could lead to misperceptions of safety. For example, superficially AEs appear to be more common with BEV–CAP, but this subpopulation is over-represented by older patients, who were also at increased risk of AEs.\n\nOur data provide only limited information on subsequent therapy, partly because of the constraints of a non-interventional study. Detailed documentation is permitted for a maximum of 15 months, making it difficult to capture patterns of subsequent therapy, especially with median PFS approaching the maximum follow-up allowed. In addition, switch maintenance therapy is not approved in Germany (or indeed anywhere in Europe), so while the strategy of switching from bevacizumab plus a taxane to BEV–CAP after an induction period demonstrated a statistically significant OS benefit in the IMELDA trial [15], such an approach is used less often than may be expected in clinical practice because of regulatory and funding challenges.\n\nA strength of the study is its real-world patient population, providing insight into everyday oncology practice. In addition, inclusion of PROs allowed assessment of quality of life over time, which did not deteriorate meaningfully either overall or in the subgroups defined by age or chemotherapy partner. These data complement real-world data from the ESME project, which used data recorded from patients receiving first-line therapy between 2008 and 2013 in French routine practice and elegant statistical methods to compare BEV–PAC with paclitaxel alone. In the ESME database, median PFS in 2127 patients treated with BEV–PAC for HER2-negative MBC was 8.1 months and median OS was 27.7 months [16].\n\nIn conclusion, in routine practice, BEV–PAC and BEV–CAP remain valid first-line treatment options for HER2-negative LR/MBC. Treatment options continue to evolve, particularly in the settings of hormone receptor-positive disease before initiation of chemotherapy and in PD-L1-positive or BRCA-mutated LR/MBC, but for the many patients not eligible for biomarker-selected therapies, bevacizumab-containing regimens remain an effective and tolerable therapy, irrespective of age.\n\nRole of the funding source\n\nThe sponsor was involved in the design and conduct of the study; data collection, management, analysis, and interpretation; and preparation, review, and approval of the manuscript.\n\nAuthor contributions\n\nVolkmar Müller: Conceptualisation, investigation, resources, visualisation, writing – original draft, writing – review & editing. Markus Ruhnke: Investigation, resources, visualisation, writing – review & editing. Oliver Hoffmann: Investigation, resources, writing – review & editing. Andrea Grafe: Investigation, resources, writing – review & editing. Oliver Tomé: Investigation, resources, writing – review & editing. Werner Fett: Investigation, resources, writing – review & editing. Harald-Robert Bruch: Investigation, resources, writing – review & editing. Ann-Katrin Sommer: Writing – review & editing. Andreas Schneeweiss: Conceptualisation, investigation, resources, visualisation, writing – original draft, writing – review & editing.\n\nDeclaration of interest statement\n\nV.M. reports honoraria from Amgen, AstraZeneca, Daiichi-Sankyo, Eisai, Pfizer, MSD, Novartis, Roche, Teva and Seattle Genetics (for advisory boards) and from Genomic Health, Hexal, Roche, Pierre Fabre, Amgen, ClinSol, Novartis, MSD, Daiichi-Sankyo, Eisai, Lilly, Tesaro, Seattle Genetics and Nektar (for consultancy); research funding to his institution from Novartis, Roche, Seattle Genetics and Genentech; and travel grants from Roche, Pfizer and Daiichi-Sankyo. O.H. reports honoraria from Roche, Novartis, Pfizer, MSD, Daiichi-Sankyo, AstraZeneca, Eisai, Hexal, Amgen and Riemser Pharma; advisory/consultancy roles for Roche, Novartis, MSD, Daiichi-Sankyo and Hexal; and travel/accommodation/expenses from Novartis, Pfizer, MSD, Daiichi-Sankyo, Eisai, Hexal and Amgen. A.-K.S.-J. is an employee of Roche Pharma AG and holds shares in Roche. A.S. reports honoraria from Roche, AstraZeneca, Celgene, Pfizer, Novartis, MSD, Tesaro and Lilly; expert testimony for Roche and AstraZeneca; research funding to his institution from Roche, Celgene and AbbVie; and travel/accommodation/expenses from Roche, Celgene and Pfizer. The remaining authors declare no conflicts of interest.\n\nData statement\n\nQualified researchers may request access to individual patient-level data through the clinical study data request platform (https://vivli.org/). Further details on Roche's criteria for eligible studies are available here (https://vivli.org/members/ourmembers/). For further details on Roche's Global Policy on the Sharing of Clinical Information and how to request access to related clinical study documents, see here (https://www.roche.com/research_and_development/who_we_are_how_we_work/clinical_trials/our_commitment_to_data_sharing.htm).\n\nAppendix A Supplementary data\n\nThe following is the Supplementary data to this article:Multimedia component 1\n\nMultimedia component 1\n\nAcknowledgements\n\nWe are grateful to the patients participating in the study and their families, the investigators and staff at participating centres and the study team at Roche Pharma AG. This study was sponsored and funded by Roche Pharma AG, Grenzach-Wyhlen, Germany. Medical writing support was provided by Jennifer Kelly, MA (Medi-Kelsey Ltd, Ashbourne, UK), funded by Roche Pharma AG.\n\n☆ Sources of support: The AVANTI study and medical writing for this publication were funded by Roche Pharma AG, Grenzach-Wyhlen, Germany.\n\nAppendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.breast.2021.08.014.\n==== Refs\nReferences\n\n1 Miller K. Wang M. Gralow J. Dickler M. Cobleigh M. Perez E.A. Paclitaxel plus bevacizumab versus paclitaxel alone for metastatic breast cancer N Engl J Med 357 2007 2666 2676 10.1056/NEJMoa072113 18160686\n2 Robert N.J. Diéras V. Glaspy J. Brufsky A.M. Bondarenko I. Lipatov O.N. RIBBON-1: randomized, double-blind, placebo-controlled, phase III trial of chemotherapy with or without bevacizumab for first-line treatment of human epidermal growth factor receptor 2-negative, locally recurrent or metastatic breast cancer J Clin Oncol 29 2011 1252 1260 10.1200/JCO.2010.28.0982 21383283\n3 Zielinski C. Láng I. Inbar M. Kahán Z. Greil R. Beslija S. TURANDOT investigators. Bevacizumab plus paclitaxel versus bevacizumab plus capecitabine as first-line treatment for HER2-negative metastatic breast cancer (TURANDOT): primary endpoint results of a randomised, open-label, non-inferiority, phase 3 trial Lancet Oncol 17 2016 1230 1239 10.1016/S1470-2045(16)30154-1 27501767\n4 Wöckel A. Festl J. Stüber T. Brust K. Krockenberger M. Heuschmann P.U. Interdisciplinary screening, diagnosis, therapy and follow-up of breast cancer. Guideline of the DGGG and the DKG (S3-Level, AWMF Registry Number 032/045OL, December 2017) - Part 2 with recommendations for the therapy of primary, recurrent and advanced breast cancer Geburtshilfe Frauenheilkd 78 2018 1056 1088 10.1055/a-0646-4630 30581198\n5 Thomssen C. Lüftner D. Untch M. Haidinger R. Würstlein R. Harbeck N. International consensus conference for advanced breast cancer, Lisbon 2019: ABC5 consensus - assessment by a German group of experts Breast Care 15 2020 82 95 10.1159/000505957 32231503\n6 Cardoso F. Senkus E. Costa A. Papadopoulos E. Aapro M. André F. 4th ESO-ESMO international consensus guidelines for advanced breast cancer (ABC 4) Ann Oncol 29 2018 1634 1657 10.1093/annonc/mdy192 30032243\n7 Onkopedia guidelines: breast cancer in women https://www.onkopedia.com/de/onkopedia/guidelines/mammakarzinom-der-frau/@@guideline/html/index.html\n8 Roche Pharma A.G. Avastin summary of product characteristics 2015 https://www.ema.europa.eu/en/documents/product-information/avastin-epar-product-information_en.pdf accessed\n9 Miles D. Cameron D. Bondarenko I. Manzyuk L. Alcedo J.C. Lopez R.I. Bevacizumab plus paclitaxel versus placebo plus paclitaxel as first-line therapy for HER2-negative metastatic breast cancer (MERiDiAN): a double-blind placebo-controlled randomised phase III trial with prospective biomarker evaluation Eur J Cancer 70 2017 146 155 10.1016/j.ejca.2016.09.024 27817944\n10 Lang I. Brodowicz T. Ryvo L. Kahan Z. Greil R. Beslija S. Bevacizumab plus paclitaxel versus bevacizumab plus capecitabine as first-line treatment for HER2-negative metastatic breast cancer: interim efficacy results of the randomised, open-label, non-inferiority, phase 3 TURANDOT trial Lancet Oncol 14 2013 125 133 10.1016/S1470-2045(12)70566-1 23312888\n11 Rugo H.S. Barry W.T. Moreno-Aspitia A. Lyss A.P. Cirrincione C. Leung E. Randomized phase III trial of paclitaxel once per week compared with nanoparticle albumin-bound nab-paclitaxel once per week or ixabepilone with bevacizumab as first-line chemotherapy for locally recurrent or metastatic breast cancer: CALGB 40502/NCCTG N063H (Alliance) J Clin Oncol 33 2015 2361 2369 10.1200/JCO.2014.59.5298 26056183\n12 Welt A. Marschner N. Lerchenmueller C. Decker T. Steffens C.C. Koehler A. Capecitabine and bevacizumab with or without vinorelbine in first-line treatment of HER2/neu-negative metastatic or locally advanced breast cancer: final efficacy and safety data of the randomised, open-label superiority phase 3 CARIN trial Breast Cancer Res Treat 156 2016 97 107 10.1007/s10549-016-3727-x 26927446\n13 Miles D. Cameron D. Hilton M. Garcia J. O’Shaughnessy J. Overall survival in MERiDiAN, a double-blind placebo-controlled randomised phase III trial evaluating first-line bevacizumab plus paclitaxel for HER2-negative metastatic breast cancer Eur J Cancer 90 2018 153 155 10.1016/j.ejca.2017.10.018 29174181\n14 Robert N.J. Dieras V. Glaspy J. Brufsky A. Bondarenko I. Lipatov O. RIBBON-1: randomized, double-blind, placebo-controlled, phase III trial of chemotherapy with or without bevacizumab (B) for first-line treatment of HER2-negative locally recurrent or metastatic breast cancer (MBC) J Clin Oncol 27 suppl 15 2009 Abstract 1005\n15 Gligorov J. Doval D. Bines J. Alba E. Cortes P. Pierga J.Y. Maintenance capecitabine and bevacizumab versus bevacizumab alone after initial first-line bevacizumab and docetaxel for patients with HER2-negative metastatic breast cancer (IMELDA): a randomised, open-label, phase 3 trial Lancet Oncol 15 2014 1351 1360 10.1016/S1470-2045(14)70444-9 25273343\n16 Delaloge S. Pérol D. Courtinard C. Brain E. Asselain B. Bachelot T. Paclitaxel plus bevacizumab or paclitaxel as first-line treatment for HER2-negative metastatic breast cancer in a multicenter national observational study Ann Oncol 27 2016 1725 1732 10.1093/annonc/mdw260 27436849\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0960-9776",
"issue": "60()",
"journal": "Breast (Edinburgh, Scotland)",
"keywords": "Bevacizumab; Metastatic breast cancer; Non-interventional study",
"medline_ta": "Breast",
"mesh_terms": null,
"nlm_unique_id": "9213011",
"other_id": null,
"pages": "70-77",
"pmc": null,
"pmid": "34488065",
"pubdate": "2021-08-27",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "First-line bevacizumab-containing therapy for HER2-negative locally advanced/metastatic breast cancer: Real-world experience from >2000 patients treated in the multicentre AVANTI study.",
"title_normalized": "first line bevacizumab containing therapy for her2 negative locally advanced metastatic breast cancer real world experience from 2000 patients treated in the multicentre avanti study"
} | [
{
"companynumb": "DE-MYLANLABS-2021M1073181",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "PACLITAXEL"
},
"drugadditional": "4",
... |
{
"abstract": "Relative contraindications to adenosine use have included heart transplant and dipyridamole. We previously demonstrated the safety and efficacy of adenosine-induced atrioventricular (AV) block in healthy young heart transplant recipients while suspending dipyridamole therapy (dual antiplatelet agent). This prospective follow-up study evaluated the safety and efficacy of adenosine use in the same cohort of heart transplant recipients while on dipyridamole.\n\n\n\nAdenosine was incrementally dosed until AV block occurred (maximum 200 mcg/kg up to 12 mg). The primary outcome was clinically significant asystole (≥12 seconds). Secondary outcomes included maximal adenosine dose, AV block duration, dysrhythmias, and clinical symptoms. Outcomes were compared to the parent study.\n\n\n\nThirty of 39 eligible patients (5-24 years) were tested. No patient (0%, CI 0%-8%) experienced clinically significant asystole. AV block occurred in 29/30 patients (97%, CI 86%-100%). The median dose causing AV block was 50mcg/kg (vs 100 mcg/kg off dipyridamole; P = .011). Seventeen patients (57%, CI 39%-72%) required less adenosine to achieve AV block on dipyridamole; six (20%) required more. AV block occurred at doses ≥25 mcg/kg in all patients. In pairwise comparison to prior testing off dipyridamole, no significant change occurred in AV block duration, frequency of cardiac ectopy, or incidence of reported symptoms. No atrial fibrillation/flutter occurred.\n\n\n\nAV block often occurs at twofold lower adenosine doses in healthy young heart transplant recipients taking oral dipyridamole, compared with previous testing of this cohort off dipyridamole. Results suggest that initial dosing of 25 mcg/kg (maximum 0.8 mg) with stepwise escalation poses low risk of prolonged asystole on dipyridamole.",
"affiliations": "Division of Pediatric Cardiology, Columbia University Irving Medical Center, New York, NY, USA.;Division of Pediatric Cardiology, Columbia University Irving Medical Center, New York, NY, USA.;Division of Pediatric Cardiology, Columbia University Irving Medical Center, New York, NY, USA.;Division of Pediatric Cardiology, Columbia University Irving Medical Center, New York, NY, USA.;Division of Pediatric Cardiology, Columbia University Irving Medical Center, New York, NY, USA.;Division of Pediatric Cardiology, Columbia University Irving Medical Center, New York, NY, USA.;Division of Pediatric Cardiology, Columbia University Irving Medical Center, New York, NY, USA.;Division of Pediatric Cardiology, Columbia University Irving Medical Center, New York, NY, USA.",
"authors": "Satzer|Michael B|MB|0000-0002-3315-4095;Flyer|Jonathan N|JN|;Zuckerman|Warren A|WA|;Liberman|Leonardo|L|;Richmond|Marc E|ME|0000-0001-5491-8085;Anderson|Brett R|BR|;Addonizio|Linda J|LJ|;Silver|Eric S|ES|",
"chemical_list": "D000889:Anti-Arrhythmia Agents; D004176:Dipyridamole; D000241:Adenosine",
"country": "Denmark",
"delete": false,
"doi": "10.1111/petr.13689",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1397-3142",
"issue": "24(3)",
"journal": "Pediatric transplantation",
"keywords": "arrhythmia; atrioventricular block; heart transplant; supraventricular tachycardia",
"medline_ta": "Pediatr Transplant",
"mesh_terms": "D000241:Adenosine; D000293:Adolescent; D000889:Anti-Arrhythmia Agents; D054537:Atrioventricular Block; D002648:Child; D002675:Child, Preschool; D004176:Dipyridamole; D004305:Dose-Response Relationship, Drug; D004334:Drug Administration Schedule; D005260:Female; D005500:Follow-Up Studies; D016027:Heart Transplantation; D006801:Humans; D008297:Male; D011183:Postoperative Complications; D011446:Prospective Studies; D013617:Tachycardia, Supraventricular; D055815:Young Adult",
"nlm_unique_id": "9802574",
"other_id": null,
"pages": "e13689",
"pmc": null,
"pmid": "32157785",
"pubdate": "2020-05",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article",
"references": null,
"title": "Impact of dipyridamole on adenosine dosing in pediatric and young adult patients after heart transplantation.",
"title_normalized": "impact of dipyridamole on adenosine dosing in pediatric and young adult patients after heart transplantation"
} | [
{
"companynumb": "US-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2020-BI-015820",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "DIPYRIDAMOLE"
},
... |
{
"abstract": "Normal blood pressure is a good marker of graft survival after renal transplantation, and effective antihypertensive treatment reduces the progression of graft damage. We conducted a long-term follow-up study of 88 hypertensive renal transplant recipients, all of whom were taking sustained cyclosporine A (CsA) immunosuppression. The patients were treated for at least three years, and initially received 240 mg/day of verapamil (N = 24, group I), 5 mg/day of enalapril (N = 24, group II) or 1 mg/day of doxazosin (N = 40, group III). Baseline creatinine did not differ in the three groups, but proteinuria was higher in the enalapril group (7 patients had proteinuria > 1.5 g/day). Treatment was withdrawn in 5 patients in the verapamil group, 5 in the enalapril group and 2 in the doxazosin group due to drug-related side effects. Blood pressure (BP) control at three years was equivalent in the three groups (systolic BP, group I 157 +/- 12; group II 149 +/- 19; group III 154 +/- 21; diastolic BP, group I 90 +/- 8.7, group II 84 +/- 9.8, group III 90.5 +/- 16; mean BP, group I 113 +/- 7, group II 106 +/- 10, group III 106 +/- 29). Two patients in group I, 3 in group II and 15 in group III required additional antihypertensive drugs. CsA levels increased in the verapamil-treated patients, allowing for an early decrease in CsA doses (1 year doses, 3.3 +/- 1 mg/kg body wt/day in group I, 4.3 +/- 1.6 in group II, 3.7 +/- 1.6 in group III). Six cardiovascular events occurred, 3 in group I, 1 in group II, and 2 in group III patients. One patient died in the enalapril group and another in the doxazosin group. Eight verapamil-treated patients, 8 enalapril-treated patients and 4 doxazosin-treated patients lost their grafts due to biopsy-proven chronic transplant nephropathy. In conclusion, the three antihypertensive agents are effective in reducing blood pressure, with no clear advantage of one above any other. Verapamil allows the CsA dose to be reduced, thus decreasing the cost of immunosupression. Enalapril can be a more effective antiproteinuric agent, but hyperkalemia or impaired allograft function may occur in patients with non-optimal allograft function. Doxazosin offers an excellent safety and efficacy profile, and when not efficient by itself in controlling blood pressure, is an ideal concomitant agent in hypertensive renal transplant patients.",
"affiliations": "Nephrology Department, Hospital de Bellvitge Principes de España, CSUB, Barcelona, Spain.",
"authors": "Martínez-Castelao|A|A|;Hueso|M|M|;Sanz|V|V|;Rejas|J|J|;Alsina|J|J|;Grinyó|J M|JM|",
"chemical_list": "D000959:Antihypertensive Agents; D002121:Calcium Channel Blockers; D004656:Enalapril; D014700:Verapamil; D017292:Doxazosin",
"country": "United States",
"delete": false,
"doi": "10.1046/j.1523-1755.1998.06826.x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0098-6577",
"issue": "68()",
"journal": "Kidney international. Supplement",
"keywords": null,
"medline_ta": "Kidney Int Suppl",
"mesh_terms": "D000328:Adult; D000959:Antihypertensive Agents; D002121:Calcium Channel Blockers; D017292:Doxazosin; D004656:Enalapril; D005260:Female; D005500:Follow-Up Studies; D006085:Graft Survival; D006801:Humans; D006937:Hypercholesterolemia; D006977:Hypertension, Renal; D007676:Kidney Failure, Chronic; D016030:Kidney Transplantation; D008137:Longitudinal Studies; D008297:Male; D008875:Middle Aged; D011183:Postoperative Complications; D014700:Verapamil",
"nlm_unique_id": "7508622",
"other_id": null,
"pages": "S130-4",
"pmc": null,
"pmid": "9839297",
"pubdate": "1998-12",
"publication_types": "D016430:Clinical Trial; D003160:Comparative Study; D016428:Journal Article",
"references": null,
"title": "Treatment of hypertension after renal transplantation: long-term efficacy of verapamil, enalapril, and doxazosin.",
"title_normalized": "treatment of hypertension after renal transplantation long term efficacy of verapamil enalapril and doxazosin"
} | [
{
"companynumb": "ES-PFIZER INC-2021058869",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DOXAZOSIN MESYLATE"
},
"drugadditional": null,... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.